Two distinct DNA sequences recognized by transcription factors represent enthalpy and entropy optima

PubMed Central

Yin, Yimeng; Das, Pratyush K; Jolma, Arttu; Zhu, Fangjie; Popov, Alexander; Xu, You; Nilsson, Lennart

2018-01-01

Most transcription factors (TFs) can bind to a population of sequences closely related to a single optimal site. However, some TFs can bind to two distinct sequences that represent two local optima in the Gibbs free energy of binding (ΔG). To determine the molecular mechanism behind this effect, we solved the structures of human HOXB13 and CDX2 bound to their two optimal DNA sequences, CAATAAA and TCGTAAA. Thermodynamic analyses by isothermal titration calorimetry revealed that both sites were bound with similar ΔG. However, the interaction with the CAA sequence was driven by change in enthalpy (ΔH), whereas the TCG site was bound with similar affinity due to smaller loss of entropy (ΔS). This thermodynamic mechanism that leads to at least two local optima likely affects many macromolecular interactions, as ΔG depends on two partially independent variables ΔH and ΔS according to the central equation of thermodynamics, ΔG = ΔH - TΔS. PMID:29638214

Constructing DNA Barcode Sets Based on Particle Swarm Optimization.

PubMed

Wang, Bin; Zheng, Xuedong; Zhou, Shihua; Zhou, Changjun; Wei, Xiaopeng; Zhang, Qiang; Wei, Ziqi

2018-01-01

Following the completion of the human genome project, a large amount of high-throughput bio-data was generated. To analyze these data, massively parallel sequencing, namely next-generation sequencing, was rapidly developed. DNA barcodes are used to identify the ownership between sequences and samples when they are attached at the beginning or end of sequencing reads. Constructing DNA barcode sets provides the candidate DNA barcodes for this application. To increase the accuracy of DNA barcode sets, a particle swarm optimization (PSO) algorithm has been modified and used to construct the DNA barcode sets in this paper. Compared with the extant results, some lower bounds of DNA barcode sets are improved. The results show that the proposed algorithm is effective in constructing DNA barcode sets.

Methods of DNA sequencing by hybridization based on optimizing concentration of matrix-bound oligonucleotide and device for carrying out same

DOEpatents

Khrapko, Konstantin R [Moscow, RU; Khorlin, Alexandr A [Moscow, RU; Ivanov, Igor B [Moskovskaya, RU; Ershov, Gennady M [Moscow, RU; Lysov, Jury P [Moscow, RU; Florentiev, Vladimir L [Moscow, RU; Mirzabekov, Andrei D [Moscow, RU

1996-09-03

A method for sequencing DNA by hybridization that includes the following steps: forming an array of oligonucleotides at such concentrations that either ensure the same dissociation temperature for all fully complementary duplexes or allows hybridization and washing of such duplexes to be conducted at the same temperature; hybridizing said oligonucleotide array with labeled test DNA; washing in duplex dissociation conditions; identifying single-base substitutions in the test DNA by analyzing the distribution of the dissociation temperatures and reconstructing the DNA nucleotide sequence based on the above analysis. A device for carrying out the method comprises a solid substrate and a matrix rigidly bound to the substrate. The matrix contains the oligonucleotide array and consists of a multiplicity of gel portions. Each gel portion contains one oligonucleotide of desired length. The gel portions are separated from one another by interstices and have a thickness not exceeding 30 .mu.m.

Sequence-specific DNA binding by MYC/MAX to low-affinity non-E-box motifs.

PubMed

Allevato, Michael; Bolotin, Eugene; Grossman, Mark; Mane-Padros, Daniel; Sladek, Frances M; Martinez, Ernest

2017-01-01

The MYC oncoprotein regulates transcription of a large fraction of the genome as an obligatory heterodimer with the transcription factor MAX. The MYC:MAX heterodimer and MAX:MAX homodimer (hereafter MYC/MAX) bind Enhancer box (E-box) DNA elements (CANNTG) and have the greatest affinity for the canonical MYC E-box (CME) CACGTG. However, MYC:MAX also recognizes E-box variants and was reported to bind DNA in a "non-specific" fashion in vitro and in vivo. Here, in order to identify potential additional non-canonical binding sites for MYC/MAX, we employed high throughput in vitro protein-binding microarrays, along with electrophoretic mobility-shift assays and bioinformatic analyses of MYC-bound genomic loci in vivo. We identified all hexameric motifs preferentially bound by MYC/MAX in vitro, which include the low-affinity non-E-box sequence AACGTT, and found that the vast majority (87%) of MYC-bound genomic sites in a human B cell line contain at least one of the top 21 motifs bound by MYC:MAX in vitro. We further show that high MYC/MAX concentrations are needed for specific binding to the low-affinity sequence AACGTT in vitro and that elevated MYC levels in vivo more markedly increase the occupancy of AACGTT sites relative to CME sites, especially at distal intergenic and intragenic loci. Hence, MYC binds diverse DNA motifs with a broad range of affinities in a sequence-specific and dose-dependent manner, suggesting that MYC overexpression has more selective effects on the tumor transcriptome than previously thought.

Demonstrating Interactions of Transcription Factors with DNA by Electrophoretic Mobility Shift Assay.

PubMed

Yousaf, Nasim; Gould, David

2017-01-01

Confirming the binding of a transcription factor with a particular DNA sequence may be important in characterizing interactions with a synthetic promoter. Electrophoretic mobility shift assay is a powerful approach to demonstrate the specific DNA sequence that is bound by a transcription factor and also to confirm the specific transcription factor involved in the interaction. In this chapter we describe a method we have successfully used to demonstrate interactions of endogenous transcription factors with sequences derived from endogenous and synthetic promoters.

Theoretical modeling of masking DNA application in aptamer-facilitated biomarker discovery.

PubMed

Cherney, Leonid T; Obrecht, Natalia M; Krylov, Sergey N

2013-04-16

In aptamer-facilitated biomarker discovery (AptaBiD), aptamers are selected from a library of random DNA (or RNA) sequences for their ability to specifically bind cell-surface biomarkers. The library is incubated with intact cells, and cell-bound DNA molecules are separated from those unbound and amplified by the polymerase chain reaction (PCR). The partitioning/amplification cycle is repeated multiple times while alternating target cells and control cells. Efficient aptamer selection in AptaBiD relies on the inclusion of masking DNA within the cell and library mixture. Masking DNA lacks primer regions for PCR amplification and is typically taken in excess to the library. The role of masking DNA within the selection mixture is to outcompete any nonspecific binding sequences within the initial library, thus allowing specific DNA sequences (i.e., aptamers) to be selected more efficiently. Efficient AptaBiD requires an optimum ratio of masking DNA to library DNA, at which aptamers still bind specific binding sites but nonaptamers within the library do not bind nonspecific binding sites. Here, we have developed a mathematical model that describes the binding processes taking place within the equilibrium mixture of masking DNA, library DNA, and target cells. An obtained mathematical solution allows one to estimate the concentration of masking DNA that is required to outcompete the library DNA at a desirable ratio of bound masking DNA to bound library DNA. The required concentration depends on concentrations of the library and cells as well as on unknown cell characteristics. These characteristics include the concentration of total binding sites on the cell surface, N, and equilibrium dissociation constants, K(nsL) and K(nsM), for nonspecific binding of the library DNA and masking DNA, respectively. We developed a theory that allows the determination of N, K(nsL), and K(nsM) based on measurements of EC50 values for cells mixed separately with the library and masking DNA (EC50 is the concentration of fluorescently labeled DNA at which half of the maximum fluorescence signal from DNA-bound cells is reached). We also obtained expressions for signals from bound DNA (measured by flow cytometry) in terms of N, K(nsL), and K(nsM). These expressions can be used for the verification of N, K(nsL), and K(nsM) values found from EC50 measurements. The developed procedure was applied to MCF-7 breast cancer cells, and corresponding values of N, K(nsL), and K(nsM) were established for the first time. The concentration of masking DNA required for AptaBiD with MCF-7 breast cancer cells was also estimated.

Molecular Dynamics Simulations of DNA-Free and DNA-Bound TAL Effectors

PubMed Central

Wan, Hua; Hu, Jian-ping; Li, Kang-shun; Tian, Xu-hong; Chang, Shan

2013-01-01

TAL (transcriptional activator-like) effectors (TALEs) are DNA-binding proteins, containing a modular central domain that recognizes specific DNA sequences. Recently, the crystallographic studies of TALEs revealed the structure of DNA-recognition domain. In this article, molecular dynamics (MD) simulations are employed to study two crystal structures of an 11.5-repeat TALE, in the presence and absence of DNA, respectively. The simulated results indicate that the specific binding of RVDs (repeat-variable diresidues) with DNA leads to the markedly reduced fluctuations of tandem repeats, especially at the two ends. In the DNA-bound TALE system, the base-specific interaction is formed mainly by the residue at position 13 within a TAL repeat. Tandem repeats with weak RVDs are unfavorable for the TALE-DNA binding. These observations are consistent with experimental studies. By using principal component analysis (PCA), the dominant motions are open-close movements between the two ends of the superhelical structure in both DNA-free and DNA-bound TALE systems. The open-close movements are found to be critical for the recognition and binding of TALE-DNA based on the analysis of free energy landscape (FEL). The conformational analysis of DNA indicates that the 5′ end of DNA target sequence has more remarkable structural deformability than the other sites. Meanwhile, the conformational change of DNA is likely associated with the specific interaction of TALE-DNA. We further suggest that the arrangement of N-terminal repeats with strong RVDs may help in the design of efficient TALEs. This study provides some new insights into the understanding of the TALE-DNA recognition mechanism. PMID:24130757

Contribution of the first K-homology domain of poly(C)-binding protein 1 to its affinity and specificity for C-rich oligonucleotides

PubMed Central

Yoga, Yano M. K.; Traore, Daouda A. K.; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R.; Barker, Andrew; Leedman, Peter J.; Wilce, Jacqueline A.; Wilce, Matthew C. J.

2012-01-01

Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5′-CCCTCCCT-3′ DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5′-ACCCCA-3′ DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad. PMID:22344691

Contribution of the first K-homology domain of poly(C)-binding protein 1 to its affinity and specificity for C-rich oligonucleotides.

PubMed

Yoga, Yano M K; Traore, Daouda A K; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R; Barker, Andrew; Leedman, Peter J; Wilce, Jacqueline A; Wilce, Matthew C J

2012-06-01

Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5'-CCCTCCCT-3' DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5'-ACCCCA-3' DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad.

Cloning and sequence analysis of complementary DNA encoding an aberrantly rearranged human T-cell gamma chain.

PubMed Central

Dialynas, D P; Murre, C; Quertermous, T; Boss, J M; Leiden, J M; Seidman, J G; Strominger, J L

1986-01-01

Complementary DNA (cDNA) encoding a human T-cell gamma chain has been cloned and sequenced. At the junction of the variable and joining regions, there is an apparent deletion of two nucleotides in the human cDNA sequence relative to the murine gamma-chain cDNA sequence, resulting simultaneously in the generation of an in-frame stop codon and in a translational frameshift. For this reason, the sequence presented here encodes an aberrantly rearranged human T-cell gamma chain. There are several surprising differences between the deduced human and murine gamma-chain amino acid sequences. These include poor homology in the variable region, poor homology in a discrete segment of the constant region precisely bounded by the expected junctions of exon CII, and the presence in the human sequence of five potential sites for N-linked glycosylation. Images PMID:3458221

Microgravity

NASA Image and Video Library

1998-12-01

Type II restriction enzymes, such as Eco R1 endonulease, present a unique advantage for the study of sequence-specific recognition because they leave a record of where they have been in the form of the cleaved ends of the DNA sites where they were bound. The differential behavior of a sequence -specific protein at sites of differing base sequence is the essence of the sequence-specificity; the core question is how do these proteins discriminate between different DNA sequences especially when the two sequences are very similar. Principal Investigator: Dan Carter/New Century Pharmaceuticals

Specific DNA binding activity of T antigen subclasses varies among different SV40-transformed cell lines.

PubMed

Burger, C; Fanning, E

1983-04-15

Large tumor antigen (T antigen) occurs in at least three different oligomeric subclasses in cells infected or transformed by simian virus 40 (SV40): 5-7 S, 14-16 S, and 23-25 S. The 23-25 S form is complexed with a host phosphoprotein (p53). The DNA binding properties of these three subclasses of T antigen from nine different cell lines and free p53 protein were compared using an immunoprecipitation assay. All three subclasses of T antigen bound specifically to SV40 DNA sequences near the origin of replication. However, the DNA binding activity varied between different cell lines over a 40- to 50-fold range. The 23-25 S and 14-16 S forms from most of the cell lines tested bound much less SV40 origin DNA than 5-7 S T antigen. The free p53 phosphoprotein did not bind specifically to any SV40 DNA sequences.

Interactions between the R2R3-MYB Transcription Factor, AtMYB61, and Target DNA Binding Sites

PubMed Central

Prouse, Michael B.; Campbell, Malcolm M.

2013-01-01

Despite the prominent roles played by R2R3-MYB transcription factors in the regulation of plant gene expression, little is known about the details of how these proteins interact with their DNA targets. For example, while Arabidopsis thaliana R2R3-MYB protein AtMYB61 is known to alter transcript abundance of a specific set of target genes, little is known about the specific DNA sequences to which AtMYB61 binds. To address this gap in knowledge, DNA sequences bound by AtMYB61 were identified using cyclic amplification and selection of targets (CASTing). The DNA targets identified using this approach corresponded to AC elements, sequences enriched in adenosine and cytosine nucleotides. The preferred target sequence that bound with the greatest affinity to AtMYB61 recombinant protein was ACCTAC, the AC-I element. Mutational analyses based on the AC-I element showed that ACC nucleotides in the AC-I element served as the core recognition motif, critical for AtMYB61 binding. Molecular modelling predicted interactions between AtMYB61 amino acid residues and corresponding nucleotides in the DNA targets. The affinity between AtMYB61 and specific target DNA sequences did not correlate with AtMYB61-driven transcriptional activation with each of the target sequences. CASTing-selected motifs were found in the regulatory regions of genes previously shown to be regulated by AtMYB61. Taken together, these findings are consistent with the hypothesis that AtMYB61 regulates transcription from specific cis-acting AC elements in vivo. The results shed light on the specifics of DNA binding by an important family of plant-specific transcriptional regulators. PMID:23741471

Sequence-dependent effects in drug-DNA interaction: the crystal structure of Hoechst 33258 bound to the d(CGCAAATTTGCG)2 duplex.

PubMed Central

Spink, N; Brown, D G; Skelly, J V; Neidle, S

1994-01-01

The bis-benzimidazole drug Hoechst 33258 has been co-crystallized with the dodecanucleotide sequence d(CGCAAATTTGCG)2. The structure has been solved by molecular replacement and refined to an R factor of 18.5% for 2125 reflections collected on a Xentronics area detector. The drug is bound in the minor groove, at the five base-pair site 5'-ATTTG and is in a unique orientation. This is displaced by one base pair in the 5' direction compared to previously-determined structures of this drug with the sequence d(CGCGAATTCGCG)2. Reasons for this difference in behaviour are discussed in terms of several sequence-dependent structural features of the DNA, with particular reference to differences in propeller twist and minor-groove width. Images PMID:7515488

Crystal structure of MboIIA methyltransferase.

PubMed

Osipiuk, Jerzy; Walsh, Martin A; Joachimiak, Andrzej

2003-09-15

DNA methyltransferases (MTases) are sequence-specific enzymes which transfer a methyl group from S-adenosyl-L-methionine (AdoMet) to the amino group of either cytosine or adenine within a recognized DNA sequence. Methylation of a base in a specific DNA sequence protects DNA from nucleolytic cleavage by restriction enzymes recognizing the same DNA sequence. We have determined at 1.74 A resolution the crystal structure of a beta-class DNA MTase MboIIA (M.MboIIA) from the bacterium Moraxella bovis, the smallest DNA MTase determined to date. M.MboIIA methylates the 3' adenine of the pentanucleotide sequence 5'-GAAGA-3'. The protein crystallizes with two molecules in the asymmetric unit which we propose to resemble the dimer when M.MboIIA is not bound to DNA. The overall structure of the enzyme closely resembles that of M.RsrI. However, the cofactor-binding pocket in M.MboIIA forms a closed structure which is in contrast to the open-form structures of other known MTases.

DNA sequence templates adjacent nucleosome and ORC sites at gene amplification origins in Drosophila

PubMed Central

Liu, Jun; Zimmer, Kurt; Rusch, Douglas B.; Paranjape, Neha; Podicheti, Ram; Tang, Haixu; Calvi, Brian R.

2015-01-01

Eukaryotic origins of DNA replication are bound by the origin recognition complex (ORC), which scaffolds assembly of a pre-replicative complex (pre-RC) that is then activated to initiate replication. Both pre-RC assembly and activation are strongly influenced by developmental changes to the epigenome, but molecular mechanisms remain incompletely defined. We have been examining the activation of origins responsible for developmental gene amplification in Drosophila. At a specific time in oogenesis, somatic follicle cells transition from genomic replication to a locus-specific replication from six amplicon origins. Previous evidence indicated that these amplicon origins are activated by nucleosome acetylation, but how this affects origin chromatin is unknown. Here, we examine nucleosome position in follicle cells using micrococcal nuclease digestion with Ilumina sequencing. The results indicate that ORC binding sites and other essential origin sequences are nucleosome-depleted regions (NDRs). Nucleosome position at the amplicons was highly similar among developmental stages during which ORC is or is not bound, indicating that being an NDR is not sufficient to specify ORC binding. Importantly, the data suggest that nucleosomes and ORC have opposite preferences for DNA sequence and structure. We propose that nucleosome hyperacetylation promotes pre-RC assembly onto adjacent DNA sequences that are disfavored by nucleosomes but favored by ORC. PMID:26227968

Structural Studies of E. coli Topoisomerase III-DNA Complexes Reveal A Novel Type IA Topoisomerase-DNA Conformational Intermediate

PubMed Central

Changela, Anita; DiGate, Russell J.; Mondragón, Alfonso

2007-01-01

Summary E. coli DNA topoisomerase III belongs to the type IA family of DNA topoisomerases, which transiently cleave single-stranded DNA (ssDNA) via a 5′ phosphotyrosine intermediate. We have solved crystal structures of wild-type E. coli topoisomerase III bound to an 8-base ssDNA molecule in three different pH environments. The structures reveal the enzyme in three distinct conformational states while bound to DNA. One conformation resembles the one observed previously with a DNA-bound, catalytically inactive mutant of topoisomerase III where DNA binding realigns catalytic residues to form a functional active site. Another conformation represents a novel intermediate in which DNA is bound along the ssDNA-binding groove but does not enter the active site, which remains in a catalytically inactive, closed state. A third conformation shows an intermediate state where the enzyme is still in a closed state, but the ssDNA is starting to invade the active site. For the first time, the active site region in the presence of both the catalytic tyrosine and ssDNA substrate is revealed for a type IA DNA topoisomerase, although there is no evidence of ssDNA cleavage. Comparative analysis of the various conformational states suggests a sequence of domain movements undertaken by the enzyme upon substrate binding. PMID:17331537

Accurate Prediction of Inducible Transcription Factor Binding Intensities In Vivo

PubMed Central

Siepel, Adam; Lis, John T.

2012-01-01

DNA sequence and local chromatin landscape act jointly to determine transcription factor (TF) binding intensity profiles. To disentangle these influences, we developed an experimental approach, called protein/DNA binding followed by high-throughput sequencing (PB–seq), that allows the binding energy landscape to be characterized genome-wide in the absence of chromatin. We applied our methods to the Drosophila Heat Shock Factor (HSF), which inducibly binds a target DNA sequence element (HSE) following heat shock stress. PB–seq involves incubating sheared naked genomic DNA with recombinant HSF, partitioning the HSF–bound and HSF–free DNA, and then detecting HSF–bound DNA by high-throughput sequencing. We compared PB–seq binding profiles with ones observed in vivo by ChIP–seq and developed statistical models to predict the observed departures from idealized binding patterns based on covariates describing the local chromatin environment. We found that DNase I hypersensitivity and tetra-acetylation of H4 were the most influential covariates in predicting changes in HSF binding affinity. We also investigated the extent to which DNA accessibility, as measured by digital DNase I footprinting data, could be predicted from MNase–seq data and the ChIP–chip profiles for many histone modifications and TFs, and found GAGA element associated factor (GAF), tetra-acetylation of H4, and H4K16 acetylation to be the most predictive covariates. Lastly, we generated an unbiased model of HSF binding sequences, which revealed distinct biophysical properties of the HSF/HSE interaction and a previously unrecognized substructure within the HSE. These findings provide new insights into the interplay between the genomic sequence and the chromatin landscape in determining transcription factor binding intensity. PMID:22479205

A Heterogeneous Nuclear Ribonucleoprotein A/B-Related Protein Binds to Single-Stranded DNA near the 5′ End or within the Genome of Feline Parvovirus and Can Modify Virus Replication

PubMed Central

Wang, Dai; Parrish, Colin R.

1999-01-01

Phage display of cDNA clones prepared from feline cells was used to identify host cell proteins that bound to DNA-containing feline panleukopenia virus (FPV) capsids but not to empty capsids. One gene found in several clones encoded a heterogeneous nuclear ribonucleoprotein (hnRNP)-related protein (DBP40) that was very similar in sequence to the A/B-type hnRNP proteins. DBP40 bound specifically to oligonucleotides representing a sequence near the 5′ end of the genome which is exposed on the outside of the full capsid but did not bind most other terminal sequences. Adding purified DBP40 to an in vitro fill-in reaction using viral DNA as a template inhibited the production of the second strand after nucleotide (nt) 289 but prior to nt 469. DBP40 bound to various regions of the viral genome, including a region between nt 295 and 330 of the viral genome which has been associated with transcriptional attenuation of the parvovirus minute virus of mice, which is mediated by a stem-loop structure of the DNA and cellular proteins. Overexpression of the protein in feline cells from a plasmid vector made them largely resistant to FPV infection. Mutagenesis of the protein binding site within the 5′ end viral genome did not affect replication of the virus. PMID:10438866

5-Hydroxymethylcytosine in E-box motifs ACAT|GTG and ACAC|GTG increases DNA-binding of the B-HLH transcription factor TCF4.

PubMed

Khund-Sayeed, Syed; He, Ximiao; Holzberg, Timothy; Wang, Jun; Rajagopal, Divya; Upadhyay, Shriyash; Durell, Stewart R; Mukherjee, Sanjit; Weirauch, Matthew T; Rose, Robert; Vinson, Charles

2016-09-12

We evaluated DNA binding of the B-HLH family members TCF4 and USF1 using protein binding microarrays (PBMs) containing double-stranded DNA probes with cytosine on both strands or 5-methylcytosine (5mC) or 5-hydroxymethylcytosine (5hmC) on one DNA strand and cytosine on the second strand. TCF4 preferentially bound the E-box motif (CAN|NTG) with strongest binding to the 8-mer CAG|GTGGT. 5mC uniformly decreases DNA binding of both TCF4 and USF1. The bulkier 5hmC also inhibited USF1 binding to DNA. In contrast, 5hmC dramatically enhanced TCF4 binding to E-box motifs ACAT|GTG and ACAC|GTG, being better bound than any 8-mer containing cytosine. Examination of X-ray structures of the closely related TCF3 and USF1 bound to DNA suggests TCF3 can undergo a conformational shift to preferentially bind to 5hmC while the USF1 basic region is bulkier and rigid precluding a conformation shift to bind 5hmC. These results greatly expand the regulatory DNA sequence landscape bound by TCF4.

Fusion of GFP to the M.EcoKI DNA methyltransferase produces a new probe of Type I DNA restriction and modification enzymes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Kai; Roberts, Gareth A.; Stephanou, Augoustinos S.

2010-07-23

Research highlights: {yields} Successful fusion of GFP to M.EcoKI DNA methyltransferase. {yields} GFP located at C-terminal of sequence specificity subunit does not later enzyme activity. {yields} FRET confirms structural model of M.EcoKI bound to DNA. -- Abstract: We describe the fusion of enhanced green fluorescent protein to the C-terminus of the HsdS DNA sequence-specificity subunit of the Type I DNA modification methyltransferase M.EcoKI. The fusion expresses well in vivo and assembles with the two HsdM modification subunits. The fusion protein functions as a sequence-specific DNA methyltransferase protecting DNA against digestion by the EcoKI restriction endonuclease. The purified enzyme shows Foerstermore » resonance energy transfer to fluorescently-labelled DNA duplexes containing the target sequence and to fluorescently-labelled ocr protein, a DNA mimic that binds to the M.EcoKI enzyme. Distances determined from the energy transfer experiments corroborate the structural model of M.EcoKI.« less

Isolation and characterization of target sequences of the chicken CdxA homeobox gene.

PubMed Central

Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A

1993-01-01

The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943

Biorecognition by DNA oligonucleotides after Exposure to Photoresists and Resist Removers

PubMed Central

Dean, Stacey L.; Morrow, Thomas J.; Patrick, Sue; Li, Mingwei; Clawson, Gary; Mayer, Theresa S.; Keating, Christine D.

2013-01-01

Combining biological molecules with integrated circuit technology is of considerable interest for next generation sensors and biomedical devices. Current lithographic microfabrication methods, however, were developed for compatibility with silicon technology rather than bioorganic molecules and consequently it cannot be assumed that biomolecules will remain attached and intact during on-chip processing. Here, we evaluate the effects of three common photoresists (Microposit S1800 series, PMGI SF6, and Megaposit SPR 3012) and two photoresist removers (acetone and 1165 remover) on the ability of surface-immobilized DNA oligonucleotides to selectively recognize their reverse-complementary sequence. Two common DNA immobilization methods were compared: adsorption of 5′-thiolated sequences directly to gold nanowires and covalent attachment of 5′-thiolated sequences to surface amines on silica coated nanowires. We found that acetone had deleterious effects on selective hybridization as compared to 1165 remover, presumably due to incomplete resist removal. Use of the PMGI photoresist, which involves a high temperature bake step, was detrimental to the later performance of nanowire-bound DNA in hybridization assays, especially for DNA attached via thiol adsorption. The other three photoresists did not substantially degrade DNA binding capacity or selectivity for complementary DNA sequences. To determine if the lithographic steps caused more subtle damage, we also tested oligonucleotides containing a single base mismatch. Finally, a two-step photolithographic process was developed and used in combination with dielectrophoretic nanowire assembly to produce an array of doubly-contacted, electrically isolated individual nanowire components on a chip. Post-fabrication fluorescence imaging indicated that nanowire-bound DNA was present and able to selectively bind complementary strands. PMID:23952639

Does TATA matter? A structural exploration of the selectivity determinants in its complexes with TATA box-binding protein.

PubMed Central

Pastor, N; Pardo, L; Weinstein, H

1997-01-01

The binding of the TATA box-binding protein (TBP) to a TATA sequence in DNA is essential for eukaryotic basal transcription. TBP binds in the minor groove of DNA, causing a large distortion of the DNA helix. Given the apparent stereochemical equivalence of AT and TA basepairs in the minor groove, DNA deformability must play a significant role in binding site selection, because not all AT-rich sequences are bound effectively by TBP. To gain insight into the precise role that the properties of the TATA sequence have in determining the specificity of the DNA substrates of TBP, the solution structure and dynamics of seven DNA dodecamers have been studied by using molecular dynamics simulations. The analysis of the structural properties of basepair steps in these TATA sequences suggests a reason for the preference for alternating pyrimidine-purine (YR) sequences, but indicates that these properties cannot be the sole determinant of the sequence specificity of TBP. Rather, recognition depends on the interplay between the inherent deformability of the DNA and steric complementarity at the molecular interface. Images FIGURE 2 PMID:9251783

Triple helix purification and sequencing

DOEpatents

Wang, Renfeng; Smith, Lloyd M.; Tong, Xinchun E.

1995-01-01

Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis.

Triple helix purification and sequencing

DOEpatents

Wang, R.; Smith, L.M.; Tong, X.E.

1995-03-28

Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis. 4 figures.

Informative priors based on transcription factor structural class improve de novo motif discovery.

PubMed

Narlikar, Leelavati; Gordân, Raluca; Ohler, Uwe; Hartemink, Alexander J

2006-07-15

An important problem in molecular biology is to identify the locations at which a transcription factor (TF) binds to DNA, given a set of DNA sequences believed to be bound by that TF. In previous work, we showed that information in the DNA sequence of a binding site is sufficient to predict the structural class of the TF that binds it. In particular, this suggests that we can predict which locations in any DNA sequence are more likely to be bound by certain classes of TFs than others. Here, we argue that traditional methods for de novo motif finding can be significantly improved by adopting an informative prior probability that a TF binding site occurs at each sequence location. To demonstrate the utility of such an approach, we present priority, a powerful new de novo motif finding algorithm. Using data from TRANSFAC, we train three classifiers to recognize binding sites of basic leucine zipper, forkhead, and basic helix loop helix TFs. These classifiers are used to equip priority with three class-specific priors, in addition to a default prior to handle TFs of other classes. We apply priority and a number of popular motif finding programs to sets of yeast intergenic regions that are reported by ChIP-chip to be bound by particular TFs. priority identifies motifs the other methods fail to identify, and correctly predicts the structural class of the TF recognizing the identified binding sites. Supplementary material and code can be found at http://www.cs.duke.edu/~amink/.

Crystal structure of MboIIA methyltransferase.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Osipiuk, J.; Walsh, M. A.; Joachimiak, A.

2003-09-15

DNA methyltransferases (MTases) are sequence-specific enzymes which transfer a methyl group from S-adenosyl-L-methionine (AdoMet) to the amino group of either cytosine or adenine within a recognized DNA sequence. Methylation of a base in a specific DNA sequence protects DNA from nucleolytic cleavage by restriction enzymes recognizing the same DNA sequence. We have determined at 1.74 {angstrom} resolution the crystal structure of a {beta}-class DNA MTase MboIIA (M {center_dot} MboIIA) from the bacterium Moraxella bovis, the smallest DNA MTase determined to date. M {center_dot} MboIIA methylates the 3' adenine of the pentanucleotide sequence 5'-GAAGA-3'. The protein crystallizes with two molecules inmore » the asymmetric unit which we propose to resemble the dimer when M {center_dot} MboIIA is not bound to DNA. The overall structure of the enzyme closely resembles that of M {center_dot} RsrI. However, the cofactor-binding pocket in M {center_dot} MboIIA forms a closed structure which is in contrast to the open-form structures of other known MTases.« less

Next-generation sequencing library construction on a surface.

PubMed

Feng, Kuan; Costa, Justin; Edwards, Jeremy S

2018-05-30

Next-generation sequencing (NGS) has revolutionized almost all fields of biology, agriculture and medicine, and is widely utilized to analyse genetic variation. Over the past decade, the NGS pipeline has been steadily improved, and the entire process is currently relatively straightforward. However, NGS instrumentation still requires upfront library preparation, which can be a laborious process, requiring significant hands-on time. Herein, we present a simple but robust approach to streamline library preparation by utilizing surface bound transposases to construct DNA libraries directly on a flowcell surface. The surface bound transposases directly fragment genomic DNA while simultaneously attaching the library molecules to the flowcell. We sequenced and analysed a Drosophila genome library generated by this surface tagmentation approach, and we showed that our surface bound library quality was comparable to the quality of the library from a commercial kit. In addition to the time and cost savings, our approach does not require PCR amplification of the library, which eliminates potential problems associated with PCR duplicates. We described the first study to construct libraries directly on a flowcell. We believe our technique could be incorporated into the existing Illumina sequencing pipeline to simplify the workflow, reduce costs, and improve data quality.

Comparison between TRF2 and TRF1 of their telomeric DNA-bound structures and DNA-binding activities

PubMed Central

Hanaoka, Shingo; Nagadoi, Aritaka; Nishimura, Yoshifumi

2005-01-01

Mammalian telomeres consist of long tandem arrays of double-stranded telomeric TTAGGG repeats packaged by the telomeric DNA-binding proteins TRF1 and TRF2. Both contain a similar C-terminal Myb domain that mediates sequence-specific binding to telomeric DNA. In a DNA complex of TRF1, only the single Myb-like domain consisting of three helices can bind specifically to double-stranded telomeric DNA. TRF2 also binds to double-stranded telomeric DNA. Although the DNA binding mode of TRF2 is likely identical to that of TRF1, TRF2 plays an important role in the t-loop formation that protects the ends of telomeres. Here, to clarify the details of the double-stranded telomeric DNA-binding modes of TRF1 and TRF2, we determined the solution structure of the DNA-binding domain of human TRF2 bound to telomeric DNA; it consists of three helices, and like TRF1, the third helix recognizes TAGGG sequence in the major groove of DNA with the N-terminal arm locating in the minor groove. However, small but significant differences are observed; in contrast to the minor groove recognition of TRF1, in which an arginine residue recognizes the TT sequence, a lysine residue of TRF2 interacts with the TT part. We examined the telomeric DNA-binding activities of both DNA-binding domains of TRF1 and TRF2 and found that TRF1 binds more strongly than TRF2. Based on the structural differences of both domains, we created several mutants of the DNA-binding domain of TRF2 with stronger binding activities compared to the wild-type TRF2. PMID:15608118

Genome-Wide Profiling of RNA–Protein Interactions Using CLIP-Seq

PubMed Central

Stork, Cheryl; Zheng, Sika

2017-01-01

UV crosslinking immunoprecipitation (CLIP) is an increasingly popular technique to study protein–RNA interactions in tissues and cells. Whole cells or tissues are ultraviolet irradiated to generate a covalent bond between RNA and proteins that are in close contact. After partial RNase digestion, antibodies specific to an RNA binding protein (RBP) or a protein–epitope tag is then used to immunoprecipitate the protein–RNA complexes. After stringent washing and gel separation the RBP–RNA complex is excised. The RBP is protease digested to allow purification of the bound RNA. Reverse transcription of the RNA followed by high-throughput sequencing of the cDNA library is now often used to identify protein bound RNA on a genome-wide scale. UV irradiation can result in cDNA truncations and/or mutations at the crosslink sites, which complicates the alignment of the sequencing library to the reference genome and the identification of the crosslinking sites. Meanwhile, one or more amino acids of a crosslinked RBP can remain attached to its bound RNA due to incomplete digestion of the protein. As a result, reverse transcriptase may not read through the crosslink sites, and produce cDNA ending at the crosslinked nucleotide. This is harnessed by one variant of CLIP methods to identify crosslinking sites at a nucleotide resolution. This method, individual nucleotide resolution CLIP (iCLIP) circularizes cDNA to capture the truncated cDNA and also increases the efficiency of ligating sequencing adapters to the library. Here, we describe the detailed procedure of iCLIP. PMID:26965263

Nanopore sensing of individual transcription factors bound to DNA

PubMed Central

Squires, Allison; Atas, Evrim; Meller, Amit

2015-01-01

Transcription factor (TF)-DNA interactions are the primary control point in regulation of gene expression. Characterization of these interactions is essential for understanding genetic regulation of biological systems and developing novel therapies to treat cellular malfunctions. Solid-state nanopores are a highly versatile class of single-molecule sensors that can provide rich information about local properties of long charged biopolymers using the current blockage patterns generated during analyte translocation, and provide a novel platform for characterization of TF-DNA interactions. The DNA-binding domain of the TF Early Growth Response Protein 1 (EGR1), a prototypical zinc finger protein known as zif268, is used as a model system for this study. zif268 adopts two distinct bound conformations corresponding to specific and nonspecific binding, according to the local DNA sequence. Here we implement a solid-state nanopore platform for direct, label- and tether-free single-molecule detection of zif268 bound to DNA. We demonstrate detection of single zif268 TFs bound to DNA according to current blockage sublevels and duration of translocation through the nanopore. We further show that the nanopore can detect and discriminate both specific and nonspecific binding conformations of zif268 on DNA via the distinct current blockage patterns corresponding to each of these two known binding modes. PMID:26109509

Nanopore sensing of individual transcription factors bound to DNA

NASA Astrophysics Data System (ADS)

Squires, Allison; Atas, Evrim; Meller, Amit

2015-06-01

Transcription factor (TF)-DNA interactions are the primary control point in regulation of gene expression. Characterization of these interactions is essential for understanding genetic regulation of biological systems and developing novel therapies to treat cellular malfunctions. Solid-state nanopores are a highly versatile class of single-molecule sensors that can provide rich information about local properties of long charged biopolymers using the current blockage patterns generated during analyte translocation, and provide a novel platform for characterization of TF-DNA interactions. The DNA-binding domain of the TF Early Growth Response Protein 1 (EGR1), a prototypical zinc finger protein known as zif268, is used as a model system for this study. zif268 adopts two distinct bound conformations corresponding to specific and nonspecific binding, according to the local DNA sequence. Here we implement a solid-state nanopore platform for direct, label- and tether-free single-molecule detection of zif268 bound to DNA. We demonstrate detection of single zif268 TFs bound to DNA according to current blockage sublevels and duration of translocation through the nanopore. We further show that the nanopore can detect and discriminate both specific and nonspecific binding conformations of zif268 on DNA via the distinct current blockage patterns corresponding to each of these two known binding modes.

Amino acids 16-275 of minute virus of mice NS1 include a domain that specifically binds (ACCA)2-3-containing DNA.

PubMed

Mouw, M; Pintel, D J

1998-11-10

GST-NS1 purified from Escherichia coli and insect cells binds double-strand DNA in an (ACCA)2-3-dependent fashion under similar ionic conditions, independent of the presence of anti-NS1 antisera or exogenously supplied ATP and interacts with single-strand DNA and RNA in a sequence-independent manner. An amino-terminal domain (amino acids 1-275) of NS1 [GST-NS1(1-275)], representing 41% of the full-length NS1 molecule, includes a domain that binds double-strand DNA in a sequence-specific manner at levels comparable to full-length GST-NS1, as well as single-strand DNA and RNA in a sequence-independent manner. The deletion of 15 additional amino-terminal amino acids yielded a molecule [GST-NS1(1-275)] that maintained (ACCA)2-3-specific double-strand DNA binding; however, this molecule was more sensitive to increasing ionic conditions than full-length GST-NS1 and GST-NS1(1-275) and could not be demonstrated to bind single-strand nucleic acids. A quantitative filter binding assay showed that E. coli- and baculovirus-expressed GST-NS1 and E. coli GST-NS1(1-275) specifically bound double-strand DNA with similar equilibrium kinetics [as measured by their apparent equilibrium DNA binding constants (KD)], whereas GST-NS1(16-275) bound 4- to 8-fold less well. Copyright 1998 Academic Press.

Structural mechanics of DNA wrapping in the nucleosome.

PubMed

Battistini, Federica; Hunter, Christopher A; Gardiner, Eleanor J; Packer, Martin J

2010-02-19

Experimental X-ray crystal structures and a database of calculated structural parameters of DNA octamers were used in combination to analyse the mechanics of DNA bending in the nucleosome core complex. The 1kx5 X-ray crystal structure of the nucleosome core complex was used to determine the relationship between local structure at the base-step level and the global superhelical conformation observed for nucleosome-bound DNA. The superhelix is characterised by a large curvature (597 degrees) in one plane and very little curvature (10 degrees) in the orthogonal plane. Analysis of the curvature at the level of 10-step segments shows that there is a uniform curvature of 30 degrees per helical turn throughout most of the structure but that there are two sharper kinks of 50 degrees at +/-2 helical turns from the central dyad base pair. The curvature is due almost entirely to the base-step parameter roll. There are large periodic variations in roll, which are in phase with the helical twist and account for 500 degrees of the total curvature. Although variations in the other base-step parameters perturb the local path of the DNA, they make minimal contributions to the total curvature. This implies that DNA bending in the nucleosome is achieved using the roll-slide-twist degree of freedom previously identified as the major degree of freedom in naked DNA oligomers. The energetics of bending into a nucleosome-bound conformation were therefore analysed using a database of structural parameters that we have previously developed for naked DNA oligomers. The minimum energy roll, the roll flexibility force constant and the maximum and minimum accessible roll values were obtained for each base step in the relevant octanucleotide context to account for the effects of conformational coupling that vary with sequence context. The distribution of base-step roll values and corresponding strain energy required to bend DNA into the nucleosome-bound conformation defined by the 1kx5 structure were obtained by applying a constant bending moment. When a single bending moment was applied to the entire sequence, the local details of the calculated structure did not match the experiment. However, when local 10-step bending moments were applied separately, the calculated structure showed excellent agreement with experiment. This implies that the protein applies variable bending forces along the DNA to maintain the superhelical path required for nucleosome wrapping. In particular, the 50 degrees kinks are constraints imposed by the protein rather than a feature of the 1kx5 DNA sequence. The kinks coincide with a relatively flexible region of the sequence, and this is probably a prerequisite for high-affinity nucleosome binding, but the bending strain energy is significantly higher at these points than for the rest of the sequence. In the most rigid regions of the sequence, a higher strain energy is also required to achieve the standard 30 degrees curvature per helical turn. We conclude that matching of the DNA sequence to the local roll periodicity required to achieve bending, together with the increased flexibility required at the kinks, determines the sequence selectivity of DNA wrapping in the nucleosome. 2009 Elsevier Ltd. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Changela, Anita; DiGate, Russell J.; Mondragon, Alfonso

Escherichia coli DNA topoisomerase III belongs to the type IA family of DNA topoisomerases, which transiently cleave single-stranded DNA (ssDNA) via a 5{prime} phosphotyrosine intermediate. We have solved crystal structures of wild-type E. coli topoisomerase III bound to an eight-base ssDNA molecule in three different pH environments. The structures reveal the enzyme in three distinct conformational states while bound to DNA. One conformation resembles the one observed previously with a DNA-bound, catalytically inactive mutant of topoisomerase III where DNA binding realigns catalytic residues to form a functional active site. Another conformation represents a novel intermediate in which DNA is boundmore » along the ssDNA-binding groove but does not enter the active site, which remains in a catalytically inactive, closed state. A third conformation shows an intermediate state where the enzyme is still in a closed state, but the ssDNA is starting to invade the active site. For the first time, the active site region in the presence of both the catalytic tyrosine and ssDNA substrate is revealed for a type IA DNA topoisomerase, although there is no evidence of ssDNA cleavage. Comparative analysis of the various conformational states suggests a sequence of domain movements undertaken by the enzyme upon substrate binding.« less

Two synthetic Sp1-binding sites functionally substitute for the 21-base-pair repeat region to activate simian virus 40 growth in CV-1 cells.

PubMed Central

Lednicky, J; Folk, W R

1992-01-01

The 21-bp repeat region of simian virus 40 (SV40) activates viral transcription and DNA replication and contains binding sites for many cellular proteins, including Sp1, LSF, ETF, Ap2, Ap4, GT-1B, H16, and p53, and for the SV40 large tumor antigen. We have attempted to reduce the complexity of this region while maintaining its growth-promoting capacity. Deletion of the 21-bp repeat region from the SV40 genome delays the expression of viral early proteins and DNA replication and reduces virus production in CV-1 cells. Replacement of the 21-bp repeat region with two copies of DNA sequence motifs bound with high affinities by Sp1 promotes SV40 growth in CV-1 cells to nearly wild-type levels, but substitution by motifs bound less avidly by Sp1 or bound by other activator proteins does not restore growth. This indicates that Sp1 or a protein with similar sequence specificity is primarily responsible for the function of the 21-bp repeat region. We speculate about how Sp1 activates both SV40 transcription and DNA replication. Images PMID:1328672

Functional specificity of a Hox protein mediated by the recognition of minor groove structure.

PubMed

Joshi, Rohit; Passner, Jonathan M; Rohs, Remo; Jain, Rinku; Sosinsky, Alona; Crickmore, Michael A; Jacob, Vinitha; Aggarwal, Aneel K; Honig, Barry; Mann, Richard S

2007-11-02

The recognition of specific DNA-binding sites by transcription factors is a critical yet poorly understood step in the control of gene expression. Members of the Hox family of transcription factors bind DNA by making nearly identical major groove contacts via the recognition helices of their homeodomains. In vivo specificity, however, often depends on extended and unstructured regions that link Hox homeodomains to a DNA-bound cofactor, Extradenticle (Exd). Using a combination of structure determination, computational analysis, and in vitro and in vivo assays, we show that Hox proteins recognize specific Hox-Exd binding sites via residues located in these extended regions that insert into the minor groove but only when presented with the correct DNA sequence. Our results suggest that these residues, which are conserved in a paralog-specific manner, confer specificity by recognizing a sequence-dependent DNA structure instead of directly reading a specific DNA sequence.

The 'dark matter' in the plant genomes: non-coding and unannotated DNA sequences associated with open chromatin.

PubMed

Jiang, Jiming

2015-04-01

Sequencing of complete plant genomes has become increasingly more routine since the advent of the next-generation sequencing technology. Identification and annotation of large amounts of noncoding but functional DNA sequences, including cis-regulatory DNA elements (CREs), have become a new frontier in plant genome research. Genomic regions containing active CREs bound to regulatory proteins are hypersensitive to DNase I digestion and are called DNase I hypersensitive sites (DHSs). Several recent DHS studies in plants illustrate that DHS datasets produced by DNase I digestion followed by next-generation sequencing (DNase-seq) are highly valuable for the identification and characterization of CREs associated with plant development and responses to environmental cues. DHS-based genomic profiling has opened a door to identify and annotate the 'dark matter' in sequenced plant genomes. Copyright © 2015 Elsevier Ltd. All rights reserved.

Rat L (long interspersed repeated DNA) elements contain guanine-rich homopurine sequences that induce unpairing of contiguous duplex DNA.

PubMed Central

Usdin, K; Furano, A V

1988-01-01

The L family (long interspersed repeated DNA) of mobile genetic elements is a persistent feature of the mammalian genome. In rats, this family contains approximately equal to 40,000 members and accounts for approximately equal to 10% of the haploid genome. We demonstrate here that the guanine-rich homopurine stretches located at the right end of L-DNA induce oligonucleotide uptake by contiguous duplex DNA. The uptake is dependent on negative supercoiling and the length of the homopurine stretch and occurs even when the L-DNA homopurine stretches are introduced into a different DNA environment. The bound oligomer primes DNA synthesis when DNA polymerase and deoxyribonucleoside triphosphates are added, resulting in a faithful copy of the template to which the oligonucleotide had bound. The implications of this property of the L-DNA guanine-rich homopurine stretches in the amplification, recombination, and dispersal of L elements is discussed. Images PMID:2837766

Structural and Thermodynamic Signatures of DNA Recognition by Mycobacterium tuberculosis DnaA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsodikov, Oleg V.; Biswas, Tapan

An essential protein, DnaA, binds to 9-bp DNA sites within the origin of replication oriC. These binding events are prerequisite to forming an enigmatic nucleoprotein scaffold that initiates replication. The number, sequences, positions, and orientations of these short DNA sites, or DnaA boxes, within the oriCs of different bacteria vary considerably. To investigate features of DnaA boxes that are important for binding Mycobacterium tuberculosis DnaA (MtDnaA), we have determined the crystal structures of the DNA binding domain (DBD) of MtDnaA bound to a cognate MtDnaA-box (at 2.0 {angstrom} resolution) and to a consensus Escherichia coli DnaA-box (at 2.3 {angstrom}). Thesemore » structures, complemented by calorimetric equilibrium binding studies of MtDnaA DBD in a series of DnaA-box variants, reveal the main determinants of DNA recognition and establish the [T/C][T/A][G/A]TCCACA sequence as a high-affinity MtDnaA-box. Bioinformatic and calorimetric analyses indicate that DnaA-box sequences in mycobacterial oriCs generally differ from the optimal binding sequence. This sequence variation occurs commonly at the first 2 bp, making an in vivo mycobacterial DnaA-box effectively a 7-mer and not a 9-mer. We demonstrate that the decrease in the affinity of these MtDnaA-box variants for MtDnaA DBD relative to that of the highest-affinity box TTGTCCACA is less than 10-fold. The understanding of DnaA-box recognition by MtDnaA and E. coli DnaA enables one to map DnaA-box sequences in the genomes of M. tuberculosis and other eubacteria.« less

Directing an artificial zinc finger protein to new targets by fusion to a non-DNA-binding domain.

PubMed

Lim, Wooi F; Burdach, Jon; Funnell, Alister P W; Pearson, Richard C M; Quinlan, Kate G R; Crossley, Merlin

2016-04-20

Transcription factors are often regarded as having two separable components: a DNA-binding domain (DBD) and a functional domain (FD), with the DBD thought to determine target gene recognition. While this holds true for DNA bindingin vitro, it appears thatin vivoFDs can also influence genomic targeting. We fused the FD from the well-characterized transcription factor Krüppel-like Factor 3 (KLF3) to an artificial zinc finger (AZF) protein originally designed to target the Vascular Endothelial Growth Factor-A (VEGF-A) gene promoter. We compared genome-wide occupancy of the KLF3FD-AZF fusion to that observed with AZF. AZF bound to theVEGF-Apromoter as predicted, but was also found to occupy approximately 25,000 other sites, a large number of which contained the expected AZF recognition sequence, GCTGGGGGC. Interestingly, addition of the KLF3 FD re-distributes the fusion protein to new sites, with total DNA occupancy detected at around 50,000 sites. A portion of these sites correspond to known KLF3-bound regions, while others contained sequences similar but not identical to the expected AZF recognition sequence. These results show that FDs can influence and may be useful in directing AZF DNA-binding proteins to specific targets and provide insights into how natural transcription factors operate. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

The application of magnetic bead hybridization for the recovery and STR amplification of degraded and inhibited forensic DNA.

PubMed

Wang, Jing; McCord, Bruce

2011-06-01

A common problem in the analysis of forensic DNA evidence is the presence of environmentally degraded and inhibited DNA. Such samples produce a variety of interpretational problems such as allele imbalance, allele dropout and sequence specific inhibition. In an attempt to develop methods to enhance the recovery of this type of evidence, magnetic bead hybridization has been applied to extract and preconcentrate DNA sequences containing short tandem repeat (STR) alleles of interest. In this work, genomic DNA was fragmented by heating, and sequences associated with STR alleles were selectively hybridized to allele-specific biotinylated probes. Each particular biotinylated probe-DNA complex was bound to streptavidin-coated magnetic beads using enabling enrichment of target DNA sequences. Experiments conducted using degraded DNA samples, as well as samples containing a large concentration of inhibitory substances, showed good specificity and recovery of missing alleles. Based on the favorable results obtained with these specific probes, this method should prove useful as a tool to improve the recovery of alleles from degraded and inhibited DNA samples. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Controlled Assembly of Ag Nanoparticles and Carbon Nanotube Hybrid Structures for Biosensing

DTIC Science & Technology

2010-01-01

to∼190 kΩ. The same device was again washed with DI water and treated with the thiolated ssDNA in high salt buffer. After a 2 h treatment, the device...after the cleaning only thiolated DNA should be present on the device, whereas the nonspecifically bound DNA as well as the buffer salts should be...ssDNA molecules for 2 h. Specific immobiliza- tion of thiolated ssDNA (sequence: 50thiol_TCATAC AGCTAGATA ACC AAAGA) was carried out in high salt

Unusual target site disruption by the rare-cutting HNH restriction endonuclease PacI

PubMed Central

Shen, Betty; Heiter, Daniel F.; Chan, Siu-Hong; Wang, Hua; Xu, Shuang-Yong; Morgan, Richard D.; Wilson, Geoffrey G.; Stoddard, Barry L.

2010-01-01

The crystal structure of the rare-cutting HNH restriction endonuclease PacI in complex with its eight base pair target recognition sequence 5'-TTAATTAA-3' has been determined to 1.9 Å resolution. The enzyme forms an extended homodimer, with each subunit containing two zinc-bound motifs surrounding a ββα-metal catalytic site. The latter is unusual in that a tyrosine residue likely initiates strand-cleavage. PacI dramatically distorts its target sequence from Watson-Crick duplex DNA basepairing, with every base separated from its original partner. Two bases on each strand are unpaired, four are engaged in non-canonical A:A and T:T base pairs, and the remaining two bases are matched with new Watson-Crick partners. This represents a highly unusual DNA binding mechanism for a restriction endonuclease, and implies that initial recognition of the target site might involve significantly different contacts from those visualized in the DNA-bound cocrystal structures. PMID:20541511

Biosensing of BCR/ABL fusion gene using an intensity-interrogation surface plasmon resonance imaging system

NASA Astrophysics Data System (ADS)

Wu, Jiangling; Huang, Yu; Bian, Xintong; Li, DanDan; Cheng, Quan; Ding, Shijia

2016-10-01

In this work, a custom-made intensity-interrogation surface plasmon resonance imaging (SPRi) system has been developed to directly detect a specific sequence of BCR/ABL fusion gene in chronic myelogenous leukemia (CML). The variation in the reflected light intensity detected from the sensor chip composed of gold islands array is proportional to the change of refractive index due to the selective hybridization of surface-bound DNA probes with target ssDNA. SPRi measurements were performed with different concentrations of synthetic target DNA sequence. The calibration curve of synthetic target sequence shows a good relationship between the concentration of synthetic target and the change of reflected light intensity. The detection limit of this SPRi measurement could approach 10.29 nM. By comparing SPRi images, the target ssDNA and non-complementary DNA sequence are able to be distinguished. This SPRi system has been applied for assay of BCR/ABL fusion gene extracted from real samples. This nucleic acid-based SPRi biosensor therefore offers an alternative high-effective, high-throughput label-free tool for DNA detection in biomedical research and molecular diagnosis.

Conserved Sequences at the Origin of Adenovirus DNA Replication

PubMed Central

Stillman, Bruce W.; Topp, William C.; Engler, Jeffrey A.

1982-01-01

The origin of adenovirus DNA replication lies within an inverted sequence repetition at either end of the linear, double-stranded viral DNA. Initiation of DNA replication is primed by a deoxynucleoside that is covalently linked to a protein, which remains bound to the newly synthesized DNA. We demonstrate that virion-derived DNA-protein complexes from five human adenovirus serological subgroups (A to E) can act as a template for both the initiation and the elongation of DNA replication in vitro, using nuclear extracts from adenovirus type 2 (Ad2)-infected HeLa cells. The heterologous template DNA-protein complexes were not as active as the homologous Ad2 DNA, most probably due to inefficient initiation by Ad2 replication factors. In an attempt to identify common features which may permit this replication, we have also sequenced the inverted terminal repeated DNA from human adenovirus serotypes Ad4 (group E), Ad9 and Ad10 (group D), and Ad31 (group A), and we have compared these to previously determined sequences from Ad2 and Ad5 (group C), Ad7 (group B), and Ad12 and Ad18 (group A) DNA. In all cases, the sequence around the origin of DNA replication can be divided into two structural domains: a proximal A · T-rich region which is partially conserved among these serotypes, and a distal G · C-rich region which is less well conserved. The G · C-rich region contains sequences similar to sequences present in papovavirus replication origins. The two domains may reflect a dual mechanism for initiation of DNA replication: adenovirus-specific protein priming of replication, and subsequent utilization of this primer by host replication factors for completion of DNA synthesis. Images PMID:7143575

DNA recognition by an RNA-guided bacterial Argonaute

PubMed Central

Doudna, Jennifer A.

2017-01-01

Argonaute (Ago) proteins are widespread in prokaryotes and eukaryotes and share a four-domain architecture capable of RNA- or DNA-guided nucleic acid recognition. Previous studies identified a prokaryotic Argonaute protein from the eubacterium Marinitoga piezophila (MpAgo), which binds preferentially to 5′-hydroxylated guide RNAs and cleaves single-stranded RNA (ssRNA) and DNA (ssDNA) targets. Here we present a 3.2 Å resolution crystal structure of MpAgo bound to a 21-nucleotide RNA guide and a complementary 21-nucleotide ssDNA substrate. Comparison of this ternary complex to other target-bound Argonaute structures reveals a unique orientation of the N-terminal domain, resulting in a straight helical axis of the entire RNA-DNA heteroduplex through the central cleft of the protein. Additionally, mismatches introduced into the heteroduplex reduce MpAgo cleavage efficiency with a symmetric profile centered around the middle of the helix. This pattern differs from the canonical mismatch tolerance of other Argonautes, which display decreased cleavage efficiency for substrates bearing sequence mismatches to the 5′ region of the guide strand. This structural analysis of MpAgo bound to a hybrid helix advances our understanding of the diversity of target recognition mechanisms by Argonaute proteins. PMID:28520746

Substrate sequence selectivity of APOBEC3A implicates intra-DNA interactions.

PubMed

Silvas, Tania V; Hou, Shurong; Myint, Wazo; Nalivaika, Ellen; Somasundaran, Mohan; Kelch, Brian A; Matsuo, Hiroshi; Kurt Yilmaz, Nese; Schiffer, Celia A

2018-05-14

The APOBEC3 (A3) family of human cytidine deaminases is renowned for providing a first line of defense against many exogenous and endogenous retroviruses. However, the ability of these proteins to deaminate deoxycytidines in ssDNA makes A3s a double-edged sword. When overexpressed, A3s can mutate endogenous genomic DNA resulting in a variety of cancers. Although the sequence context for mutating DNA varies among A3s, the mechanism for substrate sequence specificity is not well understood. To characterize substrate specificity of A3A, a systematic approach was used to quantify the affinity for substrate as a function of sequence context, length, secondary structure, and solution pH. We identified the A3A ssDNA binding motif as (T/C)TC(A/G), which correlated with enzymatic activity. We also validated that A3A binds RNA in a sequence specific manner. A3A bound tighter to substrate binding motif within a hairpin loop compared to linear oligonucleotide, suggesting A3A affinity is modulated by substrate structure. Based on these findings and previously published A3A-ssDNA co-crystal structures, we propose a new model with intra-DNA interactions for the molecular mechanism underlying A3A sequence preference. Overall, the sequence and structural preferences identified for A3A leads to a new paradigm for identifying A3A's involvement in mutation of endogenous or exogenous DNA.

Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buchman, A.R.; Kimmerly, W.J.; Rine, J.

1988-01-01

Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less

Exact method for numerically analyzing a model of local denaturation in superhelically stressed DNA

NASA Astrophysics Data System (ADS)

Fye, Richard M.; Benham, Craig J.

1999-03-01

Local denaturation, the separation at specific sites of the two strands comprising the DNA double helix, is one of the most fundamental processes in biology, required to allow the base sequence to be read both in DNA transcription and in replication. In living organisms this process can be mediated by enzymes which regulate the amount of superhelical stress imposed on the DNA. We present a numerically exact technique for analyzing a model of denaturation in superhelically stressed DNA. This approach is capable of predicting the locations and extents of transition in circular superhelical DNA molecules of kilobase lengths and specified base pair sequences. It can also be used for closed loops of DNA which are typically found in vivo to be kilobases long. The analytic method consists of an integration over the DNA twist degrees of freedom followed by the introduction of auxiliary variables to decouple the remaining degrees of freedom, which allows the use of the transfer matrix method. The algorithm implementing our technique requires O(N2) operations and O(N) memory to analyze a DNA domain containing N base pairs. However, to analyze kilobase length DNA molecules it must be implemented in high precision floating point arithmetic. An accelerated algorithm is constructed by imposing an upper bound M on the number of base pairs that can simultaneously denature in a state. This accelerated algorithm requires O(MN) operations, and has an analytically bounded error. Sample calculations show that it achieves high accuracy (greater than 15 decimal digits) with relatively small values of M (M<0.05N) for kilobase length molecules under physiologically relevant conditions. Calculations are performed on the superhelical pBR322 DNA sequence to test the accuracy of the method. With no free parameters in the model, the locations and extents of local denaturation predicted by this analysis are in quantitatively precise agreement with in vitro experimental measurements. Calculations performed on the fructose-1,6-bisphosphatase gene sequence from yeast show that this approach can also accurately treat in vivo denaturation.

Mutations altering the cleavage specificity of a homing endonuclease

PubMed Central

Seligman, Lenny M.; Chisholm, Karen M.; Chevalier, Brett S.; Chadsey, Meggen S.; Edwards, Samuel T.; Savage, Jeremiah H.; Veillet, Adeline L.

2002-01-01

The homing endonuclease I-CreI recognizes and cleaves a particular 22 bp DNA sequence. The crystal structure of I-CreI bound to homing site DNA has previously been determined, leading to a number of predictions about specific protein–DNA contacts. We test these predictions by analyzing a set of endonuclease mutants and a complementary set of homing site mutants. We find evidence that all structurally predicted I-CreI/DNA contacts contribute to DNA recognition and show that these contacts differ greatly in terms of their relative importance. We also describe the isolation of a collection of altered specificity I-CreI derivatives. The in vitro DNA-binding and cleavage properties of two such endonucleases demonstrate that our genetic approach is effective in identifying homing endonucleases that recognize and cleave novel target sequences. PMID:12202772

Genomic sequencing and in vivo footprinting of an expression-specific DNase I-hypersensitive site of avian vitellogenin II promoter reveal a demethylation of a mCpG and a change in specific interactions of proteins with DNA.

PubMed Central

Saluz, H P; Feavers, I M; Jiricny, J; Jost, J P

1988-01-01

Genomic sequencing was used to study the in vivo methylation pattern of two CpG sites in the promoter region of the avian vitellogenin gene. The CpG at position +10 was fully methylated in DNA isolated from tissues that do not express the gene but was unmethylated in the liver of mature hens and estradiol-treated roosters. In the latter tissue, this site became demethylated and DNase I hypersensitive after estradiol treatment. A second CpG (position -52) was unmethylated in all tissues examined. In vivo genomic footprinting with dimethyl sulfate revealed different patterns of DNA protection in silent and expressed genes. In rooster liver cells, at least 10 base pairs of DNA, including the methylated CpG, were protected by protein(s). Gel-shift assays indicated that a protein factor, present in rooster liver nuclear extract, bound at this site only when it was methylated. In hen liver cells, the same unmethylated CpG lies within a protected region of approximately equal to 20 base pairs. In vitro DNase I protection and gel-shift assays indicate that this sequence is bound by a protein, which binds both double- and single-stranded DNA. For the latter substrate, this factor was shown to bind solely the noncoding (i.e., mRNA-like) strand. Images PMID:3413118

Probing the dynamics of restriction endonuclease NgoMIV-DNA interaction by single-molecule FRET.

PubMed

Tutkus, Marijonas; Sasnauskas, Giedrius; Rutkauskas, Danielis

2017-12-01

Many type II restriction endonucleases require two copies of their recognition sequence for optimal activity. Concomitant binding of two DNA sites by such an enzyme produces a DNA loop. Here we exploit single-molecule Förster resonance energy transfer (smFRET) of surface-immobilized DNA fragments to study the dynamics of DNA looping induced by tetrameric endonuclease NgoMIV. We have employed a DNA fragment with two NgoMIV recognition sites and a FRET dye pair such that upon protein-induced DNA looping the dyes are brought to close proximity resulting in a FRET signal. The dynamics of DNA-NgoMIV interactions proved to be heterogeneous, with individual smFRET trajectories exhibiting broadly different average looped state durations. Distinct types of the dynamics were attributed to different types of DNA-protein complexes, mediated either by one NgoMIV tetramer simultaneously bound to two specific sites ("slow" trajectories) or by semi-specific interactions of two DNA-bound NgoMIV tetramers ("fast" trajectories), as well as to conformational heterogeneity of individual NgoMIV molecules. © 2017 Wiley Periodicals, Inc.

Chromatin-associated RNA sequencing (ChAR-seq) maps genome-wide RNA-to-DNA contacts

PubMed Central

Jukam, David; Teran, Nicole A; Risca, Viviana I; Smith, Owen K; Johnson, Whitney L; Skotheim, Jan M; Greenleaf, William James

2018-01-01

RNA is a critical component of chromatin in eukaryotes, both as a product of transcription, and as an essential constituent of ribonucleoprotein complexes that regulate both local and global chromatin states. Here, we present a proximity ligation and sequencing method called Chromatin-Associated RNA sequencing (ChAR-seq) that maps all RNA-to-DNA contacts across the genome. Using Drosophila cells, we show that ChAR-seq provides unbiased, de novo identification of targets of chromatin-bound RNAs including nascent transcripts, chromosome-specific dosage compensation ncRNAs, and genome-wide trans-associated RNAs involved in co-transcriptional RNA processing. PMID:29648534

Tumorigenic Potential of Transit Amplifying Prostate Cells

DTIC Science & Technology

2012-06-01

by ChIP-Seq showed that in both the human prostate cell line LNCaP and in mouse prostate, NKX3.1 bound DNA fragments are significantly enriched in...progression. Cancer Cell. 2010;17(5):443–454. 29. Steadman DJ, Giuffrida D, Gelmann EP. DNA - binding sequence of the human prostate-specific...bind nucleosomal DNA and destabilize nucleosomes thereby allowing other transcription factors to access their sites (7),(8). BODY Aim 1: To

kmer-SVM: a web server for identifying predictive regulatory sequence features in genomic data sets

PubMed Central

Fletez-Brant, Christopher; Lee, Dongwon; McCallion, Andrew S.; Beer, Michael A.

2013-01-01

Massively parallel sequencing technologies have made the generation of genomic data sets a routine component of many biological investigations. For example, Chromatin immunoprecipitation followed by sequence assays detect genomic regions bound (directly or indirectly) by specific factors, and DNase-seq identifies regions of open chromatin. A major bottleneck in the interpretation of these data is the identification of the underlying DNA sequence code that defines, and ultimately facilitates prediction of, these transcription factor (TF) bound or open chromatin regions. We have recently developed a novel computational methodology, which uses a support vector machine (SVM) with kmer sequence features (kmer-SVM) to identify predictive combinations of short transcription factor-binding sites, which determine the tissue specificity of these genomic assays (Lee, Karchin and Beer, Discriminative prediction of mammalian enhancers from DNA sequence. Genome Res. 2011; 21:2167–80). This regulatory information can (i) give confidence in genomic experiments by recovering previously known binding sites, and (ii) reveal novel sequence features for subsequent experimental testing of cooperative mechanisms. Here, we describe the development and implementation of a web server to allow the broader research community to independently apply our kmer-SVM to analyze and interpret their genomic datasets. We analyze five recently published data sets and demonstrate how this tool identifies accessory factors and repressive sequence elements. kmer-SVM is available at http://kmersvm.beerlab.org. PMID:23771147

kmer-SVM: a web server for identifying predictive regulatory sequence features in genomic data sets.

PubMed

Fletez-Brant, Christopher; Lee, Dongwon; McCallion, Andrew S; Beer, Michael A

2013-07-01

Massively parallel sequencing technologies have made the generation of genomic data sets a routine component of many biological investigations. For example, Chromatin immunoprecipitation followed by sequence assays detect genomic regions bound (directly or indirectly) by specific factors, and DNase-seq identifies regions of open chromatin. A major bottleneck in the interpretation of these data is the identification of the underlying DNA sequence code that defines, and ultimately facilitates prediction of, these transcription factor (TF) bound or open chromatin regions. We have recently developed a novel computational methodology, which uses a support vector machine (SVM) with kmer sequence features (kmer-SVM) to identify predictive combinations of short transcription factor-binding sites, which determine the tissue specificity of these genomic assays (Lee, Karchin and Beer, Discriminative prediction of mammalian enhancers from DNA sequence. Genome Res. 2011; 21:2167-80). This regulatory information can (i) give confidence in genomic experiments by recovering previously known binding sites, and (ii) reveal novel sequence features for subsequent experimental testing of cooperative mechanisms. Here, we describe the development and implementation of a web server to allow the broader research community to independently apply our kmer-SVM to analyze and interpret their genomic datasets. We analyze five recently published data sets and demonstrate how this tool identifies accessory factors and repressive sequence elements. kmer-SVM is available at http://kmersvm.beerlab.org.

Regulation of a Viral Proteinase by a Peptide and DNA in One-dimensional Space

PubMed Central

Graziano, Vito; Luo, Guobin; Blainey, Paul C.; Pérez-Berná, Ana J.; McGrath, William J.; Flint, S. Jane; San Martín, Carmen; Xie, X. Sunney; Mangel, Walter F.

2013-01-01

Late in an adenovirus infection, the viral proteinase (AVP) becomes activated to process virion precursor proteins used in virus assembly. AVP is activated by two cofactors, the viral DNA and pVIc, an 11-amino acid peptide originating from the C terminus of the precursor protein pVI. There is a conundrum in the activation of AVP in that AVP and pVI are sequence-independent DNA-binding proteins with nm equilibrium dissociation constants such that in the virus particle, they are predicted to be essentially irreversibly bound to the viral DNA. Here, we resolve that conundrum by showing that activation of AVP takes place on the one-dimensional contour of DNA. In vitro, pVI, a substrate, slides on DNA via one-dimensional diffusion, D1 = 1.45 × 106 bp2/s, until it binds to AVP also on the same DNA molecule. AVP, partially activated by being bound to DNA, excises pVIc, which binds to the AVP molecule that cut it out. pVIc then forms a disulfide bond with AVP forming the fully active AVP-pVIc complex bound to DNA. In vivo, in heat-disrupted immature virus, AVP was also activated by pVI in DNA-dependent reactions. This activation mechanism illustrates a new paradigm for virion maturation and a new way, by sliding on DNA, for bimolecular complexes to form among proteins not involved in DNA metabolism. PMID:23043137

Helix Unwinding and Base Flipping Enable Human MTERF1 to Terminate Mitochondrial Transcription

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yakubovskaya, E.; Mejia, E; Byrnes, J

2010-01-01

Defects in mitochondrial gene expression are associated with aging and disease. Mterf proteins have been implicated in modulating transcription, replication and protein synthesis. We have solved the structure of a member of this family, the human mitochondrial transcriptional terminator MTERF1, bound to dsDNA containing the termination sequence. The structure indicates that upon sequence recognition MTERF1 unwinds the DNA molecule, promoting eversion of three nucleotides. Base flipping is critical for stable binding and transcriptional termination. Additional structural and biochemical results provide insight into the DNA binding mechanism and explain how MTERF1 recognizes its target sequence. Finally, we have demonstrated that themore » mitochondrial pathogenic G3249A and G3244A mutations interfere with key interactions for sequence recognition, eliminating termination. Our results provide insight into the role of mterf proteins and suggest a link between mitochondrial disease and the regulation of mitochondrial transcription.« less

Sequence-specific binding of counterions to B-DNA

PubMed Central

Denisov, Vladimir P.; Halle, Bertil

2000-01-01

Recent studies by x-ray crystallography, NMR, and molecular simulations have suggested that monovalent counterions can penetrate deeply into the minor groove of B form DNA. Such groove-bound ions potentially could play an important role in AT-tract bending and groove narrowing, thereby modulating DNA function in vivo. To address this issue, we report here 23Na magnetic relaxation dispersion measurements on oligonucleotides, including difference experiments with the groove-binding drug netropsin. The exquisite sensitivity of this method to ions in long-lived and intimate association with DNA allows us to detect sequence-specific sodium ion binding in the minor groove AT tract of three B-DNA dodecamers. The sodium ion occupancy is only a few percent, however, and therefore is not likely to contribute importantly to the ensemble of B-DNA structures. We also report results of ion competition experiments, indicating that potassium, rubidium, and cesium ions bind to the minor groove with similarly weak affinity as sodium ions, whereas ammonium ion binding is somewhat stronger. The present findings are discussed in the light of previous NMR and diffraction studies of sequence-specific counterion binding to DNA. PMID:10639130

Adjacent DNA sequences modulate Sox9 transcriptional activation at paired Sox sites in three chondrocyte-specific enhancer elements

PubMed Central

Bridgewater, Laura C.; Walker, Marlan D.; Miller, Gwen C.; Ellison, Trevor A.; Holsinger, L. Daniel; Potter, Jennifer L.; Jackson, Todd L.; Chen, Reuben K.; Winkel, Vicki L.; Zhang, Zhaoping; McKinney, Sandra; de Crombrugghe, Benoit

2003-01-01

Expression of the type XI collagen gene Col11a2 is directed to cartilage by at least three chondrocyte-specific enhancer elements, two in the 5′ region and one in the first intron of the gene. The three enhancers each contain two heptameric sites with homology to the Sox protein-binding consensus sequence. The two sites are separated by 3 or 4 bp and arranged in opposite orientation to each other. Targeted mutational analyses of these three enhancers showed that in the intronic enhancer, as in the other two enhancers, both Sox sites in a pair are essential for enhancer activity. The transcription factor Sox9 binds as a dimer at the paired sites, and the introduction of insertion mutations between the sites demonstrated that physical interactions between the adjacently bound proteins are essential for enhancer activity. Additional mutational analyses demonstrated that although Sox9 binding at the paired Sox sites is necessary for enhancer activity, it alone is not sufficient. Adjacent DNA sequences in each enhancer are also required, and mutation of those sequences can eliminate enhancer activity without preventing Sox9 binding. The data suggest a new model in which adjacently bound proteins affect the DNA bend angle produced by Sox9, which in turn determines whether an active transcriptional enhancer complex is assembled. PMID:12595563

Virtual Cross-Linking of the Active Nemorubicin Metabolite PNU-159682 to Double-Stranded DNA.

PubMed

Scalabrin, Matteo; Quintieri, Luigi; Palumbo, Manlio; Riccardi Sirtori, Federico; Gatto, Barbara

2017-02-20

The DNA alkylating mechanism of PNU-159682 (PNU), a highly potent metabolite of the anthracycline nemorubicin, was investigated by gel-electrophoretic, HPLC-UV, and micro-HPLC/mass spectrometry (MS) measurements. PNU quickly reacted with double-stranded oligonucleotides, but not with single-stranded sequences, to form covalent adducts which were detectable by denaturing polyacrylamide gel electrophoresis (DPAGE). Ion-pair reverse-phase HPLC-UV analysis on CG rich duplex sequences having a 5'-CCCGGG-3' central core showed the formation of two types of adducts with PNU, which were stable and could be characterized by micro-HPLC/MS. The first type contained one alkylated species (and possibly one reversibly bound species), and the second contained two alkylated species per duplex DNA. The covalent adducts were found to produce effective bridging of DNA complementary strands through the formation of virtual cross-links reminiscent of those produced by classical anthracyclines in the presence of formaldehyde. Furthermore, the absence of reactivity of PNU with CG-rich sequence containing a TA core (CGTACG), and the minor reactivity between PNU and CGC sequences (TACGCG·CGCGTA) pointed out the importance of guanine sequence context in modulating DNA alkylation.

Characterization of Bleomycin-Mediated Cleavage of a Hairpin DNA Library

PubMed Central

Segerman, Zachary J.; Roy, Basab; Hecht, Sidney M.

2013-01-01

A study of BLM A5 was conducted using a previously isolated library of hairpin DNAs found to bind strongly to metal free BLM. The ability of Fe(II)•BLM to effect cleavage on both the 3' and 5'-arms of the hairpin DNAs was characterized. The strongly bound DNAs were found to be efficient substrates for Fe•BLM A5-mediated hairpin DNA cleavage. Surprisingly, the most prevalent site of BLM-mediated cleavage was found to be the 5′-AT-3′ dinucleotide sequence. This dinucleotide sequence, and other sequences generally not cleaved well by BLM when examined using arbitrarily chosen DNA substrates, were apparent when examining the library of ten hairpin DNAs. In total, 132 sites of DNA cleavage were produced by exposure of the hairpin DNA library to Fe•BLM A5. The existence of multiple sites of cleavage on both the 3′- and 5′-arms of the hairpin DNAs suggested that some of these might be double-strand cleavage events. Accordingly, an assay was developed with which to test the propensity of the hairpin DNAs to undergo double-strand DNA damage. One hairpin DNA was characterized using this method, and gave results consistent with earlier reports of double-strand DNA cleavage, but with a sequence selectivity different from those reported previously. PMID:23834496

DNA microdevice for electrochemical detection of Escherichia coli 0157:H7 molecular markers.

PubMed

Berganza, J; Olabarria, G; García, R; Verdoy, D; Rebollo, A; Arana, S

2007-04-15

An electrochemical DNA sensor based on the hybridization recognition of a single-stranded DNA (ssDNA) probe immobilized onto a gold electrode to its complementary ssDNA is presented. The DNA probe is bound on gold surface electrode by using self-assembled monolayer (SAM) technology. An optimized mixed SAM with a blocking molecule preventing the nonspecific adsorption on the electrode surface has been prepared. In this paper, a DNA biosensor is designed by means of the immobilization of a single stranded DNA probe on an electrochemical transducer surface to recognize specifically Escherichia coli (E. coli) 0157:H7 complementary target DNA sequence via cyclic voltammetry experiments. The 21 mer DNA probe including a C6 alkanethiol group at the 5' phosphate end has been synthesized to form the SAM onto the gold surface through the gold sulfur bond. The goal of this paper has been to design, characterise and optimise an electrochemical DNA sensor. In order to investigate the oligonucleotide probe immobilization and the hybridization detection, experiments with different concentration of DNA and mismatch sequences have been performed. This microdevice has demonstrated the suitability of oligonucleotide Self-assembled monolayers (SAMs) on gold as immobilization method. The DNA probes deposited on gold surface have been functional and able to detect changes in bases sequence in a 21-mer oligonucleotide.

Hydration properties of natural and synthetic DNA sequences with methylated adenine or cytosine bases in the R.DpnI target and BDNF promoter studied by molecular dynamics simulations

NASA Astrophysics Data System (ADS)

Shanak, Siba; Helms, Volkhard

2014-12-01

Adenine and cytosine methylation are two important epigenetic modifications of DNA sequences at the levels of the genome and transcriptome. To characterize the differential roles of methylating adenine or cytosine with respect to their hydration properties, we performed conventional MD simulations and free energy perturbation calculations for two particular DNA sequences, namely the brain-derived neurotrophic factor (BDNF) promoter and the R.DpnI-bound DNA that are known to undergo methylation of C5-methyl cytosine and N6-methyl adenine, respectively. We found that a single methylated cytosine has a clearly favorable hydration free energy over cytosine since the attached methyl group has a slightly polar character. In contrast, capping the strongly polar N6 of adenine with a methyl group gives a slightly unfavorable contribution to its free energy of solvation. Performing the same demethylation in the context of a DNA double-strand gave quite similar results for the more solvent-accessible cytosine but much more unfavorable results for the rather buried adenine. Interestingly, the same demethylation reactions are far more unfavorable when performed in the context of the opposite (BDNF or R.DpnI target) sequence. This suggests a natural preference for methylation in a specific sequence context. In addition, free energy calculations for demethylating adenine or cytosine in the context of B-DNA vs. Z-DNA suggest that the conformational B-Z transition of DNA transition is rather a property of cytosine methylated sequences but is not preferable for the adenine-methylated sequences investigated here.

Hydration properties of natural and synthetic DNA sequences with methylated adenine or cytosine bases in the R.DpnI target and BDNF promoter studied by molecular dynamics simulations.

PubMed

Shanak, Siba; Helms, Volkhard

2014-12-14

Adenine and cytosine methylation are two important epigenetic modifications of DNA sequences at the levels of the genome and transcriptome. To characterize the differential roles of methylating adenine or cytosine with respect to their hydration properties, we performed conventional MD simulations and free energy perturbation calculations for two particular DNA sequences, namely the brain-derived neurotrophic factor (BDNF) promoter and the R.DpnI-bound DNA that are known to undergo methylation of C5-methyl cytosine and N6-methyl adenine, respectively. We found that a single methylated cytosine has a clearly favorable hydration free energy over cytosine since the attached methyl group has a slightly polar character. In contrast, capping the strongly polar N6 of adenine with a methyl group gives a slightly unfavorable contribution to its free energy of solvation. Performing the same demethylation in the context of a DNA double-strand gave quite similar results for the more solvent-accessible cytosine but much more unfavorable results for the rather buried adenine. Interestingly, the same demethylation reactions are far more unfavorable when performed in the context of the opposite (BDNF or R.DpnI target) sequence. This suggests a natural preference for methylation in a specific sequence context. In addition, free energy calculations for demethylating adenine or cytosine in the context of B-DNA vs. Z-DNA suggest that the conformational B-Z transition of DNA transition is rather a property of cytosine methylated sequences but is not preferable for the adenine-methylated sequences investigated here.

Rapid detection of IHNV by molecular padlock recognition and surface-associated isothermal amplification

NASA Astrophysics Data System (ADS)

McCarthy, Erik L.; Egeler, Teressa J.; Bickerstaff, Lee E.; Pereira da Cunha, Mauricio; Millard, Paul J.

2005-11-01

RNA sequences derived from infectious hematopoeitic necrosis virus (IHNV) could be detected using a combination of surface-associated molecular padlock DNA probes (MPP) and rolling circle amplification (RCA) in microcapillary tubes. DNA oligonucleotides with base sequences identical to RNA obtained from IHNV were recognized by MPP. Circularized MPP were then captured on the inner surface of glass microcapillary tubes by immobilized DNA oligonucleotide primers. Extension of the immobilized primers by isothermal RCA gave rise to DNA concatamers, which were in turn bound by the fluorescent reporter SYBR Green II nucleic acid stain, and measured by microfluorimetry. Surface-associated molecular padlock technology, combined with isothermal RCA, exhibited high selectivity and sensitivity without thermal cycling. This technology is applicable to direct RNA and DNA detection, permitting detection of a variety of viral or bacterial pathogens.

Paging through history: parchment as a reservoir of ancient DNA for next generation sequencing

PubMed Central

Teasdale, M. D.; van Doorn, N. L.; Fiddyment, S.; Webb, C. C.; O'Connor, T.; Hofreiter, M.; Collins, M. J.; Bradley, D. G.

2015-01-01

Parchment represents an invaluable cultural reservoir. Retrieving an additional layer of information from these abundant, dated livestock-skins via the use of ancient DNA (aDNA) sequencing has been mooted by a number of researchers. However, prior PCR-based work has indicated that this may be challenged by cross-individual and cross-species contamination, perhaps from the bulk parchment preparation process. Here we apply next generation sequencing to two parchments of seventeenth and eighteenth century northern English provenance. Following alignment to the published sheep, goat, cow and human genomes, it is clear that the only genome displaying substantial unique homology is sheep and this species identification is confirmed by collagen peptide mass spectrometry. Only 4% of sequence reads align preferentially to a different species indicating low contamination across species. Moreover, mitochondrial DNA sequences suggest an upper bound of contamination at 5%. Over 45% of reads aligned to the sheep genome, and even this limited sequencing exercise yield 9 and 7% of each sampled sheep genome post filtering, allowing the mapping of genetic affinity to modern British sheep breeds. We conclude that parchment represents an excellent substrate for genomic analyses of historical livestock. PMID:25487331

Enrichment of individual KIR2DL4 sequences from genomic DNA using long-template PCR and allele-specific hybridization to magnetic bead-bound oligonucleotide probes.

PubMed

Roberts, C H; Turino, C; Madrigal, J A; Marsh, S G E

2007-06-01

DNA enrichment by allele-specific hybridization (DEASH) was used as a means to isolate individual alleles of the killer cell immunoglobulin-like receptor (KIR2DL4) gene from heterozygous genomic DNA. Using long-template polymerase chain reaction (LT-PCR), the complete KIR2DL4 gene was amplified from a cell line that had previously been characterized for its KIR gene content by PCR using sequence-specific primers (PCR-SSP). The whole gene amplicons were sequenced and we identified two heterozygous positions in accordance with the predictions of the PCR-SSP. The amplicons were then hybridized to allele-specific, biotinylated oligonucleotide probes and through binding to streptavidin-coated beads, the targeted alleles were enriched. A second PCR amplified only the exonic regions of the enriched allele, and these were then sequenced in full. We show DEASH to be capable of enriching single alleles from a heterozygous PCR product, and through sequencing the enriched DNA, we are able to produce complete coding sequences of the KIR2DL4 alleles in accordance with the typing predicted by PCR-SSP.

Perturbations in DNA structure upon interaction with porphyrins revealed by chemical probes, DNA footprinting and molecular modelling.

PubMed

Ford, K G; Neidle, S

1995-06-01

The interactions of several porphyrins with a 74 base-pair DNA sequence have been examined by footprinting and chemical protection methods. Tetra-(4-N-methyl-(pyridyl)) porphyrin (TMPy), two of its metal complexes and tetra-(4-trimethylanilinium) porphyrin (TMAP) bind to closely similar AT-rich sequences. The three TMPy ligands produce modest changes in DNA structure and base accessibility on binding, in contrast to the large-scale conformational changes observed with TMAP. Molecular modelling studies have been performed on TMPy and TMAP bound in the AT-rich minor groove of an oligonucleotide. These have shown that significant structural change is needed to accommodate the bulky trimethyl substituent groups of TMAP, in contrast to the facile minor groove fit of TMPy.

DNA attachment to support structures

DOEpatents

Balhorn, Rodney L.; Barry, Christopher H.

2002-01-01

Microscopic beads or other structures are attached to nucleic acids (DNA) using a terminal transferase. The transferase adds labeled dideoxy nucleotide bases to the ends of linear strands of DNA. The labels, such as the antigens digoxigenin and biotin, bind to the antibody compounds or other appropriate complementary ligands, which are bound to the microscopic beads or other support structures. The method does not require the synthesis of a synthetic oligonucleotide probe. The method can be used to tag or label DNA even when the DNA has an unknown sequence, has blunt ends, or is a very large fragment (e.g., >500 kilobase pairs).

Structural basis of DNA target recognition by the B3 domain of Arabidopsis epigenome reader VAL1

PubMed Central

Sasnauskas, Giedrius; Kauneckaitė, Kotryna; Siksnys, Virginijus

2018-01-01

Abstract Arabidopsis thaliana requires a prolonged period of cold exposure during winter to initiate flowering in a process termed vernalization. Exposure to cold induces epigenetic silencing of the FLOWERING LOCUS C (FLC) gene by Polycomb group (PcG) proteins. A key role in this epigenetic switch is played by transcriptional repressors VAL1 and VAL2, which specifically recognize Sph/RY DNA sequences within FLC via B3 DNA binding domains, and mediate recruitment of PcG silencing machinery. To understand the structural mechanism of site-specific DNA recognition by VAL1, we have solved the crystal structure of VAL1 B3 domain (VAL1-B3) bound to a 12 bp oligoduplex containing the canonical Sph/RY DNA sequence 5′-CATGCA-3′/5′-TGCATG-3′. We find that VAL1-B3 makes H-bonds and van der Waals contacts to DNA bases of all six positions of the canonical Sph/RY element. In agreement with the structure, in vitro DNA binding studies show that VAL1-B3 does not tolerate substitutions at any position of the 5′-TGCATG-3′ sequence. The VAL1-B3–DNA structure presented here provides a structural model for understanding the specificity of plant B3 domains interacting with the Sph/RY and other DNA sequences. PMID:29660015

Finding functional features in Saccharomyces genomes by phylogenetic footprinting.

PubMed

Cliften, Paul; Sudarsanam, Priya; Desikan, Ashwin; Fulton, Lucinda; Fulton, Bob; Majors, John; Waterston, Robert; Cohen, Barak A; Johnston, Mark

2003-07-04

The sifting and winnowing of DNA sequence that occur during evolution cause nonfunctional sequences to diverge, leaving phylogenetic footprints of functional sequence elements in comparisons of genome sequences. We searched for such footprints among the genome sequences of six Saccharomyces species and identified potentially functional sequences. Comparison of these sequences allowed us to revise the catalog of yeast genes and identify sequence motifs that may be targets of transcriptional regulatory proteins. Some of these conserved sequence motifs reside upstream of genes with similar functional annotations or similar expression patterns or those bound by the same transcription factor and are thus good candidates for functional regulatory sequences.

Probing and quantifying DNA-protein interactions with asymmetrical flow field-flow fractionation.

PubMed

Ashby, Jonathan; Schachermeyer, Samantha; Duan, Yaokai; Jimenez, Luis A; Zhong, Wenwan

2014-09-05

Tools capable of measuring binding affinities as well as amenable to downstream sequencing analysis are needed for study of DNA-protein interaction, particularly in discovery of new DNA sequences with affinity to diverse targets. Asymmetrical flow field-flow fractionation (AF4) is an open-channel separation technique that eliminates interference from column packing to the non-covalently bound complex and could potentially be applied for study of macromolecular interaction. The recovery and elution behaviors of the poly(dA)n strand and aptamers in AF4 were investigated. Good recovery of ssDNAs was achieved by judicious selection of the channel membrane with consideration of the membrane pore diameter and the radius of gyration (Rg) of the ssDNA, which was obtained with the aid of a Molecular Dynamics tool. The Rg values were also used to assess the folding situation of aptamers based on their migration times in AF4. The interactions between two ssDNA aptamers and their respective protein components were investigated. Using AF4, near-baseline resolution between the free and protein-bound aptamer fractions could be obtained. With this information, dissociation constants of ∼16nM and ∼57nM were obtained for an IgE aptamer and a streptavidin aptamer, respectively. In addition, free and protein-bound IgE aptamer was extracted from the AF4 eluate and amplified, illustrating the potential of AF4 in screening ssDNAs with high affinity to targets. Our results demonstrate that AF4 is an effective tool holding several advantages over the existing techniques and should be useful for study of diverse macromolecular interaction systems. Copyright © 2014 Elsevier B.V. All rights reserved.

Probing the structural dynamics of the CRISPR-Cas9 RNA-guided DNA-cleavage system by coarse-grained modeling.

PubMed

Zheng, Wenjun

2017-02-01

In the adaptive immune systems of many bacteria and archaea, the Cas9 endonuclease forms a complex with specific guide/scaffold RNA to identify and cleave complementary target sequences in foreign DNA. This DNA targeting machinery has been exploited in numerous applications of genome editing and transcription control. However, the molecular mechanism of the Cas9 system is still obscure. Recently, high-resolution structures have been solved for Cas9 in different structural forms (e.g., unbound forms, RNA-bound binary complexes, and RNA-DNA-bound tertiary complexes, corresponding to an inactive state, a pre-target-bound state, and a cleavage-competent or product state), which offered key structural insights to the Cas9 mechanism. To further probe the structural dynamics of Cas9 interacting with RNA and DNA at the amino-acid level of details, we have performed systematic coarse-grained modeling using an elastic network model and related analyses. Our normal mode analysis predicted a few key modes of collective motions that capture the observed conformational changes featuring large domain motions triggered by binding of RNA and DNA. Our flexibility analysis identified specific regions with high or low flexibility that coincide with key functional sites (such as DNA/RNA-binding sites, nuclease cleavage sites, and key hinges). We also identified a small set of hotspot residues that control the energetics of functional motions, which overlap with known functional sites and offer promising targets for future mutagenesis efforts to improve the specificity of Cas9. Finally, we modeled the conformational transitions of Cas9 from the unbound form to the binary complex and then the tertiary complex, and predicted a distinct sequence of domain motions. In sum, our findings have offered rich structural and dynamic details relevant to the Cas9 machinery, and will guide future investigation and engineering of the Cas9 systems. Proteins 2017; 85:342-353. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Role of the protein in the DNA sequence specificity of the cleavage site stabilized by the camptothecin topoisomerase IB inhibitor: a metadynamics study

PubMed Central

Coletta, Andrea; Desideri, Alessandro

2013-01-01

Camptothecin (CPT) is a topoisomerase IB (TopIB) selective inhibitor whose derivatives are currently used in cancer therapy. TopIB cleaves DNA at any sequence, but in the presence of CPT the only stabilized protein–DNA covalent complex is the one having a thymine in position −1 with respect to the cleavage site. A metadynamics simulation of two TopIB–DNA–CPT ternary complexes differing for the presence of a thymine or a cytosine in position −1 indicates the occurrence of two different drug’s unbinding pathways. The free-energy difference between the bound state and the transition state is large when a thymine is present in position −1 and is strongly reduced in presence of a cytosine, in line with the different drug stabilization properties of the two systems. Such a difference is strictly related to the changes in the hydrogen bond network between the protein, the DNA and the drug in the two systems, indicating a direct role of the protein in determining the specificity of the cleavage site sequence stabilized by the CPT. Calculations carried out in presence of one compound of the indenoisoquinoline family (NSC314622) indicate a comparable energy difference between the bound and the transition state independently of the presence of a thymine or a cytosine in position −1, in line with the experimental results. PMID:24003027

RNA from the 5' end of the R2 retrotransposon controls R2 protein binding to and cleavage of its DNA target site.

PubMed

Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H

2006-11-21

Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.

A septal chromosome segregator protein evolved into a conjugative DNA-translocator protein

PubMed Central

Sepulveda, Edgardo; Vogelmann, Jutta

2011-01-01

Streptomycetes, Gram-positive soil bacteria well known for the production of antibiotics feature a unique conjugative DNA transfer system. In contrast to classical conjugation which is characterized by the secretion of a pilot protein covalently linked to a single-stranded DNA molecule, in Streptomyces a double-stranded DNA molecule is translocated during conjugative transfer. This transfer involves a single plasmid encoded protein, TraB. A detailed biochemical and biophysical characterization of TraB, revealed a close relationship to FtsK, mediating chromosome segregation during bacterial cell division. TraB translocates plasmid DNA by recognizing 8-bp direct repeats located in a specific plasmid region clt. Similar sequences accidentally also occur on chromosomes and have been shown to be bound by TraB. We suggest that TraB mobilizes chromosomal genes by the interaction with these chromosomal clt-like sequences not relying on the integration of the conjugative plasmid into the chromosome. PMID:22479692

An immunoassay for the study of DNA-binding activities of herpes simplex virus protein ICP8.

PubMed

Lee, C K; Knipe, D M

1985-06-01

An immunoassay was used to examine the interaction between a herpes simplex virus protein, ICP8, and various types of DNA. The advantage of this assay is that the protein is not subjected to harsh purification procedures. We characterized the binding of ICP8 to both single-stranded (ss) and double-stranded (ds) DNA. ICP8 bound ss DNA fivefold more efficiently than ds DNA, and both binding activities were most efficient in 150 mM NaCl. Two lines of evidence indicate that the binding activities were not identical: (i) ds DNA failed to complete with ss DNA binding even with a large excess of ds DNA; (ii) Scatchard plots of DNA binding with various amounts of DNA were fundamentally different for ss DNA and ds DNA. However, the two activities were related in that ss DNA efficiently competed with the binding of ds DNA. We conclude that the ds DNA-binding activity of ICP8 is probably distinct from the ss DNA-binding activity. No evidence for sequence-specific ds DNA binding was obtained for either the entire herpes simplex virus genome or cloned viral sequences.

Simultaneously measuring multiple protein interactions and their correlations in a cell by Protein-interactome Footprinting

PubMed Central

Luo, Si-Wei; Liang, Zhi; Wu, Jia-Rui

2017-01-01

Quantitatively detecting correlations of multiple protein-protein interactions (PPIs) in vivo is a big challenge. Here we introduce a novel method, termed Protein-interactome Footprinting (PiF), to simultaneously measure multiple PPIs in one cell. The principle of PiF is that each target physical PPI in the interactome is simultaneously transcoded into a specific DNA sequence based on dimerization of the target proteins fused with DNA-binding domains. The interaction intensity of each target protein is quantified as the copy number of the specific DNA sequences bound by each fusion protein dimers. Using PiF, we quantitatively reveal dynamic patterns of PPIs and their correlation network in E. coli two-component systems. PMID:28338015

27nt-RNAs guide histone variant deposition via 'RNA-induced DNA replication interference' and thus transmit parental genome partitioning in Stylonychia.

PubMed

Postberg, Jan; Jönsson, Franziska; Weil, Patrick Philipp; Bulic, Aneta; Juranek, Stefan Andreas; Lipps, Hans-Joachim

2018-06-12

During sexual reproduction in the unicellular ciliate Stylonychia somatic macronuclei differentiate from germline micronuclei. Thereby, programmed sequence reduction takes place, leading to the elimination of > 95% of germline sequences, which priorly adopt heterochromatin structure via H3K27me3. Simultaneously, 27nt-ncRNAs become synthesized from parental transcripts and are bound by the Argonaute protein PIWI1. These 27nt-ncRNAs cover sequences destined to the developing macronucleus and are thought to protect them from degradation. We provide evidence and propose that RNA/DNA base-pairing guides PIWI1/27nt-RNA complexes to complementary macronucleus-destined DNA target sequences, hence transiently causing locally stalled replication during polytene chromosome formation. This spatiotemporal delay enables the selective deposition of temporarily available histone H3.4K27me3 nucleosomes at all other sequences being continuously replicated, thus dictating their prospective heterochromatin structure before becoming developmentally eliminated. Concomitantly, 27nt-RNA-covered sites remain protected. We introduce the concept of 'RNA-induced DNA replication interference' and explain how the parental functional genome partition could become transmitted to the progeny.

Isolation of a cDNA Encoding a Granule-Bound 152-Kilodalton Starch-Branching Enzyme in Wheat1

PubMed Central

Båga, Monica; Nair, Ramesh B.; Repellin, Anne; Scoles, Graham J.; Chibbar, Ravindra N.

2000-01-01

Screening of a wheat (Triticum aestivum) cDNA library for starch-branching enzyme I (SBEI) genes combined with 5′-rapid amplification of cDNA ends resulted in isolation of a 4,563-bp composite cDNA, Sbe1c. Based on sequence alignment to characterized SBEI cDNA clones isolated from plants, the SBEIc predicted from the cDNA sequence was produced with a transit peptide directing the polypeptide into plastids. Furthermore, the predicted mature form of SBEIc was much larger (152 kD) than previously characterized plant SBEI (80–100 kD) and contained a partial duplication of SBEI sequences. The first SBEI domain showed high amino acid similarity to a 74-kD wheat SBEI-like protein that is inactive as a branching enzyme when expressed in Escherichia coli. The second SBEI domain on SBEIc was identical in sequence to a functional 87-kD SBEI produced in the wheat endosperm. Immunoblot analysis of proteins produced in developing wheat kernels demonstrated that the 152-kD SBEIc was, in contrast to the 87- to 88-kD SBEI, preferentially associated with the starch granules. Proteins similar in size and recognized by wheat SBEI antibodies were also present in Triticum monococcum, Triticum tauschii, and Triticum turgidum subsp. durum. PMID:10982440

Single-molecule DNA unzipping reveals asymmetric modulation of a transcription factor by its binding site sequence and context

PubMed Central

Rudnizky, Sergei; Khamis, Hadeel; Malik, Omri; Squires, Allison H; Meller, Amit; Melamed, Philippa

2018-01-01

Abstract Most functional transcription factor (TF) binding sites deviate from their ‘consensus’ recognition motif, although their sites and flanking sequences are often conserved across species. Here, we used single-molecule DNA unzipping with optical tweezers to study how Egr-1, a TF harboring three zinc fingers (ZF1, ZF2 and ZF3), is modulated by the sequence and context of its functional sites in the Lhb gene promoter. We find that both the core 9 bp bound to Egr-1 in each of the sites, and the base pairs flanking them, modulate the affinity and structure of the protein–DNA complex. The effect of the flanking sequences is asymmetric, with a stronger effect for the sequence flanking ZF3. Characterization of the dissociation time of Egr-1 revealed that a local, mechanical perturbation of the interactions of ZF3 destabilizes the complex more effectively than a perturbation of the ZF1 interactions. Our results reveal a novel role for ZF3 in the interaction of Egr-1 with other proteins and the DNA, providing insight on the regulation of Lhb and other genes by Egr-1. Moreover, our findings reveal the potential of small changes in DNA sequence to alter transcriptional regulation, and may shed light on the organization of regulatory elements at promoters. PMID:29253225

Global Analysis of Transcription Factor-Binding Sites in Yeast Using ChIP-Seq

PubMed Central

Lefrançois, Philippe; Gallagher, Jennifer E. G.; Snyder, Michael

2016-01-01

Transcription factors influence gene expression through their ability to bind DNA at specific regulatory elements. Specific DNA-protein interactions can be isolated through the chromatin immunoprecipitation (ChIP) procedure, in which DNA fragments bound by the protein of interest are recovered. ChIP is followed by high-throughput DNA sequencing (Seq) to determine the genomic provenance of ChIP DNA fragments and their relative abundance in the sample. This chapter describes a ChIP-Seq strategy adapted for budding yeast to enable the genome-wide characterization of binding sites of transcription factors (TFs) and other DNA-binding proteins in an efficient and cost-effective way. Yeast strains with epitope-tagged TFs are most commonly used for ChIP-Seq, along with their matching untagged control strains. The initial step of ChIP involves the cross-linking of DNA and proteins. Next, yeast cells are lysed and sonicated to shear chromatin into smaller fragments. An antibody against an epitope-tagged TF is used to pull down chromatin complexes containing DNA and the TF of interest. DNA is then purified and proteins degraded. Specific barcoded adapters for multiplex DNA sequencing are ligated to ChIP DNA. Short DNA sequence reads (28–36 base pairs) are parsed according to the barcode and aligned against the yeast reference genome, thus generating a nucleotide-resolution map of transcription factor-binding sites and their occupancy. PMID:25213249

Crystal structure of APOBEC3A bound to single-stranded DNA reveals structural basis for cytidine deamination and specificity.

PubMed

Kouno, Takahide; Silvas, Tania V; Hilbert, Brendan J; Shandilya, Shivender M D; Bohn, Markus F; Kelch, Brian A; Royer, William E; Somasundaran, Mohan; Kurt Yilmaz, Nese; Matsuo, Hiroshi; Schiffer, Celia A

2017-04-28

Nucleic acid editing enzymes are essential components of the immune system that lethally mutate viral pathogens and somatically mutate immunoglobulins, and contribute to the diversification and lethality of cancers. Among these enzymes are the seven human APOBEC3 deoxycytidine deaminases, each with unique target sequence specificity and subcellular localization. While the enzymology and biological consequences have been extensively studied, the mechanism by which APOBEC3s recognize and edit DNA remains elusive. Here we present the crystal structure of a complex of a cytidine deaminase with ssDNA bound in the active site at 2.2 Å. This structure not only visualizes the active site poised for catalysis of APOBEC3A, but pinpoints the residues that confer specificity towards CC/TC motifs. The APOBEC3A-ssDNA complex defines the 5'-3' directionality and subtle conformational changes that clench the ssDNA within the binding groove, revealing the architecture and mechanism of ssDNA recognition that is likely conserved among all polynucleotide deaminases, thereby opening the door for the design of mechanistic-based therapeutics.

The FOXP2 forkhead domain binds to a variety of DNA sequences with different rates and affinities.

PubMed

Webb, Helen; Steeb, Olga; Blane, Ashleigh; Rotherham, Lia; Aron, Shaun; Machanick, Philip; Dirr, Heini; Fanucchi, Sylvia

2017-07-01

FOXP2 is a member of the P subfamily of FOX transcription factors, the DNA-binding domain of which is the winged helix forkhead domain (FHD). In this work we show that the FOXP2 FHD is able to bind to various DNA sequences, including a novel sequence identified in this work, with different affinities and rates as detected using surface plasmon resonance. Combining the experimental work with molecular docking, we show that high-affinity sequences remain bound to the protein for longer, form a greater number of interactions with the protein and induce a greater structural change in the protein than low-affinity sequences. We propose a binding model for the FOXP2 FHD that involves three types of binding sequence: low affinity sites which allow for rapid scanning of the genome by the protein in a partially unstructured state; moderate affinity sites which serve to locate the protein near target sites and high-affinity sites which secure the protein to the DNA and induce a conformational change necessary for functional binding and the possible initiation of downstream transcriptional events. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

Cloning and Identification of Recombinant Argonaute-Bound Small RNAs Using Next-Generation Sequencing.

PubMed

Gangras, Pooja; Dayeh, Daniel M; Mabin, Justin W; Nakanishi, Kotaro; Singh, Guramrit

2018-01-01

Argonaute proteins (AGOs) are loaded with small RNAs as guides to recognize target mRNAs. Since the target specificity heavily depends on the base complementarity between two strands, it is important to identify small guide and long target RNAs bound to AGOs. For this purpose, next-generation sequencing (NGS) technologies have extended our appreciation truly to the nucleotide level. However, the identification of RNAs via NGS from scarce RNA samples remains a challenge. Further, most commercial and published methods are compatible with either small RNAs or long RNAs, but are not equally applicable to both. Therefore, a single method that yields quantitative, bias-free NGS libraries to identify small and long RNAs from low levels of input will be of wide interest. Here, we introduce such a procedure that is based on several modifications of two published protocols and allows robust, sensitive, and reproducible cloning and sequencing of small amounts of RNAs of variable lengths. The method was applied to the identification of small RNAs bound to a purified eukaryotic AGO. Following ligation of a DNA adapter to RNA 3'-end, the key feature of this method is to use the adapter for priming reverse transcription (RT) wherein biotinylated deoxyribonucleotides specifically incorporated into the extended complementary DNA. Such RT products are enriched on streptavidin beads, circularized while immobilized on beads and directly used for PCR amplification. We provide a stepwise guide to generate RNA-Seq libraries, their purification, quantification, validation, and preparation for next-generation sequencing. We also provide basic steps in post-NGS data analyses using Galaxy, an open-source, web-based platform.

Interaction of the Sliding Clamp β-Subunit and Hda, a DnaA-Related Protein

PubMed Central

Kurz, Mareike; Dalrymple, Brian; Wijffels, Gene; Kongsuwan, Kritaya

2004-01-01

In Escherichia coli, interactions between the replication initiation protein DnaA, the β subunit of DNA polymerase III (the sliding clamp protein), and Hda, the recently identified DnaA-related protein, are required to convert the active ATP-bound form of DnaA to an inactive ADP-bound form through the accelerated hydrolysis of ATP. This rapid hydrolysis of ATP is proposed to be the main mechanism that blocks multiple initiations during cell cycle and acts as a molecular switch from initiation to replication. However, the biochemical mechanism for this crucial step in DNA synthesis has not been resolved. Using purified Hda and β proteins in a plate binding assay and Ni-nitrilotriacetic acid pulldown analysis, we show for the first time that Hda directly interacts with β in vitro. A new β-binding motif, a hexapeptide with the consensus sequence QL[SP]LPL, related to the previously identified β-binding pentapeptide motif (QL[SD]LF) was found in the amino terminus of the Hda protein. Mutants of Hda with amino acid changes in the hexapeptide motif are severely defective in their ability to bind β. A 10-amino-acid peptide containing the E. coli Hda β-binding motif was shown to compete with Hda for binding to β in an Hda-β interaction assay. These results establish that the interaction of Hda with β is mediated through the hexapeptide sequence. We propose that this interaction may be crucial to the events that lead to the inactivation of DnaA and the prevention of excess initiation of rounds of replication. PMID:15150238

Interaction of the sliding clamp beta-subunit and Hda, a DnaA-related protein.

PubMed

Kurz, Mareike; Dalrymple, Brian; Wijffels, Gene; Kongsuwan, Kritaya

2004-06-01

In Escherichia coli, interactions between the replication initiation protein DnaA, the beta subunit of DNA polymerase III (the sliding clamp protein), and Hda, the recently identified DnaA-related protein, are required to convert the active ATP-bound form of DnaA to an inactive ADP-bound form through the accelerated hydrolysis of ATP. This rapid hydrolysis of ATP is proposed to be the main mechanism that blocks multiple initiations during cell cycle and acts as a molecular switch from initiation to replication. However, the biochemical mechanism for this crucial step in DNA synthesis has not been resolved. Using purified Hda and beta proteins in a plate binding assay and Ni-nitrilotriacetic acid pulldown analysis, we show for the first time that Hda directly interacts with beta in vitro. A new beta-binding motif, a hexapeptide with the consensus sequence QL[SP]LPL, related to the previously identified beta-binding pentapeptide motif (QL[SD]LF) was found in the amino terminus of the Hda protein. Mutants of Hda with amino acid changes in the hexapeptide motif are severely defective in their ability to bind beta. A 10-amino-acid peptide containing the E. coli Hda beta-binding motif was shown to compete with Hda for binding to beta in an Hda-beta interaction assay. These results establish that the interaction of Hda with beta is mediated through the hexapeptide sequence. We propose that this interaction may be crucial to the events that lead to the inactivation of DnaA and the prevention of excess initiation of rounds of replication.

ChIP-chip.

PubMed

Kim, Tae Hoon; Dekker, Job

2018-05-01

ChIP-chip can be used to analyze protein-DNA interactions in a region-wide and genome-wide manner. DNA microarrays contain PCR products or oligonucleotide probes that are designed to represent genomic sequences. Identification of genomic sites that interact with a specific protein is based on competitive hybridization of the ChIP-enriched DNA and the input DNA to DNA microarrays. The ChIP-chip protocol can be divided into two main sections: Amplification of ChIP DNA and hybridization of ChIP DNA to arrays. A large amount of DNA is required to hybridize to DNA arrays, and hybridization to a set of multiple commercial arrays that represent the entire human genome requires two rounds of PCR amplifications. The relative hybridization intensity of ChIP DNA and that of the input DNA is used to determine whether the probe sequence is a potential site of protein-DNA interaction. Resolution of actual genomic sites bound by the protein is dependent on the size of the chromatin and on the genomic distance between the probes on the array. As with expression profiling using gene chips, ChIP-chip experiments require multiple replicates for reliable statistical measure of protein-DNA interactions. © 2018 Cold Spring Harbor Laboratory Press.

Structural insight into the specificity of the B3 DNA-binding domains provided by the co-crystal structure of the C-terminal fragment of BfiI restriction enzyme

PubMed Central

Golovenko, Dmitrij; Manakova, Elena; Zakrys, Linas; Zaremba, Mindaugas; Sasnauskas, Giedrius; Gražulis, Saulius; Siksnys, Virginijus

2014-01-01

The B3 DNA-binding domains (DBDs) of plant transcription factors (TF) and DBDs of EcoRII and BfiI restriction endonucleases (EcoRII-N and BfiI-C) share a common structural fold, classified as the DNA-binding pseudobarrel. The B3 DBDs in the plant TFs recognize a diverse set of target sequences. The only available co-crystal structure of the B3-like DBD is that of EcoRII-N (recognition sequence 5′-CCTGG-3′). In order to understand the structural and molecular mechanisms of specificity of B3 DBDs, we have solved the crystal structure of BfiI-C (recognition sequence 5′-ACTGGG-3′) complexed with 12-bp cognate oligoduplex. Structural comparison of BfiI-C–DNA and EcoRII-N–DNA complexes reveals a conserved DNA-binding mode and a conserved pattern of interactions with the phosphodiester backbone. The determinants of the target specificity are located in the loops that emanate from the conserved structural core. The BfiI-C–DNA structure presented here expands a range of templates for modeling of the DNA-bound complexes of the B3 family of plant TFs. PMID:24423868

DNA binding specificity of the basic-helix-loop-helix protein MASH-1.

PubMed

Meierhan, D; el-Ariss, C; Neuenschwander, M; Sieber, M; Stackhouse, J F; Allemann, R K

1995-09-05

Despite the high degree of sequence similarity in their basic-helix-loop-helix (BHLH) domains, MASH-1 and MyoD are involved in different biological processes. In order to define possible differences between the DNA binding specificities of these two proteins, we investigated the DNA binding properties of MASH-1 by circular dichroism spectroscopy and by electrophoretic mobility shift assays (EMSA). Upon binding to DNA, the BHLH domain of MASH-1 underwent a conformational change from a mainly unfolded to a largely alpha-helical form, and surprisingly, this change was independent of the specific DNA sequence. The same conformational transition could be induced by the addition of 20% 2,2,2-trifluoroethanol. The apparent dissociation constants (KD) of the complexes of full-length MASH-1 with various oligonucleotides were determined from half-saturation points in EMSAs. MASH-1 bound as a dimer to DNA sequences containing an E-box with high affinity KD = 1.4-4.1 x 10(-14) M2). However, the specificity of DNA binding was low. The dissociation constant for the complex between MASH-1 and the highest affinity E-box sequence (KD = 1.4 x 10(-14) M2) was only a factor of 10 smaller than for completely unrelated DNA sequences (KD = approximately 1 x 10(-13) M2). The DNA binding specificity of MASH-1 was not significantly increased by the formation of an heterodimer with the ubiquitous E12 protein. MASH-1 and MyoD displayed similar binding site preferences, suggesting that their different target gene specificities cannot be explained solely by differential DNA binding. An explanation for these findings is provided on the basis of the known crystal structure of the BHLH domain of MyoD.

Investigation of the electrostatic and hydration properties of DNA minor groove-binding by a heterocyclic diamidine by osmotic pressure.

PubMed

Erlitzki, Noa; Huang, Kenneth; Xhani, Suela; Farahat, Abdelbasset A; Kumar, Arvind; Boykin, David W; Poon, Gregory M K

2017-12-01

Previous investigations of sequence-specific DNA binding by model minor groove-binding compounds showed that the ligand/DNA complex was destabilized in the presence of compatible co-solutes. Inhibition was interpreted in terms of osmotic stress theory as the uptake of significant numbers of excess water molecules from bulk solvent upon complex formation. Here, we interrogated the AT-specific DNA complex formed with the symmetric heterocyclic diamidine DB1976 as a model for minor groove DNA recognition using both ionic (NaCl) and non-ionic cosolutes (ethylene glycol, glycine betaine, maltose, nicotinamide, urea). While the non-ionic cosolutes all destabilized the ligand/DNA complex, their quantitative effects were heterogeneous in a cosolute- and salt-dependent manner. Perturbation with NaCl in the absence of non-ionic cosolute showed that preferential hydration water was released upon formation of the DB1976/DNA complex. As salt probes counter-ion release from charged groups such as the DNA backbone, we propose that the preferential hydration uptake in DB1976/DNA binding observed in the presence of osmolytes reflects the exchange of preferentially bound cosolute with hydration water in the environs of the bound DNA, rather than a net uptake of hydration waters by the complex. Copyright © 2017 Elsevier B.V. All rights reserved.

Proteome-wide Identification of Novel Ceramide-binding Proteins by Yeast Surface cDNA Display and Deep Sequencing.

PubMed

Bidlingmaier, Scott; Ha, Kevin; Lee, Nam-Kyung; Su, Yang; Liu, Bin

2016-04-01

Although the bioactive sphingolipid ceramide is an important cell signaling molecule, relatively few direct ceramide-interacting proteins are known. We used an approach combining yeast surface cDNA display and deep sequencing technology to identify novel proteins binding directly to ceramide. We identified 234 candidate ceramide-binding protein fragments and validated binding for 20. Most (17) bound selectively to ceramide, although a few (3) bound to other lipids as well. Several novel ceramide-binding domains were discovered, including the EF-hand calcium-binding motif, the heat shock chaperonin-binding motif STI1, the SCP2 sterol-binding domain, and the tetratricopeptide repeat region motif. Interestingly, four of the verified ceramide-binding proteins (HPCA, HPCAL1, NCS1, and VSNL1) and an additional three candidate ceramide-binding proteins (NCALD, HPCAL4, and KCNIP3) belong to the neuronal calcium sensor family of EF hand-containing proteins. We used mutagenesis to map the ceramide-binding site in HPCA and to create a mutant HPCA that does not bind to ceramide. We demonstrated selective binding to ceramide by mammalian cell-produced wild type but not mutant HPCA. Intriguingly, we also identified a fragment from prostaglandin D2synthase that binds preferentially to ceramide 1-phosphate. The wide variety of proteins and domains capable of binding to ceramide suggests that many of the signaling functions of ceramide may be regulated by direct binding to these proteins. Based on the deep sequencing data, we estimate that our yeast surface cDNA display library covers ∼60% of the human proteome and our selection/deep sequencing protocol can identify target-interacting protein fragments that are present at extremely low frequency in the starting library. Thus, the yeast surface cDNA display/deep sequencing approach is a rapid, comprehensive, and flexible method for the analysis of protein-ligand interactions, particularly for the study of non-protein ligands. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Two high-mobility group box domains act together to underwind and kink DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sánchez-Giraldo, R.; Acosta-Reyes, F. J.; Malarkey, C. S.

The crystal structure of HMGB1 box A bound to an unmodified AT-rich DNA fragment is reported at a resolution of 2 Å. A new mode of DNA recognition for HMG box proteins is found in which two box A domains bind in an unusual configuration generating a highly kinked DNA structure. High-mobility group protein 1 (HMGB1) is an essential and ubiquitous DNA architectural factor that influences a myriad of cellular processes. HMGB1 contains two DNA-binding domains, box A and box B, which have little sequence specificity but have remarkable abilities to underwind and bend DNA. Although HMGB1 box A ismore » thought to be responsible for the majority of HMGB1–DNA interactions with pre-bent or kinked DNA, little is known about how it recognizes unmodified DNA. Here, the crystal structure of HMGB1 box A bound to an AT-rich DNA fragment is reported at a resolution of 2 Å. Two box A domains of HMGB1 collaborate in an unusual configuration in which the Phe37 residues of both domains stack together and intercalate the same CG base pair, generating highly kinked DNA. This represents a novel mode of DNA recognition for HMGB proteins and reveals a mechanism by which structure-specific HMG boxes kink linear DNA.« less

Architecture of the 99 bp DNA-six-protein regulatory complex of the lambda att site.

PubMed

Sun, Xingmin; Mierke, Dale F; Biswas, Tapan; Lee, Sang Yeol; Landy, Arthur; Radman-Livaja, Marta

2006-11-17

The highly directional and tightly regulated recombination reaction used to site-specifically excise the bacteriophage lambda chromosome out of its E. coli host chromosome requires the binding of six sequence-specific proteins to a 99 bp segment of the phage att site. To gain structural insights into this recombination pathway, we measured 27 FRET distances between eight points on the 99 bp regulatory DNA bound with all six proteins. Triangulation of these distances using a metric matrix distance-geometry algorithm provided coordinates for these eight points. The resulting path for the protein-bound regulatory DNA, which fits well with the genetics, biochemistry, and X-ray crystal structures describing the individual proteins and their interactions with DNA, provides a new structural perspective into the molecular mechanism and regulation of the recombination reaction and illustrates a design by which different families of higher-order complexes can be assembled from different numbers and combinations of the same few proteins.

DNA-binding regulates site-specific ubiquitination of IRF-1.

PubMed

Landré, Vivien; Pion, Emmanuelle; Narayan, Vikram; Xirodimas, Dimitris P; Ball, Kathryn L

2013-02-01

Understanding the determinants for site-specific ubiquitination by E3 ligase components of the ubiquitin machinery is proving to be a challenge. In the present study we investigate the role of an E3 ligase docking site (Mf2 domain) in an intrinsically disordered domain of IRF-1 [IFN (interferon) regulatory factor-1], a short-lived IFNγ-regulated transcription factor, in ubiquitination of the protein. Ubiquitin modification of full-length IRF-1 by E3 ligases such as CHIP [C-terminus of the Hsc (heat-shock cognate) 70-interacting protein] and MDM2 (murine double minute 2), which dock to the Mf2 domain, was specific for lysine residues found predominantly in loop structures that extend from the DNA-binding domain, whereas no modification was detected in the more conformationally flexible C-terminal half of the protein. The E3 docking site was not available when IRF-1 was in its DNA-bound conformation and cognate DNA-binding sequences strongly suppressed ubiquitination, highlighting a strict relationship between ligase binding and site-specific modification at residues in the DNA-binding domain. Hyperubiquitination of a non-DNA-binding mutant supports a mechanism where an active DNA-bound pool of IRF-1 is protected from polyubiquitination and degradation.

An electrochemical sensing platform based on local repression of electrolyte diffusion for single-step, reagentless, sensitive detection of a sequence-specific DNA-binding protein.

PubMed

Zhang, Yun; Liu, Fang; Nie, Jinfang; Jiang, Fuyang; Zhou, Caibin; Yang, Jiani; Fan, Jinlong; Li, Jianping

2014-05-07

In this paper, we report for the first time an electrochemical biosensor for single-step, reagentless, and picomolar detection of a sequence-specific DNA-binding protein using a double-stranded, electrode-bound DNA probe terminally modified with a redox active label close to the electrode surface. This new methodology is based upon local repression of electrolyte diffusion associated with protein-DNA binding that leads to reduction of the electrochemical response of the label. In the proof-of-concept study, the resulting electrochemical biosensor was quantitatively sensitive to the concentrations of the TATA binding protein (TBP, a model analyte) ranging from 40 pM to 25.4 nM with an estimated detection limit of ∼10.6 pM (∼80 to 400-fold improvement on the detection limit over previous electrochemical analytical systems).

Sequence of the structural gene for granule-bound starch synthase of potato (Solanum tuberosum L.) and evidence for a single point deletion in the amf allele.

PubMed

van der Leij, F R; Visser, R G; Ponstein, A S; Jacobsen, E; Feenstra, W J

1991-08-01

The genomic sequence of the potato gene for starch granule-bound starch synthase (GBSS; "waxy protein") has been determined for the wild-type allele of a monoploid genotype from which an amylose-free (amf) mutant was derived, and for the mutant part of the amf allele. Comparison of the wild-type sequence with a cDNA sequence from the literature and a newly isolated cDNA revealed the presence of 13 introns, the first of which is located in the untranslated leader. The promoter contains a G-box-like sequence. The deduced amino acid sequence of the precursor of GBSS shows a high degree of identity with monocot waxy protein sequences in the region corresponding to the mature form of the enzyme. The transit peptide of 77 amino acids, required for routing of the precursor to the plastids, shows much less identity with the transit peptides of the other waxy preproteins, but resembles the hydropathic distributions of these peptides. Alignment of the amino acid sequences of the four mature starch synthases with the Escherichia coli glgA gene product revealed the presence of at least three conserved boxes; there is no homology with previously proposed starch-binding domains of other enzymes involved in starch metabolism. We report the use of chimeric constructs with wild-type and amf sequences to localize, via complementation experiments, the region of the amf allele in which the mutation resides. Direct sequencing of polymerase chain reaction products confirmed that the amf mutation is a deletion of a single AT basepair in the region coding for the transit peptide.(ABSTRACT TRUNCATED AT 250 WORDS)

Herpes simplex virus DNA packaging sequences adopt novel structures that are specifically recognized by a component of the cleavage and packaging machinery.

PubMed

Adelman, K; Salmon, B; Baines, J D

2001-03-13

The product of the herpes simplex virus type 1 U(L)28 gene is essential for cleavage of concatemeric viral DNA into genome-length units and packaging of this DNA into viral procapsids. To address the role of U(L)28 in this process, purified U(L)28 protein was assayed for the ability to recognize conserved herpesvirus DNA packaging sequences. We report that DNA fragments containing the pac1 DNA packaging motif can be induced by heat treatment to adopt novel DNA conformations that migrate faster than the corresponding duplex in nondenaturing gels. Surprisingly, these novel DNA structures are high-affinity substrates for U(L)28 protein binding, whereas double-stranded DNA of identical sequence composition is not recognized by U(L)28 protein. We demonstrate that only one strand of the pac1 motif is responsible for the formation of novel DNA structures that are bound tightly and specifically by U(L)28 protein. To determine the relevance of the observed U(L)28 protein-pac1 interaction to the cleavage and packaging process, we have analyzed the binding affinity of U(L)28 protein for pac1 mutants previously shown to be deficient in cleavage and packaging in vivo. Each of the pac1 mutants exhibited a decrease in DNA binding by U(L)28 protein that correlated directly with the reported reduction in cleavage and packaging efficiency, thereby supporting a role for the U(L)28 protein-pac1 interaction in vivo. These data therefore suggest that the formation of novel DNA structures by the pac1 motif confers added specificity on recognition of DNA packaging sequences by the U(L)28-encoded component of the herpesvirus cleavage and packaging machinery.

Directed evolution of the TALE N-terminal domain for recognition of all 5' bases.

PubMed

Lamb, Brian M; Mercer, Andrew C; Barbas, Carlos F

2013-11-01

Transcription activator-like effector (TALE) proteins can be designed to bind virtually any DNA sequence. General guidelines for design of TALE DNA-binding domains suggest that the 5'-most base of the DNA sequence bound by the TALE (the N0 base) should be a thymine. We quantified the N0 requirement by analysis of the activities of TALE transcription factors (TALE-TF), TALE recombinases (TALE-R) and TALE nucleases (TALENs) with each DNA base at this position. In the absence of a 5' T, we observed decreases in TALE activity up to >1000-fold in TALE-TF activity, up to 100-fold in TALE-R activity and up to 10-fold reduction in TALEN activity compared with target sequences containing a 5' T. To develop TALE architectures that recognize all possible N0 bases, we used structure-guided library design coupled with TALE-R activity selections to evolve novel TALE N-terminal domains to accommodate any N0 base. A G-selective domain and broadly reactive domains were isolated and characterized. The engineered TALE domains selected in the TALE-R format demonstrated modularity and were active in TALE-TF and TALEN architectures. Evolved N-terminal domains provide effective and unconstrained TALE-based targeting of any DNA sequence as TALE binding proteins and designer enzymes.

Transformation of Bacillus subtilis by DNA bound on montmorillonite and effect of DNase on the transforming ability of bound DNA.

PubMed Central

Khanna, M; Stotzky, G

1992-01-01

The equilibrium adsorption and binding of DNA from Bacillus subtilis on the clay mineral montmorillonite, the ability of bound DNA to transform competent cells, and the resistance of bound DNA to degradation by DNase I are reported. Maximum adsorption of DNA on the clay occurred after 90 min of contact and was followed by a plateau. Adsorption was pH dependent and was greatest at pH 1.0 (19.9 micrograms of DNA mg of clay-1) and least at pH 9.0 (10.7 micrograms of DNA mg of clay-1). The transformation frequency increased as the pH at which the clay-DNA complexes were prepared increased, and there was no transformation by clay-DNA complexes prepared at pH 1. After extensive washing with deionized distilled water (pH 5.5) or DNA buffer (pH 7.5), 21 and 28%, respectively, of the DNA remained bound. Bound DNA was capable of transforming competent cells (as was the desorbed DNA), indicating that adsorption, desorption, and binding did not alter the transforming ability of the DNA. Maximum transformation by bound DNA occurred at 37 degrees C (the other temperatures evaluated were 0, 25, and 45 degrees C). DNA bound on montmorillonite was protected against degradation by DNase, supporting the concept that "cryptic genes" may persist in the environment when bound on particulates. The concentration of DNase required to inhibit transformation by bound DNA was higher than that required to inhibit transformation by comparable amounts of free DNA, and considerably more bound than free DNase was required to inhibit transformation by the same amount of free DNA. Similarly, when DNA and DNase were bound on the same or separate samples of montmorillonite, the bound DNA was protected from the activity of DNase. PMID:1622268

Novel Optical Metamaterials and Approaches for Fabrication

DTIC Science & Technology

2012-08-01

phage display , we have also identified peptides that bind with nanoparticles and glass substrates. This is a critical step in engineering M13 ...with 2-mercaptoethanol ............................................... 12 Figure 13: DNA sequence of the three rounds of phage display selection with...corresponding amino acids ................................................................................ 13 Figure 14: M13 Phage bound to silicon

Molecular determinants of origin discrimination by Orc1 initiators in archaea.

PubMed

Dueber, Erin C; Costa, Alessandro; Corn, Jacob E; Bell, Stephen D; Berger, James M

2011-05-01

Unlike bacteria, many eukaryotes initiate DNA replication from genomic sites that lack apparent sequence conservation. These loci are identified and bound by the origin recognition complex (ORC), and subsequently activated by a cascade of events that includes recruitment of an additional factor, Cdc6. Archaeal organisms generally possess one or more Orc1/Cdc6 homologs, belonging to the Initiator clade of ATPases associated with various cellular activities (AAA(+)) superfamily; however, these proteins recognize specific sequences within replication origins. Atomic resolution studies have shown that archaeal Orc1 proteins contact double-stranded DNA through an N-terminal AAA(+) domain and a C-terminal winged-helix domain (WHD), but use remarkably few base-specific contacts. To investigate the biochemical effects of these associations, we mutated the DNA-interacting elements of the Orc1-1 and Orc1-3 paralogs from the archaeon Sulfolobus solfataricus, and tested their effect on origin binding and deformation. We find that the AAA(+) domain has an unpredicted role in controlling the sequence selectivity of DNA binding, despite an absence of base-specific contacts to this region. Our results show that both the WHD and ATPase region influence origin recognition by Orc1/Cdc6, and suggest that not only DNA sequence, but also local DNA structure help define archaeal initiator binding sites. © The Author(s) 2011. Published by Oxford University Press.

Structure and specificity of the RNA-guided endonuclease Cas9 during DNA interrogation, target binding and cleavage

PubMed Central

Josephs, Eric A.; Kocak, D. Dewran; Fitzgibbon, Christopher J.; McMenemy, Joshua; Gersbach, Charles A.; Marszalek, Piotr E.

2015-01-01

CRISPR-associated endonuclease Cas9 cuts DNA at variable target sites designated by a Cas9-bound RNA molecule. Cas9's ability to be directed by single ‘guide RNA’ molecules to target nearly any sequence has been recently exploited for a number of emerging biological and medical applications. Therefore, understanding the nature of Cas9's off-target activity is of paramount importance for its practical use. Using atomic force microscopy (AFM), we directly resolve individual Cas9 and nuclease-inactive dCas9 proteins as they bind along engineered DNA substrates. High-resolution imaging allows us to determine their relative propensities to bind with different guide RNA variants to targeted or off-target sequences. Mapping the structural properties of Cas9 and dCas9 to their respective binding sites reveals a progressive conformational transformation at DNA sites with increasing sequence similarity to its target. With kinetic Monte Carlo (KMC) simulations, these results provide evidence of a ‘conformational gating’ mechanism driven by the interactions between the guide RNA and the 14th–17th nucleotide region of the targeted DNA, the stabilities of which we find correlate significantly with reported off-target cleavage rates. KMC simulations also reveal potential methodologies to engineer guide RNA sequences with improved specificity by considering the invasion of guide RNAs into targeted DNA duplex. PMID:26384421

A novel fluorescent DNA sensor for ultrasensitive detection of Helicobacter pylori.

PubMed

Liu, Ziping; Su, Xingguang

2017-01-15

In this work, a novel fluorescent DNA sensor for ultrasensitive detection of Helicobacter pylori (H. pylori) DNA was developed. This strategy took advantage of DNA hybridization between single-stranded DNA (ssDNA, which had been designed as an aptamer specific for H. pylori DNA) and the complementary target H. pylori DNA, and the feature that ssDNA bound to graphene oxide (GO) with significantly higher affinity than double-stranded DNA (dsDNA). ssDNA were firstly covalent conjugated with CuInS 2 quantum dots (QDs) by reaction between the carboxy group of QDs and amino group modified ssDNA, forming ssDNA-QDs genosensor. In the absence of the complementary target H. pylori DNA, GO could adsorb ssDNA-QDs DNA sensor and efficiently quench the fluorescence of ssDNA-QDs. While the complementary target H. pylori DNA was introduced, the ssDNA-QDs preferentially bound with the H. pylori DNA. The formation of dsDNA would alter the conformation of ssDNA and disturb the interaction between ssDNA and GO. Thus, the dsDNA-QDs/GO system exhibited a stronger fluorescence emission than that of the ssDNA-QDs/GO system. Under the optimized conditions, a linear correlation was established between the fluorescence intensity ratio I/I 0 and the concentration of H. pylori DNA in the range of 1.25-875pmolL -1 with a detection limit of 0.46pmolL -1 . The proposed method was applied to the determination of H. pylori DNA sequence in milk samples with satisfactory results. Copyright © 2016 Elsevier B.V. All rights reserved.

Brownian dynamics simulations of sequence-dependent duplex denaturation in dynamically superhelical DNA

NASA Astrophysics Data System (ADS)

Mielke, Steven P.; Grønbech-Jensen, Niels; Krishnan, V. V.; Fink, William H.; Benham, Craig J.

2005-09-01

The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.

Brownian dynamics simulations of sequence-dependent duplex denaturation in dynamically superhelical DNA.

PubMed

Mielke, Steven P; Grønbech-Jensen, Niels; Krishnan, V V; Fink, William H; Benham, Craig J

2005-09-22

The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.

Conformational elasticity can facilitate TALE-DNA recognition

PubMed Central

Lei, Hongxing; Sun, Jiya; Baldwin, Enoch P.; Segal, David J.; Duan, Yong

2015-01-01

Sequence-programmable transcription activator-like effector (TALE) proteins have emerged as a highly efficient tool for genome engineering. Recent crystal structures depict a transition between an open unbound solenoid and more compact DNA-bound solenoid formed by the 34 amino acid repeats. How TALEs switch conformation between these two forms without substantial energetic compensation, and how the repeat-variable di-residues (RVDs) discriminate between the cognate base and other bases still remain unclear. Computational analysis on these two aspects of TALE-DNA interaction mechanism has been conducted in order to achieve a better understanding of the energetics. High elasticity was observed in the molecular dynamics simulations of DNA-free TALE structure that started from the bound conformation where it sampled a wide range of conformations including the experimentally determined apo- and bound- conformations. This elastic feature was also observed in the simulations starting from the apo form which suggests low free energy barrier between the two conformations and small compensation required upon binding. To analyze binding specificity, we performed free energy calculations of various combinations of RVDs and bases using Poisson-Boltzmann/surface area (PBSA) and other approaches. The PBSA calculations indicated that the native RVD-base structures had lower binding free energy than mismatched structures for most of the RVDs examined. Our theoretical analyses provided new insight on the dynamics and energetics of TALE-DNA binding mechanism. PMID:24629191

Conformational elasticity can facilitate TALE-DNA recognition.

PubMed

Lei, Hongxing; Sun, Jiya; Baldwin, Enoch P; Segal, David J; Duan, Yong

2014-01-01

Sequence-programmable transcription activator-like effector (TALE) proteins have emerged as a highly efficient tool for genome engineering. Recent crystal structures depict a transition between an open unbound solenoid and more compact DNA-bound solenoid formed by the 34 amino acid repeats. How TALEs switch conformation between these two forms without substantial energetic compensation, and how the repeat-variable di-residues (RVDs) discriminate between the cognate base and other bases still remain unclear. Computational analysis on these two aspects of TALE-DNA interaction mechanism has been conducted in order to achieve a better understanding of the energetics. High elasticity was observed in the molecular dynamics simulations of DNA-free TALE structure that started from the bound conformation where it sampled a wide range of conformations including the experimentally determined apo and bound conformations. This elastic feature was also observed in the simulations starting from the apo form which suggests low free energy barrier between the two conformations and small compensation required upon binding. To analyze binding specificity, we performed free energy calculations of various combinations of RVDs and bases using Poisson-Boltzmann surface area (PBSA) and other approaches. The PBSA calculations indicated that the native RVD-base structures had lower binding free energy than mismatched structures for most of the RVDs examined. Our theoretical analyses provided new insight on the dynamics and energetics of TALE-DNA binding mechanism. © 2014 Elsevier Inc. All rights reserved.

Quantitative determination of testosterone levels with biolayer interferometry.

PubMed

Zhang, Hao; Li, Wei; Luo, Hong; Xiong, Guangming; Yu, Yuanhua

2017-10-01

Natural and synthetic steroid hormones are widely spread in the environment and are considered as pollutants due to their endocrine activities, even at low concentrations, which are harmful to human health. To detect steroid hormones in the environment, a novel biosensor system was developed based on the principle of biolayer interferometry. Detection is based on changes in the interference pattern of white light reflected from the surface of an optical fiber with bound biomolecules. Monitoring interactions between molecules does not require radioactive, enzymatic, or fluorescent labels. Here, 2 double-stranded DNA fragments of operator 1 (OP1) and OP2 containing 10-bp palindromic sequences in chromosomal Comamonas testosteroni DNA (ATCC11996) were surface-immobilized to streptavidin sensors. Interference changes were detected when repressor protein RepA bound the DNA sequences. DNA-protein interactions were characterized and kinetic parameters were obtained. The dissociation constants between the OP1 and OP2 DNA sequences and RepA were 9.865 × 10 -9  M and 2.750 × 10 -8  M, respectively. The reactions showed high specifically and affinity. Because binding of the 10-bp palindromic sequence and RepA was affected by RepA-testosterone binding, the steroid could be quantitatively determined rapidly using the biosensor system. The mechanism of the binding assay was as follows. RepA could bind both OP1 and testosterone. RepA binding to testosterone changed the protein conformation, which influenced the binding between RepA and OP1. The percentage of the signal detected negative correlation with the testosterone concentration. A standard curve was obtained, and the correlation coefficient value was approximately 0.97. We could quantitatively determine testosterone levels between 2.13 and 136.63 ng/ml. Each sample could be quantitatively detected in 17 min. These results suggested that the specific interaction between double-stranded OP1 DNA and the RepA protein could be used to rapidly and quantitatively determine environmental testosterone levels by the biolayer interferometry technique. Copyright © 2017 Elsevier B.V. All rights reserved.

Picoliter DNA Sequencing Chemistry on an Electrowetting-based Digital Microfluidic Platform

PubMed Central

Ferguson Welch, Erin R.; Lin, Yan-You; Madison, Andrew; Fair, R.B.

2011-01-01

The results of investigations into performing DNA sequencing chemistry on a picoliter-scale electrowetting digital microfluidic platform are reported. Pyrosequencing utilizes pyrophosphate produced during nucleotide base addition to initiate a process ending with detection through a chemiluminescence reaction using firefly luciferase. The intensity of light produced during the reaction can be quantified to determine the number of bases added to the DNA strand. The logic-based control and discrete fluid droplets of a digital microfluidic device lend themselves well to the pyrosequencing process. Bead-bound DNA is magnetically held in a single location, and wash or reagent droplets added or split from it to circumvent product dilution. Here we discuss the dispensing, control, and magnetic manipulation of the paramagnetic beads used to hold target DNA. We also demonstrate and characterize the picoliter-scale reaction of luciferase with adenosine triphosphate to represent the detection steps of pyrosequencing and all necessary alterations for working on this scale. PMID:21298802

Structural analysis of DNA binding by C.Csp231I, a member of a novel class of R-M controller proteins regulating gene expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shevtsov, M. B.; Streeter, S. D.; Thresh, S.-J.

2015-02-01

The structure of the new class of controller proteins (exemplified by C.Csp231I) in complex with its 21 bp DNA-recognition sequence is presented, and the molecular basis of sequence recognition in this class of proteins is discussed. An unusual extended spacer between the dimer binding sites suggests a novel interaction between the two C-protein dimers. In a wide variety of bacterial restriction–modification systems, a regulatory ‘controller’ protein (or C-protein) is required for effective transcription of its own gene and for transcription of the endonuclease gene found on the same operon. We have recently turned our attention to a new class ofmore » controller proteins (exemplified by C.Csp231I) that have quite novel features, including a much larger DNA-binding site with an 18 bp (∼60 Å) spacer between the two palindromic DNA-binding sequences and a very different recognition sequence from the canonical GACT/AGTC. Using X-ray crystallography, the structure of the protein in complex with its 21 bp DNA-recognition sequence was solved to 1.8 Å resolution, and the molecular basis of sequence recognition in this class of proteins was elucidated. An unusual aspect of the promoter sequence is the extended spacer between the dimer binding sites, suggesting a novel interaction between the two C-protein dimers when bound to both recognition sites correctly spaced on the DNA. A U-bend model is proposed for this tetrameric complex, based on the results of gel-mobility assays, hydrodynamic analysis and the observation of key contacts at the interface between dimers in the crystal.« less

Tomato ASR1 abrogates the response to abscisic acid and glucose in Arabidopsis by competing with ABI4 for DNA binding.

PubMed

Shkolnik, Doron; Bar-Zvi, Dudy

2008-05-01

The manipulation of transacting factors is commonly used to achieve a wide change in the expression of a large number of genes in transgenic plants as a result of a change in the expression of a single gene product. This is mostly achieved by the overexpression of transactivator or repressor proteins. In this study, it is demonstrated that the overexpression of an exogenous DNA-binding protein can be used to compete with the expression of an endogenous transcription factor sharing the same DNA-binding sequence. Arabidopsis was transformed with cDNA encoding tomato abscisic acid stress ripening 1 (ASR1), a sequence-specific DNA protein that has no orthologues in the Arabidopsis genome. ASR1-overexpressing (ASR1-OE) plants display an abscisic acid-insensitive 4 (abi4) phenotype: seed germination is not sensitive to inhibition by abscisic acid (ABA), glucose, NaCl and paclobutrazol. ASR1 binds coupling element 1 (CE1), a cis-acting element bound by the ABI4 transcription factor, located in the ABI4-regulated promoters, including that of the ABI4 gene. Chromatin immunoprecipitation demonstrates that ASR1 is bound in vivo to the promoter of the ABI4 gene in ASR1-OE plants, but not to promoters of genes known to be regulated by the transcription factors ABI3 or ABI5. Real-time polymerase chain reaction (PCR) analysis confirmed that the expression of ABI4 and ABI4-regulated genes is markedly reduced in ASR1-OE plants. Therefore, it is concluded that the abi4 phenotype of ASR1-OE plants is the result of competition between the foreign ASR1 and the endogenous ABI4 on specific promoter DNA sequences. The biotechnological advantage of using this approach in crop plants from the Brassicaceae family to reduce the transactivation activity of ABI4 is discussed.

Multiple conformations of the cytidine repressor DNA-binding domain coalesce to one upon recognition of a specific DNA surface.

PubMed

Moody, Colleen L; Tretyachenko-Ladokhina, Vira; Laue, Thomas M; Senear, Donald F; Cocco, Melanie J

2011-08-09

The cytidine repressor (CytR) is a member of the LacR family of bacterial repressors with distinct functional features. The Escherichia coli CytR regulon comprises nine operons whose palindromic operators vary in both sequence and, most significantly, spacing between the recognition half-sites. This suggests a strong likelihood that protein folding would be coupled to DNA binding as a mechanism to accommodate the variety of different operator architectures to which CytR is targeted. Such coupling is a common feature of sequence-specific DNA-binding proteins, including the LacR family repressors; however, there are no significant structural rearrangements upon DNA binding within the three-helix DNA-binding domains (DBDs) studied to date. We used nuclear magnetic resonance (NMR) spectroscopy to characterize the CytR DBD free in solution and to determine the high-resolution structure of a CytR DBD monomer bound specifically to one DNA half-site of the uridine phosphorylase (udp) operator. We find that the free DBD populates multiple distinct conformations distinguished by up to four sets of NMR peaks per residue. This structural heterogeneity is previously unknown in the LacR family. These stable structures coalesce into a single, more stable udp-bound form that features a three-helix bundle containing a canonical helix-turn-helix motif. However, this structure differs from all other LacR family members whose structures are known with regard to the packing of the helices and consequently their relative orientations. Aspects of CytR activity are unique among repressors; we identify here structural properties that are also distinct and that might underlie the different functional properties. © 2011 American Chemical Society

NMR and computational methods applied to the 3- dimensional structure determination of DNA and ligand-DNA complexes in solution

NASA Astrophysics Data System (ADS)

Smith, Jarrod Anson

2D homonuclear 1H NMR methods and restrained molecular dynamics (rMD) calculations have been applied to determining the three-dimensional structures of DNA and minor groove-binding ligand-DNA complexes in solution. The structure of the DNA decamer sequence d(GCGTTAACGC)2 has been solved both with a distance-based rMD protocol and an NOE relaxation matrix backcalculation-based protocol in order to probe the relative merits of the different refinement methods. In addition, three minor groove binding ligand-DNA complexes have been examined. The solution structure of the oligosaccharide moiety of the antitumor DNA scission agent calicheamicin γ1I has been determined in complex with a decamer duplex containing its high affinity 5'-TCCT- 3' binding sequence. The structure of the complex reinforces the belief that the oligosaccharide moiety is responsible for the sequence selective minor-groove binding activity of the agent, and critical intermolecular contacts are revealed. The solution structures of both the (+) and (-) enantiomers of the minor groove binding DNA alkylating agent duocarmycin SA have been determined in covalent complex with the undecamer DNA duplex d(GACTAATTGTC).d(GAC AATTAGTC). The results support the proposal that the alkylation activity of the duocarmycin antitumor antibiotics is catalyzed by a binding-induced conformational change in the ligand which activates the cyclopropyl group for reaction with the DNA. Comparisons between the structures of the two enantiomers covalently bound to the same DNA sequence at the same 5'-AATTA-3 ' site have provided insight into the binding orientation and site selectivity, as well as the relative rates of reactivity of these two agents.

Why double-stranded RNA resists condensation

PubMed Central

Tolokh, Igor S.; Pabit, Suzette A.; Katz, Andrea M.; Chen, Yujie; Drozdetski, Aleksander; Baker, Nathan; Pollack, Lois; Onufriev, Alexey V.

2014-01-01

The addition of small amounts of multivalent cations to solutions containing double-stranded DNA leads to inter-DNA attraction and eventual condensation. Surprisingly, the condensation is suppressed in double-stranded RNA, which carries the same negative charge as DNA, but assumes a different double helical form. Here, we combine experiment and atomistic simulations to propose a mechanism that explains the variations in condensation of short (25 base-pairs) nucleic acid (NA) duplexes, from B-like form of homopolymeric DNA, to mixed sequence DNA, to DNA:RNA hybrid, to A-like RNA. Circular dichroism measurements suggest that duplex helical geometry is not the fundamental property that ultimately determines the observed differences in condensation. Instead, these differences are governed by the spatial variation of cobalt hexammine (CoHex) binding to NA. There are two major NA-CoHex binding modes—internal and external—distinguished by the proximity of bound CoHex to the helical axis. We find a significant difference, up to 5-fold, in the fraction of ions bound to the external surfaces of the different NA constructs studied. NA condensation propensity is determined by the fraction of CoHex ions in the external binding mode. PMID:25123663

Crystal structure of APOBEC3A bound to single-stranded DNA reveals structural basis for cytidine deamination and specificity

PubMed Central

Kouno, Takahide; Silvas, Tania V.; Hilbert, Brendan J.; Shandilya, Shivender M. D.; Bohn, Markus F.; Kelch, Brian A.; Royer, William E.; Somasundaran, Mohan; Kurt Yilmaz, Nese; Matsuo, Hiroshi; Schiffer, Celia A.

2017-01-01

Nucleic acid editing enzymes are essential components of the immune system that lethally mutate viral pathogens and somatically mutate immunoglobulins, and contribute to the diversification and lethality of cancers. Among these enzymes are the seven human APOBEC3 deoxycytidine deaminases, each with unique target sequence specificity and subcellular localization. While the enzymology and biological consequences have been extensively studied, the mechanism by which APOBEC3s recognize and edit DNA remains elusive. Here we present the crystal structure of a complex of a cytidine deaminase with ssDNA bound in the active site at 2.2 Å. This structure not only visualizes the active site poised for catalysis of APOBEC3A, but pinpoints the residues that confer specificity towards CC/TC motifs. The APOBEC3A–ssDNA complex defines the 5′–3′ directionality and subtle conformational changes that clench the ssDNA within the binding groove, revealing the architecture and mechanism of ssDNA recognition that is likely conserved among all polynucleotide deaminases, thereby opening the door for the design of mechanistic-based therapeutics. PMID:28452355

The Agrobacterium tumefaciens Transcription Factor BlcR Is Regulated via Oligomerization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pan, Yi; Fiscus, Valena; Meng, Wuyi

2012-02-08

The Agrobacterium tumefaciens BlcR is a member of the emerging isocitrate lyase transcription regulators that negatively regulates metabolism of {gamma}-butyrolactone, and its repressing function is relieved by succinate semialdehyde (SSA). Our crystal structure showed that BlcR folded into the DNA- and SSA-binding domains and dimerized via the DNA-binding domains. Mutational analysis identified residues, including Phe{sup 147}, that are important for SSA association; BlcR{sup F147A} existed as tetramer. Two BlcR dimers bound to target DNA and in a cooperative manner, and the distance between the two BlcR-binding sequences in DNA was critical for BlcR-DNA association. Tetrameric BlcR{sup F147A} retained DNA bindingmore » activity, and importantly, this activity was not affected by the distance separating the BlcR-binding sequences in DNA. SSA did not dissociate tetrameric BlcR{sup F147A} or BlcR{sup F147A}-DNA. As well as in the SSA-binding site, Phe{sup 147} is located in a structurally flexible loop that may be involved in BlcR oligomerization. We propose that SSA regulates BlcR DNA-binding function via oligomerization.« less

Variola virus topoisomerase: DNA cleavage specificity and distribution of sites in Poxvirus genomes.

PubMed

Minkah, Nana; Hwang, Young; Perry, Kay; Van Duyne, Gregory D; Hendrickson, Robert; Lefkowitz, Elliot J; Hannenhalli, Sridhar; Bushman, Frederic D

2007-08-15

Topoisomerase enzymes regulate superhelical tension in DNA resulting from transcription, replication, repair, and other molecular transactions. Poxviruses encode an unusual type IB topoisomerase that acts only at conserved DNA sequences containing the core pentanucleotide 5'-(T/C)CCTT-3'. In X-ray structures of the variola virus topoisomerase bound to DNA, protein-DNA contacts were found to extend beyond the core pentanucleotide, indicating that the full recognition site has not yet been fully defined in functional studies. Here we report quantitation of DNA cleavage rates for an optimized 13 bp site and for all possible single base substitutions (40 total sites), with the goals of understanding the molecular mechanism of recognition and mapping topoisomerase sites in poxvirus genome sequences. The data allow a precise definition of enzyme-DNA interactions and the energetic contributions of each. We then used the resulting "action matrix" to show that favorable topoisomerase sites are distributed all along the length of poxvirus DNA sequences, consistent with a requirement for local release of superhelical tension in constrained topological domains. In orthopox genomes, an additional central cluster of sites was also evident. A negative correlation of predicted topoisomerase sites was seen relative to early terminators, but no correlation was seen with early or late promoters. These data define the full variola virus topoisomerase recognition site and provide a new window on topoisomerase function in vivo.

Differing roles for zinc fingers in DNA recognition: Structure of a six-finger transcription factor IIIA complex

PubMed Central

Nolte, Robert T.; Conlin, Rachel M.; Harrison, Stephen C.; Brown, Raymond S.

1998-01-01

The crystal structure of the six NH2-terminal zinc fingers of Xenopus laevis transcription factor IIIA (TFIIIA) bound with 31 bp of the 5S rRNA gene promoter has been determined at 3.1 Å resolution. Individual zinc fingers are positioned differently in the major groove and across the minor groove of DNA to span the entire length of the duplex. These results show how TFIIIA can recognize several separated DNA sequences by using fewer fingers than necessary for continuous winding in the major groove. PMID:9501194

Spermine Condenses DNA, but Not RNA Duplexes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Katz, Andrea M.; Tolokh, Igor S.; Pabit, Suzette A.

Interactions between the polyamine spermine and nucleic acids drive important cellular processes. Spermine condenses DNA, and some RNAs such as poly(rA):poly(rU). A large fraction of the spermine present in cells is bound to RNA, but apparently does not condense it. Here, we study the effect of spermine binding to short duplex RNA and DNA and compare our findings with predictions of molecular dynamics simulations. When small numbers of spermine are introduced, RNA with a designed sequence, containing a mixture of 14 GC pairs and 11 AU pairs, resists condensation relative to DNA of an equivalent sequence or to 25 basemore » pair poly(rA):poly(rU) RNA. Comparison of wide-angle x-ray scattering profiles with simulation suggests that spermine is sequestered deep within the major groove of mixed sequence RNA, preventing condensation by limiting opportunities to bridge to other molecules as well as stabilizing the RNA by locking it into a particular conformation. In contrast, for DNA, simulations suggest that spermine binds external to the duplex, offering opportunities for intermolecular interaction. The goal of this study is to explain how RNA can remain soluble, and available for interaction with other molecules in the cell, despite the presence of spermine at concentrations high enough to precipitate DNA.« less

Molecular genetic characterization of the RD-114 gene family of endogenous feline retroviral sequences.

PubMed Central

Reeves, R H; O'Brien, S J

1984-01-01

RD-114 is a replication-competent, xenotropic retrovirus which is homologous to a family of moderately repetitive DNA sequences present at ca. 20 copies in the normal cellular genome of domestic cats. To examine the extent and character of genomic divergence of the RD-114 gene family as well as to assess their positional association within the cat genome, we have prepared a series of molecular clones of endogenous RD-114 DNA segments from a genomic library of cat cellular DNA. Their restriction endonuclease maps were compared with each other as well as to that of the prototype-inducible RD-114 which was molecularly cloned from a chronically infected human cell line. The endogenous sequences analyzed were similar to each other in that they were colinear with RD-114 proviral DNA, were bounded by long terminal redundancies, and conserved many restriction sites in the gag and pol regions. However, the env regions of many of the sequences examined were substantially deleted. Several of the endogenous RD-114 genomes contained a novel envelope sequence which was unrelated to the env gene of the prototype RD-114 env gene but which, like RD-114 and endogenous feline leukemia virus provirus, was found only in species of the genus Felis, and not in other closely related Felidae genera. The endogenous RD-114 sequences each had a distinct cellular flank which indicates that these sequences are not tandem but dispersed nonspecifically throughout the genome. Southern analysis of cat cellular DNA confirmed the conclusions about conserved restriction sites in endogenous sequences and indicated that a single locus may be responsible for the production of the major inducible form of RD-114. Images PMID:6090693

The role of differing probe and target strand lengths in DNA microarrays investigated via Monte Carlo molecular simulation

NASA Astrophysics Data System (ADS)

Rivard, Brea R.; Cooper, Sarah J.; Stubbs, John M.

2018-02-01

DNA duplexes consisting of a 25mer together with shorter complementary sequences were studied over a range of temperature and surface binding motifs using a coarse-grained two-site nucleotide model. Results were analyzed in terms of hydrogen bonding interactions and structural characteristics and indicate that hybridization is most stable when furthest from the surface binding site. Strand elongation and straightening near the bound end are found to be correlated to duplex destabilization.

Transforming single DNA molecules into fluorescent magnetic particles for detection and enumeration of genetic variations

PubMed Central

Dressman, Devin; Yan, Hai; Traverso, Giovanni; Kinzler, Kenneth W.; Vogelstein, Bert

2003-01-01

Many areas of biomedical research depend on the analysis of uncommon variations in individual genes or transcripts. Here we describe a method that can quantify such variation at a scale and ease heretofore unattainable. Each DNA molecule in a collection of such molecules is converted into a single magnetic particle to which thousands of copies of DNA identical in sequence to the original are bound. This population of beads then corresponds to a one-to-one representation of the starting DNA molecules. Variation within the original population of DNA molecules can then be simply assessed by counting fluorescently labeled particles via flow cytometry. This approach is called BEAMing on the basis of four of its principal components (beads, emulsion, amplification, and magnetics). Millions of individual DNA molecules can be assessed in this fashion with standard laboratory equipment. Moreover, specific variants can be isolated by flow sorting and used for further experimentation. BEAMing can be used for the identification and quantification of rare mutations as well as to study variations in gene sequences or transcripts in specific populations or tissues. PMID:12857956

Changes in solvation during DNA binding and cleavage are critical to altered specificity of the EcoRI endonuclease

PubMed Central

Robinson, Clifford R.; Sligar, Stephen G.

1998-01-01

Restriction endonucleases such as EcoRI bind and cleave DNA with great specificity and represent a paradigm for protein–DNA interactions and molecular recognition. Using osmotic pressure to induce water release, we demonstrate the participation of bound waters in the sequence discrimination of substrate DNA by EcoRI. Changes in solvation can play a critical role in directing sequence-specific DNA binding by EcoRI and are also crucial in assisting site discrimination during catalysis. By measuring the volume change for complex formation, we show that at the cognate sequence (GAATTC) EcoRI binding releases about 70 fewer water molecules than binding at an alternate DNA sequence (TAATTC), which differs by a single base pair. EcoRI complexation with nonspecific DNA releases substantially less water than either of these specific complexes. In cognate substrates (GAATTC) kcat decreases as osmotic pressure is increased, indicating the binding of about 30 water molecules accompanies the cleavage reaction. For the alternate substrate (TAATTC), release of about 40 water molecules accompanies the reaction, indicated by a dramatic acceleration of the rate when osmotic pressure is raised. These large differences in solvation effects demonstrate that water molecules can be key players in the molecular recognition process during both association and catalytic phases of the EcoRI reaction, acting to change the specificity of the enzyme. For both the protein–DNA complex and the transition state, there may be substantial conformational differences between cognate and alternate sites, accompanied by significant alterations in hydration and solvent accessibility. PMID:9482860

3DNALandscapes: a database for exploring the conformational features of DNA.

PubMed

Zheng, Guohui; Colasanti, Andrew V; Lu, Xiang-Jun; Olson, Wilma K

2010-01-01

3DNALandscapes, located at: http://3DNAscapes.rutgers.edu, is a new database for exploring the conformational features of DNA. In contrast to most structural databases, which archive the Cartesian coordinates and/or derived parameters and images for individual structures, 3DNALandscapes enables searches of conformational information across multiple structures. The database contains a wide variety of structural parameters and molecular images, computed with the 3DNA software package and known to be useful for characterizing and understanding the sequence-dependent spatial arrangements of the DNA sugar-phosphate backbone, sugar-base side groups, base pairs, base-pair steps, groove structure, etc. The data comprise all DNA-containing structures--both free and bound to proteins, drugs and other ligands--currently available in the Protein Data Bank. The web interface allows the user to link, report, plot and analyze this information from numerous perspectives and thereby gain insight into DNA conformation, deformability and interactions in different sequence and structural contexts. The data accumulated from known, well-resolved DNA structures can serve as useful benchmarks for the analysis and simulation of new structures. The collective data can also help to understand how DNA deforms in response to proteins and other molecules and undergoes conformational rearrangements.

Applying Agrep to r-NSA to solve multiple sequences approximate matching.

PubMed

Ni, Bing; Wong, Man-Hon; Lam, Chi-Fai David; Leung, Kwong-Sak

2014-01-01

This paper addresses the approximate matching problem in a database consisting of multiple DNA sequences, where the proposed approach applies Agrep to a new truncated suffix array, r-NSA. The construction time of the structure is linear to the database size, and the computations of indexing a substring in the structure are constant. The number of characters processed in applying Agrep is analysed theoretically, and the theoretical upper-bound can approximate closely the empirical number of characters, which is obtained through enumerating the characters in the actual structure built. Experiments are carried out using (synthetic) random DNA sequences, as well as (real) genome sequences including Hepatitis-B Virus and X-chromosome. Experimental results show that, compared to the straight-forward approach that applies Agrep to multiple sequences individually, the proposed approach solves the matching problem in much shorter time. The speed-up of our approach depends on the sequence patterns, and for highly similar homologous genome sequences, which are the common cases in real-life genomes, it can be up to several orders of magnitude.

DNA binding of the p21 repressor ZBTB2 is inhibited by cytosine hydroxymethylation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lafaye, Céline; Barbier, Ewa; Miscioscia, Audrey

2014-03-28

Highlights: • 5-hmC epigenetic modification is measurable in HeLa, SH-SY5Y and UT7-MPL cell lines. • ZBTB2 binds to DNA probes containing 5-mC but not to sequences containing 5-hmC. • This differential binding is verified with DNA sequences involved in p21 regulation. - Abstract: Recent studies have demonstrated that the modified base 5-hydroxymethylcytosine (5-hmC) is detectable at various rates in DNA extracted from human tissues. This oxidative product of 5-methylcytosine (5-mC) constitutes a new and important actor of epigenetic mechanisms. We designed a DNA pull down assay to trap and identify nuclear proteins bound to 5-hmC and/or 5-mC. We applied thismore » strategy to three cancerous cell lines (HeLa, SH-SY5Y and UT7-MPL) in which we also measured 5-mC and 5-hmC levels by HPLC-MS/MS. We found that the putative oncoprotein Zinc finger and BTB domain-containing protein 2 (ZBTB2) is associated with methylated DNA sequences and that this interaction is inhibited by the presence of 5-hmC replacing 5-mC. As published data mention ZBTB2 recognition of p21 regulating sequences, we verified that this sequence specific binding was also alleviated by 5-hmC. ZBTB2 being considered as a multifunctional cell proliferation activator, notably through p21 repression, this work points out new epigenetic processes potentially involved in carcinogenesis.« less

Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

PubMed

Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

2017-11-28

Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

Genetic dissection of the consensus sequence for the class 2 and class 3 flagellar promoters

PubMed Central

Wozniak, Christopher E.; Hughes, Kelly T.

2008-01-01

Summary Computational searches for DNA binding sites often utilize consensus sequences. These search models make assumptions that the frequency of a base pair in an alignment relates to the base pair’s importance in binding and presume that base pairs contribute independently to the overall interaction with the DNA binding protein. These two assumptions have generally been found to be accurate for DNA binding sites. However, these assumptions are often not satisfied for promoters, which are involved in additional steps in transcription initiation after RNA polymerase has bound to the DNA. To test these assumptions for the flagellar regulatory hierarchy, class 2 and class 3 flagellar promoters were randomly mutagenized in Salmonella. Important positions were then saturated for mutagenesis and compared to scores calculated from the consensus sequence. Double mutants were constructed to determine how mutations combined for each promoter type. Mutations in the binding site for FlhD4C2, the activator of class 2 promoters, better satisfied the assumptions for the binding model than did mutations in the class 3 promoter, which is recognized by the σ28 transcription factor. These in vivo results indicate that the activator sites within flagellar promoters can be modeled using simple assumptions but that the DNA sequences recognized by the flagellar sigma factor require more complex models. PMID:18486950

Directed evolution of the TALE N-terminal domain for recognition of all 5′ bases

PubMed Central

Lamb, Brian M.; Mercer, Andrew C.; Barbas, Carlos F.

2013-01-01

Transcription activator-like effector (TALE) proteins can be designed to bind virtually any DNA sequence. General guidelines for design of TALE DNA-binding domains suggest that the 5′-most base of the DNA sequence bound by the TALE (the N0 base) should be a thymine. We quantified the N0 requirement by analysis of the activities of TALE transcription factors (TALE-TF), TALE recombinases (TALE-R) and TALE nucleases (TALENs) with each DNA base at this position. In the absence of a 5′ T, we observed decreases in TALE activity up to >1000-fold in TALE-TF activity, up to 100-fold in TALE-R activity and up to 10-fold reduction in TALEN activity compared with target sequences containing a 5′ T. To develop TALE architectures that recognize all possible N0 bases, we used structure-guided library design coupled with TALE-R activity selections to evolve novel TALE N-terminal domains to accommodate any N0 base. A G-selective domain and broadly reactive domains were isolated and characterized. The engineered TALE domains selected in the TALE-R format demonstrated modularity and were active in TALE-TF and TALEN architectures. Evolved N-terminal domains provide effective and unconstrained TALE-based targeting of any DNA sequence as TALE binding proteins and designer enzymes. PMID:23980031

Presence of DNA methyltransferase activity and CpC methylation in Drosophila melanogaster.

PubMed

Panikar, Chitra S; Rajpathak, Shriram N; Abhyankar, Varada; Deshmukh, Saniya; Deobagkar, Deepti D

2015-12-01

Drosophila melanogaster lacks DNMT1/DNMT3 based methylation machinery. Despite recent reports confirming the presence of low DNA methylation in Drosophila; little is known about the methyltransferase. Therefore, in this study, we have aimed to investigate the possible functioning of DNA methyltransferase in Drosophila. The 14 K oligo microarray slide was incubated with native cell extract from adult Drosophila to check the presence of the methyltransferase activity. After incubation under appropriate conditions, the methylated oligo sequences were identified by the binding of anti 5-methylcytosine monoclonal antibody. The antibody bound to the methylated oligos was detected using Cy3 labeled secondary antibody. Methylation sensitive restriction enzyme mediated PCR was used to assess the methylation at a few selected loci identified on the array. It could be seen that a few of the total oligos got methylated under the assay conditions. Analysis of methylated oligo sequences provides evidence for the presence of de novo methyltransferase activity and allows identification of its sequence specificity in adult Drosophila. With the help of methylation sensitive enzymes we could detect presence of CpC methylation in the selected genomic regions. This study reports presence of an active DNA methyltransferase in adult Drosophila, which exhibits sequence specificity confirmed by presence of asymmetric methylation at corresponding sites in the genomic DNA. It also provides an innovative approach to investigate methylation specificity of a native methyltransferase.

A feasibility study of colorectal cancer diagnosis via circulating tumor DNA derived CNV detection.

PubMed

Molparia, Bhuvan; Oliveira, Glenn; Wagner, Jennifer L; Spencer, Emily G; Torkamani, Ali

2018-01-01

Circulating tumor DNA (ctDNA) has shown great promise as a biomarker for early detection of cancer. However, due to the low abundance of ctDNA, especially at early stages, it is hard to detect at high accuracies while keeping sequencing costs low. Here we present a pilot stage study to detect large scale somatic copy numbers variations (CNVs), which contribute more molecules to ctDNA signal compared to point mutations, via cell free DNA sequencing. We show that it is possible to detect somatic CNVs in early stage colorectal cancer (CRC) patients and subsequently discriminate them from normal patients. With 25 normal and 24 CRC samples, we achieve 100% specificity (lower bound confidence interval: 86%) and ~79% sensitivity (95% confidence interval: 63% - 95%,), though the performance should be considered with caution given the limited sample size. We report a lack of concordance between the CNVs detected via cfDNA sequencing and CNVs identified in parent tissue samples. However, recent findings suggest that a lack of concordance is expected for CNVs in CRC because of their sub-clonal nature. Finally, the CNVs we detect very likely contribute to cancer progression as they lie in functionally important regions, and have been shown to be associated with CRC specifically. This study paves the path for a larger scale exploration of the potential of CNV detection for both diagnoses and prognoses of cancer.

Modification-dependent restriction endonuclease, MspJI, flips 5-methylcytosine out of the DNA helix

DOE PAGES

Horton, J. R.; Wang, H.; Mabuchi, M. Y.; ...

2014-09-27

MspJI belongs to a family of restriction enzymes that cleave DNA containing 5-methylcytosine (5mC) or 5-hydroxymethylcytosine (5hmC). MspJI is specific for the sequence 5(h)mC-N-N-G or A and cleaves with some variability 9/13 nucleotides downstream. Earlier, we reported the crystal structure of MspJI without DNA and proposed how it might recognize this sequence and catalyze cleavage. Here we report its co-crystal structure with a 27-base pair oligonucleotide containing 5mC. This structure confirms that MspJI acts as a homotetramer and that the modified cytosine is flipped from the DNA helix into an SRA-like-binding pocket. We expected the structure to reveal two DNAmore » molecules bound specifically to the tetramer and engaged with the enzyme's two DNA-cleavage sites. A coincidence of crystal packing precluded this organization, however. We found that each DNA molecule interacted with two adjacent tetramers, binding one specifically and the other non-specifically. The latter interaction, which prevented cleavage-site engagement, also involved base flipping and might represent the sequence-interrogation phase that precedes specific recognition. MspJI is unusual in that DNA molecules are recognized and cleaved by different subunits. Such interchange of function might explain how other complex multimeric restriction enzymes act.« less

Molecular mechanisms of conformational specificity: A study of Hox in vivo target DNA binding specificities and the structure of a Ure2p mutation that affects fibril formation rates

NASA Astrophysics Data System (ADS)

Bauer, William Joseph, Jr.

The fate of an individual cell, or even an entire organism, is often determined by minute, yet very specific differences in the conformation of a single protein species. Very often, proteins take on alternate folds or even side chain conformations to deal with different situations present within the cell. These differences can be as large as a whole domain or as subtle as the alteration of a single amino acid side chain. Yet, even these seemingly minor side chain conformational differences can determine the development of a cell type during differentiation or even dictate whether a cell will live or die. Two examples of situations where minor conformational differences within a specific protein could lead to major differences in the life cycle of a cell are described herein. The first example describes the variations seen in DNA conformations which can lead to slightly different Hox protein binding conformations responsible for recognizing biologically relevant regulatory sites. These specific differences occur in the minor groove of the bound DNA and are limited to the conformation of only two side chains. The conformation of the bound DNA, however, is not solely determined by the sequence of the DNA, as multiple sequences can result in the same DNA conformation. The second example takes place in the context of a yeast prion protein which contains a mutation that decreases the frequency at which fibrils form. While the specific interactions leading to this physiological change were not directly detected, it can be ascertained from the crystal structure that the structural changes are subtle and most likely involve another binding partner. In both cases, these conformational changes are very slight but have a profound effect on the downstream processes.

ExpandplusCrystal Structures of Poly(ADP-ribose) Polymerase-1 (PARP-1) Zinc Fingers Bound to DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

M Langelier; J Planck; S Roy

2011-12-31

Poly(ADP-ribose) polymerase-1 (PARP-1) has two homologous zinc finger domains, Zn1 and Zn2, that bind to a variety of DNA structures to stimulate poly(ADP-ribose) synthesis activity and to mediate PARP-1 interaction with chromatin. The structural basis for interaction with DNA is unknown, which limits our understanding of PARP-1 regulation and involvement in DNA repair and transcription. Here, we have determined crystal structures for the individual Zn1 and Zn2 domains in complex with a DNA double strand break, providing the first views of PARP-1 zinc fingers bound to DNA. The Zn1-DNA and Zn2-DNA structures establish a novel, bipartite mode of sequence-independent DNAmore » interaction that engages a continuous region of the phosphodiester backbone and the hydrophobic faces of exposed nucleotide bases. Biochemical and cell biological analysis indicate that the Zn1 and Zn2 domains perform distinct functions. The Zn2 domain exhibits high binding affinity to DNA compared with the Zn1 domain. However, the Zn1 domain is essential for DNA-dependent PARP-1 activity in vitro and in vivo, whereas the Zn2 domain is not strictly required. Structural differences between the Zn1-DNA and Zn2-DNA complexes, combined with mutational and structural analysis, indicate that a specialized region of the Zn1 domain is re-configured through the hydrophobic interaction with exposed nucleotide bases to initiate PARP-1 activation.« less

SpDamID: Marking DNA Bound by Protein Complexes Identifies Notch-Dimer Responsive Enhancers

PubMed Central

Hass, Matthew R.; Liow, Hien-haw; Chen, Xiaoting; Sharma, Ankur; Inoue, Yukiko U.; Inoue, Takayoshi; Reeb, Ashley; Martens, Andrew; Fulbright, Mary; Raju, Saravanan; Stevens, Michael; Boyle, Scott; Park, Joo-Seop; Weirauch, Matthew T.; Brent, Michael; Kopan, Raphael

2015-01-01

SUMMARY We developed Split DamID (SpDamID), a protein complementation version of DamID, to mark genomic DNA bound in vivo by interacting or juxtapositioned transcription factors. Inactive halves of DAM (DNA Adenine Methyltransferase) were fused to protein pairs to be queried Interaction or proximity enabled DAM reconstitution and methylation of adenine in GATC. Inducible SpDamID was used to analyze Notch-mediated transcriptional activation. We demonstrate that Notch complexes label RBP sites broadly across the genome, and show that a subset of these complexes that recruit MAML and p300 undergo changes in chromatin accessibility in response to Notch signaling. SpDamID differentiates between monomeric and dimeric binding thereby allowing for identification of half-site motifs used by Notch dimers. Motif enrichment of Notch enhancers coupled with SpDamID reveals co-targeting of regulatory sequences by Notch and Runx1. SpDamID represents a sensitive and powerful tool that enables dynamic analysis of combinatorial protein-DNA transactions at a genome-wide level. PMID:26257285

Expression, purification, and DNA-binding activity of the Herbaspirillum seropedicae RecX protein.

PubMed

Galvão, Carolina W; Pedrosa, Fábio O; Souza, Emanuel M; Yates, M Geoffrey; Chubatsu, Leda S; Steffens, Maria Berenice R

2004-06-01

The Herbaspirillum seropedicae RecX protein participates in the SOS response: a process in which the RecA protein plays a central role. The RecX protein of the H. seropedicae, fused to a His-tag sequence (RecX His-tagged), was over-expressed in Escherichia coli and purified by metal-affinity chromatography to yield a highly purified and active protein. DNA band-shift assays showed that the RecX His-tagged protein bound to both circular and linear double-stranded DNA and also to circular single-stranded DNA. The apparent affinity of RecX for DNA decreased in the presence of Mg(2+) ions. The ability of RecX to bind DNA may be relevant to its function in the SOS response.

cDNA cloning, functional expression and cellular localization of rat liver mitochondrial electron-transfer flavoprotein-ubiquinone oxidoreductase protein.

PubMed

Huang, Shengbing; Song, Wei; Lin, Qishui

2005-08-01

A membrane-bound protein was purified from rat liver mitochondria. After being digested with V8 protease, two peptides containing identical 14 amino acid residue sequences were obtained. Using the 14 amino acid peptide derived DNA sequence as gene specific primer, the cDNA of correspondent gene 5'-terminal and 3'-terminal were obtained by RACE technique. The full-length cDNA that encoded a protein of 616 amino acids was thus cloned, which included the above mentioned peptide sequence. The full length cDNA was highly homologous to that of human ETF-QO, indicating that it may be the cDNA of rat ETF-QO. ETF-QO is an iron sulfur protein located in mitochondria inner membrane containing two kinds of redox center: FAD and [4Fe-4S] center. After comparing the sequence from the cDNA of the 616 amino acids protein with that of the mature protein of rat liver mitochondria, it was found that the N terminal 32 amino acid residues did not exist in the mature protein, indicating that the cDNA was that of ETF-QOp. When the cDNA was expressed in Saccharomyces cerevisiae with inducible vectors, the protein product was enriched in mitochondrial fraction and exhibited electron transfer activity (NBT reductase activity) of ETF-QO. Results demonstrated that the 32 amino acid peptide was a mitochondrial targeting peptide, and both FAD and iron-sulfur cluster were inserted properly into the expressed ETF-QO. ETF-QO had a high level expression in rat heart, liver and kidney. The fusion protein of GFP-ETF-QO co-localized with mitochondria in COS-7 cells.

Improved Analysis of Nanopore Sequence Data and Scanning Nanopore Techniques

NASA Astrophysics Data System (ADS)

Szalay, Tamas

The field of nanopore research has been driven by the need to inexpensively and rapidly sequence DNA. In order to help realize this goal, this thesis describes the PoreSeq algorithm that identifies and corrects errors in real-world nanopore sequencing data and improves the accuracy of de novo genome assembly with increasing coverage depth. The approach relies on modeling the possible sources of uncertainty that occur as DNA advances through the nanopore and then using this model to find the sequence that best explains multiple reads of the same region of DNA. PoreSeq increases nanopore sequencing read accuracy of M13 bacteriophage DNA from 85% to 99% at 100X coverage. We also use the algorithm to assemble E. coli with 30X coverage and the lambda genome at a range of coverages from 3X to 50X. Additionally, we classify sequence variants at an order of magnitude lower coverage than is possible with existing methods. This thesis also reports preliminary progress towards controlling the motion of DNA using two nanopores instead of one. The speed at which the DNA travels through the nanopore needs to be carefully controlled to facilitate the detection of individual bases. A second nanopore in close proximity to the first could be used to slow or stop the motion of the DNA in order to enable a more accurate readout. The fabrication process for a new pyramidal nanopore geometry was developed in order to facilitate the positioning of the nanopores. This thesis demonstrates that two of them can be placed close enough to interact with a single molecule of DNA, which is a prerequisite for being able to use the driving force of the pores to exert fine control over the motion of the DNA. Another strategy for reading the DNA is to trap it completely with one pore and to move the second nanopore instead. To that end, this thesis also shows that a single strand of immobilized DNA can be captured in a scanning nanopore and examined for a full hour, with data from many scans at many different voltages obtained in order to detect a bound protein placed partway along the molecule.

The blood DNA virome in 8,000 humans.

PubMed

Moustafa, Ahmed; Xie, Chao; Kirkness, Ewen; Biggs, William; Wong, Emily; Turpaz, Yaron; Bloom, Kenneth; Delwart, Eric; Nelson, Karen E; Venter, J Craig; Telenti, Amalio

2017-03-01

The characterization of the blood virome is important for the safety of blood-derived transfusion products, and for the identification of emerging pathogens. We explored non-human sequence data from whole-genome sequencing of blood from 8,240 individuals, none of whom were ascertained for any infectious disease. Viral sequences were extracted from the pool of sequence reads that did not map to the human reference genome. Analyses sifted through close to 1 Petabyte of sequence data and performed 0.5 trillion similarity searches. With a lower bound for identification of 2 viral genomes/100,000 cells, we mapped sequences to 94 different viruses, including sequences from 19 human DNA viruses, proviruses and RNA viruses (herpesviruses, anelloviruses, papillomaviruses, three polyomaviruses, adenovirus, HIV, HTLV, hepatitis B, hepatitis C, parvovirus B19, and influenza virus) in 42% of the study participants. Of possible relevance to transfusion medicine, we identified Merkel cell polyomavirus in 49 individuals, papillomavirus in blood of 13 individuals, parvovirus B19 in 6 individuals, and the presence of herpesvirus 8 in 3 individuals. The presence of DNA sequences from two RNA viruses was unexpected: Hepatitis C virus is revealing of an integration event, while the influenza virus sequence resulted from immunization with a DNA vaccine. Age, sex and ancestry contributed significantly to the prevalence of infection. The remaining 75 viruses mostly reflect extensive contamination of commercial reagents and from the environment. These technical problems represent a major challenge for the identification of novel human pathogens. Increasing availability of human whole-genome sequences will contribute substantial amounts of data on the composition of the normal and pathogenic human blood virome. Distinguishing contaminants from real human viruses is challenging.

The nucleoid protein Dps binds genomic DNA of Escherichia coli in a non-random manner

PubMed Central

Kondrashov, F. A.; Toshchakov, S. V.; Dominova, I.; Shvyreva, U. S.; Vrublevskaya, V. V.; Morenkov, O. S.; Panyukov, V. V.

2017-01-01

Dps is a multifunctional homododecameric protein that oxidizes Fe2+ ions accumulating them in the form of Fe2O3 within its protein cavity, interacts with DNA tightly condensing bacterial nucleoid upon starvation and performs some other functions. During the last two decades from discovery of this protein, its ferroxidase activity became rather well studied, but the mechanism of Dps interaction with DNA still remains enigmatic. The crucial role of lysine residues in the unstructured N-terminal tails led to the conventional point of view that Dps binds DNA without sequence or structural specificity. However, deletion of dps changed the profile of proteins in starved cells, SELEX screen revealed genomic regions preferentially bound in vitro and certain affinity of Dps for artificial branched molecules was detected by atomic force microscopy. Here we report a non-random distribution of Dps binding sites across the bacterial chromosome in exponentially growing cells and show their enrichment with inverted repeats prone to form secondary structures. We found that the Dps-bound regions overlap with sites occupied by other nucleoid proteins, and contain overrepresented motifs typical for their consensus sequences. Of the two types of genomic domains with extensive protein occupancy, which can be highly expressed or transcriptionally silent only those that are enriched with RNA polymerase molecules were preferentially occupied by Dps. In the dps-null mutant we, therefore, observed a differentially altered expression of several targeted genes and found suppressed transcription from the dps promoter. In most cases this can be explained by the relieved interference with Dps for nucleoid proteins exploiting sequence-specific modes of DNA binding. Thus, protecting bacterial cells from different stresses during exponential growth, Dps can modulate transcriptional integrity of the bacterial chromosome hampering RNA biosynthesis from some genes via competition with RNA polymerase or, vice versa, competing with inhibitors to activate transcription. PMID:28800583

A comprehensive resource of genomic, epigenomic and transcriptomic sequencing data for the black truffle Tuber melanosporum

PubMed Central

2014-01-01

Background Tuber melanosporum, also known in the gastronomic community as “truffle”, features one of the largest fungal genomes (125 Mb) with an exceptionally high transposable element (TE) and repetitive DNA content (>58%). The main purpose of DNA methylation in fungi is TE silencing. As obligate outcrossing organisms, truffles are bound to a sexual mode of propagation, which together with TEs is thought to represent a major force driving the evolution of DNA methylation. Thus, it was of interest to examine if and how T. melanosporum exploits DNA methylation to maintain genome integrity. Findings We performed whole-genome DNA bisulfite sequencing and mRNA sequencing on different developmental stages of T. melanosporum; namely, fruitbody (“truffle”), free-living mycelium and ectomycorrhiza. The data revealed a high rate of cytosine methylation (>44%), selectively targeting TEs rather than genes with a strong preference for CpG sites. Whole genome DNA sequencing uncovered multiple TE-enriched, copy number variant regions bearing a significant fraction of hypomethylated and expressed TEs, almost exclusively in free-living mycelium propagated in vitro. Treatment of mycelia with 5-azacytidine partially reduced DNA methylation and increased TE transcription. Our transcriptome assembly also resulted in the identification of a set of novel transcripts from 614 genes. Conclusions The datasets presented here provide valuable and comprehensive (epi)genomic information that can be of interest for evolutionary genomics studies of multicellular (filamentous) fungi, in particular Ascomycetes belonging to the subphylum, Pezizomycotina. Evidence derived from comparative methylome and transcriptome analyses indicates that a non-exhaustive and partly reversible methylation process operates in truffles. PMID:25392735

A comprehensive resource of genomic, epigenomic and transcriptomic sequencing data for the black truffle Tuber melanosporum.

PubMed

Chen, Pao-Yang; Montanini, Barbara; Liao, Wen-Wei; Morselli, Marco; Jaroszewicz, Artur; Lopez, David; Ottonello, Simone; Pellegrini, Matteo

2014-01-01

Tuber melanosporum, also known in the gastronomic community as "truffle", features one of the largest fungal genomes (125 Mb) with an exceptionally high transposable element (TE) and repetitive DNA content (>58%). The main purpose of DNA methylation in fungi is TE silencing. As obligate outcrossing organisms, truffles are bound to a sexual mode of propagation, which together with TEs is thought to represent a major force driving the evolution of DNA methylation. Thus, it was of interest to examine if and how T. melanosporum exploits DNA methylation to maintain genome integrity. We performed whole-genome DNA bisulfite sequencing and mRNA sequencing on different developmental stages of T. melanosporum; namely, fruitbody ("truffle"), free-living mycelium and ectomycorrhiza. The data revealed a high rate of cytosine methylation (>44%), selectively targeting TEs rather than genes with a strong preference for CpG sites. Whole genome DNA sequencing uncovered multiple TE-enriched, copy number variant regions bearing a significant fraction of hypomethylated and expressed TEs, almost exclusively in free-living mycelium propagated in vitro. Treatment of mycelia with 5-azacytidine partially reduced DNA methylation and increased TE transcription. Our transcriptome assembly also resulted in the identification of a set of novel transcripts from 614 genes. The datasets presented here provide valuable and comprehensive (epi)genomic information that can be of interest for evolutionary genomics studies of multicellular (filamentous) fungi, in particular Ascomycetes belonging to the subphylum, Pezizomycotina. Evidence derived from comparative methylome and transcriptome analyses indicates that a non-exhaustive and partly reversible methylation process operates in truffles.

Modular structural elements in the replication origin region of Tetrahymena rDNA.

PubMed Central

Du, C; Sanzgiri, R P; Shaiu, W L; Choi, J K; Hou, Z; Benbow, R M; Dobbs, D L

1995-01-01

Computer analyses of the DNA replication origin region in the amplified rRNA genes of Tetrahymena thermophila identified a potential initiation zone in the 5'NTS [Dobbs, Shaiu and Benbow (1994), Nucleic Acids Res. 22, 2479-2489]. This region consists of a putative DNA unwinding element (DUE) aligned with predicted bent DNA segments, nuclear matrix or scaffold associated region (MAR/SAR) consensus sequences, and other common modular sequence elements previously shown to be clustered in eukaryotic chromosomal origin regions. In this study, two mung bean nuclease-hypersensitive sites in super-coiled plasmid DNA were localized within the major DUE-like element predicted by thermodynamic analyses. Three restriction fragments of the 5'NTS region predicted to contain bent DNA segments exhibited anomalous migration characteristic of bent DNA during electrophoresis on polyacrylamide gels. Restriction fragments containing the 5'NTS region bound Tetrahymena nuclear matrices in an in vitro binding assay, consistent with an association of the replication origin region with the nuclear matrix in vivo. The direct demonstration in a protozoan origin region of elements previously identified in Drosophila, chick and mammalian origin regions suggests that clusters of modular structural elements may be a conserved feature of eukaryotic chromosomal origins of replication. Images PMID:7784181

Using synthetic bacterial enhancers to reveal a looping-based mechanism for quenching-like repression

PubMed Central

Brunwasser-Meirom, Michal; Pollak, Yaroslav; Goldberg, Sarah; Levy, Lior; Atar, Orna; Amit, Roee

2016-01-01

We explore a model for ‘quenching-like' repression by studying synthetic bacterial enhancers, each characterized by a different binding site architecture. To do so, we take a three-pronged approach: first, we compute the probability that a protein-bound dsDNA molecule will loop. Second, we use hundreds of synthetic enhancers to test the model's predictions in bacteria. Finally, we verify the mechanism bioinformatically in native genomes. Here we show that excluded volume effects generated by DNA-bound proteins can generate substantial quenching. Moreover, the type and extent of the regulatory effect depend strongly on the relative arrangement of the binding sites. The implications of these results are that enhancers should be insensitive to 10–11 bp insertions or deletions (INDELs) and sensitive to 5–6 bp INDELs. We test this prediction on 61 σ54-regulated qrr genes from the Vibrio genus and confirm the tolerance of these enhancers' sequences to the DNA's helical repeat. PMID:26832446

Using synthetic bacterial enhancers to reveal a looping-based mechanism for quenching-like repression.

PubMed

Brunwasser-Meirom, Michal; Pollak, Yaroslav; Goldberg, Sarah; Levy, Lior; Atar, Orna; Amit, Roee

2016-02-02

We explore a model for 'quenching-like' repression by studying synthetic bacterial enhancers, each characterized by a different binding site architecture. To do so, we take a three-pronged approach: first, we compute the probability that a protein-bound dsDNA molecule will loop. Second, we use hundreds of synthetic enhancers to test the model's predictions in bacteria. Finally, we verify the mechanism bioinformatically in native genomes. Here we show that excluded volume effects generated by DNA-bound proteins can generate substantial quenching. Moreover, the type and extent of the regulatory effect depend strongly on the relative arrangement of the binding sites. The implications of these results are that enhancers should be insensitive to 10-11 bp insertions or deletions (INDELs) and sensitive to 5-6 bp INDELs. We test this prediction on 61 σ(54)-regulated qrr genes from the Vibrio genus and confirm the tolerance of these enhancers' sequences to the DNA's helical repeat.

An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

PubMed

Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

2018-01-16

DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of ancestral DNA polymerases to develop their promotors. Conversely, DNA polymerases could have evolved from related RNA polymerases and retained the intrinsic binding preference despite there being no clear function for such a preference in DNA biology. Copyright © 2018 American Society for Microbiology.

Decipher the mechanisms of protein conformational changes induced by nucleotide binding through free-energy landscape analysis: ATP binding to Hsp70.

PubMed

Nicolaï, Adrien; Delarue, Patrice; Senet, Patrick

2013-01-01

ATP regulates the function of many proteins in the cell by transducing its binding and hydrolysis energies into protein conformational changes by mechanisms which are challenging to identify at the atomic scale. Based on molecular dynamics (MD) simulations, a method is proposed to analyze the structural changes induced by ATP binding to a protein by computing the effective free-energy landscape (FEL) of a subset of its coordinates along its amino-acid sequence. The method is applied to characterize the mechanism by which the binding of ATP to the nucleotide-binding domain (NBD) of Hsp70 propagates a signal to its substrate-binding domain (SBD). Unbiased MD simulations were performed for Hsp70-DnaK chaperone in nucleotide-free, ADP-bound and ATP-bound states. The simulations revealed that the SBD does not interact with the NBD for DnaK in its nucleotide-free and ADP-bound states whereas the docking of the SBD was found in the ATP-bound state. The docked state induced by ATP binding found in MD is an intermediate state between the initial nucleotide-free and final ATP-bound states of Hsp70. The analysis of the FEL projected along the amino-acid sequence permitted to identify a subset of 27 protein internal coordinates corresponding to a network of 91 key residues involved in the conformational change induced by ATP binding. Among the 91 residues, 26 are identified for the first time, whereas the others were shown relevant for the allosteric communication of Hsp70 s in several experiments and bioinformatics analysis. The FEL analysis revealed also the origin of the ATP-induced structural modifications of the SBD recently measured by Electron Paramagnetic Resonance. The pathway between the nucleotide-free and the intermediate state of DnaK was extracted by applying principal component analysis to the subset of internal coordinates describing the transition. The methodology proposed is general and could be applied to analyze allosteric communication in other proteins.

Decipher the Mechanisms of Protein Conformational Changes Induced by Nucleotide Binding through Free-Energy Landscape Analysis: ATP Binding to Hsp70

PubMed Central

Nicolaï, Adrien; Delarue, Patrice; Senet, Patrick

2013-01-01

ATP regulates the function of many proteins in the cell by transducing its binding and hydrolysis energies into protein conformational changes by mechanisms which are challenging to identify at the atomic scale. Based on molecular dynamics (MD) simulations, a method is proposed to analyze the structural changes induced by ATP binding to a protein by computing the effective free-energy landscape (FEL) of a subset of its coordinates along its amino-acid sequence. The method is applied to characterize the mechanism by which the binding of ATP to the nucleotide-binding domain (NBD) of Hsp70 propagates a signal to its substrate-binding domain (SBD). Unbiased MD simulations were performed for Hsp70-DnaK chaperone in nucleotide-free, ADP-bound and ATP-bound states. The simulations revealed that the SBD does not interact with the NBD for DnaK in its nucleotide-free and ADP-bound states whereas the docking of the SBD was found in the ATP-bound state. The docked state induced by ATP binding found in MD is an intermediate state between the initial nucleotide-free and final ATP-bound states of Hsp70. The analysis of the FEL projected along the amino-acid sequence permitted to identify a subset of 27 protein internal coordinates corresponding to a network of 91 key residues involved in the conformational change induced by ATP binding. Among the 91 residues, 26 are identified for the first time, whereas the others were shown relevant for the allosteric communication of Hsp70 s in several experiments and bioinformatics analysis. The FEL analysis revealed also the origin of the ATP-induced structural modifications of the SBD recently measured by Electron Paramagnetic Resonance. The pathway between the nucleotide-free and the intermediate state of DnaK was extracted by applying principal component analysis to the subset of internal coordinates describing the transition. The methodology proposed is general and could be applied to analyze allosteric communication in other proteins. PMID:24348227

Molecular cytogenetics using fluorescence in situ hybridization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gray, J.W.; Kuo, Wen-Lin; Lucas, J.

1990-12-07

Fluorescence in situ hybridization (FISH) with chromosome-specific probes enables several new areas of cytogenetic investigation by allowing visual determination of the presence and normality of specific genetic sequences in single metaphase or interphase cells. in this approach, termed molecular cytogenetics, the genetic loci to be analyzed are made microscopically visible in single cells using in situ hybridization with nucleic acid probes specific to these loci. To accomplish this, the DNA in the target cells is made single stranded by thermal denaturation and incubated with single-stranded, chemically modified probe under conditions where the probe will anneal only with DNA sequences tomore » which it has high DNA sequence homology. The bound probe is then made visible by treatment with a fluorescent reagent such as fluorescein that binds to the chemical modification carried by the probe. The DNA to which the probe does not bind is made visible by staining with a dye such as propidium iodide that fluoresces at a wavelength different from that of the reagent used for probe visualization. We show in this report that probes are now available that make this technique useful for biological dosimetry, prenatal diagnosis and cancer biology. 31 refs., 3 figs.« less

Mechanism of DNA-binding enhancement by the human T-cell leukaemia virus transactivator Tax.

PubMed

Baranger, A M; Palmer, C R; Hamm, M K; Giebler, H A; Brauweiler, A; Nyborg, J K; Schepartz, A

1995-08-17

Tax protein activates transcription of the human T-cell leukaemia virus type I (HTLV-I) genome through three imperfect cyclic AMP-responsive element (CRE) target sites located within the viral promoter. Previous work has shown that Tax interacts with the bZIP element of proteins that bind the CRE target site to promote peptide dimerization, suggesting an association between Tax and bZIP coiled coil. Here we show that the site of interaction with Tax is not the coiled coil, but the basic segment. This interaction increases the stability of the GCN4 bZIP dimer by 1.7 kcal mol-1 and the DNA affinity of the dimer by 1.9 kcal mol-1. The differential effect of Tax on several bZip-DNA complexes that differ in peptide sequence or DNA conformation suggests a model for Tax action based on stabilization of a distinct DNA-bound protein structure. This model may explain how Tax interacts with transcription factors of considerable sequence diversity to alter patterns of gene expression.

Molecular Architecture of Full-length TRF1 Favors Its Interaction with DNA.

PubMed

Boskovic, Jasminka; Martinez-Gago, Jaime; Mendez-Pertuz, Marinela; Buscato, Alberto; Martinez-Torrecuadrada, Jorge Luis; Blasco, Maria A

2016-10-07

Telomeres are specific DNA-protein structures found at both ends of eukaryotic chromosomes that protect the genome from degradation and from being recognized as double-stranded breaks. In vertebrates, telomeres are composed of tandem repeats of the TTAGGG sequence that are bound by a six-subunit complex called shelterin. Molecular mechanisms of telomere functions remain unknown in large part due to lack of structural data on shelterins, shelterin complex, and its interaction with the telomeric DNA repeats. TRF1 is one of the best studied shelterin components; however, the molecular architecture of the full-length protein remains unknown. We have used single-particle electron microscopy to elucidate the structure of TRF1 and its interaction with telomeric DNA sequence. Our results demonstrate that full-length TRF1 presents a molecular architecture that assists its interaction with telometic DNA and at the same time makes TRFH domains accessible to other TRF1 binding partners. Furthermore, our studies suggest hypothetical models on how other proteins as TIN2 and tankyrase contribute to regulate TRF1 function. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Seongman; Chul Ahn, Byung; O'Callaghan, Dennis J.

2012-10-25

The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealedmore » that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.« less

Molecular Architecture of Full-length TRF1 Favors Its Interaction with DNA*

PubMed Central

Boskovic, Jasminka; Martinez-Gago, Jaime; Mendez-Pertuz, Marinela; Buscato, Alberto; Martinez-Torrecuadrada, Jorge Luis; Blasco, Maria A.

2016-01-01

Telomeres are specific DNA-protein structures found at both ends of eukaryotic chromosomes that protect the genome from degradation and from being recognized as double-stranded breaks. In vertebrates, telomeres are composed of tandem repeats of the TTAGGG sequence that are bound by a six-subunit complex called shelterin. Molecular mechanisms of telomere functions remain unknown in large part due to lack of structural data on shelterins, shelterin complex, and its interaction with the telomeric DNA repeats. TRF1 is one of the best studied shelterin components; however, the molecular architecture of the full-length protein remains unknown. We have used single-particle electron microscopy to elucidate the structure of TRF1 and its interaction with telomeric DNA sequence. Our results demonstrate that full-length TRF1 presents a molecular architecture that assists its interaction with telometic DNA and at the same time makes TRFH domains accessible to other TRF1 binding partners. Furthermore, our studies suggest hypothetical models on how other proteins as TIN2 and tankyrase contribute to regulate TRF1 function. PMID:27563064

Programmable Oligomers Targeting 5′-GGGG-3′ in the Minor Groove of DNA and NF-κB Binding Inhibition

PubMed Central

Chenoweth, David M.; Poposki, Julie A.; Marques, Michael A.; Dervan, Peter B.

2009-01-01

A series of hairpin oligomers containing benzimidazole (Bi) and imidazopyridine (Ip) rings were synthesized and screened to target 5′-WGGGGW-3′, a core sequence in the DNA binding site of NF-κB, a prolific transcription factor important in biology and disease. Five Bi and Ip containing oligomers bound to the 5′-WGGGGW-3′ site with high affinity. One of the oligomers (Im-Im-Im-Im-γ-PyBi-PyBi-β-Dp) was able to inhibit DNA binding by the transcription factor NF-κB. PMID:17095230

Measurement of 15N longitudinal relaxation rates in 15NH4+ spin systems to characterise rotational correlation times and chemical exchange

NASA Astrophysics Data System (ADS)

Hansen, D. Flemming

2017-06-01

Many chemical and biological processes rely on the movement of monovalent cations and an understanding of such processes can therefore only be achieved by characterising the dynamics of the involved ions. It has recently been shown that 15N-ammonium can be used as a proxy for potassium to probe potassium binding in bio-molecules such as DNA quadruplexes and enzymes. Moreover, equations have been derived to describe the time-evolution of 15N-based spin density operator elements of 15NH4+ spin systems. Herein NMR pulse sequences are derived to select specific spin density matrix elements of the 15NH4+ spin system and to measure their longitudinal relaxation in order to characterise the rotational correlation time of the 15NH4+ ion as well as report on chemical exchange events of the 15NH4+ ion. Applications to 15NH4+ in acidic aqueous solutions are used to cross-validate the developed pulse sequence while measurements of spin-relaxation rates of 15NH4+ bound to a 41 kDa domain of the bacterial Hsp70 homologue DnaK are presented to show the general applicability of the derived pulse sequence. The rotational correlation time obtained for 15N-ammonium bound to DnaK is similar to the correlation time that describes the rotation about the threefold axis of a methyl group. The methodology presented here provides, together with the previous theoretical framework, an important step towards characterising the motional properties of cations in macromolecular systems.

Principles of regulatory information conservation between mouse and human.

PubMed

Cheng, Yong; Ma, Zhihai; Kim, Bong-Hyun; Wu, Weisheng; Cayting, Philip; Boyle, Alan P; Sundaram, Vasavi; Xing, Xiaoyun; Dogan, Nergiz; Li, Jingjing; Euskirchen, Ghia; Lin, Shin; Lin, Yiing; Visel, Axel; Kawli, Trupti; Yang, Xinqiong; Patacsil, Dorrelyn; Keller, Cheryl A; Giardine, Belinda; Kundaje, Anshul; Wang, Ting; Pennacchio, Len A; Weng, Zhiping; Hardison, Ross C; Snyder, Michael P

2014-11-20

To broaden our understanding of the evolution of gene regulation mechanisms, we generated occupancy profiles for 34 orthologous transcription factors (TFs) in human-mouse erythroid progenitor, lymphoblast and embryonic stem-cell lines. By combining the genome-wide transcription factor occupancy repertoires, associated epigenetic signals, and co-association patterns, here we deduce several evolutionary principles of gene regulatory features operating since the mouse and human lineages diverged. The genomic distribution profiles, primary binding motifs, chromatin states, and DNA methylation preferences are well conserved for TF-occupied sequences. However, the extent to which orthologous DNA segments are bound by orthologous TFs varies both among TFs and with genomic location: binding at promoters is more highly conserved than binding at distal elements. Notably, occupancy-conserved TF-occupied sequences tend to be pleiotropic; they function in several tissues and also co-associate with many TFs. Single nucleotide variants at sites with potential regulatory functions are enriched in occupancy-conserved TF-occupied sequences.

Multiple conformational states of DnaA protein regulate its interaction with DnaA boxes in the initiation of DNA replication.

PubMed

Patel, Meera J; Bhatia, Lavesh; Yilmaz, Gulden; Biswas-Fiss, Esther E; Biswas, Subhasis B

2017-09-01

DnaA protein is the initiator of genomic DNA replication in prokaryotes. It binds to specific DNA sequences in the origin of DNA replication and unwinds small AT-rich sequences downstream for the assembly of the replisome. The mechanism of activation of DnaA that enables it to bind and organize the origin DNA and leads to replication initiation remains unclear. In this study, we have developed double-labeled fluorescent DnaA probes to analyze conformational states of DnaA protein upon binding DNA, nucleotide, and Soj sporulation protein using Fluorescence Resonance Energy Transfer (FRET). Our studies demonstrate that DnaA protein undergoes large conformational changes upon binding to substrates and there are multiple distinct conformational states that enable it to initiate DNA replication. DnaA protein adopted a relaxed conformation by expanding ~15Å upon binding ATP and DNA to form the ATP·DnaA·DNA complex. Hydrolysis of bound ATP to ADP led to a contraction of DnaA within the complex. The relaxed conformation of DnaA is likely required for the formation of the multi-protein ATP·DnaA·DNA complex. In the initiation of sporulation, Soj binding to DnaA prevented relaxation of its conformation. Soj·ADP appeared to block the activation of DnaA, suggesting a mechanism for Soj·ADP in switching initiation of DNA replication to sporulation. Our studies demonstrate that multiple conformational states of DnaA protein regulate its binding to DNA in the initiation of DNA replication. Copyright © 2017 Elsevier B.V. All rights reserved.

Developmental roles of 21 Drosophila transcription factors are determined by quantitative differences in binding to an overlapping set of thousands of genomic regions

DOE Office of Scientific and Technical Information (OSTI.GOV)

MacArthur, Stewart; Li, Xiao-Yong; Li, Jingyi

2009-05-15

BACKGROUND: We previously established that six sequence-specific transcription factors that initiate anterior/posterior patterning in Drosophila bind to overlapping sets of thousands of genomic regions in blastoderm embryos. While regions bound at high levels include known and probable functional targets, more poorly bound regions are preferentially associated with housekeeping genes and/or genes not transcribed in the blastoderm, and are frequently found in protein coding sequences or in less conserved non-coding DNA, suggesting that many are likely non-functional. RESULTS: Here we show that an additional 15 transcription factors that regulate other aspects of embryo patterning show a similar quantitative continuum of functionmore » and binding to thousands of genomic regions in vivo. Collectively, the 21 regulators show a surprisingly high overlap in the regions they bind given that they belong to 11 DNA binding domain families, specify distinct developmental fates, and can act via different cis-regulatory modules. We demonstrate, however, that quantitative differences in relative levels of binding to shared targets correlate with the known biological and transcriptional regulatory specificities of these factors. CONCLUSIONS: It is likely that the overlap in binding of biochemically and functionally unrelated transcription factors arises from the high concentrations of these proteins in nuclei, which, coupled with their broad DNA binding specificities, directs them to regions of open chromatin. We suggest that most animal transcription factors will be found to show a similar broad overlapping pattern of binding in vivo, with specificity achieved by modulating the amount, rather than the identity, of bound factor.« less

Generation of Aptamers from A Primer-Free Randomized ssDNA Library Using Magnetic-Assisted Rapid Aptamer Selection

NASA Astrophysics Data System (ADS)

Tsao, Shih-Ming; Lai, Ji-Ching; Horng, Horng-Er; Liu, Tu-Chen; Hong, Chin-Yih

2017-04-01

Aptamers are oligonucleotides that can bind to specific target molecules. Most aptamers are generated using random libraries in the standard systematic evolution of ligands by exponential enrichment (SELEX). Each random library contains oligonucleotides with a randomized central region and two fixed primer regions at both ends. The fixed primer regions are necessary for amplifying target-bound sequences by PCR. However, these extra-sequences may cause non-specific bindings, which potentially interfere with good binding for random sequences. The Magnetic-Assisted Rapid Aptamer Selection (MARAS) is a newly developed protocol for generating single-strand DNA aptamers. No repeat selection cycle is required in the protocol. This study proposes and demonstrates a method to isolate aptamers for C-reactive proteins (CRP) from a randomized ssDNA library containing no fixed sequences at 5‧ and 3‧ termini using the MARAS platform. Furthermore, the isolated primer-free aptamer was sequenced and binding affinity for CRP was analyzed. The specificity of the obtained aptamer was validated using blind serum samples. The result was consistent with monoclonal antibody-based nephelometry analysis, which indicated that a primer-free aptamer has high specificity toward targets. MARAS is a feasible platform for efficiently generating primer-free aptamers for clinical diagnoses.

Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.

PubMed Central

Sasaki, H; Yokoyama, E; Kuroiwa, A

1990-01-01

The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866

Redox polymer and probe DNA tethered to gold electrodes for enzyme-amplified amperometric detection of DNA hybridization.

PubMed

Kavanagh, Paul; Leech, Dónal

2006-04-15

The detection of nucleic acids based upon recognition surfaces formed by co-immobilization of a redox polymer mediator and DNA probe sequences on gold electrodes is described. The recognition surface consists of a redox polymer, [Os(2,2'-bipyridine)2(polyvinylimidazole)(10)Cl](+/2+), and a model single DNA strand cross-linked and tethered to a gold electrode via an anchoring self-assembled monolayer (SAM) of cysteamine. Hybridization between the immobilized probe DNA of the recognition surface and a biotin-conjugated target DNA sequence (designed from the ssrA gene of Listeria monocytogenes), followed by addition of an enzyme (glucose oxidase)-avidin conjugate, results in electrical contact between the enzyme and the mediating redox polymer. In the presence of glucose, the current generated due to the catalytic oxidation of glucose to gluconolactone is measured, and a response is obtained that is binding-dependent. The tethering of the probe DNA and redox polymer to the SAM improves the stability of the surface to assay conditions of rigorous washing and high salt concentration (1 M). These conditions eliminate nonspecific interaction of both the target DNA and the enzyme-avidin conjugate with the recognition surfaces. The sensor response increases linearly with increasing concentration of target DNA in the range of 1 x 10(-9) to 2 x 10(-6) M. The detection limit is approximately 1.4 fmol, (corresponding to 0.2 nM of target DNA). Regeneration of the recognition surface is possible by treatment with 0.25 M NaOH solution. After rehybridization of the regenerated surface with the target DNA sequence, >95% of the current is recovered, indicating that the redox polymer and probe DNA are strongly bound to the surface. These results demonstrate the utility of the proposed approach.

Human T-cell leukemia virus type 1 Tax requires direct access to DNA for recruitment of CREB binding protein to the viral promoter.

PubMed

Lenzmeier, B A; Giebler, H A; Nyborg, J K

1998-02-01

Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in the HTLV-1 promoter. Short stretches of dG-dC-rich (GC-rich) DNA, immediately flanking each of the viral CREs, are essential for Tax recruitment of CBP in vitro and Tax transactivation in vivo. Although the importance of the viral CRE-flanking sequences is well established, several studies have failed to identify an interaction between Tax and the DNA. The mechanistic role of the viral CRE-flanking sequences has therefore remained enigmatic. In this study, we used high resolution methidiumpropyl-EDTA iron(II) footprinting to show that Tax extended the CREB footprint into the GC-rich DNA flanking sequences of the viral CRE. The Tax-CREB footprint was enhanced but not extended by the KIX domain of CBP, suggesting that the coactivator increased the stability of the nucleoprotein complex. Conversely, the footprint pattern of CREB on a cellular CRE lacking GC-rich flanking sequences did not change in the presence of Tax or Tax plus KIX. The minor-groove DNA binding drug chromomycin A3 bound to the GC-rich flanking sequences and inhibited the association of Tax and the Tax-CBP complex without affecting CREB binding. Tax specifically cross-linked to the viral CRE in the 5'-flanking sequence, and this cross-link was blocked by chromomycin A3. Together, these data support a model where Tax interacts directly with both CREB and the minor-groove viral CRE-flanking sequences to form a high-affinity binding site for the recruitment of CBP to the HTLV-1 promoter.

The NMR solution structure of a mutant of the Max b/HLH/LZ free of DNA: insights into the specific and reversible DNA binding mechanism of dimeric transcription factors.

PubMed

Sauvé, Simon; Tremblay, Luc; Lavigne, Pierre

2004-09-17

Basic region-helix1-loop-helix2-leucine zipper (b/H(1)LH(2)/LZ) transcription factors bind specific DNA sequence in their target gene promoters as dimers. Max, a b/H(1)LH(2)/LZ transcription factor, is the obligate heterodimeric partner of the related b/H(1)LH(2)/LZ proteins of the Myc and Mad families. These heterodimers specifically bind E-box DNA sequence (CACGTG) to activate (e.g. c-Myc/Max) and repress (e.g. Mad1/Max) transcription. Max can also homodimerize and bind E-box sequences in c-Myc target gene promoters. While the X-ray structure of the Max b/H(1)LH(2)/LZ/DNA complex and that of others have been reported, the precise sequence of events leading to the reversible and specific binding of these important transcription factors is still largely unknown. In order to provide insights into the DNA binding mechanism, we have solved the NMR solution structure of a covalently homodimerized version of a Max b/H(1)LH(2)/LZ protein with two stabilizing mutations in the LZ, and characterized its backbone dynamics from (15)N spin-relaxation measurements in the absence of DNA. Apart from minor differences in the pitch of the LZ, possibly resulting from the mutations in the construct, we observe that the packing of the helices in the H(1)LH(2) domain is almost identical to that of the two crystal structures, indicating that no important conformational change in these helices occurs upon DNA binding. Conversely to the crystal structures of the DNA complexes, the first 14 residues of the basic region are found to be mostly unfolded while the loop is observed to be flexible. This indicates that these domains undergo conformational changes upon DNA binding. On the other hand, we find the last four residues of the basic region form a persistent helical turn contiguous to H(1). In addition, we provide evidence of the existence of internal motions in the backbone of H(1) that are of larger amplitude and longer time-scale (nanoseconds) than the ones in the H(2) and LZ domain. Most interestingly, we note that conformers in the ensemble of calculated structures have highly conserved basic residues (located in the persistent helical turn of the basic region and in the loop) known to be important for specific binding in a conformation that matches that of the DNA-bound state. These partially prefolded conformers can directly fit into the major groove of DNA and as such are proposed to lie on the pathway leading to the reversible and specific DNA binding. In these conformers, the conserved basic side-chains form a cluster that elevates the local electrostatic potential and could provide the necessary driving force for the generation of the internal motions localized in the H(1) and therefore link structural determinants with the DNA binding function. Overall, our results suggests that the Max homodimeric b/H(1)LH(2)/LZ can rapidly and preferentially bind DNA sequence through transient and partially prefolded states and subsequently, adopt the fully helical bound state in a DNA-assisted mechanism or induced-fit.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Twisting, supercoiling and stretching in protein bound DNA

NASA Astrophysics Data System (ADS)

Lam, Pui-Man; Zhen, Yi

2018-04-01

We have calculated theoretical results for the torque and slope of the twisted DNA, with various proteins bound on it, using the Neukirch-Marko model, in the regime where plectonemes exist. We found that the torque in the protein bound DNA decreases compared to that in the bare DNA. This is caused by the decrease in the free energy g(f) , and hence the smaller persistence lengths, in the case of protein bound DNA. We hope our results will encourage experimental investigations of supercoiling in protein bound DNA, which can provide further tests of the Neukirch-Marko model.

DNA Binding of Centromere Protein C (CENPC) Is Stabilized by Single-Stranded RNA

PubMed Central

Du, Yaqing; Topp, Christopher N.; Dawe, R. Kelly

2010-01-01

Centromeres are the attachment points between the genome and the cytoskeleton: centromeres bind to kinetochores, which in turn bind to spindles and move chromosomes. Paradoxically, the DNA sequence of centromeres has little or no role in perpetuating kinetochores. As such they are striking examples of genetic information being transmitted in a manner that is independent of DNA sequence (epigenetically). It has been found that RNA transcribed from centromeres remains bound within the kinetochore region, and this local population of RNA is thought to be part of the epigenetic marking system. Here we carried out a genetic and biochemical study of maize CENPC, a key inner kinetochore protein. We show that DNA binding is conferred by a localized region 122 amino acids long, and that the DNA-binding reaction is exquisitely sensitive to single-stranded RNA. Long, single-stranded nucleic acids strongly promote the binding of CENPC to DNA, and the types of RNAs that stabilize DNA binding match in size and character the RNAs present on kinetochores in vivo. Removal or replacement of the binding module with HIV integrase binding domain causes a partial delocalization of CENPC in vivo. The data suggest that centromeric RNA helps to recruit CENPC to the inner kinetochore by altering its DNA binding characteristics. PMID:20140237

DNA Recognition by a σ 54 Transcriptional Activator from Aquifex aeolicus

DOE PAGES

Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; ...

2014-08-23

Transcription initiation by bacterial σ 54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ 54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsiblemore » for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ 54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.« less

Structure of the Mecl Repressor from Staphylococcus aureus in Complex with the Cognate DNA Operator of mec

DOE Office of Scientific and Technical Information (OSTI.GOV)

Safo,M.; Ko, T.; Musayev, F.

The dimeric repressor MecI regulates the mecA gene that encodes the penicillin-binding protein PBP-2a in methicillin-resistant Staphylococcus aureus (MRSA). MecI is similar to BlaI, the repressor for the blaZ gene of {beta}-lactamase. MecI and BlaI can bind to both operator DNA sequences. The crystal structure of MecI in complex with the 32 base-pair cognate DNA of mec was determined to 3.8 Angstroms resolution. MecI is a homodimer and each monomer consists of a compact N-terminal winged-helix domain, which binds to DNA, and a loosely packed C-terminal helical domain, which intertwines with its counter-monomer. The crystal contains horizontal layers of virtualmore » DNA double helices extending in three directions, which are separated by perpendicular DNA segments. Each DNA segment is bound to two MecI dimers. Similar to the BlaI-mec complex, but unlike the MecI-bla complex, the MecI repressors bind to both sides of the mec DNA dyad that contains four conserved sequences of TACA/TGTA. The results confirm the up-and-down binding to the mec operator, which may account for cooperative effect of the repressor.« less

Interaction of Zn(II)bleomycin-A2 and Zn(II)peplomycin with a DNA hairpin containing the 5'-GT-3' binding site in comparison with the 5'-GC-3' binding site studied by NMR spectroscopy.

PubMed

Follett, Shelby E; Ingersoll, Azure D; Murray, Sally A; Reilly, Teresa M; Lehmann, Teresa E

2017-10-01

Bleomycins are a group of glycopeptide antibiotics synthesized by Streptomyces verticillus that are widely used for the treatment of various neoplastic diseases. These antibiotics have the ability to chelate a metal center, mainly Fe(II), and cause site-specific DNA cleavage. Bleomycins are differentiated by their C-terminal regions. Although this antibiotic family is a successful course of treatment for some types of cancers, it is known to cause pulmonary fibrosis. Previous studies have identified that bleomycin-related pulmonary toxicity is linked to the C-terminal region of these drugs. This region has been shown to closely interact with DNA. We examined the binding of Zn(II)peplomycin and Zn(II)bleomycin-A 2 to a DNA hairpin of sequence 5'-CCAGTATTTTTACTGG-3', containing the binding site 5'-GT-3', and compared the results with those obtained from our studies of the same MBLMs bound to a DNA hairpin containing the binding site 5'-GC-3'. We provide evidence that the DNA base sequence has a strong impact in the final structure of the drug-target complex.

Formation of cis-diamminedichloroplatinum(II) 1,2-intrastrand cross-links on DNA is flanking-sequence independent.

PubMed

Burstyn, J N; Heiger-Bernays, W J; Cohen, S M; Lippard, S J

2000-11-01

Mapping of cis-diamminedichloroplatinum(II) (cis-DDP, cisplatin) DNA adducts over >3000 nucleotides was carried out using a replication blockage assay. The sites of inhibition of modified T4 DNA polymerase, also referred to as stop sites, were analyzed to determine the effects of local sequence context on the distribution of intrastrand cisplatin cross-links. In a 3120 base fragment from replicative form M13mp18 DNA containing 24.6% guanine, 25.5% thymine, 26.9% adenine and 23.0% cytosine, 166 individual stop sites were observed at a bound platinum/nucleotide ratio of 1-2 per thousand. The majority of stop sites (90%) occurred at G(n>2) sequences and the remainder were located at sites containing an AG dinucleotide. For all of the GG sites present in the mapped sequences, including those with Gn(>)2, 89% blocked replication, whereas for the AG sites only 17% blocked replication. These blockage sites were independent of flanking nucleotides in a sequence of N(1)G*G*N(2) where N(1), N(2) = A, C, G, T and G*G* indicates a 1,2-intrastrand platinum cross-link. The absence of long-range sequence dependence was confirmed by monitoring the reaction of cisplatin with a plasmid containing an 800 bp insert of the human telomere repeat sequence (TTAGGG)(n). Platination reactions monitored at several formal platinum/nucleotide ratios or as a function of time reveal that the telomere insert was not preferentially damaged by cisplatin. Both replication blockage and telomere-insert plasmid platination experiments indicate that cisplatin 1,2-intrastrand adducts do not form preferentially at G-rich sequences in vitro.

Analysis of DNA-binding sites on Mhr1, a yeast mitochondrial ATP-independent homologous pairing protein.

PubMed

Masuda, Tokiha; Ling, Feng; Shibata, Takehiko; Mikawa, Tsutomu

2010-03-01

The Mhr1 protein is necessary for mtDNA homologous recombination in Saccharomyces cerevisiae. Homologous pairing (HP) is an essential reaction during homologous recombination, and is generally catalyzed by the RecA/Rad51 family of proteins in an ATP-dependent manner. Mhr1 catalyzes HP through a mechanism similar, at the DNA level, to that of the RecA/Rad51 proteins, but without utilizing ATP. However, it has no sequence homology with the RecA/Rad51 family proteins or with other ATP-independent HP proteins, and exhibits different requirements for DNA topology. We are interested in the structural features of the functional domains of Mhr1. In this study, we employed the native fluorescence of Mhr1's Trp residues to examine the energy transfer from the Trp residues to etheno-modified ssDNA bound to Mhr1. Our results showed that two of the seven Trp residues (Trp71 and Trp165) are spatially close to the bound DNA. A systematic analysis of mutant Mhr1 proteins revealed that Asp69 is involved in Mg(2+)-dependent DNA binding, and that multiple Lys and Arg residues located around Trp71 and Trp165 are involved in the DNA-binding activity of Mhr1. In addition, in vivo complementation analyses showed that a region around Trp165 is important for the maintenance of mtDNA. On the basis of these results, we discuss the function of the region surrounding Trp165.

A Single Molecule Study of Two Bacteriophage Epigenetic Switches

NASA Astrophysics Data System (ADS)

Wang, Haowei

Epigenetic switches allow organisms to evolve into different states by activating/repressing different sets of genes without mutations of the underlying DNA sequence. The study of epigenetic switches is very important to understand the mechanism of human development, the origin of cancer, mental illness and fundamental processes such as gene regulation. The coliphage lambda epigenetic switch, which allows switching from lysogeny to lysis, has been studied for more than 50 years as a paradigm, and has recently received renewed attention. Atomic force microscopy (AFM) was used here to show that the lambda repressor oligomerizes on DNA, primarily as a dodecamer, to secure a DNA loop, which is the basis of the lambda switch. This study also provides support for the idea that specifically bound repressor stabilizes adjacent, non-specifically bound repressor molecules, which confers robustness to the switch. 186 is a member of a different coliphage family. One of the major differences between the two coliphage families is that lambda phages can be induced to switch from the lysogenic to the lytic state by UV radiation, but most coliphages of P2 family, to which 186 belongs, cannot. Interaction between coliphage 186 repressor and DNA is characterized by AFM and tethered particle motion (TPM). To expedite analysis of the AFM data, MatLab codes were written to automate the laborious, manual tracing procedures. The programs automatically recognize DNA segments and protein particles in an image, in order to measure the DNA length and position of bound particles as well as their height, diameter and volume. Application of these algorithms greatly improved the efficiency of AFM analysis. It was showed that 186 CI dimers form heptameric wheels, which induce DNA wrapping and different kinds of DNA looping producing various conformations of nucleoprotein complexes. Information about the dynamics of DNA wrapping and looping on 186 CI particles was also obtained by TPM.

Fluorescence studies with DNA probes: dynamic aspects of DNA structure and DNA-protein interactions

NASA Astrophysics Data System (ADS)

Millar, David P.; Carver, Theodore E.

1994-08-01

Time-resolved fluorescence measurements of optical probes incorporated at specific sites in DNA provides a new approach to studies of DNA structure and DNA:protein interactions. This approach can be used to study complex multi-state behavior, such as the folding of DNA into alternative higher order structures or the transfer of DNA between multiple binding sites on a protein. In this study, fluorescence anisotropy decay of an internal dansyl probe attached to 17/27-mer oligonucleotides was used to monitor the distribution of DNA 3' termini bound at either the polymerase of 3' to 5' exonuclease sites of the Klenow fragment of DNA polymerase I. Partitioning of the primer terminus between the two active sites of the enzyme resulted in a heterogeneous probe environment, reflected in the associative behavior of the fluorescence anisotropy decay. Analysis of the anisotropy decay with a two state model of solvent-exposed and protein-associated dansyl probes was used to determine the fraction of DNA bound at each site. We examined complexes of Klenow fragment with DNAs containing various base mismatches. Single mismatches at the primer terminus caused a 3-fold increase in the equilibrium partitioning of DNA into the exonuclease site, while two or more consecutive G:G mismatches caused the DNA to bind exclusively at the exonuclease site, with a partitioning constant at least 250- fold greater than that of the corresponding matched DNA sequence. Internal single mismatches located up to four bases from the primer terminus produced larger effects than the same mismatch at the primer terminus. These results provide insight into the recognition mechanisms that enable DNA polymerases to proofread misincorporated bases during DNA replication.

An Enzyme-Catalyzed Multistep DNA Refolding Mechanism in Hairpin Telomere Formation

PubMed Central

Shi, Ke; Huang, Wai Mun; Aihara, Hideki

2013-01-01

Hairpin telomeres of bacterial linear chromosomes are generated by a DNA cutting–rejoining enzyme protelomerase. Protelomerase resolves a concatenated dimer of chromosomes as the last step of chromosome replication, converting a palindromic DNA sequence at the junctions between chromosomes into covalently closed hairpins. The mechanism by which protelomerase transforms a duplex DNA substrate into the hairpin telomeres remains largely unknown. We report here a series of crystal structures of the protelomerase TelA bound to DNA that represent distinct stages along the reaction pathway. The structures suggest that TelA converts a linear duplex substrate into hairpin turns via a transient strand-refolding intermediate that involves DNA-base flipping and wobble base-pairs. The extremely compact di-nucleotide hairpin structure of the product is fully stabilized by TelA prior to strand ligation, which drives the reaction to completion. The enzyme-catalyzed, multistep strand refolding is a novel mechanism in DNA rearrangement reactions. PMID:23382649

CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference.

PubMed

Hochstrasser, Megan L; Taylor, David W; Bhat, Prashant; Guegler, Chantal K; Sternberg, Samuel H; Nogales, Eva; Doudna, Jennifer A

2014-05-06

In bacteria, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) DNA-targeting complex Cascade (CRISPR-associated complex for antiviral defense) uses CRISPR RNA (crRNA) guides to bind complementary DNA targets at sites adjacent to a trinucleotide signature sequence called the protospacer adjacent motif (PAM). The Cascade complex then recruits Cas3, a nuclease-helicase that catalyzes unwinding and cleavage of foreign double-stranded DNA (dsDNA) bearing a sequence matching that of the crRNA. Cascade comprises the CasA-E proteins and one crRNA, forming a structure that binds and unwinds dsDNA to form an R loop in which the target strand of the DNA base pairs with the 32-nt RNA guide sequence. Single-particle electron microscopy reconstructions of dsDNA-bound Cascade with and without Cas3 reveal that Cascade positions the PAM-proximal end of the DNA duplex at the CasA subunit and near the site of Cas3 association. The finding that the DNA target and Cas3 colocalize with CasA implicates this subunit in a key target-validation step during DNA interference. We show biochemically that base pairing of the PAM region is unnecessary for target binding but critical for Cas3-mediated degradation. In addition, the L1 loop of CasA, previously implicated in PAM recognition, is essential for Cas3 activation following target binding by Cascade. Together, these data show that the CasA subunit of Cascade functions as an essential partner of Cas3 by recognizing DNA target sites and positioning Cas3 adjacent to the PAM to ensure cleavage.

CCAAT/enhancer-binding protein delta is a critical regulator of insulin-like growth factor-I gene transcription in osteoblasts

NASA Technical Reports Server (NTRS)

Umayahara, Y.; Billiard, J.; Ji, C.; Centrella, M.; McCarthy, T. L.; Rotwein, P.

1999-01-01

Insulin-like growth factor-I (IGF-I) plays a major role in promoting skeletal growth by stimulating bone cell replication and differentiation. Prostaglandin E2 and other agents that induce cAMP production enhance IGF-I gene transcription in cultured rat osteoblasts through a DNA element termed HS3D, located in the proximal part of the major rat IGF-I promoter. We previously determined that CCAAT/enhancer-binding protein delta (C/EBPdelta) is the key cAMP-stimulated regulator of IGF-I transcription in these cells and showed that it transactivates the rat IGF-I promoter through the HS3D site. We now have defined the physical-chemical properties and functional consequences of the interactions between C/EBPdelta and HS3D. C/EBPdelta, expressed in COS-7 cells or purified as a recombinant protein from Escherichia coli, bound to HS3D with an affinity at least equivalent to that of the albumin D-site, a known high affinity C/EBP binding sequence, and both DNA elements competed equally for C/EBPdelta. C/EBPdelta bound to HS3D as a dimer, with protein-DNA contact points located on guanine residues on both DNA strands within and just adjacent to the core C/EBP half-site, GCAAT, as determined by methylation interference footprinting. C/EBPdelta also formed protein-protein dimers in the absence of interactions with its DNA binding site, as indicated by results of glutaraldehyde cross-linking studies. As established by competition gel-mobility shift experiments, the conserved HS3D sequence from rat, human, and chicken also bound C/EBPdelta with similar affinity. We also found that prostaglandin E2-induced expression of reporter genes containing human IGF-I promoter 1 or four tandem copies of the human HS3D element fused to a minimal promoter and show that these effects were enhanced by a co-transfected C/EBPdelta expression plasmid. Taken together, our results provide evidence that C/EBPdelta is a critical activator of IGF-I gene transcription in osteoblasts and potentially in other cell types and species.

The delta-subunit of murine guanine nucleotide exchange factor eIF-2B. Characterization of cDNAs predicts isoforms differing at the amino-terminal end.

PubMed

Henderson, R A; Krissansen, G W; Yong, R Y; Leung, E; Watson, J D; Dholakia, J N

1994-12-02

Protein synthesis in mammalian cells is regulated at the level of the guanine nucleotide exchange factor, eIF-2B, which catalyzes the exchange of eukaryotic initiation factor 2-bound GDP for GTP. We have isolated and sequenced cDNA clones encoding the delta-subunit of murine eIF-2B. The cDNA sequence encodes a polypeptide of 544 amino acids with molecular mass of 60 kDa. Antibodies against a synthetic polypeptide of 30 amino acids deduced from the cDNA sequence specifically react with the delta-subunit of mammalian eIF-2B. The cDNA-derived amino acid sequence shows significant homology with the yeast translational regulator Gcd2, supporting the hypothesis that Gcd2 may be the yeast homolog of the delta-subunit of mammalian eIF-2B. Primer extension studies and anchor polymerase chain reaction analysis were performed to determine the 5'-end of the transcript for the delta-subunit of eIF-2B. Results of these experiments demonstrate two different mRNAs for the delta-subunit of eIF-2B in murine cells. The isolation and characterization of two different full-length cDNAs also predicts the presence of two alternate forms of the delta-subunit of eIF-2B in murine cells. These differ at their amino-terminal end but have identical nucleotide sequences coding for amino acids 31-544.

RNAmutants: a web server to explore the mutational landscape of RNA secondary structures

PubMed Central

Waldispühl, Jerome; Devadas, Srinivas; Berger, Bonnie; Clote, Peter

2009-01-01

The history and mechanism of molecular evolution in DNA have been greatly elucidated by contributions from genetics, probability theory and bioinformatics—indeed, mathematical developments such as Kimura's neutral theory, Kingman's coalescent theory and efficient software such as BLAST, ClustalW, Phylip, etc., provide the foundation for modern population genetics. In contrast to DNA, the function of most noncoding RNA depends on tertiary structure, experimentally known to be largely determined by secondary structure, for which dynamic programming can efficiently compute the minimum free energy secondary structure. For this reason, understanding the effect of pointwise mutations in RNA secondary structure could reveal fundamental properties of structural RNA molecules and improve our understanding of molecular evolution of RNA. The web server RNAmutants provides several efficient tools to compute the ensemble of low-energy secondary structures for all k-mutants of a given RNA sequence, where k is bounded by a user-specified upper bound. As we have previously shown, these tools can be used to predict putative deleterious mutations and to analyze regulatory sequences from the hepatitis C and human immunodeficiency genomes. Web server is available at http://bioinformatics.bc.edu/clotelab/RNAmutants/, and downloadable binaries at http://rnamutants.csail.mit.edu/. PMID:19531740

Knowledge-Based Elastic Potentials for Docking Drugs or Proteins with Nucleic Acids

PubMed Central

Ge, Wei; Schneider, Bohdan; Olson, Wilma K.

2005-01-01

Elastic ellipsoidal functions defined by the observed hydration patterns around the DNA bases provide a new basis for measuring the recognition of ligands in the grooves of double-helical structures. Here a set of knowledge-based potentials suitable for quantitative description of such behavior is extracted from the observed positions of water molecules and amino acid atoms that form hydrogen bonds with the nitrogenous bases in high resolution crystal structures. Energies based on the displacement of hydrogen-bonding sites on drugs in DNA-crystal complexes relative to the preferred locations of water binding around the heterocyclic bases are low, pointing to the reliability of the potentials and the apparent displacement of water molecules by drug atoms in these structures. The validity of the energy functions has been further examined in a series of sequence substitution studies based on the structures of DNA bound to polyamides that have been designed to recognize the minor-groove edges of Watson-Crick basepairs. The higher energies of binding to incorrect sequences superimposed (without conformational adjustment or displacement of polyamide ligands) on observed high resolution structures confirm the hypothesis that the drug subunits associate with specific DNA bases. The knowledge-based functions also account satisfactorily for the measured free energies of DNA-polyamide association in solution and the observed sites of polyamide binding on nucleosomal DNA. The computations are generally consistent with mechanisms by which minor-groove binding ligands are thought to recognize DNA basepairs. The calculations suggest that the asymmetric distributions of hydrogen-bond-forming atoms on the minor-groove edge of the basepairs may underlie ligand discrimination of G·C from C·G pairs, in addition to the commonly believed role of steric hindrance. The analysis of polyamide-bound nucleosomal structures reveals other discrepancies in the expected chemical design, including unexpected contacts to DNA and modified basepair targets of some ligands. The ellipsoidal potentials thus appear promising as a mathematical tool for the study of drug- and protein-DNA interactions and for gaining new insights into DNA-binding mechanisms. PMID:15501936

Interactions of Ku70/80 with Double-Strand DNA: Energetic, Dynamics, and Functional Implications

NASA Technical Reports Server (NTRS)

Hu, Shaowen; Cucinotta, Francis A.

2010-01-01

Space radiation is a proficient inducer of DNA damage leading to mutation, aberrant cell signaling, and cancer formation. Ku is among the first responding proteins in nucleus to recognize and bind the DNA double strand breaks (DSBs) whenever they are introduced. Once loaded Ku works as a scaffold to recruit other repair factors of non-homologous end joining and facilitates the following repair processes. The crystallographic study of the Ku70/80 heterodimer indicate the core structure of this protein shows virtually no conformational change after binding with DNA. To investigate the dynamical features as well as the energetic characteristics of Ku-DNA binding, we conduct multi-nanosecond molecular dynamics simulations of a modeled Ku70/80 structure and several complexes with two 24-bp DNA duplexes. Free energy calculations show significant energy differences between the complexes with Ku bound at DSBs and those with Ku associated at an internal site of a chromosome. The results also reveal detailed interactions between different nucleotides and the amino acids along the DNA-binding cradle of Ku, indicating subtle binding preference of Ku at specific DNA sequences. The covariance matrix analyses along the trajectories demonstrate the protein is stimulated to undergo correlated motions of different domains once bound to DNA ends. Additionally, principle component analyses identify these low frequency collective motions suitable for binding with and translocation along duplex DNA. It is proposed that the modification of dynamical properties of Ku upon binding with DSBs may provide a signal for the further recruitment of other repair factors such as DNA-PKcs, XLF, and XRCC4.

Single-molecule imaging at high fluorophore concentrations by local activation of dye

DOE Office of Scientific and Technical Information (OSTI.GOV)

Geertsema, Hylkje J.; Mangel, Walter F.; Schulte, Aartje C.

Single-molecule fluorescence microscopy is a powerful approach to observe biomolecular interactions with high spatial and temporal resolution. Detecting fluorescent signals from individual, labeled proteins above high levels of background fluorescence remains challenging, however. For this reason, the concentrations of labeled proteins in in vitro assays are often kept low compared to their in vivo concentrations. Here, we present a new fluorescence imaging technique by which single fluorescent molecules can be observed in real time at high, physiologically relevant concentrations. The technique requires a protein and its macromolecular substrate to be labeled each with a different fluorophore. Then, making use ofmore » short-distance energy-transfer mechanisms, the fluorescence from only those proteins bound to their substrate are selectively activated. This approach is demonstrated by labeling a DNA substrate with an intercalating stain, exciting the stain, and using energy transfer from the stain to activate the fluorescence of only those labeled DNA-binding proteins bound to the DNA. Such an experimental design allowed us to observe the sequence-independent interaction of Cy5-labeled interferon-inducible protein 16 (IFI16) with DNA and the sliding via one-dimensional diffusion of Cy5-labeled adenovirus protease (pVIc-AVP) on DNA in the presence of a background of hundreds of nM Cy5 fluorophore.« less

Single-molecule imaging at high fluorophore concentrations by local activation of dye

DOE PAGES

Geertsema, Hylkje J.; Mangel, Walter F.; Schulte, Aartje C.; ...

2015-02-17

Single-molecule fluorescence microscopy is a powerful approach to observe biomolecular interactions with high spatial and temporal resolution. Detecting fluorescent signals from individual, labeled proteins above high levels of background fluorescence remains challenging, however. For this reason, the concentrations of labeled proteins in in vitro assays are often kept low compared to their in vivo concentrations. Here, we present a new fluorescence imaging technique by which single fluorescent molecules can be observed in real time at high, physiologically relevant concentrations. The technique requires a protein and its macromolecular substrate to be labeled each with a different fluorophore. Then, making use ofmore » short-distance energy-transfer mechanisms, the fluorescence from only those proteins bound to their substrate are selectively activated. This approach is demonstrated by labeling a DNA substrate with an intercalating stain, exciting the stain, and using energy transfer from the stain to activate the fluorescence of only those labeled DNA-binding proteins bound to the DNA. Such an experimental design allowed us to observe the sequence-independent interaction of Cy5-labeled interferon-inducible protein 16 (IFI16) with DNA and the sliding via one-dimensional diffusion of Cy5-labeled adenovirus protease (pVIc-AVP) on DNA in the presence of a background of hundreds of nM Cy5 fluorophore.« less

Sequence-dependent catalytic regulation of the SpoIIIE motor activity ensures directionality of DNA translocation.

PubMed

Chara, Osvaldo; Borges, Augusto; Milhiet, Pierre-Emmanuel; Nöllmann, Marcelo; Cattoni, Diego I

2018-03-27

Transport of cellular cargo by molecular motors requires directionality to ensure proper biological functioning. During sporulation in Bacillus subtilis, directionality of chromosome transport is mediated by the interaction between the membrane-bound DNA translocase SpoIIIE and specific octameric sequences (SRS). Whether SRS regulate directionality by recruiting and orienting SpoIIIE or by simply catalyzing its translocation activity is still unclear. By using atomic force microscopy and single-round fast kinetics translocation assays we determined the localization and dynamics of diffusing and translocating SpoIIIE complexes on DNA with or without SRS. Our findings combined with mathematical modelling revealed that SpoIIIE directionality is not regulated by protein recruitment to SRS but rather by a fine-tuned balance among the rates governing SpoIIIE-DNA interactions and the probability of starting translocation modulated by SRS. Additionally, we found that SpoIIIE can start translocation from non-specific DNA, providing an alternative active search mechanism for SRS located beyond the exploratory length defined by 1D diffusion. These findings are relevant in vivo in the context of chromosome transport through an open channel, where SpoIIIE can rapidly explore DNA while directionality is modulated by the probability of translocation initiation upon interaction with SRS versus non-specific DNA.

Structure of the MecI repressor from Staphylococcus aureus in complex with the cognate DNA operator of mec

DOE Office of Scientific and Technical Information (OSTI.GOV)

Safo, Martin K., E-mail: msafo@vcu.edu; Ko, Tzu-Ping; Musayev, Faik N.

The up-and-down binding of dimeric MecI to mecA dyad DNA may account for the cooperative effect of the repressor. The dimeric repressor MecI regulates the mecA gene that encodes the penicillin-binding protein PBP-2a in methicillin-resistant Staphylococcus aureus (MRSA). MecI is similar to BlaI, the repressor for the blaZ gene of β-lactamase. MecI and BlaI can bind to both operator DNA sequences. The crystal structure of MecI in complex with the 32 base-pair cognate DNA of mec was determined to 3.8 Å resolution. MecI is a homodimer and each monomer consists of a compact N-terminal winged-helix domain, which binds to DNA,more » and a loosely packed C-terminal helical domain, which intertwines with its counter-monomer. The crystal contains horizontal layers of virtual DNA double helices extending in three directions, which are separated by perpendicular DNA segments. Each DNA segment is bound to two MecI dimers. Similar to the BlaI–mec complex, but unlike the MecI–bla complex, the MecI repressors bind to both sides of the mec DNA dyad that contains four conserved sequences of TACA/TGTA. The results confirm the up-and-down binding to the mec operator, which may account for cooperative effect of the repressor.« less

Concerted formation of macromolecular Suppressor–mutator transposition complexes

PubMed Central

Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina

1998-01-01

Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711

Structural basis for bifunctional zinc(II) macrocyclic complex recognition of thymine bulges in DNA.

PubMed

del Mundo, Imee Marie A; Siters, Kevin E; Fountain, Matthew A; Morrow, Janet R

2012-05-07

The zinc(II) complex of 1-(4-quinoylyl)methyl-1,4,7,10-tetraazacyclododecane (cy4q) binds selectively to thymine bulges in DNA and to a uracil bulge in RNA. Binding constants are in the low-micromolar range for thymine bulges in the stems of hairpins, for a thymine bulge in a DNA duplex, and for a uracil bulge in an RNA hairpin. Binding studies of Zn(cy4q) to a series of hairpins containing thymine bulges with different flanking bases showed that the complex had a moderate selectivity for thymine bulges with neighboring purines. The dissociation constants of the most strongly bound Zn(cy4q)-DNA thymine bulge adducts were 100-fold tighter than similar sequences with fully complementary stems or than bulges containing cytosine, guanine, or adenine. In order to probe the role of the pendent group, three additional zinc(II) complexes containing 1,4,7,10-tetraazacyclododecane (cyclen) with aromatic pendent groups were studied for binding to DNA including 1-(2-quinolyl)methyl-1,4,7,10-tetraazacyclododecane (cy2q), 1-(4-biphenyl)methyl-1,4,7,10-tetraazacyclododecane (cybp), and 5-(1,4,7,10-tetraazacyclododecan-1-ylsulfonyl)-N,N-dimethylnaphthalen-1-amine (dsc). The Zn(cybp) complex binds with moderate affinity but little selectivity to DNA hairpins with thymine bulges and to DNA lacking bulges. Similarly, Zn(dsc) binds weakly both to thymine bulges and hairpins with fully complementary stems. The zinc(II) complex of cy2q has the 2-quinolyl moiety bound to the Zn(II) center, as shown by (1)H NMR spectroscopy and pH-potentiometric titrations. As a consequence, only weak (500 μM) binding is observed to DNA with no appreciable selectivity. An NMR structure of a thymine-bulge-containing hairpin shows that the thymine is extrahelical but rotated toward the major groove. NMR data for Zn(cy4q) bound to DNA containing a thymine bulge is consistent with binding of the zinc(II) complex to the thymine N3(-) and stacking of the quinoline on top of the thymine. The thymine-bulge bound zinc(II) complex is pointed into the major groove, and there are interactions with the guanine positioned 5' to the thymine bulge.

SRY, like HMG1, recognizes sharp angles in DNA.

PubMed Central

Ferrari, S; Harley, V R; Pontiggia, A; Goodfellow, P N; Lovell-Badge, R; Bianchi, M E

1992-01-01

HMG boxes are DNA binding domains present in chromatin proteins, general transcription factors for nucleolar and mitochondrial RNA polymerases, and gene- and tissue-specific transcriptional regulators. The HMG boxes of HMG1, an abundant component of chromatin, interact specifically with four-way junctions, DNA structures that are cross-shaped and contain angles of approximately 60 and 120 degrees between their arms. We show here also that the HMG box of SRY, the protein that determines the expression of male-specific genes in humans, recognizes four-way junction DNAs irrespective of their sequence. In addition, when SRY binds to linear duplex DNA containing its specific target AACAAAG, it produces a sharp bend. Therefore, the interaction between HMG boxes and DNA appears to be predominantly structure-specific. The production of the recognition of a kink in DNA can serve several distinct functions, such as the repair of DNA lesions, the folding of DNA segments with bound transcriptional factors into productive complexes or the wrapping of DNA in chromatin. Images PMID:1425584

Archaeal RNA polymerase arrests transcription at DNA lesions.

PubMed

Gehring, Alexandra M; Santangelo, Thomas J

2017-01-01

Transcription elongation is not uniform and transcription is often hindered by protein-bound factors or DNA lesions that limit translocation and impair catalysis. Despite the high degree of sequence and structural homology of the multi-subunit RNA polymerases (RNAP), substantial differences in response to DNA lesions have been reported. Archaea encode only a single RNAP with striking structural conservation with eukaryotic RNAP II (Pol II). Here, we demonstrate that the archaeal RNAP from Thermococcus kodakarensis is sensitive to a variety of DNA lesions that pause and arrest RNAP at or adjacent to the site of DNA damage. DNA damage only halts elongation when present in the template strand, and the damage often results in RNAP arresting such that the lesion would be encapsulated with the transcription elongation complex. The strand-specific halt to archaeal transcription elongation on modified templates is supportive of RNAP recognizing DNA damage and potentially initiating DNA repair through a process akin to the well-described transcription-coupled DNA repair (TCR) pathways in Bacteria and Eukarya.

Adaptable gene-specific dye bias correction for two-channel DNA microarrays.

PubMed

Margaritis, Thanasis; Lijnzaad, Philip; van Leenen, Dik; Bouwmeester, Diane; Kemmeren, Patrick; van Hooff, Sander R; Holstege, Frank C P

2009-01-01

DNA microarray technology is a powerful tool for monitoring gene expression or for finding the location of DNA-bound proteins. DNA microarrays can suffer from gene-specific dye bias (GSDB), causing some probes to be affected more by the dye than by the sample. This results in large measurement errors, which vary considerably for different probes and also across different hybridizations. GSDB is not corrected by conventional normalization and has been difficult to address systematically because of its variance. We show that GSDB is influenced by label incorporation efficiency, explaining the variation of GSDB across different hybridizations. A correction method (Gene- And Slide-Specific Correction, GASSCO) is presented, whereby sequence-specific corrections are modulated by the overall bias of individual hybridizations. GASSCO outperforms earlier methods and works well on a variety of publically available datasets covering a range of platforms, organisms and applications, including ChIP on chip. A sequence-based model is also presented, which predicts which probes will suffer most from GSDB, useful for microarray probe design and correction of individual hybridizations. Software implementing the method is publicly available.

Adaptable gene-specific dye bias correction for two-channel DNA microarrays

PubMed Central

Margaritis, Thanasis; Lijnzaad, Philip; van Leenen, Dik; Bouwmeester, Diane; Kemmeren, Patrick; van Hooff, Sander R; Holstege, Frank CP

2009-01-01

DNA microarray technology is a powerful tool for monitoring gene expression or for finding the location of DNA-bound proteins. DNA microarrays can suffer from gene-specific dye bias (GSDB), causing some probes to be affected more by the dye than by the sample. This results in large measurement errors, which vary considerably for different probes and also across different hybridizations. GSDB is not corrected by conventional normalization and has been difficult to address systematically because of its variance. We show that GSDB is influenced by label incorporation efficiency, explaining the variation of GSDB across different hybridizations. A correction method (Gene- And Slide-Specific Correction, GASSCO) is presented, whereby sequence-specific corrections are modulated by the overall bias of individual hybridizations. GASSCO outperforms earlier methods and works well on a variety of publically available datasets covering a range of platforms, organisms and applications, including ChIP on chip. A sequence-based model is also presented, which predicts which probes will suffer most from GSDB, useful for microarray probe design and correction of individual hybridizations. Software implementing the method is publicly available. PMID:19401678

ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints

PubMed Central

He, Qiye; Johnston, Jeff; Zeitlinger, Julia

2014-01-01

Understanding how eukaryotic enhancers are bound and regulated by specific combinations of transcription factors is still a major challenge. To better map transcription factor binding genome-wide at nucleotide resolution in vivo, we have developed a robust ChIP-exo protocol called ChIP experiments with nucleotide resolution through exonuclease, unique barcode and single ligation (ChIP-nexus), which utilizes an efficient DNA self-circularization step during library preparation. Application of ChIP-nexus to four proteins—human TBP and Drosophila NFkB, Twist and Max— demonstrates that it outperforms existing ChIP protocols in resolution and specificity, pinpoints relevant binding sites within enhancers containing multiple binding motifs and allows the analysis of in vivo binding specificities. Notably, we show that Max frequently interacts with DNA sequences next to its motif, and that this binding pattern correlates with local DNA sequence features such as DNA shape. ChIP-nexus will be broadly applicable to studying in vivo transcription factor binding specificity and its relationship to cis-regulatory changes in humans and model organisms. PMID:25751057

Occupancy of a C2-C2 type 'zinc-finger' protein domain by copper. Direct observation by electrospray ionization mass spectrometry.

PubMed

Hutchens, T W; Allen, M H; Li, C M; Yip, T T

1992-09-07

The metal ion specificity of most 'zinc-finger' metal binding domains is unknown. The human estrogen receptor protein contains two different C2-C2 type 'zinc-finger' sequences within its DNA-binding domain (ERDBD). Copper inhibits the function of this protein by mechanisms which remain unclear. We have used electrospray ionization mass spectrometry to evaluate directly the 71-residue ERDBD (K180-M250) in the absence and presence of Cu(II) ions. The ERDBD showed a high affinity for Cu and was completely occupied with 4 Cu bound; each Cu ion was evidently bound to only two ligand residues (net loss of only 2 Da per bound Cu). The Cu binding stoichiometry was confirmed by atomic absorption. These results (i) provide the first direct physical evidence for the ability of the estrogen receptor DNA-binding domain to bind Cu and (ii) document a twofold difference in the Zn- and Cu-binding capacity. Differences in the ERDBD domain structure with bound Zn and Cu are predicted. Given the relative intracellular contents of Zn and Cu, our findings demonstrate the need to investigate further the Cu occupancy of this and other zinc-finger domains both in vitro and in vivo.

DNA binding by FOXP3 domain-swapped dimer suggests mechanisms of long-range chromosomal interactions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Y.; Chen, C.; Zhang, Z.

2015-01-07

FOXP3 is a lineage-specific transcription factor that is required for regulatory T cell development and function. In this study, we determined the crystal structure of the FOXP3 forkhead domain bound to DNA. The structure reveals that FOXP3 can form a stable domain-swapped dimer to bridge DNA in the absence of cofactors, suggesting that FOXP3 may play a role in long-range gene interactions. To test this hypothesis, we used circular chromosome conformation capture coupled with high throughput sequencing (4C-seq) to analyze FOXP3-dependent genomic contacts around a known FOXP3-bound locus, Ptpn22. Our studies reveal that FOXP3 induces significant changes in the chromatinmore » contacts between the Ptpn22 locus and other Foxp3-regulated genes, reflecting a mechanism by which FOXP3 reorganizes the genome architecture to coordinate the expression of its target genes. Our results suggest that FOXP3 mediates long-range chromatin interactions as part of its mechanisms to regulate specific gene expression in regulatory T cells.« less

Solving satisfiability problems using a novel microarray-based DNA computer.

PubMed

Lin, Che-Hsin; Cheng, Hsiao-Ping; Yang, Chang-Biau; Yang, Chia-Ning

2007-01-01

An algorithm based on a modified sticker model accompanied with an advanced MEMS-based microarray technology is demonstrated to solve SAT problem, which has long served as a benchmark in DNA computing. Unlike conventional DNA computing algorithms needing an initial data pool to cover correct and incorrect answers and further executing a series of separation procedures to destroy the unwanted ones, we built solutions in parts to satisfy one clause in one step, and eventually solve the entire Boolean formula through steps. No time-consuming sample preparation procedures and delicate sample applying equipment were required for the computing process. Moreover, experimental results show the bound DNA sequences can sustain the chemical solutions during computing processes such that the proposed method shall be useful in dealing with large-scale problems.

A maximum entropy model for chromatin structure

NASA Astrophysics Data System (ADS)

Farre, Pau; Emberly, Eldon; Emberly Group Team

The DNA inside the nucleus of eukaryotic cells shows a variety of conserved structures at different length scales These structures are formed by interactions between protein complexes that bind to the DNA and regulate gene activity. Recent high throughput sequencing techniques allow for the measurement both of the genome wide contact map of the folded DNA within a cell (HiC) and where various proteins are bound to the DNA (ChIP-seq). In this talk I will present a maximum-entropy method capable of both predicting HiC contact maps from binding data, and binding data from HiC contact maps. This method results in an intuitive Ising-type model that is able to predict how altering the presence of binding factors can modify chromosome conformation, without the need of polymer simulations.

The region of CQQQKPQRRP of PGC-1{alpha} interacts with the DNA-binding complex of FXR/RXR{alpha}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kanaya, Eiko; Jingami, Hisato

2006-04-14

PGC-1{alpha} co-activates transcription by several nuclear receptors. To study the interaction among PGC-1{alpha}, RXR{alpha}/FXR, and DNA, we performed electrophoresis mobility shift assays. The RXR{alpha}/FXR proteins specifically bound to DNA containing the IR-1 sequence in the absence of ligand. When the fusion protein of GST-PGC-1{alpha} was added to the mixture of RXR{alpha}/FXR/DNA, the ligand-influenced retardation of the mobility was observed. The ligand for RXR{alpha} (9-cis-retinoic acid) was necessary for this retardation, whereas, the ligand for FXR, chenodeoxycholic acid, barely had an effect. The results obtained using truncated PGC-1{alpha} proteins suggested that two regions are necessary for PGC-1{alpha} to interact with themore » DNA-binding complex of RXR{alpha}/FXR. One is the region of the second leucine-rich motif, and the other is that of the amino acid sequence CQQQKPQRRP, present between the second and third leucine-rich motifs. The results obtained with the SPQSS mutation for KPQRR suggested that the basic amino acids are important for the interaction.« less

Structural basis of DNA sequence recognition by the response regulator PhoP in Mycobacterium tuberculosis.

PubMed

He, Xiaoyuan; Wang, Liqin; Wang, Shuishu

2016-04-15

The transcriptional regulator PhoP is an essential virulence factor in Mycobacterium tuberculosis, and it presents a target for the development of new anti-tuberculosis drugs and attenuated tuberculosis vaccine strains. PhoP binds to DNA as a highly cooperative dimer by recognizing direct repeats of 7-bp motifs with a 4-bp spacer. To elucidate the PhoP-DNA binding mechanism, we determined the crystal structure of the PhoP-DNA complex. The structure revealed a tandem PhoP dimer that bound to the direct repeat. The surprising tandem arrangement of the receiver domains allowed the four domains of the PhoP dimer to form a compact structure, accounting for the strict requirement of a 4-bp spacer and the highly cooperative binding of the dimer. The PhoP-DNA interactions exclusively involved the effector domain. The sequence-recognition helix made contact with the bases of the 7-bp motif in the major groove, and the wing interacted with the adjacent minor groove. The structure provides a starting point for the elucidation of the mechanism by which PhoP regulates the virulence of M. tuberculosis and guides the design of screening platforms for PhoP inhibitors.

One recognition sequence, seven restriction enzymes, five reaction mechanisms

PubMed Central

Gowers, Darren M.; Bellamy, Stuart R.W.; Halford, Stephen E.

2004-01-01

The diversity of reaction mechanisms employed by Type II restriction enzymes was investigated by analysing the reactions of seven endonucleases at the same DNA sequence. NarI, KasI, Mly113I, SfoI, EgeI, EheI and BbeI cleave DNA at several different positions in the sequence 5′-GGCGCC-3′. Their reactions on plasmids with one or two copies of this sequence revealed five distinct mechanisms. These differ in terms of the number of sites the enzyme binds, and the number of phosphodiester bonds cleaved per turnover. NarI binds two sites, but cleaves only one bond per DNA-binding event. KasI also cuts only one bond per turnover but acts at individual sites, preferring intact to nicked sites. Mly113I cuts both strands of its recognition sites, but shows full activity only when bound to two sites, which are then cleaved concertedly. SfoI, EgeI and EheI cut both strands at individual sites, in the manner historically considered as normal for Type II enzymes. Finally, BbeI displays an absolute requirement for two sites in close physical proximity, which are cleaved concertedly. The range of reaction mechanisms for restriction enzymes is thus larger than commonly imagined, as is the number of enzymes needing two recognition sites. PMID:15226412

The structural basis of actinomycin D–binding induces nucleotide flipping out, a sharp bend and a left-handed twist in CGG triplet repeats

PubMed Central

Lo, Yu-Sheng; Tseng, Wen-Hsuan; Chuang, Chien-Ying; Hou, Ming-Hon

2013-01-01

The potent anticancer drug actinomycin D (ActD) functions by intercalating into DNA at GpC sites, thereby interrupting essential biological processes including replication and transcription. Certain neurological diseases are correlated with the expansion of (CGG)n trinucleotide sequences, which contain many contiguous GpC sites separated by a single G:G mispair. To characterize the binding of ActD to CGG triplet repeat sequences, the structural basis for the strong binding of ActD to neighbouring GpC sites flanking a G:G mismatch has been determined based on the crystal structure of ActD bound to ATGCGGCAT, which contains a CGG triplet sequence. The binding of ActD molecules to GCGGC causes many unexpected conformational changes including nucleotide flipping out, a sharp bend and a left-handed twist in the DNA helix via a two site-binding model. Heat denaturation, circular dichroism and surface plasmon resonance analyses showed that adjacent GpC sequences flanking a G:G mismatch are preferred ActD-binding sites. In addition, ActD was shown to bind the hairpin conformation of (CGG)16 in a pairwise combination and with greater stability than that of other DNA intercalators. Our results provide evidence of a possible biological consequence of ActD binding to CGG triplet repeat sequences. PMID:23408860

Genetic and DNA sequence analysis of the kanamycin resistance transposon Tn903.

PubMed Central

Grindley, N D; Joyce, C M

1980-01-01

The kanamycin resistance transposon Tn903 consists of a unique region of about 1000 base pairs bounded by a pair of 1050-base-pair inverted repeat sequences. Each repeat contains two Pvu II endonuclease cleavage sites separated by 520 base pairs. We have constructed derivatives of Tn903 in which this 520-base-pair fragment is deleted from one or both repeats. Those derivatives that lack both 520-base-pair fragments cannot transpose, whereas those that lack just one remain transposition proficient. One such transposable derivative, Tn903 delta I, has been selected for further study. We have determined the sequence of the intact inverted repeat. The 18 base pairs at each end are identical and inverted relative to one another, a structure characteristic of insertion sequences. Additional experiments indicate that a single inverted repeat from Tn903 can, in fact, transpose; we propose that this element be called IS903. To correlate the DNA sequence with genetic activities, we have created mutations by inserting a 10-base-pair DNA fragment at several sites within the intact repeat of Tn903 delta 1, and we have examined the effect of such insertions on transposability. The results suggest that IS903 encodes a 307-amino-acid polypeptide (a "transposase") that is absolutely required for transposition of IS903 or Tn903. Images PMID:6261245

Continuous expression in tobacco leaves of a Brassica napus PEND homologue blocks differentiation of plastids and development of palisade cells.

PubMed

Wycliffe, Paul; Sitbon, Folke; Wernersson, Jonny; Ezcurra, Inés; Ellerström, Mats; Rask, Lars

2005-10-01

Brassica napus complementary deoxyribonucleic acid (cDNA) clones encoding a DNA-binding protein, BnPEND, were isolated by Southwestern screening. A distinctive feature of the protein was a bZIP-like sequence in the amino-terminal portion, which, after expression in Escherichia coli, bound DNA. BnPEND transcripts were present in B. napus roots and flower buds, and to a lesser extent in stems, flowers and young leaves. Treatment in the dark for 72 h markedly increased the amount of BnPEND transcript in leaves of all ages. Sequence comparison showed that BnPEND was similar to a presumed transcription factor from B. napus, GSBF1, a protein deduced from an Arabidopsis thaliana cDNA (BX825084) and the PEND protein from Pisum sativum, believed to anchor the plastid DNA to the envelope early during plastid development. Homology to expressed sequence tag (EST) sequences from additional species suggested that BnPEND homologues are widespread among the angiosperms. Transient expression of BnPEND fused with green fluorescent protein (GFP) in Nicotiana benthamiana epidermal cells showed that BnPEND is a plastid protein, and that the 15 amino acids at the amino-terminal contain information about plastid targeting. Expression of BnPEND in Nicotiana tabacum from the Cauliflower Mosaic Virus 35S promoter gave stable transformants with different extents of white to light-green areas in the leaves, and even albino plants. In the white areas, but not in adjacent green tissue, the development of palisade cells and chloroplasts was disrupted. Our data demonstrate that the BnPEND protein, when over-expressed at an inappropriate stage, functionally blocks the development of plastids and leads to altered leaf anatomy, possibly by preventing the release of plastid DNA from the envelope.

In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.

PubMed

Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z

1994-01-01

The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.

R-loops: targets for nuclease cleavage and repeat instability.

PubMed

Freudenreich, Catherine H

2018-01-11

R-loops form when transcribed RNA remains bound to its DNA template to form a stable RNA:DNA hybrid. Stable R-loops form when the RNA is purine-rich, and are further stabilized by DNA secondary structures on the non-template strand. Interestingly, many expandable and disease-causing repeat sequences form stable R-loops, and R-loops can contribute to repeat instability. Repeat expansions are responsible for multiple neurodegenerative diseases, including Huntington's disease, myotonic dystrophy, and several types of ataxias. Recently, it was found that R-loops at an expanded CAG/CTG repeat tract cause DNA breaks as well as repeat instability (Su and Freudenreich, Proc Natl Acad Sci USA 114, E8392-E8401, 2017). Two factors were identified as causing R-loop-dependent breaks at CAG/CTG tracts: deamination of cytosines and the MutLγ (Mlh1-Mlh3) endonuclease, defining two new mechanisms for how R-loops can generate DNA breaks (Su and Freudenreich, Proc Natl Acad Sci USA 114, E8392-E8401, 2017). Following R-loop-dependent nicking, base excision repair resulted in repeat instability. These results have implications for human repeat expansion diseases and provide a paradigm for how RNA:DNA hybrids can cause genome instability at structure-forming DNA sequences. This perspective summarizes mechanisms of R-loop-induced fragility at G-rich repeats and new links between DNA breaks and repeat instability.

Prospect of Bioflavonoid Fisetin as a Quadruplex DNA Ligand: A Biophysical Approach

PubMed Central

Sengupta, Bidisha; Pahari, Biswapathik; Blackmon, Laura; Sengupta, Pradeep K.

2013-01-01

Quadruplex (G4) forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3′,4′,7-tetrahydroxyflavone) in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT) of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC) proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand. PMID:23785423

Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase.

PubMed

Yoshida, Wataru; Kezuka, Aki; Murakami, Yoshiyuki; Lee, Jinhee; Abe, Koichi; Motoki, Hiroaki; Matsuo, Takafumi; Shimura, Nobuaki; Noda, Mamoru; Igimi, Shizunobu; Ikebukuro, Kazunori

2013-11-01

An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268-luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF-luciferase fusion protein. By means of the automatic analyzer with ZF-luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0×10 to 1.0×10(6) copies. Copyright © 2013 Elsevier B.V. All rights reserved.

In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

PubMed Central

Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

2017-01-01

In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

The 193-base pair Gsg2 (haspin) promoter region regulates germ cell-specific expression bidirectionally and synchronously.

PubMed

Tokuhiro, Keizo; Miyagawa, Yasushi; Yamada, Shuichi; Hirose, Mika; Ohta, Hiroshi; Nishimune, Yoshitake; Tanaka, Hiromitsu

2007-03-01

Haspin is a unique protein kinase expressed predominantly in haploid male germ cells. The genomic structure of haspin (Gsg2) has revealed it to be intronless, and the entire transcription unit is in an intron of the integrin alphaE (Itgae) gene. Transcription occurs from a bidirectional promoter that also generates an alternatively spliced integrin alphaE-derived mRNA (Aed). In mice, the testis-specific alternative splicing of Aed is expressed bidirectionally downstream from the Gsg2 transcription initiation site, and a segment consisting of 26 bp transcribes both genomic DNA strands between Gsg2 and the Aed transcription initiation sites. To investigate the mechanisms for this unique gene regulation, we cloned and characterized the Gsg2 promoter region. The 193-bp genomic fragment from the 5' end of the Gsg2 and Aed genes, fused with EGFP and DsRed genes, drove the expression of both proteins in haploid germ cells of transgenic mice. This promoter element contained only a GC-rich sequence, and not the previously reported DNA sequences known to bind various transcription factors--with the exception of E2F1, TCFAP2A1 (AP2), and SP1. Here, we show that the 193-bp DNA sequence is sufficient for the specific, bidirectional, and synchronous expression in germ cells in the testis. We also demonstrate the existence of germ cell nuclear factors specifically bound to the promoter sequence. This activity may be regulated by binding to the promoter sequence with germ cell-specific nuclear complex(es) without regulation via DNA methylation.

Genomic maps of lincRNA occupancy reveal principles of RNA-chromatin interactions

PubMed Central

Chu, Ci; Qu, Kun; Zhong, Franklin; Artandi, Steven E.; Chang, Howard Y.

2011-01-01

SUMMARY Long intergenic noncoding RNAs (lincRNAs) are key regulators of chromatin state, yet the nature and sites of RNA-chromatin interaction are mostly unknown. Here we introduce Chromatin Isolation by RNA Purification (ChIRP), where tiling oligonucleotides retrieve specific lincRNAs with bound protein and DNA sequences, which are enumerated by deep sequencing. ChIRP-seq of three lincRNAs reveal that RNA occupancy sites in the genome are focal, sequence-specific, and numerous. Drosophila roX2 RNA occupies male X-linked gene bodies with increasing tendency toward the 3’ end, peaking at CES sites. Human telomerase RNA TERC occupies telomeres and Wnt pathway genes. HOTAIR lincRNA preferentially occupies a GA-rich DNA motif to nucleate broad domains of Polycomb occupancy and histone H3 lysine 27 trimethylation. HOTAIR occupancy occurs independently of EZH2, suggesting the order of RNA guidance of Polycomb occupancy. ChIRP-seq is generally applicable to illuminate the intersection of RNA and chromatin with newfound precision genome-wide. PMID:21963238

Principles of regulatory information conservation between mouse and human

DOE PAGES

Cheng, Yong; Ma, Zhihai; Kim, Bong-Hyun; ...

2014-11-19

To broaden our understanding of the evolution of gene regulation mechanisms, we generated occupancy profiles for 34 orthologous transcription factors (TFs) in human–mouse erythroid progenitor, lymphoblast and embryonic stem-cell lines. By combining the genome-wide transcription factor occupancy repertoires, associated epigenetic signals, and co-association patterns, here we deduce several evolutionary principles of gene regulatory features operating since the mouse and human lineages diverged. The genomic distribution profiles, primary binding motifs, chromatin states, and DNA methylation preferences are well conserved for TF-occupied sequences. However, the extent to which orthologous DNA segments are bound by orthologous TFs varies both among TFs and withmore » genomic location: binding at promoters is more highly conserved than binding at distal elements. Notably, occupancy-conserved TF-occupied sequences tend to be pleiotropic; they function in several tissues and also co-associate with many TFs. Lastly, single nucleotide variants at sites with potential regulatory functions are enriched in occupancy-conserved TF-occupied sequences.« less

Single-molecule FRET studies of the cooperative and non-cooperative binding kinetics of the bacteriophage T4 single-stranded DNA binding protein (gp32) to ssDNA lattices at replication fork junctions

PubMed Central

Lee, Wonbae; Gillies, John P.; Jose, Davis; Israels, Brett A.; von Hippel, Peter H.; Marcus, Andrew H.

2016-01-01

Gene 32 protein (gp32) is the single-stranded (ss) DNA binding protein of the bacteriophage T4. It binds transiently and cooperatively to ssDNA sequences exposed during the DNA replication process and regulates the interactions of the other sub-assemblies of the replication complex during the replication cycle. We here use single-molecule FRET techniques to build on previous thermodynamic studies of gp32 binding to initiate studies of the dynamics of the isolated and cooperative binding of gp32 molecules within the replication complex. DNA primer/template (p/t) constructs are used as models to determine the effects of ssDNA lattice length, gp32 concentration, salt concentration, binding cooperativity and binding polarity at p/t junctions. Hidden Markov models (HMMs) and transition density plots (TDPs) are used to characterize the dynamics of the multi-step assembly pathway of gp32 at p/t junctions of differing polarity, and show that isolated gp32 molecules bind to their ssDNA targets weakly and dissociate quickly, while cooperatively bound dimeric or trimeric clusters of gp32 bind much more tightly, can ‘slide’ on ssDNA sequences, and exhibit binding dynamics that depend on p/t junction polarities. The potential relationships of these binding dynamics to interactions with other components of the T4 DNA replication complex are discussed. PMID:27694621

Oncogenic ras-driven cancer cell vesiculation leads to emission of double-stranded DNA capable of interacting with target cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Tae Hoon; Chennakrishnaiah, Shilpa; Audemard, Eric

2014-08-22

Highlights: • Oncogenic H-ras stimulates emission of extracellular vesicles containing double-stranded DNA. • Vesicle-associated extracellular DNA contains mutant N-ras sequences. • Vesicles mediate intercellular transfer of mutant H-ras DNA to normal fibroblasts where it remains for several weeks. • Fibroblasts exposed to vesicles containing H-ras DNA exhibit increased proliferation. - Abstract: Cell free DNA is often regarded as a source of genetic cancer biomarkers, but the related mechanisms of DNA release, composition and biological activity remain unclear. Here we show that rat epithelial cell transformation by the human H-ras oncogene leads to an increase in production of small, exosomal-like extracellularmore » vesicles by viable cancer cells. These EVs contain chromatin-associated double-stranded DNA fragments covering the entire host genome, including full-length H-ras. Oncogenic N-ras and SV40LT sequences were also found in EVs emitted from spontaneous mouse brain tumor cells. Disruption of acidic sphingomyelinase and the p53/Rb pathway did not block emission of EV-related oncogenic DNA. Exposure of non-transformed RAT-1 cells to EVs containing mutant H-ras DNA led to the uptake and retention of this material for an extended (30 days) but transient period of time, and stimulated cell proliferation. Thus, our study suggests that H-ras-mediated transformation stimulates vesicular emission of this histone-bound oncogene, which may interact with non-transformed cells.« less

Overproduction and nucleotide sequence of the respiratory D-lactate dehydrogenase of Escherichia coli.

PubMed Central

Rule, G S; Pratt, E A; Chin, C C; Wold, F; Ho, C

1985-01-01

Recombinant DNA plasmids containing the gene for the membrane-bound D-lactate dehydrogenase (D-LDH) of Escherichia coli linked to the promoter PL from lambda were constructed. After induction, the levels of D-LDH were elevated 300-fold over that of the wild type and amounted to 35% of the total cellular protein. The nucleotide sequence of the D-LDH gene was determined and shown to agree with the amino acid composition and the amino-terminal sequence of the purified enzyme. Removal of the amino-terminal formyl-Met from D-LDH was not inhibited in cells which contained these high levels of D-LDH. Images PMID:3882663

LexA Binds to Transcription Regulatory Site of Cell Division Gene ftsZ in Toxic Cyanobacterium Microcystis aeruginosa.

PubMed

Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi

2018-05-17

Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.

DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

PubMed

Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

2013-03-29

The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

PubMed Central

Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

2013-01-01

The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

Isolation and characterization of a cDNA encoding a membrane bound acyl-CoA binding protein from Agave americana L. epidermis.

PubMed

Guerrero, Consuelo; Martín-Rufián, M; Reina, José J; Heredia, Antonio

2006-01-01

A cDNA encoding an acyl-CoA binding protein (ACBP) homologue has been cloned from a cDNA library made from mRNA isolated from epidermis of young leaves of Agave americana L. The derived amino acid sequence reveals a protein corresponding to the membrane-associated form of ACBPs only previously described in Arabidopsis and rice. Northern blot analysis showed that the A. americana ACBP gene is mainly expressed in the epidermis of mature zone of the leaves. The epidermis of A. americana leaves have a well developed cuticle with the highest amounts of the cuticular components waxes, cutin and cutan suggesting a potential role of the protein in cuticle formation.

The Activation Domain of the Bovine Papillomavirus E2 Protein Mediates Association of DNA-Bound Dimers to form DNA Loops

NASA Astrophysics Data System (ADS)

Knight, Jonathan D.; Li, Rong; Botchan, Michael

1991-04-01

The E2 transactivator protein of bovine papillomavirus binds its specific DNA target sequence as a dimer. We have found that E2 dimers, performed in solution independent of DNA, exhibit substantial cooperativity of DNA binding as detected by both nitrocellulose filter retention and footprint analysis techniques. If the binding sites are widely spaced, E2 forms stable DNA loops visible by electron microscopy. When three widely separated binding sites reside on te DNA, E2 condenses the molecule into a bow-tie structure. This implies that each E2 dimer has at least two independent surfaces for multimerization. Two naturally occurring shorter forms of the protein, E2C and D8/E2, which function in vivo as repressors of transcription, do not form such loops. Thus, the looping function of E2 maps to the 161-amino acid activation domain. These results support the looping model of transcription activation by enhancers.

Structure of a preternary complex involving a prokaryotic NHEJ DNA polymerase.

PubMed

Brissett, Nigel C; Martin, Maria J; Pitcher, Robert S; Bianchi, Julie; Juarez, Raquel; Green, Andrew J; Fox, Gavin C; Blanco, Luis; Doherty, Aidan J

2011-01-21

In many prokaryotes, a specific DNA primase/polymerase (PolDom) is required for nonhomologous end joining (NHEJ) repair of DNA double-strand breaks (DSBs). Here, we report the crystal structure of a catalytically active conformation of Mycobacterium tuberculosis PolDom, consisting of a polymerase bound to a DNA end with a 3' overhang, two metal ions, and an incoming nucleotide but, significantly, lacking a primer strand. This structure represents a polymerase:DNA complex in a preternary intermediate state. This polymerase complex occurs in solution, stabilizing the enzyme on DNA ends and promoting nucleotide extension of short incoming termini. We also demonstrate that the invariant Arg(220), contained in a conserved loop (loop 2), plays an essential role in catalysis by regulating binding of a second metal ion in the active site. We propose that this NHEJ intermediate facilitates extension reactions involving critically short or noncomplementary DNA ends, thus promoting break repair and minimizing sequence loss during DSB repair. Copyright © 2011 Elsevier Inc. All rights reserved.

Binding of pixantrone to DNA at CpA dinucleotide sequences and bulge structures.

PubMed

Konda, Shyam K; Wang, Haiqiang; Cutts, Suzanne M; Phillips, Don R; Collins, J Grant

2015-06-07

The binding of the anti-cancer drug pixantrone to three oligonucleotide sequences, d(TCATATGA)2, d(CCGAGAATTCCGG)2 {double bulge = DB} and the non-self complementary d(TACGATGAGTA) : d(TACCATCGTA) {single bulge = SB}, has been studied by NMR spectroscopy and molecular modelling. The upfield shifts observed for the aromatic resonances of pixantrone upon addition of the drug to each oligonucleotide confirmed the drug bound by intercalation. For the duplex sequence d(TCATATGA)2, NOEs were observed from the pixantrone aromatic H7/8 and aliphatic Ha/Hb protons to the H6/H8 and H1' protons of the C2, A3, T6 and G7 nucleotides, demonstrating that pixantrone preferentially binds at the symmetric CpA sites. However, weaker NOEs observed to various protons from the T4 and A5 residues indicated alternative minor binding sites. NOEs from the H7/H8 and Ha/Hb protons to both major (H6/H8) and minor groove (H1') protons indicated approximately equal proportions of intercalation was from the major and minor groove at the CpA sites. Intermolecular NOEs were observed between the H7/H8 and H4 protons of pixantrone and the A4H1' and G3H1' protons of the oligonucleotide that contains two symmetrically related bulge sites (DB), indicative of binding at the adenine bulge sites. For the oligonucleotide that only contains a single bulge site (SB), NOEs were observed from pixantrone protons to the SB G7H1', A8H1' and G9H1' protons, confirming that the drug bound selectively at the adenine bulge site. A molecular model of pixantrone-bound SB could be constructed with the drug bound from the minor groove at the A8pG9 site that was consistent with the observed NMR data. The results demonstrate that pixantrone preferentially intercalates at adenine bulge sites, compared to duplex DNA, and predominantly from the minor groove.

Genome-wide analysis identifies changes in histone retention and epigenetic modifications at developmental and imprinted gene loci in the sperm of infertile men.

PubMed

Hammoud, Saher Sue; Nix, David A; Hammoud, Ahmad O; Gibson, Mark; Cairns, Bradley R; Carrell, Douglas T

2011-09-01

The sperm chromatin of fertile men retains a small number of nucleosomes that are enriched at developmental gene promoters and imprinted gene loci. This unique chromatin packaging at certain gene promoters provides these genomic loci the ability to convey instructive epigenetic information to the zygote, potentially expanding the role and significance of the sperm epigenome in embryogenesis. We hypothesize that changes in chromatin packaging may be associated with poor reproductive outcome. Seven patients with reproductive dysfunction were recruited: three had unexplained poor embryogenesis during IVF and four were diagnosed with male infertility and previously shown to have altered protamination. Genome-wide analysis of the location of histones and histone modifications was analyzed by isolation and purification of DNA bound to histones and protamines. The histone-bound fraction of DNA was analyzed using high-throughput sequencing, both initially and following chromatin immunoprecipitation. The protamine-bound fraction was hybridized to agilent arrays. DNA methylation was examined using bisulfite sequencing. Unlike fertile men, five of seven infertile men had non-programmatic (randomly distributed) histone retention genome-wide. Interestingly, in contrast to the total histone pool, the localization of H3 Lysine 4 methylation (H3K4me) or H3 Lysine 27 methylation (H3K27me) was highly similar in the gametes of infertile men compared with fertile men. However, there was a reduction in the amount of H3K4me or H3K27me retained at developmental transcription factors and certain imprinted genes. Finally, the methylation status of candidate developmental promoters and imprinted loci were altered in a subset of the infertile men. This initial genome-wide analysis of epigenetic markings in the sperm of infertile men demonstrates differences in composition and epigenetic markings compared with fertile men, especially at certain imprinted and developmental loci. Although no single locus displays a complete change in chromatin packaging or DNA modification, the data suggest that moderate changes throughout the genome exist and may have a cumulative detrimental effect on fecundity.

Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.

PubMed

Salter, Jason D; Smith, Harold C

2018-05-23

The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Asymmetric binding of histone H1 stabilizes MMTV nucleosomes and the interaction of progesterone receptor with the exposed HRE.

PubMed

Vicent, Guillermo P; Meliá, María J; Beato, Miguel

2002-11-29

Packaging of mouse mammary tumor virus (MMTV) promoter sequences in nucleosomes modulates access of DNA binding proteins and influences the interaction among DNA bound transcription factors. Here we analyze the binding of histone H1 to MMTV mononucleosomes assembled with recombinant histones and study its influence on nucleosome structure and stability as well as on progesterone receptor (PR) binding to the hormone responsive elements (HREs). The MMTV nucleosomes can be separated into three main populations, two of which exhibited precise translational positioning. Histone H1 bound preferentially to the 5' distal nucleosomal DNA protecting additional 27-28 nt from digestion by micrococcal nuclease. Binding of histone H1 was unaffected by prior crosslinking of protein and DNA in nucleosomes with formaldehyde. Neither the translational nor the rotational nucleosome positioning was altered by histone H1 binding, but the nucleosomes were stabilized as judged by the kinetics of nuclease cleavage. Unexpectedly, binding of recombinant PR to the exposed distal HRE-I in nucleosomes was enhanced in the presence of histone H1, as demonstrated by band shift and footprinting experiments. This enhanced PR affinity may contribute to the reported positive effect of histone H1 on the hormonal activation of MMTV reporter genes.

Why double-stranded RNA resists condensation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tolokh, Igor S.; Pabit, Suzette; Katz, Andrea M.

2014-09-15

The addition of small amounts of multivalent cations to solutions containing double-stranded DNA leads to attraction between the negatively charged helices and eventually to condensation. Surprisingly, this effect is suppressed in double-stranded RNA, which carries the same charge as the DNA, but assumes a different double helical form. However, additional characterization of short (25 base-pairs) nucleic acid (NA) duplex structures by circular dichroism shows that measured differences in condensation are not solely determined by duplex helical geometry. Here we combine experiment, theory, and atomistic simulations to propose a mechanism that connects the observed variations in condensation of short NA duplexesmore » with the spatial variation of cobalt hexammine (CoHex) binding at the NA duplex surface. The atomistic picture that emerged showed that CoHex distributions around the NA reveals two major NA-CoHex binding modes -- internal and external -- distinguished by the proximity of bound CoHex to the helical axis. Decreasing trends in experimentally observed condensation propensity of the four studied NA duplexes (from B-like form of homopolymeric DNA, to mixed sequence DNA, to DNA:RNA hybrid, to A-like RNA) are explained by the progressive decrease of a single quantity: the fraction of CoHex ions in the external binding mode. Thus, while NA condensation depends on a complex interplay between various structural and sequence features, our coupled experimental and theoretical results suggest a new model in which a single parameter connects the NA condensation propensity with geometry and sequence dependence of CoHex binding.« less

Thermodynamics-Based Models of Transcriptional Regulation by Enhancers: The Roles of Synergistic Activation, Cooperative Binding and Short-Range Repression

PubMed Central

He, Xin; Samee, Md. Abul Hassan; Blatti, Charles; Sinha, Saurabh

2010-01-01

Quantitative models of cis-regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled, or heuristic approximations of the underlying regulatory mechanisms. We have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence, as a function of transcription factor concentrations and their DNA-binding specificities. It uses statistical thermodynamics theory to model not only protein-DNA interaction, but also the effect of DNA-bound activators and repressors on gene expression. In addition, the model incorporates mechanistic features such as synergistic effect of multiple activators, short range repression, and cooperativity in transcription factor-DNA binding, allowing us to systematically evaluate the significance of these features in the context of available expression data. Using this model on segmentation-related enhancers in Drosophila, we find that transcriptional synergy due to simultaneous action of multiple activators helps explain the data beyond what can be explained by cooperative DNA-binding alone. We find clear support for the phenomenon of short-range repression, where repressors do not directly interact with the basal transcriptional machinery. We also find that the binding sites contributing to an enhancer's function may not be conserved during evolution, and a noticeable fraction of these undergo lineage-specific changes. Our implementation of the model, called GEMSTAT, is the first publicly available program for simultaneously modeling the regulatory activities of a given set of sequences. PMID:20862354

Characterization of replication and conjugation of plasmid pWTY27 from a widely distributed Streptomyces species

PubMed Central

2012-01-01

Background Streptomyces species are widely distributed in natural habitats, such as soils, lakes, plants and some extreme environments. Replication loci of several Streptomyces theta-type plasmids have been reported, but are not characterized in details. Conjugation loci of some Streptomyces rolling-circle-type plasmids are identified and mechanism of conjugal transferring are described. Results We report the detection of a widely distributed Streptomyces strain Y27 and its indigenous plasmid pWTY27 from fourteen plants and four soil samples cross China by both culturing and nonculturing methods. The complete nucleotide sequence of pWTY27 consisted of 14,288 bp. A basic locus for plasmid replication comprised repAB genes and an adjacent iteron sequence, to a long inverted-repeat (ca. 105 bp) of which the RepA protein bound specifically in vitro, suggesting that RepA may recognize a second structure (e.g. a long stem-loop) of the iteron DNA. A plasmid containing the locus propagated in linear mode when the telomeres of a linear plasmid were attached, indicating a bi-directional replication mode for pWTY27. As for rolling-circle plasmids, a single traA gene and a clt sequence (covering 16 bp within traA and its adjacent 159 bp) on pWTY27 were required for plasmid transfer. TraA recognized and bound specifically to the two regions of the clt sequence, one containing all the four DC1 of 7 bp (TGACACC) and one DC2 (CCCGCCC) and most of IC1, and another covering two DC2 and part of IC1, suggesting formation of a high-ordered DNA-protein complex. Conclusions This work (i) isolates a widespread Streptomyces strain Y27 and sequences its indigenous theta-type plasmid pWTY27; (ii) identifies the replication and conjugation loci of pWTY27 and; (iii) characterizes the binding sequences of the RepA and TraA proteins. PMID:23134842

Dynamics of bleomycin interaction with a strongly bound hairpin DNA substrate, and implications for cleavage of the bound DNA.

PubMed

Bozeman, Trevor C; Nanjunda, Rupesh; Tang, Chenhong; Liu, Yang; Segerman, Zachary J; Zaleski, Paul A; Wilson, W David; Hecht, Sidney M

2012-10-31

Recent studies involving DNAs bound strongly by bleomycins have documented that such DNAs are degraded by the antitumor antibiotic with characteristics different from those observed when studying the cleavage of randomly chosen DNAs in the presence of excess Fe·BLM. In the present study, surface plasmon resonance has been used to characterize the dynamics of BLM B(2) binding to a strongly bound hairpin DNA, to define the effects of Fe(3+), salt, and temperature on BLM-DNA interaction. One strong primary DNA binding site, and at least one much weaker site, were documented. In contrast, more than one strong cleavage site was found, an observation also made for two other hairpin DNAs. Evidence is presented for BLM equilibration between the stronger and weaker binding sites in a way that renders BLM unavailable to other, less strongly bound DNAs. Thus, enhanced binding to a given site does not necessarily result in increased DNA degradation at that site; i.e., for strongly bound DNAs, the facility of DNA cleavage must involve other parameters in addition to the intrinsic rate of C-4' H atom abstraction from DNA sugars.

ETS target genes: Identification of Egr1 as a target by RNA differential display and whole genome PCR techniques

PubMed Central

Robinson, Lois; Panayiotakis, Alexandra; Papas, Takis S.; Kola, Ismail; Seth, Arun

1997-01-01

ETS transcription factors play important roles in hematopoiesis, angiogenesis, and organogenesis during murine development. The ETS genes also have a role in neoplasia, for example in Ewing’s sarcomas and retrovirally induced cancers. The ETS genes encode transcription factors that bind to specific DNA sequences and activate transcription of various cellular and viral genes. To isolate novel ETS target genes, we used two approaches. In the first approach, we isolated genes by the RNA differential display technique. Previously, we have shown that the overexpression of ETS1 and ETS2 genes effects transformation of NIH 3T3 cells and specific transformants produce high levels of the ETS proteins. To isolate ETS1 and ETS2 responsive genes in these transformed cells, we prepared RNA from ETS1, ETS2 transformants, and normal NIH 3T3 cell lines and converted it into cDNA. This cDNA was amplified by PCR and displayed on sequencing gels. The differentially displayed bands were subcloned into plasmid vectors. By Northern blot analysis, several clones showed differential patterns of mRNA expression in the NIH 3T3-, ETS1-, and ETS2-expressing cell lines. Sixteen clones were analyzed by DNA sequence analysis, and 13 of them appeared to be unique because their DNA sequences did not match with any of the known genes present in the gene bank. Three known genes were found to be identical to the CArG box binding factor, phospholipase A2-activating protein, and early growth response 1 (Egr1) genes. In the second approach, to isolate ETS target promoters directly, we performed ETS1 binding with MboI-cleaved genomic DNA in the presence of a specific mAb followed by whole genome PCR. The immune complex-bound ETS binding sites containing DNA fragments were amplified and subcloned into pBluescript and subjected to DNA sequence and computer analysis. We found that, of a large number of clones isolated, 43 represented unique sequences not previously identified. Three clones turned out to contain regulatory sequences derived from human serglycin, preproapolipoprotein C II, and Egr1 genes. The ETS binding sites derived from these three regulatory sequences showed specific binding with recombinant ETS proteins. Of interest, Egr1 was identified by both of these techniques, suggesting strongly that it is indeed an ETS target gene. PMID:9207063

Non-Homologous End Joining and Homology Directed DNA Repair Frequency of Double-Stranded Breaks Introduced by Genome Editing Reagents.

PubMed

Zaboikin, Michail; Zaboikina, Tatiana; Freter, Carl; Srinivasakumar, Narasimhachar

2017-01-01

Genome editing using transcription-activator like effector nucleases or RNA guided nucleases allows one to precisely engineer desired changes within a given target sequence. The genome editing reagents introduce double stranded breaks (DSBs) at the target site which can then undergo DNA repair by non-homologous end joining (NHEJ) or homology directed recombination (HDR) when a template DNA molecule is available. NHEJ repair results in indel mutations at the target site. As PCR amplified products from mutant target regions are likely to exhibit different melting profiles than PCR products amplified from wild type target region, we designed a high resolution melting analysis (HRMA) for rapid identification of efficient genome editing reagents. We also designed TaqMan assays using probes situated across the cut site to discriminate wild type from mutant sequences present after genome editing. The experiments revealed that the sensitivity of the assays to detect NHEJ-mediated DNA repair could be enhanced by selection of transfected cells to reduce the contribution of unmodified genomic DNA from untransfected cells to the DNA melting profile. The presence of donor template DNA lacking the target sequence at the time of genome editing further enhanced the sensitivity of the assays for detection of mutant DNA molecules by excluding the wild-type sequences modified by HDR. A second TaqMan probe that bound to an adjacent site, outside of the primary target cut site, was used to directly determine the contribution of HDR to DNA repair in the presence of the donor template sequence. The TaqMan qPCR assay, designed to measure the contribution of NHEJ and HDR in DNA repair, corroborated the results from HRMA. The data indicated that genome editing reagents can produce DSBs at high efficiency in HEK293T cells but a significant proportion of these are likely masked by reversion to wild type as a result of HDR. Supplying a donor plasmid to provide a template for HDR (that eliminates a PCR amplifiable target) revealed these cryptic DSBs and facilitated the determination of the true efficacy of genome editing reagents. The results indicated that in HEK293T cells, approximately 40% of the DSBs introduced by genome editing, were available for participation in HDR.

Context based computational analysis and characterization of ARS consensus sequences (ACS) of Saccharomyces cerevisiae genome.

PubMed

Singh, Vinod Kumar; Krishnamachari, Annangarachari

2016-09-01

Genome-wide experimental studies in Saccharomyces cerevisiae reveal that autonomous replicating sequence (ARS) requires an essential consensus sequence (ACS) for replication activity. Computational studies identified thousands of ACS like patterns in the genome. However, only a few hundreds of these sites act as replicating sites and the rest are considered as dormant or evolving sites. In a bid to understand the sequence makeup of replication sites, a content and context-based analysis was performed on a set of replicating ACS sequences that binds to origin-recognition complex (ORC) denoted as ORC-ACS and non-replicating ACS sequences (nrACS), that are not bound by ORC. In this study, DNA properties such as base composition, correlation, sequence dependent thermodynamic and DNA structural profiles, and their positions have been considered for characterizing ORC-ACS and nrACS. Analysis reveals that ORC-ACS depict marked differences in nucleotide composition and context features in its vicinity compared to nrACS. Interestingly, an A-rich motif was also discovered in ORC-ACS sequences within its nucleosome-free region. Profound changes in the conformational features, such as DNA helical twist, inclination angle and stacking energy between ORC-ACS and nrACS were observed. Distribution of ACS motifs in the non-coding segments points to the locations of ORC-ACS which are found far away from the adjacent gene start position compared to nrACS thereby enabling an accessible environment for ORC-proteins. Our attempt is novel in considering the contextual view of ACS and its flanking region along with nucleosome positioning in the S. cerevisiae genome and may be useful for any computational prediction scheme.

N-acyl homoserine lactone binding to the CarR receptor determines quorum-sensing specificity in Erwinia.

PubMed

Welch, M; Todd, D E; Whitehead, N A; McGowan, S J; Bycroft, B W; Salmond, G P

2000-02-15

Quorum sensing via an N-acyl homoserine lactone (HSL) pheromone controls the biosynthesis of a carbapenem antibiotic in Erwinia carotovora. Transcription of the carbapenem biosynthetic genes is dependent on the LuxR-type activator protein, CarR. Equilibrium binding of a range of HSL molecules, which are thought to activate CarR to bind to its DNA target sequence, was examined using fluorescence quenching, DNA bandshift analysis, limited proteolysis and reporter gene assays. CarR bound the most physiologically relevant ligand, N-(3-oxohexanoyl)-L-homoserine lactone, with a stoichiometry of two molecules of ligand per dimer of protein and a dissociation constant of 1.8 microM, in good agreement with the concentration of HSL required to activate carbapenem production in vivo. In the presence of HSL, CarR formed a very high molecular weight complex with its target DNA, indicating that the ligand causes the protein to multimerize. Chemical cross-linking analysis supported this interpretation. Our data show that the ability of a given HSL to facilitate CarR binding to its target DNA sequence is directly proportional to the affinity of the HSL for the protein.

Linear Streptomyces plasmids form superhelical circles through interactions between their terminal proteins

PubMed Central

Tsai, Hsiu-Hui; Huang, Chih-Hung; Tessmer, Ingrid; Erie, Dorothy A.; Chen, Carton W.

2011-01-01

Linear chromosomes and linear plasmids of Streptomyces possess covalently bound terminal proteins (TPs) at the 5′ ends of their telomeres. These TPs are proposed to act as primers for DNA synthesis that patches the single-stranded gaps at the 3′ ends during replication. Most (‘archetypal’) Streptomyces TPs (designated Tpg) are highly conserved in size and sequence. In addition, there are a number of atypical TPs with heterologous sequences and sizes, one of which is Tpc that caps SCP1 plasmid of Streptomyces coelicolor. Interactions between the TPs on the linear Streptomyces replicons have been suggested by electrophoretic behaviors of TP-capped DNA and circular genetic maps of Streptomyces chromosomes. Using chemical cross-linking, we demonstrated intramolecular and intermolecular interactions in vivo between Tpgs, between Tpcs and between Tpg and Tpc. Interactions between the chromosomal and plasmid telomeres were also detected in vivo. The intramolecular telomere interactions produced negative superhelicity in the linear DNA, which was relaxed by topoisomerase I. Such intramolecular association between the TPs poses a post-replicational complication in the formation of a pseudo-dimeric structure that requires resolution by exchanging TPs or DNA. PMID:21109537

A model for genesis of transcription systems.

PubMed

Burton, Zachary F; Opron, Kristopher; Wei, Guowei; Geiger, James H

2016-01-01

Repeating sequences generated from RNA gene fusions/ligations dominate ancient life, indicating central importance of building structural complexity in evolving biological systems. A simple and coherent story of life on earth is told from tracking repeating motifs that generate α/β proteins, 2-double-Ψ-β-barrel (DPBB) type RNA polymerases (RNAPs), general transcription factors (GTFs), and promoters. A general rule that emerges is that biological complexity that arises through generation of repeats is often bounded by solubility and closure (i.e., to form a pseudo-dimer or a barrel). Because the first DNA genomes were replicated by DNA template-dependent RNA synthesis followed by RNA template-dependent DNA synthesis via reverse transcriptase, the first DNA replication origins were initially 2-DPBB type RNAP promoters. A simplifying model for evolution of promoters/replication origins via repetition of core promoter elements is proposed. The model can explain why Pribnow boxes in bacterial transcription (i.e., (-12)TATAATG(-6)) so closely resemble TATA boxes (i.e., (-31)TATAAAAG(-24)) in archaeal/eukaryotic transcription. The evolution of anchor DNA sequences in bacterial (i.e., (-35)TTGACA(-30)) and archaeal (BRE(up); BRE for TFB recognition element) promoters is potentially explained. The evolution of BRE(down) elements of archaeal promoters is potentially explained.

A unique mitigator sequence determines the species specificity of the major late promoter in adenovirus type 12 DNA.

PubMed Central

Zock, C; Iselt, A; Doerfler, W

1993-01-01

Human adenovirus type 12 (Ad12) cannot replicate in hamster cells, whereas human cells are permissive for Ad12. Ad12 DNA replication and late-gene and virus-associated RNA expression are blocked in hamster cells. Early Ad12 genes are transcribed, and the viral DNA can be integrated into the host genome. Ad12 DNA replication and late-gene transcription can be complemented in hamster cells by E1 functions of Ad2 or Ad5, for which hamster cells are fully permissive (for a review, see W. Doerfler, Adv. Virus Res. 39:89-128, 1991). We have previously demonstrated that a 33-nucleotide mitigator sequence, which is located in the downstream region of the major late promoter (MLP) of Ad12 DNA, is responsible for the inactivity of the Ad12 MLP in hamster cells (C. Zock and W. Doerfler, EMBO J. 9:1615-1623, 1990). A similar negative regulator has not been found in the MLP of Ad2 DNA. We have now studied the mechanism of action of this mitigator element. The results of nuclear run-on experiments document the absence of MLP transcripts in the nuclei of Ad12-infected BHK21 hamster cells. Surprisingly, the mitigator element cannot elicit its function in in vitro transcription experiments with nuclear extracts from both hamster BHK21 and human HeLa cells. Intact nuclear topology and/or tightly bound nuclear elements that cannot be eluted in nuclear extracts are somehow required for recognition of the Ad12 mitigator. Electrophoretic mobility shift assays have not revealed significant differences in the binding of proteins from human HeLa or hamster BHK21 cells to the mitigator sequence in the MLP of Ad12 DNA or to the corresponding sequence in Ad2 DNA. We have converted the sequence of the mitigator in the MLP of Ad12 DNA to the equivalent sequence in the MLP of Ad2 DNA by site-directed mutagenesis. This construct was not active in hamster cells. When the Ad12 mitigator, on the other hand, was inserted into the Ad2 MLP, the latter's function in hamster cells was not compromised. Deletions in the 5' upstream region of the Ad12 MLP have provided evidence for the existence of additional sequences that codetermine the deficiency of the Ad12 MLP in hamster cells. The amphifunctional YY1 protein from HeLa cells can bind specifically to the mitigator and to upstream elements of the MLP of Ad12 DNA.(ABSTRACT TRUNCATED AT 400 WORDS) Images PMID:8419643

Crystal structure of RecBCD enzyme reveals a machine for processing DNA breaks

NASA Astrophysics Data System (ADS)

Singleton, Martin R.; Dillingham, Mark S.; Gaudier, Martin; Kowalczykowski, Stephen C.; Wigley, Dale B.

2004-11-01

RecBCD is a multi-functional enzyme complex that processes DNA ends resulting from a double-strand break. RecBCD is a bipolar helicase that splits the duplex into its component strands and digests them until encountering a recombinational hotspot (Chi site). The nuclease activity is then attenuated and RecBCD loads RecA onto the 3' tail of the DNA. Here we present the crystal structure of RecBCD bound to a DNA substrate. In this initiation complex, the DNA duplex has been split across the RecC subunit to create a fork with the separated strands each heading towards different helicase motor subunits. The strands pass along tunnels within the complex, both emerging adjacent to the nuclease domain of RecB. Passage of the 3' tail through one of these tunnels provides a mechanism for the recognition of a Chi sequence by RecC within the context of double-stranded DNA. Gating of this tunnel suggests how nuclease activity might be regulated.

Multiple Intrinsically Disordered Sequences Alter DNA Binding by the Homeodomain of the Drosophila Hox Protein Ultrabithorax*S⃞

PubMed Central

Liu, Ying; Matthews, Kathleen S.; Bondos, Sarah E.

2008-01-01

During animal development, distinct tissues, organs, and appendages are specified through differential gene transcription by Hox transcription factors. However, the conserved Hox homeodomains bind DNA with high affinity yet low specificity. We have therefore explored the structure of the Drosophila melanogaster Hox protein Ultrabithorax and the impact of its nonhomeodomain regions on DNA binding properties. Computational and experimental approaches identified several conserved, intrinsically disordered regions outside the homeodomain of Ultrabithorax that impact DNA binding by the homeodomain. Full-length Ultrabithorax bound to target DNA 2.5-fold weaker than its isolated homeodomain. Using N-terminal and C-terminal deletion mutants, we demonstrate that the YPWM region and the disordered microexons (termed the I1 region) inhibit DNA binding ∼2-fold, whereas the disordered I2 region inhibits homeodomain-DNA interaction a further ∼40-fold. Binding is restored almost to homeodomain affinity by the mostly disordered N-terminal 174 amino acids (R region) in a length-dependent manner. Both the I2 and R regions contain portions of the activation domain, functionally linking DNA binding and transcription regulation. Given that (i) the I1 region and a portion of the R region alter homeodomain-DNA binding as a function of pH and (ii) an internal deletion within I1 increases Ultrabithorax-DNA affinity, I1 must directly impact homeodomain-DNA interaction energetics. However, I2 appears to indirectly affect DNA binding in a manner countered by the N terminus. The amino acid sequences of I2 and much of the I1 and R regions vary significantly among Ultrabithorax orthologues, potentially diversifying Hox-DNA interactions. PMID:18508761

Flow-Induced Dispersion Analysis for Probing Anti-dsDNA Antibody Binding Heterogeneity in Systemic Lupus Erythematosus Patients: Toward a New Approach for Diagnosis and Patient Stratification.

PubMed

Poulsen, Nicklas N; Pedersen, Morten E; Østergaard, Jesper; Petersen, Nickolaj J; Nielsen, Christoffer T; Heegaard, Niels H H; Jensen, Henrik

2016-09-20

Detection of immune responses is important in the diagnosis of many diseases. For example, the detection of circulating autoantibodies against double-stranded DNA (dsDNA) is used in the diagnosis of Systemic Lupus Erythematosus (SLE). It is, however, difficult to reach satisfactory sensitivity, specificity, and accuracy with established assays. Also, existing methodologies for quantification of autoantibodies are challenging to transfer to a point-of-care setting. Here we present the use of flow-induced dispersion analysis (FIDA) for rapid (minutes) measurement of autoantibodies against dsDNA. The assay is based on Taylor dispersion analysis (TDA) and is fully automated with the use of standard capillary electrophoresis (CE) based equipment employing fluorescence detection. It is robust toward matrix effects as demonstrated by the direct analysis of samples composed of up to 85% plasma derived from human blood samples, and it allows for flexible exchange of the DNA sequences used to probe for the autoantibodies. Plasma samples from SLE positive patients were analyzed using the new FIDA methodology as well as by standard indirect immunofluorescence and solid-phase immunoassays. Interestingly, the patient antibodies bound DNA sequences with different affinities, suggesting pronounced heterogeneity among autoantibodies produced in SLE. The FIDA based methodology is a new approach for autoantibody detection and holds promise for being used for patient stratification and monitoring of disease activity.

Newer Gene Editing Technologies toward HIV Gene Therapy

PubMed Central

Manjunath, N.; Yi, Guohua; Dang, Ying; Shankar, Premlata

2013-01-01

Despite the great success of highly active antiretroviral therapy (HAART) in ameliorating the course of HIV infection, alternative therapeutic approaches are being pursued because of practical problems associated with life-long therapy. The eradication of HIV in the so-called “Berlin patient” who received a bone marrow transplant from a CCR5-negative donor has rekindled interest in genome engineering strategies to achieve the same effect. Precise gene editing within the cells is now a realistic possibility with recent advances in understanding the DNA repair mechanisms, DNA interaction with transcription factors and bacterial defense mechanisms. Within the past few years, four novel technologies have emerged that can be engineered for recognition of specific DNA target sequences to enable site-specific gene editing: Homing Endonuclease, ZFN, TALEN, and CRISPR/Cas9 system. The most recent CRISPR/Cas9 system uses a short stretch of complementary RNA bound to Cas9 nuclease to recognize and cleave target DNA, as opposed to the previous technologies that use DNA binding motifs of either zinc finger proteins or transcription activator-like effector molecules fused to an endonuclease to mediate sequence-specific DNA cleavage. Unlike RNA interference, which requires the continued presence of effector moieties to maintain gene silencing, the newer technologies allow permanent disruption of the targeted gene after a single treatment. Here, we review the applications, limitations and future prospects of novel gene-editing strategies for use as HIV therapy. PMID:24284874

The 87-kD A gamma-globin enhancer-binding protein is a product of the HOXB2(HOX2H) locus.

PubMed

Sengupta, P K; Lavelle, D E; DeSimone, J

1994-03-01

Developmental regulation of globin gene expression may be controlled by developmental stage-specific nuclear proteins that influence interactions between the locus control region and local regulatory sequences near individual globin genes. We previously isolated an 87-kD nuclear protein from K562 cells that bound to DNA sequences in the beta-globin locus control region, gamma-globin promoter, and A gamma-globin enhancer. The presence of this protein in fetal globin-expressing cells and its absence in adult globin-expressing cells suggested that it may be a developmental stage-specific factor. A lambda gt11 K562 cDNA clone encoding a portion of the HOXB2 (formerly HOX2H) homeobox gene was isolated on the basis of the ability of its beta-galactosidase fusion protein to bind to the same DNA sequences as the 87-kD K562 protein. Because no other relationship had been established between the 87-kD K562 protein and the HOXB2 protein other than their ability to bind ot the same DNA sequences, we have investigated whether the two proteins are related antigenically. Our data show that antisera produced against the HOXB2-beta-gal fusion protein and a synthetic HOXB2 decapeptide react specifically with an 87-kD protein from K562 nuclear extract, showing that the 87-kD K562 nuclear protein is a product of the HOXB2 locus, and is the first demonstration of cellular HOXB2 protein.

New t-gap insertion-deletion-like metrics for DNA hybridization thermodynamic modeling.

PubMed

D'yachkov, Arkadii G; Macula, Anthony J; Pogozelski, Wendy K; Renz, Thomas E; Rykov, Vyacheslav V; Torney, David C

2006-05-01

We discuss the concept of t-gap block isomorphic subsequences and use it to describe new abstract string metrics that are similar to the Levenshtein insertion-deletion metric. Some of the metrics that we define can be used to model a thermodynamic distance function on single-stranded DNA sequences. Our model captures a key aspect of the nearest neighbor thermodynamic model for hybridized DNA duplexes. One version of our metric gives the maximum number of stacked pairs of hydrogen bonded nucleotide base pairs that can be present in any secondary structure in a hybridized DNA duplex without pseudoknots. Thermodynamic distance functions are important components in the construction of DNA codes, and DNA codes are important components in biomolecular computing, nanotechnology, and other biotechnical applications that employ DNA hybridization assays. We show how our new distances can be calculated by using a dynamic programming method, and we derive a Varshamov-Gilbert-like lower bound on the size of some of codes using these distance functions as constraints. We also discuss software implementation of our DNA code design methods.

Cell-Free Expression and In Situ Immobilization of Parasite Proteins from Clonorchis sinensis for Rapid Identification of Antigenic Candidates

PubMed Central

Ju, Jung Won; Kim, Ho-Cheol; Shin, Hyun-Il; Kim, Yu Jung; Kim, Dong-Myung

2015-01-01

Progress towards genetic sequencing of human parasites has provided the groundwork for a post-genomic approach to develop novel antigens for the diagnosis and treatment of parasite infections. To fully utilize the genomic data, however, high-throughput methodologies are required for functional analysis of the proteins encoded in the genomic sequences. In this study, we investigated cell-free expression and in situ immobilization of parasite proteins as a novel platform for the discovery of antigenic proteins. PCR-amplified parasite DNA was immobilized on microbeads that were also functionalized to capture synthesized proteins. When the microbeads were incubated in a reaction mixture for cell-free synthesis, proteins expressed from the microbead-immobilized DNA were instantly immobilized on the same microbeads, providing a physical linkage between the genetic information and encoded proteins. This approach of in situ expression and isolation enables streamlined recovery and analysis of cell-free synthesized proteins and also allows facile identification of the genes coding antigenic proteins through direct PCR of the microbead-bound DNA. PMID:26599101

IN SITU DEMONSTRATION OF DNA HYBRIDIZING WITH CHROMOSOMAL AND NUCLEAR SAP RNA IN CHIRONOMUS TENTANS

PubMed Central

Lambert, B.; Wieslander, L.; Daneholt, B.; Egyházi, E.; Ringborg, U.

1972-01-01

Cytological hybridization combined with microdissection of Chironomus tentans salivary gland cells was used to locate DNA complementary to newly synthesized RNA from chromosomes and nuclear sap and from a single chromosomal puff, the Balbiani ring 2 (BR 2). Salivary glands were incubated with tritiated nucleosides. The labeled RNA was extracted from microdissected nuclei and hybridized to denatured squash preparations of salivary gland cells under conditions which primarily allow repeated sequences to interact. The bound RNA, resistant to ribonuclease treatment, was detected radioautographically. It was found that BR 2 RNA hybridizes specifically with the BR 2 region of chromosome IV. Nuclear sap RNA was fractionated into high and low molecular-weight RNA; the former hybridizes with the BR 2 region of chromosome IV, the latter in a diffuse distribution over the whole chromosome set. RNA from chromosome I hybridizes diffusely with all chromosomes. Nucleolar RNA hybridizes specifically with the nucleolar organizers, contained in chromosomes II and III. It is concluded that the BR 2 region of chromosome IV contains repeated DNA sequences and that nuclear sap contains BR 2 RNA. PMID:5025107

Evaluation of Phage Display Discovered Peptides as Ligands for Prostate-Specific Membrane Antigen (PSMA)

PubMed Central

Edwards, W. Barry

2013-01-01

The aim of this study was to identify potential ligands of PSMA suitable for further development as novel PSMA-targeted peptides using phage display technology. The human PSMA protein was immobilized as a target followed by incubation with a 15-mer phage display random peptide library. After one round of prescreening and two rounds of screening, high-stringency screening at the third round of panning was performed to identify the highest affinity binders. Phages which had a specific binding activity to PSMA in human prostate cancer cells were isolated and the DNA corresponding to the 15-mers were sequenced to provide three consensus sequences: GDHSPFT, SHFSVGS and EVPRLSLLAVFL as well as other sequences that did not display consensus. Two of the peptide sequences deduced from DNA sequencing of binding phages, SHSFSVGSGDHSPFT and GRFLTGGTGRLLRIS were labeled with 5-carboxyfluorescein and shown to bind and co-internalize with PSMA on human prostate cancer cells by fluorescence microscopy. The high stringency requirements yielded peptides with affinities KD∼1 µM or greater which are suitable starting points for affinity maturation. While these values were less than anticipated, the high stringency did yield peptide sequences that apparently bound to different surfaces on PSMA. These peptide sequences could be the basis for further development of peptides for prostate cancer tumor imaging and therapy. PMID:23935860

Discriminative prediction of mammalian enhancers from DNA sequence

PubMed Central

Lee, Dongwon; Karchin, Rachel; Beer, Michael A.

2011-01-01

Accurately predicting regulatory sequences and enhancers in entire genomes is an important but difficult problem, especially in large vertebrate genomes. With the advent of ChIP-seq technology, experimental detection of genome-wide EP300/CREBBP bound regions provides a powerful platform to develop predictive tools for regulatory sequences and to study their sequence properties. Here, we develop a support vector machine (SVM) framework which can accurately identify EP300-bound enhancers using only genomic sequence and an unbiased set of general sequence features. Moreover, we find that the predictive sequence features identified by the SVM classifier reveal biologically relevant sequence elements enriched in the enhancers, but we also identify other features that are significantly depleted in enhancers. The predictive sequence features are evolutionarily conserved and spatially clustered, providing further support of their functional significance. Although our SVM is trained on experimental data, we also predict novel enhancers and show that these putative enhancers are significantly enriched in both ChIP-seq signal and DNase I hypersensitivity signal in the mouse brain and are located near relevant genes. Finally, we present results of comparisons between other EP300/CREBBP data sets using our SVM and uncover sequence elements enriched and/or depleted in the different classes of enhancers. Many of these sequence features play a role in specifying tissue-specific or developmental-stage-specific enhancer activity, but our results indicate that some features operate in a general or tissue-independent manner. In addition to providing a high confidence list of enhancer targets for subsequent experimental investigation, these results contribute to our understanding of the general sequence structure of vertebrate enhancers. PMID:21875935

Directional rolling of positively charged nanoparticles along a flexibility gradient on long DNA molecules.

PubMed

Park, Suehyun; Joo, Heesun; Kim, Jun Soo

2018-01-31

Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.

Structure of the Tetrameric p53 Tumor Suppressor Bound to DNA

DTIC Science & Technology

2002-05-01

been unable to prepare suitable p53/DNA cocrystals for structure determination. Nonetheless, we have successfully determined the medium resolution (2.7A... cocrystallization with longer DNA targets or DNA targets assembled into nucleosome core particles. The structure of tetrameric p53 bound to DNA will provide

The mitochondrial genome of the pathogenic yeast Candida subhashii: GC-rich linear DNA with a protein covalently attached to the 5′ termini

PubMed Central

Fricova, Dominika; Valach, Matus; Farkas, Zoltan; Pfeiffer, Ilona; Kucsera, Judit; Tomaska, Lubomir; Nosek, Jozef

2010-01-01

As a part of our initiative aimed at a large-scale comparative analysis of fungal mitochondrial genomes, we determined the complete DNA sequence of the mitochondrial genome of the yeast Candida subhashii and found that it exhibits a number of peculiar features. First, the mitochondrial genome is represented by linear dsDNA molecules of uniform length (29 795 bp), with an unusually high content of guanine and cytosine residues (52.7 %). Second, the coding sequences lack introns; thus, the genome has a relatively compact organization. Third, the termini of the linear molecules consist of long inverted repeats and seem to contain a protein covalently bound to terminal nucleotides at the 5′ ends. This architecture resembles the telomeres in a number of linear viral and plasmid DNA genomes classified as invertrons, in which the terminal proteins serve as specific primers for the initiation of DNA synthesis. Finally, although the mitochondrial genome of C. subhashii contains essentially the same set of genes as other closely related pathogenic Candida species, we identified additional ORFs encoding two homologues of the family B protein-priming DNA polymerases and an unknown protein. The terminal structures and the genes for DNA polymerases are reminiscent of linear mitochondrial plasmids, indicating that this genome architecture might have emerged from fortuitous recombination between an ancestral, presumably circular, mitochondrial genome and an invertron-like element. PMID:20395267

Bombyx mori Nucleopolyhedrovirus Encodes a DNA-Binding Protein Capable of Destabilizing Duplex DNA

PubMed Central

Mikhailov, Victor S.; Mikhailova, Alla L.; Iwanaga, Masashi; Gomi, Sumiko; Maeda, Susumu

1998-01-01

A DNA-binding protein (designated DBP) with an apparent molecular mass of 38 kDa was purified to homogeneity from BmN cells (derived from Bombyx mori) infected with the B. mori nucleopolyhedrovirus (BmNPV). Six peptides obtained after digestion of the isolated protein with Achromobacter protease I were partially or completely sequenced. The determined amino acid sequences indicated that DBP was encoded by an open reading frame (ORF16) located at nucleotides (nt) 16189 to 17139 in the BmNPV genome (GenBank accession no. L33180). This ORF (designated dbp) is a homolog of Autographa californica multicapsid NPV ORF25, whose product has not been identified. BmNPV DBP is predicted to contain 317 amino acids (calculated molecular mass of 36.7 kDa) and to have an isoelectric point of 7.8. DBP showed a tendency to multimerization in the course of purification and was found to bind preferentially to single-stranded DNA. When bound to oligonucleotides, DBP protected them from hydrolysis by phage T4 DNA polymerase-associated 3′→5′ exonuclease. The sizes of the protected fragments indicated that a binding site size for DBP is about 30 nt per protein monomer. DBP, but not BmNPV LEF-3, was capable of unwinding partial DNA duplexes in an in vitro system. This helix-destabilizing ability is consistent with the prediction that DBP functions as a single-stranded DNA binding protein in virus replication. PMID:9525636

Differentiating Left- and Right-handed Carbon Nanotubes by DNA

NASA Astrophysics Data System (ADS)

Zheng, Ming

New structural characteristics emerge when solid-state crystals are constructed in lower dimensions. This is exemplified by single-wall carbon nanotubes, which exhibit a degree of freedom in handedness, and a multitude of helicity that gives rise to three distinct types of electronic structures - metals, quasi-metals, and semiconductors. Here, we report the use of intrinsically chiral single-stranded DNA to achieve simultaneous handedness and helicity control for all three types of nanotubes. We apply polymer aqueous two-phase systems to select special DNA-wrapped carbon nanotubes, each of which we argue must have an ordered DNA structure bound to a nanotube of defined handedness and helicity, resembling a well-folded biomacromolecule with innate stereo-selectivity. We have screened over 300 short single-stranded DNA sequences with palindrome symmetry, leading to the selection of more than 20 distinct carbon nanotube structures that have defined helicity and handedness and cover the entire chiral angle range and all three electronic types. The mechanism of handedness selection is illustrated by a DNA sequence that adopts two distinct folds on a pair of (6,5) nanotube enantiomers, respectively, rendering them large differences in fluorescence intensity and chemical reactivity. This result establishes a first example of functionally distinguishable left- and right-handed carbon nanotubes. Taken together, our work demonstrates highly efficient enantiomer differentiation by DNA, and offers a first comprehensive solution to achieve simultaneous handedness and helicity control for all three electronic types of carbon nanotubes. .

DnaA protein DNA-binding domain binds to Hda protein to promote inter-AAA+ domain interaction involved in regulatory inactivation of DnaA.

PubMed

Keyamura, Kenji; Katayama, Tsutomu

2011-08-19

Chromosomal replication is initiated from the replication origin oriC in Escherichia coli by the active ATP-bound form of DnaA protein. The regulatory inactivation of DnaA (RIDA) system, a complex of the ADP-bound Hda and the DNA-loaded replicase clamp, represses extra initiations by facilitating DnaA-bound ATP hydrolysis, yielding the inactive ADP-bound form of DnaA. However, the mechanisms involved in promoting the DnaA-Hda interaction have not been determined except for the involvement of an interaction between the AAA+ domains of the two. This study revealed that DnaA Leu-422 and Pro-423 residues within DnaA domain IV, including a typical DNA-binding HTH motif, are specifically required for RIDA-dependent ATP hydrolysis in vitro and that these residues support efficient interaction with the DNA-loaded clamp·Hda complex and with Hda in vitro. Consistently, substitutions of these residues caused accumulation of ATP-bound DnaA in vivo and oriC-dependent inhibition of cell growth. Leu-422 plays a more important role in these activities than Pro-423. By contrast, neither of these residues is crucial for DNA replication from oriC, although they are highly conserved in DnaA orthologues. Structural analysis of a DnaA·Hda complex model suggested that these residues make contact with residues in the vicinity of the Hda AAA+ sensor I that participates in formation of a nucleotide-interacting surface. Together, the results show that functional DnaA-Hda interactions require a second interaction site within DnaA domain IV in addition to the AAA+ domain and suggest that these interactions are crucial for the formation of RIDA complexes that are active for DnaA-ATP hydrolysis.

DnaA Protein DNA-binding Domain Binds to Hda Protein to Promote Inter-AAA+ Domain Interaction Involved in Regulatory Inactivation of DnaA*

PubMed Central

Keyamura, Kenji; Katayama, Tsutomu

2011-01-01

Chromosomal replication is initiated from the replication origin oriC in Escherichia coli by the active ATP-bound form of DnaA protein. The regulatory inactivation of DnaA (RIDA) system, a complex of the ADP-bound Hda and the DNA-loaded replicase clamp, represses extra initiations by facilitating DnaA-bound ATP hydrolysis, yielding the inactive ADP-bound form of DnaA. However, the mechanisms involved in promoting the DnaA-Hda interaction have not been determined except for the involvement of an interaction between the AAA+ domains of the two. This study revealed that DnaA Leu-422 and Pro-423 residues within DnaA domain IV, including a typical DNA-binding HTH motif, are specifically required for RIDA-dependent ATP hydrolysis in vitro and that these residues support efficient interaction with the DNA-loaded clamp·Hda complex and with Hda in vitro. Consistently, substitutions of these residues caused accumulation of ATP-bound DnaA in vivo and oriC-dependent inhibition of cell growth. Leu-422 plays a more important role in these activities than Pro-423. By contrast, neither of these residues is crucial for DNA replication from oriC, although they are highly conserved in DnaA orthologues. Structural analysis of a DnaA·Hda complex model suggested that these residues make contact with residues in the vicinity of the Hda AAA+ sensor I that participates in formation of a nucleotide-interacting surface. Together, the results show that functional DnaA-Hda interactions require a second interaction site within DnaA domain IV in addition to the AAA+ domain and suggest that these interactions are crucial for the formation of RIDA complexes that are active for DnaA-ATP hydrolysis. PMID:21708944

Flexible DNA bending in HU–DNA cocrystal structures

PubMed Central

Swinger, Kerren K.; Lemberg, Kathryn M.; Zhang, Ying; Rice, Phoebe A.

2003-01-01

HU and IHF are members of a family of prokaryotic proteins that interact with the DNA minor groove in a sequence-specific (IHF) or non-specific (HU) manner to induce and/or stabilize DNA bending. HU plays architectural roles in replication initiation, transcription regulation and site-specific recombination, and is associated with bacterial nucleoids. Cocrystal structures of Anabaena HU bound to DNA (1P71, 1P78, 1P51) reveal that while underlying proline intercalation and asymmetric charge neutralization mechanisms of DNA bending are similar for IHF and HU, HU stabilizes different DNA bend angles (∼105–140°). The two bend angles within a single HU complex are not coplanar, and the resulting dihedral angle is consistent with negative supercoiling. Comparison of HU–DNA and IHF–DNA structures suggests that sharper bending is correlated with longer DNA binding sites and smaller dihedral angles. An HU-induced bend may be better modeled as a hinge, not a rigid bend. The ability to induce or stabilize varying bend angles is consistent with HU’s role as an architectural cofactor in many different systems that may require differing geometries. PMID:12853489

EHMT2 directs DNA methylation for efficient gene silencing in mouse embryos

PubMed Central

Auclair, Ghislain; Borgel, Julie; Sanz, Lionel A.; Vallet, Judith; Guibert, Sylvain; Dumas, Michael; Cavelier, Patricia; Girardot, Michael; Forné, Thierry; Feil, Robert; Weber, Michael

2016-01-01

The extent to which histone modifying enzymes contribute to DNA methylation in mammals remains unclear. Previous studies suggested a link between the lysine methyltransferase EHMT2 (also known as G9A and KMT1C) and DNA methylation in the mouse. Here, we used a model of knockout mice to explore the role of EHMT2 in DNA methylation during mouse embryogenesis. The Ehmt2 gene is expressed in epiblast cells but is dispensable for global DNA methylation in embryogenesis. In contrast, EHMT2 regulates DNA methylation at specific sequences that include CpG-rich promoters of germline-specific genes. These loci are bound by EHMT2 in embryonic cells, are marked by H3K9 dimethylation, and have strongly reduced DNA methylation in Ehmt2−/− embryos. EHMT2 also plays a role in the maintenance of germline-derived DNA methylation at one imprinted locus, the Slc38a4 gene. Finally, we show that DNA methylation is instrumental for EHMT2-mediated gene silencing in embryogenesis. Our findings identify EHMT2 as a critical factor that facilitates repressive DNA methylation at specific genomic loci during mammalian development. PMID:26576615

Ancient microbes from halite fluid inclusions: optimized surface sterilization and DNA extraction.

PubMed

Sankaranarayanan, Krithivasan; Timofeeff, Michael N; Spathis, Rita; Lowenstein, Tim K; Lum, J Koji

2011-01-01

Fluid inclusions in evaporite minerals (halite, gypsum, etc.) potentially preserve genetic records of microbial diversity and changing environmental conditions of Earth's hydrosphere for nearly one billion years. Here we describe a robust protocol for surface sterilization and retrieval of DNA from fluid inclusions in halite that, unlike previously published methods, guarantees removal of potentially contaminating surface-bound DNA. The protocol involves microscopic visualization of cell structures, deliberate surface contamination followed by surface sterilization with acid and bleach washes, and DNA extraction using Amicon centrifugal filters. Methods were verified on halite crystals of four different ages from Saline Valley, California (modern, 36 ka, 64 ka, and 150 ka), with retrieval of algal and archaeal DNA, and characterization of the algal community using ITS1 sequences. The protocol we developed opens up new avenues for study of ancient microbial ecosystems in fluid inclusions, understanding microbial evolution across geological time, and investigating the antiquity of life on earth and other parts of the solar system.

Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets.

PubMed

Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard

2007-10-30

We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 x 10(8) bound targets per cm(2) sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format.

Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets

PubMed Central

Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard

2007-01-01

We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 × 108 bound targets per cm2 sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format. PMID:17951434

Minor groove binding of a bis-quaternary ammonium compound: the crystal structure of SN 7167 bound to d(CGCGAATTCGCG)2.

PubMed Central

Squire, C J; Clark, G R; Denny, W A

1997-01-01

The X-ray crystal structure of the complex between the synthetic antitumour and antiviral DNA binding ligand SN 7167 and the DNA oligonucleotide d(CGCGAATTCGCG)2 has been determined to an R factor of 18.3% at 2.6 A resolution. The ligand is located within the minor groove and covers almost 6 bp with the 1-methylpyridinium ring extending as far as the C9-G16 base pair and the 1-methylquinolinium ring lying between the G4-C21 and A5-T20 base pairs. The ligand interacts only weakly with the DNA, as evidenced by long range contacts and shallow penetration into the groove. This structure is compared with that of the complex between the parent compound SN 6999 and the alkylated DNA sequence d(CGC[e6G]AATTCGCG)2. There are significant differences between the two structures in the extent of DNA bending, ligand conformation and groove binding. PMID:9321660

Binding of radiation-induced phenylalanine radicals to DNA: influence on the biological activity of the DNA and on its sensitivity to the induction of breaks by gamma rays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vanderschans, G.P.; Vanrijn, C.J.S.; Bleichrodt, J.F.

1975-11-01

When an aqueous solution of double-stranded deoxyribonucleic acid (DNA) of bacteriophage PM2 containing phenylalanine and saturated with N2O is irradiated with gamma rays, radiation induced phenylalanine radicals are bound covalently. Under the conditions used about 25 phenylalanine molecules may be bound per lethal hit. Also for single-stranded PM2 DNA most of the phenylalanine radicals bound are nonlethal. Evidence is presented that in double-stranded DNA an appreciable fraction of the single-strand breaks is induced by phenylalanine radicals. Radiation products of phenylalanine and the phenylalanine bound to the DNA decrease the sensitivity of the DNA to the induction of single-strand breaks. Theremore » are indications that the high efficiency of protection by radiation products of phenylalanine is due to their positive charge, which will result in a relatively high concentration of these compounds in the vicinity of the negatively charged DNA molecules. (Author) (GRA)« less

Mechanisms of radiation-induced gene responses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Woloschak, G.E.; Paunesku, T.

1996-10-01

In the process of identifying genes differentially expressed in cells exposed ultraviolet radiation, we have identified a transcript having a 26-bp region that is highly conserved in a variety of species including Bacillus circulans, yeast, pumpkin, Drosophila, mouse, and man. When the 5` region (flanking region or UTR) of a gene, the sequence is predominantly in +/+ orientation with respect to the coding DNA strand; while in the coding region and the 3` region (UTR), the sequence is most frequently in the +/-orientation with respect to the coding DNA strand. In two genes, the element is split into two parts;more » however, in most cases, it is found only once but with a minimum of 11 consecutive nucleotides precisely depicting the original sequence. The element is found in a large number of different genes with diverse functions (from human ras p21 to B. circulans chitonase). Gel shift assays demonstrated the presence of a protein in HeLa cell extracts that binds to the sense and antisense single-stranded consensus oligomers, as well as to the double- stranded oligonucleotide. When double-stranded oligomer was used, the size shift demonstrated as additional protein-oligomer complex larger than the one bound to either sense or antisense single-stranded consensus oligomers alone. It is speculated either that this element binds to protein(s) important in maintaining DNA is a single-stranded orientation for transcription or, alternatively that this element is important in the transcription-coupled DNA repair process.« less

New CRISPR-Cas systems from uncultivated microbes

NASA Astrophysics Data System (ADS)

Burstein, David; Harrington, Lucas B.; Strutt, Steven C.; Probst, Alexander J.; Anantharaman, Karthik; Thomas, Brian C.; Doudna, Jennifer A.; Banfield, Jillian F.

2017-02-01

CRISPR-Cas systems provide microbes with adaptive immunity by employing short DNA sequences, termed spacers, that guide Cas proteins to cleave foreign DNA. Class 2 CRISPR-Cas systems are streamlined versions, in which a single RNA-bound Cas protein recognizes and cleaves target sequences. The programmable nature of these minimal systems has enabled researchers to repurpose them into a versatile technology that is broadly revolutionizing biological and clinical research. However, current CRISPR-Cas technologies are based solely on systems from isolated bacteria, leaving the vast majority of enzymes from organisms that have not been cultured untapped. Metagenomics, the sequencing of DNA extracted directly from natural microbial communities, provides access to the genetic material of a huge array of uncultivated organisms. Here, using genome-resolved metagenomics, we identify a number of CRISPR-Cas systems, including the first reported Cas9 in the archaeal domain of life, to our knowledge. This divergent Cas9 protein was found in little-studied nanoarchaea as part of an active CRISPR-Cas system. In bacteria, we discovered two previously unknown systems, CRISPR-CasX and CRISPR-CasY, which are among the most compact systems yet discovered. Notably, all required functional components were identified by metagenomics, enabling validation of robust in vivo RNA-guided DNA interference activity in Escherichia coli. Interrogation of environmental microbial communities combined with in vivo experiments allows us to access an unprecedented diversity of genomes, the content of which will expand the repertoire of microbe-based biotechnologies.

DNA-binding by Haemophilus influenzae and Escherichia coli YbaB, members of a widely-distributed bacterial protein family.

PubMed

Cooley, Anne E; Riley, Sean P; Kral, Keith; Miller, M Clarke; DeMoll, Edward; Fried, Michael G; Stevenson, Brian

2009-07-13

Genes orthologous to the ybaB loci of Escherichia coli and Haemophilus influenzae are widely distributed among eubacteria. Several years ago, the three-dimensional structures of the YbaB orthologs of both E. coli and H. influenzae were determined, revealing a novel "tweezer"-like structure. However, a function for YbaB had remained elusive, with an early study of the H. influenzae ortholog failing to detect DNA-binding activity. Our group recently determined that the Borrelia burgdorferi YbaB ortholog, EbfC, is a DNA-binding protein. To reconcile those results, we assessed the abilities of both the H. influenzae and E. coli YbaB proteins to bind DNA to which B. burgdorferi EbfC can bind. Both the H. influenzae and the E. coli YbaB proteins bound to tested DNAs. DNA-binding was not well competed with poly-dI-dC, indicating some sequence preferences for those two proteins. Analyses of binding characteristics determined that both YbaB orthologs bind as homodimers. Different DNA sequence preferences were observed between H. influenzae YbaB, E. coli YbaB and B. burgdorferi EbfC, consistent with amino acid differences in the putative DNA-binding domains of these proteins. Three distinct members of the YbaB/EbfC bacterial protein family have now been demonstrated to bind DNA. Members of this protein family are encoded by a broad range of bacteria, including many pathogenic species, and results of our studies suggest that all such proteins have DNA-binding activities. The functions of YbaB/EbfC family members in each bacterial species are as-yet unknown, but given the ubiquity of these DNA-binding proteins among Eubacteria, further investigations are warranted.

PNA binding to the non-template DNA strand interferes with transcription, suggesting a blockage mechanism mediated by R-loop formation.

PubMed

Belotserkovskii, Boris P; Hanawalt, Philip C

2015-11-01

Peptide Nucleic Acids (PNAs) are artificial DNA mimics with superior nucleic acid binding capabilities. T7 RNA polymerase (T7 RNAP) transcription upon encountering PNA bound to the non-template DNA strand was studied in vitro. A characteristic pattern of blockage signals was observed, extending downstream from the PNA binding site, similar to that produced by G-rich homopurine-homopyrimidine (hPu-hPy) sequences and likely caused by R-loop formation. Since blocked transcription complexes in association with stable R-loops may interfere with replication and in some cases trigger apoptosis, targeted R-loop formation might be employed to inactivate selected cells, such as those in tumors, based upon their unique complement of expressed genes. © 2014 The Authors. Molecular Carcinogenesis published by Wiley Periodicals, Inc.

SNaPshot and StripAssay as Valuable Alternatives to Direct Sequencing for KRAS Mutation Detection in Colon Cancer Routine Diagnostics

PubMed Central

Fariña Sarasqueta, Arantza; Moerland, Elna; de Bruyne, Hanneke; de Graaf, Henk; Vrancken, Tamara; van Lijnschoten, Gesina; van den Brule, Adriaan J.C.

2011-01-01

Although direct sequencing is the gold standard for KRAS mutation detection in routine diagnostics, it remains laborious, time consuming, and not very sensitive. Our objective was to evaluate SNaPshot and the KRAS StripAssay as alternatives to sequencing for KRAS mutation detection in daily practice. KRAS exon 2–specific PCR followed by sequencing or by a SNaPshot reaction was performed. For the StripAssay, a mutant-enriched PCR was followed by hybridization to KRAS-specific probes bound to a nitrocellulose strip. To test sensitivities, dilution series of mutated DNA in wild-type DNA were made. Additionally, direct sequencing and SNaPshot were evaluated in 296 colon cancer samples. Detection limits of direct sequencing, SNaPshot, and StripAssay were 20%, 10%, and 1% tumor cells, respectively. Direct sequencing and SNaPshot can detect all 12 mutations in KRAS codons 12 and 13, whereas the StripAssay detects 10 of the most frequent ones. Workload and time to results are comparable for SNaPshot and direct sequencing. SNaPshot is flexible and easy to multiplex. The StripAssay is less time consuming for daily laboratory practice. SNaPshot is more flexible and slightly more sensitive than direct sequencing. The clinical evaluation showed comparable performances between direct sequencing and SNaPshot. The StripAssay is rapid and an extremely sensitive assay that could be considered when few tumor cells are available. However, found mutants should be confirmed to avoid risk of false positives. PMID:21354055

Mechanism for verification of mismatched and homoduplex DNAs by nucleotides-bound MutS analyzed by molecular dynamics simulations.

PubMed

Ishida, Hisashi; Matsumoto, Atsushi

2016-09-01

In order to understand how MutS recognizes mismatched DNA and induces the reaction of DNA repair using ATP, the dynamics of the complexes of MutS (bound to the ADP and ATP nucleotides, or not) and DNA (with mismatched and matched base-pairs) were investigated using molecular dynamics simulations. As for DNA, the structure of the base-pairs of the homoduplex DNA which interacted with the DNA recognition site of MutS was intermittently disturbed, indicating that the homoduplex DNA was unstable. As for MutS, the disordered loops in the ATPase domains, which are considered to be necessary for the induction of DNA repair, were close to (away from) the nucleotide-binding sites in the ATPase domains when the nucleotides were (not) bound to MutS. This indicates that the ATPase domains changed their structural stability upon ATP binding using the disordered loop. Conformational analysis by principal component analysis showed that the nucleotide binding changed modes which have structurally solid ATPase domains and the large bending motion of the DNA from higher to lower frequencies. In the MutS-mismatched DNA complex bound to two nucleotides, the bending motion of the DNA at low frequency modes may play a role in triggering the formation of the sliding clamp for the following DNA-repair reaction step. Moreover, MM-PBSA/GBSA showed that the MutS-homoduplex DNA complex bound to two nucleotides was unstable because of the unfavorable interactions between MutS and DNA. This would trigger the ATP hydrolysis or separation of MutS and DNA to continue searching for mismatch base-pairs. Proteins 2016; 84:1287-1303. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts.

PubMed

Hopton, Suzanne R; Thompson, Andrew S

2011-05-17

Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.

Secondary binding sites for heavily modified triplex forming oligonucleotides

PubMed Central

Cardew, Antonia S.; Brown, Tom; Fox, Keith R.

2012-01-01

In order to enhance DNA triple helix stability synthetic oligonucleotides have been developed that bear amino groups on the sugar or base. One of the most effective of these is bis-amino-U (B), which possesses 5-propargylamino and 2′-aminoethoxy modifications. Inclusion of this modified nucleotide not only greatly enhances triplex stability, but also increases the affinity for related sequences. We have used a restriction enzyme protection, selection and amplification assay (REPSA) to isolate sequences that are bound by the heavily modified 9-mer triplex-forming oligonucleotide B6CBT. The isolated sequences contain An tracts (n = 6), suggesting that the 5′-end of this TFO was responsible for successful triplex formation. DNase I footprinting with these sequences confirmed triple helix formation at these secondary targets and demonstrated no interaction with similar oligonucleotides containing T or 5-propargylamino-dU. PMID:22180535

Protein sequences bound to mineral surfaces persist into deep time

PubMed Central

Demarchi, Beatrice; Hall, Shaun; Roncal-Herrero, Teresa; Freeman, Colin L; Woolley, Jos; Crisp, Molly K; Wilson, Julie; Fotakis, Anna; Fischer, Roman; Kessler, Benedikt M; Rakownikow Jersie-Christensen, Rosa; Olsen, Jesper V; Haile, James; Thomas, Jessica; Marean, Curtis W; Parkington, John; Presslee, Samantha; Lee-Thorp, Julia; Ditchfield, Peter; Hamilton, Jacqueline F; Ward, Martyn W; Wang, Chunting Michelle; Shaw, Marvin D; Harrison, Terry; Domínguez-Rodrigo, Manuel; MacPhee, Ross DE; Kwekason, Amandus; Ecker, Michaela; Kolska Horwitz, Liora; Chazan, Michael; Kröger, Roland; Thomas-Oates, Jane; Harding, John H; Cappellini, Enrico; Penkman, Kirsty; Collins, Matthew J

2016-01-01

Proteins persist longer in the fossil record than DNA, but the longevity, survival mechanisms and substrates remain contested. Here, we demonstrate the role of mineral binding in preserving the protein sequence in ostrich (Struthionidae) eggshell, including from the palaeontological sites of Laetoli (3.8 Ma) and Olduvai Gorge (1.3 Ma) in Tanzania. By tracking protein diagenesis back in time we find consistent patterns of preservation, demonstrating authenticity of the surviving sequences. Molecular dynamics simulations of struthiocalcin-1 and -2, the dominant proteins within the eggshell, reveal that distinct domains bind to the mineral surface. It is the domain with the strongest calculated binding energy to the calcite surface that is selectively preserved. Thermal age calculations demonstrate that the Laetoli and Olduvai peptides are 50 times older than any previously authenticated sequence (equivalent to ~16 Ma at a constant 10°C). DOI: http://dx.doi.org/10.7554/eLife.17092.001 PMID:27668515

A conserved motif in the linker domain of STAT1 transcription factor is required for both recognition and release from high-affinity DNA-binding sites.

PubMed

Hüntelmann, Bettina; Staab, Julia; Herrmann-Lingen, Christoph; Meyer, Thomas

2014-01-01

Binding to specific palindromic sequences termed gamma-activated sites (GAS) is a hallmark of gene activation by members of the STAT (signal transducer and activator of transcription) family of cytokine-inducible transcription factors. However, the precise molecular mechanisms involved in the signal-dependent finding of target genes by STAT dimers have not yet been very well studied. In this study, we have characterized a sequence motif in the STAT1 linker domain which is highly conserved among the seven human STAT proteins and includes surface-exposed residues in close proximity to the bound DNA. Using site-directed mutagenesis, we have demonstrated that a lysine residue in position 567 of the full-length molecule is required for GAS recognition. The substitution of alanine for this residue completely abolished both binding to high-affinity GAS elements and transcriptional activation of endogenous target genes in cells stimulated with interferon-γ (IFNγ), while the time course of transient nuclear accumulation and tyrosine phosphorylation were virtually unchanged. In contrast, two glutamic acid residues (E559 and E563) on each monomer are important for the dissociation of dimeric STAT1 from DNA and, when mutated to alanine, result in elevated levels of tyrosine-phosphorylated STAT1 as well as prolonged IFNγ-stimulated nuclear accumulation. In conclusion, our data indicate that the kinetics of signal-dependent GAS binding is determined by an array of glutamic acid residues located at the interior surface of the STAT1 dimer. These negatively charged residues appear to align the long axis of the STAT1 dimer in a position perpendicular to the DNA, thereby facilitating the interaction between lysine 567 and the phosphodiester backbone of a bound GAS element, which is a prerequisite for transient gene induction.

Is DNA a worm-like chain in Couette flow? In search of persistence length, a critical review.

PubMed

Rittman, Martyn; Gilroy, Emma; Koohya, Hashem; Rodger, Alison; Richards, Adair

2009-01-01

Persistence length is the foremost measure of DNA flexibility. Its origins lie in polymer theory which was adapted for DNA following the determination of BDNA structure in 1953. There is no single definition of persistence length used, and the links between published definitions are based on assumptions which may, or may not be, clearly stated. DNA flexibility is affected by local ionic strength, solvent environment, bound ligands and intrinsic sequence-dependent flexibility. This article is a review of persistence length providing a mathematical treatment of the relationships between four definitions of persistence length, including: correlation, Kuhn length, bending, and curvature. Persistence length has been measured using various microscopy, force extension and solution methods such as linear dichroism and transient electric birefringence. For each experimental method a model of DNA is required to interpret the data. The importance of understanding the underlying models, along with the assumptions required by each definition to determine a value of persistence length, is highlighted for linear dichroism data, where it transpires that no model is currently available for long DNA or medium to high shear rate experiments.

The NS1 polypeptide of the murine parvovirus minute virus of mice binds to DNA sequences containing the motif [ACCA]2-3.

PubMed Central

Cotmore, S F; Christensen, J; Nüesch, J P; Tattersall, P

1995-01-01

A DNA fragment containing the minute virus of mice 3' replication origin was specifically coprecipitated in immune complexes containing the virally coded NS1, but not the NS2, polypeptide. Antibodies directed against the amino- or carboxy-terminal regions of NS1 precipitated the NS1-origin complexes, but antibodies directed against NS1 amino acids 284 to 459 blocked complex formation. Using affinity-purified histidine-tagged NS1 preparations, we have shown that the specific protein-DNA interaction is of moderate affinity, being stable in 0.1 M salt but rapidly lost at higher salt concentrations. In contrast, generalized (or nonspecific) DNA binding by NS1 could be demonstrated only in low salt. Addition of ATP or gamma S-ATP enhanced specific DNA binding by wild-type NS1 severalfold, but binding was lost under conditions which favored ATP hydrolysis. NS1 molecules with mutations in a critical lysine residue (amino acid 405) in the consensus ATP-binding site bound to the origin, but this binding could not be enhanced by ATP addition. DNase I protection assays carried out with wild-type NS1 in the presence of gamma S-ATP gave footprints which extended over 43 nucleotides on both DNA strands, from the middle of the origin bubble sequence to a position some 14 bp beyond the nick site. The DNA-binding site for NS1 was mapped to a 22-bp fragment from the middle of the 3' replication origin which contains the sequence ACCAACCA. This conforms to a reiterated motif (ACCA)2-3, which occurs, in more or less degenerate form, at many sites throughout the minute virus of mice genome (J. W. Bodner, Virus Genes 2:167-182, 1989). Insertion of a single copy of the sequence (ACCA)3 was shown to be sufficient to confer NS1 binding on an otherwise unrecognized plasmid fragment. The functions of NS1 in the viral life cycle are reevaluated in the light of this result. PMID:7853501

The NS1 polypeptide of the murine parvovirus minute virus of mice binds to DNA sequences containing the motif [ACCA]2-3.

PubMed

Cotmore, S F; Christensen, J; Nüesch, J P; Tattersall, P

1995-03-01

A DNA fragment containing the minute virus of mice 3' replication origin was specifically coprecipitated in immune complexes containing the virally coded NS1, but not the NS2, polypeptide. Antibodies directed against the amino- or carboxy-terminal regions of NS1 precipitated the NS1-origin complexes, but antibodies directed against NS1 amino acids 284 to 459 blocked complex formation. Using affinity-purified histidine-tagged NS1 preparations, we have shown that the specific protein-DNA interaction is of moderate affinity, being stable in 0.1 M salt but rapidly lost at higher salt concentrations. In contrast, generalized (or nonspecific) DNA binding by NS1 could be demonstrated only in low salt. Addition of ATP or gamma S-ATP enhanced specific DNA binding by wild-type NS1 severalfold, but binding was lost under conditions which favored ATP hydrolysis. NS1 molecules with mutations in a critical lysine residue (amino acid 405) in the consensus ATP-binding site bound to the origin, but this binding could not be enhanced by ATP addition. DNase I protection assays carried out with wild-type NS1 in the presence of gamma S-ATP gave footprints which extended over 43 nucleotides on both DNA strands, from the middle of the origin bubble sequence to a position some 14 bp beyond the nick site. The DNA-binding site for NS1 was mapped to a 22-bp fragment from the middle of the 3' replication origin which contains the sequence ACCAACCA. This conforms to a reiterated motif (ACCA)2-3, which occurs, in more or less degenerate form, at many sites throughout the minute virus of mice genome (J. W. Bodner, Virus Genes 2:167-182, 1989). Insertion of a single copy of the sequence (ACCA)3 was shown to be sufficient to confer NS1 binding on an otherwise unrecognized plasmid fragment. The functions of NS1 in the viral life cycle are reevaluated in the light of this result.

Spatial Organization of the Core Region of Yeast TFIIIB-DNA Complexes

PubMed Central

Persinger, Jim; Sengupta, Sarojini M.; Bartholomew, Blaine

1999-01-01

The interaction of yeast TFIIIB with the region upstream of the SUP4 tRNATyr gene was extensively probed by use of photoreactive phosphodiesters, deoxyuridines, and deoxycytidines that are site specifically incorporated into DNA. The TATA binding protein (TBP) was found to be in close proximity to the minor groove of a TATA-like DNA sequence that starts 30 nucleotides upstream of the start site of transcription. TBP was cross-linked to the phosphate backbone of DNA from bp −30 to −20 in the nontranscribed strand and from bp −28 to −24 in the transcribed strand (+1 denotes the start site of transcription). Most of the major groove of DNA in this region was shown not to be in close proximity to TBP, thus resembling the binding of TBP to the TATA box, with one notable exception. TBP was shown to interact with the major groove of DNA primarily at bp −23 and to a lesser degree at bp −25 in the transcribed strand. The stable interaction of TBP with the major groove at bp −23 was shown to require the B" subunit of TFIIIB. The S4 helix and flanking region of TBP were shown to be proximal to the major groove of DNA by peptide mapping of the region of TBP cross-linked at bp −23. Thus, TBP in the TFIIIB-SUP4 gene promoter region is bound in the same direction as TBP bound to the TATA box with respect to the transcription start site. The B" and TFIIB-related factor (BRF) subunits of TFIIIB are positioned on opposite sides of the TBP-DNA core of the TFIIIB complex, as indicated by correlation of cross-linking data to the crystal structure of the TBP-TATA box complex. Evidence is given for BRF binding near the C-terminal stirrup of TBP, similar to that of TFIIB near the TBP-TATA box complex. The protein clamp formed around the TBP-DNA complex by BRF and B" would help explain the long half-life of the TFIIIB-DNA complex and its resistance to polyanions and high salt. The path of DNA traversing the surface of TBP at the 3′ end of the TATA-like element in the SUP4 tRNA gene is not the same as that of TBP bound to a TATA box element, as shown by the cross-linking of TBP at bp −23. PMID:10373570

PARACEST Properties of a Dinuclear Neodymium(III) Complex Bound to DNA or Carbonate

PubMed Central

Nwe, Kido; Andolina, Christopher M.; Huang, Ching-Hui; Morrow, Janet R.

2009-01-01

A dinuclear Nd(III) macrocyclic complex of 1 (1,4-bis[1-(4,7,10-tris(carbamoylmethyl)-1,4,7,10-tetraazacyclododecane]-p-xylene) and mononuclear complexes of 1,4,7-tris-1,4,7,10-tetraazacyclododecane 2, and 1,4,7-tris[(N-N-diethyl)carbamoylmethyl]-1,4,7,10-tetraazacyclododecane, 3, are prepared. Complexes of 1 and 2 give rise to a PARACEST (paramagnetic chemical exchange saturation transfer) peak from exchangeable amide protons that resonate approximately 12 ppm downfield from the bulk water proton resonance. The dinuclear Nd(III) complex is promising as a PARACEST contrast agent for MRI applications because it has an optimal pH of 7.5 and the rate constant for amide proton exchange (2700 s−1) is nearly as large as it can be within slow exchange conditions with bulk water. Dinuclear Ln2(1) complexes (Ln(III) = Nd(III), Eu(III)) bind tightly to anionic ligands including carbonate, diethylphosphate and DNA. The CEST amide peak of Nd2(1) is enhanced by certain DNA sequences that contain hairpin loops, but decreases in the presence of diethyl phosphate or carbonate. Direct excitation luminescence studies of Eu2(1) show that double-stranded and hairpin loop DNA sequences displace one water ligand on each Eu(III) center. DNA displaces carbonate ion despite the low dissociation constant for the Eu2(1) carbonate complex (Kd = 15 µM). Enhancement of the CEST effect of a lanthanide complex by binding to DNA is a promising step toward the preparation of PARACEST agents containing DNA scaffolds. PMID:19555071

PARACEST properties of a dinuclear neodymium(III) complex bound to DNA or carbonate.

PubMed

Nwe, Kido; Andolina, Christopher M; Huang, Ching-Hui; Morrow, Janet R

2009-07-01

A dinuclear Nd(III) macrocyclic complex of 1 (1,4-bis[1-(4,7,10-tris(carbamoylmethyl)-1,4,7,10-tetraazacyclododecane]-p-xylene) and mononuclear complexes of 1,4,7-tris-1,4,7,10-tetraazacyclododecane, 2, and 1,4,7-tris[(N-N-diethyl)carbamoylmethyl]-1,4,7,10-tetraazacyclododecane, 3, are prepared. Complexes of 1 and 2 give rise to a PARACEST (paramagnetic chemical exchange saturation transfer) peak from exchangeable amide protons that resonate approximately 12 ppm downfield from the bulk water proton resonance. The dinuclear Nd(III) complex is promising as a PARACEST contrast agent for MRI applications, because it has an optimal pH of 7.5 and the rate constant for amide proton exchange (2700 s(-1)) is nearly as large as it can be within slow exchange conditions with bulk water. Dinuclear Ln(2)(1) complexes (Ln(III) = Nd(III), Eu(III)) bind tightly to anionic ligands including carbonate, diethyl phosphate, and DNA. The CEST amide peak of Nd(2)(1) is enhanced by certain DNA sequences that contain hairpin loops, but decreases in the presence of diethyl phosphate or carbonate. Direct excitation luminescence studies of Eu(2)(1) show that double-stranded and hairpin-loop DNA sequences displace one water ligand on each Eu(III) center. DNA displaces carbonate ion despite the low dissociation constant for the Eu(2)(1) carbonate complex (K(d) = 15 microM). Enhancement of the CEST effect of a lanthanide complex by binding to DNA is a promising step toward the preparation of PARACEST agents containing DNA scaffolds.

An aptamer-based bio-barcode assay with isothermal recombinase polymerase amplification for cytochrome-c detection and anti-cancer drug screening.

PubMed

Loo, Jacky F C; Lau, P M; Ho, H P; Kong, S K

2013-10-15

Based on a recently reported ultra-sensitive bio-barcode (BBC) assay, we have developed an aptamer-based bio-barcode (ABC) alternative to detect a cell death marker cytochrome-c (Cyto-c) and its subsequent application to screen anti-cancer drugs. Aptamer is a short single-stranded DNA selected from a synthetic DNA library by virtue of its high binding affinity and specificity to its target based on its unique 3D structure from the nucleotide sequence after folding. In the BBC assay, an antigen (Ag) in analytes is captured by a micro-magnetic particle (MMP) coated with capturing antibodies (Abs). Gold nanoparticles (NPs) with another recognition Ab against the same target and hundreds of identical DNA molecules of known sequence are subsequently added to allow the formation of sandwich structures ([MMP-Ab1]-Ag-[Ab2-NP-DNA]). After isolating the sandwiches by a magnetic field, the DNAs hybridized to their complementary DNAs covalently bound on the NPs are released from the sandwiches after heating. Acting as an Ag identification tag, these bio-barcode DNAs with known DNA sequence are then amplified by polymerase chain reaction (PCR) and detected by fluorescence. In our ABC assay, we employed a Cyto-c-specific aptamer to substitute both the recognition Ab and barcode DNAs on the NPs in the BBC assay; and a novel isothermal recombinase polymerase amplification for the time-consuming PCR. The detection limit of our ABC assay for the Cyto-c was found to be 10 ng/mL and this new assay can be completed within 3h. Several potential anti-cancer drugs have been tested in vitro for their efficacy to kill liver cancer with or without multi-drug resistance. © 2013 Elsevier B.V. All rights reserved.

Increased expression of Aspergillus parasiticus aflR, encoding a sequence-specific DNA-binding protein, relieves nitrate inhibition of aflatoxin biosynthesis.

PubMed Central

Chang, P K; Ehrlich, K C; Yu, J; Bhatnagar, D; Cleveland, T E

1995-01-01

The aflR gene from Aspergillus parasiticus and Aspergillus flavus may be involved in the regulation of aflatoxin biosynthesis. The aflR gene product, AFLR, possesses a GAL4-type binuclear zinc finger DNA-binding domain. A transformant, SU1-N3 (pHSP), containing an additional copy of aflR, showed increased transcription of aflR and the aflatoxin pathway structural genes, nor-1, ver-1, and omt-1, when cells were grown in nitrate medium, which normally suppresses aflatoxin production. Electrophoretic mobility shift assays showed that the recombinant protein containing the DNA-binding domain, AFLR1, bound specifically to the palindromic sequence, TTAGGCCTAA, 120 bp upstream of the AFLR translation start site. Expression of aflR thus appears to be autoregulated. Increased expression of aflatoxin biosynthetic genes in the transformant might result from an elevated basal level of AFLR, allowing it to overcome nitrate inhibition and to bind to the aflR promotor region, thereby initiating aflatoxin biosynthesis. Results further suggest that aflR is involved in the regulation of multiple parts of the aflatoxin biosynthetic pathway. PMID:7793958

Protein and gene structure of a blue laccase from Pleurotus ostreatus1.

PubMed Central

Giardina, P; Palmieri, G; Scaloni, A; Fontanella, B; Faraco, V; Cennamo, G; Sannia, G

1999-01-01

A new laccase isoenzyme (POXA1b, where POX is phenol oxidase), produced by Pleurotus ostreatus in cultures supplemented with copper sulphate, has been purified and fully characterized. The main characteristics of this protein (molecular mass in native and denaturing conditions, pI and catalytic properties) are almost identical to the previously studied laccase POXA1w. However, POXA1b contains four copper atoms per molecule instead of one copper, two zinc and one iron atom per molecule of POXA1w. Furthermore, POXA1b shows an unusually high stability at alkaline pH. The gene and cDNA coding for POXA1b have been cloned and sequenced. The gene coding sequence contains 1599 bp, interrupted by 15 introns. Comparison of the structure of the poxa1b gene with the two previously studied P. ostreatus laccase genes (pox1 and poxc) suggests that these genes belong to two different subfamilies. The amino acid sequence of POXA1b deduced from the cDNA sequence has been almost completely verified by means of matrix-assisted laser desorption ionization MS. It has been demonstrated that three out of six putative glycosylation sites are post-translationally modified and the structure of the bound glycosidic moieties has been determined, whereas two other putative glycosylation sites are unmodified. PMID:10417329

Single DNA molecules on freestanding and supported cationic lipid bilayers: diverse conformational dynamics controlled by the local bilayer properties

NASA Astrophysics Data System (ADS)

Herold, Christoph; Schwille, Petra; Petrov, Eugene P.

2016-02-01

We present experimental results on the interaction of DNA macromolecules with cationic lipid membranes with different properties, including freestanding membranes in the fluid and gel state, and supported lipid membranes in the fluid state and under conditions of fluid-gel phase coexistence. We observe diverse conformational dynamics of membrane-bound DNA molecules controlled by the local properties of the lipid bilayer. In case of fluid-state freestanding lipid membranes, the behaviour of DNA on the membrane is controlled by the membrane charge density: whereas DNA bound to weakly charged membranes predominantly behaves as a 2D random coil, an increase in the membrane charge density leads to membrane-driven irreversible DNA collapse and formation of subresolution-sized DNA globules. On the other hand, electrostatic binding of DNA macromolecules to gel-state freestanding membranes leads to completely arrested diffusion and conformational dynamics of membrane-adsorbed DNA. A drastically different picture is observed in case of DNA interaction with supported cationic lipid bilayers: When the supported bilayer is in the fluid state, membrane-bound DNA molecules undergo 2D translational Brownian motion and conformational fluctuations, irrespectively of the charge density of the supported bilayer. At the same time, when the supported cationic membrane shows fluid-gel phase coexistence, membrane-bound DNA molecules are strongly attracted to micrometre-sized gel-phase domains enriched with the cationic lipid, which results in 2D compaction of the membrane-bound macromolecules. This DNA compaction, however, is fully reversible, and disappears as soon as the membrane is heated above the fluid-gel coexistence. We also discuss possible biological implications of our experimental findings.

Unusually Strong Binding to the DNA Minor Groove by a Highly Twisted Benzimidazole-Diphenylether: Induced Fit and Bound Water†

PubMed Central

Tanious, Farial A.; Laine, William; Peixoto, Paul; Bailly, Christian; Goodwin, Kristie D.; Lewis, Mark A.; Long, Eric C.; Georgiadis, Millie M.; Tidwell, Richard R.; Wilson, W. David

2008-01-01

RT29 is a dicationic diamidine derivative that does not obey the classical “rules” for shape and functional group placement that are expected to result in strong binding and specific recognition of the DNA minor groove. The compound contains a benzimidazole-diphenyl ether core that is flanked by the amidine cations. The diphenyl ether is highly twisted and gives the entire compound too much curvature to fit well to the shape of the minor groove. DNaseI footprinting, fluorescence intercalator displacement studies and circular dichroism spectra, however, indicate that the compound is an AT specific minor groove binding agent. Even more surprisingly, quantitative biosensor-surface plasmon resonance and isothermal titration calorimetric results indicate that the compound binds with exceptional strength to certain AT sequences in DNA with a large negative enthalpy of binding. Crystallographic results for the DNA complex of RT29 compared to calculated results for the free compound show that the compound undergoes significant conformational changes to enhance its minor groove interactions. In addition, a water molecule is incorporated directly into the complex to complete the compound-DNA interface and it forms an essential link between the compound and base pair edges at the floor of the minor groove. The calculated ΔCp value for complex formation is substantially less than the experimentally observed value in support of water being an intrinsic part of the complex with a major contribution to the ΔCp value. Both the induced fit conformational changes of the compound and the bound water are essential for strong binding to DNA by RT29. PMID:17506529

Automated hybridization/imaging device for fluorescent multiplex DNA sequencing

DOEpatents

Weiss, R.B.; Kimball, A.W.; Gesteland, R.F.; Ferguson, F.M.; Dunn, D.M.; Di Sera, L.J.; Cherry, J.L.

1995-11-28

A method is disclosed for automated multiplex sequencing of DNA with an integrated automated imaging hybridization chamber system. This system comprises an hybridization chamber device for mounting a membrane containing size-fractionated multiplex sequencing reaction products, apparatus for fluid delivery to the chamber device, imaging apparatus for light delivery to the membrane and image recording of fluorescence emanating from the membrane while in the chamber device, and programmable controller apparatus for controlling operation of the system. The multiplex reaction products are hybridized with a probe, the enzyme (such as alkaline phosphatase) is bound to a binding moiety on the probe, and a fluorogenic substrate (such as a benzothiazole derivative) is introduced into the chamber device by the fluid delivery apparatus. The enzyme converts the fluorogenic substrate into a fluorescent product which, when illuminated in the chamber device with a beam of light from the imaging apparatus, excites fluorescence of the fluorescent product to produce a pattern of hybridization. The pattern of hybridization is imaged by a CCD camera component of the imaging apparatus to obtain a series of digital signals. These signals are converted by the controller apparatus into a string of nucleotides corresponding to the nucleotide sequence an automated sequence reader. The method and apparatus are also applicable to other membrane-based applications such as colony and plaque hybridization and Southern, Northern, and Western blots. 9 figs.

Automated hybridization/imaging device for fluorescent multiplex DNA sequencing

DOEpatents

Weiss, Robert B.; Kimball, Alvin W.; Gesteland, Raymond F.; Ferguson, F. Mark; Dunn, Diane M.; Di Sera, Leonard J.; Cherry, Joshua L.

1995-01-01

A method is disclosed for automated multiplex sequencing of DNA with an integrated automated imaging hybridization chamber system. This system comprises an hybridization chamber device for mounting a membrane containing size-fractionated multiplex sequencing reaction products, apparatus for fluid delivery to the chamber device, imaging apparatus for light delivery to the membrane and image recording of fluorescence emanating from the membrane while in the chamber device, and programmable controller apparatus for controlling operation of the system. The multiplex reaction products are hybridized with a probe, then an enzyme (such as alkaline phosphatase) is bound to a binding moiety on the probe, and a fluorogenic substrate (such as a benzothiazole derivative) is introduced into the chamber device by the fluid delivery apparatus. The enzyme converts the fluorogenic substrate into a fluorescent product which, when illuminated in the chamber device with a beam of light from the imaging apparatus, excites fluorescence of the fluorescent product to produce a pattern of hybridization. The pattern of hybridization is imaged by a CCD camera component of the imaging apparatus to obtain a series of digital signals. These signals are converted by the controller apparatus into a string of nucleotides corresponding to the nucleotide sequence an automated sequence reader. The method and apparatus are also applicable to other membrane-based applications such as colony and plaque hybridization and Southern, Northern, and Western blots.

Albumin Redhill (-1 Arg, 320 Ala yields Thr): A glycoprotein variant of human serum albumin whose precursor has an aberrant signal peptidase cleavage site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brennan, S.O.; Myles, T.; Peach, R.J.

1990-01-01

Albumin Redhill is an electrophoretically slow genetic variant of human serum albumin that does not bind {sup 63}Ni{sup 2+} and has a molecular mass 2.5 kDa higher than normal albumin. Its inability to bind Ni{sup 2+} was explained by the finding of an additional residue of Arg at position -1. This did not explain the molecular basis of the genetic variation or the increase in apparent molecular mass. Fractionation of tryptic digests on concanavalin A-Sepharose followed by peptide mapping of the bound and unbound fractions and sequence analysis of the glycopeptides identified a mutation of 320 Ala {yields} Thr. Thismore » introduces as Asn-Tyr-Thr oligosaccharide attachment sequence centered on Asn-318 and explains the increase in molecular mass. This, however, did not satisfactorily explain the presence of the additional Arg residue at position -1. DNA sequencing of polymerase chain reaction-amplified genomic DNA encoding the prepro sequence of albumin indicated an additional mutation of -2 Arg {yields} Cys. The authors propose that the new Phe-Cys-Arg sequence in the propeptide is an aberrant signal peptidase cleavage site and that the signal peptidase cleaves the propeptide of albumin Redhill in the lumen of the endoplasmic reticulum before it reaches the Golgi vesicles, the site of the diarginyl-specific proalbumin convertase.« less

In and out of the minor groove: interaction of an AT-rich DNA with the drug CD27

DOE Office of Scientific and Technical Information (OSTI.GOV)

Acosta-Reyes, Francisco J.; Dardonville, Christophe; Koning, Harry P. de

New features of an antiprotozoal DNA minor-groove binding drug, which acts as a cross-linking agent, are presented. It also fills the minor groove of DNA completely and prevents the access of proteins. These features are also expected for other minor-groove binding drugs when associated with suitable DNA targets. The DNA of several pathogens is very rich in AT base pairs. Typical examples include the malaria parasite Plasmodium falciparum and the causative agents of trichomoniasis and trypanosomiases. This fact has prompted studies of drugs which interact with the minor groove of DNA, some of which are used in medical practice. Previousmore » studies have been performed almost exclusively with the AATT sequence. New features should be uncovered through the study of different DNA sequences. In this paper, the crystal structure of the complex of the DNA duplex d(AAAATTTT){sub 2} with the dicationic drug 4, 4′-bis(imidazolinylamino)diphenylamine (CD27) is presented. The drug binds to the minor groove of DNA as expected, but it shows two new features that have not previously been described: (i) the drugs protrude from the DNA and interact with neighbouring molecules, so that they may act as cross-linking agents, and (ii) the drugs completely cover the whole minor groove of DNA and displace bound water. Thus, they may prevent the access to DNA of proteins such as AT-hook proteins. These features are also expected for other minor-groove binding drugs when associated with all-AT DNA. These findings allow a better understanding of this family of compounds and will help in the development of new, more effective drugs. New data on the biological interaction of CD27 with the causative agent of trichomoniasis, Trichomonas vaginalis, are also reported.« less

The plant G box promoter sequence activates transcription in Saccharomyces cerevisiae and is bound in vitro by a yeast activity similar to GBF, the plant G box binding factor.

PubMed Central

Donald, R G; Schindler, U; Batschauer, A; Cashmore, A R

1990-01-01

G box and I box sequences of the Arabidopsis thaliana ribulose-bisphosphate-1,5-carboxylase small subunit (RBCS) promoter are required for expression mediated by the Arabidopsis rbcS-1A promoter in transgenic tobacco plants and are bound in vitro by factors from plant nuclear extracts termed GBF and GA-1, respectively. We show here that a -390 to -60 rbcS-1A promoter fragment containing the G box and two I boxes activates transcription from a truncated iso-1-cytochrome c (CYC1) gene promoter in Saccharomyces cerevisiae. Mutagenesis of either the rbcS-1A G box or both I box sequences eliminated the expression mediated by this fragment. When polymerized, I box oligonucleotides were also capable of enhancing expression from the truncated CYC1 promoter. Single-copy G box sequences from the Arabidopsis rbcS-1A, Arabidopsis Adh and tomato rbcS-3A promoters were more potent activators and were used in mobility shift assays to identify a DNA binding activity in yeast functionally similar to GBF. In methylation interference experiments, the binding specificity of the yeast protein was indistinguishable from that obtained with plant nuclear extracts. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:2161333

Structure and dynamics of proflavine association around DNA.

PubMed

Sasikala, Wilbee D; Mukherjee, Arnab

2016-04-21

Proflavine is a small molecule that intercalates into DNA and, thereby, acts as an anticancer agent. Intercalation of proflavine is shown to be a two-step process in which the first step is believed to be the formation of a pre-intercalative outside bound state. Experimental studies so far have been unable to capture the nature of the outside bound state. However, the sub-millisecond timescale observed in fluorescence kinetic experiments is often attributed to the binding of proflavine outside of DNA. Here, we have performed molecular dynamics simulations with multiple proflavine molecules to study the structure and dynamics of the formation of the outside bound state of DNA at different ion concentrations. We observed that the timescale of the outside bound state formation is, at least, five orders of magnitude faster (in nanoseconds) than the experimentally reported timescale (sub-milliseconds) attributed to binding outside DNA. Moreover, we also observed the stacked arrangement of proflavine all around DNA, which is different from the experimentally predicted stacking arrangement perpendicular to the helical axis of DNA in the close vicinity of the phosphate groups. This study, therefore, provides insight into the molecular structure and dynamics of the pre-intercalative outside bound state and will help in understanding the overall intercalation mechanism.

Major versus minor groove DNA binding of a bisarginylporphyrin hybrid molecule: A molecular mechanics investigation

NASA Astrophysics Data System (ADS)

Gresh, Nohad; Perrée-fauvet, Martine

1999-03-01

On the basis of theoretical computations, we have recently synthesised [Perrée-Fauvet, M. and Gresh, N., Tetrahedron Lett., 36 (1995) 4227] a bisarginyl conjugate of a tricationic porphyrin (BAP), designed to target, in the major groove of DNA, the d(GGC GCC)2 sequence which is part of the primary binding site of the HIV-1 retrovirus site [Wain-Hobson, S. et al., Cell, 40 (1985) 9]. In the theoretical model, the chromophore intercalates at the central d(CpG)2 step and each of the arginyl arms targets O6/N7belonging to guanine bases flanking the intercalation site. Recent IR and UV-visible spectroscopic studies have confirmed the essential features of these theoretical predictions [Mohammadi, S. et al., Biochemistry, 37 (1998) 6165]. In the present study, we compare the energies of competing intercalation modes of BAP to several double-stranded oligonucleotides, according to whether one, two or three N- methylpyridinium rings project into the major groove. Correspondingly, three minor groove binding modes were considered, the arginyl arms now targeting N3, O2 sites belonging to the purine or pyrimidine bases flanking the intercalation site. This investigation has shown that: (i) in both the major and minor grooves, the best-bound complexes have the three N-methylpyridinium rings in the groove opposite to that of the phenyl group bearing the arginyl arms; (ii) major groove binding is preferred over minor groove binding by a significant energy (29 kcal/mol); and (iii) the best-bound sequence in the major groove is d(GGC GCC)2 with two successive guanines upstream from the intercalation. On the other hand, due to the flexibility of the arginyl arms, other GC-rich sequences have close binding energies, two of them being less stable than it by less than 8 kcal/mol. These results serve as the basis for the design of derivatives of BAP with enhanced sequence selectivities in the major groove.

Two new insulator proteins, Pita and ZIPIC, target CP190 to chromatin

PubMed Central

Maksimenko, Oksana; Bartkuhn, Marek; Stakhov, Viacheslav; Herold, Martin; Zolotarev, Nickolay; Jox, Theresa; Buxa, Melanie K.; Kirsch, Ramona; Bonchuk, Artem; Fedotova, Anna; Kyrchanova, Olga

2015-01-01

Insulators are multiprotein–DNA complexes that regulate the nuclear architecture. The Drosophila CP190 protein is a cofactor for the DNA-binding insulator proteins Su(Hw), CTCF, and BEAF-32. The fact that CP190 has been found at genomic sites devoid of either of the known insulator factors has until now been unexplained. We have identified two DNA-binding zinc-finger proteins, Pita, and a new factor named ZIPIC, that interact with CP190 in vivo and in vitro at specific interaction domains. Genomic binding sites for these proteins are clustered with CP190 as well as with CTCF and BEAF-32. Model binding sites for Pita or ZIPIC demonstrate a partial enhancer-blocking activity and protect gene expression from PRE-mediated silencing. The function of the CTCF-bound MCP insulator sequence requires binding of Pita. These results identify two new insulator proteins and emphasize the unifying function of CP190, which can be recruited by many DNA-binding insulator proteins. PMID:25342723

Accessory factors promote AlfA-dependent plasmid segregation by regulating filament nucleation, disassembly, and bundling

PubMed Central

Polka, Jessica K.; Kollman, Justin M.; Mullins, R. Dyche

2014-01-01

In bacteria, some plasmids are partitioned to daughter cells by assembly of actin-like proteins (ALPs). The best understood ALP, ParM, has a core set of biochemical properties that contributes to its function, including dynamic instability, spontaneous nucleation, and bidirectional elongation. AlfA, an ALP that pushes plasmids apart in Bacillus, relies on a different set of underlying properties to segregate DNA. AlfA elongates unidirectionally and is not dynamically unstable; its assembly and disassembly are regulated by a cofactor, AlfB. Free AlfB breaks up AlfA bundles and promotes filament turnover. However, when AlfB is bound to the centromeric DNA sequence, parN, it forms a segrosome complex that nucleates and stabilizes AlfA filaments. When reconstituted in vitro, this system creates polarized, motile comet tails that associate by antiparallel filament bundling to form bipolar, DNA-segregating spindles. PMID:24481252

Identification of antigenic regions on VP2 of African horsesickness virus serotype 3 by using phage-displayed epitope libraries.

PubMed

Bentley, L; Fehrsen, J; Jordaan, F; Huismans, H; du Plessis, D H

2000-04-01

VP2 is an outer capsid protein of African horsesickness virus (AHSV) and is recognized by serotype-discriminatory neutralizing antibodies. With the objective of locating its antigenic regions, a filamentous phage library was constructed that displayed peptides derived from the fragmentation of a cDNA copy of the gene encoding VP2. Peptides ranging in size from approximately 30 to 100 amino acids were fused with pIII, the attachment protein of the display vector, fUSE2. To ensure maximum diversity, the final library consisted of three sub-libraries. The first utilized enzymatically fragmented DNA encoding only the VP2 gene, the second included plasmid sequences, while the third included a PCR step designed to allow different peptide-encoding sequences to recombine before ligation into the vector. The resulting composite library was subjected to immunoaffinity selection with AHSV-specific polyclonal chicken IgY, polyclonal horse immunoglobulins and a monoclonal antibody (MAb) known to neutralize AHSV. Antigenic peptides were located by sequencing the DNA of phages bound by the antibodies. Most antigenic determinants capable of being mapped by this method were located in the N-terminal half of VP2. Important binding areas were mapped with high resolution by identifying the minimum overlapping areas of the selected peptides. The MAb was also used to screen a random 17-mer epitope library. Sequences that may be part of a discontinuous neutralization epitope were identified. The amino acid sequences of the antigenic regions on VP2 of serotype 3 were compared with corresponding regions on three other serotypes, revealing regions with the potential to discriminate AHSV serotypes serologically.

Characterization of a digestive carboxypeptidase from the insect pest corn earworm (Helicoverpa armigera) with novel specificity towards C-terminal glutamate residues.

PubMed

Bown, David P; Gatehouse, John A

2004-05-01

Carboxypeptidases were purified from guts of larvae of corn earworm (Helicoverpa armigera), a lepidopteran crop pest, by affinity chromatography on immobilized potato carboxypeptidase inhibitor, and characterized by N-terminal sequencing. A larval gut cDNA library was screened using probes based on these protein sequences. cDNA HaCA42 encoded a carboxypeptidase with sequence similarity to enzymes of clan MC [Barrett, A. J., Rawlings, N. D. & Woessner, J. F. (1998) Handbook of Proteolytic Enzymes. Academic Press, London.], but with a novel predicted specificity towards C-terminal acidic residues. This carboxypeptidase was expressed as a recombinant proprotein in the yeast Pichia pastoris. The expressed protein could be activated by treatment with bovine trypsin; degradation of bound pro-region, rather than cleavage of pro-region from mature protein, was the rate-limiting step in activation. Activated HaCA42 carboxypeptidase hydrolysed a synthetic substrate for glutamate carboxypeptidases (FAEE, C-terminal Glu), but did not hydrolyse substrates for carboxypeptidase A or B (FAPP or FAAK, C-terminal Phe or Lys) or methotrexate, cleaved by clan MH glutamate carboxypeptidases. The enzyme was highly specific for C-terminal glutamate in peptide substrates, with slow hydrolysis of C-terminal aspartate also observed. Glutamate carboxypeptidase activity was present in larval gut extract from H. armigera. The HaCA42 protein is the first glutamate-specific metallocarboxypeptidase from clan MC to be identified and characterized. The genome of Drosophila melanogaster contains genes encoding enzymes with similar sequences and predicted specificity, and a cDNA encoding a similar enzyme has been isolated from gut tissue in tsetse fly. We suggest that digestive carboxypeptidases with sequence similarity to the classical mammalian enzymes, but with specificity towards C-terminal glutamate, are widely distributed in insects.

Biomimetic DNA emulsions: specific, thermo-reversible and adjustable binding from a liquid-like DNA layer

NASA Astrophysics Data System (ADS)

Pontani, Lea-Laetitia; Feng, Lang; Dreyfus, Remi; Seeman, Nadrian; Chaikin, Paul; Brujic, Jasna

2013-03-01

We develop micron-sized emulsions coated with specific DNA sequences and complementary sticky ends. The emulsions are stabilized with phospholipids on which the DNA strands are grafted through biotin-streptavidin interactions, which allows the DNA to diffuse freely on the surface. We produce two complementary emulsions: one is functionalized with S sticky ends and dyed with red streptavidin, the other displays the complementary S' sticky ends and green streptavidin. Mixing those emulsions reveals specific adhesion between them due to the short-range S-S' hybridization. As expected this interaction is thermo-reversible: the red-green adhesive droplets dissociate upon heating and reassemble after cooling. Here the fluid phospholipids layer also leads to diffusive adhesion patches, which allows the bound droplets to rearrange throughout the packing structure. We quantify the adhesion strength between two droplets and build a theoretical framework that captures the observed trends through parameters such as the size of the droplets, the DNA surface density, the various DNA constructs or the temperature. This colloidal-scale, specific, thermo-reversible biomimetic emulsion offers a new versatile and powerful tool for the development of complex self-assembled materials.

Radiation damage to DNA in DNA-protein complexes.

PubMed

Spotheim-Maurizot, M; Davídková, M

2011-06-03

The most aggressive product of water radiolysis, the hydroxyl (OH) radical, is responsible for the indirect effect of ionizing radiations on DNA in solution and aerobic conditions. According to radiolytic footprinting experiments, the resulting strand breaks and base modifications are inhomogeneously distributed along the DNA molecule irradiated free or bound to ligands (polyamines, thiols, proteins). A Monte-Carlo based model of simulation of the reaction of OH radicals with the macromolecules, called RADACK, allows calculating the relative probability of damage of each nucleotide of DNA irradiated alone or in complexes with proteins. RADACK calculations require the knowledge of the three dimensional structure of DNA and its complexes (determined by X-ray crystallography, NMR spectroscopy or molecular modeling). The confrontation of the calculated values with the results of the radiolytic footprinting experiments together with molecular modeling calculations show that: (1) the extent and location of the lesions are strongly dependent on the structure of DNA, which in turns is modulated by the base sequence and by the binding of proteins and (2) the regions in contact with the protein can be protected against the attack by the hydroxyl radicals via masking of the binding site and by scavenging of the radicals. 2011 Elsevier B.V. All rights reserved.

Timely binding of IHF and Fis to DARS2 regulates ATP–DnaA production and replication initiation

PubMed Central

Kasho, Kazutoshi; Fujimitsu, Kazuyuki; Matoba, Toshihiro; Oshima, Taku; Katayama, Tsutomu

2014-01-01

In Escherichia coli, the ATP-bound form of DnaA (ATP–DnaA) promotes replication initiation. During replication, the bound ATP is hydrolyzed to ADP to yield the ADP-bound form (ADP–DnaA), which is inactive for initiation. The chromosomal site DARS2 facilitates the regeneration of ATP–DnaA by catalyzing nucleotide exchange between free ATP and ADP bound to DnaA. However, the regulatory mechanisms governing this exchange reaction are unclear. Here, using in vitro reconstituted experiments, we show that two nucleoid-associated proteins, IHF and Fis, bind site-specifically to DARS2 to activate coordinately the exchange reaction. The regenerated ATP–DnaA was fully active in replication initiation and underwent DnaA–ATP hydrolysis. ADP–DnaA formed heteromultimeric complexes with IHF and Fis on DARS2, and underwent nucleotide dissociation more efficiently than ATP–DnaA. Consistently, mutant analyses demonstrated that specific binding of IHF and Fis to DARS2 stimulates the formation of ATP–DnaA production, thereby promoting timely initiation. Moreover, we show that IHF–DARS2 binding is temporally regulated during the cell cycle, whereas Fis only binds to DARS2 in exponentially growing cells. These results elucidate the regulation of ATP–DnaA and replication initiation in coordination with the cell cycle and growth phase. PMID:25378325

An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes.

PubMed

Hamula, Camille L A; Peng, Hanyong; Wang, Zhixin; Tyrrell, Gregory J; Li, Xing-Fang; Le, X Chris

2016-03-15

Streptococcus pyogenes is a clinically important pathogen consisting of various serotypes determined by different M proteins expressed on the cell surface. The M type is therefore a useful marker to monitor the spread of invasive S. pyogenes in a population. Serotyping and nucleic acid amplification/sequencing methods for the identification of M types are laborious, inconsistent, and usually confined to reference laboratories. The primary objective of this work is to develop a technique that enables generation of aptamers binding to specific M-types of S. pyogenes. We describe here an in vitro technique that directly used live bacterial cells and the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) strategy. Live S. pyogenes cells were incubated with DNA libraries consisting of 40-nucleotides randomized sequences. Those sequences that bound to the cells were separated, amplified using polymerase chain reaction (PCR), purified using gel electrophoresis, and served as the input DNA pool for the next round of SELEX selection. A specially designed forward primer containing extended polyA20/5Sp9 facilitated gel electrophoresis purification of ssDNA after PCR amplification. A counter-selection step using non-target cells was introduced to improve selectivity. DNA libraries of different starting sequence diversity (10(16) and 10(14)) were compared. Aptamer pools from each round of selection were tested for their binding to the target and non-target cells using flow cytometry. Selected aptamer pools were then cloned and sequenced. Individual aptamer sequences were screened on the basis of their binding to the 10 M-types that were used as targets. Aptamer pools obtained from SELEX rounds 5-8 showed high affinity to the target S. pyogenes cells. Tests against non-target Streptococcus bovis, Streptococcus pneumoniae, and Enterococcus species demonstrated selectivity of these aptamers for binding to S. pyogenes. Several aptamer sequences were found to bind preferentially to the M11 M-type of S. pyogenes. Estimated binding dissociation constants (Kd) were in the low nanomolar range for the M11 specific sequences; for example, sequence E-CA20 had a Kd of 7±1 nM. These affinities are comparable to those of a monoclonal antibody. The improved bacterial cell-SELEX technique is successful in generating aptamers selective for S. pyogenes and some of its M-types. These aptamers are potentially useful for detecting S. pyogenes, achieving binding profiles of the various M-types, and developing new M-typing technologies for non-specialized laboratories or point-of-care testing. Copyright © 2015 Elsevier Inc. All rights reserved.

Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum

PubMed Central

Hu, Lujun; Wang, Linlin; Lu, Wenwei; Zhao, Jianxin; Zhang, Hao; Chen, Wei

2017-01-01

A whole-bacterium-based SELEX (Systematic Evolution of Ligands by Exponential Enrichment) procedure was adopted in this study for the selection of an ssDNA aptamer that binds to Bifidobacterium bifidum. After 12 rounds of selection targeted against B. bifidum, 30 sequences were obtained and divided into seven families according to primary sequence homology and similarity of secondary structure. Four FAM (fluorescein amidite) labeled aptamer sequences from different families were selected for further characterization by flow cytometric analysis. The results reveal that the aptamer sequence CCFM641-5 demonstrated high-affinity and specificity for B. bifidum compared with the other sequences tested, and the estimated Kd value was 10.69 ± 0.89 nM. Additionally, sequence truncation experiments of the aptamer CCFM641-5 led to the conclusion that the 5′-primer and 3′-primer binding sites were essential for aptamer-target binding. In addition, the possible component of the target B. bifidum, bound by the aptamer CCFM641-5, was identified as a membrane protein by treatment with proteinase. Furthermore, to prove the potential application of the aptamer CCFM641-5, a colorimetric bioassay of the sandwich-type structure was used to detect B. bifidum. The assay had a linear range of 104 to 107 cfu/mL (R2 = 0.9834). Therefore, the colorimetric bioassay appears to be a promising method for the detection of B. bifidum based on the aptamer CCFM641-5. PMID:28441340

Repeated sequence sets in mitochondrial DNA molecules of root knot nematodes (Meloidogyne): nucleotide sequences, genome location and potential for host-race identification.

PubMed Central

Okimoto, R; Chamberlin, H M; Macfarlane, J L; Wolstenholme, D R

1991-01-01

Within a 7 kb segment of the mtDNA molecule of the root knot nematode, Meloidogyne javanica, that lacks standard mitochondrial genes, are three sets of strictly tandemly arranged, direct repeat sequences: approximately 36 copies of a 102 ntp sequence that contains a TaqI site; 11 copies of a 63 ntp sequence, and 5 copies of an 8 ntp sequence. The 7 kb repeat-containing segment is bounded by putative tRNAasp and tRNAf-met genes and the arrangement of sequences within this segment is: the tRNAasp gene; a unique 1,528 ntp segment that contains two highly stable hairpin-forming sequences; the 102 ntp repeat set; the 8 ntp repeat set; a unique 1,068 ntp segment; the 63 ntp repeat set; and the tRNAf-met gene. The nucleotide sequences of the 102 ntp copies and the 63 ntp copies have been conserved among the species examined. Data from Southern hybridization experiments indicate that 102 ntp and 63 ntp repeats occur in the mtDNAs of three, two and two races of M.incognita, M.hapla and M.arenaria, respectively. Nucleotide sequences of the M.incognita Race-3 102 ntp repeat were found to be either identical or highly similar to those of the M.javanica 102 ntp repeat. Differences in migration distance and number of 102 ntp repeat-containing bands seen in Southern hybridization autoradiographs of restriction-digested mtDNAs of M.javanica and the different host races of M.incognita, M.hapla and M.arenaria are sufficient to distinguish the different host races of each species. Images PMID:2027769

The Fanconi anemia associated protein FAAP24 uses two substrate specific binding surfaces for DNA recognition

PubMed Central

Wienk, Hans; Slootweg, Jack C.; Speerstra, Sietske; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

2013-01-01

To maintain the integrity of the genome, multiple DNA repair systems exist to repair damaged DNA. Recognition of altered DNA, including bulky adducts, pyrimidine dimers and interstrand crosslinks (ICL), partially depends on proteins containing helix-hairpin-helix (HhH) domains. To understand how ICL is specifically recognized by the Fanconi anemia proteins FANCM and FAAP24, we determined the structure of the HhH domain of FAAP24. Although it resembles other HhH domains, the FAAP24 domain contains a canonical hairpin motif followed by distorted motif. The HhH domain can bind various DNA substrates; using nuclear magnetic resonance titration experiments, we demonstrate that the canonical HhH motif is required for double-stranded DNA (dsDNA) binding, whereas the unstructured N-terminus can interact with single-stranded DNA. Both DNA binding surfaces are used for binding to ICL-like single/double-strand junction-containing DNA substrates. A structural model for FAAP24 bound to dsDNA has been made based on homology with the translesion polymerase iota. Site-directed mutagenesis, sequence conservation and charge distribution support the dsDNA-binding model. Analogous to other HhH domain-containing proteins, we suggest that multiple FAAP24 regions together contribute to binding to single/double-strand junction, which could contribute to specificity in ICL DNA recognition. PMID:23661679

The zinc fingers of YY1 bind single-stranded RNA with low sequence specificity.

PubMed

Wai, Dorothy C C; Shihab, Manar; Low, Jason K K; Mackay, Joel P

2016-11-02

Classical zinc fingers (ZFs) are traditionally considered to act as sequence-specific DNA-binding domains. More recently, classical ZFs have been recognised as potential RNA-binding modules, raising the intriguing possibility that classical-ZF transcription factors are involved in post-transcriptional gene regulation via direct RNA binding. To date, however, only one classical ZF-RNA complex, that involving TFIIIA, has been structurally characterised. Yin Yang-1 (YY1) is a multi-functional transcription factor involved in many regulatory processes, and binds DNA via four classical ZFs. Recent evidence suggests that YY1 also interacts with RNA, but the molecular nature of the interaction remains unknown. In the present work, we directly assess the ability of YY1 to bind RNA using in vitro assays. Systematic Evolution of Ligands by EXponential enrichment (SELEX) was used to identify preferred RNA sequences bound by the YY1 ZFs from a randomised library over multiple rounds of selection. However, a strong motif was not consistently recovered, suggesting that the RNA sequence selectivity of these domains is modest. YY1 ZF residues involved in binding to single-stranded RNA were identified by NMR spectroscopy and found to be largely distinct from the set of residues involved in DNA binding, suggesting that interactions between YY1 and ssRNA constitute a separate mode of nucleic acid binding. Our data are consistent with recent reports that YY1 can bind to RNA in a low-specificity, yet physiologically relevant manner. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Structural Basis for Guide RNA Processing and Seed-Dependent DNA Targeting by CRISPR-Cas12a.

PubMed

Swarts, Daan C; van der Oost, John; Jinek, Martin

2017-04-20

The CRISPR-associated protein Cas12a (Cpf1), which has been repurposed for genome editing, possesses two distinct nuclease activities: endoribonuclease activity for processing its own guide RNAs and RNA-guided DNase activity for target DNA cleavage. To elucidate the molecular basis of both activities, we determined crystal structures of Francisella novicida Cas12a bound to guide RNA and in complex with an R-loop formed by a non-cleavable guide RNA precursor and a full-length target DNA. Corroborated by biochemical experiments, these structures reveal the mechanisms of guide RNA processing and pre-ordering of the seed sequence in the guide RNA that primes Cas12a for target DNA binding. Furthermore, the R-loop complex structure reveals the strand displacement mechanism that facilitates guide-target hybridization and suggests a mechanism for double-stranded DNA cleavage involving a single active site. Together, these insights advance our mechanistic understanding of Cas12a enzymes and may contribute to further development of genome editing technologies. Copyright © 2017 Elsevier Inc. All rights reserved.

Real-time observation of DNA recognition and rejection by the RNA-guided endonuclease Cas9.

PubMed

Singh, Digvijay; Sternberg, Samuel H; Fei, Jingyi; Doudna, Jennifer A; Ha, Taekjip

2016-09-14

Binding specificity of Cas9-guide RNA complexes to DNA is important for genome-engineering applications; however, how mismatches influence target recognition/rejection kinetics is not well understood. Here we used single-molecule FRET to probe real-time interactions between Cas9-RNA and DNA targets. The bimolecular association rate is only weakly dependent on sequence; however, the dissociation rate greatly increases from <0.006 s(-1) to >2 s(-1) upon introduction of mismatches proximal to protospacer-adjacent motif (PAM), demonstrating that mismatches encountered early during heteroduplex formation induce rapid rejection of off-target DNA. In contrast, PAM-distal mismatches up to 11 base pairs in length, which prevent DNA cleavage, still allow formation of a stable complex (dissociation rate <0.006 s(-1)), suggesting that extremely slow rejection could sequester Cas9-RNA, increasing the Cas9 expression level necessary for genome-editing, thereby aggravating off-target effects. We also observed at least two different bound FRET states that may represent distinct steps in target search and proofreading.

DNA Physical Mapping via the Controlled Translocation of Single Molecules through a 5-10nm Silicon Nitride Nanopore

NASA Astrophysics Data System (ADS)

Stein, Derek; Reisner, Walter; Jiang, Zhijun; Hagerty, Nick; Wood, Charles; Chan, Jason

2009-03-01

The ability to map the binding position of sequence-specific markers, including transcription-factors, protein-nucleic acids (PNAs) or deactivated restriction enzymes, along a single DNA molecule in a nanofluidic device would be of key importance for the life-sciences. Such markers could give an indication of the active genes at particular stage in a cell's transcriptional cycle, pinpoint the location of mutations or even provide a DNA barcode that could aid in genomics applications. We have developed a setup consisting of a 5-10 nm nanopore in a 20nm thick silicon nitride film coupled to an optical tweezer setup. The translocation of DNA across the nanopore can be detected via blockades in the electrical current through the pore. By anchoring one end of the translocating DNA to an optically trapped microsphere, we hope to stretch out the molecule in the nanopore and control the translocation speed, enabling us to slowly scan across the genome and detect changes in the baseline current due to the presence of bound markers.

DNA binding and unwinding by Hel308 helicase requires dual functions of a winged helix domain.

PubMed

Northall, Sarah J; Buckley, Ryan; Jones, Nathan; Penedo, J Carlos; Soultanas, Panos; Bolt, Edward L

2017-09-01

Hel308 helicases promote genome stability linked to DNA replication in archaea, and have homologues in metazoans. In the crystal structure of archaeal Hel308 bound to a tailed DNA duplex, core helicase domains encircle single-stranded DNA (ssDNA) in a "ratchet" for directional translocation. A winged helix domain (WHD) is also present, but its function is mysterious. We investigated the WHD in full-length Hel308, identifying that mutations in a solvent exposed α-helix resulted in reduced DNA binding and unwinding activities. When isolated from the rest of Hel308, the WHD protein alone bound to duplex DNA but not ssDNA, and DNA binding by WHD protein was abolished by the same mutations as were analyzed in full-length Hel308. Isolated WHD from a human Hel308 homologue (HelQ) also bound to duplex DNA. By disrupting the interface between the Hel308 WHD and a RecA-like domain, a topology typical of Ski2 helicases, we show that this is crucial for ATPase and helicase activities. The data suggest a model in which the WHD promotes activity of Hel308 directly, through binding to duplex DNA that is distinct from ssDNA binding by core helicase, and indirectly through interaction with the RecA-like domain. We propose how the WHD may contribute to ssDNA translocation, resulting in DNA helicase activity or in removal of other DNA bound proteins by "reeling" ssDNA. Copyright © 2017 Elsevier B.V. All rights reserved.

LDsplit: screening for cis-regulatory motifs stimulating meiotic recombination hotspots by analysis of DNA sequence polymorphisms.

PubMed

Yang, Peng; Wu, Min; Guo, Jing; Kwoh, Chee Keong; Przytycka, Teresa M; Zheng, Jie

2014-02-17

As a fundamental genomic element, meiotic recombination hotspot plays important roles in life sciences. Thus uncovering its regulatory mechanisms has broad impact on biomedical research. Despite the recent identification of the zinc finger protein PRDM9 and its 13-mer binding motif as major regulators for meiotic recombination hotspots, other regulators remain to be discovered. Existing methods for finding DNA sequence motifs of recombination hotspots often rely on the enrichment of co-localizations between hotspots and short DNA patterns, which ignore the cross-individual variation of recombination rates and sequence polymorphisms in the population. Our objective in this paper is to capture signals encoded in genetic variations for the discovery of recombination-associated DNA motifs. Recently, an algorithm called "LDsplit" has been designed to detect the association between single nucleotide polymorphisms (SNPs) and proximal meiotic recombination hotspots. The association is measured by the difference of population recombination rates at a hotspot between two alleles of a candidate SNP. Here we present an open source software tool of LDsplit, with integrative data visualization for recombination hotspots and their proximal SNPs. Applying LDsplit on SNPs inside an established 7-mer motif bound by PRDM9 we observed that SNP alleles preserving the original motif tend to have higher recombination rates than the opposite alleles that disrupt the motif. Running on SNP windows around hotspots each containing an occurrence of the 7-mer motif, LDsplit is able to guide the established motif finding algorithm of MEME to recover the 7-mer motif. In contrast, without LDsplit the 7-mer motif could not be identified. LDsplit is a software tool for the discovery of cis-regulatory DNA sequence motifs stimulating meiotic recombination hotspots by screening and narrowing down to hotspot associated SNPs. It is the first computational method that utilizes the genetic variation of recombination hotspots among individuals, opening a new avenue for motif finding. Tested on an established motif and simulated datasets, LDsplit shows promise to discover novel DNA motifs for meiotic recombination hotspots.

LDsplit: screening for cis-regulatory motifs stimulating meiotic recombination hotspots by analysis of DNA sequence polymorphisms

PubMed Central

2014-01-01

Background As a fundamental genomic element, meiotic recombination hotspot plays important roles in life sciences. Thus uncovering its regulatory mechanisms has broad impact on biomedical research. Despite the recent identification of the zinc finger protein PRDM9 and its 13-mer binding motif as major regulators for meiotic recombination hotspots, other regulators remain to be discovered. Existing methods for finding DNA sequence motifs of recombination hotspots often rely on the enrichment of co-localizations between hotspots and short DNA patterns, which ignore the cross-individual variation of recombination rates and sequence polymorphisms in the population. Our objective in this paper is to capture signals encoded in genetic variations for the discovery of recombination-associated DNA motifs. Results Recently, an algorithm called “LDsplit” has been designed to detect the association between single nucleotide polymorphisms (SNPs) and proximal meiotic recombination hotspots. The association is measured by the difference of population recombination rates at a hotspot between two alleles of a candidate SNP. Here we present an open source software tool of LDsplit, with integrative data visualization for recombination hotspots and their proximal SNPs. Applying LDsplit on SNPs inside an established 7-mer motif bound by PRDM9 we observed that SNP alleles preserving the original motif tend to have higher recombination rates than the opposite alleles that disrupt the motif. Running on SNP windows around hotspots each containing an occurrence of the 7-mer motif, LDsplit is able to guide the established motif finding algorithm of MEME to recover the 7-mer motif. In contrast, without LDsplit the 7-mer motif could not be identified. Conclusions LDsplit is a software tool for the discovery of cis-regulatory DNA sequence motifs stimulating meiotic recombination hotspots by screening and narrowing down to hotspot associated SNPs. It is the first computational method that utilizes the genetic variation of recombination hotspots among individuals, opening a new avenue for motif finding. Tested on an established motif and simulated datasets, LDsplit shows promise to discover novel DNA motifs for meiotic recombination hotspots. PMID:24533858

Graph traversals, genes, and matroids: An efficient case of the travelling salesman problem

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gusfield, D.; Stelling, P.; Wang, Lusheng

1996-12-31

In this paper the authors consider graph traversal problems that arise from a particular technology for DNA sequencing - sequencing by hybridization (SBH). They first explain the connection of the graph problems to SBH and then focus on the traversal problems. They describe a practical polynomial time solution to the Travelling Salesman Problem in a rich class of directed graphs (including edge weighted binary de Bruijn graphs), and provide a bounded-error approximation algorithm for the maximum weight TSP in a superset of those directed graphs. The authors also establish the existence of a matroid structure defined on the set ofmore » Euler and Hamilton paths in the restricted class of graphs. 8 refs., 5 figs.« less

Analysis of the vhoGAC and vhtGAC operons from Methanosarcina mazei strain Gö1, both encoding a membrane-bound hydrogenase and a cytochrome b.

PubMed

Deppenmeier, U; Blaut, M; Lentes, S; Herzberg, C; Gottschalk, G

1995-01-15

DNA encompassing the structural genes of two membrane-bound hydrogenases from Methanosarcina mazei Gö1 was cloned and sequenced. The genes, arranged in the order vhoG and vhoA as well as vhtG and vhtA, were identified as those encoding the small and the large subunits of the NiFe hydrogenases [Deppenmeier, U., Blaut, M., Schmidt, B. & Gottschalk, G. (1992) Arch. Microbiol. 157, 505-511]. Northern-blot analysis revealed that the structural genes formed part of two operons, both containing one additional open reading frame (vhoC and vhtC) which codes for a cytochrome b. This conclusion was drawn from the homology of the deduced N-terminal amino acid sequences of vhoC and vhtC and the N-terminus of a 27-kDa cytochrome isolated from Ms. mazei C16. VhoC and VhtC contain four tentative hydrophobic segments which might span the cytoplasmic membrane. Hydropathy plots suggest that His23 and His50 are involved in heme coordination. The comparison of the sequencing data of vhoG and vhtG with the experimentally determined N-terminus of the small subunit indicate the presence of a 48-amino-acid leader peptide in front of the polypeptides. VhoA and VhtA contained the conserved sequence DPCXXC in the C-terminal region, which excludes the presence of a selenocysteine residue in these hydrogenases. Promoter sequences were found upstream of vhoG and vhtG, respectively. Downstream of vhoC, a putative terminator sequence was identified. Alignments of the deduced amino acid sequences of the gene clusters vhoGAC and vhtGAC showed 92-97% identity. Only the C-termini of VhoC and VhtC were not similar.

Recent development of nano-materials used in DNA biosensors.

PubMed

Xu, Kai; Huang, Junran; Ye, Zunzhong; Ying, Yibin; Li, Yanbin

2009-01-01

As knowledge of the structure and function of nucleic acid molecules has increased, sequence-specific DNA detection has gained increased importance. DNA biosensors based on nucleic acid hybridization have been actively developed because of their specificity, speed, portability, and low cost. Recently, there has been considerable interest in using nano-materials for DNA biosensors. Because of their high surface-to-volume ratios and excellent biological compatibilities, nano-materials could be used to increase the amount of DNA immobilization; moreover, DNA bound to nano-materials can maintain its biological activity. Alternatively, signal amplification by labeling a targeted analyte with nano-materials has also been reported for DNA biosensors in many papers. This review summarizes the applications of various nano-materials for DNA biosensors during past five years. We found that nano-materials of small sizes were advantageous as substrates for DNA attachment or as labels for signal amplification; and use of two or more types of nano-materials in the biosensors could improve their overall quality and to overcome the deficiencies of the individual nano-components. Most current DNA biosensors require the use of polymerase chain reaction (PCR) in their protocols. However, further development of nano-materials with smaller size and/or with improved biological and chemical properties would substantially enhance the accuracy, selectivity and sensitivity of DNA biosensors. Thus, DNA biosensors without PCR amplification may become a reality in the foreseeable future.

Recent Development of Nano-Materials Used in DNA Biosensors

PubMed Central

Xu, Kai; Huang, Junran; Ye, Zunzhong; Ying, Yibin; Li, Yanbin

2009-01-01

As knowledge of the structure and function of nucleic acid molecules has increased, sequence-specific DNA detection has gained increased importance. DNA biosensors based on nucleic acid hybridization have been actively developed because of their specificity, speed, portability, and low cost. Recently, there has been considerable interest in using nano-materials for DNA biosensors. Because of their high surface-to-volume ratios and excellent biological compatibilities, nano-materials could be used to increase the amount of DNA immobilization; moreover, DNA bound to nano-materials can maintain its biological activity. Alternatively, signal amplification by labeling a targeted analyte with nano-materials has also been reported for DNA biosensors in many papers. This review summarizes the applications of various nano-materials for DNA biosensors during past five years. We found that nano-materials of small sizes were advantageous as substrates for DNA attachment or as labels for signal amplification; and use of two or more types of nano-materials in the biosensors could improve their overall quality and to overcome the deficiencies of the individual nano-components. Most current DNA biosensors require the use of polymerase chain reaction (PCR) in their protocols. However, further development of nano-materials with smaller size and/or with improved biological and chemical properties would substantially enhance the accuracy, selectivity and sensitivity of DNA biosensors. Thus, DNA biosensors without PCR amplification may become a reality in the foreseeable future. PMID:22346713

Quorum Sensing in Chromobacterium violaceum: DNA Recognition and Gene Regulation by the CviR Receptor ▿ †

PubMed Central

Stauff, Devin L.; Bassler, Bonnie L.

2011-01-01

The bacterial pathogen Chromobacterium violaceum uses a LuxIR-type quorum-sensing system to detect and respond to changes in cell population density. CviI synthesizes the autoinducer C10-homoserine lactone (C10-HSL), and CviR is a cytoplasmic DNA binding transcription factor that activates gene expression following binding to C10-HSL. A number of behaviors are controlled by quorum sensing in C. violaceum. However, few genes have been shown to be directly controlled by CviR, in part because the DNA motif bound by CviR is not well characterized. Here, we define the DNA sequence required for promoter recognition by CviR. Using in vivo data generated from a library of point mutations in a CviR-regulated promoter, we find that CviR binds to a palindrome with the ideal sequence CTGNCCNNNNGGNCAG. We constructed a position weight matrix using these in vivo data and scanned the C. violaceum genome to predict CviR binding sites. We measured direct activation of the identified promoters by CviR and found that CviR controls the expression of the promoter for a chitinase, a type VI secretion-related gene, a transcriptional regulator gene, a guanine deaminase gene, and cviI. Indeed, regulation of cviI expression by CviR generates a canonical quorum-sensing positive-feedback loop. PMID:21622734

Quorum sensing in Chromobacterium violaceum: DNA recognition and gene regulation by the CviR receptor.

PubMed

Stauff, Devin L; Bassler, Bonnie L

2011-08-01

The bacterial pathogen Chromobacterium violaceum uses a LuxIR-type quorum-sensing system to detect and respond to changes in cell population density. CviI synthesizes the autoinducer C(10)-homoserine lactone (C(10)-HSL), and CviR is a cytoplasmic DNA binding transcription factor that activates gene expression following binding to C(10)-HSL. A number of behaviors are controlled by quorum sensing in C. violaceum. However, few genes have been shown to be directly controlled by CviR, in part because the DNA motif bound by CviR is not well characterized. Here, we define the DNA sequence required for promoter recognition by CviR. Using in vivo data generated from a library of point mutations in a CviR-regulated promoter, we find that CviR binds to a palindrome with the ideal sequence CTGNCCNNNNGGNCAG. We constructed a position weight matrix using these in vivo data and scanned the C. violaceum genome to predict CviR binding sites. We measured direct activation of the identified promoters by CviR and found that CviR controls the expression of the promoter for a chitinase, a type VI secretion-related gene, a transcriptional regulator gene, a guanine deaminase gene, and cviI. Indeed, regulation of cviI expression by CviR generates a canonical quorum-sensing positive-feedback loop.

COUP-TF (chicken ovalbumin upstream promoter transcription factor)-interacting protein 1 (CTIP1) is a sequence-specific DNA binding protein.

PubMed Central

Avram, Dorina; Fields, Andrew; Senawong, Thanaset; Topark-Ngarm, Acharawan; Leid, Mark

2002-01-01

Chicken ovalbumin upstream promoter transcription factor (COUP-TF)-interacting proteins 1 and 2 [CTIP1/Evi9/B cell leukaemia (Bcl) l1a and CTIP2/Bcl11b respectively] are highly related C(2)H(2) zinc finger proteins that are abundantly expressed in brain and the immune system, and are associated with immune system malignancies. A selection procedure was employed to isolate high-affinity DNA binding sites for CTIP1. The core binding site on DNA identified in these studies, 5'-GGCCGG-3' (upper strand), is highly related to the canonical GC box and was bound by a CTIP1 oligomeric complex(es) in vitro. Furthermore, both CTIP1 and CTIP2 repressed transcription of a reporter gene harbouring a multimerized CTIP binding site, and this repression was neither reversed by trichostatin A (an inhibitor of known class I and II histone deacetylases) nor stimulated by co-transfection of a COUP-TF family member. These results demonstrate that CTIP1 is a sequence-specific DNA binding protein and a bona fide transcriptional repressor that is capable of functioning independently of COUP-TF family members. These findings may be relevant to the physiological and/or pathological action(s) of CTIPs in cells that do not express COUP-TF family members, such as cells of the haematopoietic and immune systems. PMID:12196208

An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

PubMed

Itzhaki, H; Maxson, J M; Woodson, W R

1994-09-13

The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.

Assessment of configurations and chemistries of bridged nucleic acids-containing oligomers as external guide sequences: a methodology for inhibition of expression of antibiotic resistance genes

PubMed Central

Jackson, Alexis; Jani, Saumya; Davies-Sala, Carol; Soler-Bistué, Alfonso J. C.; Zorreguieta, Angeles; Tolmasky, Marcelo E.

2016-01-01

External guide sequences (EGSs) are short antisense oligoribonucleotides that elicit RNase P-mediated cleavage of a target mRNA, which results in inhibition of gene expression. EGS technology is used to inhibit expression of a wide variety of genes, a strategy that may lead to development of novel treatments of numerous diseases, including multidrug-resistant bacterial and viral infections. Successful development of EGS technology depends on finding nucleotide analogs that resist degradation by nucleases present in biological fluids and the environment but still elicit RNase P-mediated degradation when forming a duplex with a target mRNA. Previous results suggested that locked nucleic acids (LNA)/DNA chimeric oligomers have these properties. LNA are now considered the first generation of compounds collectively known as bridged nucleic acids (BNAs) – modified ribonucleotides that contain a bridge at the 2ʹ,4ʹ-position of the ribose. LNA and the second-generation BNA, known as BNANC, differ in the chemical nature of the bridge. Chimeric oligomers containing LNA or BNANC and deoxynucleotide monomers in different configurations are nuclease resistant and could be excellent EGS compounds. However, not all configurations may be equally active as EGSs. RNase P cleavage assays comparing LNA/DNA and BNANC/DNA chimeric oligonucleotides that share identical nucleotide sequence but with different configurations were carried out using as target the amikacin resistance aac(6ʹ)-Ib mRNA. LNA/DNA gapmers with 5 and 3/4 LNA residues at the 5ʹ- and 3ʹ-ends, respectively, were the most efficient EGSs while all BNANC/DNA gapmers showed very poor activity. When the most efficient LNA/DNA gapmer was covalently bound to a cell-penetrating peptide, the hybrid compound conserved the EGS activity as determined by RNase P cleavage assays and reduced the levels of resistance to amikacin when added to Acinetobacter baumannii cells in culture, an indication of cellular uptake and biological activity. PMID:27857983

Timely binding of IHF and Fis to DARS2 regulates ATP-DnaA production and replication initiation.

PubMed

Kasho, Kazutoshi; Fujimitsu, Kazuyuki; Matoba, Toshihiro; Oshima, Taku; Katayama, Tsutomu

2014-12-01

In Escherichia coli, the ATP-bound form of DnaA (ATP-DnaA) promotes replication initiation. During replication, the bound ATP is hydrolyzed to ADP to yield the ADP-bound form (ADP-DnaA), which is inactive for initiation. The chromosomal site DARS2 facilitates the regeneration of ATP-DnaA by catalyzing nucleotide exchange between free ATP and ADP bound to DnaA. However, the regulatory mechanisms governing this exchange reaction are unclear. Here, using in vitro reconstituted experiments, we show that two nucleoid-associated proteins, IHF and Fis, bind site-specifically to DARS2 to activate coordinately the exchange reaction. The regenerated ATP-DnaA was fully active in replication initiation and underwent DnaA-ATP hydrolysis. ADP-DnaA formed heteromultimeric complexes with IHF and Fis on DARS2, and underwent nucleotide dissociation more efficiently than ATP-DnaA. Consistently, mutant analyses demonstrated that specific binding of IHF and Fis to DARS2 stimulates the formation of ATP-DnaA production, thereby promoting timely initiation. Moreover, we show that IHF-DARS2 binding is temporally regulated during the cell cycle, whereas Fis only binds to DARS2 in exponentially growing cells. These results elucidate the regulation of ATP-DnaA and replication initiation in coordination with the cell cycle and growth phase. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Metal Ion Binding at the Catalytic Site Induces Widely Distributed Changes in a Sequence Specific Protein–DNA Complex

PubMed Central

2016-01-01

Metal ion cofactors can alter the energetics and specificity of sequence specific protein–DNA interactions, but it is unknown if the underlying effects on structure and dynamics are local or dispersed throughout the protein–DNA complex. This work uses EcoRV endonuclease as a model, and catalytically inactive lanthanide ions, which replace the Mg2+ cofactor. Nuclear magnetic resonance (NMR) titrations indicate that four Lu3+ or two La3+ cations bind, and two new crystal structures confirm that Lu3+ binding is confined to the active sites. NMR spectra show that the metal-free EcoRV complex with cognate (GATATC) DNA is structurally distinct from the nonspecific complex, and that metal ion binding sites are not assembled in the nonspecific complex. NMR chemical shift perturbations were determined for 1H–15N amide resonances, for 1H–13C Ile-δ-CH3 resonances, and for stereospecifically assigned Leu-δ-CH3 and Val-γ-CH3 resonances. Many chemical shifts throughout the cognate complex are unperturbed, so metal binding does not induce major conformational changes. However, some large perturbations of amide and side chain methyl resonances occur as far as 34 Å from the metal ions. Concerted changes in specific residues imply that local effects of metal binding are propagated via a β-sheet and an α-helix. Both amide and methyl resonance perturbations indicate changes in the interface between subunits of the EcoRV homodimer. Bound metal ions also affect amide hydrogen exchange rates for distant residues, including a distant subdomain that contacts DNA phosphates and promotes DNA bending, showing that metal ions in the active sites, which relieve electrostatic repulsion between protein and DNA, cause changes in slow dynamics throughout the complex. PMID:27786446

Tethered particle analysis of supercoiled circular DNA using peptide nucleic acid handles.

PubMed

Norregaard, Kamilla; Andersson, Magnus; Nielsen, Peter Eigil; Brown, Stanley; Oddershede, Lene B

2014-09-01

This protocol describes how to monitor individual naturally supercoiled circular DNA plasmids bound via peptide nucleic acid (PNA) handles between a bead and a surface. The protocol was developed for single-molecule investigation of the dynamics of supercoiled DNA, and it allows the investigation of both the dynamics of the molecule itself and of its interactions with a regulatory protein. Two bis-PNA clamps designed to bind with extremely high affinity to predetermined homopurine sequence sites in supercoiled DNA are prepared: one conjugated with digoxigenin for attachment to an anti-digoxigenin-coated glass cover slide, and one conjugated with biotin for attachment to a submicron-sized streptavidin-coated polystyrene bead. Plasmids are constructed, purified and incubated with the PNA handles. The dynamics of the construct is analyzed by tracking the tethered bead using video microscopy: less supercoiling results in more movement, and more supercoiling results in less movement. In contrast to other single-molecule methodologies, the current methodology allows for studying DNA in its naturally supercoiled state with constant linking number and constant writhe. The protocol has potential for use in studying the influence of supercoils on the dynamics of DNA and its associated proteins, e.g., topoisomerase. The procedure takes ~4 weeks.

Interaction of the replication terminator protein of Bacillus subtilis with DNA probed by NMR spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hastings, Adam F.; Otting, Gottfried; Folmer, Rutger H.A.

2005-09-23

Termination of DNA replication in Bacillus subtilis involves the polar arrest of replication forks by a specific complex formed between the dimeric 29 kDa replication terminator protein (RTP) and DNA terminator sites. We have used NMR spectroscopy to probe the changes in {sup 1}H-{sup 15}N correlation spectra of a {sup 15}N-labelled RTP.C110S mutant upon the addition of a 21 base pair symmetrical DNA binding site. Assignment of the {sup 1}H-{sup 15}N correlations was achieved using a suite of triple resonance NMR experiments with {sup 15}N,{sup 13}C,70% {sup 2}H enriched protein recorded at 800 MHz and using TROSY pulse sequences. Perturbationsmore » to {sup 1}H-{sup 15}N spectra revealed that the N-termini, {alpha}3-helices and several loops are affected by the binding interaction. An analysis of this data in light of the crystallographically determined apo- and DNA-bound forms of RTP.C110S revealed that the NMR spectral perturbations correlate more closely to protein structural changes upon complex formation rather than to interactions at the protein-DNA interface.« less

Fanconi anemia proteins in telomere maintenance.

PubMed

Sarkar, Jaya; Liu, Yie

2016-07-01

Mammalian chromosome ends are protected by nucleoprotein structures called telomeres. Telomeres ensure genome stability by preventing chromosome termini from being recognized as DNA damage. Telomere length homeostasis is inevitable for telomere maintenance because critical shortening or over-lengthening of telomeres may lead to DNA damage response or delay in DNA replication, and hence genome instability. Due to their repetitive DNA sequence, unique architecture, bound shelterin proteins, and high propensity to form alternate/secondary DNA structures, telomeres are like common fragile sites and pose an inherent challenge to the progression of DNA replication, repair, and recombination apparatus. It is conceivable that longer the telomeres are, greater is the severity of such challenges. Recent studies have linked excessively long telomeres with increased tumorigenesis. Here we discuss telomere abnormalities in a rare recessive chromosomal instability disorder called Fanconi Anemia and the role of the Fanconi Anemia pathway in telomere biology. Reports suggest that Fanconi Anemia proteins play a role in maintaining long telomeres, including processing telomeric joint molecule intermediates. We speculate that ablation of the Fanconi Anemia pathway would lead to inadequate aberrant structural barrier resolution at excessively long telomeres, thereby causing replicative burden on the cell. Published by Elsevier B.V.

GRID-seq reveals the global RNA-chromatin interactome

PubMed Central

Li, Xiao; Zhou, Bing; Chen, Liang; Gou, Lan-Tao; Li, Hairi; Fu, Xiang-Dong

2017-01-01

Higher eukaryotic genomes are bound by a large number of coding and non-coding RNAs, but approaches to comprehensively map the identity and binding sites of these RNAs are lacking. Here we report a method to in situ capture global RNA interactions with DNA by deep sequencing (GRID-seq), which enables the comprehensive identification of the entire repertoire of chromatin-interacting RNAs and their respective binding sites. In human, mouse and Drosophila cells, we detected a large set of tissue-specific coding and non-coding RNAs that are bound to active promoters and enhancers, especially super-enhancers. Assuming that most mRNA-chromatin interactions indicate the physical proximity of a promoter and an enhancer, we constructed a three-dimensional global connectivity map of promoters and enhancers, revealing transcription activity-linked genomic interactions in the nucleus. PMID:28922346

Fundamental Bounds for Sequence Reconstruction from Nanopore Sequencers.

PubMed

Magner, Abram; Duda, Jarosław; Szpankowski, Wojciech; Grama, Ananth

2016-06-01

Nanopore sequencers are emerging as promising new platforms for high-throughput sequencing. As with other technologies, sequencer errors pose a major challenge for their effective use. In this paper, we present a novel information theoretic analysis of the impact of insertion-deletion (indel) errors in nanopore sequencers. In particular, we consider the following problems: (i) for given indel error characteristics and rate, what is the probability of accurate reconstruction as a function of sequence length; (ii) using replicated extrusion (the process of passing a DNA strand through the nanopore), what is the number of replicas needed to accurately reconstruct the true sequence with high probability? Our results provide a number of important insights: (i) the probability of accurate reconstruction of a sequence from a single sample in the presence of indel errors tends quickly (i.e., exponentially) to zero as the length of the sequence increases; and (ii) replicated extrusion is an effective technique for accurate reconstruction. We show that for typical distributions of indel errors, the required number of replicas is a slow function (polylogarithmic) of sequence length - implying that through replicated extrusion, we can sequence large reads using nanopore sequencers. Moreover, we show that in certain cases, the required number of replicas can be related to information-theoretic parameters of the indel error distributions.

Genome sequence of the pink–pigmented marine bacterium Loktanella hongkongensis type strain (UST950701–009PT), a representative of the Roseobacter group

DOE PAGES

Lau, Stanley CK; Riedel, Thomas; Fiebig, Anne; ...

2015-08-11

Loktanella hongkongensis UST950701-009PT is a Gram-negative, non-motile and rod-shaped bacterium isolated from a marine biofilm in the subtropical seawater of Hong Kong. When growing as a monospecies biofilm on polystyrene surfaces, this bacterium is able to induce larval settlement and metamorphosis of a ubiquitous polychaete tubeworm Hydroides elegans. The inductive cues are low-molecular weight compounds bound to the exopolymeric matrix of the bacterial cells. In the present study we describe the features of L. hongkongensis strain DSM 17492T together with its genome sequence and annotation and novel aspects of its phenotype. The 3,198,444 bp long genome sequence encodes 3104 protein-codingmore » genes and 57 RNA genes. Lastly, the two unambiguously identified extrachromosomal replicons contain replication modules of the RepB and the Rhodobacteraceae-specific DnaA-like type, respectively.« less

Genome sequence of the pink-pigmented marine bacterium Loktanella hongkongensis type strain (UST950701-009P(T)), a representative of the Roseobacter group.

PubMed

Lau, Stanley Ck; Riedel, Thomas; Fiebig, Anne; Han, James; Huntemann, Marcel; Petersen, Jörn; Ivanova, Natalia N; Markowitz, Victor; Woyke, Tanja; Göker, Markus; Kyrpides, Nikos C; Klenk, Hans-Peter; Qian, Pei-Yuan

2015-01-01

Loktanella hongkongensis UST950701-009P(T) is a Gram-negative, non-motile and rod-shaped bacterium isolated from a marine biofilm in the subtropical seawater of Hong Kong. When growing as a monospecies biofilm on polystyrene surfaces, this bacterium is able to induce larval settlement and metamorphosis of a ubiquitous polychaete tubeworm Hydroides elegans. The inductive cues are low-molecular weight compounds bound to the exopolymeric matrix of the bacterial cells. In the present study we describe the features of L. hongkongensis strain DSM 17492(T) together with its genome sequence and annotation and novel aspects of its phenotype. The 3,198,444 bp long genome sequence encodes 3104 protein-coding genes and 57 RNA genes. The two unambiguously identified extrachromosomal replicons contain replication modules of the RepB and the Rhodobacteraceae-specific DnaA-like type, respectively.

New CRISPR–Cas systems from uncultivated microbes

DOE PAGES

Burstein, David; Harrington, Lucas B.; Strutt, Steven C.; ...

2016-12-22

We present that CRISPR-Cas systems provide microbes with adaptive immunity by employing short DNA sequences, termed spacers, that guide Cas proteins to cleave foreign DNA. Class 2 CRISPR-Cas systems are streamlined versions, in which a single RNA-bound Cas protein recognizes and cleaves target sequences. The programmable nature of these minimal systems has enabled researchers to repurpose them into a versatile technology that is broadly revolutionizing biological and clinical research. However, current CRISPR-Cas technologies are based solely on systems from isolated bacteria, leaving the vast majority of enzymes from organisms that have not been cultured untapped. Metagenomics, the sequencing of DNAmore » extracted directly from natural microbial communities, provides access to the genetic material of a huge array of uncultivated organisms. Here, using genome-resolved metagenomics, we identify a number of CRISPR-Cas systems, including the first reported Cas9 in the archaeal domain of life, to our knowledge. This divergent Cas9 protein was found in little-studied nanoarchaea as part of an active CRISPR-Cas system. In bacteria, we discovered two previously unknown systems, CRISPR-CasX and CRISPR-CasY, which are among the most compact systems yet discovered. Notably, all required functional components were identified by metagenomics, enabling validation of robust in vivo RNA-guided DNA interference activity in Escherichia coli. Lastly, interrogation of environmental microbial communities combined with in vivo experiments allows us to access an unprecedented diversity of genomes, the content of which will expand the repertoire of microbe-based biotechnologies.« less

New CRISPR–Cas systems from uncultivated microbes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burstein, David; Harrington, Lucas B.; Strutt, Steven C.

We present that CRISPR-Cas systems provide microbes with adaptive immunity by employing short DNA sequences, termed spacers, that guide Cas proteins to cleave foreign DNA. Class 2 CRISPR-Cas systems are streamlined versions, in which a single RNA-bound Cas protein recognizes and cleaves target sequences. The programmable nature of these minimal systems has enabled researchers to repurpose them into a versatile technology that is broadly revolutionizing biological and clinical research. However, current CRISPR-Cas technologies are based solely on systems from isolated bacteria, leaving the vast majority of enzymes from organisms that have not been cultured untapped. Metagenomics, the sequencing of DNAmore » extracted directly from natural microbial communities, provides access to the genetic material of a huge array of uncultivated organisms. Here, using genome-resolved metagenomics, we identify a number of CRISPR-Cas systems, including the first reported Cas9 in the archaeal domain of life, to our knowledge. This divergent Cas9 protein was found in little-studied nanoarchaea as part of an active CRISPR-Cas system. In bacteria, we discovered two previously unknown systems, CRISPR-CasX and CRISPR-CasY, which are among the most compact systems yet discovered. Notably, all required functional components were identified by metagenomics, enabling validation of robust in vivo RNA-guided DNA interference activity in Escherichia coli. Lastly, interrogation of environmental microbial communities combined with in vivo experiments allows us to access an unprecedented diversity of genomes, the content of which will expand the repertoire of microbe-based biotechnologies.« less

[Screening specific recognition motif of RNA-binding proteins by SELEX in combination with next-generation sequencing technique].

PubMed

Zhang, Lu; Xu, Jinhao; Ma, Jinbiao

2016-07-25

RNA-binding protein exerts important biological function by specifically recognizing RNA motif. SELEX (Systematic evolution of ligands by exponential enrichment), an in vitro selection method, can obtain consensus motif with high-affinity and specificity for many target molecules from DNA or RNA libraries. Here, we combined SELEX with next-generation sequencing to study the protein-RNA interaction in vitro. A pool of RNAs with 20 bp random sequences were transcribed by T7 promoter, and target protein was inserted into plasmid containing SBP-tag, which can be captured by streptavidin beads. Through only one cycle, the specific RNA motif can be obtained, which dramatically improved the selection efficiency. Using this method, we found that human hnRNP A1 RRMs domain (UP1 domain) bound RNA motifs containing AGG and AG sequences. The EMSA experiment indicated that hnRNP A1 RRMs could bind the obtained RNA motif. Taken together, this method provides a rapid and effective method to study the RNA binding specificity of proteins.

Mapping the miRNA interactome by crosslinking ligation and sequencing of hybrids (CLASH)

PubMed Central

Helwak, Aleksandra; Tollervey, David

2014-01-01

RNA-RNA interactions play critical roles in many cellular processes but studying them is difficult and laborious. Here, we describe an experimental procedure, termed crosslinking ligation and sequencing of hybrids (CLASH), which allows high-throughput identification of sites of RNA-RNA interaction. During CLASH, a tagged bait protein is UV crosslinked in vivo to stabilise RNA interactions and purified under denaturing conditions. RNAs associated with the bait protein are partially truncated, and the ends of RNA-duplexes are ligated together. Following linker addition, cDNA library preparation and high-throughput sequencing, the ligated duplexes give rise to chimeric cDNAs, which unambiguously identify RNA-RNA interaction sites independent of bioinformatic predictions. This protocol is optimized for studying miRNA targets bound by Argonaute proteins, but should be easily adapted for other RNA-binding proteins and classes of RNA. The protocol requires around 5 days to complete, excluding the time required for high-throughput sequencing and bioinformatic analyses. PMID:24577361

Force-driven unbinding of proteins HU and Fis from DNA quantified using a thermodynamic Maxwell relation

PubMed Central

Xiao, Botao; Zhang, Houyin; Johnson, Reid C.; Marko, John F.

2011-01-01

Determining numbers of proteins bound to large DNAs is important for understanding their chromosomal functions. Protein numbers may be affected by physical factors such as mechanical forces generated in DNA, e.g. by transcription or replication. We performed single-DNA stretching experiments with bacterial nucleoid proteins HU and Fis, verifying that the force–extension measurements were in thermodynamic equilibrium. We, therefore, could use a thermodynamic Maxwell relation to deduce the change of protein number on a single DNA due to varied force. For the binding of both HU and Fis under conditions studied, numbers of bound proteins decreased as force was increased. Our experiments showed that most of the bound HU proteins were driven off the DNA at 6.3 pN for HU concentrations lower than 150 nM; our HU data were fit well by a statistical-mechanical model of protein-induced bending of DNA. In contrast, a significant amount of Fis proteins could not be forced off the DNA at forces up to 12 pN and Fis concentrations up to 20 nM. This thermodynamic approach may be applied to measure changes in numbers of a wide variety of molecules bound to DNA or other polymers. Force-dependent DNA binding by proteins suggests mechano-chemical mechanisms for gene regulation. PMID:21427084

Investigation of arc repressor DNA-binding specificity by comparative molecular dynamics simulations.

PubMed

Song, Wei; Guo, Jun-Tao

2015-01-01

Transcription factors regulate gene expression through binding to specific DNA sequences. How transcription factors achieve high binding specificity is still not well understood. In this paper, we investigated the role of protein flexibility in protein-DNA-binding specificity by comparative molecular dynamics (MD) simulations. Protein flexibility has been considered as a key factor in molecular recognition, which is intrinsically a dynamic process involving fine structural fitting between binding components. In this study, we performed comparative MD simulations on wild-type and F10V mutant P22 Arc repressor in both free and complex conformations. The F10V mutant has lower DNA-binding specificity though both the bound and unbound main-chain structures between the wild-type and F10V mutant Arc are highly similar. We found that the DNA-binding motif of wild-type Arc is structurally more flexible than the F10V mutant in the unbound state, especially for the six DNA base-contacting residues in each dimer. We demonstrated that the flexible side chains of wild-type Arc lead to a higher DNA-binding specificity through forming more hydrogen bonds with DNA bases upon binding. Our simulations also showed a possible conformational selection mechanism for Arc-DNA binding. These results indicate the important roles of protein flexibility and dynamic properties in protein-DNA-binding specificity.

BuD, a helix–loop–helix DNA-binding domain for genome modification

PubMed Central

Stella, Stefano; Molina, Rafael; López-Méndez, Blanca; Juillerat, Alexandre; Bertonati, Claudia; Daboussi, Fayza; Campos-Olivas, Ramon; Duchateau, Phillippe; Montoya, Guillermo

2014-01-01

DNA editing offers new possibilities in synthetic biology and biomedicine for modulation or modification of cellular functions to organisms. However, inaccuracy in this process may lead to genome damage. To address this important problem, a strategy allowing specific gene modification has been achieved through the addition, removal or exchange of DNA sequences using customized proteins and the endogenous DNA-repair machinery. Therefore, the engineering of specific protein–DNA interactions in protein scaffolds is key to providing ‘toolkits’ for precise genome modification or regulation of gene expression. In a search for putative DNA-binding domains, BurrH, a protein that recognizes a 19 bp DNA target, was identified. Here, its apo and DNA-bound crystal structures are reported, revealing a central region containing 19 repeats of a helix–loop–helix modular domain (BurrH domain; BuD), which identifies the DNA target by a single residue-to-nucleotide code, thus facilitating its redesign for gene targeting. New DNA-binding specificities have been engineered in this template, showing that BuD-derived nucleases (BuDNs) induce high levels of gene targeting in a locus of the human haemoglobin β (HBB) gene close to mutations responsible for sickle-cell anaemia. Hence, the unique combination of high efficiency and specificity of the BuD arrays can push forward diverse genome-modification approaches for cell or organism redesign, opening new avenues for gene editing. PMID:25004980

A DNA-binding protein from Candida albicans that binds to the RPG box of Saccharomyces cerevisiae and the telomeric repeat sequence of C. albicans.

PubMed

Ishii, N; Yamamoto, M; Lahm, H W; Iizumi, S; Yoshihara, F; Nakayama, H; Arisawa, M; Aoki, Y

1997-02-01

Electromobility shift assays with a DNA probe containing the Saccharomyces cerevisiae ENO1 RPG box identified a specific DNA-binding protein in total protein extracts of Candida albicans. The protein, named Rbf1p (RPG-box-binding protein 1), bound to other S. cerevisiae RPG boxes, although the nucleotide recognition profile was not completely the same as that of S. cerevisiae Rap 1p (repressor-activator protein 1), an RPG-box-binding protein. The repetitive sequence of the C. albicans chromosomal telomere also competed with RPG-box binding to Rbf1p. For further analysis, we purified Rbf1p 57,600-fold from C. albicans total protein extracts, raised mAbs against the purified protein and immunologically cloned the gene, whose ORF specified a protein of 527 aa. The bacterially expressed protein showed RPG-box-binding activity with the same profile as that of the purified one. The Rbf1p, containing two glutamine-rich regions that are found in many transcription factors, showed transcriptional activation capability in S. cerevisiae and was predominantly observed in nuclei. These results suggest that Rbf1p is a transcription factor with telomere-binding activity in C. albicans.

Method and apparatus for synthesis of arrays of DNA probes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cerrina, Francesco; Sussman, Michael R.; Blattner, Frederick R.

The synthesis of arrays of DNA probes sequences, polypeptides, and the like is carried out using a patterning process on an active surface of a substrate. An image is projected onto the active surface of the substrate utilizing an image former that includes a light source that provides light to a micromirror device comprising an array of electronically addressable micromirrors, each of which can be selectively tilted between one of at least two positions. Projection optics receives the light reflected from the micromirrors along an optical axis and precisely images the micromirrors onto the active surface of the substrate, whichmore » may be used to activate the surface of the substrate. The first level of bases may then be applied to the substrate, followed by development steps, and subsequent exposure of the substrate utilizing a different pattern of micromirrors, with further repeats until the elements of a two dimensional array on the substrate surface have an appropriate base bound thereto. The micromirror array can be controlled in conjunction with a DNA synthesizer supplying appropriate reagents to a flow cell containing the active substrate to control the sequencing of images presented by the micromirror array in coordination of the reagents provided to the substrate.« less

Cloning of soluble alkaline phosphatase cDNA and molecular basis of the polymorphic nature in alkaline phosphatase isozymes of Bombyx mori midgut.

PubMed

Itoh, M; Kanamori, Y; Takao, M; Eguchi, M

1999-02-01

A cDNA coding for soluble type alkaline phosphatase (sALP) of Bombyx mori was isolated. Deduced amino acid sequence showed high identities to various ALPs and partial similarities to ATPase of Manduca sexta. Using this cDNA sequence as a probe, the molecular basis of electrophoretic polymorphism in sALP and membrane-bound type ALP (mALP) was studied. As for mALP, the result suggested that post-translational modification was important for the proteins to express activity and to represent their extensive polymorphic nature, whereas the magnitude of activities was mainly regulated by transcription. On the other hand, sALP zymogram showed poor polymorphism, but one exception was the null mutant, in which the sALP gene was largely lost. Interestingly, the sALP gene was shown to be transcribed into two mRNAs of different sizes, 2.0 and 2.4 Kb. In addition to the null mutant of sALP, we found a null mutant for mALP. Both of these mutants seem phenotypically silent, suggesting that the functional differentiation between these isozymes is not perfect, so that they can still work mutually and complement each other as an indispensable enzyme for B. mori.

Biosynthesis of edeine: II. Localization of edeine synthetase within Bacillus brevis Vm4.

PubMed

Kurylo-Borowska, Z

1975-07-14

Edeine-synthesizing polyenzymes, associated with a complex of sytoplasmic membrane and DNA, were obtained from gently lysed cells of Bacillus brevis Vm4. The polyenzymes-membrane-DNA complex, isolated from dells intensively synthesizing edeines (18--20 h culture) contained edeine B. Edeine B was found to be bound covalently t o the edeine synthetase. The amount of edeine bound to polyenzymes was 0.1--0.3 mumol/mg protein, depending on the age of cells. Detachment of deeine synthetase with a covalently bound edeine B from the membrane-DNA complex was accomplished by a treatment with (NH4)2-SO4 at 45--55% saturation or by DEAE-cellulose column fractionation. In contrast to other components of the complex, the edeine-polyenzymes fragment was not adsorbed to the DEAE-cellulose. Sephadex G-200 column chromatography separated the edeine-polyenzymes complex into 3 fractions. Edeine-polyenzymes complex, obtained from lysozyme-Brij-58-DNAase treated cells, contained edeine B bound to two protein fractions of mol. wt 210 000 and 160 000. Edeine-polyenzymes complex detached from the complex with the membrane and DNA contained edeine B, bound only to protein fraction of mol. wt 210 000. Edeine A was not found in the edeine-polyenzymes complex. No accumulation of free antibiotics within 16--22 h old cells of B. brevis Vm4 was detected. The edeine-polyenzymes complex associated with the DNA-membrane complex has shown no antimicrobial activity. By treating of above with alkali, edeine B of specific activity: 80 units/mjmol was released. The complex of DNA-membrane associated with edeine-polyenzymes complex was able to synthesize DNA, under the conditions described for synthesis, directed by a DNA-membrane complex. Edeine when associated with this complex did not effect the DNA-synthesizing activity.

Recognition of AT-Rich DNA Binding Sites by the MogR Repressor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shen, Aimee; Higgins, Darren E.; Panne, Daniel

2009-07-22

The MogR transcriptional repressor of the intracellular pathogen Listeria monocytogenes recognizes AT-rich binding sites in promoters of flagellar genes to downregulate flagellar gene expression during infection. We describe here the 1.8 A resolution crystal structure of MogR bound to the recognition sequence 5' ATTTTTTAAAAAAAT 3' present within the flaA promoter region. Our structure shows that MogR binds as a dimer. Each half-site is recognized in the major groove by a helix-turn-helix motif and in the minor groove by a loop from the symmetry-related molecule, resulting in a 'crossover' binding mode. This oversampling through minor groove interactions is important for specificity.more » The MogR binding site has structural features of A-tract DNA and is bent by approximately 52 degrees away from the dimer. The structure explains how MogR achieves binding specificity in the AT-rich genome of L. monocytogenes and explains the evolutionary conservation of A-tract sequence elements within promoter regions of MogR-regulated flagellar genes.« less

DNA sequence-dependent compartmentalization and silencing of chromatin at the nuclear lamina.

PubMed

Zullo, Joseph M; Demarco, Ignacio A; Piqué-Regi, Roger; Gaffney, Daniel J; Epstein, Charles B; Spooner, Chauncey J; Luperchio, Teresa R; Bernstein, Bradley E; Pritchard, Jonathan K; Reddy, Karen L; Singh, Harinder

2012-06-22

A large fraction of the mammalian genome is organized into inactive chromosomal domains along the nuclear lamina. The mechanism by which these lamina associated domains (LADs) are established remains to be elucidated. Using genomic repositioning assays, we show that LADs, spanning the developmentally regulated IgH and Cyp3a loci contain discrete DNA regions that associate chromatin with the nuclear lamina and repress gene activity in fibroblasts. Lamina interaction is established during mitosis and likely involves the localized recruitment of Lamin B during late anaphase. Fine-scale mapping of LADs reveals numerous lamina-associating sequences (LASs), which are enriched for a GAGA motif. This repeated motif directs lamina association and is bound by the transcriptional repressor cKrox, in a complex with HDAC3 and Lap2β. Knockdown of cKrox or HDAC3 results in dissociation of LASs/LADs from the nuclear lamina. These results reveal a mechanism that couples nuclear compartmentalization of chromatin domains with the control of gene activity. Copyright © 2012 Elsevier Inc. All rights reserved.

RNA Polymerase II Regulates Topoisomerase 1 Activity to Favor Efficient Transcription.

PubMed

Baranello, Laura; Wojtowicz, Damian; Cui, Kairong; Devaiah, Ballachanda N; Chung, Hye-Jung; Chan-Salis, Ka Yim; Guha, Rajarshi; Wilson, Kelli; Zhang, Xiaohu; Zhang, Hongliang; Piotrowski, Jason; Thomas, Craig J; Singer, Dinah S; Pugh, B Franklin; Pommier, Yves; Przytycka, Teresa M; Kouzine, Fedor; Lewis, Brian A; Zhao, Keji; Levens, David

2016-04-07

We report a mechanism through which the transcription machinery directly controls topoisomerase 1 (TOP1) activity to adjust DNA topology throughout the transcription cycle. By comparing TOP1 occupancy using chromatin immunoprecipitation sequencing (ChIP-seq) versus TOP1 activity using topoisomerase 1 sequencing (TOP1-seq), a method reported here to map catalytically engaged TOP1, TOP1 bound at promoters was discovered to become fully active only after pause-release. This transition coupled the phosphorylation of the carboxyl-terminal-domain (CTD) of RNA polymerase II (RNAPII) with stimulation of TOP1 above its basal rate, enhancing its processivity. TOP1 stimulation is strongly dependent on the kinase activity of BRD4, a protein that phosphorylates Ser2-CTD and regulates RNAPII pause-release. Thus the coordinated action of BRD4 and TOP1 overcame the torsional stress opposing transcription as RNAPII commenced elongation but preserved negative supercoiling that assists promoter melting at start sites. This nexus between transcription and DNA topology promises to elicit new strategies to intercept pathological gene expression. Copyright © 2016 Elsevier Inc. All rights reserved.

Multi-shell model of ion-induced nucleic acid condensation

NASA Astrophysics Data System (ADS)

Tolokh, Igor S.; Drozdetski, Aleksander V.; Pollack, Lois; Baker, Nathan A.; Onufriev, Alexey V.

2016-04-01

We present a semi-quantitative model of condensation of short nucleic acid (NA) duplexes induced by trivalent cobalt(iii) hexammine (CoHex) ions. The model is based on partitioning of bound counterion distribution around single NA duplex into "external" and "internal" ion binding shells distinguished by the proximity to duplex helical axis. In the aggregated phase the shells overlap, which leads to significantly increased attraction of CoHex ions in these overlaps with the neighboring duplexes. The duplex aggregation free energy is decomposed into attractive and repulsive components in such a way that they can be represented by simple analytical expressions with parameters derived from molecular dynamic simulations and numerical solutions of Poisson equation. The attractive term depends on the fractions of bound ions in the overlapping shells and affinity of CoHex to the "external" shell of nearly neutralized duplex. The repulsive components of the free energy are duplex configurational entropy loss upon the aggregation and the electrostatic repulsion of the duplexes that remains after neutralization by bound CoHex ions. The estimates of the aggregation free energy are consistent with the experimental range of NA duplex condensation propensities, including the unusually poor condensation of RNA structures and subtle sequence effects upon DNA condensation. The model predicts that, in contrast to DNA, RNA duplexes may condense into tighter packed aggregates with a higher degree of duplex neutralization. An appreciable CoHex mediated RNA-RNA attraction requires closer inter-duplex separation to engage CoHex ions (bound mostly in the "internal" shell of RNA) into short-range attractive interactions. The model also predicts that longer NA fragments will condense more readily than shorter ones. The ability of this model to explain experimentally observed trends in NA condensation lends support to proposed NA condensation picture based on the multivalent "ion binding shells."

The DnaA N-terminal domain interacts with Hda to facilitate replicase clamp-mediated inactivation of DnaA.

PubMed

Su'etsugu, Masayuki; Harada, Yuji; Keyamura, Kenji; Matsunaga, Chika; Kasho, Kazutoshi; Abe, Yoshito; Ueda, Tadashi; Katayama, Tsutomu

2013-12-01

DnaA activity for replication initiation of the Escherichia coli chromosome is negatively regulated by feedback from the DNA-loaded form of the replicase clamp. In this process, called RIDA (regulatory inactivation of DnaA), ATP-bound DnaA transiently assembles into a complex consisting of Hda and the DNA-clamp, which promotes inter-AAA+ domain association between Hda and DnaA and stimulates hydrolysis of DnaA-bound ATP, producing inactive ADP-DnaA. Using a truncated DnaA mutant, we previously demonstrated that the DnaA N-terminal domain is involved in RIDA. However, the precise role of the N-terminal domain in RIDA has remained largely unclear. Here, we used an in vitro reconstituted system to demonstrate that the Asn-44 residue in the N-terminal domain of DnaA is crucial for RIDA but not for replication initiation. Moreover, an assay termed PDAX (pull-down after cross-linking) revealed an unstable interaction between a DnaA-N44A mutant and Hda. In vivo, this mutant exhibited an increase in the cellular level of ATP-bound DnaA. These results establish a model in which interaction between DnaA Asn-44 and Hda stabilizes the association between the AAA+ domains of DnaA and Hda to facilitate DnaA-ATP hydrolysis during RIDA. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.

Single-Nucleotide-Specific Targeting of the Tf1 Retrotransposon Promoted by the DNA-Binding Protein Sap1 of Schizosaccharomyces pombe.

PubMed

Hickey, Anthony; Esnault, Caroline; Majumdar, Anasuya; Chatterjee, Atreyi Ghatak; Iben, James R; McQueen, Philip G; Yang, Andrew X; Mizuguchi, Takeshi; Grewal, Shiv I S; Levin, Henry L

2015-11-01

Transposable elements (TEs) constitute a substantial fraction of the eukaryotic genome and, as a result, have a complex relationship with their host that is both adversarial and dependent. To minimize damage to cellular genes, TEs possess mechanisms that target integration to sequences of low importance. However, the retrotransposon Tf1 of Schizosaccharomyces pombe integrates with a surprising bias for promoter sequences of stress-response genes. The clustering of integration in specific promoters suggests that Tf1 possesses a targeting mechanism that is important for evolutionary adaptation to changes in environment. We report here that Sap1, an essential DNA-binding protein, plays an important role in Tf1 integration. A mutation in Sap1 resulted in a 10-fold drop in Tf1 transposition, and measures of transposon intermediates support the argument that the defect occurred in the process of integration. Published ChIP-Seq data on Sap1 binding combined with high-density maps of Tf1 integration that measure independent insertions at single-nucleotide positions show that 73.4% of all integration occurs at genomic sequences bound by Sap1. This represents high selectivity because Sap1 binds just 6.8% of the genome. A genome-wide analysis of promoter sequences revealed that Sap1 binding and amounts of integration correlate strongly. More important, an alignment of the DNA-binding motif of Sap1 revealed integration clustered on both sides of the motif and showed high levels specifically at positions +19 and -9. These data indicate that Sap1 contributes to the efficiency and position of Tf1 integration. Copyright © 2015 by the Genetics Society of America.

Single-Nucleotide-Specific Targeting of the Tf1 Retrotransposon Promoted by the DNA-Binding Protein Sap1 of Schizosaccharomyces pombe

PubMed Central

Hickey, Anthony; Esnault, Caroline; Majumdar, Anasuya; Chatterjee, Atreyi Ghatak; Iben, James R.; McQueen, Philip G.; Yang, Andrew X.; Mizuguchi, Takeshi; Grewal, Shiv I. S.; Levin, Henry L.

2015-01-01

Transposable elements (TEs) constitute a substantial fraction of the eukaryotic genome and, as a result, have a complex relationship with their host that is both adversarial and dependent. To minimize damage to cellular genes, TEs possess mechanisms that target integration to sequences of low importance. However, the retrotransposon Tf1 of Schizosaccharomyces pombe integrates with a surprising bias for promoter sequences of stress-response genes. The clustering of integration in specific promoters suggests that Tf1 possesses a targeting mechanism that is important for evolutionary adaptation to changes in environment. We report here that Sap1, an essential DNA-binding protein, plays an important role in Tf1 integration. A mutation in Sap1 resulted in a 10-fold drop in Tf1 transposition, and measures of transposon intermediates support the argument that the defect occurred in the process of integration. Published ChIP-Seq data on Sap1 binding combined with high-density maps of Tf1 integration that measure independent insertions at single-nucleotide positions show that 73.4% of all integration occurs at genomic sequences bound by Sap1. This represents high selectivity because Sap1 binds just 6.8% of the genome. A genome-wide analysis of promoter sequences revealed that Sap1 binding and amounts of integration correlate strongly. More important, an alignment of the DNA-binding motif of Sap1 revealed integration clustered on both sides of the motif and showed high levels specifically at positions +19 and −9. These data indicate that Sap1 contributes to the efficiency and position of Tf1 integration. PMID:26358720

Ectomycorrhizal Cortinarius species participate in enzymatic oxidation of humus in northern forest ecosystems.

PubMed

Bödeker, Inga T M; Clemmensen, Karina E; de Boer, Wietse; Martin, Francis; Olson, Åke; Lindahl, Björn D

2014-07-01

In northern forests, belowground sequestration of nitrogen (N) in complex organic pools restricts nutrient availability to plants. Oxidative extracellular enzymes produced by ectomycorrhizal fungi may aid plant N acquisition by providing access to N in macromolecular complexes. We test the hypotheses that ectomycorrhizal Cortinarius species produce Mn-dependent peroxidases, and that the activity of these enzymes declines at elevated concentrations of inorganic N. In a boreal pine forest and a sub-arctic birch forest, Cortinarius DNA was assessed by 454-sequencing of ITS amplicons and related to Mn-peroxidase activity in humus samples with- and without previous N amendment. Transcription of Cortinarius Mn-peroxidase genes was investigated in field samples. Phylogenetic analyses of Cortinarius peroxidase amplicons and genome sequences were performed. We found a significant co-localization of high peroxidase activity and DNA from Cortinarius species. Peroxidase activity was reduced by high ammonium concentrations. Amplification of mRNA sequences indicated transcription of Cortinarius Mn-peroxidase genes under field conditions. The Cortinarius glaucopus genome encodes 11 peroxidases - a number comparable to many white-rot wood decomposers. These results support the hypothesis that some ectomycorrhizal fungi--Cortinarius species in particular--may play an important role in decomposition of complex organic matter, linked to their mobilization of organically bound N. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

Alteration of Escherichia coli topoisomerase IV conformation upon enzyme binding to positively supercoiled DNA.

PubMed

Crisona, Nancy J; Cozzarelli, Nicholas R

2006-07-14

Escherichia coli topoisomerase IV (topo IV) is an essential enzyme that unlinks the daughter chromosomes for proper segregation at cell division. In vitro, topo IV readily distinguishes between the two possible chiralities of crossing segments in a DNA substrate. The enzyme relaxes positive supercoils and left-handed braids 20 times faster, and with greater processivity, than negative supercoils and right-handed braids. Here, we used chemical cross-linking of topo IV to demonstrate that enzyme bound to positively supercoiled DNA is in a different conformation from that bound to other forms of DNA. Using three different reagents, we observed novel cross-linked species of topo IV when positively supercoiled DNA was in the reaction. We show that the ParE subunits are in close enough proximity to be cross-linked only when the enzyme is bound to positively supercoiled DNA. We suggest that the altered conformation reflects efficient binding by topo IV of the two DNA segments that participate in the strand passage reaction.

Evaluation of Biological and Physical Protection against Nuclease Degradation of Clay-Bound Plasmid DNA

PubMed Central

Demanèche, Sandrine; Jocteur-Monrozier, Lucile; Quiquampoix, Hervé; Simonet, Pascal

2001-01-01

In order to determine the mechanisms involved in the persistence of extracellular DNA in soils and to monitor whether bacterial transformation could occur in such an environment, we developed artificial models composed of plasmid DNA adsorbed on clay particles. We determined that clay-bound DNA submitted to an increasing range of nuclease concentrations was physically protected. The protection mechanism was mainly related to the adsorption of the nuclease on the clay mineral. The biological potential of the resulting DNA was monitored by transforming the naturally competent proteobacterium Acinetobacter sp. strain BD413, allowing us to demonstrate that adsorbed DNA was only partially available for transformation. This part of the clay-bound DNA which was available for bacteria, was also accessible to nucleases, while the remaining fraction escaped both transformation and degradation. Finally, transformation efficiency was related to the perpetuation mechanism, with homologous recombination being less sensitive to nucleases than autonomous replication, which requires intact molecules. PMID:11133458

CHD8 regulates neurodevelopmental pathways associated with autism spectrum disorder in neural progenitors

PubMed Central

Sugathan, Aarathi; Biagioli, Marta; Golzio, Christelle; Erdin, Serkan; Blumenthal, Ian; Manavalan, Poornima; Ragavendran, Ashok; Brand, Harrison; Lucente, Diane; Miles, Judith; Sheridan, Steven D.; Stortchevoi, Alexei; Kellis, Manolis; Haggarty, Stephen J.; Katsanis, Nicholas; Gusella, James F.; Talkowski, Michael E.

2014-01-01

Truncating mutations of chromodomain helicase DNA-binding protein 8 (CHD8), and of many other genes with diverse functions, are strong-effect risk factors for autism spectrum disorder (ASD), suggesting multiple mechanisms of pathogenesis. We explored the transcriptional networks that CHD8 regulates in neural progenitor cells (NPCs) by reducing its expression and then integrating transcriptome sequencing (RNA sequencing) with genome-wide CHD8 binding (ChIP sequencing). Suppressing CHD8 to levels comparable with the loss of a single allele caused altered expression of 1,756 genes, 64.9% of which were up-regulated. CHD8 showed widespread binding to chromatin, with 7,324 replicated sites that marked 5,658 genes. Integration of these data suggests that a limited array of direct regulatory effects of CHD8 produced a much larger network of secondary expression changes. Genes indirectly down-regulated (i.e., without CHD8-binding sites) reflect pathways involved in brain development, including synapse formation, neuron differentiation, cell adhesion, and axon guidance, whereas CHD8-bound genes are strongly associated with chromatin modification and transcriptional regulation. Genes associated with ASD were strongly enriched among indirectly down-regulated loci (P < 10−8) and CHD8-bound genes (P = 0.0043), which align with previously identified coexpression modules during fetal development. We also find an intriguing enrichment of cancer-related gene sets among CHD8-bound genes (P < 10−10). In vivo suppression of chd8 in zebrafish produced macrocephaly comparable to that of humans with inactivating mutations. These data indicate that heterozygous disruption of CHD8 precipitates a network of gene-expression changes involved in neurodevelopmental pathways in which many ASD-associated genes may converge on shared mechanisms of pathogenesis. PMID:25294932

Structures of apo IRF-3 and IRF-7 DNA binding domains: effect of loop L1 on DNA binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

De Ioannes, Pablo; Escalante, Carlos R.; Aggarwal, Aneel K.

2013-11-20

Interferon regulatory factors IRF-3 and IRF-7 are transcription factors essential in the activation of interferon-{beta} (IFN-{beta}) gene in response to viral infections. Although, both proteins recognize the same consensus IRF binding site AANNGAAA, they have distinct DNA binding preferences for sites in vivo. The X-ray structures of IRF-3 and IRF-7 DNA binding domains (DBDs) bound to IFN-{beta} promoter elements revealed flexibility in the loops (L1-L3) and the residues that make contacts with the target sequence. To characterize the conformational changes that occur on DNA binding and how they differ between IRF family members, we have solved the X-ray structures ofmore » IRF-3 and IRF-7 DBDs in the absence of DNA. We found that loop L1, carrying the conserved histidine that interacts with the DNA minor groove, is disordered in apo IRF-3 but is ordered in apo IRF-7. This is reflected in differences in DNA binding affinities when the conserved histidine in loop L1 is mutated to alanine in the two proteins. The stability of loop L1 in IRF-7 derives from a unique combination of hydrophobic residues that pack against the protein core. Together, our data show that differences in flexibility of loop L1 are an important determinant of differential IRF-DNA binding.« less

Role of the CCA bulge of prohead RNA of bacteriophage ø29 in DNA packaging.

PubMed

Zhao, Wei; Morais, Marc C; Anderson, Dwight L; Jardine, Paul J; Grimes, Shelley

2008-11-14

The oligomeric ring of prohead RNA (pRNA) is an essential component of the ATP-driven DNA packaging motor of bacteriophage ø29. The A-helix of pRNA binds the DNA translocating ATPase gp16 (gene product 16) and the CCA bulge in this helix is essential for DNA packaging in vitro. Mutation of the bulge by base substitution or deletion showed that the size of the bulge, rather than its sequence, is primary in DNA packaging activity. Proheads reconstituted with CCA bulge mutant pRNAs bound the packaging ATPase gp16 and the packaging substrate DNA-gp3, although DNA translocation was not detected with several mutants. Prohead/bulge-mutant pRNA complexes with low packaging activity had a higher rate of ATP hydrolysis per base pair of DNA packaged than proheads with wild-type pRNA. Cryoelectron microscopy three-dimensional reconstruction of proheads reconstituted with a CCA deletion pRNA showed that the protruding pRNA spokes of the motor occupy a different position relative to the head when compared to particles with wild-type pRNA. Therefore, the CCA bulge seems to dictate the orientation of the pRNA spokes. The conformational changes observed for this mutant pRNA may affect gp16 conformation and/or subsequent ATPase-DNA interaction and, consequently, explain the decreased packaging activity observed for CCA mutants.

Beyond the binding site: in vivo identification of tbx2, smarca5 and wnt5b as molecular targets of CNBP during embryonic development.

PubMed

Armas, Pablo; Margarit, Ezequiel; Mouguelar, Valeria S; Allende, Miguel L; Calcaterra, Nora B

2013-01-01

CNBP is a nucleic acid chaperone implicated in vertebrate craniofacial development, as well as in myotonic dystrophy type 2 (DM2) and sporadic inclusion body myositis (sIBM) human muscle diseases. CNBP is highly conserved among vertebrates and has been implicated in transcriptional regulation; however, its DNA binding sites and molecular targets remain elusive. The main goal of this work was to identify CNBP DNA binding sites that might reveal target genes involved in vertebrate embryonic development. To accomplish this, we used a recently described yeast one-hybrid assay to identify DNA sequences bound in vivo by CNBP. Bioinformatic analyses revealed that these sequences are G-enriched and show high frequency of putative G-quadruplex DNA secondary structure. Moreover, an in silico approach enabled us to establish the CNBP DNA-binding site and to predict CNBP putative targets based on gene ontology terms and synexpression with CNBP. The direct interaction between CNBP and candidate genes was proved by EMSA and ChIP assays. Besides, the role of CNBP upon the identified genes was validated in loss-of-function experiments in developing zebrafish. We successfully confirmed that CNBP up-regulates tbx2b and smarca5, and down-regulates wnt5b gene expression. The highly stringent strategy used in this work allowed us to identify new CNBP target genes functionally important in different contexts of vertebrate embryonic development. Furthermore, it represents a novel approach toward understanding the biological function and regulatory networks involving CNBP in the biology of vertebrates.

Beyond the Binding Site: In Vivo Identification of tbx2, smarca5 and wnt5b as Molecular Targets of CNBP during Embryonic Development

PubMed Central

Mouguelar, Valeria S.; Allende, Miguel L.; Calcaterra, Nora B.

2013-01-01

CNBP is a nucleic acid chaperone implicated in vertebrate craniofacial development, as well as in myotonic dystrophy type 2 (DM2) and sporadic inclusion body myositis (sIBM) human muscle diseases. CNBP is highly conserved among vertebrates and has been implicated in transcriptional regulation; however, its DNA binding sites and molecular targets remain elusive. The main goal of this work was to identify CNBP DNA binding sites that might reveal target genes involved in vertebrate embryonic development. To accomplish this, we used a recently described yeast one-hybrid assay to identify DNA sequences bound in vivo by CNBP. Bioinformatic analyses revealed that these sequences are G-enriched and show high frequency of putative G-quadruplex DNA secondary structure. Moreover, an in silico approach enabled us to establish the CNBP DNA-binding site and to predict CNBP putative targets based on gene ontology terms and synexpression with CNBP. The direct interaction between CNBP and candidate genes was proved by EMSA and ChIP assays. Besides, the role of CNBP upon the identified genes was validated in loss-of-function experiments in developing zebrafish. We successfully confirmed that CNBP up-regulates tbx2b and smarca5, and down-regulates wnt5b gene expression. The highly stringent strategy used in this work allowed us to identify new CNBP target genes functionally important in different contexts of vertebrate embryonic development. Furthermore, it represents a novel approach toward understanding the biological function and regulatory networks involving CNBP in the biology of vertebrates. PMID:23667590

Two new insulator proteins, Pita and ZIPIC, target CP190 to chromatin.

PubMed

Maksimenko, Oksana; Bartkuhn, Marek; Stakhov, Viacheslav; Herold, Martin; Zolotarev, Nickolay; Jox, Theresa; Buxa, Melanie K; Kirsch, Ramona; Bonchuk, Artem; Fedotova, Anna; Kyrchanova, Olga; Renkawitz, Rainer; Georgiev, Pavel

2015-01-01

Insulators are multiprotein-DNA complexes that regulate the nuclear architecture. The Drosophila CP190 protein is a cofactor for the DNA-binding insulator proteins Su(Hw), CTCF, and BEAF-32. The fact that CP190 has been found at genomic sites devoid of either of the known insulator factors has until now been unexplained. We have identified two DNA-binding zinc-finger proteins, Pita, and a new factor named ZIPIC, that interact with CP190 in vivo and in vitro at specific interaction domains. Genomic binding sites for these proteins are clustered with CP190 as well as with CTCF and BEAF-32. Model binding sites for Pita or ZIPIC demonstrate a partial enhancer-blocking activity and protect gene expression from PRE-mediated silencing. The function of the CTCF-bound MCP insulator sequence requires binding of Pita. These results identify two new insulator proteins and emphasize the unifying function of CP190, which can be recruited by many DNA-binding insulator proteins. © 2015 Maksimenko et al.; Published by Cold Spring Harbor Laboratory Press.

A structural-alphabet-based strategy for finding structural motifs across protein families

PubMed Central

Wu, Chih Yuan; Chen, Yao Chi; Lim, Carmay

2010-01-01

Proteins with insignificant sequence and overall structure similarity may still share locally conserved contiguous structural segments; i.e. structural/3D motifs. Most methods for finding 3D motifs require a known motif to search for other similar structures or functionally/structurally crucial residues. Here, without requiring a query motif or essential residues, a fully automated method for discovering 3D motifs of various sizes across protein families with different folds based on a 16-letter structural alphabet is presented. It was applied to structurally non-redundant proteins bound to DNA, RNA, obligate/non-obligate proteins as well as free DNA-binding proteins (DBPs) and proteins with known structures but unknown function. Its usefulness was illustrated by analyzing the 3D motifs found in DBPs. A non-specific motif was found with a ‘corner’ architecture that confers a stable scaffold and enables diverse interactions, making it suitable for binding not only DNA but also RNA and proteins. Furthermore, DNA-specific motifs present ‘only’ in DBPs were discovered. The motifs found can provide useful guidelines in detecting binding sites and computational protein redesign. PMID:20525797

Structural and Functional Studies of the Protamine 2-Zinc Complex from Syrian Gold Hamster (Mesocricetus Auratus) Spermatids and Sperm

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dolan, Cheryl E.

The research described in this dissertation consists of four major areas: (1) sequence analysis of protamine 2 from Muroid rodents to identify potential zinc-binding domain(s) of protamine 2; (2) structural studies of the protamine 2-zinc complex from Syrian Gold hamster sperm and spermatids to elucidate the role of zinc during spermiogenesis; (3) structural studies of an unique protamine 2-zinc complex from chinchilla sperm; and (4) Nuclear Magnetic Resonance (NMR) studies of soluble complexes of hairpin oligonucleotides with synthetic arginine-rich peptides or protamine 1 isolated from bull sperm. First, zinc was quantitated in spermatids and sperm by Proton-Induced X-ray Emission (PIXE)more » to determine whether zinc is present in the early stages of spermiogenesis. The PIXE results revealed the zinc content varies proportionately with the amount of protamine 2 in both spermatid and sperm nuclei. An exception was chinchilla sperm containing twice the amount of protamine 2 than zinc. Further analyses by PIXE and X-ray Absorption Spectroscopy (XAS) of zinc bound to protamines isolated from hamster sperm confirmed the majority of the zinc is bound to protamine and identified the zinc ligands of protamine 2 in hamster spermatids and sperm in vivo. These studies established that zinc is bound to the protamine 2 precursor in hamster spermatids and the coordination of zinc by protamine 2 changes during spermiogenesis. Finally, the sequence analysis combined with the XAS results suggest that the zinc-binding domain in protamine 2 resides in the amino-terminus. Similar analyses of chinchilla sperm by XAS were performed to clarify the unusual PIXE results and revealed that chinchilla has an atypical protamine 2-zinc structure. Two protamine 2 molecules coordinate one zinc atom, forming homodimers that facilitate the binding of protamine 2 to DNA and provide an organizational scheme that would accommodate the observed species-specific protamine stoichiometry in mammalian sperm. Based on these results, we propose the binding of zinc to protamine 2 molecules stabilizes a dimerization domain in other mammalian sperm. Future experiments will use the knowledge we gained of the interactions between protamine 1 and DNA from the NMR studies to obtain structural data for the DNA-protamine 2-zinc complex.« less

Gene capture from across the grass family in the allohexaploid Elymus repens (L.) Gould (Poaceae, Triticeae) as evidenced by ITS, GBSSI, and molecular cytogenetics.

PubMed

Mahelka, Václav; Kopecký, David

2010-06-01

Four accessions of hexaploid Elymus repens from its native Central European distribution area were analyzed using sequencing of multicopy (internal transcribed spacer, ITS) and single-copy (granule-bound starch synthase I, GBSSI) DNA in concert with genomic and fluorescent in situ hybridization (GISH and FISH) to disentangle its allopolyploid origin. Despite extensive ITS homogenization, nrDNA in E. repens allowed us to identify at least four distinct lineages. Apart from Pseudoroegneria and Hordeum, representing the major genome constituents, the presence of further unexpected alien genetic material, originating from species outside the Triticeae and close to Panicum (Paniceae) and Bromus (Bromeae), was revealed. GBSSI sequences provided information complementary to the ITS. Apart from Pseudoroegneria and Hordeum, two additional gene variants from within the Triticeae were discovered: One was Taeniatherum-like, but the other did not have a close relationship with any of the diploids sampled. GISH results were largely congruent with the sequence-based markers. GISH clearly confirmed Pseudoroegneria and Hordeum as major genome constituents and further showed the presence of a small chromosome segment corresponding to Panicum. It resided in the Hordeum subgenome and probably represents an old acquisition of a Hordeum progenitor. Spotty hybridization signals across all chromosomes after GISH with Taeniatherum and Bromus probes suggested that gene acquisition from these species is more likely due to common ancestry of the grasses or early introgression than to recent hybridization or allopolyploid origin of E. repens. Physical mapping of rDNA loci using FISH revealed that all rDNA loci except one minor were located on Pseudoroegneria-derived chromosomes, which suggests the loss of all Hordeum-derived loci but one. Because homogenization mechanisms seem to operate effectively among Pseudoroegneria-like copies in this species, incomplete ITS homogenization in our samples is probably due to an interstitial position of an individual minor rDNA locus located within the Hordeum-derived subgenome.

Direct observation of transcription activator-like effector (TALE) protein dynamics

NASA Astrophysics Data System (ADS)

Cuculis, Luke; Abil, Zhanar; Zhao, Huimin; Schroeder, Charles M.

2014-03-01

In this work, we describe a single molecule assay to probe the site-search dynamics of transcription activator-like effector (TALE) proteins along DNA. In modern genetics, the ability to selectively edit the human genome is an unprecedented development, driven by recent advances in targeted nuclease proteins. Specific gene editing can be accomplished using TALE proteins, which are programmable DNA-binding proteins that can be fused to a nuclease domain. In this way, TALENs are a leading technology that has shown great success in the genomic editing of pluripotent stem cells. A major hurdle facing clinical implementation, however, is the potential for deleterious off-target binding events. For these reasons, a molecular-level understanding of TALE binding and target sequence search on DNA is essential. To this end, we developed a single-molecule fluorescence imaging assay that provides a first-of-its-kind view of the 1-D diffusion of TALE proteins along stretched DNA. Taken together with co-crystal structures of DNA-bound TALEs, our results suggest a rotationally-coupled, major groove tracking model for diffusion. We further report diffusion constants for TALE proteins as a function of salt concentration, consistent with previously described models of 1-D protein diffusion.

PAM-Dependent Target DNA Recognition and Cleavage by C2c1 CRISPR-Cas Endonuclease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Hui; Gao, Pu; Rajashankar, Kanagalaghatta R.

C2c1 is a newly identified guide RNA-mediated type V-B CRISPR-Cas endonuclease that site-specifically targets and cleaves both strands of target DNA. We have determined crystal structures of Alicyclobacillus acidoterrestris C2c1 (AacC2c1) bound to sgRNA as a binary complex and to target DNAs as ternary complexes, thereby capturing catalytically competent conformations of AacC2c1 with both target and non-target DNA strands independently positioned within a single RuvC catalytic pocket. Moreover, C2c1-mediated cleavage results in a staggered seven-nucleotide break of target DNA. crRNA adopts a pre-ordered five-nucleotide A-form seed sequence in the binary complex, with release of an inserted tryptophan, facilitating zippering upmore » of 20-bp guide RNA:target DNA heteroduplex on ternary complex formation. Notably, the PAM-interacting cleft adopts a “locked” conformation on ternary complex formation. Structural comparison of C2c1 ternary complexes with their Cas9 and Cpf1 counterparts highlights the diverse mechanisms adopted by these distinct CRISPR-Cas systems, thereby broadening and enhancing their applicability as genome editing tools.« less

Resistive-pulse measurements with nanopipettes: detection of Au nanoparticles and nanoparticle-bound anti-peanut IgY.

PubMed

Wang, Yixian; Kececi, Kaan; Mirkin, Michael V; Mani, Vigneshwaran; Sardesai, Naimish; Rusling, James F

2013-02-01

Solid-state nanopores have been widely employed in sensing applications from Coulter counters to DNA sequencing devices. The analytical signal in such experiments is the change in ionic current flowing through the orifice caused by the large molecule or nanoparticle translocation through the pore. Conceptually similar nanopipette-based sensors can offer several advantages including the ease of fabrication and small physical size essential for local measurements and experiments in small spaces. This paper describes the first evaluation of nanopipettes with well characterized geometry for resistive-pulse sensing of Au nanoparticles (AuNP), nanoparticles coated with an allergen epitope peptide layer, and AuNP-peptide particles with bound antipeanut antibodies (IgY) on the peptide layer. The label-free signal produced by IgY-conjugated particles was strikingly different from those obtained with other analytes, thus suggesting the possibility of selective and sensitive resistive-pulse sensing of antibodies.

Resistive-pulse measurements with nanopipettes: detection of Au nanoparticles and nanoparticle-bound anti-peanut IgY†

PubMed Central

Wang, Yixian; Kececi, Kaan; Mani, Vigneshwaran; Sardesai, Naimish

2013-01-01

Solid-state nanopores have been widely employed in sensing applications from Coulter counters to DNA sequencing devices. The analytical signal in such experiments is the change in ionic current flowing through the orifice caused by the large molecule or nanoparticle translocation through the pore. Conceptually similar nanopipette-based sensors can offer several advantages including the ease of fabrication and small physical size essential for local measurements and experiments in small spaces. This paper describes the first evaluation of nanopipettes with well characterized geometry for resistive-pulse sensing of Au nanoparticles (AuNP), nanoparticles coated with an allergen epitope peptide layer, and AuNP–peptide particles with bound antipeanut antibodies (IgY) on the peptide layer. The label-free signal produced by IgY-conjugated particles was strikingly different from those obtained with other analytes, thus suggesting the possibility of selective and sensitive resistive-pulse sensing of antibodies. PMID:23991282

Recognition Tunneling

PubMed Central

Lindsay, Stuart; He, Jin; Sankey, Otto; Hapala, Prokop; Jelinek, Pavel; Zhang, Peiming; Chang, Shuai; Huang, Shuo

2010-01-01

Single molecules in a tunnel junction can now be interrogated reliably using chemically-functionalized electrodes. Monitoring stochastic bonding fluctuations between a ligand bound to one electrode and its target bound to a second electrode (“tethered molecule-pair” configuration) gives insight into the nature of the intermolecular bonding at a single molecule-pair level, and defines the requirements for reproducible tunneling data. Simulations show that there is an instability in the tunnel gap at large currents, and this results in a multiplicity of contacts with a corresponding spread in the measured currents. At small currents (i.e. large gaps) the gap is stable, and functionalizing a pair of electrodes with recognition reagents (the “free analyte” configuration) can generate a distinct tunneling signal when an analyte molecule is trapped in the gap. This opens up a new interface between chemistry and electronics with immediate implications for rapid sequencing of single DNA molecules. PMID:20522930

The Chemical and Biological Effects of cis-Dichlorodiammineplatinum (II), an Antitumor Agent, on DNA

PubMed Central

Munchausen, Linda L.

1974-01-01

cis-Dichlorodiammineplatinum (II) binds irreversibly to the bases in DNA; the amount of platinum complex bound can be determined from changes in the ultraviolet absorption spectrum. As the ratio of platinum to phosphate is increased, an increasing inactivation of bacterial transforming DNA is observed. At a ratio that corresponds to spectrometric saturation, transforming activity is inactivated >105-fold. The trans isomer of the platinum complex, which is not effective against tumors, induces a similar inactivation of transforming DNA but with half the efficiency, indicating a different mode of binding. The sensitivity to inactivation by cis isomer varies slightly with the genetic marker assayed but is not dependent on the excision repair system. Uptake of DNA by competent cells is unaffected by bound platinum complex; however, integration of platinum-bound transforming DNA into the host genome decreases as the mole fraction of platinum increases. This loss of integration parallels the decreased transforming activity of the DNA. Although the drug induces interstrand crosslinks in DNA in vitro, these crosslinks are relatively rare events and cannot account for the observed inactivation. PMID:4548188

cDNA cloning of the murine PEX gene implicated in X-linked hypophosphatemia and evidence for expression in bone

DOE Office of Scientific and Technical Information (OSTI.GOV)

Du, L.; Desbarats, M.; Viel, J.

1996-08-15

The recently identified human PEX g ene apparently encodes for a neutral endopeptidase that is mutated in patients with X-linked hypophosphatemia. The 3{prime} and 5{prime} ends of the coding region of PEX have not been cloned, nor has the tissue expression of the gene been identified. Here we report the isolation and characterization of the complete open reading frame of the mouse Pex gene and the demonstration of its expression in bone. Mouse Pex cDNA is predicted to encode a protein of 749 amino acids with 95% identity to the available human PEX sequence and significant homology to members ofmore » the membrane-bound metalloendopeptidase family. Northern blot analysis revealed a 6.6-kb transcript in bone and in cultured osteoblasts from normal mice that was not detectable in samples from the Hyp mouse, the murine homolog of human X-linked hypophosphatemia. Pex transcripts were, however, detectable in Hyp bone by RT-PCR amplification. Of particular interest, a cDNA clone from rat incisor shows 93% sequence identity to the 5{prime} end of Pex cDNA, suggesting that Pex may be expressed in another calcified tissue, the tooth. The association of impaired mineralization of bone and teeth and disturbed renal phosphate reabsorption with altered expression of Pex suggests that the Pex gene product may play a critical role in these processes. 47 refs., 2 figs., 1 tab.« less

Construction of trypanosome artificial mini-chromosomes.

PubMed Central

Lee, M G; E, Y; Axelrod, N

1995-01-01

We report the preparation of two linear constructs which, when transformed into the procyclic form of Trypanosoma brucei, become stably inherited artificial mini-chromosomes. Both of the two constructs, one of 10 kb and the other of 13 kb, contain a T.brucei PARP promoter driving a chloramphenicol acetyltransferase (CAT) gene. In the 10 kb construct the CAT gene is followed by one hygromycin phosphotransferase (Hph) gene, and in the 13 kb construct the CAT gene is followed by three tandemly linked Hph genes. At each end of these linear molecules are telomere repeats and subtelomeric sequences. Electroporation of these linear DNA constructs into the procyclic form of T.brucei generated hygromycin-B resistant cell lines. In these cell lines, the input DNA remained linear and bounded by the telomere ends, but it increased in size. In the cell lines generated by the 10 kb construct, the input DNA increased in size to 20-50 kb. In the cell lines generated by the 13 kb constructs, two sizes of linear DNAs containing the input plasmid were detected: one of 40-50 kb and the other of 150 kb. The increase in size was not the result of in vivo tandem repetitions of the input plasmid, but represented the addition of new sequences. These Hph containing linear DNA molecules were maintained stably in cell lines for at least 20 generations in the absence of drug selection and were subsequently referred to as trypanosome artificial mini-chromosomes, or TACs. Images PMID:8532534

Breaking Lander-Waterman’s Coverage Bound

PubMed Central

Nashta-ali, Damoun; Motahari, Seyed Abolfazl; Hosseinkhalaj, Babak

2016-01-01

Lander-Waterman’s coverage bound establishes the total number of reads required to cover the whole genome of size G bases. In fact, their bound is a direct consequence of the well-known solution to the coupon collector’s problem which proves that for such genome, the total number of bases to be sequenced should be O(G ln G). Although the result leads to a tight bound, it is based on a tacit assumption that the set of reads are first collected through a sequencing process and then are processed through a computation process, i.e., there are two different machines: one for sequencing and one for processing. In this paper, we present a significant improvement compared to Lander-Waterman’s result and prove that by combining the sequencing and computing processes, one can re-sequence the whole genome with as low as O(G) sequenced bases in total. Our approach also dramatically reduces the required computational power for the combined process. Simulation results are performed on real genomes with different sequencing error rates. The results support our theory predicting the log G improvement on coverage bound and corresponding reduction in the total number of bases required to be sequenced. PMID:27806058

Primer-Free Aptamer Selection Using A Random DNA Library

PubMed Central

Pan, Weihua; Xin, Ping; Patrick, Susan; Dean, Stacey; Keating, Christine; Clawson, Gary

2010-01-01

Aptamers are highly structured oligonucleotides (DNA or RNA) that can bind to targets with affinities comparable to antibodies 1. They are identified through an in vitro selection process called Systematic Evolution of Ligands by EXponential enrichment (SELEX) to recognize a wide variety of targets, from small molecules to proteins and other macromolecules 2-4. Aptamers have properties that are well suited for in vivo diagnostic and/or therapeutic applications: Besides good specificity and affinity, they are easily synthesized, survive more rigorous processing conditions, they are poorly immunogenic, and their relatively small size can result in facile penetration of tissues. Aptamers that are identified through the standard SELEX process usually comprise ~80 nucleotides (nt), since they are typically selected from nucleic acid libraries with ~40 nt long randomized regions plus fixed primer sites of ~20 nt on each side. The fixed primer sequences thus can comprise nearly ~50% of the library sequences, and therefore may positively or negatively compromise identification of aptamers in the selection process 3, although bioinformatics approaches suggest that the fixed sequences do not contribute significantly to aptamer structure after selection 5. To address these potential problems, primer sequences have been blocked by complementary oligonucleotides or switched to different sequences midway during the rounds of SELEX 6, or they have been trimmed to 6-9 nt 7, 8. Wen and Gray 9 designed a primer-free genomic SELEX method, in which the primer sequences were completely removed from the library before selection and were then regenerated to allow amplification of the selected genomic fragments. However, to employ the technique, a unique genomic library has to be constructed, which possesses limited diversity, and regeneration after rounds of selection relies on a linear reamplification step. Alternatively, efforts to circumvent problems caused by fixed primer sequences using high efficiency partitioning are met with problems regarding PCR amplification 10. We have developed a primer-free (PF) selection method that significantly simplifies SELEX procedures and effectively eliminates primer-interference problems 11, 12. The protocols work in a straightforward manner. The central random region of the library is purified without extraneous flanking sequences and is bound to a suitable target (for example to a purified protein or complex mixtures such as cell lines). Then the bound sequences are obtained, reunited with flanking sequences, and re-amplified to generate selected sub-libraries. As an example, here we selected aptamers to S100B, a protein marker for melanoma. Binding assays showed Kd s in the 10-7 - 10-8 M range after a few rounds of selection, and we demonstrate that the aptamers function effectively in a sandwich binding format. PMID:20689511

Reachability bounds for chemical reaction networks and strand displacement systems.

PubMed

Condon, Anne; Kirkpatrick, Bonnie; Maňuch, Ján

2014-01-01

Chemical reaction networks (CRNs) and DNA strand displacement systems (DSDs) are widely-studied and useful models of molecular programming. However, in order for some DSDs in the literature to behave in an expected manner, the initial number of copies of some reagents is required to be fixed. In this paper we show that, when multiple copies of all initial molecules are present, general types of CRNs and DSDs fail to work correctly if the length of the shortest sequence of reactions needed to produce any given molecule exceeds a threshold that grows polynomially with attributes of the system.

Analysis of the antigen recognition sites of anti-methamphetamine monoclonal antibodies (II): unique feature of MA-3 antibody.

PubMed

Ishimaru, M; Morikawa, K; Hifumi, E; Itoh, T; Uda, T

2000-01-01

A monoclonal antibody against methamphetamine (MA-3 mAb) was found to be strongly bound to ephedrine. This feature was quite different from that of other fourteen mAbs against MA. Analyses of cDNA sequence and steric conformation by molecular modeling revealed that one hydrophilic pocket was generated in the heavy chain of MA-3 mAb involving CDRH-1 and CDRH-2. Asn33, Asn35, Asn50 and Asp52 were the main components of the unique pocket capable of binding to the hydroxyl group of ephedrine.

Adaptation of Hybridization Capture of Chromatin-associated Proteins for Proteomics to Mammalian Cells.

PubMed

Guillen-Ahlers, Hector; Rao, Prahlad K; Perumalla, Danu S; Montoya, Maria J; Jadhav, Avinash Y L; Shortreed, Michael R; Smith, Lloyd M; Olivier, Michael

2018-06-01

The hybridization capture of chromatin-associated proteins for proteomics (HyCCAPP) technology was initially developed to uncover novel DNA-protein interactions in yeast. It allows analysis of a target region of interest without the need for prior knowledge about likely proteins bound to the target region. This, in theory, allows HyCCAPP to be used to analyze any genomic region of interest, and it provides sufficient flexibility to work in different cell systems. This method is not meant to study binding sites of known transcription factors, a task better suited for Chromatin Immunoprecipitation (ChIP) and ChIP-like methods. The strength of HyCCAPP lies in its ability to explore DNA regions for which there is limited or no knowledge about the proteins bound to it. It can also be a convenient method to avoid biases (present in ChIP-like methods) introduced by protein-based chromatin enrichment using antibodies. Potentially, HyCCAPP can be a powerful tool to uncover truly novel DNA-protein interactions. To date, the technology has been predominantly applied to yeast cells or to high copy repeat sequences in mammalian cells. In order to become the powerful tool we envision, HyCCAPP approaches need to be optimized to efficiently capture single-copy loci in mammalian cells. Here, we present our adaptation of the initial yeast HyCCAPP capture protocol to human cell lines, and show that single-copy chromatin regions can be efficiently isolated with this modified protocol.

Discrete persistent-chain model for protein binding on DNA.

PubMed

Lam, Pui-Man; Zhen, Yi

2011-04-01

We describe and solve a discrete persistent-chain model of protein binding on DNA, involving an extra σ(i) at a site i of the DNA. This variable takes the value 1 or 0, depending on whether or not the site is occupied by a protein. In addition, if the site is occupied by a protein, there is an extra energy cost ɛ. For a small force, we obtain analytic expressions for the force-extension curve and the fraction of bound protein on the DNA. For higher forces, the model can be solved numerically to obtain force-extension curves and the average fraction of bound proteins as a function of applied force. Our model can be used to analyze experimental force-extension curves of protein binding on DNA, and hence deduce the number of bound proteins in the case of nonspecific binding. ©2011 American Physical Society

Electrostatic occlusion and quaternary structural ion pairing are key determinants of Cu(I)-mediated allostery in the copper-sensing operon repressor (CsoR).

PubMed

Chang, Feng-Ming James; Martin, Julia E; Giedroc, David P

2015-04-21

The copper-sensing operon repressor (CsoR) is an all-α-helical disc-shaped D2-symmetric homotetramer that forms a 2:1 tetramer/DNA operator complex and represses the expression of copper-resistance genes in a number of bacteria. A previous bioinformatics analysis of CsoR-family repressors distributes Cu(I)-sensing CsoRs in four of seven distinct clades on the basis of global sequence similarity. In this work, we define energetically important determinants of DNA binding in the apo-state (ΔΔGbind), and for allosteric negative coupling of Cu(I) binding to DNA binding (ΔΔGc) in a model clade IV CsoR from Geobacillus thermodenitrificans (Gt) of known structure, by selectively targeting for mutagenesis those charged residues uniquely conserved in clade IV CsoRs. These include a folded N-terminal "tail" and a number of Cu(I)-sensor and clade-specific residues that when mapped onto a model of Cu(I)-bound Gt CsoR define a path across one face of the tetramer. We find that Cu(I)-binding prevents formation of the 2:1 "sandwich" complex rather than DNA binding altogether. Folding of the N-terminal tail (residues R18, E22, R74) upon Cu-binding to the periphery of the tetramer inhibits assembly of the 2:1 apoprotein-DNA complex. In contrast, Ala substitution of residues that surround the central "hole" (R65, K101) in the tetramer, as well R48, impact DNA binding. We also identify a quaternary structural ion-pair, E73-K101″, that crosses the tetramer interface, charge-reversal of which restores DNA binding activity, allosteric regulation by Cu(I), and transcriptional derepression by Cu(I) in cells. These findings suggest an "electrostatic occlusion" model, in which basic residues important for DNA binding and/or allostery become sequestered via ion-pairing specifically in the Cu(I)-bound state, and this aids in copper-dependent disassembly of a repression complex.

Construction of a yeast artificial chromosome contig encompassing the chromosome 14 Alzheimer`s disease locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharma, V.; Bonnycastle, L.; Poorkai, P.

1994-09-01

We have constructed a yeast artificial chromosome (YAC) contig of chromosome 14q24.3 which encompasses the chromosome 14 Alzheimer`s disease locus (AD3). Determined by linkage analysis of early-onset Alzheimer`s disease kindreds, this interval is bounded by the genetic markers D14S61-D14S63 and spans approximately 15 centimorgans. The contig consists of 29 markers and 74 YACs of which 57 are defined by one or more sequence tagged sites (STSs). The STS markers comprise 5 genes, 16 short tandem repeat polymorphisms and 8 cDNA clones. An additional number of genes, expressed sequence tags and cDNA fragments have been identified and localized to the contigmore » by hybridization and sequence analysis of anonymous clones isolated by cDNA direct selection techniques. A minimal contig of about 15 YACs averaging 0.5-1.5 megabase in length will span this interval and is, at first approximation, in rough agreement with the genetic map. For two regions of the contig, our coverage has relied on L1/THE fingerprint and Alu-PCR hybridization data of YACs provided by CEPH/Genethon. We are currently developing sequence tagged sites from these to confirm the overlaps revealed by the fingerprint data. Among the genes which map to the contig are transforming growth factor beta 3, c-fos, and heat shock protein 2A (HSPA2). C-fos is not a candidate gene for AD3 based on the sequence analysis of affected and unaffected individuals. HSPA2 maps to the proximal edge of the contig and Calmodulin 1, a candidate gene from 4q24.3, maps outside of the region. The YAC contig is a framework physical map from which cosmid or P1 clone contigs can be constructed. As more genes and cDNAs are mapped, a highly resolved transcription map will emerge, a necessary step towards positionally cloning the AD3 gene.« less

RNA binding to APOBEC3G induces the disassembly of functional deaminase complexes by displacing single-stranded DNA substrates

PubMed Central

Polevoda, Bogdan; McDougall, William M.; Tun, Bradley N.; Cheung, Michael; Salter, Jason D.; Friedman, Alan E.; Smith, Harold C.

2015-01-01

APOBEC3G (A3G) DNA deaminase activity requires a holoenzyme complex whose assembly on nascent viral reverse transcripts initiates with A3G dimers binding to ssDNA followed by formation of higher-order A3G homo oligomers. Catalytic activity is inhibited when A3G binds to RNA. Our prior studies suggested that RNA inhibited A3G binding to ssDNA. In this report, near equilibrium binding and gel shift analyses showed that A3G assembly and disassembly on ssDNA was an ordered process involving A3G dimers and multimers thereof. Although, fluorescence anisotropy showed that A3G had similar nanomolar affinity for RNA and ssDNA, RNA stochastically dissociated A3G dimers and higher-order oligomers from ssDNA, suggesting a different modality for RNA binding. Mass spectrometry mapping of A3G peptides cross-linked to nucleic acid suggested ssDNA only bound to three peptides, amino acids (aa) 181–194 in the N-terminus and aa 314–320 and 345–374 in the C-terminus that were part of a continuous exposed surface. RNA bound to these peptides and uniquely associated with three additional peptides in the N- terminus, aa 15–29, 41–52 and 83–99, that formed a continuous surface area adjacent to the ssDNA binding surface. The data predict a mechanistic model of RNA inhibition of ssDNA binding to A3G in which competitive and allosteric interactions determine RNA-bound versus ssDNA-bound conformational states. PMID:26424853

From Bioengineering to CRISPR/Cas9 – A Personal Retrospective of 20 Years of Research in Programmable Genome Targeting

PubMed Central

Jeltsch, Albert

2018-01-01

Genome targeting of restriction enzymes and DNA methyltransferases has many important applications including genome and epigenome editing. 15–20 years ago, my group was involved in the development of approaches for programmable genome targeting, aiming to connect enzymes with an oligodeoxynucleotide (ODN), which could form a sequence-specific triple helix at the genomic target site. Importantly, the target site of such enzyme-ODN conjugate could be varied simply by altering the ODN sequence promising great applicative values. However, this approach was facing many problems including the preparation and purification of the enzyme-ODN conjugates, their efficient delivery into cells, slow kinetics of triple helix formation and the requirement of a poly-purine target site sequence. Hence, for several years genome and epigenome editing approaches mainly were based on Zinc fingers and TAL proteins as targeting devices. More recently, CRISPR/Cas systems were discovered, which use a bound RNA for genome targeting that forms an RNA/DNA duplex with one DNA strand of the target site. These systems combine all potential advantages of the once imagined enzyme-ODN conjugates and avoid all main disadvantageous. Consequently, the application of CRISPR/Cas in genome and epigenome editing has exploded in recent years. We can draw two important conclusions from this example of research history. First, evolution still is the better bioengineer than humans and, whenever tested in parallel, natural solutions outcompete engineered ones. Second, CRISPR/Cas system were discovered in pure, curiosity driven, basic research, highlighting that it is basic, bottom-up research paving the way for fundamental innovation. PMID:29434619

Scar-less multi-part DNA assembly design automation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hillson, Nathan J.

The present invention provides a method of a method of designing an implementation of a DNA assembly. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding flanking homology sequences to each of the DNA oligos. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which tomore » assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding optimized overhang sequences to each of the DNA oligos.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stella, Stefano; University of Copenhagen, Blegdamsvej 3B, 2200 Copenhagen; Molina, Rafael

Crystal structures of BurrH and the BurrH–DNA complex are reported. DNA editing offers new possibilities in synthetic biology and biomedicine for modulation or modification of cellular functions to organisms. However, inaccuracy in this process may lead to genome damage. To address this important problem, a strategy allowing specific gene modification has been achieved through the addition, removal or exchange of DNA sequences using customized proteins and the endogenous DNA-repair machinery. Therefore, the engineering of specific protein–DNA interactions in protein scaffolds is key to providing ‘toolkits’ for precise genome modification or regulation of gene expression. In a search for putative DNA-bindingmore » domains, BurrH, a protein that recognizes a 19 bp DNA target, was identified. Here, its apo and DNA-bound crystal structures are reported, revealing a central region containing 19 repeats of a helix–loop–helix modular domain (BurrH domain; BuD), which identifies the DNA target by a single residue-to-nucleotide code, thus facilitating its redesign for gene targeting. New DNA-binding specificities have been engineered in this template, showing that BuD-derived nucleases (BuDNs) induce high levels of gene targeting in a locus of the human haemoglobin β (HBB) gene close to mutations responsible for sickle-cell anaemia. Hence, the unique combination of high efficiency and specificity of the BuD arrays can push forward diverse genome-modification approaches for cell or organism redesign, opening new avenues for gene editing.« less

The cellodextrinase from Pseudomonas fluorescens subsp. cellulosa consists of multiple functional domains.

PubMed Central

Ferreira, L M; Hazlewood, G P; Barker, P J; Gilbert, H J

1991-01-01

A genomic library of Pseudomonas fluorescens subsp. cellulosa DNA was constructed in pUC18 and Escherichia coli recombinants expressing 4-methylumbelliferyl beta-D-cellobioside-hydrolysing activity (MUCase) were isolated. Enzyme produced by MUCase-positive clones did not hydrolyse either cellobiose or cellotriose but converted cellotetraose into cellobiose and cleaved cellopentaose and cellohexaose, producing a mixture of cellobiose and cellotriose. There was no activity against CM-cellulose, insoluble cellulose or xylan. On this basis, the enzyme is identified as an endo-acting cellodextrinase and is designated cellodextrinase C (CELC). Nucleotide sequencing of the gene (celC) which directs the synthesis of CELC revealed an open reading frame of 2153 bp, encoding a protein of Mr 80,189. The deduced primary sequence of CELC was confirmed by the Mr of purified CELC (77,000) and by the experimentally determined N-terminus of the enzyme which was identical with residues 38-47 of the translated sequence. The N-terminal region of CELC showed strong homology with endoglucanase, xylanases and an arabinofuranosidase of Ps. fluorescens subsp. cellulosa; homologous sequences included highly conserved serine-rich regions. Full-length CELC bound tightly to crystalline cellulose. Truncated forms of celC from which the DNA sequence encoding the conserved domain had been deleted, directed the synthesis of a functional cellodextrinase that did not bind to crystalline cellulose. This is consistent with the N-terminal region of CELC comprising a non-catalytic cellulose-binding domain which is distinct from the catalytic domain. The role of the cellulose-binding region is discussed. Images Fig. 2. Fig. 6. PMID:1953673

Sox2 regulatory region 2 sequence works as a DNA nuclear targeting sequence enhancing the efficiency of an exogenous gene expression in ES cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Funabashi, Hisakage; Takatsu, Makoto; Saito, Mikako

2010-10-01

Research highlights: {yields} SV40-DTS worked as a DTS in ES cells as well as other types of cells. {yields} Sox2 regulatory region 2 worked as a DTS in ES cells and thus was termed as SRR2-DTS. {yields} SRR2-DTS was suggested as an ES cell-specific DTS. -- Abstract: In this report, the effects of two DNA nuclear targeting sequence (DTS) candidates on the gene expression efficiency in ES cells were investigated. Reporter plasmids containing the simian virus 40 (SV40) promoter/enhancer sequence (SV40-DTS), a DTS for various types of cells but not being reported yet for ES cells, and the 81 basemore » pairs of Sox2 regulatory region 2 (SRR2) where two transcriptional factors in ES cells, Oct3/4 and Sox2, are bound (SRR2-DTS), were introduced into cytoplasm in living cells by femtoinjection. The gene expression efficiencies of each plasmid in mouse insulinoma cell line MIN6 cells and mouse ES cells were then evaluated. Plasmids including SV40-DTS and SRR2-DTS exhibited higher gene expression efficiency comparing to plasmids without these DTSs, and thus it was concluded that both sequences work as a DTS in ES cells. In addition, it was suggested that SRR2-DTS works as an ES cell-specific DTS. To the best of our knowledge, this is the first report to confirm the function of DTSs in ES cells.« less

Improved exogenous DNA uptake in bovine spermatozoa and gene expression in embryos using membrane destabilizing agents in ICSI-SMGT.

PubMed

Sánchez-Villalba, Esther; Arias, María Elena; Zambrano, Fabiola; Loren, Pía; Felmer, Ricardo

2018-02-01

Sperm-mediated gene transfer (SMGT) is a simple, fast, and economical biotechnological tool for producing transgenic animals. However, transgene expression with this technique in bovine embryos is still inefficient due to low uptake and binding of exogenous DNA in spermatozoa. The present study evaluated the effects of sperm membrane destabilization on the binding capacity, location and quantity of bound exogenous DNA in cryopreserved bovine spermatozoa using Triton X-100 (TX-100), lysolecithin (LL) and sodium hydroxide (NaOH). Effects of these treatments were also evaluated by intracytoplasmic sperm injection (ICSI)-SMGT. Results showed that all treatments bound exogenous DNA to spermatozoa including the control. Spermatozoa treated with different membrane destabilizing agents bound the exogenous DNA throughout the head and tail of spermatozoa, compared with the control, in which binding occurred mainly in the post-acrosomal region and tail. The amount of exogenous DNA bound to spermatozoa was much higher for the different sperm treatments than the control (P < 0.05), most likely due to the damage induced by these treatments to the plasma and acrosomal membranes. Exogenous gene expression in embryos was also improved by these treatments. These results demonstrated that sperm membrane destabilization could be a novel strategy in bovine SMGT protocols for the generation of transgenic embryos by ICSI.

Analyte-driven switching of DNA charge transport: de novo creation of electronic sensors for an early lung cancer biomarker.

PubMed

Thomas, Jason M; Chakraborty, Banani; Sen, Dipankar; Yu, Hua-Zhong

2012-08-22

A general approach is described for the de novo design and construction of aptamer-based electrochemical biosensors, for potentially any analyte of interest (ranging from small ligands to biological macromolecules). As a demonstration of the approach, we report the rapid development of a made-to-order electronic sensor for a newly reported early biomarker for lung cancer (CTAP III/NAP2). The steps include the in vitro selection and characterization of DNA aptamer sequences, design and biochemical testing of wholly DNA sensor constructs, and translation to a functional electrode-bound sensor format. The working principle of this distinct class of electronic biosensors is the enhancement of DNA-mediated charge transport in response to analyte binding. We first verify such analyte-responsive charge transport switching in solution, using biochemical methods; successful sensor variants were then immobilized on gold electrodes. We show that using these sensor-modified electrodes, CTAP III/NAP2 can be detected with both high specificity and sensitivity (K(d) ~1 nM) through a direct electrochemical reading. To investigate the underlying basis of analyte binding-induced conductivity switching, we carried out Förster Resonance Energy Transfer (FRET) experiments. The FRET data establish that analyte binding-induced conductivity switching in these sensors results from very subtle structural/conformational changes, rather than large scale, global folding events. The implications of this finding are discussed with respect to possible charge transport switching mechanisms in electrode-bound sensors. Overall, the approach we describe here represents a unique design principle for aptamer-based electrochemical sensors; its application should enable rapid, on-demand access to a class of portable biosensors that offer robust, inexpensive, and operationally simplified alternatives to conventional antibody-based immunoassays.

Albumin Redhill (-1 Arg, 320 Ala----Thr): a glycoprotein variant of human serum albumin whose precursor has an aberrant signal peptidase cleavage site.

PubMed

Brennan, S O; Myles, T; Peach, R J; Donaldson, D; George, P M

1990-01-01

Albumin Redhill is an electrophoretically slow genetic variant of human serum albumin that does not bind 63Ni2+ and has a molecular mass 2.5 kDa higher than normal albumin. Its inability to bind Ni2+ was explained by the finding of an additional residue of Arg at position -1. This did not explain the molecular basis of the genetic variation (since proalbumin contains adjacent Arg residues at -1 and -2) or the increase in apparent molecular mass. Fractionation of tryptic digests on concanavalin A-Sepharose followed by peptide mapping of the bound and unbound fractions and sequence analysis of the glycopeptides identified a mutation of 320 Ala----Thr. This introduces an Asn-Tyr-Thr oligosaccharide attachment sequence centered on Asn-318 and explains the increase in molecular mass. This, however, did not satisfactorily explain the presence of the additional Arg residue at position -1. DNA sequencing of polymerase chain reaction-amplified genomic DNA encoding the prepro sequence of albumin indicated an additional mutation of -2 Arg----Cys. This introduces a prepro sequence, Met-Lys-Trp-Val-Thr-Phe-Ile-Ser-Leu-Leu-Phe-Leu-Phe-Ser-Ser-Ala-Tyr- Ser-Arg-Gly-Val-Phe-Cys-Arg (cf.-Tyr-Ser-Arg-Gly-Val-Phe-Arg-Arg- in normal human pre-proalbumin). We propose that the new Phe-Cys-Arg sequence in the propeptide is an aberrant signal peptidase cleavage site and that the signal peptidase cleaves the propeptide of albumin Redhill in the lumen of the endoplasmic reticulum before it reaches the Golgi vesicles, the site of the diarginyl-specific proalbumin convertase.

Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

DOEpatents

Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S

2013-06-25

A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.

Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

DOEpatents

Gardner, Shea N [San Leandro, CA; Mariella, Jr., Raymond P.; Christian, Allen T [Tracy, CA; Young, Jennifer A [Berkeley, CA; Clague, David S [Livermore, CA

2011-01-18

A method of fabricating a DNA molecule of user-defined sequence. The method comprises the steps of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an even or odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths. In one embodiment starting sequence fragments are of different lengths, n, n+1, n+2, etc.

Mapping the interactions of the single-stranded DNA binding protein of bacteriophage T4 (gp32) with DNA lattices at single nucleotide resolution: polynucleotide binding and cooperativity

PubMed Central

Jose, Davis; Weitzel, Steven E.; Baase, Walter A.; Michael, Miya M.; von Hippel, Peter H.

2015-01-01

We here use our site-specific base analog mapping approach to study the interactions and binding equilibria of cooperatively-bound clusters of the single-stranded DNA binding protein (gp32) of the T4 DNA replication complex with longer ssDNA (and dsDNA) lattices. We show that in cooperatively bound clusters the binding free energy appears to be equi-partitioned between the gp32 monomers of the cluster, so that all bind to the ssDNA lattice with comparable affinity, but also that the outer domains of the gp32 monomers at the ends of the cluster can fluctuate on and off the lattice and that the clusters of gp32 monomers can slide along the ssDNA. We also show that at very low binding densities gp32 monomers bind to the ssDNA lattice at random, but that cooperatively bound gp32 clusters bind preferentially at the 5′-end of the ssDNA lattice. We use these results and the gp32 monomer-binding results of the companion paper to propose a detailed model for how gp32 might bind to and interact with ssDNA lattices in its various binding modes, and also consider how these clusters might interact with other components of the T4 DNA replication complex. PMID:26275774

VEZF1 Elements Mediate Protection from DNA Methylation

PubMed Central

Strogantsev, Ruslan; Gaszner, Miklos; Hair, Alan; Felsenfeld, Gary; West, Adam G.

2010-01-01

There is growing consensus that genome organization and long-range gene regulation involves partitioning of the genome into domains of distinct epigenetic chromatin states. Chromatin insulator or barrier elements are key components of these processes as they can establish boundaries between chromatin states. The ability of elements such as the paradigm β-globin HS4 insulator to block the range of enhancers or the spread of repressive histone modifications is well established. Here we have addressed the hypothesis that a barrier element in vertebrates should be capable of defending a gene from silencing by DNA methylation. Using an established stable reporter gene system, we find that HS4 acts specifically to protect a gene promoter from de novo DNA methylation. Notably, protection from methylation can occur in the absence of histone acetylation or transcription. There is a division of labor at HS4; the sequences that mediate protection from methylation are separable from those that mediate CTCF-dependent enhancer blocking and USF-dependent histone modification recruitment. The zinc finger protein VEZF1 was purified as the factor that specifically interacts with the methylation protection elements. VEZF1 is a candidate CpG island protection factor as the G-rich sequences bound by VEZF1 are frequently found at CpG island promoters. Indeed, we show that VEZF1 elements are sufficient to mediate demethylation and protection of the APRT CpG island promoter from DNA methylation. We propose that many barrier elements in vertebrates will prevent DNA methylation in addition to blocking the propagation of repressive histone modifications, as either process is sufficient to direct the establishment of an epigenetically stable silent chromatin state. PMID:20062523

DNA Vaccine Molecular Adjuvants SP-D-BAFF and SP-D-APRIL Enhance Anti-gp120 Immune Response and Increase HIV-1 Neutralizing Antibody Titers

PubMed Central

Gupta, Sachin; Clark, Emily S.; Termini, James M.; Boucher, Justin; Kanagavelu, Saravana; LeBranche, Celia C.; Abraham, Sakhi; Montefiori, David C.

2015-01-01

ABSTRACT Broadly neutralizing antibodies (bNAbs) specific for conserved epitopes on the HIV-1 envelope (Env) are believed to be essential for protection against multiple HIV-1 clades. However, vaccines capable of stimulating the production of bNAbs remain a major challenge. Given that polyreactivity and autoreactivity are considered important characteristics of anti-HIV bNAbs, we designed an HIV vaccine incorporating the molecular adjuvants BAFF (B cell activating factor) and APRIL (a proliferation-inducing ligand) with the potential to facilitate the maturation of polyreactive and autoreactive B cells as well as to enhance the affinity and/or avidity of Env-specific antibodies. We designed recombinant DNA plasmids encoding soluble multitrimers of BAFF and APRIL using surfactant protein D as a scaffold, and we vaccinated mice with these molecular adjuvants using DNA and DNA-protein vaccination strategies. We found that immunization of mice with a DNA vaccine encoding BAFF or APRIL multitrimers, together with interleukin 12 (IL-12) and membrane-bound HIV-1 Env gp140, induced neutralizing antibodies against tier 1 and tier 2 (vaccine strain) viruses. The APRIL-containing vaccine was particularly effective at generating tier 2 neutralizing antibodies following a protein boost. These BAFF and APRIL effects coincided with an enhanced germinal center (GC) reaction, increased anti-gp120 antibody-secreting cells, and increased anti-gp120 functional avidity. Notably, BAFF and APRIL did not cause indiscriminate B cell expansion or an increase in total IgG. We propose that BAFF and APRIL multitrimers are promising molecular adjuvants for vaccines designed to induce bNAbs against HIV-1. IMPORTANCE Recent identification of antibodies that neutralize most HIV-1 strains has revived hopes and efforts to create novel vaccines that can effectively stimulate HIV-1 neutralizing antibodies. However, the multiple immune evasion properties of HIV have hampered these efforts. These include the instability of the gp120 trimer, the inaccessibility of the conserved sequences, highly variable protein sequences, and the loss of HIV-1-specific antibody-producing cells during development. We have shown previously that tumor necrosis factor (TNF) superfamily ligands, including BAFF and APRIL, can be multitrimerized using the lung protein SP-D (surfactant protein D), enhancing immune responses. Here we show that DNA or DNA-protein vaccines encoding BAFF or APRIL multitrimers, IL-12p70, and membrane-bound HIV-1 Env gp140 induced tier 1 and tier 2 neutralizing antibodies in a mouse model. BAFF and APRIL enhanced the immune reaction, improved antibody binding, and increased the numbers of anti-HIV-1 antibody-secreting cells. Adaptation of this vaccine design may prove useful in designing preventive HIV-1 vaccines for humans. PMID:25631080

Protein dynamics of human RPA and RAD51 on ssDNA during assembly and disassembly of the RAD51 filament

PubMed Central

Ma, Chu Jian; Gibb, Bryan; Kwon, YoungHo; Sung, Patrick; Greene, Eric C.

2017-01-01

Homologous recombination (HR) is a crucial pathway for double-stranded DNA break (DSB) repair. During the early stages of HR, the newly generated DSB ends are processed to yield long single-stranded DNA (ssDNA) overhangs, which are quickly bound by replication protein A (RPA). RPA is then replaced by the DNA recombinase Rad51, which forms extended helical filaments on the ssDNA. The resulting nucleoprotein filament, known as the presynaptic complex, is responsible for pairing the ssDNA with homologous double-stranded DNA (dsDNA), which serves as the template to guide DSB repair. Here, we use single-molecule imaging to visualize the interplay between human RPA (hRPA) and human RAD51 during presynaptic complex assembly and disassembly. We demonstrate that ssDNA-bound hRPA can undergo facilitated exchange, enabling hRPA to undergo rapid exchange between free and ssDNA-bound states only when free hRPA is present in solution. Our results also indicate that the presence of free hRPA inhibits RAD51 filament nucleation, but has a lesser impact upon filament elongation. This finding suggests that hRPA exerts important regulatory influence over RAD51 and may in turn affect the properties of the assembled RAD51 filament. These experiments provide an important basis for further investigations into the regulation of human presynaptic complex assembly. PMID:27903895

Multiple and cooperative binding of fluorescence light-up probe thioflavin T with human telomere DNA G-quadruplex.

PubMed

Gabelica, Valérie; Maeda, Ryuichi; Fujimoto, Takeshi; Yaku, Hidenobu; Murashima, Takashi; Sugimoto, Naoki; Miyoshi, Daisuke

2013-08-20

Thioflavin T (ThT), a typical probe for protein fibrils, also binds human telomeric G-quadruplexes with a fluorescent light-up signal change and high specificity against DNA duplexes. Cell penetration and low cytotoxicity of fibril probes having been widely established, modifying ThT and other fibril probes is an attractive means of generating new G-quadruplex ligands. Thus, elucidating the binding mechanism is important for the design of new drugs and fluorescent probes based on ThT. Here, we investigated the binding mechanism of ThT with several variants of the human telomeric sequence in the presence of monovalent cations. Fluorescence titrations and electrospray ionization mass spectrometry (ESI-MS) analyses demonstrated that each G-quadruplex unit cooperatively binds to several ThT molecules. ThT brightly fluoresces when a single ligand is bound to the G-quadruplex and is quenched as ligand binding stoichiometry increases. Both the light-up signal and the dissociation constants are exquisitely sensitive to the base sequence and to the G-quadruplex structure. These results are crucial for the sensible design and interpretation of G-quadruplex detection assays using fluorescent ligands in general and ThT in particular.

Application of Quaternion in improving the quality of global sequence alignment scores for an ambiguous sequence target in Streptococcus pneumoniae DNA

NASA Astrophysics Data System (ADS)

Lestari, D.; Bustamam, A.; Novianti, T.; Ardaneswari, G.

2017-07-01

DNA sequence can be defined as a succession of letters, representing the order of nucleotides within DNA, using a permutation of four DNA base codes including adenine (A), guanine (G), cytosine (C), and thymine (T). The precise code of the sequences is determined using DNA sequencing methods and technologies, which have been developed since the 1970s and currently become highly developed, advanced and highly throughput sequencing technologies. So far, DNA sequencing has greatly accelerated biological and medical research and discovery. However, in some cases DNA sequencing could produce any ambiguous and not clear enough sequencing results that make them quite difficult to be determined whether these codes are A, T, G, or C. To solve these problems, in this study we can introduce other representation of DNA codes namely Quaternion Q = (PA, PT, PG, PC), where PA, PT, PG, PC are the probability of A, T, G, C bases that could appear in Q and PA + PT + PG + PC = 1. Furthermore, using Quaternion representations we are able to construct the improved scoring matrix for global sequence alignment processes, by applying a dot product method. Moreover, this scoring matrix produces better and higher quality of the match and mismatch score between two DNA base codes. In implementation, we applied the Needleman-Wunsch global sequence alignment algorithm using Octave, to analyze our target sequence which contains some ambiguous sequence data. The subject sequences are the DNA sequences of Streptococcus pneumoniae families obtained from the Genebank, meanwhile the target DNA sequence are received from our collaborator database. As the results we found the Quaternion representations improve the quality of the sequence alignment score and we can conclude that DNA sequence target has maximum similarity with Streptococcus pneumoniae.

cDNA sequences and organization of IgM heavy chain genes in two holostean fish.

PubMed

Wilson, M R; van Ravenstein, E; Miller, N W; Clem, L W; Middleton, D L; Warr, G W

1995-01-01

Immunoglobulin M heavy chain (mu) sequences of two holostean fish, the bowfin, Amia calva, and the longnose gar, Lepisosteus osseus, were amplified from spleen mRNA by RACE-PCR, cloned, and sequenced. Each mu chain showed the conserved four constant domain structure typical of a secreted mu chain. Southern blot analyses with specific heavy chain variable (VH) and constant (CH) region probes suggest that both fish possess an IgH locus that resembles that of the teleosts, amphibians, and mammals in its organization. The overall sequence similarity of gar and bowfin mu chains was 60% and 48% at the nucleotide and amino acid levels, respectively, while similarity to the mu chains of teleosts and elasmobranchs was lower. The bowfin mu chain possesses a distinctive proline-rich sequence at the C mu 1/C mu 2 boundary; a shorter proline-rich sequence is present at this position in the gar mu chain. Both gar and bowfin show, in their C mu 4 sequences, motifs that could serve as cryptic splice donor sites for the production of mRNA encoding the membrane-bound form of the mu chains, and the bowfin also shows a potential cryptic splice donor site in the C mu 3 exon.

Molecular modeling of NK-CT1, from Indian monocellate cobra (Naja kaouthia) and its docking interaction with human DNA topoisomerase II alpha

PubMed Central

Bandopadhyay, Pathikrit; Halder, Soma; Sarkar, Mrinmoy; Kumar Bhunia, Sujay; Dey, Sananda; Gomes, Antony; Giri, Biplab

2016-01-01

A 6.76 kDa molecular weight cardio and cytotoxic protein of 60 amino acids in length called NK-CT1, was purified from the venom of Indian monocellate cobra (Naja kaouthia) by ion-exchange chromatography and HPLC as described in our earlier report. Therefore it is of interest to utlize the sequence of NK-CT1 for further functional inference using molecular modeling and docking. Thus homology model of NK-CT1 is described in this report. The anti-proliferative activity of the protein, binding with human DNA topoisomerase-II alpha was demonstrated using docking data with AUTODOCK and AUTODOCK MGL tools. Data shows that M26, V27 and S28 of NK-CT1 is in close contact with the nucleotides of the oligonucleotide, bound with topoisomerase-II alpha complex. PMID:28149043

Accessory replicative helicases and the replication of protein-bound DNA.

PubMed

Brüning, Jan-Gert; Howard, Jamieson L; McGlynn, Peter

2014-12-12

Complete, accurate duplication of the genetic material is a prerequisite for successful cell division. Achieving this accuracy is challenging since there are many barriers to replication forks that may cause failure to complete genome duplication or result in possibly catastrophic corruption of the genetic code. One of the most important types of replicative barriers are proteins bound to the template DNA, especially transcription complexes. Removal of these barriers demands energy input not only to separate the DNA strands but also to disrupt multiple bonds between the protein and DNA. Replicative helicases that unwind the template DNA for polymerases at the fork can displace proteins bound to the template. However, even occasional failures in protein displacement by the replicative helicase could spell disaster. In such circumstances, failure to restart replication could result in incomplete genome duplication. Avoiding incomplete genome duplication via the repair and restart of blocked replication forks also challenges viability since the involvement of recombination enzymes is associated with the risk of genome rearrangements. Organisms have therefore evolved accessory replicative helicases that aid replication fork movement along protein-bound DNA. These helicases reduce the dangers associated with replication blockage by protein-DNA complexes, aiding clearance of blocks and resumption of replication by the same replisome thus circumventing the need for replication repair and restart. This review summarises recent work in bacteria and eukaryotes that has begun to delineate features of accessory replicative helicases and their importance in genome stability. Copyright © 2014. Published by Elsevier Ltd.

Curcumin inhibits hepatitis B virus infection by down-regulating cccDNA-bound histone acetylation.

PubMed

Wei, Zhi-Qiang; Zhang, Yong-Hong; Ke, Chang-Zheng; Chen, Hong-Xia; Ren, Pan; He, Yu-Lin; Hu, Pei; Ma, De-Qiang; Luo, Jie; Meng, Zhong-Ji

2017-09-14

To investigate the potential effect of curcumin on hepatitis B virus (HBV) covalently closed circular DNA (cccDNA) and the underlying mechanism. A HepG2.2.15 cell line stably transfected with HBV was treated with curcumin, and HBV surface antigen (HBsAg) and e antigen (HBeAg) expression levels were assessed by ELISA. Intracellular HBV DNA replication intermediates and cccDNA were detected by Southern blot and real-time PCR, respectively. The acetylation levels of histones H3 and H4 were measured by Western blot. H3/H4-bound cccDNA was detected by chromatin immunoprecipitation (ChIP) assays. The deacetylase inhibitors trichostatin A and sodium butyrate were used to study the mechanism of action for curcumin. Additionally, short interfering RNAs (siRNAs) targeting HBV were tested along with curcumin. Curcumin treatment led to time- and dose-dependent reductions in HBsAg and HBeAg expression and significant reductions in intracellular HBV DNA replication intermediates and HBV cccDNA. After treatment with 20 μmol/L curcumin for 2 d, HBsAg and cccDNA levels in HepG2.2.15 cells were reduced by up to 57.7% ( P < 0.01) and 75.5% ( P < 0.01), respectively, compared with levels in non-treated cells. Meanwhile, time- and dose-dependent reductions in the histone H3 acetylation levels were also detected upon treatment with curcumin, accompanied by reductions in H3- and H4-bound cccDNA. Furthermore, the deacetylase inhibitors trichostatin A and sodium butyrate could block the effects of curcumin. Additionally, transfection of siRNAs targeting HBV enhanced the inhibitory effects of curcumin. Curcumin inhibits HBV gene replication via down-regulation of cccDNA-bound histone acetylation and has the potential to be developed as a cccDNA-targeting antiviral agent for hepatitis B.

Solution structure of the DNA-binding domain of RPA from Saccharomyces cerevisiae and its interaction with single-stranded DNA and SV40 T antigen

PubMed Central

Park, Chin-Ju; Lee, Joon-Hwa; Choi, Byong-Seok

2005-01-01

Replication protein A (RPA) is a three-subunit complex with multiple roles in DNA metabolism. DNA-binding domain A in the large subunit of human RPA (hRPA70A) binds to single-stranded DNA (ssDNA) and is responsible for the species-specific RPA–T antigen (T-ag) interaction required for Simian virus 40 replication. Although Saccharomyces cerevisiae RPA70A (scRPA70A) shares high sequence homology with hRPA70A, the two are not functionally equivalent. To elucidate the similarities and differences between these two homologous proteins, we determined the solution structure of scRPA70A, which closely resembled the structure of hRPA70A. The structure of ssDNA-bound scRPA70A, as simulated by residual dipolar coupling-based homology modeling, suggested that the positioning of the ssDNA is the same for scRPA70A and hRPA70A, although the conformational changes that occur in the two proteins upon ssDNA binding are not identical. NMR titrations of hRPA70A with T-ag showed that the T-ag binding surface is separate from the ssDNA-binding region and is more neutral than the corresponding part of scRPA70A. These differences might account for the species-specific nature of the hRPA70A–T-ag interaction. Our results provide insight into how these two homologous RPA proteins can exhibit functional differences, but still both retain their ability to bind ssDNA. PMID:16043636

Structural Determinants of DNA Binding by a P. falciparum ApiAP2 Transcriptional Regulator

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lindner, Scott E.; De Silva, Erandi K.; Keck, James L.

2010-11-05

Putative transcription factors have only recently been identified in the Plasmodium spp., with the major family of regulators comprising the Apicomplexan Apetala2 (AP2) proteins. To better understand the DNA-binding mechanisms of these transcriptional regulators, we characterized the structure and in vitro function of an AP2 DNA-binding domain from a prototypical Apicomplexan AP2 protein, PF14{_}0633 from Plasmodium falciparum. The X-ray crystal structure of the PF14{_}0633 AP2 domain bound to DNA reveals a {beta}-sheet fold that binds the DNA major groove through base-specific and backbone contacts; a prominent {alpha}-helix supports the {beta}-sheet structure. Substitution of predicted DNA-binding residues with alanine weakened ormore » eliminated DNA binding in solution. In contrast to plant AP2 domains, the PF14{_}0633 AP2 domain dimerizes upon binding to DNA through a domain-swapping mechanism in which the {alpha}-helices of the AP2 domains pack against the {beta}-sheets of the dimer mates. DNA-induced dimerization of PF14{_}0633 may be important for tethering two distal DNA loci together in the nucleus and/or for inducing functional rearrangements of its domains to facilitate transcriptional regulation. Consistent with a multisite binding mode, at least two copies of the consensus sequence recognized by PF14{_}0633 are present upstream of a previously identified group of sporozoite-stage genes. Taken together, these findings illustrate how Plasmodium has adapted the AP2 DNA-binding domain for genome-wide transcriptional regulation.« less

Large-Scale Concatenation cDNA Sequencing

PubMed Central

Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.

1997-01-01

A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174

Synthesis of DNA

DOEpatents

Mariella, Jr., Raymond P.

2008-11-18

A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

Nanopore Technology: A Simple, Inexpensive, Futuristic Technology for DNA Sequencing.

PubMed

Gupta, P D

2016-10-01

In health care, importance of DNA sequencing has been fully established. Sanger's Capillary Electrophoresis DNA sequencing methodology is time consuming, cumbersome, hence become more expensive. Lately, because of its versatility DNA sequencing became house hold name, and therefore, there is an urgent need of simple, fast, inexpensive, DNA sequencing technology. In the beginning of this century efforts were made, and Nanopore DNA sequencing technology was developed; still it is infancy, nevertheless, it is the futuristic technology.

Single-particle trajectories reveal two-state diffusion-kinetics of hOGG1 proteins on DNA.

PubMed

Vestergaard, Christian L; Blainey, Paul C; Flyvbjerg, Henrik

2018-03-16

We reanalyze trajectories of hOGG1 repair proteins diffusing on DNA. A previous analysis of these trajectories with the popular mean-squared-displacement approach revealed only simple diffusion. Here, a new optimal estimator of diffusion coefficients reveals two-state kinetics of the protein. A simple, solvable model, in which the protein randomly switches between a loosely bound, highly mobile state and a tightly bound, less mobile state is the simplest possible dynamic model consistent with the data. It yields accurate estimates of hOGG1's (i) diffusivity in each state, uncorrupted by experimental errors arising from shot noise, motion blur and thermal fluctuations of the DNA; (ii) rates of switching between states and (iii) rate of detachment from the DNA. The protein spends roughly equal time in each state. It detaches only from the loosely bound state, with a rate that depends on pH and the salt concentration in solution, while its rates for switching between states are insensitive to both. The diffusivity in the loosely bound state depends primarily on pH and is three to ten times higher than in the tightly bound state. We propose and discuss some new experiments that take full advantage of the new tools of analysis presented here.

The genome-wide DNA sequence specificity of the anti-tumour drug bleomycin in human cells.

PubMed

Murray, Vincent; Chen, Jon K; Tanaka, Mark M

2016-07-01

The cancer chemotherapeutic agent, bleomycin, cleaves DNA at specific sites. For the first time, the genome-wide DNA sequence specificity of bleomycin breakage was determined in human cells. Utilising Illumina next-generation DNA sequencing techniques, over 200 million bleomycin cleavage sites were examined to elucidate the bleomycin genome-wide DNA selectivity. The genome-wide bleomycin cleavage data were analysed by four different methods to determine the cellular DNA sequence specificity of bleomycin strand breakage. For the most highly cleaved DNA sequences, the preferred site of bleomycin breakage was at 5'-GT* dinucleotide sequences (where the asterisk indicates the bleomycin cleavage site), with lesser cleavage at 5'-GC* dinucleotides. This investigation also determined longer bleomycin cleavage sequences, with preferred cleavage at 5'-GT*A and 5'- TGT* trinucleotide sequences, and 5'-TGT*A tetranucleotides. For cellular DNA, the hexanucleotide DNA sequence 5'-RTGT*AY (where R is a purine and Y is a pyrimidine) was the most highly cleaved DNA sequence. It was striking that alternating purine-pyrimidine sequences were highly cleaved by bleomycin. The highest intensity cleavage sites in cellular and purified DNA were very similar although there were some minor differences. Statistical nucleotide frequency analysis indicated a G nucleotide was present at the -3 position (relative to the cleavage site) in cellular DNA but was absent in purified DNA.

Maternal cell traffic bounds for immune modulation: tracking maternal H-2 alleles in spleens of baby mice by DNA fingerprinting.

PubMed

Wan, Wenhan; Shimizu, Shoji; Ikawa, Hiromichi; Sugiyama, Kiyosh; Yamaguchi, Nobuo

2002-10-01

We have previously reported that the immunization of pregnant mice with T-dependent antigens successfully induced suppression of the antigen-specific plaque-forming cell (PFC) response to the relevant antigens in the offspring. This suppression was not caused by the administered antigens, the antibodies produced by the pregnant mother, or lactational transfer, but was dependent on the presence of the intact maternal T cells. It was major histocompatibility complex (MHC)-restricted manner tolerance, which continued for at least one-sixth of the murine life. Traditionally, the placenta acts as a natural barrier, not allowing the cells to pass through. However, the results presented strongly suggested that maternal T cells pass through the placenta and subsequently induce tolerance. In this present study, we attempted to substantiate the presence of maternal cells in the fetal circulation through the use of molecular techniques. We found that a highly polymorphic microsatellite sequence within the class II Eb gene of the H-2 complex is useful for the molecular detection of various H-2 alleles. DNA polymorphic analysis was used for tracking maternal H-2 alleles in the spleens of baby mice. The main procedure involved polymerase chain reaction amplification and restriction fragment length polymorphism analysis of the DNA sequence encompassing the H-2-specific microsatellite from the genomic DNA of baby mice. The results indicated that maternal T cells of immunized pregnant mice cross the placenta into the fetus, eventually inducing antigen-specific immunological tolerance in the offspring.

Aptamer/Au nanoparticles/cobalt sulfide nanosheets biosensor for 17β-estradiol detection using a guanine-rich complementary DNA sequence for signal amplification.

PubMed

Huang, Ke-Jing; Liu, Yu-Jie; Zhang, Ji-Zong; Cao, Jun-Tao; Liu, Yan-Ming

2015-05-15

We have developed a sensitive sensing platform for 17β-estradiol by combining the aptamer probe and hybridization reaction. In this assay, 2-dimensional cobalt sulfide nanosheet (CoS) was synthesized by a simple hydrothermal method with L-cysteine as sulfur donor. An electrochemical aptamer biosensor was constructed by assembling a thiol group tagged 17β-estradiol aptamer on CoS and gold nanoparticles (AuNPs) modified electrode. Methylene blue was applied as a tracer and a guanine-rich complementary DNA sequence was designed to bind with the unbound 17β-estradiol aptamer for signal amplification. The binding of guanine-rich DNA to the aptamer was inhibited when the aptamer captured 17β-estradiol. Using guanine-rich DNA in the assay greatly amplified the redox signal of methylene blue bound to the detection probe. The CoS/AuNPs film formed on the biosensor surface appeared to be a good conductor for accelerating the electron transfer. The method demonstrated a high sensitivity of detection with the dynamic concentration range spanning from 1.0×10(-9) to 1.0×10(-12) M and a detection limit of 7.0×10(-13) M. Besides, the fabricated biosensor exhibited good selectivity toward 17β-estradiol even when interferents were presented at 100-fold concentrations. Our attempt will extend the application of the CoS nanosheet and this signal amplification assay to biosensing areas. Copyright © 2014 Elsevier B.V. All rights reserved.

History of retinoic acid receptors.

PubMed

Benbrook, Doris M; Chambon, Pierre; Rochette-Egly, Cécile; Asson-Batres, Mary Ann

2014-01-01

The discovery of retinoic acid receptors arose from research into how vitamins are essential for life. Early studies indicated that Vitamin A was metabolized into an active factor, retinoic acid (RA), which regulates RNA and protein expression in cells. Each step forward in our understanding of retinoic acid in human health was accomplished by the development and application of new technologies. Development cDNA cloning techniques and discovery of nuclear receptors for steroid hormones provided the basis for identification of two classes of retinoic acid receptors, RARs and RXRs, each of which has three isoforms, α, β and ɣ. DNA manipulation and crystallographic studies revealed that the receptors contain discrete functional domains responsible for binding to DNA, ligands and cofactors. Ligand binding was shown to induce conformational changes in the receptors that cause release of corepressors and recruitment of coactivators to create functional complexes that are bound to consensus promoter DNA sequences called retinoic acid response elements (RAREs) and that cause opening of chromatin and transcription of adjacent genes. Homologous recombination technology allowed the development of mice lacking expression of retinoic acid receptors, individually or in various combinations, which demonstrated that the receptors exhibit vital, but redundant, functions in fetal development and in vision, reproduction, and other functions required for maintenance of adult life. More recent advancements in sequencing and proteomic technologies reveal the complexity of retinoic acid receptor involvement in cellular function through regulation of gene expression and kinase activity. Future directions will require systems biology approaches to decipher how these integrated networks affect human stem cells, health, and disease.

Separation of a chemically modified DNA oligomer bound by the carcinogen 2-Amino-1-methy-6-phenylimidazo [4,5-{beta}]pyridine using capillary gel electrophoresis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nguyen, T.N.

1994-05-06

We have optimized the reaction conditions under which unactivated metabolite of the food borne carcinogen 2-amino-1-methyl-6-phenylimidazo [4,5-{beta}]pyridine (PhIP) is covalently bound to the oligodeoxynucleotide d(CCTACGCATCC). Capillary electrophoresis (CE) was used to separate and characterize this DNA oligomer bound by PhIP. We observed 2 major and several minor PhIP adduct species. The 2 major adducts had different absorbance maxima; the major adduct eluates with faster and slower mobilities had absorbance maxima of 360 and 340 nm, respectively. One of the two major PhIP adduct species was resolvable but the peak was broad. Using detection at 260 nm, the other major PhIPmore » adduct with fastest electrophoretic mobility was not resolvable, but coelute with the huge broad unmodified DNA oligomer peak. However, at higher wavelengths (>320 nm) where DNA does not absorb, electropherograms generated by detection at these higher wavelengths showed very heterogeneous binding by PhIP to the DNA oligomer with no interfering absorbance by the DNA.« less

The intron 1 of HPV 16 has a suboptimal branch point at a guanosine.

PubMed

De la Rosa-Rios, Marco Antonio; Martínez-Salazar, Martha; Martínez-Garcia, Martha; González-Bonilla, César; Villegas-Sepúlveda, Nicolás

2006-06-01

The branch point sequence (BPS) of intron 1 of the HPV-16 was determined via RT-PCR in a cell free system, using lariat intermediates obtained by in vitro splicing reactions. We used synthetic E6/E7 transcripts and HeLa nuclear protein extracts to obtain the splicing intermediates. Then, a divergent oligonucleotide primer set, pairing on the lariat RNA that encompassed the 2'-5' phosphodiester bond formed between the 5' end of the intron and the BPS, was used for cDNA synthesis and PCR amplification. Subsequent RT-PCR assays revealed four splicing intermediates, made up of a major intermediary corresponding to the BPS and four cryptic branched sequences. Only intermediates bound at the 5' end of the intron are probably the authentic branch point sequence, and all of them branch at guanosine 328 instead of the typical adenosine. Unusually, the BPS of intron 1 of HPV-16 is a suboptimal sequence (AGUGAGU) that differs from the eukaryotic consensus BPS, which correlates with the splicing profile observed for early transcripts of HPV-16 in tumors and tumor derived cell lines. The implications of this unusual branch point sequence for splicing of the HPV-16 pre-mRNA are discussed.

Activating mutations for transformation by p53 produce a gene product that forms an hsc70-p53 complex with an altered half-life

DOE Office of Scientific and Technical Information (OSTI.GOV)

Finlay, C.A.; Hinds, P.W.; Tan, T.H.

1988-02-01

The 11-4 p53 cDNA clone failed to transform primary rat fibroblasts when cotransfected with the ras oncogene. Two linker insertion mutations at amino acid 158 or 215 (of 390 amino acids) activated this p53 cDNA for transformation with ras. These mutant cDNAs produced a p53 protein that lacked an epitope, recognized by monoclonal antibody PAb246 (localized at amino acids 88 to 110 in the protein) and preferentially bound to a heat shock protein, hsc70. In rat cells transformed by a genomic p53 clone plus ras, two populations of p53 proteins were detected, PAb246/sup +/ and PAb246/sup -/, which did ormore » did not bind to this monoclonal antibody, respectively. The PAb246/sup -/ p53 preferentially associated with hsc70, and this protein has a half-life 4- to 20-fold longer than free p53 (PAb246/sup +/). These data suggest a possible functional role for hsc70 in the transformation process. cDNAs for p53 derived from methylcholanthrene-transformed cells transform rat cells in cooperation with the ras oncogene and produce a protein that bound with the heat shock proteins. Recombinant clones produced between a Meth A cDNA and 11-4 were tested for the ability to transform rat cells. A single amino acid substitution at residue 132 was sufficient to activate the 11-4 p53 cDNA for transformation. These studies have identified a region between amino acids 132 and 215 in the p53 protein which, when mutated, can activate the p53 cDNA. These results also call into question what the correct p53 wild-type sequence is and whether a wild-type p53 gene can transform cells in culture.« less

Modified naphthalene diimide as a suitable tetraplex DNA ligand: application to cancer diagnosis and anti-cancer drug

NASA Astrophysics Data System (ADS)

Takenaka, Shigeori

2017-07-01

It is known that naphthalene diimide carrying two substituents binds to DNA duplex with threading intercalation. Naphthalene diimide carrying ferrocene moieties, ferrocenylnaphthalene diimide (FND), formed a stable complex with DNA duplex and an electrochemical gene detection was achieved with current signal generated from FND bound to the DNA duplex between target DNA and DNA probe immobilized electrode. FND couldn't bind to the mismatched and its surrounding region of DNA duplex and thus FND was applied to the precision detection of single nucleotide polymorphisms (SNPs) using the improved discrimination ability between fully matched and mismatched DNA hybrids and multi-electrode chip. Some of FND derivatives bound to telomere DNA tetraplex stronger than to DNA duplex and was applied to cancer diagnosis as a measure of the elongated telomere DNA with telomerase as a suitable maker of cancer. Furthermore, cyclic naphthalene diimides realized the extremely high preference for DNA tetraplex over DNA duplex. Such molecules will open an effective anti-cancer drug based on telomerase specific inhibitor.

Fusion of Escherichia coli heat-stable enterotoxin and heat-labile enterotoxin B subunit.

PubMed

Guzman-Verduzco, L M; Kupersztoch, Y M

1987-11-01

The 3' terminus of the DNA coding for the extracellular Escherichia coli heat-stable enterotoxin (ST) devoid of transcription and translation stop signals was fused to the 5' terminus of the DNA coding for the periplasmic B subunit of the heat-labile enterotoxin (LTB) deleted of ribosomal binding sites and leader peptide. By RNA-DNA hybridization analysis, it was shown that the fused DNA was transcribed in vivo into an RNA species in close agreement with the expected molecular weight inferred from the nucleotide sequence. The translation products of the fused DNA resulted in a hybrid molecule recognized in Western blots (immunoblots) with antibodies directed against the heat-labile moiety. Anti-LTB antibodies coupled to a solid support bound ST and LTB simultaneously when incubated with ST-LTB cellular extracts. By [35S]cysteine pulse-chase experiments, it was shown that the fused ST-LTB polypeptide was converted from a precursor with an equivalent electrophoretic mobility of 20,800 daltons to an approximately 18,500-dalton species, which accumulated within the cell. The data suggest that wild-type ST undergoes at least two processing steps during its export to the culture supernatant. Blocking the natural carboxy terminus of ST inhibited the second proteolytic step and extracellular delivery of the hybrid molecule.

Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.

PubMed Central

Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I

1998-01-01

The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions. PMID:9443977

Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.

PubMed

Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I

1998-02-01

The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions.

Macroscopic modeling and simulations of supercoiled DNA with bound proteins

NASA Astrophysics Data System (ADS)

Huang, Jing; Schlick, Tamar

2002-11-01

General methods are presented for modeling and simulating DNA molecules with bound proteins on the macromolecular level. These new approaches are motivated by the need for accurate and affordable methods to simulate slow processes (on the millisecond time scale) in DNA/protein systems, such as the large-scale motions involved in the Hin-mediated inversion process. Our approaches, based on the wormlike chain model of long DNA molecules, introduce inhomogeneous potentials for DNA/protein complexes based on available atomic-level structures. Electrostatically, treat those DNA/protein complexes as sets of effective charges, optimized by our discrete surface charge optimization package, in which the charges are distributed on an excluded-volume surface that represents the macromolecular complex. We also introduce directional bending potentials as well as non-identical bead hydrodynamics algorithm to further mimic the inhomogeneous effects caused by protein binding. These models thus account for basic elements of protein binding effects on DNA local structure but remain computational tractable. To validate these models and methods, we reproduce various properties measured by both Monte Carlo methods and experiments. We then apply the developed models to study the Hin-mediated inversion system in long DNA. By simulating supercoiled, circular DNA with or without bound proteins, we observe significant effects of protein binding on global conformations and long-time dynamics of the DNA on the kilo basepair length.

Experimental and computational studies on the effects of valganciclovir as an antiviral drug on calf thymus DNA.

PubMed

Shahabadi, Nahid; Pourfoulad, Mehdi; Moghadam, Neda Hosseinpour

2017-01-02

DNA-binding properties of an antiviral drug, valganciclovir (valcyte) was studied by using emission, absorption, circular dichroism, viscosity, differential pulse voltammetry, fluorescence techniques, and computational studies. The drug bound to calf thymus DNA (ct-DNA) in a groove-binding mode. The calculated binding constant of UV-vis, K a , is comparable to groove-binding drugs. Competitive fluorimetric studies with Hoechst 33258 showed that valcyte could displace the DNA-bound Hoechst 33258. The drug could not displace intercalated methylene blue from DNA double helix. Furthermore, the induced detectable changes in the CD spectrum of ct-DNA as well as changes in its viscosity confirm the groove-binding mode. In addition, an integrated molecular docking was employed to further investigate the binding interactions between valcyte and calf thymus DNA.

A detailed protocol for chromatin immunoprecipitation in the yeast Saccharomyces cerevisiae.

PubMed

Grably, Melanie; Engelberg, David

2010-01-01

Critical cellular processes such as DNA replication, DNA damage repair, and transcription are mediated and regulated by DNA-binding proteins. Many efforts have been invested therefore in developing methods that monitor the dynamics of protein-DNA association. As older techniques such as DNA footprinting, and electrophoretic mobility shift assays (EMSA) could be applied mostly in vitro, the development of the chromatin immunoprecipitation (ChIP) method, which allows quantitative measurement of protein-bound DNA most accurately in vivo, revolutionized our capabilities of understanding the mechanisms underlying the aforementioned processes. Furthermore, this powerful tool could be applied at the genomic-scale providing a global picture of the protein-DNA complexes at the entire genome.The procedure is conceptually simple; involves rapid crosslinking of proteins to DNA by the addition of formaldehyde to the culture, shearing the DNA and immunoprecipitating the protein of interest while covalently bound to its DNA targets. Following decrosslinking, DNA that was coimmunoprecipitated could be amplified by PCR or could serve as a probe of a genomic microarray to identify all DNA fragments that were bound to the protein.Although simple in principle, the method is not trivial to implement and the results might be misleading if proper controls are not included in the experiment. In this chapter, we provide therefore a highly detailed protocol of ChIP assay as is applied successfully in our laboratory. We pay special attention to describe every small detail, in order that any investigator could readily and successfully apply this important and powerful technology.

Presynaptic Filament Dynamics in Homologous Recombination and DNA Repair

PubMed Central

Liu, Jie; Ehmsen, Kirk T.; Heyer, Wolf-Dietrich; Morrical, Scott W.

2014-01-01

Homologous Recombination (HR) is an essential genome stability mechanism used for high-fidelity repair of DNA double-strand breaks and for the recovery of stalled or collapsed DNA replication forks. The crucial homology search and DNA strand exchange steps of HR are catalyzed by presynaptic filaments—helical filaments of a recombinase enzyme bound to single-stranded DNA. Presynaptic filaments are fundamentally dynamic structures, the assembly, catalytic turnover, and disassembly of which must be closely coordinated with other elements of the DNA recombination, repair, and replication machinery in order for genome maintenance functions to be effective. Here, we review the major dynamic elements controlling the assembly, activity, and disassembly of presynaptic filaments: some intrinsic such as recombinase ATP binding and hydrolytic activities, others extrinsic such as ssDNA-binding proteins, mediator proteins, and DNA motor proteins. We examine dynamic behavior on multiple levels, including atomic- and filament-level structural changes associated with ATP binding and hydrolysis as evidenced in crystal structures, as well as subunit binding and dissociation events driven by intrinsic and extrinsic factors. We examine the biochemical properties of recombination proteins from four model systems (T4 phage, E. coli, S. cerevisiae, and H. sapiens), demonstrating how their properties are tailored for the context-specific requirements in these diverse species. We propose that the presynaptic filament has evolved to rely on multiple external factors for increased multi-level regulation of HR processes in genomes with greater structural and sequence complexity. PMID:21599536

Sequence and Structure Dependent DNA-DNA Interactions

NASA Astrophysics Data System (ADS)

Kopchick, Benjamin; Qiu, Xiangyun

Molecular forces between dsDNA strands are largely dominated by electrostatics and have been extensively studied. Quantitative knowledge has been accumulated on how DNA-DNA interactions are modulated by varied biological constituents such as ions, cationic ligands, and proteins. Despite its central role in biology, the sequence of DNA has not received substantial attention and ``random'' DNA sequences are typically used in biophysical studies. However, ~50% of human genome is composed of non-random-sequence DNAs, particularly repetitive sequences. Furthermore, covalent modifications of DNA such as methylation play key roles in gene functions. Such DNAs with specific sequences or modifications often take on structures other than the canonical B-form. Here we present series of quantitative measurements of the DNA-DNA forces with the osmotic stress method on different DNA sequences, from short repeats to the most frequent sequences in genome, and to modifications such as bromination and methylation. We observe peculiar behaviors that appear to be strongly correlated with the incurred structural changes. We speculate the causalities in terms of the differences in hydration shell and DNA surface structures.

Identifying Bacterial Immune Evasion Proteins Using Phage Display.

PubMed

Fevre, Cindy; Scheepmaker, Lisette; Haas, Pieter-Jan

2017-01-01

Methods aimed at identification of immune evasion proteins are mainly rely on in silico prediction of sequence, structural homology to known evasion proteins or use a proteomics driven approach. Although proven successful these methods are limited by a low efficiency and or lack of functional identification. Here we describe a high-throughput genomic strategy to functionally identify bacterial immune evasion proteins using phage display technology. Genomic bacterial DNA is randomly fragmented and ligated into a phage display vector that is used to create a phage display library expressing bacterial secreted and membrane bound proteins. This library is used to select displayed bacterial secretome proteins that interact with host immune components.

Binding of leachable components of polymethyl methacrylate (PMMA) and peptide on modified SPR chip

NASA Astrophysics Data System (ADS)

Szaloki, M.; Vitalyos, G.; Harfalvi, J.; Hegedus, Cs

2013-12-01

Many types of polymers are often used in dentistry, which may cause allergic reaction, mainly methyl methacrylate allergy due to the leachable, degradable components of polymerized dental products. The aim of this study was to investigate the interaction between the leachable components of PMMA and peptides by Fourier-transform Surface Plasmon Resonance (FT SPR). In our previous work binding of oligopeptides (Ph.D.-7 and Ph.D.-12 Peptide Library Kit) was investigated to PMMA surface by phage display technique. It was found that oligopeptides bounded specifically to PMMA surface. The most common amino acids were leucine and proline inside the amino acids sequences of DNA of phages. The binding of haptens, as formaldehyde and methacrylic acid, to frequent amino acids was to investigate on the modified gold SPR chip. Self assembled monolayer (SAM) modified the surface of gold chip and ensured the specific binding between the haptens and amino acids. It was found that amino acids bounded to modified SPR gold and the haptens bounded to amino acids by creating multilayer on the chip surface. By the application of phage display and SPR modern bioanalytical methods the interaction between allergens and peptides can be investigated.

MiR-21 is enriched in the RNA-induced silencing complex and targets COL4A1 in human granulosa cell lines.

PubMed

Mase, Yuri; Ishibashi, Osamu; Ishikawa, Tomoko; Takizawa, Takami; Kiguchi, Kazushige; Ohba, Takashi; Katabuchi, Hidetaka; Takeshita, Toshiyuki; Takizawa, Toshihiro

2012-10-01

MicroRNAs (miRNAs) are noncoding small RNAs that play important roles in a variety of physiological and pathological events. In this study, we performed large-scale profiling of EIF2C2-bound miRNAs in 3 human granulosa-derived cell lines (ie, KGN, HSOGT, and GC1a) by high-throughput sequencing and found that miR-21 accounted for more than 80% of EIF2C2-bound miRNAs, suggesting that it was enriched in the RNA-induced silencing complex (RISC) and played a functional role in human granulosa cell (GC) lines. We also found high expression levels of miR-21 in primary human GCs. Assuming that miR-21 target mRNAs are enriched in RISC, we performed cDNA cloning of EIF2C2-bound mRNAs in KGN cells. We identified COL4A1 mRNA as a miR-21 target in the GC lines. These data suggest that miR-21 is involved in the regulation of the synthesis of COL4A1, a component of the basement membrane surrounding the GC layer and granulosa-embedded extracellular structure.

Electron accommodation dynamics in the DNA base thymine

NASA Astrophysics Data System (ADS)

King, Sarah B.; Stephansen, Anne B.; Yokoi, Yuki; Yandell, Margaret A.; Kunin, Alice; Takayanagi, Toshiyuki; Neumark, Daniel M.

2015-07-01

The dynamics of electron attachment to the DNA base thymine are investigated using femtosecond time-resolved photoelectron imaging of the gas phase iodide-thymine (I-T) complex. An ultraviolet pump pulse ejects an electron from the iodide and prepares an iodine-thymine temporary negative ion that is photodetached with a near-IR probe pulse. The resulting photoelectrons are analyzed with velocity-map imaging. At excitation energies ranging from -120 meV to +90 meV with respect to the vertical detachment energy (VDE) of 4.05 eV for I-T, both the dipole-bound and valence-bound negative ions of thymine are observed. A slightly longer rise time for the valence-bound state than the dipole-bound state suggests that some of the dipole-bound anions convert to valence-bound species. No evidence is seen for a dipole-bound anion of thymine at higher excitation energies, in the range of 0.6 eV above the I-T VDE, which suggests that if the dipole-bound anion acts as a "doorway" to the valence-bound anion, it only does so at excitation energies near the VDE of the complex.

Electron accommodation dynamics in the DNA base thymine.

PubMed

King, Sarah B; Stephansen, Anne B; Yokoi, Yuki; Yandell, Margaret A; Kunin, Alice; Takayanagi, Toshiyuki; Neumark, Daniel M

2015-07-14

The dynamics of electron attachment to the DNA base thymine are investigated using femtosecond time-resolved photoelectron imaging of the gas phase iodide-thymine (I(-)T) complex. An ultraviolet pump pulse ejects an electron from the iodide and prepares an iodine-thymine temporary negative ion that is photodetached with a near-IR probe pulse. The resulting photoelectrons are analyzed with velocity-map imaging. At excitation energies ranging from -120 meV to +90 meV with respect to the vertical detachment energy (VDE) of 4.05 eV for I(-)T, both the dipole-bound and valence-bound negative ions of thymine are observed. A slightly longer rise time for the valence-bound state than the dipole-bound state suggests that some of the dipole-bound anions convert to valence-bound species. No evidence is seen for a dipole-bound anion of thymine at higher excitation energies, in the range of 0.6 eV above the I(-)T VDE, which suggests that if the dipole-bound anion acts as a "doorway" to the valence-bound anion, it only does so at excitation energies near the VDE of the complex.

A Structural Basis for the Regulatory Inactivation of DnaA

PubMed Central

Xu, Qingping; McMullan, Daniel; Abdubek, Polat; Astakhova, Tamara; Carlton, Dennis; Chen, Connie; Chiu, Hsiu-Ju; Clayton, Thomas; Das, Debanu; Deller, Marc C.; Duan, Lian; Elsliger, Marc-Andre; Feuerhelm, Julie; Hale, Joanna; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K.; Johnson, Hope A.; Klock, Heath E.; Knuth, Mark W.; Kozbial, Piotr; Krishna, S. Sri; Kumar, Abhinav; Marciano, David; Miller, Mitchell D.; Morse, Andrew T.; Nigoghossian, Edward; Nopakun, Amanda; Okach, Linda; Oommachen, Silvya; Paulsen, Jessica; Puckett, Christina; Reyes, Ron; Rife, Christopher L.; Sefcovic, Natasha; Trame, Christine; van den Bedem, Henry; Weekes, Dana; Hodgson, Keith O.; Wooley, John; Deacon, Ashley M.; Godzik, Adam; Lesley, Scott A.; Wilson, Ian A.

2009-01-01

Summary Regulatory inactivation of DnaA is dependent on Hda, a protein homologous to the AAA+ ATPase region of the replication initiator DnaA. When bound to the sliding clamp loaded onto duplex DNA, Hda can stimulate the transformation of active DnaA-ATP into inactive DnaA-ADP. The crystal structure of Hda from Shewanella amazonensis SB2B at 1.75 Å resolution reveals that Hda resembles typical AAA+ ATPases. The arrangement of the two subdomains in Hda (residues 1-174, 175-241) differs dramatically from that of DnaA. A CDP molecule anchors the Hda domains in a conformation which promotes dimer formation. The Hda dimer adopts a novel oligomeric assembly for AAA+ proteins in which the arginine finger, crucial for ATP hydrolysis, is fully exposed and available to hydrolyze DnaA-ATP through a typical AAA+ type mechanism. The sliding clamp binding motifs at the N-terminus of each Hda monomer are partially buried and combine to form an antiparallel β-sheet at the dimer interface. The inaccessibility of the clamp binding motifs in the CDP bound structure of Hda suggests that conformational changes are required for Hda to form a functional complex with the clamp. Thus, the CDP-bound Hda dimer likely represents an inactive form of Hda. PMID:19000695

Cloning, in Vitro expression, and novel phylogenetic classification of a channel catfish estrogen receptor

USGS Publications Warehouse

Xia, Z.; Patino, R.; Gale, W.L.; Maule, A.G.; Densmore, L.D.

1999-01-01

We obtained two channel catfish estrogen receptor (ccER) cDNA from liver of female fish using RT–PCR. The two fragments were identical in sequence except that the smaller one had an out-of-frame deletion in the E domain, suggesting the existence of ccER splice variants. The larger fragment was used to screen a cDNA library from liver of a prepubescent female. A cDNA was obtained that encoded a 581-amino-acid ER with a deduced molecular weight of 63.8 kDa. Extracts of COS-7 cells transfected with ccER cDNA bound estrogen with high affinity (Kd = 4.7 nM) and specificity. Maximum parsimony and Neighbor Joining analyses were used to generate a phylogenetic classification of ccER on the basis of 18 full-length ER sequences. The tree suggested the existence of two major ER branches. One branch contained two clearly divergent clades which included all piscine ER (except Japanese eel ER) and all tetrapod ERα, respectively. The second major branch contained the eel ER and the mammalian ERβ. The high degree of divergence between the eel ER and mammalian ERβ suggested that they also represent distinct piscine and tetrapod ER. These data suggest that ERα and ERβ are present throughout vertebrates and that these two major ER types evolved by duplication of an ancestral ER gene. Sequence alignments with other members of the nuclear hormone receptor superfamily indicated the presence of 8 amino acids in the E domain that align exclusively among ER. Four of these amino acids have not received prior research attention and their function is unknown. The novel finding of putative ER splice variants in a nonmammalian vertebrate and the novel phylogenetic classification of ER offer new perspectives in understanding the diversification and function of ER.

The Dermatophagoides farinae group 22 allergen: cloning and expression in Escherichia coli.

PubMed

Cui, Yu-bao; Cai, Hong-xing; Zhou, Ying; Wang, Nan; Yu, Li-li; Yang, Li; Zhang, Cheng-bo

2015-09-01

Dermatophagoides farinae (Hughes) (Acari: Pyroglyphidae) and other domestic mites produce allergens that affect people worldwide. Here, the complementary DNA (cDNA) coding for group 22 allergen of D. farinae (Der f 22) from China was cloned, sequenced, and expressed successfully. The cDNA encoding Der f 22 was synthesized by reverse transcription polymerase chain reaction (RT-PCR), then ligated to the pCold-TF for expression in Escherichia coli BL21 cells. The purified recombinant fusion protein was identified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), Western-blotting, and tandem matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF/TOF). The full-length cDNA comprised 468 nucleotides and was 99.57% (466/468) identical with the reference sequence (GenBank: DQ643992). After the plasmid pCold-TF-Der f 22 was transformed into E. coli BL21 and expressed with the induction of IPTG, SDS-PAGE showed a specific band for the recombinant fusion protein. The recombinant fusion protein, which was purified by chromatography, bound with a His-tagged antibody by Western blotting. MALDI-TOF/TOF mass spectrometry revealed that the structure of the recombinant protein was identical to the predicted Der f 22 structure. The hydrophilic protein contains a signal peptide of 20 amino acids, and the mature Der f 22 consists of 135 amino acid residues with a molecular weight of 14.7 kDa and theoretical isoelectric points (pI) of 6.38. Its secondary structure comprises an alpha helix (38.5%), beta-sheet (45.9%), random coils (11.85%), and beta-turns (11.1%). This work represents the first reported full-length sequence and successful cloning of Der f 22 from D. farinae in China; bioinformatics analysis can be used to further study the allergenicity and clinical utility of the recombinant Der f 22. © 2015 ARS-AAOA, LLC.

Exonuclease III-Assisted Upconversion Resonance Energy Transfer in a Wash-Free Suspension DNA Assay.

PubMed

Chen, Yinghui; Duong, Hien T T; Wen, Shihui; Mi, Chao; Zhou, Yingzhu; Shimoni, Olga; Valenzuela, Stella M; Jin, Dayong

2018-01-02

Sensitivity is the key in optical detection of low-abundant analytes, such as circulating RNA or DNA. The enzyme Exonuclease III (Exo III) is a useful tool in this regard; its ability to recycle target DNA molecules results in markedly improved detection sensitivity. Lower limits of detection may be further achieved if the detection background of autofluorescence can be removed. Here we report an ultrasensitive and specific method to quantify trace amounts of DNA analytes in a wash-free suspension assay. In the presence of target DNA, the Exo III recycles the target DNA by selectively digesting the dye-tagged sequence-matched probe DNA strand only, so that the amount of free dye removed from the probe DNA is proportional to the number of target DNAs. Remaining intact probe DNAs are then bound onto upconversion nanoparticles (energy donor), which allows for upconversion luminescence resonance energy transfer (LRET) that can be used to quantify the difference between the free dye and tagged dye (energy acceptor). This scheme simply avoids both autofluorescence under infrared excitation and many tedious washing steps, as the free dye molecules are physically located away from the nanoparticle surface, and as such they remain "dark" in suspension. Compared to alternative approaches requiring enzyme-assisted amplification on the nanoparticle surface, introduction of probe DNAs onto nanoparticles only after DNA hybridization and signal amplification steps effectively avoids steric hindrance. Via this approach, we have achieved a detection limit of 15 pM in LRET assays of human immunodeficiency viral DNA.

Thermostable group II intron reverse transcriptase fusion proteins and their use in cDNA synthesis and next-generation RNA sequencing.

PubMed

Mohr, Sabine; Ghanem, Eman; Smith, Whitney; Sheeter, Dennis; Qin, Yidan; King, Olga; Polioudakis, Damon; Iyer, Vishwanath R; Hunicke-Smith, Scott; Swamy, Sajani; Kuersten, Scott; Lambowitz, Alan M

2013-07-01

Mobile group II introns encode reverse transcriptases (RTs) that function in intron mobility ("retrohoming") by a process that requires reverse transcription of a highly structured, 2-2.5-kb intron RNA with high processivity and fidelity. Although the latter properties are potentially useful for applications in cDNA synthesis and next-generation RNA sequencing (RNA-seq), group II intron RTs have been difficult to purify free of the intron RNA, and their utility as research tools has not been investigated systematically. Here, we developed general methods for the high-level expression and purification of group II intron-encoded RTs as fusion proteins with a rigidly linked, noncleavable solubility tag, and we applied them to group II intron RTs from bacterial thermophiles. We thus obtained thermostable group II intron RT fusion proteins that have higher processivity, fidelity, and thermostability than retroviral RTs, synthesize cDNAs at temperatures up to 81°C, and have significant advantages for qRT-PCR, capillary electrophoresis for RNA-structure mapping, and next-generation RNA sequencing. Further, we find that group II intron RTs differ from the retroviral enzymes in template switching with minimal base-pairing to the 3' ends of new RNA templates, making it possible to efficiently and seamlessly link adaptors containing PCR-primer binding sites to cDNA ends without an RNA ligase step. This novel template-switching activity enables facile and less biased cloning of nonpolyadenylated RNAs, such as miRNAs or protein-bound RNA fragments. Our findings demonstrate novel biochemical activities and inherent advantages of group II intron RTs for research, biotechnological, and diagnostic methods, with potentially wide applications.

Direct fluorescence in situ hybridization on human metaphase chromosomes using quantum dot-platinum labeled DNA probes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hwang, Gyoyeon; Biological Chemistry, Korea University of Science and Technology, 217, Gajeong-ro, Yuseong-gu, Deajeon; Lee, Hansol

The telomere shortening in chromosomes implies the senescence, apoptosis, or oncogenic transformation of cells. Since detecting telomeres in aging and diseases like cancer, is important, the direct detection of telomeres has been a very useful biomarker. We propose a telomere detection method using a newly synthesized quantum dot (QD) based probe with oligonucleotide conjugation and direct fluorescence in situ hybridization (FISH). QD-oligonucleotides were prepared with metal coordination bonding based on platinum-guanine binding reported in our previous work. The QD-oligonucleotide conjugation method has an advantage where any sequence containing guanine at the end can be easily bound to the starting QD-Ptmore » conjugate. A synthesized telomeric oligonucleotide was bound to the QD-Pt conjugate successfully and this probe hybridized specifically on the telomere of fabricated MV-4-11 and MOLT-4 chromosomes. Additionally, the QD-telomeric oligonucleotide probe successfully detected the telomeres on the CGH metaphase slide. Due to the excellent photostability and high quantum yield of QDs, the QD-oligonucleotide probe has high fluorescence intensity when compared to the organic dye-oligonucleotide probe. Our QD-oligonucleotide probe, conjugation method of this QD probe, and hybridization protocol with the chromosomes can be a useful tool for chromosome painting and FISH. - Highlights: • We prepared a probe linked between QD and telomeric oligonucleotide with platinum-guanine bonding. • Telomeres were detected by our new telomere probes successfully in three different human metaphase chromosomes. • QDPt-DNA probe has high fluorescence intensity in comparison with organic dye-DNA probe.« less

Cell and microsome mediated binding of 7,12-dimethylbenz(a)anthracene to DNA studied by fluorescence spectroscopy.

PubMed

Ivanovic, V; Geacintov, N E; Jeffrey, A M; Fu, P P; Harvey, R G; Weinstein, I B

1978-03-01

Fluorescence spectra of DNA isolated from hamster embryo cells incubated with 7,12-dimethylbenz(a)anthracene, or DNA modified in a microsomal system by reaction with this carcinogen or its 7-hydroxymethyl derivative, were compared to various model compounds. The spectra indicate that the DMBA derivative bound to DNA, in all 3 cases, has a 9,10-dimethylanthracene-like chromophore. They also provide the first evidence of the similarity in structure of the DNA-bound products between 7,12-dimethylbenz(a)anthracene and its 7-hydroxymethyl derivative. Our results are consistent with an activation mechanism that involves saturation of the 1,2,3,4-ring positions.

Direct single-stranded DNA binding by Teb1 mediates the recruitment of Tetrahymena thermophila telomerase to telomeres.

PubMed

Upton, Heather E; Hong, Kyungah; Collins, Kathleen

2014-11-15

The eukaryotic reverse transcriptase telomerase copies its internal RNA template to synthesize telomeric DNA repeats at chromosome ends in balance with sequence loss during cell proliferation. Previous work has established several factors involved in telomerase recruitment to telomeres in yeast and mammalian cells; however, it remains unclear what determines the association of telomerase with telomeres in other organisms. Here we investigate the cell cycle dependence of telomere binding by each of the seven Tetrahymena thermophila telomerase holoenzyme proteins TERT, p65, Teb1, p50, p75, p45, and p19. We observed coordinate cell cycle-regulated recruitment and release of all of the subunits, including the telomeric-repeat DNA-binding subunit Teb1. Using domain truncation and mutagenesis approaches, we investigated which subunits govern the interaction of telomerase holoenzyme with telomeres. Our results show that Teb1 is critical for telomere interaction of other holoenzyme subunits and demonstrate that high-affinity Teb1 DNA-binding activity is necessary and sufficient for cell cycle-regulated telomere association. Overall, these and additional findings indicate that in the ciliate Tetrahymena, telomerase recruitment to telomeres requires direct binding to single-stranded DNA, unlike the indirect DNA recognition through telomere-bound proteins essential in yeast and mammalian cells. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Chromatin tethering effects of hNopp140 are involved in the spatial organization of nucleolus and the rRNA gene transcription

PubMed Central

Tsai, Yi-Tzang; Lin, Chen-I; Chen, Hung-Kai; Lee, Kuo-Ming; Hsu, Chia-Yi; Yang, Shun-Jen

2008-01-01

The short arms of five human acrocentric chromosomes contain ribosomal gene (rDNA) clusters where numerous mini-nucleoli arise at the exit of mitosis. These small nucleoli tend to coalesce into one or a few large nucleoli during interphase by unknown mechanisms. Here, we demonstrate that the N- and C-terminal domains of a nucleolar protein, hNopp140, bound respectively to α-satellite arrays and rDNA clusters of acrocentric chromosomes for nucleolar formation. The central acidic-and-basic repeated domain of hNopp140, possessing a weak self-self interacting ability, was indispensable for hNopp140 to build up a nucleolar round-shaped structure. The N- or the C-terminally truncated hNopp140 caused nucleolar segregation and was able to alter locations of the rDNA transcription, as mediated by detaching the rDNA repeats from the acrocentric α-satellite arrays. Interestingly, an hNopp140 mutant, made by joining the N- and C-terminal domains but excluding the entire central repeated region, induced nucleolar disruption and global chromatin condensation. Furthermore, RNAi knockdown of hNopp140 resulted in dispersion of the rDNA and acrocentric α-satellite sequences away from nucleolus that was accompanied by rDNA transcriptional silence. Our findings indicate that hNopp140, a scaffold protein, is involved in the nucleolar assembly, fusion, and maintenance. PMID:18253863

Species-Specific Elements in the Large T-Antigen J Domain Are Required for Cellular Transformation and DNA Replication by Simian Virus 40

PubMed Central

Sullivan, Christopher S.; Tremblay, James D.; Fewell, Sheara W.; Lewis, John A.; Brodsky, Jeffrey L.; Pipas, James M.

2000-01-01

The J domain of simian virus 40 (SV40) large T antigen is required for efficient DNA replication and transformation. Despite previous reports demonstrating the promiscuity of J domains in heterologous systems, results presented here show the requirement for specific J-domain sequences in SV40 large-T-antigen-mediated activities. In particular, chimeric-T-antigen constructs in which the SV40 T-antigen J domain was replaced with that from the yeast Ydj1p or Escherichia coli DnaJ proteins failed to replicate in BSC40 cells and did not transform REF52 cells. However, T antigen containing the JC virus J domain was functional in these assays, although it was less efficient than the wild type. The inability of some large-T-antigen chimeras to promote DNA replication and elicit cellular transformation was not due to a failure to interact with hsc70, since a nonfunctional chimera, containing the DnaJ J domain, bound hsc70. However, this nonfunctional chimeric T antigen was reduced in its ability to stimulate hsc70 ATPase activity and unable to liberate E2F from p130, indicating that transcriptional activation of factors required for cell growth and DNA replication may be compromised. Our data suggest that the T-antigen J domain harbors species-specific elements required for viral activities in vivo. PMID:10891510

Flexibility of KorA, a plasmid-encoded, global transcription regulator, in the presence and the absence of its operator

PubMed Central

Rajasekar, Karthik V.; Lovering, Andrew L.; Dancea, Felician; Scott, David J.; Harris, Sarah A.; Bingle, Lewis E.H.; Roessle, Manfred; Thomas, Christopher M.; Hyde, Eva I.; White, Scott A.

2016-01-01

Abstract The IncP (Incompatibility group P) plasmids are important carriers in the spread of antibiotic resistance across Gram-negative bacteria. Gene expression in the IncP-1 plasmids is stringently controlled by a network of four global repressors, KorA, KorB, TrbA and KorC interacting cooperatively. Intriguingly, KorA and KorB can act as co-repressors at varying distances between their operators, even when they are moved to be on opposite sides of the DNA. KorA is a homodimer with the 101-amino acid subunits, folding into an N-terminal DNA-binding domain and a C-terminal dimerization domain. In this study, we have determined the structures of the free KorA repressor and two complexes each bound to a 20-bp palindromic DNA duplex containing its consensus operator sequence. Using a combination of X-ray crystallography, nuclear magnetic resonance spectroscopy, SAXS and molecular dynamics calculations, we show that the linker between the two domains is very flexible and the protein remains highly mobile in the presence of DNA. This flexibility allows the DNA-binding domains of the dimer to straddle the operator DNA on binding and is likely to be important in cooperative binding to KorB. Unexpectedly, the C-terminal domain of KorA is structurally similar to the dimerization domain of the tumour suppressor p53. PMID:27016739

The crystal structure of the Sox4 HMG domain-DNA complex suggests a mechanism for positional interdependence in DNA recognition.

PubMed

Jauch, Ralf; Ng, Calista K L; Narasimhan, Kamesh; Kolatkar, Prasanna R

2012-04-01

It has recently been proposed that the sequence preferences of DNA-binding TFs (transcription factors) can be well described by models that include the positional interdependence of the nucleotides of the target sites. Such binding models allow for multiple motifs to be invoked, such as principal and secondary motifs differing at two or more nucleotide positions. However, the structural mechanisms underlying the accommodation of such variant motifs by TFs remain elusive. In the present study we examine the crystal structure of the HMG (high-mobility group) domain of Sox4 [Sry (sex-determining region on the Y chromosome)-related HMG box 4] bound to DNA. By comparing this structure with previously solved structures of Sox17 and Sox2, we observed subtle conformational differences at the DNA-binding interface. Furthermore, using quantitative electrophoretic mobility-shift assays we validated the positional interdependence of two nucleotides and the presence of a secondary Sox motif in the affinity landscape of Sox4. These results suggest that a concerted rearrangement of two interface amino acids enables Sox4 to accommodate primary and secondary motifs. The structural adaptations lead to altered dinucleotide preferences that mutually reinforce each other. These analyses underline the complexity of the DNA recognition by TFs and provide an experimental validation for the conceptual framework of positional interdependence and secondary binding motifs.

Revisiting the TALE repeat.

PubMed

Deng, Dong; Yan, Chuangye; Wu, Jianping; Pan, Xiaojing; Yan, Nieng

2014-04-01

Transcription activator-like (TAL) effectors specifically bind to double stranded (ds) DNA through a central domain of tandem repeats. Each TAL effector (TALE) repeat comprises 33-35 amino acids and recognizes one specific DNA base through a highly variable residue at a fixed position in the repeat. Structural studies have revealed the molecular basis of DNA recognition by TALE repeats. Examination of the overall structure reveals that the basic building block of TALE protein, namely a helical hairpin, is one-helix shifted from the previously defined TALE motif. Here we wish to suggest a structure-based re-demarcation of the TALE repeat which starts with the residues that bind to the DNA backbone phosphate and concludes with the base-recognition hyper-variable residue. This new numbering system is consistent with the α-solenoid superfamily to which TALE belongs, and reflects the structural integrity of TAL effectors. In addition, it confers integral number of TALE repeats that matches the number of bound DNA bases. We then present fifteen crystal structures of engineered dHax3 variants in complex with target DNA molecules, which elucidate the structural basis for the recognition of bases adenine (A) and guanine (G) by reported or uncharacterized TALE codes. Finally, we analyzed the sequence-structure correlation of the amino acid residues within a TALE repeat. The structural analyses reported here may advance the mechanistic understanding of TALE proteins and facilitate the design of TALEN with improved affinity and specificity.

A novel, sensitive and label-free loop-mediated isothermal amplification detection method for nucleic acids using luminophore dyes.

PubMed

Roy, Sharmili; Wei, Sim Xiao; Ying, Jean Liew Zhi; Safavieh, Mohammadali; Ahmed, Minhaz Uddin

2016-12-15

Electrochemiluminescence (ECL) has been widely rendered for nucleic acid testing. Here, we integrate loop-mediated isothermal amplification (LAMP) with ECL technique for DNA detection and quantification. The target LAMP DNA bound electrostatically with [Ru(bpy)3](+2) on the carbon electrode surface, and an ECL reaction was triggered by tripropylamine (TPrA) to yield luminescence. We illustrated this method as a new and highly sensitive strategy for the detection of sequence-specific DNA from different meat species at picogram levels. The proposed strategy renders the signal amplification capacities of TPrA and combines LAMP with inherently high sensitivity of the ECL technique, to facilitate the detection of low quantities of DNA. By leveraging this technique, target DNA of Sus scrofa (pork) meat was detected as low as 1pg/µL (3.43×10(-1)copies/µL). In addition, the proposed technique was applied for detection of Bacillus subtilis DNA samples and detection limit of 10pg/µL (2.2×10(3)copies/µL) was achieved. The advantages of being isothermal, sensitive and robust with ability for multiplex detection of bio-analytes makes this method a facile and appealing sensing modality in hand-held devices to be used at the point-of-care (POC). Copyright © 2016 Elsevier B.V. All rights reserved.

A High-Throughput Process for the Solid-Phase Purification of Synthetic DNA Sequences

PubMed Central

Grajkowski, Andrzej; Cieślak, Jacek; Beaucage, Serge L.

2017-01-01

An efficient process for the purification of synthetic phosphorothioate and native DNA sequences is presented. The process is based on the use of an aminopropylated silica gel support functionalized with aminooxyalkyl functions to enable capture of DNA sequences through an oximation reaction with the keto function of a linker conjugated to the 5′-terminus of DNA sequences. Deoxyribonucleoside phosphoramidites carrying this linker, as a 5′-hydroxyl protecting group, have been synthesized for incorporation into DNA sequences during the last coupling step of a standard solid-phase synthesis protocol executed on a controlled pore glass (CPG) support. Solid-phase capture of the nucleobase- and phosphate-deprotected DNA sequences released from the CPG support is demonstrated to proceed near quantitatively. Shorter than full-length DNA sequences are first washed away from the capture support; the solid-phase purified DNA sequences are then released from this support upon reaction with tetra-n-butylammonium fluoride in dry dimethylsulfoxide (DMSO) and precipitated in tetrahydrofuran (THF). The purity of solid-phase-purified DNA sequences exceeds 98%. The simulated high-throughput and scalability features of the solid-phase purification process are demonstrated without sacrificing purity of the DNA sequences. PMID:28628204

Functional interaction of proliferating cell nuclear antigen with MSH2-MSH6 and MSH2-MSH3 complexes.

PubMed

Clark, A B; Valle, F; Drotschmann, K; Gary, R K; Kunkel, T A

2000-11-24

Eukaryotic DNA mismatch repair requires the concerted action of several proteins, including proliferating cell nuclear antigen (PCNA) and heterodimers of MSH2 complexed with either MSH3 or MSH6. Here we report that MSH3 and MSH6, but not MSH2, contain N-terminal sequence motifs characteristic of proteins that bind to PCNA. MSH3 and MSH6 peptides containing these motifs bound PCNA, as did the intact Msh2-Msh6 complex. This binding was strongly reduced when alanine was substituted for conserved residues in the motif. Yeast strains containing alanine substitutions in the PCNA binding motif of Msh6 or Msh3 had elevated mutation rates, indicating that these interactions are important for genome stability. When human MSH3 or MSH6 peptides containing the PCNA binding motif were added to a human cell extract, mismatch repair activity was inhibited at a step preceding DNA resynthesis. Thus, MSH3 and MSH6 interactions with PCNA may facilitate early steps in DNA mismatch repair and may also be important for other roles of these eukaryotic MutS homologs.

Protein dynamics of human RPA and RAD51 on ssDNA during assembly and disassembly of the RAD51 filament.

PubMed

Ma, Chu Jian; Gibb, Bryan; Kwon, YoungHo; Sung, Patrick; Greene, Eric C

2017-01-25

Homologous recombination (HR) is a crucial pathway for double-stranded DNA break (DSB) repair. During the early stages of HR, the newly generated DSB ends are processed to yield long single-stranded DNA (ssDNA) overhangs, which are quickly bound by replication protein A (RPA). RPA is then replaced by the DNA recombinase Rad51, which forms extended helical filaments on the ssDNA. The resulting nucleoprotein filament, known as the presynaptic complex, is responsible for pairing the ssDNA with homologous double-stranded DNA (dsDNA), which serves as the template to guide DSB repair. Here, we use single-molecule imaging to visualize the interplay between human RPA (hRPA) and human RAD51 during presynaptic complex assembly and disassembly. We demonstrate that ssDNA-bound hRPA can undergo facilitated exchange, enabling hRPA to undergo rapid exchange between free and ssDNA-bound states only when free hRPA is present in solution. Our results also indicate that the presence of free hRPA inhibits RAD51 filament nucleation, but has a lesser impact upon filament elongation. This finding suggests that hRPA exerts important regulatory influence over RAD51 and may in turn affect the properties of the assembled RAD51 filament. These experiments provide an important basis for further investigations into the regulation of human presynaptic complex assembly. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

An improved model for whole genome phylogenetic analysis by Fourier transform.

PubMed

Yin, Changchuan; Yau, Stephen S-T

2015-10-07

DNA sequence similarity comparison is one of the major steps in computational phylogenetic studies. The sequence comparison of closely related DNA sequences and genomes is usually performed by multiple sequence alignments (MSA). While the MSA method is accurate for some types of sequences, it may produce incorrect results when DNA sequences undergone rearrangements as in many bacterial and viral genomes. It is also limited by its computational complexity for comparing large volumes of data. Previously, we proposed an alignment-free method that exploits the full information contents of DNA sequences by Discrete Fourier Transform (DFT), but still with some limitations. Here, we present a significantly improved method for the similarity comparison of DNA sequences by DFT. In this method, we map DNA sequences into 2-dimensional (2D) numerical sequences and then apply DFT to transform the 2D numerical sequences into frequency domain. In the 2D mapping, the nucleotide composition of a DNA sequence is a determinant factor and the 2D mapping reduces the nucleotide composition bias in distance measure, and thus improving the similarity measure of DNA sequences. To compare the DFT power spectra of DNA sequences with different lengths, we propose an improved even scaling algorithm to extend shorter DFT power spectra to the longest length of the underlying sequences. After the DFT power spectra are evenly scaled, the spectra are in the same dimensionality of the Fourier frequency space, then the Euclidean distances of full Fourier power spectra of the DNA sequences are used as the dissimilarity metrics. The improved DFT method, with increased computational performance by 2D numerical representation, can be applicable to any DNA sequences of different length ranges. We assess the accuracy of the improved DFT similarity measure in hierarchical clustering of different DNA sequences including simulated and real datasets. The method yields accurate and reliable phylogenetic trees and demonstrates that the improved DFT dissimilarity measure is an efficient and effective similarity measure of DNA sequences. Due to its high efficiency and accuracy, the proposed DFT similarity measure is successfully applied on phylogenetic analysis for individual genes and large whole bacterial genomes. Copyright © 2015 Elsevier Ltd. All rights reserved.

Multi-shell model of ion-induced nucleic acid condensation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tolokh, Igor S.; Drozdetski, Aleksander V.; Pollack, Lois

We present a semi-quantitative model of condensation of short nucleic acid (NA) duplexes induced by trivalent cobalt(III) hexammine (CoHex) ions. The model is based on partitioning of bound counterion distribution around single NA duplex into “external” and “internal” ion binding shells distinguished by the proximity to duplex helical axis. In the aggregated phase the shells overlap, which leads to significantly increased attraction of CoHex ions in these overlaps with the neighboring duplexes. The duplex aggregation free energy is decomposed into attractive and repulsive components in such a way that they can be represented by simple analytical expressions with parameters derivedmore » from molecular dynamic simulations and numerical solutions of Poisson equation. The attractive term depends on the fractions of bound ions in the overlapping shells and affinity of CoHex to the “external” shell of nearly neutralized duplex. The repulsive components of the free energy are duplex configurational entropy loss upon the aggregation and the electrostatic repulsion of the duplexes that remains after neutralization by bound CoHex ions. The estimates of the aggregation free energy are consistent with the experimental range of NA duplex condensation propensities, including the unusually poor condensation of RNA structures and subtle sequence effects upon DNA condensation. The model predicts that, in contrast to DNA, RNA duplexes may condense into tighter packed aggregates with a higher degree of duplex neutralization. An appreciable CoHex mediated RNA-RNA attraction requires closer inter-duplex separation to engage CoHex ions (bound mostly in the “internal” shell of RNA) into short-range attractive interactions. The model also predicts that longer NA fragments will condense more readily than shorter ones. The ability of this model to explain experimentally observed trends in NA condensation lends support to proposed NA condensation picture based on the multivalent “ion binding shells.”.« less

Multi-shell model of ion-induced nucleic acid condensation

PubMed Central

Tolokh, Igor S.; Drozdetski, Aleksander V.; Pollack, Lois; Onufriev, Alexey V.

2016-01-01

We present a semi-quantitative model of condensation of short nucleic acid (NA) duplexes induced by trivalent cobalt(iii) hexammine (CoHex) ions. The model is based on partitioning of bound counterion distribution around single NA duplex into “external” and “internal” ion binding shells distinguished by the proximity to duplex helical axis. In the aggregated phase the shells overlap, which leads to significantly increased attraction of CoHex ions in these overlaps with the neighboring duplexes. The duplex aggregation free energy is decomposed into attractive and repulsive components in such a way that they can be represented by simple analytical expressions with parameters derived from molecular dynamic simulations and numerical solutions of Poisson equation. The attractive term depends on the fractions of bound ions in the overlapping shells and affinity of CoHex to the “external” shell of nearly neutralized duplex. The repulsive components of the free energy are duplex configurational entropy loss upon the aggregation and the electrostatic repulsion of the duplexes that remains after neutralization by bound CoHex ions. The estimates of the aggregation free energy are consistent with the experimental range of NA duplex condensation propensities, including the unusually poor condensation of RNA structures and subtle sequence effects upon DNA condensation. The model predicts that, in contrast to DNA, RNA duplexes may condense into tighter packed aggregates with a higher degree of duplex neutralization. An appreciable CoHex mediated RNA-RNA attraction requires closer inter-duplex separation to engage CoHex ions (bound mostly in the “internal” shell of RNA) into short-range attractive interactions. The model also predicts that longer NA fragments will condense more readily than shorter ones. The ability of this model to explain experimentally observed trends in NA condensation lends support to proposed NA condensation picture based on the multivalent “ion binding shells.” PMID:27389241

Ribosomal RNA Genes Contribute to the Formation of Pseudogenes and Junk DNA in the Human Genome.

PubMed

Robicheau, Brent M; Susko, Edward; Harrigan, Amye M; Snyder, Marlene

2017-02-01

Approximately 35% of the human genome can be identified as sequence devoid of a selected-effect function, and not derived from transposable elements or repeated sequences. We provide evidence supporting a known origin for a fraction of this sequence. We show that: 1) highly degraded, but near full length, ribosomal DNA (rDNA) units, including both 45S and Intergenic Spacer (IGS), can be found at multiple sites in the human genome on chromosomes without rDNA arrays, 2) that these rDNA sequences have a propensity for being centromere proximal, and 3) that sequence at all human functional rDNA array ends is divergent from canonical rDNA to the point that it is pseudogenic. We also show that small sequence strings of rDNA (from 45S + IGS) can be found distributed throughout the genome and are identifiable as an "rDNA-like signal", representing 0.26% of the q-arm of HSA21 and ∼2% of the total sequence of other regions tested. The size of sequence strings found in the rDNA-like signal intergrade into the size of sequence strings that make up the full-length degrading rDNA units found scattered throughout the genome. We conclude that the displaced and degrading rDNA sequences are likely of a similar origin but represent different stages in their evolution towards random sequence. Collectively, our data suggests that over vast evolutionary time, rDNA arrays contribute to the production of junk DNA. The concept that the production of rDNA pseudogenes is a by-product of concerted evolution represents a previously under-appreciated process; we demonstrate here its importance. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Searching for DNA Lesions: Structural Evidence for Lower- and Higher-Affinity DNA Binding Conformations of Human Alkyladenine DNA Glycosylase

PubMed Central

2011-01-01

To efficiently repair DNA, human alkyladenine DNA glycosylase (AAG) must search the million-fold excess of unmodified DNA bases to find a handful of DNA lesions. Such a search can be facilitated by the ability of glycosylases, like AAG, to interact with DNA using two affinities: a lower-affinity interaction in a searching process and a higher-affinity interaction for catalytic repair. Here, we present crystal structures of AAG trapped in two DNA-bound states. The lower-affinity depiction allows us to investigate, for the first time, the conformation of this protein in the absence of a tightly bound DNA adduct. We find that active site residues of AAG involved in binding lesion bases are in a disordered state. Furthermore, two loops that contribute significantly to the positive electrostatic surface of AAG are disordered. Additionally, a higher-affinity state of AAG captured here provides a fortuitous snapshot of how this enzyme interacts with a DNA adduct that resembles a one-base loop. PMID:22148158

Heat shock of Escherichia coli increases binding of dnaK (the hsp70 homolog) to polypeptides by promoting its phosphorylation.

PubMed Central

Sherman, M Y; Goldberg, A L

1993-01-01

The "molecular chaperone", dnaK, is induced in Escherichia coli upon heat shock and promotes ATP-dependent refolding or degradation of damaged proteins. When cells were grown at 25 degrees C and disrupted, a small fraction of the dnaK bound to affinity columns containing unfolded polypeptides (e.g., a fusion protein named CRAG or casein) and could be dissociated by ATP-Mg2+. After shifting cells to 42 degrees C for 30 min, up to 5-fold more dnaK bound to these columns than after growth at 25 degrees C. This enhanced binding capacity was reversed after shifting cells back to 25 degrees C. It resulted from a covalent modification, which decreases dnaK's electrophoretic mobility and isoelectric point. This modification appears to be phosphorylation; after treatment with phosphatases, the ATP-eluted dnaK resembled the predominant form in electrophoretic and binding properties. In addition, after incubating cells with [32P]orthophosphate at 42 degrees C, the 32P-labeled dnaK bound quantitatively to the CRAG column, unlike the nonlabeled protein. Thus, the phosphorylated dnaK is a special form of the chaperone with enhanced affinity for unfolded proteins. Its accumulation at high temperatures may account for dnaK's function as the "cellular thermometer." Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 Fig. 7 PMID:8378342

A structural basis for the regulatory inactivation of DnaA.

PubMed

Xu, Qingping; McMullan, Daniel; Abdubek, Polat; Astakhova, Tamara; Carlton, Dennis; Chen, Connie; Chiu, Hsiu-Ju; Clayton, Thomas; Das, Debanu; Deller, Marc C; Duan, Lian; Elsliger, Marc-Andre; Feuerhelm, Julie; Hale, Joanna; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K; Johnson, Hope A; Klock, Heath E; Knuth, Mark W; Kozbial, Piotr; Sri Krishna, S; Kumar, Abhinav; Marciano, David; Miller, Mitchell D; Morse, Andrew T; Nigoghossian, Edward; Nopakun, Amanda; Okach, Linda; Oommachen, Silvya; Paulsen, Jessica; Puckett, Christina; Reyes, Ron; Rife, Christopher L; Sefcovic, Natasha; Trame, Christine; van den Bedem, Henry; Weekes, Dana; Hodgson, Keith O; Wooley, John; Deacon, Ashley M; Godzik, Adam; Lesley, Scott A; Wilson, Ian A

2009-01-16

Regulatory inactivation of DnaA is dependent on Hda (homologous to DnaA), a protein homologous to the AAA+ (ATPases associated with diverse cellular activities) ATPase region of the replication initiator DnaA. When bound to the sliding clamp loaded onto duplex DNA, Hda can stimulate the transformation of active DnaA-ATP into inactive DnaA-ADP. The crystal structure of Hda from Shewanella amazonensis SB2B at 1.75 A resolution reveals that Hda resembles typical AAA+ ATPases. The arrangement of the two subdomains in Hda (residues 1-174 and 175-241) differs dramatically from that of DnaA. A CDP molecule anchors the Hda domains in a conformation that promotes dimer formation. The Hda dimer adopts a novel oligomeric assembly for AAA+ proteins in which the arginine finger, crucial for ATP hydrolysis, is fully exposed and available to hydrolyze DnaA-ATP through a typical AAA+ type of mechanism. The sliding clamp binding motifs at the N-terminus of each Hda monomer are partially buried and combine to form an antiparallel beta-sheet at the dimer interface. The inaccessibility of the clamp binding motifs in the CDP-bound structure of Hda suggests that conformational changes are required for Hda to form a functional complex with the clamp. Thus, the CDP-bound Hda dimer likely represents an inactive form of Hda.

Representation of DNA sequences in genetic codon context with applications in exon and intron prediction.

PubMed

Yin, Changchuan

2015-04-01

To apply digital signal processing (DSP) methods to analyze DNA sequences, the sequences first must be specially mapped into numerical sequences. Thus, effective numerical mappings of DNA sequences play key roles in the effectiveness of DSP-based methods such as exon prediction. Despite numerous mappings of symbolic DNA sequences to numerical series, the existing mapping methods do not include the genetic coding features of DNA sequences. We present a novel numerical representation of DNA sequences using genetic codon context (GCC) in which the numerical values are optimized by simulation annealing to maximize the 3-periodicity signal to noise ratio (SNR). The optimized GCC representation is then applied in exon and intron prediction by Short-Time Fourier Transform (STFT) approach. The results show the GCC method enhances the SNR values of exon sequences and thus increases the accuracy of predicting protein coding regions in genomes compared with the commonly used 4D binary representation. In addition, this study offers a novel way to reveal specific features of DNA sequences by optimizing numerical mappings of symbolic DNA sequences.

Single-cell genomic sequencing using Multiple Displacement Amplification.

PubMed

Lasken, Roger S

2007-10-01

Single microbial cells can now be sequenced using DNA amplified by the Multiple Displacement Amplification (MDA) reaction. The few femtograms of DNA in a bacterium are amplified into micrograms of high molecular weight DNA suitable for DNA library construction and Sanger sequencing. The MDA-generated DNA also performs well when used directly as template for pyrosequencing by the 454 Life Sciences method. While MDA from single cells loses some of the genomic sequence, this approach will greatly accelerate the pace of sequencing from uncultured microbes. The genetically linked sequences from single cells are also a powerful tool to be used in guiding genomic assembly of shotgun sequences of multiple organisms from environmental DNA extracts (metagenomic sequences).

cDNA cloning of carrot extracellular beta-fructosidase and its expression in response to wounding and bacterial infection.

PubMed

Sturm, A; Chrispeels, M J

1990-11-01

We isolated a full-length cDNA for apoplastic (extracellular or cell wall-bound) beta-fructosidase (invertase), determined its nucleotide sequence, and used it as a probe to measure changes in mRNA as a result of wounding of carrot storage roots and infection of carrot plants with the bacterial pathogen Erwinia carotovora. The derived amino acid sequence of extracellular beta-fructosidase shows that it is a basic protein (pl 9.9) with a signal sequence for entry into the endoplasmic reticulum and a propeptide at the N terminus that is not present in the mature protein. Amino acid sequence comparison with yeast and bacterial invertases shows that the overall homology is only about 28%, but that there are short conserved motifs, one of which is at the active site. Maturing carrot storage roots contain barely detectable levels of mRNA for extracellular beta-fructosidase and these levels rise slowly but dramatically after wounding with maximal expression after 12 hours. Infection of roots and leaves of carrot plants with E. carotovora results in a very fast increase in the mRNA levels with maximal expression after 1 hour. These results indicate that apoplastic beta-fructosidase is probably a new and hitherto unrecognized pathogenesis-related protein [Van Loon, L.C. (1985). Plant Mol. Biol. 4, 111-116]. Suspension-cultured carrot cells contain high levels of mRNA for extracellular beta-fructosidase and these levels remain the same whether the cells are grown on sucrose, glucose, or fructose.

cDNA cloning of carrot extracellular beta-fructosidase and its expression in response to wounding and bacterial infection.

PubMed Central

Sturm, A; Chrispeels, M J

1990-01-01

We isolated a full-length cDNA for apoplastic (extracellular or cell wall-bound) beta-fructosidase (invertase), determined its nucleotide sequence, and used it as a probe to measure changes in mRNA as a result of wounding of carrot storage roots and infection of carrot plants with the bacterial pathogen Erwinia carotovora. The derived amino acid sequence of extracellular beta-fructosidase shows that it is a basic protein (pl 9.9) with a signal sequence for entry into the endoplasmic reticulum and a propeptide at the N terminus that is not present in the mature protein. Amino acid sequence comparison with yeast and bacterial invertases shows that the overall homology is only about 28%, but that there are short conserved motifs, one of which is at the active site. Maturing carrot storage roots contain barely detectable levels of mRNA for extracellular beta-fructosidase and these levels rise slowly but dramatically after wounding with maximal expression after 12 hours. Infection of roots and leaves of carrot plants with E. carotovora results in a very fast increase in the mRNA levels with maximal expression after 1 hour. These results indicate that apoplastic beta-fructosidase is probably a new and hitherto unrecognized pathogenesis-related protein [Van Loon, L.C. (1985). Plant Mol. Biol. 4, 111-116]. Suspension-cultured carrot cells contain high levels of mRNA for extracellular beta-fructosidase and these levels remain the same whether the cells are grown on sucrose, glucose, or fructose. PMID:2152110

Estimating genotype error rates from high-coverage next-generation sequence data.

PubMed

Wall, Jeffrey D; Tang, Ling Fung; Zerbe, Brandon; Kvale, Mark N; Kwok, Pui-Yan; Schaefer, Catherine; Risch, Neil

2014-11-01

Exome and whole-genome sequencing studies are becoming increasingly common, but little is known about the accuracy of the genotype calls made by the commonly used platforms. Here we use replicate high-coverage sequencing of blood and saliva DNA samples from four European-American individuals to estimate lower bounds on the error rates of Complete Genomics and Illumina HiSeq whole-genome and whole-exome sequencing. Error rates for nonreference genotype calls range from 0.1% to 0.6%, depending on the platform and the depth of coverage. Additionally, we found (1) no difference in the error profiles or rates between blood and saliva samples; (2) Complete Genomics sequences had substantially higher error rates than Illumina sequences had; (3) error rates were higher (up to 6%) for rare or unique variants; (4) error rates generally declined with genotype quality (GQ) score, but in a nonlinear fashion for the Illumina data, likely due to loss of specificity of GQ scores greater than 60; and (5) error rates increased with increasing depth of coverage for the Illumina data. These findings, especially (3)-(5), suggest that caution should be taken in interpreting the results of next-generation sequencing-based association studies, and even more so in clinical application of this technology in the absence of validation by other more robust sequencing or genotyping methods. © 2014 Wall et al.; Published by Cold Spring Harbor Laboratory Press.

Bounds on the cross-correlation functions of state m-sequences

NASA Astrophysics Data System (ADS)

Woodcock, C. F.; Davies, Phillip A.; Shaar, Ahmed A.

1987-03-01

Lower and upper bounds on the peaks of the periodic Hamming cross-correlation function for state m-sequences, which are often used in frequency-hopped spread-spectrum systems, are derived. The state position mapped (SPM) sequences of the state m-sequences are described. The use of SPM sequences for OR-channel code division multiplexing is studied. The relation between the Hamming cross-correlation function and the correlation function of SPM sequence is examined. Numerical results which support the theoretical data are presented.

The Crystal Structure of TAL Effector PthXo1 Bound to Its DNA Target

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mak, Amanda Nga-Sze; Bradley, Philip; Cernadas, Raul A.

2012-02-10

DNA recognition by TAL effectors is mediated by tandem repeats, each 33 to 35 residues in length, that specify nucleotides via unique repeat-variable diresidues (RVDs). The crystal structure of PthXo1 bound to its DNA target was determined by high-throughput computational structure prediction and validated by heavy-atom derivatization. Each repeat forms a left-handed, two-helix bundle that presents an RVD-containing loop to the DNA. The repeats self-associate to form a right-handed superhelix wrapped around the DNA major groove. The first RVD residue forms a stabilizing contact with the protein backbone, while the second makes a base-specific contact to the DNA sense strand.more » Two degenerate amino-terminal repeats also interact with the DNA. Containing several RVDs and noncanonical associations, the structure illustrates the basis of TAL effector-DNA recognition.« less

Skipping of Exons by Premature Termination of Transcription and Alternative Splicing within Intron-5 of the Sheep SCF Gene: A Novel Splice Variant

PubMed Central

Saravanaperumal, Siva Arumugam; Pediconi, Dario; Renieri, Carlo; La Terza, Antonietta

2012-01-01

Stem cell factor (SCF) is a growth factor, essential for haemopoiesis, mast cell development and melanogenesis. In the hematopoietic microenvironment (HM), SCF is produced either as a membrane-bound (−) or soluble (+) forms. Skin expression of SCF stimulates melanocyte migration, proliferation, differentiation, and survival. We report for the first time, a novel mRNA splice variant of SCF from the skin of white merino sheep via cloning and sequencing. Reverse transcriptase (RT)-PCR and molecular prediction revealed two different cDNA products of SCF. Full-length cDNA libraries were enriched by the method of rapid amplification of cDNA ends (RACE-PCR). Nucleotide sequencing and molecular prediction revealed that the primary 1519 base pair (bp) cDNA encodes a precursor protein of 274 amino acids (aa), commonly known as ‘soluble’ isoform. In contrast, the shorter (835 and/or 725 bp) cDNA was found to be a ‘novel’ mRNA splice variant. It contains an open reading frame (ORF) corresponding to a truncated protein of 181 aa (vs 245 aa) with an unique C-terminus lacking the primary proteolytic segment (28 aa) right after the D175G site which is necessary to produce ‘soluble’ form of SCF. This alternative splice (AS) variant was explained by the complete nucleotide sequencing of splice junction covering exon 5-intron (5)-exon 6 (948 bp) with a premature termination codon (PTC) whereby exons 6 to 9/10 are skipped (Cassette Exon, CE 6–9/10). We also demonstrated that the Northern blot analysis at transcript level is mediated via an intron-5 splicing event. Our data refine the structure of SCF gene; clarify the presence (+) and/or absence (−) of primary proteolytic-cleavage site specific SCF splice variants. This work provides a basis for understanding the functional role and regulation of SCF in hair follicle melanogenesis in sheep beyond what was known in mice, humans and other mammals. PMID:22719917

H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

PubMed

Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

1989-11-01

Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, but not to other MHC cis-acting sequences or to mutant region II sequences, similar to the naturally occurring region II factor in mouse cells. The deduced amino acid sequence of H-2RIIBP revealed two putative zinc fingers homologous to the DNA-binding domain of steroid/thyroid hormone receptors. Although sequence similarity in other regions was minimal, H-2RIIBP has apparent modular domains characteristic of the nuclear hormone receptors. Further analyses showed that both H-2RIIBP and the natural region II factor bind to the estrogen response element (ERE) of the vitellogenin A2 gene. The ERE is composed of a palindrome, and half of this palindrome resembles the region II binding site of the MHC CRE. These results indicate that H-2RIIBP (i) is a member of the superfamily of nuclear hormone receptors and (ii) may regulate not only MHC class I genes but also genes containing the ERE and related sequences. Sequences homologous to the H-2RIIBP gene are widely conserved in the animal kingdom. H-2RIIBP mRNA is expressed in many mouse tissues, in agreement with the distribution of the natural region II factor.

“Gate-keeper” Residues and Active-Site Rearrangements in DNA Polymerase μ Help Discriminate Non-cognate Nucleotides

PubMed Central

Li, Yunlang; Schlick, Tamar

2013-01-01

Incorporating the cognate instead of non-cognate substrates is crucial for DNA polymerase function. Here we analyze molecular dynamics simulations of DNA polymerase μ (pol μ) bound to different non-cognate incoming nucleotides including A:dCTP, A:dGTP, A(syn):dGTP, A:dATP, A(syn):dATP, T:dCTP, and T:dGTP to study the structure-function relationships involved with aberrant base pairs in the conformational pathway; while a pol μ complex with the A:dTTP base pair is available, no solved non-cognate structures are available. We observe distinct differences of the non-cognate systems compared to the cognate system. Specifically, the motions of active-site residue His329 and Asp330 distort the active site, and Trp436, Gln440, Glu443 and Arg444 tend to tighten the nucleotide-binding pocket when non-cognate nucleotides are bound; the latter effect may further lead to an altered electrostatic potential within the active site. That most of these “gate-keeper” residues are located farther apart from the upstream primer in pol μ, compared to other X family members, also suggests an interesting relation to pol μ's ability to incorporate nucleotides when the upstream primer is not paired. By examining the correlated motions within pol μ complexes, we also observe different patterns of correlations between non-cognate systems and the cognate system, especially decreased interactions between the incoming nucleotides and the nucleotide-binding pocket. Altered correlated motions in non-cognate systems agree with our recently proposed hybrid conformational selection/induced-fit models. Taken together, our studies propose the following order for difficulty of non-cognate system insertions by pol μ: T:dGTP

Acquisition of New DNA Sequences After Infection of Chicken Cells with Avian Myeloblastosis Virus

PubMed Central

Shoyab, M.; Baluda, M. A.; Evans, R.

1974-01-01

DNA-RNA hybridization studies between 70S RNA from avian myeloblastosis virus (AMV) and an excess of DNA from (i) AMV-induced leukemic chicken myeloblasts or (ii) a mixture of normal and of congenitally infected K-137 chicken embryos producing avian leukosis viruses revealed the presence of fast- and slow-hybridizing virus-specific DNA sequences. However, the leukemic cells contained twice the level of AMV-specific DNA sequences observed in normal chicken embryonic cells. The fast-reacting sequences were two to three times more numerous in leukemic DNA than in DNA from the mixed embryos. The slow-reacting sequences had a reiteration frequency of approximately 9 and 6, in the two respective systems. Both the fast- and the slow-reacting DNA sequences in leukemic cells exhibited a higher Tm (2 C) than the respective DNA sequences in normal cells. In normal and leukemic cells the slow hybrid sequences appeared to have a Tm which was 2 C higher than that of the fast hybrid sequences. Individual non-virus-producing chicken embryos, either group-specific antigen positive or negative, contained 40 to 100 copies of the fast sequences and 2 to 6 copies of the slowly hybridizing sequences per cell genome. Normal rat cells did not contain DNA that hybridized with AMV RNA, whereas non-virus-producing rat cells transformed by B-77 avian sarcoma virus contained only the slowly reacting sequences. The results demonstrate that leukemic cells transformed by AMV contain new AMV-specific DNA sequences which were not present before infection. PMID:16789139

Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

PubMed Central

Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

2006-01-01

Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

DOEpatents

McCutchen-Maloney, Sandra L.

2002-01-01

DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

HARP preferentially co-purifies with RPA bound to DNA-PK and blocks RPA phosphorylation.

PubMed

Quan, Jinhua; Yusufzai, Timur

2014-05-01

The HepA-related protein (HARP/SMARCAL1) is an ATP-dependent annealing helicase that is capable of rewinding DNA structures that are stably unwound due to binding of the single-stranded DNA (ssDNA)-binding protein Replication Protein A (RPA). HARP has been implicated in maintaining genome integrity through its role in DNA replication and repair, two processes that generate RPA-coated ssDNA. In addition, mutations in HARP cause a rare disease known as Schimke immuno-osseous dysplasia. In this study, we purified HARP containing complexes with the goal of identifying the predominant factors that stably associate with HARP. We found that HARP preferentially interacts with RPA molecules that are bound to the DNA-dependent protein kinase (DNA-PK). We also found that RPA is phosphorylated by DNA-PK in vitro, while the RPA-HARP complexes are not. Our results suggest that, in addition to its annealing helicase activity, which eliminates the natural binding substrate for RPA, HARP blocks the phosphorylation of RPA by DNA-PK.

Cryptic MCAT enhancer regulation in fibroblasts and smooth muscle cells. Suppression of TEF-1 mediated activation by the single-stranded DNA-binding proteins, Pur alpha, Pur beta, and MSY1.

PubMed

Carlini, Leslie E; Getz, Michael J; Strauch, Arthur R; Kelm, Robert J

2002-03-08

An asymmetric polypurine-polypyrimidine cis-element located in the 5' region of the mouse vascular smooth muscle alpha-actin gene serves as a binding site for multiple proteins with specific affinity for either single- or double-stranded DNA. Here, we test the hypothesis that single-stranded DNA-binding proteins are responsible for preventing a cryptic MCAT enhancer centered within this element from cooperating with a nearby serum response factor-interacting CArG motif to trans-activate the minimal promoter in fibroblasts and smooth muscle cells. DNA binding studies revealed that the core MCAT sequence mediates binding of transcription enhancer factor-1 to the double-stranded polypurine-polypyrimidine element while flanking nucleotides account for interaction of Pur alpha and Pur beta with the purine-rich strand and MSY1 with the complementary pyrimidine-rich strand. Mutations that selectively impaired high affinity single-stranded DNA binding by fibroblast or smooth muscle cell-derived Pur alpha, Pur beta, and MSY1 in vitro, released the cryptic MCAT enhancer from repression in transfected cells. Additional experiments indicated that Pur alpha, Pur beta, and MSY1 also interact specifically, albeit weakly, with double-stranded DNA and with transcription enhancer factor-1. These results are consistent with two plausible models of cryptic MCAT enhancer regulation by Pur alpha, Pur beta, and MSY1 involving either competitive single-stranded DNA binding or masking of MCAT-bound transcription enhancer factor-1.

Determining the Specificity of Cascade Binding, Interference, and Primed Adaptation In Vivo in the Escherichia coli Type I-E CRISPR-Cas System

PubMed Central

Cooper, Lauren A.; Stringer, Anne M.

2018-01-01

ABSTRACT In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo, for the type I-E system of Escherichia coli. Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5′ end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. PMID:29666291

Surface plasmon resonance imaging reveals multiple binding modes of Agrobacterium transformation mediator VirE2 to ssDNA.

PubMed

Kim, Sanghyun; Zbaida, David; Elbaum, Michael; Leh, Hervé; Nogues, Claude; Buckle, Malcolm

2015-07-27

VirE2 is the major secreted protein of Agrobacterium tumefaciens in its genetic transformation of plant hosts. It is co-expressed with a small acidic chaperone VirE1, which prevents VirE2 oligomerization. After secretion into the host cell, VirE2 serves functions similar to a viral capsid in protecting the single-stranded transferred DNA en route to the nucleus. Binding of VirE2 to ssDNA is strongly cooperative and depends moreover on protein-protein interactions. In order to isolate the protein-DNA interactions, imaging surface plasmon resonance (SPRi) studies were conducted using surface-immobilized DNA substrates of length comparable to the protein-binding footprint. Binding curves revealed an important influence of substrate rigidity with a notable preference for poly-T sequences and absence of binding to both poly-A and double-stranded DNA fragments. Dissociation at high salt concentration confirmed the electrostatic nature of the interaction. VirE1-VirE2 heterodimers also bound to ssDNA, though by a different mechanism that was insensitive to high salt. Neither VirE2 nor VirE1-VirE2 followed the Langmuir isotherm expected for reversible monomeric binding. The differences reflect the cooperative self-interactions of VirE2 that are suppressed by VirE1. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Crystal structure of a papain-fold protein without the catalytic residue: a novel member in the cysteine proteinase family.

PubMed

Zhang, Min; Wei, Zhiyi; Chang, Shaojie; Teng, Maikun; Gong, Weimin

2006-04-21

A 31kDa cysteine protease, SPE31, was isolated from the seeds of a legume plant, Pachyrizhus erosus. The protein was purified, crystallized and the 3D structure solved using molecular replacement. The cDNA was obtained by RT PCR followed by amplification using mRNA isolated from the seeds of the legume plant as a template. Analysis of the cDNA sequence and the 3D structure indicated the protein to belong to the papain family. Detailed analysis of the structure revealed an unusual replacement of the conserved catalytic Cys with Gly. Replacement of another conserved residue Ala/Gly by a Phe sterically blocks the access of the substrate to the active site. A polyethyleneglycol molecule and a natural peptide fragment were bound to the surface of the active site. Asn159 was found to be glycosylated. The SPE31 cDNA sequence shares several features with P34, a protein found in soybeans, that is implicated in plant defense mechanisms as an elicitor receptor binding to syringolide. P34 has also been shown to interact with vegetative storage proteins and NADH-dependent hydroxypyruvate reductase. These roles suggest that SPE31 and P34 form a unique subfamily within the papain family. The crystal structure of SPE31 complexed with a natural peptide ligand reveals a unique active site architecture. In addition, the clear evidence of glycosylated Asn159 provides useful information towards understanding the functional mechanism of SPE31/P34.

Statistical-Mechanical Studies of the Collective Binding of Proteins to DNA

NASA Astrophysics Data System (ADS)

Zhang, Houyin

My dissertation work focuses on the microscopic statistical-mechanical studies of DNA-protein interactions and mainly comprises of three projects. In living cells, binding of proteins to DNA controls gene expression and packaging of the genome. Single-DNA stretching and twisting experiments provide a powerful tool to detect binding of proteins, via detection of their modification of DNA mechanical properties. However, it is often difficult or impossible to determine the numbers of proteins bound in such experiments, especially when the proteins interact nonspecifically with DNA. In the first project, we developed single-molecule versions of classical thermodynamic Maxwell relations and proposed that these relations could be used to measure DNA-bound protein numbers, changes in DNA double-helix torque with force, and many other quantities which are hard to directly measure. This approach does not need any theoretical assumptions beyond the existence of thermodynamic equilibrium and has been used in single-DNA experiments. Many single-molecule experiments associated with DNA-bending proteins suggest the existence of cooperative interactions between adjacent DNA-bound proteins. In the second project, we studied a statistical-mechanical worm-like chain model including binding cooperativity effects and found that the intrinsic cooperativity of binding sharpens force-extension curves and causes enhancement of fluctuation of extension and protein occupation. This model also allows us to estimate the intrinsic cooperativity in experiments. We also analyzed force-generated cooperativity and found that the related interaction between proteins is always attractive. This suggests that tension in DNA in vivo could alter the distribution of proteins bound along DNA, causing chromosome refolding, or changes in gene expression. In the third project, we investigated the correlations along DNA-protein complexes. We found there are two different correlation lengths corrected to the geometry of DNA bending - the shorter “longitudinal” correlation length ξ∥(f, μ) and the longer “transverse” correlation length ξ⊥( f, μ). In the high-force limit, ξ∥(f, μ) = ξ⊥(f, μ)/2 = A/4bf . Surprisingly, the range of the interaction between DNA-bending proteins is controlled by the second-longest correlation length. The effect arises from the protein-bend contribution to the Hamiltonian having an axial rotational symmetry which eliminates its coupling to the transverse bending fluctuations.

Novel Function of the Fanconi Anemia Group J or RECQ1 Helicase to Disrupt Protein-DNA Complexes in a Replication Protein A-stimulated Manner*

PubMed Central

Sommers, Joshua A.; Banerjee, Taraswi; Hinds, Twila; Wan, Bingbing; Wold, Marc S.; Lei, Ming; Brosh, Robert M.

2014-01-01

Understanding how cellular machinery deals with chromosomal genome complexity is an important question because protein bound to DNA may affect various cellular processes of nucleic acid metabolism. DNA helicases are at the forefront of such processes, yet there is only limited knowledge how they remodel protein-DNA complexes and how these mechanisms are regulated. We have determined that representative human RecQ and Fe-S cluster DNA helicases are potently blocked by a protein-DNA interaction. The Fanconi anemia group J (FANCJ) helicase partners with the single-stranded DNA-binding protein replication protein A (RPA) to displace BamHI-E111A bound to duplex DNA in a specific manner. Protein displacement was dependent on the ATPase-driven function of the helicase and unique properties of RPA. Further biochemical studies demonstrated that the shelterin proteins TRF1 and TRF2, which preferentially bind the telomeric repeat found at chromosome ends, effectively block FANCJ from unwinding the forked duplex telomeric substrate. RPA, but not the Escherichia coli single-stranded DNA-binding protein or shelterin factor Pot1, stimulated FANCJ ejection of TRF1 from the telomeric DNA substrate. FANCJ was also able to displace TRF2 from the telomeric substrate in an RPA-dependent manner. The stimulation of helicase-catalyzed protein displacement is also observed with the DNA helicase RECQ1, suggesting a conserved functional interaction of RPA-interacting helicases. These findings suggest that partnerships between RPA and interacting human DNA helicases may greatly enhance their ability to dislodge proteins bound to duplex DNA, an activity that is likely to be highly relevant to their biological roles in DNA metabolism. PMID:24895130

Methylation patterns of repetitive DNA sequences in germ cells of Mus musculus.

PubMed

Sanford, J; Forrester, L; Chapman, V; Chandley, A; Hastie, N

1984-03-26

The major and the minor satellite sequences of Mus musculus were undermethylated in both sperm and oocyte DNAs relative to the amount of undermethylation observed in adult somatic tissue DNA. This hypomethylation was specific for satellite sequences in sperm DNA. Dispersed repetitive and low copy sequences show a high degree of methylation in sperm DNA; however, a dispersed repetitive sequence was undermethylated in oocyte DNA. This finding suggests a difference in the amount of total genomic DNA methylation between sperm and oocyte DNA. The methylation levels of the minor satellite sequences did not change during spermiogenesis, and were not associated with the onset of meiosis or a specific stage in sperm development.

Deciphering the Binding between Nupr1 and MSL1 and Their DNA-Repairing Activity

PubMed Central

Doménech, Rosa; Pantoja-Uceda, David; Gironella, Meritxell; Santoro, Jorge; Velázquez-Campoy, Adrián; Neira, José L.; Iovanna, Juan L.

2013-01-01

The stress protein Nupr1 is a highly basic, multifunctional, intrinsically disordered protein (IDP). MSL1 is a histone acetyl transferase-associated protein, known to intervene in the dosage compensation complex (DCC). In this work, we show that both Nupr1 and MSL1 proteins were recruited and formed a complex into the nucleus in response to DNA-damage, which was essential for cell survival in reply to cisplatin damage. We studied the interaction of Nupr1 and MSL1, and their binding affinities to DNA by spectroscopic and biophysical methods. The MSL1 bound to Nupr1, with a moderate affinity (2.8 µM) in an entropically-driven process. MSL1 did not bind to non-damaged DNA, but it bound to chemically-damaged-DNA with a moderate affinity (1.2 µM) also in an entropically-driven process. The Nupr1 protein bound to chemically-damaged-DNA with a slightly larger affinity (0.4 µM), but in an enthalpically-driven process. Nupr1 showed different interacting regions in the formed complexes with Nupr1 or DNA; however, they were always disordered (“fuzzy”), as shown by NMR. These results underline a stochastic description of the functionality of the Nupr1 and its other interacting partners. PMID:24205110

Process of labeling specific chromosomes using recombinant repetitive DNA

DOEpatents

Moyzis, R.K.; Meyne, J.

1988-02-12

Chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family members and consensus sequences of the repetitive DNA families for the chromosome preferential sequences. The selected low homology regions are then hybridized with chromosomes to determine those low homology regions hybridized with a specific chromosome under normal stringency conditions.

The Hsp70 interdomain linker is a dynamic switch that enables allosteric communication between two structured domains.

PubMed

English, Charles A; Sherman, Woody; Meng, Wenli; Gierasch, Lila M

2017-09-08

Hsp70 molecular chaperones play key roles in cellular protein homeostasis by binding to exposed hydrophobic regions of incompletely folded or aggregated proteins. This crucial Hsp70 function relies on allosteric communication between two well-structured domains: an N-terminal nucleotide-binding domain (NBD) and a C-terminal substrate-binding domain (SBD), which are tethered by an interdomain linker. ATP or ADP binding to the NBD alters the substrate-binding affinity of the SBD, triggering functionally essential cycles of substrate binding and release. The interdomain linker is a well-structured participant in the interdomain interface in ATP-bound Hsp70s. By contrast, in the ADP-bound state, exemplified by the Escherichia coli Hsp70 DnaK, the interdomain linker is flexible. Hsp70 interdomain linker sequences are highly conserved; moreover, mutations in this region compromise interdomain allostery. To better understand the role of this region in Hsp70 allostery, we used molecular dynamics simulations to explore the conformational landscape of the interdomain linker in ADP-bound DnaK and supported our simulations by strategic experimental data. We found that while the interdomain linker samples many conformations, it behaves as three relatively ordered segments connected by hinges. As a consequence, the distances and orientations between the NBD and SBD are limited. Additionally, the C-terminal region of the linker forms previously unreported, transient interactions with the SBD, and the predominant linker-docking site is available in only one allosteric state, that with high affinity for substrate. This preferential binding implicates the interdomain linker as a dynamic allosteric switch. The linker-binding site on the SBD is a potential target for small molecule modulators of the Hsp70 allosteric cycle. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.

PubMed

Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook

2014-11-01

As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Concentration-Dependent Exchange of Replication Protein A on Single-Stranded DNA Revealed by Single-Molecule Imaging

PubMed Central

Gibb, Bryan; Ye, Ling F.; Gergoudis, Stephanie C.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.

2014-01-01

Replication protein A (RPA) is a ubiquitous eukaryotic single-stranded DNA (ssDNA) binding protein necessary for all aspects of DNA metabolism involving an ssDNA intermediate, including DNA replication, repair, recombination, DNA damage response and checkpoint activation, and telomere maintenance [1], [2], [3]. The role of RPA in most of these reactions is to protect the ssDNA until it can be delivered to downstream enzymes. Therefore a crucial feature of RPA is that it must bind very tightly to ssDNA, but must also be easily displaced from ssDNA to allow other proteins to gain access to the substrate. Here we use total internal reflection fluorescence microscopy and nanofabricated DNA curtains to visualize the behavior of Saccharomyces cerevisiae RPA on individual strands of ssDNA in real-time. Our results show that RPA remains bound to ssDNA for long periods of time when free protein is absent from solution. In contrast, RPA rapidly dissociates from ssDNA when free RPA is present in solution allowing rapid exchange between the free and bound states. In addition, the S. cerevisiae DNA recombinase Rad51 and E. coli single-stranded binding protein (SSB) also promote removal of RPA from ssDNA. These results reveal an unanticipated exchange between bound and free RPA suggesting a binding mechanism that can confer exceptionally slow off rates, yet also enables rapid displacement through a direct exchange mechanism that is reliant upon the presence of free ssDNA-binding proteins in solution. Our results indicate that RPA undergoes constant microscopic dissociation under all conditions, but this is only manifested as macroscopic dissociation (i.e. exchange) when free proteins are present in solution, and this effect is due to mass action. We propose that the dissociation of RPA from ssDNA involves a partially dissociated intermediate, which exposes a small section of ssDNA allowing other proteins to access to the DNA. PMID:24498402

Enlightenment of Yeast Mitochondrial Homoplasmy: Diversified Roles of Gene Conversion

PubMed Central

Ling, Feng; Mikawa, Tsutomu; Shibata, Takehiko

2011-01-01

Mitochondria have their own genomic DNA. Unlike the nuclear genome, each cell contains hundreds to thousands of copies of mitochondrial DNA (mtDNA). The copies of mtDNA tend to have heterogeneous sequences, due to the high frequency of mutagenesis, but are quickly homogenized within a cell (“homoplasmy”) during vegetative cell growth or through a few sexual generations. Heteroplasmy is strongly associated with mitochondrial diseases, diabetes and aging. Recent studies revealed that the yeast cell has the machinery to homogenize mtDNA, using a common DNA processing pathway with gene conversion; i.e., both genetic events are initiated by a double-stranded break, which is processed into 3′ single-stranded tails. One of the tails is base-paired with the complementary sequence of the recipient double-stranded DNA to form a D-loop (homologous pairing), in which repair DNA synthesis is initiated to restore the sequence lost by the breakage. Gene conversion generates sequence diversity, depending on the divergence between the donor and recipient sequences, especially when it occurs among a number of copies of a DNA sequence family with some sequence variations, such as in immunoglobulin diversification in chicken. MtDNA can be regarded as a sequence family, in which the members tend to be diversified by a high frequency of spontaneous mutagenesis. Thus, it would be interesting to determine why and how double-stranded breakage and D-loop formation induce sequence homogenization in mitochondria and sequence diversification in nuclear DNA. We will review the mechanisms and roles of mtDNA homoplasmy, in contrast to nuclear gene conversion, which diversifies gene and genome sequences, to provide clues toward understanding how the common DNA processing pathway results in such divergent outcomes. PMID:24710143

"First generation" automated DNA sequencing technology.

PubMed

Slatko, Barton E; Kieleczawa, Jan; Ju, Jingyue; Gardner, Andrew F; Hendrickson, Cynthia L; Ausubel, Frederick M

2011-10-01

Beginning in the 1980s, automation of DNA sequencing has greatly increased throughput, reduced costs, and enabled large projects to be completed more easily. The development of automation technology paralleled the development of other aspects of DNA sequencing: better enzymes and chemistry, separation and imaging technology, sequencing protocols, robotics, and computational advancements (including base-calling algorithms with quality scores, database developments, and sequence analysis programs). Despite the emergence of high-throughput sequencing platforms, automated Sanger sequencing technology remains useful for many applications. This unit provides background and a description of the "First-Generation" automated DNA sequencing technology. It also includes protocols for using the current Applied Biosystems (ABI) automated DNA sequencing machines. © 2011 by John Wiley & Sons, Inc.

Roles of Bacillus subtilis DprA and SsbA in RecA-mediated genetic recombination.

PubMed

Yadav, Tribhuwan; Carrasco, Begoña; Serrano, Ester; Alonso, Juan C

2014-10-03

Bacillus subtilis competence-induced RecA, SsbA, SsbB, and DprA are required to internalize and to recombine single-stranded (ss) DNA with homologous resident duplex. RecA, in the ATP · Mg(2+)-bound form (RecA · ATP), can nucleate and form filament onto ssDNA but is inactive to catalyze DNA recombination. We report that SsbA or SsbB bound to ssDNA blocks the RecA filament formation and fails to activate recombination. DprA facilitates RecA filamentation; however, the filaments cannot engage in DNA recombination. When ssDNA was preincubated with SsbA, but not SsbB, DprA was able to activate DNA strand exchange dependent on RecA · ATP. This work demonstrates that RecA · ATP, in concert with SsbA and DprA, catalyzes DNA strand exchange, and SsbB is an accessory factor in the reaction. In contrast, RecA · dATP efficiently catalyzes strand exchange even in the absence of single-stranded binding proteins or DprA, and addition of the accessory factors marginally improved it. We proposed that the RecA-bound nucleotide (ATP and to a lesser extent dATP) might dictate the requirement for accessory factors. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Influence of DNA sequence on the structure of minicircles under torsional stress

PubMed Central

Wang, Qian; Irobalieva, Rossitza N.; Chiu, Wah; Schmid, Michael F.; Fogg, Jonathan M.; Zechiedrich, Lynn

2017-01-01

Abstract The sequence dependence of the conformational distribution of DNA under various levels of torsional stress is an important unsolved problem. Combining theory and coarse-grained simulations shows that the DNA sequence and a structural correlation due to topology constraints of a circle are the main factors that dictate the 3D structure of a 336 bp DNA minicircle under torsional stress. We found that DNA minicircle topoisomers can have multiple bend locations under high torsional stress and that the positions of these sharp bends are determined by the sequence, and by a positive mechanical correlation along the sequence. We showed that simulations and theory are able to provide sequence-specific information about individual DNA minicircles observed by cryo-electron tomography (cryo-ET). We provided a sequence-specific cryo-ET tomogram fitting of DNA minicircles, registering the sequence within the geometric features. Our results indicate that the conformational distribution of minicircles under torsional stress can be designed, which has important implications for using minicircle DNA for gene therapy. PMID:28609782

Analysis of DNA Sequences by an Optical Time-Integrating Correlator: Proof-of-Concept Experiments.

DTIC Science & Technology

1992-05-01

DNA ANALYSIS STRATEGY 4 2.1 Representation of DNA Bases 4 2.2 DNA Analysis Strategy 6 3.0 CUSTOM GENERATORS FOR DNA SEQUENCES 10 3.1 Hardware Design 10...of the DNA bases where each base is represented by a 7-bits long pseudorandom sequence. 5 Figure 4: Coarse analysis of a DNA sequence. 7 Figure 5: Fine...a 20-bases long database. 32 xiii LIST OF TABLES PAGE Table 1: Short representations of the DNA bases where each base is represented by 7-bits long

DNA polymerase V activity is autoregulated by a novel intrinsic DNA-dependent ATPase

PubMed Central

Erdem, Aysen L; Jaszczur, Malgorzata; Bertram, Jeffrey G; Woodgate, Roger; Cox, Michael M; Goodman, Myron F

2014-01-01

Escherichia coli DNA polymerase V (pol V), a heterotrimeric complex composed of UmuD′2C, is marginally active. ATP and RecA play essential roles in the activation of pol V for DNA synthesis including translesion synthesis (TLS). We have established three features of the roles of ATP and RecA. (1) RecA-activated DNA polymerase V (pol V Mut), is a DNA-dependent ATPase; (2) bound ATP is required for DNA synthesis; (3) pol V Mut function is regulated by ATP, with ATP required to bind primer/template (p/t) DNA and ATP hydrolysis triggering dissociation from the DNA. Pol V Mut formed with an ATPase-deficient RecA E38K/K72R mutant hydrolyzes ATP rapidly, establishing the DNA-dependent ATPase as an intrinsic property of pol V Mut distinct from the ATP hydrolytic activity of RecA when bound to single-stranded (ss)DNA as a nucleoprotein filament (RecA*). No similar ATPase activity or autoregulatory mechanism has previously been found for a DNA polymerase. DOI: http://dx.doi.org/10.7554/eLife.02384.001 PMID:24843026

Enhanced spontaneous DNA twisting/bending fluctuations unveiled by fluorescence lifetime distributions promote mismatch recognition by the Rad4 nucleotide excision repair complex

PubMed Central

Chakraborty, Sagnik; Steinbach, Peter J; Paul, Debamita; Mu, Hong; Broyde, Suse

2018-01-01

Abstract Rad4/XPC recognizes diverse DNA lesions including ultraviolet-photolesions and carcinogen-DNA adducts, initiating nucleotide excision repair. Studies have suggested that Rad4/XPC senses lesion-induced helix-destabilization to flip out nucleotides from damaged DNA sites. However, characterizing how DNA deformability and/or distortions impact recognition has been challenging. Here, using fluorescence lifetime measurements empowered by a maximum entropy algorithm, we mapped the conformational heterogeneities of artificially destabilized mismatched DNA substrates of varying Rad4-binding specificities. The conformational distributions, as probed by FRET between a cytosine-analog pair exquisitely sensitive to DNA twisting/bending, reveal a direct connection between intrinsic DNA deformability and Rad4 recognition. High-specificity CCC/CCC mismatch, free in solution, sampled a strikingly broad range of conformations from B-DNA-like to highly distorted conformations that resembled those observed with Rad4 bound; the extent of these distortions increased with bound Rad4 and with temperature. Conversely, the non-specific TAT/TAT mismatch had a homogeneous, B-DNA-like conformation. Molecular dynamics simulations also revealed a wide distribution of conformations for CCC/CCC, complementing experimental findings. We propose that intrinsic deformability promotes Rad4 damage recognition, perhaps by stalling a diffusing protein and/or facilitating ‘conformational capture’ of pre-distorted damaged sites. Surprisingly, even mismatched DNA specifically bound to Rad4 remains highly dynamic, a feature that may reflect the versatility of Rad4/XPC to recognize many structurally dissimilar lesions. PMID:29267981

Laser mass spectrometry for DNA sequencing, disease diagnosis, and fingerprinting

NASA Astrophysics Data System (ADS)

Chen, C. H. Winston; Taranenko, N. I.; Zhu, Y. F.; Chung, C. N.; Allman, S. L.

1997-05-01

Since laser mass spectrometry has the potential for achieving very fast DNA analysis, we recently applied it to DNA sequencing, DNA typing for fingerprinting, and DNA screening for disease diagnosis. Two different approaches for sequencing DNA have been successfully demonstrated. One is to sequence DNA with DNA ladders produced from Sanger's enzymatic method. The other is to do direct sequencing without DNA ladders. The need for quick DNA typing for identification purposes is critical for forensic application. Our preliminary results indicate laser mass spectrometry can possible be used for rapid DNA fingerprinting applications at a much lower cost than gel electrophoresis. Population screening for certain genetic disease can be a very efficient step to reducing medical costs through prevention. Since laser mass spectrometry can provide very fast DNA analysis, we applied laser mass spectrometry to disease diagnosis. Clinical samples with both base deletion and point mutation have been tested with complete success.

Physical interaction between bacterial heat shock protein (Hsp) 90 and Hsp70 chaperones mediates their cooperative action to refold denatured proteins.

PubMed

Nakamoto, Hitoshi; Fujita, Kensaku; Ohtaki, Aguru; Watanabe, Satoru; Narumi, Shoichi; Maruyama, Takahiro; Suenaga, Emi; Misono, Tomoko S; Kumar, Penmetcha K R; Goloubinoff, Pierre; Yoshikawa, Hirofumi

2014-02-28

In eukaryotes, heat shock protein 90 (Hsp90) is an essential ATP-dependent molecular chaperone that associates with numerous client proteins. HtpG, a prokaryotic homolog of Hsp90, is essential for thermotolerance in cyanobacteria, and in vitro it suppresses the aggregation of denatured proteins efficiently. Understanding how the non-native client proteins bound to HtpG refold is of central importance to comprehend the essential role of HtpG under stress. Here, we demonstrate by yeast two-hybrid method, immunoprecipitation assays, and surface plasmon resonance techniques that HtpG physically interacts with DnaJ2 and DnaK2. DnaJ2, which belongs to the type II J-protein family, bound DnaK2 or HtpG with submicromolar affinity, and HtpG bound DnaK2 with micromolar affinity. Not only DnaJ2 but also HtpG enhanced the ATP hydrolysis by DnaK2. Although assisted by the DnaK2 chaperone system, HtpG enhanced native refolding of urea-denatured lactate dehydrogenase and heat-denatured glucose-6-phosphate dehydrogenase. HtpG did not substitute for DnaJ2 or GrpE in the DnaK2-assisted refolding of the denatured substrates. The heat-denatured malate dehydrogenase that did not refold by the assistance of the DnaK2 chaperone system alone was trapped by HtpG first and then transferred to DnaK2 where it refolded. Dissociation of substrates from HtpG was either ATP-dependent or -independent depending on the substrate, indicating the presence of two mechanisms of cooperative action between the HtpG and the DnaK2 chaperone system.

Micronuclear DNA of Oxytricha nova contains sequences with autonomously replicating activity in Saccharomyces cerevisiae.

PubMed Central

Colombo, M M; Swanton, M T; Donini, P; Prescott, D M

1984-01-01

Oxytricha nova is a hypotrichous ciliate with micronuclei and macronuclei. Micronuclei, which contain large, chromosomal-sized DNA, are genetically inert but undergo meiosis and exchange during cell mating. Macronuclei, which contain only small, gene-sized DNA molecules, provide all of the nuclear RNA needed to run the cell. After cell mating the macronucleus is derived from a micronucleus, a derivation that includes excision of the genes from chromosomes and elimination of the remaining DNA. The eliminated DNA includes all of the repetitious sequences and approximately 95% of the unique sequences. We cloned large restriction fragments from the micronucleus that confer replication ability on a replication-deficient plasmid in Saccharomyces cerevisiae. Sequences that confer replication ability are called autonomously replicating sequences. The frequency and effectiveness of autonomously replicating sequences in micronuclear DNA are similar to those reported for DNAs of other organisms introduced into yeast cells. Of the 12 micronuclear fragments with autonomously replicating sequence activity, 9 also showed homology to macronuclear DNA, indicating that they contain a macronuclear gene sequence. We conclude from this that autonomously replicating sequence activity is nonrandomly distributed throughout micronuclear DNA and is preferentially associated with those regions of micronuclear DNA that contain genes. Images PMID:6092934

DNA sequence-dependent mechanics and protein-assisted bending in repressor-mediated loop formation

PubMed Central

Boedicker, James Q.; Garcia, Hernan G.; Johnson, Stephanie; Phillips, Rob

2014-01-01

As the chief informational molecule of life, DNA is subject to extensive physical manipulations. The energy required to deform double-helical DNA depends on sequence, and this mechanical code of DNA influences gene regulation, such as through nucleosome positioning. Here we examine the sequence-dependent flexibility of DNA in bacterial transcription factor-mediated looping, a context for which the role of sequence remains poorly understood. Using a suite of synthetic constructs repressed by the Lac repressor and two well-known sequences that show large flexibility differences in vitro, we make precise statistical mechanical predictions as to how DNA sequence influences loop formation and test these predictions using in vivo transcription and in vitro single-molecule assays. Surprisingly, sequence-dependent flexibility does not affect in vivo gene regulation. By theoretically and experimentally quantifying the relative contributions of sequence and the DNA-bending protein HU to DNA mechanical properties, we reveal that bending by HU dominates DNA mechanics and masks intrinsic sequence-dependent flexibility. Such a quantitative understanding of how mechanical regulatory information is encoded in the genome will be a key step towards a predictive understanding of gene regulation at single-base pair resolution. PMID:24231252