Sample records for dna sequences located

  1. High-Throughput Analysis of T-DNA Location and Structure Using Sequence Capture.

    PubMed

    Inagaki, Soichi; Henry, Isabelle M; Lieberman, Meric C; Comai, Luca

    2015-01-01

    Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA-genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously, using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. Our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.

  2. High-throughput analysis of T-DNA location and structure using sequence capture

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Inagaki, Soichi; Henry, Isabelle M.; Lieberman, Meric C.

    Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously,more » using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. As a result, our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.« less

  3. High-throughput analysis of T-DNA location and structure using sequence capture

    DOE PAGES

    Inagaki, Soichi; Henry, Isabelle M.; Lieberman, Meric C.; ...

    2015-10-07

    Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously,more » using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. As a result, our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.« less

  4. Kilo-sequencing: an ordered strategy for rapid DNA sequence data acquisition.

    PubMed Central

    Barnes, W M; Bevan, M

    1983-01-01

    A strategy for rapid DNA sequence acquisition in an ordered, nonrandom manner, while retaining all of the conveniences of the dideoxy method with M13 transducing phage DNA template, is described. Target DNA 3 to 14 kb in size can be stably carried by our M13 vectors. Suitable targets are stretches of DNA which lack an enzyme recognition site which is unique on our cloning vectors and adjacent to the sequencing primer; current sites that are so useful when lacking are Pst, Xba, HindIII, BglII, EcoRI. By an in vitro procedure, we cut RF DNA once randomly and once specifically, to create thousands of deletions which start at the unique restriction site adjacent to the dideoxy sequencing primer and extend various distances across the target DNA. Phage carrying a desired size of deletions, whose DNA as template will give rise to DNA sequence data in a desired location along the target DNA, may be purified by electrophoresis alive on agarose gels. Phage running in the same location on the agarose gel thus conveniently give rise to nucleotide sequence data from the same kilobase of target DNA. Images PMID:6298723

  5. Genetic diversity based on 28S rDNA sequences among populations of Culex quinquefasciatus collected at different locations in Tamil Nadu, India.

    PubMed

    Sakthivelkumar, S; Ramaraj, P; Veeramani, V; Janarthanan, S

    2015-09-01

    The basis of the present study was to distinguish the existence of any genetic variability among populations of Culex quinquefasciatus which would be a valuable tool in the management of mosquito control programmes. In the present study, population of Cx. quinquefasciatus collected at different locations in Tamil Nadu were analyzed for their genetic variation based on 28S rDNA D2 region nucleotide sequences. A high degree of genetic polymorphism was detected in the sequences of D2 region of 28S rDNA on the predicted secondary structures in spite of high nucleotide sequence similarity. The findings based on secondary structure using rDNA sequences suggested the existence of a complex genotypic diversity of Cx. quinquefasciatus population collected at different locations of Tamil Nadu, India. This complexity in genetic diversity in a single mosquito population collected at different locations is considered an important issue towards their influence and nature of vector potential of these mosquitoes.

  6. Characterization of proviruses cloned from mink cell focus-forming virus-infected cellular DNA.

    PubMed Central

    Khan, A S; Repaske, R; Garon, C F; Chan, H W; Rowe, W P; Martin, M A

    1982-01-01

    Two proviruses were cloned from EcoRI-digested DNA extracted from mink cells chronically infected with AKR mink cell focus-forming (MCF) 247 murine leukemia virus (MuLV), using a lambda phage host vector system. One cloned MuLV DNA fragment (designated MCF 1) contained sequences extending 6.8 kilobases from an EcoRI restriction site in the 5' long terminal repeat (LTR) to an EcoRI site located in the envelope (env) region and was indistinguishable by restriction endonuclease mapping for 5.1 kilobases (except for the EcoRI site in the LTR) from the 5' end of AKR ecotropic proviral DNA. The DNA segment extending from 5.1 to 6.8 kilobases contained several restriction sites that were not present in the AKR ecotropic provirus. A 0.5-kilobase DNA segment located at the 3' end of MCF 1 DNA contained sequences which hybridized to a xenotropic env-specific DNA probe but not to labeled ecotropic env-specific DNA. This dual character of MCF 1 proviral DNA was also confirmed by analyzing heteroduplex molecules by electron microscopy. The second cloned proviral DNA (designated MCF 2) was a 6.9-kilobase EcoRI DNA fragment which contained LTR sequences at each end and a 2.0-kilobase deletion encompassing most of the env region. The MCF 2 proviral DNA proved to be a useful reagent for detecting LTRs electron microscopically due to the presence of nonoverlapping, terminally located LTR sequences which effected its circularization with DNAs containing homologous LTR sequences. Nucleotide sequence analysis demonstrated the presence of a 104-base-pair direct repeat in the LTR of MCF 2 DNA. In contrast, only a single copy of the reiterated component of the direct repeat was present in MCF 1 DNA. Images PMID:6281459

  7. Chromosomal characteristics and distribution of rDNA sequences in the brook trout Salvelinus fontinalis (Mitchill, 1814).

    PubMed

    Śliwińska-Jewsiewicka, A; Kuciński, M; Kirtiklis, L; Dobosz, S; Ocalewicz, K; Jankun, Malgorzata

    2015-08-01

    Brook trout Salvelinus fontinalis (Mitchill, 1814) chromosomes have been analyzed using conventional and molecular cytogenetic techniques enabling characteristics and chromosomal location of heterochromatin, nucleolus organizer regions (NORs), ribosomal RNA-encoding genes and telomeric DNA sequences. The C-banding and chromosome digestion with the restriction endonucleases demonstrated distribution and heterogeneity of the heterochromatin in the brook trout genome. DNA sequences of the ribosomal RNA genes, namely the nucleolus-forming 28S (major) and non-nucleolus-forming 5S (minor) rDNAs, were physically mapped using fluorescence in situ hybridization (FISH) and primed in situ labelling. The minor rDNA locus was located on the subtelo-acrocentric chromosome pair No. 9, whereas the major rDNA loci were dispersed on 14 chromosome pairs, showing a considerable inter-individual variation in the number and location. The major and minor rDNA loci were located at different chromosomes. Multichromosomal location (3-6 sites) of the NORs was demonstrated by silver nitrate (AgNO3) impregnation. All Ag-positive i.e. active NORs corresponded to the GC-rich blocks of heterochromatin. FISH with telomeric probe showed the presence of the interstitial telomeric site (ITS) adjacent to the NOR/28S rDNA site on the chromosome 11. This ITS was presumably remnant of the chromosome rearrangement(s) leading to the genomic redistribution of the rDNA sequences. Comparative analysis of the cytogenetic data among several related salmonid species confirmed huge variation in the number and the chromosomal location of rRNA gene clusters in the Salvelinus genome.

  8. Determining the Location of DNA Modification and Mutation Caused by UVB Light in Skin Cancer

    DTIC Science & Technology

    2015-09-01

    Award Number: W81XWH-12-1-0333 TITLE: Determining the Location of DNA Modification and Mutation Caused by UVB Light in Skin Cancer PRINCIPAL...COVERED 15 Aug 2012 – 14 Aug 2015 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER W81XWH-12-1-0333 Determining the Location of DNA Modification and Mutation ...sequencing libraries generated for both yeast and human cells show pyrimidine bias on the 5’ end, indicating that we are sequencing the dimers

  9. Mapping Simple Repeated DNA Sequences in Heterochromatin of Drosophila Melanogaster

    PubMed Central

    Lohe, A. R.; Hilliker, A. J.; Roberts, P. A.

    1993-01-01

    Heterochromatin in Drosophila has unusual genetic, cytological and molecular properties. Highly repeated DNA sequences (satellites) are the principal component of heterochromatin. Using probes from cloned satellites, we have constructed a chromosome map of 10 highly repeated, simple DNA sequences in heterochromatin of mitotic chromosomes of Drosophila melanogaster. Despite extensive sequence homology among some satellites, chromosomal locations could be distinguished by stringent in situ hybridizations for each satellite. Only two of the localizations previously determined using gradient-purified bulk satellite probes are correct. Eight new satellite localizations are presented, providing a megabase-level chromosome map of one-quarter of the genome. Five major satellites each exhibit a multichromosome distribution, and five minor satellites hybridize to single sites on the Y chromosome. Satellites closely related in sequence are often located near one another on the same chromosome. About 80% of Y chromosome DNA is composed of nine simple repeated sequences, in particular (AAGAC)(n) (8 Mb), (AAGAG)(n) (7 Mb) and (AATAT)(n) (6 Mb). Similarly, more than 70% of the DNA in chromosome 2 heterochromatin is composed of five simple repeated sequences. We have also generated a high resolution map of satellites in chromosome 2 heterochromatin, using a series of translocation chromosomes whose breakpoints in heterochromatin were ordered by N-banding. Finally, staining and banding patterns of heterochromatic regions are correlated with the locations of specific repeated DNA sequences. The basis for the cytochemical heterogeneity in banding appears to depend exclusively on the different satellite DNAs present in heterochromatin. PMID:8375654

  10. CancerLocator: non-invasive cancer diagnosis and tissue-of-origin prediction using methylation profiles of cell-free DNA.

    PubMed

    Kang, Shuli; Li, Qingjiao; Chen, Quan; Zhou, Yonggang; Park, Stacy; Lee, Gina; Grimes, Brandon; Krysan, Kostyantyn; Yu, Min; Wang, Wei; Alber, Frank; Sun, Fengzhu; Dubinett, Steven M; Li, Wenyuan; Zhou, Xianghong Jasmine

    2017-03-24

    We propose a probabilistic method, CancerLocator, which exploits the diagnostic potential of cell-free DNA by determining not only the presence but also the location of tumors. CancerLocator simultaneously infers the proportions and the tissue-of-origin of tumor-derived cell-free DNA in a blood sample using genome-wide DNA methylation data. CancerLocator outperforms two established multi-class classification methods on simulations and real data, even with the low proportion of tumor-derived DNA in the cell-free DNA scenarios. CancerLocator also achieves promising results on patient plasma samples with low DNA methylation sequencing coverage.

  11. Genome-wide evidence for local DNA methylation spreading from small RNA-targeted sequences in Arabidopsis.

    PubMed

    Ahmed, Ikhlak; Sarazin, Alexis; Bowler, Chris; Colot, Vincent; Quesneville, Hadi

    2011-09-01

    Transposable elements (TEs) and their relics play major roles in genome evolution. However, mobilization of TEs is usually deleterious and strongly repressed. In plants and mammals, this repression is typically associated with DNA methylation, but the relationship between this epigenetic mark and TE sequences has not been investigated systematically. Here, we present an improved annotation of TE sequences and use it to analyze genome-wide DNA methylation maps obtained at single-nucleotide resolution in Arabidopsis. We show that although the majority of TE sequences are methylated, ∼26% are not. Moreover, a significant fraction of TE sequences densely methylated at CG, CHG and CHH sites (where H = A, T or C) have no or few matching small interfering RNA (siRNAs) and are therefore unlikely to be targeted by the RNA-directed DNA methylation (RdDM) machinery. We provide evidence that these TE sequences acquire DNA methylation through spreading from adjacent siRNA-targeted regions. Further, we show that although both methylated and unmethylated TE sequences located in euchromatin tend to be more abundant closer to genes, this trend is least pronounced for methylated, siRNA-targeted TE sequences located 5' to genes. Based on these and other findings, we propose that spreading of DNA methylation through promoter regions explains at least in part the negative impact of siRNA-targeted TE sequences on neighboring gene expression.

  12. A chromatin insulator determines the nuclear localization of DNA.

    PubMed

    Gerasimova, T I; Byrd, K; Corces, V G

    2000-11-01

    Chromatin insulators might regulate gene expression by controlling the subnuclear organization of DNA. We found that a DNA sequence normally located inside of the nucleus moved to the periphery when the gypsy insulator was placed within the sequence. The presence of the gypsy insulator also caused two sequences, normally found in different regions of the nucleus, to come together at a single location. Alterations in this subnuclear organization imposed by the gypsy insulator correlated with changes in gene expression that took place during the heat-shock response. These global changes in transcription were accompanied by dramatic alterations in the distribution of insulator proteins and DNA. The results suggest that the nuclear organization imposed by the gypsy insulator on the chromatin fiber is important for gene expression.

  13. Correlation approach to identify coding regions in DNA sequences

    NASA Technical Reports Server (NTRS)

    Ossadnik, S. M.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

    1994-01-01

    Recently, it was observed that noncoding regions of DNA sequences possess long-range power-law correlations, whereas coding regions typically display only short-range correlations. We develop an algorithm based on this finding that enables investigators to perform a statistical analysis on long DNA sequences to locate possible coding regions. The algorithm is particularly successful in predicting the location of lengthy coding regions. For example, for the complete genome of yeast chromosome III (315,344 nucleotides), at least 82% of the predictions correspond to putative coding regions; the algorithm correctly identified all coding regions larger than 3000 nucleotides, 92% of coding regions between 2000 and 3000 nucleotides long, and 79% of coding regions between 1000 and 2000 nucleotides. The predictive ability of this new algorithm supports the claim that there is a fundamental difference in the correlation property between coding and noncoding sequences. This algorithm, which is not species-dependent, can be implemented with other techniques for rapidly and accurately locating relatively long coding regions in genomic sequences.

  14. On the Sequence-Directed Nature of Human Gene Mutation: The Role of Genomic Architecture and the Local DNA Sequence Environment in Mediating Gene Mutations Underlying Human Inherited Disease

    PubMed Central

    Cooper, David N.; Bacolla, Albino; Férec, Claude; Vasquez, Karen M.; Kehrer-Sawatzki, Hildegard; Chen, Jian-Min

    2011-01-01

    Different types of human gene mutation may vary in size, from structural variants (SVs) to single base-pair substitutions, but what they all have in common is that their nature, size and location are often determined either by specific characteristics of the local DNA sequence environment or by higher-order features of the genomic architecture. The human genome is now recognized to contain ‘pervasive architectural flaws’ in that certain DNA sequences are inherently mutation-prone by virtue of their base composition, sequence repetitivity and/or epigenetic modification. Here we explore how the nature, location and frequency of different types of mutation causing inherited disease are shaped in large part, and often in remarkably predictable ways, by the local DNA sequence environment. The mutability of a given gene or genomic region may also be influenced indirectly by a variety of non-canonical (non-B) secondary structures whose formation is facilitated by the underlying DNA sequence. Since these non-B DNA structures can interfere with subsequent DNA replication and repair, and may serve to increase mutation frequencies in generalized fashion (i.e. both in the context of subtle mutations and SVs), they have the potential to serve as a unifying concept in studies of mutational mechanisms underlying human inherited disease. PMID:21853507

  15. Influence of DNA sequence on the structure of minicircles under torsional stress

    PubMed Central

    Wang, Qian; Irobalieva, Rossitza N.; Chiu, Wah; Schmid, Michael F.; Fogg, Jonathan M.; Zechiedrich, Lynn

    2017-01-01

    Abstract The sequence dependence of the conformational distribution of DNA under various levels of torsional stress is an important unsolved problem. Combining theory and coarse-grained simulations shows that the DNA sequence and a structural correlation due to topology constraints of a circle are the main factors that dictate the 3D structure of a 336 bp DNA minicircle under torsional stress. We found that DNA minicircle topoisomers can have multiple bend locations under high torsional stress and that the positions of these sharp bends are determined by the sequence, and by a positive mechanical correlation along the sequence. We showed that simulations and theory are able to provide sequence-specific information about individual DNA minicircles observed by cryo-electron tomography (cryo-ET). We provided a sequence-specific cryo-ET tomogram fitting of DNA minicircles, registering the sequence within the geometric features. Our results indicate that the conformational distribution of minicircles under torsional stress can be designed, which has important implications for using minicircle DNA for gene therapy. PMID:28609782

  16. Estimating Genomic Distance from DNA Sequence Location in Cell Nuclei by a Random Walk Model

    NASA Astrophysics Data System (ADS)

    van den Engh, Ger; Sachs, Rainer; Trask, Barbara J.

    1992-09-01

    The folding of chromatin in interphase cell nuclei was studied by fluorescent in situ hybridization with pairs of unique DNA sequence probes. The sites of DNA sequences separated by 100 to 2000 kilobase pairs (kbp) are distributed in interphase chromatin according to a random walk model. This model provides the basis for calculating the spacing of sequences along the linear DNA molecule from interphase distance measurements. An interphase mapping strategy based on this model was tested with 13 probes from a 4-megabase pair (Mbp) region of chromosome 4 containing the Huntington disease locus. The results confirmed the locations of the probes and showed that the remaining gap in the published maps of this region is negligible in size. Interphase distance measurements should facilitate construction of chromosome maps with an average marker density of one per 100 kbp, approximately ten times greater than that achieved by hybridization to metaphase chromosomes.

  17. Cytogenetic Analysis of Populus trichocarpa - Ribosomal DNA, Telomere Repeat Sequence, and Marker-selected BACs

    Treesearch

    M.N. lslam-Faridi; C.D. Nelson; S.P. DiFazio; L.E. Gunter; G.A. Tuskan

    2009-01-01

    The 185-285 rDNA and 55 rDNA loci in Populus trichocarpa were localized using fluorescent in situ hybridization (FISH). Two 185-285 rDNA sites and one 55 rDNA site were identified and located at the ends of 3 different chromosomes. FISH signals from the Arabidopsis-type telomere repeat sequence were observed at the distal ends of each chromosome. Six BAC clones...

  18. High-resolution characterization of sequence signatures due to non-random cleavage of cell-free DNA.

    PubMed

    Chandrananda, Dineika; Thorne, Natalie P; Bahlo, Melanie

    2015-06-17

    High-throughput sequencing of cell-free DNA fragments found in human plasma has been used to non-invasively detect fetal aneuploidy, monitor organ transplants and investigate tumor DNA. However, many biological properties of this extracellular genetic material remain unknown. Research that further characterizes circulating DNA could substantially increase its diagnostic value by allowing the application of more sophisticated bioinformatics tools that lead to an improved signal to noise ratio in the sequencing data. In this study, we investigate various features of cell-free DNA in plasma using deep-sequencing data from two pregnant women (>70X, >50X) and compare them with matched cellular DNA. We utilize a descriptive approach to examine how the biological cleavage of cell-free DNA affects different sequence signatures such as fragment lengths, sequence motifs at fragment ends and the distribution of cleavage sites along the genome. We show that the size distributions of these cell-free DNA molecules are dependent on their autosomal and mitochondrial origin as well as the genomic location within chromosomes. DNA mapping to particular microsatellites and alpha repeat elements display unique size signatures. We show how cell-free fragments occur in clusters along the genome, localizing to nucleosomal arrays and are preferentially cleaved at linker regions by correlating the mapping locations of these fragments with ENCODE annotation of chromatin organization. Our work further demonstrates that cell-free autosomal DNA cleavage is sequence dependent. The region spanning up to 10 positions on either side of the DNA cleavage site show a consistent pattern of preference for specific nucleotides. This sequence motif is present in cleavage sites localized to nucleosomal cores and linker regions but is absent in nucleosome-free mitochondrial DNA. These background signals in cell-free DNA sequencing data stem from the non-random biological cleavage of these fragments. This sequence structure can be harnessed to improve bioinformatics algorithms, in particular for CNV and structural variant detection. Descriptive measures for cell-free DNA features developed here could also be used in biomarker analysis to monitor the changes that occur during different pathological conditions.

  19. Hiding message into DNA sequence through DNA coding and chaotic maps.

    PubMed

    Liu, Guoyan; Liu, Hongjun; Kadir, Abdurahman

    2014-09-01

    The paper proposes an improved reversible substitution method to hide data into deoxyribonucleic acid (DNA) sequence, and four measures have been taken to enhance the robustness and enlarge the hiding capacity, such as encode the secret message by DNA coding, encrypt it by pseudo-random sequence, generate the relative hiding locations by piecewise linear chaotic map, and embed the encoded and encrypted message into a randomly selected DNA sequence using the complementary rule. The key space and the hiding capacity are analyzed. Experimental results indicate that the proposed method has a better performance compared with the competing methods with respect to robustness and capacity.

  20. Brownian dynamics simulations of sequence-dependent duplex denaturation in dynamically superhelical DNA

    NASA Astrophysics Data System (ADS)

    Mielke, Steven P.; Grønbech-Jensen, Niels; Krishnan, V. V.; Fink, William H.; Benham, Craig J.

    2005-09-01

    The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.

  1. Brownian dynamics simulations of sequence-dependent duplex denaturation in dynamically superhelical DNA.

    PubMed

    Mielke, Steven P; Grønbech-Jensen, Niels; Krishnan, V V; Fink, William H; Benham, Craig J

    2005-09-22

    The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.

  2. Sequence and transcriptional analysis of the barley ctDNA region upstream of psbD-psbC encoding trnK(UUU), rps16, trnQ(UUG), psbK, psbI, and trnS(GCU).

    PubMed

    Berends Sexton, T; Jones, J T; Mullet, J E

    1990-05-01

    A 6.25 kbp barley plastid DNA region located between psbA and psbD-psbC were sequenced and RNAs produced from this DNA were analyzed. TrnK(UUU), rps16 and trnQ(UUG) were located upstream of psbA. These genes were transcribed from the same DNA strand as psbA and multiple RNAs hybridized to them. TrnK and rsp16 contained introns; a 504 amino acid open reading frame (ORF504) was located within the trnK intron. Between trnQ and psbD-psbC was a 2.24 kbp region encoding psbK, psbI and trnS(GCU). PsbK and psbI are encoded on the same DNA strand as psbD-psbC whereas trnS(GCU) is transcribed from the opposite strand. Two large RNAs accumulate in barley etioplasts which contain psbK, psbI, anti-sense trnS(GCU) and psbD-psbC sequences. Other RNAs encode psbK and psbI only, or psbK only. The divergent trnS(GCU) located upstream of psbD-psbC and a second divergent trnS(UGA) located downstream of psbD-psbC were both expressed. Furthermore, RNA complementary to psbK and psbI mRNA was detected, suggesting that transcription from divergent overlapping transcription units may modulate expression from this DNA region.

  3. Exon trapping: a genetic screen to identify candidate transcribed sequences in cloned mammalian genomic DNA.

    PubMed

    Duyk, G M; Kim, S W; Myers, R M; Cox, D R

    1990-11-01

    Identification and recovery of transcribed sequences from cloned mammalian genomic DNA remains an important problem in isolating genes on the basis of their chromosomal location. We have developed a strategy that facilitates the recovery of exons from random pieces of cloned genomic DNA. The basis of this "exon trapping" strategy is that, during a retroviral life cycle, genomic sequences of nonviral origin are correctly spliced and may be recovered as a cDNA copy of the introduced segment. By using this genetic assay for cis-acting sequences required for RNA splicing, we have screened approximately 20 kilobase pairs of cloned genomic DNA and have recovered all four predicted exons.

  4. Exon trapping: a genetic screen to identify candidate transcribed sequences in cloned mammalian genomic DNA.

    PubMed Central

    Duyk, G M; Kim, S W; Myers, R M; Cox, D R

    1990-01-01

    Identification and recovery of transcribed sequences from cloned mammalian genomic DNA remains an important problem in isolating genes on the basis of their chromosomal location. We have developed a strategy that facilitates the recovery of exons from random pieces of cloned genomic DNA. The basis of this "exon trapping" strategy is that, during a retroviral life cycle, genomic sequences of nonviral origin are correctly spliced and may be recovered as a cDNA copy of the introduced segment. By using this genetic assay for cis-acting sequences required for RNA splicing, we have screened approximately 20 kilobase pairs of cloned genomic DNA and have recovered all four predicted exons. PMID:2247475

  5. Real-Time DNA Sequencing in the Antarctic Dry Valleys Using the Oxford Nanopore Sequencer

    PubMed Central

    Johnson, Sarah S.; Zaikova, Elena; Goerlitz, David S.; Bai, Yu; Tighe, Scott W.

    2017-01-01

    The ability to sequence DNA outside of the laboratory setting has enabled novel research questions to be addressed in the field in diverse areas, ranging from environmental microbiology to viral epidemics. Here, we demonstrate the application of offline DNA sequencing of environmental samples using a hand-held nanopore sequencer in a remote field location: the McMurdo Dry Valleys, Antarctica. Sequencing was performed using a MK1B MinION sequencer from Oxford Nanopore Technologies (ONT; Oxford, United Kingdom) that was equipped with software to operate without internet connectivity. One-direction (1D) genomic libraries were prepared using portable field techniques on DNA isolated from desiccated microbial mats. By adequately insulating the sequencer and laptop, it was possible to run the sequencing protocol for up to 2½ h under arduous conditions. PMID:28337073

  6. The ability of human nuclear DNA to cause false positive low-abundance heteroplasmy calls varies across the mitochondrial genome.

    PubMed

    Albayrak, Levent; Khanipov, Kamil; Pimenova, Maria; Golovko, George; Rojas, Mark; Pavlidis, Ioannis; Chumakov, Sergei; Aguilar, Gerardo; Chávez, Arturo; Widger, William R; Fofanov, Yuriy

    2016-12-12

    Low-abundance mutations in mitochondrial populations (mutations with minor allele frequency ≤ 1%), are associated with cancer, aging, and neurodegenerative disorders. While recent progress in high-throughput sequencing technology has significantly improved the heteroplasmy identification process, the ability of this technology to detect low-abundance mutations can be affected by the presence of similar sequences originating from nuclear DNA (nDNA). To determine to what extent nDNA can cause false positive low-abundance heteroplasmy calls, we have identified mitochondrial locations of all subsequences that are common or similar (one mismatch allowed) between nDNA and mitochondrial DNA (mtDNA). Performed analysis revealed up to a 25-fold variation in the lengths of longest common and longest similar (one mismatch allowed) subsequences across the mitochondrial genome. The size of the longest subsequences shared between nDNA and mtDNA in several regions of the mitochondrial genome were found to be as low as 11 bases, which not only allows using these regions to design new, very specific PCR primers, but also supports the hypothesis of the non-random introduction of mtDNA into the human nuclear DNA. Analysis of the mitochondrial locations of the subsequences shared between nDNA and mtDNA suggested that even very short (36 bases) single-end sequencing reads can be used to identify low-abundance variation in 20.4% of the mitochondrial genome. For longer (76 and 150 bases) reads, the proportion of the mitochondrial genome where nDNA presence will not interfere found to be 44.5 and 67.9%, when low-abundance mutations at 100% of locations can be identified using 417 bases long single reads. This observation suggests that the analysis of low-abundance variations in mitochondria population can be extended to a variety of large data collections such as NCBI Sequence Read Archive, European Nucleotide Archive, The Cancer Genome Atlas, and International Cancer Genome Consortium.

  7. Differential repetitive DNA composition in the centromeric region of chromosomes of Amazonian lizard species in the family Teiidae

    PubMed Central

    Carvalho, Natalia D. M.; Carmo, Edson; Neves, Rogerio O.; Schneider, Carlos Henrique; Gross, Maria Claudia

    2016-01-01

    Abstract Differences in heterochromatin distribution patterns and its composition were observed in Amazonian teiid species. Studies have shown repetitive DNA harbors heterochromatic blocks which are located in centromeric and telomeric regions in Ameiva ameiva (Linnaeus, 1758), Kentropyx calcarata (Spix, 1825), Kentropyx pelviceps (Cope, 1868), and Tupinambis teguixin (Linnaeus, 1758). In Cnemidophorus sp.1, repetitive DNA has multiple signals along all chromosomes. The aim of this study was to characterize moderately and highly repetitive DNA sequences by Cot1-DNA from Ameiva ameiva and Cnemidophorus sp.1 genomes through cloning and DNA sequencing, as well as mapping them chromosomally to better understand its organization and genome dynamics. The results of sequencing of DNA libraries obtained by Cot1-DNA showed that different microsatellites, transposons, retrotransposons, and some gene families also comprise the fraction of repetitive DNA in the teiid species. FISH using Cot1-DNA probes isolated from both Ameiva ameiva and Cnemidophorus sp.1 showed these sequences mainly located in heterochromatic centromeric, and telomeric regions in Ameiva ameiva, Kentropyx calcarata, Kentropyx pelviceps, and Tupinambis teguixin chromosomes, indicating they play structural and functional roles in the genome of these species. In Cnemidophorus sp.1, Cot1-DNA probe isolated from Ameiva ameiva had multiple interstitial signals on chromosomes, whereas mapping of Cot1-DNA isolated from the Ameiva ameiva and Cnemidophorus sp.1 highlighted centromeric regions of some chromosomes. Thus, the data obtained showed that many repetitive DNA classes are part of the genome of Ameiva ameiva, Cnemidophorus sp.1, Kentroyx calcarata, Kentropyx pelviceps, and Tupinambis teguixin, and these sequences are shared among the analyzed teiid species, but they were not always allocated at the same chromosome position. PMID:27551343

  8. Differential repetitive DNA composition in the centromeric region of chromosomes of Amazonian lizard species in the family Teiidae.

    PubMed

    Carvalho, Natalia D M; Carmo, Edson; Neves, Rogerio O; Schneider, Carlos Henrique; Gross, Maria Claudia

    2016-01-01

    Differences in heterochromatin distribution patterns and its composition were observed in Amazonian teiid species. Studies have shown repetitive DNA harbors heterochromatic blocks which are located in centromeric and telomeric regions in Ameiva ameiva (Linnaeus, 1758), Kentropyx calcarata (Spix, 1825), Kentropyx pelviceps (Cope, 1868), and Tupinambis teguixin (Linnaeus, 1758). In Cnemidophorus sp.1, repetitive DNA has multiple signals along all chromosomes. The aim of this study was to characterize moderately and highly repetitive DNA sequences by C ot1-DNA from Ameiva ameiva and Cnemidophorus sp.1 genomes through cloning and DNA sequencing, as well as mapping them chromosomally to better understand its organization and genome dynamics. The results of sequencing of DNA libraries obtained by C ot1-DNA showed that different microsatellites, transposons, retrotransposons, and some gene families also comprise the fraction of repetitive DNA in the teiid species. FISH using C ot1-DNA probes isolated from both Ameiva ameiva and Cnemidophorus sp.1 showed these sequences mainly located in heterochromatic centromeric, and telomeric regions in Ameiva ameiva, Kentropyx calcarata, Kentropyx pelviceps, and Tupinambis teguixin chromosomes, indicating they play structural and functional roles in the genome of these species. In Cnemidophorus sp.1, C ot1-DNA probe isolated from Ameiva ameiva had multiple interstitial signals on chromosomes, whereas mapping of C ot1-DNA isolated from the Ameiva ameiva and Cnemidophorus sp.1 highlighted centromeric regions of some chromosomes. Thus, the data obtained showed that many repetitive DNA classes are part of the genome of Ameiva ameiva, Cnemidophorus sp.1, Kentroyx calcarata, Kentropyx pelviceps, and Tupinambis teguixin, and these sequences are shared among the analyzed teiid species, but they were not always allocated at the same chromosome position.

  9. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

  10. Homology between DNA polymerases of poxviruses, herpesviruses, and adenoviruses: nucleotide sequence of the vaccinia virus DNA polymerase gene.

    PubMed Central

    Earl, P L; Jones, E V; Moss, B

    1986-01-01

    A 5400-base-pair segment of the vaccinia virus genome was sequenced and an open reading frame of 938 codons was found precisely where the DNA polymerase had been mapped by transfer of a phosphonoacetate-resistance marker. A single nucleotide substitution changing glycine at position 347 to aspartic acid accounts for the drug resistance of the mutant vaccinia virus. The 5' end of the DNA polymerase mRNA was located 80 base pairs before the methionine codon initiating the open reading frame. Correspondence between the predicted Mr 108,577 polypeptide and the 110,000 purified enzyme indicates that little or no proteolytic processing occurs. Extensive homology, extending over 435 amino acids, was found upon comparing the DNA polymerase of vaccinia virus and DNA polymerase of Epstein-Barr virus. A highly conserved sequence of 14 amino acids in the carboxyl-terminal regions of the above DNA polymerases is also present at a similar location in adenovirus DNA polymerase. This structure, which is predicted to form a turn flanked by beta-pleated sheets, may form part of an essential binding or catalytic site that accounts for its presence in DNA polymerases of poxviruses, herpesviruses, and adenoviruses. Images PMID:3012524

  11. DNA Shape Dominates Sequence Affinity in Nucleosome Formation

    NASA Astrophysics Data System (ADS)

    Freeman, Gordon S.; Lequieu, Joshua P.; Hinckley, Daniel M.; Whitmer, Jonathan K.; de Pablo, Juan J.

    2014-10-01

    Nucleosomes provide the basic unit of compaction in eukaryotic genomes, and the mechanisms that dictate their position at specific locations along a DNA sequence are of central importance to genetics. In this Letter, we employ molecular models of DNA and proteins to elucidate various aspects of nucleosome positioning. In particular, we show how DNA's histone affinity is encoded in its sequence-dependent shape, including subtle deviations from the ideal straight B-DNA form and local variations of minor groove width. By relying on high-precision simulations of the free energy of nucleosome complexes, we also demonstrate that, depending on DNA's intrinsic curvature, histone binding can be dominated by bending interactions or electrostatic interactions. More generally, the results presented here explain how sequence, manifested as the shape of the DNA molecule, dominates molecular recognition in the problem of nucleosome positioning.

  12. Molecular structure and chromosome distribution of three repetitive DNA families in Anemone hortensis L. (Ranunculaceae).

    PubMed

    Mlinarec, Jelena; Chester, Mike; Siljak-Yakovlev, Sonja; Papes, Drazena; Leitch, Andrew R; Besendorfer, Visnja

    2009-01-01

    The structure, abundance and location of repetitive DNA sequences on chromosomes can characterize the nature of higher plant genomes. Here we report on three new repeat DNA families isolated from Anemone hortensis L.; (i) AhTR1, a family of satellite DNA (stDNA) composed of a 554-561 bp long EcoRV monomer; (ii) AhTR2, a stDNA family composed of a 743 bp long HindIII monomer and; (iii) AhDR, a repeat family composed of a 945 bp long HindIII fragment that exhibits some sequence similarity to Ty3/gypsy-like retroelements. Fluorescence in-situ hybridization (FISH) to metaphase chromosomes of A. hortensis (2n = 16) revealed that both AhTR1 and AhTR2 sequences co-localized with DAPI-positive AT-rich heterochromatic regions. AhTR1 sequences occur at intercalary DAPI bands while AhTR2 sequences occur at 8-10 terminally located heterochromatic blocks. In contrast AhDR sequences are dispersed over all chromosomes as expected of a Ty3/gypsy-like element. AhTR2 and AhTR1 repeat families include polyA- and polyT-tracks, AT/TA-motifs and a pentanucleotide sequence (CAAAA) that may have consequences for chromatin packing and sequence homogeneity. AhTR2 repeats also contain TTTAGGG motifs and degenerate variants. We suggest that they arose by interspersion of telomeric repeats with subtelomeric repeats, before hybrid unit(s) amplified through the heterochromatic domain. The three repetitive DNA families together occupy approximately 10% of the A. hortensis genome. Comparative analyses of eight Anemone species revealed that the divergence of the A. hortensis genome was accompanied by considerable modification and/or amplification of repeats.

  13. The Organization of Repetitive DNA in the Genomes of Amazonian Lizard Species in the Family Teiidae.

    PubMed

    Carvalho, Natalia D M; Pinheiro, Vanessa S S; Carmo, Edson J; Goll, Leonardo G; Schneider, Carlos H; Gross, Maria C

    2015-01-01

    Repetitive DNA is the largest fraction of the eukaryote genome and comprises tandem and dispersed sequences. It presents variations in relation to its composition, number of copies, distribution, dynamics, and genome organization, and participates in the evolutionary diversification of different vertebrate species. Repetitive sequences are usually located in the heterochromatin of centromeric and telomeric regions of chromosomes, contributing to chromosomal structures. Therefore, the aim of this study was to physically map repetitive DNA sequences (5S rDNA, telomeric sequences, tropomyosin gene 1, and retroelements Rex1 and SINE) of mitotic chromosomes of Amazonian species of teiids (Ameiva ameiva, Cnemidophorus sp. 1, Kentropyx calcarata, Kentropyx pelviceps, and Tupinambis teguixin) to understand their genome organization and karyotype evolution. The mapping of repetitive sequences revealed a distinct pattern in Cnemidophorus sp. 1, whereas the other species showed all sequences interspersed in the heterochromatic region. Physical mapping of the tropomyosin 1 gene was performed for the first time in lizards and showed that in addition to being functional, this gene has a structural function similar to the mapped repetitive elements as it is located preferentially in centromeric regions and termini of chromosomes. © 2016 S. Karger AG, Basel.

  14. Method for introducing unidirectional nested deletions

    DOEpatents

    Dunn, John J.; Quesada, Mark A.; Randesi, Matthew

    2001-01-01

    Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment in the context of a cloning vector which contains an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment. Also disclosed is a method for producing single-stranded DNA probes utilizing the same cloning vector. An optimal vector, PZIP is described. Methods for introducing unidirectional deletions into a terminal location of a cloned DNA sequence which is inserted into the vector of the present invention are also disclosed. These methods are useful for introducing deletions into either or both ends of a cloned DNA insert, for high throughput sequencing of any DNA of interest.

  15. Cloning and sequence analysis of a cDNA clone coding for the mouse GM2 activator protein.

    PubMed Central

    Bellachioma, G; Stirling, J L; Orlacchio, A; Beccari, T

    1993-01-01

    A cDNA (1.1 kb) containing the complete coding sequence for the mouse GM2 activator protein was isolated from a mouse macrophage library using a cDNA for the human protein as a probe. There was a single ATG located 12 bp from the 5' end of the cDNA clone followed by an open reading frame of 579 bp. Northern blot analysis of mouse macrophage RNA showed that there was a single band with a mobility corresponding to a size of 2.3 kb. We deduce from this that the mouse mRNA, in common with the mRNA for the human GM2 activator protein, has a long 3' untranslated sequence of approx. 1.7 kb. Alignment of the mouse and human deduced amino acid sequences showed 68% identity overall and 75% identity for the sequence on the C-terminal side of the first 31 residues, which in the human GM2 activator protein contains the signal peptide. Hydropathicity plots showed great similarity between the mouse and human sequences even in regions of low sequence similarity. There is a single N-glycosylation site in the mouse GM2 activator protein sequence (Asn151-Phe-Thr) which differs in its location from the single site reported in the human GM2 activator protein sequence (Asn63-Val-Thr). Images Figure 1 PMID:7689829

  16. Fusion of GFP to the M.EcoKI DNA methyltransferase produces a new probe of Type I DNA restriction and modification enzymes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Kai; Roberts, Gareth A.; Stephanou, Augoustinos S.

    2010-07-23

    Research highlights: {yields} Successful fusion of GFP to M.EcoKI DNA methyltransferase. {yields} GFP located at C-terminal of sequence specificity subunit does not later enzyme activity. {yields} FRET confirms structural model of M.EcoKI bound to DNA. -- Abstract: We describe the fusion of enhanced green fluorescent protein to the C-terminus of the HsdS DNA sequence-specificity subunit of the Type I DNA modification methyltransferase M.EcoKI. The fusion expresses well in vivo and assembles with the two HsdM modification subunits. The fusion protein functions as a sequence-specific DNA methyltransferase protecting DNA against digestion by the EcoKI restriction endonuclease. The purified enzyme shows Foerstermore » resonance energy transfer to fluorescently-labelled DNA duplexes containing the target sequence and to fluorescently-labelled ocr protein, a DNA mimic that binds to the M.EcoKI enzyme. Distances determined from the energy transfer experiments corroborate the structural model of M.EcoKI.« less

  17. Characterization of the repetitive DNA elements in the genome of fish lymphocystis disease viruses.

    PubMed

    Schnitzler, P; Darai, G

    1989-09-01

    The complete DNA nucleotide sequence of the repetitive DNA elements in the genome of fish lymphocystis disease virus (FLDV) isolated from two different species (flounder and dab) was determined. The size of these repetitive DNA elements was found to be 1413 bp which corresponds to the DNA sequences of the 5' terminus of the EcoRI DNA fragment B (0.034 to 0.052 m.u.) and to the EcoRI DNA fragment M (0.718 to 0.736 m.u.) of the FLDV genome causing lymphocystis disease in flounder and plaice. The degree of DNA nucleotide homology between both regions was found to be 99%. The repetitive DNA element in the genome of FLDV isolated from other fish species (dab) was identified and is located within the EcoRI DNA fragment B and J of the viral genome. The DNA nucleotide sequence of one duplicate of this repetition (EcoRI DNA fragment J) was determined (1410 bp) and compared to the DNA nucleotide sequences of the repetitive DNA elements of the genome of FLDV isolated from flounder. It was found that the repetitive DNA elements of the genome of FLDV derived from two different fish species are highly conserved and possess a degree of DNA sequence homology of 94%. The DNA sequences of each strand of the individual repetitive element possess one open reading frame.

  18. Caught in the act: the lifetime of synaptic intermediates during the search for homology on DNA

    PubMed Central

    Mani, Adam; Braslavsky, Ido; Arbel-Goren, Rinat; Stavans, Joel

    2010-01-01

    Homologous recombination plays pivotal roles in DNA repair and in the generation of genetic diversity. To locate homologous target sequences at which strand exchange can occur within a timescale that a cell’s biology demands, a single-stranded DNA-recombinase complex must search among a large number of sequences on a genome by forming synapses with chromosomal segments of DNA. A key element in the search is the time it takes for the two sequences of DNA to be compared, i.e. the synapse lifetime. Here, we visualize for the first time fluorescently tagged individual synapses formed by RecA, a prokaryotic recombinase, and measure their lifetime as a function of synapse length and differences in sequence between the participating DNAs. Surprisingly, lifetimes can be ∼10 s long when the DNAs are fully heterologous, and much longer for partial homology, consistently with ensemble FRET measurements. Synapse lifetime increases rapidly as the length of a region of full homology at either the 3′- or 5′-ends of the invading single-stranded DNA increases above 30 bases. A few mismatches can reduce dramatically the lifetime of synapses formed with nearly homologous DNAs. These results suggest the need for facilitated homology search mechanisms to locate homology successfully within the timescales observed in vivo. PMID:20044347

  19. Cloning and sequencing of a gene encoding a novel extracellular neutral proteinase from Streptomyces sp. strain C5 and expression of the gene in Streptomyces lividans 1326.

    PubMed Central

    Lampel, J S; Aphale, J S; Lampel, K A; Strohl, W R

    1992-01-01

    The gene encoding a novel milk protein-hydrolyzing proteinase was cloned on a 6.56-kb SstI fragment from Streptomyces sp. strain C5 genomic DNA into Streptomyces lividans 1326 by using the plasmid vector pIJ702. The gene encoding the small neutral proteinase (snpA) was located within a 2.6-kb BamHI-SstI restriction fragment that was partially sequenced. The molecular mass of the deduced amino acid sequence of the mature protein was determined to be 15,740, which corresponds very closely with the relative molecular mass of the purified protein (15,500) determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The N-terminal amino acid sequence of the purified neutral proteinase was determined, and the DNA encoding this sequence was found to be located within the sequenced DNA. The deduced amino acid sequence contains a conserved zinc binding site, although secondary ligand binding and active sites typical of thermolysinlike metalloproteinases are absent. The combination of its small size, deduced amino acid sequence, and substrate and inhibition profile indicate that snpA encodes a novel neutral proteinase. Images PMID:1569011

  20. In silico evidence for sequence-dependent nucleosome sliding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lequieu, Joshua; Schwartz, David C.; de Pablo, Juan J.

    Nucleosomes represent the basic building block of chromatin and provide an important mechanism by which cellular processes are controlled. The locations of nucleosomes across the genome are not random but instead depend on both the underlying DNA sequence and the dynamic action of other proteins within the nucleus. These processes are central to cellular function, and the molecular details of the interplay between DNA sequence and nudeosome dynamics remain poorly understood. In this work, we investigate this interplay in detail by relying on a molecular model, which permits development of a comprehensive picture of the underlying free energy surfaces andmore » the corresponding dynamics of nudeosome repositioning. The mechanism of nudeosome repositioning is shown to be strongly linked to DNA sequence and directly related to the binding energy of a given DNA sequence to the histone core. It is also demonstrated that chromatin remodelers can override DNA-sequence preferences by exerting torque, and the histone H4 tail is then identified as a key component by which DNA-sequence, histone modifications, and chromatin remodelers could in fact be coupled.« less

  1. A cDNA from a mouse pancreatic beta cell encoding a putative transcription factor of the insulin gene.

    PubMed Central

    Walker, M D; Park, C W; Rosen, A; Aronheim, A

    1990-01-01

    Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401

  2. Organization and evolution of highly repeated satellite DNA sequences in plant chromosomes.

    PubMed

    Sharma, S; Raina, S N

    2005-01-01

    A major component of the plant nuclear genome is constituted by different classes of repetitive DNA sequences. The structural, functional and evolutionary aspects of the satellite repetitive DNA families, and their organization in the chromosomes is reviewed. The tandem satellite DNA sequences exhibit characteristic chromosomal locations, usually at subtelomeric and centromeric regions. The repetitive DNA family(ies) may be widely distributed in a taxonomic family or a genus, or may be specific for a species, genome or even a chromosome. They may acquire large-scale variations in their sequence and copy number over an evolutionary time-scale. These features have formed the basis of extensive utilization of repetitive sequences for taxonomic and phylogenetic studies. Hybrid polyploids have especially proven to be excellent models for studying the evolution of repetitive DNA sequences. Recent studies explicitly show that some repetitive DNA families localized at the telomeres and centromeres have acquired important structural and functional significance. The repetitive elements are under different evolutionary constraints as compared to the genes. Satellite DNA families are thought to arise de novo as a consequence of molecular mechanisms such as unequal crossing over, rolling circle amplification, replication slippage and mutation that constitute "molecular drive". Copyright 2005 S. Karger AG, Basel.

  3. DNA Barcoding in Fragaria L. (Strawberry) Species

    USDA-ARS?s Scientific Manuscript database

    DNA barcoding for species identification using a short DNA sequence has been successful in animals due to rapid mutation rates of the mitochondrial genome where the animal DNA barocode, cytochrome c oxidase 1 gene is located. The chloroplast PsbA-trnH spacer and the nuclear ribosomal internal transc...

  4. Fluorescent in situ hybridisation to amphioxus chromosomes.

    PubMed

    Castro, Luis Filipe Costa; Holland, Peter William Harold

    2002-12-01

    We describe an efficient protocol for mapping genes and other DNA sequences to amphioxus chromosomes using fluorescent in situ hybridisation. We apply this method to identify the number and location of ribosomal DNA gene clusters and telomere sequences in metaphase spreads of Branchiostoma floridae. We also describe how the locations of two single copy genes can be mapped relative to each other, and demonstrate this by mapping an amphioxus Pax gene relative to a homologue of the Notch gene. These methods have great potential for performing comparative genomics between amphioxus and vertebrates.

  5. DNA Barcodes for Forensically Important Fly Species in Brazil.

    PubMed

    Koroiva, Ricardo; de Souza, Mirian S; Roque, Fabio de Oliveira; Pepinelli, Mateus

    2018-04-07

    Here, we analyze 248 DNA barcode sequences of 35 fly species of forensic importance in Brazil. DNA barcoding can be effectively used for specimen identification of these species, allowing the unambiguous identification of 31 species, an overall success rate of 88%. Our results show a high rate of success for molecular identification using DNA barcoding sequences and open new perspectives for immature species identification, a subject on which limited forensic investigations exist in Tropical regions. We also address the implications of building a robust forensic DNA barcode database. A geographic bias is recognized for the COI dataset available for forensically important fly species in Brazil, with concentration of sequences from specimens collected mainly in sites located in the Cerrado, Mata Atlântica, and Pampa biomes.

  6. Leaf margin phenotype-specific restriction-site-associated DNA-derived markers for pineapple (Ananas comosus L.)

    PubMed Central

    Urasaki, Naoya; Goeku, Satoko; Kaneshima, Risa; Takamine, Tomonori; Tarora, Kazuhiko; Takeuchi, Makoto; Moromizato, Chie; Yonamine, Kaname; Hosaka, Fumiko; Terakami, Shingo; Matsumura, Hideo; Yamamoto, Toshiya; Shoda, Moriyuki

    2015-01-01

    To explore genome-wide DNA polymorphisms and identify DNA markers for leaf margin phenotypes, a restriction-site-associated DNA sequencing analysis was employed to analyze three bulked DNAs of F1 progeny from a cross between a ‘piping-leaf-type’ cultivar, ‘Yugafu’, and a ‘spiny-tip-leaf-type’ variety, ‘Yonekura’. The parents were both Ananas comosus var. comosus. From the analysis, piping-leaf and spiny-tip-leaf gene-specific restriction-site-associated DNA sequencing tags were obtained and designated as PLSTs and STLSTs, respectively. The five PLSTs and two STSLTs were successfully converted to cleaved amplified polymorphic sequence (CAPS) or simple sequence repeat (SSR) markers using the sequence differences between alleles. Based on the genotyping of the F1 with two SSR and three CAPS markers, the five PLST markers were mapped in the vicinity of the P locus, with the closest marker, PLST1_SSR, being located 1.5 cM from the P locus. The two CAPS markers from STLST1 and STLST3 perfectly assessed the ‘spiny-leaf type’ as homozygotes of the recessive s allele of the S gene. The recombination value between the S locus and STLST loci was 2.4, and STLSTs were located 2.2 cM from the S locus. SSR and CAPS markers are applicable to marker-assisted selection of leaf margin phenotypes in pineapple breeding. PMID:26175625

  7. Leaf margin phenotype-specific restriction-site-associated DNA-derived markers for pineapple (Ananas comosus L.).

    PubMed

    Urasaki, Naoya; Goeku, Satoko; Kaneshima, Risa; Takamine, Tomonori; Tarora, Kazuhiko; Takeuchi, Makoto; Moromizato, Chie; Yonamine, Kaname; Hosaka, Fumiko; Terakami, Shingo; Matsumura, Hideo; Yamamoto, Toshiya; Shoda, Moriyuki

    2015-06-01

    To explore genome-wide DNA polymorphisms and identify DNA markers for leaf margin phenotypes, a restriction-site-associated DNA sequencing analysis was employed to analyze three bulked DNAs of F1 progeny from a cross between a 'piping-leaf-type' cultivar, 'Yugafu', and a 'spiny-tip-leaf-type' variety, 'Yonekura'. The parents were both Ananas comosus var. comosus. From the analysis, piping-leaf and spiny-tip-leaf gene-specific restriction-site-associated DNA sequencing tags were obtained and designated as PLSTs and STLSTs, respectively. The five PLSTs and two STSLTs were successfully converted to cleaved amplified polymorphic sequence (CAPS) or simple sequence repeat (SSR) markers using the sequence differences between alleles. Based on the genotyping of the F1 with two SSR and three CAPS markers, the five PLST markers were mapped in the vicinity of the P locus, with the closest marker, PLST1_SSR, being located 1.5 cM from the P locus. The two CAPS markers from STLST1 and STLST3 perfectly assessed the 'spiny-leaf type' as homozygotes of the recessive s allele of the S gene. The recombination value between the S locus and STLST loci was 2.4, and STLSTs were located 2.2 cM from the S locus. SSR and CAPS markers are applicable to marker-assisted selection of leaf margin phenotypes in pineapple breeding.

  8. Measuring DNA hybridization using fluorescent DNA-stabilized silver clusters to investigate mismatch effects on therapeutic oligonucleotides.

    PubMed

    de Bruin, Donny; Bossert, Nelli; Aartsma-Rus, Annemieke; Bouwmeester, Dirk

    2018-04-06

    Short nucleic acid oligomers have found a wide range of applications in experimental physics, biology and medicine, and show potential for the treatment of acquired and genetic diseases. These applications rely heavily on the predictability of hybridization through Watson-Crick base pairing to allow positioning on a nanometer scale, as well as binding to the target transcripts, but also off-target binding to transcripts with partial homology. These effects are of particular importance in the development of therapeutic oligonucleotides, where off-target effects caused by the binding of mismatched sequences need to be avoided. We employ a novel method of probing DNA hybridization using optically active DNA-stabilized silver clusters (Ag-DNA) to measure binding efficiencies through a change in fluorescence intensity. In this way we can determine their location-specific sensitivity to individual mismatches in the sequence. The results reveal a strong dependence of the hybridization on the location of the mismatch, whereby mismatches close to the edges and center show a relatively minor impact. In parallel, we propose a simple model for calculating the annealing ratios of mismatched DNA sequences, which supports our experimental results. The primary result shown in this work is a demonstration of a novel technique to measure DNA hybridization using fluorescent Ag-DNA. With this technique, we investigated the effect of mismatches on the hybridization efficiency, and found a significant dependence on the location of individual mismatches. These effects are strongly influenced by the length of the used oligonucleotides. The novel probe method based on fluorescent Ag-DNA functions as a reliable tool in measuring this behavior. As a secondary result, we formulated a simple model that is consistent with the experimental data.

  9. Molecular characterization of the canine mitochondrial DNA control region for forensic applications.

    PubMed

    Eichmann, Cordula; Parson, Walther

    2007-09-01

    The canine mitochondrial DNA (mtDNA) control region of 133 dogs living in the area around Innsbruck, Austria was sequenced. A total of 40 polymorphic sites were observed in the first hypervariable segment and 15 in the second, which resulted in the differentiation of 40 distinct haplotypes. We observed five nucleotide positions that were highly polymorphic within different haplogroups, and they represent good candidates for mtDNA screening. We found five point heteroplasmic positions; all located in HVS-I and a polythymine region in HVS-II, the latter often being associated with length heteroplasmy. In contrast to human mtDNA, the canine control region contains a hypervariable 10 nucleotide repeat region, which is located between the two hypervariable regions. In our population sample, we observed eight different repeat types, which we characterized by direct sequencing and fragment length analysis. The discrimination power of the canine mtDNA control region was 0.93, not taking the polymorphic repeat region into consideration.

  10. A computer aided thermodynamic approach for predicting the formation of Z-DNA in naturally occurring sequences

    NASA Technical Reports Server (NTRS)

    Ho, P. S.; Ellison, M. J.; Quigley, G. J.; Rich, A.

    1986-01-01

    The ease with which a particular DNA segment adopts the left-handed Z-conformation depends largely on the sequence and on the degree of negative supercoiling to which it is subjected. We describe a computer program (Z-hunt) that is designed to search long sequences of naturally occurring DNA and retrieve those nucleotide combinations of up to 24 bp in length which show a strong propensity for Z-DNA formation. Incorporated into Z-hunt is a statistical mechanical model based on empirically determined energetic parameters for the B to Z transition accumulated to date. The Z-forming potential of a sequence is assessed by ranking its behavior as a function of negative superhelicity relative to the behavior of similar sized randomly generated nucleotide sequences assembled from over 80,000 combinations. The program makes it possible to compare directly the Z-forming potential of sequences with different base compositions and different sequence lengths. Using Z-hunt, we have analyzed the DNA sequences of the bacteriophage phi X174, plasmid pBR322, the animal virus SV40 and the replicative form of the eukaryotic adenovirus-2. The results are compared with those previously obtained by others from experiments designed to locate Z-DNA forming regions in these sequences using probes which show specificity for the left-handed DNA conformation.

  11. Cytogenetic Analysis of Populus trichocarpa - Ribosomal DNA, Telomere Repeat Sequence, and Marker-selected BACs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tuskan, Gerald A; Gunter, Lee E; DiFazio, Stephen P

    The 18S-28S rDNA and 5S rDNA loci in Populus trichocarpa were localized using fluorescent in situ hybridization (FISH). Two 18S-28S rDNA sites and one 5S rDNA site were identified and located at the ends of 3 different chromosomes. FISH signals from the Arabidopsis -type telomere repeat sequence were observed at the distal ends of each chromosome. Six BAC clones selected from 2 linkage groups based on genome sequence assembly (LG-I and LG-VI) were localized on 2 chromosomes, as expected. BACs from LG-I hybridized to the longest chromosome in the complement. All BAC positions were found to be concordant with sequencemore » assembly positions. BAC-FISH will be useful for delineating each of the Populus trichocarpa chromosomes and improving the sequence assembly of this model angiosperm tree species.« less

  12. [Study of alpha-satellite DNA in cosmid libraries, specific for chromosomes 13, 21, and 22, using fluorescence in situ hybridization].

    PubMed

    Solov'ev, I V; Iurov, Iu B; Vorsanova, S G; Marcais, B; Rogaev, E I; Kapanadze, B I; Brodianskiĭ, V M; Iankovskiĭ, N K; Roizes, G

    1998-11-01

    Fluorescent in situ hybridization (FISH) was employed in mapping the alpha-satellite DNA that was revealed in the cosmid libraries specific for human chromosomes 13, 21, and 22. In total, 131 clones were revealed. They contained various elements of centromeric alphoid DNA sequences of acrocentric chromosomes, including those located close to SINEs, LINEs, and classical satellite sequences. The heterochromatin of acrocentric chromosomes was shown to contain two different groups of alphoid sequences: (1) those immediately adjacent to the centromeric regions (alpha 13-1, alpha 21-1, and alpha 22-1 loci) and (2) those located in the short arm of acrocentric chromosomes (alpha 13-2, alpha 21-2, and alpha 22-2 loci). Alphoid DNA sequences from the alpha 13-2, alpha 21-2, and alpha 22-2 loci are apparently not involved in the formation of centromeres and are absent from mitotically stable marker chromosomes with a deleted short arm. Robertsonian translocations t(13q; 21q) and t(14q; 22q), and chromosome 21p-. The heterochromatic regions of chromosomes 13, 21, and 22 were also shown to contain relatively chromosome-specific repetitive sequences of various alphoid DNA families, whose numerous copies occur in other chromosomes. Pools of centromeric alphoid cosmids can be of use in further studies of the structural and functional properties of heterochromatic DNA and the identification of centromeric sequences. Moreover, these clones can be employed in high-resolution mapping and in sequencing the heterochromatic regions of the human genome. The detailed FISH analysis of numerous alphoid cosmid clones allowed the identification of several new, highly specific DNA probes of molecular cytogenetic studies--in particular, the interphase and metaphase analyses of chromosomes 2, 9, 11, 14, 15, 16, 18, 20, 21-13, 22-14, and X.

  13. Molecular simulations of polycation-DNA binding exploring the effect of peptide chemistry and sequence in nuclear localization sequence based polycations.

    PubMed

    Elder, Robert M; Jayaraman, Arthi

    2013-10-10

    Gene therapy relies on the delivery of DNA into cells, and polycations are one class of vectors enabling efficient DNA delivery. Nuclear localization sequences (NLS), cationic oligopeptides that target molecules for nuclear entry, can be incorporated into polycations to improve their gene delivery efficiency. We use simulations to study the effect of peptide chemistry and sequence on the DNA-binding behavior of NLS-grafted polycations by systematically mutating the residues in the grafts, which are based on the SV40 NLS (peptide sequence PKKKRKV). Replacing arginine (R) with lysine (K) reduces binding strength by eliminating arginine-DNA interactions, but placing R in a less hindered location (e.g., farther from the grafting point to the polycation backbone) has surprisingly little effect on polycation-DNA binding strength. Changing the positions of the hydrophobic proline (P) and valine (V) residues relative to the polycation backbone changes hydrophobic aggregation within the polycation and, consequently, changes the conformational entropy loss that occurs upon polycation-DNA binding. Since conformational entropy loss affects the free energy of binding, the positions of P and V in the grafts affect DNA binding affinity. The insight from this work guides synthesis of polycations with tailored DNA binding affinity and, in turn, efficient DNA delivery.

  14. Co-located hAT transposable element and 5S rDNA in an interstitial telomeric sequence suggest the formation of Robertsonian fusion in armored catfish.

    PubMed

    Glugoski, Larissa; Giuliano-Caetano, Lucia; Moreira-Filho, Orlando; Vicari, Marcelo R; Nogaroto, Viviane

    2018-04-15

    Co-located 5S rDNA genes and interstitial telomeric sites (ITS) revealed the involvement of multiple 5S rDNA clusters in chromosome rearrangements of Loricariidae. Interstitial (TTAGGG)n vestiges, in addition to telomeric sites, can coincide with locations of chromosomal rearrangements, and they are considered to be hotspots for chromosome breaks. This study aimed the molecular characterization of 5S rDNA in two Rineloricaria latirostris populations and examination of roles of 5S rDNA in breakpoint sites and its in situ localization. Rineloricaria latirostris from Brazil's Das Pedras river (2n = 46 chromosomes) presented five pairs identified using a 5S rDNA probe, in addition to a pair bearing a co-located ITS/5S rDNA. Rineloricaria latirostris from the Piumhi river (2n = 48 chromosomes) revealed two pairs containing 5S rDNA, without ITS. A 702-bp amplified sequence, using 5S rDNA primers, revealed an insertion of the hAT transposable element (TE), referred to as a degenerate 5S rDNA. Double-FISH (fluorescence in situ hybridization) demonstrated co-localization of 5S rDNA/degenerate 5S rDNA, 5S rDNA/hAT and ITS/5S rDNA from the Das Pedras river population. Piumhi river isolates possessed only 5S rDNA sites. We suggest that the degenerate 5S rDNA was generated by unequal crossing over, which was driven by invasion of hAT, establishing a breakpoint region susceptible to chromosome breakage, non-homologous recombination and Robertsonian (Rb) fusion. Furthermore, the presence of clusters of 5S rDNA at fusion points in other armored catfish species suggests its re-use and that these regions represent hotspots for evolutionary rearrangements within Loricariidae genomes. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Studies of Xenopus laevis mitochondrial DNA: D-loop mapping and characterization of DNA-binding proteins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cairns, S.S.

    1987-01-01

    In X. laevis oocytes, mitochondrial DNA accumulates to 10/sup 5/ times the somatic cell complement, and is characterized by a high frequency of a triple-stranded displacement hoop structure at the origin of replication. To map the termini of the single strands, it was necessary to correct the nucleotide sequence of the D-loop region. The revised sequence of 2458 nucleotides contains 54 discrepancies in comparison to a previously published sequence. Radiolabeling of the nascent strands of the D-loop structure either at the 5' end or at the 3' end identifies a major species with a length of 1670 nucleotides. Cleavage ofmore » the 5' labeled strands reveals two families of ends located near several matches to an element, designated CSB-1, that is conserved in this location in several vertebrate genomes. Cleavage of 3' labeled strands produced one fragment. The unique 3' end maps to about 15 nucleotides preceding the tRNA/sup Pro/ gene. A search for proteins which may bind to mtDNA in this region to regulate nucleic acid synthesis has identified three activities in lysates of X. laevis mitochondria. The DNA-binding proteins were assayed by monitoring their ability to retard the migration of labeled double- or single-stranded DNA fragments in polyacrylamide gels. The DNA binding preference was determined by competition with an excess of either ds- or ssDNA.« less

  16. DNA sequence analysis of ARS elements from chromosome III of Saccharomyces cerevisiae: identification of a new conserved sequence.

    PubMed Central

    Palzkill, T G; Oliver, S G; Newlon, C S

    1986-01-01

    Four fragments of Saccharomyces cerevisiae chromosome III DNA which carry ARS elements have been sequenced. Each fragment contains multiple copies of sequences that have at least 10 out of 11 bases of homology to a previously reported 11 bp core consensus sequence. A survey of these new ARS sequences and previously reported sequences revealed the presence of an additional 11 bp conserved element located on the 3' side of the T-rich strand of the core consensus. Subcloning analysis as well as deletion and transposon insertion mutagenesis of ARS fragments support a role for 3' conserved sequence in promoting ARS activity. PMID:3529036

  17. Image Encryption Algorithm Based on Hyperchaotic Maps and Nucleotide Sequences Database

    PubMed Central

    2017-01-01

    Image encryption technology is one of the main means to ensure the safety of image information. Using the characteristics of chaos, such as randomness, regularity, ergodicity, and initial value sensitiveness, combined with the unique space conformation of DNA molecules and their unique information storage and processing ability, an efficient method for image encryption based on the chaos theory and a DNA sequence database is proposed. In this paper, digital image encryption employs a process of transforming the image pixel gray value by using chaotic sequence scrambling image pixel location and establishing superchaotic mapping, which maps quaternary sequences and DNA sequences, and by combining with the logic of the transformation between DNA sequences. The bases are replaced under the displaced rules by using DNA coding in a certain number of iterations that are based on the enhanced quaternary hyperchaotic sequence; the sequence is generated by Chen chaos. The cipher feedback mode and chaos iteration are employed in the encryption process to enhance the confusion and diffusion properties of the algorithm. Theoretical analysis and experimental results show that the proposed scheme not only demonstrates excellent encryption but also effectively resists chosen-plaintext attack, statistical attack, and differential attack. PMID:28392799

  18. Isolation of centromeric-tandem repetitive DNA sequences by chromatin affinity purification using a HaloTag7-fused centromere-specific histone H3 in tobacco.

    PubMed

    Nagaki, Kiyotaka; Shibata, Fukashi; Kanatani, Asaka; Kashihara, Kazunari; Murata, Minoru

    2012-04-01

    The centromere is a multi-functional complex comprising centromeric DNA and a number of proteins. To isolate unidentified centromeric DNA sequences, centromere-specific histone H3 variants (CENH3) and chromatin immunoprecipitation (ChIP) have been utilized in some plant species. However, anti-CENH3 antibody for ChIP must be raised in each species because of its species specificity. Production of the antibodies is time-consuming and costly, and it is not easy to produce ChIP-grade antibodies. In this study, we applied a HaloTag7-based chromatin affinity purification system to isolate centromeric DNA sequences in tobacco. This system required no specific antibody, and made it possible to apply a highly stringent wash to remove contaminated DNA. As a result, we succeeded in isolating five tandem repetitive DNA sequences in addition to the centromeric retrotransposons that were previously identified by ChIP. Three of the tandem repeats were centromere-specific sequences located on different chromosomes. These results confirm the validity of the HaloTag7-based chromatin affinity purification system as an alternative method to ChIP for isolating unknown centromeric DNA sequences. The discovery of more than two chromosome-specific centromeric DNA sequences indicates the mosaic structure of tobacco centromeres. © Springer-Verlag 2011

  19. DNA barcoding Indian freshwater fishes.

    PubMed

    Lakra, Wazir Singh; Singh, M; Goswami, Mukunda; Gopalakrishnan, A; Lal, K K; Mohindra, V; Sarkar, U K; Punia, P P; Singh, K V; Bhatt, J P; Ayyappan, S

    2016-11-01

    DNA barcoding is a promising technique for species identification using a short mitochondrial DNA sequence of cytochrome c oxidase I (COI) gene. In the present study, DNA barcodes were generated from 72 species of freshwater fish covering the Orders Cypriniformes, Siluriformes, Perciformes, Synbranchiformes, and Osteoglossiformes representing 50 genera and 19 families. All the samples were collected from diverse sites except the species endemic to a particular location. Species were represented by multiple specimens in the great majority of the barcoded species. A total of 284 COI sequences were generated. After amplification and sequencing of 700 base pair fragment of COI, primers were trimmed which invariably generated a 655 base pair barcode sequence. The average Kimura two-parameter (K2P) distances within-species, genera, families, and orders were 0.40%, 9.60%, 13.10%, and 17.16%, respectively. DNA barcode discriminated congeneric species without any confusion. The study strongly validated the efficiency of COI as an ideal marker for DNA barcoding of Indian freshwater fishes.

  20. Amplification of the major satellite DNA family (FA-SAT) in a cat fibrosarcoma might be related to chromosomal instability.

    PubMed

    Santos, Sara; Chaves, Raquel; Adega, Filomena; Bastos, Estela; Guedes-Pinto, Henrique

    2006-01-01

    Most mammalian chromosomes have satellite DNA sequences located at or near the centromeres, organized in arrays of variable size and higher order structure. The implications of these specific repetitive DNA sequences and their organization for centromere function are still quite cloudy. In contrast to most mammalian species, the domestic cat seems to have the major satellite DNA family (FA-SAT) localized primarily at the telomeres and secondarily at the centromeres of the chromosomes. In the present work, we analyzed chromosome preparations from a fibrosarcoma, in comparison with nontumor cells (epithelial tissue) from the same individual, by in situ hybridization of the FA-SAT cat satellite DNA family. This repetitive sequence was found to be amplified in the cat tumor chromosomes analyzed. The amplification of these satellite DNA sequences in the cat chromosomes with variable number and appearance (marker chromosomes) is discussed and might be related to mitotic instability, which could explain the exhibition of complex patterns of chromosome aberrations detected in the fibrosarcoma analyzed.

  1. Location of the unique integration site on an Escherichia coli chromosome by bacteriophage lambda DNA in vivo.

    PubMed

    Tal, Asaf; Arbel-Goren, Rinat; Costantino, Nina; Court, Donald L; Stavans, Joel

    2014-05-20

    The search for specific sequences on long genomes is a key process in many biological contexts. How can specific target sequences be located with high efficiency, within physiologically relevant times? We addressed this question for viral integration, a fundamental mechanism of horizontal gene transfer driving prokaryotic evolution, using the infection of Escherichia coli bacteria with bacteriophage λ and following the establishment of a lysogenic state. Following the targeting process in individual live E. coli cells in real time revealed that λ DNA remains confined near the entry point of a cell following infection. The encounter between the 15-bp-long target sequence on the chromosome and the recombination site on the viral genome is facilitated by the directed motion of bacterial DNA generated during chromosome replication, in conjunction with constrained diffusion of phage DNA. Moving the native bacterial integration site to different locations on the genome and measuring the integration frequency in these strains reveals that the frequencies of the native site and a site symmetric to it relative to the origin are similar, whereas both are significantly higher than when the integration site is moved near the terminus, consistent with the replication-driven mechanism we propose. This novel search mechanism is yet another example of the exquisite coevolution of λ with its host.

  2. Mechanism of duplex DNA destabilization by RNA-guided Cas9 nuclease during target interrogation

    PubMed Central

    Mekler, Vladimir; Minakhin, Leonid; Severinov, Konstantin

    2017-01-01

    The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9 (Cas9) endonuclease cleaves double-stranded DNA sequences specified by guide RNA molecules and flanked by a protospacer adjacent motif (PAM) and is widely used for genome editing in various organisms. The RNA-programmed Cas9 locates the target site by scanning genomic DNA. We sought to elucidate the mechanism of initial DNA interrogation steps that precede the pairing of target DNA with guide RNA. Using fluorometric and biochemical assays, we studied Cas9/guide RNA complexes with model DNA substrates that mimicked early intermediates on the pathway to the final Cas9/guide RNA–DNA complex. The results show that Cas9/guide RNA binding to PAM favors separation of a few PAM-proximal protospacer base pairs allowing initial target interrogation by guide RNA. The duplex destabilization is mediated, in part, by Cas9/guide RNA affinity for unpaired segments of nontarget strand DNA close to PAM. Furthermore, our data indicate that the entry of double-stranded DNA beyond a short threshold distance from PAM into the Cas9/single-guide RNA (sgRNA) interior is hindered. We suggest that the interactions unfavorable for duplex DNA binding promote DNA bending in the PAM-proximal region during early steps of Cas9/guide RNA–DNA complex formation, thus additionally destabilizing the protospacer duplex. The mechanism that emerges from our analysis explains how the Cas9/sgRNA complex is able to locate the correct target sequence efficiently while interrogating numerous nontarget sequences associated with correct PAMs. PMID:28484024

  3. Mechanism of duplex DNA destabilization by RNA-guided Cas9 nuclease during target interrogation.

    PubMed

    Mekler, Vladimir; Minakhin, Leonid; Severinov, Konstantin

    2017-05-23

    The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9 (Cas9) endonuclease cleaves double-stranded DNA sequences specified by guide RNA molecules and flanked by a protospacer adjacent motif (PAM) and is widely used for genome editing in various organisms. The RNA-programmed Cas9 locates the target site by scanning genomic DNA. We sought to elucidate the mechanism of initial DNA interrogation steps that precede the pairing of target DNA with guide RNA. Using fluorometric and biochemical assays, we studied Cas9/guide RNA complexes with model DNA substrates that mimicked early intermediates on the pathway to the final Cas9/guide RNA-DNA complex. The results show that Cas9/guide RNA binding to PAM favors separation of a few PAM-proximal protospacer base pairs allowing initial target interrogation by guide RNA. The duplex destabilization is mediated, in part, by Cas9/guide RNA affinity for unpaired segments of nontarget strand DNA close to PAM. Furthermore, our data indicate that the entry of double-stranded DNA beyond a short threshold distance from PAM into the Cas9/single-guide RNA (sgRNA) interior is hindered. We suggest that the interactions unfavorable for duplex DNA binding promote DNA bending in the PAM-proximal region during early steps of Cas9/guide RNA-DNA complex formation, thus additionally destabilizing the protospacer duplex. The mechanism that emerges from our analysis explains how the Cas9/sgRNA complex is able to locate the correct target sequence efficiently while interrogating numerous nontarget sequences associated with correct PAMs.

  4. DNA lability induced by nimustine and ramustine in rat glioma cells.

    PubMed Central

    Mineura, K; Fushimi, S; Itoh, Y; Kowada, M

    1988-01-01

    The DNA labile sites induced by two nitrosoureas, nimustine (ACNU) and ramustine (MCNU) synthesised in Japan, have been examined in highly reiterated DNA sequences of rat glioma cells. Reiterated fragments of 167 and 203 base pairs (bp), obtained after Hind III and Hae III restriction endonuclease digestion of rat glioma cells DNA, were used as target DNA sequences to determine the labile sites. In vitro reaction with ACNU and MCNU resulted in scission products corresponding to the locations of guanine. Subsequent piperidine hydrolysis produced more frequent breaks of the phosphodiester bonds at guanine positions, thus forming alkali-labile sites. Images PMID:3236017

  5. Extensive structural variations between mitochondrial genomes of CMS and normal peppers (Capsicum annuum L.) revealed by complete nucleotide sequencing.

    PubMed

    Jo, Yeong Deuk; Choi, Yoomi; Kim, Dong-Hwan; Kim, Byung-Dong; Kang, Byoung-Cheorl

    2014-07-04

    Cytoplasmic male sterility (CMS) is an inability to produce functional pollen that is caused by mutation of the mitochondrial genome. Comparative analyses of mitochondrial genomes of lines with and without CMS in several species have revealed structural differences between genomes, including extensive rearrangements caused by recombination. However, the mitochondrial genome structure and the DNA rearrangements that may be related to CMS have not been characterized in Capsicum spp. We obtained the complete mitochondrial genome sequences of the pepper CMS line FS4401 (507,452 bp) and the fertile line Jeju (511,530 bp). Comparative analysis between mitochondrial genomes of peppers and tobacco that are included in Solanaceae revealed extensive DNA rearrangements and poor conservation in non-coding DNA. In comparison between pepper lines, FS4401 and Jeju mitochondrial DNAs contained the same complement of protein coding genes except for one additional copy of an atp6 gene (ψatp6-2) in FS4401. In terms of genome structure, we found eighteen syntenic blocks in the two mitochondrial genomes, which have been rearranged in each genome. By contrast, sequences between syntenic blocks, which were specific to each line, accounted for 30,380 and 17,847 bp in FS4401 and Jeju, respectively. The previously-reported CMS candidate genes, orf507 and ψatp6-2, were located on the edges of the largest sequence segments that were specific to FS4401. In this region, large number of small sequence segments which were absent or found on different locations in Jeju mitochondrial genome were combined together. The incorporation of repeats and overlapping of connected sequence segments by a few nucleotides implied that extensive rearrangements by homologous recombination might be involved in evolution of this region. Further analysis using mtDNA pairs from other plant species revealed common features of DNA regions around CMS-associated genes. Although large portion of sequence context was shared by mitochondrial genomes of CMS and male-fertile pepper lines, extensive genome rearrangements were detected. CMS candidate genes located on the edges of highly-rearranged CMS-specific DNA regions and near to repeat sequences. These characteristics were detected among CMS-associated genes in other species, implying a common mechanism might be involved in the evolution of CMS-associated genes.

  6. SP-Designer: a user-friendly program for designing species-specific primer pairs from DNA sequence alignments.

    PubMed

    Villard, Pierre; Malausa, Thibaut

    2013-07-01

    SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php. © 2013 John Wiley & Sons Ltd.

  7. The TGA codons are present in the open reading frame of selenoprotein P cDNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hill, K.E.; Lloyd, R.S.; Read, R.

    1991-03-11

    The TGA codon in DNA has been shown to direct incorporation of selenocysteine into protein. Several proteins from bacteria and animals contain selenocysteine in their primary structures. Each of the cDNA clones of these selenoproteins contains one TGA codon in the open reading frame which corresponds to the selenocysteine in the protein. A cDNA clone for selenoprotein P (SeP), obtained from a {gamma}ZAP rat liver library, was sequenced by the dideoxy termination method. The correct reading frame was determined by comparison of the deduced amino acid sequence with the amino acid sequence of several peptides from SeP. Using SeP labelledmore » with {sup 75}Se in vivo, the selenocysteine content of the peptides was verified by the collection of carboxymethylated {sup 77}Se-selenocysteine as it eluted from the amino acid analyzer and determination of the radioactivity contained in the collected samples. Ten TGA codons are present in the open reading frame of the cDNA. Peptide fragmentation studies and the deduced sequence indicate that selenium-rich regions are located close to the carboxy terminus. Nine of the 10 selenocysteines are located in the terminal 26% of the sequence with four in the terminal 15 amino acids. The deduced sequence codes for a protein of 385 amino acids. Cleavage of the signal peptide gives the mature protein with 366 amino acids and a calculated mol wt of 41,052 Da. Searches of PIR and SWISSPROT protein databases revealed no similarity with glutathione peroxidase or other selenoproteins.« less

  8. Genetic diversity of Burkholderia (Proteobacteria) species from the Caatinga and Atlantic rainforest biomes in Bahia, Brazil.

    PubMed

    Santini, A C; Santos, H R M; Gross, E; Corrêa, R X

    2013-03-11

    The genus Burkholderia (β-Proteobacteria) currently comprises more than 60 species, including parasites, symbionts and free-living organisms. Several new species of Burkholderia have recently been described showing a great diversity of phenotypes. We examined the diversity of Burkholderia spp in environmental samples collected from Caatinga and Atlantic rainforest biomes of Bahia, Brazil. Legume nodules were collected from five locations, and 16S rDNA and recA genes of the isolated microorganisms were analyzed. Thirty-three contigs of 16S rRNA genes and four contigs of the recA gene related to the genus Burkholderia were obtained. The genetic dissimilarity of the strains ranged from 0 to 2.5% based on 16S rDNA analysis, indicating two main branches: one distinct branch of the dendrogram for the B. cepacia complex and another branch that rendered three major groups, partially reflecting host plants and locations. A dendrogram designed with sequences of this research and those designed with sequences of Burkholderia-type strains and the first hit BLAST had similar topologies. A dendrogram similar to that constructed by analysis of 16S rDNA was obtained using sequences of the fragment of the recA gene. The 16S rDNA sequences enabled sufficient identification of relevant similarities and groupings amongst isolates and the sequences that we obtained. Only 6 of the 33 isolates analyzed via 16S rDNA sequencing showed high similarity with the B. cepacia complex. Thus, over 3/4 of the isolates have potential for biotechnological applications.

  9. A simple method for semi-random DNA amplicon fragmentation using the methylation-dependent restriction enzyme MspJI.

    PubMed

    Shinozuka, Hiroshi; Cogan, Noel O I; Shinozuka, Maiko; Marshall, Alexis; Kay, Pippa; Lin, Yi-Han; Spangenberg, German C; Forster, John W

    2015-04-11

    Fragmentation at random nucleotide locations is an essential process for preparation of DNA libraries to be used on massively parallel short-read DNA sequencing platforms. Although instruments for physical shearing, such as the Covaris S2 focused-ultrasonicator system, and products for enzymatic shearing, such as the Nextera technology and NEBNext dsDNA Fragmentase kit, are commercially available, a simple and inexpensive method is desirable for high-throughput sequencing library preparation. MspJI is a recently characterised restriction enzyme which recognises the sequence motif CNNR (where R = G or A) when the first base is modified to 5-methylcytosine or 5-hydroxymethylcytosine. A semi-random enzymatic DNA amplicon fragmentation method was developed based on the unique cleavage properties of MspJI. In this method, random incorporation of 5-methyl-2'-deoxycytidine-5'-triphosphate is achieved through DNA amplification with DNA polymerase, followed by DNA digestion with MspJI. Due to the recognition sequence of the enzyme, DNA amplicons are fragmented in a relatively sequence-independent manner. The size range of the resulting fragments was capable of control through optimisation of 5-methyl-2'-deoxycytidine-5'-triphosphate concentration in the reaction mixture. A library suitable for sequencing using the Illumina MiSeq platform was prepared and processed using the proposed method. Alignment of generated short reads to a reference sequence demonstrated a relatively high level of random fragmentation. The proposed method may be performed with standard laboratory equipment. Although the uniformity of coverage was slightly inferior to the Covaris physical shearing procedure, due to efficiencies of cost and labour, the method may be more suitable than existing approaches for implementation in large-scale sequencing activities, such as bacterial artificial chromosome (BAC)-based genome sequence assembly, pan-genomic studies and locus-targeted genotyping-by-sequencing.

  10. Identifying sites of replication initiation in yeast chromosomes: looking for origins in all the right places.

    PubMed

    van Brabant, A J; Hunt, S Y; Fangman, W L; Brewer, B J

    1998-06-01

    DNA fragments that contain an active origin of replication generate bubble-shaped replication intermediates with diverging forks. We describe two methods that use two-dimensional (2-D) agarose gel electrophoresis along with DNA sequence information to identify replication origins in natural and artificial Saccharomyces cerevisiae chromosomes. The first method uses 2-D gels of overlapping DNA fragments to locate an active chromosomal replication origin within a region known to confer autonomous replication on a plasmid. A variant form of 2-D gels can be used to determine the direction of fork movement, and the second method uses this technique to find restriction fragments that are replicated by diverging forks, indicating that a bidirectional replication origin is located between the two fragments. Either of these two methods can be applied to the analysis of any genomic region for which there is DNA sequence information or an adequate restriction map.

  11. Functional specificity of a Hox protein mediated by the recognition of minor groove structure.

    PubMed

    Joshi, Rohit; Passner, Jonathan M; Rohs, Remo; Jain, Rinku; Sosinsky, Alona; Crickmore, Michael A; Jacob, Vinitha; Aggarwal, Aneel K; Honig, Barry; Mann, Richard S

    2007-11-02

    The recognition of specific DNA-binding sites by transcription factors is a critical yet poorly understood step in the control of gene expression. Members of the Hox family of transcription factors bind DNA by making nearly identical major groove contacts via the recognition helices of their homeodomains. In vivo specificity, however, often depends on extended and unstructured regions that link Hox homeodomains to a DNA-bound cofactor, Extradenticle (Exd). Using a combination of structure determination, computational analysis, and in vitro and in vivo assays, we show that Hox proteins recognize specific Hox-Exd binding sites via residues located in these extended regions that insert into the minor groove but only when presented with the correct DNA sequence. Our results suggest that these residues, which are conserved in a paralog-specific manner, confer specificity by recognizing a sequence-dependent DNA structure instead of directly reading a specific DNA sequence.

  12. Porcine parvovirus: DNA sequence and genome organization.

    PubMed

    Ranz, A I; Manclús, J J; Díaz-Aroca, E; Casal, J I

    1989-10-01

    We have determined the nucleotide sequence of an almost full-length clone of porcine parvovirus (PPV). The sequence is 4973 nucleotides (nt) long. The 3' end of virion DNA shows a Y-shaped configuration homologous to rodent parvoviruses. The 5' end of virion DNA shows a repetition of 127 nt at the carboxy terminus of the capsid proteins. The overall organization of the PPV genome is similar to those of other autonomous parvoviruses. There are two large open reading frames (ORFs) that almost entirely cover the genome, both located in the same frame of the complementary strand. The left ORF encodes the non-structural protein NS1 and the right ORF encodes the capsid proteins (VP1, VP2 and VP3). Promoter analysis, location of splicing sites and putative amino acid sequences for the viral proteins show a high homology of PPV with feline panleukopenia virus and canine parvoviruses (FPV and CPV) and rodent parvovirus. Therefore we conclude that PPV is related to the Kilham rat virus (KRV) group of autonomous parvoviruses formed by KRV, minute virus of mice, Lu III, H-1, FPV and CPV.

  13. DNA sequence analysis of the photosynthesis region of Rhodobacter sphaeroides 2.4.1.

    PubMed

    Choudhary, M; Kaplan, S

    2000-02-15

    This paper describes the DNA sequence of the photosynthesis region of Rhodobacter sphaeroides 2.4.1 (T). The photosynthesis gene cluster is located within a approximately 73 kb Ase I genomic DNA fragment containing the puf, puhA, cycA and puc operons. A total of 65 open reading frames (ORFs) have been identified, of which 61 showed significant similarity to genes/proteins of other organisms while only four did not reveal any significant sequence similarity to any gene/protein sequences in the database. The data were compared with the corresponding genes/ORFs from a different strain of R.sphaeroides and Rhodobacter capsulatus, a close relative of R. sphaeroides. A detailed analysis of the gene organization in the photosynthesis region revealed a similar gene order in both species with some notable differences located to the pucBAC = cycA region. In addition, photosynthesis gene regulatory protein (PpsR, FNR, IHF) binding motifs in upstream sequences of a number of photosynthesis genes have been identified and shown to differ between these two species. The difference in gene organization relative to pucBAC and cycA suggests that this region originated independently of the photosynthesis gene cluster of R.sphaeroides.

  14. DNA breaks and end resection measured genome-wide by end sequencing | Center for Cancer Research

    Cancer.gov

    About the Cover The cover depicts a ribbon of DNA portrayed as a city skyline. The central gap in the landscape localizes to the precise site of the DNA break. The features surrounding the break denote the processing of DNA-end structures (end-resection) emanating from the break location. Cover artwork by Ethan Tyler, NIH. Abstract

  15. Tolerance of DNA Mismatches in Dmc1 Recombinase-mediated DNA Strand Exchange.

    PubMed

    Borgogno, María V; Monti, Mariela R; Zhao, Weixing; Sung, Patrick; Argaraña, Carlos E; Pezza, Roberto J

    2016-03-04

    Recombination between homologous chromosomes is required for the faithful meiotic segregation of chromosomes and leads to the generation of genetic diversity. The conserved meiosis-specific Dmc1 recombinase catalyzes homologous recombination triggered by DNA double strand breaks through the exchange of parental DNA sequences. Although providing an efficient rate of DNA strand exchange between polymorphic alleles, Dmc1 must also guard against recombination between divergent sequences. How DNA mismatches affect Dmc1-mediated DNA strand exchange is not understood. We have used fluorescence resonance energy transfer to study the mechanism of Dmc1-mediated strand exchange between DNA oligonucleotides with different degrees of heterology. The efficiency of strand exchange is highly sensitive to the location, type, and distribution of mismatches. Mismatches near the 3' end of the initiating DNA strand have a small effect, whereas most mismatches near the 5' end impede strand exchange dramatically. The Hop2-Mnd1 protein complex stimulates Dmc1-catalyzed strand exchange on homologous DNA or containing a single mismatch. We observed that Dmc1 can reject divergent DNA sequences while bypassing a few mismatches in the DNA sequence. Our findings have important implications in understanding meiotic recombination. First, Dmc1 acts as an initial barrier for heterologous recombination, with the mismatch repair system providing a second level of proofreading, to ensure that ectopic sequences are not recombined. Second, Dmc1 stepping over infrequent mismatches is likely critical for allowing recombination between the polymorphic sequences of homologous chromosomes, thus contributing to gene conversion and genetic diversity. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Tolerance of DNA Mismatches in Dmc1 Recombinase-mediated DNA Strand Exchange*

    PubMed Central

    Borgogno, María V.; Monti, Mariela R.; Zhao, Weixing; Sung, Patrick; Argaraña, Carlos E.; Pezza, Roberto J.

    2016-01-01

    Recombination between homologous chromosomes is required for the faithful meiotic segregation of chromosomes and leads to the generation of genetic diversity. The conserved meiosis-specific Dmc1 recombinase catalyzes homologous recombination triggered by DNA double strand breaks through the exchange of parental DNA sequences. Although providing an efficient rate of DNA strand exchange between polymorphic alleles, Dmc1 must also guard against recombination between divergent sequences. How DNA mismatches affect Dmc1-mediated DNA strand exchange is not understood. We have used fluorescence resonance energy transfer to study the mechanism of Dmc1-mediated strand exchange between DNA oligonucleotides with different degrees of heterology. The efficiency of strand exchange is highly sensitive to the location, type, and distribution of mismatches. Mismatches near the 3′ end of the initiating DNA strand have a small effect, whereas most mismatches near the 5′ end impede strand exchange dramatically. The Hop2-Mnd1 protein complex stimulates Dmc1-catalyzed strand exchange on homologous DNA or containing a single mismatch. We observed that Dmc1 can reject divergent DNA sequences while bypassing a few mismatches in the DNA sequence. Our findings have important implications in understanding meiotic recombination. First, Dmc1 acts as an initial barrier for heterologous recombination, with the mismatch repair system providing a second level of proofreading, to ensure that ectopic sequences are not recombined. Second, Dmc1 stepping over infrequent mismatches is likely critical for allowing recombination between the polymorphic sequences of homologous chromosomes, thus contributing to gene conversion and genetic diversity. PMID:26709229

  17. LINE-1 retrotransposons: from 'parasite' sequences to functional elements.

    PubMed

    Paço, Ana; Adega, Filomena; Chaves, Raquel

    2015-02-01

    Long interspersed nuclear elements-1 (LINE-1) are the most abundant and active retrotransposons in the mammalian genomes. Traditionally, the occurrence of LINE-1 sequences in the genome of mammals has been explained by the selfish DNA hypothesis. Nevertheless, recently, it has also been argued that these sequences could play important roles in these genomes, as in the regulation of gene expression, genome modelling and X-chromosome inactivation. The non-random chromosomal distribution is a striking feature of these retroelements that somehow reflects its functionality. In the present study, we have isolated and analysed a fraction of the open reading frame 2 (ORF2) LINE-1 sequence from three rodent species, Cricetus cricetus, Peromyscus eremicus and Praomys tullbergi. Physical mapping of the isolated sequences revealed an interspersed longitudinal AT pattern of distribution along all the chromosomes of the complement in the three genomes. A detailed analysis shows that these sequences are preferentially located in the euchromatic regions, although some signals could be detected in the heterochromatin. In addition, a coincidence between the location of imprinted gene regions (as Xist and Tsix gene regions) and the LINE-1 retroelements was also observed. According to these results, we propose an involvement of LINE-1 sequences in different genomic events as gene imprinting, X-chromosome inactivation and evolution of repetitive sequences located at the heterochromatic regions (e.g. satellite DNA sequences) of the rodents' genomes analysed.

  18. FA-SAT Is an Old Satellite DNA Frozen in Several Bilateria Genomes

    PubMed Central

    Chaves, Raquel; Ferreira, Daniela; Mendes-da-Silva, Ana; Meles, Susana; Adega, Filomena

    2017-01-01

    Abstract In recent years, a growing body of evidence has recognized the tandem repeat sequences, and specifically satellite DNA, as a functional class of sequences in the genomic “dark matter.” Using an original, complementary, and thus an eclectic experimental design, we show that the cat archetypal satellite DNA sequence, FA-SAT, is “frozen” conservatively in several Bilateria genomes. We found different genomic FA-SAT architectures, and the interspersion pattern was conserved. In Carnivora genomes, the FA-SAT-related sequences are also amplified, with the predominance of a specific FA-SAT variant, at the heterochromatic regions. We inspected the cat genome project to locate FA-SAT array flanking regions and revealed an intensive intermingling with transposable elements. Our results also show that FA-SAT-related sequences are transcribed and that the most abundant FA-SAT variant is not always the most transcribed. We thus conclude that the DNA sequences of FA-SAT and their transcripts are “frozen” in these genomes. Future work is needed to disclose any putative function that these sequences may play in these genomes. PMID:29608678

  19. Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.

    1988-08-01

    The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end ofmore » the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.« less

  20. Factor IX[sub Madrid 2]: A deletion/insertion in Facotr IX gene which abolishes the sequence of the donor junction at the exon IV-intron d splice site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Solera, J.; Magallon, M.; Martin-Villar, J.

    1992-02-01

    DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends ofmore » the deleted DNA fragment.« less

  1. The site-specific ribosomal insertion element type II of Bombyx mori (R2Bm) contains the coding sequence for a reverse transcriptase-like enzyme.

    PubMed Central

    Burke, W D; Calalang, C C; Eickbush, T H

    1987-01-01

    Two classes of DNA elements interrupt a fraction of the rRNA repeats of Bombyx mori. We have analyzed by genomic blotting and sequence analysis one class of these elements which we have named R2. These elements occupy approximately 9% of the rDNA units of B. mori and appear to be homologous to the type II rDNA insertions detected in Drosophila melanogaster. Approximately 25 copies of R2 exist within the B. mori genome, of which at least 20 are located at a precise location within otherwise typical rDNA units. Nucleotide sequence analysis has revealed that the 4.2-kilobase-pair R2 element has a single large open reading frame, occupying over 82% of the total length of the element. The central region of this 1,151-amino-acid open reading frame shows homology to the reverse transcriptase enzymes found in retroviruses and certain transposable elements. Amino acid homology of this region is highest to the mobile line 1 elements of mammals, followed by the mitochondrial type II introns of fungi, and the pol gene of retroviruses. Less homology exists with transposable elements of D. melanogaster and Saccharomyces cerevisiae. Two additional regions of sequence homology between L1 and R2 elements were also found outside the reverse transcriptase region. We suggest that the R2 elements are retrotransposons that are site specific in their insertion into the genome. Such mobility would enable these elements to occupy a small fraction of the rDNA units of B. mori despite their continual elimination from the rDNA locus by sequence turnover. Images PMID:2439905

  2. Genome-wide mapping of nuclear mitochondrial DNA sequences links DNA replication origins to chromosomal double-strand break formation in Schizosaccharomyces pombe

    PubMed Central

    Lenglez, Sandrine; Hermand, Damien; Decottignies, Anabelle

    2010-01-01

    Chromosomal double-strand breaks (DSBs) threaten genome integrity and repair of these lesions is often mutagenic. How and where DSBs are formed is a major question conveniently addressed in simple model organisms like yeast. NUMTs, nuclear DNA sequences of mitochondrial origin, are present in most eukaryotic genomes and probably result from the capture of mitochondrial DNA (mtDNA) fragments into chromosomal breaks. NUMT formation is ongoing and was reported to cause de novo human genetic diseases. Study of NUMTs is likely to contribute to the understanding of naturally occurring chromosomal breaks. We show that Schizosaccharomyces pombe NUMTs are exclusively located in noncoding regions with no preference for gene promoters and, when located into promoters, do not affect gene transcription level. Strikingly, most noncoding regions comprising NUMTs are also associated with a DNA replication origin (ORI). Chromatin immunoprecipitation experiments revealed that chromosomal NUMTs are probably not acting as ORI on their own but that mtDNA insertions occurred directly next to ORIs, suggesting that these loci may be prone to DSB formation. Accordingly, induction of excessive DNA replication origin firing, a phenomenon often associated with human tumor formation, resulted in frequent nucleotide deletion events within ORI3001 subtelomeric chromosomal locus, illustrating a novel aspect of DNA replication-driven genomic instability. How mtDNA is fragmented is another important issue that we addressed by sequencing experimentally induced NUMTs. This highlighted regions of S. pombe mtDNA prone to breaking. Together with an analysis of human NUMTs, we propose that these fragile sites in mtDNA may correspond to replication pause sites. PMID:20688779

  3. Biosynthesis of Lipoic Acid in Arabidopsis: Cloning and Characterization of the cDNA for Lipoic Acid Synthase1

    PubMed Central

    Yasuno, Rie; Wada, Hajime

    1998-01-01

    Lipoic acid is a coenzyme that is essential for the activity of enzyme complexes such as those of pyruvate dehydrogenase and glycine decarboxylase. We report here the isolation and characterization of LIP1 cDNA for lipoic acid synthase of Arabidopsis. The Arabidopsis LIP1 cDNA was isolated using an expressed sequence tag homologous to the lipoic acid synthase of Escherichia coli. This cDNA was shown to code for Arabidopsis lipoic acid synthase by its ability to complement a lipA mutant of E. coli defective in lipoic acid synthase. DNA-sequence analysis of the LIP1 cDNA revealed an open reading frame predicting a protein of 374 amino acids. Comparisons of the deduced amino acid sequence with those of E. coli and yeast lipoic acid synthase homologs showed a high degree of sequence similarity and the presence of a leader sequence presumably required for import into the mitochondria. Southern-hybridization analysis suggested that LIP1 is a single-copy gene in Arabidopsis. Western analysis with an antibody against lipoic acid synthase demonstrated that this enzyme is located in the mitochondrial compartment in Arabidopsis cells as a 43-kD polypeptide. PMID:9808738

  4. Type III restriction-modification enzymes: a historical perspective.

    PubMed

    Rao, Desirazu N; Dryden, David T F; Bheemanaik, Shivakumara

    2014-01-01

    Restriction endonucleases interact with DNA at specific sites leading to cleavage of DNA. Bacterial DNA is protected from restriction endonuclease cleavage by modifying the DNA using a DNA methyltransferase. Based on their molecular structure, sequence recognition, cleavage position and cofactor requirements, restriction-modification (R-M) systems are classified into four groups. Type III R-M enzymes need to interact with two separate unmethylated DNA sequences in inversely repeated head-to-head orientations for efficient cleavage to occur at a defined location (25-27 bp downstream of one of the recognition sites). Like the Type I R-M enzymes, Type III R-M enzymes possess a sequence-specific ATPase activity for DNA cleavage. ATP hydrolysis is required for the long-distance communication between the sites before cleavage. Different models, based on 1D diffusion and/or 3D-DNA looping, exist to explain how the long-distance interaction between the two recognition sites takes place. Type III R-M systems are found in most sequenced bacteria. Genome sequencing of many pathogenic bacteria also shows the presence of a number of phase-variable Type III R-M systems, which play a role in virulence. A growing number of these enzymes are being subjected to biochemical and genetic studies, which, when combined with ongoing structural analyses, promise to provide details for mechanisms of DNA recognition and catalysis.

  5. Innovative Methods for Integrating Knowledge for Long-Term Monitoring of Contaminated Groundwater Sites: Understanding Microorganism Communities and their Associated Hydrochemical Environment

    NASA Astrophysics Data System (ADS)

    Mouser, P. J.; Rizzo, D. M.; Druschel, G.; O'Grady, P.; Stevens, L.

    2005-12-01

    This interdisciplinary study integrates hydrochemical and genome-based data to estimate the redox processes occurring at long-term monitoring sites. Groundwater samples have been collected from a well-characterized landfill-leachate contaminated aquifer in northeastern New York. Primers from the 16S rDNA gene were used to amplify Bacteria and Archaea in groundwater taken from monitoring wells located in clean, fringe, and contaminated locations within the aquifer. PCR-amplified rDNA were digested with restriction enzymes to evaluate terminal restriction fragment length polymorphism (T-RFLP) community profiles. The rDNA was cloned, sequenced, and partial sequences were matched against known organisms using the NCBI Blast database. Phylogenetic trees and bootstrapping were used to identify classifications of organisms and compare the communities from clean, fringe, and contaminated locations. We used Artificial Neural Network (ANN) models to incorporate microbial data with hydrochemical information for improving our understanding of subsurface processes.

  6. Molecular cloning and characterization of satellite DNA sequences from constitutive heterochromatin of the habu snake (Protobothrops flavoviridis, Viperidae) and the Burmese python (Python bivittatus, Pythonidae).

    PubMed

    Matsubara, Kazumi; Uno, Yoshinobu; Srikulnath, Kornsorn; Seki, Risako; Nishida, Chizuko; Matsuda, Yoichi

    2015-12-01

    Highly repetitive DNA sequences of the centromeric heterochromatin provide valuable molecular cytogenetic markers for the investigation of genomic compartmentalization in the macrochromosomes and microchromosomes of sauropsids. Here, the relationship between centromeric heterochromatin and karyotype evolution was examined using cloned repetitive DNA sequences from two snake species, the habu snake (Protobothrops flavoviridis, Crotalinae, Viperidae) and Burmese python (Python bivittatus, Pythonidae). Three satellite DNA (stDNA) families were isolated from the heterochromatin of these snakes: 168-bp PFL-MspI from P. flavoviridis and 196-bp PBI-DdeI and 174-bp PBI-MspI from P. bivittatus. The PFL-MspI and PBI-DdeI sequences were localized to the centromeric regions of most chromosomes in the respective species, suggesting that the two sequences were the major components of the centromeric heterochromatin in these organisms. The PBI-MspI sequence was localized to the pericentromeric region of four chromosome pairs. The PFL-MspI and the PBI-DdeI sequences were conserved only in the genome of closely related species, Gloydius blomhoffii (Crotalinae) and Python molurus, respectively, although their locations on the chromosomes were slightly different. In contrast, the PBI-MspI sequence was also in the genomes of P. molurus and Boa constrictor (Boidae), and additionally localized to the centromeric regions of eight chromosome pairs in B. constrictor, suggesting that this sequence originated in the genome of a common ancestor of Pythonidae and Boidae, approximately 86 million years ago. The three stDNA sequences showed no genomic compartmentalization between the macrochromosomes and microchromosomes, suggesting that homogenization of the centromeric and/or pericentromeric stDNA sequences occurred in the macrochromosomes and microchromosomes of these snakes.

  7. Fine structure of the 21S ribosomal RNA region on yeast mitochondrial DNA. III. Physical location of mitochondrial genetic markers and the molecular nature of omega.

    PubMed

    Heyting, C; Menke, H H

    1979-01-11

    1. We have determined the physical location of mitochondrial genetic markers in the 21S region of yeast mtDNA by genetic analysis of petite mutants whose mtDNA has been physically mapped on the wild-type mtDNA. 2. The order of loci, determined in this study, is in agreement with the order deduced from recombination analysis and coretention analysis except for the position of omega+: we conclude that omega+ is located between C321 (RIB-1) and E514 (RIB-3). 3. The marker E514 (RIB-3) has been localized on a DNA segment of 3800 bp, and the markers E354, E553 and cs23 (RIB-2) on a DNA segment of 1100 base pairs; both these segments overlap the 21S rRNA cistron. The marker C321 (RIB-1) has been localized within a segment of 240 bp which also overlaps the 21S rRNA cistron, and we infer on the basis of indirect evidence that this marker lies within this cistron. 4. In all our rho+ as well as rho- strains there is a one-to-one correlation between the omega+ phenotype, the ability to transmit the omega+ allele and the presence of a mtDNA segment of about 1000 bp long, located between sequences specifying RIB-3 and sequences corresponding to the loci RIB-1 and RIB-2. This segment may be inserted at this same position into omega- mtDNA by recombination. 5. The role which the different allelic forms of omega may play in the polarity of recombination is discussed.

  8. Informative priors based on transcription factor structural class improve de novo motif discovery.

    PubMed

    Narlikar, Leelavati; Gordân, Raluca; Ohler, Uwe; Hartemink, Alexander J

    2006-07-15

    An important problem in molecular biology is to identify the locations at which a transcription factor (TF) binds to DNA, given a set of DNA sequences believed to be bound by that TF. In previous work, we showed that information in the DNA sequence of a binding site is sufficient to predict the structural class of the TF that binds it. In particular, this suggests that we can predict which locations in any DNA sequence are more likely to be bound by certain classes of TFs than others. Here, we argue that traditional methods for de novo motif finding can be significantly improved by adopting an informative prior probability that a TF binding site occurs at each sequence location. To demonstrate the utility of such an approach, we present priority, a powerful new de novo motif finding algorithm. Using data from TRANSFAC, we train three classifiers to recognize binding sites of basic leucine zipper, forkhead, and basic helix loop helix TFs. These classifiers are used to equip priority with three class-specific priors, in addition to a default prior to handle TFs of other classes. We apply priority and a number of popular motif finding programs to sets of yeast intergenic regions that are reported by ChIP-chip to be bound by particular TFs. priority identifies motifs the other methods fail to identify, and correctly predicts the structural class of the TF recognizing the identified binding sites. Supplementary material and code can be found at http://www.cs.duke.edu/~amink/.

  9. A novel class of plant-specific zinc-dependent DNA-binding protein that binds to A/T-rich DNA sequences

    PubMed Central

    Nagano, Yukio; Furuhashi, Hirofumi; Inaba, Takehito; Sasaki, Yukiko

    2001-01-01

    Complementary DNA encoding a DNA-binding protein, designated PLATZ1 (plant AT-rich sequence- and zinc-binding protein 1), was isolated from peas. The amino acid sequence of the protein is similar to those of other uncharacterized proteins predicted from the genome sequences of higher plants. However, no paralogous sequences have been found outside the plant kingdom. Multiple alignments among these paralogous proteins show that several cysteine and histidine residues are invariant, suggesting that these proteins are a novel class of zinc-dependent DNA-binding proteins with two distantly located regions, C-x2-H-x11-C-x2-C-x(4–5)-C-x2-C-x(3–7)-H-x2-H and C-x2-C-x(10–11)-C-x3-C. In an electrophoretic mobility shift assay, the zinc chelator 1,10-o-phenanthroline inhibited DNA binding, and two distant zinc-binding regions were required for DNA binding. A protein blot with 65ZnCl2 showed that both regions are required for zinc-binding activity. The PLATZ1 protein non-specifically binds to A/T-rich sequences, including the upstream region of the pea GTPase pra2 and plastocyanin petE genes. Expression of the PLATZ1 repressed those of the reporter constructs containing the coding sequence of luciferase gene driven by the cauliflower mosaic virus (CaMV) 35S90 promoter fused to the tandem repeat of the A/T-rich sequences. These results indicate that PLATZ1 is a novel class of plant-specific zinc-dependent DNA-binding protein responsible for A/T-rich sequence-mediated transcriptional repression. PMID:11600698

  10. Xenopus origin recognition complex (ORC) initiates DNA replication preferentially at sequences targeted by Schizosaccharomyces pombe ORC

    PubMed Central

    Kong, Daochun; Coleman, Thomas R.; DePamphilis, Melvin L.

    2003-01-01

    Budding yeast (Saccharomyces cerevisiae) origin recognition complex (ORC) requires ATP to bind specific DNA sequences, whereas fission yeast (Schizosaccharomyces pombe) ORC binds to specific, asymmetric A:T-rich sites within replication origins, independently of ATP, and frog (Xenopus laevis) ORC seems to bind DNA non-specifically. Here we show that despite these differences, ORCs are functionally conserved. Firstly, SpOrc1, SpOrc4 and SpOrc5, like those from other eukaryotes, bound ATP and exhibited ATPase activity, suggesting that ATP is required for pre-replication complex (pre-RC) assembly rather than origin specificity. Secondly, SpOrc4, which is solely responsible for binding SpORC to DNA, inhibited up to 70% of XlORC-dependent DNA replication in Xenopus egg extract by preventing XlORC from binding to chromatin and assembling pre-RCs. Chromatin-bound SpOrc4 was located at AT-rich sequences. XlORC in egg extract bound preferentially to asymmetric A:T-sequences in either bare DNA or in sperm chromatin, and it recruited XlCdc6 and XlMcm proteins to these sequences. These results reveal that XlORC initiates DNA replication preferentially at the same or similar sites to those targeted in S.pombe. PMID:12840006

  11. Molecular cloning and analysis of Schizosaccharomyces pombe Reb1p: sequence-specific recognition of two sites in the far upstream rDNA intergenic spacer.

    PubMed Central

    Zhao, A; Guo, A; Liu, Z; Pape, L

    1997-01-01

    The coding sequences for a Schizosaccharomyces pombe sequence-specific DNA binding protein, Reb1p, have been cloned. The predicted S. pombe Reb1p is 24-29% identical to mouse TTF-1 (transcription termination factor-1) and Saccharomyces cerevisiae REB1 protein, both of which direct termination of RNA polymerase I catalyzed transcripts. The S.pombe Reb1 cDNA encodes a predicted polypeptide of 504 amino acids with a predicted molecular weight of 58.4 kDa. The S. pombe Reb1p is unusual in that the bipartite DNA binding motif identified originally in S.cerevisiae and Klyveromyces lactis REB1 proteins is uninterrupted and thus S.pombe Reb1p may contain the smallest natural REB1 homologous DNA binding domain. Its genomic coding sequences were shown to be interrupted by two introns. A recombinant histidine-tagged Reb1 protein bearing the rDNA binding domain has two homologous, sequence-specific binding sites in the S. pomber DNA intergenic spacer, located between 289 and 480 nt downstream of the end of the approximately 25S rRNA coding sequences. Each binding site is 13-14 bp downstream of two of the three proposed in vivo termination sites. The core of this 17 bp site, AGGTAAGGGTAATGCAC, is specifically protected by Reb1p in footprinting analysis. PMID:9016645

  12. Transposon-like properties of the major, long repetitive sequence family in the genome of Physarum polycephalum

    PubMed Central

    Pearston, Douglas H.; Gordon, Mairi; Hardman, Norman

    1985-01-01

    A family of long, highly-repetitive sequences, referred to previously as `HpaII-repeats', dominates the genome of the eukaryotic slime mould Physarum polycephalum. These sequences are found exclusively in scrambled clusters. They account for about one-half of the total complement of repetitive DNA in Physarum, and represent the major sequence component found in hypermethylated, 20-50 kb segments of Physarum genomic DNA that fail to be cleaved using the restriction endonuclease HpaII. The structure of this abundant repetitive element was investigated by analysing cloned segments derived from the hypermethylated genomic DNA compartment. We show that the `HpaII-repeat' forms part of a larger repetitive DNA structure, ∼8.6 kb in length, with several structural features in common with recognised eukaryotic transposable genetic elements. Scrambled clusters of the sequence probably arise as a result of transposition-like events, during which the element preferentially recombines in either orientation with target sites located in other copies of the same repeated sequence. The target sites for transposition/recombination are not related in sequence but in all cases studied they are potentially capable of promoting the formation of small `cruciforms' or `Z-DNA' structures which might be recognised during the recombination process. ImagesFig. 3.Fig. 4. PMID:16453652

  13. Chaotic Image Encryption Algorithm Based on Bit Permutation and Dynamic DNA Encoding.

    PubMed

    Zhang, Xuncai; Han, Feng; Niu, Ying

    2017-01-01

    With the help of the fact that chaos is sensitive to initial conditions and pseudorandomness, combined with the spatial configurations in the DNA molecule's inherent and unique information processing ability, a novel image encryption algorithm based on bit permutation and dynamic DNA encoding is proposed here. The algorithm first uses Keccak to calculate the hash value for a given DNA sequence as the initial value of a chaotic map; second, it uses a chaotic sequence to scramble the image pixel locations, and the butterfly network is used to implement the bit permutation. Then, the image is coded into a DNA matrix dynamic, and an algebraic operation is performed with the DNA sequence to realize the substitution of the pixels, which further improves the security of the encryption. Finally, the confusion and diffusion properties of the algorithm are further enhanced by the operation of the DNA sequence and the ciphertext feedback. The results of the experiment and security analysis show that the algorithm not only has a large key space and strong sensitivity to the key but can also effectively resist attack operations such as statistical analysis and exhaustive analysis.

  14. Chaotic Image Encryption Algorithm Based on Bit Permutation and Dynamic DNA Encoding

    PubMed Central

    2017-01-01

    With the help of the fact that chaos is sensitive to initial conditions and pseudorandomness, combined with the spatial configurations in the DNA molecule's inherent and unique information processing ability, a novel image encryption algorithm based on bit permutation and dynamic DNA encoding is proposed here. The algorithm first uses Keccak to calculate the hash value for a given DNA sequence as the initial value of a chaotic map; second, it uses a chaotic sequence to scramble the image pixel locations, and the butterfly network is used to implement the bit permutation. Then, the image is coded into a DNA matrix dynamic, and an algebraic operation is performed with the DNA sequence to realize the substitution of the pixels, which further improves the security of the encryption. Finally, the confusion and diffusion properties of the algorithm are further enhanced by the operation of the DNA sequence and the ciphertext feedback. The results of the experiment and security analysis show that the algorithm not only has a large key space and strong sensitivity to the key but can also effectively resist attack operations such as statistical analysis and exhaustive analysis. PMID:28912802

  15. Two-color, 30 second microwave-accelerated Metal-Enhanced Fluorescence DNA assays: a new Rapid Catch and Signal (RCS) technology.

    PubMed

    Dragan, Anatoliy I; Golberg, Karina; Elbaz, Amit; Marks, Robert; Zhang, Yongxia; Geddes, Chris D

    2011-03-07

    For analyses of DNA fragment sequences in solution we introduce a 2-color DNA assay, utilizing a combination of the Metal-Enhanced Fluorescence (MEF) effect and microwave-accelerated DNA hybridization. The assay is based on a new "Catch and Signal" technology, i.e. the simultaneous specific recognition of two target DNA sequences in one well by complementary anchor-ssDNAs, attached to silver island films (SiFs). It is shown that fluorescent labels (Alexa 488 and Alexa 594), covalently attached to ssDNA fragments, play the role of biosensor recognition probes, demonstrating strong response upon DNA hybridization, locating fluorophores in close proximity to silver NPs, which is ideal for MEF. Subsequently the emission dramatically increases, while the excited state lifetime decreases. It is also shown that 30s microwave irradiation of wells, containing DNA molecules, considerably (~1000-fold) speeds up the highly selective hybridization of DNA fragments at ambient temperature. The 2-color "Catch and Signal" DNA assay platform can radically expedite quantitative analysis of genome DNA sequences, creating a simple and fast bio-medical platform for nucleic acid analysis. Copyright © 2010 Elsevier B.V. All rights reserved.

  16. Fragile sites, dysfunctional telomere and chromosome fusions: What is 5S rDNA role?

    PubMed

    Barros, Alain Victor; Wolski, Michele Andressa Vier; Nogaroto, Viviane; Almeida, Mara Cristina; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo

    2017-04-15

    Repetitive DNA regions are known as fragile chromosomal sites which present a high flexibility and low stability. Our focus was characterize fragile sites in 5S rDNA regions. The Ancistrus sp. species shows a diploid number of 50 and an indicative Robertsonian fusion at chromosomal pair 1. Two sequences of 5S rDNA were identified: 5S.1 rDNA and 5S.2 rDNA. The first sequence gathers the necessary structures to gene expression and shows a functional secondary structure prediction. Otherwise, the 5S.2 rDNA sequence does not contain the upstream sequences that are required to expression, furthermore its structure prediction reveals a nonfunctional ribosomal RNA. The chromosomal mapping revealed several 5S.1 and 5S.2 rDNA clusters. In addition, the 5S.2 rDNA clusters were found in acrocentric and metacentric chromosomes proximal regions. The pair 1 5S.2 rDNA cluster is co-located with interstitial telomeric sites (ITS). Our results indicate that its clusters are hotspots to chromosomal breaks. During the meiotic prophase bouquet arrangement, double strand breaks (DSBs) at proximal 5S.2 rDNA of acrocentric chromosomes could lead to homologous and non-homologous repair mechanisms as Robertsonian fusions. Still, ITS sites provides chromosomal instability, resulting in telomeric recombination via TRF2 shelterin protein and a series of breakage-fusion-bridge cycles. Our proposal is that 5S rDNA derived sequences, act as chromosomal fragile sites in association with some chromosomal rearrangements of Loricariidae. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. The wheat cytochrome oxidase subunit II gene has an intron insert and three radical amino acid changes relative to maize

    PubMed Central

    Bonen, Linda; Boer, Poppo H.; Gray, Michael W.

    1984-01-01

    We have determined the sequence of the wheat mitochondrial gene for cytochrome oxidase subunit II (COII) and find that its derived protein sequence differs from that of maize at only three amino acid positions. Unexpectedly, all three replacements are non-conservative ones. The wheat COII gene has a highly-conserved intron at the same position as in maize, but the wheat intron is 1.5 times longer because of an insert relative to its maize counterpart. Hybridization analysis of mitochondrial DNA from rye, pea, broad bean and cucumber indicates strong sequence conservation of COII coding sequences among all these higher plants. However, only rye and maize mitochondrial DNA show homology with wheat COII intron sequences and rye alone with intron-insert sequences. We find that a sequence identical to the region of the 5' exon corresponding to the transmembrane domain of the COII protein is present at a second genomic location in wheat mitochondria. These variations in COII gene structure and size, as well as the presence of repeated COII sequences, illustrate at the DNA sequence level, factors which contribute to higher plant mitochondrial DNA diversity and complexity. ImagesFig. 3.Fig. 4.Fig. 5. PMID:16453565

  18. Identification and chromosome mapping of repetitive elements in the Astyanax scabripinnis (Teleostei: Characidae) species complex.

    PubMed

    Barbosa, Patrícia; de Oliveira, Luiz Antonio; Pucci, Marcela Baer; Santos, Mateus Henrique; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo; Nogaroto, Viviane; de Almeida, Mara Cristina; Artoni, Roberto Ferreira

    2015-02-01

    Most part of the eukaryotic genome is composed of repeated sequences or multiple copies of DNA, which were considered as "junk DNA", and may be associated to the heterochromatin. In this study, three populations of Astyanax aff. scabripinnis from Brazilian rivers of Guaratinguetá and Pindamonhangaba (São Paulo) and a population from Maringá (Paraná) were analyzed concerning the localization of the nucleolar organizer regions (Ag-NORs), the As51 satellite DNA, the 18S ribosomal DNA (rDNA), and the 5S rDNA. Repeated sequences were also isolated and identified by the Cot - 1 method, which indicated similarity (90%) with the LINE UnaL2 retrotransposon. The fluorescence in situ hybridization (FISH) showed the retrotransposon dispersed and more concentrated markers in centromeric and telomeric chromosomal regions. These sequences were co-localized and interspaced with 18S and 5S rDNA and As51, confirmed by fiber-FISH essay. The B chromosome found in these populations pointed to a conspicuous hybridization with LINE probe, which is also co-located in As51 sequences. The NORs were active at unique sites of a homologous pair in the three populations. There were no evidences that transposable elements and repetitive DNA had influence in the transcriptional regulation of ribosomal genes in our analyses.

  19. Organization of 5S rDNA in species of the fish Leporinus: two different genomic locations are characterized by distinct nontranscribed spacers.

    PubMed

    Martins, C; Galetti, P M

    2001-10-01

    To address understanding the organization of the 5S rRNA multigene family in the fish genome, the nucleotide sequence and organization array of 5S rDNA were investigated in the genus Leporinus, a representative freshwater fish group of South American fauna. PCR, subgenomic library screening, genomic blotting, fluorescence in situ hybridization, and DNA sequencing were employed in this study. Two arrays of 5S rDNA were identified for all species investigated, one consisting of monomeric repeat units of around 200 bp and another one with monomers of 900 bp. These 5S rDNA arrays were characterized by distinct NTS sequences (designated NTS-I and NTS-II for the 200- and 900-bp monomers, respectively); however, their coding sequences were nearly identical. The 5S rRNA genes were clustered in two chromosome loci, a major one corresponding to the NTS-I sites and a minor one corresponding to the NTS-II sites. The NTS-I sequence was variable among Leporinus spp., whereas the NTS-II was conserved among them and even in the related genus Schizodon. The distinct 5S rDNA arrays might characterize two 5S rRNA gene subfamilies that have been evolving independently in the genome.

  20. DNA sequence responsible for the amplification of adjacent genes.

    PubMed

    Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K

    1987-10-01

    A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.

  1. GRIM-Filter: Fast seed location filtering in DNA read mapping using processing-in-memory technologies.

    PubMed

    Kim, Jeremie S; Senol Cali, Damla; Xin, Hongyi; Lee, Donghyuk; Ghose, Saugata; Alser, Mohammed; Hassan, Hasan; Ergin, Oguz; Alkan, Can; Mutlu, Onur

    2018-05-09

    Seed location filtering is critical in DNA read mapping, a process where billions of DNA fragments (reads) sampled from a donor are mapped onto a reference genome to identify genomic variants of the donor. State-of-the-art read mappers 1) quickly generate possible mapping locations for seeds (i.e., smaller segments) within each read, 2) extract reference sequences at each of the mapping locations, and 3) check similarity between each read and its associated reference sequences with a computationally-expensive algorithm (i.e., sequence alignment) to determine the origin of the read. A seed location filter comes into play before alignment, discarding seed locations that alignment would deem a poor match. The ideal seed location filter would discard all poor match locations prior to alignment such that there is no wasted computation on unnecessary alignments. We propose a novel seed location filtering algorithm, GRIM-Filter, optimized to exploit 3D-stacked memory systems that integrate computation within a logic layer stacked under memory layers, to perform processing-in-memory (PIM). GRIM-Filter quickly filters seed locations by 1) introducing a new representation of coarse-grained segments of the reference genome, and 2) using massively-parallel in-memory operations to identify read presence within each coarse-grained segment. Our evaluations show that for a sequence alignment error tolerance of 0.05, GRIM-Filter 1) reduces the false negative rate of filtering by 5.59x-6.41x, and 2) provides an end-to-end read mapper speedup of 1.81x-3.65x, compared to a state-of-the-art read mapper employing the best previous seed location filtering algorithm. GRIM-Filter exploits 3D-stacked memory, which enables the efficient use of processing-in-memory, to overcome the memory bandwidth bottleneck in seed location filtering. We show that GRIM-Filter significantly improves the performance of a state-of-the-art read mapper. GRIM-Filter is a universal seed location filter that can be applied to any read mapper. We hope that our results provide inspiration for new works to design other bioinformatics algorithms that take advantage of emerging technologies and new processing paradigms, such as processing-in-memory using 3D-stacked memory devices.

  2. The kinetoplast DNA of the Australian trypanosome, Trypanosoma copemani, shares features with Trypanosoma cruzi and Trypanosoma lewisi.

    PubMed

    Botero, Adriana; Kapeller, Irit; Cooper, Crystal; Clode, Peta L; Shlomai, Joseph; Thompson, R C Andrew

    2018-05-17

    Kinetoplast DNA (kDNA) is the mitochondrial genome of trypanosomatids. It consists of a few dozen maxicircles and several thousand minicircles, all catenated topologically to form a two-dimensional DNA network. Minicircles are heterogeneous in size and sequence among species. They present one or several conserved regions that contain three highly conserved sequence blocks. CSB-1 (10 bp sequence) and CSB-2 (8 bp sequence) present lower interspecies homology, while CSB-3 (12 bp sequence) or the Universal Minicircle Sequence is conserved within most trypanosomatids. The Universal Minicircle Sequence is located at the replication origin of the minicircles, and is the binding site for the UMS binding protein, a protein involved in trypanosomatid survival and virulence. Here, we describe the structure and organisation of the kDNA of Trypanosoma copemani, a parasite that has been shown to infect mammalian cells and has been associated with the drastic decline of the endangered Australian marsupial, the woylie (Bettongia penicillata). Deep genomic sequencing showed that T. copemani presents two classes of minicircles that share sequence identity and organisation in the conserved sequence blocks with those of Trypanosoma cruzi and Trypanosoma lewisi. A 19,257 bp partial region of the maxicircle of T. copemani that contained the entire coding region was obtained. Comparative analysis of the T. copemani entire maxicircle coding region with the coding regions of T. cruzi and T. lewisi showed they share 71.05% and 71.28% identity, respectively. The shared features in the maxicircle/minicircle organisation and sequence between T. copemani and T. cruzi/T. lewisi suggest similarities in their process of kDNA replication, and are of significance in understanding the evolution of Australian trypanosomes. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  3. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing

    PubMed Central

    Eastman, Alexander W.; Yuan, Ze-Chun

    2015-01-01

    Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing projects. PMID:25653642

  4. A genomic landscape of mitochondrial DNA insertions in the pig nuclear genome provides evolutionary signatures of interspecies admixture.

    PubMed

    Schiavo, Giuseppina; Hoffmann, Orsolya Ivett; Ribani, Anisa; Utzeri, Valerio Joe; Ghionda, Marco Ciro; Bertolini, Francesca; Geraci, Claudia; Bovo, Samuele; Fontanesi, Luca

    2017-10-01

    Nuclear DNA sequences of mitochondrial origin (numts) are derived by insertion of mitochondrial DNA (mtDNA), into the nuclear genome. In this study, we provide, for the first time, a genome picture of numts inserted in the pig nuclear genome. The Sus scrofa reference nuclear genome (Sscrofa10.2) was aligned with circularized and consensus mtDNA sequences using LAST software. A total of 430 numt sequences that may represent 246 different numt integration events (57 numt regions determined by at least two numt sequences and 189 singletons) were identified, covering about 0.0078% of the nuclear genome. Numt integration events were correlated (0.99) to the chromosome length. The longest numt sequence (about 11 kbp) was located on SSC2. Six numts were sequenced and PCR amplified in pigs of European commercial and local pig breeds, of the Chinese Meishan breed and in European wild boars. Three of them were polymorphic for the presence or absence of the insertion. Surprisingly, the estimated age of insertion of two of the three polymorphic numts was more ancient than that of the speciation time of the Sus scrofa, supporting that these polymorphic sites were originated from interspecies admixture that contributed to shape the pig genome. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  5. Nuclear Mitochondrial DNA Activates Replication in Saccharomyces cerevisiae

    PubMed Central

    Chatre, Laurent; Ricchetti, Miria

    2011-01-01

    The nuclear genome of eukaryotes is colonized by DNA fragments of mitochondrial origin, called NUMTs. These insertions have been associated with a variety of germ-line diseases in humans. The significance of this uptake of potentially dangerous sequences into the nuclear genome is unclear. Here we provide functional evidence that sequences of mitochondrial origin promote nuclear DNA replication in Saccharomyces cerevisiae. We show that NUMTs are rich in key autonomously replicating sequence (ARS) consensus motifs, whose mutation results in the reduction or loss of DNA replication activity. Furthermore, 2D-gel analysis of the mrc1 mutant exposed to hydroxyurea shows that several NUMTs function as late chromosomal origins. We also show that NUMTs located close to or within ARS provide key sequence elements for replication. Thus NUMTs can act as independent origins, when inserted in an appropriate genomic context or affect the efficiency of pre-existing origins. These findings show that migratory mitochondrial DNAs can impact on the replication of the nuclear region they are inserted in. PMID:21408151

  6. Nuclear mitochondrial DNA activates replication in Saccharomyces cerevisiae.

    PubMed

    Chatre, Laurent; Ricchetti, Miria

    2011-03-08

    The nuclear genome of eukaryotes is colonized by DNA fragments of mitochondrial origin, called NUMTs. These insertions have been associated with a variety of germ-line diseases in humans. The significance of this uptake of potentially dangerous sequences into the nuclear genome is unclear. Here we provide functional evidence that sequences of mitochondrial origin promote nuclear DNA replication in Saccharomyces cerevisiae. We show that NUMTs are rich in key autonomously replicating sequence (ARS) consensus motifs, whose mutation results in the reduction or loss of DNA replication activity. Furthermore, 2D-gel analysis of the mrc1 mutant exposed to hydroxyurea shows that several NUMTs function as late chromosomal origins. We also show that NUMTs located close to or within ARS provide key sequence elements for replication. Thus NUMTs can act as independent origins, when inserted in an appropriate genomic context or affect the efficiency of pre-existing origins. These findings show that migratory mitochondrial DNAs can impact on the replication of the nuclear region they are inserted in.

  7. Improved efficiency in amplification of Escherichia coli o-antigen gene clusters using genome-wide sequence comparison

    USDA-ARS?s Scientific Manuscript database

    Background: In many bacteria including E. coli, genes encoding O-antigens are clustered in the chromosome, with a 39-bp JUMPstart sequence and gnd gene located upstream and downstream of the cluster, respectively. For determining the DNA sequence of the E. coli O-antigen gene cluster, one set of P...

  8. A Dual-Mode Large-Arrayed CMOS ISFET Sensor for Accurate and High-Throughput pH Sensing in Biomedical Diagnosis.

    PubMed

    Huang, Xiwei; Yu, Hao; Liu, Xu; Jiang, Yu; Yan, Mei; Wu, Dongping

    2015-09-01

    The existing ISFET-based DNA sequencing detects hydrogen ions released during the polymerization of DNA strands on microbeads, which are scattered into microwell array above the ISFET sensor with unknown distribution. However, false pH detection happens at empty microwells due to crosstalk from neighboring microbeads. In this paper, a dual-mode CMOS ISFET sensor is proposed to have accurate pH detection toward DNA sequencing. Dual-mode sensing, optical and chemical modes, is realized by integrating a CMOS image sensor (CIS) with ISFET pH sensor, and is fabricated in a standard 0.18-μm CIS process. With accurate determination of microbead physical locations with CIS pixel by contact imaging, the dual-mode sensor can correlate local pH for one DNA slice at one location-determined microbead, which can result in improved pH detection accuracy. Moreover, toward a high-throughput DNA sequencing, a correlated-double-sampling readout that supports large array for both modes is deployed to reduce pixel-to-pixel nonuniformity such as threshold voltage mismatch. The proposed CMOS dual-mode sensor is experimentally examined to show a well correlated pH map and optical image for microbeads with a pH sensitivity of 26.2 mV/pH, a fixed pattern noise (FPN) reduction from 4% to 0.3%, and a readout speed of 1200 frames/s. A dual-mode CMOS ISFET sensor with suppressed FPN for accurate large-arrayed pH sensing is proposed and demonstrated with state-of-the-art measured results toward accurate and high-throughput DNA sequencing. The developed dual-mode CMOS ISFET sensor has great potential for future personal genome diagnostics with high accuracy and low cost.

  9. DNA polymerase preference determines PCR priming efficiency.

    PubMed

    Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

    2014-01-30

    Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially available DNA polymerases. The results suggest that the interaction of the DNA polymerase with the primer:template junction during the initiation of DNA polymerization is very important in terms of overall amplification bias and has broader implications for both the primer design process and multiplex PCR.

  10. Genome-wide identification and characterisation of human DNA replication origins by initiation site sequencing (ini-seq)

    PubMed Central

    Langley, Alexander R.; Gräf, Stefan; Smith, James C.; Krude, Torsten

    2016-01-01

    Next-generation sequencing has enabled the genome-wide identification of human DNA replication origins. However, different approaches to mapping replication origins, namely (i) sequencing isolated small nascent DNA strands (SNS-seq); (ii) sequencing replication bubbles (bubble-seq) and (iii) sequencing Okazaki fragments (OK-seq), show only limited concordance. To address this controversy, we describe here an independent high-resolution origin mapping technique that we call initiation site sequencing (ini-seq). In this approach, newly replicated DNA is directly labelled with digoxigenin-dUTP near the sites of its initiation in a cell-free system. The labelled DNA is then immunoprecipitated and genomic locations are determined by DNA sequencing. Using this technique we identify >25,000 discrete origin sites at sub-kilobase resolution on the human genome, with high concordance between biological replicates. Most activated origins identified by ini-seq are found at transcriptional start sites and contain G-quadruplex (G4) motifs. They tend to cluster in early-replicating domains, providing a correlation between early replication timing and local density of activated origins. Origins identified by ini-seq show highest concordance with sites identified by SNS-seq, followed by OK-seq and bubble-seq. Furthermore, germline origins identified by positive nucleotide distribution skew jumps overlap with origins identified by ini-seq and OK-seq more frequently and more specifically than do sites identified by either SNS-seq or bubble-seq. PMID:27587586

  11. Genome-wide identification and characterisation of human DNA replication origins by initiation site sequencing (ini-seq).

    PubMed

    Langley, Alexander R; Gräf, Stefan; Smith, James C; Krude, Torsten

    2016-12-01

    Next-generation sequencing has enabled the genome-wide identification of human DNA replication origins. However, different approaches to mapping replication origins, namely (i) sequencing isolated small nascent DNA strands (SNS-seq); (ii) sequencing replication bubbles (bubble-seq) and (iii) sequencing Okazaki fragments (OK-seq), show only limited concordance. To address this controversy, we describe here an independent high-resolution origin mapping technique that we call initiation site sequencing (ini-seq). In this approach, newly replicated DNA is directly labelled with digoxigenin-dUTP near the sites of its initiation in a cell-free system. The labelled DNA is then immunoprecipitated and genomic locations are determined by DNA sequencing. Using this technique we identify >25,000 discrete origin sites at sub-kilobase resolution on the human genome, with high concordance between biological replicates. Most activated origins identified by ini-seq are found at transcriptional start sites and contain G-quadruplex (G4) motifs. They tend to cluster in early-replicating domains, providing a correlation between early replication timing and local density of activated origins. Origins identified by ini-seq show highest concordance with sites identified by SNS-seq, followed by OK-seq and bubble-seq. Furthermore, germline origins identified by positive nucleotide distribution skew jumps overlap with origins identified by ini-seq and OK-seq more frequently and more specifically than do sites identified by either SNS-seq or bubble-seq. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Fungal DNA in hotel rooms in Europe and Asia--associations with latitude, precipitation, building data, room characteristics and hotel ranking.

    PubMed

    Norbäck, Dan; Cai, Gui-Hong

    2011-10-01

    There is little information on the indoor environment in hotels. Analysis of fungal DNA by quantitative PCR (qPCR) is a new method which can detect general and specific sequences. Dust was collected through swab sampling of door frames in 69 hotel rooms in 20 countries in Europe and Asia (2007-2009). Five sequences were detected by qPCR: total fungal DNA, Aspergillus and Penicillium DNA (Asp/Pen DNA), Aspergillus versicolor (A. versicolor DNA), Stachybotrys chartarum (S. chartarum DNA) and Streptomyces spp. (Streptomyces DNA). Associations were analysed by multiple linear regression. Total fungal DNA (GM = 1.08 × 10(8) cell equivalents m(-2); GSD = 6.36) and Asp/Pen DNA (GM = 1.79 × 10(7) cell equivalents m(-2); GSD = 10.12) were detected in all rooms. A. versicolor DNA, S. chartarum DNA and Streptomyces DNA were detected in 84%, 28% and 47% of the samples. In total, 20% of the rooms had observed dampness/mould, and 30% had odour. Low latitude (range 1.5-64.2 degrees) was a predictor of Asp/Pen DNA. Seaside location, lack of mechanical ventilation, and dampness or mould were other predictors of total fungal DNA and Asp/Pen DNA. Hotel ranking (Trip Advisor) or self-rated quality of the interior of the hotel room was a predictor of total fungal DNA, A. versicolor DNA and Streptomyces DNA. Odour was a predictor of S. chartarum DNA. In conclusion, fungal DNA in swab samples from hotel rooms was related to latitude, seaside location, ventilation, visible dampness and indoor mould growth. Hotels in tropical areas may have 10-100 times higher levels of common moulds such as Aspergillus and Penicillium species, as compared to a temperate climate zone.

  13. Exact method for numerically analyzing a model of local denaturation in superhelically stressed DNA

    NASA Astrophysics Data System (ADS)

    Fye, Richard M.; Benham, Craig J.

    1999-03-01

    Local denaturation, the separation at specific sites of the two strands comprising the DNA double helix, is one of the most fundamental processes in biology, required to allow the base sequence to be read both in DNA transcription and in replication. In living organisms this process can be mediated by enzymes which regulate the amount of superhelical stress imposed on the DNA. We present a numerically exact technique for analyzing a model of denaturation in superhelically stressed DNA. This approach is capable of predicting the locations and extents of transition in circular superhelical DNA molecules of kilobase lengths and specified base pair sequences. It can also be used for closed loops of DNA which are typically found in vivo to be kilobases long. The analytic method consists of an integration over the DNA twist degrees of freedom followed by the introduction of auxiliary variables to decouple the remaining degrees of freedom, which allows the use of the transfer matrix method. The algorithm implementing our technique requires O(N2) operations and O(N) memory to analyze a DNA domain containing N base pairs. However, to analyze kilobase length DNA molecules it must be implemented in high precision floating point arithmetic. An accelerated algorithm is constructed by imposing an upper bound M on the number of base pairs that can simultaneously denature in a state. This accelerated algorithm requires O(MN) operations, and has an analytically bounded error. Sample calculations show that it achieves high accuracy (greater than 15 decimal digits) with relatively small values of M (M<0.05N) for kilobase length molecules under physiologically relevant conditions. Calculations are performed on the superhelical pBR322 DNA sequence to test the accuracy of the method. With no free parameters in the model, the locations and extents of local denaturation predicted by this analysis are in quantitatively precise agreement with in vitro experimental measurements. Calculations performed on the fructose-1,6-bisphosphatase gene sequence from yeast show that this approach can also accurately treat in vivo denaturation.

  14. Discrimination of three types of homopolymers in single-stranded DNA with solid-state nanopores through external control of the DNA motion.

    PubMed

    Akahori, Rena; Yanagi, Itaru; Goto, Yusuke; Harada, Kunio; Yokoi, Takahide; Takeda, Ken-Ichi

    2017-08-22

    To achieve DNA sequencing with solid-state nanopores, the speed of the DNA in the nanopore must be controlled to obtain sequence-specific signals. In this study, we fabricated a nanopore-sensing system equipped with a DNA motion controller. DNA strands were immobilized on a Si probe, and approach of this probe to the nanopore vicinity could be controlled using a piezo actuator and stepper motor. The area of the Si probe was larger than the area of the membrane, which meant that the immobilized DNA could enter the nanopore without the need for the probe to scan to determine the location of the nanopore in the membrane. We demonstrated that a single-stranded DNA could be inserted into and removed from a nanopore in our experimental system. The number of different ionic-current levels observed while DNA remained in the nanopore corresponded to the number of different types of homopolymers in the DNA.

  15. The dynamics of genome replication using deep sequencing

    PubMed Central

    Müller, Carolin A.; Hawkins, Michelle; Retkute, Renata; Malla, Sunir; Wilson, Ray; Blythe, Martin J.; Nakato, Ryuichiro; Komata, Makiko; Shirahige, Katsuhiko; de Moura, Alessandro P.S.; Nieduszynski, Conrad A.

    2014-01-01

    Eukaryotic genomes are replicated from multiple DNA replication origins. We present complementary deep sequencing approaches to measure origin location and activity in Saccharomyces cerevisiae. Measuring the increase in DNA copy number during a synchronous S-phase allowed the precise determination of genome replication. To map origin locations, replication forks were stalled close to their initiation sites; therefore, copy number enrichment was limited to origins. Replication timing profiles were generated from asynchronous cultures using fluorescence-activated cell sorting. Applying this technique we show that the replication profiles of haploid and diploid cells are indistinguishable, indicating that both cell types use the same cohort of origins with the same activities. Finally, increasing sequencing depth allowed the direct measure of replication dynamics from an exponentially growing culture. This is the first time this approach, called marker frequency analysis, has been successfully applied to a eukaryote. These data provide a high-resolution resource and methodological framework for studying genome biology. PMID:24089142

  16. Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

    PubMed Central

    Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

    1990-01-01

    The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

  17. Partial structure of the phylloxin gene from the giant monkey frog, Phyllomedusa bicolor: parallel cloning of precursor cDNA and genomic DNA from lyophilized skin secretion.

    PubMed

    Chen, Tianbao; Gagliardo, Ron; Walker, Brian; Zhou, Mei; Shaw, Chris

    2005-12-01

    Phylloxin is a novel prototype antimicrobial peptide from the skin of Phyllomedusa bicolor. Here, we describe parallel identification and sequencing of phylloxin precursor transcript (mRNA) and partial gene structure (genomic DNA) from the same sample of lyophilized skin secretion using our recently-described cloning technique. The open-reading frame of the phylloxin precursor was identical in nucleotide sequence to that previously reported and alignment with the nucleotide sequence derived from genomic DNA indicated the presence of a 175 bp intron located in a near identical position to that found in the dermaseptins. The highly-conserved structural organization of skin secretion peptide genes in P. bicolor can thus be extended to include that encoding phylloxin (plx). These data further reinforce our assertion that application of the described methodology can provide robust genomic/transcriptomic/peptidomic data without the need for specimen sacrifice.

  18. Human ribosomal RNA gene: nucleotide sequence of the transcription initiation region and comparison of three mammalian genes.

    PubMed Central

    Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M

    1982-01-01

    The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460

  19. Characterization of Fasciola samples by ITS of rDNA sequences revealed the existence of Fasciola hepatica and Fasciola gigantica in Yunnan Province, China.

    PubMed

    Shu, Fan-Fan; Lv, Rui-Qing; Zhang, Yi-Fang; Duan, Gang; Wu, Ding-Yu; Li, Bi-Feng; Yang, Jian-Fa; Zou, Feng-Cai

    2012-08-01

    On mainland China, liver flukes of Fasciola spp. (Digenea: Fasciolidae) can cause serious acute and chronic morbidity in numerous species of mammals such as sheep, goats, cattle, and humans. The objective of the present study was to examine the taxonomic identity of Fasciola species in Yunnan province by sequences of the first and second internal transcribed spacers (ITS-1 and ITS-2) of nuclear ribosomal DNA (rDNA). The ITS rDNA was amplified from 10 samples representing Fasciola species in cattle from 2 geographical locations in Yunnan Province, by polymerase chain reaction (PCR), and the products were sequenced directly. The lengths of the ITS-1 and ITS-2 sequences were 422 and 361-362 base pairs, respectively, for all samples sequenced. Using ITS sequences, 2 Fasciola species were revealed, namely Fasciola hepatica and Fasciola gigantica. This is the first demonstration of F. gigantica in cattle in Yunnan Province, China using a molecular approach; our findings have implications for studying the population genetic characterization of the Chinese Fasciola species and for the prevention and control of Fasciola spp. in this province.

  20. A search for specificity in DNA-drug interactions.

    PubMed

    Cruciani, G; Goodford, P J

    1994-06-01

    The GRID force field and a principal component analysis have been used in order to predict the interactions of small chemical groups with all 64 different triplet sequences of B-DNA. Factors that favor binding to guanine-cytosine base pairs have been identified, and a dictionary of ligand groups and their locations is presented as a guide to the design of specific DNA ligands.

  1. Analysis of Duck Hepatitis B Virus Reverse Transcription Indicates a Common Mechanism for the Two Template Switches during Plus-Strand DNA Synthesis

    PubMed Central

    Havert, Michael B.; Ji, Lin; Loeb, Daniel D.

    2002-01-01

    The synthesis of the hepadnavirus relaxed circular DNA genome requires two template switches, primer translocation and circularization, during plus-strand DNA synthesis. Repeated sequences serve as donor and acceptor templates for these template switches, with direct repeat 1 (DR1) and DR2 for primer translocation and 5′r and 3′r for circularization. These donor and acceptor sequences are at, or near, the ends of the minus-strand DNA. Analysis of plus-strand DNA synthesis of duck hepatitis B virus (DHBV) has indicated that there are at least three other cis-acting sequences that make contributions during the synthesis of relaxed circular DNA. These sequences, 5E, M, and 3E, are located near the 5′ end, the middle, and the 3′ end of minus-strand DNA, respectively. The mechanism by which these sequences contribute to the synthesis of plus-strand DNA was unclear. Our aim was to better understand the mechanism by which 5E and M act. We localized the DHBV 5E element to a short sequence of approximately 30 nucleotides that is 100 nucleotides 3′ of DR2 on minus-strand DNA. We found that the new 5E mutants were partially defective for primer translocation/utilization at DR2. They were also invariably defective for circularization. In addition, examination of several new DHBV M variants indicated that they too were defective for primer translocation/utilization and circularization. Thus, this analysis indicated that 5E and M play roles in both primer translocation/utilization and circularization. In conjunction with earlier findings that 3E functions in both template switches, our findings indicate that the processes of primer translocation and circularization share a common underlying mechanism. PMID:11861843

  2. Plant genotyping using fluorescently tagged inter-simple sequence repeats (ISSRs): basic principles and methodology.

    PubMed

    Prince, Linda M

    2015-01-01

    Inter-simple sequence repeat PCR (ISSR-PCR) is a fast, inexpensive genotyping technique based on length variation in the regions between microsatellites. The method requires no species-specific prior knowledge of microsatellite location or composition. Very small amounts of DNA are required, making this method ideal for organisms of conservation concern, or where the quantity of DNA is extremely limited due to organism size. ISSR-PCR can be highly reproducible but requires careful attention to detail. Optimization of DNA extraction, fragment amplification, and normalization of fragment peak heights during fluorescent detection are critical steps to minimizing the downstream time spent verifying and scoring the data.

  3. Authentication of an endangered herb Changium smyrnioides from different producing areas based on rDNA ITS sequences and allele-specific PCR.

    PubMed

    Sun, Xiaoqin; Wei, Yanglian; Qin, Minjian; Guo, Qiaosheng; Guo, Jianlin; Zhou, Yifeng; Hang, Yueyu

    2012-03-01

    The rDNA ITS region of 18 samples of Changium smyrnioides from 7 areas and of 2 samples of Chuanminshen violaceum were sequenced and analyzed. The amplified ITS region of the samples, including a partial sequence of ITS1 and complete sequences of 5.8S and ITS2, had a total length of 555 bp. After complete alignment, there were 49 variable sites, of which 45 were informative, when gaps were treated as missing data. Samples of C. smyrnioides from different locations could be identified exactly based on the variable sites. The maximum parsimony (MP) and neighbor joining (NJ) tree constructed from the ITS sequences based on Kumar's two-parameter model showed that the genetic distances of the C. smyrnioides samples from different locations were not always related to their geographical distances. A specific primer set for Allele-specific PCR authentication of C. violaceum from Jurong of Jiangsu was designed based on the SNP in the ITS sequence alignment. C. violaceum from the major genuine producing area in Jurong of Jiangsu could be identified exactly and quickly by Allele-specific PCR.

  4. Contrasting morphological and DNA barcode-suggested species boundaries among shallow-water amphipod fauna from the southern European Atlantic coast.

    PubMed

    Lobo, Jorge; Ferreira, Maria S; Antunes, Ilisa C; Teixeira, Marcos A L; Borges, Luisa M S; Sousa, Ronaldo; Gomes, Pedro A; Costa, Maria Helena; Cunha, Marina R; Costa, Filipe O

    2017-02-01

    In this study we compared DNA barcode-suggested species boundaries with morphology-based species identifications in the amphipod fauna of the southern European Atlantic coast. DNA sequences of the cytochrome c oxidase subunit I barcode region (COI-5P) were generated for 43 morphospecies (178 specimens) collected along the Portuguese coast which, together with publicly available COI-5P sequences, produced a final dataset comprising 68 morphospecies and 295 sequences. Seventy-five BINs (Barcode Index Numbers) were assigned to these morphospecies, of which 48 were concordant (i.e., 1 BIN = 1 species), 8 were taxonomically discordant, and 19 were singletons. Twelve species had matching sequences (<2% distance) with conspecifics from distant locations (e.g., North Sea). Seven morphospecies were assigned to multiple, and highly divergent, BINs, including specimens of Corophium multisetosum (18% divergence) and Dexamine spiniventris (16% divergence), which originated from sampling locations on the west coast of Portugal (only about 36 and 250 km apart, respectively). We also found deep divergence (4%-22%) among specimens of seven species from Portugal compared to those from the North Sea and Italy. The detection of evolutionarily meaningful divergence among populations of several amphipod species from southern Europe reinforces the need for a comprehensive re-assessment of the diversity of this faunal group.

  5. qPMS9: An Efficient Algorithm for Quorum Planted Motif Search

    NASA Astrophysics Data System (ADS)

    Nicolae, Marius; Rajasekaran, Sanguthevar

    2015-01-01

    Discovering patterns in biological sequences is a crucial problem. For example, the identification of patterns in DNA sequences has resulted in the determination of open reading frames, identification of gene promoter elements, intron/exon splicing sites, and SH RNAs, location of RNA degradation signals, identification of alternative splicing sites, etc. In protein sequences, patterns have led to domain identification, location of protease cleavage sites, identification of signal peptides, protein interactions, determination of protein degradation elements, identification of protein trafficking elements, discovery of short functional motifs, etc. In this paper we focus on the identification of an important class of patterns, namely, motifs. We study the (l, d) motif search problem or Planted Motif Search (PMS). PMS receives as input n strings and two integers l and d. It returns all sequences M of length l that occur in each input string, where each occurrence differs from M in at most d positions. Another formulation is quorum PMS (qPMS), where the motif appears in at least q% of the strings. We introduce qPMS9, a parallel exact qPMS algorithm that offers significant runtime improvements on DNA and protein datasets. qPMS9 solves the challenging DNA (l, d)-instances (28, 12) and (30, 13). The source code is available at https://code.google.com/p/qpms9/.

  6. Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Buchman, A.R.; Kimmerly, W.J.; Rine, J.

    1988-01-01

    Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less

  7. Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    PubMed Central

    Taylor, James A.; Pastrana, Cesar L.; Butterer, Annika; Pernstich, Christian; Gwynn, Emma J.; Sobott, Frank; Moreno-Herrero, Fernando; Dillingham, Mark S.

    2015-01-01

    The segregation of many bacterial chromosomes is dependent on the interactions of ParB proteins with centromere-like DNA sequences called parS that are located close to the origin of replication. In this work, we have investigated the binding of Bacillus subtilis ParB to DNA in vitro using a variety of biochemical and biophysical techniques. We observe tight and specific binding of a ParB homodimer to the parS sequence. Binding of ParB to non-specific DNA is more complex and displays apparent positive co-operativity that is associated with the formation of larger, poorly defined, nucleoprotein complexes. Experiments with magnetic tweezers demonstrate that non-specific binding leads to DNA condensation that is reversible by protein unbinding or force. The condensed DNA structure is not well ordered and we infer that it is formed by many looping interactions between neighbouring DNA segments. Consistent with this view, ParB is also able to stabilize writhe in single supercoiled DNA molecules and to bridge segments from two different DNA molecules in trans. The experiments provide no evidence for the promotion of non-specific DNA binding and/or condensation events by the presence of parS sequences. The implications of these observations for chromosome segregation are discussed. PMID:25572315

  8. Methylsorb: a simple method for quantifying DNA methylation using DNA-gold affinity interactions.

    PubMed

    Sina, Abu Ali Ibn; Carrascosa, Laura G; Palanisamy, Ramkumar; Rauf, Sakandar; Shiddiky, Muhammad J A; Trau, Matt

    2014-10-21

    The analysis of DNA methylation is becoming increasingly important both in the clinic and also as a research tool to unravel key epigenetic molecular mechanisms in biology. Current methodologies for the quantification of regional DNA methylation (i.e., the average methylation over a region of DNA in the genome) are largely affected by comprehensive DNA sequencing methodologies which tend to be expensive, tedious, and time-consuming for many applications. Herein, we report an alternative DNA methylation detection method referred to as "Methylsorb", which is based on the inherent affinity of DNA bases to the gold surface (i.e., the trend of the affinity interactions is adenine > cytosine ≥ guanine > thymine).1 Since the degree of gold-DNA affinity interaction is highly sequence dependent, it provides a new capability to detect DNA methylation by simply monitoring the relative adsorption of bisulfite treated DNA sequences onto a gold chip. Because the selective physical adsorption of DNA fragments to gold enable a direct read-out of regional DNA methylation, the current requirement for DNA sequencing is obviated. To demonstrate the utility of this method, we present data on the regional methylation status of two CpG clusters located in the EN1 and MIR200B genes in MCF7 and MDA-MB-231 cells. The methylation status of these regions was obtained from the change in relative mass on gold surface with respect to relative adsorption of an unmethylated DNA source and this was detected using surface plasmon resonance (SPR) in a label-free and real-time manner. We anticipate that the simplicity of this method, combined with the high level of accuracy for identifying the methylation status of cytosines in DNA, could find broad application in biology and diagnostics.

  9. Potential role of DNA methylation as a facilitator of target search processes for transcription factors through interplay with methyl-CpG-binding proteins

    PubMed Central

    Kemme, Catherine A.; Marquez, Rolando; Luu, Ross H.

    2017-01-01

    Abstract Eukaryotic genomes contain numerous non-functional high-affinity sequences for transcription factors. These sequences potentially serve as natural decoys that sequester transcription factors. We have previously shown that the presence of sequences similar to the target sequence could substantially impede association of the transcription factor Egr-1 with its targets. In this study, using a stopped-flow fluorescence method, we examined the kinetic impact of DNA methylation of decoys on the search process of the Egr-1 zinc-finger protein. We analyzed its association with an unmethylated target site on fluorescence-labeled DNA in the presence of competitor DNA duplexes, including Egr-1 decoys. DNA methylation of decoys alone did not affect target search kinetics. In the presence of the MeCP2 methyl-CpG-binding domain (MBD), however, DNA methylation of decoys substantially (∼10-30-fold) accelerated the target search process of the Egr-1 zinc-finger protein. This acceleration did not occur when the target was also methylated. These results suggest that when decoys are methylated, MBD proteins can block them and thereby allow Egr-1 to avoid sequestration in non-functional locations. This effect may occur in vivo for DNA methylation outside CpG islands (CGIs) and could facilitate localization of some transcription factors within regulatory CGIs, where DNA methylation is rare. PMID:28486614

  10. PCR amplification and DNA sequencing of Demodex injai from otic secretions of a dog.

    PubMed

    Milosevic, Milivoj A; Frank, Linda A; Brahmbhatt, Rupal A; Kania, Stephen A

    2013-04-01

    The identification of Demodex mites from dogs is usually based on morphology and location. Mites with uncharacteristic features or from unusual locations, hosts or disease manifestations could represent new species not previously described; however, this is difficult to determine based on morphology alone. The goal of this study was to identify and confirm Demodex injai in association with otitis externa in a dog using PCR amplification and DNA sequencing. Otic samples were obtained from a beagle in which a long-bodied Demodex mite was identified. For comparison, Demodex mite samples were collected from a swab and scraping of the dorsal skin of a wire-haired fox terrier and an otic sample from a dog with generalized and otic demodicosis. To identify the Demodex mite, DNA was extracted, and 16S rRNA was amplified by PCR, sequenced and compared with Demodex sequences available in public databases and from separate samples morphologically diagnosed as D. injai and Demodex canis. PCR amplification of the long-bodied mite rRNA DNA obtained from otic samples was approximately 330 bp and was identical to that from the mite morphologically identified as D. injai obtained from the dorsal skin of a dog. Furthermore, the examined mite did not have any significant homology to any of the reported genes from Demodex spp. These results confirmed that the demodex mites in this case were D. injai. © 2013 The Authors. Veterinary Dermatology © 2013 ESVD and ACVD.

  11. Identification of antigenic regions on VP2 of African horsesickness virus serotype 3 by using phage-displayed epitope libraries.

    PubMed

    Bentley, L; Fehrsen, J; Jordaan, F; Huismans, H; du Plessis, D H

    2000-04-01

    VP2 is an outer capsid protein of African horsesickness virus (AHSV) and is recognized by serotype-discriminatory neutralizing antibodies. With the objective of locating its antigenic regions, a filamentous phage library was constructed that displayed peptides derived from the fragmentation of a cDNA copy of the gene encoding VP2. Peptides ranging in size from approximately 30 to 100 amino acids were fused with pIII, the attachment protein of the display vector, fUSE2. To ensure maximum diversity, the final library consisted of three sub-libraries. The first utilized enzymatically fragmented DNA encoding only the VP2 gene, the second included plasmid sequences, while the third included a PCR step designed to allow different peptide-encoding sequences to recombine before ligation into the vector. The resulting composite library was subjected to immunoaffinity selection with AHSV-specific polyclonal chicken IgY, polyclonal horse immunoglobulins and a monoclonal antibody (MAb) known to neutralize AHSV. Antigenic peptides were located by sequencing the DNA of phages bound by the antibodies. Most antigenic determinants capable of being mapped by this method were located in the N-terminal half of VP2. Important binding areas were mapped with high resolution by identifying the minimum overlapping areas of the selected peptides. The MAb was also used to screen a random 17-mer epitope library. Sequences that may be part of a discontinuous neutralization epitope were identified. The amino acid sequences of the antigenic regions on VP2 of serotype 3 were compared with corresponding regions on three other serotypes, revealing regions with the potential to discriminate AHSV serotypes serologically.

  12. The Past, Present, and Future of Human Centromere Genomics

    PubMed Central

    Aldrup-MacDonald, Megan E.; Sullivan, Beth A.

    2014-01-01

    The centromere is the chromosomal locus essential for chromosome inheritance and genome stability. Human centromeres are located at repetitive alpha satellite DNA arrays that compose approximately 5% of the genome. Contiguous alpha satellite DNA sequence is absent from the assembled reference genome, limiting current understanding of centromere organization and function. Here, we review the progress in centromere genomics spanning the discovery of the sequence to its molecular characterization and the work done during the Human Genome Project era to elucidate alpha satellite structure and sequence variation. We discuss exciting recent advances in alpha satellite sequence assembly that have provided important insight into the abundance and complex organization of this sequence on human chromosomes. In light of these new findings, we offer perspectives for future studies of human centromere assembly and function. PMID:24683489

  13. APE1 incision activity at abasic sites in tandem repeat sequences.

    PubMed

    Li, Mengxia; Völker, Jens; Breslauer, Kenneth J; Wilson, David M

    2014-05-29

    Repetitive DNA sequences, such as those present in microsatellites and minisatellites, telomeres, and trinucleotide repeats (linked to fragile X syndrome, Huntington disease, etc.), account for nearly 30% of the human genome. These domains exhibit enhanced susceptibility to oxidative attack to yield base modifications, strand breaks, and abasic sites; have a propensity to adopt non-canonical DNA forms modulated by the positions of the lesions; and, when not properly processed, can contribute to genome instability that underlies aging and disease development. Knowledge on the repair efficiencies of DNA damage within such repetitive sequences is therefore crucial for understanding the impact of such domains on genomic integrity. In the present study, using strategically designed oligonucleotide substrates, we determined the ability of human apurinic/apyrimidinic endonuclease 1 (APE1) to cleave at apurinic/apyrimidinic (AP) sites in a collection of tandem DNA repeat landscapes involving telomeric and CAG/CTG repeat sequences. Our studies reveal the differential influence of domain sequence, conformation, and AP site location/relative positioning on the efficiency of APE1 binding and strand incision. Intriguingly, our data demonstrate that APE1 endonuclease efficiency correlates with the thermodynamic stability of the DNA substrate. We discuss how these results have both predictive and mechanistic consequences for understanding the success and failure of repair protein activity associated with such oxidatively sensitive, conformationally plastic/dynamic repetitive DNA domains. Published by Elsevier Ltd.

  14. Centromere location in Arabidopsis is unaltered by extreme divergence in CENH3 protein sequence

    PubMed Central

    2017-01-01

    During cell division, spindle fibers attach to chromosomes at centromeres. The DNA sequence at regional centromeres is fast evolving with no conserved genetic signature for centromere identity. Instead CENH3, a centromere-specific histone H3 variant, is the epigenetic signature that specifies centromere location across both plant and animal kingdoms. Paradoxically, CENH3 is also adaptively evolving. An ongoing question is whether CENH3 evolution is driven by a functional relationship with the underlying DNA sequence. Here, we demonstrate that despite extensive protein sequence divergence, CENH3 histones from distant species assemble centromeres on the same underlying DNA sequence. We first characterized the organization and diversity of centromere repeats in wild-type Arabidopsis thaliana. We show that A. thaliana CENH3-containing nucleosomes exhibit a strong preference for a unique subset of centromeric repeats. These sequences are largely missing from the genome assemblies and represent the youngest and most homogeneous class of repeats. Next, we tested the evolutionary specificity of this interaction in a background in which the native A. thaliana CENH3 is replaced with CENH3s from distant species. Strikingly, we find that CENH3 from Lepidium oleraceum and Zea mays, although specifying epigenetically weaker centromeres that result in genome elimination upon outcrossing, show a binding pattern on A. thaliana centromere repeats that is indistinguishable from the native CENH3. Our results demonstrate positional stability of a highly diverged CENH3 on independently evolved repeats, suggesting that the sequence specificity of centromeres is determined by a mechanism independent of CENH3. PMID:28223399

  15. Construction of a small Mus musculus repetitive DNA library: identification of a new satellite sequence in Mus musculus.

    PubMed Central

    Pietras, D F; Bennett, K L; Siracusa, L D; Woodworth-Gutai, M; Chapman, V M; Gross, K W; Kane-Haas, C; Hastie, N D

    1983-01-01

    We report the construction of a small library of recombinant plasmids containing Mus musculus repetitive DNA inserts. The repetitive cloned fraction was derived from denatured genomic DNA by reassociation to a Cot value at which repetitive, but not unique, sequences have reannealed followed by exhaustive S1 nuclease treatment to degrade single stranded DNA. Initial characterizations of this library by colony filter hybridizations have led to the identification of a previously undetected M. musculus minor satellite as well as to clones containing M. musculus major satellite sequences. This new satellite is repeated 10-20 times less than the major satellite in the M. musculus genome. It has a repeat length of 130 nucleotides compared with the M. musculus major satellite with a repeat length of 234 nucleotides. Sequence analysis of the minor satellite has shown that it has a 29 base pair region with extensive homology to one of the major satellite repeating subunits. We also show by in situ hybridization that this minor satellite sequence is located at the centromeres and possibly the arms of at least half the M musculus chromosomes. Sequences related to the minor satellite have been found in the DNA of a related Mus species, Mus spretus, and may represent the major satellite of that species. Images PMID:6314268

  16. The Fanconi anemia DNA damage repair pathway in the spotlight for germline predisposition to colorectal cancer.

    PubMed

    Esteban-Jurado, Clara; Franch-Expósito, Sebastià; Muñoz, Jenifer; Ocaña, Teresa; Carballal, Sabela; López-Cerón, Maria; Cuatrecasas, Miriam; Vila-Casadesús, Maria; Lozano, Juan José; Serra, Enric; Beltran, Sergi; Brea-Fernández, Alejandro; Ruiz-Ponte, Clara; Castells, Antoni; Bujanda, Luis; Garre, Pilar; Caldés, Trinidad; Cubiella, Joaquín; Balaguer, Francesc; Castellví-Bel, Sergi

    2016-10-01

    Colorectal cancer (CRC) is one of the most common neoplasms in the world. Fanconi anemia (FA) is a very rare genetic disease causing bone marrow failure, congenital growth abnormalities and cancer predisposition. The comprehensive FA DNA damage repair pathway requires the collaboration of 53 proteins and it is necessary to restore genome integrity by efficiently repairing damaged DNA. A link between FA genes in breast and ovarian cancer germline predisposition has been previously suggested. We selected 74 CRC patients from 40 unrelated Spanish families with strong CRC aggregation compatible with an autosomal dominant pattern of inheritance and without mutations in known hereditary CRC genes and performed germline DNA whole-exome sequencing with the aim of finding new candidate germline predisposition variants. After sequencing and data analysis, variant prioritization selected only those very rare alterations, producing a putative loss of function and located in genes with a role compatible with cancer. We detected an enrichment for variants in FA DNA damage repair pathway genes in our familial CRC cohort as 6 families carried heterozygous, rare, potentially pathogenic variants located in BRCA2/FANCD1, BRIP1/FANCJ, FANCC, FANCE and REV3L/POLZ. In conclusion, the FA DNA damage repair pathway may play an important role in the inherited predisposition to CRC.

  17. Chromosomal Mapping of Repetitive DNA Sequences in the Genus Bryconamericus (Characidae) and DNA Barcoding to Differentiate Populations.

    PubMed

    Santos, Angélica Rossotti Dos; Usso, Mariana Campaner; Gouveia, Juceli Gonzalez; Araya-Jaime, Cristian; Frantine-Silva, Wilson; Giuliano-Caetano, Lucia; Foresti, Fausto; Dias, Ana Lúcia

    2017-06-01

    The mapping of repetitive DNA sites by fluorescence in situ hybridization has been widely used for karyotype studies in different species of fish, especially when dealing with related species or even genera presenting high chromosome variability. This study analyzed three populations of Bryconamericus, with diploid number preserved, but with different karyotype formulae. Bryconamericus ecai, from the Forquetinha river/RS, presented three new cytotypes, increasing the number of karyotype forms to seven in this population. Other two populations of Bryconamericus sp. from the Vermelho stream/PR and Cambuta river/PR exhibited interpopulation variation. The chromosome mapping of rDNA sites revealed unique markings among the three populations, showing inter- and intrapopulation variability located in the terminal region. The molecular analysis using DNA barcoding complementing the cytogenetic analysis also showed differentiation among the three populations. The U2 small nuclear DNA repetitive sequence exhibited conserved features, being located in the interstitial region of a single chromosome pair. This is the first report on its occurrence in the genus Bryconamericus. Data obtained revealed a karyotype variability already assigned to the genus, along with polymorphism of ribosomal sites, demonstrating that this group of fish can be undergoing a divergent evolutionary process, constituting a substantive model for studies of chromosomal evolution.

  18. Identification of unique repeated patterns, location of mutation in DNA finger printing using artificial intelligence technique.

    PubMed

    Mukunthan, B; Nagaveni, N

    2014-01-01

    In genetic engineering, conventional techniques and algorithms employed by forensic scientists to assist in identification of individuals on the basis of their respective DNA profiles involves more complex computational steps and mathematical formulae, also the identification of location of mutation in a genomic sequence in laboratories is still an exigent task. This novel approach provides ability to solve the problems that do not have an algorithmic solution and the available solutions are also too complex to be found. The perfect blend made of bioinformatics and neural networks technique results in efficient DNA pattern analysis algorithm with utmost prediction accuracy.

  19. Chromosome evolution in the Thermotogales: large-scale inversions and strain diversification of CRISPR sequences.

    PubMed

    DeBoy, Robert T; Mongodin, Emmanuel F; Emerson, Joanne B; Nelson, Karen E

    2006-04-01

    In the present study, the chromosomes of two members of the Thermotogales were compared. A whole-genome alignment of Thermotoga maritima MSB8 and Thermotoga neapolitana NS-E has revealed numerous large-scale DNA rearrangements, most of which are associated with CRISPR DNA repeats and/or tRNA genes. These DNA rearrangements do not include the putative origin of DNA replication but move within the same replichore, i.e., the same replicating half of the chromosome (delimited by the replication origin and terminus). Based on cumulative GC skew analysis, both the T. maritima and T. neapolitana lineages contain one or two major inverted DNA segments. Also, based on PCR amplification and sequence analysis of the DNA joints that are associated with the major rearrangements, the overall chromosome architecture was found to be conserved at most DNA joints for other strains of T. neapolitana. Taken together, the results from this analysis suggest that the observed chromosomal rearrangements in the Thermotogales likely occurred by successive inversions after their divergence from a common ancestor and before strain diversification. Finally, sequence analysis shows that size polymorphisms in the DNA joints associated with CRISPRs can be explained by expansion and possibly contraction of the DNA repeat and spacer unit, providing a tool for discerning the relatedness of strains from different geographic locations.

  20. 50 years of DNA ‘Breathing’: Reflections on Old and New Approaches

    PubMed Central

    von Hippel, Peter H.; Johnson, Neil P.; Marcus, Andrew H.

    2015-01-01

    Summary The coding sequences for genes, and much other regulatory information involved in genome expression, are located ‘inside’ the DNA duplex. Thus the ‘macromolecular machines’ that read-out this information from the base sequence of the DNA must somehow access the DNA ‘interior’. Double-stranded (ds) DNA is a highly structured and cooperatively stabilized system at physiological temperatures, but is also only marginally stable and undergoes a cooperative ‘melting phase transition’ at temperatures not far above physiological. Furthermore, due to its length and heterogeneous sequence, with AT-rich segments being less stable than GC-rich segments, the DNA genome ‘melts’ in a multistate fashion. Therefore the DNA genome must also manifest thermally driven structural (‘breathing’) fluctuations at physiological temperatures that should reflect the heterogeneity of the dsDNA stability near the melting temperature. Thus many of the breathing fluctuations of dsDNA are likely also to be sequence dependent, and could well contain information that should be ‘readable’ and useable by regulatory proteins and protein complexes in site-specific binding reactions involving dsDNA ‘opening’. Our laboratory has been involved in studying the breathing fluctuations of duplex DNA for about 50 years. In this ‘Reflections’ article we present a relatively chronological overview of these studies, starting with the use of simple chemical probes (such as hydrogen exchange, formaldehyde and simple DNA ‘melting’ proteins) to examine the local stability of the dsDNA structure, and culminating in sophisticated spectroscopic approaches that can be used to monitor the breathing-dependent interactions of regulatory complexes with their duplex DNA targets in ‘real time’. PMID:23840028

  1. Exploring the roles of DNA methylation in the metal-reducing bacterium Shewanella oneidensis MR-1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bendall, Matthew L.; Luong, Khai; Wetmore, Kelly M.

    2013-08-30

    We performed whole genome analyses of DNA methylation in Shewanella 17 oneidensis MR-1 to examine its possible role in regulating gene expression and 18 other cellular processes. Single-Molecule Real Time (SMRT) sequencing 19 revealed extensive methylation of adenine (N6mA) throughout the 20 genome. These methylated bases were located in five sequence motifs, 21 including three novel targets for Type I restriction/modification enzymes. The 22 sequence motifs targeted by putative methyltranferases were determined via 23 SMRT sequencing of gene knockout mutants. In addition, we found S. 24 oneidensis MR-1 cultures grown under various culture conditions displayed 25 different DNA methylation patterns.more » However, the small number of differentially 26 methylated sites could not be directly linked to the much larger number of 27 differentially expressed genes in these conditions, suggesting DNA methylation is 28 not a major regulator of gene expression in S. oneidensis MR-1. The enrichment 29 of methylated GATC motifs in the origin of replication indicate DNA methylation 30 may regulate genome replication in a manner similar to that seen in Escherichia 31 coli. Furthermore, comparative analyses suggest that many 32 Gammaproteobacteria, including all members of the Shewanellaceae family, may 33 also utilize DNA methylation to regulate genome replication.« less

  2. eDNA Barcoding: Using Next-Generation Sequencing of Environmental DNA for Detection and Identification of Cetacean Species

    DTIC Science & Technology

    2015-09-30

    September 2015. Photograph courtesy of Jeanne Hyde. 4 Figure 3: The location of (e)DNA serial sampling encounter from killer whales in the...experiment’ were very success, allowing us to collect serial samples, at a range of distances and times, after the passage of killer whales from a...the first year, we have conducted a series of (e)DNA sampling experiments in the vicinity of killer whales Orcinus orca near San Juan Island in Puget

  3. Scanning sequences after Gibbs sampling to find multiple occurrences of functional elements

    PubMed Central

    Tharakaraman, Kannan; Mariño-Ramírez, Leonardo; Sheetlin, Sergey L; Landsman, David; Spouge, John L

    2006-01-01

    Background Many DNA regulatory elements occur as multiple instances within a target promoter. Gibbs sampling programs for finding DNA regulatory elements de novo can be prohibitively slow in locating all instances of such an element in a sequence set. Results We describe an improvement to the A-GLAM computer program, which predicts regulatory elements within DNA sequences with Gibbs sampling. The improvement adds an optional "scanning step" after Gibbs sampling. Gibbs sampling produces a position specific scoring matrix (PSSM). The new scanning step resembles an iterative PSI-BLAST search based on the PSSM. First, it assigns an "individual score" to each subsequence of appropriate length within the input sequences using the initial PSSM. Second, it computes an E-value from each individual score, to assess the agreement between the corresponding subsequence and the PSSM. Third, it permits subsequences with E-values falling below a threshold to contribute to the underlying PSSM, which is then updated using the Bayesian calculus. A-GLAM iterates its scanning step to convergence, at which point no new subsequences contribute to the PSSM. After convergence, A-GLAM reports predicted regulatory elements within each sequence in order of increasing E-values, so users have a statistical evaluation of the predicted elements in a convenient presentation. Thus, although the Gibbs sampling step in A-GLAM finds at most one regulatory element per input sequence, the scanning step can now rapidly locate further instances of the element in each sequence. Conclusion Datasets from experiments determining the binding sites of transcription factors were used to evaluate the improvement to A-GLAM. Typically, the datasets included several sequences containing multiple instances of a regulatory motif. The improvements to A-GLAM permitted it to predict the multiple instances. PMID:16961919

  4. Mitochondrial DNA sequence context in the penetrance of mitochondrial t-RNA mutations: A study across multiple lineages with diagnostic implications

    PubMed Central

    Queen, Rachel A.; Steyn, Jannetta S.; Lord, Phillip

    2017-01-01

    Mitochondrial DNA (mtDNA) mutations are well recognized as an important cause of inherited disease. Diseases caused by mtDNA mutations exhibit a high degree of clinical heterogeneity with a complex genotype-phenotype relationship, with many such mutations exhibiting incomplete penetrance. There is evidence that the spectrum of mutations causing mitochondrial disease might differ between different mitochondrial lineages (haplogroups) seen in different global populations. This would point to the importance of sequence context in the expression of mutations. To explore this possibility, we looked for mutations which are known to cause disease in humans, in animals of other species unaffected by mtDNA disease. The mt-tRNA genes are the location of many pathogenic mutations, with the m.3243A>G mutation on the mt-tRNA-Leu(UUR) being the most frequently seen mutation in humans. This study looked for the presence of m.3243A>G in 2784 sequences from 33 species, as well as any of the other mutations reported in association with disease located on mt-tRNA-Leu(UUR). We report a number of disease associated variations found on mt-tRNA-Leu(UUR) in other chordates, as the major population variant, with m.3243A>G being seen in 6 species. In these, we also found a number of mutations which appear compensatory and which could prevent the pathogenicity associated with this change in humans. This work has important implications for the discovery and diagnosis of mtDNA mutations in non-European populations. In addition, it might provide a partial explanation for the conflicting results in the literature that examines the role of mtDNA variants in complex traits. PMID:29161289

  5. Fine organization of genomic regions tagged to the 5S rDNA locus of the bread wheat 5B chromosome.

    PubMed

    Sergeeva, Ekaterina M; Shcherban, Andrey B; Adonina, Irina G; Nesterov, Michail A; Beletsky, Alexey V; Rakitin, Andrey L; Mardanov, Andrey V; Ravin, Nikolai V; Salina, Elena A

    2017-11-14

    The multigene family encoding the 5S rRNA, one of the most important structurally-functional part of the large ribosomal subunit, is an obligate component of all eukaryotic genomes. 5S rDNA has long been a favored target for cytological and phylogenetic studies due to the inherent peculiarities of its structural organization, such as the tandem arrays of repetitive units and their high interspecific divergence. The complex polyploid nature of the genome of bread wheat, Triticum aestivum, and the technically difficult task of sequencing clusters of tandem repeats mean that the detailed organization of extended genomic regions containing 5S rRNA genes remains unclear. This is despite the recent progress made in wheat genomic sequencing. Using pyrosequencing of BAC clones, in this work we studied the organization of two distinct 5S rDNA-tagged regions of the 5BS chromosome of bread wheat. Three BAC-clones containing 5S rDNA were identified in the 5BS chromosome-specific BAC-library of Triticum aestivum. Using the results of pyrosequencing and assembling, we obtained six 5S rDNA- containing contigs with a total length of 140,417 bp, and two sets (pools) of individual 5S rDNA sequences belonging to separate, but closely located genomic regions on the 5BS chromosome. Both regions are characterized by the presence of approximately 70-80 copies of 5S rDNA, however, they are completely different in their structural organization. The first region contained highly diverged short-type 5S rDNA units that were disrupted by multiple insertions of transposable elements. The second region contained the more conserved long-type 5S rDNA, organized as a single tandem array. FISH using probes specific to both 5S rDNA unit types showed differences in the distribution and intensity of signals on the chromosomes of polyploid wheat species and their diploid progenitors. A detailed structural organization of two closely located 5S rDNA-tagged genomic regions on the 5BS chromosome of bread wheat has been established. These two regions differ in the organization of both 5S rDNA and the neighboring sequences comprised of transposable elements, implying different modes of evolution for these regions.

  6. Recent Southeast Asian domestication and Lapita dispersal of sacred male pseudohermaphroditic “tuskers” and hairless pigs of Vanuatu

    PubMed Central

    Lum, J. Koji; McIntyre, James K.; Greger, Douglas L.; Huffman, Kirk W.; Vilar, Miguel G.

    2006-01-01

    Recent analyses of global pig populations revealed strict correlations between mtDNA phylogenies and geographic locations. An exception was the monophyletic “Pacific clade” (PC) of pigs not previously linked to any specific location. We examined mtDNA sequences of two varieties of Vanuatu sacred pigs, the male pseudohermaphroditic Narave from the island of Malo (n = 9) and the hairless Kapia from the island of Tanna (n = 9), as well as control pigs (n = 21) from the islands of Malo, Tanna, and Epi and compared them with GenBank sequences to determine (i) the distribution of PC and introduced domestic lineages within Vanuatu, (ii) relationship between the Narave and Kapia, and (iii) origin of the PC. All of the Narave share two PC mtDNA sequences, one of which matches the sequence of a Narave collected in 1927, consistent with an unbroken maternal descent of these intersex pigs from the original pigs brought to Vanuatu 3,200 years ago. One-third of the Kapia share a single PC lineage also found in the Narave. The remaining Kapia lineages are associated with recently introduced, globally distributed domestic breeds. The predominant Narave lineage is also shared with two wild boars from Vietnam. These data suggest that PC pigs were recently domesticated within Southeast Asia and dispersed during the human colonization of Remote Oceania associated with the Lapita cultural complex. More extensive sampling of Southeast Asian wild boar diversity may refine the location of Pacific pig domestication and potentially the proximate homeland of the Lapita cultural complex. PMID:17088556

  7. The Pea light-independent photomorphogenesis1 Mutant Results from Partial Duplication of COP1 Generating an Internal Promoter and Producing Two Distinct Transcripts

    PubMed Central

    Sullivan, James A.; Gray, John C.

    2000-01-01

    The pea lip1 (light-independent photomorphogenesis1) mutant shows many of the characteristics of light-grown development when grown in continuous darkness. To investigate the identity of LIP1, cDNAs encoding the pea homolog of COP1, a repressor of photomorphogenesis identified in Arabidopsis, were isolated from wild-type and lip1 pea seedlings. lip1 seedlings contained a wild-type COP1 transcript as well as a larger COP1′ transcript that contained an internal in-frame duplication of 894 bp. The COP1′ transcript segregated with the lip1 phenotype in F2 seedlings and could be translated in vitro to produce a protein of ∼100 kD. The COP1 gene in lip1 peas contained a 7.5-kb duplication, consisting of exons 1 to 7 of the wild-type sequence, located 2.5 kb upstream of a region of genomic DNA identical to the wild-type COP1 DNA sequence. Transcription and splicing of the mutant COP1 gene was predicted to produce the COP1′ transcript, whereas transcription from an internal promoter in the 2.5-kb region of DNA located between the duplicated regions of COP1 would produce the wild-type COP1 transcript. The presence of small quantities of wild-type COP1 transcripts may reduce the severity of the phenotype produced by the mutated COP1′ protein. The genomic DNA sequences of the COP1 gene from wild-type and lip1 peas and the cDNA sequences of COP1 and COP1′ transcripts have been submitted to the EMBL database under the EMBL accession numbers AJ276591, AJ276592, AJ289773, and AJ289774, respectively. PMID:11041887

  8. The minisatellite of the GPI/AMF/NLK/MF gene: interspecies conservation and transcriptional activity.

    PubMed

    Williams, R R; Hassan-Walker, A F; Lavender, F L; Morgan, M; Faik, P; Ragoussis, J

    2001-05-16

    Minisatellites are tandemly repeated DNA sequences found throughout the genomes of all eukaryotes. They are regions often prone to instability and hence hypervariability; thus repeat unit sequence is generally not conserved beyond closely related species. We have studied the minisatellite located in intron 9 of the human glucose phosphate isomerase (GPI) gene (also known as neuroleukin, autocrine motility factor, maturation and differentiation factor) and have found, by Zoo blotting coupled with PCR amplification and DNA sequencing, that similar repeat units are present in seven other species of mammal. There is also evidence for the presence of the minisatellite in chicken. The repeat unit does not appear to be present at any other locus in these genomes. Minisatellite DNA has been reported to be involved in recombination activity, control of gene expression of nearby gene(s) (both transcriptional and translational), whilst others form protein coding regions. The high level of conservation exhibited by the GPI minisatellite, coupled with the unique location, strongly suggests a functional role. Our results from transient and stable transfections using luciferase reporter constructs have shown that the GPI minisatellite region can act to increase transcription from the SV40 promoter, CMV promoter and the human GPI promoter.

  9. Preferential 5-Methylcytosine Oxidation in the Linker Region of Reconstituted Positioned Nucleosomes by Tet1 Protein.

    PubMed

    Kizaki, Seiichiro; Zou, Tingting; Li, Yue; Han, Yong-Woon; Suzuki, Yuki; Harada, Yoshie; Sugiyama, Hiroshi

    2016-11-07

    Tet (ten-eleven translocation) family proteins oxidize 5-methylcytosine (mC) to 5-hydroxymethylcytosine (hmC), 5-formylcytosine (fC), and 5-carboxycytosine (caC), and are suggested to be involved in the active DNA demethylation pathway. In this study, we reconstituted positioned mononucleosomes using CpG-methylated 382 bp DNA containing the Widom 601 sequence and recombinant histone octamer, and subjected the nucleosome to treatment with Tet1 protein. The sites of oxidized methylcytosine were identified by bisulfite sequencing. We found that, for the oxidation reaction, Tet1 protein prefers mCs located in the linker region of the nucleosome compared with those located in the core region. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Mutations Affecting Expression of the rosy Locus in Drosophila melanogaster

    PubMed Central

    Lee, Chong Sung; Curtis, Daniel; McCarron, Margaret; Love, Carol; Gray, Mark; Bender, Welcome; Chovnick, Arthur

    1987-01-01

    The rosy locus in Drosophila melanogaster codes for the enzyme xanthine dehydrogenase (XDH). Previous studies defined a "control element" near the 5' end of the gene, where variant sites affected the amount of rosy mRNA and protein produced. We have determined the DNA sequence of this region from both genomic and cDNA clones, and from the ry+10 underproducer strain. This variant strain had many sequence differences, so that the site of the regulatory change could not be fixed. A mutagenesis was also undertaken to isolate new regulatory mutations. We induced 376 new mutations with 1-ethyl-1-nitrosourea (ENU) and screened them to isolate those that reduced the amount of XDH protein produced, but did not change the properties of the enzyme. Genetic mapping was used to find mutations located near the 5' end of the gene. DNA from each of seven mutants was cloned and sequenced through the 5' region. Mutant base changes were identified in all seven; they appear to affect splicing and translation of the rosy mRNA. In a related study (T. P. Keith et al. 1987), the genomic and cDNA sequences are extended through the 3' end of the gene; the combined sequences define the processing pattern of the rosy transcript and predict the amino acid sequence of XDH. PMID:3036645

  11. The FOXP2 forkhead domain binds to a variety of DNA sequences with different rates and affinities.

    PubMed

    Webb, Helen; Steeb, Olga; Blane, Ashleigh; Rotherham, Lia; Aron, Shaun; Machanick, Philip; Dirr, Heini; Fanucchi, Sylvia

    2017-07-01

    FOXP2 is a member of the P subfamily of FOX transcription factors, the DNA-binding domain of which is the winged helix forkhead domain (FHD). In this work we show that the FOXP2 FHD is able to bind to various DNA sequences, including a novel sequence identified in this work, with different affinities and rates as detected using surface plasmon resonance. Combining the experimental work with molecular docking, we show that high-affinity sequences remain bound to the protein for longer, form a greater number of interactions with the protein and induce a greater structural change in the protein than low-affinity sequences. We propose a binding model for the FOXP2 FHD that involves three types of binding sequence: low affinity sites which allow for rapid scanning of the genome by the protein in a partially unstructured state; moderate affinity sites which serve to locate the protein near target sites and high-affinity sites which secure the protein to the DNA and induce a conformational change necessary for functional binding and the possible initiation of downstream transcriptional events. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  12. Homeologous plastid DNA transformation in tobacco is mediated by multiple recombination events.

    PubMed Central

    Kavanagh, T A; Thanh, N D; Lao, N T; McGrath, N; Peter, S O; Horváth, E M; Dix, P J; Medgyesy, P

    1999-01-01

    Efficient plastid transformation has been achieved in Nicotiana tabacum using cloned plastid DNA of Solanum nigrum carrying mutations conferring spectinomycin and streptomycin resistance. The use of the incompletely homologous (homeologous) Solanum plastid DNA as donor resulted in a Nicotiana plastid transformation frequency comparable with that of other experiments where completely homologous plastid DNA was introduced. Physical mapping and nucleotide sequence analysis of the targeted plastid DNA region in the transformants demonstrated efficient site-specific integration of the 7.8-kb Solanum plastid DNA and the exclusion of the vector DNA. The integration of the cloned Solanum plastid DNA into the Nicotiana plastid genome involved multiple recombination events as revealed by the presence of discontinuous tracts of Solanum-specific sequences that were interspersed between Nicotiana-specific markers. Marked position effects resulted in very frequent cointegration of the nonselected peripheral donor markers located adjacent to the vector DNA. Data presented here on the efficiency and features of homeologous plastid DNA recombination are consistent with the existence of an active RecA-mediated, but a diminished mismatch, recombination/repair system in higher-plant plastids. PMID:10388829

  13. Nucleotide sequence analysis establishes the role of endogenous murine leukemia virus DNA segments in formation of recombinant mink cell focus-forming murine leukemia viruses.

    PubMed Central

    Khan, A S

    1984-01-01

    The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017

  14. DNA barcoding of gypsy moths from China (Lepidoptera: Erebidae) reveals new haplotypes and divergence patterns within gypsy moth subspecies

    Treesearch

    Fang Chen; Youqing Luo; Melody A. Keena; Ying Wu; Peng Wu; Juan Shi

    2015-01-01

    The gypsy moth from Asia (two subspecies) is considered a greater threat to North America than European gypsy moth, because of a broader host range and females being capable of flight. Variation within and among gypsy moths from China (nine locations), one of the native countries of Asian gypsy moth, were compared using DNA barcode sequences (658 bp of mtDNA cytochrome...

  15. [Identification and phylogenetic analysis of one strain of Lactobacillus delbrueckii subsp. bulgaricus separated from yoghourt].

    PubMed

    Wang, Chuan; Zhang, Chaowu; Pei, Xiaofang; Liu, Hengchuan

    2007-11-01

    For being further applied and studied, one strain of Lactobacillus delbrueckii subsp. bulgaricus (wch9901) separated from yoghourt which had been identified by phenotype characteristic analysis was identified by 16S rDNA and phylogenetic analyzed. The 16S rDNA of wch9901 was amplified with the genomic DNA of wch9901 as template, and the conservative sequences of the 16S rDNA as primers. Inserted 16S rDNA amplified into clonal vector pGEM-T under the function of T4 DNA ligase to construct recombined plasmid pGEM-wch9901 16S rDNA. The recombined plasmid was identified by restriction enzyme digestion, and the eligible plasmid was presented to sequencing company for DNA sequencing. Nucleic acid sequence was blast in GenBank and phylogenetic tree was constructed using neighbor-joining method of distance methods by Mega3.1 soft. Results of blastn showed that the homology of 16S rDNA of wch9901 with the 16S rDNA of Lactobacillus delbrueckii subsp. bulgaricus strains was higher than 96%. On the phylogenetic tree, wch9901 formed a separate branch and located between Lactobacillus delbrueckii subsp. bulgaricus LGM2 evolution branch and another evolution branch which was composed of Lactobacillus delbrueckii subsp. bulgaricus DL2 evolution cluster and Lactobacillus delbrueckii subsp. bulgaricus JSQ evolution cluster. The distance between wch9901 evolution branch and Lactobacillus delbrueckii subsp. bulgaricus LGM2 evolution branch was the closest. wch9901 belonged to Lactobacillus delbrueckii subsp. bulgaricus. wch9901 showed the closest evolution relationship to Lactobacillus delbrueckii subsp. bulgaricus LGM2.

  16. Structural insight into the specificity of the B3 DNA-binding domains provided by the co-crystal structure of the C-terminal fragment of BfiI restriction enzyme

    PubMed Central

    Golovenko, Dmitrij; Manakova, Elena; Zakrys, Linas; Zaremba, Mindaugas; Sasnauskas, Giedrius; Gražulis, Saulius; Siksnys, Virginijus

    2014-01-01

    The B3 DNA-binding domains (DBDs) of plant transcription factors (TF) and DBDs of EcoRII and BfiI restriction endonucleases (EcoRII-N and BfiI-C) share a common structural fold, classified as the DNA-binding pseudobarrel. The B3 DBDs in the plant TFs recognize a diverse set of target sequences. The only available co-crystal structure of the B3-like DBD is that of EcoRII-N (recognition sequence 5′-CCTGG-3′). In order to understand the structural and molecular mechanisms of specificity of B3 DBDs, we have solved the crystal structure of BfiI-C (recognition sequence 5′-ACTGGG-3′) complexed with 12-bp cognate oligoduplex. Structural comparison of BfiI-C–DNA and EcoRII-N–DNA complexes reveals a conserved DNA-binding mode and a conserved pattern of interactions with the phosphodiester backbone. The determinants of the target specificity are located in the loops that emanate from the conserved structural core. The BfiI-C–DNA structure presented here expands a range of templates for modeling of the DNA-bound complexes of the B3 family of plant TFs. PMID:24423868

  17. Complete mitochondrial DNA sequence of a tadpole shrimp (Triops cancriformis) and analysis of museum samples.

    PubMed

    Umetsu, Kazuo; Iwabuchi, Naruki; Yuasa, Isao; Saitou, Naruya; Clark, Paul F; Boxshall, Geoff; Osawa, Motoki; Igarashi, Keiji

    2002-12-01

    The complete mitochondrial DNA (mtNDA) of the tadpole shrimp Triops cancriformis was sequenced. The sequence consisted of 15,101 bp with an A+T content of 69%. Its gene arrangement was identical with those sequences of the water flea (Daphnia pulex) and giant tiger prawn (Penaeus monodon), whereas it differed from that of the brine shrimp (Artemia franciscana) in the arrangement of its genes for tRNAs. Phylogenetic analysis revealed T. cancriformis to be more closely related to the water flea than to the brine shrimp and giant tiger prawn. We also compared the 16S rRNA sequences of five formalin-fixed tadpole shrimps that had been collected in five different locations and stored in a museum. The sequence divergence was in the range of 0-1.51%, suggesting that those samples were closely related to each other.

  18. Potential role of DNA methylation as a facilitator of target search processes for transcription factors through interplay with methyl-CpG-binding proteins.

    PubMed

    Kemme, Catherine A; Marquez, Rolando; Luu, Ross H; Iwahara, Junji

    2017-07-27

    Eukaryotic genomes contain numerous non-functional high-affinity sequences for transcription factors. These sequences potentially serve as natural decoys that sequester transcription factors. We have previously shown that the presence of sequences similar to the target sequence could substantially impede association of the transcription factor Egr-1 with its targets. In this study, using a stopped-flow fluorescence method, we examined the kinetic impact of DNA methylation of decoys on the search process of the Egr-1 zinc-finger protein. We analyzed its association with an unmethylated target site on fluorescence-labeled DNA in the presence of competitor DNA duplexes, including Egr-1 decoys. DNA methylation of decoys alone did not affect target search kinetics. In the presence of the MeCP2 methyl-CpG-binding domain (MBD), however, DNA methylation of decoys substantially (∼10-30-fold) accelerated the target search process of the Egr-1 zinc-finger protein. This acceleration did not occur when the target was also methylated. These results suggest that when decoys are methylated, MBD proteins can block them and thereby allow Egr-1 to avoid sequestration in non-functional locations. This effect may occur in vivo for DNA methylation outside CpG islands (CGIs) and could facilitate localization of some transcription factors within regulatory CGIs, where DNA methylation is rare. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. A septal chromosome segregator protein evolved into a conjugative DNA-translocator protein

    PubMed Central

    Sepulveda, Edgardo; Vogelmann, Jutta

    2011-01-01

    Streptomycetes, Gram-positive soil bacteria well known for the production of antibiotics feature a unique conjugative DNA transfer system. In contrast to classical conjugation which is characterized by the secretion of a pilot protein covalently linked to a single-stranded DNA molecule, in Streptomyces a double-stranded DNA molecule is translocated during conjugative transfer. This transfer involves a single plasmid encoded protein, TraB. A detailed biochemical and biophysical characterization of TraB, revealed a close relationship to FtsK, mediating chromosome segregation during bacterial cell division. TraB translocates plasmid DNA by recognizing 8-bp direct repeats located in a specific plasmid region clt. Similar sequences accidentally also occur on chromosomes and have been shown to be bound by TraB. We suggest that TraB mobilizes chromosomal genes by the interaction with these chromosomal clt-like sequences not relying on the integration of the conjugative plasmid into the chromosome. PMID:22479692

  20. Improved PCR-Based Detection of Soil Transmitted Helminth Infections Using a Next-Generation Sequencing Approach to Assay Design.

    PubMed

    Pilotte, Nils; Papaiakovou, Marina; Grant, Jessica R; Bierwert, Lou Ann; Llewellyn, Stacey; McCarthy, James S; Williams, Steven A

    2016-03-01

    The soil transmitted helminths are a group of parasitic worms responsible for extensive morbidity in many of the world's most economically depressed locations. With growing emphasis on disease mapping and eradication, the availability of accurate and cost-effective diagnostic measures is of paramount importance to global control and elimination efforts. While real-time PCR-based molecular detection assays have shown great promise, to date, these assays have utilized sub-optimal targets. By performing next-generation sequencing-based repeat analyses, we have identified high copy-number, non-coding DNA sequences from a series of soil transmitted pathogens. We have used these repetitive DNA elements as targets in the development of novel, multi-parallel, PCR-based diagnostic assays. Utilizing next-generation sequencing and the Galaxy-based RepeatExplorer web server, we performed repeat DNA analysis on five species of soil transmitted helminths (Necator americanus, Ancylostoma duodenale, Trichuris trichiura, Ascaris lumbricoides, and Strongyloides stercoralis). Employing high copy-number, non-coding repeat DNA sequences as targets, novel real-time PCR assays were designed, and assays were tested against established molecular detection methods. Each assay provided consistent detection of genomic DNA at quantities of 2 fg or less, demonstrated species-specificity, and showed an improved limit of detection over the existing, proven PCR-based assay. The utilization of next-generation sequencing-based repeat DNA analysis methodologies for the identification of molecular diagnostic targets has the ability to improve assay species-specificity and limits of detection. By exploiting such high copy-number repeat sequences, the assays described here will facilitate soil transmitted helminth diagnostic efforts. We recommend similar analyses when designing PCR-based diagnostic tests for the detection of other eukaryotic pathogens.

  1. Centromere location in Arabidopsis is unaltered by extreme divergence in CENH3 protein sequence.

    PubMed

    Maheshwari, Shamoni; Ishii, Takayoshi; Brown, C Titus; Houben, Andreas; Comai, Luca

    2017-03-01

    During cell division, spindle fibers attach to chromosomes at centromeres. The DNA sequence at regional centromeres is fast evolving with no conserved genetic signature for centromere identity. Instead CENH3, a centromere-specific histone H3 variant, is the epigenetic signature that specifies centromere location across both plant and animal kingdoms. Paradoxically, CENH3 is also adaptively evolving. An ongoing question is whether CENH3 evolution is driven by a functional relationship with the underlying DNA sequence. Here, we demonstrate that despite extensive protein sequence divergence, CENH3 histones from distant species assemble centromeres on the same underlying DNA sequence. We first characterized the organization and diversity of centromere repeats in wild-type Arabidopsis thaliana We show that A. thaliana CENH3-containing nucleosomes exhibit a strong preference for a unique subset of centromeric repeats. These sequences are largely missing from the genome assemblies and represent the youngest and most homogeneous class of repeats. Next, we tested the evolutionary specificity of this interaction in a background in which the native A. thaliana CENH3 is replaced with CENH3s from distant species. Strikingly, we find that CENH3 from Lepidium oleraceum and Zea mays , although specifying epigenetically weaker centromeres that result in genome elimination upon outcrossing, show a binding pattern on A. thaliana centromere repeats that is indistinguishable from the native CENH3. Our results demonstrate positional stability of a highly diverged CENH3 on independently evolved repeats, suggesting that the sequence specificity of centromeres is determined by a mechanism independent of CENH3. © 2017 Maheshwari et al.; Published by Cold Spring Harbor Laboratory Press.

  2. Precise assignment of the heavy-strand promoter of mouse mitochondrial DNA: cognate start sites are not required for transcriptional initiation.

    PubMed Central

    Chang, D D; Clayton, D A

    1986-01-01

    Transcription of the heavy strand of mouse mitochondrial DNA starts from two closely spaced, distinct sites located in the displacement loop region of the genome. We report here an analysis of regulatory sequences required for faithful transcription from these two sites. Data obtained from in vitro assays demonstrated that a 51-base-pair region, encompassing nucleotides -40 to +11 of the downstream start site, contains sufficient information for accurate transcription from both start sites. Deletion of the 3' flanking sequences, including one or both start sites to -17, resulted in the initiation of transcription by the mitochondrial RNA polymerase from alternative sites within vector DNA sequences. This feature places the mouse heavy-strand promoter uniquely among other known mitochondrial promoters, all of which absolutely require cognate start sites for transcription. Comparison of the heavy-strand promoter with those of other vertebrate mitochondrial DNAs revealed a remarkably high rate of sequence divergence among species. Images PMID:3785226

  3. Modeling kinetic rate variation in third generation DNA sequencing data to detect putative modifications to DNA bases

    PubMed Central

    Schadt, Eric E.; Banerjee, Onureena; Fang, Gang; Feng, Zhixing; Wong, Wing H.; Zhang, Xuegong; Kislyuk, Andrey; Clark, Tyson A.; Luong, Khai; Keren-Paz, Alona; Chess, Andrew; Kumar, Vipin; Chen-Plotkin, Alice; Sondheimer, Neal; Korlach, Jonas; Kasarskis, Andrew

    2013-01-01

    Current generation DNA sequencing instruments are moving closer to seamlessly sequencing genomes of entire populations as a routine part of scientific investigation. However, while significant inroads have been made identifying small nucleotide variation and structural variations in DNA that impact phenotypes of interest, progress has not been as dramatic regarding epigenetic changes and base-level damage to DNA, largely due to technological limitations in assaying all known and unknown types of modifications at genome scale. Recently, single-molecule real time (SMRT) sequencing has been reported to identify kinetic variation (KV) events that have been demonstrated to reflect epigenetic changes of every known type, providing a path forward for detecting base modifications as a routine part of sequencing. However, to date no statistical framework has been proposed to enhance the power to detect these events while also controlling for false-positive events. By modeling enzyme kinetics in the neighborhood of an arbitrary location in a genomic region of interest as a conditional random field, we provide a statistical framework for incorporating kinetic information at a test position of interest as well as at neighboring sites that help enhance the power to detect KV events. The performance of this and related models is explored, with the best-performing model applied to plasmid DNA isolated from Escherichia coli and mitochondrial DNA isolated from human brain tissue. We highlight widespread kinetic variation events, some of which strongly associate with known modification events, while others represent putative chemically modified sites of unknown types. PMID:23093720

  4. Modeling kinetic rate variation in third generation DNA sequencing data to detect putative modifications to DNA bases.

    PubMed

    Schadt, Eric E; Banerjee, Onureena; Fang, Gang; Feng, Zhixing; Wong, Wing H; Zhang, Xuegong; Kislyuk, Andrey; Clark, Tyson A; Luong, Khai; Keren-Paz, Alona; Chess, Andrew; Kumar, Vipin; Chen-Plotkin, Alice; Sondheimer, Neal; Korlach, Jonas; Kasarskis, Andrew

    2013-01-01

    Current generation DNA sequencing instruments are moving closer to seamlessly sequencing genomes of entire populations as a routine part of scientific investigation. However, while significant inroads have been made identifying small nucleotide variation and structural variations in DNA that impact phenotypes of interest, progress has not been as dramatic regarding epigenetic changes and base-level damage to DNA, largely due to technological limitations in assaying all known and unknown types of modifications at genome scale. Recently, single-molecule real time (SMRT) sequencing has been reported to identify kinetic variation (KV) events that have been demonstrated to reflect epigenetic changes of every known type, providing a path forward for detecting base modifications as a routine part of sequencing. However, to date no statistical framework has been proposed to enhance the power to detect these events while also controlling for false-positive events. By modeling enzyme kinetics in the neighborhood of an arbitrary location in a genomic region of interest as a conditional random field, we provide a statistical framework for incorporating kinetic information at a test position of interest as well as at neighboring sites that help enhance the power to detect KV events. The performance of this and related models is explored, with the best-performing model applied to plasmid DNA isolated from Escherichia coli and mitochondrial DNA isolated from human brain tissue. We highlight widespread kinetic variation events, some of which strongly associate with known modification events, while others represent putative chemically modified sites of unknown types.

  5. Genome-wide profiling of DNA-binding proteins using barcode-based multiplex Solexa sequencing.

    PubMed

    Raghav, Sunil Kumar; Deplancke, Bart

    2012-01-01

    Chromatin immunoprecipitation (ChIP) is a commonly used technique to detect the in vivo binding of proteins to DNA. ChIP is now routinely paired to microarray analysis (ChIP-chip) or next-generation sequencing (ChIP-Seq) to profile the DNA occupancy of proteins of interest on a genome-wide level. Because ChIP-chip introduces several biases, most notably due to the use of a fixed number of probes, ChIP-Seq has quickly become the method of choice as, depending on the sequencing depth, it is more sensitive, quantitative, and provides a greater binding site location resolution. With the ever increasing number of reads that can be generated per sequencing run, it has now become possible to analyze several samples simultaneously while maintaining sufficient sequence coverage, thus significantly reducing the cost per ChIP-Seq experiment. In this chapter, we provide a step-by-step guide on how to perform multiplexed ChIP-Seq analyses. As a proof-of-concept, we focus on the genome-wide profiling of RNA Polymerase II as measuring its DNA occupancy at different stages of any biological process can provide insights into the gene regulatory mechanisms involved. However, the protocol can also be used to perform multiplexed ChIP-Seq analyses of other DNA-binding proteins such as chromatin modifiers and transcription factors.

  6. From famine to feast? Selecting nuclear DNA sequence loci for plant species-level phylogeny reconstruction

    PubMed Central

    Hughes, Colin E; Eastwood, Ruth J; Donovan Bailey, C

    2005-01-01

    Phylogenetic analyses of DNA sequences have prompted spectacular progress in assembling the Tree of Life. However, progress in constructing phylogenies among closely related species, at least for plants, has been less encouraging. We show that for plants, the rapid accumulation of DNA characters at higher taxonomic levels has not been matched by conventional sequence loci at the species level, leaving a lack of well-resolved gene trees that is hindering investigations of many fundamental questions in plant evolutionary biology. The most popular approach to address this problem has been to use low-copy nuclear genes as a source of DNA sequence data. However, this has had limited success because levels of variation among nuclear intron sequences across groups of closely related species are extremely variable and generally lower than conventionally used loci, and because no universally useful low-copy nuclear DNA sequence loci have been developed. This suggests that solutions will, for the most part, be lineage-specific, prompting a move away from ‘universal’ gene thinking for species-level phylogenetics. The benefits and limitations of alternative approaches to locate more variable nuclear loci are discussed and the potential of anonymous non-genic nuclear loci is highlighted. Given the virtually unlimited number of loci that can be generated using these new approaches, it is clear that effective screening will be critical for efficient selection of the most informative loci. Strategies for screening are outlined. PMID:16553318

  7. Interaction of the alpha-subunit of Escherichia coli RNA polymerase with DNA: rigid body nature of the protein-DNA contact.

    PubMed

    Heyduk, E; Baichoo, N; Heyduk, T

    2001-11-30

    The alpha-subunit of Escherichia coli RNA polymerase plays an important role in the activity of many promoters by providing a direct protein-DNA contact with a specific sequence (UP element) located upstream of the core promoter sequence. To obtain insight into the nature of thermodynamic forces involved in the formation of this protein-DNA contact, the binding of the alpha-subunit of E. coli RNA polymerase to a fluorochrome-labeled DNA fragment containing the rrnB P1 promoter UP element sequence was quantitatively studied using fluorescence polarization. The alpha dimer and DNA formed a 1:1 complex in solution. Complex formation at 25 degrees C was enthalpy-driven, the binding was accompanied by a net release of 1-2 ions, and no significant specific ion effects were observed. The van't Hoff plot of temperature dependence of binding was linear suggesting that the heat capacity change (Deltac(p)) was close to zero. Protein footprinting with hydroxyradicals showed that the protein did not change its conformation upon protein-DNA contact formation. No conformational changes in the DNA molecule were detected by CD spectroscopy upon protein-DNA complex formation. The thermodynamic characteristics of the binding together with the lack of significant conformational changes in the protein and in the DNA suggested that the alpha-subunit formed a rigid body-like contact with the DNA in which a tight complementary recognition interface between alpha-subunit and DNA was not formed.

  8. DNA sequence chromatogram browsing using JAVA and CORBA.

    PubMed

    Parsons, J D; Buehler, E; Hillier, L

    1999-03-01

    DNA sequence chromatograms (traces) are the primary data source for all large-scale genomic and expressed sequence tags (ESTs) sequencing projects. Access to the sequencing trace assists many later analyses, for example contig assembly and polymorphism detection, but obtaining and using traces is problematic. Traces are not collected and published centrally, they are much larger than the base calls derived from them, and viewing them requires the interactivity of a local graphical client with local data. To provide efficient global access to DNA traces, we developed a client/server system based on flexible Java components integrated into other applications including an applet for use in a WWW browser and a stand-alone trace viewer. Client/server interaction is facilitated by CORBA middleware which provides a well-defined interface, a naming service, and location independence. [The software is packaged as a Jar file available from the following URL: http://www.ebi.ac.uk/jparsons. Links to working examples of the trace viewers can be found at http://corba.ebi.ac.uk/EST. All the Washington University mouse EST traces are available for browsing at the same URL.

  9. Recombinant antibody mediated delivery of organelle-specific DNA pH sensors along endocytic pathways

    NASA Astrophysics Data System (ADS)

    Modi, Souvik; Halder, Saheli; Nizak, Clément; Krishnan, Yamuna

    2013-12-01

    DNA has been used to build nanomachines with potential in cellulo and in vivo applications. However their different in cellulo applications are limited by the lack of generalizable strategies to deliver them to precise intracellular locations. Here we describe a new molecular design of DNA pH sensors with response times that are nearly 20 fold faster. Further, by changing the sequence of the pH sensitive domain of the DNA sensor, we have been able to tune their pH sensitive regimes and create a family of DNA sensors spanning ranges from pH 4 to 7.6. To enable a generalizable targeting methodology, this new sensor design also incorporates a `handle' domain. We have identified, using a phage display screen, a set of three recombinant antibodies (scFv) that bind sequence specifically to the handle domain. Sequence analysis of these antibodies revealed several conserved residues that mediate specific interactions with the cognate DNA duplex. We also found that all three scFvs clustered into different branches indicating that their specificity arises from mutations in key residues. When one of these scFvs is fused to a membrane protein (furin) that traffics via the cell surface, the scFv-furin chimera binds the `handle' and ferries a family of DNA pH sensors along the furin endocytic pathway. Post endocytosis, all DNA nanodevices retain their functionality in cellulo and provide spatiotemporal pH maps of retrogradely trafficking furin inside living cells. This new molecular technology of DNA-scFv-protein chimeras can be used to site-specifically complex DNA nanostructures for bioanalytical applications.DNA has been used to build nanomachines with potential in cellulo and in vivo applications. However their different in cellulo applications are limited by the lack of generalizable strategies to deliver them to precise intracellular locations. Here we describe a new molecular design of DNA pH sensors with response times that are nearly 20 fold faster. Further, by changing the sequence of the pH sensitive domain of the DNA sensor, we have been able to tune their pH sensitive regimes and create a family of DNA sensors spanning ranges from pH 4 to 7.6. To enable a generalizable targeting methodology, this new sensor design also incorporates a `handle' domain. We have identified, using a phage display screen, a set of three recombinant antibodies (scFv) that bind sequence specifically to the handle domain. Sequence analysis of these antibodies revealed several conserved residues that mediate specific interactions with the cognate DNA duplex. We also found that all three scFvs clustered into different branches indicating that their specificity arises from mutations in key residues. When one of these scFvs is fused to a membrane protein (furin) that traffics via the cell surface, the scFv-furin chimera binds the `handle' and ferries a family of DNA pH sensors along the furin endocytic pathway. Post endocytosis, all DNA nanodevices retain their functionality in cellulo and provide spatiotemporal pH maps of retrogradely trafficking furin inside living cells. This new molecular technology of DNA-scFv-protein chimeras can be used to site-specifically complex DNA nanostructures for bioanalytical applications. Electronic supplementary information (ESI) available: Detailed description of all oligonucleotide sequences used in this study; list of figures that support claims from the main text. Mainly these show sensor sequences, phage display results, scFv purification and binding data, cell images clamped at different pH and co-localization studies with endocytic tracers. See DOI: 10.1039/c3nr03769j

  10. Influence of quasi-specific sites on kinetics of target DNA search by a sequence-specific DNA-binding protein.

    PubMed

    Kemme, Catherine A; Esadze, Alexandre; Iwahara, Junji

    2015-11-10

    Functions of transcription factors require formation of specific complexes at particular sites in cis-regulatory elements of genes. However, chromosomal DNA contains numerous sites that are similar to the target sequences recognized by transcription factors. The influence of such "quasi-specific" sites on functions of the transcription factors is not well understood at present by experimental means. In this work, using fluorescence methods, we have investigated the influence of quasi-specific DNA sites on the efficiency of target location by the zinc finger DNA-binding domain of the inducible transcription factor Egr-1, which recognizes a 9 bp sequence. By stopped-flow assays, we measured the kinetics of Egr-1's association with a target site on 143 bp DNA in the presence of various competitor DNAs, including nonspecific and quasi-specific sites. The presence of quasi-specific sites on competitor DNA significantly decelerated the target association by the Egr-1 protein. The impact of the quasi-specific sites depended strongly on their affinity, their concentration, and the degree of their binding to the protein. To quantitatively describe the kinetic impact of the quasi-specific sites, we derived an analytical form of the apparent kinetic rate constant for the target association and used it for fitting to the experimental data. Our kinetic data with calf thymus DNA as a competitor suggested that there are millions of high-affinity quasi-specific sites for Egr-1 among the 3 billion bp of genomic DNA. This study quantitatively demonstrates that naturally abundant quasi-specific sites on DNA can considerably impede the target search processes of sequence-specific DNA-binding proteins.

  11. Influence of Quasi-Specific Sites on Kinetics of Target DNA Search by a Sequence-Specific DNA-Binding Protein

    PubMed Central

    2015-01-01

    Functions of transcription factors require formation of specific complexes at particular sites in cis-regulatory elements of genes. However, chromosomal DNA contains numerous sites that are similar to the target sequences recognized by transcription factors. The influence of such “quasi-specific” sites on functions of the transcription factors is not well understood at present by experimental means. In this work, using fluorescence methods, we have investigated the influence of quasi-specific DNA sites on the efficiency of target location by the zinc finger DNA-binding domain of the inducible transcription factor Egr-1, which recognizes a 9 bp sequence. By stopped-flow assays, we measured the kinetics of Egr-1’s association with a target site on 143 bp DNA in the presence of various competitor DNAs, including nonspecific and quasi-specific sites. The presence of quasi-specific sites on competitor DNA significantly decelerated the target association by the Egr-1 protein. The impact of the quasi-specific sites depended strongly on their affinity, their concentration, and the degree of their binding to the protein. To quantitatively describe the kinetic impact of the quasi-specific sites, we derived an analytical form of the apparent kinetic rate constant for the target association and used it for fitting to the experimental data. Our kinetic data with calf thymus DNA as a competitor suggested that there are millions of high-affinity quasi-specific sites for Egr-1 among the 3 billion bp of genomic DNA. This study quantitatively demonstrates that naturally abundant quasi-specific sites on DNA can considerably impede the target search processes of sequence-specific DNA-binding proteins. PMID:26502071

  12. Detection of environmental DNA of Bigheaded Carps in samples collected from selected locations in the St. Croix River and in the Mississippi River

    USGS Publications Warehouse

    Amberg, Jon J.; McCalla, S. Grace; Miller, Loren; Sorensen, Peter; Gaikowski, Mark P.

    2013-01-01

    The use of molecular methods, such as the detection of environmental deoxyribonucleic acid (eDNA), have become an increasingly popular tool in surveillance programs that monitor for the presence of invasive species in aquatic systems. One early application of these methods in aquatic systems was surveillance for DNA of Asian carps (specifically bighead carp Hypophthalmichthys nobilis and silver carp H. molitrix) in water samples taken from the Chicago Area Waterway System. The ability to identify DNA of a species in an environmental sample presents a potentially powerful tool because these sensitive analyses can presumably detect the presence of DNA in water even when the species is not abundant or are difficult to catch or monitor with traditional gear. Prior to research presented in this report, an initial eDNA surveillance effort was completed in selected locations in the Upper Mississippi and St. Croix Rivers in 2011 after the capture of a bighead carp in the St. Croix River near Prescott, WI. Data presented in this report were developed to duplicate the 2011 monitoring results from the Upper Mississippi and St. Croix Rivers and to provide critical insight into the technique to inform future work in these locations. We specifically sought to understand the potential confounding effects of other pathways of eDNA movement (e.g., fish-eating birds, watercraft) on the variation in background DNA by collecting water samples from (1) sites within the St. Croix River and the upper Mississippi River where the DNA of silver carp was previously detected, (2) sites considered to be free of Asian carp, and (3) a site known to have a large population of Asian carp. We also sought to establish a baseline Asian carp eDNA signature to which future eDNA sampling efforts could be compared. All samples taken as part of this effort were processed using conventional polymerase chain reaction (PCR) according to procedures outlined in the U.S. Army Corps of Engineers Quality Assurance Project Plan with minor deviations designed to enhance the rigor of our data. Presence of DNA in PCR-positive samples was confirmed by Sanger sequencing (forward and reverse) and sequences were considered positive only if sequences (forward and reverse) of ≥150 base pairs had a match of ≥95% to those of published sequences for bighead carp or silver carp. The DNA of bighead carp and silver carp was not detected in environmental samples collected above and below St. Croix Falls Dam on the St. Croix River, above and below the Coon Rapids Dam and below Lock and Dam 1 on the Upper Mississippi River, and from two negative control lakes, Square Lake and Lake Riley. The DNA of silver carp was detected in environmental samples collected below Lock and Dam 19 at Keokuk, Iowa, a reach of the river with high silver carp abundance. The portion (68%) of environmental samples taken below Lock and Dam 19 that were determined to contain the DNA of silver carp was similar to that reported in the scientific literature for other abundant species. The DNA of bighead carp, however, was not detected in environmental samples collected below Lock and Dam 19, a reach of the river known to have bighead carp. Previous reported detections of the DNA of silver carp in samples collected in 2011 were not replicated in this study. Additional analyses are planned for the DNA extracted from the samples collected in 2012. Those analyses may provide additional information regarding the lack of amplification of bighead carp DNA and the lengths of the sequences of silver carp DNA present in samples taken below Lock and Dam 19. These additional analyses may help inform the use of eDNA monitoring in large, complex systems like the Mississippi River.

  13. Transposable elements and G-quadruplexes.

    PubMed

    Kejnovsky, Eduard; Tokan, Viktor; Lexa, Matej

    2015-09-01

    A significant part of eukaryotic genomes is formed by transposable elements (TEs) containing not only genes but also regulatory sequences. Some of the regulatory sequences located within TEs can form secondary structures like hairpins or three-stranded (triplex DNA) and four-stranded (quadruplex DNA) conformations. This review focuses on recent evidence showing that G-quadruplex-forming sequences in particular are often present in specific parts of TEs in plants and humans. We discuss the potential role of these structures in the TE life cycle as well as the impact of G-quadruplexes on replication, transcription, translation, chromatin status, and recombination. The aim of this review is to emphasize that TEs may serve as vehicles for the genomic spread of G-quadruplexes. These non-canonical DNA structures and their conformational switches may constitute another regulatory system that, together with small and long non-coding RNA molecules and proteins, contribute to the complex cellular network resulting in the large diversity of eukaryotes.

  14. Purification and DNA binding properties of the blaI gene product, repressor for the beta-lactamase gene, blaP, of Bacillus licheniformis.

    PubMed Central

    Grossman, M J; Lampen, J O

    1987-01-01

    The location of the repressor gene, blaI, for the beta-lactamase gene blaP of Bacillus licheniformis 749, on the 5' side of blaP, was confirmed by sequencing the bla region of the constitutive mutant 749/C. An amber stop codon, likely to result in a nonfunctional truncated repressor, was found at codon 32 of the 128 codon blaI open reading frame (ORF) located 5' to blaP. In order to study the DNA binding activity of the repressor, the structural gene for blaI, from strain 749, with its ribosome binding site was expressed using a two plasmid T7 RNA polymerase/promotor system (S. Tabor and C. C. Richardson. Proc. Natl. Acad. Sci. 82, 1074-1078 (1985). Heat induction of this system in Escherichia coli K38 resulted in the production of BlaI as 5-10% of the soluble cell protein. Repressor protein was then purified by ammonium sulfate fractionation and cation exchange chromatography. The sequence of the N-terminal 28 amino acid residues was determined and was as predicted from the DNA. Binding of BlaI to DNA was detected by the slower migration of protein DNA complexes during polyacrylamide gel electrophoresis. BlaI was shown to selectively bind DNA fragments carrying the promoter regions of blaI and blaP. Images PMID:3498148

  15. Mutually Exclusive Formation of G-Quadruplex and i-Motif Is a General Phenomenon Governed by Steric Hindrance in Duplex DNA.

    PubMed

    Cui, Yunxi; Kong, Deming; Ghimire, Chiran; Xu, Cuixia; Mao, Hanbin

    2016-04-19

    G-Quadruplex and i-motif are tetraplex structures that may form in opposite strands at the same location of a duplex DNA. Recent discoveries have indicated that the two tetraplex structures can have conflicting biological activities, which poses a challenge for cells to coordinate. Here, by performing innovative population analysis on mechanical unfolding profiles of tetraplex structures in double-stranded DNA, we found that formations of G-quadruplex and i-motif in the two complementary strands are mutually exclusive in a variety of DNA templates, which include human telomere and promoter fragments of hINS and hTERT genes. To explain this behavior, we placed G-quadruplex- and i-motif-hosting sequences in an offset fashion in the two complementary telomeric DNA strands. We found simultaneous formation of the G-quadruplex and i-motif in opposite strands, suggesting that mutual exclusivity between the two tetraplexes is controlled by steric hindrance. This conclusion was corroborated in the BCL-2 promoter sequence, in which simultaneous formation of two tetraplexes was observed due to possible offset arrangements between G-quadruplex and i-motif in opposite strands. The mutual exclusivity revealed here sets a molecular basis for cells to efficiently coordinate opposite biological activities of G-quadruplex and i-motif at the same dsDNA location.

  16. Aquatic environmental DNA detects seasonal fish abundance and habitat preference in an urban estuary

    PubMed Central

    Soboleva, Lyubov; Charlop-Powers, Zachary

    2017-01-01

    The difficulty of censusing marine animal populations hampers effective ocean management. Analyzing water for DNA traces shed by organisms may aid assessment. Here we tested aquatic environmental DNA (eDNA) as an indicator of fish presence in the lower Hudson River estuary. A checklist of local marine fish and their relative abundance was prepared by compiling 12 traditional surveys conducted between 1988–2015. To improve eDNA identification success, 31 specimens representing 18 marine fish species were sequenced for two mitochondrial gene regions, boosting coverage of the 12S eDNA target sequence to 80% of local taxa. We collected 76 one-liter shoreline surface water samples at two contrasting estuary locations over six months beginning in January 2016. eDNA was amplified with vertebrate-specific 12S primers. Bioinformatic analysis of amplified DNA, using a reference library of GenBank and our newly generated 12S sequences, detected most (81%) locally abundant or common species and relatively few (23%) uncommon taxa, and corresponded to seasonal presence and habitat preference as determined by traditional surveys. Approximately 2% of fish reads were commonly consumed species that are rare or absent in local waters, consistent with wastewater input. Freshwater species were rarely detected despite Hudson River inflow. These results support further exploration and suggest eDNA will facilitate fine-scale geographic and temporal mapping of marine fish populations at relatively low cost. PMID:28403183

  17. Preferential cleavage sites for Sau3A restriction endonuclease in human ribosomal DNA.

    PubMed

    Kupriyanova, N S; Kirilenko, P M; Netchvolodov, K K; Ryskov, A P

    2000-07-21

    Previous studies of cloned ribosomal DNA (rDNA) variants isolated from the cosmid library of human chromosome 13 have revealed some disproportion in representativity of different rDNA regions (N. S. Kupriyanova, K. K. Netchvolodov, P. M. Kirilenko, B. I. Kapanadze, N. K. Yankovsky, and A. P. Ryskov, Mol. Biol. 30, 51-60, 1996). Here we show nonrandom cleavage of human rDNA with Sau3A or its isoshizomer MboI under mild hydrolysis conditions. The hypersensitive cleavage sites were found to be located in the ribosomal intergenic spacer (rIGS), especially in the regions of about 5-5.5 and 11 kb upstream of the rRNA transcription start point. This finding is based on sequencing mapping of the rDNA insert ends in randomly selected cosmid clones of human chromosome 13 and on the data of digestion kinetics of cloned and noncloned human genomic rDNA with Sau3A and MboI. The results show that a methylation status and superhelicity state of the rIGS have no effect on cleavage site sensitivity. It is interesting that all primary cleavage sites are adjacent to or entering into Alu or Psi cdc 27 retroposons of the rIGS suggesting a possible role of neighboring sequences in nuclease accessibility. The results explain nonequal representation of rDNA sequences in the human genomic DNA library used for this study. Copyright 2000 Academic Press.

  18. Effect of NaeI-L43K mutation on protein dynamics and DNA conformation: Insights from molecular dynamics simulations.

    PubMed

    Ramachandrakurup, Sreelakshmi; Ramakrishnan, Vigneshwar

    2017-09-01

    Protein-DNA interactions are an important class of biomolecular interactions inside the cell. Delineating the mechanisms of protein-DNA interactions and more specifically, how proteins search and bind to their specific cognate sequences has been the quest of many in the scientific community. Restriction enzymes have served as useful model systems to this end. In this work, we have investigated using molecular dynamics simulations the effect of L43K mutation on NaeI, a type IIE restriction enzyme. NaeI has two domains, the Topo and the Endo domains, each binding to identical strands of DNA sequences (GCCGGC) 2 . The binding of the DNA to the Topo domain is thought to enhance the binding and cleavage of DNA at the Endo domain. Interestingly, it has been found that the mutation of an amino acid that is distantly-located from the DNA cleavage site (L43K) converts the restriction endonuclease to a topoisomerase. Our investigations reveal that the L43K mutation not only induces local structural changes (as evidenced by changes in hydrogen bond propensities and differences in the percentage of secondary structure assignments of the residues in the ligase-like domain) but also alters the overall protein dynamics and DNA conformation which probably leads to the loss of specific cleavage of the recognition site. In a larger context, our study underscores the importance of considering the role of distantly-located amino acids in understanding protein-DNA interactions. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Structure of genes and an insertion element in the methane producing archaebacterium Methanobrevibacter smithii.

    PubMed

    Hamilton, P T; Reeve, J N

    1985-01-01

    DNA fragments cloned from the methanogenic archaebacterium Methanobrevibacter smithii which complement mutations in the purE and proC genes of E. coli have been sequenced. Sequence analyses, transposon mutagenesis and expression in E. coli minicells indicate that purE and proC complementations result from the synthesis of M. smithii polypeptides with molecular weights of 36,697 and 27,836 respectively. The encoding genes appear to be located in operons. The M. smithii genome contains 69% A/T basepairs (bp) which is reflected in unusual codon usages and intergenic regions containing approximately 85% A/T bp. An insertion element, designated ISM1, was found within the cloned M. smithii DNA located adjacent to the proC complementing region. ISM1 is 1381 bp in length, has 29 bp terminal inverted repeat sequences and contains one major ORF encoded in 87% of the ISM1 sequence. ISM1 is mobile, present in approximately 10 copies per genome and integration duplicates 8 bp at the site of insertion. The duplicated sequences show homology with sequences within the 29 bp terminal repeat sequence of ISM1. Comparison of our data with sequences from halophilic archaebacteria suggests that 5'GAANTTTCA and 5'TTTTAATATAAA may be consensus promoter sequences for archaebacteria. These sequences closely resemble the consensus sequences which precede Drosophila heat-shock genes (Pelham 1982; Davidson et al. 1983). Methanogens appear to employ the eubacterial system of mRNA: 16SrRNA hybridization to ensure initiation of translation; the consensus ribosome binding sequence is 5'AGGTGA.

  20. Evolutionary Dynamics of 5S rDNA and Recurrent Association of Transposable Elements in Electric Fish of the Family Gymnotidae (Gymnotiformes): The Case of Gymnotus mamiraua.

    PubMed

    da Silva, Maelin; Barbosa, Patricia; Artoni, Roberto F; Feldberg, Eliana

    2016-01-01

    Gymnotidae is a family of electric fish endemic to the Neotropics consisting of 2 genera: Electrophorus and Gymnotus. The genus Gymnotus is widely distributed and is found in all of the major Brazilian river systems. Physical and molecular mapping data for the ribosomal DNA (rDNA) in this genus are still scarce, with its chromosomal location known in only 11 species. As other species of Gymnotus with 2n = 54 chromosomes from the Paraná-Paraguay basin, G. mamiraua was found to have a large number of 5S rDNA sites. Isolation and cloning of the 5S rDNA sequences from G. mamiraua identified a fragment of a transposable element similar to the Tc1/mariner transposon associated with a non-transcribed spacer. Double fluorescence in situ hybridization analysis of this element and the 5S rDNA showed that they were colocalized on several chromosomes, in addition to acting as nonsyntenic markers on others. Our data show the association between these sequences and suggest that the Tc1 retrotransposon may be the agent that drives the spread of these 5S rDNA-like sequences in the G. mamiraua genome. © 2016 S. Karger AG, Basel.

  1. Solution structure of telomere binding domain of AtTRB2 derived from Arabidopsis thaliana

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yun, Ji-Hye; Lee, Won Kyung; Kim, Heeyoun

    Highlights: • We have determined solution structure of Myb domain of AtTRB2. • The Myb domain of AtTRB2 is located in the N-terminal region. • The Myb domain of AtTRB2 binds to plant telomeric DNA without fourth helix. • Helix 2 and 3 of the Myb domain of AtTRB2 are involved in DNA recognition. • AtTRB2 is a novel protein distinguished from other known plant TBP. - Abstract: Telomere homeostasis is regulated by telomere-associated proteins, and the Myb domain is well conserved for telomere binding. AtTRB2 is a member of the SMH (Single-Myb-Histone)-like family in Arabidopsis thaliana, having an N-terminalmore » Myb domain, which is responsible for DNA binding. The Myb domain of AtTRB2 contains three α-helices and loops for DNA binding, which is unusual given that other plant telomere-binding proteins have an additional fourth helix that is essential for DNA binding. To understand the structural role for telomeric DNA binding of AtTRB2, we determined the solution structure of the Myb domain of AtTRB2 (AtTRB2{sub 1–64}) using nuclear magnetic resonance (NMR) spectroscopy. In addition, the inter-molecular interaction between AtTRB2{sub 1–64} and telomeric DNA has been characterized by the electrophoretic mobility shift assay (EMSA) and NMR titration analyses for both plant (TTTAGGG)n and human (TTAGGG)n telomere sequences. Data revealed that Trp28, Arg29, and Val47 residues located in Helix 2 and Helix 3 are crucial for DNA binding, which are well conserved among other plant telomere binding proteins. We concluded that although AtTRB2 is devoid of the additional fourth helix in the Myb-extension domain, it is able to bind to plant telomeric repeat sequences as well as human telomeric repeat sequences.« less

  2. Polymorphic design of DNA origami structures through mechanical control of modular components.

    PubMed

    Lee, Chanseok; Lee, Jae Young; Kim, Do-Nyun

    2017-12-12

    Scaffolded DNA origami enables the bottom-up fabrication of diverse DNA nanostructures by designing hundreds of staple strands, comprised of complementary sequences to the specific binding locations of a scaffold strand. Despite its exceptionally high design flexibility, poor reusability of staples has been one of the major hurdles to fabricate assorted DNA constructs in an effective way. Here we provide a rational module-based design approach to create distinct bent shapes with controllable geometries and flexibilities from a single, reference set of staples. By revising the staple connectivity within the desired module, we can control the location, stiffness, and included angle of hinges precisely, enabling the construction of dozens of single- or multiple-hinge structures with the replacement of staple strands up to 12.8% only. Our design approach, combined with computational shape prediction and analysis, can provide a versatile and cost-effective procedure in the design of DNA origami shapes with stiffness-tunable units.

  3. Complete mitochondrial genome of the giant African snail, Achatina fulica (Mollusca: Achatinidae): a novel location of putative control regions (CR) in the mitogenome within Pulmonate species.

    PubMed

    He, Zhang-Ping; Dai, Xia-Bin; Zhang, Shuai; Zhi, Ting-Ting; Lun, Zhao-Rong; Wu, Zhong-Dao; Yang, Ting-Bao

    2016-01-01

    The whole sequence (15,057 bp) of the mitochondrial DNA (mtDNA) of the terrestrial snail Achatina fulica (order Stylommatophora) was determined. The mitogenome, as the typical metazoan mtDNA, contains 13 protein-coding genes (PCG), 2 ribosomal RNA genes (rRNA) and 22 transfer RNA genes (tRNA). The tRNA genes include two trnS without standard secondary structure. Interestingly, among the known mitogenomes of Pulmonata species, we firstly characterized an unassigned lengthy sequence (551 bp) between the cox1 and the trnV which may be the CR for the sake of its AT bases usage bias (65.70%) and potential hairpin structure.

  4. Identification, sequencing and expression of an integral membrane protein of the trans-Golgi network (TGN38).

    PubMed Central

    Luzio, J P; Brake, B; Banting, G; Howell, K E; Braghetta, P; Stanley, K K

    1990-01-01

    Organelle-specific integral membrane proteins were identified by a novel strategy which gives rise to monospecific antibodies to these proteins as well as to the cDNA clones encoding them. A cDNA expression library was screened with a polyclonal antiserum raised against Triton X-114-extracted organelle proteins and clones were then grouped using antibodies affinity-purified on individual fusion proteins. The identification, molecular cloning and sequencing are described of a type 1 membrane protein (TGN38) which is located specifically in the trans-Golgi network. Images Fig. 1. Fig. 3. PMID:2204342

  5. Identification and cloning of a gamma 3 subunit splice variant of the human GABA(A) receptor.

    PubMed

    Poulsen, C F; Christjansen, K N; Hastrup, S; Hartvig, L

    2000-05-31

    cDNA sequences encoding two forms of the GABA(A) gamma 3 receptor subunit were cloned from human hippocampus. The nucleotide sequences differ by the absence (gamma 3S) or presence (gamma 3L) of 18 bp located in the presumed intracellular loop between transmembrane region (TM) III and IV. The extra 18 bp in the gamma 3L subunit generates a consensus site for phosphorylation by protein kinase C (PKC). Analysis of human genomic DNA encoding the gamma 3 subunit reveals that the 18 bp insert is contiguous with the upstream proximal exon.

  6. Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

    PubMed

    Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

    1999-01-01

    Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

  7. Modulation of cyclobutane thymine photodimer formation in T11-tracts in rotationally phased nucleosome core particles and DNA minicircles.

    PubMed

    Wang, Kesai; Taylor, John-Stephen A

    2017-07-07

    Cyclobutane pyrimidine dimers (CPDs) are DNA photoproducts linked to skin cancer, whose mutagenicity depends in part on their frequency of formation and deamination. Nucleosomes modulate CPD formation, favoring outside facing sites and disfavoring inward facing sites. A similar pattern of CPD formation in protein-free DNA loops suggests that DNA bending causes the modulation in nucleosomes. To systematically study the cause and effect of nucleosome structure on CPD formation and deamination, we have developed a circular permutation synthesis strategy for positioning a target sequence at different superhelix locations (SHLs) across a nucleosome in which the DNA has been rotationally phased with respect to the histone octamer by TG motifs. We have used this system to show that the nucleosome dramatically modulates CPD formation in a T11-tract that covers one full turn of the nucleosome helix at seven different SHLs, and that the position of maximum CPD formation at all locations is shifted to the 5΄-side of that found in mixed-sequence nucleosomes. We also show that an 80-mer minicircle DNA using the same TG-motifs faithfully reproduces the CPD pattern in the nucleosome, indicating that it is a good model for protein-free rotationally phased bent DNA of the same curvature as in a nucleosome, and that bending is modulating CPD formation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Analysis of the DNA sequence of a 15,500 bp fragment near the left telomere of chromosome XV from Saccharomyces cerevisiae reveals a putative sugar transporter, a carboxypeptidase homologue and two new open reading frames.

    PubMed

    Gamo, F J; Lafuente, M J; Casamayor, A; Ariño, J; Aldea, M; Casas, C; Herrero, E; Gancedo, C

    1996-06-15

    We report the sequence of a 15.5 kb DNA segment located near the left telomere of chromosome XV of Saccharomyces cerevisiae. The sequence contains nine open reading frames (ORFs) longer than 300 bp. Three of them are internal to other ones. One corresponds to the gene LGT3 that encodes a putative sugar transporter. Three adjacent ORFs were separated by two stop codons in frame. These ORFs presented homology with the gene CPS1 that encodes carboxypeptidase S. The stop codons were not found in the same sequence derived from another yeast strain. Two other ORFs without significant homology in databases were also found. One of them, O0420, is very rich in serine and threonine and presents a series of repeated or similar amino acid stretches along the sequence.

  9. Second generation noninvasive fetal genome analysis reveals de novo mutations, single-base parental inheritance, and preferred DNA ends

    PubMed Central

    Chan, K. C. Allen; Jiang, Peiyong; Sun, Kun; Cheng, Yvonne K. Y.; Tong, Yu K.; Cheng, Suk Hang; Wong, Ada I. C.; Hudecova, Irena; Leung, Tak Y.; Chiu, Rossa W. K.; Lo, Yuk Ming Dennis

    2016-01-01

    Plasma DNA obtained from a pregnant woman was sequenced to a depth of 270× haploid genome coverage. Comparing the maternal plasma DNA sequencing data with the parental genomic DNA data and using a series of bioinformatics filters, fetal de novo mutations were detected at a sensitivity of 85% and a positive predictive value of 74%. These results represent a 169-fold improvement in the positive predictive value over previous attempts. Improvements in the interpretation of the sequence information of every base position in the genome allowed us to interrogate the maternal inheritance of the fetus for 618,271 of 656,676 (94.2%) heterozygous SNPs within the maternal genome. The fetal genotype at each of these sites was deduced individually, unlike previously, where the inheritance was determined for a collection of sites within a haplotype. These results represent a 90-fold enhancement in the resolution in determining the fetus’s maternal inheritance. Selected genomic locations were more likely to be found at the ends of plasma DNA molecules. We found that a subset of such preferred ends exhibited selectivity for fetal- or maternal-derived DNA in maternal plasma. The ratio of the number of maternal plasma DNA molecules with fetal preferred ends to those with maternal preferred ends showed a correlation with the fetal DNA fraction. Finally, this second generation approach for noninvasive fetal whole-genome analysis was validated in a pregnancy diagnosed with cardiofaciocutaneous syndrome with maternal plasma DNA sequenced to 195× coverage. The causative de novo BRAF mutation was successfully detected through the maternal plasma DNA analysis. PMID:27799561

  10. Comparing COI and ITS as DNA barcode markers for mushrooms and allies (Agaricomycotina).

    PubMed

    Dentinger, Bryn T M; Didukh, Maryna Y; Moncalvo, Jean-Marc

    2011-01-01

    DNA barcoding is an approach to rapidly identify species using short, standard genetic markers. The mitochondrial cytochrome oxidase I gene (COI) has been proposed as the universal barcode locus, but its utility for barcoding in mushrooms (ca. 20,000 species) has not been established. We succeeded in generating 167 partial COI sequences (~450 bp) representing ~100 morphospecies from ~650 collections of Agaricomycotina using several sets of new primers. Large introns (~1500 bp) at variable locations were detected in ~5% of the sequences we obtained. We suspect that widespread presence of large introns is responsible for our low PCR success (~30%) with this locus. We also sequenced the nuclear internal transcribed spacer rDNA regions (ITS) to compare with COI. Among the small proportion of taxa for which COI could be sequenced, COI and ITS perform similarly as a barcode. However, in a densely sampled set of closely related taxa, COI was less divergent than ITS and failed to distinguish all terminal clades. Given our results and the wealth of ITS data already available in public databases, we recommend that COI be abandoned in favor of ITS as the primary DNA barcode locus in mushrooms.

  11. End Joining-Mediated Gene Expression in Mammalian Cells Using PCR-Amplified DNA Constructs that Contain Terminator in Front of Promoter.

    PubMed

    Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Tomiyoshi, Keisuke; Hoshida, Hisashi; Akada, Rinji

    2015-12-01

    Mammalian gene expression constructs are generally prepared in a plasmid vector, in which a promoter and terminator are located upstream and downstream of a protein-coding sequence, respectively. In this study, we found that front terminator constructs-DNA constructs containing a terminator upstream of a promoter rather than downstream of a coding region-could sufficiently express proteins as a result of end joining of the introduced DNA fragment. By taking advantage of front terminator constructs, FLAG substitutions, and deletions were generated using mutagenesis primers to identify amino acids specifically recognized by commercial FLAG antibodies. A minimal epitope sequence for polyclonal FLAG antibody recognition was also identified. In addition, we analyzed the sequence of a C-terminal Ser-Lys-Leu peroxisome localization signal, and identified the key residues necessary for peroxisome targeting. Moreover, front terminator constructs of hepatitis B surface antigen were used for deletion analysis, leading to the identification of regions required for the particle formation. Collectively, these results indicate that front terminator constructs allow for easy manipulations of C-terminal protein-coding sequences, and suggest that direct gene expression with PCR-amplified DNA is useful for high-throughput protein analysis in mammalian cells.

  12. Comparing COI and ITS as DNA Barcode Markers for Mushrooms and Allies (Agaricomycotina)

    PubMed Central

    Dentinger, Bryn T. M.; Didukh, Maryna Y.; Moncalvo, Jean-Marc

    2011-01-01

    DNA barcoding is an approach to rapidly identify species using short, standard genetic markers. The mitochondrial cytochrome oxidase I gene (COI) has been proposed as the universal barcode locus, but its utility for barcoding in mushrooms (ca. 20,000 species) has not been established. We succeeded in generating 167 partial COI sequences (∼450 bp) representing ∼100 morphospecies from ∼650 collections of Agaricomycotina using several sets of new primers. Large introns (∼1500 bp) at variable locations were detected in ∼5% of the sequences we obtained. We suspect that widespread presence of large introns is responsible for our low PCR success (∼30%) with this locus. We also sequenced the nuclear internal transcribed spacer rDNA regions (ITS) to compare with COI. Among the small proportion of taxa for which COI could be sequenced, COI and ITS perform similarly as a barcode. However, in a densely sampled set of closely related taxa, COI was less divergent than ITS and failed to distinguish all terminal clades. Given our results and the wealth of ITS data already available in public databases, we recommend that COI be abandoned in favor of ITS as the primary DNA barcode locus in mushrooms. PMID:21966418

  13. Scaling features of noncoding DNA

    NASA Technical Reports Server (NTRS)

    Stanley, H. E.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C. K.; Simons, M.

    1999-01-01

    We review evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene, and utilize this fact to build a Coding Sequence Finder Algorithm, which uses statistical ideas to locate the coding regions of an unknown DNA sequence. Finally, we describe briefly some recent work adapting to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function, and reporting that noncoding regions in eukaryotes display a larger redundancy than coding regions. Specifically, we consider the possibility that this result is solely a consequence of nucleotide concentration differences as first noted by Bonhoeffer and his collaborators. We find that cytosine-guanine (CG) concentration does have a strong "background" effect on redundancy. However, we find that for the purine-pyrimidine binary mapping rule, which is not affected by the difference in CG concentration, the Shannon redundancy for the set of analyzed sequences is larger for noncoding regions compared to coding regions.

  14. Identification of G-quadruplex forming sequences in three manatee papillomaviruses

    PubMed Central

    Zahin, Maryam; Dean, William L.; Ghim, Shin-je; Joh, Joongho; Gray, Robert D.; Khanal, Sujita; Bossart, Gregory D.; Mignucci-Giannoni, Antonio A.; Rouchka, Eric C.; Jenson, Alfred B.; Trent, John O.; Chaires, Jonathan B.

    2018-01-01

    The Florida manatee (Trichechus manatus latirotris) is a threatened aquatic mammal in United States coastal waters. Over the past decade, the appearance of papillomavirus-induced lesions and viral papillomatosis in manatees has been a concern for those involved in the management and rehabilitation of this species. To date, three manatee papillomaviruses (TmPVs) have been identified in Florida manatees, one forming cutaneous lesions (TmPV1) and two forming genital lesions (TmPV3 and TmPV4). We identified DNA sequences with the potential to form G-quadruplex structures (G4) across the three genomes. G4 were located on both DNA strands and across coding and non-coding regions on all TmPVs, offering multiple targets for viral control. Although G4 have been identified in several viral genomes, including human PVs, most research has focused on canonical structures comprised of three G-tetrads. In contrast, the vast majority of sequences we identified would allow the formation of non-canonical structures with only two G-tetrads. Our biophysical analysis confirmed the formation of G4 with parallel topology in three such sequences from the E2 region. Two of the structures appear comprised of multiple stacked two G-tetrad structures, perhaps serving to increase structural stability. Computational analysis demonstrated enrichment of G4 sequences on all TmPVs on the reverse strand in the E2/E4 region and on both strands in the L2 region. Several G4 sequences occurred at similar regional locations on all PVs, most notably on the reverse strand in the E2 region. In other cases, G4 were identified at similar regional locations only on PVs forming genital lesions. On all TmPVs, G4 sequences were located in the non-coding region near putative E2 binding sites. Together, these findings suggest that G4 are possible regulatory elements in TmPVs. PMID:29630682

  15. Repair of O6-methylguanine adducts in human telomeric G-quadruplex DNA by O6-alkylguanine-DNA alkyltransferase

    PubMed Central

    Hellman, Lance M.; Spear, Tyler J.; Koontz, Colton J.; Melikishvili, Manana; Fried, Michael G.

    2014-01-01

    O6-alkylguanine-DNA alkyltransferase (AGT) is a single-cycle DNA repair enzyme that removes pro-mutagenic O6-alkylguanine adducts from DNA. Its functions with short single-stranded and duplex substrates have been characterized, but its ability to act on other DNA structures remains poorly understood. Here, we examine the functions of this enzyme on O6-methylguanine (6mG) adducts in the four-stranded structure of the human telomeric G-quadruplex. On a folded 22-nt G-quadruplex substrate, binding saturated at 2 AGT:DNA, significantly less than the ∼5 AGT:DNA found with linear single-stranded DNAs of similar length, and less than the value found with the telomere sequence under conditions that inhibit quadruplex formation (4 AGT:DNA). Despite these differences, AGT repaired 6mG adducts located within folded G-quadruplexes, at rates that were comparable to those found for a duplex DNA substrate under analogous conditions. Repair was kinetically biphasic with the amplitudes of rapid and slow phases dependent on the position of the adduct within the G-quadruplex: in general, adducts located in the top or bottom tetrads of a quadruplex stack exhibited more rapid-phase repair than did adducts located in the inner tetrad. This distinction may reflect differences in the conformational dynamics of 6mG residues in G-quadruplex DNAs. PMID:25080506

  16. Diversity in Requirement of Genetic and Epigenetic Factors for Centromere Function in Fungi ▿

    PubMed Central

    Roy, Babhrubahan; Sanyal, Kaustuv

    2011-01-01

    A centromere is a chromosomal region on which several proteins assemble to form the kinetochore. The centromere-kinetochore complex helps in the attachment of chromosomes to spindle microtubules to mediate segregation of chromosomes to daughter cells during mitosis and meiosis. In several budding yeast species, the centromere forms in a DNA sequence-dependent manner, whereas in most other fungi, factors other than the DNA sequence also determine the centromere location, as centromeres were able to form on nonnative sequences (neocentromeres) when native centromeres were deleted in engineered strains. Thus, in the absence of a common DNA sequence, the cues that have facilitated centromere formation on a specific DNA sequence for millions of years remain a mystery. Kinetochore formation is facilitated by binding of a centromere-specific histone protein member of the centromeric protein A (CENP-A) family that replaces a canonical histone H3 to form a specialized centromeric chromatin structure. However, the process of kinetochore formation on the rapidly evolving and seemingly diverse centromere DNAs in different fungal species is largely unknown. More interestingly, studies in various yeasts suggest that the factors required for de novo centromere formation (establishment) may be different from those required for maintenance (propagation) of an already established centromere. Apart from the DNA sequence and CENP-A, many other factors, such as posttranslational modification (PTM) of histones at centric and pericentric chromatin, RNA interference, and DNA methylation, are also involved in centromere formation, albeit in a species-specific manner. In this review, we discuss how several genetic and epigenetic factors influence the evolution of structure and function of centromeres in fungal species. PMID:21908596

  17. Comparative genomics of 9 novel Paenibacillus larvae bacteriophages

    PubMed Central

    Stamereilers, Casey; LeBlanc, Lucy; Yost, Diane; Amy, Penny S.; Tsourkas, Philippos K.

    2016-01-01

    ABSTRACT American Foulbrood Disease, caused by the bacterium Paenibacillus larvae, is one of the most destructive diseases of the honeybee, Apis mellifera. Our group recently published the sequences of 9 new phages with the ability to infect and lyse P. larvae. Here, we characterize the genomes of these P. larvae phages, compare them to each other and to other sequenced P. larvae phages, and putatively identify protein function. The phage genomes are 38–45 kb in size and contain 68–86 genes, most of which appear to be unique to P. larvae phages. We classify P. larvae phages into 2 main clusters and one singleton based on nucleotide sequence identity. Three of the new phages show sequence similarity to other sequenced P. larvae phages, while the remaining 6 do not. We identified functions for roughly half of the P. larvae phage proteins, including structural, assembly, host lysis, DNA replication/metabolism, regulatory, and host-related functions. Structural and assembly proteins are highly conserved among our phages and are located at the start of the genome. DNA replication/metabolism, regulatory, and host-related proteins are located in the middle and end of the genome, and are not conserved, with many of these genes found in some of our phages but not others. All nine phages code for a conserved N-acetylmuramoyl-L-alanine amidase. Comparative analysis showed the phages use the “cohesive ends with 3′ overhang” DNA packaging strategy. This work is the first in-depth study of P. larvae phage genomics, and serves as a marker for future work in this area. PMID:27738559

  18. Location analysis for the estrogen receptor-α reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

    PubMed Central

    Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

    2010-01-01

    Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10–20% nucleotide deviation from the canonical ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966

  19. Location analysis for the estrogen receptor-alpha reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements.

    PubMed

    Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B

    2010-04-01

    Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10-20% nucleotide deviation from the canonical ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.

  20. Genetics, structure, and prevalence of FP967 (CDC Triffid) T-DNA in flax.

    PubMed

    Young, Lester; Hammerlindl, Joseph; Babic, Vivijan; McLeod, Jamille; Sharpe, Andrew; Matsalla, Chad; Bekkaoui, Faouzi; Marquess, Leigh; Booker, Helen M

    2015-01-01

    The detection of T-DNA from a genetically modified flaxseed line (FP967, formally CDC Triffid) in a shipment of Canadian flaxseed exported to Europe resulted in a large decrease in the amount of flax planted in Canada. The Canadian flaxseed industry undertook major changes to ensure the removal of FP967 from the supply chain. This study aimed to resolve the genetics and structure of the FP967 transfer DNA (T-DNA). The FP967 T-DNA is thought to be inserted in at single genomic locus. The junction between the T-DNA and genomic DNA consisted of two inverted Right Borders with no Left Border (LB) flanking genomic DNA sequences recovered. This information was used to develop an event-specific quantitative PCR (qPCR) assay. This assay and an existing assay specific to the T-DNA construct were used to determine the genetics and prevalence of the FP967 T-DNA. These data supported the hypothesis that the T-DNA is present at a single location in the genome. The FP967 T-DNA is present at a low level (between 0.01 and 0.1%) in breeder seed lots from 2009 and 2010. None of the 11,000 and 16,000 lines selected for advancement through the Flax Breeding Program in 2010 and 2011, respectively, tested positive for the FP967 T-DNA, however. Most of the FP967 T-DNA sequence was resolved via PCR cloning and next generation sequencing. A 3,720 bp duplication of an internal portion of the T-DNA (including a Right Border) was discovered between the flanking genomic DNA and the LB. An event-specific assay, SAT2-LB, was developed for the junction between this repeat and the LB.

  1. Detection of DNA double-strand breaks and chromosome translocations using ligation-mediated PCR and inverse PCR.

    PubMed

    Singh, Sheetal; Shih, Shyh-Jen; Vaughan, Andrew T M

    2014-01-01

    Current techniques for examining the global creation and repair of DNA double-strand breaks are restricted in their sensitivity, and such techniques mask any site-dependent variations in breakage and repair rate or fidelity. We present here a system for analyzing the fate of documented DNA breaks, using the MLL gene as an example, through application of ligation-mediated PCR. Here, a simple asymmetric double-stranded DNA adapter molecule is ligated to experimentally induced DNA breaks and subjected to seminested PCR using adapter- and gene-specific primers. The rate of appearance and loss of specific PCR products allows detection of both the break and its repair. Using the additional technique of inverse PCR, the presence of misrepaired products (translocations) can be detected at the same site, providing information on the fidelity of the ligation reaction in intact cells. Such techniques may be adapted for the analysis of DNA breaks and rearrangements introduced into any identifiable genomic location. We have also applied parallel sequencing for the high-throughput analysis of inverse PCR products to facilitate the unbiased recording of all rearrangements located at a specific genomic location.

  2. Differential structural status of the RNA counterpart of an undecamer quasi-palindromic DNA sequence present in LCR of human β-globin gene cluster.

    PubMed

    Kaushik, Mahima; Kukreti, Shrikant

    2015-01-01

    Our previous work on structural polymorphism shown at a single nucleotide polymorphism (SNP) (A → G) site located on HS4 region of locus control region (LCR) of β-globin gene has established a hairpin → duplex equilibrium corresponding to A → B like DNA transition (Kaushik M, Kukreti, R., Grover, D., Brahmachari, S.K. and Kukreti S. Nucleic Acids Res. 2003; Kaushik M, Kukreti S. Nucleic Acids Res. 2006). The G-allele of A → G SNP has been shown to be significantly associated with the occurrence of β-thalassemia. Considering the significance of this 11-nt long quasi-palindromic sequence [5'-TGGGG(G/A)CCCCA; HP(G/A)11] of β-globin gene LCR, we further explored the differential behavior of the same DNA sequence with its RNA counterpart, using various biophysical and biochemical techniques. In contrast to its DNA counterpart exhibiting a A → B structural transition and an equilibrium between duplex and hairpin forms, the studied RNA oligonucleotide sequence [5'-UGGGG(G/A)CCCCA; RHP(G/A)11] existed only in duplex form (A-conformation) and did not form hairpin. The single residue difference from A to G led to the unusual thermal stability of the RNA structure formed by the studied sequence. Since, naturally occurring mutations and various SNP sites may stabilize or destabilize the local DNA/RNA secondary structures, these structural transitions may affect the gene expression by a change in the protein-DNA recognition patterns.

  3. Comparative genomics and repetitive sequence divergence in the species of diploid Nicotiana section Alatae.

    PubMed

    Lim, K Yoong; Kovarik, Ales; Matyasek, Roman; Chase, Mark W; Knapp, Sandra; McCarthy, Elizabeth; Clarkson, James J; Leitch, Andrew R

    2006-12-01

    Combining phylogenetic reconstructions of species relationships with comparative genomic approaches is a powerful way to decipher evolutionary events associated with genome divergence. Here, we reconstruct the history of karyotype and tandem repeat evolution in species of diploid Nicotiana section Alatae. By analysis of plastid DNA, we resolved two clades with high bootstrap support, one containing N. alata, N. langsdorffii, N. forgetiana and N. bonariensis (called the n = 9 group) and another containing N. plumbaginifolia and N. longiflora (called the n = 10 group). Despite little plastid DNA sequence divergence, we observed, via fluorescent in situ hybridization, substantial chromosomal repatterning, including altered chromosome numbers, structure and distribution of repeats. Effort was focussed on 35S and 5S nuclear ribosomal DNA (rDNA) and the HRS60 satellite family of tandem repeats comprising the elements HRS60, NP3R and NP4R. We compared divergence of these repeats in diploids and polyploids of Nicotiana. There are dramatic shifts in the distribution of the satellite repeats and complete replacement of intergenic spacers (IGSs) of 35S rDNA associated with divergence of the species in section Alatae. We suggest that sequence homogenization has replaced HRS60 family repeats at sub-telomeric regions, but that this process may not occur, or occurs more slowly, when the repeats are found at intercalary locations. Sequence homogenization acts more rapidly (at least two orders of magnitude) on 35S rDNA than 5S rDNA and sub-telomeric satellite sequences. This rapid rate of divergence is analogous to that found in polyploid species, and is therefore, in plants, not only associated with polyploidy.

  4. The barley EST DNA Replication and Repair Database (bEST-DRRD) as a tool for the identification of the genes involved in DNA replication and repair.

    PubMed

    Gruszka, Damian; Marzec, Marek; Szarejko, Iwona

    2012-06-14

    The high level of conservation of genes that regulate DNA replication and repair indicates that they may serve as a source of information on the origin and evolution of the species and makes them a reliable system for the identification of cross-species homologs. Studies that had been conducted to date shed light on the processes of DNA replication and repair in bacteria, yeast and mammals. However, there is still much to be learned about the process of DNA damage repair in plants. These studies, which were conducted mainly using bioinformatics tools, enabled the list of genes that participate in various pathways of DNA repair in Arabidopsis thaliana (L.) Heynh to be outlined; however, information regarding these mechanisms in crop plants is still very limited. A similar, functional approach is particularly difficult for a species whose complete genomic sequences are still unavailable. One of the solutions is to apply ESTs (Expressed Sequence Tags) as the basis for gene identification. For the construction of the barley EST DNA Replication and Repair Database (bEST-DRRD), presented here, the Arabidopsis nucleotide and protein sequences involved in DNA replication and repair were used to browse for and retrieve the deposited sequences, derived from four barley (Hordeum vulgare L.) sequence databases, including the "Barley Genome version 0.05" database (encompassing ca. 90% of barley coding sequences) and from two databases covering the complete genomes of two monocot models: Oryza sativa L. and Brachypodium distachyon L. in order to identify homologous genes. Sequences of the categorised Arabidopsis queries are used for browsing the repositories, which are located on the ViroBLAST platform. The bEST-DRRD is currently used in our project during the identification and validation of the barley genes involved in DNA repair. The presented database provides information about the Arabidopsis genes involved in DNA replication and repair, their expression patterns and models of protein interactions. It was designed and established to provide an open-access tool for the identification of monocot homologs of known Arabidopsis genes that are responsible for DNA-related processes. The barley genes identified in the project are currently being analysed to validate their function.

  5. Repetitive sequences: the hidden diversity of heterochromatin in prochilodontid fish

    PubMed Central

    Terencio, Maria L.; Schneider, Carlos H.; Gross, Maria C.; do Carmo, Edson Junior; Nogaroto, Viviane; de Almeida, Mara Cristina; Artoni, Roberto Ferreira; Vicari, Marcelo R.; Feldberg, Eliana

    2015-01-01

    Abstract The structure and organization of repetitive elements in fish genomes are still relatively poorly understood, although most of these elements are believed to be located in heterochromatic regions. Repetitive elements are considered essential in evolutionary processes as hotspots for mutations and chromosomal rearrangements, among other functions – thus providing new genomic alternatives and regulatory sites for gene expression. The present study sought to characterize repetitive DNA sequences in the genomes of Semaprochilodus insignis (Jardine & Schomburgk, 1841) and Semaprochilodus taeniurus (Valenciennes, 1817) and identify regions of conserved syntenic blocks in this genome fraction of three species of Prochilodontidae (Semaprochilodus insignis, Semaprochilodus taeniurus, and Prochilodus lineatus (Valenciennes, 1836) by cross-FISH using Cot-1 DNA (renaturation kinetics) probes. We found that the repetitive fractions of the genomes of Semaprochilodus insignis and Semaprochilodus taeniurus have significant amounts of conserved syntenic blocks in hybridization sites, but with low degrees of similarity between them and the genome of Prochilodus lineatus, especially in relation to B chromosomes. The cloning and sequencing of the repetitive genomic elements of Semaprochilodus insignis and Semaprochilodus taeniurus using Cot-1 DNA identified 48 fragments that displayed high similarity with repetitive sequences deposited in public DNA databases and classified as microsatellites, transposons, and retrotransposons. The repetitive fractions of the Semaprochilodus insignis and Semaprochilodus taeniurus genomes exhibited high degrees of conserved syntenic blocks in terms of both the structures and locations of hybridization sites, but a low degree of similarity with the syntenic blocks of the Prochilodus lineatus genome. Future comparative analyses of other prochilodontidae species will be needed to advance our understanding of the organization and evolution of the genomes in this group of fish. PMID:26752156

  6. Ribosomal DNA, tri- and bi-partite pericentromeres in the permanent translocation heterozygote Rhoeo spathacea.

    PubMed

    Golczyk, Hieronim; Hasterok, Robert; Szklarczyk, Marek

    2010-12-01

    High- and low-stringency FISH and base-specific fluorescence were performed on the permanent translocation heterozygote Rhoeo spathacea (2n = 12). Our results indicate that 45S rDNA arrays, rDNA-related sequences and other GC-rich DNA fraction(s) are located within the pericentromeric regions of all twelve chromosomes, usually colocalizing with the chromomycin A(3)-positive bands. Homogenization of the pericentromeric regions appears to result from the concerted spread of GC-rich sequences, with differential amplification likely. We found new 5S rDNA patterns, which suggest a variability in the breakpoints and in the consequent chromosome reorganizations. It was found that the large 5S rDNA locus residing on each of the 8E and 9E arms consisted of two smaller loci. On each of the two chromosome arms 3b and 4b, in addition to the major subtelomeric 5S rDNA locus, a new minor locus was found interstitially about 40% along the arm length. The arrangement of cytotogenetic landmarks and chromosome arm measurements are discussed with regard to genome repatterning in Rhoeo.

  7. A Review of Computational Intelligence Methods for Eukaryotic Promoter Prediction.

    PubMed

    Singh, Shailendra; Kaur, Sukhbir; Goel, Neelam

    2015-01-01

    In past decades, prediction of genes in DNA sequences has attracted the attention of many researchers but due to its complex structure it is extremely intricate to correctly locate its position. A large number of regulatory regions are present in DNA that helps in transcription of a gene. Promoter is one such region and to find its location is a challenging problem. Various computational methods for promoter prediction have been developed over the past few years. This paper reviews these promoter prediction methods. Several difficulties and pitfalls encountered by these methods are also detailed, along with future research directions.

  8. Morphology and genome organization of the virus PSV of the hyperthermophilic archaeal genera Pyrobaculum and Thermoproteus: a novel virus family, the Globuloviridae.

    PubMed

    Häring, Monika; Peng, Xu; Brügger, Kim; Rachel, Reinhard; Stetter, Karl O; Garrett, Roger A; Prangishvili, David

    2004-06-01

    A novel virus, termed Pyrobaculum spherical virus (PSV), is described that infects anaerobic hyperthermophilic archaea of the genera Pyrobaculum and Thermoproteus. Spherical enveloped virions, about 100 nm in diameter, contain a major multimeric 33-kDa protein and host-derived lipids. A viral envelope encases a superhelical nucleoprotein core containing linear double-stranded DNA. The PSV infection cycle does not cause lysis of host cells. The viral genome was sequenced and contains 28337 bp. The genome is unique for known archaeal viruses in that none of the genes, including that encoding the major structural protein, show any significant sequence matches to genes in public sequence databases. Exceptionally for an archaeal double-stranded DNA virus, almost all the recognizable genes are located on one DNA strand. The ends of the genome consist of 190-bp inverted repeats that contain multiple copies of short direct repeats. The two DNA strands are probably covalently linked at their termini. On the basis of the unusual morphological and genomic properties of this DNA virus, we propose to assign PSV to a new viral family, the Globuloviridae.

  9. Structure-based Analysis to Hu-DNA Binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Swinger,K.; Rice, P.

    2007-01-01

    HU and IHF are prokaryotic proteins that induce very large bends in DNA. They are present in high concentrations in the bacterial nucleoid and aid in chromosomal compaction. They also function as regulatory cofactors in many processes, such as site-specific recombination and the initiation of replication and transcription. HU and IHF have become paradigms for understanding DNA bending and indirect readout of sequence. While IHF shows significant sequence specificity, HU binds preferentially to certain damaged or distorted DNAs. However, none of the structurally diverse HU substrates previously studied in vitro is identical with the distorted substrates in the recently publishedmore » Anabaena HU(AHU)-DNA cocrystal structures. Here, we report binding affinities for AHU and the DNA in the cocrystal structures. The binding free energies for formation of these AHU-DNA complexes range from 10-14.5 kcal/mol, representing K{sub d} values in the nanomolar to low picomolar range, and a maximum stabilization of at least 6.3 kcal/mol relative to complexes with undistorted, non-specific DNA. We investigated IHF binding and found that appropriate structural distortions can greatly enhance its affinity. On the basis of the coupling of structural and relevant binding data, we estimate the amount of conformational strain in an IHF-mediated DNA kink that is relieved by a nick (at least 0.76 kcal/mol) and pinpoint the location of the strain. We show that AHU has a sequence preference for an A+T-rich region in the center of its DNA-binding site, correlating with an unusually narrow minor groove. This is similar to sequence preferences shown by the eukaryotic nucleosome.« less

  10. cDNA cloning, functional expression and cellular localization of rat liver mitochondrial electron-transfer flavoprotein-ubiquinone oxidoreductase protein.

    PubMed

    Huang, Shengbing; Song, Wei; Lin, Qishui

    2005-08-01

    A membrane-bound protein was purified from rat liver mitochondria. After being digested with V8 protease, two peptides containing identical 14 amino acid residue sequences were obtained. Using the 14 amino acid peptide derived DNA sequence as gene specific primer, the cDNA of correspondent gene 5'-terminal and 3'-terminal were obtained by RACE technique. The full-length cDNA that encoded a protein of 616 amino acids was thus cloned, which included the above mentioned peptide sequence. The full length cDNA was highly homologous to that of human ETF-QO, indicating that it may be the cDNA of rat ETF-QO. ETF-QO is an iron sulfur protein located in mitochondria inner membrane containing two kinds of redox center: FAD and [4Fe-4S] center. After comparing the sequence from the cDNA of the 616 amino acids protein with that of the mature protein of rat liver mitochondria, it was found that the N terminal 32 amino acid residues did not exist in the mature protein, indicating that the cDNA was that of ETF-QOp. When the cDNA was expressed in Saccharomyces cerevisiae with inducible vectors, the protein product was enriched in mitochondrial fraction and exhibited electron transfer activity (NBT reductase activity) of ETF-QO. Results demonstrated that the 32 amino acid peptide was a mitochondrial targeting peptide, and both FAD and iron-sulfur cluster were inserted properly into the expressed ETF-QO. ETF-QO had a high level expression in rat heart, liver and kidney. The fusion protein of GFP-ETF-QO co-localized with mitochondria in COS-7 cells.

  11. Comparison between TRF2 and TRF1 of their telomeric DNA-bound structures and DNA-binding activities

    PubMed Central

    Hanaoka, Shingo; Nagadoi, Aritaka; Nishimura, Yoshifumi

    2005-01-01

    Mammalian telomeres consist of long tandem arrays of double-stranded telomeric TTAGGG repeats packaged by the telomeric DNA-binding proteins TRF1 and TRF2. Both contain a similar C-terminal Myb domain that mediates sequence-specific binding to telomeric DNA. In a DNA complex of TRF1, only the single Myb-like domain consisting of three helices can bind specifically to double-stranded telomeric DNA. TRF2 also binds to double-stranded telomeric DNA. Although the DNA binding mode of TRF2 is likely identical to that of TRF1, TRF2 plays an important role in the t-loop formation that protects the ends of telomeres. Here, to clarify the details of the double-stranded telomeric DNA-binding modes of TRF1 and TRF2, we determined the solution structure of the DNA-binding domain of human TRF2 bound to telomeric DNA; it consists of three helices, and like TRF1, the third helix recognizes TAGGG sequence in the major groove of DNA with the N-terminal arm locating in the minor groove. However, small but significant differences are observed; in contrast to the minor groove recognition of TRF1, in which an arginine residue recognizes the TT sequence, a lysine residue of TRF2 interacts with the TT part. We examined the telomeric DNA-binding activities of both DNA-binding domains of TRF1 and TRF2 and found that TRF1 binds more strongly than TRF2. Based on the structural differences of both domains, we created several mutants of the DNA-binding domain of TRF2 with stronger binding activities compared to the wild-type TRF2. PMID:15608118

  12. Bovine papilloma virus contains an activator of gene expression at the distal end of the early transcription unit.

    PubMed Central

    Lusky, M; Berg, L; Weiher, H; Botchan, M

    1983-01-01

    Bovine papilloma virus (BPV) contains a cis-acting DNA element which can enhance transcription of distal promoters. Utilizing both direct and indirect transient transfection assays, we showed that a 59-base-pair DNA sequence from the BPV genome could activate the simian virus 40 promoter from distances exceeding 2.5 kilobases and in an orientation-independent manner. In contrast to the promoter 5'-proximal localization of other known viral activators, this element was located immediately 3' to the early polyadenylation signal in the BPV genome. Deletion of these sequences from the BPV genome inactivated the transforming ability of BPV recombinant plasmids. Orientation-independent reinsertion of this 59-base-pair sequence, or alternatively of activator DNA sequences from simian virus 40 or polyoma virus, restored the transforming activity of the BPV recombinant plasmids. Furthermore, the stable transformation frequency of the herpes simplex virus type 1 thymidine kinase gene was enhanced when linked to restriction fragments of BPV DNA which included the defined activator element. This enhancement was orientation independent with respect to the thymidine kinase promoter. The enhancement also appeared to be unrelated to the establishment of the recombinant plasmids as episomes, since in transformed cells these sequences are found linked to high-molecular-weight DNA. We propose that the enhancement of stable transformation frequencies and the activation of transcription units are in this case alternate manifestations of the same biochemical events. Images PMID:6308425

  13. Mitochondrial DNA repairs double-strand breaks in yeast chromosomes.

    PubMed

    Ricchetti, M; Fairhead, C; Dujon, B

    1999-11-04

    The endosymbiotic theory for the origin of eukaryotic cells proposes that genetic information can be transferred from mitochondria to the nucleus of a cell, and genes that are probably of mitochondrial origin have been found in nuclear chromosomes. Occasionally, short or rearranged sequences homologous to mitochondrial DNA are seen in the chromosomes of different organisms including yeast, plants and humans. Here we report a mechanism by which fragments of mitochondrial DNA, in single or tandem array, are transferred to yeast chromosomes under natural conditions during the repair of double-strand breaks in haploid mitotic cells. These repair insertions originate from noncontiguous regions of the mitochondrial genome. Our analysis of the Saccharomyces cerevisiae mitochondrial genome indicates that the yeast nuclear genome does indeed contain several short sequences of mitochondrial origin which are similar in size and composition to those that repair double-strand breaks. These sequences are located predominantly in non-coding regions of the chromosomes, frequently in the vicinity of retrotransposon long terminal repeats, and appear as recent integration events. Thus, colonization of the yeast genome by mitochondrial DNA is an ongoing process.

  14. The ChIP-exo Method: Identifying Protein-DNA Interactions with Near Base Pair Precision.

    PubMed

    Perreault, Andrea A; Venters, Bryan J

    2016-12-23

    Chromatin immunoprecipitation (ChIP) is an indispensable tool in the fields of epigenetics and gene regulation that isolates specific protein-DNA interactions. ChIP coupled to high throughput sequencing (ChIP-seq) is commonly used to determine the genomic location of proteins that interact with chromatin. However, ChIP-seq is hampered by relatively low mapping resolution of several hundred base pairs and high background signal. The ChIP-exo method is a refined version of ChIP-seq that substantially improves upon both resolution and noise. The key distinction of the ChIP-exo methodology is the incorporation of lambda exonuclease digestion in the library preparation workflow to effectively footprint the left and right 5' DNA borders of the protein-DNA crosslink site. The ChIP-exo libraries are then subjected to high throughput sequencing. The resulting data can be leveraged to provide unique and ultra-high resolution insights into the functional organization of the genome. Here, we describe the ChIP-exo method that we have optimized and streamlined for mammalian systems and next-generation sequencing-by-synthesis platform.

  15. Human papillomavirus type 16 DNA in periungual squamous cell carcinomas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moy, R.L.; Eliezri, Y.D.; Bennett, R.G.

    1989-05-12

    Ten squamous cell carcinomas (in situ or invasive) of the fingernail region were analyzed for the presence of DNA sequences homologous to human papilloma-virus (HPV) by dot blot hybridization. In most patients, the lesions were verrucae of long-term duration that were refractory to conventional treatment methods. Eight of the lesions contained HPV DNA sequences, and in six of these the sequences were related to HPV 16 as deduced from low-stringency nucleic acid hybridization followed by low- and high-stringency washes. Furthermore, the restriction endonuclease digestion pattern of DNA isolated from four of these lesions was diagnostic of episomal HPV 16. Themore » high-frequency association of HPV 16 with periungual squamous cell carcinoma is similar to that reported for HPV 16 with squamous cell carcinomas on mucous membranes at other sites, notably the genital tract. The findings suggest that HPV 16 may play an important role in the development of squamous cell carcinomas of the finger, most notably those lesions that are chronic and located in the periungual area.« less

  16. SamSelect: a sample sequence selection algorithm for quorum planted motif search on large DNA datasets.

    PubMed

    Yu, Qiang; Wei, Dingbang; Huo, Hongwei

    2018-06-18

    Given a set of t n-length DNA sequences, q satisfying 0 < q ≤ 1, and l and d satisfying 0 ≤ d < l < n, the quorum planted motif search (qPMS) finds l-length strings that occur in at least qt input sequences with up to d mismatches and is mainly used to locate transcription factor binding sites in DNA sequences. Existing qPMS algorithms have been able to efficiently process small standard datasets (e.g., t = 20 and n = 600), but they are too time consuming to process large DNA datasets, such as ChIP-seq datasets that contain thousands of sequences or more. We analyze the effects of t and q on the time performance of qPMS algorithms and find that a large t or a small q causes a longer computation time. Based on this information, we improve the time performance of existing qPMS algorithms by selecting a sample sequence set D' with a small t and a large q from the large input dataset D and then executing qPMS algorithms on D'. A sample sequence selection algorithm named SamSelect is proposed. The experimental results on both simulated and real data show (1) that SamSelect can select D' efficiently and (2) that the qPMS algorithms executed on D' can find implanted or real motifs in a significantly shorter time than when executed on D. We improve the ability of existing qPMS algorithms to process large DNA datasets from the perspective of selecting high-quality sample sequence sets so that the qPMS algorithms can find motifs in a short time in the selected sample sequence set D', rather than take an unfeasibly long time to search the original sequence set D. Our motif discovery method is an approximate algorithm.

  17. The Agrobacterium tumefaciens Transcription Factor BlcR Is Regulated via Oligomerization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pan, Yi; Fiscus, Valena; Meng, Wuyi

    2012-02-08

    The Agrobacterium tumefaciens BlcR is a member of the emerging isocitrate lyase transcription regulators that negatively regulates metabolism of {gamma}-butyrolactone, and its repressing function is relieved by succinate semialdehyde (SSA). Our crystal structure showed that BlcR folded into the DNA- and SSA-binding domains and dimerized via the DNA-binding domains. Mutational analysis identified residues, including Phe{sup 147}, that are important for SSA association; BlcR{sup F147A} existed as tetramer. Two BlcR dimers bound to target DNA and in a cooperative manner, and the distance between the two BlcR-binding sequences in DNA was critical for BlcR-DNA association. Tetrameric BlcR{sup F147A} retained DNA bindingmore » activity, and importantly, this activity was not affected by the distance separating the BlcR-binding sequences in DNA. SSA did not dissociate tetrameric BlcR{sup F147A} or BlcR{sup F147A}-DNA. As well as in the SSA-binding site, Phe{sup 147} is located in a structurally flexible loop that may be involved in BlcR oligomerization. We propose that SSA regulates BlcR DNA-binding function via oligomerization.« less

  18. A single amino-acid substitution in the Ets domain alters core DNA binding specificity of Ets1 to that of the related transcription factors Elf1 and E74.

    PubMed

    Bosselut, R; Levin, J; Adjadj, E; Ghysdael, J

    1993-11-11

    Ets proteins form a family of sequence specific DNA binding proteins which bind DNA through a 85 aminoacids conserved domain, the Ets domain, whose sequence is unrelated to any other characterized DNA binding domain. Unlike all other known Ets proteins, which bind specific DNA sequences centered over either GGAA or GGAT core motifs, E74 and Elf1 selectively bind to GGAA corecontaining sites. Elf1 and E74 differ from other Ets proteins in three residues located in an otherwise highly conserved region of the Ets domain, referred to as conserved region III (CRIII). We show that a restricted selectivity for GGAA core-containing sites could be conferred to Ets1 upon changing a single lysine residue within CRIII to the threonine found in Elf1 and E74 at this position. Conversely, the reciprocal mutation in Elf1 confers to this protein the ability to bind to GGAT core containing EBS. This, together with the fact that mutation of two invariant arginine residues in CRIII abolishes DNA binding, indicates that CRIII plays a key role in Ets domain recognition of the GGAA/T core motif and lead us to discuss a model of Ets proteins--core motif interaction.

  19. Characterization of Dermanyssus gallinae (Acarina: Dermanissydae) by sequence analysis of the ribosomal internal transcribed spacer regions.

    PubMed

    Potenza, L; Cafiero, M A; Camarda, A; La Salandra, G; Cucchiarini, L; Dachà, M

    2009-10-01

    In the present work mites previously identified as Dermanyssus gallinae De Geer (Acari, Mesostigmata) using morphological keys were investigated by molecular tools. The complete internal transcribed spacer 1 (ITS1), 5.8S ribosomal DNA, and ITS2 region of the ribosomal DNA from mites were amplified and sequenced to examine the level of sequence variations and to explore the feasibility of using this region in the identification of this mite. Conserved primers located at the 3'end of 18S and at the 5'start of 28S rRNA genes were used first, and amplified fragments were sequenced. Sequence analyses showed no variation in 5.8S and ITS2 region while slight intraspecific variations involving substitutions as well as deletions concentrated in the ITS1 region. Based on the sequence analyses a nested PCR of the ITS2 region followed by RFLP analyses has been set up in the attempt to provide a rapid molecular diagnostic tool of D. gallinae.

  20. Number and location of mouse mammary tumor virus proviral DNA in mouse DNA of normal tissue and of mammary tumors.

    PubMed Central

    Groner, B; Hynes, N E

    1980-01-01

    The Southern DNA filter transfer technique was used to characterize the genomic location of the mouse mammary tumor proviral DNA in different inbred strains of mice. Two of the strains (C3H and CBA) arose from a cross of a Bagg albino (BALB/c) mouse and a DBA mouse. The mouse mammary tumor virus-containing restriction enzyme DNA fragments of these strains had similar patterns, suggesting that the proviruses of these mice are in similar genomic locations. Conversely, the pattern arising from the DNA of the GR mouse, a strain genetically unrelated to the others, appeared different, suggesting that its mouse mammary tumor proviruses are located in different genomic sites. The structure of another gene, that coding for beta-globin, was also compared. The mice strains which we studied can be categorized into two classes, expressing either one or two beta-globin proteins. The macroenvironment of the beta-globin gene appeared similar among the mice strains belonging to one genetic class. Female mice of the C3H strain exogenously transmit mouse mammary tumor virus via the milk, and their offspring have a high incidence of mammary tumor occurrence. DNA isolated from individual mammary tumors taken from C3H mice or from BALB/c mice foster nursed on C3H mothers was analyzed by the DNA filter transfer technique. Additional mouse mammary tumor virus-containing fragments were found in the DNA isolated from each mammary tumor. These proviral sequences were integrated into different genomic sites in each tumor. Images PMID:6245257

  1. Simulation of the charge migration in DNA under irradiation with heavy ions.

    PubMed

    Belov, Oleg V; Boyda, Denis L; Plante, Ianik; Shirmovsky, Sergey Eh

    2015-01-01

    A computer model to simulate the processes of charge injection and migration through DNA after irradiation by a heavy charged particle was developed. The most probable sites of charge injection were obtained by merging spatial models of short DNA sequence and a single 1 GeV/u iron particle track simulated by the code RITRACKS (Relativistic Ion Tracks). Charge migration was simulated by using a quantum-classical nonlinear model of the DNA-charge system. It was found that charge migration depends on the environmental conditions. The oxidative damage in DNA occurring during hole migration was simulated concurrently, which allowed the determination of probable locations of radiation-induced DNA lesions.

  2. Particle sizer and DNA sequencer

    DOEpatents

    Olivares, Jose A.; Stark, Peter C.

    2005-09-13

    An electrophoretic device separates and detects particles such as DNA fragments, proteins, and the like. The device has a capillary which is coated with a coating with a low refractive index such as Teflon.RTM. AF. A sample of particles is fluorescently labeled and injected into the capillary. The capillary is filled with an electrolyte buffer solution. An electrical field is applied across the capillary causing the particles to migrate from a first end of the capillary to a second end of the capillary. A detector light beam is then scanned along the length of the capillary to detect the location of the separated particles. The device is amenable to a high throughput system by providing additional capillaries. The device can also be used to determine the actual size of the particles and for DNA sequencing.

  3. Picoliter DNA Sequencing Chemistry on an Electrowetting-based Digital Microfluidic Platform

    PubMed Central

    Ferguson Welch, Erin R.; Lin, Yan-You; Madison, Andrew; Fair, R.B.

    2011-01-01

    The results of investigations into performing DNA sequencing chemistry on a picoliter-scale electrowetting digital microfluidic platform are reported. Pyrosequencing utilizes pyrophosphate produced during nucleotide base addition to initiate a process ending with detection through a chemiluminescence reaction using firefly luciferase. The intensity of light produced during the reaction can be quantified to determine the number of bases added to the DNA strand. The logic-based control and discrete fluid droplets of a digital microfluidic device lend themselves well to the pyrosequencing process. Bead-bound DNA is magnetically held in a single location, and wash or reagent droplets added or split from it to circumvent product dilution. Here we discuss the dispensing, control, and magnetic manipulation of the paramagnetic beads used to hold target DNA. We also demonstrate and characterize the picoliter-scale reaction of luciferase with adenosine triphosphate to represent the detection steps of pyrosequencing and all necessary alterations for working on this scale. PMID:21298802

  4. J Genes for Heavy Chain Immunoglobulins of Mouse

    NASA Astrophysics Data System (ADS)

    Newell, Nanette; Richards, Julia E.; Tucker, Philip W.; Blattner, Frederick R.

    1980-09-01

    A 15.8-kilobase pair fragment of BALB/c mouse liver DNA, cloned in the Charon 4Aλ phage vector system, was shown to contain the μ heavy chain constant region (CHμ ) gene for the mouse immunoglobulin M. In addition, this fragment of DNA contains at least two J genes, used to code for the carboxyl terminal portion of heavy chain variable regions. These genes are located in genomic DNA about eight kilobase pairs to the 5' side of the CHμ gene. The complete nucleotide sequence of a 1120-base pair stretch of DNA that includes the two J genes has been determined.

  5. Informatic and genomic analysis of melanocyte cDNA libraries as a resource for the study of melanocyte development and function.

    PubMed

    Baxter, Laura L; Hsu, Benjamin J; Umayam, Lowell; Wolfsberg, Tyra G; Larson, Denise M; Frith, Martin C; Kawai, Jun; Hayashizaki, Yoshihide; Carninci, Piero; Pavan, William J

    2007-06-01

    As part of the RIKEN mouse encyclopedia project, two cDNA libraries were prepared from melanocyte-derived cell lines, using techniques of full-length clone selection and subtraction/normalization to enrich for rare transcripts. End sequencing showed that these libraries display over 83% complete coding sequence at the 5' end and 96-97% complete coding sequence at the 3' end. Evaluation of the libraries, derived from B16F10Y tumor cells and melan-c cells, revealed that they contain clones for a majority of the genes previously demonstrated to function in melanocyte biology. Analysis of genomic locations for transcripts revealed that the distribution of melanocyte genes is non-random throughout the genome. Three genomic regions identified that showed significant clustering of melanocyte-expressed genes contain one or more genes previously shown to regulate melanocyte development or function. A catalog of genes expressed in these libraries is presented, providing a valuable resource of cDNA clones and sequence information that can be used for identification of new genes important for melanocyte development, function, and disease.

  6. Molecular cloning of a cDNA coding for GTP cyclohydrolase I from Dictyostelium discoideum.

    PubMed Central

    Witter, K; Cahill, D J; Werner, T; Ziegler, I; Rödl, W; Bacher, A; Gütlich, M

    1996-01-01

    The GTP cyclohydrolase I (GTP-CH) gene of the cellular slime mould Dictyostelium discoideum has been cloned and sequenced. The 855 bp cDNA of this gene contains the open reading frame (ORF) encoding 232 amino acids with a predicted molecular mass of approx. 26 kDa. Southern blot analysis indicated the presence of a single gene for GTP-CH in Dictyostelium. PCR amplification of the ORF from chromosomal DNA and sequencing showed the existence of a 101 bp intron in the GTP-CH gene of Dictyostelium discoideum. The amino acid sequence has 47% and 49% positional identity to those of the human and yeast enzymes respectively. Most of the sequence variation between species is located in the N-terminal part of the protein. The overall identity with the E. coli protein is markedly lower. The enzyme was expressed in E. coli and purified as a 68 kDa fusion protein with the maltose-binding protein of E. coli. GTP-CH of Dictyostelium is heat-stable and showed maximal activity at 60 degrees C. The Km value for GTP is 50 microM. PMID:8870645

  7. Trichomonas vaginalis ribosomal RNA: identification and characterisation of the transcription promoter and terminator sequences.

    PubMed

    Franco, Bernardo; Hernández, Roberto; López-Villaseñor, Imelda

    2012-09-01

    Trichomonas vaginalis is a parasitic protozoan of both medical and biological relevance. Transcriptional studies in this organism have focused mainly on type II pol promoters, whereas the elements necessary for transcription by polI or polIII have not been investigated. Here, with the aid of a transient transcription system, we characterised the rDNA intergenic region, defining both the promoter and the terminator sequences required for transcription. We defined the promoter as a compact region of approximately 180 bp. We also identified a potential upstream control element (UCE) that was located 80 bp upstream of the transcription start point (TSP). A transcription termination element was identified within a 34 bp region that was located immediately downstream of the 28S coding sequence. The function of this element depends upon polarity and the presence of both a stretch of uridine residues (U's) and a hairpin structure in the transcript. Our observations provide a strong basis for the study of DNA recognition by the polI transcriptional machinery in this early divergent organism. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Pea chloroplast tRNA(Lys) (UUU) gene: transcription and analysis of an intron-containing gene.

    PubMed

    Boyer, S K; Mullet, J E

    1988-07-01

    The pea chloroplast trnK gene which encodes tRNA(Lys) (UUU) was sequenced. TrnK is located 210 bp upstream from the promoter of psbA and immediately downstream from the 3'-end of rbcL. The gene is transcribed from the same DNA strand as psbA and rbcL. A 2447 bp intron with class II features is located in the trnK anticodon loop. The intron contains a 506 amino acid open reading frame which could encode an RNA maturase. The primary transcript of trnK is 2.9 kb long; its 5'-end was identified as a site of transcription initiation by in vitro transcription experiments. The 5'-terminus is adjacent to DNA sequences previously identified as transcription promoter elements. The most abundant trnK transcript is 2.5 kb long with termini corresponding to the 5' and 3' ends of the trnK exons. Intron specific RNAs were not detected. This suggests that RNA processing which produces tRNA(Lys) leads to rapid degradation of intron sequences.

  9. Assessment of three plastid DNA barcode markers for identification of Clinacanthus nutans (Acanthaceae).

    PubMed

    Ismail, Noor Zafirah; Arsad, Hasni; Samian, Mohammed Razip; Hamdan, Mohammad Razak; Othman, Ahmad Sofiman

    2018-01-01

    This study was conducted to determine the feasibility of using three plastid DNA regions ( matK , trnH - psbA , and rbcL ) as DNA barcodes to identify the medicinal plant Clinacanthus nutans . In this study, C. nutans was collected at several different locations. Total genomic DNA was extracted, amplified by polymerase chain reaction (PCR), and sequenced using matK , trnH - psbA , and rbcL , primers. DNA sequences generated from PCR were submitted to the National Center for Biotechnology Information's (NCBI) GenBank. Identification of C. nutans was carried out using NCBI's Basic Local Alignment Search Tool (BLAST). The rbcL and trnH - psbA regions successfully identified C. nutans with sequencing rates of 100% through BLAST identification. Molecular Evolutionary Genetics Analysis (MEGA) 6.0 was used to analyze interspecific and intraspecific divergence of plastid DNA sequences. rbcL and matK exhibited the lowest average interspecific distance (0.0487 and 0.0963, respectively), whereas trnH - psbA exhibited the highest average interspecific distance (0.2029). The R package Spider revealed that trnH - psbA correctly identified Barcode of Life Data System (BOLD) 96%, best close match 79%, and near neighbor 100% of the species, compared to matK (BOLD 72%; best close match 64%; near neighbor 78%) and rbcL (BOLD 77%; best close match 62%; near neighbor 88%). These results indicate that trnH - psbA is very effective at identifying C. nutans , as it performed well in discriminating species in Acanthaceae.

  10. Analysis of the regulatory region of the protease III (ptr) gene of Escherichia coli K-12.

    PubMed

    Claverie-Martin, F; Diaz-Torres, M R; Kushner, S R

    1987-01-01

    The ptr gene of Escherichia coli encodes protease III (Mr 110,000) and a 50-kDa polypeptide, both of which are found in the periplasmic space. The gene is physically located between the recC and recB loci on the E. coli chromosome. The nucleotide sequence of a 1167-bp EcoRV-ClaI fragment of chromosomal DNA containing the promoter region and 885 bp of the ptr coding sequence has been determined. S1 nuclease mapping analysis showed that the major 5' end of the ptr mRNA was localized 127 bp upstream from the ATG start codon. The open reading frame (ORF), preceded by a Shine-Dalgarno sequence, extends to the end of the sequenced DNA. Downstream from the -35 and -10 regions is a sequence that strongly fits the consensus sequence of known nitrogen-regulated promoters. A signal peptide of 23 amino acids residues is present at the N terminus of the derived amino acid sequence. The cleavage site as well as the ORF were confirmed by sequencing the N terminus of mature protease III.

  11. Molecular organization and chromosomal localization of 5S rDNA in Amazonian Engystomops (Anura, Leiuperidae)

    PubMed Central

    2012-01-01

    Background For anurans, knowledge of 5S rDNA is scarce. For Engystomops species, chromosomal homeologies are difficult to recognize due to the high level of inter- and intraspecific cytogenetic variation. In an attempt to better compare the karyotypes of the Amazonian species Engystomops freibergi and Engystomops petersi, and to extend the knowledge of 5S rDNA organization in anurans, the 5S rDNA sequences of Amazonian Engystomops species were isolated, characterized, and mapped. Results Two types of 5S rDNA, which were readily differentiated by their NTS (non-transcribed spacer) sizes and compositions, were isolated from specimens of E. freibergi from Brazil and E. petersi from two Ecuadorian localities (Puyo and Yasuní). In the E. freibergi karyotypes, the entire type I 5S rDNA repeating unit hybridized to the pericentromeric region of 3p, whereas the entire type II 5S rDNA repeating unit mapped to the distal region of 6q, suggesting a differential localization of these sequences. The type I NTS probe clearly detected the 3p pericentromeric region in the karyotypes of E. freibergi and E. petersi from Puyo and the 5p pericentromeric region in the karyotype of E. petersi from Yasuní, but no distal or interstitial signals were observed. Interestingly, this probe also detected many centromeric regions in the three karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. The type II NTS probe detected only distal 6q regions in the three karyotypes, corroborating the differential distribution of the two types of 5S rDNA. Conclusions Because the 5S rDNA types found in Engystomops are related to those of Physalaemus with respect to their nucleotide sequences and chromosomal locations, their origin likely preceded the evolutionary divergence of these genera. In addition, our data indicated homeology between Chromosome 5 in E. petersi from Yasuní and Chromosomes 3 in E. freibergi and E. petersi from Puyo. In addition, the chromosomal location of the type II 5S rDNA corroborates the hypothesis that the Chromosomes 6 of E. petersi and E. freibergi are homeologous despite the great differences observed between the karyotypes of the Yasuní specimens and the others. PMID:22433220

  12. Molecular organization and chromosomal localization of 5S rDNA in Amazonian Engystomops (Anura, Leiuperidae).

    PubMed

    Rodrigues, Débora Silva; Rivera, Miryan; Lourenço, Luciana Bolsoni

    2012-03-20

    For anurans, knowledge of 5S rDNA is scarce. For Engystomops species, chromosomal homeologies are difficult to recognize due to the high level of inter- and intraspecific cytogenetic variation. In an attempt to better compare the karyotypes of the Amazonian species Engystomops freibergi and Engystomops petersi, and to extend the knowledge of 5S rDNA organization in anurans, the 5S rDNA sequences of Amazonian Engystomops species were isolated, characterized, and mapped. Two types of 5S rDNA, which were readily differentiated by their NTS (non-transcribed spacer) sizes and compositions, were isolated from specimens of E. freibergi from Brazil and E. petersi from two Ecuadorian localities (Puyo and Yasuní). In the E. freibergi karyotypes, the entire type I 5S rDNA repeating unit hybridized to the pericentromeric region of 3p, whereas the entire type II 5S rDNA repeating unit mapped to the distal region of 6q, suggesting a differential localization of these sequences. The type I NTS probe clearly detected the 3p pericentromeric region in the karyotypes of E. freibergi and E. petersi from Puyo and the 5p pericentromeric region in the karyotype of E. petersi from Yasuní, but no distal or interstitial signals were observed. Interestingly, this probe also detected many centromeric regions in the three karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. The type II NTS probe detected only distal 6q regions in the three karyotypes, corroborating the differential distribution of the two types of 5S rDNA. Because the 5S rDNA types found in Engystomops are related to those of Physalaemus with respect to their nucleotide sequences and chromosomal locations, their origin likely preceded the evolutionary divergence of these genera. In addition, our data indicated homeology between Chromosome 5 in E. petersi from Yasuní and Chromosomes 3 in E. freibergi and E. petersi from Puyo. In addition, the chromosomal location of the type II 5S rDNA corroborates the hypothesis that the Chromosomes 6 of E. petersi and E. freibergi are homeologous despite the great differences observed between the karyotypes of the Yasuní specimens and the others.

  13. Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites

    PubMed Central

    Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou

    2011-01-01

    DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738

  14. Determining the Location of DNA Modification and Mutation Caused by UVB Light in Skin Cancer

    DTIC Science & Technology

    2013-09-01

    we obtain cleavage patterns consistent with the administered UV dosage and that sequencing libraries generated for both yeast and human cells show...understanding the mutations they cause. 15. SUBJECT TERMS UV DNA modification, HeLa cells, Skin Cancer 16. SECURITY CLASSIFICATION OF: 17...of mutations that are caused by UV light in cells and correlate them to modification frequencies. Understanding the initial chemical changes

  15. Longitudinal Metagenomic Analysis of Hospital Air Identifies Clinically Relevant Microbes.

    PubMed

    King, Paula; Pham, Long K; Waltz, Shannon; Sphar, Dan; Yamamoto, Robert T; Conrad, Douglas; Taplitz, Randy; Torriani, Francesca; Forsyth, R Allyn

    2016-01-01

    We describe the sampling of sixty-three uncultured hospital air samples collected over a six-month period and analysis using shotgun metagenomic sequencing. Our primary goals were to determine the longitudinal metagenomic variability of this environment, identify and characterize genomes of potential pathogens and determine whether they are atypical to the hospital airborne metagenome. Air samples were collected from eight locations which included patient wards, the main lobby and outside. The resulting DNA libraries produced 972 million sequences representing 51 gigabases. Hierarchical clustering of samples by the most abundant 50 microbial orders generated three major nodes which primarily clustered by type of location. Because the indoor locations were longitudinally consistent, episodic relative increases in microbial genomic signatures related to the opportunistic pathogens Aspergillus, Penicillium and Stenotrophomonas were identified as outliers at specific locations. Further analysis of microbial reads specific for Stenotrophomonas maltophilia indicated homology to a sequenced multi-drug resistant clinical strain and we observed broad sequence coverage of resistance genes. We demonstrate that a shotgun metagenomic sequencing approach can be used to characterize the resistance determinants of pathogen genomes that are uncharacteristic for an otherwise consistent hospital air microbial metagenomic profile.

  16. 3DNALandscapes: a database for exploring the conformational features of DNA.

    PubMed

    Zheng, Guohui; Colasanti, Andrew V; Lu, Xiang-Jun; Olson, Wilma K

    2010-01-01

    3DNALandscapes, located at: http://3DNAscapes.rutgers.edu, is a new database for exploring the conformational features of DNA. In contrast to most structural databases, which archive the Cartesian coordinates and/or derived parameters and images for individual structures, 3DNALandscapes enables searches of conformational information across multiple structures. The database contains a wide variety of structural parameters and molecular images, computed with the 3DNA software package and known to be useful for characterizing and understanding the sequence-dependent spatial arrangements of the DNA sugar-phosphate backbone, sugar-base side groups, base pairs, base-pair steps, groove structure, etc. The data comprise all DNA-containing structures--both free and bound to proteins, drugs and other ligands--currently available in the Protein Data Bank. The web interface allows the user to link, report, plot and analyze this information from numerous perspectives and thereby gain insight into DNA conformation, deformability and interactions in different sequence and structural contexts. The data accumulated from known, well-resolved DNA structures can serve as useful benchmarks for the analysis and simulation of new structures. The collective data can also help to understand how DNA deforms in response to proteins and other molecules and undergoes conformational rearrangements.

  17. Colonization of heterochromatic genes by transposable elements in Drosophila.

    PubMed

    Dimitri, Patrizio; Junakovic, Nikolaj; Arcà, Bruno

    2003-04-01

    As a further step toward understanding transposable element-host genome interactions, we investigated the molecular anatomy of introns from five heterochromatic and 22 euchromatic protein-coding genes of Drosophila melanogaster. A total of 79 kb of intronic sequences from heterochromatic genes and 355 kb of intronic sequences from euchromatic genes have been used in Blast searches against Drosophila transposable elements (TEs). The results show that TE-homologous sequences belonging to 19 different families represent about 50% of intronic DNA from heterochromatic genes. In contrast, only 0.1% of the euchromatic intron DNA exhibits homology to known TEs. Intraspecific and interspecific size polymorphisms of introns were found, which are likely to be associated with changes in TE-related sequences. Together, the enrichment in TEs and the apparent dynamic state of heterochromatic introns suggest that TEs contribute significantly to the evolution of genes located in heterochromatin.

  18. DNA sequence analysis of a 10 624 bp fragment of the left arm of chromosome XV from Saccharomyces cerevisiae reveals a RNA binding protein, a mitochondrial protein, two ribosomal proteins and two new open reading frames.

    PubMed

    Lafuente, M J; Gamo, F J; Gancedo, C

    1996-09-01

    We have determined the sequence of a 10624 bp DNA segment located in the left arm of chromosome XV of Saccharomyces cerevisiae. The sequence contains eight open reading frames (ORFs) longer than 100 amino acids. Two of them do not present significant homology with sequences found in the databases. The product of ORF o0553 is identical to the protein encoded by the gene SMF1. Internal to it there is another ORF, o0555 that is apparently expressed. The proteins encoded by ORFs o0559 and o0565 are identical to ribosomal proteins S19.e and L18 respectively. ORF o0550 encodes a protein with an RNA binding signature including RNP motifs and stretches rich in asparagine, glutamine and arginine.

  19. A 21.7 kb DNA segment on the left arm of yeast chromosome XIV carries WHI3, GCR2, SPX18, SPX19, an homologue to the heat shock gene SSB1 and 8 new open reading frames of unknown function.

    PubMed

    Jonniaux, J L; Coster, F; Purnelle, B; Goffeau, A

    1994-12-01

    We report the amino acid sequence of 13 open reading frames (ORF > 299 bp) located on a 21.7 kb DNA segment from the left arm of chromosome XIV of Saccharomyces cerevisiae. Five open reading frames had been entirely or partially sequenced previously: WHI3, GCR2, SPX19, SPX18 and a heat shock gene similar to SSB1. The products of 8 other ORFs are new putative proteins among which N1394 is probably a membrane protein. N1346 contains a leucine zipper pattern and the corresponding ORF presents an HAP (global regulator of respiratory genes) upstream activating sequence in the promoting region. N1386 shares homologies with the DNA structure-specific recognition protein family SSRPs and the corresponding ORF is preceded by an MCB (MluI cell cycle box) upstream activating factor.

  20. CRISPR/Cas9 for genome editing: progress, implications and challenges.

    PubMed

    Zhang, Feng; Wen, Yan; Guo, Xiong

    2014-09-15

    Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) protein 9 system provides a robust and multiplexable genome editing tool, enabling researchers to precisely manipulate specific genomic elements, and facilitating the elucidation of target gene function in biology and diseases. CRISPR/Cas9 comprises of a nonspecific Cas9 nuclease and a set of programmable sequence-specific CRISPR RNA (crRNA), which can guide Cas9 to cleave DNA and generate double-strand breaks at target sites. Subsequent cellular DNA repair process leads to desired insertions, deletions or substitutions at target sites. The specificity of CRISPR/Cas9-mediated DNA cleavage requires target sequences matching crRNA and a protospacer adjacent motif locating at downstream of target sequences. Here, we review the molecular mechanism, applications and challenges of CRISPR/Cas9-mediated genome editing and clinical therapeutic potential of CRISPR/Cas9 in future. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  1. Dimensions and Global Twist of Single-Layer DNA Origami Measured by Small-Angle X-ray Scattering.

    PubMed

    Baker, Matthew A B; Tuckwell, Andrew J; Berengut, Jonathan F; Bath, Jonathan; Benn, Florence; Duff, Anthony P; Whitten, Andrew E; Dunn, Katherine E; Hynson, Robert M; Turberfield, Andrew J; Lee, Lawrence K

    2018-06-04

    The rational design of complementary DNA sequences can be used to create nanostructures that self-assemble with nanometer precision. DNA nanostructures have been imaged by atomic force microscopy and electron microscopy. Small-angle X-ray scattering (SAXS) provides complementary structural information on the ensemble-averaged state of DNA nanostructures in solution. Here we demonstrate that SAXS can distinguish between different single-layer DNA origami tiles that look identical when immobilized on a mica surface and imaged with atomic force microscopy. We use SAXS to quantify the magnitude of global twist of DNA origami tiles with different crossover periodicities: these measurements highlight the extreme structural sensitivity of single-layer origami to the location of strand crossovers. We also use SAXS to quantify the distance between pairs of gold nanoparticles tethered to specific locations on a DNA origami tile and use this method to measure the overall dimensions and geometry of the DNA nanostructure in solution. Finally, we use indirect Fourier methods, which have long been used for the interpretation of SAXS data from biomolecules, to measure the distance between DNA helix pairs in a DNA origami nanotube. Together, these results provide important methodological advances in the use of SAXS to analyze DNA nanostructures in solution and insights into the structures of single-layer DNA origami.

  2. Satellite DNA in Plants: More than Just Rubbish.

    PubMed

    Garrido-Ramos, Manuel A

    2015-01-01

    For decades, satellite DNAs have been the hidden part of genomes. Initially considered as junk DNA, there is currently an increasing appreciation of the functional significance of satellite DNA repeats and of their sequences. Satellite DNA families accumulate in the heterochromatin in different parts of the eukaryotic chromosomes, mainly in pericentromeric and subtelomeric regions, but they also span the functional centromere. Tandem repeat sequences may spread from subtelomeric to interstitial loci, leading to the formation of chromosome-specific loci or to the accumulation in equilocal sites in different chromosomes. They also appear as the main components of the heterochromatin in the sex-specific region of sex chromosomes. Satellite DNA, required for chromosome organization, also plays a role in pairing and segregation. Some satellite repeats are transcribed and can participate in the formation and maintenance of heterochromatin structure and in the modulation of gene expression. In addition to the identification of the different satellite DNA families, their characteristics and location, we are interested in determining their impact on the genomes, by identifying the mechanisms leading to their appearance and amplification as well as in understanding how they change over time, the factors affecting these changes, and the influence exerted by the evolutionary history of the organisms. On the other hand, satellite DNA sequences are rapidly evolving sequences that may cause reproductive barriers between organisms and promote speciation. The accumulation of experimental data collected in recent years and the emergence of new approaches based on next-generation sequencing and high-throughput genome analysis are opening new perspectives that are changing our understanding of satellite DNA. This review examines recent data to provide a timely update on the overall information gathered about this part of the genome, focusing on the advances in the knowledge of its origin, its evolution, and its potential functional roles. © 2015 S. Karger AG, Basel.

  3. Molecular gene organisation and secondary structure of the mitochondrial large subunit ribosomal RNA from the cultivated Basidiomycota Agrocybe aegerita: a 13 kb gene possessing six unusual nucleotide extensions and eight introns.

    PubMed

    Gonzalez, P; Barroso, G; Labarère, J

    1999-04-01

    The complete gene sequence and secondary structure of the mitochondrial LSU rRNA from the cultivated Basidiomycota Agrocybe aegerita was derived by chromosome walking. The A.aegerita LSU rRNA gene (13 526 nt) represents, to date, the longest described, due to the highest number of introns (eight) and the occurrence of six long nucleotidic extensions. Seven introns belong to group I, while the intronic sequence i5 constitutes the first typical group II intron reported in a fungal mitochondrial LSU rDNA. As with most fungal LSU rDNA introns reported to date, four introns (i5-i8) are distributed in domain V associated with the peptidyl-transferase activity. One intron (i1) is located in domain I, and three (i2-i4) in domain II. The introns i2-i8 possess homologies with other fungal, algal or protozoan introns located at the same position in LSU rDNAs. One of them (i6) is located at the same insertion site as most Ascomycota or algae LSU introns, suggesting a possible inheritance from a common ancestor. On the contrary, intron i1 is located at a so-far unreported insertion site. Among the six unusual nucleotide extensions, five are located in domain I and one in domain V. This is the first report of a mitochondrial LSU rRNA gene sequence and secondary structure for the whole Basidiomycota division.

  4. First ancient DNA sequences from the Late Pleistocene red deer (Cervus elaphus) in the Crimea, Ukraine

    NASA Astrophysics Data System (ADS)

    Stanković, Ana; Nadachowski, Adam; Doan, Karolina; Stefaniak, Krzysztof; Baca, Mateusz; Socha, Paweł; Wegleński, Piotr; Ridush, Bogdan

    2010-05-01

    The Late Pleistocene has been a period of significant population and species turnover and extinctions among the large mammal fauna. Massive climatic and environmental changes during Pleistocene significantly influenced the distribution and also genetic diversity of plants and animals. The model of glacial refugia and habitat contraction to southern peninsulas in Europe as areas for the survival of temperate animal species during unfavourable Pleistocene glaciations is at present widely accepted. However, both molecular data and the fossil record indicate the presence of northern and perhaps north-eastern refugia in Europe. In recent years, much new palaeontological data have been obtained in the Crimean Peninsula, Ukraine, following extensive investigations. The red deer (Cervus elaphus) samples for aDNA studies were collected in Emine-Bair-Khosar Cave, situated on the north edge of Lower Plateau of the Chatyrdag Massif (Crimean Mountains). The cave is a vertical shaft, which functioned as a huge mega-trap over a long period of time (probably most of the Pleistocene). The bone assemblages provided about 5000 bones belonging to more than 40 species. The C. elaphus bones were collected from three different stratigraphical levels, radiocarbon dated by accelerator mass spectrometry (AMS) method. The bone fragments of four specimens of red deer were used for the DNA isolation and analysis. The mtDNA (Cytochome b) was successfully isolated from three bone fragments and the cytochrome b sequences were amplified by multiplex PCR. The sequences obtained so far allowed for the reconstruction of only preliminary phylogenetic trees. A fragment of metatarsus from level dated to ca. 48,500±2,000 years BP, yielded a sequence of 513 bp, allowing to locate the specimen on the phylogenetic tree within modern C. elaphus specimens from southern and middle Europe. The second bone fragment, a fragment of mandible, collected from level dated approximately to ca. 33,500±400 years BP, yielded a sequence (696 bp) locating this specimen much closer to the modern C. elaphus specimens from China and Far East. From the third bone fragment (metatarsus), dated between ca. 12,000 years BP and 30,000 years BP, the sequence of only 346 bp has been obtained. It locates this specimen between European and Asiatic haplogroups. The preliminary results of analysis of the DNA from Crimean C. elaphus fossils reveal the great genetic heterogeneity and a complex phylogeographical pattern of the material studied. The obtained results support the opinion that Crimean Peninsula was the most north-eastern refugium in Europe during Late Pleistocene playing a major role in recolonization and dispersal processes of temperate species during and after the Late Pleistocene in this part of the Euro-Asian continent.

  5. SV40 host-substituted variants: a new look at the monkey DNA inserts and recombinant junctions.

    PubMed

    Singer, Maxine; Winocour, Ernest

    2011-04-10

    The available monkey genomic data banks were examined in order to determine the chromosomal locations of the host DNA inserts in 8 host-substituted SV40 variant DNAs. Five of the 8 variants contained more than one linked monkey DNA insert per tandem repeat unit and in all cases but one, the 19 monkey DNA inserts in the 8 variants mapped to different locations in the monkey genome. The 50 parental DNAs (32 monkey and 18 SV40 DNA segments) which spanned the crossover and flanking regions that participated in monkey/monkey and monkey/SV40 recombinations were characterized by substantial levels of microhomology of up to 8 nucleotides in length; the parental DNAs also exhibited direct and inverted repeats at or adjacent to the crossover sequences. We discuss how the host-substituted SV40 variants arose and the nature of the recombination mechanisms involved. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. Syntenic conservation of HSP70 genes in cattle and humans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Grosz, M.D.; Womack, J.E.; Skow, L.C.

    1992-12-01

    A phage library of bovine genomic DNA was screened for hybridization with a human HSP70 cDNA probe, and 21 positive plaques were identified and isolated. Restriction mapping and blot hybridization analysis of DNA from the recombinant plaques demonstrated that the cloned DNAs were derived from three different regions of the bovine genome. Ore region contains two tandemly arrayed HSP70 sequences, designated HSP70-1 and HSP70-2, separated by approximately 8 kb of DNA. Single HSP70 sequences, designated HSP70-3 and HSP70-4, were found in two other genomic regions. Locus-specific probes of unique flanking sequences from representative HSP70 clones were hybridized to restriction endonuclease-digestedmore » DNA from bovine-hamster and bovine-mouse somatic cell hybrid panels to determine the chromosomal location of the HSP70 sequences. The probe for the tandemly arrayed HSP70-1 and HSP70-2 sequences mapped to bovine chromosome 23, syntenic with glyoxalase 1, 21 steroid hydroxylase, and major histocompatibility class I loci. HSP70-3 sequences mapped to bovine chromosome 10, syntenic with nucleoside phosphorylase and murine osteosarcoma viral oncogene (v-fos), and HSP70-4 mapped to bovine syntenic group U6, syntenic with amylase 1 and phosphoglucomutase 1. On the basis of these data, the authors propose that bovine HSP70-1,2 are homologous to human HSPA1 and HSPA1L on chromosome 6p21.3, bovine HSP70-3 is the homolog of an unnamed human HSP70 gene on chromosome 14q22-q24, and bovine HSP70-4 is homologous to one of the human HSPA-6,-7 genes on chromosome 1. 34 refs., 2 figs., 1 tab.« less

  7. Genome Analysis of the Domestic Dog (Korean Jindo) by Massively Parallel Sequencing

    PubMed Central

    Kim, Ryong Nam; Kim, Dae-Soo; Choi, Sang-Haeng; Yoon, Byoung-Ha; Kang, Aram; Nam, Seong-Hyeuk; Kim, Dong-Wook; Kim, Jong-Joo; Ha, Ji-Hong; Toyoda, Atsushi; Fujiyama, Asao; Kim, Aeri; Kim, Min-Young; Park, Kun-Hyang; Lee, Kang Seon; Park, Hong-Seog

    2012-01-01

    Although pioneering sequencing projects have shed light on the boxer and poodle genomes, a number of challenges need to be met before the sequencing and annotation of the dog genome can be considered complete. Here, we present the DNA sequence of the Jindo dog genome, sequenced to 45-fold average coverage using Illumina massively parallel sequencing technology. A comparison of the sequence to the reference boxer genome led to the identification of 4 675 437 single nucleotide polymorphisms (SNPs, including 3 346 058 novel SNPs), 71 642 indels and 8131 structural variations. Of these, 339 non-synonymous SNPs and 3 indels are located within coding sequences (CDS). In particular, 3 non-synonymous SNPs and a 26-bp deletion occur in the TCOF1 locus, implying that the difference observed in cranial facial morphology between Jindo and boxer dogs might be influenced by those variations. Through the annotation of the Jindo olfactory receptor gene family, we found 2 unique olfactory receptor genes and 236 olfactory receptor genes harbouring non-synonymous homozygous SNPs that are likely to affect smelling capability. In addition, we determined the DNA sequence of the Jindo dog mitochondrial genome and identified Jindo dog-specific mtDNA genotypes. This Jindo genome data upgrade our understanding of dog genomic architecture and will be a very valuable resource for investigating not only dog genetics and genomics but also human and dog disease genetics and comparative genomics. PMID:22474061

  8. A novel amino acid substitution in a voltage-gated sodium channel is associated with knockdown resistance to permethrin in Aedes aegypti.

    PubMed

    Chang, Cheng; Shen, Wen-Kai; Wang, Tzu-Ting; Lin, Ying-Hsi; Hsu, Err-Lieh; Dai, Shu-Mei

    2009-04-01

    To identify pertinent mutations associated with knockdown resistance to permethrin, the entire coding sequence of the voltage-gated sodium channel gene Aa-para was sequenced and analyzed from a Per-R strain with 190-fold resistance to permethrin and two susceptible strains of Aedes aegypti. The longest transcript, a 6441bp open reading frame, encodes 2147 amino acid residues with an estimated molecular mass of 241kDa. A total of 33 exons were found in the Aa-para gene over 293kb of genomic DNA. Three previously unreported optional exons were identified. The first two exons, m and n, were located within the intracellular domain I/II, and the third, f', was found within the II/III linkers. The two mutually exclusive exons, d and l, were the only alternative exons in all the cDNA clones sequenced in this study. The most distinct finding was a novel amino acid substitution mutation, D1794Y, located within the extracellular linker between IVS5 and IVS6, which is concurrent with the known V1023G mutation in Aa-para of the Per-R strain. The high frequency and coexistence of the two mutations in the Per-R strain suggest that they might exert a synergistic effect to provide the knockdown resistance to permethrin. Furthermore, both cDNA and genomic DNA data from the same individual mosquitoes have demonstrated that RNA editing was not involved in amino acid substitutions of the Per-R strain.

  9. MicroRNAs Form Triplexes with Double Stranded DNA at Sequence-Specific Binding Sites; a Eukaryotic Mechanism via which microRNAs Could Directly Alter Gene Expression

    PubMed Central

    Grace, Christy R.; Ferreira, Antonio M.; Waddell, M. Brett; Ridout, Granger; Naeve, Deanna; Leuze, Michael; LoCascio, Philip F.; Panetta, John C.; Wilkinson, Mark R.; Pui, Ching-Hon; Naeve, Clayton W.; Uberbacher, Edward C.; Bonten, Erik J.; Evans, William E.

    2016-01-01

    MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA) and typically down-regulating their stability or translation. Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence (i.e., NMR, FRET, SPR) that purine or pyrimidine-rich microRNAs of appropriate length and sequence form triple-helical structures with purine-rich sequences of duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show that several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 × 10−16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. This work has thus revealed a new mechanism by which microRNAs could interact with gene promoter regions to modify gene transcription. PMID:26844769

  10. Repetitive sequence analysis and karyotyping reveals centromere-associated DNA sequences in radish (Raphanus sativus L.).

    PubMed

    He, Qunyan; Cai, Zexi; Hu, Tianhua; Liu, Huijun; Bao, Chonglai; Mao, Weihai; Jin, Weiwei

    2015-04-18

    Radish (Raphanus sativus L., 2n = 2x = 18) is a major root vegetable crop especially in eastern Asia. Radish root contains various nutritions which play an important role in strengthening immunity. Repetitive elements are primary components of the genomic sequence and the most important factors in genome size variations in higher eukaryotes. To date, studies about repetitive elements of radish are still limited. To better understand genome structure of radish, we undertook a study to evaluate the proportion of repetitive elements and their distribution in radish. We conducted genome-wide characterization of repetitive elements in radish with low coverage genome sequencing followed by similarity-based cluster analysis. Results showed that about 31% of the genome was composed of repetitive sequences. Satellite repeats were the most dominating elements of the genome. The distribution pattern of three satellite repeat sequences (CL1, CL25, and CL43) on radish chromosomes was characterized using fluorescence in situ hybridization (FISH). CL1 was predominantly located at the centromeric region of all chromosomes, CL25 located at the subtelomeric region, and CL43 was a telomeric satellite. FISH signals of two satellite repeats, CL1 and CL25, together with 5S rDNA and 45S rDNA, provide useful cytogenetic markers to identify each individual somatic metaphase chromosome. The centromere-specific histone H3 (CENH3) has been used as a marker to identify centromere DNA sequences. One putative CENH3 (RsCENH3) was characterized and cloned from radish. Its deduced amino acid sequence shares high similarities to those of the CENH3s in Brassica species. An antibody against B. rapa CENH3, specifically stained radish centromeres. Immunostaining and chromatin immunoprecipitation (ChIP) tests with anti-BrCENH3 antibody demonstrated that both the centromere-specific retrotransposon (CR-Radish) and satellite repeat (CL1) are directly associated with RsCENH3 in radish. Proportions of repetitive elements in radish were estimated and satellite repeats were the most dominating elements. Fine karyotyping analysis was established which allow us to easily identify each individual somatic metaphase chromosome. Immunofluorescence- and ChIP-based assays demonstrated the functional significance of satellite and centromere-specific retrotransposon at centromeres. Our study provides a valuable basis for future genomic studies in radish.

  11. New insights into Acinetobacter baumannii pathogenesis revealed by high-density pyrosequencing and transposon mutagenesis.

    PubMed

    Smith, Michael G; Gianoulis, Tara A; Pukatzki, Stefan; Mekalanos, John J; Ornston, L Nicholas; Gerstein, Mark; Snyder, Michael

    2007-03-01

    Acinetobacter baumannii has emerged as an important and problematic human pathogen as it is the causative agent of several types of infections including pneumonia, meningitis, septicemia, and urinary tract infections. We explored the pathogenic content of this harmful pathogen using a combination of DNA sequencing and insertional mutagenesis. The genome of this organism was sequenced using a strategy involving high-density pyrosequencing, a novel, rapid method of high-throughput sequencing. Excluding the rDNA repeats, the assembled genome is 3,976,746 base pairs (bp) and has 3830 ORFs. A significant fraction of ORFs (17.2%) are located in 28 putative alien islands, indicating that the genome has acquired a large amount of foreign DNA. Consistent with its role in pathogenesis, a remarkable number of the islands (16) contain genes implicated in virulence, indicating the organism devotes a considerable portion of its genes to pathogenesis. The largest island contains elements homologous to the Legionella/Coxiella Type IV secretion apparatus. Type IV secretion systems have been demonstrated to be important for virulence in other organisms and thus are likely to help mediate pathogenesis of A. baumannii. Insertional mutagenesis generated avirulent isolates of A. baumannii and verified that six of the islands contain virulence genes, including two novel islands containing genes that lacked homology with others in the databases. The DNA sequencing approach described in this study allows the rapid elucidation of the DNA sequence of any microbe and, when combined with genetic screens, can identify many novel genes important for microbial pathogenesis.

  12. Formation of cis-diamminedichloroplatinum(II) 1,2-intrastrand cross-links on DNA is flanking-sequence independent.

    PubMed

    Burstyn, J N; Heiger-Bernays, W J; Cohen, S M; Lippard, S J

    2000-11-01

    Mapping of cis-diamminedichloroplatinum(II) (cis-DDP, cisplatin) DNA adducts over >3000 nucleotides was carried out using a replication blockage assay. The sites of inhibition of modified T4 DNA polymerase, also referred to as stop sites, were analyzed to determine the effects of local sequence context on the distribution of intrastrand cisplatin cross-links. In a 3120 base fragment from replicative form M13mp18 DNA containing 24.6% guanine, 25.5% thymine, 26.9% adenine and 23.0% cytosine, 166 individual stop sites were observed at a bound platinum/nucleotide ratio of 1-2 per thousand. The majority of stop sites (90%) occurred at G(n>2) sequences and the remainder were located at sites containing an AG dinucleotide. For all of the GG sites present in the mapped sequences, including those with Gn(>)2, 89% blocked replication, whereas for the AG sites only 17% blocked replication. These blockage sites were independent of flanking nucleotides in a sequence of N(1)G*G*N(2) where N(1), N(2) = A, C, G, T and G*G* indicates a 1,2-intrastrand platinum cross-link. The absence of long-range sequence dependence was confirmed by monitoring the reaction of cisplatin with a plasmid containing an 800 bp insert of the human telomere repeat sequence (TTAGGG)(n). Platination reactions monitored at several formal platinum/nucleotide ratios or as a function of time reveal that the telomere insert was not preferentially damaged by cisplatin. Both replication blockage and telomere-insert plasmid platination experiments indicate that cisplatin 1,2-intrastrand adducts do not form preferentially at G-rich sequences in vitro.

  13. Sequence conservation on the Y chromosome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gibson, L.H.; Yang-Feng, L.; Lau, C.

    The Y chromosome is present in all mammals and is considered to be essential to sex determination. Despite intense genomic research, only a few genes have been identified and mapped to this chromosome in humans. Several of them, such as SRY and ZFY, have been demonstrated to be conserved and Y-located in other mammals. In order to address the issue of sequence conservation on the Y chromosome, we performed fluorescence in situ hybridization (FISH) with DNA from a human Y cosmid library as a probe to study the Y chromosomes from other mammalian species. Total DNA from 3,000-4,500 cosmid poolsmore » were labeled with biotinylated-dUTP and hybridized to metaphase chromosomes. For human and primate preparations, human cot1 DNA was included in the hybridization mixture to suppress the hybridization from repeat sequences. FISH signals were detected on the Y chromosomes of human, gorilla, orangutan and baboon (Old World monkey) and were absent on those of squirrel monkey (New World monkey), Indian munjac, wood lemming, Chinese hamster, rat and mouse. Since sequence analysis suggested that specific genes, e.g. SRY and ZFY, are conserved between these two groups, the lack of detectable hybridization in the latter group implies either that conservation of the human Y sequences is limited to the Y chromosomes of the great apes and Old World monkeys, or that the size of the syntenic segment is too small to be detected under the resolution of FISH, or that homologeous sequences have undergone considerable divergence. Further studies with reduced hybridization stringency are currently being conducted. Our results provide some clues as to Y-sequence conservation across species and demonstrate the limitations of FISH across species with total DNA sequences from a particular chromosome.« less

  14. Integrating De Novo Transcriptome Assembly and Cloning to Obtain Chicken Ovocleidin-17 Full-Length cDNA

    PubMed Central

    Ning, ZhongHua; Hincke, Maxwell T.; Yang, Ning; Hou, ZhuoCheng

    2014-01-01

    Efficiently obtaining full-length cDNA for a target gene is the key step for functional studies and probing genetic variations. However, almost all sequenced domestic animal genomes are not ‘finished’. Many functionally important genes are located in these gapped regions. It can be difficult to obtain full-length cDNA for which only partial amino acid/EST sequences exist. In this study we report a general pipeline to obtain full-length cDNA, and illustrate this approach for one important gene (Ovocleidin-17, OC-17) that is associated with chicken eggshell biomineralization. Chicken OC-17 is one of the best candidates to control and regulate the deposition of calcium carbonate in the calcified eggshell layer. OC-17 protein has been purified, sequenced, and has had its three-dimensional structure solved. However, researchers still cannot conduct OC-17 mRNA related studies because the mRNA sequence is unknown and the gene is absent from the current chicken genome. We used RNA-Seq to obtain the entire transcriptome of the adult hen uterus, and then conducted de novo transcriptome assembling with bioinformatics analysis to obtain candidate OC-17 transcripts. Based on this sequence, we used RACE and PCR cloning methods to successfully obtain the full-length OC-17 cDNA. Temporal and spatial OC-17 mRNA expression analyses were also performed to demonstrate that OC-17 is predominantly expressed in the adult hen uterus during the laying cycle and barely at immature developmental stages. Differential uterine expression of OC-17 was observed in hens laying eggs with weak versus strong eggshell, confirming its important role in the regulation of eggshell mineralization and providing a new tool for genetic selection for eggshell quality parameters. This study is the first one to report the full-length OC-17 cDNA sequence, and builds a foundation for OC-17 mRNA related studies. We provide a general method for biologists experiencing difficulty in obtaining candidate gene full-length cDNA sequences. PMID:24676480

  15. Integrating de novo transcriptome assembly and cloning to obtain chicken Ovocleidin-17 full-length cDNA.

    PubMed

    Zhang, Quan; Liu, Long; Zhu, Feng; Ning, ZhongHua; Hincke, Maxwell T; Yang, Ning; Hou, ZhuoCheng

    2014-01-01

    Efficiently obtaining full-length cDNA for a target gene is the key step for functional studies and probing genetic variations. However, almost all sequenced domestic animal genomes are not 'finished'. Many functionally important genes are located in these gapped regions. It can be difficult to obtain full-length cDNA for which only partial amino acid/EST sequences exist. In this study we report a general pipeline to obtain full-length cDNA, and illustrate this approach for one important gene (Ovocleidin-17, OC-17) that is associated with chicken eggshell biomineralization. Chicken OC-17 is one of the best candidates to control and regulate the deposition of calcium carbonate in the calcified eggshell layer. OC-17 protein has been purified, sequenced, and has had its three-dimensional structure solved. However, researchers still cannot conduct OC-17 mRNA related studies because the mRNA sequence is unknown and the gene is absent from the current chicken genome. We used RNA-Seq to obtain the entire transcriptome of the adult hen uterus, and then conducted de novo transcriptome assembling with bioinformatics analysis to obtain candidate OC-17 transcripts. Based on this sequence, we used RACE and PCR cloning methods to successfully obtain the full-length OC-17 cDNA. Temporal and spatial OC-17 mRNA expression analyses were also performed to demonstrate that OC-17 is predominantly expressed in the adult hen uterus during the laying cycle and barely at immature developmental stages. Differential uterine expression of OC-17 was observed in hens laying eggs with weak versus strong eggshell, confirming its important role in the regulation of eggshell mineralization and providing a new tool for genetic selection for eggshell quality parameters. This study is the first one to report the full-length OC-17 cDNA sequence, and builds a foundation for OC-17 mRNA related studies. We provide a general method for biologists experiencing difficulty in obtaining candidate gene full-length cDNA sequences.

  16. Structural features based genome-wide characterization and prediction of nucleosome organization

    PubMed Central

    2012-01-01

    Background Nucleosome distribution along chromatin dictates genomic DNA accessibility and thus profoundly influences gene expression. However, the underlying mechanism of nucleosome formation remains elusive. Here, taking a structural perspective, we systematically explored nucleosome formation potential of genomic sequences and the effect on chromatin organization and gene expression in S. cerevisiae. Results We analyzed twelve structural features related to flexibility, curvature and energy of DNA sequences. The results showed that some structural features such as DNA denaturation, DNA-bending stiffness, Stacking energy, Z-DNA, Propeller twist and free energy, were highly correlated with in vitro and in vivo nucleosome occupancy. Specifically, they can be classified into two classes, one positively and the other negatively correlated with nucleosome occupancy. These two kinds of structural features facilitated nucleosome binding in centromere regions and repressed nucleosome formation in the promoter regions of protein-coding genes to mediate transcriptional regulation. Based on these analyses, we integrated all twelve structural features in a model to predict more accurately nucleosome occupancy in vivo than the existing methods that mainly depend on sequence compositional features. Furthermore, we developed a novel approach, named DLaNe, that located nucleosomes by detecting peaks of structural profiles, and built a meta predictor to integrate information from different structural features. As a comparison, we also constructed a hidden Markov model (HMM) to locate nucleosomes based on the profiles of these structural features. The result showed that the meta DLaNe and HMM-based method performed better than the existing methods, demonstrating the power of these structural features in predicting nucleosome positions. Conclusions Our analysis revealed that DNA structures significantly contribute to nucleosome organization and influence chromatin structure and gene expression regulation. The results indicated that our proposed methods are effective in predicting nucleosome occupancy and positions and that these structural features are highly predictive of nucleosome organization. The implementation of our DLaNe method based on structural features is available online. PMID:22449207

  17. The complete sequence and promoter activity of the human A-raf-1 gene (ARAF1)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, J.E.; Beck, T.W.; Brennscheidt, U.

    1994-03-01

    The raf proto-oncogenes encode cytoplasmic protein serine/threonine kinases, which play a critical role in cell growth and development. One of these, A-raf-1 (human gene symbol, ARAF1), which is predominantly expressed in mouse urogenital tissues, has been mapped to an evolutionarily conserved linkage group composed of ARAF1, SYN1, TIMP, and properdin located at human chromosome Xp11.2. The authors have isolated human genomic DNA clones containing the expressed gene (ARAF1) on the X chromosome and a pseudogene (ARAF2) on chromosome 7p12-q11.21. Analysis of the nucleotide sequence from the ARAF1 genomic clones demonstrated that it consists of 16 exons encoded by minimally 10,776more » nucleotides. The major transcriptional start site (+1) was determined by RNase protection and primer extension assays. Promoter activity was confirmed by functional assays using DNA fragments fused to a CAT reporter gene. The ARAF1 minimal promoter, located between nucleotides -59 and +93, has a low G + C content and lacks consensus TATA and Inr sequences but shows sequence similarity at position -1 to the E box that is known to interact with USF and TFII-I transcription factors. 65 refs., 7 figs., 1 tab.« less

  18. mtDNA control-region sequence variation suggests multiple independent origins of an "Asian-specific" 9-bp deletion in sub-Saharan Africans.

    PubMed Central

    Soodyall, H.; Vigilant, L.; Hill, A. V.; Stoneking, M.; Jenkins, T.

    1996-01-01

    The intergenic COII/tRNA(Lys) 9-bp deletion in human mtDNA, which is found at varying frequencies in Asia, Southeast Asia, Polynesia, and the New World, was also found in 81 of 919 sub-Saharan Africans. Using mtDNA control-region sequence data from a subset of 41 individuals with the deletion, we identified 22 unique mtDNA types associated with the deletion in Africa. A comparison of the unique mtDNA types from sub-Saharan Africans and Asians with the 9-bp deletion revealed that sub-Saharan Africans and Asians have sequence profiles that differ in the locations and frequencies of variant sites. Both phylogenetic and mismatch-distribution analysis suggest that 9-bp deletion arose independently in sub-Saharan Africa and Asia and that the deletion has arisen more than once in Africa. Within Africa, the deletion was not found among Khoisan peoples and was rare to absent in western and southwestern African populations, but it did occur in Pygmy and Negroid populations from central Africa and in Malawi and southern African Bantu-speakers. The distribution of the 9-bp deletion in Africa suggests that the deletion could have arisen in central Africa and was then introduced to southern Africa via the recent "Bantu expansion." PMID:8644719

  19. Satellite DNA and cytogenetic evolution: molecular aspects and implications for man. [Kangaroo rats

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hatch, F.T.; Mazrimas, J.

    1977-02-28

    Simple, highly reiterated DNA sequences, often observed in density gradients as satellite DNAs, exist in condensed heterochromatin. This material is predominantly located at chromosomal centromeres, occasionally at telomeres, or intercalated within arms; in a few species it occupies entire chromosome arms. Satellite DNAs are a highly variable component of the genome of most higher eukaryotes, but their functions have remained speculative. The genus of kangaroo rats (Dipodomys) exhibits remarkable interspecies variations in content of three satellite DNAs, consisting of simple sequences 3 to 10 base pairs long, and in species karyotypes. A broad range of diploid-DNA content is correlated withmore » satellite-DNA content. The latter is correlated positively with predominance of biarmed over uniarmed chromosomes (high fundamental number FN) and inversely with two anatomical indices (leg-bone-length ratios) of specialization for the jumping gait. Karyotypic variation is achieved via chromosomal rearrangements, e.g., Robertsonian fusion, C-band heteromorphism, and pericentric inversion. Environmental adaptation is achieved, in part, by reassortment of gene-linkage groups and regulatory controls as a result of the chromosomal rearrangements. The foregoing relationships led to the postulation that highly reiterated DNA sequences play a supragenic, global role in environmental adaptation and the evolution of new species.« less

  20. The site-specific ribosomal DNA insertion element R1Bm belongs to a class of non-long-terminal-repeat retrotransposons.

    PubMed Central

    Xiong, Y; Eickbush, T H

    1988-01-01

    Two types of insertion elements, R1 and R2 (previously called type I and type II), are known to interrupt the 28S ribosomal genes of several insect species. In the silkmoth, Bombyx mori, each element occupies approximately 10% of the estimated 240 ribosomal DNA units, while at most only a few copies are located outside the ribosomal DNA units. We present here the complete nucleotide sequence of an R1 insertion from B. mori (R1Bm). This 5.1-kilobase element contains two overlapping open reading frames (ORFs) which together occupy 88% of its length. ORF1 is 461 amino acids in length and exhibits characteristics of retroviral gag genes. ORF2 is 1,051 amino acids in length and contains homology to reverse transcriptase-like enzymes. The analysis of 3' and 5' ends of independent isolates from the ribosomal locus supports the suggestion that R1 is still functioning as a transposable element. The precise location of the element within the genome implies that its transposition must occur with remarkable insertion sequence specificity. Comparison of the deduced amino acid sequences from six retrotransposons, R1 and R2 of B. mori, I factor and F element of Drosophila melanogaster, L1 of Mus domesticus, and Ingi of Trypanosoma brucei, reveals a relatively high level of sequence homology in the reverse transcriptase region. Like R1, these elements lack long terminal repeats. We have therefore named this class of related elements the non-long-terminal-repeat (non-LTR) retrotransposons. Images PMID:2447482

  1. An Easy Phylogenetically Informative Method to Trace the Globally Invasive Potamopyrgus Mud Snail from River's eDNA.

    PubMed

    Clusa, Laura; Ardura, Alba; Gower, Fiona; Miralles, Laura; Tsartsianidou, Valentina; Zaiko, Anastasija; Garcia-Vazquez, Eva

    2016-01-01

    Potamopyrgus antipodarum (New Zealand mud snail) is a prosobranch mollusk native to New Zealand with a wide invasive distribution range. Its non-indigenous populations are reported from Australia, Asia, Europe and North America. Being an extremely tolerant species, Potamopyrgus is capable to survive in a great range of salinity and temperature conditions, which explains its high invasiveness and successful spread outside the native range. Here we report the first finding of Potamopyrgus antipodarum in a basin of the Cantabrian corridor in North Iberia (Bay of Biscay, Spain). Two haplotypes already described in Europe were found in different sectors of River Nora (Nalon basin), suggesting the secondary introductions from earlier established invasive populations. To enhance the surveillance of the species and tracking its further spread in the region, we developed a specific set of primers for the genus Potamopyrgus that amplify a fragment of 16S rDNA. The sequences obtained from PCR on DNA extracted from tissue and water samples (environmental DNA, eDNA) were identical in each location, suggesting clonal reproduction of the introduced individuals. Multiple introduction events from different source populations were inferred from our sequence data. The eDNA tool developed here can serve for tracing New Zealand mud snail populations outside its native range, and for inventorying mud snail population assemblages in the native settings if high throughput sequencing methodologies are employed.

  2. An Easy Phylogenetically Informative Method to Trace the Globally Invasive Potamopyrgus Mud Snail from River’s eDNA

    PubMed Central

    Clusa, Laura; Ardura, Alba; Gower, Fiona; Miralles, Laura; Tsartsianidou, Valentina; Zaiko, Anastasija; Garcia-Vazquez, Eva

    2016-01-01

    Potamopyrgus antipodarum (New Zealand mud snail) is a prosobranch mollusk native to New Zealand with a wide invasive distribution range. Its non-indigenous populations are reported from Australia, Asia, Europe and North America. Being an extremely tolerant species, Potamopyrgus is capable to survive in a great range of salinity and temperature conditions, which explains its high invasiveness and successful spread outside the native range. Here we report the first finding of Potamopyrgus antipodarum in a basin of the Cantabrian corridor in North Iberia (Bay of Biscay, Spain). Two haplotypes already described in Europe were found in different sectors of River Nora (Nalon basin), suggesting the secondary introductions from earlier established invasive populations. To enhance the surveillance of the species and tracking its further spread in the region, we developed a specific set of primers for the genus Potamopyrgus that amplify a fragment of 16S rDNA. The sequences obtained from PCR on DNA extracted from tissue and water samples (environmental DNA, eDNA) were identical in each location, suggesting clonal reproduction of the introduced individuals. Multiple introduction events from different source populations were inferred from our sequence data. The eDNA tool developed here can serve for tracing New Zealand mud snail populations outside its native range, and for inventorying mud snail population assemblages in the native settings if high throughput sequencing methodologies are employed. PMID:27706172

  3. Triangulating the provenance of African elephants using mitochondrial DNA

    PubMed Central

    Ishida, Yasuko; Georgiadis, Nicholas J; Hondo, Tomoko; Roca, Alfred L

    2013-01-01

    African elephant mitochondrial (mt) DNA follows a distinctive evolutionary trajectory. As females do not migrate between elephant herds, mtDNA exhibits low geographic dispersal. We therefore examined the effectiveness of mtDNA for assigning the provenance of African elephants (or their ivory). For 653 savanna and forest elephants from 22 localities in 13 countries, 4258 bp of mtDNA was sequenced. We detected eight mtDNA subclades, of which seven had regionally restricted distributions. Among 108 unique haplotypes identified, 72% were found at only one locality and 84% were country specific, while 44% of individuals carried a haplotype detected only at their sampling locality. We combined 316 bp of our control region sequences with those generated by previous trans-national surveys of African elephants. Among 101 unique control region haplotypes detected in African elephants across 81 locations in 22 countries, 62% were present in only a single country. Applying our mtDNA results to a previous microsatellite-based assignment study would improve estimates of the provenance of elephants in 115 of 122 mis-assigned cases. Nuclear partitioning followed species boundaries and not mtDNA subclade boundaries. For taxa such as elephants in which nuclear and mtDNA markers differ in phylogeography, combining the two markers can triangulate the origins of confiscated wildlife products. PMID:23798975

  4. A bioinformatics approach for identifying transgene insertion sites using whole genome sequencing data.

    PubMed

    Park, Doori; Park, Su-Hyun; Ban, Yong Wook; Kim, Youn Shic; Park, Kyoung-Cheul; Kim, Nam-Soo; Kim, Ju-Kon; Choi, Ik-Young

    2017-08-15

    Genetically modified crops (GM crops) have been developed to improve the agricultural traits of modern crop cultivars. Safety assessments of GM crops are of paramount importance in research at developmental stages and before releasing transgenic plants into the marketplace. Sequencing technology is developing rapidly, with higher output and labor efficiencies, and will eventually replace existing methods for the molecular characterization of genetically modified organisms. To detect the transgenic insertion locations in the three GM rice gnomes, Illumina sequencing reads are mapped and classified to the rice genome and plasmid sequence. The both mapped reads are classified to characterize the junction site between plant and transgene sequence by sequence alignment. Herein, we present a next generation sequencing (NGS)-based molecular characterization method, using transgenic rice plants SNU-Bt9-5, SNU-Bt9-30, and SNU-Bt9-109. Specifically, using bioinformatics tools, we detected the precise insertion locations and copy numbers of transfer DNA, genetic rearrangements, and the absence of backbone sequences, which were equivalent to results obtained from Southern blot analyses. NGS methods have been suggested as an effective means of characterizing and detecting transgenic insertion locations in genomes. Our results demonstrate the use of a combination of NGS technology and bioinformatics approaches that offers cost- and time-effective methods for assessing the safety of transgenic plants.

  5. Complementary and partially complementary DNA duplexes tethered to a functionalized substrate: a molecular dynamics approach to biosensing.

    PubMed

    Monti, Susanna; Cacelli, Ivo; Ferretti, Alessandro; Prampolini, Giacomo; Barone, Vincenzo

    2011-07-21

    Molecular dynamics simulations (90 ns) of different DNA complexes attached to a functionalized substrate in solution were performed in order to clarify the behavior of mismatched DNA sequences captured by a tethered DNA probe (biochip). Examination of the trajectories revealed that the substrate influence and a series of cooperative events, including recognition, reorientation and reorganization of the bases, could induce the formation of stable duplexes having non-canonical arrangements. Major adjustment of the structures was observed when the mutated base was located in the end region of the chain close to the surface. This journal is © the Owner Societies 2011

  6. Reversal of a Neurospora Translocation by Crossing over Involving Displaced Rdna, and Methylation of the Rdna Segments That Result from Recombination

    PubMed Central

    Perkins, David D.; Metzenberg, Robert L.; Raju, Namboori B.; Selker, Eric U.; Barry, Edward G.

    1986-01-01

    In translocation OY321 of Neurospora crassa, the nucleolus organizer is divided into two segments, a proximal portion located interstitially in one interchange chromosome, and a distal portion now located terminally on another chromosome, linkage group I. In crosses of Translocation x Translocation, exceptional progeny are recovered nonselectively in which the chromosome sequence has apparently reverted to Normal. Genetic, cytological, and molecular evidence indicates that reversion is the result of meiotic crossing over between homologous displaced rDNA repeats. Marker linkages are wild type in these exceptional progeny. They differ from wild type, however, in retaining an interstitial block of rRNA genes which can be demonstrated cytologically by the presence of a second, small interstitial nucleolus and genetically by linkage of an rDNA restriction site polymorphism to the mating-type locus in linkage group I. The interstitial rDNA is more highly methylated than the terminal rDNA. The mechanism by which methylation enzymes distinguish between interstitial rDNA and terminal rDNA is unknown. Some hypotheses are considered. PMID:2947829

  7. DNA sequences and proteic antigens of H. pylori in cholecystic bile and tissue of patients with gallstones.

    PubMed

    Neri, V; Margiotta, M; de Francesco, V; Ambrosi, A; Valle, N Della; Fersini, A; Tartaglia, N; Minenna, M F; Ricciardelli, C; Giorgio, F; Panella, C; Ierardi, E

    2005-10-15

    Although Helicobacter pylori DNA sequences have been detected in cholecystic bile and tissue of patients with gallstones, controversial results are reported from different geographic areas. To detect H. pylori in cholecystic bile and tissue of patients with gallstones from a previously uninvestigated geographic area, southern Italy. Detection included both the bacterial DNA and the specific antigen (H. pylori stool antigen) identified in the stools of infected patients for diagnostic purposes. The study enclosed 33 consecutive patients undergoing laparoscopic cholecystectomy for gallstones. DNA sequences of H. pylori were detected by polymerase chain reaction in both cholecystic bile and tissue homogenate. Moreover, we assayed H.pylori stool antigen on gall-bladder cytosolic and biliary proteins after their extraction. Bacterial presence in the stomach was assessed by urea breath test in all patients and Deltadelta13CPDB value assumed as marker of intragastric load. Fisher's exact probability and Student's t-tests were used for statistical analysis. DNA sequences of H. pylori in bile were found in 51.5% and significantly correlated with its presence in cholecystic tissue homogenate (P<0.005), H. pylori stool antigen in gall-bladder (P=0.0013) and bile (P=0.04) proteins, gastric infection (P<0.01) and intragastric bacterial load (P<0.001). No correlation was found, however, with sex and age of the patients. Our prevalence value of bacterial DNA in bile and gall-bladder of patients with gallstones agreed with that of the only other Italian study. The simultaneous presence of both bacterial DNA and proteic antigen suggests that the same prototype of bacterium could be located at both intestinal and cholecystic level and, therefore, the intestine represents the source of biliary contagion.

  8. Genome-Wide Spectra of Transcription Insertions and Deletions Reveal That Slippage Depends on RNA:DNA Hybrid Complementarity

    PubMed Central

    Traverse, Charles C.

    2017-01-01

    ABSTRACT Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola, which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. PMID:28851848

  9. Visual ModuleOrganizer: a graphical interface for the detection and comparative analysis of repeat DNA modules

    PubMed Central

    2014-01-01

    Background DNA repeats, such as transposable elements, minisatellites and palindromic sequences, are abundant in sequences and have been shown to have significant and functional roles in the evolution of the host genomes. In a previous study, we introduced the concept of a repeat DNA module, a flexible motif present in at least two occurences in the sequences. This concept was embedded into ModuleOrganizer, a tool allowing the detection of repeat modules in a set of sequences. However, its implementation remains difficult for larger sequences. Results Here we present Visual ModuleOrganizer, a Java graphical interface that enables a new and optimized version of the ModuleOrganizer tool. To implement this version, it was recoded in C++ with compressed suffix tree data structures. This leads to less memory usage (at least 120-fold decrease in average) and decreases by at least four the computation time during the module detection process in large sequences. Visual ModuleOrganizer interface allows users to easily choose ModuleOrganizer parameters and to graphically display the results. Moreover, Visual ModuleOrganizer dynamically handles graphical results through four main parameters: gene annotations, overlapping modules with known annotations, location of the module in a minimal number of sequences, and the minimal length of the modules. As a case study, the analysis of FoldBack4 sequences clearly demonstrated that our tools can be extended to comparative and evolutionary analyses of any repeat sequence elements in a set of genomic sequences. With the increasing number of sequences available in public databases, it is now possible to perform comparative analyses of repeated DNA modules in a graphic and friendly manner within a reasonable time period. Availability Visual ModuleOrganizer interface and the new version of the ModuleOrganizer tool are freely available at: http://lcb.cnrs-mrs.fr/spip.php?rubrique313. PMID:24678954

  10. Identification of an expressed gene in Dipylidium caninum.

    PubMed

    Miranda, Rodrigo R C; Costa-Júnior, Livio M; Campos, Artur K; Santos, Hudson A; Rabelo, Elida M L

    2004-10-01

    Recombinant DNA studies have been focused on developing vaccines to different cestodes. But few studies involving Dipylidium caninum molecular biology and genes have been done. Only partial sequences of mitochondrial DNA and ribosomal RNA gene are available in databases. Any molecular work with this parasite, including epidemiology, study of drug-resistant strains, and vaccine development, is hampered by the lack of knowledge of its genome. Thus, the knowledge of specific genes of different developmental stages of D. caninum is crucial to locate potential targets to be used as candidates to develop a vaccine and/or new drugs against this parasite. Here we report, for the first time, the sequencing of a fragment of a D. caninum expressed gene.

  11. Mapping vaccinia virus DNA replication origins at nucleotide level by deep sequencing.

    PubMed

    Senkevich, Tatiana G; Bruno, Daniel; Martens, Craig; Porcella, Stephen F; Wolf, Yuri I; Moss, Bernard

    2015-09-01

    Poxviruses reproduce in the host cytoplasm and encode most or all of the enzymes and factors needed for expression and synthesis of their double-stranded DNA genomes. Nevertheless, the mode of poxvirus DNA replication and the nature and location of the replication origins remain unknown. A current but unsubstantiated model posits only leading strand synthesis starting at a nick near one covalently closed end of the genome and continuing around the other end to generate a concatemer that is subsequently resolved into unit genomes. The existence of specific origins has been questioned because any plasmid can replicate in cells infected by vaccinia virus (VACV), the prototype poxvirus. We applied directional deep sequencing of short single-stranded DNA fragments enriched for RNA-primed nascent strands isolated from the cytoplasm of VACV-infected cells to pinpoint replication origins. The origins were identified as the switching points of the fragment directions, which correspond to the transition from continuous to discontinuous DNA synthesis. Origins containing a prominent initiation point mapped to a sequence within the hairpin loop at one end of the VACV genome and to the same sequence within the concatemeric junction of replication intermediates. These findings support a model for poxvirus genome replication that involves leading and lagging strand synthesis and is consistent with the requirements for primase and ligase activities as well as earlier electron microscopic and biochemical studies implicating a replication origin at the end of the VACV genome.

  12. Diversity of ribosomal 16S DNA- and RNA-based bacterial community in an office building drinking water system.

    PubMed

    Inkinen, J; Jayaprakash, B; Santo Domingo, J W; Keinänen-Toivola, M M; Ryu, H; Pitkänen, T

    2016-06-01

    Next-generation sequencing of 16S ribosomal RNA genes (rDNA) and ribosomal RNA (rRNA) was used to characterize water and biofilm microbiome collected from a drinking water distribution system of an office building after its first year of operation. The total bacterial community (rDNA) and active bacterial members (rRNA) sequencing databases were generated by Illumina MiSeq PE250 platform. As estimated by Chao1 index, species richness in cold water system was lower (180-260) in biofilms (Sphingomonas spp., Methylobacterium spp., Limnohabitans spp., Rhizobiales order) than in waters (250-580), (also Methylotenera spp.) (P = 0·005, n = 20). Similarly species richness (Chao1) was slightly higher (210-580) in rDNA libraries compared to rRNA libraries (150-400; P = 0·054, n = 24). Active Mycobacterium spp. was found in cross-linked polyethylene (PEX), but not in corresponding copper pipeline biofilm. Nonpathogenic Legionella spp. was found in rDNA libraries but not in rRNA libraries. Microbial communities differed between water and biofilms, between cold and hot water systems, locations in the building and between water rRNA and rDNA libraries, as shown by clear clusters in principal component analysis (PcoA). By using the rRNA method, we found that not all bacterial community members were active (e.g. Legionella spp.), whereas other members showed increased activity in some locations; for example, Pseudomonas spp. in hot water circulations' biofilm and order Rhizobiales and Limnohabitans spp. in stagnated locations' water and biofilm. rRNA-based methods may be better than rDNA-based methods for evaluating human health implications as rRNA methods can be used to describe the active bacterial fraction. This study indicates that copper as a pipeline material might have an adverse impact on the occurrence of Mycobacterium spp. The activity of Legionella spp. maybe questionable when detected solely by using DNA-based methods. © 2016 The Society for Applied Microbiology.

  13. Localization of the 5S and 45S rDNA Sites and cpDNA Sequence Analysis in Species of the Quadrifaria Group of Paspalum (Poaceae, Paniceae)

    PubMed Central

    VAIO, MAGDALENA; SPERANZA, PABLO; VALLS, JOSÉ FRANCISCO; GUERRA, MARCELO; MAZZELLA, CRISTINA

    2005-01-01

    • Background and Aims The Quadrifaria group of Paspalum (Poaceae, Paniceae) comprises species native to the subtropical and temperate regions of South America. The purpose of this research was to characterize the I genomes in five species of this group and to establish phylogenetic relationships among them. • Methods Prometaphase chromatin condensation patterns, the physical location of 5S and 45S rDNA sites by fluorescence in situ hybridization (FISH), and sequences of five chloroplast non-coding regions were analysed. • Key Results The condensation patterns observed were highly conserved among diploid and tetraploid accessions studied and not influenced by the dyes used or by the FISH procedure, allowing the identification of almost all the chromosome pairs that carried the rDNA signals. The FISH analysis of 5S rDNA sites showed the same localization and a correspondence between the number of sites and ploidy level. In contrast, the distribution of 45S rDNA sites was variable. Two general patterns were observed with respect to the location of the 45S rDNA. The species and cytotypes Paspalum haumanii 2x, P. intermedium 2x, P. quadrifarium 4x and P. exaltatum 4x showed proximal sites on chromosome 8 and two to four distal sites in other chromosomes, while P. quarinii 4x and P. quadrifarium 2x showed only distal sites located on a variable number of small chromosomes and on the long arm of chromosome 1. The single most-parsimonious tree found from the phylogenetic analysis showed the Quadrifaria species partitioned in two clades, one of them includes P. haumanii 2x and P. intermedium 2x together with P. quadrifarium 4x and P. exaltatum 4x, while the other contains P. quadrifarium 2x and P. quarinii 4x. • Conclusions The subdivision found with FISH is consistent with the clades recovered with cpDNA data and both analyses suggest that the Quadrifaria group, as presently defined, is not monophyletic and its species belong in at least two clades. PMID:15911540

  14. Engineering the DNA cytosine-5 methyltransferase reaction for sequence-specific labeling of DNA

    PubMed Central

    Lukinavičius, Gražvydas; Lapinaitė, Audronė; Urbanavičiūtė, Giedrė; Gerasimaitė, Rūta; Klimašauskas, Saulius

    2012-01-01

    DNA methyltransferases catalyse the transfer of a methyl group from the ubiquitous cofactor S-adenosyl-L-methionine (AdoMet) onto specific target sites on DNA and play important roles in organisms from bacteria to humans. AdoMet analogs with extended propargylic side chains have been chemically produced for methyltransferase-directed transfer of activated groups (mTAG) onto DNA, although the efficiency of reactions with synthetic analogs remained low. We performed steric engineering of the cofactor pocket in a model DNA cytosine-5 methyltransferase (C5-MTase), M.HhaI, by systematic replacement of three non-essential positions, located in two conserved sequence motifs and in a variable region, with smaller residues. We found that double and triple replacements lead to a substantial improvement of the transalkylation activity, which manifests itself in a mild increase of cofactor binding affinity and a larger increase of the rate of alkyl transfer. These effects are accompanied with reduction of both the stability of the product DNA–M.HhaI–AdoHcy complex and the rate of methylation, permitting competitive mTAG labeling in the presence of AdoMet. Analogous replacements of two conserved residues in M.HpaII and M2.Eco31I also resulted in improved transalkylation activity attesting a general applicability of the homology-guided engineering to the C5-MTase family and expanding the repertoire of sequence-specific tools for covalent in vitro and ex vivo labeling of DNA. PMID:23042683

  15. Chromosomal organization of four classes of repetitive DNA sequences in killifish Orestias ascotanensis Parenti, 1984 (Cyprinodontiformes, Cyprinodontidae)

    PubMed Central

    Araya-Jaime, Cristian; Lam, Natalia; Pinto, Irma Vila; Méndez, Marco A.; Iturra, Patricia

    2017-01-01

    Abstract Orestias Valenciennes, 1839 is a genus of freshwater fish endemic to the South American Altiplano. Cytogenetic studies of these species have focused on conventional karyotyping. The aim of this study was to use classical and molecular cytogenetic methods to identify the constitutive heterochromatin distribution and chromosome organization of four classes of repetitive DNA sequences (histone H3 DNA, U2 snRNA, 18S rDNA and 5S rDNA) in the chromosomes of O. ascotanensis Parenti, 1984, an endemic species restricted to the Salar de Ascotán in the Chilean Altiplano. All individuals analyzed had a diploid number of 48 chromosomes. C-banding identified constitutive heterochromatin mainly in the pericentromeric region of most chromosomes, especially a GC-rich heterochromatic block of the short arm of pair 3. FISH assay with an 18S probe confirmed the location of the NOR in pair 3 and revealed that the minor rDNA cluster occurs interstitially on the long arm of pair 2. Dual FISH identified a single block of U2 snDNA sequences in the pericentromeric regions of a subtelocentric chromosome pair, while histone H3 sites were observed as small signals scattered in throughout the all chromosomes. This work represents the first effort to document the physical organization of the repetitive fraction of the Orestias genome. These data will improve our understanding of the chromosomal evolution of a genus facing serious conservation problems. PMID:29093798

  16. Association of Amine-Receptor DNA Sequence Variants with Associative Learning in the Honeybee.

    PubMed

    Lagisz, Malgorzata; Mercer, Alison R; de Mouzon, Charlotte; Santos, Luana L S; Nakagawa, Shinichi

    2016-03-01

    Octopamine- and dopamine-based neuromodulatory systems play a critical role in learning and learning-related behaviour in insects. To further our understanding of these systems and resulting phenotypes, we quantified DNA sequence variations at six loci coding octopamine-and dopamine-receptors and their association with aversive and appetitive learning traits in a population of honeybees. We identified 79 polymorphic sequence markers (mostly SNPs and a few insertions/deletions) located within or close to six candidate genes. Intriguingly, we found that levels of sequence variation in the protein-coding regions studied were low, indicating that sequence variation in the coding regions of receptor genes critical to learning and memory is strongly selected against. Non-coding and upstream regions of the same genes, however, were less conserved and sequence variations in these regions were weakly associated with between-individual differences in learning-related traits. While these associations do not directly imply a specific molecular mechanism, they suggest that the cross-talk between dopamine and octopamine signalling pathways may influence olfactory learning and memory in the honeybee.

  17. MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

    DOE PAGES

    Paugh, Steven W.; Coss, David R.; Bao, Ju; ...

    2016-02-04

    MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

  18. Detection and Phylogenetic Analysis of Wolbachia in the Asiatic Rice Leafroller, Cnaphalocrocis medinalis, in Chinese Populations

    PubMed Central

    Chai, Huan-Na; Du, Yu-Zhou; Qiu, Bao-Li; Zhai, Bao-Ping

    2011-01-01

    Wolbachia are a group of intracellular inherited endosymbiontic bacteria infecting a wide range of insects. In this study the infection status of Wolbachia (Rickettsiales: Rickettsiaceae) was measured in the Asiatic rice leafroller, Cnaphalocrocis medinalis (Guenée) (Lepidoptera: Pyralidae), from twenty locations in China by sequencing wsp, ftsZ and 16S rDNA genes. The results showed high infection rates of Wolbachia in C. medinalis populations. Wolbachia was detected in all geographically separate populations; the average infection rate was ∼ 62.5%, and the highest rates were 90% in Wenzhou and Yangzhou populations. The Wolbachia detected in different C. medinalis populations were 100% identical to each other when wsp, ftsZ, and 16S rDNA sequences were compared, with all sequences belonging to the Wolbachia B supergroup. Based on wsp, ftsZ and 16S rDNA sequences of Wolbachia, three phylogenetic trees of similar pattern emerged. This analysis indicated the possibility of inter-species and intra-species horizontal transmission of Wolbachia in different arthropods in related geographical regions. The migration route of C. medinalis in mainland China was also discussed since large differentiation had been found between the wsp sequences of Chinese and Thai populations. PMID:22233324

  19. Saccharomyces cerevisiae SSB1 protein and its relationship to nucleolar RNA-binding proteins.

    PubMed

    Jong, A Y; Clark, M W; Gilbert, M; Oehm, A; Campbell, J L

    1987-08-01

    To better define the function of Saccharomyces cerevisiae SSB1, an abundant single-stranded nucleic acid-binding protein, we determined the nucleotide sequence of the SSB1 gene and compared it with those of other proteins of known function. The amino acid sequence contains 293 amino acid residues and has an Mr of 32,853. There are several stretches of sequence characteristic of other eucaryotic single-stranded nucleic acid-binding proteins. At the amino terminus, residues 39 to 54 are highly homologous to a peptide in calf thymus UP1 and UP2 and a human heterogeneous nuclear ribonucleoprotein. Residues 125 to 162 constitute a fivefold tandem repeat of the sequence RGGFRG, the composition of which suggests a nucleic acid-binding site. Near the C terminus, residues 233 to 245 are homologous to several RNA-binding proteins. Of 18 C-terminal residues, 10 are acidic, a characteristic of the procaryotic single-stranded DNA-binding proteins and eucaryotic DNA- and RNA-binding proteins. In addition, examination of the subcellular distribution of SSB1 by immunofluorescence microscopy indicated that SSB1 is a nuclear protein, predominantly located in the nucleolus. Sequence homologies and the nucleolar localization make it likely that SSB1 functions in RNA metabolism in vivo, although an additional role in DNA metabolism cannot be excluded.

  20. MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Paugh, Steven W.; Coss, David R.; Bao, Ju

    MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

  1. Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.

    PubMed Central

    Sasaki, H; Yokoyama, E; Kuroiwa, A

    1990-01-01

    The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866

  2. Potential concerns with analytical Methods Used for the detection of Batrachochytrium salamandrivorans from archived DNA of amphibian swab samples, Oregon, USA

    USGS Publications Warehouse

    Iwanowicz, Deborah; Olson, Deanna H.; Adams, Michael J.; Adams, Cynthia; Anderson, Chauncey; Blaustein, Andrew R; Densmore, Christine L.; Figiel, Chester; Schill, William B.; Chestnut, Tara

    2017-01-01

    Taxonomic identification of pollen has historically been accomplished via light microscopy but requires specialized knowledge and reference collections, particularly when identification to lower taxonomic levels is necessary. Recently, next-generation sequencing technology has been used as a cost-effective alternative for identifying bee-collected pollen; however, this novel approach has not been tested on a spatially or temporally robust number of pollen samples. Here, we compare pollen identification results derived from light microscopy and DNA sequencing techniques with samples collected from honey bee colonies embedded within a gradient of intensive agricultural landscapes in the Northern Great Plains throughout the 2010–2011 growing seasons. We demonstrate that at all taxonomic levels, DNA sequencing was able to discern a greater number of taxa, and was particularly useful for the identification of infrequently detected species. Importantly, substantial phenological overlap did occur for commonly detected taxa using either technique, suggesting that DNA sequencing is an appropriate, and enhancing, substitutive technique for accurately capturing the breadth of bee-collected species of pollen present across agricultural landscapes. We also show that honey bees located in high and low intensity agricultural settings forage on dissimilar plants, though with overlap of the most abundantly collected pollen taxa. We highlight practical applications of utilizing sequencing technology, including addressing ecological issues surrounding land use, climate change, importance of taxa relative to abundance, and evaluating the impact of conservation program habitat enhancement efforts.

  3. CaMV-35S promoter sequence-specific DNA methylation in lettuce.

    PubMed

    Okumura, Azusa; Shimada, Asahi; Yamasaki, Satoshi; Horino, Takuya; Iwata, Yuji; Koizumi, Nozomu; Nishihara, Masahiro; Mishiba, Kei-ichiro

    2016-01-01

    We found 35S promoter sequence-specific DNA methylation in lettuce. Additionally, transgenic lettuce plants having a modified 35S promoter lost methylation, suggesting the modified sequence is subjected to the methylation machinery. We previously reported that cauliflower mosaic virus 35S promoter-specific DNA methylation in transgenic gentian (Gentiana triflora × G. scabra) plants occurs irrespective of the copy number and the genomic location of T-DNA, and causes strong gene silencing. To confirm whether 35S-specific methylation can occur in other plant species, transgenic lettuce (Lactuca sativa L.) plants with a single copy of the 35S promoter-driven sGFP gene were produced and analyzed. Among 10 lines of transgenic plants, 3, 4, and 3 lines showed strong, weak, and no expression of sGFP mRNA, respectively. Bisulfite genomic sequencing of the 35S promoter region showed hypermethylation at CpG and CpWpG (where W is A or T) sites in 9 of 10 lines. Gentian-type de novo methylation pattern, consisting of methylated cytosines at CpHpH (where H is A, C, or T) sites, was also observed in the transgenic lettuce lines, suggesting that lettuce and gentian share similar methylation machinery. Four of five transgenic lettuce lines having a single copy of a modified 35S promoter, which was modified in the proposed core target of de novo methylation in gentian, exhibited 35S hypomethylation, indicating that the modified sequence may be the target of the 35S-specific methylation machinery.

  4. Mixed Sequence Reader: A Program for Analyzing DNA Sequences with Heterozygous Base Calling

    PubMed Central

    Chang, Chun-Tien; Tsai, Chi-Neu; Tang, Chuan Yi; Chen, Chun-Houh; Lian, Jang-Hau; Hu, Chi-Yu; Tsai, Chia-Lung; Chao, Angel; Lai, Chyong-Huey; Wang, Tzu-Hao; Lee, Yun-Shien

    2012-01-01

    The direct sequencing of PCR products generates heterozygous base-calling fluorescence chromatograms that are useful for identifying single-nucleotide polymorphisms (SNPs), insertion-deletions (indels), short tandem repeats (STRs), and paralogous genes. Indels and STRs can be easily detected using the currently available Indelligent or ShiftDetector programs, which do not search reference sequences. However, the detection of other genomic variants remains a challenge due to the lack of appropriate tools for heterozygous base-calling fluorescence chromatogram data analysis. In this study, we developed a free web-based program, Mixed Sequence Reader (MSR), which can directly analyze heterozygous base-calling fluorescence chromatogram data in .abi file format using comparisons with reference sequences. The heterozygous sequences are identified as two distinct sequences and aligned with reference sequences. Our results showed that MSR may be used to (i) physically locate indel and STR sequences and determine STR copy number by searching NCBI reference sequences; (ii) predict combinations of microsatellite patterns using the Federal Bureau of Investigation Combined DNA Index System (CODIS); (iii) determine human papilloma virus (HPV) genotypes by searching current viral databases in cases of double infections; (iv) estimate the copy number of paralogous genes, such as β-defensin 4 (DEFB4) and its paralog HSPDP3. PMID:22778697

  5. Quantitative analysis of herpes virus sequences from normal tissue and fibropapillomas of marine turtles with real-time PCR

    USGS Publications Warehouse

    Quackenbush, S.L.; Casey, R.N.; Murcek, R.J.; Paul, T.A.; Work, Thierry M.; Limpus, C.J.; Chaves, A.; duToit, L.; Perez, J.V.; Aguirre, A.A.; Spraker, T.R.; Horrocks, J.A.; Vermeer, L.A.; Balazs, G.S.; Casey, J.W.

    2001-01-01

    Quantitative real-time PCR has been used to measure fibropapilloma-associated turtle herpesvirus (FPTHV) pol DNA loads in fibropapillomas, fibromas, and uninvolved tissues of green, loggerhead, and olive ridley turtles from Hawaii, Florida, Costa Rica, Australia, Mexico, and the West Indies. The viral DNA loads from tumors obtained from terminal animals were relatively homogenous (range 2a??20 copies/cell), whereas DNA copy numbers from biopsied tumors and skin of otherwise healthy turtles displayed a wide variation (range 0.001a??170 copies/cell) and may reflect the stage of tumor development. FPTHV DNA loads in tumors were 2.5a??4.5 logs higher than in uninvolved skin from the same animal regardless of geographic location, further implying a role for FPTHV in the etiology of fibropapillomatosis. Although FPTHV pol sequences amplified from tumors are highly related to each other, single signature amino acid substitutions distinguish the Australia/Hawaii, Mexico/Costa Rica, and Florida/Caribbean groups.

  6. Targeting of >1.5 Mb of Human DNA into the Mouse X Chromosome Reveals Presence of cis-Acting Regulators of Epigenetic Silencing

    PubMed Central

    Yang, Christine; McLeod, Andrea J.; Cotton, Allison M.; de Leeuw, Charles N.; Laprise, Stéphanie; Banks, Kathleen G.; Simpson, Elizabeth M.; Brown, Carolyn J.

    2012-01-01

    Regulatory sequences can influence the expression of flanking genes over long distances, and X chromosome inactivation is a classic example of cis-acting epigenetic gene regulation. Knock-ins directed to the Mus musculus Hprt locus offer a unique opportunity to analyze the spread of silencing into different human DNA sequences in the identical genomic environment. X chromosome inactivation of four knock-in constructs, including bacterial artificial chromosome (BAC) integrations of over 195 kb, was demonstrated by both the lack of expression from the inactive X chromosome in females with nonrandom X chromosome inactivation and promoter DNA methylation of the human transgene in females. We further utilized promoter DNA methylation to assess the inactivation status of 74 human reporter constructs comprising >1.5 Mb of DNA. Of the 47 genes examined, only the PHB gene showed female DNA hypomethylation approaching the level seen in males, and escape from X chromosome inactivation was verified by demonstration of expression from the inactive X chromosome. Integration of PHB resulted in lower DNA methylation of the flanking HPRT promoter in females, suggesting the action of a dominant cis-acting escape element. Female-specific DNA hypermethylation of CpG islands not associated with promoters implies a widespread imposition of DNA methylation during X chromosome inactivation; yet transgenes demonstrated differential capacities to accumulate DNA methylation when integrated into the identical location on the inactive X chromosome, suggesting additional cis-acting sequence effects. As only one of the human transgenes analyzed escaped X chromosome inactivation, we conclude that elements permitting ongoing expression from the inactive X are rare in the human genome. PMID:23023002

  7. Identification of a factor in HeLa cells specific for an upstream transcriptional control sequence of an EIA-inducible adenovirus promoter and its relative abundance in infected and uninfected cells.

    PubMed Central

    SivaRaman, L; Subramanian, S; Thimmappaya, B

    1986-01-01

    Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943

  8. Chromosomal rearrangements involving telomeric DNA sequences in Balb/3T3 cells transfected with the Ha-ras oncogene.

    PubMed

    Peitl, Paulo; Mello, Stephano S; Camparoto, Marjori L; Passos, Geraldo A S; Hande, Manoor P; Cardoso, Renato S; Sakamoto-Hojo, Elza T

    2002-01-01

    Chromosomal instability involving telomeric DNA sequences was studied in mouse Balb/3T3 fibroblasts transfected with a mutated human c-Ha-ras-1 gene (B61 cells) and spontaneously immortalized normal parental cells (A31 cells), using fluorescence in situ hybridization (FISH). FISH analysis with a telomeric probe revealed high frequencies of chromosome alterations involving telomeric regions, mainly stable and unstable Robertsonian fusion-like configurations (RLC) (0.25 and 1.95/cell in A31 and B61 cells, respectively) and chromosome ends lacking telomeric signals in one (LTS') or both chromatids (LTS") (5.9 and 17.5/cell for A31 and B61 cells, respectively). Interstitial telomeric sequences (ITS) were also detected at both non-telomeric sites and in the centromeres of RLC. The frequencies of RLCs with ITS located in the centromeres were 3-fold higher in B61 compared with A31 cells. We demonstrated a high level of chromosome instability involving telomeric DNA sequences in ras-transfected cells overexpressing ras mRNA, which could be a consequence of rapid cell cycle progression associated with a deficient telomere capping mechanism.

  9. The GAGA protein of Drosophila is phosphorylated by CK2.

    PubMed

    Bonet, Carles; Fernández, Irene; Aran, Xavier; Bernués, Jordi; Giralt, Ernest; Azorín, Fernando

    2005-08-19

    The GAGA factor of Drosophila is a sequence-specific DNA-binding protein that contributes to multiple processes from the regulation of gene expression to the structural organisation of heterochromatin and chromatin remodelling. GAGA is known to interact with various other proteins (tramtrack, pipsqueak, batman and dSAP18) and protein complexes (PRC1, NURF and FACT). GAGA functions are likely regulated at the level of post-translational modifications. Little is known, however, about its actual pattern of modification. It was proposed that GAGA can be O-glycosylated. Here, we report that GAGA519 isoform is a phosphoprotein that is phosphorylated by CK2 at the region of the DNA-binding domain. Our results indicate that phosphorylation occurs at S388 and, to a lesser extent, at S378. These two residues are located in a region of the DNA-binding domain that makes no direct contact with DNA, being dispensable for sequence-specific recognition. Phosphorylation at these sites does not abolish DNA binding but reduces the affinity of the interaction. These results are discussed in the context of the various functions and interactions that GAGA supports.

  10. Mechanism of DNA-binding enhancement by the human T-cell leukaemia virus transactivator Tax.

    PubMed

    Baranger, A M; Palmer, C R; Hamm, M K; Giebler, H A; Brauweiler, A; Nyborg, J K; Schepartz, A

    1995-08-17

    Tax protein activates transcription of the human T-cell leukaemia virus type I (HTLV-I) genome through three imperfect cyclic AMP-responsive element (CRE) target sites located within the viral promoter. Previous work has shown that Tax interacts with the bZIP element of proteins that bind the CRE target site to promote peptide dimerization, suggesting an association between Tax and bZIP coiled coil. Here we show that the site of interaction with Tax is not the coiled coil, but the basic segment. This interaction increases the stability of the GCN4 bZIP dimer by 1.7 kcal mol-1 and the DNA affinity of the dimer by 1.9 kcal mol-1. The differential effect of Tax on several bZip-DNA complexes that differ in peptide sequence or DNA conformation suggests a model for Tax action based on stabilization of a distinct DNA-bound protein structure. This model may explain how Tax interacts with transcription factors of considerable sequence diversity to alter patterns of gene expression.

  11. Sequence and structural implications of a bovine corneal keratan sulfate proteoglycan core protein. Protein 37B represents bovine lumican and proteins 37A and 25 are unique

    NASA Technical Reports Server (NTRS)

    Funderburgh, J. L.; Funderburgh, M. L.; Brown, S. J.; Vergnes, J. P.; Hassell, J. R.; Mann, M. M.; Conrad, G. W.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    Amino acid sequence from tryptic peptides of three different bovine corneal keratan sulfate proteoglycan (KSPG) core proteins (designated 37A, 37B, and 25) showed similarities to the sequence of a chicken KSPG core protein lumican. Bovine lumican cDNA was isolated from a bovine corneal expression library by screening with chicken lumican cDNA. The bovine cDNA codes for a 342-amino acid protein, M(r) 38,712, containing amino acid sequences identified in the 37B KSPG core protein. The bovine lumican is 68% identical to chicken lumican, with an 83% identity excluding the N-terminal 40 amino acids. Location of 6 cysteine and 4 consensus N-glycosylation sites in the bovine sequence were identical to those in chicken lumican. Bovine lumican had about 50% identity to bovine fibromodulin and 20% identity to bovine decorin and biglycan. About two-thirds of the lumican protein consists of a series of 10 amino acid leucine-rich repeats that occur in regions of calculated high beta-hydrophobic moment, suggesting that the leucine-rich repeats contribute to beta-sheet formation in these proteins. Sequences obtained from 37A and 25 core proteins were absent in bovine lumican, thus predicting a unique primary structure and separate mRNA for each of the three bovine KSPG core proteins.

  12. Strong transcription blockage mediated by R-loop formation within a G-rich homopurine–homopyrimidine sequence localized in the vicinity of the promoter

    PubMed Central

    Soo Shin, Jane Hae

    2017-01-01

    Abstract Guanine-rich (G-rich) homopurine–homopyrimidine nucleotide sequences can block transcription with an efficiency that depends upon their orientation, composition and length, as well as the presence of negative supercoiling or breaks in the non-template DNA strand. We report that a G-rich sequence in the non-template strand reduces the yield of T7 RNA polymerase transcription by more than an order of magnitude when positioned close (9 bp) to the promoter, in comparison to that for a distal (∼250 bp) location of the same sequence. This transcription blockage is much less pronounced for a C-rich sequence, and is not significant for an A-rich sequence. Remarkably, the blockage is not pronounced if transcription is performed in the presence of RNase H, which specifically digests the RNA strands within RNA–DNA hybrids. The blockage also becomes less pronounced upon reduced RNA polymerase concentration. Based upon these observations and those from control experiments, we conclude that the blockage is primarily due to the formation of stable RNA–DNA hybrids (R-loops), which inhibit successive rounds of transcription. Our results could be relevant to transcription dynamics in vivo (e.g. transcription ‘bursting’) and may also have practical implications for the design of expression vectors. PMID:28498974

  13. Strong transcription blockage mediated by R-loop formation within a G-rich homopurine-homopyrimidine sequence localized in the vicinity of the promoter.

    PubMed

    Belotserkovskii, Boris P; Soo Shin, Jane Hae; Hanawalt, Philip C

    2017-06-20

    Guanine-rich (G-rich) homopurine-homopyrimidine nucleotide sequences can block transcription with an efficiency that depends upon their orientation, composition and length, as well as the presence of negative supercoiling or breaks in the non-template DNA strand. We report that a G-rich sequence in the non-template strand reduces the yield of T7 RNA polymerase transcription by more than an order of magnitude when positioned close (9 bp) to the promoter, in comparison to that for a distal (∼250 bp) location of the same sequence. This transcription blockage is much less pronounced for a C-rich sequence, and is not significant for an A-rich sequence. Remarkably, the blockage is not pronounced if transcription is performed in the presence of RNase H, which specifically digests the RNA strands within RNA-DNA hybrids. The blockage also becomes less pronounced upon reduced RNA polymerase concentration. Based upon these observations and those from control experiments, we conclude that the blockage is primarily due to the formation of stable RNA-DNA hybrids (R-loops), which inhibit successive rounds of transcription. Our results could be relevant to transcription dynamics in vivo (e.g. transcription 'bursting') and may also have practical implications for the design of expression vectors. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Satellite DNA and Transposable Elements in Seabuckthorn (Hippophae rhamnoides), a Dioecious Plant with Small Y and Large X Chromosomes

    PubMed Central

    Puterova, Janka; Razumova, Olga; Martinek, Tomas; Alexandrov, Oleg; Divashuk, Mikhail; Kubat, Zdenek; Hobza, Roman; Karlov, Gennady

    2017-01-01

    Seabuckthorn (Hippophae rhamnoides) is a dioecious shrub commonly used in the pharmaceutical, cosmetic, and environmental industry as a source of oil, minerals and vitamins. In this study, we analyzed the transposable elements and satellites in its genome. We carried out Illumina DNA sequencing and reconstructed the main repetitive DNA sequences. For data analysis, we developed a new bioinformatics approach for advanced satellite DNA analysis and showed that about 25% of the genome consists of satellite DNA and about 24% is formed of transposable elements, dominated by Ty3/Gypsy and Ty1/Copia LTR retrotransposons. FISH mapping revealed X chromosome-accumulated, Y chromosome-specific or both sex chromosomes-accumulated satellites but most satellites were found on autosomes. Transposable elements were located mostly in the subtelomeres of all chromosomes. The 5S rDNA and 45S rDNA were localized on one autosomal locus each. Although we demonstrated the small size of the Y chromosome of the seabuckthorn and accumulated satellite DNA there, we were unable to estimate the age and extent of the Y chromosome degeneration. Analysis of dioecious relatives such as Shepherdia would shed more light on the evolution of these sex chromosomes. PMID:28057732

  15. Cloning vector

    DOEpatents

    Guilfoyle, Richard A.; Smith, Lloyd M.

    1994-01-01

    A vector comprising a filamentous phage sequence containing a first copy of filamentous phage gene X and other sequences necessary for the phage to propagate is disclosed. The vector also contains a second copy of filamentous phage gene X downstream from a promoter capable of promoting transcription in a bacterial host. In a preferred form of the present invention, the filamentous phage is M13 and the vector additionally includes a restriction endonuclease site located in such a manner as to substantially inactivate the second gene X when a DNA sequence is inserted into the restriction site.

  16. Cloning vector

    DOEpatents

    Guilfoyle, R.A.; Smith, L.M.

    1994-12-27

    A vector comprising a filamentous phage sequence containing a first copy of filamentous phage gene X and other sequences necessary for the phage to propagate is disclosed. The vector also contains a second copy of filamentous phage gene X downstream from a promoter capable of promoting transcription in a bacterial host. In a preferred form of the present invention, the filamentous phage is M13 and the vector additionally includes a restriction endonuclease site located in such a manner as to substantially inactivate the second gene X when a DNA sequence is inserted into the restriction site. 2 figures.

  17. DNA typing of ancient parasite eggs from environmental samples identifies human and animal worm infections in Viking-age settlement.

    PubMed

    Søe, Martin Jensen; Nejsum, Peter; Fredensborg, Brian Lund; Kapel, Christian Moliin Outzen

    2015-02-01

    Ancient parasite eggs were recovered from environmental samples collected at a Viking-age settlement in Viborg, Denmark, dated 1018-1030 A.D. Morphological examination identified Ascaris sp., Trichuris sp., and Fasciola sp. eggs, but size and shape did not allow species identification. By carefully selecting genetic markers, PCR amplification and sequencing of ancient DNA (aDNA) isolates resulted in identification of: the human whipworm, Trichuris trichiura , using SSUrRNA sequence homology; Ascaris sp. with 100% homology to cox1 haplotype 07; and Fasciola hepatica using ITS1 sequence homology. The identification of T. trichiura eggs indicates that human fecal material is present and, hence, that the Ascaris sp. haplotype 07 was most likely a human variant in Viking-age Denmark. The location of the F. hepatica finding suggests that sheep or cattle are the most likely hosts. Further, we sequenced the Ascaris sp. 18S rRNA gene in recent isolates from humans and pigs of global distribution and show that this is not a suited marker for species-specific identification. Finally, we discuss ancient parasitism in Denmark and the implementation of aDNA analysis methods in paleoparasitological studies. We argue that when employing species-specific identification, soil samples offer excellent opportunities for studies of human parasite infections and of human and animal interactions of the past.

  18. Analysis of LexA binding sites and transcriptomics in response to genotoxic stress in Leptospira interrogans.

    PubMed

    Schons-Fonseca, Luciane; da Silva, Josefa B; Milanez, Juliana S; Domingos, Renan H; Smith, Janet L; Nakaya, Helder I; Grossman, Alan D; Ho, Paulo L; da Costa, Renata M A

    2016-02-18

    We determined the effects of DNA damage caused by ultraviolet radiation on gene expression in Leptospira interrogans using DNA microarrays. These data were integrated with DNA binding in vivo of LexA1, a regulator of the DNA damage response, assessed by chromatin immunoprecipitation and massively parallel DNA sequencing (ChIP-seq). In response to DNA damage, Leptospira induced expression of genes involved in DNA metabolism, in mobile genetic elements and defective prophages. The DNA repair genes involved in removal of photo-damage (e.g. nucleotide excision repair uvrABC, recombinases recBCD and resolvases ruvABC) were not induced. Genes involved in various metabolic pathways were down regulated, including genes involved in cell growth, RNA metabolism and the tricarboxylic acid cycle. From ChIP-seq data, we observed 24 LexA1 binding sites located throughout chromosome 1 and one binding site in chromosome 2. Expression of many, but not all, genes near those sites was increased following DNA damage. Binding sites were found as far as 550 bp upstream from the start codon, or 1 kb into the coding sequence. Our findings indicate that there is a shift in gene expression following DNA damage that represses genes involved in cell growth and virulence, and induces genes involved in mutagenesis and recombination. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Next generation sequencing analysis reveals a relationship between rDNA unit diversity and locus number in Nicotiana diploids

    PubMed Central

    2012-01-01

    Background Tandemly arranged nuclear ribosomal DNA (rDNA), encoding 18S, 5.8S and 26S ribosomal RNA (rRNA), exhibit concerted evolution, a pattern thought to result from the homogenisation of rDNA arrays. However rDNA homogeneity at the single nucleotide polymorphism (SNP) level has not been detailed in organisms with more than a few hundred copies of the rDNA unit. Here we study rDNA complexity in species with arrays consisting of thousands of units. Methods We examined homogeneity of genic (18S) and non-coding internally transcribed spacer (ITS1) regions of rDNA using Roche 454 and/or Illumina platforms in four angiosperm species, Nicotiana sylvestris, N. tomentosiformis, N. otophora and N. kawakamii. We compared the data with Southern blot hybridisation revealing the structure of intergenic spacer (IGS) sequences and with the number and distribution of rDNA loci. Results and Conclusions In all four species the intragenomic homogeneity of the 18S gene was high; a single ribotype makes up over 90% of the genes. However greater variation was observed in the ITS1 region, particularly in species with two or more rDNA loci, where >55% of rDNA units were a single ribotype, with the second most abundant variant accounted for >18% of units. IGS heterogeneity was high in all species. The increased number of ribotypes in ITS1 compared with 18S sequences may reflect rounds of incomplete homogenisation with strong selection for functional genic regions and relaxed selection on ITS1 variants. The relationship between the number of ITS1 ribotypes and the number of rDNA loci leads us to propose that rDNA evolution and complexity is influenced by locus number and/or amplification of orphaned rDNA units at new chromosomal locations. PMID:23259460

  20. Association, intrinsic shape, and molecular recognition: Elucidating DNA biophysics through coarse-grained simulation

    NASA Astrophysics Data System (ADS)

    Freeman, Gordon Samuel

    DNA is of central importance in biology as it is responsible for carrying, copying, and translating the genetic code into the building blocks that comprise life. In order to accomplish these tasks, the DNA molecule must be versatile and robust. Indeed, the underlying molecular interactions that allow DNA to execute these tasks are complex and their origins are only beginning to be understood. While experiments are able to elucidate many key biophysical phenomena, there remain many unanswered questions. Molecular simulation is able to shed light on phenomena at the molecular scale and provide information that is missing from experimental views of DNA behavior. In this dissertation I use state-of-the-art coarse-grained DNA models to address two key problems. In the first, metadynamics calculations are employed to uncover the free energy surface of two complimentary DNA strands. This free energy surface takes on the appearance of a hybridization funnel and reveals candidates for intermediate states in the hybridization of short DNA oligomers. Such short oligomers are important building blocks for DNA-driven self-assembly and the mechanism of hybridization in this regime is not well understood. The second problem is that of nucleosome formation. Nucleosomes are the fundamental subunit of genome compaction in the nucleus of a cell. As such, nucleosomes are a key epigenetic factor and affect gene expression and the ability of DNA-binding proteins to locate and bind to the appropriate position in the genome. However, the factors that drive nucleosome positioning are not well understood. While DNA sequence is known to affect nucleosome formation, the mechanism by which it does so has not been established and a number of hypotheses explaining this sequence-dependence exist in the literature. I demonstrate that DNA shape dominates this process with contributions arising from both intrinsic DNA curvature as well as DNA-protein interactions driven by sequence-dependent variations in minor groove dimensions.

  1. Twenty-seven nonoverlapping zinc finger cDNAs from human T cells map to nine different chromosomes with apparent clustering.

    PubMed Central

    Huebner, K; Druck, T; Croce, C M; Thiesen, H J

    1991-01-01

    cDNA clones encoding zinc finger structures were isolated by screening Molt4 and Jurkat cDNA libraries with zinc finger consensus sequences. Candidate clones were partially sequenced to verify the presence of zinc finger-encoding regions; nonoverlapping cDNA clones were chosen on the basis of sequences and genomic hybridization pattern. Zinc finger structure-encoding clones, which were designated by the term "Kox" and a number from 1 to 32 and which were apparently unique (i.e., distinct from each other and distinct from those isolated by other laboratories), were chosen for mapping in the human genome. DNAs from rodent-human somatic cell hybrids retaining defined complements of human chromosomes were analyzed for the presence of each of the Kox genes. Correlation between the presence of specific human chromosome regions and specific Kox genes established the chromosomal locations. Multiple Kox loci were mapped to 7q (Kox 18 and 25 and a locus detected by both Kox 8 cDNA and Kox 27 cDNA), 8q24 5' to the myc locus (Kox 9 and 32), 10cen----q24 (Kox 2, 15, 19, 21, 30, and 31), 12q13-qter (Kox 1 and 20), 17p13 (Kox 11 and 26), and 19q (Kox 5, 6, 10, 22, 24, and 28). Single Kox loci were mapped to 7p22 (Kox 3), 18q12 (Kox 17), 19p (Kox 13), 22q11 between IG lambda and BCR-1 (locus detected by both Kox 8 cDNA and Kox 27 cDNA), and Xp (Kox 14). Several of the Kox loci map to regions in which other zinc finger structure-encoding loci have already been localized, indicating possible zinc finger gene clusters. In addition, Kox genes at 8q24, 17p13, and 22q11--and perhaps other Kox genes--are located near recurrent chromosomal translocation breakpoints. Others, such as those on 7p and 7q, may be near regions specifically active in T cells. Images Figure 4 Figure 5 Figure 2 Figure 3 PMID:2014798

  2. Molecular characterization of an ependymin precursor from goldfish brain.

    PubMed

    Königstorfer, A; Sterrer, S; Eckerskorn, C; Lottspeich, F; Schmidt, R; Hoffmann, W

    1989-01-01

    Ependymins are thought to be implicated in fundamental processes involved in plasticity of the goldfish CNS. Gas-phase sequencing of purified ependymins beta and gamma revealed that they share the same N-terminal sequence. Each sequence displays microheterogeneities at several positions. Based on the protein sequences obtained, we constructed synthetic oligonucleotides and used them as hybridization probes for screening cDNA libraries of goldfish brain. In this article we describe the full-length sequence of a mRNA encoding a precursor of ependymins. A cleavable signal sequence characteristic of secretory proteins is located at the N-terminal end, followed directly by the ependymin sequence. Also, two potential N-glycosylation sites were detected. A computer search revealed that ependymins form a novel family of unique proteins.

  3. Complementary DNA characterization and chromosomal localization of a human gene related to the poliovirus receptor-encoding gene.

    PubMed

    Lopez, M; Eberlé, F; Mattei, M G; Gabert, J; Birg, F; Bardin, F; Maroc, C; Dubreuil, P

    1995-04-03

    The human poliovirus (PV) receptor (PVR) is a member of the immunoglobulin (Ig) superfamily with unknown cellular function. We have isolated a human PVR-related (PRR) cDNA. The deduced amino acid (aa) sequence of PRR showed, in the extracellular region, 51.7 and 54.3% similarity with human PVR and with the murine PVR homolog, respectively. The cDNA coding sequence is 1.6-kb long and encodes a deduced 57-kDa protein; this protein has a structural organization analogous to that of PVR, that is, one V- and two C-set Ig domains, with a conserved number of aa. Northern blot analysis indicated that a major 5.9-kb transcript is present in all normal human tissues tested. In situ hybridization showed that the PRR gene is located at bands q23-q24 of human chromosome 11.

  4. Kits for Characterization of Chromosomal Inversions Using Probes

    NASA Technical Reports Server (NTRS)

    Ray, F. Andrew (Inventor)

    2017-01-01

    A kit for the characterization of chromosomal inversions using single-stranded probes that are either all identical or all complementary to a single-stranded chromatid is described. Reporter species are attached to oligonucleotide strands designed such that they may hybridize to portions of only one of a pair of single-stranded sister chromatids which may be prepared by the CO-FISH procedure. If an inversion has occurred, these marker probes will be detected on the second sister chromatid at the same location as the inversion on the first chromatid. The kit includes non-repetitive probes that are either all identical or all complementary to at least a portion of a target DNA sequence of only one DNA strand of only one chromatid and may in some embodiments include reagents suitable for performing CO-FISH and/or reagents for hybridizing the probes to the target DNA sequence.

  5. DNA methylation Landscape of body size variation in sheep.

    PubMed

    Cao, Jiaxue; Wei, Caihong; Liu, Dongming; Wang, Huihua; Wu, Mingming; Xie, Zhiyuan; Capellini, Terence D; Zhang, Li; Zhao, Fuping; Li, Li; Zhong, Tao; Wang, Linjie; Lu, Jian; Liu, Ruizao; Zhang, Shifang; Du, Yongfei; Zhang, Hongping; Du, Lixin

    2015-10-16

    Sub-populations of Chinese Mongolian sheep exhibit significant variance in body mass. In the present study, we sequenced the whole genome DNA methylation in these breeds to detect whether DNA methylation plays a role in determining the body mass of sheep by Methylated DNA immunoprecipitation - sequencing method. A high quality methylation map of Chinese Mongolian sheep was obtained in this study. We identified 399 different methylated regions located in 93 human orthologs, which were previously reported as body size related genes in human genome-wide association studies. We tested three regions in LTBP1, and DNA methylation of two CpG sites showed significant correlation with its RNA expression. Additionally, a particular set of differentially methylated windows enriched in the "development process" (GO: 0032502) was identified as potential candidates for association with body mass variation. Next, we validated small part of these windows in 5 genes; DNA methylation of SMAD1, TSC1 and AKT1 showed significant difference across breeds, and six CpG were significantly correlated with RNA expression. Interestingly, two CpG sites showed significant correlation with TSC1 protein expression. This study provides a thorough understanding of body size variation in sheep from an epigenetic perspective.

  6. Traceless splicing enabled by substrate-induced activation of the Nostoc punctiforme Npu DnaE intein after mutation of a catalytic cysteine to serine.

    PubMed

    Cheriyan, Manoj; Chan, Siu-Hong; Perler, Francine

    2014-12-12

    Inteins self-catalytically cleave out of precursor proteins while ligating the surrounding extein fragments with a native peptide bond. Much attention has been lavished on these molecular marvels with the hope of understanding and harnessing their chemistry for novel biochemical transformations including coupling peptides from synthetic or biological origins and controlling protein function. Despite an abundance of powerful applications, the use of inteins is still hampered by limitations in our understanding of their specificity (defined as flanking sequences that permit splicing) and the challenge of inserting inteins into target proteins. We examined the frequently used Nostoc punctiforme Npu DnaE intein after the C-extein cysteine nucleophile (Cys+1) was mutated to serine or threonine. Previous studies demonstrated reduced rates and/or splicing yields with the Npu DnaE intein after mutation of Cys+1 to Ser+1. In this study, genetic selection identified extein sequences with Ser+1 that enabled the Npu DnaE intein to splice with only a 5-fold reduction in rate compared to the wild-type Cys+1 intein and without mutation of the intein itself to activate Ser+1 as a nucleophile. Three different proteins spliced efficiently after insertion of the intein flanked by the selected sequences. We then used this selected specificity to achieve traceless splicing in a targeted enzyme at a location predicted by primary sequence similarity to only the selected C-extein sequence. This study highlights the latent catalytic potential of the Npu DnaE intein to splice with an alternative nucleophile and enables broader intein utility by increasing insertion site choices. Copyright © 2014. Published by Elsevier Ltd.

  7. Photophysical Characterization of Enhanced 6-Methylisoxanthopterin Fluorescence in Duplex DNA.

    PubMed

    Moreno, Andrew; Knee, J L; Mukerji, Ishita

    2016-12-08

    The structure and dynamic motions of bases in DNA duplexes and other constructs are important for understanding mechanisms of selectivity and recognition of DNA-binding proteins. The fluorescent guanine analogue, 6-methylisoxanthopterin 6-MI, is well suited to this purpose as it exhibits an unexpected 3- to 4-fold increase in relative quantum yield upon duplex formation when incorporated into the following sequences: ATFAA, AAFTA, or ATFTA (where F represents 6-MI). To better understand some of the factors leading to the 6-MI fluorescence increase upon duplex formation, we characterized the effect of local sequence and structural perturbations on 6-MI photophysics through temperature melts, quantum yield measurements, fluorescence quenching assays, and fluorescence lifetime measurements. By examining 21 sequences we have determined that the duplex-enhanced fluorescence (DEF) depends on the composition of bases adjacent to 6-MI and the presence of adenines at locations n ± 2 from the probe. Investigation of duplex stability and local solvent accessibility measurements support a model in which the DEF arises from a constrained geometry of 6-MI in the duplex, which remains H-bonded to cytosine, stacked with adjacent bases and inaccessible to quenchers. Perturbation of DNA structure through the introduction of an unpaired base 3' to 6-MI or a mismatched basepair increases 6-MI dynamic motion leading to fluorescence quenching and a reduction in quantum yield. Molecular dynamics simulations suggest the enhanced fluorescence results from a greater degree of twist at the X-F step relative to the quenched duplexes examined. These results point to a model where adenine residues located at n ± 2 from 6-MI induce a structural geometry with greater twist in the duplex that hinders local motion reducing dynamic quenching and producing an increase in 6-MI fluorescence.

  8. Mitochondrial DNA (mtDNA) variants in the European haplogroups HV, JT, and U do not have a major role in schizophrenia.

    PubMed

    Torrell, Helena; Salas, Antonio; Abasolo, Nerea; Morén, Constanza; Garrabou, Glòria; Valero, Joaquín; Alonso, Yolanda; Vilella, Elisabet; Costas, Javier; Martorell, Lourdes

    2014-10-01

    It has been reported that certain genetic factors involved in schizophrenia could be located in the mitochondrial DNA (mtDNA). Therefore, we hypothesized that mtDNA mutations and/or variants would be present in schizophrenia patients and may be related to schizophrenia characteristics and mitochondrial function. This study was performed in three steps: (1) identification of pathogenic mutations and variants in 14 schizophrenia patients with an apparent maternal inheritance of the disease by sequencing the entire mtDNA; (2) case-control association study of 23 variants identified in step 1 (16 missense, 3 rRNA, and 4 tRNA variants) in 495 patients and 615 controls, and (3) analyses of the associated variants according to the clinical, psychopathological, and neuropsychological characteristics and according to the oxidative and enzymatic activities of the mitochondrial respiratory chain. We did not identify pathogenic mtDNA mutations in the 14 sequenced patients. Two known variants were nominally associated with schizophrenia and were further studied. The MT-RNR2 1811A > G variant likely does not play a major role in schizophrenia, as it was not associated with clinical, psychopathological, or neuropsychological variables, and the MT-ATP6 9110T > C p.Ile195Thr variant did not result in differences in the oxidative and enzymatic functions of the mitochondrial respiratory chain. The patients with apparent maternal inheritance of schizophrenia did not exhibit any mutations in their mtDNA. The variants nominally associated with schizophrenia in the present study were not related either to phenotypic characteristics or to mitochondrial function. We did not find evidence pointing to a role for mtDNA sequence variation in schizophrenia. © 2014 Wiley Periodicals, Inc.

  9. Targeting vector construction through recombineering.

    PubMed

    Malureanu, Liviu A

    2011-01-01

    Gene targeting in mouse embryonic stem cells is an essential, yet still very expensive and highly time-consuming, tool and method to study gene function at the organismal level or to create mouse models of human diseases. Conventional cloning-based methods have been largely used for generating targeting vectors, but are hampered by a number of limiting factors, including the variety and location of restriction enzymes in the gene locus of interest, the specific PCR amplification of repetitive DNA sequences, and cloning of large DNA fragments. Recombineering is a technique that exploits the highly efficient homologous recombination function encoded by λ phage in Escherichia coli. Bacteriophage-based recombination can recombine homologous sequences as short as 30-50 bases, allowing manipulations such as insertion, deletion, or mutation of virtually any genomic region. The large availability of mouse genomic bacterial artificial chromosome (BAC) libraries covering most of the genome facilitates the retrieval of genomic DNA sequences from the bacterial chromosomes through recombineering. This chapter describes a successfully applied protocol and aims to be a detailed guide through the steps of generation of targeting vectors through recombineering.

  10. A purified transcription factor (TIF-IB) binds to essential sequences of the mouse rDNA promoter.

    PubMed Central

    Clos, J; Buttgereit, D; Grummt, I

    1986-01-01

    A transcription factor that is specific for mouse rDNA has been partially purified from Ehrlich ascites cells. This factor [designated transcription initiation factor (TIF)-IB] is required for accurate in vitro synthesis of mouse rRNA in addition to RNA polymerase I and another regulatory factor, TIF-IA. TIF-IB activity is present in extracts both from growing and nongrowing cells in comparable amounts. Prebinding competition experiments with wild-type and mutant templates suggest that TIF-IB interacts with the core control element of the rDNA promoter, which is located immediately upstream of the initiation site. The specific binding of TIF-IB to the RNA polymerase I promoter is demonstrated by exonuclease III protection experiments. The 3' border of the sequences protected by TIF-IB is shown to be on the coding strand at position -21 and on the noncoding strand at position -7. The results suggest that direct binding of TIF-IB to sequences in the core promoter element is the mechanism by which this factor imparts promoter selectivity to RNA polymerase I. Images PMID:3456157

  11. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  12. Numerous uncharacterized and highly divergent microbes which colonize humans are revealed by circulating cell-free DNA

    PubMed Central

    Camunas-Soler, Joan; Kertesz, Michael; De Vlaminck, Iwijn; Koh, Winston; Pan, Wenying; Martin, Lance; Neff, Norma F.; Okamoto, Jennifer; Wong, Ronald J.; Kharbanda, Sandhya; El-Sayed, Yasser; Blumenfeld, Yair; Stevenson, David K.; Shaw, Gary M.; Wolfe, Nathan D.; Quake, Stephen R.

    2017-01-01

    Blood circulates throughout the human body and contains molecules drawn from virtually every tissue, including the microbes and viruses which colonize the body. Through massive shotgun sequencing of circulating cell-free DNA from the blood, we identified hundreds of new bacteria and viruses which represent previously unidentified members of the human microbiome. Analyzing cumulative sequence data from 1,351 blood samples collected from 188 patients enabled us to assemble 7,190 contiguous regions (contigs) larger than 1 kbp, of which 3,761 are novel with little or no sequence homology in any existing databases. The vast majority of these novel contigs possess coding sequences, and we have validated their existence both by finding their presence in independent experiments and by performing direct PCR amplification. When their nearest neighbors are located in the tree of life, many of the organisms represent entirely novel taxa, showing that microbial diversity within the human body is substantially broader than previously appreciated. PMID:28830999

  13. The thiostrepton-resistance-encoding gene in Streptomyces laurentii is located within a cluster of ribosomal protein operons.

    PubMed

    Smith, T M; Jiang, Y F; Shipley, P; Floss, H G

    1995-10-16

    A common approach to identify and clone biosynthetic gene from an antibiotic-producing streptomycete is to clone the resistance gene for the antibiotic of interest and then use that gene to clone DNA that is linked to it. As a first step toward cloning the genes responsible for the biosynthesis of thiostrepton (Th) in Streptomyces laurentii (Sl), the Th resistance-encoding gene (tsnR) was cloned as a 1.5-kb BamHI-PvuII fragment in Escherichia coli (Ec), and shown to confer Th resistance when introduced into S. lividans TK24. The tsnR-containing DNA fragment was used as a probe to isolate clones from cosmid libraries of DNA in the Ec cosmid vector SuperCos, and pOJ446 (an Ec/streptomycete) cosmid vector. Sequence and genetic analysis of the DNA flanking the tsnR indicates that the Sl tsnR is not closely linked to biosynthetic genes. Instead it is located within a cluster of ribosomal protein operons.

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kennedy, M.A.; Morris, C.M.; Fitzgerald, P.H.

    The human kappa deleting element (Kde) mediates loss of CK and JK genes in B cells. A probe for Kde detects two genomic sequences on Southern blots. The Kde is located 24kb 3{prime} to CK, but the position of the homologous sequence is unknown. The authors in situ hybridized m141-2 to metaphase cells of JC11, a B-cell line bearing a t(2;14)(p11;q32) in which the chromosome 2 breakpoint is within JK or the VK-JK intron. Three peaks of labelled sites were obtained. Southern analysis of BamH1 digested DNA showed that Kde (14kb) and the homologous sequence (3kb) were both intact. Kdemore » accounts for hybridization to 14q+ and the 2p- signal presumably derives from the related sequence. This locates the sequence homologous to Kde upstream from JK, possibly within the VK cluster, and may reflect transposition or some other duplicative event as proposed for the evolution of other regions of the kappa locus.« less

  15. Dual phylogenetic origins of Nigerian lions (Panthera leo).

    PubMed

    Tende, Talatu; Bensch, Staffan; Ottosson, Ulf; Hansson, Bengt

    2014-07-01

    Lion fecal DNA extracts from four individuals each from Yankari Game Reserve and Kainji-Lake National Park (central northeast and west Nigeria, respectively) were Sanger-sequenced for the mitochondrial cytochrome b gene. The sequences were aligned against 61 lion reference sequences from other parts of Africa and India. The sequence data were analyzed further for the construction of phylogenetic trees using the maximum-likelihood approach to depict phylogenetic patterns of distribution among sequences. Our results show that Nigerian lions grouped together with lions from West and Central Africa. At the smaller geographical scale, lions from Kainji-Lake National Park in western Nigeria grouped with lions from Benin (located west of Nigeria), whereas lions from Yankari Game Reserve in central northeastern Nigeria grouped with the lion populations in Cameroon (located east of Nigeria). The finding that the two remaining lion populations in Nigeria have different phylogenetic origins is an important aspect to consider in future decisions regarding management and conservation of rapidly shrinking lion populations in West Africa.

  16. Dual phylogenetic origins of Nigerian lions (Panthera leo)

    PubMed Central

    Tende, Talatu; Bensch, Staffan; Ottosson, Ulf; Hansson, Bengt

    2014-01-01

    Lion fecal DNA extracts from four individuals each from Yankari Game Reserve and Kainji-Lake National Park (central northeast and west Nigeria, respectively) were Sanger-sequenced for the mitochondrial cytochrome b gene. The sequences were aligned against 61 lion reference sequences from other parts of Africa and India. The sequence data were analyzed further for the construction of phylogenetic trees using the maximum-likelihood approach to depict phylogenetic patterns of distribution among sequences. Our results show that Nigerian lions grouped together with lions from West and Central Africa. At the smaller geographical scale, lions from Kainji-Lake National Park in western Nigeria grouped with lions from Benin (located west of Nigeria), whereas lions from Yankari Game Reserve in central northeastern Nigeria grouped with the lion populations in Cameroon (located east of Nigeria). The finding that the two remaining lion populations in Nigeria have different phylogenetic origins is an important aspect to consider in future decisions regarding management and conservation of rapidly shrinking lion populations in West Africa. PMID:25077018

  17. Annotation of differentially expressed genes in the somatic embryogenesis of musa and their location in the banana genome.

    PubMed

    Maldonado-Borges, Josefina Ines; Ku-Cauich, José Roberto; Escobedo-Graciamedrano, Rosa Maria

    2013-01-01

    Analysis of cDNA-AFLP was used to study the genes expressed in zygotic and somatic embryogenesis of Musa acuminata Colla ssp. malaccensis, and a comparison was made between their differential transcribed fragments (TDFs) and the sequenced genome of the double haploid- (DH-) Pahang of the malaccensis subspecies that is available in the network. A total of 253 transcript-derived fragments (TDFs) were detected with apparent size of 100-4000 bp using 5 pairs of AFLP primers, of which 21 were differentially expressed during the different stages of banana embryogenesis; 15 of the sequences have matched DH-Pahang chromosomes, with 7 of them being homologous to gene sequences encoding either known or putative protein domains of higher plants. Four TDF sequences were located in all Musa chromosomes, while the rest were located in one or two chromosomes. Their putative individual function is briefly reviewed based on published information, and the potential roles of these genes in embryo development are discussed. Thus the availability of the genome of Musa and the information of TDFs sequences presented here opens new possibilities for an in-depth study of the molecular and biochemical research of zygotic and somatic embryogenesis of Musa.

  18. A complete mitochondrial genome sequence of Asian black bear Sichuan subspecies (Ursus thibetanus mupinensis)

    PubMed Central

    Hou, Wan-ru; Chen, Yu; Wu, Xia; Hu, Jin-chu; Peng, Zheng-song; Yang, Jung; Tang, Zong-xiang; Zhou, Cai-Quan; Li, Yu-ming; Yang, Shi-kui; Du, Yu-jie; Kong, Ling-lu; Ren, Zheng-long; Zhang, Huai-yu; Shuai, Su-rong

    2007-01-01

    We obtained the complete mitochondrial genome of U.thibetanus mupinensis by DNA sequencing based on the PCR fragments of 18 primers we designed. The results indicate that the mtDNA is 16 868 bp in size, encodes 13 protein genes, 22 tRNA genes, and 2 rRNA genes, with an overall H-strand base composition of 31.2% A, 25.4% C, 15.5% G and 27.9% T. The sequence of the control region (CR) located between tRNA-Pro and tRNA-Phe is 1422 bp in size, consists of 8.43% of the whole genome, GC content is 51.9% and has a 6bp tandem repeat and two 10bp tandem repeats identified by using the Tandem Repeats Finder. U. thibetanus mupinensis mitochondrial genome shares high similarity with those of three other Ursidae: U. americanus (91.46%), U. arctos (89.25%) and U. maritimus (87.66%). PMID:17205108

  19. Locating and Activating Molecular ‘Time Bombs’: Induction of Mycolata Prophages

    PubMed Central

    Dyson, Zoe A.; Brown, Teagan L.; Farrar, Ben; Doyle, Stephen R.; Tucci, Joseph; Seviour, Robert J.; Petrovski, Steve

    2016-01-01

    Little is known about the prevalence, functionality and ecological roles of temperate phages for members of the mycolic acid producing bacteria, the Mycolata. While many lytic phages infective for these organisms have been isolated, and assessed for their suitability for use as biological control agents of activated sludge foaming, no studies have investigated how temperate phages might be induced for this purpose. Bioinformatic analysis using the PHAge Search Tool (PHAST) on Mycolata whole genome sequence data in GenBank for members of the genera Gordonia, Mycobacterium, Nocardia, Rhodococcus, and Tsukamurella revealed 83% contained putative prophage DNA sequences. Subsequent prophage inductions using mitomycin C were conducted on 17 Mycolata strains. This led to the isolation and genome characterization of three novel Caudovirales temperate phages, namely GAL1, GMA1, and TPA4, induced from Gordonia alkanivorans, Gordonia malaquae, and Tsukamurella paurometabola, respectively. All possessed highly distinctive dsDNA genome sequences. PMID:27487243

  20. Sequence and expression of two cry8 genes from Bacillus thuringiensis INTA Fr7-4, a native strain from Argentina.

    PubMed

    Navas, Laura E; Berretta, Marcelo F; Pérez, Melisa P; Amadio, Ariel F; Ortiz, Elio M; Sauka, Diego H; Benintende, Graciela B; Zandomeni, Rubén O

    2014-01-01

    We found and characterized two cry8 genes from the Bacillus thuringiensis strain INTA Fr7-4 isolated in Argentina. These genes, cry8Kb3 and cry8Pa3, are located in a tandem array within a 13,200-bp DNA segment sequenced from a preparation of total DNA. They encode 1,169- and 1,176-amino-acid proteins, respectively. Both genes were cloned with their promoter sequences and the proteins were expressed separately in an acrystalliferous strain of B. thuringiensis leading to the formation of ovoid crystals in the recombinant strains. The toxicity against larvae of Anthonomus grandis Bh. (Coleoptera: Curculionidae) of a spore-crystal suspension from the recombinant strain containing cry8Pa3 was similar to that of the parent strain INTA Fr7-4. © 2014 S. Karger AG, Basel.

  1. Principles of regulatory information conservation between mouse and human.

    PubMed

    Cheng, Yong; Ma, Zhihai; Kim, Bong-Hyun; Wu, Weisheng; Cayting, Philip; Boyle, Alan P; Sundaram, Vasavi; Xing, Xiaoyun; Dogan, Nergiz; Li, Jingjing; Euskirchen, Ghia; Lin, Shin; Lin, Yiing; Visel, Axel; Kawli, Trupti; Yang, Xinqiong; Patacsil, Dorrelyn; Keller, Cheryl A; Giardine, Belinda; Kundaje, Anshul; Wang, Ting; Pennacchio, Len A; Weng, Zhiping; Hardison, Ross C; Snyder, Michael P

    2014-11-20

    To broaden our understanding of the evolution of gene regulation mechanisms, we generated occupancy profiles for 34 orthologous transcription factors (TFs) in human-mouse erythroid progenitor, lymphoblast and embryonic stem-cell lines. By combining the genome-wide transcription factor occupancy repertoires, associated epigenetic signals, and co-association patterns, here we deduce several evolutionary principles of gene regulatory features operating since the mouse and human lineages diverged. The genomic distribution profiles, primary binding motifs, chromatin states, and DNA methylation preferences are well conserved for TF-occupied sequences. However, the extent to which orthologous DNA segments are bound by orthologous TFs varies both among TFs and with genomic location: binding at promoters is more highly conserved than binding at distal elements. Notably, occupancy-conserved TF-occupied sequences tend to be pleiotropic; they function in several tissues and also co-associate with many TFs. Single nucleotide variants at sites with potential regulatory functions are enriched in occupancy-conserved TF-occupied sequences.

  2. Tobacco chloroplast tRNALys(UUU) gene contains a 2.5-kilobase-pair intron: An open reading frame and a conserved boundary sequence in the intron

    PubMed Central

    Sugita, Mamoru; Shinozaki, Kazuo; Sugiura, Masahiro

    1985-01-01

    The nucleotide sequence of a tRNALys(UUU) gene on tobacco (Nicotiana tabacum) chloroplast DNA has been determined. This gene is located 215 base pairs upstream from the gene for the 32,000-dalton thylakoid membrane protein on the same DNA strand and has a 2526-base-pair intron in the anticodon loop. The intron boundary sequence does not follow the G-U/A-G rule but is similar to those of tobacco chloroplast split genes for tRNAGly(UCC) and ribosomal proteins L2 and S12. The intron contains one major open reading frame of 509 codons. The codon usage in the open reading frame resembles those observed in the genes for tobacco chloroplast proteins so far analyzed. The primary transcript of this tRNA gene is 2.7 kilobases long. Images PMID:16593561

  3. Tobacco chloroplast tRNA(UUU) gene contains a 2.5-kilobase-pair intron: An open reading frame and a conserved boundary sequence in the intron.

    PubMed

    Sugita, M; Shinozaki, K; Sugiura, M

    1985-06-01

    The nucleotide sequence of a tRNA(Lys)(UUU) gene on tobacco (Nicotiana tabacum) chloroplast DNA has been determined. This gene is located 215 base pairs upstream from the gene for the 32,000-dalton thylakoid membrane protein on the same DNA strand and has a 2526-base-pair intron in the anticodon loop. The intron boundary sequence does not follow the G-U/A-G rule but is similar to those of tobacco chloroplast split genes for tRNA(Gly)(UCC) and ribosomal proteins L2 and S12. The intron contains one major open reading frame of 509 codons. The codon usage in the open reading frame resembles those observed in the genes for tobacco chloroplast proteins so far analyzed. The primary transcript of this tRNA gene is 2.7 kilobases long.

  4. A unique mitigator sequence determines the species specificity of the major late promoter in adenovirus type 12 DNA.

    PubMed Central

    Zock, C; Iselt, A; Doerfler, W

    1993-01-01

    Human adenovirus type 12 (Ad12) cannot replicate in hamster cells, whereas human cells are permissive for Ad12. Ad12 DNA replication and late-gene and virus-associated RNA expression are blocked in hamster cells. Early Ad12 genes are transcribed, and the viral DNA can be integrated into the host genome. Ad12 DNA replication and late-gene transcription can be complemented in hamster cells by E1 functions of Ad2 or Ad5, for which hamster cells are fully permissive (for a review, see W. Doerfler, Adv. Virus Res. 39:89-128, 1991). We have previously demonstrated that a 33-nucleotide mitigator sequence, which is located in the downstream region of the major late promoter (MLP) of Ad12 DNA, is responsible for the inactivity of the Ad12 MLP in hamster cells (C. Zock and W. Doerfler, EMBO J. 9:1615-1623, 1990). A similar negative regulator has not been found in the MLP of Ad2 DNA. We have now studied the mechanism of action of this mitigator element. The results of nuclear run-on experiments document the absence of MLP transcripts in the nuclei of Ad12-infected BHK21 hamster cells. Surprisingly, the mitigator element cannot elicit its function in in vitro transcription experiments with nuclear extracts from both hamster BHK21 and human HeLa cells. Intact nuclear topology and/or tightly bound nuclear elements that cannot be eluted in nuclear extracts are somehow required for recognition of the Ad12 mitigator. Electrophoretic mobility shift assays have not revealed significant differences in the binding of proteins from human HeLa or hamster BHK21 cells to the mitigator sequence in the MLP of Ad12 DNA or to the corresponding sequence in Ad2 DNA. We have converted the sequence of the mitigator in the MLP of Ad12 DNA to the equivalent sequence in the MLP of Ad2 DNA by site-directed mutagenesis. This construct was not active in hamster cells. When the Ad12 mitigator, on the other hand, was inserted into the Ad2 MLP, the latter's function in hamster cells was not compromised. Deletions in the 5' upstream region of the Ad12 MLP have provided evidence for the existence of additional sequences that codetermine the deficiency of the Ad12 MLP in hamster cells. The amphifunctional YY1 protein from HeLa cells can bind specifically to the mitigator and to upstream elements of the MLP of Ad12 DNA.(ABSTRACT TRUNCATED AT 400 WORDS) Images PMID:8419643

  5. Differentiation of Trichophyton rubrum clinical isolates from Japanese and Chinese patients by randomly amplified polymorphic DNA and DNA sequence analysis of the non-transcribed spacer region of the rRNA gene.

    PubMed

    Yang, Xiumin; Sugita, Takashi; Takashima, Masako; Hiruma, Masataro; Li, Ruoyu; Sudo, Hajime; Ogawa, Hideoki; Ikeda, Shigaku

    2009-04-01

    Trichophyton rubrum is the most common pathogen causing dermatophytosis worldwide. Recent genetic investigations showed that the microorganism originated in Africa and then spread to Europe and North America via Asia. We investigated the intraspecific diversity of T. rubrum isolated from two closely located Asian countries, Japan and China. A total of 150 clinical isolates of T. rubrum obtained from Japanese and Chinese patients were analyzed by randomly amplified polymorphic DNA (RAPD) and DNA sequence analysis of the non-transcribed spacer (NTS) region in the rRNA gene. RAPD analysis divided the 150 strains into two major clusters, A and B. Of the Japanese isolates, 30% belonged to cluster A and 70% belonged to cluster B, whereas 91% of the Chinese isolates were in cluster A. The NTS region of the rRNA gene was divided into four major groups (I-IV) based on DNA sequencing. The majority of Japanese isolates were type IV (51%), and the majority of Chinese isolates were type III (75%). These results suggest that although Japan and China are neighboring countries, the origins of T. rubrum isolates from these countries may not be identical. These findings provide information useful for tracing the global transmission routes of T. rubrum.

  6. Chromosome-Encoded Broad-Spectrum Ambler Class A β-Lactamase RUB-1 from Serratia rubidaea

    PubMed Central

    Didi, Jennifer; Ergani, Ayla; Lima, Sandra

    2016-01-01

    ABSTRACT Whole-genome sequencing of Serratia rubidaea CIP 103234T revealed a chromosomally located Ambler class A β-lactamase gene. The gene was cloned, and the β-lactamase, RUB-1, was characterized. RUB-1 displayed 74% and 73% amino acid sequence identity with the GIL-1 and TEM-1 penicillinases, respectively, and its substrate profile was similar to that of the latter β-lactamases. Analysis by 5′ rapid amplification of cDNA ends revealed promoter sequences highly divergent from the Escherichia coli σ70 consensus sequence. This work further illustrates the heterogeneity of β-lactamases among Serratia spp. PMID:27956418

  7. Chromosome-Encoded Broad-Spectrum Ambler Class A β-Lactamase RUB-1 from Serratia rubidaea.

    PubMed

    Bonnin, Rémy A; Didi, Jennifer; Ergani, Ayla; Lima, Sandra; Naas, Thierry

    2017-02-01

    Whole-genome sequencing of Serratia rubidaea CIP 103234 T revealed a chromosomally located Ambler class A β-lactamase gene. The gene was cloned, and the β-lactamase, RUB-1, was characterized. RUB-1 displayed 74% and 73% amino acid sequence identity with the GIL-1 and TEM-1 penicillinases, respectively, and its substrate profile was similar to that of the latter β-lactamases. Analysis by 5' rapid amplification of cDNA ends revealed promoter sequences highly divergent from the Escherichia coli σ 70 consensus sequence. This work further illustrates the heterogeneity of β-lactamases among Serratia spp. Copyright © 2017 American Society for Microbiology.

  8. Gene capture from across the grass family in the allohexaploid Elymus repens (L.) Gould (Poaceae, Triticeae) as evidenced by ITS, GBSSI, and molecular cytogenetics.

    PubMed

    Mahelka, Václav; Kopecký, David

    2010-06-01

    Four accessions of hexaploid Elymus repens from its native Central European distribution area were analyzed using sequencing of multicopy (internal transcribed spacer, ITS) and single-copy (granule-bound starch synthase I, GBSSI) DNA in concert with genomic and fluorescent in situ hybridization (GISH and FISH) to disentangle its allopolyploid origin. Despite extensive ITS homogenization, nrDNA in E. repens allowed us to identify at least four distinct lineages. Apart from Pseudoroegneria and Hordeum, representing the major genome constituents, the presence of further unexpected alien genetic material, originating from species outside the Triticeae and close to Panicum (Paniceae) and Bromus (Bromeae), was revealed. GBSSI sequences provided information complementary to the ITS. Apart from Pseudoroegneria and Hordeum, two additional gene variants from within the Triticeae were discovered: One was Taeniatherum-like, but the other did not have a close relationship with any of the diploids sampled. GISH results were largely congruent with the sequence-based markers. GISH clearly confirmed Pseudoroegneria and Hordeum as major genome constituents and further showed the presence of a small chromosome segment corresponding to Panicum. It resided in the Hordeum subgenome and probably represents an old acquisition of a Hordeum progenitor. Spotty hybridization signals across all chromosomes after GISH with Taeniatherum and Bromus probes suggested that gene acquisition from these species is more likely due to common ancestry of the grasses or early introgression than to recent hybridization or allopolyploid origin of E. repens. Physical mapping of rDNA loci using FISH revealed that all rDNA loci except one minor were located on Pseudoroegneria-derived chromosomes, which suggests the loss of all Hordeum-derived loci but one. Because homogenization mechanisms seem to operate effectively among Pseudoroegneria-like copies in this species, incomplete ITS homogenization in our samples is probably due to an interstitial position of an individual minor rDNA locus located within the Hordeum-derived subgenome.

  9. The SIDER2 elements, interspersed repeated sequences that populate the Leishmania genomes, constitute subfamilies showing chromosomal proximity relationship.

    PubMed

    Requena, Jose M; Folgueira, Cristina; López, Manuel C; Thomas, M Carmen

    2008-06-02

    Protozoan parasites of the genus Leishmania are causative agents of a diverse spectrum of human diseases collectively known as leishmaniasis. These eukaryotic pathogens that diverged early from the main eukaryotic lineage possess a number of unusual genomic, molecular and biochemical features. The completion of the genome projects for three Leishmania species has generated invaluable information enabling a direct analysis of genome structure and organization. By using DNA macroarrays, made with Leishmania infantum genomic clones and hybridized with total DNA from the parasite, we identified a clone containing a repeated sequence. An analysis of the recently completed genome sequence of L. infantum, using this repeated sequence as bait, led to the identification of a new class of repeated elements that are interspersed along the different L. infantum chromosomes. These elements turned out to be homologues of SIDER2 sequences, which were recently identified in the Leishmania major genome; thus, we adopted this nomenclature for the Leishmania elements described herein. Since SIDER2 elements are very heterogeneous in sequence, their precise identification is rather laborious. We have characterized 54 LiSIDER2 elements in chromosome 32 and 27 ones in chromosome 20. The mean size for these elements is 550 bp and their sequence is G+C rich (mean value of 66.5%). On the basis of sequence similarity, these elements can be grouped in subfamilies that show a remarkable relationship of proximity, i.e. SIDER2s of a given subfamily locate close in a chromosomal region without intercalating elements. For comparative purposes, we have identified the SIDER2 elements existing in L. major and Leishmania braziliensis chromosomes 32. While SIDER2 elements are highly conserved both in number and location between L. infantum and L. major, no such conservation exists when comparing with SIDER2s in L. braziliensis chromosome 32. SIDER2 elements constitute a relevant piece in the Leishmania genome organization. Sequence characteristics, genomic distribution and evolutionarily conservation of SIDER2s are suggestive of relevant functions for these elements in Leishmania. Apart from a proved involvement in post-transcriptional mechanisms of gene regulation, SIDER2 elements could be involved in DNA amplification processes and, perhaps, in chromosome segregation as centromeric sequences.

  10. Sequence-dependent catalytic regulation of the SpoIIIE motor activity ensures directionality of DNA translocation.

    PubMed

    Chara, Osvaldo; Borges, Augusto; Milhiet, Pierre-Emmanuel; Nöllmann, Marcelo; Cattoni, Diego I

    2018-03-27

    Transport of cellular cargo by molecular motors requires directionality to ensure proper biological functioning. During sporulation in Bacillus subtilis, directionality of chromosome transport is mediated by the interaction between the membrane-bound DNA translocase SpoIIIE and specific octameric sequences (SRS). Whether SRS regulate directionality by recruiting and orienting SpoIIIE or by simply catalyzing its translocation activity is still unclear. By using atomic force microscopy and single-round fast kinetics translocation assays we determined the localization and dynamics of diffusing and translocating SpoIIIE complexes on DNA with or without SRS. Our findings combined with mathematical modelling revealed that SpoIIIE directionality is not regulated by protein recruitment to SRS but rather by a fine-tuned balance among the rates governing SpoIIIE-DNA interactions and the probability of starting translocation modulated by SRS. Additionally, we found that SpoIIIE can start translocation from non-specific DNA, providing an alternative active search mechanism for SRS located beyond the exploratory length defined by 1D diffusion. These findings are relevant in vivo in the context of chromosome transport through an open channel, where SpoIIIE can rapidly explore DNA while directionality is modulated by the probability of translocation initiation upon interaction with SRS versus non-specific DNA.

  11. Analysis of Ethnic Admixture in Prostate Cancer

    DTIC Science & Technology

    2006-12-01

    low penetrant genes have been identified as potential PCA suscept- ibility genes. These candidate genes include SRD5A2 (MIM 607306), CYP3A4 (MIM 124010...progression [13]. The CDH1gene is located at 16q22.1 and consists of 16 exons spanning approximately 100 kb of genomic DNA. Several polymorphisms, germline and...upstreamof theATGstart site and all 16 exons of CDH1 were screened for DNA sequence variation by denaturing high-performance liquid chro- matography

  12. Mouse mammary tumor virus-like RNA transcripts and DNA are found in affected cells of human breast cancer.

    PubMed

    Ford, Caroline E; Faedo, Margaret; Rawlinson, William D

    2004-11-01

    Identifiable risk factors for the development of breast cancer include age, diet, family history, and lifetime estrogen exposure. An infectious agent (mouse mammary tumor virus; MMTV) is known to cause murine breast tumors and may be involved in the pathogenesis of human disease. Multiple studies have detected MMTV-like sequences in 30 to 60% of breast cancer samples and up to 1.8% of samples from normal breast. Using in situ PCR of MMTV-like sequences of formalin-fixed, paraffin-embedded breast tissue, viral sequences have been located in cancerous epithelial cells in breast acini of male and female breast tumors, but not in adjacent nonmalignant cells. MMTV-like sequences were also located in the epithelial cells of male gynecomastia samples. Using reverse transcriptase in situ PCR, RNA transcripts from the env gene were also detected within cancerous epithelial cells of 78% of DNA-positive tumors, 80% of gynecomastia samples, and 0% of normal tissues screened. This suggests the virus may be replicating in these cells. The epidemiologic and histopathological data are consistent with the association of an MMTV-like virus with breast cancers in men and women. The association with gynecomastia, a benign, possibly premalignant condition suggests hormonal influences, rather than cancer per se, may be the dominant factor in determining viral presence and replication.

  13. Mitochondrial Genome Sequence of the Legume Vicia faba

    PubMed Central

    Negruk, Valentine

    2013-01-01

    The number of plant mitochondrial genomes sequenced exceeds two dozen. However, for a detailed comparative study of different phylogenetic branches more plant mitochondrial genomes should be sequenced. This article presents sequencing data and comparative analysis of mitochondrial DNA (mtDNA) of the legume Vicia faba. The size of the V. faba circular mitochondrial master chromosome of cultivar Broad Windsor was estimated as 588,000 bp with a genome complexity of 387,745 bp and 52 conservative mitochondrial genes; 32 of them encoding proteins, 3 rRNA, and 17 tRNA genes. Six tRNA genes were highly homologous to chloroplast genome sequences. In addition to the 52 conservative genes, 114 unique open reading frames (ORFs) were found, 36 without significant homology to any known proteins and 29 with homology to the Medicago truncatula nuclear genome and to other plant mitochondrial ORFs, 49 ORFs were not homologous to M. truncatula but possessed sequences with significant homology to other plant mitochondrial or nuclear ORFs. In general, the unique ORFs revealed very low homology to known closely related legumes, but several sequence homologies were found between V. faba, Beta vulgaris, Nicotiana tabacum, Vitis vinifera, and even the monocots Oryza sativa and Zea mays. Most likely these ORFs arose independently during angiosperm evolution (Kubo and Mikami, 2007; Kubo and Newton, 2008). Computational analysis revealed in total about 45% of V. faba mtDNA sequence being homologous to the Medicago truncatula nuclear genome (more than to any sequenced plant mitochondrial genome), and 35% of this homology ranging from a few dozen to 12,806 bp are located on chromosome 1. Apparently, mitochondrial rrn5, rrn18, rps10, ATP synthase subunit alpha, cox2, and tRNA sequences are part of transcribed nuclear mosaic ORFs. PMID:23675376

  14. Plasma DNA aberrations in systemic lupus erythematosus revealed by genomic and methylomic sequencing

    PubMed Central

    Chan, Rebecca W. Y.; Jiang, Peiyong; Peng, Xianlu; Tam, Lai-Shan; Liao, Gary J. W.; Li, Edmund K. M.; Wong, Priscilla C. H.; Sun, Hao; Chan, K. C. Allen; Chiu, Rossa W. K.; Lo, Y. M. Dennis

    2014-01-01

    We performed a high-resolution analysis of the biological characteristics of plasma DNA in systemic lupus erythematosus (SLE) patients using massively parallel genomic and methylomic sequencing. A number of plasma DNA abnormalities were found. First, aberrations in measured genomic representations (MGRs) were identified in the plasma DNA of SLE patients. The extent of the aberrations in MGRs correlated with anti-double–stranded DNA (anti-dsDNA) antibody level. Second, the plasma DNA of active SLE patients exhibited skewed molecular size-distribution profiles with a significantly increased proportion of short DNA fragments. The extent of plasma DNA shortening in SLE patients correlated with the SLE disease activity index (SLEDAI) and anti-dsDNA antibody level. Third, the plasma DNA of active SLE patients showed decreased methylation densities. The extent of hypomethylation correlated with SLEDAI and anti-dsDNA antibody level. To explore the impact of anti-dsDNA antibody on plasma DNA in SLE, a column-based protein G capture approach was used to fractionate the IgG-bound and non–IgG-bound DNA in plasma. Compared with healthy individuals, SLE patients had higher concentrations of IgG-bound DNA in plasma. More IgG binding occurs at genomic locations showing increased MGRs. Furthermore, the IgG-bound plasma DNA was shorter in size and more hypomethylated than the non–IgG-bound plasma DNA. These observations have enhanced our understanding of the spectrum of plasma DNA aberrations in SLE and may provide new molecular markers for SLE. Our results also suggest that caution should be exercised when interpreting plasma DNA-based noninvasive prenatal testing and cancer testing conducted for SLE patients. PMID:25427797

  15. What Information is Stored in DNA: Does it Contain Digital Error Correcting Codes?

    NASA Astrophysics Data System (ADS)

    Liebovitch, Larry

    1998-03-01

    The longest term correlations in living systems are the information stored in DNA which reflects the evolutionary history of an organism. The 4 bases (A,T,G,C) encode sequences of amino acids as well as locations of binding sites for proteins that regulate DNA. The fidelity of this important information is maintained by ANALOG error check mechanisms. When a single strand of DNA is replicated the complementary base is inserted in the new strand. Sometimes the wrong base is inserted that sticks out disrupting the phosphate backbone. The new base is not yet methylated, so repair enzymes, that slide along the DNA, can tear out the wrong base and replace it with the right one. The bases in DNA form a sequence of 4 different symbols and so the information is encoded in a DIGITAL form. All the digital codes in our society (ISBN book numbers, UPC product codes, bank account numbers, airline ticket numbers) use error checking code, where some digits are functions of other digits to maintain the fidelity of transmitted informaiton. Does DNA also utitlize a DIGITAL error chekcing code to maintain the fidelity of its information and increase the accuracy of replication? That is, are some bases in DNA functions of other bases upstream or downstream? This raises the interesting mathematical problem: How does one determine whether some symbols in a sequence of symbols are a function of other symbols. It also bears on the issue of determining algorithmic complexity: What is the function that generates the shortest algorithm for reproducing the symbol sequence. The error checking codes most used in our technology are linear block codes. We developed an efficient method to test for the presence of such codes in DNA. We coded the 4 bases as (0,1,2,3) and used Gaussian elimination, modified for modulus 4, to test if some bases are linear combinations of other bases. We used this method to analyze the base sequence in the genes from the lac operon and cytochrome C. We did not find evidence for such error correcting codes in these genes. However, we analyzed only a small amount of DNA and if digitial error correcting schemes are present in DNA, they may be more subtle than such simple linear block codes. The basic issue we raise here, is how information is stored in DNA and an appreciation that digital symbol sequences, such as DNA, admit of interesting schemes to store and protect the fidelity of their information content. Liebovitch, Tao, Todorov, Levine. 1996. Biophys. J. 71:1539-1544. Supported by NIH grant EY6234.

  16. Significant variance in genetic diversity among populations of Schistosoma haematobium detected using microsatellite DNA loci from a genome-wide database.

    PubMed

    Glenn, Travis C; Lance, Stacey L; McKee, Anna M; Webster, Bonnie L; Emery, Aidan M; Zerlotini, Adhemar; Oliveira, Guilherme; Rollinson, David; Faircloth, Brant C

    2013-10-17

    Urogenital schistosomiasis caused by Schistosoma haematobium is widely distributed across Africa and is increasingly being targeted for control. Genome sequences and population genetic parameters can give insight into the potential for population- or species-level drug resistance. Microsatellite DNA loci are genetic markers in wide use by Schistosoma researchers, but there are few primers available for S. haematobium. We sequenced 1,058,114 random DNA fragments from clonal cercariae collected from a snail infected with a single Schistosoma haematobium miracidium. We assembled and aligned the S. haematobium sequences to the genomes of S. mansoni and S. japonicum, identifying microsatellite DNA loci across all three species and designing primers to amplify the loci in S. haematobium. To validate our primers, we screened 32 randomly selected primer pairs with population samples of S. haematobium. We designed >13,790 primer pairs to amplify unique microsatellite loci in S. haematobium, (available at http://www.cebio.org/projetos/schistosoma-haematobium-genome). The three Schistosoma genomes contained similar overall frequencies of microsatellites, but the frequency and length distributions of specific motifs differed among species. We identified 15 primer pairs that amplified consistently and were easily scored. We genotyped these 15 loci in S. haematobium individuals from six locations: Zanzibar had the highest levels of diversity; Malawi, Mauritius, Nigeria, and Senegal were nearly as diverse; but the sample from South Africa was much less diverse. About half of the primers in the database of Schistosoma haematobium microsatellite DNA loci should yield amplifiable and easily scored polymorphic markers, thus providing thousands of potential markers. Sequence conservation among S. haematobium, S. japonicum, and S. mansoni is relatively high, thus it should now be possible to identify markers that are universal among Schistosoma species (i.e., using DNA sequences conserved among species), as well as other markers that are specific to species or species-groups (i.e., using DNA sequences that differ among species). Full genome-sequencing of additional species and specimens of S. haematobium, S. japonicum, and S. mansoni is desirable to better characterize differences within and among these species, to develop additional genetic markers, and to examine genes as well as conserved non-coding elements associated with drug resistance.

  17. Availability: A Metric for Nucleic Acid Strand Displacement Systems.

    PubMed

    Olson, Xiaoping; Kotani, Shohei; Padilla, Jennifer E; Hallstrom, Natalya; Goltry, Sara; Lee, Jeunghoon; Yurke, Bernard; Hughes, William L; Graugnard, Elton

    2017-01-20

    DNA strand displacement systems have transformative potential in synthetic biology. While powerful examples have been reported in DNA nanotechnology, such systems are plagued by leakage, which limits network stability, sensitivity, and scalability. An approach to mitigate leakage in DNA nanotechnology, which is applicable to synthetic biology, is to introduce mismatches to complementary fuel sequences at key locations. However, this method overlooks nuances in the secondary structure of the fuel and substrate that impact the leakage reaction kinetics in strand displacement systems. In an effort to quantify the impact of secondary structure on leakage, we introduce the concepts of availability and mutual availability and demonstrate their utility for network analysis. Our approach exposes vulnerable locations on the substrate and quantifies the secondary structure of fuel strands. Using these concepts, a 4-fold reduction in leakage has been achieved. The result is a rational design process that efficiently suppresses leakage and provides new insight into dynamic nucleic acid networks.

  18. High Mitochondrial DNA Stability in B-Cell Chronic Lymphocytic Leukemia

    PubMed Central

    Cerezo, María; Bandelt, Hans-Jürgen; Martín-Guerrero, Idoia; Ardanaz, Maite; Vega, Ana; Carracedo, Ángel; García-Orad, África; Salas, Antonio

    2009-01-01

    Background Chronic Lymphocytic Leukemia (CLL) leads to progressive accumulation of lymphocytes in the blood, bone marrow, and lymphatic tissues. Previous findings have suggested that the mtDNA could play an important role in CLL. Methodology/Principal Findings The mitochondrial DNA (mtDNA) control-region was analyzed in lymphocyte cell DNA extracts and compared with their granulocyte counterpart extract of 146 patients suffering from B-Cell CLL; B-CLL (all recruited from the Basque country). Major efforts were undertaken to rule out methodological artefacts that would render a high false positive rate for mtDNA instabilities and thus lead to erroneous interpretation of sequence instabilities. Only twenty instabilities were finally confirmed, most of them affecting the homopolymeric stretch located in the second hypervariable segment (HVS-II) around position 310, which is well known to constitute an extreme mutational hotspot of length polymorphism, as these mutations are frequently observed in the general human population. A critical revision of the findings in previous studies indicates a lack of proper methodological standards, which eventually led to an overinterpretation of the role of the mtDNA in CLL tumorigenesis. Conclusions/Significance Our results suggest that mtDNA instability is not the primary causal factor in B-CLL. A secondary role of mtDNA mutations cannot be fully ruled out under the hypothesis that the progressive accumulation of mtDNA instabilities could finally contribute to the tumoral process. Recommendations are given that would help to minimize erroneous interpretation of sequencing results in mtDNA studies in tumorigenesis. PMID:19924307

  19. Evolutionary genomics of miniature inverted-repeat transposable elements (MITEs) in Brassica.

    PubMed

    Nouroz, Faisal; Noreen, Shumaila; Heslop-Harrison, J S

    2015-12-01

    Miniature inverted-repeat transposable elements (MITEs) are truncated derivatives of autonomous DNA transposons, and are dispersed abundantly in most eukaryotic genomes. We aimed to characterize various MITEs families in Brassica in terms of their presence, sequence characteristics and evolutionary activity. Dot plot analyses involving comparison of homoeologous bacterial artificial chromosome (BAC) sequences allowed identification of 15 novel families of mobile MITEs. Of which, 5 were Stowaway-like with TA Target Site Duplications (TSDs), 4 Tourist-like with TAA/TTA TSDs, 5 Mutator-like with 9-10 bp TSDs and 1 novel MITE (BoXMITE1) flanked by 3 bp TSDs. Our data suggested that there are about 30,000 MITE-related sequences in Brassica rapa and B. oleracea genomes. In situ hybridization showed one abundant family was dispersed in the A-genome, while another was located near 45S rDNA sites. PCR analysis using primers flanking sequences of MITE elements detected MITE insertion polymorphisms between and within the three Brassica (AA, BB, CC) genomes, with many insertions being specific to single genomes and others showing evidence of more recent evolutionary insertions. Our BAC sequence comparison strategy enables identification of evolutionarily active MITEs with no prior knowledge of MITE sequences. The details of MITE families reported in Brassica enable their identification, characterization and annotation. Insertion polymorphisms of MITEs and their transposition activity indicated important mechanism of genome evolution and diversification. MITE families derived from known Mariner, Harbinger and Mutator DNA transposons were discovered, as well as some novel structures. The identification of Brassica MITEs will have broad applications in Brassica genomics, breeding, hybridization and phylogeny through their use as DNA markers.

  20. Structural analysis of two length variants of the rDNA intergenic spacer from Eruca sativa.

    PubMed

    Lakshmikumaran, M; Negi, M S

    1994-03-01

    Restriction enzyme analysis of the rRNA genes of Eruca sativa indicated the presence of many length variants within a single plant and also between different cultivars which is unusual for most crucifers studied so far. Two length variants of the rDNA intergenic spacer (IGS) from a single individual E. sativa (cv. Itsa) plant were cloned and characterized. The complete nucleotide sequences of both the variants (3 kb and 4 kb) were determined. The intergenic spacer contains three families of tandemly repeated DNA sequences denoted as A, B and C. However, the long (4 kb) variant shows the presence of an additional repeat, denoted as D, which is a duplication of a 224 bp sequence just upstream of the putative transcription initiation site. Repeat units belonging to the three different families (A, B and C) were in the size range of 22 to 30 bp. Such short repeat elements are present in the IGS of most of the crucifers analysed so far. Sequence analysis of the variants (3 kb and 4 kb) revealed that the length heterogeneity of the spacer is located at three different regions and is due to the varying copy numbers of repeat units belonging to families A and B. Length variation of the spacer is also due to the presence of a large duplication (D repeats) in the 4 kb variant which is absent in the 3 kb variant. The putative transcription initiation site was identified by comparisons with the rDNA sequences from other plant species.

  1. Base-resolution detection of N 4-methylcytosine in genomic DNA using 4mC-Tet-assisted-bisulfite-sequencing

    DOE PAGES

    Yu, Miao; Ji, Lexiang; Neumann, Drexel A.; ...

    2015-07-15

    Restriction-modification (R-M) systems pose a major barrier to DNA transformation and genetic engineering of bacterial species. Systematic identification of DNA methylation in R-M systems, including N 6-methyladenine (6mA), 5-methylcytosine (5mC) and N 4-methylcytosine (4mC), will enable strategies to make these species genetically tractable. Although single-molecule, real time (SMRT) sequencing technology is capable of detecting 4mC directly for any bacterial species regardless of whether an assembled genome exists or not, it is not as scalable to profiling hundreds to thousands of samples compared with the commonly used next-generation sequencing technologies. Here, we present 4mC-Tet-assisted bisulfite-sequencing (4mC-TAB-seq), a next-generation sequencing method thatmore » rapidly and cost efficiently reveals the genome-wide locations of 4mC for bacterial species with an available assembled reference genome. In 4mC-TAB-seq, both cytosines and 5mCs are read out as thymines, whereas only 4mCs are read out as cytosines, revealing their specific positions throughout the genome. We applied 4mC-TAB-seq to study the methylation of a member of the hyperthermophilc genus, Caldicellulosiruptor, in which 4mC-related restriction is a major barrier to DNA transformation from other species. Lastly, in combination with MethylC-seq, both 4mC- and 5mC-containing motifs are identified which can assist in rapid and efficient genetic engineering of these bacteria in the future.« less

  2. Scar-less multi-part DNA assembly design automation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hillson, Nathan J.

    The present invention provides a method of a method of designing an implementation of a DNA assembly. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding flanking homology sequences to each of the DNA oligos. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which tomore » assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding optimized overhang sequences to each of the DNA oligos.« less

  3. Whole genome nucleosome sequencing identifies novel types of forensic markers in degraded DNA samples

    PubMed Central

    Dong, Chun-nan; Yang, Ya-dong; Li, Shu-jin; Yang, Ya-ran; Zhang, Xiao-jing; Fang, Xiang-dong; Yan, Jiang-wei; Cong, Bin

    2016-01-01

    In the case of mass disasters, missing persons and forensic caseworks, highly degraded biological samples are often encountered. It can be a challenge to analyze and interpret the DNA profiles from these samples. Here we provide a new strategy to solve the problem by taking advantage of the intrinsic structural properties of DNA. We have assessed the in vivo positions of more than 35 million putative nucleosome cores in human leukocytes using high-throughput whole genome sequencing, and identified 2,462 single nucleotide variations (SNVs), 128 insertion-deletion polymorphisms (indels). After comparing the sequence reads with 44 STR loci commonly used in forensics, five STRs (TH01, TPOX, D18S51, DYS391, and D10S1248)were matched. We compared these “nucleosome protected STRs” (NPSTRs) with five other non-NPSTRs using mini-STR primer design, real-time PCR, and capillary gel electrophoresis on artificially degraded DNA. Moreover, genotyping performance of the five NPSTRs and five non-NPSTRs was also tested with real casework samples. All results show that loci located in nucleosomes are more likely to be successfully genotyped in degraded samples. In conclusion, after further strict validation, these markers could be incorporated into future forensic and paleontology identification kits, resulting in higher discriminatory power for certain degraded sample types. PMID:27189082

  4. Soil DNA metabarcoding and high-throughput sequencing as a forensic tool: considerations, potential limitations and recommendations.

    PubMed

    Young, J M; Austin, J J; Weyrich, L S

    2017-02-01

    Analysis of physical evidence is typically a deciding factor in forensic casework by establishing what transpired at a scene or who was involved. Forensic geoscience is an emerging multi-disciplinary science that can offer significant benefits to forensic investigations. Soil is a powerful, nearly 'ideal' contact trace evidence, as it is highly individualistic, easy to characterise, has a high transfer and retention probability, and is often overlooked in attempts to conceal evidence. However, many real-life cases encounter close proximity soil samples or soils with low inorganic content, which cannot be easily discriminated based on current physical and chemical analysis techniques. The capability to improve forensic soil discrimination, and identify key indicator taxa from soil using the organic fraction is currently lacking. The development of new DNA sequencing technologies offers the ability to generate detailed genetic profiles from soils and enhance current forensic soil analyses. Here, we discuss the use of DNA metabarcoding combined with high-throughput sequencing (HTS) technology to distinguish between soils from different locations in a forensic context. Specifically, we provide recommendations for best practice, outline the potential limitations encountered in a forensic context and describe the future directions required to integrate soil DNA analysis into casework. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. HIP1 propagates in cyanobacterial DNA via nucleotide substitutions but promotes excision at similar frequencies in Escherichia coli and Synechococcus PCC 7942.

    PubMed

    Robinson, P J; Cranenburgh, R M; Head, I M; Robinson, N J

    1997-04-01

    The sequence 5'-GCGATCGC-3', designated HIP1, for highly iterated palindrome, was first identified at the borders of a gene-deletion event and subsequently shown to constitute up to 2.5% of the DNA in some cyanobacteria. It is now reported that HIP1 is polyphyletic, occurring in several distinct cyanobacterial lineages and not defining a clade. HIP1 does not introduce gaps into sequence alignments. It aligns with partial HIP1 sites in related sequences showing that it propagates by nucleotide substitutions rather than insertion. Constructs have been created to determine the frequencies at which deletion events occur between palindromes located within the selectable marker neo. Deletion between HIP1 sites was more frequent in Synechococcus PCC 7942 than deletion between control palindromes, 5'-CCGATCGG-3', designated PAL0. However, this is not due to a recombinase that recognises HIP1 and is peculiar to cyanobacteria because similar deletion frequencies were detected in Escherichia coli. Furthermore, the frequency of deletion of DNA flanked asymmetrically by one HIP1 site and one PAL0 site was less than the frequency of deletion of DNA flanked asymmetrically by identical copies of either palindrome. This is consistent with deletion by copy-choice.

  6. Synthesis and structures of a pincer-type rhodium(iii) complex: reactivity toward biomolecules.

    PubMed

    Milutinović, Milan M; Bogojeski, Jovana V; Klisurić, Olivera; Scheurer, Andreas; Elmroth, Sofi K C; Bugarčić, Živadin D

    2016-10-04

    A novel rhodium(iii) complex [Rh III (H 2 L tBu )Cl 3 ] (1) (H 2 L tBu = 2,6-bis(5-tert-butyl-1H-pyrazol-3-yl)pyridine) containing a pincer type, tridentate nitrogen-donor chelate system was synthesized. Single crystal X-ray structure analysis revealed that 1 crystallizes in the orthorhombic space group Pbcn with a = 20.7982(6), b = 10.8952(4), c = 10.9832(4) Å, V = 2488.80(15) Å 3 , and eight molecules in the unit cell. The rhodium center in the complex [Rh III (H 2 L tBu )Cl 3 ] (1) is coordinated in a slightly distorted octahedral geometry by the tridentate N,N,N-donor and three chloro ligands, adopting a mer arrangement with an essentially planar ligand skeleton. Due to the tridentate coordination of the N,N,N-donor, the central nitrogen atom N1 is located closer to the Rh III center. The reactivity of the synthesized complex toward small biomolecules (l-methionine (l-Met), guanosine-5'-monophosphate (5'-GMP), l-histidine (l-His) and glutathione (GSH)) and to a series of duplex DNAs and RNA was investigated. The order of reactivity of the studied small biomolecules is: 5'-GMP > GSH > l-Met > l-His. Duplex RNA reacts faster with the [Rh III (H 2 L tBu )Cl 3 ] complex than duplex DNA, while shorter duplex DNA (15mer GG) reacts faster compared with 22mer GG duplex DNA. In addition, a higher reactivity is achieved with a DNA duplex with a centrally located GG-sequence than with a 22GTG duplex DNA, in which the GG-sequence is separated by a T base. Furthermore, the interaction of this metal complex 1 with calf thymus DNA (CT-DNA) and bovine serum albumin (BSA) was examined by absorption (UV-Vis) and emission spectral studies (EthBr displacement studies). Overall, the studied complex exhibited good DNA and BSA interaction ability.

  7. Characterization of a tandemly repeated DNA sequence family originally derived by retroposition of tRNA(Glu) in the newt.

    PubMed

    Nagahashi, S; Endoh, H; Suzuki, Y; Okada, N

    1991-11-20

    A previous report from this laboratory showed that in vitro transcription of total genomic DNA of the newt Cynopus pyrrhogaster resulted in a discrete sized 8 S RNA, which represented highly repetitive and transcribable sequences with a glutamic acid tRNA-like structure in the newt genome. We isolated four independent clones from a newt genomic library and determined the complete sequences of three 2000 to 2400 base-pair PstI fragments spanning the 8 S RNA gene. The glutamic acid tRNA-related segment in the 8 S RNA gene contains the CCA sequence expected as the 3' terminus of a tRNA molecule. Further, the 11 nucleotides located 13 nucleotides upstream from one of the two transcription initiation sites of the 8 S RNA were found to be repeated in the region upstream from the termination site, suggesting that the original unit, which is shorter than the 8 S RNA, was retrotransposed via cDNA intermediates from the PolIII transcript. In the upstream region of the 8 S RNA gene, a 360 nucleotide unit containing the glutamic acid tRNA-related segment was found to be duplicated (clones NE1 and NE10) or triplicated (clone NE3). Except for the difference in the number of the 360 nucleotide unit, the three sequences of the 2000 to 2400 base-pair PstI fragment were essentially the same with only a few mutations and minor deletions. Inverse polymerase chain reaction and sequence determination of the products, together with a Southern hybridization experiment, demonstrated that the family consists of a tandemly repeated unit of 3300, 3700 or 4100 base-pairs. Thus during evolution, this family in the newt was created by retroposition via cDNA intermediates, followed by duplication or triplication of the 360 nucleotide unit and multiplication of the 3300 to 4100 base-pair region at the DNA level.

  8. Microbial community structure across a wastewater-impacted riparian buffer zone in the southeastern coastal plain.

    PubMed

    Ducey, T F; Johnson, P R; Shriner, A D; Matheny, T A; Hunt, P G

    2013-01-01

    Riparian buffer zones are important for both natural and developed ecosystems throughout the world because of their ability to retain nutrients, prevent soil erosion, protect aquatic environments from excessive sedimentation, and filter pollutants. Despite their importance, the microbial community structures of riparian buffer zones remains poorly defined. Our objectives for this study were twofold: first, to characterize the microbial populations found in riparian buffer zone soils; and second, to determine if microbial community structure could be linked to denitrification enzyme activity (DEA). To achieve these objectives, we investigated the microbial populations of a riparian buffer zone located downslope of a pasture irrigated with swine lagoon effluent, utilizing DNA sequencing of the 16S rDNA, DEA, and quantitative PCR (qPCR) of the denitrification genes nirK, nirS, and nosZ. Clone libraries of the 16S rDNA gene were generated from each of twelve sites across the riparian buffer with a total of 986 partial sequences grouped into 654 operational taxonomic units (OTUs). The Proteobacteria were the dominant group (49.8% of all OTUs), with the Acidobacteria also well represented (19.57% of all OTUs). Analysis of qPCR results identified spatial relationships between soil series, site location, and gene abundance, which could be used to infer both incomplete and total DEA rates.

  9. The complete sequence of the mitochondrial genome of the African Penguin (Spheniscus demersus).

    PubMed

    Labuschagne, Christiaan; Kotzé, Antoinette; Grobler, J Paul; Dalton, Desiré L

    2014-01-15

    The complete mitochondrial genome of the African Penguin (Spheniscus demersus) was sequenced. The molecule was sequenced via next generation sequencing and primer walking. The size of the genome is 17,346 bp in length. Comparison with the mitochondrial DNA of two other penguin genomes that have so far been reported was conducted namely; Little blue penguin (Eudyptula minor) and the Rockhopper penguin (Eudyptes chrysocome). This analysis made it possible to identify common penguin mitochondrial DNA characteristics. The S. demersus mtDNA genome is very similar, both in composition and length to both the E. chrysocome and E. minor genomes. The gene content of the African penguin mitochondrial genome is typical of vertebrates and all three penguin species have the standard gene order originally identified in the chicken. The control region for S. demersus is located between tRNA-Glu and tRNA-Phe and all three species of penguins contain two sets of similar repeats with varying copy numbers towards the 3' end of the control region, accounting for the size variance. This is the first report of the complete nucleotide sequence for the mitochondrial genome of the African penguin, S. demersus. These results can be subsequently used to provide information for penguin phylogenetic studies and insights into the evolution of genomes. © 2013 Elsevier B.V. All rights reserved.

  10. Recombinational hotspot specific to female meiosis in the mouse major histocompatibility complex.

    PubMed

    Shiroishi, T; Hanzawa, N; Sagai, T; Ishiura, M; Gojobori, T; Steinmetz, M; Moriwaki, K

    1990-01-01

    The wm7 haplotype of the major histocompatibility complex (MHC), derived from the Japanese wild mouse Mus musculus molossinus, enhances recombination specific to female meiosis in the K/A beta interval of the MHC. We have mapped crossover points of fifteen independent recombinants from genetic crosses of the wm7 and laboratory haplotypes. Most of them were confined to a short segment of approximately 1 kilobase (kb) of DNA between the A beta 3 and A beta 2 genes, indicating the presence of a female-specific recombinational hotspot. Its location overlaps with a sex-independent hotspot previously identified in the Mus musculus castaneus CAS3 haplotype. We have cloned and sequenced DNA fragments surrounding the hotspot from the wm7 haplotype and the corresponding regions from the hotspot-negative B10.A and C57BL/10 strains. There is no significant difference between the sequences of these three strains, or between these and the published sequences of the CAS3 and C57BL/6 strains. However, a comparison of this A beta 3/A beta 2 hotspot with a previously characterized hotspot in the E beta gene revealed that they have a very similar molecular organization. Each hotspot consists of two elements, the consensus sequence of the mouse middle repetitive MT family and the tetrameric repeated sequences, which are separated by 1 kb of DNA.

  11. Saccharomyces cerevisiae SSB1 protein and its relationship to nucleolar RNA-binding proteins.

    PubMed Central

    Jong, A Y; Clark, M W; Gilbert, M; Oehm, A; Campbell, J L

    1987-01-01

    To better define the function of Saccharomyces cerevisiae SSB1, an abundant single-stranded nucleic acid-binding protein, we determined the nucleotide sequence of the SSB1 gene and compared it with those of other proteins of known function. The amino acid sequence contains 293 amino acid residues and has an Mr of 32,853. There are several stretches of sequence characteristic of other eucaryotic single-stranded nucleic acid-binding proteins. At the amino terminus, residues 39 to 54 are highly homologous to a peptide in calf thymus UP1 and UP2 and a human heterogeneous nuclear ribonucleoprotein. Residues 125 to 162 constitute a fivefold tandem repeat of the sequence RGGFRG, the composition of which suggests a nucleic acid-binding site. Near the C terminus, residues 233 to 245 are homologous to several RNA-binding proteins. Of 18 C-terminal residues, 10 are acidic, a characteristic of the procaryotic single-stranded DNA-binding proteins and eucaryotic DNA- and RNA-binding proteins. In addition, examination of the subcellular distribution of SSB1 by immunofluorescence microscopy indicated that SSB1 is a nuclear protein, predominantly located in the nucleolus. Sequence homologies and the nucleolar localization make it likely that SSB1 functions in RNA metabolism in vivo, although an additional role in DNA metabolism cannot be excluded. Images PMID:2823109

  12. Genetic signature analysis of Perkinsus marinus in Mexico suggests possible translocation from the Atlantic Ocean to the Pacific coast of Mexico.

    PubMed

    Ek-Huchim, Juan Pablo; Aguirre-Macedo, Ma Leopoldina; Améndola-Pimenta, Monica; Vidal-Martínez, Victor Manuel; Pérez-Vega, Juan Antonio; Simá-Alvarez, Raúl; Jiménez-García, Isabel; Zamora-Bustillos, Roberto; Rodríguez-Canul, Rossanna

    2017-08-02

    The protozoan Perkinsus marinus (Mackin, Owen & Collier) Levine, 1978 causes perkinsosis in the American oyster Crassostrea virginica Gmelin, 1791. This pathogen is present in cultured C. virginica from the Gulf of Mexico and has been reported recently in Saccostrea palmula (Carpenter, 1857), Crassostrea corteziensis (Hertlein, 1951) and Crassostrea gigas (Thunberg, 1793) from the Mexican Pacific coast. Transportation of fresh oysters for human consumption and repopulation could be implicated in the transmission and dissemination of this parasite across the Mexican Pacific coast. The aim of this study was two-fold. First, we evaluated the P. marinus infection parameters by PCR and RFTM (Ray's fluid thioglycollate medium) in C. virginica from four major lagoons (Términos Lagoon, Campeche; Carmen-Pajonal-Machona Lagoon complex, Tabasco; Mandinga Lagoon, Veracruz; and La Pesca Lagoon, Tamaulipas) from the Gulf of Mexico. Secondly, we used DNA sequence analyses of the ribosomal non-transcribed spacer (rNTS) region of P. marinus to determine the possible translocation of this species from the Gulf of Mexico to the Mexican Pacific coast. Perkinsus marinus prevalence by PCR was 57.7% (338 out of 586 oysters) and 38.2% (224 out of 586 oysters) by RFTM. The highest prevalence was observed in the Carmen-Pajonal-Machona Lagoon complex in the state of Tabasco (73% by PCR and 58% by RFTM) and the estimated weighted prevalence (WP) was less than 1.0 in the four lagoons. Ten unique rDNA-NTS sequences of P. marinus [termed herein the "P. marinus (Pm) haplotype"] were identified in the Gulf of Mexico sample. They shared 96-100% similarity with 18 rDNA-NTS sequences from the GenBank database which were derived from 16 Mexican Pacific coast infections and two sequences from the USA. The phylogenetic tree and the haplotype network showed that the P. marinus rDNA-NTS sequences from Mexico were distant from the rDNA-NTS sequences of P. marinus reported from the USA. The ten rDNA-NTS sequences described herein were restricted to specific locations displaying different geographical connections within the Gulf of Mexico; the Carmen-Pajonal-Machona Pm1 haplotype from the state of Tabasco shared a cluster with P. marinus isolates reported from the Mexican Pacific coast. The rDNA-NTS sequences of P. marinus from the state of Tabasco shared high similarity with the reference rDNA-NTS sequences from the Mexican Pacific coast. The high similarity suggests a transfer of oysters infected with P. marinus from the Mexican part of the Gulf of Mexico into the Mexican Pacific coast.

  13. IMG/VR: a database of cultured and uncultured DNA Viruses and retroviruses

    DOE PAGES

    Paez-Espino, David; Chen, I. -Min A.; Palaniappan, Krishna; ...

    2016-10-30

    Viruses represent the most abundant life forms on the planet. Recent experimental and computational improvements have led to a dramatic increase in the number of viral genome sequences identified primarily from metagenomic samples. As a result of the expanding catalog of metagenomic viral sequences, there exists a need for a comprehensive computational platform integrating all these sequences with associated metadata and analytical tools. Here we present IMG/VR (https://img.jgi.doe.gov/vr/), the largest publicly available database of 3908 isolate reference DNA viruses with 264 413 computationally identified viral contigs from > 6000 ecologically diverse metagenomic samples. Approximately half of the viral contigs aremore » grouped into genetically distinct quasi-species clusters. Microbial hosts are predicted for 20 000 viral sequences, revealing nine microbial phyla previously unreported to be infected by viruses. Viral sequences can be queried using a variety of associated metadata, including habitat type and geographic location of the samples, or taxonomic classification according to hallmark viral genes. IMG/VR has a user-friendly interface that allows users to interrogate all integrated data and interact by comparingwith external sequences, thus serving as an essential resource in the viral genomics community.« less

  14. IMG/VR: a database of cultured and uncultured DNA Viruses and retroviruses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Paez-Espino, David; Chen, I. -Min A.; Palaniappan, Krishna

    Viruses represent the most abundant life forms on the planet. Recent experimental and computational improvements have led to a dramatic increase in the number of viral genome sequences identified primarily from metagenomic samples. As a result of the expanding catalog of metagenomic viral sequences, there exists a need for a comprehensive computational platform integrating all these sequences with associated metadata and analytical tools. Here we present IMG/VR (https://img.jgi.doe.gov/vr/), the largest publicly available database of 3908 isolate reference DNA viruses with 264 413 computationally identified viral contigs from > 6000 ecologically diverse metagenomic samples. Approximately half of the viral contigs aremore » grouped into genetically distinct quasi-species clusters. Microbial hosts are predicted for 20 000 viral sequences, revealing nine microbial phyla previously unreported to be infected by viruses. Viral sequences can be queried using a variety of associated metadata, including habitat type and geographic location of the samples, or taxonomic classification according to hallmark viral genes. IMG/VR has a user-friendly interface that allows users to interrogate all integrated data and interact by comparingwith external sequences, thus serving as an essential resource in the viral genomics community.« less

  15. Effect of the reflectional symmetry on the coherent hole transport across DNA hairpins

    NASA Astrophysics Data System (ADS)

    Zarea, Mehdi; Berlin, Yuri; Ratner, Mark A.

    2017-03-01

    The coherent hole transfer in three types of DNA hairpins containing strands with adenine (A) and guanine (G) nucleobases has been studied. The investigated hairpins involve An+1GGAn, AnGAGAn, or (AG)2nA strands that connect the hole donor and hole acceptor located on opposite ends of hairpins. The positive charge transfer from the photo-excited donor to the acceptor is shown to be slower for An+1GGAn in comparison with AnGAGAn and (AG)2nA sequences. We have revealed that this is due to the reflectional symmetry of the last two sequences with respect to the axis passing through the middle base. As has been demonstrated, the symmetry of the sequence structure manifests itself in the reflectional symmetry of the energy eigenstates. In addition, it has been shown that (AG)2nA is the only symmetric sequence with a zero energy state in the middle of the LUMO tight-binding energy band. Based on our theoretical findings, we predict that the hairpin with this sequence should have the fastest coherent hole transfer rate among the class of base sequences studied.

  16. The primary structure of the thymidine kinase gene of fish lymphocystis disease virus.

    PubMed

    Schnitzler, P; Handermann, M; Szépe, O; Darai, G

    1991-06-01

    The DNA nucleotide sequence of the thymidine kinase (TK) gene of fish lymphocystis disease virus (FLDV) which has been localized between the coordinates 0.678 to 0.688 of the viral genome was determined. The analysis of the DNA nucleotide sequence located between the recognition sites of HindIII (0.669 map unit; nucleotide position 1) and AccI (nucleotide position 2032) revealed the presence of an open reading frame of 954 bp on the lower strand of this region between nucleotide positions 1868 (ATG) and 915 (TAA). It encodes for a protein of 318 amino acid residues. The evolutionary relationships of the TK gene of FLDV to the other known TK genes was investigated using the method of progressive sequence alignment. These analyses revealed a high degree of diversity between the protein sequence of FLDV TK gene and the amino acid composition of other TKs tested. However, significant conservations were detected at several regions of amino acid residues of the FLDV TK protein when compared to the amino acid sequence of TKs of African swine fever virus, fowlpox virus, shope fibroma virus, and vaccinia virus and to the amino acid sequences of the cellular cytoplasmic TK of chicken, mouse, and man.

  17. Using Drosophila melanogaster as a Model for Genotoxic Chemical Mutational Studies with a New Program, SnpSift

    PubMed Central

    Cingolani, Pablo; Patel, Viral M.; Coon, Melissa; Nguyen, Tung; Land, Susan J.; Ruden, Douglas M.; Lu, Xiangyi

    2012-01-01

    This paper describes a new program SnpSift for filtering differential DNA sequence variants between two or more experimental genomes after genotoxic chemical exposure. Here, we illustrate how SnpSift can be used to identify candidate phenotype-relevant variants including single nucleotide polymorphisms, multiple nucleotide polymorphisms, insertions, and deletions (InDels) in mutant strains isolated from genome-wide chemical mutagenesis of Drosophila melanogaster. First, the genomes of two independently isolated mutant fly strains that are allelic for a novel recessive male-sterile locus generated by genotoxic chemical exposure were sequenced using the Illumina next-generation DNA sequencer to obtain 20- to 29-fold coverage of the euchromatic sequences. The sequencing reads were processed and variants were called using standard bioinformatic tools. Next, SnpEff was used to annotate all sequence variants and their potential mutational effects on associated genes. Then, SnpSift was used to filter and select differential variants that potentially disrupt a common gene in the two allelic mutant strains. The potential causative DNA lesions were partially validated by capillary sequencing of polymerase chain reaction-amplified DNA in the genetic interval as defined by meiotic mapping and deletions that remove defined regions of the chromosome. Of the five candidate genes located in the genetic interval, the Pka-like gene CG12069 was found to carry a separate pre-mature stop codon mutation in each of the two allelic mutants whereas the other four candidate genes within the interval have wild-type sequences. The Pka-like gene is therefore a strong candidate gene for the male-sterile locus. These results demonstrate that combining SnpEff and SnpSift can expedite the identification of candidate phenotype-causative mutations in chemically mutagenized Drosophila strains. This technique can also be used to characterize the variety of mutations generated by genotoxic chemicals. PMID:22435069

  18. Molecular Cytogenetics Guides Massively Parallel Sequencing of a Radiation-Induced Chromosome Translocation in Human Cells.

    PubMed

    Cornforth, Michael N; Anur, Pavana; Wang, Nicholas; Robinson, Erin; Ray, F Andrew; Bedford, Joel S; Loucas, Bradford D; Williams, Eli S; Peto, Myron; Spellman, Paul; Kollipara, Rahul; Kittler, Ralf; Gray, Joe W; Bailey, Susan M

    2018-05-11

    Chromosome rearrangements are large-scale structural variants that are recognized drivers of oncogenic events in cancers of all types. Cytogenetics allows for their rapid, genome-wide detection, but does not provide gene-level resolution. Massively parallel sequencing (MPS) promises DNA sequence-level characterization of the specific breakpoints involved, but is strongly influenced by bioinformatics filters that affect detection efficiency. We sought to characterize the breakpoint junctions of chromosomal translocations and inversions in the clonal derivatives of human cells exposed to ionizing radiation. Here, we describe the first successful use of DNA paired-end analysis to locate and sequence across the breakpoint junctions of a radiation-induced reciprocal translocation. The analyses employed, with varying degrees of success, several well-known bioinformatics algorithms, a task made difficult by the involvement of repetitive DNA sequences. As for underlying mechanisms, the results of Sanger sequencing suggested that the translocation in question was likely formed via microhomology-mediated non-homologous end joining (mmNHEJ). To our knowledge, this represents the first use of MPS to characterize the breakpoint junctions of a radiation-induced chromosomal translocation in human cells. Curiously, these same approaches were unsuccessful when applied to the analysis of inversions previously identified by directional genomic hybridization (dGH). We conclude that molecular cytogenetics continues to provide critical guidance for structural variant discovery, validation and in "tuning" analysis filters to enable robust breakpoint identification at the base pair level.

  19. Diverse Applications of Environmental DNA Methods in Parasitology.

    PubMed

    Bass, David; Stentiford, Grant D; Littlewood, D T J; Hartikainen, Hanna

    2015-10-01

    Nucleic acid extraction and sequencing of genes from organisms within environmental samples encompasses a variety of techniques collectively referred to as environmental DNA or 'eDNA'. The key advantages of eDNA analysis include the detection of cryptic or otherwise elusive organisms, large-scale sampling with fewer biases than specimen-based methods, and generation of data for molecular systematics. These are particularly relevant for parasitology because parasites can be difficult to locate and are morphologically intractable and genetically divergent. However, parasites have rarely been the focus of eDNA studies. Focusing on eukaryote parasites, we review the increasing diversity of the 'eDNA toolbox'. Combining eDNA methods with complementary tools offers much potential to understand parasite communities, disease risk, and parasite roles in broader ecosystem processes such as food web structuring and community assembly. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.

  20. Comprehensive evaluation of genome-wide 5-hydroxymethylcytosine profiling approaches in human DNA.

    PubMed

    Skvortsova, Ksenia; Zotenko, Elena; Luu, Phuc-Loi; Gould, Cathryn M; Nair, Shalima S; Clark, Susan J; Stirzaker, Clare

    2017-01-01

    The discovery that 5-methylcytosine (5mC) can be oxidized to 5-hydroxymethylcytosine (5hmC) by the ten-eleven translocation (TET) proteins has prompted wide interest in the potential role of 5hmC in reshaping the mammalian DNA methylation landscape. The gold-standard bisulphite conversion technologies to study DNA methylation do not distinguish between 5mC and 5hmC. However, new approaches to mapping 5hmC genome-wide have advanced rapidly, although it is unclear how the different methods compare in accurately calling 5hmC. In this study, we provide a comparative analysis on brain DNA using three 5hmC genome-wide approaches, namely whole-genome bisulphite/oxidative bisulphite sequencing (WG Bis/OxBis-seq), Infinium HumanMethylation450 BeadChip arrays coupled with oxidative bisulphite (HM450K Bis/OxBis) and antibody-based immunoprecipitation and sequencing of hydroxymethylated DNA (hMeDIP-seq). We also perform loci-specific TET-assisted bisulphite sequencing (TAB-seq) for validation of candidate regions. We show that whole-genome single-base resolution approaches are advantaged in providing precise 5hmC values but require high sequencing depth to accurately measure 5hmC, as this modification is commonly in low abundance in mammalian cells. HM450K arrays coupled with oxidative bisulphite provide a cost-effective representation of 5hmC distribution, at CpG sites with 5hmC levels >~10%. However, 5hmC analysis is restricted to the genomic location of the probes, which is an important consideration as 5hmC modification is commonly enriched at enhancer elements. Finally, we show that the widely used hMeDIP-seq method provides an efficient genome-wide profile of 5hmC and shows high correlation with WG Bis/OxBis-seq 5hmC distribution in brain DNA. However, in cell line DNA with low levels of 5hmC, hMeDIP-seq-enriched regions are not detected by WG Bis/OxBis or HM450K, either suggesting misinterpretation of 5hmC calls by hMeDIP or lack of sensitivity of the latter methods. We highlight both the advantages and caveats of three commonly used genome-wide 5hmC profiling technologies and show that interpretation of 5hmC data can be significantly influenced by the sensitivity of methods used, especially as the levels of 5hmC are low and vary in different cell types and different genomic locations.

  1. Satellite DNA and Transposable Elements in Seabuckthorn (Hippophae rhamnoides), a Dioecious Plant with Small Y and Large X Chromosomes.

    PubMed

    Puterova, Janka; Razumova, Olga; Martinek, Tomas; Alexandrov, Oleg; Divashuk, Mikhail; Kubat, Zdenek; Hobza, Roman; Karlov, Gennady; Kejnovsky, Eduard

    2017-01-01

    Seabuckthorn (Hippophae rhamnoides) is a dioecious shrub commonly used in the pharmaceutical, cosmetic, and environmental industry as a source of oil, minerals and vitamins. In this study, we analyzed the transposable elements and satellites in its genome. We carried out Illumina DNA sequencing and reconstructed the main repetitive DNA sequences. For data analysis, we developed a new bioinformatics approach for advanced satellite DNA analysis and showed that about 25% of the genome consists of satellite DNA and about 24% is formed of transposable elements, dominated by Ty3/Gypsy and Ty1/Copia LTR retrotransposons. FISH mapping revealed X chromosome-accumulated, Y chromosome-specific or both sex chromosomes-accumulated satellites but most satellites were found on autosomes. Transposable elements were located mostly in the subtelomeres of all chromosomes. The 5S rDNA and 45S rDNA were localized on one autosomal locus each. Although we demonstrated the small size of the Y chromosome of the seabuckthorn and accumulated satellite DNA there, we were unable to estimate the age and extent of the Y chromosome degeneration. Analysis of dioecious relatives such as Shepherdia would shed more light on the evolution of these sex chromosomes. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  2. Systematic Characteristic Exploration of the Chimeras Generated in Multiple Displacement Amplification through Next Generation Sequencing Data Reanalysis

    PubMed Central

    Gao, Shen; Yao, Bei; Lu, Zuhong

    2015-01-01

    Background The chimeric sequences produced by phi29 DNA polymerase, which are named as chimeras, influence the performance of the multiple displacement amplification (MDA) and also increase the difficulty of sequence data process. Despite several articles have reported the existence of chimeric sequence, there was only one research focusing on the structure and generation mechanism of chimeras, and it was merely based on hundreds of chimeras found in the sequence data of E. coli genome. Method We finished data mining towards a series of Next Generation Sequencing (NGS) reads which were used for whole genome haplotype assembling in a primary study. We established a bioinformatics pipeline based on subsection alignment strategy to discover all the chimeras inside and achieve their structural visualization. Then, we artificially defined two statistical indexes (the chimeric distance and the overlap length), and their regular abundance distribution helped illustrate of the structural characteristics of the chimeras. Finally we analyzed the relationship between the chimera type and the average insertion size, so that illustrate a method to decrease the proportion of wasted data in the procedure of DNA library construction. Results/Conclusion 131.4 Gb pair-end (PE) sequence data was reanalyzed for the chimeras. Totally, 40,259,438 read pairs (6.19%) with chimerism were discovered among 650,430,811 read pairs. The chimeric sequences are consisted of two or more parts which locate inconsecutively but adjacently on the chromosome. The chimeric distance between the locations of adjacent parts on the chromosome followed an approximate bimodal distribution ranging from 0 to over 5,000 nt, whose peak was at about 250 to 300 nt. The overlap length of adjacent parts followed an approximate Poisson distribution and revealed a peak at 6 nt. Moreover, unmapped chimeras, which were classified as the wasted data, could be reduced by properly increasing the length of the insertion segment size through a linear correlation analysis. Significance This study exhibited the profile of the phi29MDA chimeras by tens of millions of chimeric sequences, and helped understand the amplification mechanism of the phi29 DNA polymerase. Our work also illustrated the importance of NGS data reanalysis, not only for the improvement of data utilization efficiency, but also for more potential genomic information. PMID:26440104

  3. Rat L (long interspersed repeated DNA) elements contain guanine-rich homopurine sequences that induce unpairing of contiguous duplex DNA.

    PubMed Central

    Usdin, K; Furano, A V

    1988-01-01

    The L family (long interspersed repeated DNA) of mobile genetic elements is a persistent feature of the mammalian genome. In rats, this family contains approximately equal to 40,000 members and accounts for approximately equal to 10% of the haploid genome. We demonstrate here that the guanine-rich homopurine stretches located at the right end of L-DNA induce oligonucleotide uptake by contiguous duplex DNA. The uptake is dependent on negative supercoiling and the length of the homopurine stretch and occurs even when the L-DNA homopurine stretches are introduced into a different DNA environment. The bound oligomer primes DNA synthesis when DNA polymerase and deoxyribonucleoside triphosphates are added, resulting in a faithful copy of the template to which the oligonucleotide had bound. The implications of this property of the L-DNA guanine-rich homopurine stretches in the amplification, recombination, and dispersal of L elements is discussed. Images PMID:2837766

  4. DNA methylome profiling identifies novel methylated genes in African American patients with colorectal neoplasia.

    PubMed

    Ashktorab, Hassan; Daremipouran, M; Goel, Ajay; Varma, Sudhir; Leavitt, R; Sun, Xueguang; Brim, Hassan

    2014-04-01

    The identification of genes that are differentially methylated in colorectal cancer (CRC) has potential value for both diagnostic and therapeutic interventions specifically in high-risk populations such as African Americans (AAs). However, DNA methylation patterns in CRC, especially in AAs, have not been systematically explored and remain poorly understood. Here, we performed DNA methylome profiling to identify the methylation status of CpG islands within candidate genes involved in critical pathways important in the initiation and development of CRC. We used reduced representation bisulfite sequencing (RRBS) in colorectal cancer and adenoma tissues that were compared with DNA methylome from a healthy AA subject's colon tissue and peripheral blood DNA. The identified methylation markers were validated in fresh frozen CRC tissues and corresponding normal tissues from AA patients diagnosed with CRC at Howard University Hospital. We identified and validated the methylation status of 355 CpG sites located within 16 gene promoter regions associated with CpG islands. Fifty CpG sites located within CpG islands-in genes ATXN7L1 (2), BMP3 (7), EID3 (15), GAS7 (1), GPR75 (24), and TNFAIP2 (1)-were significantly hypermethylated in tumor vs. normal tissues (P<0.05). The methylation status of BMP3, EID3, GAS7, and GPR75 was confirmed in an independent, validation cohort. Ingenuity pathway analysis mapped three of these markers (GAS7, BMP3 and GPR) in the insulin and TGF-β1 network-the two key pathways in CRC. In addition to hypermethylated genes, our analysis also revealed that LINE-1 repeat elements were progressively hypomethylated in the normal-adenoma-cancer sequence. We conclude that DNA methylome profiling based on RRBS is an effective method for screening aberrantly methylated genes in CRC. While previous studies focused on the limited identification of hypermethylated genes, ours is the first study to systematically and comprehensively identify novel hypermethylated genes, as well as hypomethylated LINE-1 sequences, which may serve as potential biomarkers for CRC in African Americans. Our discovered biomarkers were intimately linked to the insulin/TGF-B1 pathway, further strengthening the association of diabetic disorders with colon oncogenic transformation.

  5. [Molecular genetic characterization of the Far Eastern trematode Skrjabino lecithum spasskii Belous, 1954 (Digenea: Haploporidae)), a parasite of mullets].

    PubMed

    Atopkin, D M; Nikitenko, A Yu; Ngo, H D; Ha, N V; Tang, N V

    2015-01-01

    Intraspecific genetic differentiation of the trematode Skrjabinolecithum spasskii and its phylogenetic relationships with other species of the family Haploporidae were studied by comparing the nucleotide sequences of a part of the 28S rRNA gene and the ITS1-5.8S-ITS2 rDNA region. Trematodes were isolated from so-iuy mullet Liza haematocheila fishes collected in rivers of Primorye and flathead grey mullet Mugil cephalus fishes collected in water bodies of Vietnam (27 fishes in total). A phylogenetic analysis showed that S. spasskii is close to species of the genus Capitimitta of the subfamily Waretrematinae. By intraspecific variation of rDNA sequences, trematodes were divided into three groups with tree different genotypes, which had fixed nucleotide substitutions. Genotype I was found in trematodes from fishes collected in Primorye. Genotype II was detected in trematodes from M. cephalus fishes collected in the Tonkin Bay, Cat Ba Island, Vietnam. Genotype III was found in five trematodes from L. haematocheila collected in the Kievka River, Primorye. The genetic distances between genotypes I and III from Primorye were 0.4 and 0.65% by 28S and ITS rDNA sequences, respectively. The lowest genetic distances were observed between genotypes II (Vietnam) and III (Primorye), 0.1 and 0.33% by 28S and ITS rDNA sequences, respectively. Possible causes of genetic differentiation of S. spasskii from different geographic locations and different definitive host species are discussed.

  6. Novel DNA packaging recognition in the unusual bacteriophage N15

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Feiss, Michael; Geyer, Henriette, E-mail: henriettegeyer@gmail.com; Division of Viral Infections, Robert Koch Institute, Berlin

    Phage lambda's cosB packaging recognition site is tripartite, consisting of 3 TerS binding sites, called R sequences. TerS binding to the critical R3 site positions the TerL endonuclease for nicking cosN to generate cohesive ends. The N15 cos (cos{sup N15}) is closely related to cos{sup λ}, but whereas the cosB{sup N15} subsite has R3, it lacks the R2 and R1 sites and the IHF binding site of cosB{sup λ}. A bioinformatic study of N15-like phages indicates that cosB{sup N15} also has an accessory, remote rR2 site, which is proposed to increase packaging efficiency, like R2 and R1 of lambda. N15more » plus five prophages all have the rR2 sequence, which is located in the TerS-encoding 1 gene, approximately 200 bp distal to R3. An additional set of four highly related prophages, exemplified by Monarch, has R3 sequence, but also has R2 and R1 sequences characteristic of cosB–λ. The DNA binding domain of TerS-N15 is a dimer. - Highlights: • There are two classes of DNA packaging signals in N15-related phages. • Phage N15's TerS binding site: a critical site and a possible remote accessory site. • Viral DNA recognition signals by the λ-like bacteriophages: the odd case of N15.« less

  7. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    DOEpatents

    Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S

    2013-06-25

    A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.

  8. Complete nucleotide sequence of Sida golden mosaic Florida virus and phylogenetic relationships with other begomoviruses infecting malvaceous weeds in the Caribbean.

    PubMed

    Fiallo-Olivé, Elvira; Martínez-Zubiaur, Yamila; Moriones, Enrique; Navas-Castillo, Jesús

    2010-09-01

    The complete genome sequence of two isolates of the bipartite begomovirus (genus Begomovirus, family Geminiviridae) Sida golden mosaic Florida virus (SiGMFV) is presented. We propose that both isolates, found infecting Malvastrum coromandelianum (family Malvaceae) in Cuba, belong to a new strain of SiGMFV. Phylogenetic analysis showed that SiGMFV DNA-A is located in a monophyletic cluster that includes begomoviruses infecting malvaceous weeds from the Caribbean.

  9. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    DOEpatents

    Gardner, Shea N [San Leandro, CA; Mariella, Jr., Raymond P.; Christian, Allen T [Tracy, CA; Young, Jennifer A [Berkeley, CA; Clague, David S [Livermore, CA

    2011-01-18

    A method of fabricating a DNA molecule of user-defined sequence. The method comprises the steps of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an even or odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths. In one embodiment starting sequence fragments are of different lengths, n, n+1, n+2, etc.

  10. Adaptable gene-specific dye bias correction for two-channel DNA microarrays.

    PubMed

    Margaritis, Thanasis; Lijnzaad, Philip; van Leenen, Dik; Bouwmeester, Diane; Kemmeren, Patrick; van Hooff, Sander R; Holstege, Frank C P

    2009-01-01

    DNA microarray technology is a powerful tool for monitoring gene expression or for finding the location of DNA-bound proteins. DNA microarrays can suffer from gene-specific dye bias (GSDB), causing some probes to be affected more by the dye than by the sample. This results in large measurement errors, which vary considerably for different probes and also across different hybridizations. GSDB is not corrected by conventional normalization and has been difficult to address systematically because of its variance. We show that GSDB is influenced by label incorporation efficiency, explaining the variation of GSDB across different hybridizations. A correction method (Gene- And Slide-Specific Correction, GASSCO) is presented, whereby sequence-specific corrections are modulated by the overall bias of individual hybridizations. GASSCO outperforms earlier methods and works well on a variety of publically available datasets covering a range of platforms, organisms and applications, including ChIP on chip. A sequence-based model is also presented, which predicts which probes will suffer most from GSDB, useful for microarray probe design and correction of individual hybridizations. Software implementing the method is publicly available.

  11. Adaptable gene-specific dye bias correction for two-channel DNA microarrays

    PubMed Central

    Margaritis, Thanasis; Lijnzaad, Philip; van Leenen, Dik; Bouwmeester, Diane; Kemmeren, Patrick; van Hooff, Sander R; Holstege, Frank CP

    2009-01-01

    DNA microarray technology is a powerful tool for monitoring gene expression or for finding the location of DNA-bound proteins. DNA microarrays can suffer from gene-specific dye bias (GSDB), causing some probes to be affected more by the dye than by the sample. This results in large measurement errors, which vary considerably for different probes and also across different hybridizations. GSDB is not corrected by conventional normalization and has been difficult to address systematically because of its variance. We show that GSDB is influenced by label incorporation efficiency, explaining the variation of GSDB across different hybridizations. A correction method (Gene- And Slide-Specific Correction, GASSCO) is presented, whereby sequence-specific corrections are modulated by the overall bias of individual hybridizations. GASSCO outperforms earlier methods and works well on a variety of publically available datasets covering a range of platforms, organisms and applications, including ChIP on chip. A sequence-based model is also presented, which predicts which probes will suffer most from GSDB, useful for microarray probe design and correction of individual hybridizations. Software implementing the method is publicly available. PMID:19401678

  12. Non-canonical ribosomal DNA segments in the human genome, and nucleoli functioning.

    PubMed

    Kupriyanova, Natalia S; Netchvolodov, Kirill K; Sadova, Anastasia A; Cherepanova, Marina D; Ryskov, Alexei P

    2015-11-10

    Ribosomal DNA (rDNA) in the human genome is represented by tandem repeats of 43 kb nucleotide sequences that form nucleoli organizers (NORs) on each of five pairs of acrocentric chromosomes. RDNA-similar segments of different lengths are also present on (NOR)(-) chromosomes. Many of these segments contain nucleotide substitutions, supplementary microsatellite clusters, and extended deletions. Recently, it was shown that, in addition to ribosome biogenesis, nucleoli exhibit additional functions, such as cell-cycle regulation and response to stresses. In particular, several stress-inducible loci located in the ribosomal intergenic spacer (rIGS) produce stimuli-specific noncoding nucleolus RNAs. By mapping the 5'/3' ends of the rIGS segments scattered throughout (NOR)(-) chromosomes, we discovered that the bonds in the rIGS that were most often susceptible to disruption in the rIGS were adjacent to, or overlapped with stimuli-specific inducible loci. This suggests the interconnection of the two phenomena - nucleoli functioning and the scattering of rDNA-like sequences on (NOR)(-) chromosomes. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Epigenetics of Ancient DNA.

    PubMed

    Zhenilo, S V; Sokolov, A S; Prokhortchouk, E B

    2016-01-01

    Initially, the study of DNA isolated from ancient specimens had been based on the analysis of the primary nucleotide sequence. This approach has allowed researchers to study the evolutionary changes that occur in different populations and determine the influence of the environment on genetic selection. However, the improvement of methodological approaches to genome-wide analysis has opened up new possibilities in the search for the epigenetic mechanisms involved in the regulation of gene expression. It was discovered recently that the methylation status of the regulatory elements of the HOXD cluster and MEIS 1 gene changed during human evolution. Epigenetic changes in these genes played a key role in the evolution of the limbs of modern humans. Recent works have demonstrated that it is possible to determine the transcriptional activity of genes in ancient DNA samples by combining information on DNA methylation and the DNAaseI hypersensitive sequences located at the transcription start sites of genes. In the nearest future, if a preserved fossils brain is found, it will be possible to identify the evolutionary changes in the higher nervous system associated with epigenetic differences.

  14. Reduced Mtdna Diversity in the Ngobe Amerinds of Panama

    PubMed Central

    Kolman, C. J.; Bermingham, E.; Cooke, R.; Ward, R. H.; Arias, T. D.; Guionneau-Sinclair, F.

    1995-01-01

    Mitochondrial DNA (mtDNA) haplotype diversity was determined for 46 Ngobe Amerinds sampled widely across their geographic range in western Panama. The Ngobe data were compared with mtDNA control region I sequences from two additional Amerind groups located at the northern and southern extremes of Amerind distribution, the Nuu-Chah-Nulth of the Pacific Northwest and the Chilean Mapuche and from one Na-Dene group, the Haida of the Pacific Northwest. The Ngobe exhibit the lowest mtDNA control region sequence diversity yet reported for an Amerind group. Moreover, they carry only two of the four Amerind founding lineages first described by Wallace and coworkers. We posit that the Ngobe passed through a population bottleneck caused by ethnogenesis from a small founding population and/or European conquest and colonization. Dating of the Ngobe population expansion using the HARPENDING et al. approach to the analysis of pairwise genetic differences indicates a Ngobe expansion at roughly 6800 years before present (range: 1850-14,000 years before present), a date more consistent with a bottleneck at Chibcha ethnogenesis than a conquest-based event. PMID:7635293

  15. Isolation of active regulatory elements from eukaryotic chromatin using FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements)

    PubMed Central

    Giresi, Paul G.; Lieb, Jason D.

    2009-01-01

    The binding of sequence-specific regulatory factors and the recruitment of chromatin remodeling activities cause nucleosomes to be evicted from chromatin in eukaryotic cells. Traditionally, these active sites have been identified experimentally through their sensitivity to nucleases. Here we describe the details of a simple procedure for the genome-wide isolation of nucleosome-depleted DNA from human chromatin, termed FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements). We also provide protocols for different methods of detecting FAIRE-enriched DNA, including use of PCR, DNA microarrays, and next-generation sequencing. FAIRE works on all eukaryotic chromatin tested to date. To perform FAIRE, chromatin is crosslinked with formaldehyde, sheared by sonication, and phenol-chloroform extracted. Most genomic DNA is crosslinked to nucleosomes and is sequestered to the interphase, whereas DNA recovered in the aqueous phase corresponds to nucleosome-depleted regions of the genome. The isolated regions are largely coincident with the location of DNaseI hypersensitive sites, transcriptional start sites, enhancers, insulators, and active promoters. Given its speed and simplicity, FAIRE has utility in establishing chromatin profiles of diverse cell types in health and disease, isolating DNA regulatory elements en masse for further characterization, and as a screening assay for the effects of small molecules on chromatin organization. PMID:19303047

  16. Use of mariner transposases for one-step delivery and integration of DNA in prokaryotes and eukaryotes by transfection

    PubMed Central

    Michlewski, Gracjan; Finnegan, David J.; Elfick, Alistair; Rosser, Susan J.

    2017-01-01

    Abstract Delivery of DNA to cells and its subsequent integration into the host genome is a fundamental task in molecular biology, biotechnology and gene therapy. Here we describe an IP-free one-step method that enables stable genome integration into either prokaryotic or eukaryotic cells. A synthetic mariner transposon is generated by flanking a DNA sequence with short inverted repeats. When purified recombinant Mos1 or Mboumar-9 transposase is co-transfected with transposon-containing plasmid DNA, it penetrates prokaryotic or eukaryotic cells and integrates the target DNA into the genome. In vivo integrations by purified transposase can be achieved by electroporation, chemical transfection or Lipofection of the transposase:DNA mixture, in contrast to other published transposon-based protocols which require electroporation or microinjection. As in other transposome systems, no helper plasmids are required since transposases are not expressed inside the host cells, thus leading to generation of stable cell lines. Since it does not require electroporation or microinjection, this tool has the potential to be applied for automated high-throughput creation of libraries of random integrants for purposes including gene knock-out libraries, screening for optimal integration positions or safe genome locations in different organisms, selection of the highest production of valuable compounds for biotechnology, and sequencing. PMID:28204586

  17. Comparative Analysis of Repetitive DNA between the Main Vectors of Chagas Disease: Triatoma infestans and Rhodnius prolixus.

    PubMed

    Pita, Sebastián; Mora, Pablo; Vela, Jesús; Palomeque, Teresa; Sánchez, Antonio; Panzera, Francisco; Lorite, Pedro

    2018-04-24

    Chagas disease or American trypanosomiasis affects six to seven million people worldwide, mostly in Latin America. This disease is transmitted by hematophagous insects known as "kissing bugs" (Hemiptera, Triatominae), with Triatoma infestans and Rhodnius prolixus being the two most important vector species. Despite the fact that both species present the same diploid chromosome number (2 n = 22), they have remarkable differences in their total DNA content, chromosome structure and genome organization. Variations in the DNA genome size are expected to be due to differences in the amount of repetitive DNA sequences. The T. infestans genome-wide analysis revealed the existence of 42 satellite DNA families. BLAST searches of these sequences against the R. prolixus genome assembly revealed that only four of these satellite DNA families are shared between both species, suggesting a great differentiation between the Triatoma and Rhodnius genomes. Fluorescence in situ hybridization (FISH) location of these repetitive DNAs in both species showed that they are dispersed on the euchromatic regions of all autosomes and the X chromosome. Regarding the Y chromosome, these common satellite DNAs are absent in T. infestans but they are present in the R. prolixus Y chromosome. These results support a different origin and/or evolution in the Y chromosome of both species.

  18. DNA accumulation on ventilation system filters in university buildings in Singapore

    PubMed Central

    Luhung, Irvan; Wu, Yan; Xu, Siyu; Yamamoto, Naomichi; Nazaroff, William W.

    2017-01-01

    Introduction Biological particles deposit on air handling system filters as they process air. This study reports and interprets abundance and diversity information regarding biomass accumulation on ordinarily used filters acquired from several locations in a university environment. Methods DNA-based analysis was applied both to quantify (via DNA fluorometry and qPCR) and to characterize (via high-throughput sequencing) the microbial material on filters, which mainly processed recirculated indoor air. Results were interpreted in relation to building occupancy and ventilation system operational parameters. Results Based on accumulated biomass, average DNA concentrations per AHU filter surface area across nine indoor locations after twelve weeks of filter use were in the respective ranges 1.1 to 41 ng per cm2 for total DNA, 0.02 to 3.3 ng per cm2 for bacterial DNA and 0.2 to 2.0 ng DNA per cm2 for fungal DNA. The most abundant genera detected on the AHU filter samples were Clostridium, Streptophyta, Bacillus, Acinetobacter and Ktedonobacter for bacteria and Aspergillus, Cladosporium, Nigrospora, Rigidoporus and Lentinus for fungi. Conditional indoor airborne DNA concentrations (median (range)) were estimated to be 13 (2.6–107) pg/m3 for total DNA, 0.4 (0.05–8.4) pg/m3 for bacterial DNA and 2.3 (1.0–5.1) pg/m3 for fungal DNA. Conclusion Conditional airborne concentrations and the relative abundances of selected groups of genera correlate well with occupancy level. Bacterial DNA was found to be more responsive than fungal DNA to differences in occupancy level and indoor environmental conditions. PMID:29023520

  19. A preliminary assessment of the true morels (Morchella) in Newfoundland and Labrador

    USDA-ARS?s Scientific Manuscript database

    A preliminary assessment of true morels (Morchella) from Newfoundland and Labrador (NL) was obtained by using DNA sequence data from portions of three genes to identify 20 collections from Newfoundland and one from a remote location in Labrador. To place this work in a broader context, data on 25 co...

  20. Saturation analysis of ChIP-seq data for reproducible identification of binding peaks

    PubMed Central

    Hansen, Peter; Hecht, Jochen; Ibrahim, Daniel M.; Krannich, Alexander; Truss, Matthias; Robinson, Peter N.

    2015-01-01

    Chromatin immunoprecipitation coupled with next-generation sequencing (ChIP-seq) is a powerful technology to identify the genome-wide locations of transcription factors and other DNA binding proteins. Computational ChIP-seq peak calling infers the location of protein–DNA interactions based on various measures of enrichment of sequence reads. In this work, we introduce an algorithm, Q, that uses an assessment of the quadratic enrichment of reads to center candidate peaks followed by statistical analysis of saturation of candidate peaks by 5′ ends of reads. We show that our method not only is substantially faster than several competing methods but also demonstrates statistically significant advantages with respect to reproducibility of results and in its ability to identify peaks with reproducible binding site motifs. We show that Q has superior performance in the delineation of double RNAPII and H3K4me3 peaks surrounding transcription start sites related to a better ability to resolve individual peaks. The method is implemented in C+l+ and is freely available under an open source license. PMID:26163319

  1. The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

    PubMed Central

    Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

    1987-01-01

    Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

  2. Palindromic repetitive DNA elements with coding potential in Methanocaldococcus jannaschii.

    PubMed

    Suyama, Mikita; Lathe, Warren C; Bork, Peer

    2005-10-10

    We have identified 141 novel palindromic repetitive elements in the genome of euryarchaeon Methanocaldococcus jannaschii. The total length of these elements is 14.3kb, which corresponds to 0.9% of the total genomic sequence and 6.3% of all extragenic regions. The elements can be divided into three groups (MJRE1-3) based on the sequence similarity. The low sequence identity within each of the groups suggests rather old origin of these elements in M. jannaschii. Three MJRE2 elements were located within the protein coding regions without disrupting the coding potential of the host genes, indicating that insertion of repeats might be a widespread mechanism to enhance sequence diversity in coding regions.

  3. DNA methylation inhibits expression and transposition of the Neurospora Tad retrotransposon.

    PubMed

    Zhou, Y; Cambareri, E B; Kinsey, J A

    2001-06-01

    Tad is a LINE-like retrotransposon of the filamentous fungus Neurospora crassa. We have analyzed both expression and transposition of this element using strains with a single copy of Tad located in the 5' noncoding sequences of the am (glutamate dehydrogenase) gene. Tad in this position has been shown to carry a de novo cytosine methylation signal which causes reversible methylation of both Tad and am upstream sequences. Here we find that methylation of the Tad sequences inhibits both Tad expression and transposition. This inhibition can be relieved by the use of 5-azacytidine, a drug which reduces cytosine methylation, or by placing the Tad/am sequences in a dim-2 genetic background.

  4. Anchovies to Whales: tracking vertebrate biodiversity in Monterey Bay by metabarcoding environmental DNA (eDNA)

    NASA Astrophysics Data System (ADS)

    Closek, C. J.; Starks, H.; Walz, K.; Boehm, A. B.; Chavez, F.

    2016-12-01

    The oscillation between the dominance of Sardinops sagax (pacific sardine) and Engraulis mordax (northern anchovy) has been documented in the California Coastal Ecosystem for more than 100 years. These two species are strong drivers of trophic interactions in the region. As part of the Marine Biodiversity Observational Network (MBON) initiative, we used archived filtered seawater samples collected late-summer to mid-fall over a span of 8 years from Monterey Bay, CA to examine the change in marine vertebrate environmental DNA (eDNA). Water samples were collected from a nearshore location in Monterey Bay (C1) during the years of 2008-15. The water was then filtered, and the filter was archived at -80°C. DNA was extracted from the filters, and the 12S rRNA gene present in mitochondrial DNA was PCR amplification using primers designed to amplify 12s rRNA genes from marine vertebrates. The amplicons were subsequently sequenced with an Illumina MiSeq and the data processed using an analysis pipeline for sequence annotation. More than 20 fish genera were noted in the sequences from 2008-12, with Engraulis the dominant fish genus from 2013-15. Anchovy and Megaptera novaeangliae (humpback whale) were present in temporal patterns similar to those noted during visual observations where anchovy and humpback whale were more abundant during the years of 2013-2015 than the other years. This study demonstrates our ability to detect megafauna and fish species that are important to the Monterey Bay ecosystem from coastal water samples and determine community structural differences over time.

  5. A new polymorphic and multicopy MHC gene family related to nonmammalian class I

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leelayuwat, C.; Degli-Esposti, M.A.; Abraham, L.J.

    1994-12-31

    The authors have used genomic analysis to characterize a region of the central major histocompatibility complex (MHC) spanning {approximately} 300 kilobases (kb) between TNF and HLA-B. This region has been suggested to carry genetic factors relevant to the development of autoimmune diseases such as myasthenia gravis (MG) and insulin dependent diabetes mellitus (IDDM). Genomic sequence was analyzed for coding potential, using two neural network programs, GRAIL and GeneParser. A genomic probe, JAB, containing putative coding sequences (PERB11) located 60 kb centromeric of HLA-B, was used for northern analysis of human tissues. Multiple transcripts were detected. Southern analysis of genomic DNAmore » and overlapping YAC clones, covering the region from BAT1 to HLA-F, indicated that there are at least five copies of PERB11, four of which are located within this region of the MHC. The partial cDNA sequence of PERB11 was obtained from poly-A RNA derived from skeletal muscle. The putative amino acid sequence of PERB11 shares {approximately} 30% identity to MHC class I molecules from various species, including reptiles, chickens, and frogs, as well as to other MHC class I-like molecules, such as the IgG FcR of the mouse and rat and the human Zn-{alpha}2-glycoprotein. From direct comparison of amino acid sequences, it is concluded that PERB11 is a distinct molecule more closely related to nonmammalian than known mammalian MHC class I molecules. Genomic sequence analysis of PERB11 from five MHC ancestral haplotypes (AH) indicated that the gene is polymorphic at both DNA and protein level. The results suggest that the authors have identified a novel polymorphic gene family with multiple copies within the MHC. 48 refs., 10 figs., 2 tabs.« less

  6. Bacterial communities in Great Barrier Reef calcareous sediments: Contrasting 16S rDNA libraries from nearshore and outer shelf reefs

    NASA Astrophysics Data System (ADS)

    Uthicke, S.; McGuire, K.

    2007-03-01

    Bacterial communities in eight 16S rDNA clone libraries from calcareous sediments were investigated to provide an assessment of the bacterial diversity on sediments of the Great Barrier Reef (GBR) and to investigate differences due to decreased water quality. Sample effort was spread across two locations on each of four coral reefs, with two reefs located nearshore and two reefs on the outer shelf to allow robust statistical comparison of nearshore reefs (subjected to enhanced runoff) and outer shelf reefs (pristine conditions). Out of 221 non-chimeric sequences, 189 (85.5%) were unique and only one sequence occurred in more than one library. Rarefaction analyses and coverage calculations indicated that only a small fraction of the diversity was sampled. Cluster analyses and comparison to published sequences indicated that sequences retrieved belonged to the α, γ and δ subdivision of the Proteobacteria (6.8, 29.4 and 13.6% of the total, respectively), Cytophaga-Flavobacteria-Bacteroidetes (CFB) group (20.4%), Cyanobacteria (5.4%), Planctomycetaceae (7.7%), Verrucomicrobiaceae (6.8%), Acidobacteriaceae (2.7%). Analysis of Similarity (ANOSIM, based on grouping all retrieved sequences into 9 phylogenetic groups) indicated that subtle differences do exist in the community composition between nearshore and outer shelf reefs. Similarity percentage analysis (SIMPER) indicated that Acidobacteriaceae and Cyanobacteriaceae were the main contributors to the dissimilarity. A significant difference between bacteria on nearshore and outer shelf reefs also existed on the molecular level ( FST = 0.008, p = 0.007 for all samples, 0.006, p = 0.022 when repeated sequences within libraries were removed). Thus, bacterial communities on carbonate sediments investigated were highly diverse and differences in community composition may provide important leads for the search for indicator species or communities for water quality differences.

  7. Non-random distribution and co-localization of purine/pyrimidine-encoded information and transcriptional regulatory domains.

    PubMed

    Povinelli, C M

    1992-01-01

    In order to detect sequence-based information predictive for the location of eukaryotic transcriptional regulatory domains, the frequencies and distributions of the 36 possible purine/pyrimidine reverse complement hexamer pairs was determined for test sets of real and random sequences. The distribution of one of the hexamer pairs (RRYYRR/YYRRYY, referred to as M1) was further examined in a larger set of sequences (> 32 genes, 230 kb). Predominant clusters of M1 and the locations of eukaryotic transcriptional regulatory domains were found to be associated and non-randomly distributed along the DNA consistent with a periodicity of approximately 1.2 kb. In the context of higher ordered chromatin this would align promoters, enhancers and the predominant clusters of M1 longitudinally along one face of a 30 nm fiber. Using only information about the distribution of the M1 motif, 50-70% of a sequence could be eliminated as being unlikely to contain transcriptional regulatory domains with an 87% recovery of the regulatory domains present.

  8. SSRscanner: a program for reporting distribution and exact location of simple sequence repeats.

    PubMed

    Anwar, Tamanna; Khan, Asad U

    2006-02-20

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. These repeated DNA sequences are found in both prokaryotes and eukaryotes. They are distributed almost at random throughout the genome, ranging from mononucleotide to trinucleotide repeats. They are also found at longer lengths (> 6 repeating units) of tracts. Most of the computer programs that find SSRs do not report its exact position. A computer program SSRscanner was written to find out distribution, frequency and exact location of each SSR in the genome. SSRscanner is user friendly. It can search repeats of any length and produce outputs with their exact position on chromosome and their frequency of occurrence in the sequence. This program has been written in PERL and is freely available for non-commercial users by request from the authors. Please contact the authors by E-mail: huzzi99@hotmail.com.

  9. Application of Quaternion in improving the quality of global sequence alignment scores for an ambiguous sequence target in Streptococcus pneumoniae DNA

    NASA Astrophysics Data System (ADS)

    Lestari, D.; Bustamam, A.; Novianti, T.; Ardaneswari, G.

    2017-07-01

    DNA sequence can be defined as a succession of letters, representing the order of nucleotides within DNA, using a permutation of four DNA base codes including adenine (A), guanine (G), cytosine (C), and thymine (T). The precise code of the sequences is determined using DNA sequencing methods and technologies, which have been developed since the 1970s and currently become highly developed, advanced and highly throughput sequencing technologies. So far, DNA sequencing has greatly accelerated biological and medical research and discovery. However, in some cases DNA sequencing could produce any ambiguous and not clear enough sequencing results that make them quite difficult to be determined whether these codes are A, T, G, or C. To solve these problems, in this study we can introduce other representation of DNA codes namely Quaternion Q = (PA, PT, PG, PC), where PA, PT, PG, PC are the probability of A, T, G, C bases that could appear in Q and PA + PT + PG + PC = 1. Furthermore, using Quaternion representations we are able to construct the improved scoring matrix for global sequence alignment processes, by applying a dot product method. Moreover, this scoring matrix produces better and higher quality of the match and mismatch score between two DNA base codes. In implementation, we applied the Needleman-Wunsch global sequence alignment algorithm using Octave, to analyze our target sequence which contains some ambiguous sequence data. The subject sequences are the DNA sequences of Streptococcus pneumoniae families obtained from the Genebank, meanwhile the target DNA sequence are received from our collaborator database. As the results we found the Quaternion representations improve the quality of the sequence alignment score and we can conclude that DNA sequence target has maximum similarity with Streptococcus pneumoniae.

  10. Context based computational analysis and characterization of ARS consensus sequences (ACS) of Saccharomyces cerevisiae genome.

    PubMed

    Singh, Vinod Kumar; Krishnamachari, Annangarachari

    2016-09-01

    Genome-wide experimental studies in Saccharomyces cerevisiae reveal that autonomous replicating sequence (ARS) requires an essential consensus sequence (ACS) for replication activity. Computational studies identified thousands of ACS like patterns in the genome. However, only a few hundreds of these sites act as replicating sites and the rest are considered as dormant or evolving sites. In a bid to understand the sequence makeup of replication sites, a content and context-based analysis was performed on a set of replicating ACS sequences that binds to origin-recognition complex (ORC) denoted as ORC-ACS and non-replicating ACS sequences (nrACS), that are not bound by ORC. In this study, DNA properties such as base composition, correlation, sequence dependent thermodynamic and DNA structural profiles, and their positions have been considered for characterizing ORC-ACS and nrACS. Analysis reveals that ORC-ACS depict marked differences in nucleotide composition and context features in its vicinity compared to nrACS. Interestingly, an A-rich motif was also discovered in ORC-ACS sequences within its nucleosome-free region. Profound changes in the conformational features, such as DNA helical twist, inclination angle and stacking energy between ORC-ACS and nrACS were observed. Distribution of ACS motifs in the non-coding segments points to the locations of ORC-ACS which are found far away from the adjacent gene start position compared to nrACS thereby enabling an accessible environment for ORC-proteins. Our attempt is novel in considering the contextual view of ACS and its flanking region along with nucleosome positioning in the S. cerevisiae genome and may be useful for any computational prediction scheme.

  11. TIA: algorithms for development of identity-linked SNP islands for analysis by massively parallel DNA sequencing.

    PubMed

    Farris, M Heath; Scott, Andrew R; Texter, Pamela A; Bartlett, Marta; Coleman, Patricia; Masters, David

    2018-04-11

    Single nucleotide polymorphisms (SNPs) located within the human genome have been shown to have utility as markers of identity in the differentiation of DNA from individual contributors. Massively parallel DNA sequencing (MPS) technologies and human genome SNP databases allow for the design of suites of identity-linked target regions, amenable to sequencing in a multiplexed and massively parallel manner. Therefore, tools are needed for leveraging the genotypic information found within SNP databases for the discovery of genomic targets that can be evaluated on MPS platforms. The SNP island target identification algorithm (TIA) was developed as a user-tunable system to leverage SNP information within databases. Using data within the 1000 Genomes Project SNP database, human genome regions were identified that contain globally ubiquitous identity-linked SNPs and that were responsive to targeted resequencing on MPS platforms. Algorithmic filters were used to exclude target regions that did not conform to user-tunable SNP island target characteristics. To validate the accuracy of TIA for discovering these identity-linked SNP islands within the human genome, SNP island target regions were amplified from 70 contributor genomic DNA samples using the polymerase chain reaction. Multiplexed amplicons were sequenced using the Illumina MiSeq platform, and the resulting sequences were analyzed for SNP variations. 166 putative identity-linked SNPs were targeted in the identified genomic regions. Of the 309 SNPs that provided discerning power across individual SNP profiles, 74 previously undefined SNPs were identified during evaluation of targets from individual genomes. Overall, DNA samples of 70 individuals were uniquely identified using a subset of the suite of identity-linked SNP islands. TIA offers a tunable genome search tool for the discovery of targeted genomic regions that are scalable in the population frequency and numbers of SNPs contained within the SNP island regions. It also allows the definition of sequence length and sequence variability of the target region as well as the less variable flanking regions for tailoring to MPS platforms. As shown in this study, TIA can be used to discover identity-linked SNP islands within the human genome, useful for differentiating individuals by targeted resequencing on MPS technologies.

  12. Genetic analysis of Fasciola isolates from cattle in Korea based on second internal transcribed spacer (ITS-2) sequence of nuclear ribosomal DNA.

    PubMed

    Choe, Se-Eun; Nguyen, Thuy Thi-Dieu; Kang, Tae-Gyu; Kweon, Chang-Hee; Kang, Seung-Won

    2011-09-01

    Nuclear ribosomal DNA sequence of the second internal transcribed spacer (ITS-2) has been used efficiently to identify the liver fluke species collected from different hosts and various geographic regions. ITS-2 sequences of 19 Fasciola samples collected from Korean native cattle were determined and compared. Sequence comparison including ITS-2 sequences of isolates from this study and reference sequences from Fasciola hepatica and Fasciola gigantica and intermediate Fasciola in Genbank revealed seven identical variable sites of investigated isolates. Among 19 samples, 12 individuals had ITS-2 sequences completely identical to that of pure F. hepatica, five possessed the sequences identical to F. gigantica type, whereas two shared the sequence of both F. hepatica and F. gigantica. No variations in length and nucleotide composition of ITS-2 sequence were observed within isolates that belonged to F. hepatica or F. gigantica. At the position of 218, five Fasciola containing a single-base substitution (C>T) formed a distinct branch inside the F. gigantica-type group which was similar to those of Asian-origin isolates. The phylogenetic tree of the Fasciola spp. based on complete ITS-2 sequences from this study and other representative isolates in different locations clearly showed that pure F. hepatica, F. gigantica type and intermediate Fasciola were observed. The result also provided additional genetic evidence for the existence of three forms of Fasciola isolated from native cattle in Korea by genetic approach using ITS-2 sequence.

  13. The TTSMI database: a catalog of triplex target DNA sites associated with genes and regulatory elements in the human genome.

    PubMed

    Jenjaroenpun, Piroon; Chew, Chee Siang; Yong, Tai Pang; Choowongkomon, Kiattawee; Thammasorn, Wimada; Kuznetsov, Vladimir A

    2015-01-01

    A triplex target DNA site (TTS), a stretch of DNA that is composed of polypurines, is able to form a triple-helix (triplex) structure with triplex-forming oligonucleotides (TFOs) and is able to influence the site-specific modulation of gene expression and/or the modification of genomic DNA. The co-localization of a genomic TTS with gene regulatory signals and functional genome structures suggests that TFOs could potentially be exploited in antigene strategies for the therapy of cancers and other genetic diseases. Here, we present the TTS Mapping and Integration (TTSMI; http://ttsmi.bii.a-star.edu.sg) database, which provides a catalog of unique TTS locations in the human genome and tools for analyzing the co-localization of TTSs with genomic regulatory sequences and signals that were identified using next-generation sequencing techniques and/or predicted by computational models. TTSMI was designed as a user-friendly tool that facilitates (i) fast searching/filtering of TTSs using several search terms and criteria associated with sequence stability and specificity, (ii) interactive filtering of TTSs that co-localize with gene regulatory signals and non-B DNA structures, (iii) exploration of dynamic combinations of the biological signals of specific TTSs and (iv) visualization of a TTS simultaneously with diverse annotation tracks via the UCSC genome browser. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Identification by Subtractive Hybridization of a Novel Insertion Sequence Specific for Virulent Strains of Porphyromonas gingivalis

    PubMed Central

    Sawada, Koichi; Kokeguchi, Susumu; Hongyo, Hiroshi; Sawada, Satoko; Miyamoto, Manabu; Maeda, Hiroshi; Nishimura, Fusanori; Takashiba, Shogo; Murayama, Yoji

    1999-01-01

    Subtractive hybridization was employed to isolate specific genes from virulent Porphyromonas gingivalis strains that are possibly related to abscess formation. The genomic DNA from the virulent strain P. gingivalis W83 was subtracted with DNA from the avirulent strain ATCC 33277. Three clones unique to strain W83 were isolated and sequenced. The cloned DNA fragments were 885, 369, and 132 bp and had slight homology with only Bacillus stearothermophilus IS5377, which is a putative transposase. The regions flanking the cloned DNA fragments were isolated and sequenced, and the gene structure around the clones was revealed. These three clones were located side-by-side in a gene reported as an outer membrane protein. The three clones interrupt the open reading frame of the outer membrane protein gene. This inserted DNA, consisting of three isolated clones, was designated IS1598, which was 1,396 bp (i.e., a 1,158-bp open reading frame) in length and was flanked by 16-bp terminal inverted repeats and a 9-bp duplicated target sequence. IS1598 was detected in P. gingivalis W83, W50, and FDC 381 by Southern hybridization. All three P. gingivalis strains have been shown to possess abscess-forming ability in animal models. However, IS1598 was not detected in avirulent strains of P. gingivalis, including ATCC 33277. The IS1598 may interrupt the synthesis of the outer membrane protein, resulting in changes in the structure of the bacterial outer membrane. The IS1598 isolated in this study is a novel insertion element which might be a specific marker for virulent P. gingivalis strains. PMID:10531208

  15. Investigating the potential use of environmental DNA (eDNA) for genetic monitoring of marine mammals.

    PubMed

    Foote, Andrew D; Thomsen, Philip Francis; Sveegaard, Signe; Wahlberg, Magnus; Kielgast, Jos; Kyhn, Line A; Salling, Andreas B; Galatius, Anders; Orlando, Ludovic; Gilbert, M Thomas P

    2012-01-01

    The exploitation of non-invasive samples has been widely used in genetic monitoring of terrestrial species. In aquatic ecosystems, non-invasive samples such as feces, shed hair or skin, are less accessible. However, the use of environmental DNA (eDNA) has recently been shown to be an effective tool for genetic monitoring of species presence in freshwater ecosystems. Detecting species in the marine environment using eDNA potentially offers a greater challenge due to the greater dilution, amount of mixing and salinity compared with most freshwater ecosystems. To determine the potential use of eDNA for genetic monitoring we used specific primers that amplify short mitochondrial DNA sequences to detect the presence of a marine mammal, the harbor porpoise, Phocoena phocoena, in a controlled environment and in natural marine locations. The reliability of the genetic detections was investigated by comparing with detections of harbor porpoise echolocation clicks by static acoustic monitoring devices. While we were able to consistently genetically detect the target species under controlled conditions, the results from natural locations were less consistent and detection by eDNA was less successful than acoustic detections. However, at one site we detected long-finned pilot whale, Globicephala melas, a species rarely sighted in the Baltic. Therefore, with optimization aimed towards processing larger volumes of seawater this method has the potential to compliment current visual and acoustic methods of species detection of marine mammals.

  16. Random whole metagenomic sequencing for forensic discrimination of soils.

    PubMed

    Khodakova, Anastasia S; Smith, Renee J; Burgoyne, Leigh; Abarno, Damien; Linacre, Adrian

    2014-01-01

    Here we assess the ability of random whole metagenomic sequencing approaches to discriminate between similar soils from two geographically distinct urban sites for application in forensic science. Repeat samples from two parklands in residential areas separated by approximately 3 km were collected and the DNA was extracted. Shotgun, whole genome amplification (WGA) and single arbitrarily primed DNA amplification (AP-PCR) based sequencing techniques were then used to generate soil metagenomic profiles. Full and subsampled metagenomic datasets were then annotated against M5NR/M5RNA (taxonomic classification) and SEED Subsystems (metabolic classification) databases. Further comparative analyses were performed using a number of statistical tools including: hierarchical agglomerative clustering (CLUSTER); similarity profile analysis (SIMPROF); non-metric multidimensional scaling (NMDS); and canonical analysis of principal coordinates (CAP) at all major levels of taxonomic and metabolic classification. Our data showed that shotgun and WGA-based approaches generated highly similar metagenomic profiles for the soil samples such that the soil samples could not be distinguished accurately. An AP-PCR based approach was shown to be successful at obtaining reproducible site-specific metagenomic DNA profiles, which in turn were employed for successful discrimination of visually similar soil samples collected from two different locations.

  17. Annotation of Differentially Expressed Genes in the Somatic Embryogenesis of Musa and Their Location in the Banana Genome

    PubMed Central

    Maldonado-Borges, Josefina Ines; Ku-Cauich, José Roberto; Escobedo-GraciaMedrano, Rosa Maria

    2013-01-01

    Analysis of cDNA-AFLP was used to study the genes expressed in zygotic and somatic embryogenesis of Musa acuminata Colla ssp. malaccensis, and a comparison was made between their differential transcribed fragments (TDFs) and the sequenced genome of the double haploid- (DH-) Pahang of the malaccensis subspecies that is available in the network. A total of 253 transcript-derived fragments (TDFs) were detected with apparent size of 100–4000 bp using 5 pairs of AFLP primers, of which 21 were differentially expressed during the different stages of banana embryogenesis; 15 of the sequences have matched DH-Pahang chromosomes, with 7 of them being homologous to gene sequences encoding either known or putative protein domains of higher plants. Four TDF sequences were located in all Musa chromosomes, while the rest were located in one or two chromosomes. Their putative individual function is briefly reviewed based on published information, and the potential roles of these genes in embryo development are discussed. Thus the availability of the genome of Musa and the information of TDFs sequences presented here opens new possibilities for an in-depth study of the molecular and biochemical research of zygotic and somatic embryogenesis of Musa. PMID:24027442

  18. Large-Scale Concatenation cDNA Sequencing

    PubMed Central

    Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.

    1997-01-01

    A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174

  19. Synthesis of DNA

    DOEpatents

    Mariella, Jr., Raymond P.

    2008-11-18

    A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

  20. Sequences required for transcription termination at the intrinsic lambdatI terminator.

    PubMed

    Martínez-Trujillo, Miguel; Sánchez-Trujillo, Alejandra; Ceja, Víctor; Avila-Moreno, Federico; Bermúdez-Cruz, Rosa María; Court, Donald; Montañez, Cecilia

    2010-02-01

    The lambdatI terminator is located approximately 280 bp beyond the lambdaint gene, and it has a typical structure of an intrinsic terminator. To identify sequences required for lambdatI transcription termination a set of deletion mutants were generated, either from the 5' or the 3' end onto the lambdatI region. The termination efficiency was determined by measuring galactokinase (galK) levels by Northern blot assays and by in vitro transcription termination. The importance of the uridines and the stability of the stem structure in the termination were demonstrated. The nontranscribed DNA beyond the 3' end also affects termination. Additionally, sequences upstream have a small effect on transcription termination. The in vivo RNA termination sites at lambdatI were determined by S1 mapping and were located at 8 different positions. Processing of transcripts from the 3' end confirmed the importance of the hairpin stem in protection against exonuclease.

  1. Chromosomal location and gene paucity of the male specific region on papaya Y chromosome.

    PubMed

    Yu, Qingyi; Hou, Shaobin; Hobza, Roman; Feltus, F Alex; Wang, Xiue; Jin, Weiwei; Skelton, Rachel L; Blas, Andrea; Lemke, Cornelia; Saw, Jimmy H; Moore, Paul H; Alam, Maqsudul; Jiang, Jiming; Paterson, Andrew H; Vyskot, Boris; Ming, Ray

    2007-08-01

    Sex chromosomes in flowering plants evolved recently and many of them remain homomorphic, including those in papaya. We investigated the chromosomal location of papaya's small male specific region of the hermaphrodite Y (Yh) chromosome (MSY) and its genomic features. We conducted chromosome fluorescence in situ hybridization mapping of Yh-specific bacterial artificial chromosomes (BACs) and placed the MSY near the centromere of the papaya Y chromosome. Then we sequenced five MSY BACs to examine the genomic features of this specialized region, which resulted in the largest collection of contiguous genomic DNA sequences of a Y chromosome in flowering plants. Extreme gene paucity was observed in the papaya MSY with no functional gene identified in 715 kb MSY sequences. A high density of retroelements and local sequence duplications were detected in the MSY that is suppressed for recombination. Location of the papaya MSY near the centromere might have provided recombination suppression and fostered paucity of genes in the male specific region of the Y chromosome. Our findings provide critical information for deciphering the sex chromosomes in papaya and reference information for comparative studies of other sex chromosomes in animals and plants.

  2. Optical mapping reveals a large genetic inversion between two methicillin-resistant Staphylococcus aureus strains.

    PubMed

    Shukla, Sanjay K; Kislow, Jennifer; Briska, Adam; Henkhaus, John; Dykes, Colin

    2009-09-01

    Staphylococcus aureus is a highly versatile and evolving bacterium of great clinical importance. S. aureus can evolve by acquiring single nucleotide polymorphisms and mobile genetic elements and by recombination events. Identification and location of novel genomic elements in a bacterial genome are not straightforward, unless the whole genome is sequenced. Optical mapping is a new tool that creates a high-resolution, in situ ordered restriction map of a bacterial genome. These maps can be used to determine genomic organization and perform comparative genomics to identify genomic rearrangements, such as insertions, deletions, duplications, and inversions, compared to an in silico (virtual) restriction map of a known genome sequence. Using this technology, we report here the identification, approximate location, and characterization of a genetic inversion of approximately 500 kb of a DNA element between the NRS387 (USA800) and FPR3757 (USA300) strains. The presence of the inversion and location of its junction sites were confirmed by site-specific PCR and sequencing. At both the left and right junction sites in NRS387, an IS1181 element and a 73-bp sequence were identified as inverted repeats, which could explain the possible mechanism of the inversion event.

  3. TRF1 and TRF2 use different mechanisms to find telomeric DNA but share a novel mechanism to search for protein partners at telomeres.

    PubMed

    Lin, Jiangguo; Countryman, Preston; Buncher, Noah; Kaur, Parminder; E, Longjiang; Zhang, Yiyun; Gibson, Greg; You, Changjiang; Watkins, Simon C; Piehler, Jacob; Opresko, Patricia L; Kad, Neil M; Wang, Hong

    2014-02-01

    Human telomeres are maintained by the shelterin protein complex in which TRF1 and TRF2 bind directly to duplex telomeric DNA. How these proteins find telomeric sequences among a genome of billions of base pairs and how they find protein partners to form the shelterin complex remains uncertain. Using single-molecule fluorescence imaging of quantum dot-labeled TRF1 and TRF2, we study how these proteins locate TTAGGG repeats on DNA tightropes. By virtue of its basic domain TRF2 performs an extensive 1D search on nontelomeric DNA, whereas TRF1's 1D search is limited. Unlike the stable and static associations observed for other proteins at specific binding sites, TRF proteins possess reduced binding stability marked by transient binding (∼ 9-17 s) and slow 1D diffusion on specific telomeric regions. These slow diffusion constants yield activation energy barriers to sliding ∼ 2.8-3.6 κ(B)T greater than those for nontelomeric DNA. We propose that the TRF proteins use 1D sliding to find protein partners and assemble the shelterin complex, which in turn stabilizes the interaction with specific telomeric DNA. This 'tag-team proofreading' represents a more general mechanism to ensure a specific set of proteins interact with each other on long repetitive specific DNA sequences without requiring external energy sources.

  4. Phylogeography and connectivity of molluscan parasites: Perkinsus spp. in Panama and beyond.

    PubMed

    Pagenkopp Lohan, Katrina M; Hill-Spanik, Kristina M; Torchin, Mark E; Fleischer, Robert C; Carnegie, Ryan B; Reece, Kimberly S; Ruiz, Gregory M

    2018-02-01

    Panama is a major hub for commercial shipping between two oceans, making it an ideal location to examine parasite biogeography, potential invasions, and the spread of infectious agents. Our goals were to (i) characterise the diversity and genetic connectivity of Perkinsus spp. haplotypes across the Panamanian Isthmus and (ii) combine these data with sequences from around the world to evaluate the current phylogeography and genetic connectivity of these widespread molluscan parasites. We collected 752 bivalves from 12 locations along the coast of Panama including locations around the Bocas del Toro archipelago and the Caribbean and Pacific entrances to the Panama Canal, from December 2012 to February 2013. We used molecular genetic methods to screen for Perkinsus spp. and obtained internal transcribed spacer region (ITS) ribosomal DNA (rDNA) sequences for all positive samples. Our sequence data were used to evaluate regional haplotype diversity and distribution across both coasts of Panama, and were then combined with publicly available sequences to create global haplotype networks. We found 26 ITS haplotypes from four Perkinsus spp. (1-12 haplotypes per species) in Panama. Perkinsus beihaiensis haplotypes had the highest genetic diversity, were the most regionally widespread, and were associated with the greatest number of hosts. On a global scale, network analyses demonstrated that some haplotypes found in Panama were cosmopolitan (Perkinsus chesapeaki, Perkinsus marinus), while others were more geographically restricted (Perkinsus olseni, P. beihaiensis), indicating different levels of genetic connectivity and dispersal. We found some Perkinsus haplotypes were shared across the Isthmus of Panama and several regions around the world, including across ocean basins. We also found that haplotype diversity is currently underestimated and directly related to the number of sequences. Nevertheless, our results demonstrate long-range dispersal and global connectivity for many haplotypes, suggesting that dispersal through shipping probably contributes to these biogeographical patterns. Published by Elsevier Ltd.

  5. The genomic organization of a human creatine transporter (CRTR) gene located in Xq28

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sandoval, N.; Bauer, D.; Brenner, V.

    1996-07-15

    During the course of a large-scale sequencing project in Xq28, a human creatine transporter (CRTR) gene was discovered. The gene is located approximately 36 kb centromeric to ALD. The gene contains 13 exons and spans about 8.5 kb of genomic DNA. Since the creatine transporter has a prominent function in muscular physiology, it is a candidate gene for Barth syndrome and infantile cardiomyopathy mapped to Xq28. 19 refs., 1 fig., 1 tab.

  6. Nanopore Technology: A Simple, Inexpensive, Futuristic Technology for DNA Sequencing.

    PubMed

    Gupta, P D

    2016-10-01

    In health care, importance of DNA sequencing has been fully established. Sanger's Capillary Electrophoresis DNA sequencing methodology is time consuming, cumbersome, hence become more expensive. Lately, because of its versatility DNA sequencing became house hold name, and therefore, there is an urgent need of simple, fast, inexpensive, DNA sequencing technology. In the beginning of this century efforts were made, and Nanopore DNA sequencing technology was developed; still it is infancy, nevertheless, it is the futuristic technology.

  7. The genome-wide DNA sequence specificity of the anti-tumour drug bleomycin in human cells.

    PubMed

    Murray, Vincent; Chen, Jon K; Tanaka, Mark M

    2016-07-01

    The cancer chemotherapeutic agent, bleomycin, cleaves DNA at specific sites. For the first time, the genome-wide DNA sequence specificity of bleomycin breakage was determined in human cells. Utilising Illumina next-generation DNA sequencing techniques, over 200 million bleomycin cleavage sites were examined to elucidate the bleomycin genome-wide DNA selectivity. The genome-wide bleomycin cleavage data were analysed by four different methods to determine the cellular DNA sequence specificity of bleomycin strand breakage. For the most highly cleaved DNA sequences, the preferred site of bleomycin breakage was at 5'-GT* dinucleotide sequences (where the asterisk indicates the bleomycin cleavage site), with lesser cleavage at 5'-GC* dinucleotides. This investigation also determined longer bleomycin cleavage sequences, with preferred cleavage at 5'-GT*A and 5'- TGT* trinucleotide sequences, and 5'-TGT*A tetranucleotides. For cellular DNA, the hexanucleotide DNA sequence 5'-RTGT*AY (where R is a purine and Y is a pyrimidine) was the most highly cleaved DNA sequence. It was striking that alternating purine-pyrimidine sequences were highly cleaved by bleomycin. The highest intensity cleavage sites in cellular and purified DNA were very similar although there were some minor differences. Statistical nucleotide frequency analysis indicated a G nucleotide was present at the -3 position (relative to the cleavage site) in cellular DNA but was absent in purified DNA.

  8. Microhomology-mediated end joining induces hypermutagenesis at breakpoint junctions

    PubMed Central

    Li, Fuyang; Villarreal, Diana; Shim, Jae Hoon; Myung, Kyungjae; Shim, Eun Yong; Lee, Sang Eun

    2017-01-01

    Microhomology (MH) flanking a DNA double-strand break (DSB) drives chromosomal rearrangements but its role in mutagenesis has not yet been analyzed. Here we determined the mutation frequency of a URA3 reporter gene placed at multiple locations distal to a DSB, which is flanked by different sizes (15-, 18-, or 203-bp) of direct repeat sequences for efficient repair in budding yeast. Induction of a DSB accumulates mutations in the reporter gene situated up to 14-kb distal to the 15-bp MH, but more modestly to those carrying 18- and 203-bp or no homology. Increased mutagenesis in MH-mediated end joining (MMEJ) appears coupled to its slower repair kinetics and the extensive resection occurring at flanking DNA. Chromosomal translocations via MMEJ also elevate mutagenesis of the flanking DNA sequences 7.1 kb distal to the breakpoint junction as compared to those without MH. The results suggest that MMEJ could destabilize genomes by triggering structural alterations and increasing mutation burden. PMID:28419093

  9. A close relative of the nuclear, chromosomal high-mobility group protein HMG1 in yeast mitochondria.

    PubMed Central

    Diffley, J F; Stillman, B

    1991-01-01

    ABF2 (ARS-binding factor 2), a small, basic DNA-binding protein that binds specifically to the autonomously replicating sequence ARS1, is located primarily in the mitochondria of the yeast Saccharomyces cerevisiae. The abundance of ABF2 and the phenotype of abf2- null mutants argue that this protein plays a key role in the structure, maintenance, and expression of the yeast mitochondrial genome. The predicted amino acid sequence of ABF2 is closely related to the high-mobility group proteins HMG1 and HMG2 from vertebrate cell nuclei and to several other DNA-binding proteins. Additionally, ABF2 and the other HMG-related proteins are related to a globular domain from the heat shock protein hsp70 family. ABF2 interacts with DNA both nonspecifically and in a specific manner within regulatory regions, suggesting a mechanism whereby it may aid in compacting the mitochondrial genome without interfering with expression. Images PMID:1881919

  10. Genome-wide methylation analysis identified sexually dimorphic methylated regions in hybrid tilapia

    PubMed Central

    Wan, Zi Yi; Xia, Jun Hong; Lin, Grace; Wang, Le; Lin, Valerie C. L.; Yue, Gen Hua

    2016-01-01

    Sexual dimorphism is an interesting biological phenomenon. Previous studies showed that DNA methylation might play a role in sexual dimorphism. However, the overall picture of the genome-wide methylation landscape in sexually dimorphic species remains unclear. We analyzed the DNA methylation landscape and transcriptome in hybrid tilapia (Oreochromis spp.) using whole genome bisulfite sequencing (WGBS) and RNA-sequencing (RNA-seq). We found 4,757 sexually dimorphic differentially methylated regions (DMRs), with significant clusters of DMRs located on chromosomal regions associated with sex determination. CpG methylation in promoter regions was negatively correlated with the gene expression level. MAPK/ERK pathway was upregulated in male tilapia. We also inferred active cis-regulatory regions (ACRs) in skeletal muscle tissues from WGBS datasets, revealing sexually dimorphic cis-regulatory regions. These results suggest that DNA methylation contribute to sex-specific phenotypes and serve as resources for further investigation to analyze the functions of these regions and their contributions towards sexual dimorphisms. PMID:27782217

  11. Mapping genes to human chromosome 19

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Connolly, Sarah

    1996-05-01

    For this project, 22 Expressed Sequence Tags (ESTs) were fine mapped to regions of human chromosome 19. An EST is a short DNA sequence that occurs once in the genome and corresponds to a single expressed gene. {sup 32}P-radiolabeled probes were made by polymerase chain reaction for each EST and hybridized to filters containing a chromosome 19-specific cosmid library. The location of the ESTs on the chromosome was determined by the location of the ordered cosmid to which the EST hybridized. Of the 22 ESTs that were sublocalized, 6 correspond to known genes, and 16 correspond to anonymous genes. Thesemore » localized ESTs may serve as potential candidates for disease genes, as well as markers for future physical mapping.« less

  12. Uncovering the Ancestry of B Chromosomes in Moenkhausia sanctaefilomenae (Teleostei, Characidae)

    PubMed Central

    Utsunomia, Ricardo; Silva, Duílio Mazzoni Zerbinato de Andrade; Ruiz-Ruano, Francisco J.; Araya-Jaime, Cristian; Pansonato-Alves, José Carlos; Scacchetti, Priscilla Cardim; Hashimoto, Diogo Teruo; Oliveira, Claudio; Trifonov, Vladmir A.; Porto-Foresti, Fábio; Camacho, Juan Pedro M.; Foresti, Fausto

    2016-01-01

    B chromosomes constitute a heterogeneous mixture of genomic parasites that are sometimes derived intraspecifically from the standard genome of the host species, but result from interspecific hybridization in other cases. The mode of origin determines the DNA content, with the B chromosomes showing high similarity with the A genome in the first case, but presenting higher similarity with a different species in the second. The characid fish Moenkhausia sanctaefilomenae harbours highly invasive B chromosomes, which are present in all populations analyzed to date in the Parana and Tietê rivers. To investigate the origin of these B chromosomes, we analyzed two natural populations: one carrying B chromosomes and the other lacking them, using a combination of molecular cytogenetic techniques, nucleotide sequence analysis and high-throughput sequencing (Illumina HiSeq2000). Our results showed that i) B chromosomes have not yet reached the Paranapanema River basin; ii) B chromosomes are mitotically unstable; iii) there are two types of B chromosomes, the most frequent of which is lightly C-banded (similar to euchromatin in A chromosomes) (B1), while the other is darkly C-banded (heterochromatin-like) (B2); iv) the two B types contain the same tandem repeat DNA sequences (18S ribosomal DNA, H3 histone genes, MS3 and MS7 satellite DNA), with a higher content of 18S rDNA in the heterochromatic variant; v) all of these repetitive DNAs are present together only in the paracentromeric region of autosome pair no. 6, suggesting that the B chromosomes are derived from this A chromosome; vi) the two B chromosome variants show MS3 sequences that are highly divergent from each other and from the 0B genome, although the B2-derived sequences exhibit higher similarity with the 0B genome (this suggests an independent origin of the two B variants, with the less frequent, B2 type presumably being younger); and vii) the dN/dS ratio for the H3.2 histone gene is almost 4–6 times higher for B chromosomes than for A chromosome sequences, suggesting that purifying selection is relaxed for the DNA sequences located on the B chromosomes, presumably because they are mostly inactive. PMID:26934481

  13. MHC class II B diversity in blue tits: a preliminary study.

    PubMed

    Aguilar, Juan Rivero-de; Schut, Elske; Merino, Santiago; Martínez, Javier; Komdeur, Jan; Westerdahl, Helena

    2013-07-01

    In this study, we partly characterize major histocompatibility complex (MHC) class II B in the blue tit (Cyanistes caeruleus). A total of 22 individuals from three different European locations: Spain, The Netherlands, and Sweden were screened for MHC allelic diversity. The MHC genes were investigated using both PCR-based methods and unamplified genomic DNA with restriction fragment length polymorphism (RFLP) and southern blots. A total of 13 different exon 2 sequences were obtained independently from DNA and/or RNA, thus confirming gene transcription and likely functionality of the genes. Nine out of 13 alleles were found in more than one country, and two alleles appeared in all countries. Positive selection was detected in the region coding for the peptide binding region (PBR). A maximum of three alleles per individual was detected by sequencing and the RFLP pattern consisted of 4-7 fragments, indicating a minimum number of 2-4 loci per individual. A phylogenetic analysis, demonstrated that the blue tit sequences are divergent compared to sequences from other passerines resembling a different MHC lineage than those possessed by most passerines studied to date.

  14. MHC class II B diversity in blue tits: a preliminary study

    PubMed Central

    Aguilar, Juan Rivero-de; Schut, Elske; Merino, Santiago; Martínez, Javier; Komdeur, Jan; Westerdahl, Helena

    2013-01-01

    In this study, we partly characterize major histocompatibility complex (MHC) class II B in the blue tit (Cyanistes caeruleus). A total of 22 individuals from three different European locations: Spain, The Netherlands, and Sweden were screened for MHC allelic diversity. The MHC genes were investigated using both PCR-based methods and unamplified genomic DNA with restriction fragment length polymorphism (RFLP) and southern blots. A total of 13 different exon 2 sequences were obtained independently from DNA and/or RNA, thus confirming gene transcription and likely functionality of the genes. Nine out of 13 alleles were found in more than one country, and two alleles appeared in all countries. Positive selection was detected in the region coding for the peptide binding region (PBR). A maximum of three alleles per individual was detected by sequencing and the RFLP pattern consisted of 4–7 fragments, indicating a minimum number of 2–4 loci per individual. A phylogenetic analysis, demonstrated that the blue tit sequences are divergent compared to sequences from other passerines resembling a different MHC lineage than those possessed by most passerines studied to date. PMID:23919136

  15. Variations in Nuclear Localization Strategies Among Pol X Family Enzymes.

    PubMed

    Kirby, Thomas W; Pedersen, Lars C; Gabel, Scott A; Gassman, Natalie R; London, Robert E

    2018-06-22

    Despite the essential roles of pol X family enzymes in DNA repair, information about the structural basis of their nuclear import is limited. Recent studies revealed the unexpected presence of a functional NLS in DNA polymerase β, indicating the importance of active nuclear targeting, even for enzymes likely to leak into and out of the nucleus. The current studies further explore the active nuclear transport of these enzymes by identifying and structurally characterizing the functional NLS sequences in the three remaining human pol X enzymes: terminal deoxynucleotidyl transferase (TdT), DNA polymerase μ (pol μ), and DNA polymerase λ (pol λ). NLS identifications are based on Importin α (Impα) binding affinity determined by fluorescence polarization of fluorescein-labeled NLS peptides, X-ray crystallographic analysis of the Impα∆IBB•NLS complexes, and fluorescence-based subcellular localization studies. All three polymerases use NLS sequences located near their N-terminus; TdT and pol μ utilize monopartite NLS sequences, while pol λ utilizes a bipartite sequence, unique among the pol X family members. The pol μ NLS has relatively weak measured affinity for Impα, due in part to its proximity to the N-terminus that limits non-specific interactions of flanking residues preceding the NLS. However, this effect is partially mitigated by an N-terminal sequence unsupportive of Met1 removal by methionine aminopeptidase, leading to a 3-fold increase in affinity when the N-terminal methionine is present. Nuclear targeting is unique to each pol X family enzyme with variations dependent on the structure and unique functional role of each polymerase. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  16. Genome-wide DNA methylation patterns in wild samples of two morphotypes of threespine stickleback (Gasterosteus aculeatus).

    PubMed

    Smith, Gilbert; Smith, Carl; Kenny, John G; Chaudhuri, Roy R; Ritchie, Michael G

    2015-04-01

    Epigenetic marks such as DNA methylation play important biological roles in gene expression regulation and cellular differentiation during development. To examine whether DNA methylation patterns are potentially associated with naturally occurring phenotypic differences, we examined genome-wide DNA methylation within Gasterosteus aculeatus, using reduced representation bisulfite sequencing. First, we identified highly methylated regions of the stickleback genome, finding such regions to be located predominantly within genes, and associated with genes functioning in metabolism and biosynthetic processes, cell adhesion, signaling pathways, and blood vessel development. Next, we identified putative differentially methylated regions (DMRs) of the genome between complete and low lateral plate morphs of G. aculeatus. We detected 77 DMRs that were mainly located in intergenic regions. Annotations of genes associated with these DMRs revealed potential functions in a number of known divergent adaptive phenotypes between G. aculeatus ecotypes, including cardiovascular development, growth, and neuromuscular development. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. Interstitial telomeric repeats are not preferentially involved in radiation-induced chromosome aberrations in human cells.

    PubMed

    Desmaze, C; Pirzio, L M; Blaise, R; Mondello, C; Giulotto, E; Murnane, J P; Sabatier, L

    2004-01-01

    Telomeric repeat sequences, located at the end of eukaryotic chromosomes, have been detected at intrachromosomal locations in many species. Large blocks of telomeric sequences are located near the centromeres in hamster cells, and have been reported to break spontaneously or after exposure to ionizing radiation, leading to chromosome aberrations. In human cells, interstitial telomeric sequences (ITS) can be composed of short tracts of telomeric repeats (less than twenty), or of longer stretches of exact and degenerated hexanucleotides, mainly localized at subtelomeres. In this paper, we analyzed the radiation sensitivity of a naturally occurring short ITS localized in 2q31 and we found that this region is not a hot spot of radiation-induced chromosome breaks. We then selected a human cell line in which approximately 800 bp of telomeric DNA had been introduced by transfection into an internal euchromatic chromosomal region in chromosome 4q. In parallel, a cell line containing the plasmid without telomeric sequences was also analyzed. Both regions containing the transfected plasmids showed a higher frequency of radiation-induced breaks than expected, indicating that the instability of the regions containing the transfected sequences is not due to the presence of telomeric sequences. Taken together, our data show that ITS themselves do not enhance the formation of radiation-induced chromosome rearrangements in these human cell lines. Copyright 2003 S. Karger AG, Basel

  18. Extensive gene conversion at the PMS2 DNA mismatch repair locus.

    PubMed

    Hayward, Bruce E; De Vos, Michel; Valleley, Elizabeth M A; Charlton, Ruth S; Taylor, Graham R; Sheridan, Eamonn; Bonthron, David T

    2007-05-01

    Mutations of the PMS2 DNA repair gene predispose to a characteristic range of malignancies, with either childhood onset (when both alleles are mutated) or a partially penetrant adult onset (if heterozygous). These mutations have been difficult to detect, due to interference from a family of pseudogenes located on chromosome 7. One of these, the PMS2CL pseudogene, lies within a 100-kb inverted duplication (inv dup), 700 kb centromeric to PMS2 itself on 7p22. Here, we show that the reference genomic sequences cannot be relied upon to distinguish PMS2 from PMS2CL, because of sequence transfer between the two loci. The 7p22 inv dup occurred prior to the divergence of modern ape species (15 million years ago [Mya]), but has undergone extensive sequence homogenization. This process appears to be ongoing, since there is considerable allelic diversity within the duplicated region, much of it derived from sequence exchange between PMS2 and PMS2CL. This sequence diversity can result in both false-positive and false-negative mutation analysis at this locus. Great caution is still needed in the design and interpretation of PMS2 mutation screens. 2007 Wiley-Liss, Inc.

  19. Sequence and Structure Dependent DNA-DNA Interactions

    NASA Astrophysics Data System (ADS)

    Kopchick, Benjamin; Qiu, Xiangyun

    Molecular forces between dsDNA strands are largely dominated by electrostatics and have been extensively studied. Quantitative knowledge has been accumulated on how DNA-DNA interactions are modulated by varied biological constituents such as ions, cationic ligands, and proteins. Despite its central role in biology, the sequence of DNA has not received substantial attention and ``random'' DNA sequences are typically used in biophysical studies. However, ~50% of human genome is composed of non-random-sequence DNAs, particularly repetitive sequences. Furthermore, covalent modifications of DNA such as methylation play key roles in gene functions. Such DNAs with specific sequences or modifications often take on structures other than the canonical B-form. Here we present series of quantitative measurements of the DNA-DNA forces with the osmotic stress method on different DNA sequences, from short repeats to the most frequent sequences in genome, and to modifications such as bromination and methylation. We observe peculiar behaviors that appear to be strongly correlated with the incurred structural changes. We speculate the causalities in terms of the differences in hydration shell and DNA surface structures.

  20. Investigating population continuity with ancient DNA under a spatially explicit simulation framework.

    PubMed

    Silva, Nuno Miguel; Rio, Jeremy; Currat, Mathias

    2017-12-15

    Recent advances in sequencing technologies have allowed for the retrieval of ancient DNA data (aDNA) from skeletal remains, providing direct genetic snapshots from diverse periods of human prehistory. Comparing samples taken in the same region but at different times, hereafter called "serial samples", may indicate whether there is continuity in the peopling history of that area or whether an immigration of a genetically different population has occurred between the two sampling times. However, the exploration of genetic relationships between serial samples generally ignores their geographical locations and the spatiotemporal dynamics of populations. Here, we present a new coalescent-based, spatially explicit modelling approach to investigate population continuity using aDNA, which includes two fundamental elements neglected in previous methods: population structure and migration. The approach also considers the extensive temporal and geographical variance that is commonly found in aDNA population samples. We first showed that our spatially explicit approach is more conservative than the previous (panmictic) approach and should be preferred to test for population continuity, especially when small and isolated populations are considered. We then applied our method to two mitochondrial datasets from Germany and France, both including modern and ancient lineages dating from the early Neolithic. The results clearly reject population continuity for the maternal line over the last 7500 years for the German dataset but not for the French dataset, suggesting regional heterogeneity in post-Neolithic migratory processes. Here, we demonstrate the benefits of using a spatially explicit method when investigating population continuity with aDNA. It constitutes an improvement over panmictic methods by considering the spatiotemporal dynamics of genetic lineages and the precise location of ancient samples. The method can be used to investigate population continuity between any pair of serial samples (ancient-ancient or ancient-modern) and to investigate more complex evolutionary scenarios. Although we based our study on mitochondrial DNA sequences, diploid molecular markers of different types (DNA, SNP, STR) can also be simulated with our approach. It thus constitutes a promising tool for the analysis of the numerous aDNA datasets being produced, including genome wide data, in humans but also in many other species.

  1. Genetic divergence and fine scale population structure of the common bottlenose dolphin (Tursiops truncatus, Montagu) found in the Gulf of Guayaquil, Ecuador

    PubMed Central

    Bayas-Rea, Rosa de los Ángeles; Félix, Fernando

    2018-01-01

    The common bottlenose dolphin, Tursiops truncatus, is widely distributed along the western coast of South America. In Ecuador, a resident population of bottlenose dolphins inhabits the inner estuarine area of the Gulf of Guayaquil located in the southwestern part of the country and is under threat from different human activities in the area. Only one genetic study on South American common bottlenose dolphins has been carried out to date, and understanding genetic variation of wildlife populations, especially species that are identified as threatened, is crucial for defining conservation units and developing appropriate conservation strategies. In order to evaluate the evolutionary link of this population, we assessed the phylogenetic relationships, phylogeographic patterns, and population structure using mitochondrial DNA (mtDNA). The sampling comprised: (i) 31 skin samples collected from free-ranging dolphins at three locations in the Gulf of Guayaquil inner estuary, (ii) 38 samples from stranded dolphins available at the collection of the “Museo de Ballenas de Salinas,” (iii) 549 mtDNA control region (mtDNA CR) sequences from GenBank, and (iv) 66 concatenated sequences from 7-mtDNA regions (12S rRNA, 16S rRNA, NADH dehydrogenase subunit I–II, cytochrome oxidase I and II, cytochrome b, and CR) obtained from mitogenomes available in GenBank. Our analyses indicated population structure between both inner and outer estuary dolphin populations as well as with distinct populations of T. truncatus using mtDNA CR. Moreover, the inner estuary bottlenose dolphin (estuarine bottlenose dolphin) population exhibited lower levels of genetic diversity than the outer estuary dolphin population according to the mtDNA CR. Finally, the estuarine bottlenose dolphin population was genetically distinct from other T. truncatus populations based on mtDNA CR and 7-mtDNA regions. From these results, we suggest that the estuarine bottlenose dolphin population should be considered a distinct lineage. This dolphin population faces a variety of anthropogenic threats in this area; thus, we highlight its fragility and urge authorities to issue prompt management and conservation measures. PMID:29707430

  2. Bioaerosol DNA Extraction Technique from Air Filters Collected from Marine and Freshwater Locations

    NASA Astrophysics Data System (ADS)

    Beckwith, M.; Crandall, S. G.; Barnes, A.; Paytan, A.

    2015-12-01

    Bioaerosols are composed of microorganisms suspended in air. Among these organisms include bacteria, fungi, virus, and protists. Microbes introduced into the atmosphere can drift, primarily by wind, into natural environments different from their point of origin. Although bioaerosols can impact atmospheric dynamics as well as the ecology and biogeochemistry of terrestrial systems, very little is known about the composition of bioaerosols collected from marine and freshwater environments. The first step to determine composition of airborne microbes is to successfully extract environmental DNA from air filters. We asked 1) can DNA be extracted from quartz (SiO2) air filters? and 2) how can we optimize the DNA yield for downstream metagenomic sequencing? Aerosol filters were collected and archived on a weekly basis from aquatic sites (USA, Bermuda, Israel) over the course of 10 years. We successfully extracted DNA from a subsample of ~ 20 filters. We modified a DNA extraction protocol (Qiagen) by adding a beadbeating step to mechanically shear cell walls in order to optimize our DNA product. We quantified our DNA yield using a spectrophotometer (Nanodrop 1000). Results indicate that DNA can indeed be extracted from quartz filters. The additional beadbeating step helped increase our yield - up to twice as much DNA product was obtained compared to when this step was omitted. Moreover, bioaerosol DNA content does vary across time. For instance, the DNA extracted from filters from Lake Tahoe, USA collected near the end of June decreased from 9.9 ng/μL in 2007 to 3.8 ng/μL in 2008. Further next-generation sequencing analysis of our extracted DNA will be performed to determine the composition of these microbes. We will also model the meteorological and chemical factors that are good predictors for microbial composition for our samples over time and space.

  3. Origin and composition of cell-free DNA in spent medium from human embryo culture during preimplantation development.

    PubMed

    Vera-Rodriguez, M; Diez-Juan, A; Jimenez-Almazan, J; Martinez, S; Navarro, R; Peinado, V; Mercader, A; Meseguer, M; Blesa, D; Moreno, I; Valbuena, D; Rubio, C; Simon, C

    2018-04-01

    What is the origin and composition of cell-free DNA in human embryo spent culture media? Cell-free DNA from human embryo spent culture media represents a mix of maternal and embryonic DNA, and the mixture can be more complex for mosaic embryos. In 2016, ~300 000 human embryos were chromosomally and/or genetically analyzed using preimplantation genetic testing for aneuploidies (PGT-A) or monogenic disorders (PGT-M) before transfer into the uterus. While progress in genetic techniques has enabled analysis of the full karyotype in a single cell with high sensitivity and specificity, these approaches still require an embryo biopsy. Thus, non-invasive techniques are sought as an alternative. This study was based on a total of 113 human embryos undergoing trophectoderm biopsy as part of PGT-A analysis. For each embryo, the spent culture media used between Day 3 and Day 5 of development were collected for cell-free DNA analysis. In addition to the 113 spent culture media samples, 28 media drops without embryo contact were cultured in parallel under the same conditions to use as controls. In total, 141 media samples were collected and divided into two groups: one for direct DNA quantification (53 spent culture media and 17 controls), the other for whole-genome amplification (60 spent culture media and 11 controls) and subsequent quantification. Some samples with amplified DNA (N = 56) were used for aneuploidy testing by next-generation sequencing; of those, 35 samples underwent single-nucleotide polymorphism (SNP) sequencing to detect maternal contamination. Finally, from the 35 spent culture media analyzed by SNP sequencing, 12 whole blastocysts were analyzed by fluorescence in situ hybridization (FISH) to determine the level of mosaicism in each embryo, as a possible origin for discordance between sample types. Trophectoderm biopsies and culture media samples (20 μl) underwent whole-genome amplification, then libraries were generated and sequenced for an aneuploidy study. For SNP sequencing, triads including trophectoderm DNA, cell-free DNA, and follicular fluid DNA were analyzed. In total, 124 SNPs were included with 90 SNPs distributed among all autosomes and 34 SNPs located on chromosome Y. Finally, 12 whole blastocysts were fixed and individual cells were analyzed by FISH using telomeric/centromeric probes for the affected chromosomes. We found a higher quantity of cell-free DNA in spent culture media co-cultured with embryos versus control media samples (P ≤ 0.001). The presence of cell-free DNA in the spent culture media enabled a chromosomal diagnosis, although results differed from those of trophectoderm biopsy analysis in most cases (67%). Discordant results were mainly attributable to a high percentage of maternal DNA in the spent culture media, with a median percentage of embryonic DNA estimated at 8%. Finally, from the discordant cases, 91.7% of whole blastocysts analyzed by FISH were mosaic and 75% of the analyzed chromosomes were concordant with the trophectoderm DNA diagnosis instead of the cell-free DNA result. This study was limited by the sample size and the number of cells analyzed by FISH. This is the first study to combine chromosomal analysis of cell-free DNA, SNP sequencing to identify maternal contamination, and whole-blastocyst analysis for detecting mosaicism. Our results provide a better understanding of the origin of cell-free DNA in spent culture media, offering an important step toward developing future non-invasive karyotyping that must rely on the specific identification of DNA released from human embryos. This work was funded by Igenomix S.L. There are no competing interests.

  4. A comparison of honey bee-collected pollen from working agricultural lands using light microscopy and ITS metabarcoding

    USGS Publications Warehouse

    Smart, Matthew; Cornman, Robert S.; Iwanowicz, Deborah; McDermott-Kubeczko, Margaret; Pettis, Jeff S; Spivak, Marla S; Otto, Clint R.

    2017-01-01

    Taxonomic identification of pollen has historically been accomplished via light microscopy but requires specialized knowledge and reference collections, particularly when identification to lower taxonomic levels is necessary. Recently, next-generation sequencing technology has been used as a cost-effective alternative for identifying bee-collected pollen; however, this novel approach has not been tested on a spatially or temporally robust number of pollen samples. Here, we compare pollen identification results derived from light microscopy and DNA sequencing techniques with samples collected from honey bee colonies embedded within a gradient of intensive agricultural landscapes in the Northern Great Plains throughout the 2010–2011 growing seasons. We demonstrate that at all taxonomic levels, DNA sequencing was able to discern a greater number of taxa, and was particularly useful for the identification of infrequently detected species. Importantly, substantial phenological overlap did occur for commonly detected taxa using either technique, suggesting that DNA sequencing is an appropriate, and enhancing, substitutive technique for accurately capturing the breadth of bee-collected species of pollen present across agricultural landscapes. We also show that honey bees located in high and low intensity agricultural settings forage on dissimilar plants, though with overlap of the most abundantly collected pollen taxa. We highlight practical applications of utilizing sequencing technology, including addressing ecological issues surrounding land use, climate change, importance of taxa relative to abundance, and evaluating the impact of conservation program habitat enhancement efforts.

  5. Strain diversity and host specificity in bee gut symbionts revealed by deep sampling of single copy protein-coding sequences

    PubMed Central

    Powell, J. Elijah; Ratnayeke, Nalin; Moran, Nancy A.

    2017-01-01

    High throughput rRNA amplicon surveys of bacterial communities provide a rapid snapshot of taxonomic composition. But strains with nearly identical rRNA sequences often differ in gene repertoires and metabolic capabilities. To assess strain-level variation within Snodgrassella alvi, a gut symbiont of corbiculate bees, we performed deep sequencing on amplicons of a single copy coding gene (minD) as well as the 16S rDNA V4 region. We surveyed honey bees (Apis mellifera) sampled globally and 12 bumble bee species (Bombus) sampled from two regions of the USA. The minD analyses reveal that S. alvi contains far more strain diversity than is evident from 16S rDNA analysis. Many taxa inferred on the basis of 16S rDNA are shared between A. mellifera and Bombus species, but taxa inferred on the basis of minD are never shared and often are restricted to particular Bombus species. Clustering based on minD revealed that gut communities often reflect host species and geographic location. Both minD and 16S rDNA analyses indicate that strain diversity is higher in A. mellifera than in Bombus species. The minD locus flanks a 16S gene, enabling development of strain-specific 16S fluorescent probes to illuminate the spatial relationship of strains within the bee gut. PMID:27482856

  6. Random-breakage mapping method applied to human DNA sequences

    NASA Technical Reports Server (NTRS)

    Lobrich, M.; Rydberg, B.; Cooper, P. K.; Chatterjee, A. (Principal Investigator)

    1996-01-01

    The random-breakage mapping method [Game et al. (1990) Nucleic Acids Res., 18, 4453-4461] was applied to DNA sequences in human fibroblasts. The methodology involves NotI restriction endonuclease digestion of DNA from irradiated calls, followed by pulsed-field gel electrophoresis, Southern blotting and hybridization with DNA probes recognizing the single copy sequences of interest. The Southern blots show a band for the unbroken restriction fragments and a smear below this band due to radiation induced random breaks. This smear pattern contains two discontinuities in intensity at positions that correspond to the distance of the hybridization site to each end of the restriction fragment. By analyzing the positions of those discontinuities we confirmed the previously mapped position of the probe DXS1327 within a NotI fragment on the X chromosome, thus demonstrating the validity of the technique. We were also able to position the probes D21S1 and D21S15 with respect to the ends of their corresponding NotI fragments on chromosome 21. A third chromosome 21 probe, D21S11, has previously been reported to be close to D21S1, although an uncertainty about a second possible location existed. Since both probes D21S1 and D21S11 hybridized to a single NotI fragment and yielded a similar smear pattern, this uncertainty is removed by the random-breakage mapping method.

  7. Target sites for the transposition of rat long interspersed repeated DNA elements (LINEs) are not random.

    PubMed Central

    Furano, A V; Somerville, C C; Tsichlis, P N; D'Ambrosio, E

    1986-01-01

    The long interspersed repeated DNA family of rats (LINE or L1Rn family) contains about 40,000 6.7-kilobase (kb) long members (1). LINE members may be currently mobile since their presence or absence causes allelic variation at three single copy loci (2, 3): insulin 1, Moloney leukemia virus integration 2 (Mlvi-2) (4), and immunoglobulin heavy chain (Igh). To characterize target sites for LINE insertion, we compared the DNA sequences of the unoccupied Mlvi-2 target site, its LINE-containing allele, and several other LINE-containing sites. Although not homologous overall, the target sites share three characteristics: First, depending on the site, they are from 68% to 86% (A+T) compared to 58% (A+T) for total rat DNA (5). Depending on the site, a 7- to 15-bp target site sequence becomes duplicated and flanks the inserted LINE member. The second is a version (0 or 1 mismatch) of the hexanucleotide, TACTCA, which is also present in the LINE member, in a highly conserved region located just before the A-rich right end of the LINE member. The third is a stretch of alternating purine/pyrimidine (PQ). The A-rich right ends of different LINE members vary in length and composition, and the sequence of a particularly long one suggests that it contains the A-rich target site from a previous transposition. PMID:3012480

  8. Metagenomic analyses of the dominant bacterial community in the Fildes Peninsula, King George Island (South Shetland Islands)

    NASA Astrophysics Data System (ADS)

    Foong, Choon Pin; Wong Vui Ling, Clemente Michael; González, Marcelo

    2010-08-01

    There is little information on the bacterial diversity of the Fildes Peninsula, King George Island. Hence, this study was conducted to determine the bacterial population of sediments and soils from the lakes, river, glacier and an abandoned oil tank area in the Fildes Peninsula, using a metagenomic approach. DNA was extracted from the sediment and soil samples, and analyzed using the 16S rDNA polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE). A total of 299 DNA fragments resolved using the DGGE were sequenced. The results of the analysis provided an overview of the predominant groups of bacteria and the diversity of the bacterial communities. The most abundant phyla of bacteria in Fildes Peninsula were Bacteroidetes, Proteobacteria, Acidobacteria, Gemmatimonadetes, Nitrospira, Firmicutes, Actinobacteria, Chloroflexi, Cyanobacteria, Spirochaetes, Deinococcus-Thermus, WS3 and BRC1. All of the sediment samples from the lakes had different representatives of dominant bacterial species. Interestingly, 15% of the operational taxonomic units (OTUs) did not group into any of the existing phyla in the Ribosomal Database Project (RDP). One of the OTUs had a similarity of <0.90 when compared to the GenBank sequences and probably was a novel bacterium specific to that location. The majority of the bacterial 16S rDNA sequences were found to be closely related to those found elsewhere.

  9. Development of a PCR assay to detect cyprinid herpesvirus 1 in koi and common carp.

    PubMed

    Viadanna, Pedro H O; Miller-Morgan, Tim; Peterson, Trace; Way, Keith; Stone, David M; Marty, Gary D; Pilarski, Fabiana; Hedrick, Ronald P; Waltzek, Thomas B

    2017-02-08

    Cyprinid herpesvirus 1 (CyHV1) infects all scaled and color varieties of common carp Cyprinus carpio, including koi. While it is most often associated with unsightly growths known as 'carp pox,' the underlying lesion (epidermal hyperplasia) can arise from a variety of disease processes. CyHV1-induced epidermal hyperplasia may occur transiently in response to water temperature, and thus histopathology cannot be used in isolation to assess CyHV1 infection status. To address this problem, here we describe a PCR assay targeted to the putative thymidine kinase gene of CyHV1. The PCR assay generates a 141 bp amplicon and reliably detects down to 10 copies of control plasmid DNA sequence (analytic sensitivity). The PCR does not cross-detect genomic DNA from cyprinid herpesvirus 2 and 3 (analytic specificity). The CyHV1 PCR effectively detected viral DNA in koi and common carp sampled from various locations in the UK, USA, Brazil, and Japan. Viral DNA was detected in both normal appearing and grossly affected epidermal tissues from koi experiencing natural epizootics. The new CyHV1 PCR provides an additional approach to histopathology for the rapid detection of CyHV1. Analysis of the thymidine kinase gene sequences determined for 7 PCR-positive carp originating from disparate geographical regions identified 3 sequence types, with 1 type occurring in both koi and common carp.

  10. RPG: the Ribosomal Protein Gene database.

    PubMed

    Nakao, Akihiro; Yoshihama, Maki; Kenmochi, Naoya

    2004-01-01

    RPG (http://ribosome.miyazaki-med.ac.jp/) is a new database that provides detailed information about ribosomal protein (RP) genes. It contains data from humans and other organisms, including Drosophila melanogaster, Caenorhabditis elegans, Saccharo myces cerevisiae, Methanococcus jannaschii and Escherichia coli. Users can search the database by gene name and organism. Each record includes sequences (genomic, cDNA and amino acid sequences), intron/exon structures, genomic locations and information about orthologs. In addition, users can view and compare the gene structures of the above organisms and make multiple amino acid sequence alignments. RPG also provides information on small nucleolar RNAs (snoRNAs) that are encoded in the introns of RP genes.

  11. RPG: the Ribosomal Protein Gene database

    PubMed Central

    Nakao, Akihiro; Yoshihama, Maki; Kenmochi, Naoya

    2004-01-01

    RPG (http://ribosome.miyazaki-med.ac.jp/) is a new database that provides detailed information about ribosomal protein (RP) genes. It contains data from humans and other organisms, including Drosophila melanogaster, Caenorhabditis elegans, Saccharo myces cerevisiae, Methanococcus jannaschii and Escherichia coli. Users can search the database by gene name and organism. Each record includes sequences (genomic, cDNA and amino acid sequences), intron/exon structures, genomic locations and information about orthologs. In addition, users can view and compare the gene structures of the above organisms and make multiple amino acid sequence alignments. RPG also provides information on small nucleolar RNAs (snoRNAs) that are encoded in the introns of RP genes. PMID:14681386

  12. Adenovirus sequences required for replication in vivo.

    PubMed Central

    Wang, K; Pearson, G D

    1985-01-01

    We have studied the in vivo replication properties of plasmids carrying deletion mutations within cloned adenovirus terminal sequences. Deletion mapping located the adenovirus DNA replication origin entirely within the first 67 bp of the adenovirus inverted terminal repeat. This region could be further subdivided into two functional domains: a minimal replication origin and an adjacent auxillary region which boosted the efficiency of replication by more than 100-fold. The minimal origin occupies the first 18 to 21 bp and includes sequences conserved between all adenovirus serotypes. The adjacent auxillary region extends past nucleotide 36 but not past nucleotide 67 and contains the binding site for nuclear factor I. Images PMID:2991857

  13. An expanded mammal mitogenome dataset from Southeast Asia

    PubMed Central

    Ramos-Madrigal, Jazmín; Peñaloza, Fernando; Liu, Shanlin; Mikkel-Holger, S. Sinding; Riddhi, P. Patel; Martins, Renata; Lenz, Dorina; Fickel, Jörns; Roos, Christian; Shamsir, Mohd Shahir; Azman, Mohammad Shahfiz; Burton, K. Lim; Stephen, J. Rossiter; Wilting, Andreas

    2017-01-01

    Abstract Southeast (SE) Asia is 1 of the most biodiverse regions in the world, and it holds approximately 20% of all mammal species. Despite this, the majority of SE Asia's genetic diversity is still poorly characterized. The growing interest in using environmental DNA to assess and monitor SE Asian species, in particular threatened mammals—has created the urgent need to expand the available reference database of mitochondrial barcode and complete mitogenome sequences. We have partially addressed this need by generating 72 new mitogenome sequences reconstructed from DNA isolated from a range of historical and modern tissue samples. Approximately 55 gigabases of raw sequence were generated. From this data, we assembled 72 complete mitogenome sequences, with an average depth of coverage of ×102.9 and ×55.2 for modern samples and historical samples, respectively. This dataset represents 52 species, of which 30 species had no previous mitogenome data available. The mitogenomes were geotagged to their sampling location, where known, to display a detailed geographical distribution of the species. Our new database of 52 taxa will strongly enhance the utility of environmental DNA approaches for monitoring mammals in SE Asia as it greatly increases the likelihoods that identification of metabarcoding sequencing reads can be assigned to reference sequences. This magnifies the confidence in species detections and thus allows more robust surveys and monitoring programmes of SE Asia's threatened mammal biodiversity. The extensive collections of historical samples from SE Asia in western and SE Asian museums should serve as additional valuable material to further enrich this reference database. PMID:28873965

  14. An expanded mammal mitogenome dataset from Southeast Asia.

    PubMed

    Mohd Salleh, Faezah; Ramos-Madrigal, Jazmín; Peñaloza, Fernando; Liu, Shanlin; Mikkel-Holger, S Sinding; Riddhi, P Patel; Martins, Renata; Lenz, Dorina; Fickel, Jörns; Roos, Christian; Shamsir, Mohd Shahir; Azman, Mohammad Shahfiz; Burton, K Lim; Stephen, J Rossiter; Wilting, Andreas; Gilbert, M Thomas P

    2017-08-01

    Southeast (SE) Asia is 1 of the most biodiverse regions in the world, and it holds approximately 20% of all mammal species. Despite this, the majority of SE Asia's genetic diversity is still poorly characterized. The growing interest in using environmental DNA to assess and monitor SE Asian species, in particular threatened mammals-has created the urgent need to expand the available reference database of mitochondrial barcode and complete mitogenome sequences. We have partially addressed this need by generating 72 new mitogenome sequences reconstructed from DNA isolated from a range of historical and modern tissue samples. Approximately 55 gigabases of raw sequence were generated. From this data, we assembled 72 complete mitogenome sequences, with an average depth of coverage of ×102.9 and ×55.2 for modern samples and historical samples, respectively. This dataset represents 52 species, of which 30 species had no previous mitogenome data available. The mitogenomes were geotagged to their sampling location, where known, to display a detailed geographical distribution of the species. Our new database of 52 taxa will strongly enhance the utility of environmental DNA approaches for monitoring mammals in SE Asia as it greatly increases the likelihoods that identification of metabarcoding sequencing reads can be assigned to reference sequences. This magnifies the confidence in species detections and thus allows more robust surveys and monitoring programmes of SE Asia's threatened mammal biodiversity. The extensive collections of historical samples from SE Asia in western and SE Asian museums should serve as additional valuable material to further enrich this reference database. © The Author 2017. Published by Oxford University Press.

  15. UV-vis spectroscopy and dynamic light scattering study of gold nanorods aggregation.

    PubMed

    Kanjanawarut, Roejarek; Yuan, Bo; XiaoDi, Su

    2013-08-01

    Gold nanorods (AuNRs) were used as spectroscopic sensing elements to detect specific DNA sequences with a single-base mismatch sensitivity. The assay was based on the observation that the stabilizing repulsive forces between CTA(+)-coated AuNRs can be removed by citrate ions, which causes aggregation among AuNRs; whereas nucleic acids of different structures[ i.e., peptide nucleic acid (PNA), single-stranded DNA (ssDNA), PNA-DNA complex, and double-stranded DNA (dsDNA)] can retard the aggregation. Moreover, the dsDNA PNA-DNA duplexes provide larger retardation than that by unhybridized ssDNA and PNA probe. This assay can differentiate single-base mismatched targets with base substitution at different locations (center and end) with AuNRs of a larger aspect ratio. Besides ultraviolet-visable spectroscopy measurement of particle assembly-induced plasmonic coupling that in turn provides a spectroscopic detection of the specific DNA, dynamic light scattering and transmission electron microscope (TEM) were used to measure smaller degree of aggregation that can reveal sodium citrate- and dsDNA-AuNRs interactions in fine detail.

  16. Genotyping of ancient Mycobacterium tuberculosis strains reveals historic genetic diversity.

    PubMed

    Müller, Romy; Roberts, Charlotte A; Brown, Terence A

    2014-04-22

    The evolutionary history of the Mycobacterium tuberculosis complex (MTBC) has previously been studied by analysis of sequence diversity in extant strains, but not addressed by direct examination of strain genotypes in archaeological remains. Here, we use ancient DNA sequencing to type 11 single nucleotide polymorphisms and two large sequence polymorphisms in the MTBC strains present in 10 archaeological samples from skeletons from Britain and Europe dating to the second-nineteenth centuries AD. The results enable us to assign the strains to groupings and lineages recognized in the extant MTBC. We show that at least during the eighteenth-nineteenth centuries AD, strains of M. tuberculosis belonging to different genetic groups were present in Britain at the same time, possibly even at a single location, and we present evidence for a mixed infection in at least one individual. Our study shows that ancient DNA typing applied to multiple samples can provide sufficiently detailed information to contribute to both archaeological and evolutionary knowledge of the history of tuberculosis.

  17. Principles of regulatory information conservation between mouse and human

    DOE PAGES

    Cheng, Yong; Ma, Zhihai; Kim, Bong-Hyun; ...

    2014-11-19

    To broaden our understanding of the evolution of gene regulation mechanisms, we generated occupancy profiles for 34 orthologous transcription factors (TFs) in human–mouse erythroid progenitor, lymphoblast and embryonic stem-cell lines. By combining the genome-wide transcription factor occupancy repertoires, associated epigenetic signals, and co-association patterns, here we deduce several evolutionary principles of gene regulatory features operating since the mouse and human lineages diverged. The genomic distribution profiles, primary binding motifs, chromatin states, and DNA methylation preferences are well conserved for TF-occupied sequences. However, the extent to which orthologous DNA segments are bound by orthologous TFs varies both among TFs and withmore » genomic location: binding at promoters is more highly conserved than binding at distal elements. Notably, occupancy-conserved TF-occupied sequences tend to be pleiotropic; they function in several tissues and also co-associate with many TFs. Lastly, single nucleotide variants at sites with potential regulatory functions are enriched in occupancy-conserved TF-occupied sequences.« less

  18. Linkage map of the fragments of herpesvirus papio DNA.

    PubMed Central

    Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H

    1981-01-01

    Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015

  19. Biomonitoring of marine vertebrates in Monterey Bay using eDNA metabarcoding.

    PubMed

    Andruszkiewicz, Elizabeth A; Starks, Hilary A; Chavez, Francisco P; Sassoubre, Lauren M; Block, Barbara A; Boehm, Alexandria B

    2017-01-01

    Molecular analysis of environmental DNA (eDNA) can be used to assess vertebrate biodiversity in aquatic systems, but limited work has applied eDNA technologies to marine waters. Further, there is limited understanding of the spatial distribution of vertebrate eDNA in marine waters. Here, we use an eDNA metabarcoding approach to target and amplify a hypervariable region of the mitochondrial 12S rRNA gene to characterize vertebrate communities at 10 oceanographic stations spanning 45 km within the Monterey Bay National Marine Sanctuary (MBNMS). In this study, we collected three biological replicates of small volume water samples (1 L) at 2 depths at each of the 10 stations. We amplified fish mitochondrial DNA using a universal primer set. We obtained 5,644,299 high quality Illumina sequence reads from the environmental samples. The sequence reads were annotated to the lowest taxonomic assignment using a bioinformatics pipeline. The eDNA survey identified, to the lowest taxonomic rank, 7 families, 3 subfamilies, 10 genera, and 72 species of vertebrates at the study sites. These 92 distinct taxa come from 33 unique marine vertebrate families. We observed significantly different vertebrate community composition between sampling depths (0 m and 20/40 m deep) across all stations and significantly different communities at stations located on the continental shelf (<200 m bottom depth) versus in the deeper waters of the canyons of Monterey Bay (>200 m bottom depth). All but 1 family identified using eDNA metabarcoding is known to occur in MBNMS. The study informs the implementation of eDNA metabarcoding for vertebrate biomonitoring.

  20. Product analysis illuminates the final steps of IES deletion in Tetrahymena thermophila

    PubMed Central

    Saveliev, Sergei V.; Cox, Michael M.

    2001-01-01

    DNA sequences (IES elements) eliminated from the developing macronucleus in the ciliate Tetrahymena thermophila are released as linear fragments, which have now been detected and isolated. A PCR-mediated examination of fragment end structures reveals three types of strand scission events, reflecting three steps in the deletion process. New evidence is provided for two steps proposed previously: an initiating double-stranded cleavage, and strand transfer to create a branched deletion intermediate. The fragment ends provide evidence for a previously uncharacterized third step: the branched DNA strand is cleaved at one of several defined sites located within 15–16 nucleotides of the IES boundary, liberating the deleted DNA in a linear form. PMID:11406601

  1. Product analysis illuminates the final steps of IES deletion in Tetrahymena thermophila.

    PubMed

    Saveliev, S V; Cox, M M

    2001-06-15

    DNA sequences (IES elements) eliminated from the developing macronucleus in the ciliate Tetrahymena thermophila are released as linear fragments, which have now been detected and isolated. A PCR-mediated examination of fragment end structures reveals three types of strand scission events, reflecting three steps in the deletion process. New evidence is provided for two steps proposed previously: an initiating double-stranded cleavage, and strand transfer to create a branched deletion intermediate. The fragment ends provide evidence for a previously uncharacterized third step: the branched DNA strand is cleaved at one of several defined sites located within 15-16 nucleotides of the IES boundary, liberating the deleted DNA in a linear form.

  2. Structure and chromosomal localization of the human PD-1 gene (PDCD1)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shinohara, T.; Ishida, Y.; Kawaichi, M.

    1994-10-01

    A cDNA encoding mouse PD-1, a member of the immunoglobulin superfamily, was previously isolated from apoptosis-induced cells by subtractive hybridization. To determine the structure and chromosomal location of the human PD-1 gene, we screened a human T cell cDNA library by mouse PD-1 probe and isolated a cDNA coding for the human PD-1 protein. The deduced amino acid sequence of human PD-1 was 60% identical to the mouse counterpart, and a putative tyrosine kinase-association motif was well conserved. The human PD-1 gene was mapped to 2q37.3 by chromosomal in situ hybridization. 7 refs., 3 figs.

  3. Towards computational improvement of DNA database indexing and short DNA query searching.

    PubMed

    Stojanov, Done; Koceski, Sašo; Mileva, Aleksandra; Koceska, Nataša; Bande, Cveta Martinovska

    2014-09-03

    In order to facilitate and speed up the search of massive DNA databases, the database is indexed at the beginning, employing a mapping function. By searching through the indexed data structure, exact query hits can be identified. If the database is searched against an annotated DNA query, such as a known promoter consensus sequence, then the starting locations and the number of potential genes can be determined. This is particularly relevant if unannotated DNA sequences have to be functionally annotated. However, indexing a massive DNA database and searching an indexed data structure with millions of entries is a time-demanding process. In this paper, we propose a fast DNA database indexing and searching approach, identifying all query hits in the database, without having to examine all entries in the indexed data structure, limiting the maximum length of a query that can be searched against the database. By applying the proposed indexing equation, the whole human genome could be indexed in 10 hours on a personal computer, under the assumption that there is enough RAM to store the indexed data structure. Analysing the methodology proposed by Reneker, we observed that hits at starting positions [Formula: see text] are not reported, if the database is searched against a query shorter than [Formula: see text] nucleotides, such that [Formula: see text] is the length of the DNA database words being mapped and [Formula: see text] is the length of the query. A solution of this drawback is also presented.

  4. Mapping three guanine oxidation products along DNA following exposure to three types of reactive oxygen species.

    PubMed

    Matter, Brock; Seiler, Christopher L; Murphy, Kristopher; Ming, Xun; Zhao, Jianwei; Lindgren, Bruce; Jones, Roger; Tretyakova, Natalia

    2018-06-01

    Reactive oxygen and nitrogen species generated during respiration, inflammation, and immune response can damage cellular DNA, contributing to aging, cancer, and neurodegeneration. The ability of oxidized DNA bases to interfere with DNA replication and transcription is strongly influenced by their chemical structures and locations within the genome. In the present work, we examined the influence of local DNA sequence context, DNA secondary structure, and oxidant identity on the efficiency and the chemistry of guanine oxidation in the context of the Kras protooncogene. A novel isotope labeling strategy developed in our laboratory was used to accurately map the formation of 2,2-diamino-4-[(2-deoxy-β-D-erythropentofuranosyl)amino]- 5(2 H)-oxazolone (Z), 8-oxo-7,8-dihydro-2'-deoxyguanosine (OG), and 8-nitroguanine (8-NO 2 -G) lesions along DNA duplexes following photooxidation in the presence of riboflavin, treatment with nitrosoperoxycarbonate, and oxidation in the presence of hydroxyl radicals. Riboflavin-mediated photooxidation preferentially induced OG lesions at 5' guanines within GG repeats, while treatment with nitrosoperoxycarbonate targeted 3'-guanines within GG and AG dinucleotides. Little sequence selectivity was observed following hydroxyl radical-mediated oxidation. However, Z and 8-NO 2 -G adducts were overproduced at duplex ends, irrespective of oxidant identity. Overall, our results indicate that the patterns of Z, OG, and 8-NO 2 -G adduct formation in the genome are distinct and are influenced by oxidant identity and the secondary structure of DNA. Copyright © 2018 Elsevier Inc. All rights reserved.

  5. Variation of DNA Methylome of Zebrafish Cells under Cold Pressure

    PubMed Central

    Xu, Qiongqiong; Luo, Juntao; Shi, Yingdi; Li, Xiaoxia; Yan, Xiaonan; Zhang, Junfang

    2016-01-01

    DNA methylation is an essential epigenetic mechanism involved in multiple biological processes. However, the relationship between DNA methylation and cold acclimation remains poorly understood. In this study, Methylated DNA Immunoprecipitation Sequencing (MeDIP-seq) was performed to reveal a genome-wide methylation profile of zebrafish (Danio rerio) embryonic fibroblast cells (ZF4) and its variation under cold pressure. MeDIP-seq assay was conducted with ZF4 cells cultured at appropriate temperature of 28°C and at low temperature of 18°C for 5 (short-term) and 30 (long-term) days, respectively. Our data showed that DNA methylation level of whole genome increased after a short-term cold exposure and decreased after a long-term cold exposure. It is interesting that metabolism of folate pathway is significantly hypomethylated after short-term cold exposure, which is consistent with the increased DNA methylation level. 21% of methylation peaks were significantly altered after cold treatment. About 8% of altered DNA methylation peaks are located in promoter regions, while the majority of them are located in non-coding regions. Methylation of genes involved in multiple cold responsive biological processes were significantly affected, such as anti-oxidant system, apoptosis, development, chromatin modifying and immune system suggesting that those processes are responsive to cold stress through regulation of DNA methylation. Our data indicate the involvement of DNA methylation in cellular response to cold pressure, and put a new insight into the genome-wide epigenetic regulation under cold pressure. PMID:27494266

  6. Human chromosome Y and SRY.

    PubMed

    Shah, V C; Smart, V

    1996-01-01

    The precise location of the SRY gene on the human Y chromosome has been revealed through studies of sex reversal cases involving deletion, cross-linking and mutations of the SRY gene. Its DNA sequence and mechanism of action are being understood. Similarity of SRY with Sry of mice and its interaction with other genes in male sex determination are discussed.

  7. Immigration history of amphidromous species on a Greater Antillean island

    Treesearch

    Benjamin D. Cook; Catherine M. Pringle; Jane M. Hughes

    2010-01-01

    Aim To use molecular data to test for dispersal structuring in the immigration history of an amphidromous community on an island. Location The Caribbean island of Puerto Rico. Methods Mitochondrial DNA sequences were obtained from 11 amphidromous species, including shrimps, fish and a gastropod, sampled from throughout the island. The timing of population expansion (TE...

  8. Analyses of the population structure in a global collection of Phytophthora nicotianae isolates inferred from mitochondrial and nuclear DNA sequences

    USDA-ARS?s Scientific Manuscript database

    Genetic variation within the heterothallic cosmopolitan plant pathogen Phytophthora nicotianae was determined in 96 isolates from a wide range of hosts and geographic locations by characterizing four mitochondrial (10% of the genome) and three nuclear loci. Fifty-two SNPs ( average of 1 every 58 bp)...

  9. A High-Throughput Process for the Solid-Phase Purification of Synthetic DNA Sequences

    PubMed Central

    Grajkowski, Andrzej; Cieślak, Jacek; Beaucage, Serge L.

    2017-01-01

    An efficient process for the purification of synthetic phosphorothioate and native DNA sequences is presented. The process is based on the use of an aminopropylated silica gel support functionalized with aminooxyalkyl functions to enable capture of DNA sequences through an oximation reaction with the keto function of a linker conjugated to the 5′-terminus of DNA sequences. Deoxyribonucleoside phosphoramidites carrying this linker, as a 5′-hydroxyl protecting group, have been synthesized for incorporation into DNA sequences during the last coupling step of a standard solid-phase synthesis protocol executed on a controlled pore glass (CPG) support. Solid-phase capture of the nucleobase- and phosphate-deprotected DNA sequences released from the CPG support is demonstrated to proceed near quantitatively. Shorter than full-length DNA sequences are first washed away from the capture support; the solid-phase purified DNA sequences are then released from this support upon reaction with tetra-n-butylammonium fluoride in dry dimethylsulfoxide (DMSO) and precipitated in tetrahydrofuran (THF). The purity of solid-phase-purified DNA sequences exceeds 98%. The simulated high-throughput and scalability features of the solid-phase purification process are demonstrated without sacrificing purity of the DNA sequences. PMID:28628204

  10. Chromosomal mapping of the human M6 genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Olinsky, S.; Loop, B.T.; DeKosky, A.

    1996-05-01

    M6 is a neuronal membrane glycoprotein that may have an important role in neural development. This molecule was initially defined by a monoclonal antibody that affected the survival of cultured cerebellar neurons and the outgrowth of neurites. The nature of the antigen was discovered by expression cDNA cloning using this monoclonal antibody. Two distinct murine M6 cDNAs (designated M6a and M6b) whose deduced amino acid sequences were remarkably similar to that of the myelin proteolipid protein human cDNA and genomic clones encoding M6a and M6b and have characterized them by restriction mapping, Southern hybridization with cDNA probes, and sequence analysis.more » We have localized these genes within the human genome by FISH (fluorescence in situ hybridization). The human M6a gene is located at 4q34, and the M6b gene is located at Xp22.2 A number of human neurological disorders have been mapped to the Xp22 region, including Aicardi syndrome (MIM 304050), Rett syndrome (MIM 312750), X-linked Charcot-Marie-Tooth neuropathy (MIM 302801), and X-linked mental retardation syndromes (MRX1, MIM 309530). This raises the possibility that a defect in the M6b gene is responsible for one of these neurological disorders. 8 refs., 3 figs.« less

  11. IMG/VR: a database of cultured and uncultured DNA Viruses and retroviruses.

    PubMed

    Paez-Espino, David; Chen, I-Min A; Palaniappan, Krishna; Ratner, Anna; Chu, Ken; Szeto, Ernest; Pillay, Manoj; Huang, Jinghua; Markowitz, Victor M; Nielsen, Torben; Huntemann, Marcel; K Reddy, T B; Pavlopoulos, Georgios A; Sullivan, Matthew B; Campbell, Barbara J; Chen, Feng; McMahon, Katherine; Hallam, Steve J; Denef, Vincent; Cavicchioli, Ricardo; Caffrey, Sean M; Streit, Wolfgang R; Webster, John; Handley, Kim M; Salekdeh, Ghasem H; Tsesmetzis, Nicolas; Setubal, Joao C; Pope, Phillip B; Liu, Wen-Tso; Rivers, Adam R; Ivanova, Natalia N; Kyrpides, Nikos C

    2017-01-04

    Viruses represent the most abundant life forms on the planet. Recent experimental and computational improvements have led to a dramatic increase in the number of viral genome sequences identified primarily from metagenomic samples. As a result of the expanding catalog of metagenomic viral sequences, there exists a need for a comprehensive computational platform integrating all these sequences with associated metadata and analytical tools. Here we present IMG/VR (https://img.jgi.doe.gov/vr/), the largest publicly available database of 3908 isolate reference DNA viruses with 264 413 computationally identified viral contigs from >6000 ecologically diverse metagenomic samples. Approximately half of the viral contigs are grouped into genetically distinct quasi-species clusters. Microbial hosts are predicted for 20 000 viral sequences, revealing nine microbial phyla previously unreported to be infected by viruses. Viral sequences can be queried using a variety of associated metadata, including habitat type and geographic location of the samples, or taxonomic classification according to hallmark viral genes. IMG/VR has a user-friendly interface that allows users to interrogate all integrated data and interact by comparing with external sequences, thus serving as an essential resource in the viral genomics community. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. An improved model for whole genome phylogenetic analysis by Fourier transform.

    PubMed

    Yin, Changchuan; Yau, Stephen S-T

    2015-10-07

    DNA sequence similarity comparison is one of the major steps in computational phylogenetic studies. The sequence comparison of closely related DNA sequences and genomes is usually performed by multiple sequence alignments (MSA). While the MSA method is accurate for some types of sequences, it may produce incorrect results when DNA sequences undergone rearrangements as in many bacterial and viral genomes. It is also limited by its computational complexity for comparing large volumes of data. Previously, we proposed an alignment-free method that exploits the full information contents of DNA sequences by Discrete Fourier Transform (DFT), but still with some limitations. Here, we present a significantly improved method for the similarity comparison of DNA sequences by DFT. In this method, we map DNA sequences into 2-dimensional (2D) numerical sequences and then apply DFT to transform the 2D numerical sequences into frequency domain. In the 2D mapping, the nucleotide composition of a DNA sequence is a determinant factor and the 2D mapping reduces the nucleotide composition bias in distance measure, and thus improving the similarity measure of DNA sequences. To compare the DFT power spectra of DNA sequences with different lengths, we propose an improved even scaling algorithm to extend shorter DFT power spectra to the longest length of the underlying sequences. After the DFT power spectra are evenly scaled, the spectra are in the same dimensionality of the Fourier frequency space, then the Euclidean distances of full Fourier power spectra of the DNA sequences are used as the dissimilarity metrics. The improved DFT method, with increased computational performance by 2D numerical representation, can be applicable to any DNA sequences of different length ranges. We assess the accuracy of the improved DFT similarity measure in hierarchical clustering of different DNA sequences including simulated and real datasets. The method yields accurate and reliable phylogenetic trees and demonstrates that the improved DFT dissimilarity measure is an efficient and effective similarity measure of DNA sequences. Due to its high efficiency and accuracy, the proposed DFT similarity measure is successfully applied on phylogenetic analysis for individual genes and large whole bacterial genomes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Core histone genes of Giardia intestinalis: genomic organization, promoter structure, and expression

    PubMed Central

    Yee, Janet; Tang, Anita; Lau, Wei-Ling; Ritter, Heather; Delport, Dewald; Page, Melissa; Adam, Rodney D; Müller, Miklós; Wu, Gang

    2007-01-01

    Background Giardia intestinalis is a protist found in freshwaters worldwide, and is the most common cause of parasitic diarrhea in humans. The phylogenetic position of this parasite is still much debated. Histones are small, highly conserved proteins that associate tightly with DNA to form chromatin within the nucleus. There are two classes of core histone genes in higher eukaryotes: DNA replication-independent histones and DNA replication-dependent ones. Results We identified two copies each of the core histone H2a, H2b and H3 genes, and three copies of the H4 gene, at separate locations on chromosomes 3, 4 and 5 within the genome of Giardia intestinalis, but no gene encoding a H1 linker histone could be recognized. The copies of each gene share extensive DNA sequence identities throughout their coding and 5' noncoding regions, which suggests these copies have arisen from relatively recent gene duplications or gene conversions. The transcription start sites are at triplet A sequences 1–27 nucleotides upstream of the translation start codon for each gene. We determined that a 50 bp region upstream from the start of the histone H4 coding region is the minimal promoter, and a highly conserved 15 bp sequence called the histone motif (him) is essential for its activity. The Giardia core histone genes are constitutively expressed at approximately equivalent levels and their mRNAs are polyadenylated. Competition gel-shift experiments suggest that a factor within the protein complex that binds him may also be a part of the protein complexes that bind other promoter elements described previously in Giardia. Conclusion In contrast to other eukaryotes, the Giardia genome has only a single class of core histone genes that encode replication-independent histones. Our inability to locate a gene encoding the linker histone H1 leads us to speculate that the H1 protein may not be required for the compaction of Giardia's small and gene-rich genome. PMID:17425802

  14. Nucleotide sequence of the COX1 gene in Kluyveromyces lactis mitochondrial DNA: evidence for recent horizontal transfer of a group II intron.

    PubMed

    Hardy, C M; Clark-Walker, G D

    1991-07-01

    The cytochrome oxidase subunit 1 gene (COX1) in K. lactis K8 mtDNA spans 8,826 bp and contains five exons (termed E1-E5) totalling 1,602 bp that show 88% nucleotide base matching and 91% amino acid homology to the equivalent gene in S. cerevisiae. The four introns (termed K1 cox1.1-1.4) contain open reading frames encoding proteins of 786, 333, 319 and 395 amino acids respectively that potentially encode maturase enzymes. The first intron belongs to group II whereas the remaining three are group I type B. Introns K1 cox1.1, 1.3, and 1.4 are found at identical locations to introns Sc cox1.2, 1.5 a, and 1.5 b respectively from S. cerevisiae. Horizontal transfer of an intron between recent progenitors of K. lactis and S. cerevisiae is suggested by the observation that K1 cox1.1 and Sc cox1.2 show 96% base matching. Sequence comparisons between K1 cox1.3/Sc cox1.5 a and K1 cox1.4/Sc cox1.5 b suggest that these introns are likely to have been present in the ancestral COX1 gene of these yeasts. Intron K1 cox1.2 is not found in S. cerevisiae and appears at an unique location in K. lactis. A feature of the DNA sequences of the group I introns K1 cox1.2, 1.3, and 1.4 is the presence of 11 GC-rich clusters inserted into both coding and noncoding regions. Immediately downstream of the COX1 gene is the ATPase subunit 8 gene (A8) that shows 82.6% base matching to its counterpart in S. cerevisiae mtDNA.

  15. Effects of a Transposable Element Insertion on Alcohol Dehydrogenase Expression in Drosophila Melanogaster

    PubMed Central

    Dunn, R. C.; Laurie, C. C.

    1995-01-01

    Variation in the DNA sequence and level of alcohol dehydrogenase (Adh) gene expression in Drosophila melanogaster have been studied to determine what types of DNA polymorphisms contribute to phenotypic variation in natural populations. The Adh gene, like many others, shows a high level of variability in both DNA sequence and quantitative level of expression. A number of transposable element insertions occur in the Adh region and one of these, a copia insertion in the 5' flanking region, is associated with unusually low Adh expression. To determine whether this insertion (called RI42) causes the low expression level, the insertion was excised from the cloned RI42 Adh gene and the effect was assessed by P-element transformation. Removal of this insertion causes a threefold increase in the level of ADH, clearly showing that it contributes to the naturally occurring variation in expression at this locus. Removal of all but one LTR also causes a threefold increase, indicating that the mechanism is not a simple sequence disruption. Furthermore, this copia insertion, which is located between the two Adh promoters and their upstream enhancer sequences, has differential effects on the levels of proximal and distal transcripts. Finally, a test for the possible modifying effects of two suppressor loci, su(w(a)) and su(f), on this insertional mutation was negative, in contrast to a previous report in the literature. PMID:7498745

  16. Genomic in situ hybridization in interspecific hybrids of scallops (Bivalvia, Pectinidae) and localization of the satellite DNA Cf303, and the vertebrate telomeric sequences (TTAGGG)n on chromosomes of scallop Chlamys farreri (Jones & Preston, 1904)

    PubMed Central

    Hu, Liping; Jiang, Liming; Bi, Ke; Liao, Huan; Yang, Zujing; Huang, Xiaoting; Bao, Zhenmin

    2018-01-01

    Abstract Mitotic chromosome preparations of the interspecific hybrids Chlamys farreri (Jones & Preston, 1904) × Patinopecten yessoensis (Jay, 1857), C. farreri × Argopecten irradians (Lamarck, 1819) and C. farreri × Mimachlamys nobilis (Reeve, 1852) were used to compare two different scallop genomes in a single slide. Although genomic in situ hybridization (GISH) using genomic DNA from each scallop species as probe painted mitotic chromosomes of the interspecific hybrids, the painting results were not uniform; instead it showed species-specific distribution patterns of fluorescent signals among the chromosomes. The most prominent GISH-bands were mainly located at centromeric or telomeric regions of scallop chromosomes. In order to illustrate the sequence constitution of the GISH-bands, the satellite Cf303 sequences of C. farreri and the vertebrate telomeric (TTAGGG)n sequences were used to map mitotic chromosomes of C. farreri by fluorescence in situ hybridization (FISH). The results indicated that the GISH-banding pattern presented by the chromosomes of C. farreri is mainly due to the distribution of the satellite Cf303 DNA, therefore suggesting that the GISH-banding patterns found in the other three scallops could also be the result of the chromosomal distribution of other species-specific satellite DNAs. PMID:29675138

  17. Genomic in situ hybridization in interspecific hybrids of scallops (Bivalvia, Pectinidae) and localization of the satellite DNA Cf303, and the vertebrate telomeric sequences (TTAGGG)n on chromosomes of scallop Chlamys farreri (Jones & Preston, 1904).

    PubMed

    Hu, Liping; Jiang, Liming; Bi, Ke; Liao, Huan; Yang, Zujing; Huang, Xiaoting; Bao, Zhenmin

    2018-01-01

    Mitotic chromosome preparations of the interspecific hybrids Chlamys farreri (Jones & Preston, 1904) × Patinopecten yessoensis (Jay, 1857), C. farreri × Argopecten irradians (Lamarck, 1819) and C. farreri × Mimachlamys nobilis (Reeve, 1852) were used to compare two different scallop genomes in a single slide. Although genomic in situ hybridization (GISH) using genomic DNA from each scallop species as probe painted mitotic chromosomes of the interspecific hybrids, the painting results were not uniform; instead it showed species-specific distribution patterns of fluorescent signals among the chromosomes. The most prominent GISH-bands were mainly located at centromeric or telomeric regions of scallop chromosomes. In order to illustrate the sequence constitution of the GISH-bands, the satellite Cf303 sequences of C. farreri and the vertebrate telomeric (TTAGGG) n sequences were used to map mitotic chromosomes of C. farreri by fluorescence in situ hybridization (FISH). The results indicated that the GISH-banding pattern presented by the chromosomes of C. farreri is mainly due to the distribution of the satellite Cf303 DNA, therefore suggesting that the GISH-banding patterns found in the other three scallops could also be the result of the chromosomal distribution of other species-specific satellite DNAs.

  18. Isolation and sequencing of the gene encoding Sp23, a structural protein of spermatophore of the mealworm beetle, Tenebrio molitor.

    PubMed

    Feng, X; Happ, G M

    1996-11-14

    The cDNA for Sp23, a structural protein of the spermatophore of Tenebrio molitor, had been previously cloned and characterized (Paesen, G.C., Schwartz, M.B., Peferoen, M., Weyda, F. and Happ, G.M. (1992a) Amino acid sequence of Sp23, a structure protein of the spermatophore of the mealworm beetle, Tenebrio molitor. J. Biol. Chem. 257, 18852-18857). Using the labeled cDNA for Sp23 as a probe to screen a library of genomic DNA from Tenebrio molitor, we isolated a genomic clone for Sp23. A 5373-base pair (bp) restriction fragment containing the Sp23 gene was sequenced. The coding region is separated by a 55-bp intron which is located close to the translation start site. Three putative ecdysone response elements (EcRE) are identified in the 5' flanking region of the Sp23 gene. Comparison of the flanking regions of the Sp23 gene with those of the D-protein gene expressed in the accessory glands of Tenebrio reveals similar sequences present in the flanking regions of the two genes. The genomic organization of the coding region of the Sp23 gene shares similarities with that of the D-protein gene, three Drosophila accessory gland genes and two Drosophila 20-OH ecdysone-responsive genes.

  19. Ribosomal RNA Genes Contribute to the Formation of Pseudogenes and Junk DNA in the Human Genome.

    PubMed

    Robicheau, Brent M; Susko, Edward; Harrigan, Amye M; Snyder, Marlene

    2017-02-01

    Approximately 35% of the human genome can be identified as sequence devoid of a selected-effect function, and not derived from transposable elements or repeated sequences. We provide evidence supporting a known origin for a fraction of this sequence. We show that: 1) highly degraded, but near full length, ribosomal DNA (rDNA) units, including both 45S and Intergenic Spacer (IGS), can be found at multiple sites in the human genome on chromosomes without rDNA arrays, 2) that these rDNA sequences have a propensity for being centromere proximal, and 3) that sequence at all human functional rDNA array ends is divergent from canonical rDNA to the point that it is pseudogenic. We also show that small sequence strings of rDNA (from 45S + IGS) can be found distributed throughout the genome and are identifiable as an "rDNA-like signal", representing 0.26% of the q-arm of HSA21 and ∼2% of the total sequence of other regions tested. The size of sequence strings found in the rDNA-like signal intergrade into the size of sequence strings that make up the full-length degrading rDNA units found scattered throughout the genome. We conclude that the displaced and degrading rDNA sequences are likely of a similar origin but represent different stages in their evolution towards random sequence. Collectively, our data suggests that over vast evolutionary time, rDNA arrays contribute to the production of junk DNA. The concept that the production of rDNA pseudogenes is a by-product of concerted evolution represents a previously under-appreciated process; we demonstrate here its importance. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. Availability: A Metric for Nucleic Acid Strand Displacement Systems

    PubMed Central

    2016-01-01

    DNA strand displacement systems have transformative potential in synthetic biology. While powerful examples have been reported in DNA nanotechnology, such systems are plagued by leakage, which limits network stability, sensitivity, and scalability. An approach to mitigate leakage in DNA nanotechnology, which is applicable to synthetic biology, is to introduce mismatches to complementary fuel sequences at key locations. However, this method overlooks nuances in the secondary structure of the fuel and substrate that impact the leakage reaction kinetics in strand displacement systems. In an effort to quantify the impact of secondary structure on leakage, we introduce the concepts of availability and mutual availability and demonstrate their utility for network analysis. Our approach exposes vulnerable locations on the substrate and quantifies the secondary structure of fuel strands. Using these concepts, a 4-fold reduction in leakage has been achieved. The result is a rational design process that efficiently suppresses leakage and provides new insight into dynamic nucleic acid networks. PMID:26875531

  1. Visualization of chromatin domains created by the gypsy insulator of Drosophila.

    PubMed

    Byrd, Keith; Corces, Victor G

    2003-08-18

    Insulators might regulate gene expression by establishing and maintaining the organization of the chromatin fiber within the nucleus. Biochemical fractionation and in situ high salt extraction of lysed cells show that two known protein components of the gypsy insulator are present in the nuclear matrix. Using FISH with DNA probes located between two endogenous Su(Hw) binding sites, we show that the intervening DNA is arranged in a loop, with the two insulators located at the base. Mutations in insulator proteins, subjecting the cells to a brief heat shock, or destruction of the nuclear matrix lead to disruption of the loop. Insertion of an additional gypsy insulator in the center of the loop results in the formation of paired loops through the attachment of the inserted sequences to the nuclear matrix. These results suggest that the gypsy insulator might establish higher-order domains of chromatin structure and regulate nuclear organization by tethering the DNA to the nuclear matrix and creating chromatin loops.

  2. Representation of DNA sequences in genetic codon context with applications in exon and intron prediction.

    PubMed

    Yin, Changchuan

    2015-04-01

    To apply digital signal processing (DSP) methods to analyze DNA sequences, the sequences first must be specially mapped into numerical sequences. Thus, effective numerical mappings of DNA sequences play key roles in the effectiveness of DSP-based methods such as exon prediction. Despite numerous mappings of symbolic DNA sequences to numerical series, the existing mapping methods do not include the genetic coding features of DNA sequences. We present a novel numerical representation of DNA sequences using genetic codon context (GCC) in which the numerical values are optimized by simulation annealing to maximize the 3-periodicity signal to noise ratio (SNR). The optimized GCC representation is then applied in exon and intron prediction by Short-Time Fourier Transform (STFT) approach. The results show the GCC method enhances the SNR values of exon sequences and thus increases the accuracy of predicting protein coding regions in genomes compared with the commonly used 4D binary representation. In addition, this study offers a novel way to reveal specific features of DNA sequences by optimizing numerical mappings of symbolic DNA sequences.

  3. Single-cell genomic sequencing using Multiple Displacement Amplification.

    PubMed

    Lasken, Roger S

    2007-10-01

    Single microbial cells can now be sequenced using DNA amplified by the Multiple Displacement Amplification (MDA) reaction. The few femtograms of DNA in a bacterium are amplified into micrograms of high molecular weight DNA suitable for DNA library construction and Sanger sequencing. The MDA-generated DNA also performs well when used directly as template for pyrosequencing by the 454 Life Sciences method. While MDA from single cells loses some of the genomic sequence, this approach will greatly accelerate the pace of sequencing from uncultured microbes. The genetically linked sequences from single cells are also a powerful tool to be used in guiding genomic assembly of shotgun sequences of multiple organisms from environmental DNA extracts (metagenomic sequences).

  4. [Using IRAP markers for analysis of genetic variability in populations of resource and rare species of plants].

    PubMed

    Boronnikova, S V; Kalendar', R N

    2010-01-01

    Species-specific LTR retrotransposons were first cloned in five rare relic species of drug plants located in the Perm' region. Sequences of LTR retrotransposons were used for PCR analysis based on amplification of repeated sequences from LTR or other sites of retrotransposons (IRAP). Genetic diversity was studied in six populations of rare relic species of plants Adonis vernalis L. by means of the IRAP method; 125 polymorphic IRAP-markers were analyzed. Parameters for DNA polymorphism and genetic diversity of A. vernalis populations were determined.

  5. Combination of the immunization with the sequence close to the consensus sequence and two DNA prime plus one VLP boost generate H5 hemagglutinin specific broad neutralizing antibodies

    PubMed Central

    Wang, Guiqin; Yin, Renfu; Zhou, Paul; Ding, Zhuang

    2017-01-01

    Hemagglutinin (HA) head has long been considered to be able to elicit only a narrow, strain-specific antibody response as it undergoes rapid antigenic drift. However, we previously showed that a heterologous prime-boost strategy, in which mice were primed twice with DNA encoding HA and boosted once with virus-like particles (VLP) from an H5N1 strain A/Thailand/1(KAN)-1/2004 (noted as TH DDV), induced anti-head broad cross-H5 neutralizing antibody response. To explain why TH DDV immunization could generate such breadth, we systemically compared the neutralization breadth and potency between TH DDV sera and immune sera elicited by TH DDD (three times of DNA immunizations), TH VVV (three times of VLP immunizations), TH DV (one DNA prime plus one VLP boost) and TK DDV (plasmid DNA and VLP derived from another H5N1 strain, A/Turkey/65596/2006). Then we determined the antigenic sites (AS) on TH HA head and the key residues of the main antigenic site. Through the comparison of different regiments, we found that the combination of the immunization with the sequence close to the consensus sequence and two DNA prime plus one VLP boost caused that TH DDV immunization generate broad neutralizing antibodies. Antigenic analysis showed that TH DDV, TH DV, TH DDD and TH VVV sera recognize the common antigenic site AS1. Antibodies directed to AS1 contribute to the largest proportion of the neutralizing activity of these immune sera. Residues 188 and 193 in AS1 are the key residues which are responsible for neutralization breadth of the immune sera. Interestingly, residues 188 and 193 locate in classical antigen sites but are relatively conserved among the 16 tested strains and 1,663 HA sequences from NCBI database. Thus, our results strongly indicate that it is feasible to develop broad cross-H5 influenza vaccines against HA head. PMID:28542275

  6. Evidence of accelerated evolution and ectodermal-specific expression of presumptive BDS toxin cDNAs from Anemonia viridis.

    PubMed

    Nicosia, Aldo; Maggio, Teresa; Mazzola, Salvatore; Cuttitta, Angela

    2013-10-30

    Anemonia viridis is a widespread and extensively studied Mediterranean species of sea anemone from which a large number of polypeptide toxins, such as blood depressing substances (BDS) peptides, have been isolated. The first members of this class, BDS-1 and BDS-2, are polypeptides belonging to the β-defensin fold family and were initially described for their antihypertensive and antiviral activities. BDS-1 and BDS-2 are 43 amino acid peptides characterised by three disulfide bonds that act as neurotoxins affecting Kv3.1, Kv3.2 and Kv3.4 channel gating kinetics. In addition, BDS-1 inactivates the Nav1.7 and Nav1.3 channels. The development of a large dataset of A. viridis expressed sequence tags (ESTs) and the identification of 13 putative BDS-like cDNA sequences has attracted interest, especially as scientific and diagnostic tools. A comparison of BDS cDNA sequences showed that the untranslated regions are more conserved than the protein-coding regions. Moreover, the KA/KS ratios calculated for all pairwise comparisons showed values greater than 1, suggesting mechanisms of accelerated evolution. The structures of the BDS homologs were predicted by molecular modelling. All toxins possess similar 3D structures that consist of a triple-stranded antiparallel β-sheet and an additional small antiparallel β-sheet located downstream of the cleavage/maturation site; however, the orientation of the triple-stranded β-sheet appears to differ among the toxins. To characterise the spatial expression profile of the putative BDS cDNA sequences, tissue-specific cDNA libraries, enriched for BDS transcripts, were constructed. In addition, the proper amplification of ectodermal or endodermal markers ensured the tissue specificity of each library. Sequencing randomly selected clones from each library revealed ectodermal-specific expression of ten BDS transcripts, while transcripts of BDS-8, BDS-13, BDS-14 and BDS-15 failed to be retrieved, likely due to under-representation in our cDNA libraries. The calculation of the relative abundance of BDS transcripts in the cDNA libraries revealed that BDS-1, BDS-3, BDS-4, BDS-5 and BDS-6 are the most represented transcripts.

  7. UV-Vis Spectroscopy and Dynamic Light Scattering Study of Gold Nanorods Aggregation

    PubMed Central

    Kanjanawarut, Roejarek; Yuan, Bo

    2013-01-01

    Gold nanorods (AuNRs) were used as spectroscopic sensing elements to detect specific DNA sequences with a single-base mismatch sensitivity. The assay was based on the observation that the stabilizing repulsive forces between CTA+-coated AuNRs can be removed by citrate ions, which causes aggregation among AuNRs; whereas nucleic acids of different structures[ i.e., peptide nucleic acid (PNA), single-stranded DNA (ssDNA), PNA-DNA complex, and double-stranded DNA (dsDNA)] can retard the aggregation. Moreover, the dsDNA PNA-DNA duplexes provide larger retardation than that by unhybridized ssDNA and PNA probe. This assay can differentiate single-base mismatched targets with base substitution at different locations (center and end) with AuNRs of a larger aspect ratio. Besides ultraviolet–visable spectroscopy measurement of particle assembly-induced plasmonic coupling that in turn provides a spectroscopic detection of the specific DNA, dynamic light scattering and transmission electron microscope (TEM) were used to measure smaller degree of aggregation that can reveal sodium citrate– and dsDNA–AuNRs interactions in fine detail. PMID:23902360

  8. In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

    PubMed Central

    Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

    2017-01-01

    In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

  9. Mechanism of Genome Interrogation: How CRISPR RNA-Guided Cas9 Proteins Locate Specific Targets on DNA.

    PubMed

    Shvets, Alexey A; Kolomeisky, Anatoly B

    2017-10-03

    The ability to precisely edit and modify a genome opens endless opportunities to investigate fundamental properties of living systems as well as to advance various medical techniques and bioengineering applications. This possibility is now close to reality due to a recent discovery of the adaptive bacterial immune system, which is based on clustered regularly interspaced short palindromic repeats (CRISPR)-associated proteins (Cas) that utilize RNA to find and cut the double-stranded DNA molecules at specific locations. Here we develop a quantitative theoretical approach to analyze the mechanism of target search on DNA by CRISPR RNA-guided Cas9 proteins, which is followed by a selective cleavage of nucleic acids. It is based on a discrete-state stochastic model that takes into account the most relevant physical-chemical processes in the system. Using a method of first-passage processes, a full dynamic description of the target search is presented. It is found that the location of specific sites on DNA by CRISPR Cas9 proteins is governed by binding first to protospacer adjacent motif sequences on DNA, which is followed by reversible transitions into DNA interrogation states. In addition, the search dynamics is strongly influenced by the off-target cutting. Our theoretical calculations allow us to explain the experimental observations and to give experimentally testable predictions. Thus, the presented theoretical model clarifies some molecular aspects of the genome interrogation by CRISPR RNA-guided Cas9 proteins. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  10. Translocation-coupled DNA cleavage by the Type ISP restriction-modification enzymes

    PubMed Central

    Chand, Mahesh Kumar; Nirwan, Neha; Diffin, Fiona M.; van Aelst, Kara; Kulkarni, Manasi; Pernstich, Christian; Szczelkun, Mark D.; Saikrishnan, Kayarat

    2015-01-01

    Endonucleolytic double-strand DNA break production requires separate strand cleavage events. Although catalytic mechanisms for simple dimeric endonucleases are available, there are many complex nuclease machines which are poorly understood in comparison. Here we studied the single polypeptide Type ISP restriction-modification (RM) enzymes, which cleave random DNA between distant target sites when two enzymes collide following convergent ATP-driven translocation. We report the 2.7 Angstroms resolution X-ray crystal structure of a Type ISP enzyme-DNA complex, revealing that both the helicase-like ATPase and nuclease are unexpectedly located upstream of the direction of translocation, inconsistent with simple nuclease domain-dimerization. Using single-molecule and biochemical techniques, we demonstrate that each ATPase remodels its DNA-protein complex and translocates along DNA without looping it, leading to a collision complex where the nuclease domains are distal. Sequencing of single cleavage events suggests a previously undescribed endonuclease model, where multiple, stochastic strand nicking events combine to produce DNA scission. PMID:26389736

  11. MFP1 is a thylakoid-associated, nucleoid-binding protein with a coiled-coil structure

    PubMed Central

    Jeong, Sun Yong; Rose, Annkatrin; Meier, Iris

    2003-01-01

    Plastid DNA, like bacterial and mitochondrial DNA, is organized into protein–DNA complexes called nucleoids. Plastid nucleoids are believed to be associated with the inner envelope in developing plastids and the thylakoid membranes in mature chloroplasts, but the mechanism for this re-localization is unknown. Here, we present the further characterization of the coiled-coil DNA-binding protein MFP1 as a protein associated with nucleoids and with the thylakoid membranes in mature chloroplasts. MFP1 is located in plastids in both suspension culture cells and leaves and is attached to the thylakoid membranes with its C-terminal DNA-binding domain oriented towards the stroma. It has a major DNA-binding activity in mature Arabidopsis chloroplasts and binds to all tested chloroplast DNA fragments without detectable sequence specificity. Its expression is tightly correlated with the accumulation of thylakoid membranes. Importantly, it is associated in vivo with nucleoids, suggesting a function for MFP1 at the interface between chloroplast nucleoids and the developing thylakoid membrane system. PMID:12930969

  12. Acquisition of New DNA Sequences After Infection of Chicken Cells with Avian Myeloblastosis Virus

    PubMed Central

    Shoyab, M.; Baluda, M. A.; Evans, R.

    1974-01-01

    DNA-RNA hybridization studies between 70S RNA from avian myeloblastosis virus (AMV) and an excess of DNA from (i) AMV-induced leukemic chicken myeloblasts or (ii) a mixture of normal and of congenitally infected K-137 chicken embryos producing avian leukosis viruses revealed the presence of fast- and slow-hybridizing virus-specific DNA sequences. However, the leukemic cells contained twice the level of AMV-specific DNA sequences observed in normal chicken embryonic cells. The fast-reacting sequences were two to three times more numerous in leukemic DNA than in DNA from the mixed embryos. The slow-reacting sequences had a reiteration frequency of approximately 9 and 6, in the two respective systems. Both the fast- and the slow-reacting DNA sequences in leukemic cells exhibited a higher Tm (2 C) than the respective DNA sequences in normal cells. In normal and leukemic cells the slow hybrid sequences appeared to have a Tm which was 2 C higher than that of the fast hybrid sequences. Individual non-virus-producing chicken embryos, either group-specific antigen positive or negative, contained 40 to 100 copies of the fast sequences and 2 to 6 copies of the slowly hybridizing sequences per cell genome. Normal rat cells did not contain DNA that hybridized with AMV RNA, whereas non-virus-producing rat cells transformed by B-77 avian sarcoma virus contained only the slowly reacting sequences. The results demonstrate that leukemic cells transformed by AMV contain new AMV-specific DNA sequences which were not present before infection. PMID:16789139

  13. Evolutionary Story of a Satellite DNA from Phodopus sungorus (Rodentia, Cricetidae)

    PubMed Central

    Paço, Ana; Adega, Filomena; Meštrović, Nevenka; Plohl, Miroslav; Chaves, Raquel

    2014-01-01

    With the goal to contribute for the understanding of satellite DNA evolution and its genomic involvement, in this work it was isolated and characterized the first satellite DNA (PSUcentSat) from Phodopus sungorus (Cricetidae). Physical mapping of this sequence in P. sungorus showed large PSUcentSat arrays located at the heterochromatic (peri)centromeric region of five autosomal pairs and Y-chromosome. The presence of orthologous PSUcentSat sequences in the genomes of other Cricetidae and Muridae rodents was also verified, presenting however, an interspersed chromosomal distribution. This distribution pattern suggests a PSUcentSat-scattered location in an ancestor of Muridae/Cricetidae families, that assumed afterwards, in the descendant genome of P. sungorus a restricted localization to few chromosomes in the (peri)centromeric region. We believe that after the divergence of the studied species, PSUcentSat was most probably highly amplified in the (peri)centromeric region of some chromosome pairs of this hamster by recombinational mechanisms. The bouquet chromosome configuration (prophase I) possibly displays an important role in this selective amplification, providing physical proximity of centromeric regions between chromosomes with similar size and/or morphology. This seems particularly evident for the acrocentric chromosomes of P. sungorus (including the Y-chromosome), all presenting large PSUcentSat arrays at the (peri)centromeric region. The conservation of this sequence in the studied genomes and its (peri)centromeric amplification in P. sungorus strongly suggests functional significance, possibly displaying this satellite family different functions in the different genomes. The verification of PSUcentSat transcriptional activity in normal proliferative cells suggests that its transcription is not stage-limited, as described for some other satellites. PMID:25336681

  14. Peruvian Maca (Lepidium peruvianum) – III: The Effects of Cultivation Altitude on Phytochemical and Genetic Differences in the Four Prime Maca Phenotypes

    PubMed Central

    Meissner, Henry O.; Mscisz, Alina; Baraniak, Marek; Piatkowska, Ewa; Pisulewski, Pawel; Mrozikiewicz, Mieczyslaw; Bobkiewicz-Kozlowska, Teresa

    2017-01-01

    In two trials, dietary and Glucosinolates’ characteristics in four Maca phenotypes have been examined with an extension into the determination of DNA sequences. Hypocotyls of the four prime phenotypes of Peruvian Maca - Lepidium peruvianum Chacon, labelled as “Yellow”, “Black”, “Red” and “Purple” were separated from mixed Maca crops cultivated in four geographically-distant locations in the Peruvian Andes at altitudes between 2,800m and 4,300 m a.s.l. It was found that at higher altitudes where Red and Purple Maca phenotypes were grown, the significantly higher (P<0.05) Glucosinolates’ concentrations, adopted as the marker of Maca physiological activity, were observed with the Purple phenotype showing the highest Glucosinolates’ content at 4,300m a.s.l., followed by the Red-coloured hypocotyls. Black Maca showed a reversal, but also a significant (P<0.05) trend, while the Yellow phenotype showed no visible altitude-inflicted response (P>0.05) and has consistently the lowest Glucosinolates content. Thus, it is reasonable to assume that the altitude at which Red, Purple and Black phenotypes of L. peruvianum are grown, may be responsible for the variation in physiologic functionalities, leading to different than expected specific therapeutic and health benefits induced by Maca phenotypes grown at diverse altitudes. Although promising, insufficiently precise differences in DNA sequences failed to distinguish, without any reasonable doubt, four Maca phenotypes cultivated either in the same or geographically-distant locations, and harvested at different altitudes a.s.l. Further research on DNA sequences is needed, with more primers and larger number of Maca phenotypes, considering biosynthesis of secondary metabolites and adaptation pathways induced by harsh environment at altitudes where Maca is cultivated. PMID:28824342

  15. Peruvian Maca (Lepidium peruvianum) - III: The Effects of Cultivation Altitude on Phytochemical and Genetic Differences in the Four Prime Maca Phenotypes.

    PubMed

    Meissner, Henry O; Mscisz, Alina; Baraniak, Marek; Piatkowska, Ewa; Pisulewski, Pawel; Mrozikiewicz, Mieczyslaw; Bobkiewicz-Kozlowska, Teresa

    2017-06-01

    In two trials, dietary and Glucosinolates' characteristics in four Maca phenotypes have been examined with an extension into the determination of DNA sequences. Hypocotyls of the four prime phenotypes of Peruvian Maca - Lepidium peruvianum Chacon, labelled as "Yellow", "Black", "Red" and "Purple" were separated from mixed Maca crops cultivated in four geographically-distant locations in the Peruvian Andes at altitudes between 2,800m and 4,300 m a.s.l. It was found that at higher altitudes where Red and Purple Maca phenotypes were grown, the significantly higher ( P <0.05) Glucosinolates' concentrations, adopted as the marker of Maca physiological activity, were observed with the Purple phenotype showing the highest Glucosinolates' content at 4,300m a.s.l., followed by the Red-coloured hypocotyls. Black Maca showed a reversal, but also a significant ( P <0.05) trend, while the Yellow phenotype showed no visible altitude-inflicted response ( P >0.05) and has consistently the lowest Glucosinolates content. Thus, it is reasonable to assume that the altitude at which Red, Purple and Black phenotypes of L. peruvianum are grown, may be responsible for the variation in physiologic functionalities, leading to different than expected specific therapeutic and health benefits induced by Maca phenotypes grown at diverse altitudes. Although promising, insufficiently precise differences in DNA sequences failed to distinguish, without any reasonable doubt, four Maca phenotypes cultivated either in the same or geographically-distant locations, and harvested at different altitudes a.s.l. Further research on DNA sequences is needed, with more primers and larger number of Maca phenotypes, considering biosynthesis of secondary metabolites and adaptation pathways induced by harsh environment at altitudes where Maca is cultivated.

  16. Genome-wide prediction of cis-regulatory regions using supervised deep learning methods.

    PubMed

    Li, Yifeng; Shi, Wenqiang; Wasserman, Wyeth W

    2018-05-31

    In the human genome, 98% of DNA sequences are non-protein-coding regions that were previously disregarded as junk DNA. In fact, non-coding regions host a variety of cis-regulatory regions which precisely control the expression of genes. Thus, Identifying active cis-regulatory regions in the human genome is critical for understanding gene regulation and assessing the impact of genetic variation on phenotype. The developments of high-throughput sequencing and machine learning technologies make it possible to predict cis-regulatory regions genome wide. Based on rich data resources such as the Encyclopedia of DNA Elements (ENCODE) and the Functional Annotation of the Mammalian Genome (FANTOM) projects, we introduce DECRES based on supervised deep learning approaches for the identification of enhancer and promoter regions in the human genome. Due to their ability to discover patterns in large and complex data, the introduction of deep learning methods enables a significant advance in our knowledge of the genomic locations of cis-regulatory regions. Using models for well-characterized cell lines, we identify key experimental features that contribute to the predictive performance. Applying DECRES, we delineate locations of 300,000 candidate enhancers genome wide (6.8% of the genome, of which 40,000 are supported by bidirectional transcription data), and 26,000 candidate promoters (0.6% of the genome). The predicted annotations of cis-regulatory regions will provide broad utility for genome interpretation from functional genomics to clinical applications. The DECRES model demonstrates potentials of deep learning technologies when combined with high-throughput sequencing data, and inspires the development of other advanced neural network models for further improvement of genome annotations.

  17. Phylogenetic study of six species of Anopheles mosquitoes in Peninsular Malaysia based on inter-transcribed spacer region 2 (ITS2) of ribosomal DNA.

    PubMed

    Sum, Jia-Siang; Lee, Wenn-Chyau; Amir, Amirah; Braima, Kamil A; Jeffery, John; Abdul-Aziz, Noraishah M; Fong, Mun-Yik; Lau, Yee-Ling

    2014-07-03

    Molecular techniques are invaluable for investigation on the biodiversity of Anopheles mosquitoes. This study aimed at investigating the spatial-genetic variations among Anopheles mosquitoes from different areas of Peninsular Malaysia, as well as deciphering evolutionary relationships of the local Anopheles mosquitoes with the mosquitoes from neighbouring countries using the anopheline ITS2 rDNA gene. Mosquitoes were collected, identified, dissected to check infection status, and DNA extraction was performed for PCR with primers targeting the ITS2 rDNA region. Sequencing was done and phylogenetic tree was constructed to study the evolutionary relationship among Anopheles mosquitoes within Peninsular Malaysia, as well as across the Asian region. A total of 133 Anopheles mosquitoes consisting of six different species were collected from eight different locations across Peninsular Malaysia. Of these, 65 ITS2 rDNA sequences were obtained. The ITS2 rDNA amplicons of the studied species were of different sizes. One collected species, Anopheles sinensis, shows two distinct pools of population in Peninsular Malaysia, suggesting evolvement of geographic race or allopatric speciation. Anopheles mosquitoes from Peninsular Malaysia show close evolutionary relationship with the Asian anophelines. Nevertheless, genetic differences due to geographical segregation can be seen. Meanwhile, some Anopheles mosquitoes in Peninsular Malaysia show vicariance, exemplified by the emergence of distinct cluster of An. sinensis population.

  18. Phylogenetic study of six species of Anopheles mosquitoes in Peninsular Malaysia based on inter-transcribed spacer region 2 (ITS2) of ribosomal DNA

    PubMed Central

    2014-01-01

    Background Molecular techniques are invaluable for investigation on the biodiversity of Anopheles mosquitoes. This study aimed at investigating the spatial-genetic variations among Anopheles mosquitoes from different areas of Peninsular Malaysia, as well as deciphering evolutionary relationships of the local Anopheles mosquitoes with the mosquitoes from neighbouring countries using the anopheline ITS2 rDNA gene. Methods Mosquitoes were collected, identified, dissected to check infection status, and DNA extraction was performed for PCR with primers targeting the ITS2 rDNA region. Sequencing was done and phylogenetic tree was constructed to study the evolutionary relationship among Anopheles mosquitoes within Peninsular Malaysia, as well as across the Asian region. Results A total of 133 Anopheles mosquitoes consisting of six different species were collected from eight different locations across Peninsular Malaysia. Of these, 65 ITS2 rDNA sequences were obtained. The ITS2 rDNA amplicons of the studied species were of different sizes. One collected species, Anopheles sinensis, shows two distinct pools of population in Peninsular Malaysia, suggesting evolvement of geographic race or allopatric speciation. Conclusion Anopheles mosquitoes from Peninsular Malaysia show close evolutionary relationship with the Asian anophelines. Nevertheless, genetic differences due to geographical segregation can be seen. Meanwhile, some Anopheles mosquitoes in Peninsular Malaysia show vicariance, exemplified by the emergence of distinct cluster of An. sinensis population. PMID:24993022

  19. Genes for cytochrome c oxidase subunit I, URF2, and three tRNAs in Drosophila mitochondrial DNA.

    PubMed Central

    Clary, D O; Wolstenholme, D R

    1983-01-01

    Genes for URF2, tRNAtrp, tRNAcys, tRNAtyr and cytochrome c oxidase subunit I (COI) have been identified within a sequenced segment of the Drosophila yakuba mtDNA molecule. The five genes are arranged in the order given. Transcription of the tRNAcys and tRNAtyr genes is in the same direction as replication, while transcription of the URF2, tRNAtrp and COI genes is in the opposite direction. A similar arrangement of these genes is found in mammalian mtDNA except that in the latter, the tRNAala and tRNAasn genes are located between the tRNAtrp and tRNAcys genes. Also, a sequence found between the tRNAasn and tRNAcys genes in mammalian mtDNA, which is associated with the initiation of second strand DNA synthesis, is not found in this region of the D. yakuba mtDNA molecule. As the D. yakuba COI gene lacks a standard translation initiation codon, we consider the possibility that the quadruplet ATAA may serve this function. As in other D. yakuba mitochondrial polypeptide genes, AGA codons in the URF2 and COI genes do not correspond in position to arginine-specifying codons in the equivalent genes of mouse and yeast mtDNAs, but do most frequently correspond to serine-specifying codons. PMID:6314262

  20. Physical locations of 5S and 18S-25S rDNA in Asian and American diploid Hordeum species with the I genome.

    PubMed

    Taketa, S; Ando, H; Takeda, K; von Bothmer, R

    2001-05-01

    The physical locations of 5S and 18S-25S rDNA sequences in 15 diploid Hordeum species with the I genome were examined by double-target in situ hybridization with pTa71 (18S-25S rDNA) and pTa794 (5S rDNA) clones as probes. All the three Asian species had a species-specific rDNA pattern. In 12 American species studied, eight different rDNA types were found. The type reported previously in H. chilense (the 'chilense' type) was observed in eight American species. The chilense type had double 5S rDNA sites - two sites on one chromosome arm separated by a short distance - and two pairs of major 18S-25S rDNA sites on two pairs of satellite chromosomes. The other seven types found in American species were similar to the chilense type and could be derived from the chilense type through deletion, reduction or addition of a rDNA site. Intraspecific polymorphisms were observed in three American species. The overall similarity in rDNA patterns among American species indicates the close relationships between North and South American species and their derivation from a single ancestral source. The differences in the distribution patterns of 5S and 18S-25S rDNA between Asian and American species suggest differentiation between the I genomes of Asian and American species. The 5S and 18S-25S rDNA sites are useful chromosome markers for delimiting Asian species, but have limited value as a taxonomic character in American species. On the basis of rDNA patterns, karyotype evolution and phylogeny of the I-genome diploid species are discussed.

  1. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

    PubMed Central

    Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

    2006-01-01

    Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

  2. W-enriched satellite sequence in the Indian meal moth, Plodia interpunctella (Lepidoptera, Pyralidae).

    PubMed

    Dalíková, Martina; Zrzavá, Magda; Kubíčková, Svatava; Marec, František

    2017-10-01

    The W chromosome of most lepidopteran species represents the largest heterochromatin entity in the female genome. Although satellite DNA is a typical component of constitutive heterochromatin, there are only a few known satellite DNAs (satDNAs) located on the W chromosome in moths and butterflies. In this study, we isolated and characterized new satDNA (PiSAT1) from microdissected W chromosomes of the Indian meal moth, Plodia interpunctella. Even though the PiSAT1 is mainly localized near the female-specific segment of the W chromosome, short arrays of this satDNA also occur on autosomes and/or the Z chromosome. Probably due to the predominant location in the non-recombining part of the genome, PiSAT1 exhibits a relatively large nucleotide variability in its monomers. However, at least a part of all predicted functional motifs is located in conserved regions. Moreover, we detected polyadenylated transcripts of PiSAT1 in all developmental stages and in both sexes (female and male larvae, pupae and adults). Our results suggest a potential structural and functional role of PiSAT1 in the P. interpunctella genome, which is consistent with accumulating evidence for the important role of satDNAs in eukaryotic genomes.

  3. Ferrate oxidation of murine leukemia virus reverse transcriptase: identification of the template-primer binding domain.

    PubMed

    Reddy, G; Nanduri, V B; Basu, A; Modak, M J

    1991-08-20

    Treatment of murine leukemia virus reverse transcriptase (MuLV RT) with potassium ferrate, an oxidizing agent known to oxidize amino acids involved in phosphate binding domains of proteins, results in the irreversible inactivation of both the DNA polymerase and the RNase H activities. Significant protection from ferrate-mediated inactivation is observed in the presence of template-primer but not in the presence of substrate deoxynucleoside triphosphates. Furthermore, ferrate-treated enzyme loses template-primer binding activity as judged by UV-mediated cross-linking of radiolabeled DNA. Comparative tryptic peptide mapping by reverse-phase HPLC of native and ferrate-oxidized enzyme indicated the presence of two new peptides eluting at 38 and 57 min and a significant loss of a peptide eluting at 74 min. Purification, amino acid composition, and sequencing of these affected peptides revealed that they correspond to amino acid residues 285-295, 630-640, and 586-599, respectively, in the primary amino acid sequence of MuLV RT. These results indicate that the domains constituted by the above peptides are important for the template-primer binding function in MuLV RT. Peptide I is located in the polymerase domain whereas peptides II and III are located in the RNase H domain. Amino acid sequence analysis of peptides I and II suggested Lys-285 and Cys-635 as the probable sites of ferrate action.

  4. Structure and Genetic Content of the Megaplasmids of Neurotoxigenic Clostridium butyricum Type E Strains from Italy

    PubMed Central

    Iacobino, Angelo; Scalfaro, Concetta; Franciosa, Giovanna

    2013-01-01

    We determined the genetic maps of the megaplasmids of six neutoroxigenic Clostridium butyricum type E strains from Italy using molecular and bioinformatics techniques. The megaplasmids are circular, not linear as we had previously proposed. The differently-sized megaplasmids share a genetic region that includes structural, metabolic and regulatory genes. In addition, we found that a 168 kb genetic region is present only in the larger megaplasmids of two tested strains, whereas it is absent from the smaller megaplasmids of the four remaining strains. The genetic region unique to the larger megaplasmids contains, among other features, a locus for clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR associated (cas) genes, i.e. a bacterial adaptive immune system providing sequence-specific protection from invading genetic elements. Some CRISPR spacer sequences of the neurotoxigenic C. butyricum type E strains showed homology to prophage, phage and plasmid sequences from closely related clostridia species or from distant species, all sharing the intestinal habitat, suggesting that the CRISPR locus might be involved in the microorganism adaptation to the human or animal intestinal environment. Besides, we report here that each of four distinct CRISPR spacers partially matched DNA sequences of different prophages and phages, at identical nucleotide locations. This suggests that, at least in neurotoxigenic C. butyricum type E, the CRISPR locus is potentially able to recognize the same conserved DNA sequence of different invading genetic elements, besides targeting sequences unique to previously encountered invading DNA, as currently predicted for a CRISPR locus. Thus, the results of this study introduce the possibility that CRISPR loci can provide resistance to a wider range of invading DNA elements than previously appreciated. Whether it is more advantageous for the peculiar neurotoxigenic C. butyricum type E strains to maintain or to lose the CRISPR-cas system remains an open question. PMID:23967192

  5. Yeast Sub1 and human PC4 are G-quadruplex binding proteins that suppress genome instability at co-transcriptionally formed G4 DNA.

    PubMed

    Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun

    2017-06-02

    G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  7. Footprinting reveals that nogalamycin and actinomycin shuffle between DNA binding sites.

    PubMed Central

    Fox, K R; Waring, M J

    1986-01-01

    The hypothesis that sequence-selective DNA-binding antibiotics locate their preferred binding sites by a process involving migration from nonspecific sites has been tested by footprinting with DNAase I. Footprinting patterns on the tyrT DNA fragment produced by nogalamycin and actinomycin change with time after mixing the antibiotic with the DNA. Sites of protection as well as enhanced cleavage are seen to develop in a fashion which is both temperature and concentration-dependent. At certain sites cutting is transiently enhanced, then blocked. Limited evidence for slow reaction with echinomycin and mithramycin is presented, but the kinetics of footprinting with daunomycin and distamycin appear instantaneous. The feasibility of adducing direct evidence for shuffling by footprinting seems to be governed by slow dissociation of the antibiotic-DNA complex. It may also be dependent upon the mode of binding, be it intercalative or non-intercalative in character. Images PMID:2421246

  8. Characterization of two new plasmid DNAs found in mitochondria of wild-type Neurospora intermedia strains.

    PubMed Central

    Stohl, L L; Collins, R A; Cole, M D; Lambowitz, A M

    1982-01-01

    Mitochondria from two Neurospora intermedia strains (P4O5-Labelle and Fiji N6-6) were found to contain plasmid DNAs in addition to the standard mitochondrial DNA species. The plasmid DNAs consist of monomeric circles (4.1-4.3 kbp and 5.2-5.3 kbp for Labelle and Fiji, respectively) and oligomers in which monomers are organized as head-to-tail repeats. DNA-DNA hybridization experiments showed that the plasmids have no substantial sequence homology to mtDNA, to each other, or to a previously characterized mitochondrial plasmid from N. crassa strain Mauriceville-lc (Collins et al. Cell 24, 443-452, 1981). The intramitochondrial location of the plasmids was established by cell fractionation and nuclease protection experiments. In sexual crosses, the plasmids showed strict maternal inheritance, the same as Neurospora mitochondrial DNA. The plasmids may represent a novel class of mitochondrial genetic elements. Images PMID:6280144

  9. Structure solution of DNA-binding proteins and complexes with ARCIMBOLDO libraries

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pröpper, Kevin; Instituto de Biologia Molecular de Barcelona; Meindl, Kathrin

    2014-06-01

    The structure solution of DNA-binding protein structures and complexes based on the combination of location of DNA-binding protein motif fragments with density modification in a multi-solution frame is described. Protein–DNA interactions play a major role in all aspects of genetic activity within an organism, such as transcription, packaging, rearrangement, replication and repair. The molecular detail of protein–DNA interactions can be best visualized through crystallography, and structures emphasizing insight into the principles of binding and base-sequence recognition are essential to understanding the subtleties of the underlying mechanisms. An increasing number of high-quality DNA-binding protein structure determinations have been witnessed despite themore » fact that the crystallographic particularities of nucleic acids tend to pose specific challenges to methods primarily developed for proteins. Crystallographic structure solution of protein–DNA complexes therefore remains a challenging area that is in need of optimized experimental and computational methods. The potential of the structure-solution program ARCIMBOLDO for the solution of protein–DNA complexes has therefore been assessed. The method is based on the combination of locating small, very accurate fragments using the program Phaser and density modification with the program SHELXE. Whereas for typical proteins main-chain α-helices provide the ideal, almost ubiquitous, small fragments to start searches, in the case of DNA complexes the binding motifs and DNA double helix constitute suitable search fragments. The aim of this work is to provide an effective library of search fragments as well as to determine the optimal ARCIMBOLDO strategy for the solution of this class of structures.« less

  10. Methylation patterns of repetitive DNA sequences in germ cells of Mus musculus.

    PubMed

    Sanford, J; Forrester, L; Chapman, V; Chandley, A; Hastie, N

    1984-03-26

    The major and the minor satellite sequences of Mus musculus were undermethylated in both sperm and oocyte DNAs relative to the amount of undermethylation observed in adult somatic tissue DNA. This hypomethylation was specific for satellite sequences in sperm DNA. Dispersed repetitive and low copy sequences show a high degree of methylation in sperm DNA; however, a dispersed repetitive sequence was undermethylated in oocyte DNA. This finding suggests a difference in the amount of total genomic DNA methylation between sperm and oocyte DNA. The methylation levels of the minor satellite sequences did not change during spermiogenesis, and were not associated with the onset of meiosis or a specific stage in sperm development.

  11. Evolutionary dynamics and sites of illegitimate recombination revealed in the interspersion and sequence junctions of two nonhomologous satellite DNAs in cactophilic Drosophila species.

    PubMed

    Kuhn, G C S; Teo, C H; Schwarzacher, T; Heslop-Harrison, J S

    2009-05-01

    Satellite DNA (satDNA) is a major component of genomes but relatively little is known about the fine-scale organization of unrelated satDNAs residing at the same chromosome location, and the sequence structure and dynamics of satDNA junctions. We studied the organization and sequence junctions of two nonhomologous satDNAs, pBuM and DBC-150, in three species from the neotropical Drosophila buzzatii cluster (repleta group). In situ hybridization to microchromosomes, interphase nuclei and extended DNA fibers showed frequent interspersion of the two satellites in D. gouveai, D. antonietae and, to a lesser extent, D. seriema. We isolated by PCR six pBuM x DBC-150 junctions: four are exclusive to D. gouveai and two are exclusive to D. antonietae. The six junction breakpoints occur at different positions within monomers, suggesting independent origin. Four junctions showed abrupt transitions between the two satellites, whereas two junctions showed a distinct 10 bp tandem duplication before the junction. Unlike pBuM, DBC-150 junction repeats are more variable than randomly cloned monomers and showed diagnostic features in common to a 3-monomer higher-order repeat seen in the sister species D. serido. The high levels of interspersion between pBuM and DBC-150 repeats suggest extensive rearrangements between the two satellites, maybe favored by specific features of the microchromosomes. Our interpretation is that the junctions evolved by multiples events of illegitimate recombination between nonhomologous satDNA repeats, with subsequent rounds of unequal crossing-over expanding the copy number of some of the junctions.

  12. Process of labeling specific chromosomes using recombinant repetitive DNA

    DOEpatents

    Moyzis, R.K.; Meyne, J.

    1988-02-12

    Chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family members and consensus sequences of the repetitive DNA families for the chromosome preferential sequences. The selected low homology regions are then hybridized with chromosomes to determine those low homology regions hybridized with a specific chromosome under normal stringency conditions.

  13. Visualizing conserved gene location across microbe genomes

    NASA Astrophysics Data System (ADS)

    Shaw, Chris D.

    2009-01-01

    This paper introduces an analysis-based zoomable visualization technique for displaying the location of genes across many related species of microbes. The purpose of this visualizatiuon is to enable a biologist to examine the layout of genes in the organism of interest with respect to the gene organization of related organisms. During the genomic annotation process, the ability to observe gene organization in common with previously annotated genomes can help a biologist better confirm the structure and function of newly analyzed microbe DNA sequences. We have developed a visualization and analysis tool that enables the biologist to observe and examine gene organization among genomes, in the context of the primary sequence of interest. This paper describes the visualization and analysis steps, and presents a case study using a number of Rickettsia genomes.

  14. DNA Scrunching in the Packaging of Viral Genomes.

    PubMed

    Waters, James T; Kim, Harold D; Gumbart, James C; Lu, Xiang-Jun; Harvey, Stephen C

    2016-07-07

    The motors that drive double-stranded DNA (dsDNA) genomes into viral capsids are among the strongest of all biological motors for which forces have been measured, but it is not known how they generate force. We previously proposed that the DNA is not a passive substrate but that it plays an active role in force generation. This "scrunchworm hypothesis" holds that the motor proteins repeatedly dehydrate and rehydrate the DNA, which then undergoes cyclic shortening and lengthening motions. These are captured by a coupled protein-DNA grip-and-release cycle to rectify the motion and translocate the DNA into the capsid. In this study, we examined the interactions of dsDNA with the dodecameric connector protein of bacteriophage ϕ29, using molecular dynamics simulations on four different DNA sequences, starting from two different conformations (A-DNA and B-DNA). In all four simulations starting with the protein equilibrated with A-DNA in the channel, we observed transitions to a common, metastable, highly scrunched conformation, designated A*. This conformation is very similar to one recently reported by Kumar and Grubmüller in much longer MD simulations on B-DNA docked into the ϕ29 connector. These results are significant for four reasons. First, the scrunched conformations occur spontaneously, without requiring lever-like protein motions often believed to be necessary for DNA translocation. Second, the transition takes place within the connector, providing the location of the putative "dehydrator". Third, the protein has more contacts with one strand of the DNA than with the other; the former was identified in single-molecule laser tweezer experiments as the "load-bearing strand". Finally, the spontaneity of the DNA-protein interaction suggests that it may play a role in the initial docking of DNA in motors like that of T4 that can load and package any sequence.

  15. Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.

    PubMed

    Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook

    2014-11-01

    As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  16. A novel tandem repeat sequence located on human chromosome 4p: isolation and characterization.

    PubMed

    Kogi, M; Fukushige, S; Lefevre, C; Hadano, S; Ikeda, J E

    1997-06-01

    In an effort to analyze the genomic region of the distal half of human chromosome 4p, to where Huntington disease and other diseases have been mapped, we have isolated the cosmid clone (CRS447) that was likely to contain a region with specific repeat sequences. Clone CRS447 was subjected to detailed analysis, including chromosome mapping, restriction mapping, and DNA sequencing. Chromosome mapping by both a human-CHO hybrid cell panel and FISH revealed that CRS447 was predominantly located in the 4p15.1-15.3 region. CRS447 was shown to consist of tandem repeats of 4.7-kb units present on chromosome 4p. A single EcoRI unit was subcloned (pRS447), and the complete sequence was determined as 4752 nucleotides. When pRS447 was used as a probe, the number of copies of this repeat per haploid genome was estimated to be 50-70. Sequence analysis revealed that it contained two internal CA repeats and one putative ORF. Database search established that this sequence was unreported. However, two homologous STS markers were found in the database. We concluded that CRS447/pRS447 is a novel tandem repeat sequence that is mainly specific to human chromosome 4p.

  17. Impact of the Location of CpG Methylation within the GSTP1 Gene on Its Specificity as a DNA Marker for Hepatocellular Carcinoma

    PubMed Central

    Jain, Surbhi; Boldbaatar, Batbold; Hamilton, James P.; Lin, Selena Y.; Chang, Ting-Tsung; Chen, Shun-Hua; Song, Wei; Meltzer, Stephen J.; Block, Timothy M.; Su, Ying-Hsiu

    2012-01-01

    Hypermethylation of the glutathione S-transferase π 1 (GSTP1) gene promoter region has been reported to be a potential biomarker to distinguish hepatocellular carcinoma (HCC) from other liver diseases. However, reports regarding how specific a marker it is have ranged from 100% to 0%. We hypothesized that, to a large extent, the variation of specificity depends on the location of the CpG sites analyzed. To test this hypothesis, we compared the methylation status of the GSTP1 promoter region of the DNA isolated from HCC, cirrhosis, hepatitis, and normal liver tissues by bisulfite–PCR sequencing. We found that the 5′ region of the position −48 nt from the transcription start site of the GSTP1 gene is selectively methylated in HCC, whereas the 3′ region is methylated in all liver tissues examined, including normal liver and the HCC tissue. Interestingly, when DNA derived from fetal liver and 11 nonhepatic normal tissue was also examined by bisulfite-PCR sequencing, we found that methylation of the 3′ region of the promoter appeared to be liver-specific. A methylation-specific PCR assay targeting the 5′ region of the promoter was developed and used to quantify the methylated GSTP1 gene in various diseased liver tissues including HCC. When we used an assay targeting the 3′ region, we found that the methylation of the 5′-end of the GSTP1 promoter was significantly more specific than that of the 3′-end (97.1% vs. 60%, p<0.0001 by Fisher's exact test) for distinguishing HCC (n = 120) from hepatitis (n = 35) and cirrhosis (n = 35). Encouragingly, 33.8% of the AFP-negative HCC contained the methylated GSTP1 gene. This study clearly demonstrates the importance of the location of CpG site methylation for HCC specificity and how liver-specific DNA methylation should be considered when an epigenetic DNA marker is studied for detection of HCC. PMID:22536438

  18. Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach.

    PubMed

    Frimodt-Møller, Jakob; Charbon, Godefroid; Krogfelt, Karen A; Løbner-Olesen, Anders

    2017-09-11

    The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In bacteria, the impact of the genetic context on the function of a genetic element can be difficult to assess. Several mechanisms, including topological effects, transcriptional interference from neighboring genes, and/or replication-associated gene dosage, may affect the function of a given genetic element. Here, we describe a method that permits the random integration of a DNA element into the chromosome of Escherichia coli and select the most favorable locations using a simple growth competition experiment. The method takes advantage of a well-described transposon-based system of random insertion, coupled with a selection of the fittest clone(s) by growth advantage, a procedure that is easily adjustable to experimental needs. The nature of the fittest clone(s) can be determined by whole-genome sequencing on a complex multi-clonal population or by easy gene walking for the rapid identification of selected clones. Here, the non-coding DNA region DARS2, which controls the initiation of chromosome replication in E. coli, was used as an example. The function of DARS2 is known to be affected by replication-associated gene dosage; the closer DARS2 gets to the origin of DNA replication, the more active it becomes. DARS2 was randomly inserted into the chromosome of a DARS2-deleted strain. The resultant clones containing individual insertions were pooled and competed against one another for hundreds of generations. Finally, the fittest clones were characterized and found to contain DARS2 inserted in close proximity to the original DARS2 location.

  19. Enlightenment of Yeast Mitochondrial Homoplasmy: Diversified Roles of Gene Conversion

    PubMed Central

    Ling, Feng; Mikawa, Tsutomu; Shibata, Takehiko

    2011-01-01

    Mitochondria have their own genomic DNA. Unlike the nuclear genome, each cell contains hundreds to thousands of copies of mitochondrial DNA (mtDNA). The copies of mtDNA tend to have heterogeneous sequences, due to the high frequency of mutagenesis, but are quickly homogenized within a cell (“homoplasmy”) during vegetative cell growth or through a few sexual generations. Heteroplasmy is strongly associated with mitochondrial diseases, diabetes and aging. Recent studies revealed that the yeast cell has the machinery to homogenize mtDNA, using a common DNA processing pathway with gene conversion; i.e., both genetic events are initiated by a double-stranded break, which is processed into 3′ single-stranded tails. One of the tails is base-paired with the complementary sequence of the recipient double-stranded DNA to form a D-loop (homologous pairing), in which repair DNA synthesis is initiated to restore the sequence lost by the breakage. Gene conversion generates sequence diversity, depending on the divergence between the donor and recipient sequences, especially when it occurs among a number of copies of a DNA sequence family with some sequence variations, such as in immunoglobulin diversification in chicken. MtDNA can be regarded as a sequence family, in which the members tend to be diversified by a high frequency of spontaneous mutagenesis. Thus, it would be interesting to determine why and how double-stranded breakage and D-loop formation induce sequence homogenization in mitochondria and sequence diversification in nuclear DNA. We will review the mechanisms and roles of mtDNA homoplasmy, in contrast to nuclear gene conversion, which diversifies gene and genome sequences, to provide clues toward understanding how the common DNA processing pathway results in such divergent outcomes. PMID:24710143

  20. Bombyx mori Nucleopolyhedrovirus Encodes a DNA-Binding Protein Capable of Destabilizing Duplex DNA

    PubMed Central

    Mikhailov, Victor S.; Mikhailova, Alla L.; Iwanaga, Masashi; Gomi, Sumiko; Maeda, Susumu

    1998-01-01

    A DNA-binding protein (designated DBP) with an apparent molecular mass of 38 kDa was purified to homogeneity from BmN cells (derived from Bombyx mori) infected with the B. mori nucleopolyhedrovirus (BmNPV). Six peptides obtained after digestion of the isolated protein with Achromobacter protease I were partially or completely sequenced. The determined amino acid sequences indicated that DBP was encoded by an open reading frame (ORF16) located at nucleotides (nt) 16189 to 17139 in the BmNPV genome (GenBank accession no. L33180). This ORF (designated dbp) is a homolog of Autographa californica multicapsid NPV ORF25, whose product has not been identified. BmNPV DBP is predicted to contain 317 amino acids (calculated molecular mass of 36.7 kDa) and to have an isoelectric point of 7.8. DBP showed a tendency to multimerization in the course of purification and was found to bind preferentially to single-stranded DNA. When bound to oligonucleotides, DBP protected them from hydrolysis by phage T4 DNA polymerase-associated 3′→5′ exonuclease. The sizes of the protected fragments indicated that a binding site size for DBP is about 30 nt per protein monomer. DBP, but not BmNPV LEF-3, was capable of unwinding partial DNA duplexes in an in vitro system. This helix-destabilizing ability is consistent with the prediction that DBP functions as a single-stranded DNA binding protein in virus replication. PMID:9525636

Top