Normalization, bias correction, and peak calling for ChIP-seq

PubMed Central

Diaz, Aaron; Park, Kiyoub; Lim, Daniel A.; Song, Jun S.

2012-01-01

Next-generation sequencing is rapidly transforming our ability to profile the transcriptional, genetic, and epigenetic states of a cell. In particular, sequencing DNA from the immunoprecipitation of protein-DNA complexes (ChIP-seq) and methylated DNA (MeDIP-seq) can reveal the locations of protein binding sites and epigenetic modifications. These approaches contain numerous biases which may significantly influence the interpretation of the resulting data. Rigorous computational methods for detecting and removing such biases are still lacking. Also, multi-sample normalization still remains an important open problem. This theoretical paper systematically characterizes the biases and properties of ChIP-seq data by comparing 62 separate publicly available datasets, using rigorous statistical models and signal processing techniques. Statistical methods for separating ChIP-seq signal from background noise, as well as correcting enrichment test statistics for sequence-dependent and sonication biases, are presented. Our method effectively separates reads into signal and background components prior to normalization, improving the signal-to-noise ratio. Moreover, most peak callers currently use a generic null model which suffers from low specificity at the sensitivity level requisite for detecting subtle, but true, ChIP enrichment. The proposed method of determining a cell type-specific null model, which accounts for cell type-specific biases, is shown to be capable of achieving a lower false discovery rate at a given significance threshold than current methods. PMID:22499706

Strand-Specific Analysis of DNA Synthesis and Proteins Association with DNA Replication Forks in Budding Yeast.

PubMed

Yu, Chuanhe; Gan, Haiyun; Zhang, Zhiguo

2018-01-01

DNA replication initiates at DNA replication origins after unwinding of double-strand DNA(dsDNA) by replicative helicase to generate single-stranded DNA (ssDNA) templates for the continuous synthesis of leading-strand and the discontinuous synthesis of lagging-strand. Therefore, methods capable of detecting strand-specific information will likely yield insight into the association of proteins at leading and lagging strand of DNA replication forks and the regulation of leading and lagging strand synthesis during DNA replication. The enrichment and Sequencing of Protein-Associated Nascent DNA (eSPAN), which measure the relative amounts of proteins at nascent leading and lagging strands of DNA replication forks, is a step-wise procedure involving the chromatin immunoprecipitation (ChIP) of a protein of interest followed by the enrichment of protein-associated nascent DNA through BrdU immunoprecipitation. The isolated ssDNA is then subjected to strand-specific sequencing. This method can detect whether a protein is enriched at leading or lagging strand of DNA replication forks. In addition to eSPAN, two other strand-specific methods, (ChIP-ssSeq), which detects potential protein-ssDNA binding and BrdU-IP-ssSeq, which can measure synthesis of both leading and lagging strand, were developed along the way. These methods can provide strand-specific and complementary information about the association of the target protein with DNA replication forks as well as synthesis of leading and lagging strands genome wide. Below, we describe the detailed eSPAN, ChIP-ssSeq, and BrdU-IP-ssSeq protocols.

Chromatin immunoprecipitation (ChIP) method for non-model fruit flies (Diptera: Tephritidae) and evidence of histone modifications.

PubMed

Nagalingam, Kumaran; Lorenc, Michał T; Manoli, Sahana; Cameron, Stephen L; Clarke, Anthony R; Dudley, Kevin J

2018-01-01

Interactions between DNA and proteins located in the cell nucleus play an important role in controlling physiological processes by specifying, augmenting and regulating context-specific transcription events. Chromatin immunoprecipitation (ChIP) is a widely used methodology to study DNA-protein interactions and has been successfully used in various cell types for over three decades. More recently, by combining ChIP with genomic screening technologies and Next Generation Sequencing (e.g. ChIP-seq), it has become possible to profile DNA-protein interactions (including covalent histone modifications) across entire genomes. However, the applicability of ChIP-chip and ChIP-seq has rarely been extended to non-model species because of a number of technical challenges. Here we report a method that can be used to identify genome wide covalent histone modifications in a group of non-model fruit fly species (Diptera: Tephritidae). The method was developed by testing and refining protocols that have been used in model organisms, including Drosophila melanogaster. We demonstrate that this method is suitable for a group of economically important pest fruit fly species, viz., Bactrocera dorsalis, Ceratitis capitata, Zeugodacus cucurbitae and Bactrocera tryoni. We also report an example ChIP-seq dataset for B. tryoni, providing evidence for histone modifications in the genome of a tephritid fruit fly for the first time. Since tephritids are major agricultural pests globally, this methodology will be a valuable resource to study taxa-specific evolutionary questions and to assist with pest management. It also provides a basis for researchers working with other non-model species to undertake genome wide DNA-protein interaction studies.

ChIPpeakAnno: a Bioconductor package to annotate ChIP-seq and ChIP-chip data

PubMed Central

2010-01-01

Background Chromatin immunoprecipitation (ChIP) followed by high-throughput sequencing (ChIP-seq) or ChIP followed by genome tiling array analysis (ChIP-chip) have become standard technologies for genome-wide identification of DNA-binding protein target sites. A number of algorithms have been developed in parallel that allow identification of binding sites from ChIP-seq or ChIP-chip datasets and subsequent visualization in the University of California Santa Cruz (UCSC) Genome Browser as custom annotation tracks. However, summarizing these tracks can be a daunting task, particularly if there are a large number of binding sites or the binding sites are distributed widely across the genome. Results We have developed ChIPpeakAnno as a Bioconductor package within the statistical programming environment R to facilitate batch annotation of enriched peaks identified from ChIP-seq, ChIP-chip, cap analysis of gene expression (CAGE) or any experiments resulting in a large number of enriched genomic regions. The binding sites annotated with ChIPpeakAnno can be viewed easily as a table, a pie chart or plotted in histogram form, i.e., the distribution of distances to the nearest genes for each set of peaks. In addition, we have implemented functionalities for determining the significance of overlap between replicates or binding sites among transcription factors within a complex, and for drawing Venn diagrams to visualize the extent of the overlap between replicates. Furthermore, the package includes functionalities to retrieve sequences flanking putative binding sites for PCR amplification, cloning, or motif discovery, and to identify Gene Ontology (GO) terms associated with adjacent genes. Conclusions ChIPpeakAnno enables batch annotation of the binding sites identified from ChIP-seq, ChIP-chip, CAGE or any technology that results in a large number of enriched genomic regions within the statistical programming environment R. Allowing users to pass their own annotation data such as a different Chromatin immunoprecipitation (ChIP) preparation and a dataset from literature, or existing annotation packages, such as GenomicFeatures and BSgenome, provides flexibility. Tight integration to the biomaRt package enables up-to-date annotation retrieval from the BioMart database. PMID:20459804

An Alternative Approach to ChIP-Seq Normalization Enables Detection of Genome-Wide Changes in Histone H3 Lysine 27 Trimethylation upon EZH2 Inhibition

PubMed Central

Yuan, Chih-Chi; Craske, Madeleine Lisa; Labhart, Paul; Guler, Gulfem D.; Arnott, David; Maile, Tobias M.; Busby, Jennifer; Henry, Chisato; Kelly, Theresa K.; Tindell, Charles A.; Jhunjhunwala, Suchit; Zhao, Feng; Hatton, Charlie; Bryant, Barbara M.

2016-01-01

Chromatin immunoprecipitation and DNA sequencing (ChIP-seq) has been instrumental in inferring the roles of histone post-translational modifications in the regulation of transcription, chromatin compaction and other cellular processes that require modulation of chromatin structure. However, analysis of ChIP-seq data is challenging when the manipulation of a chromatin-modifying enzyme significantly affects global levels of histone post-translational modifications. For example, small molecule inhibition of the methyltransferase EZH2 reduces global levels of histone H3 lysine 27 trimethylation (H3K27me3). However, standard ChIP-seq normalization and analysis methods fail to detect a decrease upon EZH2 inhibitor treatment. We overcome this challenge by employing an alternative normalization approach that is based on the addition of Drosophila melanogaster chromatin and a D. melanogaster-specific antibody into standard ChIP reactions. Specifically, the use of an antibody that exclusively recognizes the D. melanogaster histone variant H2Av enables precipitation of D. melanogaster chromatin as a minor fraction of the total ChIP DNA. The D. melanogaster ChIP-seq tags are used to normalize the human ChIP-seq data from DMSO and EZH2 inhibitor-treated samples. Employing this strategy, a substantial reduction in H3K27me3 signal is now observed in ChIP-seq data from EZH2 inhibitor treated samples. PMID:27875550

An Alternative Approach to ChIP-Seq Normalization Enables Detection of Genome-Wide Changes in Histone H3 Lysine 27 Trimethylation upon EZH2 Inhibition.

PubMed

Egan, Brian; Yuan, Chih-Chi; Craske, Madeleine Lisa; Labhart, Paul; Guler, Gulfem D; Arnott, David; Maile, Tobias M; Busby, Jennifer; Henry, Chisato; Kelly, Theresa K; Tindell, Charles A; Jhunjhunwala, Suchit; Zhao, Feng; Hatton, Charlie; Bryant, Barbara M; Classon, Marie; Trojer, Patrick

2016-01-01

Chromatin immunoprecipitation and DNA sequencing (ChIP-seq) has been instrumental in inferring the roles of histone post-translational modifications in the regulation of transcription, chromatin compaction and other cellular processes that require modulation of chromatin structure. However, analysis of ChIP-seq data is challenging when the manipulation of a chromatin-modifying enzyme significantly affects global levels of histone post-translational modifications. For example, small molecule inhibition of the methyltransferase EZH2 reduces global levels of histone H3 lysine 27 trimethylation (H3K27me3). However, standard ChIP-seq normalization and analysis methods fail to detect a decrease upon EZH2 inhibitor treatment. We overcome this challenge by employing an alternative normalization approach that is based on the addition of Drosophila melanogaster chromatin and a D. melanogaster-specific antibody into standard ChIP reactions. Specifically, the use of an antibody that exclusively recognizes the D. melanogaster histone variant H2Av enables precipitation of D. melanogaster chromatin as a minor fraction of the total ChIP DNA. The D. melanogaster ChIP-seq tags are used to normalize the human ChIP-seq data from DMSO and EZH2 inhibitor-treated samples. Employing this strategy, a substantial reduction in H3K27me3 signal is now observed in ChIP-seq data from EZH2 inhibitor treated samples.

FUNDAMENTALS OF VITAMIN D HORMONE-REGULATED GENE EXPRESSION

PubMed Central

Pike, J. Wesley; Meyer, Mark B.

2014-01-01

Initial research focused upon several known genetic targets provided early insight into the mechanism of action of the vitamin D hormone (1,25-dihydroxyvitamin D3 (1,25(OH)2D3)). Recently, however, a series of technical advances involving the coupling of chromatin immunoprecipitation (ChIP) to unbiased methodologies that initially involved tiled DNA microarrays (ChIP-chip analysis) and now Next Generation DNA Sequencing techniques (ChIP-Seq analysis) has opened new avenues of research into the mechanisms through which 1,25(OH)2D3 regulates gene expression. In this review, we summarize briefly the results of this early work and then focus on more recent studies in which ChIP-chip and ChIP-seq analyses have been used to explore the mechanisms of 1,25(OH)2D3 action on a genome-wide scale providing specific target genes as examples. The results of this work have advanced our understanding of the mechanisms involved at both genetic and epigenetic levels and have revealed a series of new principles through which the vitamin D hormone functions to control the expression of genes. PMID:24239506

Multiplexed ChIP-Seq Using Direct Nucleosome Barcoding: A Tool for High-Throughput Chromatin Analysis.

PubMed

Chabbert, Christophe D; Adjalley, Sophie H; Steinmetz, Lars M; Pelechano, Vicent

2018-01-01

Chromatin immunoprecipitation followed by sequencing (ChIP-Seq) or microarray hybridization (ChIP-on-chip) are standard methods for the study of transcription factor binding sites and histone chemical modifications. However, these approaches only allow profiling of a single factor or protein modification at a time.In this chapter, we present Bar-ChIP, a higher throughput version of ChIP-Seq that relies on the direct ligation of molecular barcodes to chromatin fragments. Bar-ChIP enables the concurrent profiling of multiple DNA-protein interactions and is therefore amenable to experimental scale-up, without the need for any robotic instrumentation.

ChIP-Seq Analysis for Identifying Genome-Wide Histone Modifications Associated with Stress-Responsive Genes in Plants.

PubMed

Li, Guosheng; Jagadeeswaran, Guru; Mort, Andrew; Sunkar, Ramanjulu

2017-01-01

Histone modifications represent the crux of epigenetic gene regulation essential for most biological processes including abiotic stress responses in plants. Thus, identification of histone modifications at the genome-scale can provide clues for how some genes are 'turned-on' while some others are "turned-off" in response to stress. This chapter details a step-by-step protocol for identifying genome-wide histone modifications associated with stress-responsive gene regulation using chromatin immunoprecipitation (ChIP) followed by sequencing of the DNA (ChIP-seq).

Genome-wide identification and characterisation of human DNA replication origins by initiation site sequencing (ini-seq)

PubMed Central

Langley, Alexander R.; Gräf, Stefan; Smith, James C.; Krude, Torsten

2016-01-01

Next-generation sequencing has enabled the genome-wide identification of human DNA replication origins. However, different approaches to mapping replication origins, namely (i) sequencing isolated small nascent DNA strands (SNS-seq); (ii) sequencing replication bubbles (bubble-seq) and (iii) sequencing Okazaki fragments (OK-seq), show only limited concordance. To address this controversy, we describe here an independent high-resolution origin mapping technique that we call initiation site sequencing (ini-seq). In this approach, newly replicated DNA is directly labelled with digoxigenin-dUTP near the sites of its initiation in a cell-free system. The labelled DNA is then immunoprecipitated and genomic locations are determined by DNA sequencing. Using this technique we identify >25,000 discrete origin sites at sub-kilobase resolution on the human genome, with high concordance between biological replicates. Most activated origins identified by ini-seq are found at transcriptional start sites and contain G-quadruplex (G4) motifs. They tend to cluster in early-replicating domains, providing a correlation between early replication timing and local density of activated origins. Origins identified by ini-seq show highest concordance with sites identified by SNS-seq, followed by OK-seq and bubble-seq. Furthermore, germline origins identified by positive nucleotide distribution skew jumps overlap with origins identified by ini-seq and OK-seq more frequently and more specifically than do sites identified by either SNS-seq or bubble-seq. PMID:27587586

Genome-wide identification and characterisation of human DNA replication origins by initiation site sequencing (ini-seq).

PubMed

Langley, Alexander R; Gräf, Stefan; Smith, James C; Krude, Torsten

2016-12-01

Next-generation sequencing has enabled the genome-wide identification of human DNA replication origins. However, different approaches to mapping replication origins, namely (i) sequencing isolated small nascent DNA strands (SNS-seq); (ii) sequencing replication bubbles (bubble-seq) and (iii) sequencing Okazaki fragments (OK-seq), show only limited concordance. To address this controversy, we describe here an independent high-resolution origin mapping technique that we call initiation site sequencing (ini-seq). In this approach, newly replicated DNA is directly labelled with digoxigenin-dUTP near the sites of its initiation in a cell-free system. The labelled DNA is then immunoprecipitated and genomic locations are determined by DNA sequencing. Using this technique we identify >25,000 discrete origin sites at sub-kilobase resolution on the human genome, with high concordance between biological replicates. Most activated origins identified by ini-seq are found at transcriptional start sites and contain G-quadruplex (G4) motifs. They tend to cluster in early-replicating domains, providing a correlation between early replication timing and local density of activated origins. Origins identified by ini-seq show highest concordance with sites identified by SNS-seq, followed by OK-seq and bubble-seq. Furthermore, germline origins identified by positive nucleotide distribution skew jumps overlap with origins identified by ini-seq and OK-seq more frequently and more specifically than do sites identified by either SNS-seq or bubble-seq. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

iTAR: a web server for identifying target genes of transcription factors using ChIP-seq or ChIP-chip data.

PubMed

Yang, Chia-Chun; Andrews, Erik H; Chen, Min-Hsuan; Wang, Wan-Yu; Chen, Jeremy J W; Gerstein, Mark; Liu, Chun-Chi; Cheng, Chao

2016-08-12

Chromatin immunoprecipitation followed by massively parallel DNA sequencing (ChIP-seq) or microarray hybridization (ChIP-chip) has been widely used to determine the genomic occupation of transcription factors (TFs). We have previously developed a probabilistic method, called TIP (Target Identification from Profiles), to identify TF target genes using ChIP-seq/ChIP-chip data. To achieve high specificity, TIP applies a conservative method to estimate significance of target genes, with the trade-off being a relatively low sensitivity of target gene identification compared to other methods. Additionally, TIP's output does not render binding-peak locations or intensity, information highly useful for visualization and general experimental biological use, while the variability of ChIP-seq/ChIP-chip file formats has made input into TIP more difficult than desired. To improve upon these facets, here we present are fined TIP with key extensions. First, it implements a Gaussian mixture model for p-value estimation, increasing target gene identification sensitivity and more accurately capturing the shape of TF binding profile distributions. Second, it enables the incorporation of TF binding-peak data by identifying their locations in significant target gene promoter regions and quantifies their strengths. Finally, for full ease of implementation we have incorporated it into a web server ( http://syslab3.nchu.edu.tw/iTAR/ ) that enables flexibility of input file format, can be used across multiple species and genome assembly versions, and is freely available for public use. The web server additionally performs GO enrichment analysis for the identified target genes to reveal the potential function of the corresponding TF. The iTAR web server provides a user-friendly interface and supports target gene identification in seven species, ranging from yeast to human. To facilitate investigating the quality of ChIP-seq/ChIP-chip data, the web server generates the chart of the characteristic binding profiles and the density plot of normalized regulatory scores. The iTAR web server is a useful tool in identifying TF target genes from ChIP-seq/ChIP-chip data and discovering biological insights.

Comprehensive evaluation of genome-wide 5-hydroxymethylcytosine profiling approaches in human DNA.

PubMed

Skvortsova, Ksenia; Zotenko, Elena; Luu, Phuc-Loi; Gould, Cathryn M; Nair, Shalima S; Clark, Susan J; Stirzaker, Clare

2017-01-01

The discovery that 5-methylcytosine (5mC) can be oxidized to 5-hydroxymethylcytosine (5hmC) by the ten-eleven translocation (TET) proteins has prompted wide interest in the potential role of 5hmC in reshaping the mammalian DNA methylation landscape. The gold-standard bisulphite conversion technologies to study DNA methylation do not distinguish between 5mC and 5hmC. However, new approaches to mapping 5hmC genome-wide have advanced rapidly, although it is unclear how the different methods compare in accurately calling 5hmC. In this study, we provide a comparative analysis on brain DNA using three 5hmC genome-wide approaches, namely whole-genome bisulphite/oxidative bisulphite sequencing (WG Bis/OxBis-seq), Infinium HumanMethylation450 BeadChip arrays coupled with oxidative bisulphite (HM450K Bis/OxBis) and antibody-based immunoprecipitation and sequencing of hydroxymethylated DNA (hMeDIP-seq). We also perform loci-specific TET-assisted bisulphite sequencing (TAB-seq) for validation of candidate regions. We show that whole-genome single-base resolution approaches are advantaged in providing precise 5hmC values but require high sequencing depth to accurately measure 5hmC, as this modification is commonly in low abundance in mammalian cells. HM450K arrays coupled with oxidative bisulphite provide a cost-effective representation of 5hmC distribution, at CpG sites with 5hmC levels >~10%. However, 5hmC analysis is restricted to the genomic location of the probes, which is an important consideration as 5hmC modification is commonly enriched at enhancer elements. Finally, we show that the widely used hMeDIP-seq method provides an efficient genome-wide profile of 5hmC and shows high correlation with WG Bis/OxBis-seq 5hmC distribution in brain DNA. However, in cell line DNA with low levels of 5hmC, hMeDIP-seq-enriched regions are not detected by WG Bis/OxBis or HM450K, either suggesting misinterpretation of 5hmC calls by hMeDIP or lack of sensitivity of the latter methods. We highlight both the advantages and caveats of three commonly used genome-wide 5hmC profiling technologies and show that interpretation of 5hmC data can be significantly influenced by the sensitivity of methods used, especially as the levels of 5hmC are low and vary in different cell types and different genomic locations.

Guidelines for whole genome bisulphite sequencing of intact and FFPET DNA on the Illumina HiSeq X Ten.

PubMed

Nair, Shalima S; Luu, Phuc-Loi; Qu, Wenjia; Maddugoda, Madhavi; Huschtscha, Lily; Reddel, Roger; Chenevix-Trench, Georgia; Toso, Martina; Kench, James G; Horvath, Lisa G; Hayes, Vanessa M; Stricker, Phillip D; Hughes, Timothy P; White, Deborah L; Rasko, John E J; Wong, Justin J-L; Clark, Susan J

2018-05-28

Comprehensive genome-wide DNA methylation profiling is critical to gain insights into epigenetic reprogramming during development and disease processes. Among the different genome-wide DNA methylation technologies, whole genome bisulphite sequencing (WGBS) is considered the gold standard for assaying genome-wide DNA methylation at single base resolution. However, the high sequencing cost to achieve the optimal depth of coverage limits its application in both basic and clinical research. To achieve 15× coverage of the human methylome, using WGBS, requires approximately three lanes of 100-bp-paired-end Illumina HiSeq 2500 sequencing. It is important, therefore, for advances in sequencing technologies to be developed to enable cost-effective high-coverage sequencing. In this study, we provide an optimised WGBS methodology, from library preparation to sequencing and data processing, to enable 16-20× genome-wide coverage per single lane of HiSeq X Ten, HCS 3.3.76. To process and analyse the data, we developed a WGBS pipeline (METH10X) that is fast and can call SNPs. We performed WGBS on both high-quality intact DNA and degraded DNA from formalin-fixed paraffin-embedded tissue. First, we compared different library preparation methods on the HiSeq 2500 platform to identify the best method for sequencing on the HiSeq X Ten. Second, we optimised the PhiX and genome spike-ins to achieve higher quality and coverage of WGBS data on the HiSeq X Ten. Third, we performed integrated whole genome sequencing (WGS) and WGBS of the same DNA sample in a single lane of HiSeq X Ten to improve data output. Finally, we compared methylation data from the HiSeq 2500 and HiSeq X Ten and found high concordance (Pearson r > 0.9×). Together we provide a systematic, efficient and complete approach to perform and analyse WGBS on the HiSeq X Ten. Our protocol allows for large-scale WGBS studies at reasonable processing time and cost on the HiSeq X Ten platform.

Methylation Sensitive Amplification Polymorphism Sequencing (MSAP-Seq)-A Method for High-Throughput Analysis of Differentially Methylated CCGG Sites in Plants with Large Genomes.

PubMed

Chwialkowska, Karolina; Korotko, Urszula; Kosinska, Joanna; Szarejko, Iwona; Kwasniewski, Miroslaw

2017-01-01

Epigenetic mechanisms, including histone modifications and DNA methylation, mutually regulate chromatin structure, maintain genome integrity, and affect gene expression and transposon mobility. Variations in DNA methylation within plant populations, as well as methylation in response to internal and external factors, are of increasing interest, especially in the crop research field. Methylation Sensitive Amplification Polymorphism (MSAP) is one of the most commonly used methods for assessing DNA methylation changes in plants. This method involves gel-based visualization of PCR fragments from selectively amplified DNA that are cleaved using methylation-sensitive restriction enzymes. In this study, we developed and validated a new method based on the conventional MSAP approach called Methylation Sensitive Amplification Polymorphism Sequencing (MSAP-Seq). We improved the MSAP-based approach by replacing the conventional separation of amplicons on polyacrylamide gels with direct, high-throughput sequencing using Next Generation Sequencing (NGS) and automated data analysis. MSAP-Seq allows for global sequence-based identification of changes in DNA methylation. This technique was validated in Hordeum vulgare . However, MSAP-Seq can be straightforwardly implemented in different plant species, including crops with large, complex and highly repetitive genomes. The incorporation of high-throughput sequencing into MSAP-Seq enables parallel and direct analysis of DNA methylation in hundreds of thousands of sites across the genome. MSAP-Seq provides direct genomic localization of changes and enables quantitative evaluation. We have shown that the MSAP-Seq method specifically targets gene-containing regions and that a single analysis can cover three-quarters of all genes in large genomes. Moreover, MSAP-Seq's simplicity, cost effectiveness, and high-multiplexing capability make this method highly affordable. Therefore, MSAP-Seq can be used for DNA methylation analysis in crop plants with large and complex genomes.

Methylation Sensitive Amplification Polymorphism Sequencing (MSAP-Seq)—A Method for High-Throughput Analysis of Differentially Methylated CCGG Sites in Plants with Large Genomes

PubMed Central

Chwialkowska, Karolina; Korotko, Urszula; Kosinska, Joanna; Szarejko, Iwona; Kwasniewski, Miroslaw

2017-01-01

Epigenetic mechanisms, including histone modifications and DNA methylation, mutually regulate chromatin structure, maintain genome integrity, and affect gene expression and transposon mobility. Variations in DNA methylation within plant populations, as well as methylation in response to internal and external factors, are of increasing interest, especially in the crop research field. Methylation Sensitive Amplification Polymorphism (MSAP) is one of the most commonly used methods for assessing DNA methylation changes in plants. This method involves gel-based visualization of PCR fragments from selectively amplified DNA that are cleaved using methylation-sensitive restriction enzymes. In this study, we developed and validated a new method based on the conventional MSAP approach called Methylation Sensitive Amplification Polymorphism Sequencing (MSAP-Seq). We improved the MSAP-based approach by replacing the conventional separation of amplicons on polyacrylamide gels with direct, high-throughput sequencing using Next Generation Sequencing (NGS) and automated data analysis. MSAP-Seq allows for global sequence-based identification of changes in DNA methylation. This technique was validated in Hordeum vulgare. However, MSAP-Seq can be straightforwardly implemented in different plant species, including crops with large, complex and highly repetitive genomes. The incorporation of high-throughput sequencing into MSAP-Seq enables parallel and direct analysis of DNA methylation in hundreds of thousands of sites across the genome. MSAP-Seq provides direct genomic localization of changes and enables quantitative evaluation. We have shown that the MSAP-Seq method specifically targets gene-containing regions and that a single analysis can cover three-quarters of all genes in large genomes. Moreover, MSAP-Seq's simplicity, cost effectiveness, and high-multiplexing capability make this method highly affordable. Therefore, MSAP-Seq can be used for DNA methylation analysis in crop plants with large and complex genomes. PMID:29250096

Illuminating choices for library prep: a comparison of library preparation methods for whole genome sequencing of Cryptococcus neoformans using Illumina HiSeq.

PubMed

Rhodes, Johanna; Beale, Mathew A; Fisher, Matthew C

2014-01-01

The industry of next-generation sequencing is constantly evolving, with novel library preparation methods and new sequencing machines being released by the major sequencing technology companies annually. The Illumina TruSeq v2 library preparation method was the most widely used kit and the market leader; however, it has now been discontinued, and in 2013 was replaced by the TruSeq Nano and TruSeq PCR-free methods, leaving a gap in knowledge regarding which is the most appropriate library preparation method to use. Here, we used isolates from the pathogenic fungi Cryptococcus neoformans var. grubii and sequenced them using the existing TruSeq DNA v2 kit (Illumina), along with two new kits: the TruSeq Nano DNA kit (Illumina) and the NEBNext Ultra DNA kit (New England Biolabs) to provide a comparison. Compared to the original TruSeq DNA v2 kit, both newer kits gave equivalent or better sequencing data, with increased coverage. When comparing the two newer kits, we found little difference in cost and workflow, with the NEBNext Ultra both slightly cheaper and faster than the TruSeq Nano. However, the quality of data generated using the TruSeq Nano DNA kit was superior due to higher coverage at regions of low GC content, and more SNPs identified. Researchers should therefore evaluate their resources and the type of application (and hence data quality) being considered when ultimately deciding on which library prep method to use.

A fast one-chip event-preprocessor and sequencer for the Simbol-X Low Energy Detector

NASA Astrophysics Data System (ADS)

Schanz, T.; Tenzer, C.; Maier, D.; Kendziorra, E.; Santangelo, A.

2010-12-01

We present an FPGA-based digital camera electronics consisting of an Event-Preprocessor (EPP) for on-board data preprocessing and a related Sequencer (SEQ) to generate the necessary signals to control the readout of the detector. The device has been originally designed for the Simbol-X low energy detector (LED). The EPP operates on 64×64 pixel images and has a real-time processing capability of more than 8000 frames per second. The already working releases of the EPP and the SEQ are now combined into one Digital-Camera-Controller-Chip (D3C).

Diff-seq: A high throughput sequencing-based mismatch detection assay for DNA variant enrichment and discovery

PubMed Central

Karas, Vlad O; Sinnott-Armstrong, Nicholas A; Varghese, Vici; Shafer, Robert W; Greenleaf, William J; Sherlock, Gavin

2018-01-01

Abstract Much of the within species genetic variation is in the form of single nucleotide polymorphisms (SNPs), typically detected by whole genome sequencing (WGS) or microarray-based technologies. However, WGS produces mostly uninformative reads that perfectly match the reference, while microarrays require genome-specific reagents. We have developed Diff-seq, a sequencing-based mismatch detection assay for SNP discovery without the requirement for specialized nucleic-acid reagents. Diff-seq leverages the Surveyor endonuclease to cleave mismatched DNA molecules that are generated after cross-annealing of a complex pool of DNA fragments. Sequencing libraries enriched for Surveyor-cleaved molecules result in increased coverage at the variant sites. Diff-seq detected all mismatches present in an initial test substrate, with specific enrichment dependent on the identity and context of the variation. Application to viral sequences resulted in increased observation of variant alleles in a biologically relevant context. Diff-Seq has the potential to increase the sensitivity and efficiency of high-throughput sequencing in the detection of variation. PMID:29361139

Identification of Prostate Cancer-Specific microDNAs

DTIC Science & Technology

2014-12-01

displacement amplification (MDA). 2 adopted multiple displacement amplification (MDA) with random primers for enriched circular DNA by rolling circle ... amplification (RCA) (Fig. 1) and then amplified DNA fragments were subject to deep sequencing. Sequence NO of Reads seq 1 184 seq 2 133 seq 3 2407 seq...prostate cancer cells through multiple displacement amplification .  Clone #7 is the top candidate which has been cloned in an expression vector and it

DNA Microarray for Rapid Detection and Identification of Food and Water Borne Bacteria: From Dry to Wet Lab.

PubMed

Ranjbar, Reza; Behzadi, Payam; Najafi, Ali; Roudi, Raheleh

2017-01-01

A rapid, accurate, flexible and reliable diagnostic method may significantly decrease the costs of diagnosis and treatment. Designing an appropriate microarray chip reduces noises and probable biases in the final result. The aim of this study was to design and construct a DNA Microarray Chip for a rapid detection and identification of 10 important bacterial agents. In the present survey, 10 unique genomic regions relating to 10 pathogenic bacterial agents including Escherichia coli (E.coli), Shigella boydii, Sh.dysenteriae, Sh.flexneri, Sh.sonnei, Salmonella typhi, S.typhimurium, Brucella sp., Legionella pneumophila, and Vibrio cholera were selected for designing specific long oligo microarray probes. For this reason, the in-silico operations including utilization of the NCBI RefSeq database, Servers of PanSeq and Gview, AlleleID 7.7 and Oligo Analyzer 3.1 was done. On the other hand, the in-vitro part of the study comprised stages of robotic microarray chip probe spotting, bacterial DNAs extraction and DNA labeling, hybridization and microarray chip scanning. In wet lab section, different tools and apparatus such as Nexterion® Slide E, Qarray mini spotter, NimbleGen kit, TrayMix TM S4, and Innoscan 710 were used. A DNA microarray chip including 10 long oligo microarray probes was designed and constructed for detection and identification of 10 pathogenic bacteria. The DNA microarray chip was capable to identify all 10 bacterial agents tested simultaneously. The presence of a professional bioinformatician as a probe designer is needed to design appropriate multifunctional microarray probes to increase the accuracy of the outcomes.

Performance of amplicon-based next generation DNA sequencing for diagnostic gene mutation profiling in oncopathology.

PubMed

Sie, Daoud; Snijders, Peter J F; Meijer, Gerrit A; Doeleman, Marije W; van Moorsel, Marinda I H; van Essen, Hendrik F; Eijk, Paul P; Grünberg, Katrien; van Grieken, Nicole C T; Thunnissen, Erik; Verheul, Henk M; Smit, Egbert F; Ylstra, Bauke; Heideman, Daniëlle A M

2014-10-01

Next generation DNA sequencing (NGS) holds promise for diagnostic applications, yet implementation in routine molecular pathology practice requires performance evaluation on DNA derived from routine formalin-fixed paraffin-embedded (FFPE) tissue specimens. The current study presents a comprehensive analysis of TruSeq Amplicon Cancer Panel-based NGS using a MiSeq Personal sequencer (TSACP-MiSeq-NGS) for somatic mutation profiling. TSACP-MiSeq-NGS (testing 212 hotspot mutation amplicons of 48 genes) and a data analysis pipeline were evaluated in a retrospective learning/test set approach (n = 58/n = 45 FFPE-tumor DNA samples) against 'gold standard' high-resolution-melting (HRM)-sequencing for the genes KRAS, EGFR, BRAF and PIK3CA. Next, the performance of the validated test algorithm was assessed in an independent, prospective cohort of FFPE-tumor DNA samples (n = 75). In the learning set, a number of minimum parameter settings was defined to decide whether a FFPE-DNA sample is qualified for TSACP-MiSeq-NGS and for calling mutations. The resulting test algorithm revealed 82% (37/45) compliance to the quality criteria and 95% (35/37) concordant assay findings for KRAS, EGFR, BRAF and PIK3CA with HRM-sequencing (kappa = 0.92; 95% CI = 0.81-1.03) in the test set. Subsequent application of the validated test algorithm to the prospective cohort yielded a success rate of 84% (63/75), and a high concordance with HRM-sequencing (95% (60/63); kappa = 0.92; 95% CI = 0.84-1.01). TSACP-MiSeq-NGS detected 77 mutations in 29 additional genes. TSACP-MiSeq-NGS is suitable for diagnostic gene mutation profiling in oncopathology.

Sunflower centromeres consist of a centromere-specific LINE and a chromosome-specific tandem repeat.

PubMed

Nagaki, Kiyotaka; Tanaka, Keisuke; Yamaji, Naoki; Kobayashi, Hisato; Murata, Minoru

2015-01-01

The kinetochore is a protein complex including kinetochore-specific proteins that plays a role in chromatid segregation during mitosis and meiosis. The complex associates with centromeric DNA sequences that are usually species-specific. In plant species, tandem repeats including satellite DNA sequences and retrotransposons have been reported as centromeric DNA sequences. In this study on sunflowers, a cDNA-encoding centromere-specific histone H3 (CENH3) was isolated from a cDNA pool from a seedling, and an antibody was raised against a peptide synthesized from the deduced cDNA. The antibody specifically recognized the sunflower CENH3 (HaCENH3) and showed centromeric signals by immunostaining and immunohistochemical staining analysis. The antibody was also applied in chromatin immunoprecipitation (ChIP)-Seq to isolate centromeric DNA sequences and two different types of repetitive DNA sequences were identified. One was a long interspersed nuclear element (LINE)-like sequence, which showed centromere-specific signals on almost all chromosomes in sunflowers. This is the first report of a centromeric LINE sequence, suggesting possible centromere targeting ability. Another type of identified repetitive DNA was a tandem repeat sequence with a 187-bp unit that was found only on a pair of chromosomes. The HaCENH3 content of the tandem repeats was estimated to be much higher than that of the LINE, which implies centromere evolution from LINE-based centromeres to more stable tandem-repeat-based centromeres. In addition, the epigenetic status of the sunflower centromeres was investigated by immunohistochemical staining and ChIP, and it was found that centromeres were heterochromatic.

Combined Targeted DNA Sequencing in Non-Small Cell Lung Cancer (NSCLC) Using UNCseq and NGScopy, and RNA Sequencing Using UNCqeR for the Detection of Genetic Aberrations in NSCLC

PubMed Central

Walter, Vonn; Patel, Nirali M.; Eberhard, David A.; Hayward, Michele C.; Salazar, Ashley H.; Jo, Heejoon; Soloway, Matthew G.; Wilkerson, Matthew D.; Parker, Joel S.; Yin, Xiaoying; Zhang, Guosheng; Siegel, Marni B.; Rosson, Gary B.; Earp, H. Shelton; Sharpless, Norman E.; Gulley, Margaret L.; Weck, Karen E.

2015-01-01

The recent FDA approval of the MiSeqDx platform provides a unique opportunity to develop targeted next generation sequencing (NGS) panels for human disease, including cancer. We have developed a scalable, targeted panel-based assay termed UNCseq, which involves a NGS panel of over 200 cancer-associated genes and a standardized downstream bioinformatics pipeline for detection of single nucleotide variations (SNV) as well as small insertions and deletions (indel). In addition, we developed a novel algorithm, NGScopy, designed for samples with sparse sequencing coverage to detect large-scale copy number variations (CNV), similar to human SNP Array 6.0 as well as small-scale intragenic CNV. Overall, we applied this assay to 100 snap-frozen lung cancer specimens lacking same-patient germline DNA (07–0120 tissue cohort) and validated our results against Sanger sequencing, SNP Array, and our recently published integrated DNA-seq/RNA-seq assay, UNCqeR, where RNA-seq of same-patient tumor specimens confirmed SNV detected by DNA-seq, if RNA-seq coverage depth was adequate. In addition, we applied the UNCseq assay on an independent lung cancer tumor tissue collection with available same-patient germline DNA (11–1115 tissue cohort) and confirmed mutations using assays performed in a CLIA-certified laboratory. We conclude that UNCseq can identify SNV, indel, and CNV in tumor specimens lacking germline DNA in a cost-efficient fashion. PMID:26076459

Separation and parallel sequencing of the genomes and transcriptomes of single cells using G&T-seq.

PubMed

Macaulay, Iain C; Teng, Mabel J; Haerty, Wilfried; Kumar, Parveen; Ponting, Chris P; Voet, Thierry

2016-11-01

Parallel sequencing of a single cell's genome and transcriptome provides a powerful tool for dissecting genetic variation and its relationship with gene expression. Here we present a detailed protocol for G&T-seq, a method for separation and parallel sequencing of genomic DNA and full-length polyA(+) mRNA from single cells. We provide step-by-step instructions for the isolation and lysis of single cells; the physical separation of polyA(+) mRNA from genomic DNA using a modified oligo-dT bead capture and the respective whole-transcriptome and whole-genome amplifications; and library preparation and sequence analyses of these amplification products. The method allows the detection of thousands of transcripts in parallel with the genetic variants captured by the DNA-seq data from the same single cell. G&T-seq differs from other currently available methods for parallel DNA and RNA sequencing from single cells, as it involves physical separation of the DNA and RNA and does not require bespoke microfluidics platforms. The process can be implemented manually or through automation. When performed manually, paired genome and transcriptome sequencing libraries from eight single cells can be produced in ∼3 d by researchers experienced in molecular laboratory work. For users with experience in the programming and operation of liquid-handling robots, paired DNA and RNA libraries from 96 single cells can be produced in the same time frame. Sequence analysis and integration of single-cell G&T-seq DNA and RNA data requires a high level of bioinformatics expertise and familiarity with a wide range of informatics tools.

Micro-chromatin Immunoprecipation (μChIP) Protocol for Real-time PCR Analysis of a Limited Amount of Cells.

PubMed

Gillotin, Sébastien; Guillemot, François

2016-06-20

Chromatin immunoprecipitation followed by deep sequencing (ChIP-Seq) is an important strategy to study gene regulation. When availability of cells is limited, however, it can be useful to focus on specific genes to investigate in depth the role of transcription factors or histone marks. Unfortunately, performing ChIP experiments to study transcription factors' binding to DNA can be difficult when biological material is restricted. This protocol describes a robust method to perform μChIP for over-expressed or endogenous transcription factors using ~100,000 cells per ChIP experiment (Masserdotti et al ., 2015). We also describe optimization steps, which we think are critical for this protocol to work and which can be used to further reduce the number of cells.

Indel detection from DNA and RNA sequencing data with transIndel.

PubMed

Yang, Rendong; Van Etten, Jamie L; Dehm, Scott M

2018-04-19

Insertions and deletions (indels) are a major class of genomic variation associated with human disease. Indels are primarily detected from DNA sequencing (DNA-seq) data but their transcriptional consequences remain unexplored due to challenges in discriminating medium-sized and large indels from splicing events in RNA-seq data. Here, we developed transIndel, a splice-aware algorithm that parses the chimeric alignments predicted by a short read aligner and reconstructs the mid-sized insertions and large deletions based on the linear alignments of split reads from DNA-seq or RNA-seq data. TransIndel exhibits competitive or superior performance over eight state-of-the-art indel detection tools on benchmarks using both synthetic and real DNA-seq data. Additionally, we applied transIndel to DNA-seq and RNA-seq datasets from 333 primary prostate cancer patients from The Cancer Genome Atlas (TCGA) and 59 metastatic prostate cancer patients from AACR-PCF Stand-Up- To-Cancer (SU2C) studies. TransIndel enhanced the taxonomy of DNA- and RNA-level alterations in prostate cancer by identifying recurrent FOXA1 indels as well as exitron splicing in genes implicated in disease progression. Our study demonstrates that transIndel is a robust tool for elucidation of medium- and large-sized indels from DNA-seq and RNA-seq data. Including RNA-seq in indel discovery efforts leads to significant improvements in sensitivity for identification of med-sized and large indels missed by DNA-seq, and reveals non-canonical RNA-splicing events in genes associated with disease pathology.

Determination of fetal DNA fraction from the plasma of pregnant women using sequence read counts.

PubMed

Kim, Sung K; Hannum, Gregory; Geis, Jennifer; Tynan, John; Hogg, Grant; Zhao, Chen; Jensen, Taylor J; Mazloom, Amin R; Oeth, Paul; Ehrich, Mathias; van den Boom, Dirk; Deciu, Cosmin

2015-08-01

This study introduces a novel method, referred to as SeqFF, for estimating the fetal DNA fraction in the plasma of pregnant women and to infer the underlying mechanism that allows for such statistical modeling. Autosomal regional read counts from whole-genome massively parallel single-end sequencing of circulating cell-free DNA (ccfDNA) from the plasma of 25 312 pregnant women were used to train a multivariate model. The pretrained model was then applied to 505 pregnant samples to assess the performance of SeqFF against known methodologies for fetal DNA fraction calculations. Pearson's correlation between chromosome Y and SeqFF for pregnancies with male fetuses from two independent cohorts ranged from 0.932 to 0.938. Comparison between a single-nucleotide polymorphism-based approach and SeqFF yielded a Pearson's correlation of 0.921. Paired-end sequencing suggests that shorter ccfDNA, that is, less than 150 bp in length, is nonuniformly distributed across the genome. Regions exhibiting an increased proportion of short ccfDNA, which are more likely of fetal origin, tend to provide more information in the SeqFF calculations. SeqFF is a robust and direct method to determine fetal DNA fraction. Furthermore, the method is applicable to both male and female pregnancies and can greatly improve the accuracy of noninvasive prenatal testing for fetal copy number variation. © 2015 John Wiley & Sons, Ltd.

Development of a High-Throughput Resequencing Array for the Detection of Pathogenic Mutations in Osteogenesis Imperfecta

PubMed Central

Wang, Yao; Cui, Yazhou; Zhou, Xiaoyan; Han, Jinxiang

2015-01-01

Objective Osteogenesis imperfecta (OI) is a rare inherited skeletal disease, characterized by bone fragility and low bone density. The mutations in this disorder have been widely reported to be on various exonal hotspots of the candidate genes, including COL1A1, COL1A2, CRTAP, LEPRE1, and FKBP10, thus creating a great demand for precise genetic tests. However, large genome sizes make the process daunting and the analyses, inefficient and expensive. Therefore, we aimed at developing a fast, accurate, efficient, and cheaper sequencing platform for OI diagnosis; and to this end, use of an advanced array-based technique was proposed. Method A CustomSeq Affymetrix Resequencing Array was established for high-throughput sequencing of five genes simultaneously. Genomic DNA extraction from 13 OI patients and 85 normal controls and amplification using long-range PCR (LR-PCR) were followed by DNA fragmentation and chip hybridization, according to standard Affymetrix protocols. Hybridization signals were determined using GeneChip Sequence Analysis Software (GSEQ). To examine the feasibility, the outcome from new resequencing approach was validated by conventional capillary sequencing method. Result Overall call rates using resequencing array was 96–98% and the agreement between microarray and capillary sequencing was 99.99%. 11 out of 13 OI patients with pathogenic mutations were successfully detected by the chip analysis without adjustment, and one mutation could also be identified using manual visual inspection. Conclusion A high-throughput resequencing array was developed that detects the disease-associated mutations in OI, providing a potential tool to facilitate large-scale genetic screening for OI patients. Through this method, a novel mutation was also found. PMID:25742658

Is this the right normalization? A diagnostic tool for ChIP-seq normalization.

PubMed

Angelini, Claudia; Heller, Ruth; Volkinshtein, Rita; Yekutieli, Daniel

2015-05-09

Chip-seq experiments are becoming a standard approach for genome-wide profiling protein-DNA interactions, such as detecting transcription factor binding sites, histone modification marks and RNA Polymerase II occupancy. However, when comparing a ChIP sample versus a control sample, such as Input DNA, normalization procedures have to be applied in order to remove experimental source of biases. Despite the substantial impact that the choice of the normalization method can have on the results of a ChIP-seq data analysis, their assessment is not fully explored in the literature. In particular, there are no diagnostic tools that show whether the applied normalization is indeed appropriate for the data being analyzed. In this work we propose a novel diagnostic tool to examine the appropriateness of the estimated normalization procedure. By plotting the empirical densities of log relative risks in bins of equal read count, along with the estimated normalization constant, after logarithmic transformation, the researcher is able to assess the appropriateness of the estimated normalization constant. We use the diagnostic plot to evaluate the appropriateness of the estimates obtained by CisGenome, NCIS and CCAT on several real data examples. Moreover, we show the impact that the choice of the normalization constant can have on standard tools for peak calling such as MACS or SICER. Finally, we propose a novel procedure for controlling the FDR using sample swapping. This procedure makes use of the estimated normalization constant in order to gain power over the naive choice of constant (used in MACS and SICER), which is the ratio of the total number of reads in the ChIP and Input samples. Linear normalization approaches aim to estimate a scale factor, r, to adjust for different sequencing depths when comparing ChIP versus Input samples. The estimated scaling factor can easily be incorporated in many peak caller algorithms to improve the accuracy of the peak identification. The diagnostic plot proposed in this paper can be used to assess how adequate ChIP/Input normalization constants are, and thus it allows the user to choose the most adequate estimate for the analysis.

Evaluation of partial 16S ribosomal DNA sequencing for identification of nocardia species by using the MicroSeq 500 system with an expanded database.

PubMed

Cloud, Joann L; Conville, Patricia S; Croft, Ann; Harmsen, Dag; Witebsky, Frank G; Carroll, Karen C

2004-02-01

Identification of clinically significant nocardiae to the species level is important in patient diagnosis and treatment. A study was performed to evaluate Nocardia species identification obtained by partial 16S ribosomal DNA (rDNA) sequencing by the MicroSeq 500 system with an expanded database. The expanded portion of the database was developed from partial 5' 16S rDNA sequences derived from 28 reference strains (from the American Type Culture Collection and the Japanese Collection of Microorganisms). The expanded MicroSeq 500 system was compared to (i). conventional identification obtained from a combination of growth characteristics with biochemical and drug susceptibility tests; (ii). molecular techniques involving restriction enzyme analysis (REA) of portions of the 16S rRNA and 65-kDa heat shock protein genes; and (iii). when necessary, sequencing of a 999-bp fragment of the 16S rRNA gene. An unknown isolate was identified as a particular species if the sequence obtained by partial 16S rDNA sequencing by the expanded MicroSeq 500 system was 99.0% similar to that of the reference strain. Ninety-four nocardiae representing 10 separate species were isolated from patient specimens and examined by using the three different methods. Sequencing of partial 16S rDNA by the expanded MicroSeq 500 system resulted in only 72% agreement with conventional methods for species identification and 90% agreement with the alternative molecular methods. Molecular methods for identification of Nocardia species provide more accurate and rapid results than the conventional methods using biochemical and susceptibility testing. With an expanded database, the MicroSeq 500 system for partial 16S rDNA was able to correctly identify the human pathogens N. brasiliensis, N. cyriacigeorgica, N. farcinica, N. nova, N. otitidiscaviarum, and N. veterana.

BrAD-seq: Breath Adapter Directional sequencing: a streamlined, ultra-simple and fast library preparation protocol for strand specific mRNA library construction.

PubMed

Townsley, Brad T; Covington, Michael F; Ichihashi, Yasunori; Zumstein, Kristina; Sinha, Neelima R

2015-01-01

Next Generation Sequencing (NGS) is driving rapid advancement in biological understanding and RNA-sequencing (RNA-seq) has become an indispensable tool for biology and medicine. There is a growing need for access to these technologies although preparation of NGS libraries remains a bottleneck to wider adoption. Here we report a novel method for the production of strand specific RNA-seq libraries utilizing the terminal breathing of double-stranded cDNA to capture and incorporate a sequencing adapter. Breath Adapter Directional sequencing (BrAD-seq) reduces sample handling and requires far fewer enzymatic steps than most available methods to produce high quality strand-specific RNA-seq libraries. The method we present is optimized for 3-prime Digital Gene Expression (DGE) libraries and can easily extend to full transcript coverage shotgun (SHO) type strand-specific libraries and is modularized to accommodate a diversity of RNA and DNA input materials. BrAD-seq offers a highly streamlined and inexpensive option for RNA-seq libraries.

A MBD-seq protocol for large-scale methylome-wide studies with (very) low amounts of DNA.

PubMed

Aberg, Karolina A; Chan, Robin F; Shabalin, Andrey A; Zhao, Min; Turecki, Gustavo; Staunstrup, Nicklas Heine; Starnawska, Anna; Mors, Ole; Xie, Lin Y; van den Oord, Edwin Jcg

2017-09-01

We recently showed that, after optimization, our methyl-CpG binding domain sequencing (MBD-seq) application approximates the methylome-wide coverage obtained with whole-genome bisulfite sequencing (WGB-seq), but at a cost that enables adequately powered large-scale association studies. A prior drawback of MBD-seq is the relatively large amount of genomic DNA (ideally >1 µg) required to obtain high-quality data. Biomaterials are typically expensive to collect, provide a finite amount of DNA, and may simply not yield sufficient starting material. The ability to use low amounts of DNA will increase the breadth and number of studies that can be conducted. Therefore, we further optimized the enrichment step. With this low starting material protocol, MBD-seq performed equally well, or better, than the protocol requiring ample starting material (>1 µg). Using only 15 ng of DNA as input, there is minimal loss in data quality, achieving 93% of the coverage of WGB-seq (with standard amounts of input DNA) at similar false/positive rates. Furthermore, across a large number of genomic features, the MBD-seq methylation profiles closely tracked those observed for WGB-seq with even slightly larger effect sizes. This suggests that MBD-seq provides similar information about the methylome and classifies methylation status somewhat more accurately. Performance decreases with <15 ng DNA as starting material but, even with as little as 5 ng, MBD-seq still achieves 90% of the coverage of WGB-seq with comparable genome-wide methylation profiles. Thus, the proposed protocol is an attractive option for adequately powered and cost-effective methylome-wide investigations using (very) low amounts of DNA.

Library construction for next-generation sequencing: Overviews and challenges

PubMed Central

Head, Steven R.; Komori, H. Kiyomi; LaMere, Sarah A.; Whisenant, Thomas; Van Nieuwerburgh, Filip; Salomon, Daniel R.; Ordoukhanian, Phillip

2014-01-01

High-throughput sequencing, also known as next-generation sequencing (NGS), has revolutionized genomic research. In recent years, NGS technology has steadily improved, with costs dropping and the number and range of sequencing applications increasing exponentially. Here, we examine the critical role of sequencing library quality and consider important challenges when preparing NGS libraries from DNA and RNA sources. Factors such as the quantity and physical characteristics of the RNA or DNA source material as well as the desired application (i.e., genome sequencing, targeted sequencing, RNA-seq, ChIP-seq, RIP-seq, and methylation) are addressed in the context of preparing high quality sequencing libraries. In addition, the current methods for preparing NGS libraries from single cells are also discussed. PMID:24502796

Single-Cell mRNA-Seq Using the Fluidigm C1 System and Integrated Fluidics Circuits.

PubMed

Gong, Haibiao; Do, Devin; Ramakrishnan, Ramesh

2018-01-01

Single-cell mRNA-seq is a valuable tool to dissect expression profiles and to understand the regulatory network of genes. Microfluidics is well suited for single-cell analysis owing both to the small volume of the reaction chambers and easiness of automation. Here we describe the workflow of single-cell mRNA-seq using C1 IFC, which can isolate and process up to 96 cells. Both on-chip procedure (lysis, reverse transcription, and preamplification PCR) and off-chip sequencing library preparation protocols are described. The workflow generates full-length mRNA information, which is more valuable compared to 3' end counting method for many applications.

Plasmonic SERS nanochips and nanoprobes for medical diagnostics and bio-energy applications

NASA Astrophysics Data System (ADS)

Ngo, Hoan T.; Wang, Hsin-Neng; Crawford, Bridget M.; Fales, Andrew M.; Vo-Dinh, Tuan

2017-02-01

The development of rapid, easy-to-use, cost-effective, high accuracy, and high sensitive DNA detection methods for molecular diagnostics has been receiving increasing interest. Over the last five years, our laboratory has developed several chip-based DNA detection techniques including the molecular sentinel-on-chip (MSC), the multiplex MSC, and the inverse molecular sentinel-on-chip (iMS-on-Chip). In these techniques, plasmonic surface-enhanced Raman scattering (SERS) Nanowave chips were functionalized with DNA probes for single-step DNA detection. Sensing mechanisms were based on hybridization of target sequences and DNA probes, resulting in a distance change between SERS reporters and the Nanowave chip's gold surface. This distance change resulted in change in SERS intensity, thus indicating the presence and capture of the target sequences. Our techniques were single-step DNA detection techniques. Target sequences were detected by simple delivery of sample solutions onto DNA probe-functionalized Nanowave chips and SERS signals were measured after 1h - 2h incubation. Target sequence labeling or washing to remove unreacted components was not required, making the techniques simple, easy-to-use, and cost effective. The usefulness of the techniques for medical diagnostics was illustrated by the detection of genetic biomarkers for respiratory viral infection and of dengue virus 4 DNA.

Processing and population genetic analysis of multigenic datasets with ProSeq3 software.

PubMed

Filatov, Dmitry A

2009-12-01

The current tendency in molecular population genetics is to use increasing numbers of genes in the analysis. Here I describe a program for handling and population genetic analysis of DNA polymorphism data collected from multiple genes. The program includes a sequence/alignment editor and an internal relational database that simplify the preparation and manipulation of multigenic DNA polymorphism datasets. The most commonly used DNA polymorphism analyses are implemented in ProSeq3, facilitating population genetic analysis of large multigenic datasets. Extensive input/output options make ProSeq3 a convenient hub for sequence data processing and analysis. The program is available free of charge from http://dps.plants.ox.ac.uk/sequencing/proseq.htm.

DNA methylome profiling of maternal peripheral blood and placentas reveal potential fetal DNA markers for non-invasive prenatal testing.

PubMed

Xiang, Yuqian; Zhang, Junyu; Li, Qiaoli; Zhou, Xinyao; Wang, Teng; Xu, Mingqing; Xia, Shihui; Xing, Qinghe; Wang, Lei; He, Lin; Zhao, Xinzhi

2014-09-01

Utilizing epigenetic (DNA methylation) differences to differentiate between maternal peripheral blood (PBL) and fetal (placental) DNA has been a promising strategy for non-invasive prenatal testing (NIPT). However, the differentially methylated regions (DMRs) have yet to be fully ascertained. In the present study, we performed genome-wide comparative methylome analysis between maternal PBL and placental DNA from pregnancies of first trimester by methylated DNA immunoprecipitation-sequencing (MeDIP-Seq) and Infinium HumanMethylation450 BeadChip assays. A total of 36 931 DMRs and 45 804 differentially methylated sites (DMSs) covering the whole genome, exclusive of the Y chromosome, were identified via MeDIP-Seq and Infinium 450k array, respectively, of which 3759 sites in 2188 regions were confirmed by both methods. Not only did we find the previously reported potential fetal DNA markers in our identified DMRs/DMSs but also we verified fully the identified DMRs/DMSs in the validation round by MassARRAY EpiTYPER. The screened potential fetal DNA markers may be used for NIPT on aneuploidies and other chromosomal diseases, such as cri du chat syndrome and velo-cardio-facial syndrome. In addition, these potential markers may have application in the early diagnosis of placental dysfunction, such as pre-eclampsia. © The Author 2014. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Chromatin Immunoprecipitation (ChIP) Protocol for Low-abundance Embryonic Samples.

PubMed

Rehimi, Rizwan; Bartusel, Michaela; Solinas, Francesca; Altmüller, Janine; Rada-Iglesias, Alvaro

2017-08-29

Chromatin immunoprecipitation (ChIP) is a widely-used technique for mapping the localization of post-translationally modified histones, histone variants, transcription factors, or chromatin-modifying enzymes at a given locus or on a genome-wide scale. The combination of ChIP assays with next-generation sequencing (i.e., ChIP-Seq) is a powerful approach to globally uncover gene regulatory networks and to improve the functional annotation of genomes, especially of non-coding regulatory sequences. ChIP protocols normally require large amounts of cellular material, thus precluding the applicability of this method to investigating rare cell types or small tissue biopsies. In order to make the ChIP assay compatible with the amount of biological material that can typically be obtained in vivo during early vertebrate embryogenesis, we describe here a simplified ChIP protocol in which the number of steps required to complete the assay were reduced to minimize sample loss. This ChIP protocol has been successfully used to investigate different histone modifications in various embryonic chicken and adult mouse tissues using low to medium cell numbers (5 x 10 4 - 5 x 10 5 cells). Importantly, this protocol is compatible with ChIP-seq technology using standard library preparation methods, thus providing global epigenomic maps in highly relevant embryonic tissues.

MOCCS: Clarifying DNA-binding motif ambiguity using ChIP-Seq data.

PubMed

Ozaki, Haruka; Iwasaki, Wataru

2016-08-01

As a key mechanism of gene regulation, transcription factors (TFs) bind to DNA by recognizing specific short sequence patterns that are called DNA-binding motifs. A single TF can accept ambiguity within its DNA-binding motifs, which comprise both canonical (typical) and non-canonical motifs. Clarification of such DNA-binding motif ambiguity is crucial for revealing gene regulatory networks and evaluating mutations in cis-regulatory elements. Although chromatin immunoprecipitation sequencing (ChIP-seq) now provides abundant data on the genomic sequences to which a given TF binds, existing motif discovery methods are unable to directly answer whether a given TF can bind to a specific DNA-binding motif. Here, we report a method for clarifying the DNA-binding motif ambiguity, MOCCS. Given ChIP-Seq data of any TF, MOCCS comprehensively analyzes and describes every k-mer to which that TF binds. Analysis of simulated datasets revealed that MOCCS is applicable to various ChIP-Seq datasets, requiring only a few minutes per dataset. Application to the ENCODE ChIP-Seq datasets proved that MOCCS directly evaluates whether a given TF binds to each DNA-binding motif, even if known position weight matrix models do not provide sufficient information on DNA-binding motif ambiguity. Furthermore, users are not required to provide numerous parameters or background genomic sequence models that are typically unavailable. MOCCS is implemented in Perl and R and is freely available via https://github.com/yuifu/moccs. By complementing existing motif-discovery software, MOCCS will contribute to the basic understanding of how the genome controls diverse cellular processes via DNA-protein interactions. Copyright © 2016 Elsevier Ltd. All rights reserved.

Gel-seq: A Method for Simultaneous Sequencing Library Preparation of DNA and RNA Using Hydrogel Matrices.

PubMed

Hoople, Gordon D; Richards, Andrew; Wu, Yan; Pisano, Albert P; Zhang, Kun

2018-03-26

The ability to amplify and sequence either DNA or RNA from small starting samples has only been achieved in the last five years. Unfortunately, the standard protocols for generating genomic or transcriptomic libraries are incompatible and researchers must choose whether to sequence DNA or RNA for a particular sample. Gel-seq solves this problem by enabling researchers to simultaneously prepare libraries for both DNA and RNA starting with 100 - 1000 cells using a simple hydrogel device. This paper presents a detailed approach for the fabrication of the device as well as the biological protocol to generate paired libraries. We designed Gel-seq so that it could be easily implemented by other researchers; many genetics labs already have the necessary equipment to reproduce the Gel-seq device fabrication. Our protocol employs commonly-used kits for both whole-transcript amplification (WTA) and library preparation, which are also likely to be familiar to researchers already versed in generating genomic and transcriptomic libraries. Our approach allows researchers to bring to bear the power of both DNA and RNA sequencing on a single sample without splitting and with negligible added cost.

Experimental approaches to identify cellular G-quadruplex structures and functions.

PubMed

Di Antonio, Marco; Rodriguez, Raphaël; Balasubramanian, Shankar

2012-05-01

Guanine-rich nucleic acids can fold into non-canonical DNA secondary structures called G-quadruplexes. The formation of these structures can interfere with the biology that is crucial to sustain cellular homeostases and metabolism via mechanisms that include transcription, translation, splicing, telomere maintenance and DNA recombination. Thus, due to their implication in several biological processes and possible role promoting genomic instability, G-quadruplex forming sequences have emerged as potential therapeutic targets. There has been a growing interest in the development of synthetic molecules and biomolecules for sensing G-quadruplex structures in cellular DNA. In this review, we summarise and discuss recent methods developed for cellular imaging of G-quadruplexes, and the application of experimental genomic approaches to detect G-quadruplexes throughout genomic DNA. In particular, we will discuss the use of engineered small molecules and natural proteins to enable pull-down, ChIP-Seq, ChIP-chip and fluorescence imaging of G-quadruplex structures in cellular DNA. Copyright © 2012 Elsevier Inc. All rights reserved.

Digital RNA sequencing minimizes sequence-dependent bias and amplification noise with optimized single-molecule barcodes

PubMed Central

Shiroguchi, Katsuyuki; Jia, Tony Z.; Sims, Peter A.; Xie, X. Sunney

2012-01-01

RNA sequencing (RNA-Seq) is a powerful tool for transcriptome profiling, but is hampered by sequence-dependent bias and inaccuracy at low copy numbers intrinsic to exponential PCR amplification. We developed a simple strategy for mitigating these complications, allowing truly digital RNA-Seq. Following reverse transcription, a large set of barcode sequences is added in excess, and nearly every cDNA molecule is uniquely labeled by random attachment of barcode sequences to both ends. After PCR, we applied paired-end deep sequencing to read the two barcodes and cDNA sequences. Rather than counting the number of reads, RNA abundance is measured based on the number of unique barcode sequences observed for a given cDNA sequence. We optimized the barcodes to be unambiguously identifiable, even in the presence of multiple sequencing errors. This method allows counting with single-copy resolution despite sequence-dependent bias and PCR-amplification noise, and is analogous to digital PCR but amendable to quantifying a whole transcriptome. We demonstrated transcriptome profiling of Escherichia coli with more accurate and reproducible quantification than conventional RNA-Seq. PMID:22232676

ChIP-chip.

PubMed

Kim, Tae Hoon; Dekker, Job

2018-05-01

ChIP-chip can be used to analyze protein-DNA interactions in a region-wide and genome-wide manner. DNA microarrays contain PCR products or oligonucleotide probes that are designed to represent genomic sequences. Identification of genomic sites that interact with a specific protein is based on competitive hybridization of the ChIP-enriched DNA and the input DNA to DNA microarrays. The ChIP-chip protocol can be divided into two main sections: Amplification of ChIP DNA and hybridization of ChIP DNA to arrays. A large amount of DNA is required to hybridize to DNA arrays, and hybridization to a set of multiple commercial arrays that represent the entire human genome requires two rounds of PCR amplifications. The relative hybridization intensity of ChIP DNA and that of the input DNA is used to determine whether the probe sequence is a potential site of protein-DNA interaction. Resolution of actual genomic sites bound by the protein is dependent on the size of the chromatin and on the genomic distance between the probes on the array. As with expression profiling using gene chips, ChIP-chip experiments require multiple replicates for reliable statistical measure of protein-DNA interactions. © 2018 Cold Spring Harbor Laboratory Press.

Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

PubMed

Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

2013-07-01

The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets

PubMed Central

Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.

2013-01-01

The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967

Expression Profiling Smackdown: Human Transcriptome Array HTA 2.0 vs. RNA-Seq

PubMed Central

Palermo, Meghann; Driscoll, Heather; Tighe, Scott; Dragon, Julie; Bond, Jeff; Shukla, Arti; Vangala, Mahesh; Vincent, James; Hunter, Tim

2014-01-01

The advent of both microarray and massively parallel sequencing have revolutionized high-throughput analysis of the human transcriptome. Due to limitations in microarray technology, detecting and quantifying coding transcript isoforms, in addition to non-coding transcripts, has been challenging. As a result, RNA-Seq has been the preferred method for characterizing the full human transcriptome, until now. A new high-resolution array from Affymetrix, GeneChip Human Transcriptome Array 2.0 (HTA 2.0), has been designed to interrogate all transcript isoforms in the human transcriptome with >6 million probes targeting coding transcripts, exon-exon splice junctions, and non-coding transcripts. Here we compare expression results from GeneChip HTA 2.0 and RNA-Seq data using identical RNA extractions from three samples each of healthy human mesothelial cells in culture, LP9-C1, and healthy mesothelial cells treated with asbestos, LP9-A1. For GeneChip HTA 2.0 sample preparation, we chose to compare two target preparation methods, NuGEN Ovation Pico WTA V2 with the Encore Biotin Module versus Affymetrix's GeneChip WT PLUS with the WT Terminal Labeling Kit, on identical RNA extractions from both untreated and treated samples. These same RNA extractions were used for the RNA-Seq library preparation. All analyses were performed in Partek Genomics Suite 6.6. Expression profiles for control and asbestos-treated mesothelial cells prepared with NuGEN versus Affymetrix target preparation methods (GeneChip HTA 2.0) are compared to each other as well as to RNA-Seq results.

Chromatin-associated RNA sequencing (ChAR-seq) maps genome-wide RNA-to-DNA contacts

PubMed Central

Jukam, David; Teran, Nicole A; Risca, Viviana I; Smith, Owen K; Johnson, Whitney L; Skotheim, Jan M; Greenleaf, William James

2018-01-01

RNA is a critical component of chromatin in eukaryotes, both as a product of transcription, and as an essential constituent of ribonucleoprotein complexes that regulate both local and global chromatin states. Here, we present a proximity ligation and sequencing method called Chromatin-Associated RNA sequencing (ChAR-seq) that maps all RNA-to-DNA contacts across the genome. Using Drosophila cells, we show that ChAR-seq provides unbiased, de novo identification of targets of chromatin-bound RNAs including nascent transcripts, chromosome-specific dosage compensation ncRNAs, and genome-wide trans-associated RNAs involved in co-transcriptional RNA processing. PMID:29648534

Simultaneous measurement of chromatin accessibility, DNA methylation, and nucleosome phasing in single cells

PubMed Central

Pott, Sebastian

2017-01-01

Gaining insights into the regulatory mechanisms that underlie the transcriptional variation observed between individual cells necessitates the development of methods that measure chromatin organization in single cells. Here I adapted Nucleosome Occupancy and Methylome-sequencing (NOMe-seq) to measure chromatin accessibility and endogenous DNA methylation in single cells (scNOMe-seq). scNOMe-seq recovered characteristic accessibility and DNA methylation patterns at DNase hypersensitive sites (DHSs). An advantage of scNOMe-seq is that sequencing reads are sampled independently of the accessibility measurement. scNOMe-seq therefore controlled for fragment loss, which enabled direct estimation of the fraction of accessible DHSs within individual cells. In addition, scNOMe-seq provided high resolution of chromatin accessibility within individual loci which was exploited to detect footprints of CTCF binding events and to estimate the average nucleosome phasing distances in single cells. scNOMe-seq is therefore well-suited to characterize the chromatin organization of single cells in heterogeneous cellular mixtures. DOI: http://dx.doi.org/10.7554/eLife.23203.001 PMID:28653622

DNA Breaks and End Resection Measured Genome-wide by End Sequencing.

PubMed

Canela, Andres; Sridharan, Sriram; Sciascia, Nicholas; Tubbs, Anthony; Meltzer, Paul; Sleckman, Barry P; Nussenzweig, André

2016-09-01

DNA double-strand breaks (DSBs) arise during physiological transcription, DNA replication, and antigen receptor diversification. Mistargeting or misprocessing of DSBs can result in pathological structural variation and mutation. Here we describe a sensitive method (END-seq) to monitor DNA end resection and DSBs genome-wide at base-pair resolution in vivo. We utilized END-seq to determine the frequency and spectrum of restriction-enzyme-, zinc-finger-nuclease-, and RAG-induced DSBs. Beyond sequence preference, chromatin features dictate the repertoire of these genome-modifying enzymes. END-seq can detect at least one DSB per cell among 10,000 cells not harboring DSBs, and we estimate that up to one out of 60 cells contains off-target RAG cleavage. In addition to site-specific cleavage, we detect DSBs distributed over extended regions during immunoglobulin class-switch recombination. Thus, END-seq provides a snapshot of DNA ends genome-wide, which can be utilized for understanding genome-editing specificities and the influence of chromatin on DSB pathway choice. Published by Elsevier Inc.

COBRA-Seq: Sensitive and Quantitative Methylome Profiling

PubMed Central

Varinli, Hilal; Statham, Aaron L.; Clark, Susan J.; Molloy, Peter L.; Ross, Jason P.

2015-01-01

Combined Bisulfite Restriction Analysis (COBRA) quantifies DNA methylation at a specific locus. It does so via digestion of PCR amplicons produced from bisulfite-treated DNA, using a restriction enzyme that contains a cytosine within its recognition sequence, such as TaqI. Here, we introduce COBRA-seq, a genome wide reduced methylome method that requires minimal DNA input (0.1–1.0 μg) and can either use PCR or linear amplification to amplify the sequencing library. Variants of COBRA-seq can be used to explore CpG-depleted as well as CpG-rich regions in vertebrate DNA. The choice of enzyme influences enrichment for specific genomic features, such as CpG-rich promoters and CpG islands, or enrichment for less CpG dense regions such as enhancers. COBRA-seq coupled with linear amplification has the additional advantage of reduced PCR bias by producing full length fragments at high abundance. Unlike other reduced representative methylome methods, COBRA-seq has great flexibility in the choice of enzyme and can be multiplexed and tuned, to reduce sequencing costs and to interrogate different numbers of sites. Moreover, COBRA-seq is applicable to non-model organisms without the reference genome and compatible with the investigation of non-CpG methylation by using restriction enzymes containing CpA, CpT, and CpC in their recognition site. PMID:26512698

Isolation of centromeric-tandem repetitive DNA sequences by chromatin affinity purification using a HaloTag7-fused centromere-specific histone H3 in tobacco.

PubMed

Nagaki, Kiyotaka; Shibata, Fukashi; Kanatani, Asaka; Kashihara, Kazunari; Murata, Minoru

2012-04-01

The centromere is a multi-functional complex comprising centromeric DNA and a number of proteins. To isolate unidentified centromeric DNA sequences, centromere-specific histone H3 variants (CENH3) and chromatin immunoprecipitation (ChIP) have been utilized in some plant species. However, anti-CENH3 antibody for ChIP must be raised in each species because of its species specificity. Production of the antibodies is time-consuming and costly, and it is not easy to produce ChIP-grade antibodies. In this study, we applied a HaloTag7-based chromatin affinity purification system to isolate centromeric DNA sequences in tobacco. This system required no specific antibody, and made it possible to apply a highly stringent wash to remove contaminated DNA. As a result, we succeeded in isolating five tandem repetitive DNA sequences in addition to the centromeric retrotransposons that were previously identified by ChIP. Three of the tandem repeats were centromere-specific sequences located on different chromosomes. These results confirm the validity of the HaloTag7-based chromatin affinity purification system as an alternative method to ChIP for isolating unknown centromeric DNA sequences. The discovery of more than two chromosome-specific centromeric DNA sequences indicates the mosaic structure of tobacco centromeres. © Springer-Verlag 2011

Nucleic and amino acid sequences relating to a novel transketolase, and methods for the expression thereof

DOEpatents

Croteau, Rodney Bruce; Wildung, Mark Raymond; Lange, Bernd Markus; McCaskill, David G.

2001-01-01

cDNAs encoding 1-deoxyxylulose-5-phosphate synthase from peppermint (Mentha piperita) have been isolated and sequenced, and the corresponding amino acid sequences have been determined. Accordingly, isolated DNA sequences (SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7) are provided which code for the expression of 1-deoxyxylulose-5-phosphate synthase from plants. In another aspect the present invention provides for isolated, recombinant DXPS proteins, such as the proteins having the sequences set forth in SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO:8. In other aspects, replicable recombinant cloning vehicles are provided which code for plant 1-deoxyxylulose-5-phosphate synthases, or for a base sequence sufficiently complementary to at least a portion of 1-deoxyxylulose-5-phosphate synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding a plant 1-deoxyxylulose-5-phosphate synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant 1-deoxyxylulose-5-phosphate synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant 1-deoxyxylulose-5-phosphate synthase may be used to obtain expression or enhanced expression of 1-deoxyxylulose-5-phosphate synthase in plants in order to enhance the production of 1-deoxyxylulose-5-phosphate, or its derivatives such as isopentenyl diphosphate (BP), or may be otherwise employed for the regulation or expression of 1-deoxyxylulose-5-phosphate synthase, or the production of its products.

Considerations on Experimental Design and Data Analysis of Chromatin Immunoprecipitation Experiments.

PubMed

Jordán-Pla, Antonio; Visa, Neus

2018-01-01

Arguably one of the most valuable techniques to study chromatin organization, ChIP is the method of choice to map the contacts established between proteins and genomic DNA. Ever since its inception, more than 30 years ago, ChIP has been constantly evolving, improving, and expanding its capabilities and reach. Despite its widespread use by many laboratories across a wide variety of disciplines, ChIP assays can be sometimes challenging to design, and are often sensitive to variations in practical implementation.In this chapter, we provide a general overview of the ChIP method and its most common variations, with a special focus on ChIP-seq. We try to address some of the most important aspects that need to be taken into account in order to design and perform experiments that generate the most reproducible, high-quality data. Some of the main topics covered include the use of properly characterized antibodies, alternatives to chromatin preparation, the need for proper controls, and some recommendations about ChIP-seq data analysis.

Using single nuclei for RNA-seq to capture the transcriptome of postmortem neurons

PubMed Central

Krishnaswami, Suguna Rani; Grindberg, Rashel V; Novotny, Mark; Venepally, Pratap; Lacar, Benjamin; Bhutani, Kunal; Linker, Sara B; Pham, Son; Erwin, Jennifer A; Miller, Jeremy A; Hodge, Rebecca; McCarthy, James K; Kelder, Martin; McCorrison, Jamison; Aevermann, Brian D; Fuertes, Francisco Diez; Scheuermann, Richard H; Lee, Jun; Lein, Ed S; Schork, Nicholas; McConnell, Michael J; Gage, Fred H; Lasken, Roger S

2016-01-01

A protocol is described for sequencing the transcriptome of a cell nucleus. Nuclei are isolated from specimens and sorted by FACS, cDNA libraries are constructed and RNA-seq is performed, followed by data analysis. Some steps follow published methods (Smart-seq2 for cDNA synthesis and Nextera XT barcoded library preparation) and are not described in detail here. Previous single-cell approaches for RNA-seq from tissues include cell dissociation using protease treatment at 30 °C, which is known to alter the transcriptome. We isolate nuclei at 4 °C from tissue homogenates, which cause minimal damage. Nuclear transcriptomes can be obtained from postmortem human brain tissue stored at −80 °C, making brain archives accessible for RNA-seq from individual neurons. The method also allows investigation of biological features unique to nuclei, such as enrichment of certain transcripts and precursors of some noncoding RNAs. By following this procedure, it takes about 4 d to construct cDNA libraries that are ready for sequencing. PMID:26890679

Monoterpene synthases from common sage (Salvia officinalis)

DOEpatents

Croteau, Rodney Bruce; Wise, Mitchell Lynn; Katahira, Eva Joy; Savage, Thomas Jonathan

1999-01-01

cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.

Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins

PubMed Central

Foulk, Michael S.; Urban, John M.; Casella, Cinzia; Gerbi, Susan A.

2015-01-01

Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (λ-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent strands intact. We used genomics and biochemical approaches to determine if λ-exo digests all parental DNA sequences equally. We report that λ-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, λ-exo digestion of nonreplicating genomic DNA (LexoG0) enriches GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand–independent λ-exo biases in NS-seq and validated this approach at the rDNA locus. The λ-exo–controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s are not general determinants for origin specification but may play a role for a subset. Interestingly, we observed a periodic spacing of G4 motifs and nucleosomes around the peak summits, suggesting that G4s may position nucleosomes at this subset of origins. Finally, we demonstrate that use of Na+ instead of K+ in the λ-exo digestion buffer reduced the effect of G4s on λ-exo digestion and discuss ways to increase both the sensitivity and specificity of NS-seq. PMID:25695952

Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins.

PubMed

Foulk, Michael S; Urban, John M; Casella, Cinzia; Gerbi, Susan A

2015-05-01

Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (λ-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent strands intact. We used genomics and biochemical approaches to determine if λ-exo digests all parental DNA sequences equally. We report that λ-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, λ-exo digestion of nonreplicating genomic DNA (LexoG0) enriches GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent λ-exo biases in NS-seq and validated this approach at the rDNA locus. The λ-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s are not general determinants for origin specification but may play a role for a subset. Interestingly, we observed a periodic spacing of G4 motifs and nucleosomes around the peak summits, suggesting that G4s may position nucleosomes at this subset of origins. Finally, we demonstrate that use of Na(+) instead of K(+) in the λ-exo digestion buffer reduced the effect of G4s on λ-exo digestion and discuss ways to increase both the sensitivity and specificity of NS-seq. © 2015 Foulk et al.; Published by Cold Spring Harbor Laboratory Press.

Comparison and quantitative verification of mapping algorithms for whole genome bisulfite sequencing

USDA-ARS?s Scientific Manuscript database

Coupling bisulfite conversion with next-generation sequencing (Bisulfite-seq) enables genome-wide measurement of DNA methylation, but poses unique challenges for mapping. However, despite a proliferation of Bisulfite-seq mapping tools, no systematic comparison of their genomic coverage and quantitat...

Single-cell template strand sequencing by Strand-seq enables the characterization of individual homologs.

PubMed

Sanders, Ashley D; Falconer, Ester; Hills, Mark; Spierings, Diana C J; Lansdorp, Peter M

2017-06-01

The ability to distinguish between genome sequences of homologous chromosomes in single cells is important for studies of copy-neutral genomic rearrangements (such as inversions and translocations), building chromosome-length haplotypes, refining genome assemblies, mapping sister chromatid exchange events and exploring cellular heterogeneity. Strand-seq is a single-cell sequencing technology that resolves the individual homologs within a cell by restricting sequence analysis to the DNA template strands used during DNA replication. This protocol, which takes up to 4 d to complete, relies on the directionality of DNA, in which each single strand of a DNA molecule is distinguished based on its 5'-3' orientation. Culturing cells in a thymidine analog for one round of cell division labels nascent DNA strands, allowing for their selective removal during genomic library construction. To preserve directionality of template strands, genomic preamplification is bypassed and labeled nascent strands are nicked and not amplified during library preparation. Each single-cell library is multiplexed for pooling and sequencing, and the resulting sequence data are aligned, mapping to either the minus or plus strand of the reference genome, to assign template strand states for each chromosome in the cell. The major adaptations to conventional single-cell sequencing protocols include harvesting of daughter cells after a single round of BrdU incorporation, bypassing of whole-genome amplification, and removal of the BrdU + strand during Strand-seq library preparation. By sequencing just template strands, the structure and identity of each homolog are preserved.

SeqCompress: an algorithm for biological sequence compression.

PubMed

Sardaraz, Muhammad; Tahir, Muhammad; Ikram, Ataul Aziz; Bajwa, Hassan

2014-10-01

The growth of Next Generation Sequencing technologies presents significant research challenges, specifically to design bioinformatics tools that handle massive amount of data efficiently. Biological sequence data storage cost has become a noticeable proportion of total cost in the generation and analysis. Particularly increase in DNA sequencing rate is significantly outstripping the rate of increase in disk storage capacity, which may go beyond the limit of storage capacity. It is essential to develop algorithms that handle large data sets via better memory management. This article presents a DNA sequence compression algorithm SeqCompress that copes with the space complexity of biological sequences. The algorithm is based on lossless data compression and uses statistical model as well as arithmetic coding to compress DNA sequences. The proposed algorithm is compared with recent specialized compression tools for biological sequences. Experimental results show that proposed algorithm has better compression gain as compared to other existing algorithms. Copyright © 2014 Elsevier Inc. All rights reserved.

Accurate RNA consensus sequencing for high-fidelity detection of transcriptional mutagenesis-induced epimutations.

PubMed

Reid-Bayliss, Kate S; Loeb, Lawrence A

2017-08-29

Transcriptional mutagenesis (TM) due to misincorporation during RNA transcription can result in mutant RNAs, or epimutations, that generate proteins with altered properties. TM has long been hypothesized to play a role in aging, cancer, and viral and bacterial evolution. However, inadequate methodologies have limited progress in elucidating a causal association. We present a high-throughput, highly accurate RNA sequencing method to measure epimutations with single-molecule sensitivity. Accurate RNA consensus sequencing (ARC-seq) uniquely combines RNA barcoding and generation of multiple cDNA copies per RNA molecule to eliminate errors introduced during cDNA synthesis, PCR, and sequencing. The stringency of ARC-seq can be scaled to accommodate the quality of input RNAs. We apply ARC-seq to directly assess transcriptome-wide epimutations resulting from RNA polymerase mutants and oxidative stress.

Comparison of sequencing-based methods to profile DNA methylation and identification of monoallelic epigenetic modifications

USDA-ARS?s Scientific Manuscript database

Analysis of DNA methylation patterns relies increasingly on sequencing-based profiling methods. The four most frequently used sequencing-based technologies are the bisulfite-based methods MethylC-seq and reduced representation bisulfite sequencing (RRBS), and the enrichment-based techniques methylat...

High quality methylome-wide investigations through next-generation sequencing of DNA from a single archived dry blood spot

PubMed Central

Aberg, Karolina A.; Xie, Lin Y.; Nerella, Srilaxmi; Copeland, William E.; Costello, E. Jane; van den Oord, Edwin J.C.G.

2013-01-01

The potential importance of DNA methylation in the etiology of complex diseases has led to interest in the development of methylome-wide association studies (MWAS) aimed at interrogating all methylation sites in the human genome. When using blood as biomaterial for a MWAS the DNA is typically extracted directly from fresh or frozen whole blood that was collected via venous puncture. However, DNA extracted from dry blood spots may also be an alternative starting material. In the present study, we apply a methyl-CpG binding domain (MBD) protein enrichment-based technique in combination with next generation sequencing (MBD-seq) to assess the methylation status of the ~27 million CpGs in the human autosomal reference genome. We investigate eight methylomes using DNA from blood spots. This data are compared with 1,500 methylomes previously assayed with the same MBD-seq approach using DNA from whole blood. When investigating the sequence quality and the enrichment profile across biological features, we find that DNA extracted from blood spots gives comparable results with DNA extracted from whole blood. Only if the amount of starting material is ≤ 0.5µg DNA we observe a slight decrease in the assay performance. In conclusion, we show that high quality methylome-wide investigations using MBD-seq can be conducted in DNA extracted from archived dry blood spots without sacrificing quality and without bias in enrichment profile as long as the amount of starting material is sufficient. In general, the amount of DNA extracted from a single blood spot is sufficient for methylome-wide investigations with the MBD-seq approach. PMID:23644822

High quality methylome-wide investigations through next-generation sequencing of DNA from a single archived dry blood spot.

PubMed

Aberg, Karolina A; Xie, Lin Y; Nerella, Srilaxmi; Copeland, William E; Costello, E Jane; van den Oord, Edwin J C G

2013-05-01

The potential importance of DNA methylation in the etiology of complex diseases has led to interest in the development of methylome-wide association studies (MWAS) aimed at interrogating all methylation sites in the human genome. When using blood as biomaterial for a MWAS the DNA is typically extracted directly from fresh or frozen whole blood that was collected via venous puncture. However, DNA extracted from dry blood spots may also be an alternative starting material. In the present study, we apply a methyl-CpG binding domain (MBD) protein enrichment-based technique in combination with next generation sequencing (MBD-seq) to assess the methylation status of the ~27 million CpGs in the human autosomal reference genome. We investigate eight methylomes using DNA from blood spots. This data are compared with 1,500 methylomes previously assayed with the same MBD-seq approach using DNA from whole blood. When investigating the sequence quality and the enrichment profile across biological features, we find that DNA extracted from blood spots gives comparable results with DNA extracted from whole blood. Only if the amount of starting material is ≤ 0.5µg DNA we observe a slight decrease in the assay performance. In conclusion, we show that high quality methylome-wide investigations using MBD-seq can be conducted in DNA extracted from archived dry blood spots without sacrificing quality and without bias in enrichment profile as long as the amount of starting material is sufficient. In general, the amount of DNA extracted from a single blood spot is sufficient for methylome-wide investigations with the MBD-seq approach.

Quick genome sequencing of “Candidatus Liberibacter” strains by use of Enrichment-Enlargement-Next generation sequencing (EEN)

USDA-ARS?s Scientific Manuscript database

Members of “Candidatus Liberibacter” are associated with several important plant diseases such as citrus Huanglongbing (HLB) and potato zebra chip (ZC) disease. Inability to culture and low titers in infected hosts have been major obstacles for research on these bacteria. The use of whole genome seq...

Genome-wide mapping of DNase I hypersensitive sites in rare cell populations using single-cell DNase sequencing.

PubMed

Cooper, James; Ding, Yi; Song, Jiuzhou; Zhao, Keji

2017-11-01

Increased chromatin accessibility is a feature of cell-type-specific cis-regulatory elements; therefore, mapping of DNase I hypersensitive sites (DHSs) enables the detection of active regulatory elements of transcription, including promoters, enhancers, insulators and locus-control regions. Single-cell DNase sequencing (scDNase-seq) is a method of detecting genome-wide DHSs when starting with either single cells or <1,000 cells from primary cell sources. This technique enables genome-wide mapping of hypersensitive sites in a wide range of cell populations that cannot be analyzed using conventional DNase I sequencing because of the requirement for millions of starting cells. Fresh cells, formaldehyde-cross-linked cells or cells recovered from formalin-fixed paraffin-embedded (FFPE) tissue slides are suitable for scDNase-seq assays. To generate scDNase-seq libraries, cells are lysed and then digested with DNase I. Circular carrier plasmid DNA is included during subsequent DNA purification and library preparation steps to prevent loss of the small quantity of DHS DNA. Libraries are generated for high-throughput sequencing on the Illumina platform using standard methods. Preparation of scDNase-seq libraries requires only 2 d. The materials and molecular biology techniques described in this protocol should be accessible to any general molecular biology laboratory. Processing of high-throughput sequencing data requires basic bioinformatics skills and uses publicly available bioinformatics software.

An integrated semiconductor device enabling non-optical genome sequencing.

PubMed

Rothberg, Jonathan M; Hinz, Wolfgang; Rearick, Todd M; Schultz, Jonathan; Mileski, William; Davey, Mel; Leamon, John H; Johnson, Kim; Milgrew, Mark J; Edwards, Matthew; Hoon, Jeremy; Simons, Jan F; Marran, David; Myers, Jason W; Davidson, John F; Branting, Annika; Nobile, John R; Puc, Bernard P; Light, David; Clark, Travis A; Huber, Martin; Branciforte, Jeffrey T; Stoner, Isaac B; Cawley, Simon E; Lyons, Michael; Fu, Yutao; Homer, Nils; Sedova, Marina; Miao, Xin; Reed, Brian; Sabina, Jeffrey; Feierstein, Erika; Schorn, Michelle; Alanjary, Mohammad; Dimalanta, Eileen; Dressman, Devin; Kasinskas, Rachel; Sokolsky, Tanya; Fidanza, Jacqueline A; Namsaraev, Eugeni; McKernan, Kevin J; Williams, Alan; Roth, G Thomas; Bustillo, James

2011-07-20

The seminal importance of DNA sequencing to the life sciences, biotechnology and medicine has driven the search for more scalable and lower-cost solutions. Here we describe a DNA sequencing technology in which scalable, low-cost semiconductor manufacturing techniques are used to make an integrated circuit able to directly perform non-optical DNA sequencing of genomes. Sequence data are obtained by directly sensing the ions produced by template-directed DNA polymerase synthesis using all-natural nucleotides on this massively parallel semiconductor-sensing device or ion chip. The ion chip contains ion-sensitive, field-effect transistor-based sensors in perfect register with 1.2 million wells, which provide confinement and allow parallel, simultaneous detection of independent sequencing reactions. Use of the most widely used technology for constructing integrated circuits, the complementary metal-oxide semiconductor (CMOS) process, allows for low-cost, large-scale production and scaling of the device to higher densities and larger array sizes. We show the performance of the system by sequencing three bacterial genomes, its robustness and scalability by producing ion chips with up to 10 times as many sensors and sequencing a human genome.

Mapping of transcription factor binding regions in mammalian cells by ChIP: Comparison of array- and sequencing-based technologies

PubMed Central

Euskirchen, Ghia M.; Rozowsky, Joel S.; Wei, Chia-Lin; Lee, Wah Heng; Zhang, Zhengdong D.; Hartman, Stephen; Emanuelsson, Olof; Stolc, Viktor; Weissman, Sherman; Gerstein, Mark B.; Ruan, Yijun; Snyder, Michael

2007-01-01

Recent progress in mapping transcription factor (TF) binding regions can largely be credited to chromatin immunoprecipitation (ChIP) technologies. We compared strategies for mapping TF binding regions in mammalian cells using two different ChIP schemes: ChIP with DNA microarray analysis (ChIP-chip) and ChIP with DNA sequencing (ChIP-PET). We first investigated parameters central to obtaining robust ChIP-chip data sets by analyzing STAT1 targets in the ENCODE regions of the human genome, and then compared ChIP-chip to ChIP-PET. We devised methods for scoring and comparing results among various tiling arrays and examined parameters such as DNA microarray format, oligonucleotide length, hybridization conditions, and the use of competitor Cot-1 DNA. The best performance was achieved with high-density oligonucleotide arrays, oligonucleotides ≥50 bases (b), the presence of competitor Cot-1 DNA and hybridizations conducted in microfluidics stations. When target identification was evaluated as a function of array number, 80%–86% of targets were identified with three or more arrays. Comparison of ChIP-chip with ChIP-PET revealed strong agreement for the highest ranked targets with less overlap for the low ranked targets. With advantages and disadvantages unique to each approach, we found that ChIP-chip and ChIP-PET are frequently complementary in their relative abilities to detect STAT1 targets for the lower ranked targets; each method detected validated targets that were missed by the other method. The most comprehensive list of STAT1 binding regions is obtained by merging results from ChIP-chip and ChIP-sequencing. Overall, this study provides information for robust identification, scoring, and validation of TF targets using ChIP-based technologies. PMID:17568005

SIDR: simultaneous isolation and parallel sequencing of genomic DNA and total RNA from single cells.

PubMed

Han, Kyung Yeon; Kim, Kyu-Tae; Joung, Je-Gun; Son, Dae-Soon; Kim, Yeon Jeong; Jo, Areum; Jeon, Hyo-Jeong; Moon, Hui-Sung; Yoo, Chang Eun; Chung, Woosung; Eum, Hye Hyeon; Kim, Sangmin; Kim, Hong Kwan; Lee, Jeong Eon; Ahn, Myung-Ju; Lee, Hae-Ock; Park, Donghyun; Park, Woong-Yang

2018-01-01

Simultaneous sequencing of the genome and transcriptome at the single-cell level is a powerful tool for characterizing genomic and transcriptomic variation and revealing correlative relationships. However, it remains technically challenging to analyze both the genome and transcriptome in the same cell. Here, we report a novel method for simultaneous isolation of genomic DNA and total RNA (SIDR) from single cells, achieving high recovery rates with minimal cross-contamination, as is crucial for accurate description and integration of the single-cell genome and transcriptome. For reliable and efficient separation of genomic DNA and total RNA from single cells, the method uses hypotonic lysis to preserve nuclear lamina integrity and subsequently captures the cell lysate using antibody-conjugated magnetic microbeads. Evaluating the performance of this method using real-time PCR demonstrated that it efficiently recovered genomic DNA and total RNA. Thorough data quality assessments showed that DNA and RNA simultaneously fractionated by the SIDR method were suitable for genome and transcriptome sequencing analysis at the single-cell level. The integration of single-cell genome and transcriptome sequencing by SIDR (SIDR-seq) showed that genetic alterations, such as copy-number and single-nucleotide variations, were more accurately captured by single-cell SIDR-seq compared with conventional single-cell RNA-seq, although copy-number variations positively correlated with the corresponding gene expression levels. These results suggest that SIDR-seq is potentially a powerful tool to reveal genetic heterogeneity and phenotypic information inferred from gene expression patterns at the single-cell level. © 2018 Han et al.; Published by Cold Spring Harbor Laboratory Press.

SIDR: simultaneous isolation and parallel sequencing of genomic DNA and total RNA from single cells

PubMed Central

Han, Kyung Yeon; Kim, Kyu-Tae; Joung, Je-Gun; Son, Dae-Soon; Kim, Yeon Jeong; Jo, Areum; Jeon, Hyo-Jeong; Moon, Hui-Sung; Yoo, Chang Eun; Chung, Woosung; Eum, Hye Hyeon; Kim, Sangmin; Kim, Hong Kwan; Lee, Jeong Eon; Ahn, Myung-Ju; Lee, Hae-Ock; Park, Donghyun; Park, Woong-Yang

2018-01-01

Simultaneous sequencing of the genome and transcriptome at the single-cell level is a powerful tool for characterizing genomic and transcriptomic variation and revealing correlative relationships. However, it remains technically challenging to analyze both the genome and transcriptome in the same cell. Here, we report a novel method for simultaneous isolation of genomic DNA and total RNA (SIDR) from single cells, achieving high recovery rates with minimal cross-contamination, as is crucial for accurate description and integration of the single-cell genome and transcriptome. For reliable and efficient separation of genomic DNA and total RNA from single cells, the method uses hypotonic lysis to preserve nuclear lamina integrity and subsequently captures the cell lysate using antibody-conjugated magnetic microbeads. Evaluating the performance of this method using real-time PCR demonstrated that it efficiently recovered genomic DNA and total RNA. Thorough data quality assessments showed that DNA and RNA simultaneously fractionated by the SIDR method were suitable for genome and transcriptome sequencing analysis at the single-cell level. The integration of single-cell genome and transcriptome sequencing by SIDR (SIDR-seq) showed that genetic alterations, such as copy-number and single-nucleotide variations, were more accurately captured by single-cell SIDR-seq compared with conventional single-cell RNA-seq, although copy-number variations positively correlated with the corresponding gene expression levels. These results suggest that SIDR-seq is potentially a powerful tool to reveal genetic heterogeneity and phenotypic information inferred from gene expression patterns at the single-cell level. PMID:29208629

Antibody performance in ChIP-sequencing assays: From quality scores of public data sets to quantitative certification.

PubMed

Mendoza-Parra, Marco-Antonio; Saravaki, Vincent; Cholley, Pierre-Etienne; Blum, Matthias; Billoré, Benjamin; Gronemeyer, Hinrich

2016-01-01

We have established a certification system for antibodies to be used in chromatin immunoprecipitation assays coupled to massive parallel sequencing (ChIP-seq). This certification comprises a standardized ChIP procedure and the attribution of a numerical quality control indicator (QCi) to biological replicate experiments. The QCi computation is based on a universally applicable quality assessment that quantitates the global deviation of randomly sampled subsets of ChIP-seq dataset with the original genome-aligned sequence reads. Comparison with a QCi database for >28,000 ChIP-seq assays were used to attribute quality grades (ranging from 'AAA' to 'DDD') to a given dataset. In the present report we used the numerical QC system to assess the factors influencing the quality of ChIP-seq assays, including the nature of the target, the sequencing depth and the commercial source of the antibody.  We have used this approach specifically to certify mono and polyclonal antibodies obtained from Active Motif directed against the histone modification marks H3K4me3, H3K27ac and H3K9ac for ChIP-seq. The antibodies received the grades AAA to BBC ( www.ngs-qc.org). We propose to attribute such quantitative grading of all antibodies attributed with the label "ChIP-seq grade".

msCentipede: Modeling Heterogeneity across Genomic Sites and Replicates Improves Accuracy in the Inference of Transcription Factor Binding

PubMed Central

Gilad, Yoav; Pritchard, Jonathan K.; Stephens, Matthew

2015-01-01

Understanding global gene regulation depends critically on accurate annotation of regulatory elements that are functional in a given cell type. CENTIPEDE, a powerful, probabilistic framework for identifying transcription factor binding sites from tissue-specific DNase I cleavage patterns and genomic sequence content, leverages the hypersensitivity of factor-bound chromatin and the information in the DNase I spatial cleavage profile characteristic of each DNA binding protein to accurately infer functional factor binding sites. However, the model for the spatial profile in this framework fails to account for the substantial variation in the DNase I cleavage profiles across different binding sites. Neither does it account for variation in the profiles at the same binding site across multiple replicate DNase I experiments, which are increasingly available. In this work, we introduce new methods, based on multi-scale models for inhomogeneous Poisson processes, to account for such variation in DNase I cleavage patterns both within and across binding sites. These models account for the spatial structure in the heterogeneity in DNase I cleavage patterns for each factor. Using DNase-seq measurements assayed in a lymphoblastoid cell line, we demonstrate the improved performance of this model for several transcription factors by comparing against the Chip-seq peaks for those factors. Finally, we explore the effects of DNase I sequence bias on inference of factor binding using a simple extension to our framework that allows for a more flexible background model. The proposed model can also be easily applied to paired-end ATAC-seq and DNase-seq data. msCentipede, a Python implementation of our algorithm, is available at http://rajanil.github.io/msCentipede. PMID:26406244

msCentipede: Modeling Heterogeneity across Genomic Sites and Replicates Improves Accuracy in the Inference of Transcription Factor Binding.

PubMed

Raj, Anil; Shim, Heejung; Gilad, Yoav; Pritchard, Jonathan K; Stephens, Matthew

2015-01-01

Understanding global gene regulation depends critically on accurate annotation of regulatory elements that are functional in a given cell type. CENTIPEDE, a powerful, probabilistic framework for identifying transcription factor binding sites from tissue-specific DNase I cleavage patterns and genomic sequence content, leverages the hypersensitivity of factor-bound chromatin and the information in the DNase I spatial cleavage profile characteristic of each DNA binding protein to accurately infer functional factor binding sites. However, the model for the spatial profile in this framework fails to account for the substantial variation in the DNase I cleavage profiles across different binding sites. Neither does it account for variation in the profiles at the same binding site across multiple replicate DNase I experiments, which are increasingly available. In this work, we introduce new methods, based on multi-scale models for inhomogeneous Poisson processes, to account for such variation in DNase I cleavage patterns both within and across binding sites. These models account for the spatial structure in the heterogeneity in DNase I cleavage patterns for each factor. Using DNase-seq measurements assayed in a lymphoblastoid cell line, we demonstrate the improved performance of this model for several transcription factors by comparing against the Chip-seq peaks for those factors. Finally, we explore the effects of DNase I sequence bias on inference of factor binding using a simple extension to our framework that allows for a more flexible background model. The proposed model can also be easily applied to paired-end ATAC-seq and DNase-seq data. msCentipede, a Python implementation of our algorithm, is available at http://rajanil.github.io/msCentipede.

A label-free, fluorescence based assay for microarray

NASA Astrophysics Data System (ADS)

Niu, Sanjun

DNA chip technology has drawn tremendous attention since it emerged in the mid 90's as a method that expedites gene sequencing by over 100-fold. DNA chip, also called DNA microarray, is a combinatorial technology in which different single-stranded DNA (ssDNA) molecules of known sequences are immobilized at specific spots. The immobilized ssDNA strands are called probes. In application, the chip is exposed to a solution containing ssDNA of unknown sequence, called targets, which are labeled with fluorescent dyes. Due to specific molecular recognition among the base pairs in the DNA, the binding or hybridization occurs only when the probe and target sequences are complementary. The nucleotide sequence of the target is determined by imaging the fluorescence from the spots. The uncertainty of background in signal detection and statistical error in data analysis, primarily due to the error in the DNA amplification process and statistical distribution of the tags in the target DNA, have become the fundamental barriers in bringing the technology into application for clinical diagnostics. Furthermore, the dye and tagging process are expensive, making the cost of DNA chips inhibitive for clinical testing. These limitations and challenges make it difficult to implement DNA chip methods as a diagnostic tool in a pathology laboratory. The objective of this dissertation research is to provide an alternative approach that will address the above challenges. In this research, a label-free assay is designed and studied. Polystyrene (PS), a commonly used polymeric material, serves as the fluorescence agent. Probe ssDNA is covalently immobilized on polystyrene thin film that is supported by a reflecting substrate. When this chip is exposed to excitation light, fluorescence light intensity from PS is detected as the signal. Since the optical constants and conformations of ssDNA and dsDNA (double stranded DNA) are different, the measured fluorescence from PS changes for the same intensity of excitation light. The fluorescence contrast is used to quantify the amount of probe-target hybridization. A mathematical model that considers multiple reflections and scattering is developed to explain the mechanism of the fluorescence contrast which depends on the thickness of the PS film. Scattering is the dominant factor that contributes to the contrast. The potential of this assay to detect single nucleotide polymorphism is also tested.

The Porcelain Crab Transcriptome and PCAD, the Porcelain Crab Microarray and Sequence Database

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tagmount, Abderrahmane; Wang, Mei; Lindquist, Erika

2010-01-27

Background: With the emergence of a completed genome sequence of the freshwater crustacean Daphnia pulex, construction of genomic-scale sequence databases for additional crustacean sequences are important for comparative genomics and annotation. Porcelain crabs, genus Petrolisthes, have been powerful crustacean models for environmental and evolutionary physiology with respect to thermal adaptation and understanding responses of marine organisms to climate change. Here, we present a large-scale EST sequencing and cDNA microarray database project for the porcelain crab Petrolisthes cinctipes. Methodology/Principal Findings: A set of ~;;30K unique sequences (UniSeqs) representing ~;;19K clusters were generated from ~;;98K high quality ESTs from a set ofmore » tissue specific non-normalized and mixed-tissue normalized cDNA libraries from the porcelain crab Petrolisthes cinctipes. Homology for each UniSeq was assessed using BLAST, InterProScan, GO and KEGG database searches. Approximately 66percent of the UniSeqs had homology in at least one of the databases. All EST and UniSeq sequences along with annotation results and coordinated cDNA microarray datasets have been made publicly accessible at the Porcelain Crab Array Database (PCAD), a feature-enriched version of the Stanford and Longhorn Array Databases.Conclusions/Significance: The EST project presented here represents the third largest sequencing effort for any crustacean, and the largest effort for any crab species. Our assembly and clustering results suggest that our porcelain crab EST data set is equally diverse to the much larger EST set generated in the Daphnia pulex genome sequencing project, and thus will be an important resource to the Daphnia research community. Our homology results support the pancrustacea hypothesis and suggest that Malacostraca may be ancestral to Branchiopoda and Hexapoda. Our results also suggest that our cDNA microarrays cover as much of the transcriptome as can reasonably be captured in EST library sequencing approaches, and thus represent a rich resource for studies of environmental genomics.« less

JVM: Java Visual Mapping tool for next generation sequencing read.

PubMed

Yang, Ye; Liu, Juan

2015-01-01

We developed a program JVM (Java Visual Mapping) for mapping next generation sequencing read to reference sequence. The program is implemented in Java and is designed to deal with millions of short read generated by sequence alignment using the Illumina sequencing technology. It employs seed index strategy and octal encoding operations for sequence alignments. JVM is useful for DNA-Seq, RNA-Seq when dealing with single-end resequencing. JVM is a desktop application, which supports reads capacity from 1 MB to 10 GB.

Illumina MiSeq Sequencing for Preliminary Analysis of Microbiome Causing Primary Endodontic Infections in Egypt

PubMed Central

Azab, Marwa Mohamed; Fayyad, Dalia Mukhtar

2018-01-01

The use of high throughput next generation technologies has allowed more comprehensive analysis than traditional Sanger sequencing. The specific aim of this study was to investigate the microbial diversity of primary endodontic infections using Illumina MiSeq sequencing platform in Egyptian patients. Samples were collected from 19 patients in Suez Canal University Hospital (Endodontic Department) using sterile # 15K file and paper points. DNA was extracted using Mo Bio power soil DNA isolation extraction kit followed by PCR amplification and agarose gel electrophoresis. The microbiome was characterized on the basis of the V3 and V4 hypervariable region of the 16S rRNA gene by using paired-end sequencing on Illumina MiSeq device. MOTHUR software was used in sequence filtration and analysis of sequenced data. A total of 1858 operational taxonomic units at 97% similarity were assigned to 26 phyla, 245 families, and 705 genera. Four main phyla Firmicutes, Bacteroidetes, Proteobacteria, and Synergistetes were predominant in all samples. At genus level, Prevotella, Bacillus, Porphyromonas, Streptococcus, and Bacteroides were the most abundant. Illumina MiSeq platform sequencing can be used to investigate oral microbiome composition of endodontic infections. Elucidating the ecology of endodontic infections is a necessary step in developing effective intracanal antimicrobials. PMID:29849646

Base-resolution detection of N 4-methylcytosine in genomic DNA using 4mC-Tet-assisted-bisulfite-sequencing

DOE PAGES

Yu, Miao; Ji, Lexiang; Neumann, Drexel A.; ...

2015-07-15

Restriction-modification (R-M) systems pose a major barrier to DNA transformation and genetic engineering of bacterial species. Systematic identification of DNA methylation in R-M systems, including N 6-methyladenine (6mA), 5-methylcytosine (5mC) and N 4-methylcytosine (4mC), will enable strategies to make these species genetically tractable. Although single-molecule, real time (SMRT) sequencing technology is capable of detecting 4mC directly for any bacterial species regardless of whether an assembled genome exists or not, it is not as scalable to profiling hundreds to thousands of samples compared with the commonly used next-generation sequencing technologies. Here, we present 4mC-Tet-assisted bisulfite-sequencing (4mC-TAB-seq), a next-generation sequencing method thatmore » rapidly and cost efficiently reveals the genome-wide locations of 4mC for bacterial species with an available assembled reference genome. In 4mC-TAB-seq, both cytosines and 5mCs are read out as thymines, whereas only 4mCs are read out as cytosines, revealing their specific positions throughout the genome. We applied 4mC-TAB-seq to study the methylation of a member of the hyperthermophilc genus, Caldicellulosiruptor, in which 4mC-related restriction is a major barrier to DNA transformation from other species. Lastly, in combination with MethylC-seq, both 4mC- and 5mC-containing motifs are identified which can assist in rapid and efficient genetic engineering of these bacteria in the future.« less

Touch imprint cytology with massively parallel sequencing (TIC-seq): a simple and rapid method to snapshot genetic alterations in tumors.

PubMed

Amemiya, Kenji; Hirotsu, Yosuke; Goto, Taichiro; Nakagomi, Hiroshi; Mochizuki, Hitoshi; Oyama, Toshio; Omata, Masao

2016-12-01

Identifying genetic alterations in tumors is critical for molecular targeting of therapy. In the clinical setting, formalin-fixed paraffin-embedded (FFPE) tissue is usually employed for genetic analysis. However, DNA extracted from FFPE tissue is often not suitable for analysis because of its low levels and poor quality. Additionally, FFPE sample preparation is time-consuming. To provide early treatment for cancer patients, a more rapid and robust method is required for precision medicine. We present a simple method for genetic analysis, called touch imprint cytology combined with massively paralleled sequencing (touch imprint cytology [TIC]-seq), to detect somatic mutations in tumors. We prepared FFPE tissues and TIC specimens from tumors in nine lung cancer patients and one patient with breast cancer. We found that the quality and quantity of TIC DNA was higher than that of FFPE DNA, which requires microdissection to enrich DNA from target tissues. Targeted sequencing using a next-generation sequencer obtained sufficient sequence data using TIC DNA. Most (92%) somatic mutations in lung primary tumors were found to be consistent between TIC and FFPE DNA. We also applied TIC DNA to primary and metastatic tumor tissues to analyze tumor heterogeneity in a breast cancer patient, and showed that common and distinct mutations among primary and metastatic sites could be classified into two distinct histological subtypes. TIC-seq is an alternative and feasible method to analyze genomic alterations in tumors by simply touching the cut surface of specimens to slides. © 2016 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

A computational method for estimating the PCR duplication rate in DNA and RNA-seq experiments.

PubMed

Bansal, Vikas

2017-03-14

PCR amplification is an important step in the preparation of DNA sequencing libraries prior to high-throughput sequencing. PCR amplification introduces redundant reads in the sequence data and estimating the PCR duplication rate is important to assess the frequency of such reads. Existing computational methods do not distinguish PCR duplicates from "natural" read duplicates that represent independent DNA fragments and therefore, over-estimate the PCR duplication rate for DNA-seq and RNA-seq experiments. In this paper, we present a computational method to estimate the average PCR duplication rate of high-throughput sequence datasets that accounts for natural read duplicates by leveraging heterozygous variants in an individual genome. Analysis of simulated data and exome sequence data from the 1000 Genomes project demonstrated that our method can accurately estimate the PCR duplication rate on paired-end as well as single-end read datasets which contain a high proportion of natural read duplicates. Further, analysis of exome datasets prepared using the Nextera library preparation method indicated that 45-50% of read duplicates correspond to natural read duplicates likely due to fragmentation bias. Finally, analysis of RNA-seq datasets from individuals in the 1000 Genomes project demonstrated that 70-95% of read duplicates observed in such datasets correspond to natural duplicates sampled from genes with high expression and identified outlier samples with a 2-fold greater PCR duplication rate than other samples. The method described here is a useful tool for estimating the PCR duplication rate of high-throughput sequence datasets and for assessing the fraction of read duplicates that correspond to natural read duplicates. An implementation of the method is available at https://github.com/vibansal/PCRduplicates .

Position-specific binding of FUS to nascent RNA regulates mRNA length

PubMed Central

Masuda, Akio; Takeda, Jun-ichi; Okuno, Tatsuya; Okamoto, Takaaki; Ohkawara, Bisei; Ito, Mikako; Ishigaki, Shinsuke; Sobue, Gen

2015-01-01

More than half of all human genes produce prematurely terminated polyadenylated short mRNAs. However, the underlying mechanisms remain largely elusive. CLIP-seq (cross-linking immunoprecipitation [CLIP] combined with deep sequencing) of FUS (fused in sarcoma) in neuronal cells showed that FUS is frequently clustered around an alternative polyadenylation (APA) site of nascent RNA. ChIP-seq (chromatin immunoprecipitation [ChIP] combined with deep sequencing) of RNA polymerase II (RNAP II) demonstrated that FUS stalls RNAP II and prematurely terminates transcription. When an APA site is located upstream of an FUS cluster, FUS enhances polyadenylation by recruiting CPSF160 and up-regulates the alternative short transcript. In contrast, when an APA site is located downstream from an FUS cluster, polyadenylation is not activated, and the RNAP II-suppressing effect of FUS leads to down-regulation of the alternative short transcript. CAGE-seq (cap analysis of gene expression [CAGE] combined with deep sequencing) and PolyA-seq (a strand-specific and quantitative method for high-throughput sequencing of 3' ends of polyadenylated transcripts) revealed that position-specific regulation of mRNA lengths by FUS is operational in two-thirds of transcripts in neuronal cells, with enrichment in genes involved in synaptic activities. PMID:25995189

Misconceptions on Missing Data in RAD-seq Phylogenetics with a Deep-scale Example from Flowering Plants.

PubMed

Eaton, Deren A R; Spriggs, Elizabeth L; Park, Brian; Donoghue, Michael J

2017-05-01

Restriction-site associated DNA (RAD) sequencing and related methods rely on the conservation of enzyme recognition sites to isolate homologous DNA fragments for sequencing, with the consequence that mutations disrupting these sites lead to missing information. There is thus a clear expectation for how missing data should be distributed, with fewer loci recovered between more distantly related samples. This observation has led to a related expectation: that RAD-seq data are insufficiently informative for resolving deeper scale phylogenetic relationships. Here we investigate the relationship between missing information among samples at the tips of a tree and information at edges within it. We re-analyze and review the distribution of missing data across ten RAD-seq data sets and carry out simulations to determine expected patterns of missing information. We also present new empirical results for the angiosperm clade Viburnum (Adoxaceae, with a crown age >50 Ma) for which we examine phylogenetic information at different depths in the tree and with varied sequencing effort. The total number of loci, the proportion that are shared, and phylogenetic informativeness varied dramatically across the examined RAD-seq data sets. Insufficient or uneven sequencing coverage accounted for similar proportions of missing data as dropout from mutation-disruption. Simulations reveal that mutation-disruption, which results in phylogenetically distributed missing data, can be distinguished from the more stochastic patterns of missing data caused by low sequencing coverage. In Viburnum, doubling sequencing coverage nearly doubled the number of parsimony informative sites, and increased by >10X the number of loci with data shared across >40 taxa. Our analysis leads to a set of practical recommendations for maximizing phylogenetic information in RAD-seq studies. [hierarchical redundancy; phylogenetic informativeness; quartet informativeness; Restriction-site associated DNA (RAD) sequencing; sequencing coverage; Viburnum.]. © The authors 2016. Published by Oxford University Press, on behalf of the Society of Systematic Biologists. All rights reserved. For permissions, please e-mail: journals.permission@oup.com.

Quantum-Sequencing: Fast electronic single DNA molecule sequencing

NASA Astrophysics Data System (ADS)

Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

2014-03-01

A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

Integrated digital error suppression for improved detection of circulating tumor DNA

PubMed Central

Kurtz, David M.; Chabon, Jacob J.; Scherer, Florian; Stehr, Henning; Liu, Chih Long; Bratman, Scott V.; Say, Carmen; Zhou, Li; Carter, Justin N.; West, Robert B.; Sledge, George W.; Shrager, Joseph B.; Loo, Billy W.; Neal, Joel W.; Wakelee, Heather A.; Diehn, Maximilian; Alizadeh, Ash A.

2016-01-01

High-throughput sequencing of circulating tumor DNA (ctDNA) promises to facilitate personalized cancer therapy. However, low quantities of cell-free DNA (cfDNA) in the blood and sequencing artifacts currently limit analytical sensitivity. To overcome these limitations, we introduce an approach for integrated digital error suppression (iDES). Our method combines in silico elimination of highly stereotypical background artifacts with a molecular barcoding strategy for the efficient recovery of cfDNA molecules. Individually, these two methods each improve the sensitivity of cancer personalized profiling by deep sequencing (CAPP-Seq) by ~3 fold, and synergize when combined to yield ~15-fold improvements. As a result, iDES-enhanced CAPP-Seq facilitates noninvasive variant detection across hundreds of kilobases. Applied to clinical non-small cell lung cancer (NSCLC) samples, our method enabled biopsy-free profiling of EGFR kinase domain mutations with 92% sensitivity and 96% specificity and detection of ctDNA down to 4 in 105 cfDNA molecules. We anticipate that iDES will aid the noninvasive genotyping and detection of ctDNA in research and clinical settings. PMID:27018799

Enzymic colorimetry-based DNA chip: a rapid and accurate assay for detecting mutations for clarithromycin resistance in the 23S rRNA gene of Helicobacter pylori.

PubMed

Xuan, Shi-Hai; Zhou, Yu-Gui; Shao, Bo; Cui, Ya-Lin; Li, Jian; Yin, Hong-Bo; Song, Xiao-Ping; Cong, Hui; Jing, Feng-Xiang; Jin, Qing-Hui; Wang, Hui-Min; Zhou, Jie

2009-11-01

Macrolide drugs, such as clarithromycin (CAM), are a key component of many combination therapies used to eradicate Helicobacter pylori. However, resistance to CAM is increasing in H. pylori and is becoming a serious problem in H. pylori eradication therapy. CAM resistance in H. pylori is mostly due to point mutations (A2142G/C, A2143G) in the peptidyltransferase-encoding region of the 23S rRNA gene. In this study an enzymic colorimetry-based DNA chip was developed to analyse single-nucleotide polymorphisms of the 23S rRNA gene to determine the prevalence of mutations in CAM-related resistance in H. pylori-positive patients. The results of the colorimetric DNA chip were confirmed by direct DNA sequencing. In 63 samples, the incidence of the A2143G mutation was 17.46 % (11/63). The results of the colorimetric DNA chip were concordant with DNA sequencing in 96.83 % of results (61/63). The colorimetric DNA chip could detect wild-type and mutant signals at every site, even at a DNA concentration of 1.53 x 10(2) copies microl(-1). Thus, the colorimetric DNA chip is a reliable assay for rapid and accurate detection of mutations in the 23S rRNA gene of H. pylori that lead to CAM-related resistance, directly from gastric tissues.

oPOSSUM-3: Advanced Analysis of Regulatory Motif Over-Representation Across Genes or ChIP-Seq Datasets

PubMed Central

Kwon, Andrew T.; Arenillas, David J.; Hunt, Rebecca Worsley; Wasserman, Wyeth W.

2012-01-01

oPOSSUM-3 is a web-accessible software system for identification of over-represented transcription factor binding sites (TFBS) and TFBS families in either DNA sequences of co-expressed genes or sequences generated from high-throughput methods, such as ChIP-Seq. Validation of the system with known sets of co-regulated genes and published ChIP-Seq data demonstrates the capacity for oPOSSUM-3 to identify mediating transcription factors (TF) for co-regulated genes or co-recovered sequences. oPOSSUM-3 is available at http://opossum.cisreg.ca. PMID:22973536

oPOSSUM-3: advanced analysis of regulatory motif over-representation across genes or ChIP-Seq datasets.

PubMed

Kwon, Andrew T; Arenillas, David J; Worsley Hunt, Rebecca; Wasserman, Wyeth W

2012-09-01

oPOSSUM-3 is a web-accessible software system for identification of over-represented transcription factor binding sites (TFBS) and TFBS families in either DNA sequences of co-expressed genes or sequences generated from high-throughput methods, such as ChIP-Seq. Validation of the system with known sets of co-regulated genes and published ChIP-Seq data demonstrates the capacity for oPOSSUM-3 to identify mediating transcription factors (TF) for co-regulated genes or co-recovered sequences. oPOSSUM-3 is available at http://opossum.cisreg.ca.

Pervasive, Genome-Wide Transcription in the Organelle Genomes of Diverse Plastid-Bearing Protists.

PubMed

Sanitá Lima, Matheus; Smith, David Roy

2017-11-06

Organelle genomes are among the most sequenced kinds of chromosome. This is largely because they are small and widely used in molecular studies, but also because next-generation sequencing technologies made sequencing easier, faster, and cheaper. However, studies of organelle RNA have not kept pace with those of DNA, despite huge amounts of freely available eukaryotic RNA-sequencing (RNA-seq) data. Little is known about organelle transcription in nonmodel species, and most of the available eukaryotic RNA-seq data have not been mined for organelle transcripts. Here, we use publicly available RNA-seq experiments to investigate organelle transcription in 30 diverse plastid-bearing protists with varying organelle genomic architectures. Mapping RNA-seq data to organelle genomes revealed pervasive, genome-wide transcription, regardless of the taxonomic grouping, gene organization, or noncoding content. For every species analyzed, transcripts covered ≥85% of the mitochondrial and/or plastid genomes (all of which were ≤105 kb), indicating that most of the organelle DNA-coding and noncoding-is transcriptionally active. These results follow earlier studies of model species showing that organellar transcription is coupled and ubiquitous across the genome, requiring significant downstream processing of polycistronic transcripts. Our findings suggest that noncoding organelle DNA can be transcriptionally active, raising questions about the underlying function of these transcripts and underscoring the utility of publicly available RNA-seq data for recovering complete genome sequences. If pervasive transcription is also found in bigger organelle genomes (>105 kb) and across a broader range of eukaryotes, this could indicate that noncoding organelle RNAs are regulating fundamental processes within eukaryotic cells. Copyright © 2017 Sanitá Lima and Smith.

Mapping Ribonucleotides Incorporated into DNA by Hydrolytic End-Sequencing.

PubMed

Orebaugh, Clinton D; Lujan, Scott A; Burkholder, Adam B; Clausen, Anders R; Kunkel, Thomas A

2018-01-01

Ribonucleotides embedded within DNA render the DNA sensitive to the formation of single-stranded breaks under alkali conditions. Here, we describe a next-generation sequencing method called hydrolytic end sequencing (HydEn-seq) to map ribonucleotides inserted into the genome of Saccharomyce cerevisiae strains deficient in ribonucleotide excision repair. We use this method to map several genomic features in wild-type and replicase variant yeast strains.

Sequence Capture versus Restriction Site Associated DNA Sequencing for Shallow Systematics.

PubMed

Harvey, Michael G; Smith, Brian Tilston; Glenn, Travis C; Faircloth, Brant C; Brumfield, Robb T

2016-09-01

Sequence capture and restriction site associated DNA sequencing (RAD-Seq) are two genomic enrichment strategies for applying next-generation sequencing technologies to systematics studies. At shallow timescales, such as within species, RAD-Seq has been widely adopted among researchers, although there has been little discussion of the potential limitations and benefits of RAD-Seq and sequence capture. We discuss a series of issues that may impact the utility of sequence capture and RAD-Seq data for shallow systematics in non-model species. We review prior studies that used both methods, and investigate differences between the methods by re-analyzing existing RAD-Seq and sequence capture data sets from a Neotropical bird (Xenops minutus). We suggest that the strengths of RAD-Seq data sets for shallow systematics are the wide dispersion of markers across the genome, the relative ease and cost of laboratory work, the deep coverage and read overlap at recovered loci, and the high overall information that results. Sequence capture's benefits include flexibility and repeatability in the genomic regions targeted, success using low-quality samples, more straightforward read orthology assessment, and higher per-locus information content. The utility of a method in systematics, however, rests not only on its performance within a study, but on the comparability of data sets and inferences with those of prior work. In RAD-Seq data sets, comparability is compromised by low overlap of orthologous markers across species and the sensitivity of genetic diversity in a data set to an interaction between the level of natural heterozygosity in the samples examined and the parameters used for orthology assessment. In contrast, sequence capture of conserved genomic regions permits interrogation of the same loci across divergent species, which is preferable for maintaining comparability among data sets and studies for the purpose of drawing general conclusions about the impact of historical processes across biotas. We argue that sequence capture should be given greater attention as a method of obtaining data for studies in shallow systematics and comparative phylogeography. © The Author(s) 2016. Published by Oxford University Press, on behalf of the Society of Systematic Biologists. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Quantification of differential gene expression by multiplexed targeted resequencing of cDNA

PubMed Central

Arts, Peer; van der Raadt, Jori; van Gestel, Sebastianus H.C.; Steehouwer, Marloes; Shendure, Jay; Hoischen, Alexander; Albers, Cornelis A.

2017-01-01

Whole-transcriptome or RNA sequencing (RNA-Seq) is a powerful and versatile tool for functional analysis of different types of RNA molecules, but sample reagent and sequencing cost can be prohibitive for hypothesis-driven studies where the aim is to quantify differential expression of a limited number of genes. Here we present an approach for quantification of differential mRNA expression by targeted resequencing of complementary DNA using single-molecule molecular inversion probes (cDNA-smMIPs) that enable highly multiplexed resequencing of cDNA target regions of ∼100 nucleotides and counting of individual molecules. We show that accurate estimates of differential expression can be obtained from molecule counts for hundreds of smMIPs per reaction and that smMIPs are also suitable for quantification of relative gene expression and allele-specific expression. Compared with low-coverage RNA-Seq and a hybridization-based targeted RNA-Seq method, cDNA-smMIPs are a cost-effective high-throughput tool for hypothesis-driven expression analysis in large numbers of genes (10 to 500) and samples (hundreds to thousands). PMID:28474677

A highly sensitive and accurate gene expression analysis by sequencing ("bead-seq") for a single cell.

PubMed

Matsunaga, Hiroko; Goto, Mari; Arikawa, Koji; Shirai, Masataka; Tsunoda, Hiroyuki; Huang, Huan; Kambara, Hideki

2015-02-15

Analyses of gene expressions in single cells are important for understanding detailed biological phenomena. Here, a highly sensitive and accurate method by sequencing (called "bead-seq") to obtain a whole gene expression profile for a single cell is proposed. A key feature of the method is to use a complementary DNA (cDNA) library on magnetic beads, which enables adding washing steps to remove residual reagents in a sample preparation process. By adding the washing steps, the next steps can be carried out under the optimal conditions without losing cDNAs. Error sources were carefully evaluated to conclude that the first several steps were the key steps. It is demonstrated that bead-seq is superior to the conventional methods for single-cell gene expression analyses in terms of reproducibility, quantitative accuracy, and biases caused during sample preparation and sequencing processes. Copyright © 2014 Elsevier Inc. All rights reserved.

Benchmarking of the Oxford Nanopore MinION sequencing for quantitative and qualitative assessment of cDNA populations.

PubMed

Oikonomopoulos, Spyros; Wang, Yu Chang; Djambazian, Haig; Badescu, Dunarel; Ragoussis, Jiannis

2016-08-24

To assess the performance of the Oxford Nanopore Technologies MinION sequencing platform, cDNAs from the External RNA Controls Consortium (ERCC) RNA Spike-In mix were sequenced. This mix mimics mammalian mRNA species and consists of 92 polyadenylated transcripts with known concentration. cDNA libraries were generated using a template switching protocol to facilitate the direct comparison between different sequencing platforms. The MinION performance was assessed for its ability to sequence the cDNAs directly with good accuracy in terms of abundance and full length. The abundance of the ERCC cDNA molecules sequenced by MinION agreed with their expected concentration. No length or GC content bias was observed. The majority of cDNAs were sequenced as full length. Additionally, a complex cDNA population derived from a human HEK-293 cell line was sequenced on an Illumina HiSeq 2500, PacBio RS II and ONT MinION platforms. We observed that there was a good agreement in the measured cDNA abundance between PacBio RS II and ONT MinION (rpearson = 0.82, isoforms with length more than 700bp) and between Illumina HiSeq 2500 and ONT MinION (rpearson = 0.75). This indicates that the ONT MinION can sequence quantitatively both long and short full length cDNA molecules.

An Integrated Approach for RNA-seq Data Normalization.

PubMed

Yang, Shengping; Mercante, Donald E; Zhang, Kun; Fang, Zhide

2016-01-01

DNA copy number alteration is common in many cancers. Studies have shown that insertion or deletion of DNA sequences can directly alter gene expression, and significant correlation exists between DNA copy number and gene expression. Data normalization is a critical step in the analysis of gene expression generated by RNA-seq technology. Successful normalization reduces/removes unwanted nonbiological variations in the data, while keeping meaningful information intact. However, as far as we know, no attempt has been made to adjust for the variation due to DNA copy number changes in RNA-seq data normalization. In this article, we propose an integrated approach for RNA-seq data normalization. Comparisons show that the proposed normalization can improve power for downstream differentially expressed gene detection and generate more biologically meaningful results in gene profiling. In addition, our findings show that due to the effects of copy number changes, some housekeeping genes are not always suitable internal controls for studying gene expression. Using information from DNA copy number, integrated approach is successful in reducing noises due to both biological and nonbiological causes in RNA-seq data, thus increasing the accuracy of gene profiling.

ScaffoldSeq: Software for characterization of directed evolution populations.

PubMed

Woldring, Daniel R; Holec, Patrick V; Hackel, Benjamin J

2016-07-01

ScaffoldSeq is software designed for the numerous applications-including directed evolution analysis-in which a user generates a population of DNA sequences encoding for partially diverse proteins with related functions and would like to characterize the single site and pairwise amino acid frequencies across the population. A common scenario for enzyme maturation, antibody screening, and alternative scaffold engineering involves naïve and evolved populations that contain diversified regions, varying in both sequence and length, within a conserved framework. Analyzing the diversified regions of such populations is facilitated by high-throughput sequencing platforms; however, length variability within these regions (e.g., antibody CDRs) encumbers the alignment process. To overcome this challenge, the ScaffoldSeq algorithm takes advantage of conserved framework sequences to quickly identify diverse regions. Beyond this, unintended biases in sequence frequency are generated throughout the experimental workflow required to evolve and isolate clones of interest prior to DNA sequencing. ScaffoldSeq software uniquely handles this issue by providing tools to quantify and remove background sequences, cluster similar protein families, and dampen the impact of dominant clones. The software produces graphical and tabular summaries for each region of interest, allowing users to evaluate diversity in a site-specific manner as well as identify epistatic pairwise interactions. The code and detailed information are freely available at http://research.cems.umn.edu/hackel. Proteins 2016; 84:869-874. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Methodology challenges in studying human gut microbiota - effects of collection, storage, DNA extraction and next generation sequencing technologies.

PubMed

Panek, Marina; Čipčić Paljetak, Hana; Barešić, Anja; Perić, Mihaela; Matijašić, Mario; Lojkić, Ivana; Vranešić Bender, Darija; Krznarić, Željko; Verbanac, Donatella

2018-03-23

The information on microbiota composition in the human gastrointestinal tract predominantly originates from the analyses of human faeces by application of next generation sequencing (NGS). However, the detected composition of the faecal bacterial community can be affected by various factors including experimental design and procedures. This study evaluated the performance of different protocols for collection and storage of faecal samples (native and OMNIgene.GUT system) and bacterial DNA extraction (MP Biomedicals, QIAGEN and MO BIO kits), using two NGS platforms for 16S rRNA gene sequencing (Ilumina MiSeq and Ion Torrent PGM). OMNIgene.GUT proved as a reliable and convenient system for collection and storage of faecal samples although favouring Sutterella genus. MP provided superior DNA yield and quality, MO BIO depleted Gram positive organisms while using QIAGEN with OMNIgene.GUT resulted in greatest variability compared to other two kits. MiSeq and IT platforms in their supplier recommended setups provided comparable reproducibility of donor faecal microbiota. The differences included higher diversity observed with MiSeq and increased capacity of MiSeq to detect Akkermansia muciniphila, [Odoribacteraceae], Erysipelotrichaceae and Ruminococcaceae (primarily Faecalibacterium prausnitzii). The results of our study could assist the investigators using NGS technologies to make informed decisions on appropriate tools for their experimental pipelines.

Existing and emerging detection technologies for DNA (Deoxyribonucleic Acid) finger printing, sequencing, bio- and analytical chips: a multidisciplinary development unifying molecular biology, chemical and electronics engineering.

PubMed

Kumar Khanna, Vinod

2007-01-01

The current status and research trends of detection techniques for DNA-based analysis such as DNA finger printing, sequencing, biochips and allied fields are examined. An overview of main detectors is presented vis-à-vis these DNA operations. The biochip method is explained, the role of micro- and nanoelectronic technologies in biochip realization is highlighted, various optical and electrical detection principles employed in biochips are indicated, and the operational mechanisms of these detection devices are described. Although a diversity of biochips for diagnostic and therapeutic applications has been demonstrated in research laboratories worldwide, only some of these chips have entered the clinical market, and more chips are awaiting commercialization. The necessity of tagging is eliminated in refractive-index change based devices, but the basic flaw of indirect nature of most detection methodologies can only be overcome by generic and/or reagentless DNA sensors such as the conductance-based approach and the DNA-single electron transistor (DNA-SET) structure. Devices of the electrical detection-based category are expected to pave the pathway for the next-generation DNA chips. The review provides a comprehensive coverage of the detection technologies for DNA finger printing, sequencing and related techniques, encompassing a variety of methods from the primitive art to the state-of-the-art scenario as well as promising methods for the future.

Developmental validation of the MiSeq FGx Forensic Genomics System for Targeted Next Generation Sequencing in Forensic DNA Casework and Database Laboratories.

PubMed

Jäger, Anne C; Alvarez, Michelle L; Davis, Carey P; Guzmán, Ernesto; Han, Yonmee; Way, Lisa; Walichiewicz, Paulina; Silva, David; Pham, Nguyen; Caves, Glorianna; Bruand, Jocelyne; Schlesinger, Felix; Pond, Stephanie J K; Varlaro, Joe; Stephens, Kathryn M; Holt, Cydne L

2017-05-01

Human DNA profiling using PCR at polymorphic short tandem repeat (STR) loci followed by capillary electrophoresis (CE) size separation and length-based allele typing has been the standard in the forensic community for over 20 years. Over the last decade, Next-Generation Sequencing (NGS) matured rapidly, bringing modern advantages to forensic DNA analysis. The MiSeq FGx™ Forensic Genomics System, comprised of the ForenSeq™ DNA Signature Prep Kit, MiSeq FGx™ Reagent Kit, MiSeq FGx™ instrument and ForenSeq™ Universal Analysis Software, uses PCR to simultaneously amplify up to 231 forensic loci in a single multiplex reaction. Targeted loci include Amelogenin, 27 common, forensic autosomal STRs, 24 Y-STRs, 7 X-STRs and three classes of single nucleotide polymorphisms (SNPs). The ForenSeq™ kit includes two primer sets: Amelogenin, 58 STRs and 94 identity informative SNPs (iiSNPs) are amplified using DNA Primer Set A (DPMA; 153 loci); if a laboratory chooses to generate investigative leads using DNA Primer Set B, amplification is targeted to the 153 loci in DPMA plus 22 phenotypic informative (piSNPs) and 56 biogeographical ancestry SNPs (aiSNPs). High-resolution genotypes, including detection of intra-STR sequence variants, are semi-automatically generated with the ForenSeq™ software. This system was subjected to developmental validation studies according to the 2012 Revised SWGDAM Validation Guidelines. A two-step PCR first amplifies the target forensic STR and SNP loci (PCR1); unique, sample-specific indexed adapters or "barcodes" are attached in PCR2. Approximately 1736 ForenSeq™ reactions were analyzed. Studies include DNA substrate testing (cotton swabs, FTA cards, filter paper), species studies from a range of nonhuman organisms, DNA input sensitivity studies from 1ng down to 7.8pg, two-person human DNA mixture testing with three genotype combinations, stability analysis of partially degraded DNA, and effects of five commonly encountered PCR inhibitors. Calculations from ForenSeq™ STR and SNP repeatability and reproducibility studies (1ng template) indicate 100.0% accuracy of the MiSeq FGx™ System in allele calling relative to CE for STRs (1260 samples), and >99.1% accuracy relative to bead array typing for SNPs (1260 samples for iiSNPs, 310 samples for aiSNPs and piSNPs), with >99.0% and >97.8% precision, respectively. Call rates of >99.0% were observed for all STRs and SNPs amplified with both ForenSeq™ primer mixes. Limitations of the MiSeq FGx™ System are discussed. Results described here demonstrate that the MiSeq FGx™ System meets forensic DNA quality assurance guidelines with robust, reliable, and reproducible performance on samples of various quantities and qualities. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Towards Clinical Molecular Diagnosis of Inherited Cardiac Conditions: A Comparison of Bench-Top Genome DNA Sequencers

PubMed Central

Wilkinson, Samuel L.; John, Shibu; Walsh, Roddy; Novotny, Tomas; Valaskova, Iveta; Gupta, Manu; Game, Laurence; Barton, Paul J R.; Cook, Stuart A.; Ware, James S.

2013-01-01

Background Molecular genetic testing is recommended for diagnosis of inherited cardiac disease, to guide prognosis and treatment, but access is often limited by cost and availability. Recently introduced high-throughput bench-top DNA sequencing platforms have the potential to overcome these limitations. Methodology/Principal Findings We evaluated two next-generation sequencing (NGS) platforms for molecular diagnostics. The protein-coding regions of six genes associated with inherited arrhythmia syndromes were amplified from 15 human samples using parallelised multiplex PCR (Access Array, Fluidigm), and sequenced on the MiSeq (Illumina) and Ion Torrent PGM (Life Technologies). Overall, 97.9% of the target was sequenced adequately for variant calling on the MiSeq, and 96.8% on the Ion Torrent PGM. Regions missed tended to be of high GC-content, and most were problematic for both platforms. Variant calling was assessed using 107 variants detected using Sanger sequencing: within adequately sequenced regions, variant calling on both platforms was highly accurate (Sensitivity: MiSeq 100%, PGM 99.1%. Positive predictive value: MiSeq 95.9%, PGM 95.5%). At the time of the study the Ion Torrent PGM had a lower capital cost and individual runs were cheaper and faster. The MiSeq had a higher capacity (requiring fewer runs), with reduced hands-on time and simpler laboratory workflows. Both provide significant cost and time savings over conventional methods, even allowing for adjunct Sanger sequencing to validate findings and sequence exons missed by NGS. Conclusions/Significance MiSeq and Ion Torrent PGM both provide accurate variant detection as part of a PCR-based molecular diagnostic workflow, and provide alternative platforms for molecular diagnosis of inherited cardiac conditions. Though there were performance differences at this throughput, platforms differed primarily in terms of cost, scalability, protocol stability and ease of use. Compared with current molecular genetic diagnostic tests for inherited cardiac arrhythmias, these NGS approaches are faster, less expensive, and yet more comprehensive. PMID:23861798

Rapid Quantification of Mutant Fitness in Diverse Bacteria by Sequencing Randomly Bar-Coded Transposons

PubMed Central

Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.; Lamson, Jacob S.; He, Jennifer; Hoover, Cindi A.; Blow, Matthew J.; Bristow, James; Butland, Gareth

2015-01-01

ABSTRACT Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with any transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative d-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. PMID:25968644

msgbsR: An R package for analysing methylation-sensitive restriction enzyme sequencing data.

PubMed

Mayne, Benjamin T; Leemaqz, Shalem Y; Buckberry, Sam; Rodriguez Lopez, Carlos M; Roberts, Claire T; Bianco-Miotto, Tina; Breen, James

2018-02-01

Genotyping-by-sequencing (GBS) or restriction-site associated DNA marker sequencing (RAD-seq) is a practical and cost-effective method for analysing large genomes from high diversity species. This method of sequencing, coupled with methylation-sensitive enzymes (often referred to as methylation-sensitive restriction enzyme sequencing or MRE-seq), is an effective tool to study DNA methylation in parts of the genome that are inaccessible in other sequencing techniques or are not annotated in microarray technologies. Current software tools do not fulfil all methylation-sensitive restriction sequencing assays for determining differences in DNA methylation between samples. To fill this computational need, we present msgbsR, an R package that contains tools for the analysis of methylation-sensitive restriction enzyme sequencing experiments. msgbsR can be used to identify and quantify read counts at methylated sites directly from alignment files (BAM files) and enables verification of restriction enzyme cut sites with the correct recognition sequence of the individual enzyme. In addition, msgbsR assesses DNA methylation based on read coverage, similar to RNA sequencing experiments, rather than methylation proportion and is a useful tool in analysing differential methylation on large populations. The package is fully documented and available freely online as a Bioconductor package ( https://bioconductor.org/packages/release/bioc/html/msgbsR.html ).

Quantitative phenotyping via deep barcode sequencing.

PubMed

Smith, Andrew M; Heisler, Lawrence E; Mellor, Joseph; Kaper, Fiona; Thompson, Michael J; Chee, Mark; Roth, Frederick P; Giaever, Guri; Nislow, Corey

2009-10-01

Next-generation DNA sequencing technologies have revolutionized diverse genomics applications, including de novo genome sequencing, SNP detection, chromatin immunoprecipitation, and transcriptome analysis. Here we apply deep sequencing to genome-scale fitness profiling to evaluate yeast strain collections in parallel. This method, Barcode analysis by Sequencing, or "Bar-seq," outperforms the current benchmark barcode microarray assay in terms of both dynamic range and throughput. When applied to a complex chemogenomic assay, Bar-seq quantitatively identifies drug targets, with performance superior to the benchmark microarray assay. We also show that Bar-seq is well-suited for a multiplex format. We completely re-sequenced and re-annotated the yeast deletion collection using deep sequencing, found that approximately 20% of the barcodes and common priming sequences varied from expectation, and used this revised list of barcode sequences to improve data quality. Together, this new assay and analysis routine provide a deep-sequencing-based toolkit for identifying gene-environment interactions on a genome-wide scale.

Comparison and evaluation of two exome capture kits and sequencing platforms for variant calling.

PubMed

Zhang, Guoqiang; Wang, Jianfeng; Yang, Jin; Li, Wenjie; Deng, Yutian; Li, Jing; Huang, Jun; Hu, Songnian; Zhang, Bing

2015-08-05

To promote the clinical application of next-generation sequencing, it is important to obtain accurate and consistent variants of target genomic regions at low cost. Ion Proton, the latest updated semiconductor-based sequencing instrument from Life Technologies, is designed to provide investigators with an inexpensive platform for human whole exome sequencing that achieves a rapid turnaround time. However, few studies have comprehensively compared and evaluated the accuracy of variant calling between Ion Proton and Illumina sequencing platforms such as HiSeq 2000, which is the most popular sequencing platform for the human genome. The Ion Proton sequencer combined with the Ion TargetSeq Exome Enrichment Kit together make up TargetSeq-Proton, whereas SureSelect-Hiseq is based on the Agilent SureSelect Human All Exon v4 Kit and the HiSeq 2000 sequencer. Here, we sequenced exonic DNA from four human blood samples using both TargetSeq-Proton and SureSelect-HiSeq. We then called variants in the exonic regions that overlapped between the two exome capture kits (33.6 Mb). The rates of shared variant loci called by two sequencing platforms were from 68.0 to 75.3% in four samples, whereas the concordance of co-detected variant loci reached 99%. Sanger sequencing validation revealed that the validated rate of concordant single nucleotide polymorphisms (SNPs) (91.5%) was higher than the SNPs specific to TargetSeq-Proton (60.0%) or specific to SureSelect-HiSeq (88.3%). With regard to 1-bp small insertions and deletions (InDels), the Sanger sequencing validated rates of concordant variants (100.0%) and SureSelect-HiSeq-specific (89.6%) were higher than those of TargetSeq-Proton-specific (15.8%). In the sequencing of exonic regions, a combination of using of two sequencing strategies (SureSelect-HiSeq and TargetSeq-Proton) increased the variant calling specificity for concordant variant loci and the sensitivity for variant loci called by any one platform. However, for the sequencing of platform-specific variants, the accuracy of variant calling by HiSeq 2000 was higher than that of Ion Proton, specifically for the InDel detection. Moreover, the variant calling software also influences the detection of SNPs and, specifically, InDels in Ion Proton exome sequencing.

Application of Stochastic Labeling with Random-Sequence Barcodes for Simultaneous Quantification and Sequencing of Environmental 16S rRNA Genes.

PubMed

Hoshino, Tatsuhiko; Inagaki, Fumio

2017-01-01

Next-generation sequencing (NGS) is a powerful tool for analyzing environmental DNA and provides the comprehensive molecular view of microbial communities. For obtaining the copy number of particular sequences in the NGS library, however, additional quantitative analysis as quantitative PCR (qPCR) or digital PCR (dPCR) is required. Furthermore, number of sequences in a sequence library does not always reflect the original copy number of a target gene because of biases caused by PCR amplification, making it difficult to convert the proportion of particular sequences in the NGS library to the copy number using the mass of input DNA. To address this issue, we applied stochastic labeling approach with random-tag sequences and developed a NGS-based quantification protocol, which enables simultaneous sequencing and quantification of the targeted DNA. This quantitative sequencing (qSeq) is initiated from single-primer extension (SPE) using a primer with random tag adjacent to the 5' end of target-specific sequence. During SPE, each DNA molecule is stochastically labeled with the random tag. Subsequently, first-round PCR is conducted, specifically targeting the SPE product, followed by second-round PCR to index for NGS. The number of random tags is only determined during the SPE step and is therefore not affected by the two rounds of PCR that may introduce amplification biases. In the case of 16S rRNA genes, after NGS sequencing and taxonomic classification, the absolute number of target phylotypes 16S rRNA gene can be estimated by Poisson statistics by counting random tags incorporated at the end of sequence. To test the feasibility of this approach, the 16S rRNA gene of Sulfolobus tokodaii was subjected to qSeq, which resulted in accurate quantification of 5.0 × 103 to 5.0 × 104 copies of the 16S rRNA gene. Furthermore, qSeq was applied to mock microbial communities and environmental samples, and the results were comparable to those obtained using digital PCR and relative abundance based on a standard sequence library. We demonstrated that the qSeq protocol proposed here is advantageous for providing less-biased absolute copy numbers of each target DNA with NGS sequencing at one time. By this new experiment scheme in microbial ecology, microbial community compositions can be explored in more quantitative manner, thus expanding our knowledge of microbial ecosystems in natural environments.

Combining multiple ChIP-seq peak detection systems using combinatorial fusion.

PubMed

Schweikert, Christina; Brown, Stuart; Tang, Zuojian; Smith, Phillip R; Hsu, D Frank

2012-01-01

Due to the recent rapid development in ChIP-seq technologies, which uses high-throughput next-generation DNA sequencing to identify the targets of Chromatin Immunoprecipitation, there is an increasing amount of sequencing data being generated that provides us with greater opportunity to analyze genome-wide protein-DNA interactions. In particular, we are interested in evaluating and enhancing computational and statistical techniques for locating protein binding sites. Many peak detection systems have been developed; in this study, we utilize the following six: CisGenome, MACS, PeakSeq, QuEST, SISSRs, and TRLocator. We define two methods to merge and rescore the regions of two peak detection systems and analyze the performance based on average precision and coverage of transcription start sites. The results indicate that ChIP-seq peak detection can be improved by fusion using score or rank combination. Our method of combination and fusion analysis would provide a means for generic assessment of available technologies and systems and assist researchers in choosing an appropriate system (or fusion method) for analyzing ChIP-seq data. This analysis offers an alternate approach for increasing true positive rates, while decreasing false positive rates and hence improving the ChIP-seq peak identification process.

Discovering transcription factor binding sites in highly repetitive regions of genomes with multi-read analysis of ChIP-Seq data.

PubMed

Chung, Dongjun; Kuan, Pei Fen; Li, Bo; Sanalkumar, Rajendran; Liang, Kun; Bresnick, Emery H; Dewey, Colin; Keleş, Sündüz

2011-07-01

Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) is rapidly replacing chromatin immunoprecipitation combined with genome-wide tiling array analysis (ChIP-chip) as the preferred approach for mapping transcription-factor binding sites and chromatin modifications. The state of the art for analyzing ChIP-seq data relies on using only reads that map uniquely to a relevant reference genome (uni-reads). This can lead to the omission of up to 30% of alignable reads. We describe a general approach for utilizing reads that map to multiple locations on the reference genome (multi-reads). Our approach is based on allocating multi-reads as fractional counts using a weighted alignment scheme. Using human STAT1 and mouse GATA1 ChIP-seq datasets, we illustrate that incorporation of multi-reads significantly increases sequencing depths, leads to detection of novel peaks that are not otherwise identifiable with uni-reads, and improves detection of peaks in mappable regions. We investigate various genome-wide characteristics of peaks detected only by utilization of multi-reads via computational experiments. Overall, peaks from multi-read analysis have similar characteristics to peaks that are identified by uni-reads except that the majority of them reside in segmental duplications. We further validate a number of GATA1 multi-read only peaks by independent quantitative real-time ChIP analysis and identify novel target genes of GATA1. These computational and experimental results establish that multi-reads can be of critical importance for studying transcription factor binding in highly repetitive regions of genomes with ChIP-seq experiments.

Incorporation of unique molecular identifiers in TruSeq adapters improves the accuracy of quantitative sequencing.

PubMed

Hong, Jungeui; Gresham, David

2017-11-01

Quantitative analysis of next-generation sequencing (NGS) data requires discriminating duplicate reads generated by PCR from identical molecules that are of unique origin. Typically, PCR duplicates are identified as sequence reads that align to the same genomic coordinates using reference-based alignment. However, identical molecules can be independently generated during library preparation. Misidentification of these molecules as PCR duplicates can introduce unforeseen biases during analyses. Here, we developed a cost-effective sequencing adapter design by modifying Illumina TruSeq adapters to incorporate a unique molecular identifier (UMI) while maintaining the capacity to undertake multiplexed, single-index sequencing. Incorporation of UMIs into TruSeq adapters (TrUMIseq adapters) enables identification of bona fide PCR duplicates as identically mapped reads with identical UMIs. Using TrUMIseq adapters, we show that accurate removal of PCR duplicates results in improved accuracy of both allele frequency (AF) estimation in heterogeneous populations using DNA sequencing and gene expression quantification using RNA-Seq.

Partial bisulfite conversion for unique template sequencing

PubMed Central

Kumar, Vijay; Rosenbaum, Julie; Wang, Zihua; Forcier, Talitha; Ronemus, Michael; Wigler, Michael

2018-01-01

Abstract We introduce a new protocol, mutational sequencing or muSeq, which uses sodium bisulfite to randomly deaminate unmethylated cytosines at a fixed and tunable rate. The muSeq protocol marks each initial template molecule with a unique mutation signature that is present in every copy of the template, and in every fragmented copy of a copy. In the sequenced read data, this signature is observed as a unique pattern of C-to-T or G-to-A nucleotide conversions. Clustering reads with the same conversion pattern enables accurate count and long-range assembly of initial template molecules from short-read sequence data. We explore count and low-error sequencing by profiling 135 000 restriction fragments in a PstI representation, demonstrating that muSeq improves copy number inference and significantly reduces sporadic sequencer error. We explore long-range assembly in the context of cDNA, generating contiguous transcript clusters greater than 3,000 bp in length. The muSeq assemblies reveal transcriptional diversity not observable from short-read data alone. PMID:29161423

Massively parallel sequencing of forensic STRs and SNPs using the Illumina® ForenSeq™ DNA Signature Prep Kit on the MiSeq FGx™ Forensic Genomics System.

PubMed

Guo, Fei; Yu, Jiao; Zhang, Lu; Li, Jun

2017-11-01

The ForenSeq™ DNA Signature Prep Kit (ForenSeq Kit) is designed to detect more than 200 forensically relevant markers in a single reaction on the MiSeq FGx™ Forensic Genomics System (MiSeq FGx System), including Amelogenin, 27 autosomal short tandem repeats (A-STRs), 7 X chromosomal STRs (X-STRs), 24 Y chromosomal STRs (Y-STRs) and 94 identity-informative single nucleotide polymorphisms (iSNPs) with the option to contain 22 phenotypic-informative SNPs (pSNPs) and 56 ancestry-informative SNPs (aSNPs). In this study, we evaluated the MiSeq FGx System on three major parts: methodological optimization (DNA extraction, sample quantification, library normalization, diluted libraries concentration, and sample-to-cell arrangement), massively parallel sequencing (MPS) performance (depth of coverage, sequence coverage ratio, and allele coverage ratio), and ForenSeq Kit characteristics (repeatability and concordance, sensitivity, mixture, stability and case-type samples). Results showed that quantitative polymerase chain reaction (qPCR)-based sample quantification and library normalization and the appropriate number of pooled libraries and concentration of diluted libraries provided a greater level of MPS performance and repeatability. Repeatable and concordant genotypes were obtained by the ForenSeq Kit. Full profiles were obtained from ≥100pg input DNA for STRs and ≥200pg for SNPs. A sample with ≥5% minor contributors was considered as a mixture by imbalanced allele coverage ratio distribution, and full profiles from minor contributors were easily detected between 9:1 and 1:9 mixtures with known reference profiles. The ForenSeq Kit tolerated considerable concentrations of inhibitors like ≤200μM hematin and ≤50μg/ml humic acid, and >56% STR profiles and >88% SNP profiles were obtained from ≥200-bp degraded samples. Also, it was adapted to case-type samples. As a whole, the ForenSeq Kit is a well-performed, robust, reliable, reproducible and highly informative assay, and it can fully meet requirements for human identification. Further, sensitive QC indicator and automated sample comparison function in the ForenSeq™ Universal Analysis Software are quite helpful, so that we can concentrate on questionable genotypes and avoid tedious and time-consuming labor to maximum the time spent in data analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

Argo_CUDA: Exhaustive GPU based approach for motif discovery in large DNA datasets.

PubMed

Vishnevsky, Oleg V; Bocharnikov, Andrey V; Kolchanov, Nikolay A

2018-02-01

The development of chromatin immunoprecipitation sequencing (ChIP-seq) technology has revolutionized the genetic analysis of the basic mechanisms underlying transcription regulation and led to accumulation of information about a huge amount of DNA sequences. There are a lot of web services which are currently available for de novo motif discovery in datasets containing information about DNA/protein binding. An enormous motif diversity makes their finding challenging. In order to avoid the difficulties, researchers use different stochastic approaches. Unfortunately, the efficiency of the motif discovery programs dramatically declines with the query set size increase. This leads to the fact that only a fraction of top "peak" ChIP-Seq segments can be analyzed or the area of analysis should be narrowed. Thus, the motif discovery in massive datasets remains a challenging issue. Argo_Compute Unified Device Architecture (CUDA) web service is designed to process the massive DNA data. It is a program for the detection of degenerate oligonucleotide motifs of fixed length written in 15-letter IUPAC code. Argo_CUDA is a full-exhaustive approach based on the high-performance GPU technologies. Compared with the existing motif discovery web services, Argo_CUDA shows good prediction quality on simulated sets. The analysis of ChIP-Seq sequences revealed the motifs which correspond to known transcription factor binding sites.

Inferring nucleosome positions with their histone mark annotation from ChIP data

PubMed Central

Mammana, Alessandro; Vingron, Martin; Chung, Ho-Ryun

2013-01-01

Motivation: The nucleosome is the basic repeating unit of chromatin. It contains two copies each of the four core histones H2A, H2B, H3 and H4 and about 147 bp of DNA. The residues of the histone proteins are subject to numerous post-translational modifications, such as methylation or acetylation. Chromatin immunoprecipitiation followed by sequencing (ChIP-seq) is a technique that provides genome-wide occupancy data of these modified histone proteins, and it requires appropriate computational methods. Results: We present NucHunter, an algorithm that uses the data from ChIP-seq experiments directed against many histone modifications to infer positioned nucleosomes. NucHunter annotates each of these nucleosomes with the intensities of the histone modifications. We demonstrate that these annotations can be used to infer nucleosomal states with distinct correlations to underlying genomic features and chromatin-related processes, such as transcriptional start sites, enhancers, elongation by RNA polymerase II and chromatin-mediated repression. Thus, NucHunter is a versatile tool that can be used to predict positioned nucleosomes from a panel of histone modification ChIP-seq experiments and infer distinct histone modification patterns associated to different chromatin states. Availability: The software is available at http://epigen.molgen.mpg.de/nuchunter/. Contact: chung@molgen.mpg.de Supplementary information: Supplementary data are available at Bioinformatics online. PMID:23981350

Nbs1 ChIP-Seq Identifies Off-Target DNA Double-Strand Breaks Induced by AID in Activated Splenic B Cells

PubMed Central

Linehan, Erin K.; Schrader, Carol E.; Stavnezer, Janet

2015-01-01

Activation-induced cytidine deaminase (AID) is required for initiation of Ig class switch recombination (CSR) and somatic hypermutation (SHM) of antibody genes during immune responses. AID has also been shown to induce chromosomal translocations, mutations, and DNA double-strand breaks (DSBs) involving non-Ig genes in activated B cells. To determine what makes a DNA site a target for AID-induced DSBs, we identify off-target DSBs induced by AID by performing chromatin immunoprecipitation (ChIP) for Nbs1, a protein that binds DSBs, followed by deep sequencing (ChIP-Seq). We detect and characterize hundreds of off-target AID-dependent DSBs. Two types of tandem repeats are highly enriched within the Nbs1-binding sites: long CA repeats, which can form Z-DNA, and tandem pentamers containing the AID target hotspot WGCW. These tandem repeats are not nearly as enriched at AID-independent DSBs, which we also identified. Msh2, a component of the mismatch repair pathway and important for genome stability, increases off-target DSBs, similar to its effect on Ig switch region DSBs, which are required intermediates during CSR. Most of the off-target DSBs are two-ended, consistent with generation during G1 phase, similar to DSBs in Ig switch regions. However, a minority are one-ended, presumably due to conversion of single-strand breaks to DSBs during replication. One-ended DSBs are repaired by processes involving homologous recombination, including break-induced replication repair, which can lead to genome instability. Off-target DSBs, especially those present during S phase, can lead to chromosomal translocations, deletions and gene amplifications, resulting in the high frequency of B cell lymphomas derived from cells that express or have expressed AID. PMID:26263206

Software for rapid time dependent ChIP-sequencing analysis (TDCA).

PubMed

Myschyshyn, Mike; Farren-Dai, Marco; Chuang, Tien-Jui; Vocadlo, David

2017-11-25

Chromatin immunoprecipitation followed by DNA sequencing (ChIP-seq) and associated methods are widely used to define the genome wide distribution of chromatin associated proteins, post-translational epigenetic marks, and modifications found on DNA bases. An area of emerging interest is to study time dependent changes in the distribution of such proteins and marks by using serial ChIP-seq experiments performed in a time resolved manner. Despite such time resolved studies becoming increasingly common, software to facilitate analysis of such data in a robust automated manner is limited. We have designed software called Time-Dependent ChIP-Sequencing Analyser (TDCA), which is the first program to automate analysis of time-dependent ChIP-seq data by fitting to sigmoidal curves. We provide users with guidance for experimental design of TDCA for modeling of time course (TC) ChIP-seq data using two simulated data sets. Furthermore, we demonstrate that this fitting strategy is widely applicable by showing that automated analysis of three previously published TC data sets accurately recapitulates key findings reported in these studies. Using each of these data sets, we highlight how biologically relevant findings can be readily obtained by exploiting TDCA to yield intuitive parameters that describe behavior at either a single locus or sets of loci. TDCA enables customizable analysis of user input aligned DNA sequencing data, coupled with graphical outputs in the form of publication-ready figures that describe behavior at either individual loci or sets of loci sharing common traits defined by the user. TDCA accepts sequencing data as standard binary alignment map (BAM) files and loci of interest in browser extensible data (BED) file format. TDCA accurately models the number of sequencing reads, or coverage, at loci from TC ChIP-seq studies or conceptually related TC sequencing experiments. TC experiments are reduced to intuitive parametric values that facilitate biologically relevant data analysis, and the uncovering of variations in the time-dependent behavior of chromatin. TDCA automates the analysis of TC ChIP-seq experiments, permitting researchers to easily obtain raw and modeled data for specific loci or groups of loci with similar behavior while also enhancing consistency of data analysis of TC data within the genomics field.

TEA: the epigenome platform for Arabidopsis methylome study.

PubMed

Su, Sheng-Yao; Chen, Shu-Hwa; Lu, I-Hsuan; Chiang, Yih-Shien; Wang, Yu-Bin; Chen, Pao-Yang; Lin, Chung-Yen

2016-12-22

Bisulfite sequencing (BS-seq) has become a standard technology to profile genome-wide DNA methylation at single-base resolution. It allows researchers to conduct genome-wise cytosine methylation analyses on issues about genomic imprinting, transcriptional regulation, cellular development and differentiation. One single data from a BS-Seq experiment is resolved into many features according to the sequence contexts, making methylome data analysis and data visualization a complex task. We developed a streamlined platform, TEA, for analyzing and visualizing data from whole-genome BS-Seq (WGBS) experiments conducted in the model plant Arabidopsis thaliana. To capture the essence of the genome methylation level and to meet the efficiency for running online, we introduce a straightforward method for measuring genome methylation in each sequence context by gene. The method is scripted in Java to process BS-Seq mapping results. Through a simple data uploading process, the TEA server deploys a web-based platform for deep analysis by linking data to an updated Arabidopsis annotation database and toolkits. TEA is an intuitive and efficient online platform for analyzing the Arabidopsis genomic DNA methylation landscape. It provides several ways to help users exploit WGBS data. TEA is freely accessible for academic users at: http://tea.iis.sinica.edu.tw .

Isoform Sequencing and State-of-Art Applications for Unravelling Complexity of Plant Transcriptomes

PubMed Central

An, Dong; Li, Changsheng; Humbeck, Klaus

2018-01-01

Single-molecule real-time (SMRT) sequencing developed by PacBio, also called third-generation sequencing (TGS), offers longer reads than the second-generation sequencing (SGS). Given its ability to obtain full-length transcripts without assembly, isoform sequencing (Iso-Seq) of transcriptomes by PacBio is advantageous for genome annotation, identification of novel genes and isoforms, as well as the discovery of long non-coding RNA (lncRNA). In addition, Iso-Seq gives access to the direct detection of alternative splicing, alternative polyadenylation (APA), gene fusion, and DNA modifications. Such applications of Iso-Seq facilitate the understanding of gene structure, post-transcriptional regulatory networks, and subsequently proteomic diversity. In this review, we summarize its applications in plant transcriptome study, specifically pointing out challenges associated with each step in the experimental design and highlight the development of bioinformatic pipelines. We aim to provide the community with an integrative overview and a comprehensive guidance to Iso-Seq, and thus to promote its applications in plant research. PMID:29346292

Predicting conformational ensembles and genome-wide transcription factor binding sites from DNA sequences.

PubMed

Andrabi, Munazah; Hutchins, Andrew Paul; Miranda-Saavedra, Diego; Kono, Hidetoshi; Nussinov, Ruth; Mizuguchi, Kenji; Ahmad, Shandar

2017-06-22

DNA shape is emerging as an important determinant of transcription factor binding beyond just the DNA sequence. The only tool for large scale DNA shape estimates, DNAshape was derived from Monte-Carlo simulations and predicts four broad and static DNA shape features, Propeller twist, Helical twist, Minor groove width and Roll. The contributions of other shape features e.g. Shift, Slide and Opening cannot be evaluated using DNAshape. Here, we report a novel method DynaSeq, which predicts molecular dynamics-derived ensembles of a more exhaustive set of DNA shape features. We compared the DNAshape and DynaSeq predictions for the common features and applied both to predict the genome-wide binding sites of 1312 TFs available from protein interaction quantification (PIQ) data. The results indicate a good agreement between the two methods for the common shape features and point to advantages in using DynaSeq. Predictive models employing ensembles from individual conformational parameters revealed that base-pair opening - known to be important in strand separation - was the best predictor of transcription factor-binding sites (TFBS) followed by features employed by DNAshape. Of note, TFBS could be predicted not only from the features at the target motif sites, but also from those as far as 200 nucleotides away from the motif.

Chromatin Immunoprecipitation Sequencing (ChIP-Seq) for Transcription Factors and Chromatin Factors in Arabidopsis thaliana Roots: From Material Collection to Data Analysis.

PubMed

Cortijo, Sandra; Charoensawan, Varodom; Roudier, François; Wigge, Philip A

2018-01-01

Chromatin immunoprecipitation combined with next-generation sequencing (ChIP-seq) is a powerful technique to investigate in vivo transcription factor (TF) binding to DNA, as well as chromatin marks. Here we provide a detailed protocol for all the key steps to perform ChIP-seq in Arabidopsis thaliana roots, also working on other A. thaliana tissues and in most non-ligneous plants. We detail all steps from material collection, fixation, chromatin preparation, immunoprecipitation, library preparation, and finally computational analysis based on a combination of publicly available tools.

The promise and challenge of high-throughput sequencing of the antibody repertoire

PubMed Central

Georgiou, George; Ippolito, Gregory C; Beausang, John; Busse, Christian E; Wardemann, Hedda; Quake, Stephen R

2014-01-01

Efforts to determine the antibody repertoire encoded by B cells in the blood or lymphoid organs using high-throughput DNA sequencing technologies have been advancing at an extremely rapid pace and are transforming our understanding of humoral immune responses. Information gained from high-throughput DNA sequencing of immunoglobulin genes (Ig-seq) can be applied to detect B-cell malignancies with high sensitivity, to discover antibodies specific for antigens of interest, to guide vaccine development and to understand autoimmunity. Rapid progress in the development of experimental protocols and informatics analysis tools is helping to reduce sequencing artifacts, to achieve more precise quantification of clonal diversity and to extract the most pertinent biological information. That said, broader application of Ig-seq, especially in clinical settings, will require the development of a standardized experimental design framework that will enable the sharing and meta-analysis of sequencing data generated by different laboratories. PMID:24441474

Comparison of Four Human Papillomavirus Genotyping Methods: Next-generation Sequencing, INNO-LiPA, Electrochemical DNA Chip, and Nested-PCR.

PubMed

Nilyanimit, Pornjarim; Chansaenroj, Jira; Poomipak, Witthaya; Praianantathavorn, Kesmanee; Payungporn, Sunchai; Poovorawan, Yong

2018-03-01

Human papillomavirus (HPV) infection causes cervical cancer, thus necessitating early detection by screening. Rapid and accurate HPV genotyping is crucial both for the assessment of patients with HPV infection and for surveillance studies. Fifty-eight cervicovaginal samples were tested for HPV genotypes using four methods in parallel: nested-PCR followed by conventional sequencing, INNO-LiPA, electrochemical DNA chip, and next-generation sequencing (NGS). Seven HPV genotypes (16, 18, 31, 33, 45, 56, and 58) were identified by all four methods. Nineteen HPV genotypes were detected by NGS, but not by nested-PCR, INNO-LiPA, or electrochemical DNA chip. Although NGS is relatively expensive and complex, it may serve as a sensitive HPV genotyping method. Because of its highly sensitive detection of multiple HPV genotypes, NGS may serve as an alternative for diagnostic HPV genotyping in certain situations. © The Korean Society for Laboratory Medicine

YAMAT-seq: an efficient method for high-throughput sequencing of mature transfer RNAs

PubMed Central

Shigematsu, Megumi; Honda, Shozo; Loher, Phillipe; Telonis, Aristeidis G.; Rigoutsos, Isidore

2017-01-01

Abstract Besides translation, transfer RNAs (tRNAs) play many non-canonical roles in various biological pathways and exhibit highly variable expression profiles. To unravel the emerging complexities of tRNA biology and molecular mechanisms underlying them, an efficient tRNA sequencing method is required. However, the rigid structure of tRNA has been presenting a challenge to the development of such methods. We report the development of Y-shaped Adapter-ligated MAture TRNA sequencing (YAMAT-seq), an efficient and convenient method for high-throughput sequencing of mature tRNAs. YAMAT-seq circumvents the issue of inefficient adapter ligation, a characteristic of conventional RNA sequencing methods for mature tRNAs, by employing the efficient and specific ligation of Y-shaped adapter to mature tRNAs using T4 RNA Ligase 2. Subsequent cDNA amplification and next-generation sequencing successfully yield numerous mature tRNA sequences. YAMAT-seq has high specificity for mature tRNAs and high sensitivity to detect most isoacceptors from minute amount of total RNA. Moreover, YAMAT-seq shows quantitative capability to estimate expression levels of mature tRNAs, and has high reproducibility and broad applicability for various cell lines. YAMAT-seq thus provides high-throughput technique for identifying tRNA profiles and their regulations in various transcriptomes, which could play important regulatory roles in translation and other biological processes. PMID:28108659

Single-cell triple omics sequencing reveals genetic, epigenetic, and transcriptomic heterogeneity in hepatocellular carcinomas

PubMed Central

Hou, Yu; Guo, Huahu; Cao, Chen; Li, Xianlong; Hu, Boqiang; Zhu, Ping; Wu, Xinglong; Wen, Lu; Tang, Fuchou; Huang, Yanyi; Peng, Jirun

2016-01-01

Single-cell genome, DNA methylome, and transcriptome sequencing methods have been separately developed. However, to accurately analyze the mechanism by which transcriptome, genome and DNA methylome regulate each other, these omic methods need to be performed in the same single cell. Here we demonstrate a single-cell triple omics sequencing technique, scTrio-seq, that can be used to simultaneously analyze the genomic copy-number variations (CNVs), DNA methylome, and transcriptome of an individual mammalian cell. We show that large-scale CNVs cause proportional changes in RNA expression of genes within the gained or lost genomic regions, whereas these CNVs generally do not affect DNA methylation in these regions. Furthermore, we applied scTrio-seq to 25 single cancer cells derived from a human hepatocellular carcinoma tissue sample. We identified two subpopulations within these cells based on CNVs, DNA methylome, or transcriptome of individual cells. Our work offers a new avenue of dissecting the complex contribution of genomic and epigenomic heterogeneities to the transcriptomic heterogeneity within a population of cells. PMID:26902283

Niche and neutral processes both shape community structure in parallelized, aerobic, single carbon-source enrichments

DOE Data Explorer

Flynn, Theodore M.; Koval, Jason C.; Greenwald, Stephanie M.; Owens, Sarah M.; Kemner, Kenneth M.; Antonopoulos, Dionysios A.

2017-01-01

We present DNA sequence data in FASTA-formatted files from aerobic environmental microcosms inoculated with a sole carbon source. DNA sequences are of 16S rRNA genes present in DNA extracted from each microcosm along with the environmental samples (soil, water) used to inoculate them. These samples were sequenced using the Illumina MiSeq platform at the Environmental Sample Preparation and Sequencing Facility at Argonne National Laboratory. This data is compatible with standard microbiome analysis pipelines (e.g., QIIME, mothur, etc.).

Analyses of Methylomes Derived from Meso-American Common Bean (Phaseolus vulgaris L.) Using MeDIP-Seq and Whole Genome Sodium Bisulfite-Sequencing.

PubMed

Crampton, Mollee; Sripathi, Venkateswara R; Hossain, Khwaja; Kalavacharla, Venu

2016-01-01

Common bean (Phaseolus vulgaris L.) is economically important for its high protein, fiber, and micronutrient contents, with a relatively small genome size of ∼587 Mb. Common bean is genetically diverse with two major gene pools, Meso-American and Andean. The phenotypic variability within common bean is partly attributed to the genetic diversity and epigenetic changes that are largely influenced by environmental factors. It is well established that an important epigenetic regulator of gene expression is DNA methylation. Here, we present results generated from two high-throughput sequencing technologies, methylated DNA immunoprecipitation-sequencing (MeDIP-seq) and whole genome bisulfite-sequencing (BS-Seq). Our analyses revealed that this Meso-American common bean displays similar methylation patterns as other previously published plant methylomes, with CG ∼50%, CHG ∼30%, and CHH ∼2.7% methylation, however, these differ from the common bean reference methylome of Andean origin. We identified higher CG methylation levels in both promoter and genic regions than CHG and CHH contexts. Moreover, we found relatively higher CG methylation levels in genes than in promoters. Conversely, the CHG and CHH methylation levels were highest in promoters than in genes. This is the first genome-wide DNA methylation profiling study in a Meso-American common bean cultivar ("Sierra") using NGS approaches. Our long-term goal is to generate genome-wide epigenomic maps in common bean focusing on chromatin accessibility, histone modifications, and DNA methylation.

Analyses of Methylomes Derived from Meso-American Common Bean (Phaseolus vulgaris L.) Using MeDIP-Seq and Whole Genome Sodium Bisulfite-Sequencing

PubMed Central

Crampton, Mollee; Sripathi, Venkateswara R.; Hossain, Khwaja; Kalavacharla, Venu

2016-01-01

Common bean (Phaseolus vulgaris L.) is economically important for its high protein, fiber, and micronutrient contents, with a relatively small genome size of ∼587 Mb. Common bean is genetically diverse with two major gene pools, Meso-American and Andean. The phenotypic variability within common bean is partly attributed to the genetic diversity and epigenetic changes that are largely influenced by environmental factors. It is well established that an important epigenetic regulator of gene expression is DNA methylation. Here, we present results generated from two high-throughput sequencing technologies, methylated DNA immunoprecipitation-sequencing (MeDIP-seq) and whole genome bisulfite-sequencing (BS-Seq). Our analyses revealed that this Meso-American common bean displays similar methylation patterns as other previously published plant methylomes, with CG ∼50%, CHG ∼30%, and CHH ∼2.7% methylation, however, these differ from the common bean reference methylome of Andean origin. We identified higher CG methylation levels in both promoter and genic regions than CHG and CHH contexts. Moreover, we found relatively higher CG methylation levels in genes than in promoters. Conversely, the CHG and CHH methylation levels were highest in promoters than in genes. This is the first genome-wide DNA methylation profiling study in a Meso-American common bean cultivar (“Sierra”) using NGS approaches. Our long-term goal is to generate genome-wide epigenomic maps in common bean focusing on chromatin accessibility, histone modifications, and DNA methylation. PMID:27199997

Quantitative phenotyping via deep barcode sequencing

PubMed Central

Smith, Andrew M.; Heisler, Lawrence E.; Mellor, Joseph; Kaper, Fiona; Thompson, Michael J.; Chee, Mark; Roth, Frederick P.; Giaever, Guri; Nislow, Corey

2009-01-01

Next-generation DNA sequencing technologies have revolutionized diverse genomics applications, including de novo genome sequencing, SNP detection, chromatin immunoprecipitation, and transcriptome analysis. Here we apply deep sequencing to genome-scale fitness profiling to evaluate yeast strain collections in parallel. This method, Barcode analysis by Sequencing, or “Bar-seq,” outperforms the current benchmark barcode microarray assay in terms of both dynamic range and throughput. When applied to a complex chemogenomic assay, Bar-seq quantitatively identifies drug targets, with performance superior to the benchmark microarray assay. We also show that Bar-seq is well-suited for a multiplex format. We completely re-sequenced and re-annotated the yeast deletion collection using deep sequencing, found that ∼20% of the barcodes and common priming sequences varied from expectation, and used this revised list of barcode sequences to improve data quality. Together, this new assay and analysis routine provide a deep-sequencing-based toolkit for identifying gene–environment interactions on a genome-wide scale. PMID:19622793

Quantum-Sequencing: Biophysics of quantum tunneling through nucleic acids

NASA Astrophysics Data System (ADS)

Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

2014-03-01

Tunneling microscopy and spectroscopy has extensively been used in physical surface sciences to study quantum tunneling to measure electronic local density of states of nanomaterials and to characterize adsorbed species. Quantum-Sequencing (Q-Seq) is a new method based on tunneling microscopy for electronic sequencing of single molecule of nucleic acids. A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free single-molecule sequencing method. Here, we present the unique ``electronic fingerprints'' for all nucleotides on DNA and RNA using Q-Seq along their intrinsic biophysical parameters. We have analyzed tunneling spectra for the nucleotides at different pH conditions and analyzed the HOMO, LUMO and energy gap for all of them. In addition we show a number of biophysical parameters to further characterize all nucleobases (electron and hole transition voltage and energy barriers). These results highlight the robustness of Q-Seq as a technique for next-generation sequencing.

Performance of the ForenSeqTM DNA Signature Prep kit on highly degraded samples.

PubMed

Fattorini, Paolo; Previderé, Carlo; Carboni, Ilaria; Marrubini, Giorgio; Sorçaburu-Cigliero, Solange; Grignani, Pierangela; Bertoglio, Barbara; Vatta, Paolo; Ricci, Ugo

2017-04-01

Next generation sequencing (NGS) is the emerging technology in forensic genomics laboratories. It offers higher resolution to address most problems of human identification, greater efficiency and potential ability to interrogate very challenging forensic casework samples. In this study, a trial set of DNA samples was artificially degraded by progressive aqueous hydrolysis, and analyzed together with the corresponding unmodified DNA sample and control sample 2800 M, to test the performance and reliability of the ForenSeq TM DNA Signature Prep kit using the MiSeq Sequencer (Illumina). The results of replicate tests performed on the unmodified sample (1.0 ng) and on scalar dilutions (1.0, 0.5 and 0.1 ng) of the reference sample 2800 M showed the robustness and the reliability of the NGS approach even from sub-optimal amounts of high quality DNA. The degraded samples showed a very limited number of reads/sample, from 2.9-10.2 folds lower than the ones reported for the less concentrated 2800 M DNA dilution (0.1 ng). In addition, it was impossible to assign up to 78.2% of the genotypes in the degraded samples as the software identified the corresponding loci as "low coverage" (< 50x). Amplification artifacts such as allelic imbalances, allele drop outs and a single allele drop in were also scored in the degraded samples. However, the ForenSeq TM DNA Sequencing kit, on the Illumina MiSeq, was able to generate data which led to the correct typing of 5.1-44.8% and 10.9-58.7% of 58 of the STRs and 92 SNPs, respectively. In all trial samples, the SNP markers showed higher chances to be typed correctly compared to the STRs. This NGS approach showed very promising results in terms of ability to recover genetic information from heavily degraded DNA samples for which the conventional PCR/CE approach gave no results. The frequency of genetic mistyping was very low, reaching the value of 1.4% for only one of the degraded samples. However, these results suggest that further validation studies and a definition of interpretation criteria for NGS data are needed before implementation of this technique in forensic genetics. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Progress in ion torrent semiconductor chip based sequencing.

PubMed

Merriman, Barry; Rothberg, Jonathan M

2012-12-01

In order for next-generation sequencing to become widely used as a diagnostic in the healthcare industry, sequencing instrumentation will need to be mass produced with a high degree of quality and economy. One way to achieve this is to recast DNA sequencing in a format that fully leverages the manufacturing base created for computer chips, complementary metal-oxide semiconductor chip fabrication, which is the current pinnacle of large scale, high quality, low-cost manufacturing of high technology. To achieve this, ideally the entire sensory apparatus of the sequencer would be embodied in a standard semiconductor chip, manufactured in the same fab facilities used for logic and memory chips. Recently, such a sequencing chip, and the associated sequencing platform, has been developed and commercialized by Ion Torrent, a division of Life Technologies, Inc. Here we provide an overview of this semiconductor chip based sequencing technology, and summarize the progress made since its commercial introduction. We described in detail the progress in chip scaling, sequencing throughput, read length, and accuracy. We also summarize the enhancements in the associated platform, including sample preparation, data processing, and engagement of the broader development community through open source and crowdsourcing initiatives. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons

DOE PAGES

Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.; ...

2015-05-12

Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with anymore » transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative D-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. A large challenge in microbiology is the functional assessment of the millions of uncharacterized genes identified by genome sequencing. Transposon mutagenesis coupled to next-generation sequencing (TnSeq) is a powerful approach to assign phenotypes and functions to genes. However, the current strategies for TnSeq are too laborious to be applied to hundreds of experimental conditions across multiple bacteria. Here, we describe an approach, random bar code transposon-site sequencing (RB-TnSeq), which greatly simplifies the measurement of gene fitness by using bar code sequencing (BarSeq) to monitor the abundance of mutants. We performed 387 genome-wide fitness assays across five bacteria and identified phenotypes for over 5,000 genes. RB-TnSeq can be applied to diverse bacteria and is a powerful tool to annotate uncharacterized genes using phenotype data.« less

Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.

Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with anymore » transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative D-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. A large challenge in microbiology is the functional assessment of the millions of uncharacterized genes identified by genome sequencing. Transposon mutagenesis coupled to next-generation sequencing (TnSeq) is a powerful approach to assign phenotypes and functions to genes. However, the current strategies for TnSeq are too laborious to be applied to hundreds of experimental conditions across multiple bacteria. Here, we describe an approach, random bar code transposon-site sequencing (RB-TnSeq), which greatly simplifies the measurement of gene fitness by using bar code sequencing (BarSeq) to monitor the abundance of mutants. We performed 387 genome-wide fitness assays across five bacteria and identified phenotypes for over 5,000 genes. RB-TnSeq can be applied to diverse bacteria and is a powerful tool to annotate uncharacterized genes using phenotype data.« less

Arrays of nucleic acid probes on biological chips

DOEpatents

Chee, Mark; Cronin, Maureen T.; Fodor, Stephen P. A.; Huang, Xiaohua X.; Hubbell, Earl A.; Lipshutz, Robert J.; Lobban, Peter E.; Morris, MacDonald S.; Sheldon, Edward L.

1998-11-17

DNA chips containing arrays of oligonucleotide probes can be used to determine whether a target nucleic acid has a nucleotide sequence identical to or different from a specific reference sequence. The array of probes comprises probes exactly complementary to the reference sequence, as well as probes that differ by one or more bases from the exactly complementary probes.

Partial bisulfite conversion for unique template sequencing.

PubMed

Kumar, Vijay; Rosenbaum, Julie; Wang, Zihua; Forcier, Talitha; Ronemus, Michael; Wigler, Michael; Levy, Dan

2018-01-25

We introduce a new protocol, mutational sequencing or muSeq, which uses sodium bisulfite to randomly deaminate unmethylated cytosines at a fixed and tunable rate. The muSeq protocol marks each initial template molecule with a unique mutation signature that is present in every copy of the template, and in every fragmented copy of a copy. In the sequenced read data, this signature is observed as a unique pattern of C-to-T or G-to-A nucleotide conversions. Clustering reads with the same conversion pattern enables accurate count and long-range assembly of initial template molecules from short-read sequence data. We explore count and low-error sequencing by profiling 135 000 restriction fragments in a PstI representation, demonstrating that muSeq improves copy number inference and significantly reduces sporadic sequencer error. We explore long-range assembly in the context of cDNA, generating contiguous transcript clusters greater than 3,000 bp in length. The muSeq assemblies reveal transcriptional diversity not observable from short-read data alone. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Application of next-generation sequencing for rapid marker development in molecular plant breeding: a case study on anthracnose disease resistance in Lupinus angustifolius L.

PubMed Central

2012-01-01

Background In the last 30 years, a number of DNA fingerprinting methods such as RFLP, RAPD, AFLP, SSR, DArT, have been extensively used in marker development for molecular plant breeding. However, it remains a daunting task to identify highly polymorphic and closely linked molecular markers for a target trait for molecular marker-assisted selection. The next-generation sequencing (NGS) technology is far more powerful than any existing generic DNA fingerprinting methods in generating DNA markers. In this study, we employed a grain legume crop Lupinus angustifolius (lupin) as a test case, and examined the utility of an NGS-based method of RAD (restriction-site associated DNA) sequencing as DNA fingerprinting for rapid, cost-effective marker development tagging a disease resistance gene for molecular breeding. Results Twenty informative plants from a cross of RxS (disease resistant x susceptible) in lupin were subjected to RAD single-end sequencing by multiplex identifiers. The entire RAD sequencing products were resolved in two lanes of the 16-lanes per run sequencing platform Solexa HiSeq2000. A total of 185 million raw reads, approximately 17 Gb of sequencing data, were collected. Sequence comparison among the 20 test plants discovered 8207 SNP markers. Filtration of DNA sequencing data with marker identification parameters resulted in the discovery of 38 molecular markers linked to the disease resistance gene Lanr1. Five randomly selected markers were converted into cost-effective, simple PCR-based markers. Linkage analysis using marker genotyping data and disease resistance phenotyping data on a F8 population consisting of 186 individual plants confirmed that all these five markers were linked to the R gene. Two of these newly developed sequence-specific PCR markers, AnSeq3 and AnSeq4, flanked the target R gene at a genetic distance of 0.9 centiMorgan (cM), and are now replacing the markers previously developed by a traditional DNA fingerprinting method for marker-assisted selection in the Australian national lupin breeding program. Conclusions We demonstrated that more than 30 molecular markers linked to a target gene of agronomic trait of interest can be identified from a small portion (1/8) of one sequencing run on HiSeq2000 by applying NGS based RAD sequencing in marker development. The markers developed by the strategy described in this study are all co-dominant SNP markers, which can readily be converted into high throughput multiplex format or low-cost, simple PCR-based markers desirable for large scale marker implementation in plant breeding programs. The high density and closely linked molecular markers associated with a target trait help to overcome a major bottleneck for implementation of molecular markers on a wide range of germplasm in breeding programs. We conclude that application of NGS based RAD sequencing as DNA fingerprinting is a very rapid and cost-effective strategy for marker development in molecular plant breeding. The strategy does not require any prior genome knowledge or molecular information for the species under investigation, and it is applicable to other plant species. PMID:22805587

Application of next-generation sequencing for rapid marker development in molecular plant breeding: a case study on anthracnose disease resistance in Lupinus angustifolius L.

PubMed

Yang, Huaan; Tao, Ye; Zheng, Zequn; Li, Chengdao; Sweetingham, Mark W; Howieson, John G

2012-07-17

In the last 30 years, a number of DNA fingerprinting methods such as RFLP, RAPD, AFLP, SSR, DArT, have been extensively used in marker development for molecular plant breeding. However, it remains a daunting task to identify highly polymorphic and closely linked molecular markers for a target trait for molecular marker-assisted selection. The next-generation sequencing (NGS) technology is far more powerful than any existing generic DNA fingerprinting methods in generating DNA markers. In this study, we employed a grain legume crop Lupinus angustifolius (lupin) as a test case, and examined the utility of an NGS-based method of RAD (restriction-site associated DNA) sequencing as DNA fingerprinting for rapid, cost-effective marker development tagging a disease resistance gene for molecular breeding. Twenty informative plants from a cross of RxS (disease resistant x susceptible) in lupin were subjected to RAD single-end sequencing by multiplex identifiers. The entire RAD sequencing products were resolved in two lanes of the 16-lanes per run sequencing platform Solexa HiSeq2000. A total of 185 million raw reads, approximately 17 Gb of sequencing data, were collected. Sequence comparison among the 20 test plants discovered 8207 SNP markers. Filtration of DNA sequencing data with marker identification parameters resulted in the discovery of 38 molecular markers linked to the disease resistance gene Lanr1. Five randomly selected markers were converted into cost-effective, simple PCR-based markers. Linkage analysis using marker genotyping data and disease resistance phenotyping data on a F8 population consisting of 186 individual plants confirmed that all these five markers were linked to the R gene. Two of these newly developed sequence-specific PCR markers, AnSeq3 and AnSeq4, flanked the target R gene at a genetic distance of 0.9 centiMorgan (cM), and are now replacing the markers previously developed by a traditional DNA fingerprinting method for marker-assisted selection in the Australian national lupin breeding program. We demonstrated that more than 30 molecular markers linked to a target gene of agronomic trait of interest can be identified from a small portion (1/8) of one sequencing run on HiSeq2000 by applying NGS based RAD sequencing in marker development. The markers developed by the strategy described in this study are all co-dominant SNP markers, which can readily be converted into high throughput multiplex format or low-cost, simple PCR-based markers desirable for large scale marker implementation in plant breeding programs. The high density and closely linked molecular markers associated with a target trait help to overcome a major bottleneck for implementation of molecular markers on a wide range of germplasm in breeding programs. We conclude that application of NGS based RAD sequencing as DNA fingerprinting is a very rapid and cost-effective strategy for marker development in molecular plant breeding. The strategy does not require any prior genome knowledge or molecular information for the species under investigation, and it is applicable to other plant species.

CoDE-seq, an augmented whole-exome sequencing, enables the accurate detection of CNVs and mutations in Mendelian obesity and intellectual disability.

PubMed

Montagne, Louise; Derhourhi, Mehdi; Piton, Amélie; Toussaint, Bénédicte; Durand, Emmanuelle; Vaillant, Emmanuel; Thuillier, Dorothée; Gaget, Stefan; De Graeve, Franck; Rabearivelo, Iandry; Lansiaux, Amélie; Lenne, Bruno; Sukno, Sylvie; Desailloud, Rachel; Cnop, Miriam; Nicolescu, Ramona; Cohen, Lior; Zagury, Jean-François; Amouyal, Mélanie; Weill, Jacques; Muller, Jean; Sand, Olivier; Delobel, Bruno; Froguel, Philippe; Bonnefond, Amélie

2018-05-16

The molecular diagnosis of extreme forms of obesity, in which accurate detection of both copy number variations (CNVs) and point mutations, is crucial for an optimal care of the patients and genetic counseling for their families. Whole-exome sequencing (WES) has benefited considerably this molecular diagnosis, but its poor ability to detect CNVs remains a major limitation. We aimed to develop a method (CoDE-seq) enabling the accurate detection of both CNVs and point mutations in one step. CoDE-seq is based on an augmented WES method, using probes distributed uniformly throughout the genome. CoDE-seq was validated in 40 patients for whom chromosomal DNA microarray was available. CNVs and mutations were assessed in 82 children/young adults with suspected Mendelian obesity and/or intellectual disability and in their parents when available (n total  = 145). CoDE-seq not only detected all of the 97 CNVs identified by chromosomal DNA microarrays but also found 84 additional CNVs, due to a better resolution. When compared to CoDE-seq and chromosomal DNA microarrays, WES failed to detect 37% and 14% of CNVs, respectively. In the 82 patients, a likely molecular diagnosis was achieved in >30% of the patients. Half of the genetic diagnoses were explained by CNVs while the other half by mutations. CoDE-seq has proven cost-efficient and highly effective as it avoids the sequential genetic screening approaches currently used in clinical practice for the accurate detection of CNVs and point mutations. Copyright © 2018 The Authors. Published by Elsevier GmbH.. All rights reserved.

Low-coverage MiSeq next generation sequencing reveals the mitochondrial genome of the Eastern Rock Lobster, Sagmariasus verreauxi.

PubMed

Doyle, Stephen R; Griffith, Ian S; Murphy, Nick P; Strugnell, Jan M

2015-01-01

The complete mitochondrial genome of the Eastern Rock lobster, Sagmariasus verreauxi, is reported for the first time. Using low-coverage, long read MiSeq next generation sequencing, we constructed and determined the mtDNA genome organization of the 15,470 bp sequence from two isolates from Eastern Tasmania, Australia and Northern New Zealand, and identified 46 polymorphic nucleotides between the two sequences. This genome sequence and its genetic polymorphisms will likely be useful in understanding the distribution and population connectivity of the Eastern Rock Lobster, and in the fisheries management of this commercially important species.

Comparison of the analytical and clinical performances of Abbott RealTime High Risk HPV, Hybrid Capture 2, and DNA Chip assays in gynecology patients.

PubMed

Park, Seungman; Kang, Youjin; Kim, Dong Geun; Kim, Eui-Chong; Park, Sung Sup; Seong, Moon-Woo

2013-08-01

The detection of high-risk (HR) HPV in cervical cancer screening is important for early diagnosis of cervical cancer or pre-cancerous lesions. We evaluated the analytical and clinical performances of 3 HR HPV assays in Gynecology patients. A total of 991 specimens were included in this study: 787 specimens for use with a Hybrid Capture 2 (HC2) and 204 specimens for a HPV DNA microarray (DNA Chip). All specimens were tested using an Abbott RealTime High Risk HPV assay (Real-time HR), PGMY PCR, and sequence analysis. Clinical sensitivities for severe abnormal cytology (severe than high-grade squamous intraepithelial lesion) were 81.8% for Real-time HR, 77.3% for HC2, and 66.7% for DNA Chip, and clinical sensitivities for severe abnormal histology (cervical intraepithelial neoplasia grade 2+) were 91.7% for HC2, 87.5% for Real-time HR, and 73.3% for DNA Chip. As compared to results of the sequence analysis, HC2, Real-time HR, and DNA Chip showed concordance rates of 94.3% (115/122), 90.0% (117/130), and 61.5% (16/26), respectively. The HC2 assay and Real-time HR assay showed comparable results to each other in both clinical and analytical performances, while the DNA Chip assay showed poor clinical and analytical performances. The Real-time HR assay can be a good alternative option for HR HPV testing with advantages of allowing full automation and simultaneous genotyping of HR types 16 and 18. Copyright © 2013 Elsevier Inc. All rights reserved.

High-throughput sequencing of forensic genetic samples using punches of FTA cards with buccal swabs.

PubMed

Kampmann, Marie-Louise; Buchard, Anders; Børsting, Claus; Morling, Niels

2016-01-01

Here, we demonstrate that punches from buccal swab samples preserved on FTA cards can be used for high-throughput DNA sequencing, also known as massively parallel sequencing (MPS). We typed 44 reference samples with the HID-Ion AmpliSeq Identity Panel using washed 1.2 mm punches from FTA cards with buccal swabs and compared the results with those obtained with DNA extracted using the EZ1 DNA Investigator Kit. Concordant profiles were obtained for all samples. Our protocol includes simple punch, wash, and PCR steps, reducing cost and hands-on time in the laboratory. Furthermore, it facilitates automation of DNA sequencing.

Uniform, optimal signal processing of mapped deep-sequencing data.

PubMed

Kumar, Vibhor; Muratani, Masafumi; Rayan, Nirmala Arul; Kraus, Petra; Lufkin, Thomas; Ng, Huck Hui; Prabhakar, Shyam

2013-07-01

Despite their apparent diversity, many problems in the analysis of high-throughput sequencing data are merely special cases of two general problems, signal detection and signal estimation. Here we adapt formally optimal solutions from signal processing theory to analyze signals of DNA sequence reads mapped to a genome. We describe DFilter, a detection algorithm that identifies regulatory features in ChIP-seq, DNase-seq and FAIRE-seq data more accurately than assay-specific algorithms. We also describe EFilter, an estimation algorithm that accurately predicts mRNA levels from as few as 1-2 histone profiles (R ∼0.9). Notably, the presence of regulatory motifs in promoters correlates more with histone modifications than with mRNA levels, suggesting that histone profiles are more predictive of cis-regulatory mechanisms. We show by applying DFilter and EFilter to embryonic forebrain ChIP-seq data that regulatory protein identification and functional annotation are feasible despite tissue heterogeneity. The mathematical formalism underlying our tools facilitates integrative analysis of data from virtually any sequencing-based functional profile.

A non-parametric peak calling algorithm for DamID-Seq.

PubMed

Li, Renhua; Hempel, Leonie U; Jiang, Tingbo

2015-01-01

Protein-DNA interactions play a significant role in gene regulation and expression. In order to identify transcription factor binding sites (TFBS) of double sex (DSX)-an important transcription factor in sex determination, we applied the DNA adenine methylation identification (DamID) technology to the fat body tissue of Drosophila, followed by deep sequencing (DamID-Seq). One feature of DamID-Seq data is that induced adenine methylation signals are not assured to be symmetrically distributed at TFBS, which renders the existing peak calling algorithms for ChIP-Seq, including SPP and MACS, inappropriate for DamID-Seq data. This challenged us to develop a new algorithm for peak calling. A challenge in peaking calling based on sequence data is estimating the averaged behavior of background signals. We applied a bootstrap resampling method to short sequence reads in the control (Dam only). After data quality check and mapping reads to a reference genome, the peaking calling procedure compromises the following steps: 1) reads resampling; 2) reads scaling (normalization) and computing signal-to-noise fold changes; 3) filtering; 4) Calling peaks based on a statistically significant threshold. This is a non-parametric method for peak calling (NPPC). We also used irreproducible discovery rate (IDR) analysis, as well as ChIP-Seq data to compare the peaks called by the NPPC. We identified approximately 6,000 peaks for DSX, which point to 1,225 genes related to the fat body tissue difference between female and male Drosophila. Statistical evidence from IDR analysis indicated that these peaks are reproducible across biological replicates. In addition, these peaks are comparable to those identified by use of ChIP-Seq on S2 cells, in terms of peak number, location, and peaks width.

YAMAT-seq: an efficient method for high-throughput sequencing of mature transfer RNAs.

PubMed

Shigematsu, Megumi; Honda, Shozo; Loher, Phillipe; Telonis, Aristeidis G; Rigoutsos, Isidore; Kirino, Yohei

2017-05-19

Besides translation, transfer RNAs (tRNAs) play many non-canonical roles in various biological pathways and exhibit highly variable expression profiles. To unravel the emerging complexities of tRNA biology and molecular mechanisms underlying them, an efficient tRNA sequencing method is required. However, the rigid structure of tRNA has been presenting a challenge to the development of such methods. We report the development of Y-shaped Adapter-ligated MAture TRNA sequencing (YAMAT-seq), an efficient and convenient method for high-throughput sequencing of mature tRNAs. YAMAT-seq circumvents the issue of inefficient adapter ligation, a characteristic of conventional RNA sequencing methods for mature tRNAs, by employing the efficient and specific ligation of Y-shaped adapter to mature tRNAs using T4 RNA Ligase 2. Subsequent cDNA amplification and next-generation sequencing successfully yield numerous mature tRNA sequences. YAMAT-seq has high specificity for mature tRNAs and high sensitivity to detect most isoacceptors from minute amount of total RNA. Moreover, YAMAT-seq shows quantitative capability to estimate expression levels of mature tRNAs, and has high reproducibility and broad applicability for various cell lines. YAMAT-seq thus provides high-throughput technique for identifying tRNA profiles and their regulations in various transcriptomes, which could play important regulatory roles in translation and other biological processes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

iASeq: integrative analysis of allele-specificity of protein-DNA interactions in multiple ChIP-seq datasets

PubMed Central

2012-01-01

Background ChIP-seq provides new opportunities to study allele-specific protein-DNA binding (ASB). However, detecting allelic imbalance from a single ChIP-seq dataset often has low statistical power since only sequence reads mapped to heterozygote SNPs are informative for discriminating two alleles. Results We develop a new method iASeq to address this issue by jointly analyzing multiple ChIP-seq datasets. iASeq uses a Bayesian hierarchical mixture model to learn correlation patterns of allele-specificity among multiple proteins. Using the discovered correlation patterns, the model allows one to borrow information across datasets to improve detection of allelic imbalance. Application of iASeq to 77 ChIP-seq samples from 40 ENCODE datasets and 1 genomic DNA sample in GM12878 cells reveals that allele-specificity of multiple proteins are highly correlated, and demonstrates the ability of iASeq to improve allelic inference compared to analyzing each individual dataset separately. Conclusions iASeq illustrates the value of integrating multiple datasets in the allele-specificity inference and offers a new tool to better analyze ASB. PMID:23194258

Landscape of DNA Virus Associations across Human Malignant Cancers: Analysis of 3,775 Cases Using RNA-Seq

PubMed Central

Tannir, Nizar M.; Williams, Michelle D.; Chen, Yunxin; Yao, Hui; Zhang, Jianping; Thompson, Erika J.; Meric-Bernstam, Funda; Medeiros, L. Jeffrey; Weinstein, John N.

2013-01-01

Elucidation of tumor-DNA virus associations in many cancer types has enhanced our knowledge of fundamental oncogenesis mechanisms and provided a basis for cancer prevention initiatives. RNA-Seq is a novel tool to comprehensively assess such associations. We interrogated RNA-Seq data from 3,775 malignant neoplasms in The Cancer Genome Atlas database for the presence of viral sequences. Viral integration sites were also detected in expressed transcripts using a novel approach. The detection capacity of RNA-Seq was compared to available clinical laboratory data. Human papillomavirus (HPV) transcripts were detected using RNA-Seq analysis in head-and-neck squamous cell carcinoma, uterine endometrioid carcinoma, and squamous cell carcinoma of the lung. Detection of HPV by RNA-Seq correlated with detection by in situ hybridization and immunohistochemistry in squamous cell carcinoma tumors of the head and neck. Hepatitis B virus and Epstein-Barr virus (EBV) were detected using RNA-Seq in hepatocellular carcinoma and gastric carcinoma tumors, respectively. Integration sites of viral genes and oncogenes were detected in cancers harboring HPV or hepatitis B virus but not in EBV-positive gastric carcinoma. Integration sites of expressed viral transcripts frequently involved known coding areas of the host genome. No DNA virus transcripts were detected in acute myeloid leukemia, cutaneous melanoma, low- and high-grade gliomas of the brain, and adenocarcinomas of the breast, colon and rectum, lung, prostate, ovary, kidney, and thyroid. In conclusion, this study provides a large-scale overview of the landscape of DNA viruses in human malignant cancers. While further validation is necessary for specific cancer types, our findings highlight the utility of RNA-Seq in detecting tumor-associated DNA viruses and identifying viral integration sites that may unravel novel mechanisms of cancer pathogenesis. PMID:23740984

A simple and novel method for RNA-seq library preparation of single cell cDNA analysis by hyperactive Tn5 transposase.

PubMed

Brouilette, Scott; Kuersten, Scott; Mein, Charles; Bozek, Monika; Terry, Anna; Dias, Kerith-Rae; Bhaw-Rosun, Leena; Shintani, Yasunori; Coppen, Steven; Ikebe, Chiho; Sawhney, Vinit; Campbell, Niall; Kaneko, Masahiro; Tano, Nobuko; Ishida, Hidekazu; Suzuki, Ken; Yashiro, Kenta

2012-10-01

Deep sequencing of single cell-derived cDNAs offers novel insights into oncogenesis and embryogenesis. However, traditional library preparation for RNA-seq analysis requires multiple steps with consequent sample loss and stochastic variation at each step significantly affecting output. Thus, a simpler and better protocol is desirable. The recently developed hyperactive Tn5-mediated library preparation, which brings high quality libraries, is likely one of the solutions. Here, we tested the applicability of hyperactive Tn5-mediated library preparation to deep sequencing of single cell cDNA, optimized the protocol, and compared it with the conventional method based on sonication. This new technique does not require any expensive or special equipment, which secures wider availability. A library was constructed from only 100 ng of cDNA, which enables the saving of precious specimens. Only a few steps of robust enzymatic reaction resulted in saved time, enabling more specimens to be prepared at once, and with a more reproducible size distribution among the different specimens. The obtained RNA-seq results were comparable to the conventional method. Thus, this Tn5-mediated preparation is applicable for anyone who aims to carry out deep sequencing for single cell cDNAs. Copyright © 2012 Wiley Periodicals, Inc.

SeqTrim: a high-throughput pipeline for pre-processing any type of sequence read

PubMed Central

2010-01-01

Background High-throughput automated sequencing has enabled an exponential growth rate of sequencing data. This requires increasing sequence quality and reliability in order to avoid database contamination with artefactual sequences. The arrival of pyrosequencing enhances this problem and necessitates customisable pre-processing algorithms. Results SeqTrim has been implemented both as a Web and as a standalone command line application. Already-published and newly-designed algorithms have been included to identify sequence inserts, to remove low quality, vector, adaptor, low complexity and contaminant sequences, and to detect chimeric reads. The availability of several input and output formats allows its inclusion in sequence processing workflows. Due to its specific algorithms, SeqTrim outperforms other pre-processors implemented as Web services or standalone applications. It performs equally well with sequences from EST libraries, SSH libraries, genomic DNA libraries and pyrosequencing reads and does not lead to over-trimming. Conclusions SeqTrim is an efficient pipeline designed for pre-processing of any type of sequence read, including next-generation sequencing. It is easily configurable and provides a friendly interface that allows users to know what happened with sequences at every pre-processing stage, and to verify pre-processing of an individual sequence if desired. The recommended pipeline reveals more information about each sequence than previously described pre-processors and can discard more sequencing or experimental artefacts. PMID:20089148

Peregrine

PubMed Central

Langevin, Stanley A.; Bent, Zachary W.; Solberg, Owen D.; Curtis, Deanna J.; Lane, Pamela D.; Williams, Kelly P.; Schoeniger, Joseph S.; Sinha, Anupama; Lane, Todd W.; Branda, Steven S.

2013-01-01

Use of second generation sequencing (SGS) technologies for transcriptional profiling (RNA-Seq) has revolutionized transcriptomics, enabling measurement of RNA abundances with unprecedented specificity and sensitivity and the discovery of novel RNA species. Preparation of RNA-Seq libraries requires conversion of the RNA starting material into cDNA flanked by platform-specific adaptor sequences. Each of the published methods and commercial kits currently available for RNA-Seq library preparation suffers from at least one major drawback, including long processing times, large starting material requirements, uneven coverage, loss of strand information and high cost. We report the development of a new RNA-Seq library preparation technique that produces representative, strand-specific RNA-Seq libraries from small amounts of starting material in a fast, simple and cost-effective manner. Additionally, we have developed a new quantitative PCR-based assay for precisely determining the number of PCR cycles to perform for optimal enrichment of the final library, a key step in all SGS library preparation workflows. PMID:23558773

Mapping of the Gynoecy in Bitter Gourd (Momordica charantia) Using RAD-Seq Analysis

PubMed Central

Matsumura, Hideo; Miyagi, Norimichi; Taniai, Naoki; Fukushima, Mai; Tarora, Kazuhiko; Shudo, Ayano; Urasaki, Naoya

2014-01-01

Momordica charantia is a monoecious plant of the Cucurbitaceae family that has both male and female unisexual flowers. Its unique gynoecious line, OHB61-5, is essential as a maternal parent in the production of F1 cultivars. To identify the DNA markers for this gynoecy, a RAD-seq (restriction-associated DNA tag sequencing) analysis was employed to reveal genome-wide DNA polymorphisms and to genotype the F2 progeny from a cross between OHB61-5 and a monoecious line. Based on a RAD-seq analysis of F2 individuals, a linkage map was constructed using 552 co-dominant markers. In addition, after analyzing the pooled genomic DNA from monoecious or gynoecious F2 plants, several SNP loci that are genetically linked to gynoecy were identified. GTFL-1, the closest SNP locus to the putative gynoecious locus, was converted to a conventional DNA marker using invader assay technology, which is applicable to the marker-assisted selection of gynoecy in M. charantia breeding. PMID:24498029

Nucleic acid molecules encoding isopentenyl monophosphate kinase, and methods of use

DOEpatents

Croteau, Rodney B.; Lange, Bernd M.

2001-01-01

A cDNA encoding isopentenyl monophosphate kinase (IPK) from peppermint (Mentha x piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of isopentenyl monophosphate kinase (SEQ ID NO:2), from peppermint (Mentha x piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for isopentenyl monophosphate kinase, or for a base sequence sufficiently complementary to at least a portion of isopentenyl monophosphate kinase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding isopentenyl monophosphate kinase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant isopentenyl monophosphate kinase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant isopentenyl monophosphate kinase may be used to obtain expression or enhanced expression of isopentenyl monophosphate kinase in plants in order to enhance the production of isopentenyl monophosphate kinase, or isoprenoids derived therefrom, or may be otherwise employed for the regulation or expression of isopentenyl monophosphate kinase, or the production of its products.

Isolation and bacterial expression of a sesquiterpene synthase cDNA clone from peppermint (Mentha x piperita, L.) that produces the aphid alarm pheromone (E)-.beta.-farnesene

DOEpatents

Croteau, Rodney Bruce; Crock, John E.

2005-01-25

A cDNA encoding (E)-.beta.-farnesene synthase from peppermint (Mentha piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of (E)-.beta.-farnesene synthase (SEQ ID NO:2), from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for (E)-.beta.-farnesene synthase, or for a base sequence sufficiently complementary to at least a portion of (E)-.beta.-farnesene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (E)-.beta.-farnesene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant (E)-.beta.-famesene synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant (E)-.beta.-farnesene synthase may be used to obtain expression or enhanced expression of (E)-.beta.-famesene synthase in plants in order to enhance the production of (E)-.beta.-farnesene, or may be otherwise employed for the regulation or expression of (E)-.beta.-farnesene synthase, or the production of its product.

Optimal use of tandem biotin and V5 tags in ChIP assays

PubMed Central

Kolodziej, Katarzyna E; Pourfarzad, Farzin; de Boer, Ernie; Krpic, Sanja; Grosveld, Frank; Strouboulis, John

2009-01-01

Background Chromatin immunoprecipitation (ChIP) assays coupled to genome arrays (Chip-on-chip) or massive parallel sequencing (ChIP-seq) lead to the genome wide identification of binding sites of chromatin associated proteins. However, the highly variable quality of antibodies and the availability of epitopes in crosslinked chromatin can compromise genomic ChIP outcomes. Epitope tags have often been used as more reliable alternatives. In addition, we have employed protein in vivo biotinylation tagging as a very high affinity alternative to antibodies. In this paper we describe the optimization of biotinylation tagging for ChIP and its coupling to a known epitope tag in providing a reliable and efficient alternative to antibodies. Results Using the biotin tagged erythroid transcription factor GATA-1 as example, we describe several optimization steps for the application of the high affinity biotin streptavidin system in ChIP. We find that the omission of SDS during sonication, the use of fish skin gelatin as blocking agent and choice of streptavidin beads can lead to significantly improved ChIP enrichments and lower background compared to antibodies. We also show that the V5 epitope tag performs equally well under the conditions worked out for streptavidin ChIP and that it may suffer less from the effects of formaldehyde crosslinking. Conclusion The combined use of the very high affinity biotin tag with the less sensitive to crosslinking V5 tag provides for a flexible ChIP platform with potential implications in ChIP sequencing outcomes. PMID:19196479

Validation of Pooled Whole-Genome Re-Sequencing in Arabidopsis lyrata.

PubMed

Fracassetti, Marco; Griffin, Philippa C; Willi, Yvonne

2015-01-01

Sequencing pooled DNA of multiple individuals from a population instead of sequencing individuals separately has become popular due to its cost-effectiveness and simple wet-lab protocol, although some criticism of this approach remains. Here we validated a protocol for pooled whole-genome re-sequencing (Pool-seq) of Arabidopsis lyrata libraries prepared with low amounts of DNA (1.6 ng per individual). The validation was based on comparing single nucleotide polymorphism (SNP) frequencies obtained by pooling with those obtained by individual-based Genotyping By Sequencing (GBS). Furthermore, we investigated the effect of sample number, sequencing depth per individual and variant caller on population SNP frequency estimates. For Pool-seq data, we compared frequency estimates from two SNP callers, VarScan and Snape; the former employs a frequentist SNP calling approach while the latter uses a Bayesian approach. Results revealed concordance correlation coefficients well above 0.8, confirming that Pool-seq is a valid method for acquiring population-level SNP frequency data. Higher accuracy was achieved by pooling more samples (25 compared to 14) and working with higher sequencing depth (4.1× per individual compared to 1.4× per individual), which increased the concordance correlation coefficient to 0.955. The Bayesian-based SNP caller produced somewhat higher concordance correlation coefficients, particularly at low sequencing depth. We recommend pooling at least 25 individuals combined with sequencing at a depth of 100× to produce satisfactory frequency estimates for common SNPs (minor allele frequency above 0.05).

FibroChip, a Functional DNA Microarray to Monitor Cellulolytic and Hemicellulolytic Activities of Rumen Microbiota

PubMed Central

Comtet-Marre, Sophie; Chaucheyras-Durand, Frédérique; Bouzid, Ourdia; Mosoni, Pascale; Bayat, Ali R.; Peyret, Pierre; Forano, Evelyne

2018-01-01

Ruminants fulfill their energy needs for growth primarily through microbial breakdown of plant biomass in the rumen. Several biotic and abiotic factors influence the efficiency of fiber degradation, which can ultimately impact animal productivity and health. To provide more insight into mechanisms involved in the modulation of fibrolytic activity, a functional DNA microarray targeting genes encoding key enzymes involved in cellulose and hemicellulose degradation by rumen microbiota was designed. Eight carbohydrate-active enzyme (CAZyme) families (GH5, GH9, GH10, GH11, GH43, GH48, CE1, and CE6) were selected which represented 392 genes from bacteria, protozoa, and fungi. The DNA microarray, designated as FibroChip, was validated using targets of increasing complexity and demonstrated sensitivity and specificity. In addition, FibroChip was evaluated for its explorative and semi-quantitative potential. Differential expression of CAZyme genes was evidenced in the rumen bacterium Fibrobacter succinogenes S85 grown on wheat straw or cellobiose. FibroChip was used to identify the expressed CAZyme genes from the targeted families in the rumen of a cow fed a mixed diet based on grass silage. Among expressed genes, those encoding GH43, GH5, and GH10 families were the most represented. Most of the F. succinogenes genes detected by the FibroChip were also detected following RNA-seq analysis of RNA transcripts obtained from the rumen fluid sample. Use of the FibroChip also indicated that transcripts of fiber degrading enzymes derived from eukaryotes (protozoa and anaerobic fungi) represented a significant proportion of the total microbial mRNA pool. FibroChip represents a reliable and high-throughput tool that enables researchers to monitor active members of fiber degradation in the rumen. PMID:29487591

FibroChip, a Functional DNA Microarray to Monitor Cellulolytic and Hemicellulolytic Activities of Rumen Microbiota.

PubMed

Comtet-Marre, Sophie; Chaucheyras-Durand, Frédérique; Bouzid, Ourdia; Mosoni, Pascale; Bayat, Ali R; Peyret, Pierre; Forano, Evelyne

2018-01-01

Ruminants fulfill their energy needs for growth primarily through microbial breakdown of plant biomass in the rumen. Several biotic and abiotic factors influence the efficiency of fiber degradation, which can ultimately impact animal productivity and health. To provide more insight into mechanisms involved in the modulation of fibrolytic activity, a functional DNA microarray targeting genes encoding key enzymes involved in cellulose and hemicellulose degradation by rumen microbiota was designed. Eight carbohydrate-active enzyme (CAZyme) families (GH5, GH9, GH10, GH11, GH43, GH48, CE1, and CE6) were selected which represented 392 genes from bacteria, protozoa, and fungi. The DNA microarray, designated as FibroChip, was validated using targets of increasing complexity and demonstrated sensitivity and specificity. In addition, FibroChip was evaluated for its explorative and semi-quantitative potential. Differential expression of CAZyme genes was evidenced in the rumen bacterium Fibrobacter succinogenes S85 grown on wheat straw or cellobiose. FibroChip was used to identify the expressed CAZyme genes from the targeted families in the rumen of a cow fed a mixed diet based on grass silage. Among expressed genes, those encoding GH43, GH5, and GH10 families were the most represented. Most of the F. succinogenes genes detected by the FibroChip were also detected following RNA-seq analysis of RNA transcripts obtained from the rumen fluid sample. Use of the FibroChip also indicated that transcripts of fiber degrading enzymes derived from eukaryotes (protozoa and anaerobic fungi) represented a significant proportion of the total microbial mRNA pool. FibroChip represents a reliable and high-throughput tool that enables researchers to monitor active members of fiber degradation in the rumen.

Peregrine: A rapid and unbiased method to produce strand-specific RNA-Seq libraries from small quantities of starting material.

PubMed

Langevin, Stanley A; Bent, Zachary W; Solberg, Owen D; Curtis, Deanna J; Lane, Pamela D; Williams, Kelly P; Schoeniger, Joseph S; Sinha, Anupama; Lane, Todd W; Branda, Steven S

2013-04-01

Use of second generation sequencing (SGS) technologies for transcriptional profiling (RNA-Seq) has revolutionized transcriptomics, enabling measurement of RNA abundances with unprecedented specificity and sensitivity and the discovery of novel RNA species. Preparation of RNA-Seq libraries requires conversion of the RNA starting material into cDNA flanked by platform-specific adaptor sequences. Each of the published methods and commercial kits currently available for RNA-Seq library preparation suffers from at least one major drawback, including long processing times, large starting material requirements, uneven coverage, loss of strand information and high cost. We report the development of a new RNA-Seq library preparation technique that produces representative, strand-specific RNA-Seq libraries from small amounts of starting material in a fast, simple and cost-effective manner. Additionally, we have developed a new quantitative PCR-based assay for precisely determining the number of PCR cycles to perform for optimal enrichment of the final library, a key step in all SGS library preparation workflows.

Sequencing on the SOLiD 5500xl System - in-depth characterization of the GC bias.

PubMed

Roeh, Simone; Weber, Peter; Rex-Haffner, Monika; Deussing, Jan M; Binder, Elisabeth B; Jakovcevski, Mira

2017-07-04

Different types of sequencing biases have been described and subsequently improved for a variety of sequencing systems, mostly focusing on the widely used Illumina systems. Similar studies are missing for the SOLiD 5500xl system, a sequencer which produced many data sets available to researchers today. Describing and understanding the bias is important to accurately interpret and integrate these published data in various ongoing research projects. We report a particularly strong GC bias for this sequencing system when analyzing a defined gDNA mix of 5 microbes with a wide range of different GC contents (20-72%) when comparing to the expected distribution and Illumina MiSeq data from the same DNA pool. Since we observed this bias already under PCR-free conditions, changing the PCR conditions during library preparation - a common strategy to handle bias in the Illumina system - was not relevant. Source of the bias appeared to be an uneven heat distribution during the SOLiD emulsion PCR (ePCR) - for enrichment of libraries prior loading - since ePCR in either small pouches or in 96-well plates improved the GC bias. Sequencing of chromatin immunoprecipitated DNA (ChIP-seq) is a common approach in epigenetics. ChIP-seq of the mixed source histone mark H3K9ac (acetyl Histone H3 lysine 9), typically found on promoter regions and on gene bodies, including CpG islands, performed on a SOLiD 5500xl machine, resulted in major loss of reads at GC rich loci (GC content ≥ 62%), not explained by low sequencing depth. This was improved with adaptations of the ePCR.

Cohort analysis of a single nucleotide polymorphism on DNA chips.

PubMed

Schwonbeck, Susanne; Krause-Griep, Andrea; Gajovic-Eichelmann, Nenad; Ehrentreich-Förster, Eva; Meinl, Walter; Glatt, Hansrüdi; Bier, Frank F

2004-11-15

A method has been developed to determine SNPs on DNA chips by applying a flow-through bioscanner. As a practical application we demonstrated the fast and simple SNP analysis of 24 genotypes in an array of 96 spots with a single hybridisation and dissociation experiment. The main advantage of this methodical concept is the parallel and fast analysis without any need of enzymatic digestion. Additionally, the DNA chip format used is appropriate for parallel analysis up to 400 spots. The polymorphism in the gene of the human phenol sulfotransferase SULT1A1 was studied as a model SNP. Biotinylated PCR products containing the SNP (The SNP summary web site: ) (mutant) and those containing no mutation (wild-type) were brought onto the chips coated with NeutrAvidin using non-contact spotting. This was followed by an analysis which was carried out in a flow-through biochip scanner while constantly rinsing with buffer. After removing the non-biotinylated strand a fluorescent probe was hybridised, which is complementary to the wild-type sequence. If this probe binds to a mutant sequence, then one single base is not fully matching. Thereby, the mismatched hybrid (mutant) is less stable than the full-matched hybrid (wild-type). The final step after hybridisation on the chip involves rinsing with a buffer to start dissociation of the fluorescent probe from the immobilised DNA strand. The online measurement of the fluorescence intensity by the biochip scanner provides the possibility to follow the kinetics of the hybridisation and dissociation processes. According to the different stability of the full-match and the mismatch, either visual discrimination or kinetic analysis is possible to distinguish SNP-containing sequence from the wild-type sequence.

Comparative performance of the BGISEQ-500 vs Illumina HiSeq2500 sequencing platforms for palaeogenomic sequencing

PubMed Central

Mak, Sarah Siu Tze; Gopalakrishnan, Shyam; Carøe, Christian; Geng, Chunyu; Liu, Shanlin; Sinding, Mikkel-Holger S; Kuderna, Lukas F K; Zhang, Wenwei; Fu, Shujin; Vieira, Filipe G; Germonpré, Mietje; Bocherens, Hervé; Fedorov, Sergey; Petersen, Bent; Sicheritz-Pontén, Thomas; Marques-Bonet, Tomas; Zhang, Guojie; Jiang, Hui; Gilbert, M Thomas P

2017-01-01

Abstract Ancient DNA research has been revolutionized following development of next-generation sequencing platforms. Although a number of such platforms have been applied to ancient DNA samples, the Illumina series are the dominant choice today, mainly because of high production capacities and short read production. Recently a potentially attractive alternative platform for palaeogenomic data generation has been developed, the BGISEQ-500, whose sequence output are comparable with the Illumina series. In this study, we modified the standard BGISEQ-500 library preparation specifically for use on degraded DNA, then directly compared the sequencing performance and data quality of the BGISEQ-500 to the Illumina HiSeq2500 platform on DNA extracted from 8 historic and ancient dog and wolf samples. The data generated were largely comparable between sequencing platforms, with no statistically significant difference observed for parameters including level (P = 0.371) and average sequence length (P = 0718) of endogenous nuclear DNA, sequence GC content (P = 0.311), double-stranded DNA damage rate (v. 0.309), and sequence clonality (P = 0.093). Small significant differences were found in single-strand DNA damage rate (δS; slightly lower for the BGISEQ-500, P = 0.011) and the background rate of difference from the reference genome (θ; slightly higher for BGISEQ-500, P = 0.012). This may result from the differences in amplification cycles used to polymerase chain reaction–amplify the libraries. A significant difference was also observed in the mitochondrial DNA percentages recovered (P = 0.018), although we believe this is likely a stochastic effect relating to the extremely low levels of mitochondria that were sequenced from 3 of the samples with overall very low levels of endogenous DNA. Although we acknowledge that our analyses were limited to animal material, our observations suggest that the BGISEQ-500 holds the potential to represent a valid and potentially valuable alternative platform for palaeogenomic data generation that is worthy of future exploration by those interested in the sequencing and analysis of degraded DNA. PMID:28854615

Probe-Directed Degradation (PDD) for Flexible Removal of Unwanted cDNA Sequences from RNA-Seq Libraries.

PubMed

Archer, Stuart K; Shirokikh, Nikolay E; Preiss, Thomas

2015-04-01

Most applications for RNA-seq require the depletion of abundant transcripts to gain greater coverage of the underlying transcriptome. The sequences to be targeted for depletion depend on application and species and in many cases may not be supported by commercial depletion kits. This unit describes a method for generating RNA-seq libraries that incorporates probe-directed degradation (PDD), which can deplete any unwanted sequence set, with the low-bias split-adapter method of library generation (although many other library generation methods are in principle compatible). The overall strategy is suitable for applications requiring customized sequence depletion or where faithful representation of fragment ends and lack of sequence bias is paramount. We provide guidelines to rapidly design specific probes against the target sequence, and a detailed protocol for library generation using the split-adapter method including several strategies for streamlining the technique and reducing adapter dimer content. Copyright © 2015 John Wiley & Sons, Inc.

In silico analysis of 16S ribosomal RNA gene sequencing‐based methods for identification of medically important anaerobic bacteria

PubMed Central

Woo, Patrick C Y; Chung, Liliane M W; Teng, Jade L L; Tse, Herman; Pang, Sherby S Y; Lau, Veronica Y T; Wong, Vanessa W K; Kam, Kwok‐ling; Lau, Susanna K P; Yuen, Kwok‐Yung

2007-01-01

This study is the first study that provides useful guidelines to clinical microbiologists and technicians on the usefulness of full 16S rRNA sequencing, 5′‐end 527‐bp 16S rRNA sequencing and the existing MicroSeq full and 500 16S rDNA bacterial identification system (MicroSeq, Perkin‐Elmer Applied Biosystems Division, Foster City, California, USA) databases for the identification of all existing medically important anaerobic bacteria. Full and 527‐bp 16S rRNA sequencing are able to identify 52–63% of 130 Gram‐positive anaerobic rods, 72–73% of 86 Gram‐negative anaerobic rods and 78% of 23 anaerobic cocci. The existing MicroSeq databases are able to identify only 19–25% of 130 Gram‐positive anaerobic rods, 38% of 86 Gram‐negative anaerobic rods and 39% of 23 anaerobic cocci. These represent only 45–46% of those that should be confidently identified by full and 527‐bp 16S rRNA sequencing. To improve the usefulness of MicroSeq, bacterial species that should be confidently identified by full and/or 527‐bp 16S rRNA sequencing but not included in the existing MicroSeq databases should be included. PMID:17046845

Species classifier choice is a key consideration when analysing low-complexity food microbiome data.

PubMed

Walsh, Aaron M; Crispie, Fiona; O'Sullivan, Orla; Finnegan, Laura; Claesson, Marcus J; Cotter, Paul D

2018-03-20

The use of shotgun metagenomics to analyse low-complexity microbial communities in foods has the potential to be of considerable fundamental and applied value. However, there is currently no consensus with respect to choice of species classification tool, platform, or sequencing depth. Here, we benchmarked the performances of three high-throughput short-read sequencing platforms, the Illumina MiSeq, NextSeq 500, and Ion Proton, for shotgun metagenomics of food microbiota. Briefly, we sequenced six kefir DNA samples and a mock community DNA sample, the latter constructed by evenly mixing genomic DNA from 13 food-related bacterial species. A variety of bioinformatic tools were used to analyse the data generated, and the effects of sequencing depth on these analyses were tested by randomly subsampling reads. Compositional analysis results were consistent between the platforms at divergent sequencing depths. However, we observed pronounced differences in the predictions from species classification tools. Indeed, PERMANOVA indicated that there was no significant differences between the compositional results generated by the different sequencers (p = 0.693, R 2  = 0.011), but there was a significant difference between the results predicted by the species classifiers (p = 0.01, R 2  = 0.127). The relative abundances predicted by the classifiers, apart from MetaPhlAn2, were apparently biased by reference genome sizes. Additionally, we observed varying false-positive rates among the classifiers. MetaPhlAn2 had the lowest false-positive rate, whereas SLIMM had the greatest false-positive rate. Strain-level analysis results were also similar across platforms. Each platform correctly identified the strains present in the mock community, but accuracy was improved slightly with greater sequencing depth. Notably, PanPhlAn detected the dominant strains in each kefir sample above 500,000 reads per sample. Again, the outputs from functional profiling analysis using SUPER-FOCUS were generally accordant between the platforms at different sequencing depths. Finally, and expectedly, metagenome assembly completeness was significantly lower on the MiSeq than either on the NextSeq (p = 0.03) or the Proton (p = 0.011), and it improved with increased sequencing depth. Our results demonstrate a remarkable similarity in the results generated by the three sequencing platforms at different sequencing depths, and, in fact, the choice of bioinformatics methodology had a more evident impact on results than the choice of sequencer did.

Selective amplification and sequencing of cyclic phosphate-containing RNAs by the cP-RNA-seq method.

PubMed

Honda, Shozo; Morichika, Keisuke; Kirino, Yohei

2016-03-01

RNA digestions catalyzed by many ribonucleases generate RNA fragments that contain a 2',3'-cyclic phosphate (cP) at their 3' termini. However, standard RNA-seq methods are unable to accurately capture cP-containing RNAs because the cP inhibits the adapter ligation reaction. We recently developed a method named cP-RNA-seq that is able to selectively amplify and sequence cP-containing RNAs. Here we describe the cP-RNA-seq protocol in which the 3' termini of all RNAs, except those containing a cP, are cleaved through a periodate treatment after phosphatase treatment; hence, subsequent adapter ligation and cDNA amplification steps are exclusively applied to cP-containing RNAs. cP-RNA-seq takes ∼6 d, excluding the time required for sequencing and bioinformatics analyses, which are not covered in detail in this protocol. Biochemical validation of the existence of cP in the identified RNAs takes ∼3 d. Even though the cP-RNA-seq method was developed to identify angiogenin-generating 5'-tRNA halves as a proof of principle, the method should be applicable to global identification of cP-containing RNA repertoires in various transcriptomes.

Parallel factor ChIP provides essential internal control for quantitative differential ChIP-seq.

PubMed

Guertin, Michael J; Cullen, Amy E; Markowetz, Florian; Holding, Andrew N

2018-04-17

A key challenge in quantitative ChIP combined with high-throughput sequencing (ChIP-seq) is the normalization of data in the presence of genome-wide changes in occupancy. Analysis-based normalization methods were developed for transcriptomic data and these are dependent on the underlying assumption that total transcription does not change between conditions. For genome-wide changes in transcription factor (TF) binding, these assumptions do not hold true. The challenges in normalization are confounded by experimental variability during sample preparation, processing and recovery. We present a novel normalization strategy utilizing an internal standard of unchanged peaks for reference. Our method can be readily applied to monitor genome-wide changes by ChIP-seq that are otherwise lost or misrepresented through analytical normalization. We compare our approach to normalization by total read depth and two alternative methods that utilize external experimental controls to study TF binding. We successfully resolve the key challenges in quantitative ChIP-seq analysis and demonstrate its application by monitoring the loss of Estrogen Receptor-alpha (ER) binding upon fulvestrant treatment, ER binding in response to estrodiol, ER mediated change in H4K12 acetylation and profiling ER binding in patient-derived xenographs. This is supported by an adaptable pipeline to normalize and quantify differential TF binding genome-wide and generate metrics for differential binding at individual sites.

Sequencing the extrachromosomal circular mobilome reveals retrotransposon activity in plants

PubMed Central

Llauro, Christel; Jobet, Edouard; Robakowska-Hyzorek, Dagmara; Lasserre, Eric; Ghesquière, Alain; Panaud, Olivier

2017-01-01

Retrotransposons are mobile genetic elements abundant in plant and animal genomes. While efficiently silenced by the epigenetic machinery, they can be reactivated upon stress or during development. Their level of transcription not reflecting their transposition ability, it is thus difficult to evaluate their contribution to the active mobilome. Here we applied a simple methodology based on the high throughput sequencing of extrachromosomal circular DNA (eccDNA) forms of active retrotransposons to characterize the repertoire of mobile retrotransposons in plants. This method successfully identified known active retrotransposons in both Arabidopsis and rice material where the epigenome is destabilized. When applying mobilome-seq to developmental stages in wild type rice, we identified PopRice as a highly active retrotransposon producing eccDNA forms in the wild type endosperm. The mobilome-seq strategy opens new routes for the characterization of a yet unexplored fraction of plant genomes. PMID:28212378

Sequencing the extrachromosomal circular mobilome reveals retrotransposon activity in plants.

PubMed

Lanciano, Sophie; Carpentier, Marie-Christine; Llauro, Christel; Jobet, Edouard; Robakowska-Hyzorek, Dagmara; Lasserre, Eric; Ghesquière, Alain; Panaud, Olivier; Mirouze, Marie

2017-02-01

Retrotransposons are mobile genetic elements abundant in plant and animal genomes. While efficiently silenced by the epigenetic machinery, they can be reactivated upon stress or during development. Their level of transcription not reflecting their transposition ability, it is thus difficult to evaluate their contribution to the active mobilome. Here we applied a simple methodology based on the high throughput sequencing of extrachromosomal circular DNA (eccDNA) forms of active retrotransposons to characterize the repertoire of mobile retrotransposons in plants. This method successfully identified known active retrotransposons in both Arabidopsis and rice material where the epigenome is destabilized. When applying mobilome-seq to developmental stages in wild type rice, we identified PopRice as a highly active retrotransposon producing eccDNA forms in the wild type endosperm. The mobilome-seq strategy opens new routes for the characterization of a yet unexplored fraction of plant genomes.

An improved ChIP-seq peak detection system for simultaneously identifying post-translational modified transcription factors by combinatorial fusion, using SUMOylation as an example.

PubMed

Cheng, Chia-Yang; Chu, Chia-Han; Hsu, Hung-Wei; Hsu, Fang-Rong; Tang, Chung Yi; Wang, Wen-Ching; Kung, Hsing-Jien; Chang, Pei-Ching

2014-01-01

Post-translational modification (PTM) of transcriptional factors and chromatin remodelling proteins is recognized as a major mechanism by which transcriptional regulation occurs. Chromatin immunoprecipitation (ChIP) in combination with high-throughput sequencing (ChIP-seq) is being applied as a gold standard when studying the genome-wide binding sites of transcription factor (TFs). This has greatly improved our understanding of protein-DNA interactions on a genomic-wide scale. However, current ChIP-seq peak calling tools are not sufficiently sensitive and are unable to simultaneously identify post-translational modified TFs based on ChIP-seq analysis; this is largely due to the wide-spread presence of multiple modified TFs. Using SUMO-1 modification as an example; we describe here an improved approach that allows the simultaneous identification of the particular genomic binding regions of all TFs with SUMO-1 modification. Traditional peak calling methods are inadequate when identifying multiple TF binding sites that involve long genomic regions and therefore we designed a ChIP-seq processing pipeline for the detection of peaks via a combinatorial fusion method. Then, we annotate the peaks with known transcription factor binding sites (TFBS) using the Transfac Matrix Database (v7.0), which predicts potential SUMOylated TFs. Next, the peak calling result was further analyzed based on the promoter proximity, TFBS annotation, a literature review, and was validated by ChIP-real-time quantitative PCR (qPCR) and ChIP-reChIP real-time qPCR. The results show clearly that SUMOylated TFs are able to be pinpointed using our pipeline. A methodology is presented that analyzes SUMO-1 ChIP-seq patterns and predicts related TFs. Our analysis uses three peak calling tools. The fusion of these different tools increases the precision of the peak calling results. TFBS annotation method is able to predict potential SUMOylated TFs. Here, we offer a new approach that enhances ChIP-seq data analysis and allows the identification of multiple SUMOylated TF binding sites simultaneously, which can then be utilized for other functional PTM binding site prediction in future.

Targeted Capture and High-Throughput Sequencing Using Molecular Inversion Probes (MIPs).

PubMed

Cantsilieris, Stuart; Stessman, Holly A; Shendure, Jay; Eichler, Evan E

2017-01-01

Molecular inversion probes (MIPs) in combination with massively parallel DNA sequencing represent a versatile, yet economical tool for targeted sequencing of genomic DNA. Several thousand genomic targets can be selectively captured using long oligonucleotides containing unique targeting arms and universal linkers. The ability to append sequencing adaptors and sample-specific barcodes allows large-scale pooling and subsequent high-throughput sequencing at relatively low cost per sample. Here, we describe a "wet bench" protocol detailing the capture and subsequent sequencing of >2000 genomic targets from 192 samples, representative of a single lane on the Illumina HiSeq 2000 platform.

Easy detection of multiple Alexandrium species using DNA chromatography chip.

PubMed

Nagai, Satoshi; Miyamoto, Shigehiko; Ino, Keita; Tajimi, Seisuke; Nishi, Hiromi; Tomono, Jun

2016-01-01

In this study, the Kaneka DNA chromatography chip (KDCC) for the Alexandrium species was successfully developed for simultaneous detection of five Alexandrium species. This method utilizes a DNA-DNA hybridization technology. In the PCR process, specifically designed tagged-primers are used, i.e. a forward primer consisting of a tag domain, which can conjugate with gold nanocolloids on the chip, and a primer domain, which can anneal/amplify the target sequence. However, the reverse primer consists of a tag domain, which can hybridize to the solid-phased capture probe on the chip, and a primer domain, which can anneal/amplify the target sequence. As a result, a red line that originates from gold nanocolloids appears as a positive signal on the chip, and the amplicon is detected visually by the naked eye. This technique is simple, because it is possible to visually detect the target species soon after (<5min) the application of 2μL of PCR amplicon and 65μL of development buffer to the sample pad of the chip. Further, this technique is relatively inexpensive and does not require expensive laboratory equipment, such as real-time Q-PCR machines or DNA microarray detectors, but a thermal cycler. Regarding the detection limit of KDCC for the five Alexandrium species, it varied among species and it was <0.1-10pg and equivalent to 5-500 copies of rRNA genes, indicating that the technique is sensitive enough for practical use to detect several cells of the target species from 1L of seawater. The detection sensitivity of KDCC was also evaluated with two different techniques, i.e. a multiplex-PCR and a digital DNA hybridization by digital DNA chip analyzer (DDCA), using natural plankton assemblages. There was no significant difference in the detection sensitivity among the three techniques, suggesting KDCC can be readily used to monitor the HAB species. Copyright © 2015 Elsevier B.V. All rights reserved.

Robust Sub-nanomolar Library Preparation for High Throughput Next Generation Sequencing.

PubMed

Wu, Wells W; Phue, Je-Nie; Lee, Chun-Ting; Lin, Changyi; Xu, Lai; Wang, Rong; Zhang, Yaqin; Shen, Rong-Fong

2018-05-04

Current library preparation protocols for Illumina HiSeq and MiSeq DNA sequencers require ≥2 nM initial library for subsequent loading of denatured cDNA onto flow cells. Such amounts are not always attainable from samples having a relatively low DNA or RNA input; or those for which a limited number of PCR amplification cycles is preferred (less PCR bias and/or more even coverage). A well-tested sub-nanomolar library preparation protocol for Illumina sequencers has however not been reported. The aim of this study is to provide a much needed working protocol for sub-nanomolar libraries to achieve outcomes as informative as those obtained with the higher library input (≥ 2 nM) recommended by Illumina's protocols. Extensive studies were conducted to validate a robust sub-nanomolar (initial library of 100 pM) protocol using PhiX DNA (as a control), genomic DNA (Bordetella bronchiseptica and microbial mock community B for 16S rRNA gene sequencing), messenger RNA, microRNA, and other small noncoding RNA samples. The utility of our protocol was further explored for PhiX library concentrations as low as 25 pM, which generated only slightly fewer than 50% of the reads achieved under the standard Illumina protocol starting with > 2 nM. A sub-nanomolar library preparation protocol (100 pM) could generate next generation sequencing (NGS) results as robust as the standard Illumina protocol. Following the sub-nanomolar protocol, libraries with initial concentrations as low as 25 pM could also be sequenced to yield satisfactory and reproducible sequencing results.

In vivo insertion pool sequencing identifies virulence factors in a complex fungal–host interaction

PubMed Central

Uhse, Simon; Pflug, Florian G.; Stirnberg, Alexandra; Ehrlinger, Klaus; von Haeseler, Arndt

2018-01-01

Large-scale insertional mutagenesis screens can be powerful genome-wide tools if they are streamlined with efficient downstream analysis, which is a serious bottleneck in complex biological systems. A major impediment to the success of next-generation sequencing (NGS)-based screens for virulence factors is that the genetic material of pathogens is often underrepresented within the eukaryotic host, making detection extremely challenging. We therefore established insertion Pool-Sequencing (iPool-Seq) on maize infected with the biotrophic fungus U. maydis. iPool-Seq features tagmentation, unique molecular barcodes, and affinity purification of pathogen insertion mutant DNA from in vivo-infected tissues. In a proof of concept using iPool-Seq, we identified 28 virulence factors, including 23 that were previously uncharacterized, from an initial pool of 195 candidate effector mutants. Because of its sensitivity and quantitative nature, iPool-Seq can be applied to any insertional mutagenesis library and is especially suitable for genetically complex setups like pooled infections of eukaryotic hosts. PMID:29684023

Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

DOEpatents

McCutchen-Maloney, Sandra L.

2002-01-01

DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

Comparing sequencing assays and human-machine analyses in actionable genomics for glioblastoma.

PubMed

Wrzeszczynski, Kazimierz O; Frank, Mayu O; Koyama, Takahiko; Rhrissorrakrai, Kahn; Robine, Nicolas; Utro, Filippo; Emde, Anne-Katrin; Chen, Bo-Juen; Arora, Kanika; Shah, Minita; Vacic, Vladimir; Norel, Raquel; Bilal, Erhan; Bergmann, Ewa A; Moore Vogel, Julia L; Bruce, Jeffrey N; Lassman, Andrew B; Canoll, Peter; Grommes, Christian; Harvey, Steve; Parida, Laxmi; Michelini, Vanessa V; Zody, Michael C; Jobanputra, Vaidehi; Royyuru, Ajay K; Darnell, Robert B

2017-08-01

To analyze a glioblastoma tumor specimen with 3 different platforms and compare potentially actionable calls from each. Tumor DNA was analyzed by a commercial targeted panel. In addition, tumor-normal DNA was analyzed by whole-genome sequencing (WGS) and tumor RNA was analyzed by RNA sequencing (RNA-seq). The WGS and RNA-seq data were analyzed by a team of bioinformaticians and cancer oncologists, and separately by IBM Watson Genomic Analytics (WGA), an automated system for prioritizing somatic variants and identifying drugs. More variants were identified by WGS/RNA analysis than by targeted panels. WGA completed a comparable analysis in a fraction of the time required by the human analysts. The development of an effective human-machine interface in the analysis of deep cancer genomic datasets may provide potentially clinically actionable calls for individual patients in a more timely and efficient manner than currently possible. NCT02725684.

Research Associate | Center for Cancer Research

Cancer.gov

The Basic Science Program (BSP) at the Frederick National Laboratory for Cancer Research (FNLCR) pursues independent, multidisciplinary research programs in basic or applied molecular biology, immunology, retrovirology, cancer biology or human genetics. As part of the BSP, the Microbiome and Genetics Core (the Core) characterizes microbiomes by next-generation sequencing to determine their composition and variation, as influenced by immune, genetic, and host health factors. The Core provides support across a spectrum of processes, from nucleic acid isolation through bioinformatics and statistical analysis. KEY ROLES/RESPONSIBILITIES The Research Associate II will provide support in the areas of automated isolation, preparation, PCR and sequencing of DNA on next generation platforms (Illumina MiSeq and NextSeq). An opportunity exists to join the Core’s team of highly trained experimentalists and bioinformaticians working to characterize microbiome samples. The following represent requirements of the position: A minimum of five (5) years related of biomedical experience. Experience with high-throughput nucleic acid (DNA/RNA) extraction. Experience in performing PCR amplification (including quantitative real-time PCR). Experience or familiarity with robotic liquid handling protocols (especially on the Eppendorf epMotion 5073 or 5075 platforms). Experience in operating and maintaining benchtop Illumina sequencers (MiSeq and NextSeq). Ability to evaluate experimental quality and to troubleshoot molecular biology protocols. Experience with sample tracking, inventory management and biobanking. Ability to operate and communicate effectively in a team-oriented work environment.

Utility of next-generation RNA-sequencing in identifying chimeric transcription involving human endogenous retroviruses.

PubMed

Sokol, Martin; Jessen, Karen Margrethe; Pedersen, Finn Skou

2016-01-01

Several studies have shown that human endogenous retroviruses and endogenous retrovirus-like repeats (here collectively HERVs) impose direct regulation on human genes through enhancer and promoter motifs present in their long terminal repeats (LTRs). Although chimeric transcription in which novel gene isoforms containing retroviral and human sequence are transcribed from viral promoters are commonly associated with disease, regulation by HERVs is beneficial in other settings; for example, in human testis chimeric isoforms of TP63 induced by an ERV9 LTR protect the male germ line upon DNA damage by inducing apoptosis, whereas in the human globin locus the γ- and β-globin switch during normal hematopoiesis is mediated by complex interactions of an ERV9 LTR and surrounding human sequence. The advent of deep sequencing or next-generation sequencing (NGS) has revolutionized the way researchers solve important scientific questions and develop novel hypotheses in relation to human genome regulation. We recently applied next-generation paired-end RNA-sequencing (RNA-seq) together with chromatin immunoprecipitation with sequencing (ChIP-seq) to examine ERV9 chimeric transcription in human reference cell lines from Encyclopedia of DNA Elements (ENCODE). This led to the discovery of advanced regulation mechanisms by ERV9s and other HERVs across numerous human loci including transcription of large gene-unannotated genomic regions, as well as cooperative regulation by multiple HERVs and non-LTR repeats such as Alu elements. In this article, well-established examples of human gene regulation by HERVs are reviewed followed by a description of paired-end RNA-seq, and its application in identifying chimeric transcription genome-widely. Based on integrative analyses of RNA-seq and ChIP-seq, data we then present novel examples of regulation by ERV9s of tumor suppressor genes CADM2 and SEMA3A, as well as transcription of an unannotated region. Taken together, this article highlights the high suitability of contemporary sequencing methods in future analyses of human biology in relation to evolutionary acquired retroviruses in the human genome. © 2016 APMIS. Published by John Wiley & Sons Ltd.

Genome-wide uniformity of human ‘open’ pre-initiation complexes

PubMed Central

Lai, William K.M.; Pugh, B. Franklin

2017-01-01

Transcription of protein-coding and noncoding DNA occurs pervasively throughout the mammalian genome. Their sites of initiation are generally inferred from transcript 5′ ends and are thought to be either locally dispersed or focused. How these two modes of initiation relate is unclear. Here, we apply permanganate treatment and chromatin immunoprecipitation (PIP-seq) of initiation factors to identify the precise location of melted DNA separately associated with the preinitiation complex (PIC) and the adjacent paused complex (PC). This approach revealed the two known modes of transcription initiation. However, in contrast to prevailing views, they co-occurred within the same promoter region: initiation originating from a focused PIC, and broad nucleosome-linked initiation. PIP-seq allowed transcriptional orientation of Pol II to be determined, which may be useful near promoters where sufficient sense/anti-sense transcript mapping information is lacking. PIP-seq detected divergently oriented Pol II at both coding and noncoding promoters, as well as at enhancers. Their occupancy levels were not necessarily coupled in the two orientations. DNA sequence and shape analysis of initiation complex sites suggest that both sequence and shape contribute to specificity, but in a context-restricted manner. That is, initiation sites have the locally “best” initiator (INR) sequence and/or shape. These findings reveal a common core to pervasive Pol II initiation throughout the human genome. PMID:27927716

Clinically Relevant Cytotoxic Immune Cell Signatures and Clonal Expansion of T Cell Receptors in High-risk MYCN-not-amplified Human Neuroblastoma | Office of Cancer Genomics

Cancer.gov

Purpose: High-risk neuroblastoma is an aggressive disease. DNA sequencing studies have revealed a paucity of actionable genomic alterations and a low mutation burden, posing challenges to develop effective novel therapies. We used RNA sequencing (RNA-seq) to investigate the biology of this disease including a focus on tumor-infiltrating lymphocytes (TILs). Experimental Design: We performed deep RNA-seq on pre-treatment diagnostic tumors from 129 high-risk and 21 low- or intermediate-risk patients with neuroblastomas.

Geranyl diphosphate synthase from mint

DOEpatents

Croteau, Rodney Bruce; Wildung, Mark Raymond; Burke, Charles Cullen; Gershenzon, Jonathan

1999-01-01

A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.

Geranyl diphosphate synthase from mint

DOEpatents

Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.

1999-03-02

A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.

Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks

PubMed Central

Trapnell, Cole; Roberts, Adam; Goff, Loyal; Pertea, Geo; Kim, Daehwan; Kelley, David R; Pimentel, Harold; Salzberg, Steven L; Rinn, John L; Pachter, Lior

2012-01-01

Recent advances in high-throughput cDNA sequencing (RNA-seq) can reveal new genes and splice variants and quantify expression genome-wide in a single assay. The volume and complexity of data from RNA-seq experiments necessitate scalable, fast and mathematically principled analysis software. TopHat and Cufflinks are free, open-source software tools for gene discovery and comprehensive expression analysis of high-throughput mRNA sequencing (RNA-seq) data. Together, they allow biologists to identify new genes and new splice variants of known ones, as well as compare gene and transcript expression under two or more conditions. This protocol describes in detail how to use TopHat and Cufflinks to perform such analyses. It also covers several accessory tools and utilities that aid in managing data, including CummeRbund, a tool for visualizing RNA-seq analysis results. Although the procedure assumes basic informatics skills, these tools assume little to no background with RNA-seq analysis and are meant for novices and experts alike. The protocol begins with raw sequencing reads and produces a transcriptome assembly, lists of differentially expressed and regulated genes and transcripts, and publication-quality visualizations of analysis results. The protocol's execution time depends on the volume of transcriptome sequencing data and available computing resources but takes less than 1 d of computer time for typical experiments and ~1 h of hands-on time. PMID:22383036

JASPAR 2010: the greatly expanded open-access database of transcription factor binding profiles

PubMed Central

Portales-Casamar, Elodie; Thongjuea, Supat; Kwon, Andrew T.; Arenillas, David; Zhao, Xiaobei; Valen, Eivind; Yusuf, Dimas; Lenhard, Boris; Wasserman, Wyeth W.; Sandelin, Albin

2010-01-01

JASPAR (http://jaspar.genereg.net) is the leading open-access database of matrix profiles describing the DNA-binding patterns of transcription factors (TFs) and other proteins interacting with DNA in a sequence-specific manner. Its fourth major release is the largest expansion of the core database to date: the database now holds 457 non-redundant, curated profiles. The new entries include the first batch of profiles derived from ChIP-seq and ChIP-chip whole-genome binding experiments, and 177 yeast TF binding profiles. The introduction of a yeast division brings the convenience of JASPAR to an active research community. As binding models are refined by newer data, the JASPAR database now uses versioning of matrices: in this release, 12% of the older models were updated to improved versions. Classification of TF families has been improved by adopting a new DNA-binding domain nomenclature. A curated catalog of mammalian TFs is provided, extending the use of the JASPAR profiles to additional TFs belonging to the same structural family. The changes in the database set the system ready for more rapid acquisition of new high-throughput data sources. Additionally, three new special collections provide matrix profile data produced by recent alternative high-throughput approaches. PMID:19906716

ERASE-Seq: Leveraging replicate measurements to enhance ultralow frequency variant detection in NGS data

PubMed Central

Kamps-Hughes, Nick; McUsic, Andrew; Kurihara, Laurie; Harkins, Timothy T.; Pal, Prithwish; Ray, Claire

2018-01-01

The accurate detection of ultralow allele frequency variants in DNA samples is of interest in both research and medical settings, particularly in liquid biopsies where cancer mutational status is monitored from circulating DNA. Next-generation sequencing (NGS) technologies employing molecular barcoding have shown promise but significant sensitivity and specificity improvements are still needed to detect mutations in a majority of patients before the metastatic stage. To address this we present analytical validation data for ERASE-Seq (Elimination of Recurrent Artifacts and Stochastic Errors), a method for accurate and sensitive detection of ultralow frequency DNA variants in NGS data. ERASE-Seq differs from previous methods by creating a robust statistical framework to utilize technical replicates in conjunction with background error modeling, providing a 10 to 100-fold reduction in false positive rates compared to published molecular barcoding methods. ERASE-Seq was tested using spiked human DNA mixtures with clinically realistic DNA input quantities to detect SNVs and indels between 0.05% and 1% allele frequency, the range commonly found in liquid biopsy samples. Variants were detected with greater than 90% sensitivity and a false positive rate below 0.1 calls per 10,000 possible variants. The approach represents a significant performance improvement compared to molecular barcoding methods and does not require changing molecular reagents. PMID:29630678

SALP, a new single-stranded DNA library preparation method especially useful for the high-throughput characterization of chromatin openness states.

PubMed

Wu, Jian; Dai, Wei; Wu, Lin; Wang, Jinke

2018-02-13

Next-generation sequencing (NGS) is fundamental to the current biological and biomedical research. Construction of sequencing library is a key step of NGS. Therefore, various library construction methods have been explored. However, the current methods are still limited by some shortcomings. This study developed a new NGS library construction method, Single strand Adaptor Library Preparation (SALP), by using a novel single strand adaptor (SSA). SSA is a double-stranded oligonucleotide with a 3' overhang of 3 random nucleotides, which can be efficiently ligated to the 3' end of single strand DNA by T4 DNA ligase. SALP can be started with any denatured DNA fragments such as those sheared by Tn5 tagmentation, enzyme digestion and sonication. When started with Tn5-tagmented chromatin, SALP can overcome a key limitation of ATAC-seq and become a high-throughput NGS library construction method, SALP-seq, which can be used to comparatively characterize the chromatin openness state of multiple cells unbiasly. In this way, this study successfully characterized the comparative chromatin openness states of four different cell lines, including GM12878, HepG2, HeLa and 293T, with SALP-seq. Similarly, this study also successfully characterized the chromatin openness states of HepG2 cells with SALP-seq by using 10 5 to 500 cells. This study developed a new NGS library construction method, SALP, by using a novel kind of single strand adaptor (SSA), which should has wide applications in the future due to its unique performance.

Isolation and bacterial expression of a sesquiterpene synthase CDNA clone from peppermint(mentha .chi. piperita, L.) that produces the aphid alarm pheromone (E)-.beta.-farnesene

DOEpatents

Croteau, Rodney Bruce; Wildung, Mark Raymond; Crock, John E.

1999-01-01

A cDNA encoding (E)-.beta.-farnesene synthase from peppermint (Mentha piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of (E)-.beta.-farnesene synthase (SEQ ID NO:2), from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for (E)-.beta.-farnesene synthase, or for a base sequence sufficiently complementary to at least a portion of (E)-.beta.-farnesene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (E)-.beta.-farnesene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant (E)-.beta.-farnesene synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant (E)-.beta.-farnesene synthase may be used to obtain expression or enhanced expression of (E)-.beta.-farnesene synthase in plants in order to enhance the production of (E)-.beta.-farnesene, or may be otherwise employed for the regulation or expression of (E)-.beta.-farnesene synthase, or the production of its product.

Multiplex single-molecule interaction profiling of DNA-barcoded proteins.

PubMed

Gu, Liangcai; Li, Chao; Aach, John; Hill, David E; Vidal, Marc; Church, George M

2014-11-27

In contrast with advances in massively parallel DNA sequencing, high-throughput protein analyses are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule protein detection using optical methods is limited by the number of spectrally non-overlapping chromophores. Here we introduce a single-molecular-interaction sequencing (SMI-seq) technology for parallel protein interaction profiling leveraging single-molecule advantages. DNA barcodes are attached to proteins collectively via ribosome display or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide thin film to construct a random single-molecule array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies) and analysed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimetre. Furthermore, protein interactions can be measured on the basis of the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor and antibody-binding profiling, are demonstrated. SMI-seq enables 'library versus library' screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity.

Multiplex single-molecule interaction profiling of DNA barcoded proteins

PubMed Central

Gu, Liangcai; Li, Chao; Aach, John; Hill, David E.; Vidal, Marc; Church, George M.

2014-01-01

In contrast with advances in massively parallel DNA sequencing1, high-throughput protein analyses2-4 are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule (SM) protein detection achieved using optical methods5 is limited by the number of spectrally nonoverlapping chromophores. Here, we introduce a single molecular interaction-sequencing (SMI-Seq) technology for parallel protein interaction profiling leveraging SM advantages. DNA barcodes are attached to proteins collectively via ribosome display6 or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide (PAA) thin film to construct a random SM array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies)7 and analyzed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimeter. Furthermore, protein interactions can be measured based on the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor (GPCR) and antibody binding profiling, were demonstrated. SMI-Seq enables “library vs. library” screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity. PMID:25252978

Next generation sequencing of DNA-launched Chikungunya vaccine virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hidajat, Rachmat; Nickols, Brian; Forrester, Naomi

Chikungunya virus (CHIKV) represents a pandemic threat with no approved vaccine available. Recently, we described a novel vaccination strategy based on iDNA® infectious clone designed to launch a live-attenuated CHIKV vaccine from plasmid DNA in vitro or in vivo. As a proof of concept, we prepared iDNA plasmid pCHIKV-7 encoding the full-length cDNA of the 181/25 vaccine. The DNA-launched CHIKV-7 virus was prepared and compared to the 181/25 virus. Illumina HiSeq2000 sequencing revealed that with the exception of the 3′ untranslated region, CHIKV-7 viral RNA consistently showed a lower frequency of single-nucleotide polymorphisms than the 181/25 RNA including at themore » E2-12 and E2-82 residues previously identified as attenuating mutations. In the CHIKV-7, frequencies of reversions at E2-12 and E2-82 were 0.064% and 0.086%, while in the 181/25, frequencies were 0.179% and 0.133%, respectively. We conclude that the DNA-launched virus has a reduced probability of reversion mutations, thereby enhancing vaccine safety. - Highlights: • Chikungunya virus (CHIKV) is an emerging pandemic threat. • In vivo DNA-launched attenuated CHIKV is a novel vaccine technology. • DNA-launched virus was sequenced using HiSeq2000 and compared to the 181/25 virus. • DNA-launched virus has lower frequency of SNPs at E2-12 and E2-82 attenuation loci.« less

Identification of SNPs associated with muscle yield and quality traits using allelic-imbalance analyses of pooled RNA-Seq samples in rainbow trout.

PubMed

Al-Tobasei, Rafet; Ali, Ali; Leeds, Timothy D; Liu, Sixin; Palti, Yniv; Kenney, Brett; Salem, Mohamed

2017-08-07

Coding/functional SNPs change the biological function of a gene and, therefore, could serve as "large-effect" genetic markers. In this study, we used two bioinformatics pipelines, GATK and SAMtools, for discovering coding/functional SNPs with allelic-imbalances associated with total body weight, muscle yield, muscle fat content, shear force, and whiteness. Phenotypic data were collected for approximately 500 fish, representing 98 families (5 fish/family), from a growth-selected line, and the muscle transcriptome was sequenced from 22 families with divergent phenotypes (4 low- versus 4 high-ranked families per trait). GATK detected 59,112 putative SNPs; of these SNPs, 4798 showed allelic imbalances (>2.0 as an amplification and <0.5 as loss of heterozygosity). SAMtools detected 87,066 putative SNPs; and of them, 4962 had allelic imbalances between the low- and high-ranked families. Only 1829 SNPs with allelic imbalances were common between the two datasets, indicating significant differences in algorithms. The two datasets contained 7930 non-redundant SNPs of which 4439 mapped to 1498 protein-coding genes (with 6.4% non-synonymous SNPs) and 684 mapped to 295 lncRNAs. Validation of a subset of 92 SNPs revealed 1) 86.7-93.8% success rate in calling polymorphic SNPs and 2) 95.4% consistent matching between DNA and cDNA genotypes indicating a high rate of identifying SNPs with allelic imbalances. In addition, 4.64% SNPs revealed random monoallelic expression. Genome distribution of the SNPs with allelic imbalances exhibited high density for all five traits in several chromosomes, especially chromosome 9, 20 and 28. Most of the SNP-harboring genes were assigned to important growth-related metabolic pathways. These results demonstrate utility of RNA-Seq in assessing phenotype-associated allelic imbalances in pooled RNA-Seq samples. The SNPs identified in this study were included in a new SNP-Chip design (available from Affymetrix) for genomic and genetic analyses in rainbow trout.

RefSeq microbial genomes database: new representation and annotation strategy.

PubMed

Tatusova, Tatiana; Ciufo, Stacy; Fedorov, Boris; O'Neill, Kathleen; Tolstoy, Igor

2014-01-01

The source of the microbial genomic sequences in the RefSeq collection is the set of primary sequence records submitted to the International Nucleotide Sequence Database public archives. These can be accessed through the Entrez search and retrieval system at http://www.ncbi.nlm.nih.gov/genome. Next-generation sequencing has enabled researchers to perform genomic sequencing at rates that were unimaginable in the past. Microbial genomes can now be sequenced in a matter of hours, which has led to a significant increase in the number of assembled genomes deposited in the public archives. This huge increase in DNA sequence data presents new challenges for the annotation, analysis and visualization bioinformatics tools. New strategies have been developed for the annotation and representation of reference genomes and sequence variations derived from population studies and clinical outbreaks.

Evolution of DNA-Binding Sites of a Floral Master Regulatory Transcription Factor

PubMed Central

Muiño, Jose M.; de Bruijn, Suzanne; Pajoro, Alice; Geuten, Koen; Vingron, Martin; Angenent, Gerco C.; Kaufmann, Kerstin

2016-01-01

Flower development is controlled by the action of key regulatory transcription factors of the MADS-domain family. The function of these factors appears to be highly conserved among species based on mutant phenotypes. However, the conservation of their downstream processes is much less well understood, mostly because the evolutionary turnover and variation of their DNA-binding sites (BSs) among plant species have not yet been experimentally determined. Here, we performed comparative ChIP (chromatin immunoprecipitation)-seq experiments of the MADS-domain transcription factor SEPALLATA3 (SEP3) in two closely related Arabidopsis species: Arabidopsis thaliana and A. lyrata which have very similar floral organ morphology. We found that BS conservation is associated with DNA sequence conservation, the presence of the CArG-box BS motif and on the relative position of the BS to its potential target gene. Differences in genome size and structure can explain that SEP3 BSs in A. lyrata can be located more distantly to their potential target genes than their counterparts in A. thaliana. In A. lyrata, we identified transposition as a mechanism to generate novel SEP3 binding locations in the genome. Comparative gene expression analysis shows that the loss/gain of BSs is associated with a change in gene expression. In summary, this study investigates the evolutionary dynamics of DNA BSs of a floral key-regulatory transcription factor and explores factors affecting this phenomenon. PMID:26429922

Translational genomics for analysis of complex traits in peanut and sorghum

USDA-ARS?s Scientific Manuscript database

The integration of sequencing and genotype data from natural variation studies (by whole genome resequencing [wgs] or genotype by sequencing [gbs]), transcriptome (RNA-seq) and mutant analysis (also by wgs) facilitated the development of DNA markers in the form of single nucleotide polymorphic (SNP)...

Simultaneous and complete genome sequencing of influenza A and B with high coverage by Illumina MiSeq Platform.

PubMed

Rutvisuttinunt, Wiriya; Chinnawirotpisan, Piyawan; Simasathien, Sriluck; Shrestha, Sanjaya K; Yoon, In-Kyu; Klungthong, Chonticha; Fernandez, Stefan

2013-11-01

Active global surveillance and characterization of influenza viruses are essential for better preparation against possible pandemic events. Obtaining comprehensive information about the influenza genome can improve our understanding of the evolution of influenza viruses and emergence of new strains, and improve the accuracy when designing preventive vaccines. This study investigated the use of deep sequencing by the next-generation sequencing (NGS) Illumina MiSeq Platform to obtain complete genome sequence information from influenza virus isolates. The influenza virus isolates were cultured from 6 respiratory acute clinical specimens collected in Thailand and Nepal. DNA libraries obtained from each viral isolate were mixed and all were sequenced simultaneously. Total information of 2.6 Gbases was obtained from a 455±14 K/mm2 density with 95.76% (8,571,655/8,950,724 clusters) of the clusters passing quality control (QC) filters. Approximately 93.7% of all sequences from Read1 and 83.5% from Read2 contained high quality sequences that were ≥Q30, a base calling QC score standard. Alignments analysis identified three seasonal influenza A H3N2 strains, one 2009 pandemic influenza A H1N1 strain and two influenza B strains. The nearly entire genomes of all six virus isolates yielded equal or greater than 600-fold sequence coverage depth. MiSeq Platform identified seasonal influenza A H3N2, 2009 pandemic influenza A H1N1and influenza B in the DNA library mixtures efficiently. Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.

GUIDE-Seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases

PubMed Central

Nguyen, Nhu T.; Liebers, Matthew; Topkar, Ved V.; Thapar, Vishal; Wyvekens, Nicolas; Khayter, Cyd; Iafrate, A. John; Le, Long P.; Aryee, Martin J.; Joung, J. Keith

2014-01-01

CRISPR RNA-guided nucleases (RGNs) are widely used genome-editing reagents, but methods to delineate their genome-wide off-target cleavage activities have been lacking. Here we describe an approach for global detection of DNA double-stranded breaks (DSBs) introduced by RGNs and potentially other nucleases. This method, called Genome-wide Unbiased Identification of DSBs Enabled by Sequencing (GUIDE-Seq), relies on capture of double-stranded oligodeoxynucleotides into breaks Application of GUIDE-Seq to thirteen RGNs in two human cell lines revealed wide variability in RGN off-target activities and unappreciated characteristics of off-target sequences. The majority of identified sites were not detected by existing computational methods or ChIP-Seq. GUIDE-Seq also identified RGN-independent genomic breakpoint ‘hotspots’. Finally, GUIDE-Seq revealed that truncated guide RNAs exhibit substantially reduced RGN-induced off-target DSBs. Our experiments define the most rigorous framework for genome-wide identification of RGN off-target effects to date and provide a method for evaluating the safety of these nucleases prior to clinical use. PMID:25513782

Developmental validation of a Nextera XT mitogenome Illumina MiSeq sequencing method for high-quality samples.

PubMed

Peck, Michelle A; Sturk-Andreaggi, Kimberly; Thomas, Jacqueline T; Oliver, Robert S; Barritt-Ross, Suzanne; Marshall, Charla

2018-05-01

Generating mitochondrial genome (mitogenome) data from reference samples in a rapid and efficient manner is critical to harnessing the greater power of discrimination of the entire mitochondrial DNA (mtDNA) marker. The method of long-range target enrichment, Nextera XT library preparation, and Illumina sequencing on the MiSeq is a well-established technique for generating mitogenome data from high-quality samples. To this end, a validation was conducted for this mitogenome method processing up to 24 samples simultaneously along with analysis in the CLC Genomics Workbench and utilizing the AQME (AFDIL-QIAGEN mtDNA Expert) tool to generate forensic profiles. This validation followed the Federal Bureau of Investigation's Quality Assurance Standards (QAS) for forensic DNA testing laboratories and the Scientific Working Group on DNA Analysis Methods (SWGDAM) validation guidelines. The evaluation of control DNA, non-probative samples, blank controls, mixtures, and nonhuman samples demonstrated the validity of this method. Specifically, the sensitivity was established at ≥25 pg of nuclear DNA input for accurate mitogenome profile generation. Unreproducible low-level variants were observed in samples with low amplicon yields. Further, variant quality was shown to be a useful metric for identifying sequencing error and crosstalk. Success of this method was demonstrated with a variety of reference sample substrates and extract types. These studies further demonstrate the advantages of using NGS techniques by highlighting the quantitative nature of heteroplasmy detection. The results presented herein from more than 175 samples processed in ten sequencing runs, show this mitogenome sequencing method and analysis strategy to be valid for the generation of reference data. Copyright © 2018 Elsevier B.V. All rights reserved.

Recent advances in ChIP-seq analysis: from quality management to whole-genome annotation.

PubMed

Nakato, Ryuichiro; Shirahige, Katsuhiko

2017-03-01

Chromatin immunoprecipitation followed by sequencing (ChIP-seq) analysis can detect protein/DNA-binding and histone-modification sites across an entire genome. Recent advances in sequencing technologies and analyses enable us to compare hundreds of samples simultaneously; such large-scale analysis has potential to reveal the high-dimensional interrelationship level for regulatory elements and annotate novel functional genomic regions de novo. Because many experimental considerations are relevant to the choice of a method in a ChIP-seq analysis, the overall design and quality management of the experiment are of critical importance. This review offers guiding principles of computation and sample preparation for ChIP-seq analyses, highlighting the validity and limitations of the state-of-the-art procedures at each step. We also discuss the latest challenges of single-cell analysis that will encourage a new era in this field. © The Author 2016. Published by Oxford University Press.

A ChIP-Seq Data Analysis Pipeline Based on Bioconductor Packages.

PubMed

Park, Seung-Jin; Kim, Jong-Hwan; Yoon, Byung-Ha; Kim, Seon-Young

2017-03-01

Nowadays, huge volumes of chromatin immunoprecipitation-sequencing (ChIP-Seq) data are generated to increase the knowledge on DNA-protein interactions in the cell, and accordingly, many tools have been developed for ChIP-Seq analysis. Here, we provide an example of a streamlined workflow for ChIP-Seq data analysis composed of only four packages in Bioconductor: dada2, QuasR, mosaics, and ChIPseeker. 'dada2' performs trimming of the high-throughput sequencing data. 'QuasR' and 'mosaics' perform quality control and mapping of the input reads to the reference genome and peak calling, respectively. Finally, 'ChIPseeker' performs annotation and visualization of the called peaks. This workflow runs well independently of operating systems (e.g., Windows, Mac, or Linux) and processes the input fastq files into various results in one run. R code is available at github: https://github.com/ddhb/Workflow_of_Chipseq.git.

A ChIP-Seq Data Analysis Pipeline Based on Bioconductor Packages

PubMed Central

Park, Seung-Jin; Kim, Jong-Hwan; Yoon, Byung-Ha; Kim, Seon-Young

2017-01-01

Nowadays, huge volumes of chromatin immunoprecipitation-sequencing (ChIP-Seq) data are generated to increase the knowledge on DNA-protein interactions in the cell, and accordingly, many tools have been developed for ChIP-Seq analysis. Here, we provide an example of a streamlined workflow for ChIP-Seq data analysis composed of only four packages in Bioconductor: dada2, QuasR, mosaics, and ChIPseeker. ‘dada2’ performs trimming of the high-throughput sequencing data. ‘QuasR’ and ‘mosaics’ perform quality control and mapping of the input reads to the reference genome and peak calling, respectively. Finally, ‘ChIPseeker’ performs annotation and visualization of the called peaks. This workflow runs well independently of operating systems (e.g., Windows, Mac, or Linux) and processes the input fastq files into various results in one run. R code is available at github: https://github.com/ddhb/Workflow_of_Chipseq.git. PMID:28416945

Mismatch and G-Stack Modulated Probe Signals on SNP Microarrays

PubMed Central

Binder, Hans; Fasold, Mario; Glomb, Torsten

2009-01-01

Background Single nucleotide polymorphism (SNP) arrays are important tools widely used for genotyping and copy number estimation. This technology utilizes the specific affinity of fragmented DNA for binding to surface-attached oligonucleotide DNA probes. We analyze the variability of the probe signals of Affymetrix GeneChip SNP arrays as a function of the probe sequence to identify relevant sequence motifs which potentially cause systematic biases of genotyping and copy number estimates. Methodology/Principal Findings The probe design of GeneChip SNP arrays enables us to disentangle different sources of intensity modulations such as the number of mismatches per duplex, matched and mismatched base pairings including nearest and next-nearest neighbors and their position along the probe sequence. The effect of probe sequence was estimated in terms of triple-motifs with central matches and mismatches which include all 256 combinations of possible base pairings. The probe/target interactions on the chip can be decomposed into nearest neighbor contributions which correlate well with free energy terms of DNA/DNA-interactions in solution. The effect of mismatches is about twice as large as that of canonical pairings. Runs of guanines (G) and the particular type of mismatched pairings formed in cross-allelic probe/target duplexes constitute sources of systematic biases of the probe signals with consequences for genotyping and copy number estimates. The poly-G effect seems to be related to the crowded arrangement of probes which facilitates complex formation of neighboring probes with at minimum three adjacent G's in their sequence. Conclusions The applied method of “triple-averaging” represents a model-free approach to estimate the mean intensity contributions of different sequence motifs which can be applied in calibration algorithms to correct signal values for sequence effects. Rules for appropriate sequence corrections are suggested. PMID:19924253

Genome-wide ChIP-seq mapping and analysis of butyrate-induced H3K9 and H3K27 acetylation and epigenomic landscape alteration in bovine cells

USDA-ARS?s Scientific Manuscript database

Utilizing next-generation sequencing technology, combined with ChIP (Chromatin Immunoprecipitation) technology, we analyzed histone modification (acetylation) induced by butyrate and the large-scale mapping of the epigenomic landscape of normal histone H3 and acetylated histone H3K9 and H3K27. To d...

Integrated and translational genomics for analysis of complex traits in crops

USDA-ARS?s Scientific Manuscript database

We report here on integration of sequencing and genotype data from natural variation (by whole genome resequencing [wgs] or genotype by sequencing [gbs]), transcriptome (RNA-seq) and mutant analysis (also by wgs) with the goal of translating gems from these resources into useable DNA markers in the ...

Transcriptome analysis by strand-specific sequencing of complementary DNA

PubMed Central

Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey

2009-01-01

High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online. PMID:19620212

Transcriptome analysis by strand-specific sequencing of complementary DNA.

PubMed

Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey

2009-10-01

High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online.

Ultrafast DNA sequencing on a microchip by a hybrid separation mechanism that gives 600 bases in 6.5 minutes.

PubMed

Fredlake, Christopher P; Hert, Daniel G; Kan, Cheuk-Wai; Chiesl, Thomas N; Root, Brian E; Forster, Ryan E; Barron, Annelise E

2008-01-15

To realize the immense potential of large-scale genomic sequencing after the completion of the second human genome (Venter's), the costs for the complete sequencing of additional genomes must be dramatically reduced. Among the technologies being developed to reduce sequencing costs, microchip electrophoresis is the only new technology ready to produce the long reads most suitable for the de novo sequencing and assembly of large and complex genomes. Compared with the current paradigm of capillary electrophoresis, microchip systems promise to reduce sequencing costs dramatically by increasing throughput, reducing reagent consumption, and integrating the many steps of the sequencing pipeline onto a single platform. Although capillary-based systems require approximately 70 min to deliver approximately 650 bases of contiguous sequence, we report sequencing up to 600 bases in just 6.5 min by microchip electrophoresis with a unique polymer matrix/adsorbed polymer wall coating combination. This represents a two-thirds reduction in sequencing time over any previously published chip sequencing result, with comparable read length and sequence quality. We hypothesize that these ultrafast long reads on chips can be achieved because the combined polymer system engenders a recently discovered "hybrid" mechanism of DNA electromigration, in which DNA molecules alternate rapidly between repeating through the intact polymer network and disrupting network entanglements to drag polymers through the solution, similar to dsDNA dynamics we observe in single-molecule DNA imaging studies. Most importantly, these results reveal the surprisingly powerful ability of microchip electrophoresis to provide ultrafast Sanger sequencing, which will translate to increased system throughput and reduced costs.

Ultrafast DNA sequencing on a microchip by a hybrid separation mechanism that gives 600 bases in 6.5 minutes

PubMed Central

Fredlake, Christopher P.; Hert, Daniel G.; Kan, Cheuk-Wai; Chiesl, Thomas N.; Root, Brian E.; Forster, Ryan E.; Barron, Annelise E.

2008-01-01

To realize the immense potential of large-scale genomic sequencing after the completion of the second human genome (Venter's), the costs for the complete sequencing of additional genomes must be dramatically reduced. Among the technologies being developed to reduce sequencing costs, microchip electrophoresis is the only new technology ready to produce the long reads most suitable for the de novo sequencing and assembly of large and complex genomes. Compared with the current paradigm of capillary electrophoresis, microchip systems promise to reduce sequencing costs dramatically by increasing throughput, reducing reagent consumption, and integrating the many steps of the sequencing pipeline onto a single platform. Although capillary-based systems require ≈70 min to deliver ≈650 bases of contiguous sequence, we report sequencing up to 600 bases in just 6.5 min by microchip electrophoresis with a unique polymer matrix/adsorbed polymer wall coating combination. This represents a two-thirds reduction in sequencing time over any previously published chip sequencing result, with comparable read length and sequence quality. We hypothesize that these ultrafast long reads on chips can be achieved because the combined polymer system engenders a recently discovered “hybrid” mechanism of DNA electromigration, in which DNA molecules alternate rapidly between reptating through the intact polymer network and disrupting network entanglements to drag polymers through the solution, similar to dsDNA dynamics we observe in single-molecule DNA imaging studies. Most importantly, these results reveal the surprisingly powerful ability of microchip electrophoresis to provide ultrafast Sanger sequencing, which will translate to increased system throughput and reduced costs. PMID:18184818

Identification and removal of low-complexity sites in allele-specific analysis of ChIP-seq data.

PubMed

Waszak, Sebastian M; Kilpinen, Helena; Gschwind, Andreas R; Orioli, Andrea; Raghav, Sunil K; Witwicki, Robert M; Migliavacca, Eugenia; Yurovsky, Alisa; Lappalainen, Tuuli; Hernandez, Nouria; Reymond, Alexandre; Dermitzakis, Emmanouil T; Deplancke, Bart

2014-01-15

High-throughput sequencing technologies enable the genome-wide analysis of the impact of genetic variation on molecular phenotypes at unprecedented resolution. However, although powerful, these technologies can also introduce unexpected artifacts. We investigated the impact of library amplification bias on the identification of allele-specific (AS) molecular events from high-throughput sequencing data derived from chromatin immunoprecipitation assays (ChIP-seq). Putative AS DNA binding activity for RNA polymerase II was determined using ChIP-seq data derived from lymphoblastoid cell lines of two parent-daughter trios. We found that, at high-sequencing depth, many significant AS binding sites suffered from an amplification bias, as evidenced by a larger number of clonal reads representing one of the two alleles. To alleviate this bias, we devised an amplification bias detection strategy, which filters out sites with low read complexity and sites featuring a significant excess of clonal reads. This method will be useful for AS analyses involving ChIP-seq and other functional sequencing assays. The R package abs filter for library clonality simulations and detection of amplification-biased sites is available from http://updepla1srv1.epfl.ch/waszaks/absfilter

Integrated sequencing of exome and mRNA of large-sized single cells.

PubMed

Wang, Lily Yan; Guo, Jiajie; Cao, Wei; Zhang, Meng; He, Jiankui; Li, Zhoufang

2018-01-10

Current approaches of single cell DNA-RNA integrated sequencing are difficult to call SNPs, because a large amount of DNA and RNA is lost during DNA-RNA separation. Here, we performed simultaneous single-cell exome and transcriptome sequencing on individual mouse oocytes. Using microinjection, we kept the nuclei intact to avoid DNA loss, while retaining the cytoplasm inside the cell membrane, to maximize the amount of DNA and RNA captured from the single cell. We then conducted exome-sequencing on the isolated nuclei and mRNA-sequencing on the enucleated cytoplasm. For single oocytes, exome-seq can cover up to 92% of exome region with an average sequencing depth of 10+, while mRNA-sequencing reveals more than 10,000 expressed genes in enucleated cytoplasm, with similar performance for intact oocytes. This approach provides unprecedented opportunities to study DNA-RNA regulation, such as RNA editing at single nucleotide level in oocytes. In future, this method can also be applied to other large cells, including neurons, large dendritic cells and large tumour cells for integrated exome and transcriptome sequencing.

Saturation analysis of ChIP-seq data for reproducible identification of binding peaks

PubMed Central

Hansen, Peter; Hecht, Jochen; Ibrahim, Daniel M.; Krannich, Alexander; Truss, Matthias; Robinson, Peter N.

2015-01-01

Chromatin immunoprecipitation coupled with next-generation sequencing (ChIP-seq) is a powerful technology to identify the genome-wide locations of transcription factors and other DNA binding proteins. Computational ChIP-seq peak calling infers the location of protein–DNA interactions based on various measures of enrichment of sequence reads. In this work, we introduce an algorithm, Q, that uses an assessment of the quadratic enrichment of reads to center candidate peaks followed by statistical analysis of saturation of candidate peaks by 5′ ends of reads. We show that our method not only is substantially faster than several competing methods but also demonstrates statistically significant advantages with respect to reproducibility of results and in its ability to identify peaks with reproducible binding site motifs. We show that Q has superior performance in the delineation of double RNAPII and H3K4me3 peaks surrounding transcription start sites related to a better ability to resolve individual peaks. The method is implemented in C+l+ and is freely available under an open source license. PMID:26163319

5' Rapid Amplification of cDNA Ends and Illumina MiSeq Reveals B Cell Receptor Features in Healthy Adults, Adults With Chronic HIV-1 Infection, Cord Blood, and Humanized Mice.

PubMed

Waltari, Eric; Jia, Manxue; Jiang, Caroline S; Lu, Hong; Huang, Jing; Fernandez, Cristina; Finzi, Andrés; Kaufmann, Daniel E; Markowitz, Martin; Tsuji, Moriya; Wu, Xueling

2018-01-01

Using 5' rapid amplification of cDNA ends, Illumina MiSeq, and basic flow cytometry, we systematically analyzed the expressed B cell receptor (BCR) repertoire in 14 healthy adult PBMCs, 5 HIV-1+ adult PBMCs, 5 cord blood samples, and 3 HIS-CD4/B mice, examining the full-length variable region of μ, γ, α, κ, and λ chains for V-gene usage, somatic hypermutation (SHM), and CDR3 length. Adding to the known repertoire of healthy adults, Illumina MiSeq consistently detected small fractions of reads with high mutation frequencies including hypermutated μ reads, and reads with long CDR3s. Additionally, the less studied IgA repertoire displayed similar characteristics to that of IgG. Compared to healthy adults, the five HIV-1 chronically infected adults displayed elevated mutation frequencies for all μ, γ, α, κ, and λ chains examined and slightly longer CDR3 lengths for γ, α, and λ. To evaluate the reconstituted human BCR sequences in a humanized mouse model, we analyzed cord blood and HIS-CD4/B mice, which all lacked the typical SHM seen in the adult reference. Furthermore, MiSeq revealed identical unmutated IgM sequences derived from separate cell aliquots, thus for the first time demonstrating rare clonal members of unmutated IgM B cells by sequencing.

Biotechnological applications of mobile group II introns and their reverse transcriptases: gene targeting, RNA-seq, and non-coding RNA analysis.

PubMed

Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M

2014-01-13

Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into 'targetrons.' Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and 'cut-and-pastes' (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA-seq). The high processivity and fidelity of group II intron reverse transcriptases along with their novel template-switching activity, which can directly link RNA-seq adaptor sequences to cDNAs during reverse transcription, open new approaches for RNA-seq and the identification and profiling of non-coding RNAs, with potentially wide applications in research and biotechnology.

Dynamic maps of UV damage formation and repair for the human genome

PubMed Central

Hu, Jinchuan; Adebali, Ogun; Adar, Sheera; Sancar, Aziz

2017-01-01

Formation and repair of UV-induced DNA damage in human cells are affected by cellular context. To study factors influencing damage formation and repair genome-wide, we developed a highly sensitive single-nucleotide resolution damage mapping method [high-sensitivity damage sequencing (HS–Damage-seq)]. Damage maps of both cyclobutane pyrimidine dimers (CPDs) and pyrimidine-pyrimidone (6-4) photoproducts [(6-4)PPs] from UV-irradiated cellular and naked DNA revealed that the effect of transcription factor binding on bulky adducts formation varies, depending on the specific transcription factor, damage type, and strand. We also generated time-resolved UV damage maps of both CPDs and (6-4)PPs by HS–Damage-seq and compared them to the complementary repair maps of the human genome obtained by excision repair sequencing to gain insight into factors that affect UV-induced DNA damage and repair and ultimately UV carcinogenesis. The combination of the two methods revealed that, whereas UV-induced damage is virtually uniform throughout the genome, repair is affected by chromatin states, transcription, and transcription factor binding, in a manner that depends on the type of DNA damage. PMID:28607063

Dynamic maps of UV damage formation and repair for the human genome.

PubMed

Hu, Jinchuan; Adebali, Ogun; Adar, Sheera; Sancar, Aziz

2017-06-27

Formation and repair of UV-induced DNA damage in human cells are affected by cellular context. To study factors influencing damage formation and repair genome-wide, we developed a highly sensitive single-nucleotide resolution damage mapping method [high-sensitivity damage sequencing (HS-Damage-seq)]. Damage maps of both cyclobutane pyrimidine dimers (CPDs) and pyrimidine-pyrimidone (6-4) photoproducts [(6-4)PPs] from UV-irradiated cellular and naked DNA revealed that the effect of transcription factor binding on bulky adducts formation varies, depending on the specific transcription factor, damage type, and strand. We also generated time-resolved UV damage maps of both CPDs and (6-4)PPs by HS-Damage-seq and compared them to the complementary repair maps of the human genome obtained by excision repair sequencing to gain insight into factors that affect UV-induced DNA damage and repair and ultimately UV carcinogenesis. The combination of the two methods revealed that, whereas UV-induced damage is virtually uniform throughout the genome, repair is affected by chromatin states, transcription, and transcription factor binding, in a manner that depends on the type of DNA damage.

Analysis of LexA binding sites and transcriptomics in response to genotoxic stress in Leptospira interrogans.

PubMed

Schons-Fonseca, Luciane; da Silva, Josefa B; Milanez, Juliana S; Domingos, Renan H; Smith, Janet L; Nakaya, Helder I; Grossman, Alan D; Ho, Paulo L; da Costa, Renata M A

2016-02-18

We determined the effects of DNA damage caused by ultraviolet radiation on gene expression in Leptospira interrogans using DNA microarrays. These data were integrated with DNA binding in vivo of LexA1, a regulator of the DNA damage response, assessed by chromatin immunoprecipitation and massively parallel DNA sequencing (ChIP-seq). In response to DNA damage, Leptospira induced expression of genes involved in DNA metabolism, in mobile genetic elements and defective prophages. The DNA repair genes involved in removal of photo-damage (e.g. nucleotide excision repair uvrABC, recombinases recBCD and resolvases ruvABC) were not induced. Genes involved in various metabolic pathways were down regulated, including genes involved in cell growth, RNA metabolism and the tricarboxylic acid cycle. From ChIP-seq data, we observed 24 LexA1 binding sites located throughout chromosome 1 and one binding site in chromosome 2. Expression of many, but not all, genes near those sites was increased following DNA damage. Binding sites were found as far as 550 bp upstream from the start codon, or 1 kb into the coding sequence. Our findings indicate that there is a shift in gene expression following DNA damage that represses genes involved in cell growth and virulence, and induces genes involved in mutagenesis and recombination. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Synthetic spike-in standards for high-throughput 16S rRNA gene amplicon sequencing

PubMed Central

Tourlousse, Dieter M.; Yoshiike, Satowa; Ohashi, Akiko; Matsukura, Satoko; Noda, Naohiro

2017-01-01

Abstract High-throughput sequencing of 16S rRNA gene amplicons (16S-seq) has become a widely deployed method for profiling complex microbial communities but technical pitfalls related to data reliability and quantification remain to be fully addressed. In this work, we have developed and implemented a set of synthetic 16S rRNA genes to serve as universal spike-in standards for 16S-seq experiments. The spike-ins represent full-length 16S rRNA genes containing artificial variable regions with negligible identity to known nucleotide sequences, permitting unambiguous identification of spike-in sequences in 16S-seq read data from any microbiome sample. Using defined mock communities and environmental microbiota, we characterized the performance of the spike-in standards and demonstrated their utility for evaluating data quality on a per-sample basis. Further, we showed that staggered spike-in mixtures added at the point of DNA extraction enable concurrent estimation of absolute microbial abundances suitable for comparative analysis. Results also underscored that template-specific Illumina sequencing artifacts may lead to biases in the perceived abundance of certain taxa. Taken together, the spike-in standards represent a novel bioanalytical tool that can substantially improve 16S-seq-based microbiome studies by enabling comprehensive quality control along with absolute quantification. PMID:27980100

Research and development of biochip technologies in Taiwan

NASA Astrophysics Data System (ADS)

Ting, Solomon J.; Chiou, Arthur E. T.

2000-07-01

Recent advancements in several genome-sequencing projects have stimulated an enormous interest in microarray DNA chip technology, especially in the biomedical sciences and pharmaceutical industries. The DNA chips facilitated the miniaturization of conventional nucleic acid hybridizations, by either robotically spotting thousands of library cDNAs or in situ synthesis of high-density oligonucleotides onto solid supports. These innovations have found a wide range of applications in molecular biology, especially in studying gene expression and discovering new genes from the global view of genomic analysis. The research and development of this powerful tool has also received great attentions in Taiwan. In this paper, we report the current progresses of our DNA chip project, along with the current status of other biochip projects in Taiwan, such as protein chip, PCR chip, electrophoresis chip, olfactory chip, etc. The new development of biochip technologies integrates the biotechnology with the semiconductor processing, the micro- electro-mechanical, optoelectronic, and digital signal processing technologies. Most of these biochip technologies utilitze optical detection methods for data acquisition and analysis. The strengths and advantages of different approaches are compared and discussed in this report.

Improved Analysis of Nanopore Sequence Data and Scanning Nanopore Techniques

NASA Astrophysics Data System (ADS)

Szalay, Tamas

The field of nanopore research has been driven by the need to inexpensively and rapidly sequence DNA. In order to help realize this goal, this thesis describes the PoreSeq algorithm that identifies and corrects errors in real-world nanopore sequencing data and improves the accuracy of de novo genome assembly with increasing coverage depth. The approach relies on modeling the possible sources of uncertainty that occur as DNA advances through the nanopore and then using this model to find the sequence that best explains multiple reads of the same region of DNA. PoreSeq increases nanopore sequencing read accuracy of M13 bacteriophage DNA from 85% to 99% at 100X coverage. We also use the algorithm to assemble E. coli with 30X coverage and the lambda genome at a range of coverages from 3X to 50X. Additionally, we classify sequence variants at an order of magnitude lower coverage than is possible with existing methods. This thesis also reports preliminary progress towards controlling the motion of DNA using two nanopores instead of one. The speed at which the DNA travels through the nanopore needs to be carefully controlled to facilitate the detection of individual bases. A second nanopore in close proximity to the first could be used to slow or stop the motion of the DNA in order to enable a more accurate readout. The fabrication process for a new pyramidal nanopore geometry was developed in order to facilitate the positioning of the nanopores. This thesis demonstrates that two of them can be placed close enough to interact with a single molecule of DNA, which is a prerequisite for being able to use the driving force of the pores to exert fine control over the motion of the DNA. Another strategy for reading the DNA is to trap it completely with one pore and to move the second nanopore instead. To that end, this thesis also shows that a single strand of immobilized DNA can be captured in a scanning nanopore and examined for a full hour, with data from many scans at many different voltages obtained in order to detect a bound protein placed partway along the molecule.

Illumina GA IIx& HiSeq 2000 Production Sequenccing and QC Analysis Pipelines at the DOE Joint Genome Institute

DOE Office of Scientific and Technical Information (OSTI.GOV)

Daum, Christopher; Zane, Matthew; Han, James

2011-01-31

The U.S. Department of Energy (DOE) Joint Genome Institute's (JGI) Production Sequencing group is committed to the generation of high-quality genomic DNA sequence to support the mission areas of renewable energy generation, global carbon management, and environmental characterization and clean-up. Within the JGI's Production Sequencing group, a robust Illumina Genome Analyzer and HiSeq pipeline has been established. Optimization of the sesequencer pipelines has been ongoing with the aim of continual process improvement of the laboratory workflow, reducing operational costs and project cycle times to increases ample throughput, and improving the overall quality of the sequence generated. A sequence QC analysismore » pipeline has been implemented to automatically generate read and assembly level quality metrics. The foremost of these optimization projects, along with sequencing and operational strategies, throughput numbers, and sequencing quality results will be presented.« less

Genomic maps of lincRNA occupancy reveal principles of RNA-chromatin interactions

PubMed Central

Chu, Ci; Qu, Kun; Zhong, Franklin; Artandi, Steven E.; Chang, Howard Y.

2011-01-01

SUMMARY Long intergenic noncoding RNAs (lincRNAs) are key regulators of chromatin state, yet the nature and sites of RNA-chromatin interaction are mostly unknown. Here we introduce Chromatin Isolation by RNA Purification (ChIRP), where tiling oligonucleotides retrieve specific lincRNAs with bound protein and DNA sequences, which are enumerated by deep sequencing. ChIRP-seq of three lincRNAs reveal that RNA occupancy sites in the genome are focal, sequence-specific, and numerous. Drosophila roX2 RNA occupies male X-linked gene bodies with increasing tendency toward the 3’ end, peaking at CES sites. Human telomerase RNA TERC occupies telomeres and Wnt pathway genes. HOTAIR lincRNA preferentially occupies a GA-rich DNA motif to nucleate broad domains of Polycomb occupancy and histone H3 lysine 27 trimethylation. HOTAIR occupancy occurs independently of EZH2, suggesting the order of RNA guidance of Polycomb occupancy. ChIRP-seq is generally applicable to illuminate the intersection of RNA and chromatin with newfound precision genome-wide. PMID:21963238

Comparing sequencing assays and human-machine analyses in actionable genomics for glioblastoma

PubMed Central

Wrzeszczynski, Kazimierz O.; Frank, Mayu O.; Koyama, Takahiko; Rhrissorrakrai, Kahn; Robine, Nicolas; Utro, Filippo; Emde, Anne-Katrin; Chen, Bo-Juen; Arora, Kanika; Shah, Minita; Vacic, Vladimir; Norel, Raquel; Bilal, Erhan; Bergmann, Ewa A.; Moore Vogel, Julia L.; Bruce, Jeffrey N.; Lassman, Andrew B.; Canoll, Peter; Grommes, Christian; Harvey, Steve; Parida, Laxmi; Michelini, Vanessa V.; Zody, Michael C.; Jobanputra, Vaidehi; Royyuru, Ajay K.

2017-01-01

Objective: To analyze a glioblastoma tumor specimen with 3 different platforms and compare potentially actionable calls from each. Methods: Tumor DNA was analyzed by a commercial targeted panel. In addition, tumor-normal DNA was analyzed by whole-genome sequencing (WGS) and tumor RNA was analyzed by RNA sequencing (RNA-seq). The WGS and RNA-seq data were analyzed by a team of bioinformaticians and cancer oncologists, and separately by IBM Watson Genomic Analytics (WGA), an automated system for prioritizing somatic variants and identifying drugs. Results: More variants were identified by WGS/RNA analysis than by targeted panels. WGA completed a comparable analysis in a fraction of the time required by the human analysts. Conclusions: The development of an effective human-machine interface in the analysis of deep cancer genomic datasets may provide potentially clinically actionable calls for individual patients in a more timely and efficient manner than currently possible. ClinicalTrials.gov identifier: NCT02725684. PMID:28740869

Genome-wide base-resolution mapping of DNA methylation in single cells using single-cell bisulfite sequencing (scBS-seq).

PubMed

Clark, Stephen J; Smallwood, Sébastien A; Lee, Heather J; Krueger, Felix; Reik, Wolf; Kelsey, Gavin

2017-03-01

DNA methylation (DNAme) is an important epigenetic mark in diverse species. Our current understanding of DNAme is based on measurements from bulk cell samples, which obscures intercellular differences and prevents analyses of rare cell types. Thus, the ability to measure DNAme in single cells has the potential to make important contributions to the understanding of several key biological processes, such as embryonic development, disease progression and aging. We have recently reported a method for generating genome-wide DNAme maps from single cells, using single-cell bisulfite sequencing (scBS-seq), allowing the quantitative measurement of DNAme at up to 50% of CpG dinucleotides throughout the mouse genome. Here we present a detailed protocol for scBS-seq that includes our most recent developments to optimize recovery of CpGs, mapping efficiency and success rate; reduce hands-on time; and increase sample throughput with the option of using an automated liquid handler. We provide step-by-step instructions for each stage of the method, comprising cell lysis and bisulfite (BS) conversion, preamplification and adaptor tagging, library amplification, sequencing and, lastly, alignment and methylation calling. An individual with relevant molecular biology expertise can complete library preparation within 3 d. Subsequent computational steps require 1-3 d for someone with bioinformatics expertise.

Single-Cell Sequencing for Drug Discovery and Drug Development.

PubMed

Wu, Hongjin; Wang, Charles; Wu, Shixiu

2017-01-01

Next-generation sequencing (NGS), particularly single-cell sequencing, has revolutionized the scale and scope of genomic and biomedical research. Recent technological advances in NGS and singlecell studies have made the deep whole-genome (DNA-seq), whole epigenome and whole-transcriptome sequencing (RNA-seq) at single-cell level feasible. NGS at the single-cell level expands our view of genome, epigenome and transcriptome and allows the genome, epigenome and transcriptome of any organism to be explored without a priori assumptions and with unprecedented throughput. And it does so with single-nucleotide resolution. NGS is also a very powerful tool for drug discovery and drug development. In this review, we describe the current state of single-cell sequencing techniques, which can provide a new, more powerful and precise approach for analyzing effects of drugs on treated cells and tissues. Our review discusses single-cell whole genome/exome sequencing (scWGS/scWES), single-cell transcriptome sequencing (scRNA-seq), single-cell bisulfite sequencing (scBS), and multiple omics of single-cell sequencing. We also highlight the advantages and challenges of each of these approaches. Finally, we describe, elaborate and speculate the potential applications of single-cell sequencing for drug discovery and drug development. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Isotachophoresis for fractionation and recovery of cytoplasmic RNA and nucleus from single cells.

PubMed

Kuriyama, Kentaro; Shintaku, Hirofumi; Santiago, Juan G

2015-07-01

There is a substantial need for simultaneous analyses of RNA and DNA from individual single cells. Such analysis provides unique evidence of cell-to-cell differences and the correlation between gene expression and genomic mutation in highly heterogeneous cell populations. We present a novel microfluidic system that leverages isotachophoresis to fractionate and isolate cytoplasmic RNA and genomic DNA (gDNA) from single cells. The system uniquely enables independent, sequence-specific analyses of these critical markers. Our system uses a microfluidic chip with a simple geometry and four end-channel electrodes, and completes the entire process in <5 min, including lysis, purification, fractionation, and delivery to DNA and RNA output reservoirs, each containing high quality and purity aliquots with no measurable cross-contamination of cytoplasmic RNA versus gDNA. We demonstrate our system with simultaneous, sequence-specific quantitation using off-chip RT-qPCR and qPCR for simultaneous cytoplasmic RNA and gDNA analyses, respectively. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Recovering complete mitochondrial genome sequences from RNA-Seq: A case study of Polytomella non-photosynthetic green algae.

PubMed

Tian, Yao; Smith, David Roy

2016-05-01

Thousands of mitochondrial genomes have been sequenced, but there are comparatively few available mitochondrial transcriptomes. This might soon be changing. High-throughput RNA sequencing (RNA-Seq) techniques have made it fast and cheap to generate massive amounts of mitochondrial transcriptomic data. Here, we explore the utility of RNA-Seq for assembling mitochondrial genomes and studying their expression patterns. Specifically, we investigate the mitochondrial transcriptomes from Polytomella non-photosynthetic green algae, which have among the smallest, most reduced mitochondrial genomes from the Archaeplastida as well as fragmented rRNA-coding regions, palindromic genes, and linear chromosomes with telomeres. Isolation of whole genomic RNA from the four known Polytomella species followed by Illumina paired-end sequencing generated enough mitochondrial-derived reads to easily recover almost-entire mitochondrial genome sequences. Read-mapping and coverage statistics also gave insights into Polytomella mitochondrial transcriptional architecture, revealing polycistronic transcripts and the expression of telomeres and palindromic genes. Ultimately, RNA-Seq is a promising, cost-effective technique for studying mitochondrial genetics, but it does have drawbacks, which are discussed. One of its greatest potentials, as shown here, is that it can be used to generate near-complete mitochondrial genome sequences, which could be particularly useful in situations where there is a lack of available mtDNA data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Advances in DNA sequencing technologies for high resolution HLA typing.

PubMed

Cereb, Nezih; Kim, Hwa Ran; Ryu, Jaejun; Yang, Soo Young

2015-12-01

This communication describes our experience in large-scale G group-level high resolution HLA typing using three different DNA sequencing platforms - ABI 3730 xl, Illumina MiSeq and PacBio RS II. Recent advances in DNA sequencing technologies, so-called next generation sequencing (NGS), have brought breakthroughs in deciphering the genetic information in all living species at a large scale and at an affordable level. The NGS DNA indexing system allows sequencing multiple genes for large number of individuals in a single run. Our laboratory has adopted and used these technologies for HLA molecular testing services. We found that each sequencing technology has its own strengths and weaknesses, and their sequencing performances complement each other. HLA genes are highly complex and genotyping them is quite challenging. Using these three sequencing platforms, we were able to meet all requirements for G group-level high resolution and high volume HLA typing. Copyright © 2015 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

EST Express: PHP/MySQL based automated annotation of ESTs from expression libraries

PubMed Central

Smith, Robin P; Buchser, William J; Lemmon, Marcus B; Pardinas, Jose R; Bixby, John L; Lemmon, Vance P

2008-01-01

Background Several biological techniques result in the acquisition of functional sets of cDNAs that must be sequenced and analyzed. The emergence of redundant databases such as UniGene and centralized annotation engines such as Entrez Gene has allowed the development of software that can analyze a great number of sequences in a matter of seconds. Results We have developed "EST Express", a suite of analytical tools that identify and annotate ESTs originating from specific mRNA populations. The software consists of a user-friendly GUI powered by PHP and MySQL that allows for online collaboration between researchers and continuity with UniGene, Entrez Gene and RefSeq. Two key features of the software include a novel, simplified Entrez Gene parser and tools to manage cDNA library sequencing projects. We have tested the software on a large data set (2,016 samples) produced by subtractive hybridization. Conclusion EST Express is an open-source, cross-platform web server application that imports sequences from cDNA libraries, such as those generated through subtractive hybridization or yeast two-hybrid screens. It then provides several layers of annotation based on Entrez Gene and RefSeq to allow the user to highlight useful genes and manage cDNA library projects. PMID:18402700

EST Express: PHP/MySQL based automated annotation of ESTs from expression libraries.

PubMed

Smith, Robin P; Buchser, William J; Lemmon, Marcus B; Pardinas, Jose R; Bixby, John L; Lemmon, Vance P

2008-04-10

Several biological techniques result in the acquisition of functional sets of cDNAs that must be sequenced and analyzed. The emergence of redundant databases such as UniGene and centralized annotation engines such as Entrez Gene has allowed the development of software that can analyze a great number of sequences in a matter of seconds. We have developed "EST Express", a suite of analytical tools that identify and annotate ESTs originating from specific mRNA populations. The software consists of a user-friendly GUI powered by PHP and MySQL that allows for online collaboration between researchers and continuity with UniGene, Entrez Gene and RefSeq. Two key features of the software include a novel, simplified Entrez Gene parser and tools to manage cDNA library sequencing projects. We have tested the software on a large data set (2,016 samples) produced by subtractive hybridization. EST Express is an open-source, cross-platform web server application that imports sequences from cDNA libraries, such as those generated through subtractive hybridization or yeast two-hybrid screens. It then provides several layers of annotation based on Entrez Gene and RefSeq to allow the user to highlight useful genes and manage cDNA library projects.

Sequence information signal processor for local and global string comparisons

DOEpatents

Peterson, John C.; Chow, Edward T.; Waterman, Michael S.; Hunkapillar, Timothy J.

1997-01-01

A sequence information signal processing integrated circuit chip designed to perform high speed calculation of a dynamic programming algorithm based upon the algorithm defined by Waterman and Smith. The signal processing chip of the present invention is designed to be a building block of a linear systolic array, the performance of which can be increased by connecting additional sequence information signal processing chips to the array. The chip provides a high speed, low cost linear array processor that can locate highly similar global sequences or segments thereof such as contiguous subsequences from two different DNA or protein sequences. The chip is implemented in a preferred embodiment using CMOS VLSI technology to provide the equivalent of about 400,000 transistors or 100,000 gates. Each chip provides 16 processing elements, and is designed to provide 16 bit, two's compliment operation for maximum score precision of between -32,768 and +32,767. It is designed to provide a comparison between sequences as long as 4,194,304 elements without external software and between sequences of unlimited numbers of elements with the aid of external software. Each sequence can be assigned different deletion and insertion weight functions. Each processor is provided with a similarity measure device which is independently variable. Thus, each processor can contribute to maximum value score calculation using a different similarity measure.

Selective amplification and sequencing of cyclic phosphate-containing RNAs by the cP-RNA-seq method

PubMed Central

Honda, Shozo; Morichika, Keisuke; Kirino, Yohei

2016-01-01

RNA digestions catalyzed by many ribonucleases generate RNA fragments containing a 2′,3′-cyclic phosphate (cP) at their 3′-termini. However, standard RNA-seq methods are unable to accurately capture cP-containing RNAs because the cP inhibits the adapter ligation reaction. We recently developed a method named “cP-RNA-seq” that is able to selectively amplify and sequence cP-containing RNAs. Here we describe the cP-RNA-seq protocol in which the 3′-termini of all RNAs, except those containing a cP, are cleaved through a periodate treatment after phosphatase treatment, hence subsequent adapter ligation and cDNA amplification steps are exclusively applied to cP-containing RNAs. cP-RNA-seq takes ~6 d, excluding the time required for sequencing and bioinformatics analyses, such downstream assays are not covered in detail in this protocol. Biochemical validation of the existence of cP in the identified RNAs takes ~3 d. Even though the cP-RNA-seq method was developed to identify angiogenin-generating 5′-tRNA halves as a proof of principle, the method should be applicable to global identification of cP-containing RNA repertoires in various transcriptomes. PMID:26866791

High-Throughput Amplicon-Based Copy Number Detection of 11 Genes in Formalin-Fixed Paraffin-Embedded Ovarian Tumour Samples by MLPA-Seq

PubMed Central

Kondrashova, Olga; Love, Clare J.; Lunke, Sebastian; Hsu, Arthur L.; Waring, Paul M.; Taylor, Graham R.

2015-01-01

Whilst next generation sequencing can report point mutations in fixed tissue tumour samples reliably, the accurate determination of copy number is more challenging. The conventional Multiplex Ligation-dependent Probe Amplification (MLPA) assay is an effective tool for measurement of gene dosage, but is restricted to around 50 targets due to size resolution of the MLPA probes. By switching from a size-resolved format, to a sequence-resolved format we developed a scalable, high-throughput, quantitative assay. MLPA-seq is capable of detecting deletions, duplications, and amplifications in as little as 5ng of genomic DNA, including from formalin-fixed paraffin-embedded (FFPE) tumour samples. We show that this method can detect BRCA1, BRCA2, ERBB2 and CCNE1 copy number changes in DNA extracted from snap-frozen and FFPE tumour tissue, with 100% sensitivity and >99.5% specificity. PMID:26569395

Hyb-Seq: Combining target enrichment and genome skimming for plant phylogenomics1

PubMed Central

Weitemier, Kevin; Straub, Shannon C. K.; Cronn, Richard C.; Fishbein, Mark; Schmickl, Roswitha; McDonnell, Angela; Liston, Aaron

2014-01-01

• Premise of the study: Hyb-Seq, the combination of target enrichment and genome skimming, allows simultaneous data collection for low-copy nuclear genes and high-copy genomic targets for plant systematics and evolution studies. • Methods and Results: Genome and transcriptome assemblies for milkweed (Asclepias syriaca) were used to design enrichment probes for 3385 exons from 768 genes (>1.6 Mbp) followed by Illumina sequencing of enriched libraries. Hyb-Seq of 12 individuals (10 Asclepias species and two related genera) resulted in at least partial assembly of 92.6% of exons and 99.7% of genes and an average assembly length >2 Mbp. Importantly, complete plastomes and nuclear ribosomal DNA cistrons were assembled using off-target reads. Phylogenomic analyses demonstrated signal conflict between genomes. • Conclusions: The Hyb-Seq approach enables targeted sequencing of thousands of low-copy nuclear exons and flanking regions, as well as genome skimming of high-copy repeats and organellar genomes, to efficiently produce genome-scale data sets for phylogenomics. PMID:25225629

Analysis of ChIP-seq Data in R/Bioconductor.

PubMed

de Santiago, Ines; Carroll, Thomas

2018-01-01

The development of novel high-throughput sequencing methods for ChIP (chromatin immunoprecipitation) has provided a very powerful tool to study gene regulation in multiple conditions at unprecedented resolution and scale. Proactive quality-control and appropriate data analysis techniques are of critical importance to extract the most meaningful results from the data. Over the last years, an array of R/Bioconductor tools has been developed allowing researchers to process and analyze ChIP-seq data. This chapter provides an overview of the methods available to analyze ChIP-seq data based primarily on software packages from the open-source Bioconductor project. Protocols described in this chapter cover basic steps including data alignment, peak calling, quality control and data visualization, as well as more complex methods such as the identification of differentially bound regions and functional analyses to annotate regulatory regions. The steps in the data analysis process were demonstrated on publicly available data sets and will serve as a demonstration of the computational procedures routinely used for the analysis of ChIP-seq data in R/Bioconductor, from which readers can construct their own analysis pipelines.

Characteristics of microbial community functional structure of a biological coking wastewater treatment system.

PubMed

Joshi, Dev Raj; Zhang, Yu; Zhang, Hong; Gao, Yingxin; Yang, Min

2018-01-01

Nitrogenous heterocyclic compounds are key pollutants in coking wastewater; however, the functional potential of microbial communities for biodegradation of such contaminants during biological treatment is still elusive. Herein, a high throughput functional gene array (GeoChip 5.0) in combination with Illumina HiSeq2500 sequencing was used to compare and characterize the microbial community functional structure in a long run (500days) bench scale bioreactor treating coking wastewater, with a control system treating synthetic wastewater. Despite the inhibitory toxic pollutants, GeoChip 5.0 detected almost all key functional gene (average 61,940 genes) categories in the coking wastewater sludge. With higher abundance, aromatic ring cleavage dioxygenase genes including multi ring1,2diox; one ring2,3diox; catechol represented significant functional potential for degradation of aromatic pollutants which was further confirmed by Illumina HiSeq2500 analysis results. Response ratio analysis revealed that three nitrogenous compound degrading genes- nbzA (nitro-aromatics), tdnB (aniline), and scnABC (thiocyanate) were unique for coking wastewater treatment, which might be strong cause to increase ammonia level during the aerobic process. Additionally, HiSeq2500 elucidated carbozole and isoquinoline degradation genes in the system. These findings expanded our understanding on functional potential of microbial communities to remove organic nitrogenous pollutants; hence it will be useful in optimization strategies for biological treatment of coking wastewater. Copyright © 2017. Published by Elsevier B.V.

Analysis and Visualization Tool for Targeted Amplicon Bisulfite Sequencing on Ion Torrent Sequencers

PubMed Central

Pabinger, Stephan; Ernst, Karina; Pulverer, Walter; Kallmeyer, Rainer; Valdes, Ana M.; Metrustry, Sarah; Katic, Denis; Nuzzo, Angelo; Kriegner, Albert; Vierlinger, Klemens; Weinhaeusel, Andreas

2016-01-01

Targeted sequencing of PCR amplicons generated from bisulfite deaminated DNA is a flexible, cost-effective way to study methylation of a sample at single CpG resolution and perform subsequent multi-target, multi-sample comparisons. Currently, no platform specific protocol, support, or analysis solution is provided to perform targeted bisulfite sequencing on a Personal Genome Machine (PGM). Here, we present a novel tool, called TABSAT, for analyzing targeted bisulfite sequencing data generated on Ion Torrent sequencers. The workflow starts with raw sequencing data, performs quality assessment, and uses a tailored version of Bismark to map the reads to a reference genome. The pipeline visualizes results as lollipop plots and is able to deduce specific methylation-patterns present in a sample. The obtained profiles are then summarized and compared between samples. In order to assess the performance of the targeted bisulfite sequencing workflow, 48 samples were used to generate 53 different Bisulfite-Sequencing PCR amplicons from each sample, resulting in 2,544 amplicon targets. We obtained a mean coverage of 282X using 1,196,822 aligned reads. Next, we compared the sequencing results of these targets to the methylation level of the corresponding sites on an Illumina 450k methylation chip. The calculated average Pearson correlation coefficient of 0.91 confirms the sequencing results with one of the industry-leading CpG methylation platforms and shows that targeted amplicon bisulfite sequencing provides an accurate and cost-efficient method for DNA methylation studies, e.g., to provide platform-independent confirmation of Illumina Infinium 450k methylation data. TABSAT offers a novel way to analyze data generated by Ion Torrent instruments and can also be used with data from the Illumina MiSeq platform. It can be easily accessed via the Platomics platform, which offers a web-based graphical user interface along with sample and parameter storage. TABSAT is freely available under a GNU General Public License version 3.0 (GPLv3) at https://github.com/tadkeys/tabsat/ and http://demo.platomics.com/. PMID:27467908

Synthetic spike-in standards for high-throughput 16S rRNA gene amplicon sequencing.

PubMed

Tourlousse, Dieter M; Yoshiike, Satowa; Ohashi, Akiko; Matsukura, Satoko; Noda, Naohiro; Sekiguchi, Yuji

2017-02-28

High-throughput sequencing of 16S rRNA gene amplicons (16S-seq) has become a widely deployed method for profiling complex microbial communities but technical pitfalls related to data reliability and quantification remain to be fully addressed. In this work, we have developed and implemented a set of synthetic 16S rRNA genes to serve as universal spike-in standards for 16S-seq experiments. The spike-ins represent full-length 16S rRNA genes containing artificial variable regions with negligible identity to known nucleotide sequences, permitting unambiguous identification of spike-in sequences in 16S-seq read data from any microbiome sample. Using defined mock communities and environmental microbiota, we characterized the performance of the spike-in standards and demonstrated their utility for evaluating data quality on a per-sample basis. Further, we showed that staggered spike-in mixtures added at the point of DNA extraction enable concurrent estimation of absolute microbial abundances suitable for comparative analysis. Results also underscored that template-specific Illumina sequencing artifacts may lead to biases in the perceived abundance of certain taxa. Taken together, the spike-in standards represent a novel bioanalytical tool that can substantially improve 16S-seq-based microbiome studies by enabling comprehensive quality control along with absolute quantification. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Developing cDNA Libraries of Receptors Involved in the Recruitment of the Biofouling Tubeworm Hydroides elegans

DTIC Science & Technology

2014-06-12

Transcriptome, Hydroides elegans, Next Generation Sequencing, Illumina HiSeq, PacBio SMRT, Biofilm , Metamorphosis 16. SECURITY CLASSIFICATION OF: a...to a bacterial cue from a bacterial biofilm . Recently, this cue has been identified to be a phage-tail like bacteriocin produced by the bacterium...submitted to the Huntsman Cancer Institute at the University of Utah and the subsequent isolation of mRNA was used for Illumina HiSeq 101 paired end

Mapping RNA Structure In Vitro with SHAPE Chemistry and Next-Generation Sequencing (SHAPE-Seq).

PubMed

Watters, Kyle E; Lucks, Julius B

2016-01-01

Mapping RNA structure with selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) chemistry has proven to be a versatile method for characterizing RNA structure in a variety of contexts. SHAPE reagents covalently modify RNAs in a structure-dependent manner to create adducts at the 2'-OH group of the ribose backbone at nucleotides that are structurally flexible. The positions of these adducts are detected using reverse transcriptase (RT) primer extension, which stops one nucleotide before the modification, to create a pool of cDNAs whose lengths reflect the location of SHAPE modification. Quantification of the cDNA pools is used to estimate the "reactivity" of each nucleotide in an RNA molecule to the SHAPE reagent. High reactivities indicate nucleotides that are structurally flexible, while low reactivities indicate nucleotides that are inflexible. These SHAPE reactivities can then be used to infer RNA structures by restraining RNA structure prediction algorithms. Here, we provide a state-of-the-art protocol describing how to perform in vitro RNA structure probing with SHAPE chemistry using next-generation sequencing to quantify cDNA pools and estimate reactivities (SHAPE-Seq). The use of next-generation sequencing allows for higher throughput, more consistent data analysis, and multiplexing capabilities. The technique described herein, SHAPE-Seq v2.0, uses a universal reverse transcription priming site that is ligated to the RNA after SHAPE modification. The introduced priming site allows for the structural analysis of an RNA independent of its sequence.

Microfluidic single-cell whole-transcriptome sequencing.

PubMed

Streets, Aaron M; Zhang, Xiannian; Cao, Chen; Pang, Yuhong; Wu, Xinglong; Xiong, Liang; Yang, Lu; Fu, Yusi; Zhao, Liang; Tang, Fuchou; Huang, Yanyi

2014-05-13

Single-cell whole-transcriptome analysis is a powerful tool for quantifying gene expression heterogeneity in populations of cells. Many techniques have, thus, been recently developed to perform transcriptome sequencing (RNA-Seq) on individual cells. To probe subtle biological variation between samples with limiting amounts of RNA, more precise and sensitive methods are still required. We adapted a previously developed strategy for single-cell RNA-Seq that has shown promise for superior sensitivity and implemented the chemistry in a microfluidic platform for single-cell whole-transcriptome analysis. In this approach, single cells are captured and lysed in a microfluidic device, where mRNAs with poly(A) tails are reverse-transcribed into cDNA. Double-stranded cDNA is then collected and sequenced using a next generation sequencing platform. We prepared 94 libraries consisting of single mouse embryonic cells and technical replicates of extracted RNA and thoroughly characterized the performance of this technology. Microfluidic implementation increased mRNA detection sensitivity as well as improved measurement precision compared with tube-based protocols. With 0.2 M reads per cell, we were able to reconstruct a majority of the bulk transcriptome with 10 single cells. We also quantified variation between and within different types of mouse embryonic cells and found that enhanced measurement precision, detection sensitivity, and experimental throughput aided the distinction between biological variability and technical noise. With this work, we validated the advantages of an early approach to single-cell RNA-Seq and showed that the benefits of combining microfluidic technology with high-throughput sequencing will be valuable for large-scale efforts in single-cell transcriptome analysis.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Andersen, G.L.; He, Z.; DeSantis, T.Z.

Microarrays have proven to be a useful and high-throughput method to provide targeted DNA sequence information for up to many thousands of specific genetic regions in a single test. A microarray consists of multiple DNA oligonucleotide probes that, under high stringency conditions, hybridize only to specific complementary nucleic acid sequences (targets). A fluorescent signal indicates the presence and, in many cases, the abundance of genetic regions of interest. In this chapter we will look at how microarrays are used in microbial ecology, especially with the recent increase in microbial community DNA sequence data. Of particular interest to microbial ecologists, phylogeneticmore » microarrays are used for the analysis of phylotypes in a community and functional gene arrays are used for the analysis of functional genes, and, by inference, phylotypes in environmental samples. A phylogenetic microarray that has been developed by the Andersen laboratory, the PhyloChip, will be discussed as an example of a microarray that targets the known diversity within the 16S rRNA gene to determine microbial community composition. Using multiple, confirmatory probes to increase the confidence of detection and a mismatch probe for every perfect match probe to minimize the effect of cross-hybridization by non-target regions, the PhyloChip is able to simultaneously identify any of thousands of taxa present in an environmental sample. The PhyloChip is shown to reveal greater diversity within a community than rRNA gene sequencing due to the placement of the entire gene product on the microarray compared with the analysis of up to thousands of individual molecules by traditional sequencing methods. A functional gene array that has been developed by the Zhou laboratory, the GeoChip, will be discussed as an example of a microarray that dynamically identifies functional activities of multiple members within a community. The recent version of GeoChip contains more than 24,000 50mer oligonucleotide probes and covers more than 10,000 gene sequences in 150 gene categories involved in carbon, nitrogen, sulfur, and phosphorus cycling, metal resistance and reduction, and organic contaminant degradation. GeoChip can be used as a generic tool for microbial community analysis, and also link microbial community structure to ecosystem functioning. Examples of the application of both arrays in different environmental samples will be described in the two subsequent sections.« less

The Nuclear Receptor, RORγ, Regulates Pathways Necessary for Breast Cancer Metastasis

PubMed Central

Oh, Tae Gyu; Wang, Shu-Ching M.; Acharya, Bipul R.; Goode, Joel M.; Graham, J. Dinny; Clarke, Christine L.; Yap, Alpha S.; Muscat, George E.O.

2016-01-01

We have previously reported that RORγ expression was decreased in ER − ve breast cancer, and increased expression improves clinical outcomes. However, the underlying RORγ dependent mechanisms that repress breast carcinogenesis have not been elucidated. Here we report that RORγ negatively regulates the oncogenic TGF-β/EMT and mammary stem cell (MaSC) pathways, whereas RORγ positively regulates DNA-repair. We demonstrate that RORγ expression is: (i) decreased in basal-like subtype cancers, and (ii) inversely correlated with histological grade and drivers of carcinogenesis in breast cancer cohorts. Furthermore, integration of RNA-seq and ChIP-chip data reveals that RORγ regulates the expression of many genes involved in TGF-β/EMT-signaling, DNA-repair and MaSC pathways (including the non-coding RNA, LINC00511). In accordance, pharmacological studies demonstrate that an RORγ agonist suppresses breast cancer cell viability, migration, the EMT transition (microsphere outgrowth) and mammosphere-growth. In contrast, RNA-seq demonstrates an RORγ inverse agonist induces TGF-β/EMT-signaling. These findings suggest pharmacological modulation of RORγ activity may have utility in breast cancer. PMID:27211549

GenomicTools: a computational platform for developing high-throughput analytics in genomics.

PubMed

Tsirigos, Aristotelis; Haiminen, Niina; Bilal, Erhan; Utro, Filippo

2012-01-15

Recent advances in sequencing technology have resulted in the dramatic increase of sequencing data, which, in turn, requires efficient management of computational resources, such as computing time, memory requirements as well as prototyping of computational pipelines. We present GenomicTools, a flexible computational platform, comprising both a command-line set of tools and a C++ API, for the analysis and manipulation of high-throughput sequencing data such as DNA-seq, RNA-seq, ChIP-seq and MethylC-seq. GenomicTools implements a variety of mathematical operations between sets of genomic regions thereby enabling the prototyping of computational pipelines that can address a wide spectrum of tasks ranging from pre-processing and quality control to meta-analyses. Additionally, the GenomicTools platform is designed to analyze large datasets of any size by minimizing memory requirements. In practical applications, where comparable, GenomicTools outperforms existing tools in terms of both time and memory usage. The GenomicTools platform (version 2.0.0) was implemented in C++. The source code, documentation, user manual, example datasets and scripts are available online at http://code.google.com/p/ibm-cbc-genomic-tools.

Tumorigenic Potential of Transit Amplifying Prostate Cells

DTIC Science & Technology

2012-06-01

by ChIP-Seq showed that in both the human prostate cell line LNCaP and in mouse prostate, NKX3.1 bound DNA fragments are significantly enriched in...progression. Cancer Cell. 2010;17(5):443–454. 29. Steadman DJ, Giuffrida D, Gelmann EP. DNA - binding sequence of the human prostate-specific...bind nucleosomal DNA and destabilize nucleosomes thereby allowing other transcription factors to access their sites (7),(8). BODY Aim 1: To

The 'dark matter' in the plant genomes: non-coding and unannotated DNA sequences associated with open chromatin.

PubMed

Jiang, Jiming

2015-04-01

Sequencing of complete plant genomes has become increasingly more routine since the advent of the next-generation sequencing technology. Identification and annotation of large amounts of noncoding but functional DNA sequences, including cis-regulatory DNA elements (CREs), have become a new frontier in plant genome research. Genomic regions containing active CREs bound to regulatory proteins are hypersensitive to DNase I digestion and are called DNase I hypersensitive sites (DHSs). Several recent DHS studies in plants illustrate that DHS datasets produced by DNase I digestion followed by next-generation sequencing (DNase-seq) are highly valuable for the identification and characterization of CREs associated with plant development and responses to environmental cues. DHS-based genomic profiling has opened a door to identify and annotate the 'dark matter' in sequenced plant genomes. Copyright © 2015 Elsevier Ltd. All rights reserved.

Whole genome sequence and genome annotation of Colletotrichum acutatum, causal agent of anthracnose in pepper plants in South Korea.

PubMed

Han, Joon-Hee; Chon, Jae-Kyung; Ahn, Jong-Hwa; Choi, Ik-Young; Lee, Yong-Hwan; Kim, Kyoung Su

2016-06-01

Colletotrichum acutatum is a destructive fungal pathogen which causes anthracnose in a wide range of crops. Here we report the whole genome sequence and annotation of C. acutatum strain KC05, isolated from an infected pepper in Kangwon, South Korea. Genomic DNA from the KC05 strain was used for the whole genome sequencing using a PacBio sequencer and the MiSeq system. The KC05 genome was determined to be 52,190,760 bp in size with a G + C content of 51.73% in 27 scaffolds and to contain 13,559 genes with an average length of 1516 bp. Gene prediction and annotation were performed by incorporating RNA-Seq data. The genome sequence of the KC05 was deposited at DDBJ/ENA/GenBank under the accession number LUXP00000000.

zUMIs - A fast and flexible pipeline to process RNA sequencing data with UMIs.

PubMed

Parekh, Swati; Ziegenhain, Christoph; Vieth, Beate; Enard, Wolfgang; Hellmann, Ines

2018-06-01

Single-cell RNA-sequencing (scRNA-seq) experiments typically analyze hundreds or thousands of cells after amplification of the cDNA. The high throughput is made possible by the early introduction of sample-specific bar codes (BCs), and the amplification bias is alleviated by unique molecular identifiers (UMIs). Thus, the ideal analysis pipeline for scRNA-seq data needs to efficiently tabulate reads according to both BC and UMI. zUMIs is a pipeline that can handle both known and random BCs and also efficiently collapse UMIs, either just for exon mapping reads or for both exon and intron mapping reads. If BC annotation is missing, zUMIs can accurately detect intact cells from the distribution of sequencing reads. Another unique feature of zUMIs is the adaptive downsampling function that facilitates dealing with hugely varying library sizes but also allows the user to evaluate whether the library has been sequenced to saturation. To illustrate the utility of zUMIs, we analyzed a single-nucleus RNA-seq dataset and show that more than 35% of all reads map to introns. Also, we show that these intronic reads are informative about expression levels, significantly increasing the number of detected genes and improving the cluster resolution. zUMIs flexibility makes if possible to accommodate data generated with any of the major scRNA-seq protocols that use BCs and UMIs and is the most feature-rich, fast, and user-friendly pipeline to process such scRNA-seq data.

Traditional karyotyping vs copy number variation sequencing for detection of chromosomal abnormalities associated with spontaneous miscarriage.

PubMed

Liu, S; Song, L; Cram, D S; Xiong, L; Wang, K; Wu, R; Liu, J; Deng, K; Jia, B; Zhong, M; Yang, F

2015-10-01

To compare the performance of traditional G-banding karyotyping with that of copy number variation sequencing (CNV-Seq) for detection of chromosomal abnormalities associated with miscarriage. Products of conception (POC) were collected from spontaneous miscarriages. Chromosomal abnormalities were detected using high-resolution G-banding karyotyping and CNV sequencing. Quantitative fluorescent polymerase chain reaction analysis of maternal and POC DNA for short tandem repeat (STR) markers was used to both monitor maternal cell contamination and confirm the chromosomal status and sex of the miscarriage tissue. A total of 64 samples of POC, comprising 16 with an abnormal and 48 with a normal karyotype, were selected and coded for analysis by CNV-Seq. CNV-Seq results were concordant for 14 (87.5%) of the 16 gross chromosomal abnormalities identified by karyotyping, including 11 autosomal trisomies and three sex chromosomal aneuploidies (45,X). Of the two discordant results, a 69,XXX polyploidy was missed by CNV-Seq, although supporting STR marker analysis confirmed the triploidy. In contrast, CNV-Seq identified a sample with 45,X karyotype as a 45,X/46,XY mosaic. In the remaining 48 samples of POC with a normal karyotype, CNV-Seq detected a 2.58-Mb 22q deletion associated with DiGeorge syndrome and nine different smaller CNVs of no apparent clinical significance. CNV-Seq used in parallel with STR profiling is a reliable and accurate alternative to karyotyping for identifying chromosome copy number abnormalities associated with spontaneous miscarriage. Copyright © 2015 ISUOG. Published by John Wiley & Sons Ltd.

Sequence Alignment to Predict Across Species Susceptibility ...

EPA Pesticide Factsheets

Conservation of a molecular target across species can be used as a line-of-evidence to predict the likelihood of chemical susceptibility. The web-based Sequence Alignment to Predict Across Species Susceptibility (SeqAPASS) tool was developed to simplify, streamline, and quantitatively assess protein sequence/structural similarity across taxonomic groups as a means to predict relative intrinsic susceptibility. The intent of the tool is to allow for evaluation of any potential protein target, so it is amenable to variable degrees of protein characterization, depending on available information about the chemical/protein interaction and the molecular target itself. To allow for flexibility in the analysis, a layered strategy was adopted for the tool. The first level of the SeqAPASS analysis compares primary amino acid sequences to a query sequence, calculating a metric for sequence similarity (including detection of candidate orthologs), the second level evaluates sequence similarity within selected domains (e.g., ligand-binding domain, DNA binding domain), and the third level of analysis compares individual amino acid residue positions identified as being of importance for protein conformation and/or ligand binding upon chemical perturbation. Each level of the SeqAPASS analysis provides increasing evidence to apply toward rapid, screening-level assessments of probable cross species susceptibility. Such analyses can support prioritization of chemicals for further ev

The LAM-PCR Method to Sequence LV Integration Sites.

PubMed

Wang, Wei; Bartholomae, Cynthia C; Gabriel, Richard; Deichmann, Annette; Schmidt, Manfred

2016-01-01

Integrating viral gene transfer vectors are commonly used gene delivery tools in clinical gene therapy trials providing stable integration and continuous gene expression of the transgene in the treated host cell. However, integration of the reverse-transcribed vector DNA into the host genome is a potentially mutagenic event that may directly contribute to unwanted side effects. A comprehensive and accurate analysis of the integration site (IS) repertoire is indispensable to study clonality in transduced cells obtained from patients undergoing gene therapy and to identify potential in vivo selection of affected cell clones. To date, next-generation sequencing (NGS) of vector-genome junctions allows sophisticated studies on the integration repertoire in vitro and in vivo. We have explored the use of the Illumina MiSeq Personal Sequencer platform to sequence vector ISs amplified by non-restrictive linear amplification-mediated PCR (nrLAM-PCR) and LAM-PCR. MiSeq-based high-quality IS sequence retrieval is accomplished by the introduction of a double-barcode strategy that substantially minimizes the frequency of IS sequence collisions compared to the conventionally used single-barcode protocol. Here, we present an updated protocol of (nr)LAM-PCR for the analysis of lentiviral IS using a double-barcode system and followed by deep sequencing using the MiSeq device.

Chromatin immunoprecipitation of mouse embryos.

PubMed

Voss, Anne K; Dixon, Mathew P; McLennan, Tamara; Kueh, Andrew J; Thomas, Tim

2012-01-01

During prenatal development, a large number of different cell types are formed, the vast majority of which contain identical genetic material. The basis of the great variety in cell phenotype and function is the differential expression of the approximately 25,000 genes in the mammalian genome. Transcriptional activity is regulated at many levels by proteins, including members of the basal transcriptional apparatus, DNA-binding transcription factors, and chromatin-binding proteins. Importantly, chromatin structure dictates the availability of a specific genomic locus for transcriptional activation as well as the efficiency, with which transcription can occur. Chromatin immunoprecipitation (ChIP) is a method to assess if chromatin modifications or proteins are present at a specific locus. ChIP involves the cross linking of DNA and associated proteins and immunoprecipitation using specific antibodies to DNA-associated proteins followed by examination of the co-precipitated DNA sequences or proteins. In the last few years, ChIP has become an essential technique for scientists studying transcriptional regulation and chromatin structure. Using ChIP on mouse embryos, we can document the presence or absence of specific proteins and chromatin modifications at genomic loci in vivo during mammalian development. Here, we describe a ChIP technique adapted for mouse embryos.

Low-Cost, High-Throughput Sequencing of DNA Assemblies Using a Highly Multiplexed Nextera Process.

PubMed

Shapland, Elaine B; Holmes, Victor; Reeves, Christopher D; Sorokin, Elena; Durot, Maxime; Platt, Darren; Allen, Christopher; Dean, Jed; Serber, Zach; Newman, Jack; Chandran, Sunil

2015-07-17

In recent years, next-generation sequencing (NGS) technology has greatly reduced the cost of sequencing whole genomes, whereas the cost of sequence verification of plasmids via Sanger sequencing has remained high. Consequently, industrial-scale strain engineers either limit the number of designs or take short cuts in quality control. Here, we show that over 4000 plasmids can be completely sequenced in one Illumina MiSeq run for less than $3 each (15× coverage), which is a 20-fold reduction over using Sanger sequencing (2× coverage). We reduced the volume of the Nextera tagmentation reaction by 100-fold and developed an automated workflow to prepare thousands of samples for sequencing. We also developed software to track the samples and associated sequence data and to rapidly identify correctly assembled constructs having the fewest defects. As DNA synthesis and assembly become a centralized commodity, this NGS quality control (QC) process will be essential to groups operating high-throughput pipelines for DNA construction.

cChIP-seq: a robust small-scale method for investigation of histone modifications.

PubMed

Valensisi, Cristina; Liao, Jo Ling; Andrus, Colin; Battle, Stephanie L; Hawkins, R David

2015-12-21

ChIP-seq is highly utilized for mapping histone modifications that are informative about gene regulation and genome annotations. For example, applying ChIP-seq to histone modifications such as H3K4me1 has facilitated generating epigenomic maps of putative enhancers. This powerful technology, however, is limited in its application by the large number of cells required. ChIP-seq involves extensive manipulation of sample material and multiple reactions with limited quality control at each step, therefore, scaling down the number of cells required has proven challenging. Recently, several methods have been proposed to overcome this limit but most of these methods require extensive optimization to tailor the protocol to the specific antibody used or number of cells being profiled. Here we describe a robust, yet facile method, which we named carrier ChIP-seq (cChIP-seq), for use on limited cell amounts. cChIP-seq employs a DNA-free histone carrier in order to maintain the working ChIP reaction scale, removing the need to tailor reactions to specific amounts of cells or histone modifications to be assayed. We have applied our method to three different histone modifications, H3K4me3, H3K4me1 and H3K27me3 in the K562 cell line, and H3K4me1 in H1 hESCs. We successfully obtained epigenomic maps for these histone modifications starting with as few as 10,000 cells. We compared cChIP-seq data to data generated as part of the ENCODE project. ENCODE data are the reference standard in the field and have been generated starting from tens of million of cells. Our results show that cChIP-seq successfully recapitulates bulk data. Furthermore, we showed that the differences observed between small-scale ChIP-seq data and ENCODE data are largely to be due to lab-to-lab variability rather than operating on a reduced scale. Data generated using cChIP-seq are equivalent to reference epigenomic maps from three orders of magnitude more cells. Our method offers a robust and straightforward approach to scale down ChIP-seq to as low as 10,000 cells. The underlying principle of our strategy makes it suitable for being applied to a vast range of chromatin modifications without requiring expensive optimization. Furthermore, our strategy of a DNA-free carrier can be adapted to most ChIP-seq protocols.

DNA microarray-based PCR ribotyping of Clostridium difficile.

PubMed

Schneeberg, Alexander; Ehricht, Ralf; Slickers, Peter; Baier, Vico; Neubauer, Heinrich; Zimmermann, Stefan; Rabold, Denise; Lübke-Becker, Antina; Seyboldt, Christian

2015-02-01

This study presents a DNA microarray-based assay for fast and simple PCR ribotyping of Clostridium difficile strains. Hybridization probes were designed to query the modularly structured intergenic spacer region (ISR), which is also the template for conventional and PCR ribotyping with subsequent capillary gel electrophoresis (seq-PCR) ribotyping. The probes were derived from sequences available in GenBank as well as from theoretical ISR module combinations. A database of reference hybridization patterns was set up from a collection of 142 well-characterized C. difficile isolates representing 48 seq-PCR ribotypes. The reference hybridization patterns calculated by the arithmetic mean were compared using a similarity matrix analysis. The 48 investigated seq-PCR ribotypes revealed 27 array profiles that were clearly distinguishable. The most frequent human-pathogenic ribotypes 001, 014/020, 027, and 078/126 were discriminated by the microarray. C. difficile strains related to 078/126 (033, 045/FLI01, 078, 126, 126/FLI01, 413, 413/FLI01, 598, 620, 652, and 660) and 014/020 (014, 020, and 449) showed similar hybridization patterns, confirming their genetic relatedness, which was previously reported. A panel of 50 C. difficile field isolates was tested by seq-PCR ribotyping and the DNA microarray-based assay in parallel. Taking into account that the current version of the microarray does not discriminate some closely related seq-PCR ribotypes, all isolates were typed correctly. Moreover, seq-PCR ribotypes without reference profiles available in the database (ribotype 009 and 5 new types) were correctly recognized as new ribotypes, confirming the performance and expansion potential of the microarray. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Improving RNA-Seq expression estimates by correcting for fragment bias

PubMed Central

2011-01-01

The biochemistry of RNA-Seq library preparation results in cDNA fragments that are not uniformly distributed within the transcripts they represent. This non-uniformity must be accounted for when estimating expression levels, and we show how to perform the needed corrections using a likelihood based approach. We find improvements in expression estimates as measured by correlation with independently performed qRT-PCR and show that correction of bias leads to improved replicability of results across libraries and sequencing technologies. PMID:21410973

Gene encoding herbicide safener binding protein

DOEpatents

Walton, Jonathan D.; Scott-Craig, John S.

1999-01-01

The cDNA encoding safener binding protein (SafBP), also referred to as SBP1, is set forth in FIG. 5 and SEQ ID No. 1. The deduced amino acid sequence is provided in FIG. 5 and SEQ ID No. 2. Methods of making and using SBP1 and SafBP to alter a plant's sensitivity to certain herbicides or a plant's responsiveness to certain safeners are also provided, as well as expression vectors, transgenic plants or other organisms transfected with said vectors and seeds from said plants.

Arpeggio: harmonic compression of ChIP-seq data reveals protein-chromatin interaction signatures

PubMed Central

Stanton, Kelly Patrick; Parisi, Fabio; Strino, Francesco; Rabin, Neta; Asp, Patrik; Kluger, Yuval

2013-01-01

Researchers generating new genome-wide data in an exploratory sequencing study can gain biological insights by comparing their data with well-annotated data sets possessing similar genomic patterns. Data compression techniques are needed for efficient comparisons of a new genomic experiment with large repositories of publicly available profiles. Furthermore, data representations that allow comparisons of genomic signals from different platforms and across species enhance our ability to leverage these large repositories. Here, we present a signal processing approach that characterizes protein–chromatin interaction patterns at length scales of several kilobases. This allows us to efficiently compare numerous chromatin-immunoprecipitation sequencing (ChIP-seq) data sets consisting of many types of DNA-binding proteins collected from a variety of cells, conditions and organisms. Importantly, these interaction patterns broadly reflect the biological properties of the binding events. To generate these profiles, termed Arpeggio profiles, we applied harmonic deconvolution techniques to the autocorrelation profiles of the ChIP-seq signals. We used 806 publicly available ChIP-seq experiments and showed that Arpeggio profiles with similar spectral densities shared biological properties. Arpeggio profiles of ChIP-seq data sets revealed characteristics that are not easily detected by standard peak finders. They also allowed us to relate sequencing data sets from different genomes, experimental platforms and protocols. Arpeggio is freely available at http://sourceforge.net/p/arpeggio/wiki/Home/. PMID:23873955

Arpeggio: harmonic compression of ChIP-seq data reveals protein-chromatin interaction signatures.

PubMed

Stanton, Kelly Patrick; Parisi, Fabio; Strino, Francesco; Rabin, Neta; Asp, Patrik; Kluger, Yuval

2013-09-01

Researchers generating new genome-wide data in an exploratory sequencing study can gain biological insights by comparing their data with well-annotated data sets possessing similar genomic patterns. Data compression techniques are needed for efficient comparisons of a new genomic experiment with large repositories of publicly available profiles. Furthermore, data representations that allow comparisons of genomic signals from different platforms and across species enhance our ability to leverage these large repositories. Here, we present a signal processing approach that characterizes protein-chromatin interaction patterns at length scales of several kilobases. This allows us to efficiently compare numerous chromatin-immunoprecipitation sequencing (ChIP-seq) data sets consisting of many types of DNA-binding proteins collected from a variety of cells, conditions and organisms. Importantly, these interaction patterns broadly reflect the biological properties of the binding events. To generate these profiles, termed Arpeggio profiles, we applied harmonic deconvolution techniques to the autocorrelation profiles of the ChIP-seq signals. We used 806 publicly available ChIP-seq experiments and showed that Arpeggio profiles with similar spectral densities shared biological properties. Arpeggio profiles of ChIP-seq data sets revealed characteristics that are not easily detected by standard peak finders. They also allowed us to relate sequencing data sets from different genomes, experimental platforms and protocols. Arpeggio is freely available at http://sourceforge.net/p/arpeggio/wiki/Home/.

The easy road to genome-wide medium density SNP screening in a non-model species: development and application of a 10 K SNP-chip for the house sparrow (Passer domesticus).

PubMed

Hagen, Ingerid J; Billing, Anna M; Rønning, Bernt; Pedersen, Sindre A; Pärn, Henrik; Slate, Jon; Jensen, Henrik

2013-05-01

With the advent of next generation sequencing, new avenues have opened to study genomics in wild populations of non-model species. Here, we describe a successful approach to a genome-wide medium density Single Nucleotide Polymorphism (SNP) panel in a non-model species, the house sparrow (Passer domesticus), through the development of a 10 K Illumina iSelect HD BeadChip. Genomic DNA and cDNA derived from six individuals were sequenced on a 454 GS FLX system and generated a total of 1.2 million sequences, in which SNPs were detected. As no reference genome exists for the house sparrow, we used the zebra finch (Taeniopygia guttata) reference genome to determine the most likely position of each SNP. The 10 000 SNPs on the SNP-chip were selected to be distributed evenly across 31 chromosomes, giving on average one SNP per 100 000 bp. The SNP-chip was screened across 1968 individual house sparrows from four island populations. Of the original 10 000 SNPs, 7413 were found to be variable, and 99% of these SNPs were successfully called in at least 93% of all individuals. We used the SNP-chip to demonstrate the ability of such genome-wide marker data to detect population sub-division, and compared these results to similar analyses using microsatellites. The SNP-chip will be used to map Quantitative Trait Loci (QTL) for fitness-related phenotypic traits in natural populations. © 2013 Blackwell Publishing Ltd.

Global DNA methylation analysis reveals miR-214-3p contributes to cisplatin resistance in pediatric intracranial nongerminomatous malignant germ cell tumors.

PubMed

Hsieh, Tsung-Han; Liu, Yun-Ru; Chang, Ting-Yu; Liang, Muh-Lii; Chen, Hsin-Hung; Wang, Hsei-Wei; Yen, Yun; Wong, Tai-Tong

2018-03-27

Pediatric central nervous system germ cell tumors (CNSGCTs) are rare and heterogeneous neoplasms, which can be divided into germinomas and nongerminomatous germ cell tumors (NGGCTs). NGGCTs are further subdivided into mature teratomas and nongerminomatous malignant GCTs (NGMGCTs). Clinical outcomes suggest that NGMGCTs have poor prognosis and survival and that they require more extensive radiotherapy and adjuvant chemotherapy. However, the mechanisms underlying this difference are still unclear. DNA methylation alteration is generally acknowledged to cause therapeutic resistance in cancers. We hypothesized that the pediatric NGMGCTs exhibit a different genome-wide DNA methylation pattern, which is involved in the mechanism of its therapeutic resistance. We performed methylation and hydroxymethylation DNA immunoprecipitation sequencing, mRNA expression microarray, and small RNA sequencing (smRNA-seq) to determine methylation-regulated genes, including microRNAs (miRNAs). The expression levels of 97 genes and 8 miRNAs were correlated with promoter DNA methylation and hydroxymethylation status, such as the miR-199/-214 cluster, and treatment with DNA demethylating agent 5-aza-2'-deoxycytidine elevated its expression level. Furthermore, smRNA-seq analysis showed 27 novel miRNA candidates with differential expression between germinomas and NGMGCTs. Overexpresssion of miR-214-3p in NCCIT cells leads to reduced expression of the pro-apoptotic protein BCL2-like 11 and induces cisplatin resistance. We interrogated the differential DNA methylation patterns between germinomas and NGMGCTs and proposed a mechanism for chemoresistance in NGMGCTs. In addition, our sequencing data provide a roadmap for further pediatric CNSGCT research and potential targets for the development of new therapeutic strategies.

Biorecognition by DNA oligonucleotides after Exposure to Photoresists and Resist Removers

PubMed Central

Dean, Stacey L.; Morrow, Thomas J.; Patrick, Sue; Li, Mingwei; Clawson, Gary; Mayer, Theresa S.; Keating, Christine D.

2013-01-01

Combining biological molecules with integrated circuit technology is of considerable interest for next generation sensors and biomedical devices. Current lithographic microfabrication methods, however, were developed for compatibility with silicon technology rather than bioorganic molecules and consequently it cannot be assumed that biomolecules will remain attached and intact during on-chip processing. Here, we evaluate the effects of three common photoresists (Microposit S1800 series, PMGI SF6, and Megaposit SPR 3012) and two photoresist removers (acetone and 1165 remover) on the ability of surface-immobilized DNA oligonucleotides to selectively recognize their reverse-complementary sequence. Two common DNA immobilization methods were compared: adsorption of 5′-thiolated sequences directly to gold nanowires and covalent attachment of 5′-thiolated sequences to surface amines on silica coated nanowires. We found that acetone had deleterious effects on selective hybridization as compared to 1165 remover, presumably due to incomplete resist removal. Use of the PMGI photoresist, which involves a high temperature bake step, was detrimental to the later performance of nanowire-bound DNA in hybridization assays, especially for DNA attached via thiol adsorption. The other three photoresists did not substantially degrade DNA binding capacity or selectivity for complementary DNA sequences. To determine if the lithographic steps caused more subtle damage, we also tested oligonucleotides containing a single base mismatch. Finally, a two-step photolithographic process was developed and used in combination with dielectrophoretic nanowire assembly to produce an array of doubly-contacted, electrically isolated individual nanowire components on a chip. Post-fabrication fluorescence imaging indicated that nanowire-bound DNA was present and able to selectively bind complementary strands. PMID:23952639

Identification of methylated genes in salivary gland adenoid cystic carcinoma xenografts using global demethylation and methylation microarray screening

PubMed Central

LING, SHIZHANG; RETTIG, ELENI M.; TAN, MARIETTA; CHANG, XIAOFEI; WANG, ZHIMING; BRAIT, MARIANA; BISHOP, JUSTIN A.; FERTIG, ELANA J.; CONSIDINE, MICHAEL; WICK, MICHAEL J.; HA, PATRICK K.

2016-01-01

Salivary gland adenoid cystic carcinoma (ACC) is a rare head and neck malignancy without molecular biomarkers that can be used to predict the chemotherapeutic response or prognosis of ACC. The regulation of gene expression of oncogenes and tumor suppressor genes (TSGs) through DNA promoter methylation may play a role in the carcinogenesis of ACC. To identify differentially methylated genes in ACC, a global demethylating agent, 5-aza-2′-deoxycytidine (5-AZA) was utilized to unmask putative TSG silencing in ACC xenograft models in mice. Fresh xenografts were passaged, implanted in triplicate in mice that were treated with 5-AZA daily for 28 days. These xenografts were then evaluated for genome-wide DNA methylation patterns using the Illumina Infinium HumanMethylation27 BeadChip array. Validation of the 32 candidate genes was performed by bisulfite sequencing (BS-seq) in a separate cohort of 6 ACC primary tumors and 6 normal control salivary gland tissues. Hypermethylation was identified in the HCN2 gene promoter in all 6 control tissues, but hypomethylation was found in all 6 ACC tumor tissues. Quantitative validation of HCN2 promoter methylation level in the region detected by BS-seq was performed in a larger cohort of primary tumors (n=32) confirming significant HCN2 hypomethylation in ACCs compared with normal samples (n=10; P=0.04). HCN2 immunohistochemical staining was performed on an ACC tissue microarray. HCN2 staining intensity and H-score, but not percentage of the positively stained cells, were significantly stronger in normal tissues than those of ACC tissues. With our novel screening and sequencing methods, we identified several gene candidates that were methylated. The most significant of these genes, HCN2, was actually hypomethylated in tumors. However, promoter methylation status does not appear to be a major determinant of HCN2 expression in normal and ACC tissues. HCN2 hypomethylation is a biomarker of ACC and may play an important role in the carcinogenesis of ACC. PMID:27212063

metaseq: a Python package for integrative genome-wide analysis reveals relationships between chromatin insulators and associated nuclear mRNA.

PubMed

Dale, Ryan K; Matzat, Leah H; Lei, Elissa P

2014-08-01

Here we introduce metaseq, a software library written in Python, which enables loading multiple genomic data formats into standard Python data structures and allows flexible, customized manipulation and visualization of data from high-throughput sequencing studies. We demonstrate its practical use by analyzing multiple datasets related to chromatin insulators, which are DNA-protein complexes proposed to organize the genome into distinct transcriptional domains. Recent studies in Drosophila and mammals have implicated RNA in the regulation of chromatin insulator activities. Moreover, the Drosophila RNA-binding protein Shep has been shown to antagonize gypsy insulator activity in a tissue-specific manner, but the precise role of RNA in this process remains unclear. Better understanding of chromatin insulator regulation requires integration of multiple datasets, including those from chromatin-binding, RNA-binding, and gene expression experiments. We use metaseq to integrate RIP- and ChIP-seq data for Shep and the core gypsy insulator protein Su(Hw) in two different cell types, along with publicly available ChIP-chip and RNA-seq data. Based on the metaseq-enabled analysis presented here, we propose a model where Shep associates with chromatin cotranscriptionally, then is recruited to insulator complexes in trans where it plays a negative role in insulator activity. Published by Oxford University Press on behalf of Nucleic Acids Research 2014. This work is written by (a) US Government employee(s) and is in the public domain in the US.

Prediction of constitutive A-to-I editing sites from human transcriptomes in the absence of genomic sequences

PubMed Central

2013-01-01

Background Adenosine-to-inosine (A-to-I) RNA editing is recognized as a cellular mechanism for generating both RNA and protein diversity. Inosine base pairs with cytidine during reverse transcription and therefore appears as guanosine during sequencing of cDNA. Current approaches of RNA editing identification largely depend on the comparison between transcriptomes and genomic DNA (gDNA) sequencing datasets from the same individuals, and it has been challenging to identify editing candidates from transcriptomes in the absence of gDNA information. Results We have developed a new strategy to accurately predict constitutive RNA editing sites from publicly available human RNA-seq datasets in the absence of relevant genomic sequences. Our approach establishes new parameters to increase the ability to map mismatches and to minimize sequencing/mapping errors and unreported genome variations. We identified 695 novel constitutive A-to-I editing sites that appear in clusters (named “editing boxes”) in multiple samples and which exhibit spatial and dynamic regulation across human tissues. Some of these editing boxes are enriched in non-repetitive regions lacking inverted repeat structures and contain an extremely high conversion frequency of As to Is. We validated a number of editing boxes in multiple human cell lines and confirmed that ADAR1 is responsible for the observed promiscuous editing events in non-repetitive regions, further expanding our knowledge of the catalytic substrate of A-to-I RNA editing by ADAR enzymes. Conclusions The approach we present here provides a novel way of identifying A-to-I RNA editing events by analyzing only RNA-seq datasets. This method has allowed us to gain new insights into RNA editing and should also aid in the identification of more constitutive A-to-I editing sites from additional transcriptomes. PMID:23537002

ProteinSeq: High-Performance Proteomic Analyses by Proximity Ligation and Next Generation Sequencing

PubMed Central

Vänelid, Johan; Siegbahn, Agneta; Ericsson, Olle; Fredriksson, Simon; Bäcklin, Christofer; Gut, Marta; Heath, Simon; Gut, Ivo Glynne; Wallentin, Lars; Gustafsson, Mats G.; Kamali-Moghaddam, Masood; Landegren, Ulf

2011-01-01

Despite intense interest, methods that provide enhanced sensitivity and specificity in parallel measurements of candidate protein biomarkers in numerous samples have been lacking. We present herein a multiplex proximity ligation assay with readout via realtime PCR or DNA sequencing (ProteinSeq). We demonstrate improved sensitivity over conventional sandwich assays for simultaneous analysis of sets of 35 proteins in 5 µl of blood plasma. Importantly, we observe a minimal tendency to increased background with multiplexing, compared to a sandwich assay, suggesting that higher levels of multiplexing are possible. We used ProteinSeq to analyze proteins in plasma samples from cardiovascular disease (CVD) patient cohorts and matched controls. Three proteins, namely P-selectin, Cystatin-B and Kallikrein-6, were identified as putative diagnostic biomarkers for CVD. The latter two have not been previously reported in the literature and their potential roles must be validated in larger patient cohorts. We conclude that ProteinSeq is promising for screening large numbers of proteins and samples while the technology can provide a much-needed platform for validation of diagnostic markers in biobank samples and in clinical use. PMID:21980495

A powerful and flexible statistical framework for testing hypotheses of allele-specific gene expression from RNA-seq data

PubMed Central

Skelly, Daniel A.; Johansson, Marnie; Madeoy, Jennifer; Wakefield, Jon; Akey, Joshua M.

2011-01-01

Variation in gene expression is thought to make a significant contribution to phenotypic diversity among individuals within populations. Although high-throughput cDNA sequencing offers a unique opportunity to delineate the genome-wide architecture of regulatory variation, new statistical methods need to be developed to capitalize on the wealth of information contained in RNA-seq data sets. To this end, we developed a powerful and flexible hierarchical Bayesian model that combines information across loci to allow both global and locus-specific inferences about allele-specific expression (ASE). We applied our methodology to a large RNA-seq data set obtained in a diploid hybrid of two diverse Saccharomyces cerevisiae strains, as well as to RNA-seq data from an individual human genome. Our statistical framework accurately quantifies levels of ASE with specified false-discovery rates, achieving high reproducibility between independent sequencing platforms. We pinpoint loci that show unusual and biologically interesting patterns of ASE, including allele-specific alternative splicing and transcription termination sites. Our methodology provides a rigorous, quantitative, and high-resolution tool for profiling ASE across whole genomes. PMID:21873452

The Application of Next-Generation Sequencing for Mutation Detection in Autosomal-Dominant Hereditary Hearing Impairment.

PubMed

Gürtler, Nicolas; Röthlisberger, Benno; Ludin, Katja; Schlegel, Christoph; Lalwani, Anil K

2017-07-01

Identification of the causative mutation using next-generation sequencing in autosomal-dominant hereditary hearing impairment, as mutation analysis in hereditary hearing impairment by classic genetic methods, is hindered by the high heterogeneity of the disease. Two Swiss families with autosomal-dominant hereditary hearing impairment. Amplified DNA libraries for next-generation sequencing were constructed from extracted genomic DNA, derived from peripheral blood, and enriched by a custom-made sequence capture library. Validated, pooled libraries were sequenced on an Illumina MiSeq instrument, 300 cycles and paired-end sequencing. Technical data analysis was performed with SeqMonk, variant analysis with GeneTalk or VariantStudio. The detection of mutations in genes related to hearing loss by next-generation sequencing was subsequently confirmed using specific polymerase-chain-reaction and Sanger sequencing. Mutation detection in hearing-loss-related genes. The first family harbored the mutation c.5383+5delGTGA in the TECTA-gene. In the second family, a novel mutation c.2614-2625delCATGGCGCCGTG in the WFS1-gene and a second mutation TCOF1-c.1028G>A were identified. Next-generation sequencing successfully identified the causative mutation in families with autosomal-dominant hereditary hearing impairment. The results helped to clarify the pathogenic role of a known mutation and led to the detection of a novel one. NGS represents a feasible approach with great potential future in the diagnostics of hereditary hearing impairment, even in smaller labs.

Halvade-RNA: Parallel variant calling from transcriptomic data using MapReduce.

PubMed

Decap, Dries; Reumers, Joke; Herzeel, Charlotte; Costanza, Pascal; Fostier, Jan

2017-01-01

Given the current cost-effectiveness of next-generation sequencing, the amount of DNA-seq and RNA-seq data generated is ever increasing. One of the primary objectives of NGS experiments is calling genetic variants. While highly accurate, most variant calling pipelines are not optimized to run efficiently on large data sets. However, as variant calling in genomic data has become common practice, several methods have been proposed to reduce runtime for DNA-seq analysis through the use of parallel computing. Determining the effectively expressed variants from transcriptomics (RNA-seq) data has only recently become possible, and as such does not yet benefit from efficiently parallelized workflows. We introduce Halvade-RNA, a parallel, multi-node RNA-seq variant calling pipeline based on the GATK Best Practices recommendations. Halvade-RNA makes use of the MapReduce programming model to create and manage parallel data streams on which multiple instances of existing tools such as STAR and GATK operate concurrently. Whereas the single-threaded processing of a typical RNA-seq sample requires ∼28h, Halvade-RNA reduces this runtime to ∼2h using a small cluster with two 20-core machines. Even on a single, multi-core workstation, Halvade-RNA can significantly reduce runtime compared to using multi-threading, thus providing for a more cost-effective processing of RNA-seq data. Halvade-RNA is written in Java and uses the Hadoop MapReduce 2.0 API. It supports a wide range of distributions of Hadoop, including Cloudera and Amazon EMR.

[Genome-scale sequence data processing and epigenetic analysis of DNA methylation].

PubMed

Wang, Ting-Zhang; Shan, Gao; Xu, Jian-Hong; Xue, Qing-Zhong

2013-06-01

A new approach recently developed for detecting cytosine DNA methylation (mC) and analyzing the genome-scale DNA methylation profiling, is called BS-Seq which is based on bisulfite conversion of genomic DNA combined with next-generation sequencing. The method can not only provide an insight into the difference of genome-scale DNA methylation among different organisms, but also reveal the conservation of DNA methylation in all contexts and nucleotide preference for different genomic regions, including genes, exons, and repetitive DNA sequences. It will be helpful to under-stand the epigenetic impacts of cytosine DNA methylation on the regulation of gene expression and maintaining silence of repetitive sequences, such as transposable elements. In this paper, we introduce the preprocessing steps of DNA methylation data, by which cytosine (C) and guanine (G) in the reference sequence are transferred to thymine (T) and adenine (A), and cytosine in reads is transferred to thymine, respectively. We also comprehensively review the main content of the DNA methylation analysis on the genomic scale: (1) the cytosine methylation under the context of different sequences; (2) the distribution of genomic methylcytosine; (3) DNA methylation context and the preference for the nucleotides; (4) DNA- protein interaction sites of DNA methylation; (5) degree of methylation of cytosine in the different structural elements of genes. DNA methylation analysis technique provides a powerful tool for the epigenome study in human and other species, and genes and environment interaction, and founds the theoretical basis for further development of disease diagnostics and therapeutics in human.

Integrating restriction site-associated DNA sequencing (RAD-seq) with morphological cladistic analysis clarifies evolutionary relationships among major species groups of bee orchids

PubMed Central

Sramkó, Gábor; Paun, Ovidiu

2018-01-01

Abstract Background and Aims Bee orchids (Ophrys) have become the most popular model system for studying reproduction via insect-mediated pseudo-copulation and for exploring the consequent, putatively adaptive, evolutionary radiations. However, despite intensive past research, both the phylogenetic structure and species diversity within the genus remain highly contentious. Here, we integrate next-generation sequencing and morphological cladistic techniques to clarify the phylogeny of the genus. Methods At least two accessions of each of the ten species groups previously circumscribed from large-scale cloned nuclear ribosomal internal transcibed spacer (nrITS) sequencing were subjected to restriction site-associated sequencing (RAD-seq). The resulting matrix of 4159 single nucleotide polymorphisms (SNPs) for 34 accessions was used to construct an unrooted network and a rooted maximum likelihood phylogeny. A parallel morphological cladistic matrix of 43 characters generated both polymorphic and non-polymorphic sets of parsimony trees before being mapped across the RAD-seq topology. Key Results RAD-seq data strongly support the monophyly of nine out of ten groups previously circumscribed using nrITS and resolve three major clades; in contrast, supposed microspecies are barely distinguishable. Strong incongruence separated the RAD-seq trees from both the morphological trees and traditional classifications; mapping of the morphological characters across the RAD-seq topology rendered them far more homoplastic. Conclusions The comparatively high level of morphological homoplasy reflects extensive convergence, whereas the derived placement of the fusca group is attributed to paedomorphic simplification. The phenotype of the most recent common ancestor of the extant lineages is inferred, but it post-dates the majority of the character-state changes that typify the genus. RAD-seq may represent the high-water mark of the contribution of molecular phylogenetics to understanding evolution within Ophrys; further progress will require large-scale population-level studies that integrate phenotypic and genotypic data in a cogent conceptual framework. PMID:29325077

Integrating restriction site-associated DNA sequencing (RAD-seq) with morphological cladistic analysis clarifies evolutionary relationships among major species groups of bee orchids.

PubMed

Bateman, Richard M; Sramkó, Gábor; Paun, Ovidiu

2018-01-25

Bee orchids (Ophrys) have become the most popular model system for studying reproduction via insect-mediated pseudo-copulation and for exploring the consequent, putatively adaptive, evolutionary radiations. However, despite intensive past research, both the phylogenetic structure and species diversity within the genus remain highly contentious. Here, we integrate next-generation sequencing and morphological cladistic techniques to clarify the phylogeny of the genus. At least two accessions of each of the ten species groups previously circumscribed from large-scale cloned nuclear ribosomal internal transcibed spacer (nrITS) sequencing were subjected to restriction site-associated sequencing (RAD-seq). The resulting matrix of 4159 single nucleotide polymorphisms (SNPs) for 34 accessions was used to construct an unrooted network and a rooted maximum likelihood phylogeny. A parallel morphological cladistic matrix of 43 characters generated both polymorphic and non-polymorphic sets of parsimony trees before being mapped across the RAD-seq topology. RAD-seq data strongly support the monophyly of nine out of ten groups previously circumscribed using nrITS and resolve three major clades; in contrast, supposed microspecies are barely distinguishable. Strong incongruence separated the RAD-seq trees from both the morphological trees and traditional classifications; mapping of the morphological characters across the RAD-seq topology rendered them far more homoplastic. The comparatively high level of morphological homoplasy reflects extensive convergence, whereas the derived placement of the fusca group is attributed to paedomorphic simplification. The phenotype of the most recent common ancestor of the extant lineages is inferred, but it post-dates the majority of the character-state changes that typify the genus. RAD-seq may represent the high-water mark of the contribution of molecular phylogenetics to understanding evolution within Ophrys; further progress will require large-scale population-level studies that integrate phenotypic and genotypic data in a cogent conceptual framework. © The Author(s) 2018. Published by Oxford University Press on behalf of the Annals of Botany Company.

Picking ChIP-seq peak detectors for analyzing chromatin modification experiments

PubMed Central

Micsinai, Mariann; Parisi, Fabio; Strino, Francesco; Asp, Patrik; Dynlacht, Brian D.; Kluger, Yuval

2012-01-01

Numerous algorithms have been developed to analyze ChIP-Seq data. However, the complexity of analyzing diverse patterns of ChIP-Seq signals, especially for epigenetic marks, still calls for the development of new algorithms and objective comparisons of existing methods. We developed Qeseq, an algorithm to detect regions of increased ChIP read density relative to background. Qeseq employs critical novel elements, such as iterative recalibration and neighbor joining of reads to identify enriched regions of any length. To objectively assess its performance relative to other 14 ChIP-Seq peak finders, we designed a novel protocol based on Validation Discriminant Analysis (VDA) to optimally select validation sites and generated two validation datasets, which are the most comprehensive to date for algorithmic benchmarking of key epigenetic marks. In addition, we systematically explored a total of 315 diverse parameter configurations from these algorithms and found that typically optimal parameters in one dataset do not generalize to other datasets. Nevertheless, default parameters show the most stable performance, suggesting that they should be used. This study also provides a reproducible and generalizable methodology for unbiased comparative analysis of high-throughput sequencing tools that can facilitate future algorithmic development. PMID:22307239

Picking ChIP-seq peak detectors for analyzing chromatin modification experiments.

PubMed

Micsinai, Mariann; Parisi, Fabio; Strino, Francesco; Asp, Patrik; Dynlacht, Brian D; Kluger, Yuval

2012-05-01

Numerous algorithms have been developed to analyze ChIP-Seq data. However, the complexity of analyzing diverse patterns of ChIP-Seq signals, especially for epigenetic marks, still calls for the development of new algorithms and objective comparisons of existing methods. We developed Qeseq, an algorithm to detect regions of increased ChIP read density relative to background. Qeseq employs critical novel elements, such as iterative recalibration and neighbor joining of reads to identify enriched regions of any length. To objectively assess its performance relative to other 14 ChIP-Seq peak finders, we designed a novel protocol based on Validation Discriminant Analysis (VDA) to optimally select validation sites and generated two validation datasets, which are the most comprehensive to date for algorithmic benchmarking of key epigenetic marks. In addition, we systematically explored a total of 315 diverse parameter configurations from these algorithms and found that typically optimal parameters in one dataset do not generalize to other datasets. Nevertheless, default parameters show the most stable performance, suggesting that they should be used. This study also provides a reproducible and generalizable methodology for unbiased comparative analysis of high-throughput sequencing tools that can facilitate future algorithmic development.

GeneChip{sup {trademark}} screening assay for cystic fibrosis mutations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cronn, M.T.; Miyada, C.G.; Fucini, R.V.

1994-09-01

GeneChip{sup {trademark}} assays are based on high density, carefully designed arrays of short oligonucleotide probes (13-16 bases) built directly on derivatized silica substrates. DNA target sequence analysis is achieved by hybridizing fluorescently labeled amplification products to these arrays. Fluorescent hybridization signals located within the probe array are translated into target sequence information using the known probe sequence at each array feature. The mutation screening assay for cystic fibrosis includes sets of oligonucleotide probes designed to detect numerous different mutations that have been described in 14 exons and one intron of the CFTR gene. Each mutation site is addressed by amore » sub-array of at least 40 probe sequences, half designed to detect the wild type gene sequence and half designed to detect the reported mutant sequence. Hybridization with homozygous mutant, homozygous wild type or heterozygous targets results in distinctive hybridization patterns within a sub-array, permitting specific discrimination of each mutation. The GeneChip probe arrays are very small (approximately 1 cm{sup 2}). There miniature size coupled with their high information content make GeneChip probe arrays a useful and practical means for providing CF mutation analysis in a clinical setting.« less

Pyicos: a versatile toolkit for the analysis of high-throughput sequencing data.

PubMed

Althammer, Sonja; González-Vallinas, Juan; Ballaré, Cecilia; Beato, Miguel; Eyras, Eduardo

2011-12-15

High-throughput sequencing (HTS) has revolutionized gene regulation studies and is now fundamental for the detection of protein-DNA and protein-RNA binding, as well as for measuring RNA expression. With increasing variety and sequencing depth of HTS datasets, the need for more flexible and memory-efficient tools to analyse them is growing. We describe Pyicos, a powerful toolkit for the analysis of mapped reads from diverse HTS experiments: ChIP-Seq, either punctuated or broad signals, CLIP-Seq and RNA-Seq. We prove the effectiveness of Pyicos to select for significant signals and show that its accuracy is comparable and sometimes superior to that of methods specifically designed for each particular type of experiment. Pyicos facilitates the analysis of a variety of HTS datatypes through its flexibility and memory efficiency, providing a useful framework for data integration into models of regulatory genomics. Open-source software, with tutorials and protocol files, is available at http://regulatorygenomics.upf.edu/pyicos or as a Galaxy server at http://regulatorygenomics.upf.edu/galaxy eduardo.eyras@upf.edu Supplementary data are available at Bioinformatics online.

A fully sealed plastic chip for multiplex PCR and its application in bacteria identification.

PubMed

Xu, Youchun; Yan, He; Zhang, Yan; Jiang, Kewei; Lu, Ying; Ren, Yonghong; Wang, Hui; Wang, Shan; Xing, Wanli

2015-07-07

Multiplex PCR is an effective tool for simultaneous multiple target detection but is limited by the intrinsic interference and competition among primer pairs when it is performed in one reaction tube. Dividing a multiplex PCR into many single PCRs is a simple strategy to overcome this issue. Here, we constructed a plastic, easy-to-use, fully sealed multiplex PCR chip based on reversible centrifugation for the simultaneous detection of 63 target DNA sequences. The structure of the chip is quite simple, which contains sine-shaped infusing channels and a number of reaction chambers connecting to one side of these channels. Primer pairs for multiplex PCR were sequentially preloaded in the different reaction chambers, and the chip was enclosed with PCR-compatible adhesive tape. For usage, the PCR master mix containing a DNA template is pipetted into the infusing channels and centrifuged into the reaction chambers, leaving the infusing channels filled with air to avoid cross-contamination of the different chambers. Then, the chip is sealed and placed on a flat thermal cycler for PCR. Finally, amplification products can be detected in situ using a fluorescence scanner or recovered by reverse centrifugation for further analyses. Therefore, our chip possesses two functions: 1) it can be used for multi-target detection based on end-point in situ fluorescence detection; and 2) it can work as a sample preparation unit for analyses that need multiplex PCR such as hybridization and target sequencing. The performance of this chip was carefully examined and further illustrated in the identification of 8 pathogenic bacterial genomic DNA samples and 13 drug-resistance genes. Due to simplicity of its structure and operation, accuracy and generality, high-throughput capacity, and versatile functions (i.e., for in situ detection and sample preparation), our multiplex PCR chip has great potential in clinical diagnostics and nucleic acid-based point-of-care testing.

1-deoxy-d-xylulose-5-phosphate reductoisomerases and method of use

DOEpatents

Croteau, Rodney B.; Lange, Bernd M.

2001-01-01

The present invention relates to isolated DNA sequences which code for the expression of plant 1-deoxy-D-xylulose-5-phosphate reductoisomerase protein, such as the sequence presented in SEQ ID NO:1 which encodes a 1-deoxy-D-xylulose-5-phosphate reductoisomerase protein from peppermint (Mentha x piperita). Additionally, the present invention relates to isolated plant 1-deoxy-D-xylulose-5-phosphate reductoisomerase protein. In other aspects, the present invention is directed to replicable recombinant cloning vehicles comprising a nucleic acid sequence which codes for a plant 1-deoxy-D-xylulose-5-phosphate reductoisomerase, to modified host cells transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence of the invention.

1-deoxy-D-xylulose-5-phosphate reductoisomerases, and methods of use

DOEpatents

Croteau, Rodney B.; Lange, Bernd M.

2002-07-16

The present invention relates to isolated DNA sequences which code for the expression of plant 1-deoxy-D-xylulose-5-phosphate reductoisomerase protein, such as the sequence presented in SEQ ID NO:1 which encodes a 1-deoxy-D-xylulose-5-phosphate reductoisomerase protein from peppermint (Mentha x piperita). Additionally, the present invention relates to isolated plant 1-deoxy-D-xylulose-5-phosphate reductoisomerase protein. In other aspects, the present invention is directed to replicable recombinant cloning vehicles comprising a nucleic acid sequence which codes for a plant 1-deoxy-D-xylulose-5-phosphate reductoisomerase, to modified host cells transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence of the invention.

Next Generation MUT-MAP, a High-Sensitivity High-Throughput Microfluidics Chip-Based Mutation Analysis Panel

PubMed Central

Patel, Rajesh; Tsan, Alison; Sumiyoshi, Teiko; Fu, Ling; Desai, Rupal; Schoenbrunner, Nancy; Myers, Thomas W.; Bauer, Keith; Smith, Edward; Raja, Rajiv

2014-01-01

Molecular profiling of tumor tissue to detect alterations, such as oncogenic mutations, plays a vital role in determining treatment options in oncology. Hence, there is an increasing need for a robust and high-throughput technology to detect oncogenic hotspot mutations. Although commercial assays are available to detect genetic alterations in single genes, only a limited amount of tissue is often available from patients, requiring multiplexing to allow for simultaneous detection of mutations in many genes using low DNA input. Even though next-generation sequencing (NGS) platforms provide powerful tools for this purpose, they face challenges such as high cost, large DNA input requirement, complex data analysis, and long turnaround times, limiting their use in clinical settings. We report the development of the next generation mutation multi-analyte panel (MUT-MAP), a high-throughput microfluidic, panel for detecting 120 somatic mutations across eleven genes of therapeutic interest (AKT1, BRAF, EGFR, FGFR3, FLT3, HRAS, KIT, KRAS, MET, NRAS, and PIK3CA) using allele-specific PCR (AS-PCR) and Taqman technology. This mutation panel requires as little as 2 ng of high quality DNA from fresh frozen or 100 ng of DNA from formalin-fixed paraffin-embedded (FFPE) tissues. Mutation calls, including an automated data analysis process, have been implemented to run 88 samples per day. Validation of this platform using plasmids showed robust signal and low cross-reactivity in all of the newly added assays and mutation calls in cell line samples were found to be consistent with the Catalogue of Somatic Mutations in Cancer (COSMIC) database allowing for direct comparison of our platform to Sanger sequencing. High correlation with NGS when compared to the SuraSeq500 panel run on the Ion Torrent platform in a FFPE dilution experiment showed assay sensitivity down to 0.45%. This multiplexed mutation panel is a valuable tool for high-throughput biomarker discovery in personalized medicine and cancer drug development. PMID:24658394

Detection of cystic fibrosis mutations in a GeneChip{trademark} assay format

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miyada, C.G.; Cronin, M.T.; Kim, S.M.

1994-09-01

We are developing assays for the detection of cystic fibrosis mutations based on DNA hybridization. A DNA sample is amplified by PCR, labeled by incorporating a fluorescein-tagged dNTP, enzymatically treated to produce smaller fragments and hybridized to a series of short (13-16 bases) oligonucleotides synthesized on a glass surface via photolithography. The hybrids are detected by eqifluorescence and mutations are identified by the specific pattern of hybridization. In a GeneChip assay, the chip surface is composed of a series of subarrays, each being specific for a particular mutation. Each subarray is further subdivided into a series of probes (40 total),more » half based on the mutant sequence and the remainder based on the wild-type sequence. For each of the subarrays, there is a redundancy in the number of probes that should hybridize to either a wild-type or a mutant target. The multiple probe strategy provides sequence information for a short five base region overlapping the mutation site. In addition, homozygous wild-type and mutant as well as heterozygous samples are each identified by a specific pattern of hybridization. The small size of each probe feature (250 x 250 {mu}m{sup 2}) permits the inclusion of additional probes required to generate sequence information by hybridization.« less

A Predictive Approach to Network Reverse-Engineering

NASA Astrophysics Data System (ADS)

Wiggins, Chris

2005-03-01

A central challenge of systems biology is the ``reverse engineering" of transcriptional networks: inferring which genes exert regulatory control over which other genes. Attempting such inference at the genomic scale has only recently become feasible, via data-intensive biological innovations such as DNA microrrays (``DNA chips") and the sequencing of whole genomes. In this talk we present a predictive approach to network reverse-engineering, in which we integrate DNA chip data and sequence data to build a model of the transcriptional network of the yeast S. cerevisiae capable of predicting the response of genes in unseen experiments. The technique can also be used to extract ``motifs,'' sequence elements which act as binding sites for regulatory proteins. We validate by a number of approaches and present comparison of theoretical prediction vs. experimental data, along with biological interpretations of the resulting model. En route, we will illustrate some basic notions in statistical learning theory (fitting vs. over-fitting; cross- validation; assessing statistical significance), highlighting ways in which physicists can make a unique contribution in data- driven approaches to reverse engineering.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Octopus-toolkit: a workflow to automate mining of public epigenomic and transcriptomic next-generation sequencing data

PubMed Central

Kim, Taemook; Seo, Hogyu David; Hennighausen, Lothar; Lee, Daeyoup

2018-01-01

Abstract Octopus-toolkit is a stand-alone application for retrieving and processing large sets of next-generation sequencing (NGS) data with a single step. Octopus-toolkit is an automated set-up-and-analysis pipeline utilizing the Aspera, SRA Toolkit, FastQC, Trimmomatic, HISAT2, STAR, Samtools, and HOMER applications. All the applications are installed on the user's computer when the program starts. Upon the installation, it can automatically retrieve original files of various epigenomic and transcriptomic data sets, including ChIP-seq, ATAC-seq, DNase-seq, MeDIP-seq, MNase-seq and RNA-seq, from the gene expression omnibus data repository. The downloaded files can then be sequentially processed to generate BAM and BigWig files, which are used for advanced analyses and visualization. Currently, it can process NGS data from popular model genomes such as, human (Homo sapiens), mouse (Mus musculus), dog (Canis lupus familiaris), plant (Arabidopsis thaliana), zebrafish (Danio rerio), fruit fly (Drosophila melanogaster), worm (Caenorhabditis elegans), and budding yeast (Saccharomyces cerevisiae) genomes. With the processed files from Octopus-toolkit, the meta-analysis of various data sets, motif searches for DNA-binding proteins, and the identification of differentially expressed genes and/or protein-binding sites can be easily conducted with few commands by users. Overall, Octopus-toolkit facilitates the systematic and integrative analysis of available epigenomic and transcriptomic NGS big data. PMID:29420797

Multiplexed detection of DNA sequences using a competitive displacement assay in a microfluidic SERRS-based device.

PubMed

Yazdi, Soroush H; Giles, Kristen L; White, Ian M

2013-11-05

We demonstrate sensitive and multiplexed detection of DNA sequences through a surface enhanced resonance Raman spectroscopy (SERRS)-based competitive displacement assay in an integrated microsystem. The use of the competitive displacement scheme, in which the target DNA sequence displaces a Raman-labeled reporter sequence that has lower affinity for the immobilized probe, enables detection of unlabeled target DNA sequences with a simple single-step procedure. In our implementation, the displacement reaction occurs in a microporous packed column of silica beads prefunctionalized with probe-reporter pairs. The use of a functionalized packed-bead column in a microfluidic channel provides two major advantages: (i) immobilization surface chemistry can be performed as a batch process instead of on a chip-by-chip basis, and (ii) the microporous network eliminates the diffusion limitations of a typical biological assay, which increases the sensitivity. Packed silica beads are also leveraged to improve the SERRS detection of the Raman-labeled reporter. Following displacement, the reporter adsorbs onto aggregated silver nanoparticles in a microfluidic mixer; the nanoparticle-reporter conjugates are then trapped and concentrated in the silica bead matrix, which leads to a significant increase in plasmonic nanoparticles and adsorbed Raman reporters within the detection volume as compared to an open microfluidic channel. The experimental results reported here demonstrate detection down to 100 pM of the target DNA sequence, and the experiments are shown to be specific, repeatable, and quantitative. Furthermore, we illustrate the advantage of using SERRS by demonstrating multiplexed detection. The sensitivity of the assay, combined with the advantages of multiplexed detection and single-step operation with unlabeled target sequences makes this method attractive for practical applications. Importantly, while we illustrate DNA sequence detection, the SERRS-based competitive displacement assay is applicable to detection of a variety of biological macromolecules, including proteins and proteolytic enzymes.

Combining genomic and proteomic approaches for epigenetics research

PubMed Central

Han, Yumiao; Garcia, Benjamin A

2014-01-01

Epigenetics is the study of changes in gene expression or cellular phenotype that do not change the DNA sequence. In this review, current methods, both genomic and proteomic, associated with epigenetics research are discussed. Among them, chromatin immunoprecipitation (ChIP) followed by sequencing and other ChIP-based techniques are powerful techniques for genome-wide profiling of DNA-binding proteins, histone post-translational modifications or nucleosome positions. However, mass spectrometry-based proteomics is increasingly being used in functional biological studies and has proved to be an indispensable tool to characterize histone modifications, as well as DNA–protein and protein–protein interactions. With the development of genomic and proteomic approaches, combination of ChIP and mass spectrometry has the potential to expand our knowledge of epigenetics research to a higher level. PMID:23895656

Identification of Genomic Insertion and Flanking Sequence of G2-EPSPS and GAT Transgenes in Soybean Using Whole Genome Sequencing Method.

PubMed

Guo, Bingfu; Guo, Yong; Hong, Huilong; Qiu, Li-Juan

2016-01-01

Molecular characterization of sequence flanking exogenous fragment insertion is essential for safety assessment and labeling of genetically modified organism (GMO). In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS) method. More than 22.4 Gb sequence data (∼21 × coverage) for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundaries of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of genomic insertion sites of G2-EPSPS and GAT transgenes will facilitate the utilization of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS was a cost-effective and rapid method for identifying sites of T-DNA insertions and flanking sequences in soybean.

The Nuclear Receptor, RORγ, Regulates Pathways Necessary for Breast Cancer Metastasis.

PubMed

Oh, Tae Gyu; Wang, Shu-Ching M; Acharya, Bipul R; Goode, Joel M; Graham, J Dinny; Clarke, Christine L; Yap, Alpha S; Muscat, George E O

2016-04-01

We have previously reported that RORγ expression was decreased in ER-ve breast cancer, and increased expression improves clinical outcomes. However, the underlying RORγ dependent mechanisms that repress breast carcinogenesis have not been elucidated. Here we report that RORγ negatively regulates the oncogenic TGF-β/EMT and mammary stem cell (MaSC) pathways, whereas RORγ positively regulates DNA-repair. We demonstrate that RORγ expression is: (i) decreased in basal-like subtype cancers, and (ii) inversely correlated with histological grade and drivers of carcinogenesis in breast cancer cohorts. Furthermore, integration of RNA-seq and ChIP-chip data reveals that RORγ regulates the expression of many genes involved in TGF-β/EMT-signaling, DNA-repair and MaSC pathways (including the non-coding RNA, LINC00511). In accordance, pharmacological studies demonstrate that an RORγ agonist suppresses breast cancer cell viability, migration, the EMT transition (microsphere outgrowth) and mammosphere-growth. In contrast, RNA-seq demonstrates an RORγ inverse agonist induces TGF-β/EMT-signaling. These findings suggest pharmacological modulation of RORγ activity may have utility in breast cancer. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Comparative performance of high-density oligonucleotide sequencing and dideoxynucleotide sequencing of HIV type 1 pol from clinical samples.

PubMed

Günthard, H F; Wong, J K; Ignacio, C C; Havlir, D V; Richman, D D

1998-07-01

The performance of the high-density oligonucleotide array methodology (GeneChip) in detecting drug resistance mutations in HIV-1 pol was compared with that of automated dideoxynucleotide sequencing (ABI) of clinical samples, viral stocks, and plasmid-derived NL4-3 clones. Sequences from 29 clinical samples (plasma RNA, n = 17; lymph node RNA, n = 5; lymph node DNA, n = 7) from 12 patients, from 6 viral stock RNA samples, and from 13 NL4-3 clones were generated by both methods. Editing was done independently by a different investigator for each method before comparing the sequences. In addition, NL4-3 wild type (WT) and mutants were mixed in varying concentrations and sequenced by both methods. Overall, a concordance of 99.1% was found for a total of 30,865 bases compared. The comparison of clinical samples (plasma RNA and lymph node RNA and DNA) showed a slightly lower match of base calls, 98.8% for 19,831 nucleotides compared (protease region, 99.5%, n = 8272; RT region, 98.3%, n = 11,316), than for viral stocks and NL4-3 clones (protease region, 99.8%; RT region, 99.5%). Artificial mixing experiments showed a bias toward calling wild-type bases by GeneChip. Discordant base calls are most likely due to differential detection of mixtures. The concordance between GeneChip and ABI was high and appeared dependent on the nature of the templates (directly amplified versus cloned) and the complexity of mixes.

Breaking the 1000-gene barrier for Mimivirus using ultra-deep genome and transcriptome sequencing.

PubMed

Legendre, Matthieu; Santini, Sébastien; Rico, Alain; Abergel, Chantal; Claverie, Jean-Michel

2011-03-04

Mimivirus, a giant dsDNA virus infecting Acanthamoeba, is the prototype of the mimiviridae family, the latest addition to the family of the nucleocytoplasmic large DNA viruses (NCLDVs). Its 1.2 Mb-genome was initially predicted to encode 917 genes. A subsequent RNA-Seq analysis precisely mapped many transcript boundaries and identified 75 new genes. We now report a much deeper analysis using the SOLiD™ technology combining RNA-Seq of the Mimivirus transcriptome during the infectious cycle (202.4 Million reads), and a complete genome re-sequencing (45.3 Million reads). This study corrected the genome sequence and identified several single nucleotide polymorphisms. Our results also provided clear evidence of previously overlooked transcription units, including an important RNA polymerase subunit distantly related to Euryarchea homologues. The total Mimivirus gene count is now 1018, 11% greater than the original annotation. This study highlights the huge progress brought about by ultra-deep sequencing for the comprehensive annotation of virus genomes, opening the door to a complete one-nucleotide resolution level description of their transcriptional activity, and to the realistic modeling of the viral genome expression at the ultimate molecular level. This work also illustrates the need to go beyond bioinformatics-only approaches for the annotation of short protein and non-coding genes in viral genomes.

Phylogenetic analysis of higher-level relationships within Hydroidolina (Cnidaria: Hydrozoa) using mitochondrial genome data and insight into their mitochondrial transcription.

PubMed

Kayal, Ehsan; Bentlage, Bastian; Cartwright, Paulyn; Yanagihara, Angel A; Lindsay, Dhugal J; Hopcroft, Russell R; Collins, Allen G

2015-01-01

Hydrozoans display the most morphological diversity within the phylum Cnidaria. While recent molecular studies have provided some insights into their evolutionary history, sister group relationships remain mostly unresolved, particularly at mid-taxonomic levels. Specifically, within Hydroidolina, the most speciose hydrozoan subclass, the relationships and sometimes integrity of orders are highly unsettled. Here we obtained the near complete mitochondrial sequence of twenty-six hydroidolinan hydrozoan species from a range of sources (DNA and RNA-seq data, long-range PCR). Our analyses confirm previous inference of the evolution of mtDNA in Hydrozoa while introducing a novel genome organization. Using RNA-seq data, we propose a mechanism for the expression of mitochondrial mRNA in Hydroidolina that can be extrapolated to the other medusozoan taxa. Phylogenetic analyses using the full set of mitochondrial gene sequences provide some insights into the order-level relationships within Hydroidolina, including siphonophores as the first diverging clade, a well-supported clade comprised of Leptothecata-Filifera III-IV, and a second clade comprised of Aplanulata-Capitata s.s.-Filifera I-II. Finally, we describe our relatively inexpensive and accessible multiplexing strategy to sequence long-range PCR amplicons that can be adapted to most high-throughput sequencing platforms.

Phylogenetic analysis of higher-level relationships within Hydroidolina (Cnidaria: Hydrozoa) using mitochondrial genome data and insight into their mitochondrial transcription

PubMed Central

Bentlage, Bastian; Cartwright, Paulyn; Yanagihara, Angel A.; Lindsay, Dhugal J.; Hopcroft, Russell R.; Collins, Allen G.

2015-01-01

Hydrozoans display the most morphological diversity within the phylum Cnidaria. While recent molecular studies have provided some insights into their evolutionary history, sister group relationships remain mostly unresolved, particularly at mid-taxonomic levels. Specifically, within Hydroidolina, the most speciose hydrozoan subclass, the relationships and sometimes integrity of orders are highly unsettled. Here we obtained the near complete mitochondrial sequence of twenty-six hydroidolinan hydrozoan species from a range of sources (DNA and RNA-seq data, long-range PCR). Our analyses confirm previous inference of the evolution of mtDNA in Hydrozoa while introducing a novel genome organization. Using RNA-seq data, we propose a mechanism for the expression of mitochondrial mRNA in Hydroidolina that can be extrapolated to the other medusozoan taxa. Phylogenetic analyses using the full set of mitochondrial gene sequences provide some insights into the order-level relationships within Hydroidolina, including siphonophores as the first diverging clade, a well-supported clade comprised of Leptothecata-Filifera III–IV, and a second clade comprised of Aplanulata-Capitata s.s.-Filifera I–II. Finally, we describe our relatively inexpensive and accessible multiplexing strategy to sequence long-range PCR amplicons that can be adapted to most high-throughput sequencing platforms. PMID:26618080

Comparison of the performance of Ion Torrent chips in noninvasive prenatal trisomy detection.

PubMed

Wang, Yanlin; Wen, Zujia; Shen, Jiawei; Cheng, Weiwei; Li, Jun; Qin, Xiaolan; Ma, Duan; Shi, Yongyong

2014-07-01

Semiconductor high-throughput sequencing, represented by Ion Torrent PGM/Proton, proves to be feasible in the noninvasive prenatal diagnosis of fetal aneuploidies. It is commendable that, with less data and relevant cost also, an accurate result can be achieved owing to the high sensitivity and specificity of such kind of technology. We conducted a comparative analysis of the performance of four different Ion chips in detecting fetal chromosomal aneuploidies. Eight maternal plasma DNA samples, including four pregnancies with normal fetuses and four with trisomy 21 fetuses, were sequenced on Ion Torrent 314/316/318/PI chips, respectively. Results such as read mapped ratio, correlation coefficient and phred quality score were calculated and parallelly compared. All samples were correctly classified even with low-throughput chip, and, among the four chips, the 316 chip had the highest read mapped ratio, correlation coefficient, mean read length and phred quality score. All chips were well consistent with each other. Our results showed that all Ion chips are applicable in noninvasive prenatal fetal aneuploidy diagnosis. We recommend researchers or clinicians to use the appropriate chip with barcoding technology on the basis of the sample number.

Comparing viral metagenomics methods using a highly multiplexed human viral pathogens reagent

PubMed Central

Li, Linlin; Deng, Xutao; Mee, Edward T.; Collot-Teixeira, Sophie; Anderson, Rob; Schepelmann, Silke; Minor, Philip D.; Delwart, Eric

2014-01-01

Unbiased metagenomic sequencing holds significant potential as a diagnostic tool for the simultaneous detection of any previously genetically described viral nucleic acids in clinical samples. Viral genome sequences can also inform on likely phenotypes including drug susceptibility or neutralization serotypes. In this study, different variables of the laboratory methods often used to generate viral metagenomics libraries on the efficiency of viral detection and virus genome coverage were compared. A biological reagent consisting of 25 different human RNA and DNA viral pathogens was used to estimate the effect of filtration and nuclease digestion, DNA/RNA extraction methods, pre-amplification and the use of different library preparation kits on the detection of viral nucleic acids. Filtration and nuclease treatment led to slight decreases in the percentage of viral sequence reads and number of viruses detected. For nucleic acid extractions silica spin columns improved viral sequence recovery relative to magnetic beads and Trizol extraction. Pre-amplification using random RT-PCR while generating more viral sequence reads resulted in detection of fewer viruses, more overlapping sequences, and lower genome coverage. The ScriptSeq library preparation method retrieved more viruses and a greater fraction of their genomes than the TruSeq and Nextera methods. Viral metagenomics sequencing was able to simultaneously detect up to 22 different viruses in the biological reagent analyzed including all those detected by qPCR. Further optimization will be required for the detection of viruses in biologically more complex samples such as tissues, blood, or feces. PMID:25497414

A novel ultra high-throughput 16S rRNA gene amplicon sequencing library preparation method for the Illumina HiSeq platform.

PubMed

de Muinck, Eric J; Trosvik, Pål; Gilfillan, Gregor D; Hov, Johannes R; Sundaram, Arvind Y M

2017-07-06

Advances in sequencing technologies and bioinformatics have made the analysis of microbial communities almost routine. Nonetheless, the need remains to improve on the techniques used for gathering such data, including increasing throughput while lowering cost and benchmarking the techniques so that potential sources of bias can be better characterized. We present a triple-index amplicon sequencing strategy to sequence large numbers of samples at significantly lower c ost and in a shorter timeframe compared to existing methods. The design employs a two-stage PCR protocol, incorpo rating three barcodes to each sample, with the possibility to add a fourth-index. It also includes heterogeneity spacers to overcome low complexity issues faced when sequencing amplicons on Illumina platforms. The library preparation method was extensively benchmarked through analysis of a mock community in order to assess biases introduced by sample indexing, number of PCR cycles, and template concentration. We further evaluated the method through re-sequencing of a standardized environmental sample. Finally, we evaluated our protocol on a set of fecal samples from a small cohort of healthy adults, demonstrating good performance in a realistic experimental setting. Between-sample variation was mainly related to batch effects, such as DNA extraction, while sample indexing was also a significant source of bias. PCR cycle number strongly influenced chimera formation and affected relative abundance estimates of species with high GC content. Libraries were sequenced using the Illumina HiSeq and MiSeq platforms to demonstrate that this protocol is highly scalable to sequence thousands of samples at a very low cost. Here, we provide the most comprehensive study of performance and bias inherent to a 16S rRNA gene amplicon sequencing method to date. Triple-indexing greatly reduces the number of long custom DNA oligos required for library preparation, while the inclusion of variable length heterogeneity spacers minimizes the need for PhiX spike-in. This design results in a significant cost reduction of highly multiplexed amplicon sequencing. The biases we characterize highlight the need for highly standardized protocols. Reassuringly, we find that the biological signal is a far stronger structuring factor than the various sources of bias.

Quantitative RNA-seq analysis of the Campylobacter jejuni transcriptome

PubMed Central

Chaudhuri, Roy R.; Yu, Lu; Kanji, Alpa; Perkins, Timothy T.; Gardner, Paul P.; Choudhary, Jyoti; Maskell, Duncan J.

2011-01-01

Campylobacter jejuni is the most common bacterial cause of foodborne disease in the developed world. Its general physiology and biochemistry, as well as the mechanisms enabling it to colonize and cause disease in various hosts, are not well understood, and new approaches are required to understand its basic biology. High-throughput sequencing technologies provide unprecedented opportunities for functional genomic research. Recent studies have shown that direct Illumina sequencing of cDNA (RNA-seq) is a useful technique for the quantitative and qualitative examination of transcriptomes. In this study we report RNA-seq analyses of the transcriptomes of C. jejuni (NCTC11168) and its rpoN mutant. This has allowed the identification of hitherto unknown transcriptional units, and further defines the regulon that is dependent on rpoN for expression. The analysis of the NCTC11168 transcriptome was supplemented by additional proteomic analysis using liquid chromatography-MS. The transcriptomic and proteomic datasets represent an important resource for the Campylobacter research community. PMID:21816880

The skin microbiome in psoriatic arthritis: methodology development and pilot data.

PubMed

Castelino, Madhura; Eyre, Stephen; Moat, John; Fox, Graeme; Martin, Paul; Ijaz, Umer; Quince, Christopher; Ho, Pauline; Upton, Mathew; Barton, Anne

2015-02-26

Skin microbiota are likely to be important in the development of conditions such as psoriatic arthritis. Profiling the bacterial community in the psosriatic plaques will contribute to our understanding of the role of the skin microbiome in these conditions. The aim of this work was to determine the optimum study design for work on the skin microbiome with use of the MiSeq platform. The objectives were to compare data generated from two platforms for two primer pairs in a low density mock bacterial community. DNA was obtained from two low density mock communities of 11 diverse bacterial strains (with and without human DNA supplementation) and from swabs taken from the skin of four healthy volunteers. The DNA was amplified with primer pairs covering hypervariable regions of the 16S rRNA gene: primers 63F and 519R (V1-V3), and 347F and 803R (V3-V4). The resultant libraries were indexed for the MiSeq and Roche454 platforms and sequenced. Both datasets were de-noised, cleaned of chimeras, and analysed by use of QIIME software (version 1.8.0). No significant difference in the diversity indices at the phylum and the genus level between the platforms was seen. Comparison of the diversity indices for the mock community data for the two primer pairs demonstrated that the V3-V4 hypervariable region had significantly better capture of bacterial diversity than did the V1-V3 region. Amplification with the same primer pairs showed strong concordance within each platform (98·9-99·8%), with negligible effect of spiked human DNA contamination. Comparison at the family level classification between samples processed on the MiSeq and Roche454 platforms using the V3-V4 hypervariable region also showed a high level of concordance (87%), although less so for the V1-V3 primers (10%). The pilot data from healthy volunteers were similar. Results obtained from the V3-V4 16S rRNA hypervariable region, sequencing on the MiSeq and Roche454 platforms, were concordant between replicates, and between each other. These findings suggest that the MiSeq platform, and these primers, is a comparable method for determining skin microbiota to the widely used Roche454 methodology. NIHR Manchester Musculoskeletal Biomedical Research Unit. Copyright © 2015 Elsevier Ltd. All rights reserved.

The Prevalence of Gap Junction Protein Beta 2 (GJB2) Mutations in Non Syndromic Sensorineural Hearing Loss in Çukurova Region.

PubMed

Bozdoğan, Sevcan Tuğ; Kuran, Gökhan; Yüregir, Özge Özalp; Aslan, Hüseyin; Haytoğlu, Süheyl; Ayaz, Akif; Arıkan, Osman Kürşat

2015-08-01

To date, studies in all populations showed that mutations in the gene of Gap junction protein beta 2 (GJB2) play an important role in non-syndromic autosomal recessive congenital hearing loss. The aim of this study was to evaluate GJB2 gene of patients with hearing loss in our region using deoxyribonucleic acid (DNA) sequencing method and to demonstrate region-specific mutation and polymorphism distribution. Patients who had bilateral severe sensorineural non-syndromic hearing loss identified by audiologic evaluation were included. Peripheral blood samples were collected and the GJB2 gene exon1 and exon 2 regions were amplified by polymerase chain reaction (PCR). Obtained PCR products were sequenced by the DNA sequence analysis method (SeqFinder Sequencing System; ABI 3130; Foster City, CA, USA) and analyzed using the SeqScape software. Of the 77 patients, 16 had homozygous or heterozygous mutation. The mutation of 35delG, which is known as the most frequent mutation of GJB2 gene, was also the most frequently seen mutation at a ratio of 5.5% in patients with hearing loss in our region; this was followed by the V27I mutation. As this is the first study conducted by sequence analysis in our region, it was worth to be presented in terms of showing the distribution of mutation.

Prunus transcription factors: breeding perspectives

PubMed Central

Bianchi, Valmor J.; Rubio, Manuel; Trainotti, Livio; Verde, Ignazio; Bonghi, Claudio; Martínez-Gómez, Pedro

2015-01-01

Many plant processes depend on differential gene expression, which is generally controlled by complex proteins called transcription factors (TFs). In peach, 1533 TFs have been identified, accounting for about 5.5% of the 27,852 protein-coding genes. These TFs are the reference for the rest of the Prunus species. TF studies in Prunus have been performed on the gene expression analysis of different agronomic traits, including control of the flowering process, fruit quality, and biotic and abiotic stress resistance. These studies, using quantitative RT-PCR, have mainly been performed in peach, and to a lesser extent in other species, including almond, apricot, black cherry, Fuji cherry, Japanese apricot, plum, and sour and sweet cherry. Other tools have also been used in TF studies, including cDNA-AFLP, LC-ESI-MS, RNA, and DNA blotting or mapping. More recently, new tools assayed include microarray and high-throughput DNA sequencing (DNA-Seq) and RNA sequencing (RNA-Seq). New functional genomics opportunities include genome resequencing and the well-known synteny among Prunus genomes and transcriptomes. These new functional studies should be applied in breeding programs in the development of molecular markers. With the genome sequences available, some strategies that have been used in model systems (such as SNP genotyping assays and genotyping-by-sequencing) may be applicable in the functional analysis of Prunus TFs as well. In addition, the knowledge of the gene functions and position in the peach reference genome of the TFs represents an additional advantage. These facts could greatly facilitate the isolation of genes via QTL (quantitative trait loci) map-based cloning in the different Prunus species, following the association of these TFs with the identified QTLs using the peach reference genome. PMID:26124770

Qualitative and quantitative assessment of Illumina's forensic STR and SNP kits on MiSeq FGx™.

PubMed

Sharma, Vishakha; Chow, Hoi Yan; Siegel, Donald; Wurmbach, Elisa

2017-01-01

Massively parallel sequencing (MPS) is a powerful tool transforming DNA analysis in multiple fields ranging from medicine, to environmental science, to evolutionary biology. In forensic applications, MPS offers the ability to significantly increase the discriminatory power of human identification as well as aid in mixture deconvolution. However, before the benefits of any new technology can be employed, a thorough evaluation of its quality, consistency, sensitivity, and specificity must be rigorously evaluated in order to gain a detailed understanding of the technique including sources of error, error rates, and other restrictions/limitations. This extensive study assessed the performance of Illumina's MiSeq FGx MPS system and ForenSeq™ kit in nine experimental runs including 314 reaction samples. In-depth data analysis evaluated the consequences of different assay conditions on test results. Variables included: sample numbers per run, targets per run, DNA input per sample, and replications. Results are presented as heat maps revealing patterns for each locus. Data analysis focused on read numbers (allele coverage), drop-outs, drop-ins, and sequence analysis. The study revealed that loci with high read numbers performed better and resulted in fewer drop-outs and well balanced heterozygous alleles. Several loci were prone to drop-outs which led to falsely typed homozygotes and therefore to genotype errors. Sequence analysis of allele drop-in typically revealed a single nucleotide change (deletion, insertion, or substitution). Analyses of sequences, no template controls, and spurious alleles suggest no contamination during library preparation, pooling, and sequencing, but indicate that sequencing or PCR errors may have occurred due to DNA polymerase infidelities. Finally, we found utilizing Illumina's FGx System at recommended conditions does not guarantee 100% outcomes for all samples tested, including the positive control, and required manual editing due to low read numbers and/or allele drop-in. These findings are important for progressing towards implementation of MPS in forensic DNA testing.

A long PCR–based approach for DNA enrichment prior to next-generation sequencing for systematic studies1

PubMed Central

Uribe-Convers, Simon; Duke, Justin R.; Moore, Michael J.; Tank, David C.

2014-01-01

• Premise of the study: We present an alternative approach for molecular systematic studies that combines long PCR and next-generation sequencing. Our approach can be used to generate templates from any DNA source for next-generation sequencing. Here we test our approach by amplifying complete chloroplast genomes, and we present a set of 58 potentially universal primers for angiosperms to do so. Additionally, this approach is likely to be particularly useful for nuclear and mitochondrial regions. • Methods and Results: Chloroplast genomes of 30 species across angiosperms were amplified to test our approach. Amplification success varied depending on whether PCR conditions were optimized for a given taxon. To further test our approach, some amplicons were sequenced on an Illumina HiSeq 2000. • Conclusions: Although here we tested this approach by sequencing plastomes, long PCR amplicons could be generated using DNA from any genome, expanding the possibilities of this approach for molecular systematic studies. PMID:25202592

MIG-seq: an effective PCR-based method for genome-wide single-nucleotide polymorphism genotyping using the next-generation sequencing platform

PubMed Central

Suyama, Yoshihisa; Matsuki, Yu

2015-01-01

Restriction-enzyme (RE)-based next-generation sequencing methods have revolutionized marker-assisted genetic studies; however, the use of REs has limited their widespread adoption, especially in field samples with low-quality DNA and/or small quantities of DNA. Here, we developed a PCR-based procedure to construct reduced representation libraries without RE digestion steps, representing de novo single-nucleotide polymorphism discovery, and its genotyping using next-generation sequencing. Using multiplexed inter-simple sequence repeat (ISSR) primers, thousands of genome-wide regions were amplified effectively from a wide variety of genomes, without prior genetic information. We demonstrated: 1) Mendelian gametic segregation of the discovered variants; 2) reproducibility of genotyping by checking its applicability for individual identification; and 3) applicability in a wide variety of species by checking standard population genetic analysis. This approach, called multiplexed ISSR genotyping by sequencing, should be applicable to many marker-assisted genetic studies with a wide range of DNA qualities and quantities. PMID:26593239

Adaptable gene-specific dye bias correction for two-channel DNA microarrays.

PubMed

Margaritis, Thanasis; Lijnzaad, Philip; van Leenen, Dik; Bouwmeester, Diane; Kemmeren, Patrick; van Hooff, Sander R; Holstege, Frank C P

2009-01-01

DNA microarray technology is a powerful tool for monitoring gene expression or for finding the location of DNA-bound proteins. DNA microarrays can suffer from gene-specific dye bias (GSDB), causing some probes to be affected more by the dye than by the sample. This results in large measurement errors, which vary considerably for different probes and also across different hybridizations. GSDB is not corrected by conventional normalization and has been difficult to address systematically because of its variance. We show that GSDB is influenced by label incorporation efficiency, explaining the variation of GSDB across different hybridizations. A correction method (Gene- And Slide-Specific Correction, GASSCO) is presented, whereby sequence-specific corrections are modulated by the overall bias of individual hybridizations. GASSCO outperforms earlier methods and works well on a variety of publically available datasets covering a range of platforms, organisms and applications, including ChIP on chip. A sequence-based model is also presented, which predicts which probes will suffer most from GSDB, useful for microarray probe design and correction of individual hybridizations. Software implementing the method is publicly available.

Adaptable gene-specific dye bias correction for two-channel DNA microarrays

PubMed Central

Margaritis, Thanasis; Lijnzaad, Philip; van Leenen, Dik; Bouwmeester, Diane; Kemmeren, Patrick; van Hooff, Sander R; Holstege, Frank CP

2009-01-01

DNA microarray technology is a powerful tool for monitoring gene expression or for finding the location of DNA-bound proteins. DNA microarrays can suffer from gene-specific dye bias (GSDB), causing some probes to be affected more by the dye than by the sample. This results in large measurement errors, which vary considerably for different probes and also across different hybridizations. GSDB is not corrected by conventional normalization and has been difficult to address systematically because of its variance. We show that GSDB is influenced by label incorporation efficiency, explaining the variation of GSDB across different hybridizations. A correction method (Gene- And Slide-Specific Correction, GASSCO) is presented, whereby sequence-specific corrections are modulated by the overall bias of individual hybridizations. GASSCO outperforms earlier methods and works well on a variety of publically available datasets covering a range of platforms, organisms and applications, including ChIP on chip. A sequence-based model is also presented, which predicts which probes will suffer most from GSDB, useful for microarray probe design and correction of individual hybridizations. Software implementing the method is publicly available. PMID:19401678

ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints

PubMed Central

He, Qiye; Johnston, Jeff; Zeitlinger, Julia

2014-01-01

Understanding how eukaryotic enhancers are bound and regulated by specific combinations of transcription factors is still a major challenge. To better map transcription factor binding genome-wide at nucleotide resolution in vivo, we have developed a robust ChIP-exo protocol called ChIP experiments with nucleotide resolution through exonuclease, unique barcode and single ligation (ChIP-nexus), which utilizes an efficient DNA self-circularization step during library preparation. Application of ChIP-nexus to four proteins—human TBP and Drosophila NFkB, Twist and Max— demonstrates that it outperforms existing ChIP protocols in resolution and specificity, pinpoints relevant binding sites within enhancers containing multiple binding motifs and allows the analysis of in vivo binding specificities. Notably, we show that Max frequently interacts with DNA sequences next to its motif, and that this binding pattern correlates with local DNA sequence features such as DNA shape. ChIP-nexus will be broadly applicable to studying in vivo transcription factor binding specificity and its relationship to cis-regulatory changes in humans and model organisms. PMID:25751057

Transcription profiling using RNA-Seq demonstrates expression differences in the body walls of juvenile albino and normal sea cucumbers Apostichopus japonicus

NASA Astrophysics Data System (ADS)

Ma, Deyou; Yang, Hongsheng; Sun, Lina; Chen, Muyan

2014-01-01

Sea cucumbers Apostichopus japonicus are one of the most important aquaculture species in China. Their normal body color is black to fit their surroundings. Wild albinos are rare and hard to breed. To understand the differences between albino and normal (control) sea cucumbers at the transcriptional level, we sequenced the transcriptomes in their body-wall tissues using RNA-Seq high-throughput sequencing. Approximately 4.876 million (M) and 4.884 M 200-nucleotide-long cDNA reads were produced in the cDNA libraries derived from the body walls of albino and control samples, respectively. A total of 9 561 (46.89%) putative genes were identified from among the RNA-Seq reads in both libraries. After filtering, 837 significantly differentially regulated genes were identified in the albino library compared with in the control library, and 3.6% of the differentially expressed genes (DEGs) were found to have changed those more than five-fold. The expression levels of 10 DEGs were checked by real-time PCR and the results were in full accord with the RNA-Seq expression trends, although the amplitude of the differences in expression levels was lower in all cases. A series of pathways were significantly enriched for the DEGs. These pathways were closely related to phagocytosis, the complement and coagulation cascades, apoptosis-related diseases, cytokine-cytokine receptor interaction, and cell adhesion. The differences in gene expression and enriched pathways between the albino and control sea cucumbers offer control targets for cultivating excellent albino A. japonicus strains in the future.

Base resolution methylome profiling: considerations in platform selection, data preprocessing and analysis

PubMed Central

Sun, Zhifu; Cunningham, Julie; Slager, Susan; Kocher, Jean-Pierre

2015-01-01

Bisulfite treatment-based methylation microarray (mainly Illumina 450K Infinium array) and next-generation sequencing (reduced representation bisulfite sequencing, Agilent SureSelect Human Methyl-Seq, NimbleGen SeqCap Epi CpGiant or whole-genome bisulfite sequencing) are commonly used for base resolution DNA methylome research. Although multiple tools and methods have been developed and used for the data preprocessing and analysis, confusions remains for these platforms including how and whether the 450k array should be normalized; which platform should be used to better fit researchers’ needs; and which statistical models would be more appropriate for differential methylation analysis. This review presents the commonly used platforms and compares the pros and cons of each in methylome profiling. We then discuss approaches to study design, data normalization, bias correction and model selection for differentially methylated individual CpGs and regions. PMID:26366945

Transcriptome Analysis at the Single-Cell Level Using SMART Technology.

PubMed

Fish, Rachel N; Bostick, Magnolia; Lehman, Alisa; Farmer, Andrew

2016-10-10

RNA sequencing (RNA-seq) is a powerful method for analyzing cell state, with minimal bias, and has broad applications within the biological sciences. However, transcriptome analysis of seemingly homogenous cell populations may in fact overlook significant heterogeneity that can be uncovered at the single-cell level. The ultra-low amount of RNA contained in a single cell requires extraordinarily sensitive and reproducible transcriptome analysis methods. As next-generation sequencing (NGS) technologies mature, transcriptome profiling by RNA-seq is increasingly being used to decipher the molecular signature of individual cells. This unit describes an ultra-sensitive and reproducible protocol to generate cDNA and sequencing libraries directly from single cells or RNA inputs ranging from 10 pg to 10 ng. Important considerations for working with minute RNA inputs are given. © 2016 by John Wiley & Sons, Inc. Copyright © 2016 John Wiley & Sons, Inc.

Detection of Bacterial Pathogens from Broncho-Alveolar Lavage by Next-Generation Sequencing.

PubMed

Leo, Stefano; Gaïa, Nadia; Ruppé, Etienne; Emonet, Stephane; Girard, Myriam; Lazarevic, Vladimir; Schrenzel, Jacques

2017-09-20

The applications of whole-metagenome shotgun sequencing (WMGS) in routine clinical analysis are still limited. A combination of a DNA extraction procedure, sequencing, and bioinformatics tools is essential for the removal of human DNA and for improving bacterial species identification in a timely manner. We tackled these issues with a broncho-alveolar lavage (BAL) sample from an immunocompromised patient who had developed severe chronic pneumonia. We extracted DNA from the BAL sample with protocols based either on sequential lysis of human and bacterial cells or on the mechanical disruption of all cells. Metagenomic libraries were sequenced on Illumina HiSeq platforms. Microbial community composition was determined by k-mer analysis or by mapping to taxonomic markers. Results were compared to those obtained by conventional clinical culture and molecular methods. Compared to mechanical cell disruption, a sequential lysis protocol resulted in a significantly increased proportion of bacterial DNA over human DNA and higher sequence coverage of Mycobacterium abscessus , Corynebacterium jeikeium and Rothia dentocariosa , the bacteria reported by clinical microbiology tests. In addition, we identified anaerobic bacteria not searched for by the clinical laboratory. Our results further support the implementation of WMGS in clinical routine diagnosis for bacterial identification.

Systolic array IC for genetic computation

NASA Technical Reports Server (NTRS)

Anderson, D.

1991-01-01

Measuring similarities between large sequences of genetic information is a formidable task requiring enormous amounts of computer time. Geneticists claim that nearly two months of CRAY-2 time are required to run a single comparison of the known database against the new bases that will be found this year, and more than a CRAY-2 year for next year's genetic discoveries, and so on. The DNA IC, designed at HP-ICBD in cooperation with the California Institute of Technology and the Jet Propulsion Laboratory, is being implemented in order to move the task of genetic comparison onto workstations and personal computers, while vastly improving performance. The chip is a systolic (pumped) array comprised of 16 processors, control logic, and global RAM, totaling 400,000 FETS. At 12 MHz, each chip performs 2.7 billion 16 bit operations per second. Using 35 of these chips in series on one PC board (performing nearly 100 billion operations per second), a sequence of 560 bases can be compared against the eventual total genome of 3 billion bases, in minutes--on a personal computer. While the designed purpose of the DNA chip is for genetic research, other disciplines requiring similarity measurements between strings of 7 bit encoded data could make use of this chip as well. Cryptography and speech recognition are two examples. A mix of full custom design and standard cells, in CMOS34, were used to achieve these goals. Innovative test methods were developed to enhance controllability and observability in the array. This paper describes these techniques as well as the chip's functionality. This chip was designed in the 1989-90 timeframe.

Identification of Predictive Cis-Regulatory Elements Using a Discriminative Objective Function and a Dynamic Search Space

PubMed Central

Karnik, Rahul; Beer, Michael A.

2015-01-01

The generation of genomic binding or accessibility data from massively parallel sequencing technologies such as ChIP-seq and DNase-seq continues to accelerate. Yet state-of-the-art computational approaches for the identification of DNA binding motifs often yield motifs of weak predictive power. Here we present a novel computational algorithm called MotifSpec, designed to find predictive motifs, in contrast to over-represented sequence elements. The key distinguishing feature of this algorithm is that it uses a dynamic search space and a learned threshold to find discriminative motifs in combination with the modeling of motifs using a full PWM (position weight matrix) rather than k-mer words or regular expressions. We demonstrate that our approach finds motifs corresponding to known binding specificities in several mammalian ChIP-seq datasets, and that our PWMs classify the ChIP-seq signals with accuracy comparable to, or marginally better than motifs from the best existing algorithms. In other datasets, our algorithm identifies novel motifs where other methods fail. Finally, we apply this algorithm to detect motifs from expression datasets in C. elegans using a dynamic expression similarity metric rather than fixed expression clusters, and find novel predictive motifs. PMID:26465884

Identification of Predictive Cis-Regulatory Elements Using a Discriminative Objective Function and a Dynamic Search Space.

PubMed

Karnik, Rahul; Beer, Michael A

2015-01-01

The generation of genomic binding or accessibility data from massively parallel sequencing technologies such as ChIP-seq and DNase-seq continues to accelerate. Yet state-of-the-art computational approaches for the identification of DNA binding motifs often yield motifs of weak predictive power. Here we present a novel computational algorithm called MotifSpec, designed to find predictive motifs, in contrast to over-represented sequence elements. The key distinguishing feature of this algorithm is that it uses a dynamic search space and a learned threshold to find discriminative motifs in combination with the modeling of motifs using a full PWM (position weight matrix) rather than k-mer words or regular expressions. We demonstrate that our approach finds motifs corresponding to known binding specificities in several mammalian ChIP-seq datasets, and that our PWMs classify the ChIP-seq signals with accuracy comparable to, or marginally better than motifs from the best existing algorithms. In other datasets, our algorithm identifies novel motifs where other methods fail. Finally, we apply this algorithm to detect motifs from expression datasets in C. elegans using a dynamic expression similarity metric rather than fixed expression clusters, and find novel predictive motifs.

Digital gene expression analysis with sample multiplexing and PCR duplicate detection: A straightforward protocol.

PubMed

Rozenberg, Andrey; Leese, Florian; Weiss, Linda C; Tollrian, Ralph

2016-01-01

Tag-Seq is a high-throughput approach used for discovering SNPs and characterizing gene expression. In comparison to RNA-Seq, Tag-Seq eases data processing and allows detection of rare mRNA species using only one tag per transcript molecule. However, reduced library complexity raises the issue of PCR duplicates, which distort gene expression levels. Here we present a novel Tag-Seq protocol that uses the least biased methods for RNA library preparation combined with a novel approach for joint PCR template and sample labeling. In our protocol, input RNA is fragmented by hydrolysis, and poly(A)-bearing RNAs are selected and directly ligated to mixed DNA-RNA P5 adapters. The P5 adapters contain i5 barcodes composed of sample-specific (moderately) degenerate base regions (mDBRs), which later allow detection of PCR duplicates. The P7 adapter is attached via reverse transcription with individual i7 barcodes added during the amplification step. The resulting libraries can be sequenced on an Illumina sequencer. After sample demultiplexing and PCR duplicate removal with a free software tool we designed, the data are ready for downstream analysis. Our protocol was tested on RNA samples from predator-induced and control Daphnia microcrustaceans.

Differences in DNA Binding Specificity of Floral Homeotic Protein Complexes Predict Organ-Specific Target Genes.

PubMed

Smaczniak, Cezary; Muiño, Jose M; Chen, Dijun; Angenent, Gerco C; Kaufmann, Kerstin

2017-08-01

Floral organ identities in plants are specified by the combinatorial action of homeotic master regulatory transcription factors. However, how these factors achieve their regulatory specificities is still largely unclear. Genome-wide in vivo DNA binding data show that homeotic MADS domain proteins recognize partly distinct genomic regions, suggesting that DNA binding specificity contributes to functional differences of homeotic protein complexes. We used in vitro systematic evolution of ligands by exponential enrichment followed by high-throughput DNA sequencing (SELEX-seq) on several floral MADS domain protein homo- and heterodimers to measure their DNA binding specificities. We show that specification of reproductive organs is associated with distinct binding preferences of a complex formed by SEPALLATA3 and AGAMOUS. Binding specificity is further modulated by different binding site spacing preferences. Combination of SELEX-seq and genome-wide DNA binding data allows differentiation between targets in specification of reproductive versus perianth organs in the flower. We validate the importance of DNA binding specificity for organ-specific gene regulation by modulating promoter activity through targeted mutagenesis. Our study shows that intrafamily protein interactions affect DNA binding specificity of floral MADS domain proteins. Differential DNA binding of MADS domain protein complexes plays a role in the specificity of target gene regulation. © 2017 American Society of Plant Biologists. All rights reserved.

A simple method for semi-random DNA amplicon fragmentation using the methylation-dependent restriction enzyme MspJI.

PubMed

Shinozuka, Hiroshi; Cogan, Noel O I; Shinozuka, Maiko; Marshall, Alexis; Kay, Pippa; Lin, Yi-Han; Spangenberg, German C; Forster, John W

2015-04-11

Fragmentation at random nucleotide locations is an essential process for preparation of DNA libraries to be used on massively parallel short-read DNA sequencing platforms. Although instruments for physical shearing, such as the Covaris S2 focused-ultrasonicator system, and products for enzymatic shearing, such as the Nextera technology and NEBNext dsDNA Fragmentase kit, are commercially available, a simple and inexpensive method is desirable for high-throughput sequencing library preparation. MspJI is a recently characterised restriction enzyme which recognises the sequence motif CNNR (where R = G or A) when the first base is modified to 5-methylcytosine or 5-hydroxymethylcytosine. A semi-random enzymatic DNA amplicon fragmentation method was developed based on the unique cleavage properties of MspJI. In this method, random incorporation of 5-methyl-2'-deoxycytidine-5'-triphosphate is achieved through DNA amplification with DNA polymerase, followed by DNA digestion with MspJI. Due to the recognition sequence of the enzyme, DNA amplicons are fragmented in a relatively sequence-independent manner. The size range of the resulting fragments was capable of control through optimisation of 5-methyl-2'-deoxycytidine-5'-triphosphate concentration in the reaction mixture. A library suitable for sequencing using the Illumina MiSeq platform was prepared and processed using the proposed method. Alignment of generated short reads to a reference sequence demonstrated a relatively high level of random fragmentation. The proposed method may be performed with standard laboratory equipment. Although the uniformity of coverage was slightly inferior to the Covaris physical shearing procedure, due to efficiencies of cost and labour, the method may be more suitable than existing approaches for implementation in large-scale sequencing activities, such as bacterial artificial chromosome (BAC)-based genome sequence assembly, pan-genomic studies and locus-targeted genotyping-by-sequencing.

Nitrogen Cycle Evaluation (NiCE) Chip for the Simultaneous Analysis of Multiple N-Cycle Associated Genes.

PubMed

Oshiki, Mamoru; Segawa, Takahiro; Ishii, Satoshi

2018-02-02

Various microorganisms play key roles in the Nitrogen (N) cycle. Quantitative PCR (qPCR) and PCR-amplicon sequencing of the N cycle functional genes allow us to analyze the abundance and diversity of microbes responsible in the N transforming reactions in various environmental samples. However, analysis of multiple target genes can be cumbersome and expensive. PCR-independent analysis, such as metagenomics and metatranscriptomics, is useful but expensive especially when we analyze multiple samples and try to detect N cycle functional genes present at relatively low abundance. Here, we present the application of microfluidic qPCR chip technology to simultaneously quantify and prepare amplicon sequence libraries for multiple N cycle functional genes as well as taxon-specific 16S rRNA gene markers for many samples. This approach, named as N cycle evaluation (NiCE) chip, was evaluated by using DNA from pure and artificially mixed bacterial cultures and by comparing the results with those obtained by conventional qPCR and amplicon sequencing methods. Quantitative results obtained by the NiCE chip were comparable to those obtained by conventional qPCR. In addition, the NiCE chip was successfully applied to examine abundance and diversity of N cycle functional genes in wastewater samples. Although non-specific amplification was detected on the NiCE chip, this could be overcome by optimizing the primer sequences in the future. As the NiCE chip can provide high-throughput format to quantify and prepare sequence libraries for multiple N cycle functional genes, this tool should advance our ability to explore N cycling in various samples. Importance. We report a novel approach, namely Nitrogen Cycle Evaluation (NiCE) chip by using microfluidic qPCR chip technology. By sequencing the amplicons recovered from the NiCE chip, we can assess diversities of the N cycle functional genes. The NiCE chip technology is applicable to analyze the temporal dynamics of the N cycle gene transcriptions in wastewater treatment bioreactors. The NiCE chip can provide high-throughput format to quantify and prepare sequence libraries for multiple N cycle functional genes. While there is a room for future improvement, this tool should significantly advance our ability to explore the N cycle in various environmental samples. Copyright © 2018 American Society for Microbiology.

Next-Generation Genomics Facility at C-CAMP: Accelerating Genomic Research in India

PubMed Central

S, Chandana; Russiachand, Heikham; H, Pradeep; S, Shilpa; M, Ashwini; S, Sahana; B, Jayanth; Atla, Goutham; Jain, Smita; Arunkumar, Nandini; Gowda, Malali

2014-01-01

Next-Generation Sequencing (NGS; http://www.genome.gov/12513162) is a recent life-sciences technological revolution that allows scientists to decode genomes or transcriptomes at a much faster rate with a lower cost. Genomic-based studies are in a relatively slow pace in India due to the non-availability of genomics experts, trained personnel and dedicated service providers. Using NGS there is a lot of potential to study India's national diversity (of all kinds). We at the Centre for Cellular and Molecular Platforms (C-CAMP) have launched the Next Generation Genomics Facility (NGGF) to provide genomics service to scientists, to train researchers and also work on national and international genomic projects. We have HiSeq1000 from Illumina and GS-FLX Plus from Roche454. The long reads from GS FLX Plus, and high sequence depth from HiSeq1000, are the best and ideal hybrid approaches for de novo and re-sequencing of genomes and transcriptomes. At our facility, we have sequenced around 70 different organisms comprising of more than 388 genomes and 615 transcriptomes – prokaryotes and eukaryotes (fungi, plants and animals). In addition we have optimized other unique applications such as small RNA (miRNA, siRNA etc), long Mate-pair sequencing (2 to 20 Kb), Coding sequences (Exome), Methylome (ChIP-Seq), Restriction Mapping (RAD-Seq), Human Leukocyte Antigen (HLA) typing, mixed genomes (metagenomes) and target amplicons, etc. Translating DNA sequence data from NGS sequencer into meaningful information is an important exercise. Under NGGF, we have bioinformatics experts and high-end computing resources to dissect NGS data such as genome assembly and annotation, gene expression, target enrichment, variant calling (SSR or SNP), comparative analysis etc. Our services (sequencing and bioinformatics) have been utilized by more than 45 organizations (academia and industry) both within India and outside, resulting several publications in peer-reviewed journals and several genomic/transcriptomic data is available at NCBI.

Reproducibility of Illumina platform deep sequencing errors allows accurate determination of DNA barcodes in cells.

PubMed

Beltman, Joost B; Urbanus, Jos; Velds, Arno; van Rooij, Nienke; Rohr, Jan C; Naik, Shalin H; Schumacher, Ton N

2016-04-02

Next generation sequencing (NGS) of amplified DNA is a powerful tool to describe genetic heterogeneity within cell populations that can both be used to investigate the clonal structure of cell populations and to perform genetic lineage tracing. For applications in which both abundant and rare sequences are biologically relevant, the relatively high error rate of NGS techniques complicates data analysis, as it is difficult to distinguish rare true sequences from spurious sequences that are generated by PCR or sequencing errors. This issue, for instance, applies to cellular barcoding strategies that aim to follow the amount and type of offspring of single cells, by supplying these with unique heritable DNA tags. Here, we use genetic barcoding data from the Illumina HiSeq platform to show that straightforward read threshold-based filtering of data is typically insufficient to filter out spurious barcodes. Importantly, we demonstrate that specific sequencing errors occur at an approximately constant rate across different samples that are sequenced in parallel. We exploit this observation by developing a novel approach to filter out spurious sequences. Application of our new method demonstrates its value in the identification of true sequences amongst spurious sequences in biological data sets.

Distributed biotin–streptavidin transcription roadblocks for mapping cotranscriptional RNA folding

PubMed Central

Strobel, Eric J.; Nedialkov, Yuri; Artsimovitch, Irina

2017-01-01

Abstract RNA folding during transcription directs an order of folding that can determine RNA structure and function. However, the experimental study of cotranscriptional RNA folding has been limited by the lack of easily approachable methods that can interrogate nascent RNA structure at nucleotide resolution. To address this, we previously developed cotranscriptional selective 2΄-hydroxyl acylation analyzed by primer extension sequencing (SHAPE-Seq) to simultaneously probe all intermediate RNA transcripts during transcription by stalling elongation complexes at catalytically dead EcoRIE111Q roadblocks. While effective, the distribution of elongation complexes using EcoRIE111Q requires laborious PCR using many different oligonucleotides for each sequence analyzed. Here, we improve the broad applicability of cotranscriptional SHAPE-Seq by developing a sequence-independent biotin–streptavidin (SAv) roadblocking strategy that simplifies the preparation of roadblocking DNA templates. We first determine the properties of biotin–SAv roadblocks. We then show that randomly distributed biotin–SAv roadblocks can be used in cotranscriptional SHAPE-Seq experiments to identify the same RNA structural transitions related to a riboswitch decision-making process that we previously identified using EcoRIE111Q. Lastly, we find that EcoRIE111Q maps nascent RNA structure to specific transcript lengths more precisely than biotin–SAv and propose guidelines to leverage the complementary strengths of each transcription roadblock in cotranscriptional SHAPE-Seq. PMID:28398514

High-sensitivity HLA typing by Saturated Tiling Capture Sequencing (STC-Seq).

PubMed

Jiao, Yang; Li, Ran; Wu, Chao; Ding, Yibin; Liu, Yanning; Jia, Danmei; Wang, Lifeng; Xu, Xiang; Zhu, Jing; Zheng, Min; Jia, Junling

2018-01-15

Highly polymorphic human leukocyte antigen (HLA) genes are responsible for fine-tuning the adaptive immune system. High-resolution HLA typing is important for the treatment of autoimmune and infectious diseases. Additionally, it is routinely performed for identifying matched donors in transplantation medicine. Although many HLA typing approaches have been developed, the complexity, low-efficiency and high-cost of current HLA-typing assays limit their application in population-based high-throughput HLA typing for donors, which is required for creating large-scale databases for transplantation and precision medicine. Here, we present a cost-efficient Saturated Tiling Capture Sequencing (STC-Seq) approach to capturing 14 HLA class I and II genes. The highly efficient capture (an approximately 23,000-fold enrichment) of these genes allows for simplified allele calling. Tests on five genes (HLA-A/B/C/DRB1/DQB1) from 31 human samples and 351 datasets using STC-Seq showed results that were 98% consistent with the known two sets of digitals (field1 and field2) genotypes. Additionally, STC can capture genomic DNA fragments longer than 3 kb from HLA loci, making the library compatible with the third-generation sequencing. STC-Seq is a highly accurate and cost-efficient method for HLA typing which can be used to facilitate the establishment of population-based HLA databases for the precision and transplantation medicine.

Distributed biotin-streptavidin transcription roadblocks for mapping cotranscriptional RNA folding.

PubMed

Strobel, Eric J; Watters, Kyle E; Nedialkov, Yuri; Artsimovitch, Irina; Lucks, Julius B

2017-07-07

RNA folding during transcription directs an order of folding that can determine RNA structure and function. However, the experimental study of cotranscriptional RNA folding has been limited by the lack of easily approachable methods that can interrogate nascent RNA structure at nucleotide resolution. To address this, we previously developed cotranscriptional selective 2΄-hydroxyl acylation analyzed by primer extension sequencing (SHAPE-Seq) to simultaneously probe all intermediate RNA transcripts during transcription by stalling elongation complexes at catalytically dead EcoRIE111Q roadblocks. While effective, the distribution of elongation complexes using EcoRIE111Q requires laborious PCR using many different oligonucleotides for each sequence analyzed. Here, we improve the broad applicability of cotranscriptional SHAPE-Seq by developing a sequence-independent biotin-streptavidin (SAv) roadblocking strategy that simplifies the preparation of roadblocking DNA templates. We first determine the properties of biotin-SAv roadblocks. We then show that randomly distributed biotin-SAv roadblocks can be used in cotranscriptional SHAPE-Seq experiments to identify the same RNA structural transitions related to a riboswitch decision-making process that we previously identified using EcoRIE111Q. Lastly, we find that EcoRIE111Q maps nascent RNA structure to specific transcript lengths more precisely than biotin-SAv and propose guidelines to leverage the complementary strengths of each transcription roadblock in cotranscriptional SHAPE-Seq. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

CNV-seq, a new method to detect copy number variation using high-throughput sequencing.

PubMed

Xie, Chao; Tammi, Martti T

2009-03-06

DNA copy number variation (CNV) has been recognized as an important source of genetic variation. Array comparative genomic hybridization (aCGH) is commonly used for CNV detection, but the microarray platform has a number of inherent limitations. Here, we describe a method to detect copy number variation using shotgun sequencing, CNV-seq. The method is based on a robust statistical model that describes the complete analysis procedure and allows the computation of essential confidence values for detection of CNV. Our results show that the number of reads, not the length of the reads is the key factor determining the resolution of detection. This favors the next-generation sequencing methods that rapidly produce large amount of short reads. Simulation of various sequencing methods with coverage between 0.1x to 8x show overall specificity between 91.7 - 99.9%, and sensitivity between 72.2 - 96.5%. We also show the results for assessment of CNV between two individual human genomes.

A reference human genome dataset of the BGISEQ-500 sequencer.

PubMed

Huang, Jie; Liang, Xinming; Xuan, Yuankai; Geng, Chunyu; Li, Yuxiang; Lu, Haorong; Qu, Shoufang; Mei, Xianglin; Chen, Hongbo; Yu, Ting; Sun, Nan; Rao, Junhua; Wang, Jiahao; Zhang, Wenwei; Chen, Ying; Liao, Sha; Jiang, Hui; Liu, Xin; Yang, Zhaopeng; Mu, Feng; Gao, Shangxian

2017-05-01

BGISEQ-500 is a new desktop sequencer developed by BGI. Using DNA nanoball and combinational probe anchor synthesis developed from Complete Genomics™ sequencing technologies, it generates short reads at a large scale. Here, we present the first human whole-genome sequencing dataset of BGISEQ-500. The dataset was generated by sequencing the widely used cell line HG001 (NA12878) in two sequencing runs of paired-end 50 bp (PE50) and two sequencing runs of paired-end 100 bp (PE100). We also include examples of the raw images from the sequencer for reference. Finally, we identified variations using this dataset, estimated the accuracy of the variations, and compared to that of the variations identified from similar amounts of publicly available HiSeq2500 data. We found similar single nucleotide polymorphism (SNP) detection accuracy for the BGISEQ-500 PE100 data (false positive rate [FPR] = 0.00020%, sensitivity = 96.20%) compared to the PE150 HiSeq2500 data (FPR = 0.00017%, sensitivity = 96.60%) better SNP detection accuracy than the PE50 data (FPR = 0.0006%, sensitivity = 94.15%). But for insertions and deletions (indels), we found lower accuracy for BGISEQ-500 data (FPR = 0.00069% and 0.00067% for PE100 and PE50 respectively, sensitivity = 88.52% and 70.93%) than the HiSeq2500 data (FPR = 0.00032%, sensitivity = 96.28%). Our dataset can serve as the reference dataset, providing basic information not just for future development, but also for all research and applications based on the new sequencing platform. © The Authors 2017. Published by Oxford University Press.

Design of RNA splicing analysis null models for post hoc filtering of Drosophila head RNA-Seq data with the splicing analysis kit (Spanki)

PubMed Central

2013-01-01

Background The production of multiple transcript isoforms from one gene is a major source of transcriptome complexity. RNA-Seq experiments, in which transcripts are converted to cDNA and sequenced, allow the resolution and quantification of alternative transcript isoforms. However, methods to analyze splicing are underdeveloped and errors resulting in incorrect splicing calls occur in every experiment. Results We used RNA-Seq data to develop sequencing and aligner error models. By applying these error models to known input from simulations, we found that errors result from false alignment to minor splice motifs and antisense stands, shifted junction positions, paralog joining, and repeat induced gaps. By using a series of quantitative and qualitative filters, we eliminated diagnosed errors in the simulation, and applied this to RNA-Seq data from Drosophila melanogaster heads. We used high-confidence junction detections to specifically interrogate local splicing differences between transcripts. This method out-performed commonly used RNA-seq methods to identify known alternative splicing events in the Drosophila sex determination pathway. We describe a flexible software package to perform these tasks called Splicing Analysis Kit (Spanki), available at http://www.cbcb.umd.edu/software/spanki. Conclusions Splice-junction centric analysis of RNA-Seq data provides advantages in specificity for detection of alternative splicing. Our software provides tools to better understand error profiles in RNA-Seq data and improve inference from this new technology. The splice-junction centric approach that this software enables will provide more accurate estimates of differentially regulated splicing than current tools. PMID:24209455

Design of RNA splicing analysis null models for post hoc filtering of Drosophila head RNA-Seq data with the splicing analysis kit (Spanki).

PubMed

Sturgill, David; Malone, John H; Sun, Xia; Smith, Harold E; Rabinow, Leonard; Samson, Marie-Laure; Oliver, Brian

2013-11-09

The production of multiple transcript isoforms from one gene is a major source of transcriptome complexity. RNA-Seq experiments, in which transcripts are converted to cDNA and sequenced, allow the resolution and quantification of alternative transcript isoforms. However, methods to analyze splicing are underdeveloped and errors resulting in incorrect splicing calls occur in every experiment. We used RNA-Seq data to develop sequencing and aligner error models. By applying these error models to known input from simulations, we found that errors result from false alignment to minor splice motifs and antisense stands, shifted junction positions, paralog joining, and repeat induced gaps. By using a series of quantitative and qualitative filters, we eliminated diagnosed errors in the simulation, and applied this to RNA-Seq data from Drosophila melanogaster heads. We used high-confidence junction detections to specifically interrogate local splicing differences between transcripts. This method out-performed commonly used RNA-seq methods to identify known alternative splicing events in the Drosophila sex determination pathway. We describe a flexible software package to perform these tasks called Splicing Analysis Kit (Spanki), available at http://www.cbcb.umd.edu/software/spanki. Splice-junction centric analysis of RNA-Seq data provides advantages in specificity for detection of alternative splicing. Our software provides tools to better understand error profiles in RNA-Seq data and improve inference from this new technology. The splice-junction centric approach that this software enables will provide more accurate estimates of differentially regulated splicing than current tools.

Pyicos: a versatile toolkit for the analysis of high-throughput sequencing data

PubMed Central

Althammer, Sonja; González-Vallinas, Juan; Ballaré, Cecilia; Beato, Miguel; Eyras, Eduardo

2011-01-01

Motivation: High-throughput sequencing (HTS) has revolutionized gene regulation studies and is now fundamental for the detection of protein–DNA and protein–RNA binding, as well as for measuring RNA expression. With increasing variety and sequencing depth of HTS datasets, the need for more flexible and memory-efficient tools to analyse them is growing. Results: We describe Pyicos, a powerful toolkit for the analysis of mapped reads from diverse HTS experiments: ChIP-Seq, either punctuated or broad signals, CLIP-Seq and RNA-Seq. We prove the effectiveness of Pyicos to select for significant signals and show that its accuracy is comparable and sometimes superior to that of methods specifically designed for each particular type of experiment. Pyicos facilitates the analysis of a variety of HTS datatypes through its flexibility and memory efficiency, providing a useful framework for data integration into models of regulatory genomics. Availability: Open-source software, with tutorials and protocol files, is available at http://regulatorygenomics.upf.edu/pyicos or as a Galaxy server at http://regulatorygenomics.upf.edu/galaxy Contact: eduardo.eyras@upf.edu Supplementary Information: Supplementary data are available at Bioinformatics online. PMID:21994224

Protospacer Adjacent Motif (PAM)-Distal Sequences Engage CRISPR Cas9 DNA Target Cleavage

PubMed Central

Ethier, Sylvain; Schmeing, T. Martin; Dostie, Josée; Pelletier, Jerry

2014-01-01

The clustered regularly interspaced short palindromic repeat (CRISPR)-associated enzyme Cas9 is an RNA-guided nuclease that has been widely adapted for genome editing in eukaryotic cells. However, the in vivo target specificity of Cas9 is poorly understood and most studies rely on in silico predictions to define the potential off-target editing spectrum. Using chromatin immunoprecipitation followed by sequencing (ChIP-seq), we delineate the genome-wide binding panorama of catalytically inactive Cas9 directed by two different single guide (sg) RNAs targeting the Trp53 locus. Cas9:sgRNA complexes are able to load onto multiple sites with short seed regions adjacent to 5′NGG3′ protospacer adjacent motifs (PAM). Yet among 43 ChIP-seq sites harboring seed regions analyzed for mutational status, we find editing only at the intended on-target locus and one off-target site. In vitro analysis of target site recognition revealed that interactions between the 5′ end of the guide and PAM-distal target sequences are necessary to efficiently engage Cas9 nucleolytic activity, providing an explanation for why off-target editing is significantly lower than expected from ChIP-seq data. PMID:25275497

19 CFR 12.39 - Imported articles involving unfair methods of competition or practices.

Code of Federal Regulations, 2011 CFR

2011-04-01

... the authorization or consent of the Government. (e) Importations of semiconductor chip products. (1) In accordance with the Semiconductor Chip Protection Act of 1984 (17 U.S.C. 901 et seq.), if the... imported semiconductor chip products which infringe his rights in such mask work, the owner must obtain a...

Mansonella ozzardi mitogenome and pseudogene characterisation provides new perspectives on filarial parasite systematics and CO-1 barcoding.

PubMed

Crainey, James Lee; Marín, Michel Abanto; Silva, Túllio Romão Ribeiro da; de Medeiros, Jansen Fernandes; Pessoa, Felipe Arley Costa; Santos, Yago Vinícius; Vicente, Ana Carolina Paulo; Luz, Sérgio Luiz Bessa

2018-04-18

Despite the broad distribution of M. ozzardi in Latin America and the Caribbean, there is still very little DNA sequence data available to study this neglected parasite's epidemiology. Mitochondrial DNA (mtDNA) sequences, especially the cytochrome oxidase (CO1) gene's barcoding region, have been targeted successfully for filarial diagnostics and for epidemiological, ecological and evolutionary studies. MtDNA-based studies can, however, be compromised by unrecognised mitochondrial pseudogenes, such as Numts. Here, we have used shot-gun Illumina-HiSeq sequencing to recover the first complete Mansonella genus mitogenome and to identify several mitochondrial-origin pseudogenes. Mitogenome phylogenetic analysis placed M. ozzardi in the Onchocercidae "ONC5" clade and suggested that Mansonella parasites are more closely related to Wuchereria and Brugia genera parasites than they are to Loa genus parasites. DNA sequence alignments, BLAST searches and conceptual translations have been used to compliment phylogenetic analysis showing that M. ozzardi from the Amazon and Caribbean regions are near-identical and that previously reported Peruvian M. ozzardi CO1 reference sequences are probably of pseudogene origin. In addition to adding a much-needed resource to the Mansonella genus's molecular tool-kit and providing evidence that some M. ozzardi CO1 sequence deposits are pseudogenes, our results suggest that all Neotropical M. ozzardi parasites are closely related.

Microfluidic Chip-Based Detection and Intraspecies Strain Discrimination of Salmonella Serovars Derived from Whole Blood of Septic Mice

PubMed Central

Patterson, Adriana S.; Heithoff, Douglas M.; Ferguson, Brian S.; Soh, H. Tom; Mahan, Michael J.

2013-01-01

Salmonella is a zoonotic pathogen that poses a considerable public health and economic burden in the United States and worldwide. Resultant human diseases range from enterocolitis to bacteremia to sepsis and are acutely dependent on the particular serovar of Salmonella enterica subsp. enterica, which comprises over 99% of human-pathogenic S. enterica isolates. Point-of-care methods for detection and strain discrimination of Salmonella serovars would thus have considerable benefit to medical, veterinary, and field applications that safeguard public health and reduce industry-associated losses. Here we describe a single, disposable microfluidic chip that supports isothermal amplification and sequence-specific detection and discrimination of Salmonella serovars derived from whole blood of septic mice. The integrated microfluidic electrochemical DNA (IMED) chip consists of an amplification chamber that supports loop-mediated isothermal amplification (LAMP), a rapid, single-temperature amplification method as an alternative to PCR that offers advantages in terms of sensitivity, reaction speed, and amplicon yield. The amplification chamber is connected via a microchannel to a detection chamber containing a reagentless, multiplexed (here biplex) sensing array for sequence-specific electrochemical DNA (E-DNA) detection of the LAMP products. Validation of the IMED device was assessed by the detection and discrimination of S. enterica subsp. enterica serovars Typhimurium and Choleraesuis, the causative agents of enterocolitis and sepsis in humans, respectively. IMED chips conferred rapid (under 2 h) detection and discrimination of these strains at clinically relevant levels (<1,000 CFU/ml) from whole, unprocessed blood collected from septic animals. The IMED-based chip assay shows considerable promise as a rapid, inexpensive, and portable point-of-care diagnostic platform for the detection and strain-specific discrimination of microbial pathogens. PMID:23354710

RNA Polymerase II Regulates Topoisomerase 1 Activity to Favor Efficient Transcription.

PubMed

Baranello, Laura; Wojtowicz, Damian; Cui, Kairong; Devaiah, Ballachanda N; Chung, Hye-Jung; Chan-Salis, Ka Yim; Guha, Rajarshi; Wilson, Kelli; Zhang, Xiaohu; Zhang, Hongliang; Piotrowski, Jason; Thomas, Craig J; Singer, Dinah S; Pugh, B Franklin; Pommier, Yves; Przytycka, Teresa M; Kouzine, Fedor; Lewis, Brian A; Zhao, Keji; Levens, David

2016-04-07

We report a mechanism through which the transcription machinery directly controls topoisomerase 1 (TOP1) activity to adjust DNA topology throughout the transcription cycle. By comparing TOP1 occupancy using chromatin immunoprecipitation sequencing (ChIP-seq) versus TOP1 activity using topoisomerase 1 sequencing (TOP1-seq), a method reported here to map catalytically engaged TOP1, TOP1 bound at promoters was discovered to become fully active only after pause-release. This transition coupled the phosphorylation of the carboxyl-terminal-domain (CTD) of RNA polymerase II (RNAPII) with stimulation of TOP1 above its basal rate, enhancing its processivity. TOP1 stimulation is strongly dependent on the kinase activity of BRD4, a protein that phosphorylates Ser2-CTD and regulates RNAPII pause-release. Thus the coordinated action of BRD4 and TOP1 overcame the torsional stress opposing transcription as RNAPII commenced elongation but preserved negative supercoiling that assists promoter melting at start sites. This nexus between transcription and DNA topology promises to elicit new strategies to intercept pathological gene expression. Copyright © 2016 Elsevier Inc. All rights reserved.

Primer and platform effects on 16S rRNA tag sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tremblay, Julien; Singh, Kanwar; Fern, Alison

Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

Primer and platform effects on 16S rRNA tag sequencing

DOE PAGES

Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...

2015-08-04

Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

Modified RNA-seq method for microbial community and diversity analysis using rRNA in different types of environmental samples

PubMed Central

Yan, Yong-Wei; Zou, Bin; Zhu, Ting; Hozzein, Wael N.

2017-01-01

RNA-seq-based SSU (small subunit) rRNA (ribosomal RNA) analysis has provided a better understanding of potentially active microbial community within environments. However, for RNA-seq library construction, high quantities of purified RNA are typically required. We propose a modified RNA-seq method for SSU rRNA-based microbial community analysis that depends on the direct ligation of a 5’ adaptor to RNA before reverse-transcription. The method requires only a low-input quantity of RNA (10–100 ng) and does not require a DNA removal step. The method was initially tested on three mock communities synthesized with enriched SSU rRNA of archaeal, bacterial and fungal isolates at different ratios, and was subsequently used for environmental samples of high or low biomass. For high-biomass salt-marsh sediments, enriched SSU rRNA and total nucleic acid-derived RNA-seq datasets revealed highly consistent community compositions for all of the SSU rRNA sequences, and as much as 46.4%-59.5% of 16S rRNA sequences were suitable for OTU (operational taxonomic unit)-based community and diversity analyses with complete coverage of V1-V2 regions. OTU-based community structures for the two datasets were also highly consistent with those determined by all of the 16S rRNA reads. For low-biomass samples, total nucleic acid-derived RNA-seq datasets were analyzed, and highly active bacterial taxa were also identified by the OTU-based method, notably including members of the previously underestimated genus Nitrospira and phylum Acidobacteria in tap water, members of the phylum Actinobacteria on a shower curtain, and members of the phylum Cyanobacteria on leaf surfaces. More than half of the bacterial 16S rRNA sequences covered the complete region of primer 8F, and non-coverage rates as high as 38.7% were obtained for phylum-unclassified sequences, providing many opportunities to identify novel bacterial taxa. This modified RNA-seq method will provide a better snapshot of diverse microbial communities, most notably by OTU-based analysis, even communities with low-biomass samples. PMID:29016661

An optimized methodology for whole genome sequencing of RNA respiratory viruses from nasopharyngeal aspirates.

PubMed

Goya, Stephanie; Valinotto, Laura E; Tittarelli, Estefania; Rojo, Gabriel L; Nabaes Jodar, Mercedes S; Greninger, Alexander L; Zaiat, Jonathan J; Marti, Marcelo A; Mistchenko, Alicia S; Viegas, Mariana

2018-01-01

Over the last decade, the number of viral genome sequences deposited in available databases has grown exponentially. However, sequencing methodology vary widely and many published works have relied on viral enrichment by viral culture or nucleic acid amplification with specific primers rather than through unbiased techniques such as metagenomics. The genome of RNA viruses is highly variable and these enrichment methodologies may be difficult to achieve or may bias the results. In order to obtain genomic sequences of human respiratory syncytial virus (HRSV) from positive nasopharyngeal aspirates diverse methodologies were evaluated and compared. A total of 29 nearly complete and complete viral genomes were obtained. The best performance was achieved with a DNase I treatment to the RNA directly extracted from the nasopharyngeal aspirate (NPA), sequence-independent single-primer amplification (SISPA) and library preparation performed with Nextera XT DNA Library Prep Kit with manual normalization. An average of 633,789 and 1,674,845 filtered reads per library were obtained with MiSeq and NextSeq 500 platforms, respectively. The higher output of NextSeq 500 was accompanied by the increasing of duplicated reads percentage generated during SISPA (from an average of 1.5% duplicated viral reads in MiSeq to an average of 74% in NextSeq 500). HRSV genome recovery was not affected by the presence or absence of duplicated reads but the computational demand during the analysis was increased. Considering that only samples with viral load ≥ E+06 copies/ml NPA were tested, no correlation between sample viral loads and number of total filtered reads was observed, nor with the mapped viral reads. The HRSV genomes showed a mean coverage of 98.46% with the best methodology. In addition, genomes of human metapneumovirus (HMPV), human rhinovirus (HRV) and human parainfluenza virus types 1-3 (HPIV1-3) were also obtained with the selected optimal methodology.

GUIDEseq: a bioconductor package to analyze GUIDE-Seq datasets for CRISPR-Cas nucleases.

PubMed

Zhu, Lihua Julie; Lawrence, Michael; Gupta, Ankit; Pagès, Hervé; Kucukural, Alper; Garber, Manuel; Wolfe, Scot A

2017-05-15

Genome editing technologies developed around the CRISPR-Cas9 nuclease system have facilitated the investigation of a broad range of biological questions. These nucleases also hold tremendous promise for treating a variety of genetic disorders. In the context of their therapeutic application, it is important to identify the spectrum of genomic sequences that are cleaved by a candidate nuclease when programmed with a particular guide RNA, as well as the cleavage efficiency of these sites. Powerful new experimental approaches, such as GUIDE-seq, facilitate the sensitive, unbiased genome-wide detection of nuclease cleavage sites within the genome. Flexible bioinformatics analysis tools for processing GUIDE-seq data are needed. Here, we describe an open source, open development software suite, GUIDEseq, for GUIDE-seq data analysis and annotation as a Bioconductor package in R. The GUIDEseq package provides a flexible platform with more than 60 adjustable parameters for the analysis of datasets associated with custom nuclease applications. These parameters allow data analysis to be tailored to different nuclease platforms with different length and complexity in their guide and PAM recognition sequences or their DNA cleavage position. They also enable users to customize sequence aggregation criteria, and vary peak calling thresholds that can influence the number of potential off-target sites recovered. GUIDEseq also annotates potential off-target sites that overlap with genes based on genome annotation information, as these may be the most important off-target sites for further characterization. In addition, GUIDEseq enables the comparison and visualization of off-target site overlap between different datasets for a rapid comparison of different nuclease configurations or experimental conditions. For each identified off-target, the GUIDEseq package outputs mapped GUIDE-Seq read count as well as cleavage score from a user specified off-target cleavage score prediction algorithm permitting the identification of genomic sequences with unexpected cleavage activity. The GUIDEseq package enables analysis of GUIDE-data from various nuclease platforms for any species with a defined genomic sequence. This software package has been used successfully to analyze several GUIDE-seq datasets. The software, source code and documentation are freely available at http://www.bioconductor.org/packages/release/bioc/html/GUIDEseq.html .

RNA-sequence data normalization through in silico prediction of reference genes: the bacterial response to DNA damage as case study.

PubMed

Berghoff, Bork A; Karlsson, Torgny; Källman, Thomas; Wagner, E Gerhart H; Grabherr, Manfred G

2017-01-01

Measuring how gene expression changes in the course of an experiment assesses how an organism responds on a molecular level. Sequencing of RNA molecules, and their subsequent quantification, aims to assess global gene expression changes on the RNA level (transcriptome). While advances in high-throughput RNA-sequencing (RNA-seq) technologies allow for inexpensive data generation, accurate post-processing and normalization across samples is required to eliminate any systematic noise introduced by the biochemical and/or technical processes. Existing methods thus either normalize on selected known reference genes that are invariant in expression across the experiment, assume that the majority of genes are invariant, or that the effects of up- and down-regulated genes cancel each other out during the normalization. Here, we present a novel method, moose 2 , which predicts invariant genes in silico through a dynamic programming (DP) scheme and applies a quadratic normalization based on this subset. The method allows for specifying a set of known or experimentally validated invariant genes, which guides the DP. We experimentally verified the predictions of this method in the bacterium Escherichia coli , and show how moose 2 is able to (i) estimate the expression value distances between RNA-seq samples, (ii) reduce the variation of expression values across all samples, and (iii) to subsequently reveal new functional groups of genes during the late stages of DNA damage. We further applied the method to three eukaryotic data sets, on which its performance compares favourably to other methods. The software is implemented in C++ and is publicly available from http://grabherr.github.io/moose2/. The proposed RNA-seq normalization method, moose 2 , is a valuable alternative to existing methods, with two major advantages: (i) in silico prediction of invariant genes provides a list of potential reference genes for downstream analyses, and (ii) non-linear artefacts in RNA-seq data are handled adequately to minimize variations between replicates.

Avatar DNA Nanohybrid System in Chip-on-a-Phone

NASA Astrophysics Data System (ADS)

Park, Dae-Hwan; Han, Chang Jo; Shul, Yong-Gun; Choy, Jin-Ho

2014-05-01

Long admired for informational role and recognition function in multidisciplinary science, DNA nanohybrids have been emerging as ideal materials for molecular nanotechnology and genetic information code. Here, we designed an optical machine-readable DNA icon on microarray, Avatar DNA, for automatic identification and data capture such as Quick Response and ColorZip codes. Avatar icon is made of telepathic DNA-DNA hybrids inscribed on chips, which can be identified by camera of smartphone with application software. Information encoded in base-sequences can be accessed by connecting an off-line icon to an on-line web-server network to provide message, index, or URL from database library. Avatar DNA is then converged with nano-bio-info-cogno science: each building block stands for inorganic nanosheets, nucleotides, digits, and pixels. This convergence could address item-level identification that strengthens supply-chain security for drug counterfeits. It can, therefore, provide molecular-level vision through mobile network to coordinate and integrate data management channels for visual detection and recording.

Avatar DNA Nanohybrid System in Chip-on-a-Phone

PubMed Central

Park, Dae-Hwan; Han, Chang Jo; Shul, Yong-Gun; Choy, Jin-Ho

2014-01-01

Long admired for informational role and recognition function in multidisciplinary science, DNA nanohybrids have been emerging as ideal materials for molecular nanotechnology and genetic information code. Here, we designed an optical machine-readable DNA icon on microarray, Avatar DNA, for automatic identification and data capture such as Quick Response and ColorZip codes. Avatar icon is made of telepathic DNA-DNA hybrids inscribed on chips, which can be identified by camera of smartphone with application software. Information encoded in base-sequences can be accessed by connecting an off-line icon to an on-line web-server network to provide message, index, or URL from database library. Avatar DNA is then converged with nano-bio-info-cogno science: each building block stands for inorganic nanosheets, nucleotides, digits, and pixels. This convergence could address item-level identification that strengthens supply-chain security for drug counterfeits. It can, therefore, provide molecular-level vision through mobile network to coordinate and integrate data management channels for visual detection and recording. PMID:24824876

Performance comparison of two commercial human whole-exome capture systems on formalin-fixed paraffin-embedded lung adenocarcinoma samples.

PubMed

Bonfiglio, Silvia; Vanni, Irene; Rossella, Valeria; Truini, Anna; Lazarevic, Dejan; Dal Bello, Maria Giovanna; Alama, Angela; Mora, Marco; Rijavec, Erika; Genova, Carlo; Cittaro, Davide; Grossi, Francesco; Coco, Simona

2016-08-30

Next Generation Sequencing (NGS) has become a valuable tool for molecular landscape characterization of cancer genomes, leading to a better understanding of tumor onset and progression, and opening new avenues in translational oncology. Formalin-fixed paraffin-embedded (FFPE) tissue is the method of choice for storage of clinical samples, however low quality of FFPE genomic DNA (gDNA) can limit its use for downstream applications. To investigate the FFPE specimen suitability for NGS analysis and to establish the performance of two solution-based exome capture technologies, we compared the whole-exome sequencing (WES) data of gDNA extracted from 5 fresh frozen (FF) and 5 matched FFPE lung adenocarcinoma tissues using: SeqCap EZ Human Exome v.3.0 (Roche NimbleGen) and SureSelect XT Human All Exon v.5 (Agilent Technologies). Sequencing metrics on Illumina HiSeq were optimal for both exome systems and comparable among FFPE and FF samples, with a slight increase of PCR duplicates in FFPE, mainly in Roche NimbleGen libraries. Comparison of single nucleotide variants (SNVs) between FFPE-FF pairs reached overlapping values >90 % in both systems. Both WES showed high concordance with target re-sequencing data by Ion PGM™ in 22 lung-cancer genes, regardless the source of samples. Exon coverage of 623 cancer-related genes revealed high coverage efficiency of both kits, proposing WES as a valid alternative to target re-sequencing. High-quality and reliable data can be successfully obtained from WES of FFPE samples starting from a relatively low amount of input gDNA, suggesting the inclusion of NGS-based tests into clinical contest. In conclusion, our analysis suggests that the WES approach could be extended to a translational research context as well as to the clinic (e.g. to study rare malignancies), where the simultaneous analysis of the whole coding region of the genome may help in the detection of cancer-linked variants.

De novo assembled expressed gene catalog of a fast-growing Eucalyptus tree produced by Illumina mRNA-Seq

PubMed Central

2010-01-01

Background De novo assembly of transcript sequences produced by short-read DNA sequencing technologies offers a rapid approach to obtain expressed gene catalogs for non-model organisms. A draft genome sequence will be produced in 2010 for a Eucalyptus tree species (E. grandis) representing the most important hardwood fibre crop in the world. Genome annotation of this valuable woody plant and genetic dissection of its superior growth and productivity will be greatly facilitated by the availability of a comprehensive collection of expressed gene sequences from multiple tissues and organs. Results We present an extensive expressed gene catalog for a commercially grown E. grandis × E. urophylla hybrid clone constructed using only Illumina mRNA-Seq technology and de novo assembly. A total of 18,894 transcript-derived contigs, a large proportion of which represent full-length protein coding genes were assembled and annotated. Analysis of assembly quality, length and diversity show that this dataset represent the most comprehensive expressed gene catalog for any Eucalyptus tree. mRNA-Seq analysis furthermore allowed digital expression profiling of all of the assembled transcripts across diverse xylogenic and non-xylogenic tissues, which is invaluable for ascribing putative gene functions. Conclusions De novo assembly of Illumina mRNA-Seq reads is an efficient approach for transcriptome sequencing and profiling in Eucalyptus and other non-model organisms. The transcriptome resource (Eucspresso, http://eucspresso.bi.up.ac.za/) generated by this study will be of value for genomic analysis of woody biomass production in Eucalyptus and for comparative genomic analysis of growth and development in woody and herbaceous plants. PMID:21122097

Unified View of Backward Backtracking in Short Read Mapping

NASA Astrophysics Data System (ADS)

Mäkinen, Veli; Välimäki, Niko; Laaksonen, Antti; Katainen, Riku

Mapping short DNA reads to the reference genome is the core task in the recent high-throughput technologies to study e.g. protein-DNA interactions (ChIP-seq) and alternative splicing (RNA-seq). Several tools for the task (bowtie, bwa, SOAP2, TopHat) have been developed that exploit Burrows-Wheeler transform and the backward backtracking technique on it, to map the reads to their best approximate occurrences in the genome. These tools use different tailored mechanisms for small error-levels to prune the search phase significantly. We propose a new pruning mechanism that can be seen a generalization of the tailored mechanisms used so far. It uses a novel idea of storing all cyclic rotations of fixed length substrings of the reference sequence with a compressed index that is able to exploit the repetitions created to level out the growth of the input set. For RNA-seq we propose a new method that combines dynamic programming with backtracking to map efficiently and correctly all reads that span two exons. Same mechanism can also be used for mapping mate-pair reads.

Motif-based analysis of large nucleotide data sets using MEME-ChIP

PubMed Central

Ma, Wenxiu; Noble, William S; Bailey, Timothy L

2014-01-01

MEME-ChIP is a web-based tool for analyzing motifs in large DNA or RNA data sets. It can analyze peak regions identified by ChIP-seq, cross-linking sites identified by cLIP-seq and related assays, as well as sets of genomic regions selected using other criteria. MEME-ChIP performs de novo motif discovery, motif enrichment analysis, motif location analysis and motif clustering, providing a comprehensive picture of the DNA or RNA motifs that are enriched in the input sequences. MEME-ChIP performs two complementary types of de novo motif discovery: weight matrix–based discovery for high accuracy; and word-based discovery for high sensitivity. Motif enrichment analysis using DNA or RNA motifs from human, mouse, worm, fly and other model organisms provides even greater sensitivity. MEME-ChIP’s interactive HTML output groups and aligns significant motifs to ease interpretation. this protocol takes less than 3 h, and it provides motif discovery approaches that are distinct and complementary to other online methods. PMID:24853928

Whole mitochondrial genome screening in maternally inherited non-syndromic hearing impairment using a microarray resequencing mitochondrial DNA chip.

PubMed

Lévêque, Marianne; Marlin, Sandrine; Jonard, Laurence; Procaccio, Vincent; Reynier, Pascal; Amati-Bonneau, Patrizia; Baulande, Sylvain; Pierron, Denis; Lacombe, Didier; Duriez, Françoise; Francannet, Christine; Mom, Thierry; Journel, Hubert; Catros, Hélène; Drouin-Garraud, Valérie; Obstoy, Marie-Françoise; Dollfus, Hélène; Eliot, Marie-Madeleine; Faivre, Laurence; Duvillard, Christian; Couderc, Remy; Garabedian, Eréa-Noël; Petit, Christine; Feldmann, Delphine; Denoyelle, Françoise

2007-11-01

Mitochondrial DNA (mtDNA) mutations have been implicated in non-syndromic hearing loss either as primary or as predisposing factors. As only a part of the mitochondrial genome is usually explored in deafness, its prevalence is probably under-estimated. Among 1350 families with non-syndromic sensorineural hearing loss collected through a French collaborative network, we selected 29 large families with a clear maternal lineage and screened them for known mtDNA mutations in 12S rRNA, tRNASer(UCN) and tRNALeu(UUR) genes. When no mutation could be identified, a whole mitochondrial genome screening was performed, using a microarray resequencing chip: the MitoChip version 2.0 developed by Affymetrix Inc. Known mtDNA mutations was found in nine of the 29 families, which are described in the article: five with A1555G, two with the T7511C, one with 7472insC and one with A3243G mutation. In the remaining 20 families, the resequencing Mitochip detected 258 mitochondrial homoplasmic variants and 107 potentially heteroplasmic variants. Controls were made by direct sequencing on selected fragments and showed a high sensibility of the MitoChip but a low specificity, especially for heteroplasmic variations. An original analysis on the basis of species conservation, frequency and phylogenetic investigation was performed to select the more probably pathogenic variants. The entire genome analysis allowed us to identify five additional families with a putatively pathogenic mitochondrial variant: T669C, C1537T, G8078A, G12236A and G15077A. These results indicate that the new MitoChip platform is a rapid and valuable tool for identification of new mtDNA mutations in deafness.

Full genome virus detection in fecal samples using sensitive nucleic acid preparation, deep sequencing, and a novel iterative sequence classification algorithm.

PubMed

Cotten, Matthew; Oude Munnink, Bas; Canuti, Marta; Deijs, Martin; Watson, Simon J; Kellam, Paul; van der Hoek, Lia

2014-01-01

We have developed a full genome virus detection process that combines sensitive nucleic acid preparation optimised for virus identification in fecal material with Illumina MiSeq sequencing and a novel post-sequencing virus identification algorithm. Enriched viral nucleic acid was converted to double-stranded DNA and subjected to Illumina MiSeq sequencing. The resulting short reads were processed with a novel iterative Python algorithm SLIM for the identification of sequences with homology to known viruses. De novo assembly was then used to generate full viral genomes. The sensitivity of this process was demonstrated with a set of fecal samples from HIV-1 infected patients. A quantitative assessment of the mammalian, plant, and bacterial virus content of this compartment was generated and the deep sequencing data were sufficient to assembly 12 complete viral genomes from 6 virus families. The method detected high levels of enteropathic viruses that are normally controlled in healthy adults, but may be involved in the pathogenesis of HIV-1 infection and will provide a powerful tool for virus detection and for analyzing changes in the fecal virome associated with HIV-1 progression and pathogenesis.

Full Genome Virus Detection in Fecal Samples Using Sensitive Nucleic Acid Preparation, Deep Sequencing, and a Novel Iterative Sequence Classification Algorithm

PubMed Central

Cotten, Matthew; Oude Munnink, Bas; Canuti, Marta; Deijs, Martin; Watson, Simon J.; Kellam, Paul; van der Hoek, Lia

2014-01-01

We have developed a full genome virus detection process that combines sensitive nucleic acid preparation optimised for virus identification in fecal material with Illumina MiSeq sequencing and a novel post-sequencing virus identification algorithm. Enriched viral nucleic acid was converted to double-stranded DNA and subjected to Illumina MiSeq sequencing. The resulting short reads were processed with a novel iterative Python algorithm SLIM for the identification of sequences with homology to known viruses. De novo assembly was then used to generate full viral genomes. The sensitivity of this process was demonstrated with a set of fecal samples from HIV-1 infected patients. A quantitative assessment of the mammalian, plant, and bacterial virus content of this compartment was generated and the deep sequencing data were sufficient to assembly 12 complete viral genomes from 6 virus families. The method detected high levels of enteropathic viruses that are normally controlled in healthy adults, but may be involved in the pathogenesis of HIV-1 infection and will provide a powerful tool for virus detection and for analyzing changes in the fecal virome associated with HIV-1 progression and pathogenesis. PMID:24695106

A deep learning method for lincRNA detection using auto-encoder algorithm.

PubMed

Yu, Ning; Yu, Zeng; Pan, Yi

2017-12-06

RNA sequencing technique (RNA-seq) enables scientists to develop novel data-driven methods for discovering more unidentified lincRNAs. Meantime, knowledge-based technologies are experiencing a potential revolution ignited by the new deep learning methods. By scanning the newly found data set from RNA-seq, scientists have found that: (1) the expression of lincRNAs appears to be regulated, that is, the relevance exists along the DNA sequences; (2) lincRNAs contain some conversed patterns/motifs tethered together by non-conserved regions. The two evidences give the reasoning for adopting knowledge-based deep learning methods in lincRNA detection. Similar to coding region transcription, non-coding regions are split at transcriptional sites. However, regulatory RNAs rather than message RNAs are generated. That is, the transcribed RNAs participate the biological process as regulatory units instead of generating proteins. Identifying these transcriptional regions from non-coding regions is the first step towards lincRNA recognition. The auto-encoder method achieves 100% and 92.4% prediction accuracy on transcription sites over the putative data sets. The experimental results also show the excellent performance of predictive deep neural network on the lincRNA data sets compared with support vector machine and traditional neural network. In addition, it is validated through the newly discovered lincRNA data set and one unreported transcription site is found by feeding the whole annotated sequences through the deep learning machine, which indicates that deep learning method has the extensive ability for lincRNA prediction. The transcriptional sequences of lincRNAs are collected from the annotated human DNA genome data. Subsequently, a two-layer deep neural network is developed for the lincRNA detection, which adopts the auto-encoder algorithm and utilizes different encoding schemes to obtain the best performance over intergenic DNA sequence data. Driven by those newly annotated lincRNA data, deep learning methods based on auto-encoder algorithm can exert their capability in knowledge learning in order to capture the useful features and the information correlation along DNA genome sequences for lincRNA detection. As our knowledge, this is the first application to adopt the deep learning techniques for identifying lincRNA transcription sequences.

DEPPDB - DNA electrostatic potential properties database. Electrostatic properties of genome DNA elements.

PubMed

Osypov, Alexander A; Krutinin, Gleb G; Krutinina, Eugenia A; Kamzolova, Svetlana G

2012-04-01

Electrostatic properties of genome DNA are important to its interactions with different proteins, in particular, related to transcription. DEPPDB - DNA Electrostatic Potential (and other Physical) Properties Database - provides information on the electrostatic and other physical properties of genome DNA combined with its sequence and annotation of biological and structural properties of genomes and their elements. Genomes are organized on taxonomical basis, supporting comparative and evolutionary studies. Currently, DEPPDB contains all completely sequenced bacterial, viral, mitochondrial, and plastids genomes according to the NCBI RefSeq, and some model eukaryotic genomes. Data for promoters, regulation sites, binding proteins, etc., are incorporated from established DBs and literature. The database is complemented by analytical tools. User sequences calculations are available. Case studies discovered electrostatics complementing DNA bending in E.coli plasmid BNT2 promoter functioning, possibly affecting host-environment metabolic switch. Transcription factors binding sites gravitate to high potential regions, confirming the electrostatics universal importance in protein-DNA interactions beyond the classical promoter-RNA polymerase recognition and regulation. Other genome elements, such as terminators, also show electrostatic peculiarities. Most intriguing are gene starts, exhibiting taxonomic correlations. The necessity of the genome electrostatic properties studies is discussed.

Deppdb--DNA electrostatic potential properties database: electrostatic properties of genome DNA.

PubMed

Osypov, Alexander A; Krutinin, Gleb G; Kamzolova, Svetlana G

2010-06-01

The electrostatic properties of genome DNA influence its interactions with different proteins, in particular, the regulation of transcription by RNA-polymerases. DEPPDB--DNA Electrostatic Potential Properties Database--was developed to hold and provide all available information on the electrostatic properties of genome DNA combined with its sequence and annotation of biological and structural properties of genome elements and whole genomes. Genomes in DEPPDB are organized on a taxonomical basis. Currently, the database contains all the completely sequenced bacterial and viral genomes according to NCBI RefSeq. General properties of the genome DNA electrostatic potential profile and principles of its formation are revealed. This potential correlates with the GC content but does not correspond to it exactly and strongly depends on both the sequence arrangement and its context (flanking regions). Analysis of the promoter regions for bacterial and viral RNA polymerases revealed a correspondence between the scale of these proteins' physical properties and electrostatic profile patterns. We also discovered a direct correlation between the potential value and the binding frequency of RNA polymerase to DNA, supporting the idea of the role of electrostatics in these interactions. This matches a pronounced tendency of the promoter regions to possess higher values of the electrostatic potential.

Error baseline rates of five sample preparation methods used to characterize RNA virus populations.

PubMed

Kugelman, Jeffrey R; Wiley, Michael R; Nagle, Elyse R; Reyes, Daniel; Pfeffer, Brad P; Kuhn, Jens H; Sanchez-Lockhart, Mariano; Palacios, Gustavo F

2017-01-01

Individual RNA viruses typically occur as populations of genomes that differ slightly from each other due to mutations introduced by the error-prone viral polymerase. Understanding the variability of RNA virus genome populations is critical for understanding virus evolution because individual mutant genomes may gain evolutionary selective advantages and give rise to dominant subpopulations, possibly even leading to the emergence of viruses resistant to medical countermeasures. Reverse transcription of virus genome populations followed by next-generation sequencing is the only available method to characterize variation for RNA viruses. However, both steps may lead to the introduction of artificial mutations, thereby skewing the data. To better understand how such errors are introduced during sample preparation, we determined and compared error baseline rates of five different sample preparation methods by analyzing in vitro transcribed Ebola virus RNA from an artificial plasmid-based system. These methods included: shotgun sequencing from plasmid DNA or in vitro transcribed RNA as a basic "no amplification" method, amplicon sequencing from the plasmid DNA or in vitro transcribed RNA as a "targeted" amplification method, sequence-independent single-primer amplification (SISPA) as a "random" amplification method, rolling circle reverse transcription sequencing (CirSeq) as an advanced "no amplification" method, and Illumina TruSeq RNA Access as a "targeted" enrichment method. The measured error frequencies indicate that RNA Access offers the best tradeoff between sensitivity and sample preparation error (1.4-5) of all compared methods.

Error baseline rates of five sample preparation methods used to characterize RNA virus populations

PubMed Central

Kugelman, Jeffrey R.; Wiley, Michael R.; Nagle, Elyse R.; Reyes, Daniel; Pfeffer, Brad P.; Kuhn, Jens H.; Sanchez-Lockhart, Mariano; Palacios, Gustavo F.

2017-01-01

Individual RNA viruses typically occur as populations of genomes that differ slightly from each other due to mutations introduced by the error-prone viral polymerase. Understanding the variability of RNA virus genome populations is critical for understanding virus evolution because individual mutant genomes may gain evolutionary selective advantages and give rise to dominant subpopulations, possibly even leading to the emergence of viruses resistant to medical countermeasures. Reverse transcription of virus genome populations followed by next-generation sequencing is the only available method to characterize variation for RNA viruses. However, both steps may lead to the introduction of artificial mutations, thereby skewing the data. To better understand how such errors are introduced during sample preparation, we determined and compared error baseline rates of five different sample preparation methods by analyzing in vitro transcribed Ebola virus RNA from an artificial plasmid-based system. These methods included: shotgun sequencing from plasmid DNA or in vitro transcribed RNA as a basic “no amplification” method, amplicon sequencing from the plasmid DNA or in vitro transcribed RNA as a “targeted” amplification method, sequence-independent single-primer amplification (SISPA) as a “random” amplification method, rolling circle reverse transcription sequencing (CirSeq) as an advanced “no amplification” method, and Illumina TruSeq RNA Access as a “targeted” enrichment method. The measured error frequencies indicate that RNA Access offers the best tradeoff between sensitivity and sample preparation error (1.4−5) of all compared methods. PMID:28182717

GobyWeb: Simplified Management and Analysis of Gene Expression and DNA Methylation Sequencing Data

PubMed Central

Dorff, Kevin C.; Chambwe, Nyasha; Zeno, Zachary; Simi, Manuele; Shaknovich, Rita; Campagne, Fabien

2013-01-01

We present GobyWeb, a web-based system that facilitates the management and analysis of high-throughput sequencing (HTS) projects. The software provides integrated support for a broad set of HTS analyses and offers a simple plugin extension mechanism. Analyses currently supported include quantification of gene expression for messenger and small RNA sequencing, estimation of DNA methylation (i.e., reduced bisulfite sequencing and whole genome methyl-seq), or the detection of pathogens in sequenced data. In contrast to previous analysis pipelines developed for analysis of HTS data, GobyWeb requires significantly less storage space, runs analyses efficiently on a parallel grid, scales gracefully to process tens or hundreds of multi-gigabyte samples, yet can be used effectively by researchers who are comfortable using a web browser. We conducted performance evaluations of the software and found it to either outperform or have similar performance to analysis programs developed for specialized analyses of HTS data. We found that most biologists who took a one-hour GobyWeb training session were readily able to analyze RNA-Seq data with state of the art analysis tools. GobyWeb can be obtained at http://gobyweb.campagnelab.org and is freely available for non-commercial use. GobyWeb plugins are distributed in source code and licensed under the open source LGPL3 license to facilitate code inspection, reuse and independent extensions http://github.com/CampagneLaboratory/gobyweb2-plugins. PMID:23936070

Multimodal RNA-seq using single-strand, double-strand, and CircLigase-based capture yields a refined and extended description of the C. elegans transcriptome.

PubMed

Lamm, Ayelet T; Stadler, Michael R; Zhang, Huibin; Gent, Jonathan I; Fire, Andrew Z

2011-02-01

We have used a combination of three high-throughput RNA capture and sequencing methods to refine and augment the transcriptome map of a well-studied genetic model, Caenorhabditis elegans. The three methods include a standard (non-directional) library preparation protocol relying on cDNA priming and foldback that has been used in several previous studies for transcriptome characterization in this species, and two directional protocols, one involving direct capture of single-stranded RNA fragments and one involving circular-template PCR (CircLigase). We find that each RNA-seq approach shows specific limitations and biases, with the application of multiple methods providing a more complete map than was obtained from any single method. Of particular note in the analysis were substantial advantages of CircLigase-based and ssRNA-based capture for defining sequences and structures of the precise 5' ends (which were lost using the double-strand cDNA capture method). Of the three methods, ssRNA capture was most effective in defining sequences to the poly(A) junction. Using data sets from a spectrum of C. elegans strains and stages and the UCSC Genome Browser, we provide a series of tools, which facilitate rapid visualization and assignment of gene structures.

A Rapid Method for Optimizing Running Temperature of Electrophoresis through Repetitive On-Chip CE Operations

PubMed Central

Kaneda, Shohei; Ono, Koichi; Fukuba, Tatsuhiro; Nojima, Takahiko; Yamamoto, Takatoki; Fujii, Teruo

2011-01-01

In this paper, a rapid and simple method to determine the optimal temperature conditions for denaturant electrophoresis using a temperature-controlled on-chip capillary electrophoresis (CE) device is presented. Since on-chip CE operations including sample loading, injection and separation are carried out just by switching the electric field, we can repeat consecutive run-to-run CE operations on a single on-chip CE device by programming the voltage sequences. By utilizing the high-speed separation and the repeatability of the on-chip CE, a series of electrophoretic operations with different running temperatures can be implemented. Using separations of reaction products of single-stranded DNA (ssDNA) with a peptide nucleic acid (PNA) oligomer, the effectiveness of the presented method to determine the optimal temperature conditions required to discriminate a single-base substitution (SBS) between two different ssDNAs is demonstrated. It is shown that a single run for one temperature condition can be executed within 4 min, and the optimal temperature to discriminate the SBS could be successfully found using the present method. PMID:21845077

DNA sequence+shape kernel enables alignment-free modeling of transcription factor binding.

PubMed

Ma, Wenxiu; Yang, Lin; Rohs, Remo; Noble, William Stafford

2017-10-01

Transcription factors (TFs) bind to specific DNA sequence motifs. Several lines of evidence suggest that TF-DNA binding is mediated in part by properties of the local DNA shape: the width of the minor groove, the relative orientations of adjacent base pairs, etc. Several methods have been developed to jointly account for DNA sequence and shape properties in predicting TF binding affinity. However, a limitation of these methods is that they typically require a training set of aligned TF binding sites. We describe a sequence + shape kernel that leverages DNA sequence and shape information to better understand protein-DNA binding preference and affinity. This kernel extends an existing class of k-mer based sequence kernels, based on the recently described di-mismatch kernel. Using three in vitro benchmark datasets, derived from universal protein binding microarrays (uPBMs), genomic context PBMs (gcPBMs) and SELEX-seq data, we demonstrate that incorporating DNA shape information improves our ability to predict protein-DNA binding affinity. In particular, we observe that (i) the k-spectrum + shape model performs better than the classical k-spectrum kernel, particularly for small k values; (ii) the di-mismatch kernel performs better than the k-mer kernel, for larger k; and (iii) the di-mismatch + shape kernel performs better than the di-mismatch kernel for intermediate k values. The software is available at https://bitbucket.org/wenxiu/sequence-shape.git. rohs@usc.edu or william-noble@uw.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

Quantum dot-based microfluidic biosensor for cancer detection

NASA Astrophysics Data System (ADS)

Ghrera, Aditya Sharma; Pandey, Chandra Mouli; Ali, Md. Azahar; Malhotra, Bansi Dhar

2015-05-01

We report results of the studies relating to fabrication of an impedimetric microfluidic-based nucleic acid sensor for quantification of DNA sequences specific to chronic myelogenous leukemia (CML). The sensor chip is prepared by patterning an indium-tin-oxide (ITO) coated glass substrate via wet chemical etching method followed by sealing with polydimethylsiloxane (PDMS) microchannel for fluid control. The fabricated microfluidic chip comprising of a patterned ITO substrate is modified by depositing cadmium selenide quantum dots (QCdSe) via Langmuir-Blodgett technique. Further, the QCdSe surface has been functionalized with specific DNA probe for CML detection. The probe DNA functionalized QCdSe integrated miniaturized system has been used to monitor target complementary DNA concentration by measuring the interfacial charge transfer resistance via hybridization. The presence of complementary DNA in buffer solution significantly results in decreased electro-conductivity of the interface due to presence of a charge barrier for transport of the redox probe ions. The microfluidic DNA biosensor exhibits improved linearity in the concentration range of 10-15 M to 10-11 M.

X-MATE: a flexible system for mapping short read data

PubMed Central

Pearson, John V.; Cloonan, Nicole; Grimmond, Sean M.

2011-01-01

Summary: Accurate and complete mapping of short-read sequencing to a reference genome greatly enhances the discovery of biological results and improves statistical predictions. We recently presented RNA-MATE, a pipeline for the recursive mapping of RNA-Seq datasets. With the rapid increase in genome re-sequencing projects, progression of available mapping software and the evolution of file formats, we now present X-MATE, an updated version of RNA-MATE, capable of mapping both RNA-Seq and DNA datasets and with improved performance, output file formats, configuration files, and flexibility in core mapping software. Availability: Executables, source code, junction libraries, test data and results and the user manual are available from http://grimmond.imb.uq.edu.au/X-MATE/. Contact: n.cloonan@uq.edu.au; s.grimmond@uq.edu.au Supplementary information: Supplementary data are available at Bioinformatics Online. PMID:21216778

Computational method and system for modeling, analyzing, and optimizing DNA amplification and synthesis

DOEpatents

Vandersall, Jennifer A.; Gardner, Shea N.; Clague, David S.

2010-05-04

A computational method and computer-based system of modeling DNA synthesis for the design and interpretation of PCR amplification, parallel DNA synthesis, and microarray chip analysis. The method and system include modules that address the bioinformatics, kinetics, and thermodynamics of DNA amplification and synthesis. Specifically, the steps of DNA selection, as well as the kinetics and thermodynamics of DNA hybridization and extensions, are addressed, which enable the optimization of the processing and the prediction of the products as a function of DNA sequence, mixing protocol, time, temperature and concentration of species.

SraTailor: graphical user interface software for processing and visualizing ChIP-seq data.

PubMed

Oki, Shinya; Maehara, Kazumitsu; Ohkawa, Yasuyuki; Meno, Chikara

2014-12-01

Raw data from ChIP-seq (chromatin immunoprecipitation combined with massively parallel DNA sequencing) experiments are deposited in public databases as SRAs (Sequence Read Archives) that are publically available to all researchers. However, to graphically visualize ChIP-seq data of interest, the corresponding SRAs must be downloaded and converted into BigWig format, a process that involves complicated command-line processing. This task requires users to possess skill with script languages and sequence data processing, a requirement that prevents a wide range of biologists from exploiting SRAs. To address these challenges, we developed SraTailor, a GUI (Graphical User Interface) software package that automatically converts an SRA into a BigWig-formatted file. Simplicity of use is one of the most notable features of SraTailor: entering an accession number of an SRA and clicking the mouse are the only steps required to obtain BigWig-formatted files and to graphically visualize the extents of reads at given loci. SraTailor is also able to make peak calls, generate files of other formats, process users' own data, and accept various command-line-like options. Therefore, this software makes ChIP-seq data fully exploitable by a wide range of biologists. SraTailor is freely available at http://www.devbio.med.kyushu-u.ac.jp/sra_tailor/, and runs on both Mac and Windows machines. © 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd.

Analysis of Pre-Analytic Factors Affecting the Success of Clinical Next-Generation Sequencing of Solid Organ Malignancies.

PubMed

Chen, Hui; Luthra, Rajyalakshmi; Goswami, Rashmi S; Singh, Rajesh R; Roy-Chowdhuri, Sinchita

2015-08-28

Application of next-generation sequencing (NGS) technology to routine clinical practice has enabled characterization of personalized cancer genomes to identify patients likely to have a response to targeted therapy. The proper selection of tumor sample for downstream NGS based mutational analysis is critical to generate accurate results and to guide therapeutic intervention. However, multiple pre-analytic factors come into play in determining the success of NGS testing. In this review, we discuss pre-analytic requirements for AmpliSeq PCR-based sequencing using Ion Torrent Personal Genome Machine (PGM) (Life Technologies), a NGS sequencing platform that is often used by clinical laboratories for sequencing solid tumors because of its low input DNA requirement from formalin fixed and paraffin embedded tissue. The success of NGS mutational analysis is affected not only by the input DNA quantity but also by several other factors, including the specimen type, the DNA quality, and the tumor cellularity. Here, we review tissue requirements for solid tumor NGS based mutational analysis, including procedure types, tissue types, tumor volume and fraction, decalcification, and treatment effects.

Vidjil: A Web Platform for Analysis of High-Throughput Repertoire Sequencing.

PubMed

Duez, Marc; Giraud, Mathieu; Herbert, Ryan; Rocher, Tatiana; Salson, Mikaël; Thonier, Florian

2016-01-01

The B and T lymphocytes are white blood cells playing a key role in the adaptive immunity. A part of their DNA, called the V(D)J recombinations, is specific to each lymphocyte, and enables recognition of specific antigenes. Today, with new sequencing techniques, one can get billions of DNA sequences from these regions. With dedicated Repertoire Sequencing (RepSeq) methods, it is now possible to picture population of lymphocytes, and to monitor more accurately the immune response as well as pathologies such as leukemia. Vidjil is an open-source platform for the interactive analysis of high-throughput sequencing data from lymphocyte recombinations. It contains an algorithm gathering reads into clonotypes according to their V(D)J junctions, a web application made of a sample, experiment and patient database and a visualization for the analysis of clonotypes along the time. Vidjil is implemented in C++, Python and Javascript and licensed under the GPLv3 open-source license. Source code, binaries and a public web server are available at http://www.vidjil.org and at http://bioinfo.lille.inria.fr/vidjil. Using the Vidjil web application consists of four steps: 1. uploading a raw sequence file (typically a FASTQ); 2. running RepSeq analysis software; 3. visualizing the results; 4. annotating the results and saving them for future use. For the end-user, the Vidjil web application needs no specific installation and just requires a connection and a modern web browser. Vidjil is used by labs in hematology or immunology for research and clinical applications.

Vidjil: A Web Platform for Analysis of High-Throughput Repertoire Sequencing

PubMed Central

Duez, Marc; Herbert, Ryan; Rocher, Tatiana; Salson, Mikaël; Thonier, Florian

2016-01-01

Background The B and T lymphocytes are white blood cells playing a key role in the adaptive immunity. A part of their DNA, called the V(D)J recombinations, is specific to each lymphocyte, and enables recognition of specific antigenes. Today, with new sequencing techniques, one can get billions of DNA sequences from these regions. With dedicated Repertoire Sequencing (RepSeq) methods, it is now possible to picture population of lymphocytes, and to monitor more accurately the immune response as well as pathologies such as leukemia. Methods and Results Vidjil is an open-source platform for the interactive analysis of high-throughput sequencing data from lymphocyte recombinations. It contains an algorithm gathering reads into clonotypes according to their V(D)J junctions, a web application made of a sample, experiment and patient database and a visualization for the analysis of clonotypes along the time. Vidjil is implemented in C++, Python and Javascript and licensed under the GPLv3 open-source license. Source code, binaries and a public web server are available at http://www.vidjil.org and at http://bioinfo.lille.inria.fr/vidjil. Using the Vidjil web application consists of four steps: 1. uploading a raw sequence file (typically a FASTQ); 2. running RepSeq analysis software; 3. visualizing the results; 4. annotating the results and saving them for future use. For the end-user, the Vidjil web application needs no specific installation and just requires a connection and a modern web browser. Vidjil is used by labs in hematology or immunology for research and clinical applications. PMID:27835690

Strand-Specific RNA-Seq Analyses of Fruiting Body Development in Coprinopsis cinerea

DOE PAGES

Muraguchi, Hajime; Umezawa, Kiwamu; Niikura, Mai; ...

2015-10-28

We report that the basidiomycete fungus Coprinopsis cinerea is an important model system for multicellular development. Fruiting bodies of C. cinerea are typical mushrooms, which can be produced synchronously on defined media in the laboratory. To investigate the transcriptome in detail during fruiting body development, high-throughput sequencing (RNA-seq) was performed using cDNA libraries strand-specifically constructed from 13 points (stages/tissues) with two biological replicates. The reads were aligned to 14,245 predicted transcripts, and counted for forward and reverse transcripts. Differentially expressed genes (DEGs) between two adjacent points and between vegetative mycelium and each point were detected by Tag Count Comparison (TCC).more » To validate RNA-seq data, expression levels of selected genes were compared using RPKM values in RNA-seq data and qRT-PCR data, and DEGs detected in microarray data were examined in MA plots of RNA-seq data by TCC. We discuss events deduced from GO analysis of DEGs. In addition, we uncovered both transcription factor candidates and antisense transcripts that are likely to be involved in developmental regulation for fruiting.« less

Strand-Specific RNA-Seq Analyses of Fruiting Body Development in Coprinopsis cinerea

DOE Office of Scientific and Technical Information (OSTI.GOV)

Muraguchi, Hajime; Umezawa, Kiwamu; Niikura, Mai

We report that the basidiomycete fungus Coprinopsis cinerea is an important model system for multicellular development. Fruiting bodies of C. cinerea are typical mushrooms, which can be produced synchronously on defined media in the laboratory. To investigate the transcriptome in detail during fruiting body development, high-throughput sequencing (RNA-seq) was performed using cDNA libraries strand-specifically constructed from 13 points (stages/tissues) with two biological replicates. The reads were aligned to 14,245 predicted transcripts, and counted for forward and reverse transcripts. Differentially expressed genes (DEGs) between two adjacent points and between vegetative mycelium and each point were detected by Tag Count Comparison (TCC).more » To validate RNA-seq data, expression levels of selected genes were compared using RPKM values in RNA-seq data and qRT-PCR data, and DEGs detected in microarray data were examined in MA plots of RNA-seq data by TCC. We discuss events deduced from GO analysis of DEGs. In addition, we uncovered both transcription factor candidates and antisense transcripts that are likely to be involved in developmental regulation for fruiting.« less

Filipino DNA variation at 12 X-chromosome short tandem repeat markers.

PubMed

Salvador, Jazelyn M; Apaga, Dame Loveliness T; Delfin, Frederick C; Calacal, Gayvelline C; Dennis, Sheila Estacio; De Ungria, Maria Corazon A

2018-06-08

Demands for solving complex kinship scenarios where only distant relatives are available for testing have risen in the past years. In these instances, other genetic markers such as X-chromosome short tandem repeat (X-STR) markers are employed to supplement autosomal and Y-chromosomal STR DNA typing. However, prior to use, the degree of STR polymorphism in the population requires evaluation through generation of an allele or haplotype frequency population database. This population database is also used for statistical evaluation of DNA typing results. Here, we report X-STR data from 143 unrelated Filipino male individuals who were genotyped via conventional polymerase chain reaction-capillary electrophoresis (PCR-CE) using the 12 X-STR loci included in the Investigator ® Argus X-12 kit (Qiagen) and via massively parallel sequencing (MPS) of seven X-STR loci included in the ForenSeq ™ DNA Signature Prep kit of the MiSeq ® FGx ™ Forensic Genomics System (Illumina). Allele calls between PCR-CE and MPS systems were consistent (100% concordance) across seven overlapping X-STRs. Allele and haplotype frequencies and other parameters of forensic interest were calculated based on length (PCR-CE, 12 X-STRs) and sequence (MPS, seven X-STRs) variations observed in the population. Results of our study indicate that the 12 X-STRs in the PCR-CE system are highly informative for the Filipino population. MPS of seven X-STR loci identified 73 X-STR alleles compared with 55 X-STR alleles that were identified solely by length via PCR-CE. Of the 73 sequence-based alleles observed, six alleles have not been reported in the literature. The population data presented here may serve as a reference Philippine frequency database of X-STRs for forensic casework applications. Copyright © 2018 Elsevier B.V. All rights reserved.

Aptaligner: automated software for aligning pseudorandom DNA X-aptamers from next-generation sequencing data.

PubMed

Lu, Emily; Elizondo-Riojas, Miguel-Angel; Chang, Jeffrey T; Volk, David E

2014-06-10

Next-generation sequencing results from bead-based aptamer libraries have demonstrated that traditional DNA/RNA alignment software is insufficient. This is particularly true for X-aptamers containing specialty bases (W, X, Y, Z, ...) that are identified by special encoding. Thus, we sought an automated program that uses the inherent design scheme of bead-based X-aptamers to create a hypothetical reference library and Markov modeling techniques to provide improved alignments. Aptaligner provides this feature as well as length error and noise level cutoff features, is parallelized to run on multiple central processing units (cores), and sorts sequences from a single chip into projects and subprojects.

The population structure and recent colonization history of Oregon threespine stickleback determined using restriction-site associated DNA-sequencing.

PubMed

Catchen, Julian; Bassham, Susan; Wilson, Taylor; Currey, Mark; O'Brien, Conor; Yeates, Quick; Cresko, William A

2013-06-01

Understanding how genetic variation is partitioned across genomes within and among populations is a fundamental problem in ecological and evolutionary genetics. To address this problem, we studied the threespine stickleback fish, which has repeatedly undergone parallel phenotypic and genetic differentiation when oceanic fish have invaded freshwater habitats. While significant evolutionary genetic research has been performed using stickleback from geographic regions that have been deglaciated in the last 20 000 years, less research has focused on freshwater populations that predate the last glacial maximum. We performed restriction-site associated DNA-sequencing (RAD-seq) based population genomic analyses on stickleback from across Oregon, which was not glaciated during the last maximum. We sampled stickleback from coastal, Willamette Basin and central Oregon sites, analysed their genetic diversity using RAD-seq, performed structure analyses, reconstructed their phylogeographic history and tested the hypothesis of recent stickleback introduction into central Oregon, where incidence of this species was only recently documented. Our results showed a clear phylogeographic break between coastal and inland populations, with oceanic populations exhibiting the lowest levels of divergence from one another. Willamette Basin and central Oregon populations formed a clade of closely related populations, a finding consistent with a recent introduction of stickleback into central Oregon. Finally, genome-wide analysis of genetic diversity (π) and correlations of alleles within individuals in subpopulations (FIS) supported a role for introgressive hybridization in coastal populations and a recent expansion in central Oregon. Our results exhibit the power of next-generation sequencing genomic approaches such as RAD-seq to identify both historical population structure and recent colonization history. © 2013 John Wiley & Sons Ltd.

De novo prediction of human chromosome structures: Epigenetic marking patterns encode genome architecture.

PubMed

Di Pierro, Michele; Cheng, Ryan R; Lieberman Aiden, Erez; Wolynes, Peter G; Onuchic, José N

2017-11-14

Inside the cell nucleus, genomes fold into organized structures that are characteristic of cell type. Here, we show that this chromatin architecture can be predicted de novo using epigenetic data derived from chromatin immunoprecipitation-sequencing (ChIP-Seq). We exploit the idea that chromosomes encode a 1D sequence of chromatin structural types. Interactions between these chromatin types determine the 3D structural ensemble of chromosomes through a process similar to phase separation. First, a neural network is used to infer the relation between the epigenetic marks present at a locus, as assayed by ChIP-Seq, and the genomic compartment in which those loci reside, as measured by DNA-DNA proximity ligation (Hi-C). Next, types inferred from this neural network are used as an input to an energy landscape model for chromatin organization [Minimal Chromatin Model (MiChroM)] to generate an ensemble of 3D chromosome conformations at a resolution of 50 kilobases (kb). After training the model, dubbed Maximum Entropy Genomic Annotation from Biomarkers Associated to Structural Ensembles (MEGABASE), on odd-numbered chromosomes, we predict the sequences of chromatin types and the subsequent 3D conformational ensembles for the even chromosomes. We validate these structural ensembles by using ChIP-Seq tracks alone to predict Hi-C maps, as well as distances measured using 3D fluorescence in situ hybridization (FISH) experiments. Both sets of experiments support the hypothesis of phase separation being the driving process behind compartmentalization. These findings strongly suggest that epigenetic marking patterns encode sufficient information to determine the global architecture of chromosomes and that de novo structure prediction for whole genomes may be increasingly possible. Copyright © 2017 the Author(s). Published by PNAS.

Biosensing of BCR/ABL fusion gene using an intensity-interrogation surface plasmon resonance imaging system

NASA Astrophysics Data System (ADS)

Wu, Jiangling; Huang, Yu; Bian, Xintong; Li, DanDan; Cheng, Quan; Ding, Shijia

2016-10-01

In this work, a custom-made intensity-interrogation surface plasmon resonance imaging (SPRi) system has been developed to directly detect a specific sequence of BCR/ABL fusion gene in chronic myelogenous leukemia (CML). The variation in the reflected light intensity detected from the sensor chip composed of gold islands array is proportional to the change of refractive index due to the selective hybridization of surface-bound DNA probes with target ssDNA. SPRi measurements were performed with different concentrations of synthetic target DNA sequence. The calibration curve of synthetic target sequence shows a good relationship between the concentration of synthetic target and the change of reflected light intensity. The detection limit of this SPRi measurement could approach 10.29 nM. By comparing SPRi images, the target ssDNA and non-complementary DNA sequence are able to be distinguished. This SPRi system has been applied for assay of BCR/ABL fusion gene extracted from real samples. This nucleic acid-based SPRi biosensor therefore offers an alternative high-effective, high-throughput label-free tool for DNA detection in biomedical research and molecular diagnosis.

Spatial and temporal plasticity of chromatin during programmed DNA-reorganization in Stylonychia macronuclear development

PubMed Central

Postberg, Jan; Heyse, Katharina; Cremer, Marion; Cremer, Thomas; Lipps, Hans J

2008-01-01

Background: In this study we exploit the unique genome organization of ciliates to characterize the biological function of histone modification patterns and chromatin plasticity for the processing of specific DNA sequences during a nuclear differentiation process. Ciliates are single-cell eukaryotes containing two morphologically and functionally specialized types of nuclei, the somatic macronucleus and the germline micronucleus. In the course of sexual reproduction a new macronucleus develops from a micronuclear derivative. During this process specific DNA sequences are eliminated from the genome, while sequences that will be transcribed in the mature macronucleus are retained. Results: We show by immunofluorescence microscopy, Western analyses and chromatin immunoprecipitation (ChIP) experiments that each nuclear type establishes its specific histone modification signature. Our analyses reveal that the early macronuclear anlage adopts a permissive chromatin state immediately after the fusion of two heterochromatic germline micronuclei. As macronuclear development progresses, repressive histone modifications that specify sequences to be eliminated are introduced de novo. ChIP analyses demonstrate that permissive histone modifications are associated with sequences that will be retained in the new macronucleus. Furthermore, our data support the hypothesis that a PIWI-family protein is involved in a transnuclear cross-talk and in the RNAi-dependent control of developmental chromatin reorganization. Conclusion: Based on these data we present a comprehensive analysis of the spatial and temporal pattern of histone modifications during this nuclear differentiation process. Results obtained in this study may also be relevant for our understanding of chromatin plasticity during metazoan embryogenesis. PMID:19014664

SeqLib: a C ++ API for rapid BAM manipulation, sequence alignment and sequence assembly

PubMed Central

Wala, Jeremiah; Beroukhim, Rameen

2017-01-01

Abstract We present SeqLib, a C ++ API and command line tool that provides a rapid and user-friendly interface to BAM/SAM/CRAM files, global sequence alignment operations and sequence assembly. Four C libraries perform core operations in SeqLib: HTSlib for BAM access, BWA-MEM and BLAT for sequence alignment and Fermi for error correction and sequence assembly. Benchmarking indicates that SeqLib has lower CPU and memory requirements than leading C ++ sequence analysis APIs. We demonstrate an example of how minimal SeqLib code can extract, error-correct and assemble reads from a CRAM file and then align with BWA-MEM. SeqLib also provides additional capabilities, including chromosome-aware interval queries and read plotting. Command line tools are available for performing integrated error correction, micro-assemblies and alignment. Availability and Implementation: SeqLib is available on Linux and OSX for the C ++98 standard and later at github.com/walaj/SeqLib. SeqLib is released under the Apache2 license. Additional capabilities for BLAT alignment are available under the BLAT license. Contact: jwala@broadinstitue.org; rameen@broadinstitute.org PMID:28011768

SeqLib: a C ++ API for rapid BAM manipulation, sequence alignment and sequence assembly.

PubMed

Wala, Jeremiah; Beroukhim, Rameen

2017-03-01

We present SeqLib, a C ++ API and command line tool that provides a rapid and user-friendly interface to BAM/SAM/CRAM files, global sequence alignment operations and sequence assembly. Four C libraries perform core operations in SeqLib: HTSlib for BAM access, BWA-MEM and BLAT for sequence alignment and Fermi for error correction and sequence assembly. Benchmarking indicates that SeqLib has lower CPU and memory requirements than leading C ++ sequence analysis APIs. We demonstrate an example of how minimal SeqLib code can extract, error-correct and assemble reads from a CRAM file and then align with BWA-MEM. SeqLib also provides additional capabilities, including chromosome-aware interval queries and read plotting. Command line tools are available for performing integrated error correction, micro-assemblies and alignment. SeqLib is available on Linux and OSX for the C ++98 standard and later at github.com/walaj/SeqLib. SeqLib is released under the Apache2 license. Additional capabilities for BLAT alignment are available under the BLAT license. jwala@broadinstitue.org ; rameen@broadinstitute.org. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Development of Thinopyrum ponticum-specific molecular markers and FISH probes based on SLAF-seq technology.

PubMed

Liu, Liqin; Luo, Qiaoling; Teng, Wan; Li, Bin; Li, Hongwei; Li, Yiwen; Li, Zhensheng; Zheng, Qi

2018-05-01

Based on SLAF-seq, 67 Thinopyrum ponticum-specific markers and eight Th. ponticum-specific FISH probes were developed, and these markers and probes could be used for detection of alien chromatin in a wheat background. Decaploid Thinopyrum ponticum (2n = 10x = 70) is a valuable gene reservoir for wheat improvement. Identification of Th. ponticum introgression would facilitate its transfer into diverse wheat genetic backgrounds and its practical utilization in wheat improvement. Based on specific-locus-amplified fragment sequencing (SLAF-seq) technology, 67 new Th. ponticum-specific molecular markers and eight Th. ponticum-specific fluorescence in situ hybridization (FISH) probes have been developed from a tiny wheat-Th. ponticum translocation line. These newly developed molecular markers allowed the detection of Th. ponticum DNA in a variety of materials specifically and steadily at high throughput. According to the hybridization signal pattern, the eight Th. ponticum-specific probes could be divided into two groups. The first group including five dispersed repetitive sequence probes could identify Th. ponticum chromatin more sensitively and accurately than genomic in situ hybridization (GISH). Whereas the second group having three tandem repetitive sequence probes enabled the discrimination of Th. ponticum chromosomes together with another clone pAs1 in wheat-Th. ponticum partial amphiploid Xiaoyan 68.

fCCAC: functional canonical correlation analysis to evaluate covariance between nucleic acid sequencing datasets.

PubMed

Madrigal, Pedro

2017-03-01

Computational evaluation of variability across DNA or RNA sequencing datasets is a crucial step in genomic science, as it allows both to evaluate reproducibility of biological or technical replicates, and to compare different datasets to identify their potential correlations. Here we present fCCAC, an application of functional canonical correlation analysis to assess covariance of nucleic acid sequencing datasets such as chromatin immunoprecipitation followed by deep sequencing (ChIP-seq). We show how this method differs from other measures of correlation, and exemplify how it can reveal shared covariance between histone modifications and DNA binding proteins, such as the relationship between the H3K4me3 chromatin mark and its epigenetic writers and readers. An R/Bioconductor package is available at http://bioconductor.org/packages/fCCAC/ . pmb59@cam.ac.uk. Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.

Comprehensive analysis of single molecule sequencing-derived complete genome and whole transcriptome of Hyposidra talaca nuclear polyhedrosis virus.

PubMed

Nguyen, Thong T; Suryamohan, Kushal; Kuriakose, Boney; Janakiraman, Vasantharajan; Reichelt, Mike; Chaudhuri, Subhra; Guillory, Joseph; Divakaran, Neethu; Rabins, P E; Goel, Ridhi; Deka, Bhabesh; Sarkar, Suman; Ekka, Preety; Tsai, Yu-Chih; Vargas, Derek; Santhosh, Sam; Mohan, Sangeetha; Chin, Chen-Shan; Korlach, Jonas; Thomas, George; Babu, Azariah; Seshagiri, Somasekar

2018-06-12

We sequenced the Hyposidra talaca NPV (HytaNPV) double stranded circular DNA genome using PacBio single molecule sequencing technology. We found that the HytaNPV genome is 139,089 bp long with a GC content of 39.6%. It encodes 141 open reading frames (ORFs) including the 37 baculovirus core genes, 25 genes conserved among lepidopteran baculoviruses, 72 genes known in baculovirus, and 7 genes unique to the HytaNPV genome. It is a group II alphabaculovirus that codes for the F protein and lacks the gp64 gene found in group I alphabaculovirus viruses. Using RNA-seq, we confirmed the expression of the ORFs identified in the HytaNPV genome. Phylogenetic analysis showed HytaNPV to be closest to BusuNPV, SujuNPV and EcobNPV that infect other tea pests, Buzura suppressaria, Sucra jujuba, and Ectropis oblique, respectively. We identified repeat elements and a conserved non-coding baculovirus element in the genome. Analysis of the putative promoter sequences identified motif consistent with the temporal expression of the genes observed in the RNA-seq data.

Comparative Analysis of Single-Cell RNA Sequencing Methods.

PubMed

Ziegenhain, Christoph; Vieth, Beate; Parekh, Swati; Reinius, Björn; Guillaumet-Adkins, Amy; Smets, Martha; Leonhardt, Heinrich; Heyn, Holger; Hellmann, Ines; Enard, Wolfgang

2017-02-16

Single-cell RNA sequencing (scRNA-seq) offers new possibilities to address biological and medical questions. However, systematic comparisons of the performance of diverse scRNA-seq protocols are lacking. We generated data from 583 mouse embryonic stem cells to evaluate six prominent scRNA-seq methods: CEL-seq2, Drop-seq, MARS-seq, SCRB-seq, Smart-seq, and Smart-seq2. While Smart-seq2 detected the most genes per cell and across cells, CEL-seq2, Drop-seq, MARS-seq, and SCRB-seq quantified mRNA levels with less amplification noise due to the use of unique molecular identifiers (UMIs). Power simulations at different sequencing depths showed that Drop-seq is more cost-efficient for transcriptome quantification of large numbers of cells, while MARS-seq, SCRB-seq, and Smart-seq2 are more efficient when analyzing fewer cells. Our quantitative comparison offers the basis for an informed choice among six prominent scRNA-seq methods, and it provides a framework for benchmarking further improvements of scRNA-seq protocols. Copyright © 2017 Elsevier Inc. All rights reserved.

A Feature-Based Approach to Modeling Protein–DNA Interactions

PubMed Central

Segal, Eran

2008-01-01

Transcription factor (TF) binding to its DNA target site is a fundamental regulatory interaction. The most common model used to represent TF binding specificities is a position specific scoring matrix (PSSM), which assumes independence between binding positions. However, in many cases, this simplifying assumption does not hold. Here, we present feature motif models (FMMs), a novel probabilistic method for modeling TF–DNA interactions, based on log-linear models. Our approach uses sequence features to represent TF binding specificities, where each feature may span multiple positions. We develop the mathematical formulation of our model and devise an algorithm for learning its structural features from binding site data. We also developed a discriminative motif finder, which discovers de novo FMMs that are enriched in target sets of sequences compared to background sets. We evaluate our approach on synthetic data and on the widely used TF chromatin immunoprecipitation (ChIP) dataset of Harbison et al. We then apply our algorithm to high-throughput TF ChIP data from mouse and human, reveal sequence features that are present in the binding specificities of mouse and human TFs, and show that FMMs explain TF binding significantly better than PSSMs. Our FMM learning and motif finder software are available at http://genie.weizmann.ac.il/. PMID:18725950

AN ECOLOGICAL PERSPECTIVE OF GENOMICS: ASSESSING ECOLOGICAL RISK THROUGH PARTNERSHIPS

EPA Science Inventory

The application of new molecular biological tools to environmental toxicology was discussed at an international workshop attended by
approximately 60 government, academic, and industrial scientists. The sequencing of the human genome, development of microarrays and
DNA chip...

ChIPBase: a database for decoding the transcriptional regulation of long non-coding RNA and microRNA genes from ChIP-Seq data.

PubMed

Yang, Jian-Hua; Li, Jun-Hao; Jiang, Shan; Zhou, Hui; Qu, Liang-Hu

2013-01-01

Long non-coding RNAs (lncRNAs) and microRNAs (miRNAs) represent two classes of important non-coding RNAs in eukaryotes. Although these non-coding RNAs have been implicated in organismal development and in various human diseases, surprisingly little is known about their transcriptional regulation. Recent advances in chromatin immunoprecipitation with next-generation DNA sequencing (ChIP-Seq) have provided methods of detecting transcription factor binding sites (TFBSs) with unprecedented sensitivity. In this study, we describe ChIPBase (http://deepbase.sysu.edu.cn/chipbase/), a novel database that we have developed to facilitate the comprehensive annotation and discovery of transcription factor binding maps and transcriptional regulatory relationships of lncRNAs and miRNAs from ChIP-Seq data. The current release of ChIPBase includes high-throughput sequencing data that were generated by 543 ChIP-Seq experiments in diverse tissues and cell lines from six organisms. By analysing millions of TFBSs, we identified tens of thousands of TF-lncRNA and TF-miRNA regulatory relationships. Furthermore, two web-based servers were developed to annotate and discover transcriptional regulatory relationships of lncRNAs and miRNAs from ChIP-Seq data. In addition, we developed two genome browsers, deepView and genomeView, to provide integrated views of multidimensional data. Moreover, our web implementation supports diverse query types and the exploration of TFs, lncRNAs, miRNAs, gene ontologies and pathways.

Cell culture compositions

DOEpatents

Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yiao, Jian

2014-03-18

The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6 (SEQ ID NO:1 encodes the full length endoglucanase; SEQ ID NO:4 encodes the mature form), and the corresponding endoglucanase VI amino acid sequence ("EGVI"; SEQ ID NO:3 is the signal sequence; SEQ ID NO:2 is the mature sequence). The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

TagDigger: user-friendly extraction of read counts from GBS and RAD-seq data.

PubMed

Clark, Lindsay V; Sacks, Erik J

2016-01-01

In genotyping-by-sequencing (GBS) and restriction site-associated DNA sequencing (RAD-seq), read depth is important for assessing the quality of genotype calls and estimating allele dosage in polyploids. However, existing pipelines for GBS and RAD-seq do not provide read counts in formats that are both accurate and easy to access. Additionally, although existing pipelines allow previously-mined SNPs to be genotyped on new samples, they do not allow the user to manually specify a subset of loci to examine. Pipelines that do not use a reference genome assign arbitrary names to SNPs, making meta-analysis across projects difficult. We created the software TagDigger, which includes three programs for analyzing GBS and RAD-seq data. The first script, tagdigger_interactive.py, rapidly extracts read counts and genotypes from FASTQ files using user-supplied sets of barcodes and tags. Input and output is in CSV format so that it can be opened by spreadsheet software. Tag sequences can also be imported from the Stacks, TASSEL-GBSv2, TASSEL-UNEAK, or pyRAD pipelines, and a separate file can be imported listing the names of markers to retain. A second script, tag_manager.py, consolidates marker names and sequences across multiple projects. A third script, barcode_splitter.py, assists with preparing FASTQ data for deposit in a public archive by splitting FASTQ files by barcode and generating MD5 checksums for the resulting files. TagDigger is open-source and freely available software written in Python 3. It uses a scalable, rapid search algorithm that can process over 100 million FASTQ reads per hour. TagDigger will run on a laptop with any operating system, does not consume hard drive space with intermediate files, and does not require programming skill to use.

PySeqLab: an open source Python package for sequence labeling and segmentation.

PubMed

Allam, Ahmed; Krauthammer, Michael

2017-11-01

Text and genomic data are composed of sequential tokens, such as words and nucleotides that give rise to higher order syntactic constructs. In this work, we aim at providing a comprehensive Python library implementing conditional random fields (CRFs), a class of probabilistic graphical models, for robust prediction of these constructs from sequential data. Python Sequence Labeling (PySeqLab) is an open source package for performing supervised learning in structured prediction tasks. It implements CRFs models, that is discriminative models from (i) first-order to higher-order linear-chain CRFs, and from (ii) first-order to higher-order semi-Markov CRFs (semi-CRFs). Moreover, it provides multiple learning algorithms for estimating model parameters such as (i) stochastic gradient descent (SGD) and its multiple variations, (ii) structured perceptron with multiple averaging schemes supporting exact and inexact search using 'violation-fixing' framework, (iii) search-based probabilistic online learning algorithm (SAPO) and (iv) an interface for Broyden-Fletcher-Goldfarb-Shanno (BFGS) and the limited-memory BFGS algorithms. Viterbi and Viterbi A* are used for inference and decoding of sequences. Using PySeqLab, we built models (classifiers) and evaluated their performance in three different domains: (i) biomedical Natural language processing (NLP), (ii) predictive DNA sequence analysis and (iii) Human activity recognition (HAR). State-of-the-art performance comparable to machine-learning based systems was achieved in the three domains without feature engineering or the use of knowledge sources. PySeqLab is available through https://bitbucket.org/A_2/pyseqlab with tutorials and documentation. ahmed.allam@yale.edu or michael.krauthammer@yale.edu. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Inference of hierarchical regulatory network of estrogen-dependent breast cancer through ChIP-based data

PubMed Central

2010-01-01

Background Global profiling of in vivo protein-DNA interactions using ChIP-based technologies has evolved rapidly in recent years. Although many genome-wide studies have identified thousands of ERα binding sites and have revealed the associated transcription factor (TF) partners, such as AP1, FOXA1 and CEBP, little is known about ERα associated hierarchical transcriptional regulatory networks. Results In this study, we applied computational approaches to analyze three public available ChIP-based datasets: ChIP-seq, ChIP-PET and ChIP-chip, and to investigate the hierarchical regulatory network for ERα and ERα partner TFs regulation in estrogen-dependent breast cancer MCF7 cells. 16 common TFs and two common new TF partners (RORA and PITX2) were found among ChIP-seq, ChIP-chip and ChIP-PET datasets. The regulatory networks were constructed by scanning the ChIP-peak region with TF specific position weight matrix (PWM). A permutation test was performed to test the reliability of each connection of the network. We then used DREM software to perform gene ontology function analysis on the common genes. We found that FOS, PITX2, RORA and FOXA1 were involved in the up-regulated genes. We also conducted the ERα and Pol-II ChIP-seq experiments in tamoxifen resistance MCF7 cells (denoted as MCF7-T in this study) and compared the difference between MCF7 and MCF7-T cells. The result showed very little overlap between these two cells in terms of targeted genes (21.2% of common genes) and targeted TFs (25% of common TFs). The significant dissimilarity may indicate totally different transcriptional regulatory mechanisms between these two cancer cells. Conclusions Our study uncovers new estrogen-mediated regulatory networks by mining three ChIP-based data in MCF7 cells and ChIP-seq data in MCF7-T cells. We compared the different ChIP-based technologies as well as different breast cancer cells. Our computational analytical approach may guide biologists to further study the underlying mechanisms in breast cancer cells or other human diseases. PMID:21167036

Direct PCR Offers a Fast and Reliable Alternative to Conventional DNA Isolation Methods for Gut Microbiomes.

PubMed

Videvall, Elin; Strandh, Maria; Engelbrecht, Anel; Cloete, Schalk; Cornwallis, Charlie K

2017-01-01

The gut microbiome of animals is emerging as an important factor influencing ecological and evolutionary processes. A major bottleneck in obtaining microbiome data from large numbers of samples is the time-consuming laboratory procedures required, specifically the isolation of DNA and generation of amplicon libraries. Recently, direct PCR kits have been developed that circumvent conventional DNA extraction steps, thereby streamlining the laboratory process by reducing preparation time and costs. However, the reliability and efficacy of direct PCR for measuring host microbiomes have not yet been investigated other than in humans with 454 sequencing. Here, we conduct a comprehensive evaluation of the microbial communities obtained with direct PCR and the widely used Mo Bio PowerSoil DNA extraction kit in five distinct gut sample types (ileum, cecum, colon, feces, and cloaca) from 20 juvenile ostriches, using 16S rRNA Illumina MiSeq sequencing. We found that direct PCR was highly comparable over a range of measures to the DNA extraction method in cecal, colon, and fecal samples. However, the two methods significantly differed in samples with comparably low bacterial biomass: cloacal and especially ileal samples. We also sequenced 100 replicate sample pairs to evaluate repeatability during both extraction and PCR stages and found that both methods were highly consistent for cecal, colon, and fecal samples ( r s > 0.7) but had low repeatability for cloacal ( r s = 0.39) and ileal ( r s = -0.24) samples. This study indicates that direct PCR provides a fast, cheap, and reliable alternative to conventional DNA extraction methods for retrieving 16S rRNA data, which can aid future gut microbiome studies. IMPORTANCE The microbial communities of animals can have large impacts on their hosts, and the number of studies using high-throughput sequencing to measure gut microbiomes is rapidly increasing. However, the library preparation procedure in microbiome research is both costly and time-consuming, especially for large numbers of samples. We investigated a cheaper and faster direct PCR method designed to bypass the DNA isolation steps during 16S rRNA library preparation and compared it with a standard DNA extraction method. We used both techniques on five different gut sample types collected from 20 juvenile ostriches and sequenced samples with Illumina MiSeq. The methods were highly comparable and highly repeatable in three sample types with high microbial biomass (cecum, colon, and feces), but larger differences and low repeatability were found in the microbiomes obtained from the ileum and cloaca. These results will help microbiome researchers assess library preparation procedures and plan their studies accordingly.

A genome-wide interactome of DNA-associated proteins in the human liver.

PubMed

Ramaker, Ryne C; Savic, Daniel; Hardigan, Andrew A; Newberry, Kimberly; Cooper, Gregory M; Myers, Richard M; Cooper, Sara J

2017-11-01

Large-scale efforts like the ENCODE Project have made tremendous progress in cataloging the genomic binding patterns of DNA-associated proteins (DAPs), such as transcription factors (TFs). However, most chromatin immunoprecipitation-sequencing (ChIP-seq) analyses have focused on a few immortalized cell lines whose activities and physiology differ in important ways from endogenous cells and tissues. Consequently, binding data from primary human tissue are essential to improving our understanding of in vivo gene regulation. Here, we identify and analyze more than 440,000 binding sites using ChIP-seq data for 20 DAPs in two human liver tissue samples. We integrated binding data with transcriptome and phased WGS data to investigate allelic DAP interactions and the impact of heterozygous sequence variation on the expression of neighboring genes. Our tissue-based data set exhibits binding patterns more consistent with liver biology than cell lines, and we describe uses of these data to better prioritize impactful noncoding variation. Collectively, our rich data set offers novel insights into genome function in human liver tissue and provides a valuable resource for assessing disease-related disruptions. © 2017 Ramaker et al.; Published by Cold Spring Harbor Laboratory Press.

Rapid self-assembly of DNA on a microfluidic chip

PubMed Central

Zheng, Yao; Footz, Tim; Manage, Dammika P; Backhouse, Christopher James

2005-01-01

Background DNA self-assembly methods have played a major role in enabling methods for acquiring genetic information without having to resort to sequencing, a relatively slow and costly procedure. However, even self-assembly processes tend to be very slow when they rely upon diffusion on a large scale. Miniaturisation and integration therefore hold the promise of greatly increasing this speed of operation. Results We have developed a rapid method for implementing the self-assembly of DNA within a microfluidic system by electrically extracting the DNA from an environment containing an uncharged denaturant. By controlling the parameters of the electrophoretic extraction and subsequent analysis of the DNA we are able to control when the hybridisation occurs as well as the degree of hybridisation. By avoiding off-chip processing or long thermal treatments we are able to perform this hybridisation rapidly and can perform hybridisation, sizing, heteroduplex analysis and single-stranded conformation analysis within a matter of minutes. The rapidity of this analysis allows the sampling of transient effects that may improve the sensitivity of mutation detection. Conclusions We believe that this method will aid the integration of self-assembly methods upon microfluidic chips. The speed of this analysis also appears to provide information upon the dynamics of the self-assembly process. PMID:15717935

A Pre-mRNA-Splicing Factor Is Required for RNA-Directed DNA Methylation in Arabidopsis

PubMed Central

Huang, Chao-Feng; Miki, Daisuke; Tang, Kai; Zhou, Hao-Ran; Zheng, Zhimin; Chen, Wei; Ma, Ze-Yang; Yang, Lan; Zhang, Heng; Liu, Renyi; He, Xin-Jian; Zhu, Jian-Kang

2013-01-01

Cytosine DNA methylation is a stable epigenetic mark that is frequently associated with the silencing of genes and transposable elements (TEs). In Arabidopsis, the establishment of DNA methylation is through the RNA-directed DNA methylation (RdDM) pathway. Here, we report the identification and characterization of RDM16, a new factor in the RdDM pathway. Mutation of RDM16 reduced the DNA methylation levels and partially released the silencing of a reporter gene as well as some endogenous genomic loci in the DNA demethylase ros1-1 mutant background. The rdm16 mutant had morphological defects and was hypersensitive to salt stress and abscisic acid (ABA). Map-based cloning and complementation test led to the identification of RDM16, which encodes a pre-mRNA-splicing factor 3, a component of the U4/U6 snRNP. RNA-seq analysis showed that 308 intron retention events occurred in rdm16, confirming that RDM16 is involved in pre-mRNA splicing in planta. RNA-seq and mRNA expression analysis also revealed that the RDM16 mutation did not affect the pre-mRNA splicing of known RdDM genes, suggesting that RDM16 might be directly involved in RdDM. Small RNA expression analysis on loci showing RDM16-dependent DNA methylation suggested that unlike the previously reported putative splicing factor mutants, rdm16 did not affect small RNA levels; instead, the rdm16 mutation caused a decrease in the levels of Pol V transcripts. ChIP assays revealed that RDM16 was enriched at some Pol V target loci. Our results suggest that RDM16 regulates DNA methylation through influencing Pol V transcript levels. Finally, our genome-wide DNA methylation analysis indicated that RDM16 regulates the overall methylation of TEs and gene-surrounding regions, and preferentially targets Pol IV-dependent DNA methylation loci and the ROS1 target loci. Our work thus contributes to the understanding of RdDM and its interactions with active DNA demethylation. PMID:24068953

Nebula--a web-server for advanced ChIP-seq data analysis.

PubMed

Boeva, Valentina; Lermine, Alban; Barette, Camille; Guillouf, Christel; Barillot, Emmanuel

2012-10-01

ChIP-seq consists of chromatin immunoprecipitation and deep sequencing of the extracted DNA fragments. It is the technique of choice for accurate characterization of the binding sites of transcription factors and other DNA-associated proteins. We present a web service, Nebula, which allows inexperienced users to perform a complete bioinformatics analysis of ChIP-seq data. Nebula was designed for both bioinformaticians and biologists. It is based on the Galaxy open source framework. Galaxy already includes a large number of functionalities for mapping reads and peak calling. We added the following to Galaxy: (i) peak calling with FindPeaks and a module for immunoprecipitation quality control, (ii) de novo motif discovery with ChIPMunk, (iii) calculation of the density and the cumulative distribution of peak locations relative to gene transcription start sites, (iv) annotation of peaks with genomic features and (v) annotation of genes with peak information. Nebula generates the graphs and the enrichment statistics at each step of the process. During Steps 3-5, Nebula optionally repeats the analysis on a control dataset and compares these results with those from the main dataset. Nebula can also incorporate gene expression (or gene modulation) data during these steps. In summary, Nebula is an innovative web service that provides an advanced ChIP-seq analysis pipeline providing ready-to-publish results. Nebula is available at http://nebula.curie.fr/ Supplementary data are available at Bioinformatics online.

Discovery of common sequences absent in the human reference genome using pooled samples from next generation sequencing.

PubMed

Liu, Yu; Koyutürk, Mehmet; Maxwell, Sean; Xiang, Min; Veigl, Martina; Cooper, Richard S; Tayo, Bamidele O; Li, Li; LaFramboise, Thomas; Wang, Zhenghe; Zhu, Xiaofeng; Chance, Mark R

2014-08-16

Sequences up to several megabases in length have been found to be present in individual genomes but absent in the human reference genome. These sequences may be common in populations, and their absence in the reference genome may indicate rare variants in the genomes of individuals who served as donors for the human genome project. As the reference genome is used in probe design for microarray technology and mapping short reads in next generation sequencing (NGS), this missing sequence could be a source of bias in functional genomic studies and variant analysis. One End Anchor (OEA) and/or orphan reads from paired-end sequencing have been used to identify novel sequences that are absent in reference genome. However, there is no study to investigate the distribution, evolution and functionality of those sequences in human populations. To systematically identify and study the missing common sequences (micSeqs), we extended the previous method by pooling OEA reads from large number of individuals and applying strict filtering methods to remove false sequences. The pipeline was applied to data from phase 1 of the 1000 Genomes Project. We identified 309 micSeqs that are present in at least 1% of the human population, but absent in the reference genome. We confirmed 76% of these 309 micSeqs by comparison to other primate genomes, individual human genomes, and gene expression data. Furthermore, we randomly selected fifteen micSeqs and confirmed their presence using PCR validation in 38 additional individuals. Functional analysis using published RNA-seq and ChIP-seq data showed that eleven micSeqs are highly expressed in human brain and three micSeqs contain transcription factor (TF) binding regions, suggesting they are functional elements. In addition, the identified micSeqs are absent in non-primates and show dynamic acquisition during primate evolution culminating with most micSeqs being present in Africans, suggesting some micSeqs may be important sources of human diversity. 76% of micSeqs were confirmed by a comparative genomics approach. Fourteen micSeqs are expressed in human brain or contain TF binding regions. Some micSeqs are primate-specific, conserved and may play a role in the evolution of primates.

The emerging genomics and systems biology research lead to systems genomics studies.

PubMed

Yang, Mary Qu; Yoshigoe, Kenji; Yang, William; Tong, Weida; Qin, Xiang; Dunker, A; Chen, Zhongxue; Arbania, Hamid R; Liu, Jun S; Niemierko, Andrzej; Yang, Jack Y

2014-01-01

Synergistically integrating multi-layer genomic data at systems level not only can lead to deeper insights into the molecular mechanisms related to disease initiation and progression, but also can guide pathway-based biomarker and drug target identification. With the advent of high-throughput next-generation sequencing technologies, sequencing both DNA and RNA has generated multi-layer genomic data that can provide DNA polymorphism, non-coding RNA, messenger RNA, gene expression, isoform and alternative splicing information. Systems biology on the other hand studies complex biological systems, particularly systematic study of complex molecular interactions within specific cells or organisms. Genomics and molecular systems biology can be merged into the study of genomic profiles and implicated biological functions at cellular or organism level. The prospectively emerging field can be referred to as systems genomics or genomic systems biology. The Mid-South Bioinformatics Centre (MBC) and Joint Bioinformatics Ph.D. Program of University of Arkansas at Little Rock and University of Arkansas for Medical Sciences are particularly interested in promoting education and research advancement in this prospectively emerging field. Based on past investigations and research outcomes, MBC is further utilizing differential gene and isoform/exon expression from RNA-seq and co-regulation from the ChiP-seq specific for different phenotypes in combination with protein-protein interactions, and protein-DNA interactions to construct high-level gene networks for an integrative genome-phoneme investigation at systems biology level.

Large-scale collection of full-length cDNA and transcriptome analysis in Hevea brasiliensis.

PubMed

Makita, Yuko; Ng, Kiaw Kiaw; Veera Singham, G; Kawashima, Mika; Hirakawa, Hideki; Sato, Shusei; Othman, Ahmad Sofiman; Matsui, Minami

2017-04-01

Natural rubber has unique physical properties that cannot be replaced by products from other latex-producing plants or petrochemically produced synthetic rubbers. Rubber from Hevea brasiliensis is the main commercial source for this natural rubber that has a cis-polyisoprene configuration. For sustainable production of enough rubber to meet demand elucidation of the molecular mechanisms involved in the production of latex is vital. To this end, we firstly constructed rubber full-length cDNA libraries of RRIM 600 cultivar and sequenced around 20,000 clones by the Sanger method and over 15,000 contigs by Illumina sequencer. With these data, we updated around 5,500 gene structures and newly annotated around 9,500 transcription start sites. Second, to elucidate the rubber biosynthetic pathways and their transcriptional regulation, we carried out tissue- and cultivar-specific RNA-Seq analysis. By using our recently published genome sequence, we confirmed the expression patterns of the rubber biosynthetic genes. Our data suggest that the cytoplasmic mevalonate (MVA) pathway is the main route for isoprenoid biosynthesis in latex production. In addition to the well-studied polymerization factors, we suggest that rubber elongation factor 8 (REF8) is a candidate factor in cis-polyisoprene biosynthesis. We have also identified 39 transcription factors that may be key regulators in latex production. Expression profile analysis using two additional cultivars, RRIM 901 and PB 350, via an RNA-Seq approach revealed possible expression differences between a high latex-yielding cultivar and a disease-resistant cultivar. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Application of High-Throughput Next-Generation Sequencing for HLA Typing on Buccal Extracted DNA: Results from over 10,000 Donor Recruitment Samples

PubMed Central

Nguyen, David; Valenzuela, Nicole; Takemura, Ping; Bolon, Yung-Tsi; Springer, Brianna; Saito, Katsuyuki; Zheng, Ying; Hague, Tim; Pasztor, Agnes; Horvath, Gyorgy; Rigo, Krisztina; Reed, Elaine F.; Zhang, Qiuheng

2016-01-01

Background Unambiguous HLA typing is important in hematopoietic stem cell transplantation (HSCT), HLA disease association studies, and solid organ transplantation. However, current molecular typing methods only interrogate the antigen recognition site (ARS) of HLA genes, resulting in many cis-trans ambiguities that require additional typing methods to resolve. Here we report high-resolution HLA typing of 10,063 National Marrow Donor Program (NMDP) registry donors using long-range PCR by next generation sequencing (NGS) approach on buccal swab DNA. Methods Multiplex long-range PCR primers amplified the full-length of HLA class I genes (A, B, C) from promotor to 3’ UTR. Class II genes (DRB1, DQB1) were amplified from exon 2 through part of exon 4. PCR amplicons were pooled and sheared using Covaris fragmentation. Library preparation was performed using the Illumina TruSeq Nano kit on the Beckman FX automated platform. Each sample was tagged with a unique barcode, followed by 2×250 bp paired-end sequencing on the Illumina MiSeq. HLA typing was assigned using Omixon Twin software that combines two independent computational algorithms to ensure high confidence in allele calling. Consensus sequence and typing results were reported in Histoimmunogenetics Markup Language (HML) format. All homozygous alleles were confirmed by Luminex SSO typing and exon novelties were confirmed by Sanger sequencing. Results Using this automated workflow, over 10,063 NMDP registry donors were successfully typed under high-resolution by NGS. Despite known challenges of nucleic acid degradation and low DNA concentration commonly associated with buccal-based specimens, 97.8% of samples were successfully amplified using long-range PCR. Among these, 98.2% were successfully reported by NGS, with an accuracy rate of 99.84% in an independent blind Quality Control audit performed by the NDMP. In this study, NGS-HLA typing identified 23 null alleles (0.023%), 92 rare alleles (0.091%) and 42 exon novelties (0.042%). Conclusion Long-range, unambiguous HLA genotyping is achievable on clinical buccal swab-extracted DNA. Importantly, full-length gene sequencing and the ability to curate full sequence data will permit future interrogation of the impact of introns, expanded exons, and other gene regulatory sequences on clinical outcomes in transplantation. PMID:27798706

Application of High-Throughput Next-Generation Sequencing for HLA Typing on Buccal Extracted DNA: Results from over 10,000 Donor Recruitment Samples.

PubMed

Yin, Yuxin; Lan, James H; Nguyen, David; Valenzuela, Nicole; Takemura, Ping; Bolon, Yung-Tsi; Springer, Brianna; Saito, Katsuyuki; Zheng, Ying; Hague, Tim; Pasztor, Agnes; Horvath, Gyorgy; Rigo, Krisztina; Reed, Elaine F; Zhang, Qiuheng

2016-01-01

Unambiguous HLA typing is important in hematopoietic stem cell transplantation (HSCT), HLA disease association studies, and solid organ transplantation. However, current molecular typing methods only interrogate the antigen recognition site (ARS) of HLA genes, resulting in many cis-trans ambiguities that require additional typing methods to resolve. Here we report high-resolution HLA typing of 10,063 National Marrow Donor Program (NMDP) registry donors using long-range PCR by next generation sequencing (NGS) approach on buccal swab DNA. Multiplex long-range PCR primers amplified the full-length of HLA class I genes (A, B, C) from promotor to 3' UTR. Class II genes (DRB1, DQB1) were amplified from exon 2 through part of exon 4. PCR amplicons were pooled and sheared using Covaris fragmentation. Library preparation was performed using the Illumina TruSeq Nano kit on the Beckman FX automated platform. Each sample was tagged with a unique barcode, followed by 2×250 bp paired-end sequencing on the Illumina MiSeq. HLA typing was assigned using Omixon Twin software that combines two independent computational algorithms to ensure high confidence in allele calling. Consensus sequence and typing results were reported in Histoimmunogenetics Markup Language (HML) format. All homozygous alleles were confirmed by Luminex SSO typing and exon novelties were confirmed by Sanger sequencing. Using this automated workflow, over 10,063 NMDP registry donors were successfully typed under high-resolution by NGS. Despite known challenges of nucleic acid degradation and low DNA concentration commonly associated with buccal-based specimens, 97.8% of samples were successfully amplified using long-range PCR. Among these, 98.2% were successfully reported by NGS, with an accuracy rate of 99.84% in an independent blind Quality Control audit performed by the NDMP. In this study, NGS-HLA typing identified 23 null alleles (0.023%), 92 rare alleles (0.091%) and 42 exon novelties (0.042%). Long-range, unambiguous HLA genotyping is achievable on clinical buccal swab-extracted DNA. Importantly, full-length gene sequencing and the ability to curate full sequence data will permit future interrogation of the impact of introns, expanded exons, and other gene regulatory sequences on clinical outcomes in transplantation.

Defiant: (DMRs: easy, fast, identification and ANnoTation) identifies differentially Methylated regions from iron-deficient rat hippocampus.

PubMed

Condon, David E; Tran, Phu V; Lien, Yu-Chin; Schug, Jonathan; Georgieff, Michael K; Simmons, Rebecca A; Won, Kyoung-Jae

2018-02-05

Identification of differentially methylated regions (DMRs) is the initial step towards the study of DNA methylation-mediated gene regulation. Previous approaches to call DMRs suffer from false prediction, use extreme resources, and/or require library installation and input conversion. We developed a new approach called Defiant to identify DMRs. Employing Weighted Welch Expansion (WWE), Defiant showed superior performance to other predictors in the series of benchmarking tests on artificial and real data. Defiant was subsequently used to investigate DNA methylation changes in iron-deficient rat hippocampus. Defiant identified DMRs close to genes associated with neuronal development and plasticity, which were not identified by its competitor. Importantly, Defiant runs between 5 to 479 times faster than currently available software packages. Also, Defiant accepts 10 different input formats widely used for DNA methylation data. Defiant effectively identifies DMRs for whole-genome bisulfite sequencing (WGBS), reduced-representation bisulfite sequencing (RRBS), Tet-assisted bisulfite sequencing (TAB-seq), and HpaII tiny fragment enrichment by ligation-mediated PCR-tag (HELP) assays.

High diversity of airborne fungi in the hospital environment as revealed by meta-sequencing-based microbiome analysis

PubMed Central

Tong, Xunliang; Xu, Hongtao; Zou, Lihui; Cai, Meng; Xu, Xuefeng; Zhao, Zuotao; Xiao, Fei; Li, Yanming

2017-01-01

Invasive fungal infections acquired in the hospital have progressively emerged as an important cause of life-threatening infection. In particular, airborne fungi in hospitals are considered critical pathogens of hospital-associated infections. To identify the causative airborne microorganisms, high-volume air samplers were utilized for collection, and species identification was performed using a culture-based method and DNA sequencing analysis with the Illumina MiSeq and HiSeq 2000 sequencing systems. Few bacteria were grown after cultivation in blood agar. However, using microbiome sequencing, the relative abundance of fungi, Archaea species, bacteria and viruses was determined. The distribution characteristics of fungi were investigated using heat map analysis of four departments, including the Respiratory Intensive Care Unit, Intensive Care Unit, Emergency Room and Outpatient Department. The prevalence of Aspergillus among fungi was the highest at the species level, approximately 17% to 61%, and the prevalence of Aspergillus fumigatus among Aspergillus species was from 34% to 50% in the four departments. Draft genomes of microorganisms isolated from the hospital environment were obtained by sequence analysis, indicating that investigation into the diversity of airborne fungi may provide reliable results for hospital infection control and surveillance. PMID:28045065

Simultaneously learning DNA motif along with its position and sequence rank preferences through expectation maximization algorithm.

PubMed

Zhang, ZhiZhuo; Chang, Cheng Wei; Hugo, Willy; Cheung, Edwin; Sung, Wing-Kin

2013-03-01

Although de novo motifs can be discovered through mining over-represented sequence patterns, this approach misses some real motifs and generates many false positives. To improve accuracy, one solution is to consider some additional binding features (i.e., position preference and sequence rank preference). This information is usually required from the user. This article presents a de novo motif discovery algorithm called SEME (sampling with expectation maximization for motif elicitation), which uses pure probabilistic mixture model to model the motif's binding features and uses expectation maximization (EM) algorithms to simultaneously learn the sequence motif, position, and sequence rank preferences without asking for any prior knowledge from the user. SEME is both efficient and accurate thanks to two important techniques: the variable motif length extension and importance sampling. Using 75 large-scale synthetic datasets, 32 metazoan compendium benchmark datasets, and 164 chromatin immunoprecipitation sequencing (ChIP-Seq) libraries, we demonstrated the superior performance of SEME over existing programs in finding transcription factor (TF) binding sites. SEME is further applied to a more difficult problem of finding the co-regulated TF (coTF) motifs in 15 ChIP-Seq libraries. It identified significantly more correct coTF motifs and, at the same time, predicted coTF motifs with better matching to the known motifs. Finally, we show that the learned position and sequence rank preferences of each coTF reveals potential interaction mechanisms between the primary TF and the coTF within these sites. Some of these findings were further validated by the ChIP-Seq experiments of the coTFs. The application is available online.

SeqWare Query Engine: storing and searching sequence data in the cloud.

PubMed

O'Connor, Brian D; Merriman, Barry; Nelson, Stanley F

2010-12-21

Since the introduction of next-generation DNA sequencers the rapid increase in sequencer throughput, and associated drop in costs, has resulted in more than a dozen human genomes being resequenced over the last few years. These efforts are merely a prelude for a future in which genome resequencing will be commonplace for both biomedical research and clinical applications. The dramatic increase in sequencer output strains all facets of computational infrastructure, especially databases and query interfaces. The advent of cloud computing, and a variety of powerful tools designed to process petascale datasets, provide a compelling solution to these ever increasing demands. In this work, we present the SeqWare Query Engine which has been created using modern cloud computing technologies and designed to support databasing information from thousands of genomes. Our backend implementation was built using the highly scalable, NoSQL HBase database from the Hadoop project. We also created a web-based frontend that provides both a programmatic and interactive query interface and integrates with widely used genome browsers and tools. Using the query engine, users can load and query variants (SNVs, indels, translocations, etc) with a rich level of annotations including coverage and functional consequences. As a proof of concept we loaded several whole genome datasets including the U87MG cell line. We also used a glioblastoma multiforme tumor/normal pair to both profile performance and provide an example of using the Hadoop MapReduce framework within the query engine. This software is open source and freely available from the SeqWare project (http://seqware.sourceforge.net). The SeqWare Query Engine provided an easy way to make the U87MG genome accessible to programmers and non-programmers alike. This enabled a faster and more open exploration of results, quicker tuning of parameters for heuristic variant calling filters, and a common data interface to simplify development of analytical tools. The range of data types supported, the ease of querying and integrating with existing tools, and the robust scalability of the underlying cloud-based technologies make SeqWare Query Engine a nature fit for storing and searching ever-growing genome sequence datasets.

SeqWare Query Engine: storing and searching sequence data in the cloud

PubMed Central

2010-01-01

Background Since the introduction of next-generation DNA sequencers the rapid increase in sequencer throughput, and associated drop in costs, has resulted in more than a dozen human genomes being resequenced over the last few years. These efforts are merely a prelude for a future in which genome resequencing will be commonplace for both biomedical research and clinical applications. The dramatic increase in sequencer output strains all facets of computational infrastructure, especially databases and query interfaces. The advent of cloud computing, and a variety of powerful tools designed to process petascale datasets, provide a compelling solution to these ever increasing demands. Results In this work, we present the SeqWare Query Engine which has been created using modern cloud computing technologies and designed to support databasing information from thousands of genomes. Our backend implementation was built using the highly scalable, NoSQL HBase database from the Hadoop project. We also created a web-based frontend that provides both a programmatic and interactive query interface and integrates with widely used genome browsers and tools. Using the query engine, users can load and query variants (SNVs, indels, translocations, etc) with a rich level of annotations including coverage and functional consequences. As a proof of concept we loaded several whole genome datasets including the U87MG cell line. We also used a glioblastoma multiforme tumor/normal pair to both profile performance and provide an example of using the Hadoop MapReduce framework within the query engine. This software is open source and freely available from the SeqWare project (http://seqware.sourceforge.net). Conclusions The SeqWare Query Engine provided an easy way to make the U87MG genome accessible to programmers and non-programmers alike. This enabled a faster and more open exploration of results, quicker tuning of parameters for heuristic variant calling filters, and a common data interface to simplify development of analytical tools. The range of data types supported, the ease of querying and integrating with existing tools, and the robust scalability of the underlying cloud-based technologies make SeqWare Query Engine a nature fit for storing and searching ever-growing genome sequence datasets. PMID:21210981

Detecting a single molecule using a micropore-nanopore hybrid chip

PubMed Central

2013-01-01

Nanopore-based DNA sequencing and biomolecule sensing have attracted more and more attention. In this work, novel sensing devices were built on the basis of the chips containing nanopore arrays in polycarbonate (PC) membranes and micropores in Si3N4 films. Using the integrated chips, the transmembrane ionic current induced by biomolecule's translocation was recorded and analyzed, which suggested that the detected current did not change linearly as commonly expected with increasing biomolecule concentration. On the other hand, detailed translocation information (such as translocation gesture) was also extracted from the discrete current blockages in basic current curves. These results indicated that the nanofluidic device based on the chips integrated by micropores and nanopores possessed comparative potentials in biomolecule sensing. PMID:24261484

Detecting a single molecule using a micropore-nanopore hybrid chip.

PubMed

Liu, Lei; Zhu, Lizhong; Ni, Zhonghua; Chen, Yunfei

2013-11-21

Nanopore-based DNA sequencing and biomolecule sensing have attracted more and more attention. In this work, novel sensing devices were built on the basis of the chips containing nanopore arrays in polycarbonate (PC) membranes and micropores in Si3N4 films. Using the integrated chips, the transmembrane ionic current induced by biomolecule's translocation was recorded and analyzed, which suggested that the detected current did not change linearly as commonly expected with increasing biomolecule concentration. On the other hand, detailed translocation information (such as translocation gesture) was also extracted from the discrete current blockages in basic current curves. These results indicated that the nanofluidic device based on the chips integrated by micropores and nanopores possessed comparative potentials in biomolecule sensing.

Variation of DNA Methylome of Zebrafish Cells under Cold Pressure

PubMed Central

Xu, Qiongqiong; Luo, Juntao; Shi, Yingdi; Li, Xiaoxia; Yan, Xiaonan; Zhang, Junfang

2016-01-01

DNA methylation is an essential epigenetic mechanism involved in multiple biological processes. However, the relationship between DNA methylation and cold acclimation remains poorly understood. In this study, Methylated DNA Immunoprecipitation Sequencing (MeDIP-seq) was performed to reveal a genome-wide methylation profile of zebrafish (Danio rerio) embryonic fibroblast cells (ZF4) and its variation under cold pressure. MeDIP-seq assay was conducted with ZF4 cells cultured at appropriate temperature of 28°C and at low temperature of 18°C for 5 (short-term) and 30 (long-term) days, respectively. Our data showed that DNA methylation level of whole genome increased after a short-term cold exposure and decreased after a long-term cold exposure. It is interesting that metabolism of folate pathway is significantly hypomethylated after short-term cold exposure, which is consistent with the increased DNA methylation level. 21% of methylation peaks were significantly altered after cold treatment. About 8% of altered DNA methylation peaks are located in promoter regions, while the majority of them are located in non-coding regions. Methylation of genes involved in multiple cold responsive biological processes were significantly affected, such as anti-oxidant system, apoptosis, development, chromatin modifying and immune system suggesting that those processes are responsive to cold stress through regulation of DNA methylation. Our data indicate the involvement of DNA methylation in cellular response to cold pressure, and put a new insight into the genome-wide epigenetic regulation under cold pressure. PMID:27494266

P53 Mutation Analysis to Predict Tumor Response in Patients Undergoing Neoadjuvant Treatment for Locally Advanced Breast Cancer

DTIC Science & Technology

2006-10-01

then sequenced (for GeneChip- positiv SSCP (for GeneChip-negative). We have received a total of 43 core breast biopsy DNA samples from the UNC... quantitative luciferase reporter. Both reporters exploit a “rheostatable” promoter for p53 expression and utilize the “delitto perfetto” in vivo... quantitative luciferase-based assay is also being used to characterize the altered function sistent an tion T mutants in greater detail. Preliminary

GenoGAM: genome-wide generalized additive models for ChIP-Seq analysis.

PubMed

Stricker, Georg; Engelhardt, Alexander; Schulz, Daniel; Schmid, Matthias; Tresch, Achim; Gagneur, Julien

2017-08-01

Chromatin immunoprecipitation followed by deep sequencing (ChIP-Seq) is a widely used approach to study protein-DNA interactions. Often, the quantities of interest are the differential occupancies relative to controls, between genetic backgrounds, treatments, or combinations thereof. Current methods for differential occupancy of ChIP-Seq data rely however on binning or sliding window techniques, for which the choice of the window and bin sizes are subjective. Here, we present GenoGAM (Genome-wide Generalized Additive Model), which brings the well-established and flexible generalized additive models framework to genomic applications using a data parallelism strategy. We model ChIP-Seq read count frequencies as products of smooth functions along chromosomes. Smoothing parameters are objectively estimated from the data by cross-validation, eliminating ad hoc binning and windowing needed by current approaches. GenoGAM provides base-level and region-level significance testing for full factorial designs. Application to a ChIP-Seq dataset in yeast showed increased sensitivity over existing differential occupancy methods while controlling for type I error rate. By analyzing a set of DNA methylation data and illustrating an extension to a peak caller, we further demonstrate the potential of GenoGAM as a generic statistical modeling tool for genome-wide assays. Software is available from Bioconductor: https://www.bioconductor.org/packages/release/bioc/html/GenoGAM.html . gagneur@in.tum.de. Supplementary information is available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

RNA-Seq analysis to capture the transcriptome landscape of a single cell

PubMed Central

Tang, Fuchou; Barbacioru, Catalin; Nordman, Ellen; Xu, Nanlan; Bashkirov, Vladimir I; Lao, Kaiqin; Surani, M. Azim

2013-01-01

We describe here a protocol for digital transcriptome analysis in a single mouse blastomere using a deep sequencing approach. An individual blastomere was first isolated and put into lysate buffer by mouth pipette. Reverse transcription was then performed directly on the whole cell lysate. After this, the free primers were removed by Exonuclease I and a poly(A) tail was added to the 3′ end of the first-strand cDNA by Terminal Deoxynucleotidyl Transferase. Then the single cell cDNAs were amplified by 20 plus 9 cycles of PCR. Then 100-200 ng of these amplified cDNAs were used to construct a sequencing library. The sequencing library can be used for deep sequencing using the SOLiD system. Compared with the cDNA microarray technique, our assay can capture up to 75% more genes expressed in early embryos. The protocol can generate deep sequencing libraries within 6 days for 16 single cell samples. PMID:20203668

TCL1A, a Novel Transcription Factor and a Coregulator of Nuclear Factor κB p65: Single Nucleotide Polymorphism and Estrogen Dependence.

PubMed

Ho, Ming-Fen; Lummertz da Rocha, Edroaldo; Zhang, Cheng; Ingle, James N; Goss, Paul E; Shepherd, Lois E; Kubo, Michiaki; Wang, Liewei; Li, Hu; Weinshilboum, Richard M

2018-06-01

T-cell leukemia 1A ( TCL1A ) single-nucleotide polymorphisms (SNPs) have been associated with aromatase inhibitor-induced musculoskeletal adverse events. We previously demonstrated that TCL1A is inducible by estradiol (E 2 ) and plays a critical role in the regulation of cytokines, chemokines, and Toll-like receptors in a TCL1A SNP genotype and estrogen-dependent fashion. Furthermore, TCLIA SNP-dependent expression phenotypes can be "reversed" by exposure to selective estrogen receptor modulators such as 4-hydroxytamoxifen (4OH-TAM). The present study was designed to comprehensively characterize the role of TCL1A in transcriptional regulation across the genome by performing RNA sequencing (RNA-seq) and chromatin immunoprecipitation sequencing (ChIP-seq) assays with lymphoblastoid cell lines. RNA-seq identified 357 genes that were regulated in a TCL1A SNP- and E 2 -dependent fashion with expression patterns that were 4OH-TAM reversible. ChIP-seq for the same cells identified 57 TCL1A binding sites that could be regulated by E 2 in a SNP-dependent fashion. Even more striking, nuclear factor- κ B (NF- κ B) p65 bound to those same DNA regions. In summary, TCL1A is a novel transcription factor with expression that is regulated in a SNP- and E 2 -dependent fashion-a pattern of expression that can be reversed by 4OH-TAM. Integrated RNA-seq and ChIP-seq results suggest that TCL1A also acts as a transcriptional coregulator with NF- κ B p65, an important immune system transcription factor. Copyright © 2018 by The American Society for Pharmacology and Experimental Therapeutics.

GenSeq: An updated nomenclature and ranking for genetic sequences from type and non-type sources

PubMed Central

Chakrabarty, Prosanta; Warren, Melanie; Page, Lawrence M.; Baldwin, Carole C.

2013-01-01

Abstract An improved and expanded nomenclature for genetic sequences is introduced that corresponds with a ranking of the reliability of the taxonomic identification of the source specimens. This nomenclature is an advancement of the “Genetypes” naming system, which some have been reluctant to adopt because of the use of the “type” suffix in the terminology. In the new nomenclature, genetic sequences are labeled “genseq,” followed by a reliability ranking (e.g., 1 if the sequence is from a primary type), followed by the name of the genes from which the sequences were derived (e.g., genseq-1 16S, COI). The numbered suffix provides an indication of the likely reliability of taxonomic identification of the voucher. Included in this ranking system, in descending order of taxonomic reliability, are the following: sequences from primary types – “genseq-1,” secondary types – “genseq-2,” collection-vouchered topotypes – “genseq-3,” collection-vouchered non-types – “genseq-4,” and non-types that lack specimen vouchers but have photo vouchers – “genseq-5.” To demonstrate use of the new nomenclature, we review recently published new-species descriptions in the ichthyological literature that include DNA data and apply the GenSeq nomenclature to sequences referenced in those publications. We encourage authors to adopt the GenSeq nomenclature (note capital “G” and “S” when referring to the nomenclatural program) to provide a searchable tag (e.g., “genseq”; note lowercase “g” and “s” when referring to sequences) for genetic sequences from types and other vouchered specimens. Use of the new nomenclature and ranking system will improve integration of molecular phylogenetics and biological taxonomy and enhance the ability of researchers to assess the reliability of sequence data. We further encourage authors to update sequence information on databases such as GenBank whenever nomenclatural changes are made. PMID:24223486

Quantum dot-based microfluidic biosensor for cancer detection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ghrera, Aditya Sharma; School of Engineering and Technology, ITM University, Gurgaon-122017; Pandey, Chandra Mouli

2015-05-11

We report results of the studies relating to fabrication of an impedimetric microfluidic–based nucleic acid sensor for quantification of DNA sequences specific to chronic myelogenous leukemia (CML). The sensor chip is prepared by patterning an indium–tin–oxide (ITO) coated glass substrate via wet chemical etching method followed by sealing with polydimethylsiloxane (PDMS) microchannel for fluid control. The fabricated microfluidic chip comprising of a patterned ITO substrate is modified by depositing cadmium selenide quantum dots (QCdSe) via Langmuir–Blodgett technique. Further, the QCdSe surface has been functionalized with specific DNA probe for CML detection. The probe DNA functionalized QCdSe integrated miniaturized system hasmore » been used to monitor target complementary DNA concentration by measuring the interfacial charge transfer resistance via hybridization. The presence of complementary DNA in buffer solution significantly results in decreased electro-conductivity of the interface due to presence of a charge barrier for transport of the redox probe ions. The microfluidic DNA biosensor exhibits improved linearity in the concentration range of 10{sup −15} M to 10{sup −11} M.« less

AN ECOLOGICAL PERSPECTIVE OF GENOMICS: ASSESSING ECOLOGICAL RISK THROUGH PARTNERSHIPS

EPA Science Inventory

A workshop attended by approximately 60 scientists from around the world met to discuss the application of new molecular biology tools to issues in environmental toxicology and chemistry. With the sequencing of the human genome, development of microarrays and DNA chips, and devel...

Single molecule and single cell epigenomics.

PubMed

Hyun, Byung-Ryool; McElwee, John L; Soloway, Paul D

2015-01-15

Dynamically regulated changes in chromatin states are vital for normal development and can produce disease when they go awry. Accordingly, much effort has been devoted to characterizing these states under normal and pathological conditions. Chromatin immunoprecipitation followed by sequencing (ChIP-seq) is the most widely used method to characterize where in the genome transcription factors, modified histones, modified nucleotides and chromatin binding proteins are found; bisulfite sequencing (BS-seq) and its variants are commonly used to characterize the locations of DNA modifications. Though very powerful, these methods are not without limitations. Notably, they are best at characterizing one chromatin feature at a time, yet chromatin features arise and function in combination. Investigators commonly superimpose separate ChIP-seq or BS-seq datasets, and then infer where chromatin features are found together. While these inferences might be correct, they can be misleading when the chromatin source has distinct cell types, or when a given cell type exhibits any cell to cell variation in chromatin state. These ambiguities can be eliminated by robust methods that directly characterize the existence and genomic locations of combinations of chromatin features in very small inputs of cells or ideally, single cells. Here we review single molecule epigenomic methods under development to overcome these limitations, the technical challenges associated with single molecule methods and their potential application to single cells. Copyright © 2014 Elsevier Inc. All rights reserved.

Single Molecule and Single Cell Epigenomics

PubMed Central

Hyun, Byung-Ryool; McElwee, John L.; Soloway, Paul D.

2014-01-01

Dynamically regulated changes in chromatin states are vital for normal development and can produce disease when they go awry. Accordingly, much effort has been devoted to characterizing these states under normal and pathological conditions. Chromatin immunoprecipitation followed by sequencing (ChIP-seq) is the most widely used method to characterize where in the genome transcription factors, modified histones, modified nucleotides and chromatin binding proteins are found; bisulfite sequencing (BS-seq) and its variants are commonly used to characterize the locations of DNA modifications. Though very powerful, these methods are not without limitations. Notably, they are best at characterizing one chromatin feature at a time, yet chromatin features arise and function in combination. Investigators commonly superimpose separate ChIP-seq or BS-seq datasets, and then infer where chromatin features are found together. While these inferences might be correct, they can be misleading when the chromatin source has distinct cell types, or when a given cell type exhibits any cell to cell variation in chromatin state. These ambiguities can be eliminated by robust methods that directly characterize the existence and genomic locations of combinations of chromatin features in very small inputs of cells or ideally, single cells. Here we review single molecule epigenomic methods under development to overcome these limitations, the technical challenges associated with single molecule methods and their potential application to single cells. PMID:25204781

Development and Verification of an RNA Sequencing (RNA-Seq) Assay for the Detection of Gene Fusions in Tumors.

PubMed

Winters, Jennifer L; Davila, Jaime I; McDonald, Amber M; Nair, Asha A; Fadra, Numrah; Wehrs, Rebecca N; Thomas, Brittany C; Balcom, Jessica R; Jin, Long; Wu, Xianglin; Voss, Jesse S; Klee, Eric W; Oliver, Gavin R; Graham, Rondell P; Neff, Jadee L; Rumilla, Kandelaria M; Aypar, Umut; Kipp, Benjamin R; Jenkins, Robert B; Jen, Jin; Halling, Kevin C

2018-06-13

We assessed the performance characteristics of an RNA sequencing (RNA-Seq) assay designed to detect gene fusions in 571 genes to help manage patients with cancer. Polyadenylated RNA was converted to cDNA, which was then used to prepare next-generation sequencing libraries that were sequenced on an Illumina HiSeq 2500 instrument and analyzed with an in-house developed bioinformatic pipeline. The assay identified 38 of 41 gene fusions detected by another method, such as fluorescence in situ hybridization or RT-PCR, for a sensitivity of 93%. No false-positive gene fusions were identified in 15 normal tissue specimens and 10 tumor specimens that were negative for fusions by RNA sequencing or Mate Pair NGS (100% specificity). The assay also identified 22 fusions in 17 tumor specimens that had not been detected by other methods. Eighteen of the 22 fusions had not previously been described. Good intra-assay and interassay reproducibility was observed with complete concordance for the presence or absence of gene fusions in replicates. The analytical sensitivity of the assay was tested by diluting RNA isolated from gene fusion-positive cases with fusion-negative RNA. Gene fusions were generally detectable down to 12.5% dilutions for most fusions and as little as 3% for some fusions. This assay can help identify fusions in patients with cancer; these patients may in turn benefit from both US Food and Drug Administration-approved and investigational targeted therapies. Copyright © 2018 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

DNA Clutch Probes for Circulating Tumor DNA Analysis.

PubMed

Das, Jagotamoy; Ivanov, Ivaylo; Sargent, Edward H; Kelley, Shana O

2016-08-31

Progress toward the development of minimally invasive liquid biopsies of disease is being bolstered by breakthroughs in the analysis of circulating tumor DNA (ctDNA): DNA released from cancer cells into the bloodstream. However, robust, sensitive, and specific methods of detecting this emerging analyte are lacking. ctDNA analysis has unique challenges, since it is imperative to distinguish circulating DNA from normal cells vs mutation-bearing sequences originating from tumors. Here we report the electrochemical detection of mutated ctDNA in samples collected from cancer patients. By developing a strategy relying on the use of DNA clutch probes (DCPs) that render specific sequences of ctDNA accessible, we were able to readout the presence of mutated ctDNA. DCPs prevent reassociation of denatured DNA strands: they make one of the two strands of a dsDNA accessible for hybridization to a probe, and they also deactivate other closely related sequences in solution. DCPs ensure thereby that only mutated sequences associate with chip-based sensors detecting hybridization events. The assay exhibits excellent sensitivity and specificity in the detection of mutated ctDNA: it detects 1 fg/μL of a target mutation in the presence of 100 pg/μL of wild-type DNA, corresponding to detecting mutations at a level of 0.01% relative to wild type. This approach allows accurate analysis of samples collected from lung cancer and melanoma patients. This work represents the first detection of ctDNA without enzymatic amplification.

A Framework Phylogeny of the American Oak Clade Based on Sequenced RAD Data

PubMed Central

Hipp, Andrew L.; Eaton, Deren A. R.; Cavender-Bares, Jeannine; Fitzek, Elisabeth; Nipper, Rick; Manos, Paul S.

2014-01-01

Previous phylogenetic studies in oaks (Quercus, Fagaceae) have failed to resolve the backbone topology of the genus with strong support. Here, we utilize next-generation sequencing of restriction-site associated DNA (RAD-Seq) to resolve a framework phylogeny of a predominantly American clade of oaks whose crown age is estimated at 23–33 million years old. Using a recently developed analytical pipeline for RAD-Seq phylogenetics, we created a concatenated matrix of 1.40 E06 aligned nucleotides, constituting 27,727 sequence clusters. RAD-Seq data were readily combined across runs, with no difference in phylogenetic placement between technical replicates, which overlapped by only 43–64% in locus coverage. 17% (4,715) of the loci we analyzed could be mapped with high confidence to one or more expressed sequence tags in NCBI Genbank. A concatenated matrix of the loci that BLAST to at least one EST sequence provides approximately half as many variable or parsimony-informative characters as equal-sized datasets from the non-EST loci. The EST-associated matrix is more complete (fewer missing loci) and has slightly lower homoplasy than non-EST subsampled matrices of the same size, but there is no difference in phylogenetic support or relative attribution of base substitutions to internal versus terminal branches of the phylogeny. We introduce a partitioned RAD visualization method (implemented in the R package RADami; http://cran.r-project.org/web/packages/RADami) to investigate the possibility that suboptimal topologies supported by large numbers of loci—due, for example, to reticulate evolution or lineage sorting—are masked by the globally optimal tree. We find no evidence for strongly-supported alternative topologies in our study, suggesting that the phylogeny we recover is a robust estimate of large-scale phylogenetic patterns in the American oak clade. Our study is one of the first to demonstrate the utility of RAD-Seq data for inferring phylogeny in a 23–33 million year-old clade. PMID:24705617

Sequence variation between 462 human individuals fine-tunes functional sites of RNA processing

NASA Astrophysics Data System (ADS)

Ferreira, Pedro G.; Oti, Martin; Barann, Matthias; Wieland, Thomas; Ezquina, Suzana; Friedländer, Marc R.; Rivas, Manuel A.; Esteve-Codina, Anna; Estivill, Xavier; Guigó, Roderic; Dermitzakis, Emmanouil; Antonarakis, Stylianos; Meitinger, Thomas; Strom, Tim M.; Palotie, Aarno; François Deleuze, Jean; Sudbrak, Ralf; Lerach, Hans; Gut, Ivo; Syvänen, Ann-Christine; Gyllensten, Ulf; Schreiber, Stefan; Rosenstiel, Philip; Brunner, Han; Veltman, Joris; Hoen, Peter A. C. T.; Jan van Ommen, Gert; Carracedo, Angel; Brazma, Alvis; Flicek, Paul; Cambon-Thomsen, Anne; Mangion, Jonathan; Bentley, David; Hamosh, Ada; Rosenstiel, Philip; Strom, Tim M.; Lappalainen, Tuuli; Guigó, Roderic; Sammeth, Michael

2016-09-01

Recent advances in the cost-efficiency of sequencing technologies enabled the combined DNA- and RNA-sequencing of human individuals at the population-scale, making genome-wide investigations of the inter-individual genetic impact on gene expression viable. Employing mRNA-sequencing data from the Geuvadis Project and genome sequencing data from the 1000 Genomes Project we show that the computational analysis of DNA sequences around splice sites and poly-A signals is able to explain several observations in the phenotype data. In contrast to widespread assessments of statistically significant associations between DNA polymorphisms and quantitative traits, we developed a computational tool to pinpoint the molecular mechanisms by which genetic markers drive variation in RNA-processing, cataloguing and classifying alleles that change the affinity of core RNA elements to their recognizing factors. The in silico models we employ further suggest RNA editing can moonlight as a splicing-modulator, albeit less frequently than genomic sequence diversity. Beyond existing annotations, we demonstrate that the ultra-high resolution of RNA-Seq combined from 462 individuals also provides evidence for thousands of bona fide novel elements of RNA processing—alternative splice sites, introns, and cleavage sites—which are often rare and lowly expressed but in other characteristics similar to their annotated counterparts.

Characterization of the Burkholderia thailandensis SOS Response by Using Whole-Transcriptome Shotgun Sequencing

PubMed Central

Ulrich, Ricky L.; DeShazer, David; Kenny, Tara A.; Ulrich, Melanie P.; Moravusova, Anna; Opperman, Timothy; Bavari, Sina; Bowlin, Terry L.; Moir, Donald T.

2013-01-01

The bacterial SOS response is a well-characterized regulatory network encoded by most prokaryotic bacterial species and is involved in DNA repair. In addition to nucleic acid repair, the SOS response is involved in pathogenicity, stress-induced mutagenesis, and the emergence and dissemination of antibiotic resistance. Using high-throughput sequencing technology (SOLiD RNA-Seq), we analyzed the Burkholderia thailandensis global SOS response to the fluoroquinolone antibiotic, ciprofloxacin (CIP), and the DNA-damaging chemical, mitomycin C (MMC). We demonstrate that a B. thailandensis recA mutant (RU0643) is ∼4-fold more sensitive to CIP in contrast to the parental strain B. thailandensis DW503. Our RNA-Seq results show that CIP and MMC treatment (P < 0.01) resulted in the differential expression of 344 genes in B. thailandensis and 210 genes in RU0643. Several genes associated with the SOS response were induced and include lexA, uvrA, dnaE, dinB, recX, and recA. At the genome-wide level, we found an overall decrease in gene expression, especially for genes involved in amino acid and carbohydrate transport and metabolism, following both CIP and MMC exposure. Interestingly, we observed the upregulation of several genes involved in bacterial motility and enhanced transcription of a B. thailandensis genomic island encoding a Siphoviridae bacteriophage designated ϕE264. Using B. thailandensis plaque assays and PCR with B. mallei ATCC 23344 as the host, we demonstrate that CIP and MMC exposure in B. thailandensis DW503 induces the transcription and translation of viable bacteriophage in a RecA-dependent manner. This is the first report of the SOS response in Burkholderia spp. to DNA-damaging agents. We have identified both common and unique adaptive responses of B. thailandensis to chemical stress and DNA damage. PMID:23872555

Dynamic DNA cytosine methylation in the Populus trichocarpa genome: tissue-level variation and relationship to gene expression

PubMed Central

2012-01-01

Background DNA cytosine methylation is an epigenetic modification that has been implicated in many biological processes. However, large-scale epigenomic studies have been applied to very few plant species, and variability in methylation among specialized tissues and its relationship to gene expression is poorly understood. Results We surveyed DNA methylation from seven distinct tissue types (vegetative bud, male inflorescence [catkin], female catkin, leaf, root, xylem, phloem) in the reference tree species black cottonwood (Populus trichocarpa). Using 5-methyl-cytosine DNA immunoprecipitation followed by Illumina sequencing (MeDIP-seq), we mapped a total of 129,360,151 36- or 32-mer reads to the P. trichocarpa reference genome. We validated MeDIP-seq results by bisulfite sequencing, and compared methylation and gene expression using published microarray data. Qualitative DNA methylation differences among tissues were obvious on a chromosome scale. Methylated genes had lower expression than unmethylated genes, but genes with methylation in transcribed regions ("gene body methylation") had even lower expression than genes with promoter methylation. Promoter methylation was more frequent than gene body methylation in all tissues except male catkins. Male catkins differed in demethylation of particular transposable element categories, in level of gene body methylation, and in expression range of genes with methylated transcribed regions. Tissue-specific gene expression patterns were correlated with both gene body and promoter methylation. Conclusions We found striking differences among tissues in methylation, which were apparent at the chromosomal scale and when genes and transposable elements were examined. In contrast to other studies in plants, gene body methylation had a more repressive effect on transcription than promoter methylation. PMID:22251412

Characterization of the Burkholderia thailandensis SOS response by using whole-transcriptome shotgun sequencing.

PubMed

Ulrich, Ricky L; Deshazer, David; Kenny, Tara A; Ulrich, Melanie P; Moravusova, Anna; Opperman, Timothy; Bavari, Sina; Bowlin, Terry L; Moir, Donald T; Panchal, Rekha G

2013-10-01

The bacterial SOS response is a well-characterized regulatory network encoded by most prokaryotic bacterial species and is involved in DNA repair. In addition to nucleic acid repair, the SOS response is involved in pathogenicity, stress-induced mutagenesis, and the emergence and dissemination of antibiotic resistance. Using high-throughput sequencing technology (SOLiD RNA-Seq), we analyzed the Burkholderia thailandensis global SOS response to the fluoroquinolone antibiotic, ciprofloxacin (CIP), and the DNA-damaging chemical, mitomycin C (MMC). We demonstrate that a B. thailandensis recA mutant (RU0643) is ∼4-fold more sensitive to CIP in contrast to the parental strain B. thailandensis DW503. Our RNA-Seq results show that CIP and MMC treatment (P < 0.01) resulted in the differential expression of 344 genes in B. thailandensis and 210 genes in RU0643. Several genes associated with the SOS response were induced and include lexA, uvrA, dnaE, dinB, recX, and recA. At the genome-wide level, we found an overall decrease in gene expression, especially for genes involved in amino acid and carbohydrate transport and metabolism, following both CIP and MMC exposure. Interestingly, we observed the upregulation of several genes involved in bacterial motility and enhanced transcription of a B. thailandensis genomic island encoding a Siphoviridae bacteriophage designated E264. Using B. thailandensis plaque assays and PCR with B. mallei ATCC 23344 as the host, we demonstrate that CIP and MMC exposure in B. thailandensis DW503 induces the transcription and translation of viable bacteriophage in a RecA-dependent manner. This is the first report of the SOS response in Burkholderia spp. to DNA-damaging agents. We have identified both common and unique adaptive responses of B. thailandensis to chemical stress and DNA damage.

Chip-based sequencing nucleic acids

DOEpatents

Beer, Neil Reginald

2014-08-26

A system for fast DNA sequencing by amplification of genetic material within microreactors, denaturing, demulsifying, and then sequencing the material, while retaining it in a PCR/sequencing zone by a magnetic field. One embodiment includes sequencing nucleic acids on a microchip that includes a microchannel flow channel in the microchip. The nucleic acids are isolated and hybridized to magnetic nanoparticles or to magnetic polystyrene-coated beads. Microreactor droplets are formed in the microchannel flow channel. The microreactor droplets containing the nucleic acids and the magnetic nanoparticles are retained in a magnetic trap in the microchannel flow channel and sequenced.

Squeezing water from a stone: high-throughput sequencing from a 145-year old holotype resolves (barely) a cryptic species problem in flying lizards.

PubMed

McGuire, Jimmy A; Cotoras, Darko D; O'Connell, Brendan; Lawalata, Shobi Z S; Wang-Claypool, Cynthia Y; Stubbs, Alexander; Huang, Xiaoting; Wogan, Guinevere O U; Hykin, Sarah M; Reilly, Sean B; Bi, Ke; Riyanto, Awal; Arida, Evy; Smith, Lydia L; Milne, Heather; Streicher, Jeffrey W; Iskandar, Djoko T

2018-01-01

We used Massively Parallel High-Throughput Sequencing to obtain genetic data from a 145-year old holotype specimen of the flying lizard, Draco cristatellus . Obtaining genetic data from this holotype was necessary to resolve an otherwise intractable taxonomic problem involving the status of this species relative to closely related sympatric Draco species that cannot otherwise be distinguished from one another on the basis of museum specimens. Initial analyses suggested that the DNA present in the holotype sample was so degraded as to be unusable for sequencing. However, we used a specialized extraction procedure developed for highly degraded ancient DNA samples and MiSeq shotgun sequencing to obtain just enough low-coverage mitochondrial DNA (721 base pairs) to conclusively resolve the species status of the holotype as well as a second known specimen of this species. The holotype was prepared before the advent of formalin-fixation and therefore was most likely originally fixed with ethanol and never exposed to formalin. Whereas conventional wisdom suggests that formalin-fixed samples should be the most challenging for DNA sequencing, we propose that evaporation during long-term alcohol storage and consequent water-exposure may subject older ethanol-fixed museum specimens to hydrolytic damage. If so, this may pose an even greater challenge for sequencing efforts involving historical samples.

Generational comparisons (F1 versus F3) of vinclozolin induced epigenetic transgenerational inheritance of sperm differential DNA methylation regions (epimutations) using MeDIP-Seq.

PubMed

Beck, Daniel; Sadler-Riggleman, Ingrid; Skinner, Michael K

2017-07-01

Environmentally induced epigenetic transgenerational inheritance of disease and phenotypic variation has been shown to involve DNA methylation alterations in the germline (e.g. sperm). These differential DNA methylation regions (DMRs) are termed epimutations and in part transmit the transgenerational phenotypes. The agricultural fungicide vinclozolin exposure of a gestating female rat has previously been shown to promote transgenerational disease and epimutations in F3 generation (great-grand-offspring) animals. The current study was designed to investigate the actions of direct fetal exposure on the F1 generation rat sperm DMRs compared to the F3 transgenerational sperm DMRs. A protocol involving methylated DNA immunoprecipitation (MeDIP) followed by next-generation sequencing (Seq) was used in the current study. Bioinformatics analysis of the MeDIP-Seq data was developed and several different variations in the bioinformatic analysis were evaluated. Observations indicate needs to be considered. Interestingly, the F1 generation DMRs were found to be fewer in number and for the most part distinct from the F3 generation epimutations. Observations suggest the direct exposure induced F1 generation sperm DMRs appear to promote in subsequent generations alterations in the germ cell developmental programming that leads to the distinct epimutations in the F3 generation. This may help explain the differences in disease and phenotypes between the direct exposure F1 generation and transgenerational F3 generation. Observations demonstrate a distinction between the direct exposure versus transgenerational epigenetic programming induced by environmental exposures and provide insights into the molecular mechanisms involved in the epigenetic transgenerational inheritance phenomenon.

BlackOPs: increasing confidence in variant detection through mappability filtering.

PubMed

Cabanski, Christopher R; Wilkerson, Matthew D; Soloway, Matthew; Parker, Joel S; Liu, Jinze; Prins, Jan F; Marron, J S; Perou, Charles M; Hayes, D Neil

2013-10-01

Identifying variants using high-throughput sequencing data is currently a challenge because true biological variants can be indistinguishable from technical artifacts. One source of technical artifact results from incorrectly aligning experimentally observed sequences to their true genomic origin ('mismapping') and inferring differences in mismapped sequences to be true variants. We developed BlackOPs, an open-source tool that simulates experimental RNA-seq and DNA whole exome sequences derived from the reference genome, aligns these sequences by custom parameters, detects variants and outputs a blacklist of positions and alleles caused by mismapping. Blacklists contain thousands of artifact variants that are indistinguishable from true variants and, for a given sample, are expected to be almost completely false positives. We show that these blacklist positions are specific to the alignment algorithm and read length used, and BlackOPs allows users to generate a blacklist specific to their experimental setup. We queried the dbSNP and COSMIC variant databases and found numerous variants indistinguishable from mapping errors. We demonstrate how filtering against blacklist positions reduces the number of potential false variants using an RNA-seq glioblastoma cell line data set. In summary, accounting for mapping-caused variants tuned to experimental setups reduces false positives and, therefore, improves genome characterization by high-throughput sequencing.

Mitochondrial DNA variant at HVI region as a candidate of genetic markers of type 2 diabetes

NASA Astrophysics Data System (ADS)

Gumilar, Gun Gun; Purnamasari, Yunita; Setiadi, Rahmat

2016-02-01

Mitochondrial DNA (mtDNA) is maternally inherited. mtDNA mutations which can contribute to the excess of maternal inheritance of type 2 diabetes. Due to the high mutation rate, one of the areas in the mtDNA that is often associated with the disease is the hypervariable region I (HVI). Therefore, this study was conducted to determine the genetic variants of human mtDNA HVI that related to the type 2 diabetes in four samples that were taken from four generations in one lineage. Steps being taken include the lyses of hair follicles, amplification of mtDNA HVI fragment using Polymerase Chain Reaction (PCR), detection of PCR products through agarose gel electrophoresis technique, the measurement of the concentration of mtDNA using UV-Vis spectrophotometer, determination of the nucleotide sequence via direct sequencing method and analysis of the sequencing results using SeqMan DNASTAR program. Based on the comparison between nucleotide sequence of samples and revised Cambridge Reference Sequence (rCRS) obtained six same mutations that these are C16147T, T16189C, C16193del, T16127C, A16235G, and A16293C. After comparing the data obtained to the secondary data from Mitomap and NCBI, it were found that two mutations, T16189C and T16217C, become candidates as genetic markers of type 2 diabetes even the mutations were found also in the generations of undiagnosed type 2 diabetes. The results of this study are expected to give contribution to the collection of human mtDNA database of genetic variants that associated to metabolic diseases, so that in the future it can be utilized in various fields, especially in medicine.

Analytical study of a microfludic DNA amplification chip using water cooling effect.

PubMed

Chen, Jyh Jian; Shen, Chia Ming; Ko, Yu Wei

2013-04-01

A novel continuous-flow polymerase chain reaction (PCR) chip has been analyzed in our work. Two temperature zones are controlled by two external controllers and the other temperature zone at the chip center is controlled by the flow rate of the fluid inside a channel under the glass chip. By employing a water cooling channel at the chip center, the sequence of denaturation, annealing, and extension can be created due to the forced convection effect. The required annealing temperature of PCR less than 313 K can also be demonstrated in this chip. The Poly(methyl methacrylate) (PMMA) cooling channel with the thin aluminum cover is utilized to enhance the temperature uniformity. The size of this chip is 76 mm × 26 mm × 3 mm. This device represents the first demonstration of water cooling thermocycling within continuous-flow PCR microfluidics. The commercial software CFD-ACE+(TM) is utilized to determine the distances between the heating assemblies within the chip. We investigate the influences of various chip materials, operational parameters of the cooling channel and geometric parameters of the chip on the temperature uniformity on the chip surface. Concerning the temperature uniformity of the working zones and the lowest temperature at the annealing zone, the air gap spacing of 1 mm and the cooling channel thicknesses of 1 mm of the PMMA channel with an aluminum cover are recommended in our design. The hydrophobic surface of the PDMS channel was modified by filling it with 20 % Tween 20 solution and then adding bovine serum albumin (BSA) solution to the PCR mixture. DNA fragments with different lengths (372 bp and 478 bp) are successfully amplified with the device.

Carbohydrate degrading polypeptide and uses thereof

DOEpatents

Sagt, Cornelis Maria Jacobus; Schooneveld-Bergmans, Margot Elisabeth Francoise; Roubos, Johannes Andries; Los, Alrik Pieter

2015-10-20

The invention relates to a polypeptide having carbohydrate material degrading activity which comprises the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 4, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 96% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 96% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional protein and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

Identification of copy number variations associated with congenital heart disease by chromosomal microarray analysis and next-generation sequencing.

PubMed

Zhu, Xiangyu; Li, Jie; Ru, Tong; Wang, Yaping; Xu, Yan; Yang, Ying; Wu, Xing; Cram, David S; Hu, Yali

2016-04-01

To determine the type and frequency of pathogenic chromosomal abnormalities in fetuses diagnosed with congenital heart disease (CHD) using chromosomal microarray analysis (CMA) and validate next-generation sequencing as an alternative diagnostic method. Chromosomal aneuploidies and submicroscopic copy number variations (CNVs) were identified in amniocytes DNA samples from CHD fetuses using high-resolution CMA and copy number variation sequencing (CNV-Seq). Overall, 21 of 115 CHD fetuses (18.3%) referred for CMA had a pathogenic chromosomal anomaly. In six of 73 fetuses (8.2%) with an isolated CHD, CMA identified two cases of DiGeorge syndrome, and one case each of 1q21.1 microdeletion, 16p11.2 microdeletion and Angelman/Prader Willi syndromes, and 22q11.21 microduplication syndrome. In 12 of 42 fetuses (28.6%) with CHD and additional structural abnormalities, CMA identified eight whole or partial trisomies (19.0%), five CNVs (11.9%) associated with DiGeorge, Wolf-Hirschhorn, Miller-Dieker, Cri du Chat and Blepharophimosis, Ptosis, and Epicanthus Inversus syndromes and four other rare pathogenic CNVs (9.5%). Overall, there was a 100% diagnostic concordance between CMA and CNV-Seq for detecting all 21 pathogenic chromosomal abnormalities associated with CHD. CMA and CNV-Seq are reliable and accurate prenatal techniques for identifying pathogenic fetal chromosomal abnormalities associated with cardiac defects. © 2016 John Wiley & Sons, Ltd. © 2016 John Wiley & Sons, Ltd.

Methods for processing high-throughput RNA sequencing data.

PubMed

Ares, Manuel

2014-11-03

High-throughput sequencing (HTS) methods for analyzing RNA populations (RNA-Seq) are gaining rapid application to many experimental situations. The steps in an RNA-Seq experiment require thought and planning, especially because the expense in time and materials is currently higher and the protocols are far less routine than those used for other high-throughput methods, such as microarrays. As always, good experimental design will make analysis and interpretation easier. Having a clear biological question, an idea about the best way to do the experiment, and an understanding of the number of replicates needed will make the entire process more satisfying. Whether the goal is capturing transcriptome complexity from a tissue or identifying small fragments of RNA cross-linked to a protein of interest, conversion of the RNA to cDNA followed by direct sequencing using the latest methods is a developing practice, with new technical modifications and applications appearing every day. Even more rapid are the development and improvement of methods for analysis of the very large amounts of data that arrive at the end of an RNA-Seq experiment, making considerations regarding reproducibility, validation, visualization, and interpretation increasingly important. This introduction is designed to review and emphasize a pathway of analysis from experimental design through data presentation that is likely to be successful, with the recognition that better methods are right around the corner. © 2014 Cold Spring Harbor Laboratory Press.

Read clouds uncover variation in complex regions of the human genome

PubMed Central

Bishara, Alex; Liu, Yuling; Weng, Ziming; Kashef-Haghighi, Dorna; Newburger, Daniel E.; West, Robert; Sidow, Arend; Batzoglou, Serafim

2015-01-01

Although an increasing amount of human genetic variation is being identified and recorded, determining variants within repeated sequences of the human genome remains a challenge. Most population and genome-wide association studies have therefore been unable to consider variation in these regions. Core to the problem is the lack of a sequencing technology that produces reads with sufficient length and accuracy to enable unique mapping. Here, we present a novel methodology of using read clouds, obtained by accurate short-read sequencing of DNA derived from long fragment libraries, to confidently align short reads within repeat regions and enable accurate variant discovery. Our novel algorithm, Random Field Aligner (RFA), captures the relationships among the short reads governed by the long read process via a Markov Random Field. We utilized a modified version of the Illumina TruSeq synthetic long-read protocol, which yielded shallow-sequenced read clouds. We test RFA through extensive simulations and apply it to discover variants on the NA12878 human sample, for which shallow TruSeq read cloud sequencing data are available, and on an invasive breast carcinoma genome that we sequenced using the same method. We demonstrate that RFA facilitates accurate recovery of variation in 155 Mb of the human genome, including 94% of 67 Mb of segmental duplication sequence and 96% of 11 Mb of transcribed sequence, that are currently hidden from short-read technologies. PMID:26286554

The complete mitochondrial genome of Haliotis laevigata (Gastropoda: Haliotidae) using MiSeq and HiSeq sequencing.

PubMed

Robinson, Nick A; Hall, Nathan E; Ross, Elizabeth M; Cooke, Ira R; Shiel, Brett P; Robinson, Andrew J; Strugnell, Jan M

2016-01-01

The mitochondrial genome of greenlip abalone, Haliotis laevigata, is reported. MiSeq and HiSeq sequencing of one individual was assembled to yield a single 16,545 bp contig. The sequence shares 92% identity to the H. rubra mitochondrial genome (a closely related species that hybridize with H. laevigata in the wild). The sequence will be useful for determining the maternal contribution to hybrid populations, for investigating population structure and stock-enhancement effectiveness.

Nanopore DNA Sequencing and Genome Assembly on the International Space Station.

PubMed

Castro-Wallace, Sarah L; Chiu, Charles Y; John, Kristen K; Stahl, Sarah E; Rubins, Kathleen H; McIntyre, Alexa B R; Dworkin, Jason P; Lupisella, Mark L; Smith, David J; Botkin, Douglas J; Stephenson, Timothy A; Juul, Sissel; Turner, Daniel J; Izquierdo, Fernando; Federman, Scot; Stryke, Doug; Somasekar, Sneha; Alexander, Noah; Yu, Guixia; Mason, Christopher E; Burton, Aaron S

2017-12-21

We evaluated the performance of the MinION DNA sequencer in-flight on the International Space Station (ISS), and benchmarked its performance off-Earth against the MinION, Illumina MiSeq, and PacBio RS II sequencing platforms in terrestrial laboratories. Samples contained equimolar mixtures of genomic DNA from lambda bacteriophage, Escherichia coli (strain K12, MG1655) and Mus musculus (female BALB/c mouse). Nine sequencing runs were performed aboard the ISS over a 6-month period, yielding a total of 276,882 reads with no apparent decrease in performance over time. From sequence data collected aboard the ISS, we constructed directed assemblies of the ~4.6 Mb E. coli genome, ~48.5 kb lambda genome, and a representative M. musculus sequence (the ~16.3 kb mitochondrial genome), at 100%, 100%, and 96.7% consensus pairwise identity, respectively; de novo assembly of the E. coli genome from raw reads yielded a single contig comprising 99.9% of the genome at 98.6% consensus pairwise identity. Simulated real-time analyses of in-flight sequence data using an automated bioinformatic pipeline and laptop-based genomic assembly demonstrated the feasibility of sequencing analysis and microbial identification aboard the ISS. These findings illustrate the potential for sequencing applications including disease diagnosis, environmental monitoring, and elucidating the molecular basis for how organisms respond to spaceflight.

19 CFR 12.39 - Imported articles involving unfair methods of competition or practices.

Code of Federal Regulations, 2010 CFR

2010-04-01

... economically operated United States industry, or to restrain or monopolize trade and commerce in the United... the authorization or consent of the Government. (e) Importations of semiconductor chip products. (1) In accordance with the Semiconductor Chip Protection Act of 1984 (17 U.S.C. 901 et seq.), if the...

VaDiR: an integrated approach to Variant Detection in RNA.

PubMed

Neums, Lisa; Suenaga, Seiji; Beyerlein, Peter; Anders, Sara; Koestler, Devin; Mariani, Andrea; Chien, Jeremy

2018-02-01

Advances in next-generation DNA sequencing technologies are now enabling detailed characterization of sequence variations in cancer genomes. With whole-genome sequencing, variations in coding and non-coding sequences can be discovered. But the cost associated with it is currently limiting its general use in research. Whole-exome sequencing is used to characterize sequence variations in coding regions, but the cost associated with capture reagents and biases in capture rate limit its full use in research. Additional limitations include uncertainty in assigning the functional significance of the mutations when these mutations are observed in the non-coding region or in genes that are not expressed in cancer tissue. We investigated the feasibility of uncovering mutations from expressed genes using RNA sequencing datasets with a method called Variant Detection in RNA(VaDiR) that integrates 3 variant callers, namely: SNPiR, RVBoost, and MuTect2. The combination of all 3 methods, which we called Tier 1 variants, produced the highest precision with true positive mutations from RNA-seq that could be validated at the DNA level. We also found that the integration of Tier 1 variants with those called by MuTect2 and SNPiR produced the highest recall with acceptable precision. Finally, we observed a higher rate of mutation discovery in genes that are expressed at higher levels. Our method, VaDiR, provides a possibility of uncovering mutations from RNA sequencing datasets that could be useful in further functional analysis. In addition, our approach allows orthogonal validation of DNA-based mutation discovery by providing complementary sequence variation analysis from paired RNA/DNA sequencing datasets.

Single-cell genome sequencing at ultra-high-throughput with microfluidic droplet barcoding.

PubMed

Lan, Freeman; Demaree, Benjamin; Ahmed, Noorsher; Abate, Adam R

2017-07-01

The application of single-cell genome sequencing to large cell populations has been hindered by technical challenges in isolating single cells during genome preparation. Here we present single-cell genomic sequencing (SiC-seq), which uses droplet microfluidics to isolate, fragment, and barcode the genomes of single cells, followed by Illumina sequencing of pooled DNA. We demonstrate ultra-high-throughput sequencing of >50,000 cells per run in a synthetic community of Gram-negative and Gram-positive bacteria and fungi. The sequenced genomes can be sorted in silico based on characteristic sequences. We use this approach to analyze the distributions of antibiotic-resistance genes, virulence factors, and phage sequences in microbial communities from an environmental sample. The ability to routinely sequence large populations of single cells will enable the de-convolution of genetic heterogeneity in diverse cell populations.

Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

PubMed Central

Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

2016-01-01

DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

454 next generation-sequencing outperforms allele-specific PCR, Sanger sequencing, and pyrosequencing for routine KRAS mutation analysis of formalin-fixed, paraffin-embedded samples

PubMed Central

Altimari, Annalisa; de Biase, Dario; De Maglio, Giovanna; Gruppioni, Elisa; Capizzi, Elisa; Degiovanni, Alessio; D’Errico, Antonia; Pession, Annalisa; Pizzolitto, Stefano; Fiorentino, Michelangelo; Tallini, Giovanni

2013-01-01

Detection of KRAS mutations in archival pathology samples is critical for therapeutic appropriateness of anti-EGFR monoclonal antibodies in colorectal cancer. We compared the sensitivity, specificity, and accuracy of Sanger sequencing, ARMS-Scorpion (TheraScreen®) real-time polymerase chain reaction (PCR), pyrosequencing, chip array hybridization, and 454 next-generation sequencing to assess KRAS codon 12 and 13 mutations in 60 nonconsecutive selected cases of colorectal cancer. Twenty of the 60 cases were detected as wild-type KRAS by all methods with 100% specificity. Among the 40 mutated cases, 13 were discrepant with at least one method. The sensitivity was 85%, 90%, 93%, and 92%, and the accuracy was 90%, 93%, 95%, and 95% for Sanger sequencing, TheraScreen real-time PCR, pyrosequencing, and chip array hybridization, respectively. The main limitation of Sanger sequencing was its low analytical sensitivity, whereas TheraScreen real-time PCR, pyrosequencing, and chip array hybridization showed higher sensitivity but suffered from the limitations of predesigned assays. Concordance between the methods was k = 0.79 for Sanger sequencing and k > 0.85 for the other techniques. Tumor cell enrichment correlated significantly with the abundance of KRAS-mutated deoxyribonucleic acid (DNA), evaluated as ΔCt for TheraScreen real-time PCR (P = 0.03), percentage of mutation for pyrosequencing (P = 0.001), ratio for chip array hybridization (P = 0.003), and percentage of mutation for 454 next-generation sequencing (P = 0.004). Also, 454 next-generation sequencing showed the best cross correlation for quantification of mutation abundance compared with all the other methods (P < 0.001). Our comparison showed the superiority of next-generation sequencing over the other techniques in terms of sensitivity and specificity. Next-generation sequencing will replace Sanger sequencing as the reference technique for diagnostic detection of KRAS mutation in archival tumor tissues. PMID:23950653

Mediator binding to UASs is broadly uncoupled from transcription and cooperative with TFIID recruitment to promoters.

PubMed

Grünberg, Sebastian; Henikoff, Steven; Hahn, Steven; Zentner, Gabriel E

2016-11-15

Mediator is a conserved, essential transcriptional coactivator complex, but its in vivo functions have remained unclear due to conflicting data regarding its genome-wide binding pattern obtained by genome-wide ChIP Here, we used ChEC-seq, a method orthogonal to ChIP, to generate a high-resolution map of Mediator binding to the yeast genome. We find that Mediator associates with upstream activating sequences (UASs) rather than the core promoter or gene body under all conditions tested. Mediator occupancy is surprisingly correlated with transcription levels at only a small fraction of genes. Using the same approach to map TFIID, we find that TFIID is associated with both TFIID- and SAGA-dependent genes and that TFIID and Mediator occupancy is cooperative. Our results clarify Mediator recruitment and binding to the genome, showing that Mediator binding to UASs is widespread, partially uncoupled from transcription, and mediated in part by TFIID. © 2016 The Authors.

Clinical next-generation sequencing in patients with non-small cell lung cancer.

PubMed

Hagemann, Ian S; Devarakonda, Siddhartha; Lockwood, Christina M; Spencer, David H; Guebert, Kalin; Bredemeyer, Andrew J; Al-Kateb, Hussam; Nguyen, TuDung T; Duncavage, Eric J; Cottrell, Catherine E; Kulkarni, Shashikant; Nagarajan, Rakesh; Seibert, Karen; Baggstrom, Maria; Waqar, Saiama N; Pfeifer, John D; Morgensztern, Daniel; Govindan, Ramaswamy

2015-02-15

A clinical assay was implemented to perform next-generation sequencing (NGS) of genes commonly mutated in multiple cancer types. This report describes the feasibility and diagnostic yield of this assay in 381 consecutive patients with non-small cell lung cancer (NSCLC). Clinical targeted sequencing of 23 genes was performed with DNA from formalin-fixed, paraffin-embedded (FFPE) tumor tissue. The assay used Agilent SureSelect hybrid capture followed by Illumina HiSeq 2000, MiSeq, or HiSeq 2500 sequencing in a College of American Pathologists-accredited, Clinical Laboratory Improvement Amendments-certified laboratory. Single-nucleotide variants and insertion/deletion events were reported. This assay was performed before methods were developed to detect rearrangements by NGS. Two hundred nine of all requisitioned samples (55%) were successfully sequenced. The most common reason for not performing the sequencing was an insufficient quantity of tissue available in the blocks (29%). Excisional, endoscopic, and core biopsy specimens were sufficient for testing in 95%, 66%, and 40% of the cases, respectively. The median turnaround time (TAT) in the pathology laboratory was 21 days, and there was a trend of an improved TAT with more rapid sequencing platforms. Sequencing yielded a mean coverage of 1318×. Potentially actionable mutations (ie, predictive or prognostic) were identified in 46% of 209 samples and were most commonly found in KRAS (28%), epidermal growth factor receptor (14%), phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha (4%), phosphatase and tensin homolog (1%), and BRAF (1%). Five percent of the samples had multiple actionable mutations. A targeted therapy was instituted on the basis of NGS in 11% of the sequenced patients or in 6% of all patients. NGS-based diagnostics are feasible in NSCLC and provide clinically relevant information from readily available FFPE tissue. The sample type is associated with the probability of successful testing. © 2014 American Cancer Society.

Direct electrical and mechanical characterization of in situ generated DNA between the tips of silicon nanotweezers (SNT).

PubMed

Karsten, Stanislav L; Kumemura, Momoko; Jalabert, Laurent; Lafitte, Nicolas; Kudo, Lili C; Collard, Dominique; Fujita, Hiroyuki

2016-05-24

Previously, we reported the application of micromachined silicon nanotweezers (SNT) integrated with a comb-drive actuator and capacitive sensors for capturing and mechanical characterization of DNA bundles. Here, we demonstrate direct DNA amplification on such a MEMS structure with subsequent electrical and mechanical characterization of a single stranded DNA (ssDNA) bundle generated between the tips of SNT via isothermal rolling circle amplification (RCA) and dielectrophoresis (DEP). An in situ generated ssDNA bundle was visualized and evaluated via electrical conductivity (I-V) and mechanical frequency response measurements. Colloidal gold nanoparticles significantly enhanced (P < 0.01) the electrical properties of thin ssDNA bundles. The proposed technology allows direct in situ synthesis of DNA with a predefined sequence on the tips of a MEMS sensor device, such as SNT, followed by direct DNA electrical and mechanical characterization. In addition, our data provides a "proof-of-principle" for the feasibility of the on-chip label free DNA detection device that can be used for a variety of biomedical applications focused on sequence specific DNA detection.

Technical Considerations for Reduced Representation Bisulfite Sequencing with Multiplexed Libraries

PubMed Central

Chatterjee, Aniruddha; Rodger, Euan J.; Stockwell, Peter A.; Weeks, Robert J.; Morison, Ian M.

2012-01-01

Reduced representation bisulfite sequencing (RRBS), which couples bisulfite conversion and next generation sequencing, is an innovative method that specifically enriches genomic regions with a high density of potential methylation sites and enables investigation of DNA methylation at single-nucleotide resolution. Recent advances in the Illumina DNA sample preparation protocol and sequencing technology have vastly improved sequencing throughput capacity. Although the new Illumina technology is now widely used, the unique challenges associated with multiplexed RRBS libraries on this platform have not been previously described. We have made modifications to the RRBS library preparation protocol to sequence multiplexed libraries on a single flow cell lane of the Illumina HiSeq 2000. Furthermore, our analysis incorporates a bioinformatics pipeline specifically designed to process bisulfite-converted sequencing reads and evaluate the output and quality of the sequencing data generated from the multiplexed libraries. We obtained an average of 42 million paired-end reads per sample for each flow-cell lane, with a high unique mapping efficiency to the reference human genome. Here we provide a roadmap of modifications, strategies, and trouble shooting approaches we implemented to optimize sequencing of multiplexed libraries on an a RRBS background. PMID:23193365

Market surveillance on non-halal additives incorporated in surimi based products using polymerase chain reaction (PCR)-southern hybridization analysis

NASA Astrophysics Data System (ADS)

Aravindran, S.; Sahilah, A. M.; Aminah, A.

2014-09-01

Halal surveillance on halal ingredients incorporated in surimi based products were studied using polymerase chain reaction (PCR)-southern hybridization on chip analysis. The primers used in this technique were targeted on mitochondria DNA (mtDNA) of cytochrome b (cyt b) gene sequence which able to differentiate 7 type (beef, chicken, duck, goat, buffalo, lamb and pork) of species on a single chip. 17 (n = 17*3) different brands of surimi-based product were purchased randomly from Selangor local market in January 2013. Of 17 brands, 3 (n = 3*3) brands were positive for chicken DNA, 1 (n = 1*3) brand was positive for goat DNA, and the remainder 13 brands (n = 13*3) have no DNA species detected. The sensitivity of PCR-southern hybridization primers to detect each meat species was 0.1 ng. In the present study, it is evidence that PCR-Southern Hybridization analysis offered a reliable result due to its highly specific and sensitive properties in detecting non-halal additive such as plasma protein incorporation in surimi-based product.

TP53, PIK3CA, FBXW7 and KRAS Mutations in Esophageal Cancer Identified by Targeted Sequencing.

PubMed

Zheng, Huili; Wang, Yan; Tang, Chuanning; Jones, Lindsey; Ye, Hua; Zhang, Guangchun; Cao, Weihai; Li, Jingwen; Liu, Lifeng; Liu, Zhencong; Zhang, Chao; Lou, Feng; Liu, Zhiyuan; Li, Yangyang; Shi, Zhenfen; Zhang, Jingbo; Zhang, Dandan; Sun, Hong; Dong, Haichao; Dong, Zhishou; Guo, Baishuai; Yan, H E; Lu, Qingyu; Huang, Xue; Chen, Si-Yi

2016-01-01

Esophageal cancer (EC) is a common malignancy with significant morbidity and mortality. As individual cancers exhibit unique mutation patterns, identifying and characterizing gene mutations in EC that may serve as biomarkers might help predict patient outcome and guide treatment. Traditionally, personalized cancer DNA sequencing was impractical and expensive. Recent technological advancements have made targeted DNA sequencing more cost- and time-effective with reliable results. This technology may be useful for clinicians to direct patient treatment. The Ion PGM and AmpliSeq Cancer Panel was used to identify mutations at 737 hotspot loci of 45 cancer-related genes in 64 EC samples from Chinese patients. Frequent mutations were found in TP53 and less frequent mutations in PIK3CA, FBXW7 and KRAS. These results demonstrate that targeted sequencing can reliably identify mutations in individual tumors that make this technology a possibility for clinical use. Copyright© 2016, International Institute of Anticancer Research (Dr. John G. Delinasios), All rights reserved.

Sequence Alignment to Predict Across Species Susceptibility (SeqAPASS) Version 3.0 User Guide

EPA Science Inventory

User Guide to describe the complete functionality of the Sequence Alignment to Predict Across Species Susceptibility (SeqAPASS) Version 3.0 online tool. The US Environmental Protection Agency Sequence Alignment to Predict Across Species Susceptibility tool (SeqAPASS; https://seqa...

Genome characterization of the selected long- and short-sleep mouse lines.

PubMed

Dowell, Robin; Odell, Aaron; Richmond, Phillip; Malmer, Daniel; Halper-Stromberg, Eitan; Bennett, Beth; Larson, Colin; Leach, Sonia; Radcliffe, Richard A

2016-12-01

The Inbred Long- and Short-Sleep (ILS, ISS) mouse lines were selected for differences in acute ethanol sensitivity using the loss of righting response (LORR) as the selection trait. The lines show an over tenfold difference in LORR and, along with a recombinant inbred panel derived from them (the LXS), have been widely used to dissect the genetic underpinnings of acute ethanol sensitivity. Here we have sequenced the genomes of the ILS and ISS to investigate the DNA variants that contribute to their sensitivity difference. We identified ~2.7 million high-confidence SNPs and small indels and ~7000 structural variants between the lines; variants were found to occur in 6382 annotated genes. Using a hidden Markov model, we were able to reconstruct the genome-wide ancestry patterns of the eight inbred progenitor strains from which the ILS and ISS were derived, and found that quantitative trait loci that have been mapped for LORR were slightly enriched for DNA variants. Finally, by mapping and quantifying RNA-seq reads from the ILS and ISS to their strain-specific genomes rather than to the reference genome, we found a substantial improvement in a differential expression analysis between the lines. This work will help in identifying and characterizing the DNA sequence variants that contribute to the difference in ethanol sensitivity between the ILS and ISS and will also aid in accurate quantification of RNA-seq data generated from the LXS RIs.

A Personal Journey of Discovery: Developing Technology and Changing Biology

NASA Astrophysics Data System (ADS)

Hood, Lee

2008-07-01

This autobiographical article describes my experiences in developing chemically based, biological technologies for deciphering biological information: DNA, RNA, proteins, interactions, and networks. The instruments developed include protein and DNA sequencers and synthesizers, as well as ink-jet technology for synthesizing DNA chips. Diverse new strategies for doing biology also arose from novel applications of these instruments. The functioning of these instruments can be integrated to generate powerful new approaches to cloning and characterizing genes from a small amount of protein sequence or to using gene sequences to synthesize peptide fragments so as to characterize various properties of the proteins. I also discuss the five paradigm changes in which I have participated: the development and integration of biological instrumentation; the human genome project; cross-disciplinary biology; systems biology; and predictive, personalized, preventive, and participatory (P4) medicine. Finally, I discuss the origins, the philosophy, some accomplishments, and the future trajectories of the Institute for Systems Biology.

Microfluidic integration of parallel solid-phase liquid chromatography.

PubMed

Huft, Jens; Haynes, Charles A; Hansen, Carl L

2013-03-05

We report the development of a fully integrated microfluidic chromatography system based on a recently developed column geometry that allows for robust packing of high-performance separation columns in poly(dimethylsiloxane) microfluidic devices having integrated valves made by multilayer soft lithography (MSL). The combination of parallel high-performance separation columns and on-chip plumbing was used to achieve a fully integrated system for on-chip chromatography, including all steps of automated sample loading, programmable gradient generation, separation, fluorescent detection, and sample recovery. We demonstrate this system in the separation of fluorescently labeled DNA and parallel purification of reverse transcription polymerase chain reaction (RT-PCR) amplified variable regions of mouse immunoglobulin genes using a strong anion exchange (AEX) resin. Parallel sample recovery in an immiscible oil stream offers the advantage of low sample dilution and high recovery rates. The ability to perform nucleic acid size selection and recovery on subnanogram samples of DNA holds promise for on-chip genomics applications including sequencing library preparation, cloning, and sample fractionation for diagnostics.

Identification of Major Rhizobacterial Taxa Affected by a Glyphosate-Tolerant Soybean Line via Shotgun Metagenomic Approach

PubMed Central

Hua, Xiao-Mei; Liang, Li; Wen, Zhong-Ling; Du, Mei-Hang; Meng, Fan-Fan; Pang, Yan-Jun; Tang, Cheng-Yi

2018-01-01

The worldwide commercial cultivation of transgenic crops, including glyphosate-tolerant (GT) soybeans, has increased widely during the past 20 years. However, it is accompanied with a growing concern about potential effects of transgenic crops on the soil microbial communities, especially on rhizosphere bacterial communities. Our previous study found that the GT soybean line NZL06-698 (N698) significantly affected rhizosphere bacteria, including some unidentified taxa, through 16S rRNA gene (16S rDNA) V4 region amplicon deep sequencing via Illumina MiSeq. In this study, we performed 16S rDNA V5–V7 region amplicon deep sequencing via Illumina MiSeq and shotgun metagenomic approaches to identify those major taxa. Results of these processes revealed that the species richness and evenness increased in the rhizosphere bacterial communities of N698, the beta diversity of the rhizosphere bacterial communities of N698 was affected, and that certain dominant bacterial phyla and genera were related to N698 compared with its control cultivar Mengdou12. Consistent with our previous findings, this study showed that N698 affects the rhizosphere bacterial communities. In specific, N698 negatively affects Rahnella, Janthinobacterium, Stenotrophomonas, Sphingomonas and Luteibacter while positively affecting Arthrobacter, Bradyrhizobium, Ramlibacter and Nitrospira. PMID:29659545

Whole-transcriptome, high-throughput RNA sequence analysis of the bovine macrophage response to Mycobacterium bovis infection in vitro.

PubMed

Nalpas, Nicolas C; Park, Stephen D E; Magee, David A; Taraktsoglou, Maria; Browne, John A; Conlon, Kevin M; Rue-Albrecht, Kévin; Killick, Kate E; Hokamp, Karsten; Lohan, Amanda J; Loftus, Brendan J; Gormley, Eamonn; Gordon, Stephen V; MacHugh, David E

2013-04-08

Mycobacterium bovis, the causative agent of bovine tuberculosis, is an intracellular pathogen that can persist inside host macrophages during infection via a diverse range of mechanisms that subvert the host immune response. In the current study, we have analysed and compared the transcriptomes of M. bovis-infected monocyte-derived macrophages (MDM) purified from six Holstein-Friesian females with the transcriptomes of non-infected control MDM from the same animals over a 24 h period using strand-specific RNA sequencing (RNA-seq). In addition, we compare gene expression profiles generated using RNA-seq with those previously generated by us using the high-density Affymetrix® GeneChip® Bovine Genome Array platform from the same MDM-extracted RNA. A mean of 7.2 million reads from each MDM sample mapped uniquely and unambiguously to single Bos taurus reference genome locations. Analysis of these mapped reads showed 2,584 genes (1,392 upregulated; 1,192 downregulated) and 757 putative natural antisense transcripts (558 upregulated; 119 downregulated) that were differentially expressed based on sense and antisense strand data, respectively (adjusted P-value ≤ 0.05). Of the differentially expressed genes, 694 were common to both the sense and antisense data sets, with the direction of expression (i.e. up- or downregulation) positively correlated for 693 genes and negatively correlated for the remaining gene. Gene ontology analysis of the differentially expressed genes revealed an enrichment of immune, apoptotic and cell signalling genes. Notably, the number of differentially expressed genes identified from RNA-seq sense strand analysis was greater than the number of differentially expressed genes detected from microarray analysis (2,584 genes versus 2,015 genes). Furthermore, our data reveal a greater dynamic range in the detection and quantification of gene transcripts for RNA-seq compared to microarray technology. This study highlights the value of RNA-seq in identifying novel immunomodulatory mechanisms that underlie host-mycobacterial pathogen interactions during infection, including possible complex post-transcriptional regulation of host gene expression involving antisense RNA.

Linkage maps of the Atlantic salmon (Salmo salar) genome derived from RAD sequencing

PubMed Central

2014-01-01

Background Genetic linkage maps are useful tools for mapping quantitative trait loci (QTL) influencing variation in traits of interest in a population. Genotyping-by-sequencing approaches such as Restriction-site Associated DNA sequencing (RAD-Seq) now enable the rapid discovery and genotyping of genome-wide SNP markers suitable for the development of dense SNP linkage maps, including in non-model organisms such as Atlantic salmon (Salmo salar). This paper describes the development and characterisation of a high density SNP linkage map based on SbfI RAD-Seq SNP markers from two Atlantic salmon reference families. Results Approximately 6,000 SNPs were assigned to 29 linkage groups, utilising markers from known genomic locations as anchors. Linkage maps were then constructed for the four mapping parents separately. Overall map lengths were comparable between male and female parents, but the distribution of the SNPs showed sex-specific patterns with a greater degree of clustering of sire-segregating SNPs to single chromosome regions. The maps were integrated with the Atlantic salmon draft reference genome contigs, allowing the unique assignment of ~4,000 contigs to a linkage group. 112 genome contigs mapped to two or more linkage groups, highlighting regions of putative homeology within the salmon genome. A comparative genomics analysis with the stickleback reference genome identified putative genes closely linked to approximately half of the ordered SNPs and demonstrated blocks of orthology between the Atlantic salmon and stickleback genomes. A subset of 47 RAD-Seq SNPs were successfully validated using a high-throughput genotyping assay, with a correspondence of 97% between the two assays. Conclusions This Atlantic salmon RAD-Seq linkage map is a resource for salmonid genomics research as genotyping-by-sequencing becomes increasingly common. This is aided by the integration of the SbfI RAD-Seq SNPs with existing reference maps and the draft reference genome, as well as the identification of putative genes proximal to the SNPs. Differences in the distribution of recombination events between the sexes is evident, and regions of homeology have been identified which are reflective of the recent salmonid whole genome duplication. PMID:24571138

Investigation of Experimental Factors That Underlie BRCA1/2 mRNA Isoform Expression Variation: Recommendations for Utilizing Targeted RNA Sequencing to Evaluate Potential Spliceogenic Variants

PubMed Central

Lattimore, Vanessa L.; Pearson, John F.; Currie, Margaret J.; Spurdle, Amanda B.; Robinson, Bridget A.; Walker, Logan C.

2018-01-01

PCR-based RNA splicing assays are commonly used in diagnostic and research settings to assess the potential effects of variants of uncertain clinical significance in BRCA1 and BRCA2. The Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA) consortium completed a multicentre investigation to evaluate differences in assay design and the integrity of published data, raising a number of methodological questions associated with cell culture conditions and PCR-based protocols. We utilized targeted RNA-seq to re-assess BRCA1 and BRCA2 mRNA isoform expression patterns in lymphoblastoid cell lines (LCLs) previously used in the multicentre ENIGMA study. Capture of the targeted cDNA sequences was carried out using 34 BRCA1 and 28 BRCA2 oligonucleotides from the Illumina Truseq Targeted RNA Expression platform. Our results show that targeted RNA-seq analysis of LCLs overcomes many of the methodology limitations associated with PCR-based assays leading us to make the following observations and recommendations: (1) technical replicates (n > 2) of variant carriers to capture methodology induced variability associated with RNA-seq assays, (2) LCLs can undergo multiple freeze/thaw cycles and can be cultured up to 2 weeks without noticeably influencing isoform expression levels, (3) nonsense-mediated decay inhibitors are essential prior to splicing assays for comprehensive mRNA isoform detection, (4) quantitative assessment of exon:exon junction levels across BRCA1 and BRCA2 can help distinguish between normal and aberrant isoform expression patterns. Experimentally derived recommendations from this study will facilitate the application of targeted RNA-seq platforms for the quantitation of BRCA1 and BRCA2 mRNA aberrations associated with sequence variants of uncertain clinical significance. PMID:29774201

Investigation of Experimental Factors That Underlie BRCA1/2 mRNA Isoform Expression Variation: Recommendations for Utilizing Targeted RNA Sequencing to Evaluate Potential Spliceogenic Variants.

PubMed

Lattimore, Vanessa L; Pearson, John F; Currie, Margaret J; Spurdle, Amanda B; Robinson, Bridget A; Walker, Logan C

2018-01-01

PCR-based RNA splicing assays are commonly used in diagnostic and research settings to assess the potential effects of variants of uncertain clinical significance in BRCA1 and BRCA2 . The Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA) consortium completed a multicentre investigation to evaluate differences in assay design and the integrity of published data, raising a number of methodological questions associated with cell culture conditions and PCR-based protocols. We utilized targeted RNA-seq to re-assess BRCA1 and BRCA2 mRNA isoform expression patterns in lymphoblastoid cell lines (LCLs) previously used in the multicentre ENIGMA study. Capture of the targeted cDNA sequences was carried out using 34 BRCA1 and 28 BRCA2 oligonucleotides from the Illumina Truseq Targeted RNA Expression platform. Our results show that targeted RNA-seq analysis of LCLs overcomes many of the methodology limitations associated with PCR-based assays leading us to make the following observations and recommendations: (1) technical replicates ( n  > 2) of variant carriers to capture methodology induced variability associated with RNA-seq assays, (2) LCLs can undergo multiple freeze/thaw cycles and can be cultured up to 2 weeks without noticeably influencing isoform expression levels, (3) nonsense-mediated decay inhibitors are essential prior to splicing assays for comprehensive mRNA isoform detection, (4) quantitative assessment of exon:exon junction levels across BRCA1 and BRCA2 can help distinguish between normal and aberrant isoform expression patterns. Experimentally derived recommendations from this study will facilitate the application of targeted RNA-seq platforms for the quantitation of BRCA1 and BRCA2 mRNA aberrations associated with sequence variants of uncertain clinical significance.

Phenotype classification of single cells using SRS microscopy, RNA sequencing, and microfluidics (Conference Presentation)

NASA Astrophysics Data System (ADS)

Streets, Aaron M.; Cao, Chen; Zhang, Xiannian; Huang, Yanyi

2016-03-01

Phenotype classification of single cells reveals biological variation that is masked in ensemble measurement. This heterogeneity is found in gene and protein expression as well as in cell morphology. Many techniques are available to probe phenotypic heterogeneity at the single cell level, for example quantitative imaging and single-cell RNA sequencing, but it is difficult to perform multiple assays on the same single cell. In order to directly track correlation between morphology and gene expression at the single cell level, we developed a microfluidic platform for quantitative coherent Raman imaging and immediate RNA sequencing (RNA-Seq) of single cells. With this device we actively sort and trap cells for analysis with stimulated Raman scattering microscopy (SRS). The cells are then processed in parallel pipelines for lysis, and preparation of cDNA for high-throughput transcriptome sequencing. SRS microscopy offers three-dimensional imaging with chemical specificity for quantitative analysis of protein and lipid distribution in single cells. Meanwhile, the microfluidic platform facilitates single-cell manipulation, minimizes contamination, and furthermore, provides improved RNA-Seq detection sensitivity and measurement precision, which is necessary for differentiating biological variability from technical noise. By combining coherent Raman microscopy with RNA sequencing, we can better understand the relationship between cellular morphology and gene expression at the single-cell level.

Whole-Exome Sequencing in a South American Cohort Links ALDH1A3, FOXN1 and Retinoic Acid Regulation Pathways to Autism Spectrum Disorders.

PubMed

Moreno-Ramos, Oscar A; Olivares, Ana María; Haider, Neena B; de Autismo, Liga Colombiana; Lattig, María Claudia

2015-01-01

Autism spectrum disorders (ASDs) are a range of complex neurodevelopmental conditions principally characterized by dysfunctions linked to mental development. Previous studies have shown that there are more than 1000 genes likely involved in ASD, expressed mainly in brain and highly interconnected among them. We applied whole exome sequencing in Colombian-South American trios. Two missense novel SNVs were found in the same child: ALDH1A3 (RefSeq NM_000693: c.1514T>C (p.I505T)) and FOXN1 (RefSeq NM_003593: c.146C>T (p.S49L)). Gene expression studies reveal that Aldh1a3 and Foxn1 are expressed in ~E13.5 mouse embryonic brain, as well as in adult piriform cortex (PC; ~P30). Conserved Retinoic Acid Response Elements (RAREs) upstream of human ALDH1A3 and FOXN1 and in mouse Aldh1a3 and Foxn1 genes were revealed using bioinformatic approximation. Chromatin immunoprecipitation (ChIP) assay using Retinoid Acid Receptor B (Rarb) as the immunoprecipitation target suggests RA regulation of Aldh1a3 and Foxn1 in mice. Our results frame a possible link of RA regulation in brain to ASD etiology, and a feasible non-additive effect of two apparently unrelated variants in ALDH1A3 and FOXN1 recognizing that every result given by next generation sequencing should be cautiously analyzed, as it might be an incidental finding.

A multi-scale analysis of bull sperm methylome revealed both species peculiarities and conserved tissue-specific features.

PubMed

Perrier, Jean-Philippe; Sellem, Eli; Prézelin, Audrey; Gasselin, Maxime; Jouneau, Luc; Piumi, François; Al Adhami, Hala; Weber, Michaël; Fritz, Sébastien; Boichard, Didier; Le Danvic, Chrystelle; Schibler, Laurent; Jammes, Hélène; Kiefer, Hélène

2018-05-29

Spermatozoa have a remarkable epigenome in line with their degree of specialization, their unique nature and different requirements for successful fertilization. Accordingly, perturbations in the establishment of DNA methylation patterns during male germ cell differentiation have been associated with infertility in several species. While bull semen is widely used in artificial insemination, the literature describing DNA methylation in bull spermatozoa is still scarce. The purpose of this study was therefore to characterize the bull sperm methylome relative to both bovine somatic cells and the sperm of other mammals through a multiscale analysis. The quantification of DNA methylation at CCGG sites using luminometric methylation assay (LUMA) highlighted the undermethylation of bull sperm compared to the sperm of rams, stallions, mice, goats and men. Total blood cells displayed a similarly high level of methylation in bulls and rams, suggesting that undermethylation of the bovine genome was specific to sperm. Annotation of CCGG sites in different species revealed no striking bias in the distribution of genome features targeted by LUMA that could explain undermethylation of bull sperm. To map DNA methylation at a genome-wide scale, bull sperm was compared with bovine liver, fibroblasts and monocytes using reduced representation bisulfite sequencing (RRBS) and immunoprecipitation of methylated DNA followed by microarray hybridization (MeDIP-chip). These two methods exhibited differences in terms of genome coverage, and consistently, two independent sets of sequences differentially methylated in sperm and somatic cells were identified for RRBS and MeDIP-chip. Remarkably, in the two sets most of the differentially methylated sequences were hypomethylated in sperm. In agreement with previous studies in other species, the sequences that were specifically hypomethylated in bull sperm targeted processes relevant to the germline differentiation program (piRNA metabolism, meiosis, spermatogenesis) and sperm functions (cell adhesion, fertilization), as well as satellites and rDNA repeats. These results highlight the undermethylation of bull spermatozoa when compared with both bovine somatic cells and the sperm of other mammals, and raise questions regarding the dynamics of DNA methylation in bovine male germline. Whether sperm undermethylation has potential interactions with structural variation in the cattle genome may deserve further attention.

Nascent Transcription Affected by RNA Polymerase IV in Zea mays

PubMed Central

Erhard, Karl F.; Talbot, Joy-El R. B.; Deans, Natalie C.; McClish, Allison E.; Hollick, Jay B.

2015-01-01

All eukaryotes use three DNA-dependent RNA polymerases (RNAPs) to create cellular RNAs from DNA templates. Plants have additional RNAPs related to Pol II, but their evolutionary role(s) remain largely unknown. Zea mays (maize) RNA polymerase D1 (RPD1), the largest subunit of RNA polymerase IV (Pol IV), is required for normal plant development, paramutation, transcriptional repression of certain transposable elements (TEs), and transcriptional regulation of specific alleles. Here, we define the nascent transcriptomes of rpd1 mutant and wild-type (WT) seedlings using global run-on sequencing (GRO-seq) to identify the broader targets of RPD1-based regulation. Comparisons of WT and rpd1 mutant GRO-seq profiles indicate that Pol IV globally affects transcription at both transcriptional start sites and immediately downstream of polyadenylation addition sites. We found no evidence of divergent transcription from gene promoters as seen in mammalian GRO-seq profiles. Statistical comparisons identify genes and TEs whose transcription is affected by RPD1. Most examples of significant increases in genic antisense transcription appear to be initiated by 3ʹ-proximal long terminal repeat retrotransposons. These results indicate that maize Pol IV specifies Pol II-based transcriptional regulation for specific regions of the maize genome including genes having developmental significance. PMID:25653306

Genomic Heat Shock Element Sequences Drive Cooperative Human Heat Shock Factor 1 DNA Binding and Selectivity*

PubMed Central

Jaeger, Alex M.; Makley, Leah N.; Gestwicki, Jason E.; Thiele, Dennis J.

2014-01-01

The heat shock transcription factor 1 (HSF1) activates expression of a variety of genes involved in cell survival, including protein chaperones, the protein degradation machinery, anti-apoptotic proteins, and transcription factors. Although HSF1 activation has been linked to amelioration of neurodegenerative disease, cancer cells exhibit a dependence on HSF1 for survival. Indeed, HSF1 drives a program of gene expression in cancer cells that is distinct from that activated in response to proteotoxic stress, and HSF1 DNA binding activity is elevated in cycling cells as compared with arrested cells. Active HSF1 homotrimerizes and binds to a DNA sequence consisting of inverted repeats of the pentameric sequence nGAAn, known as heat shock elements (HSEs). Recent comprehensive ChIP-seq experiments demonstrated that the architecture of HSEs is very diverse in the human genome, with deviations from the consensus sequence in the spacing, orientation, and extent of HSE repeats that could influence HSF1 DNA binding efficacy and the kinetics and magnitude of target gene expression. To understand the mechanisms that dictate binding specificity, HSF1 was purified as either a monomer or trimer and used to evaluate DNA-binding site preferences in vitro using fluorescence polarization and thermal denaturation profiling. These results were compared with quantitative chromatin immunoprecipitation assays in vivo. We demonstrate a role for specific orientations of extended HSE sequences in driving preferential HSF1 DNA binding to target loci in vivo. These studies provide a biochemical basis for understanding differential HSF1 target gene recognition and transcription in neurodegenerative disease and in cancer. PMID:25204655

ChIP-Chip Identifies SEC23A, CFDP1, and NSD1 as TFII-I Target Genes in Human Neural Crest Progenitor Cells.

PubMed

Makeyev, Aleksandr V; Bayarsaihan, Dashzeveg

2013-05-01

Objectives :  GTF2I and GTF2IRD1 genes located in Williams-Beuren syndrome (WBS) critical region encode TFII-I family transcription factors. The aim of this study was to map genomic sites bound by these proteins across promoter regions of developmental regulators associated with craniofacial development. Design :  Chromatin was isolated from human neural crest progenitor cells and the DNA-binding profile was generated using the human RefSeq tiling promoter ChIP-chip arrays. Results :  TFII-I transcription factors are recruited to the promoters of SEC23A, CFDP1, and NSD1 previously defined as TFII-I target genes. Moreover, our analysis revealed additional binding elements that contain E-boxes and initiator-like motifs. Conclusions :  Genome-wide promoter binding studies revealed SEC23A, CFDP1, and NSD1 linked to craniofacial or dental development as direct TFII-I targets. Developmental regulation of these genes by TFII-I factors could contribute to the WBS-specific facial dysmorphism.

Large-scale collection of full-length cDNA and transcriptome analysis in Hevea brasiliensis

PubMed Central

Makita, Yuko; Ng, Kiaw Kiaw; Veera Singham, G.; Kawashima, Mika; Hirakawa, Hideki; Sato, Shusei

2017-01-01

Abstract Natural rubber has unique physical properties that cannot be replaced by products from other latex-producing plants or petrochemically produced synthetic rubbers. Rubber from Hevea brasiliensis is the main commercial source for this natural rubber that has a cis-polyisoprene configuration. For sustainable production of enough rubber to meet demand elucidation of the molecular mechanisms involved in the production of latex is vital. To this end, we firstly constructed rubber full-length cDNA libraries of RRIM 600 cultivar and sequenced around 20,000 clones by the Sanger method and over 15,000 contigs by Illumina sequencer. With these data, we updated around 5,500 gene structures and newly annotated around 9,500 transcription start sites. Second, to elucidate the rubber biosynthetic pathways and their transcriptional regulation, we carried out tissue- and cultivar-specific RNA-Seq analysis. By using our recently published genome sequence, we confirmed the expression patterns of the rubber biosynthetic genes. Our data suggest that the cytoplasmic mevalonate (MVA) pathway is the main route for isoprenoid biosynthesis in latex production. In addition to the well-studied polymerization factors, we suggest that rubber elongation factor 8 (REF8) is a candidate factor in cis-polyisoprene biosynthesis. We have also identified 39 transcription factors that may be key regulators in latex production. Expression profile analysis using two additional cultivars, RRIM 901 and PB 350, via an RNA-Seq approach revealed possible expression differences between a high latex-yielding cultivar and a disease-resistant cultivar. PMID:28431015

On-chip concentration of bacteria using a 3D dielectrophoretic chip and subsequent laser-based DNA extraction in the same chip

NASA Astrophysics Data System (ADS)

Cho, Yoon-Kyoung; Kim, Tae-hyeong; Lee, Jeong-Gun

2010-06-01

We report the on-chip concentration of bacteria using a dielectrophoretic (DEP) chip with 3D electrodes and subsequent laser-based DNA extraction in the same chip. The DEP chip has a set of interdigitated Au post electrodes with 50 µm height to generate a network of non-uniform electric fields for the efficient trapping by DEP. The metal post array was fabricated by photolithography and subsequent Ni and Au electroplating. Three model bacteria samples (Escherichia coli, Staphylococcus epidermidis, Streptococcus mutans) were tested and over 80-fold concentrations were achieved within 2 min. Subsequently, on-chip DNA extraction from the concentrated bacteria in the 3D DEP chip was performed by laser irradiation using the laser-irradiated magnetic bead system (LIMBS) in the same chip. The extracted DNA was analyzed with silicon chip-based real-time polymerase chain reaction (PCR). The total process of on-chip bacteria concentration and the subsequent DNA extraction can be completed within 10 min including the manual operation time.

Prospective chromosome analysis of 3429 amniocentesis samples in China using copy number variation sequencing.

PubMed

Wang, Jing; Chen, Lin; Zhou, Cong; Wang, Li; Xie, Hanbin; Xiao, Yuanyuan; Zhu, Hongmei; Hu, Ting; Zhang, Zhu; Zhu, Qian; Liu, Zhiying; Liu, Shanlin; Wang, He; Xu, Mengnan; Ren, Zhilin; Yu, Fuli; Cram, David S; Liu, Hongqian

2018-05-28

Next generation sequencing (NGS) is emerging as a viable alternative to chromosome microarray analysis for the diagnosis of chromosome disease syndromes. One NGS methodology, copy number variation sequencing (CNV-Seq), has been shown to deliver high reliability, accuracy and reproducibility for detection of fetal CNVs in prenatal samples. However, its clinical utility as a first tier diagnostic method has yet to be demonstrated in a large cohort of pregnant women referred for fetal chromosome testing. To evaluate CNV-Seq as a first tier diagnostic method for detection of fetal chromosome anomalies in a general population of pregnant women with high-risk prenatal indications. Prospective analysis of 3429 pregnant women referred for amniocentesis and fetal chromosome testing for different risk indications, including advanced maternal age (AMA), high-risk maternal serum screening (HR-MSS), and positivity for an ultrasound soft marker (USM). Amniocentesis was performed by standard procedures. Amniocyte DNA was analyzed by CNV-Seq with a chromosome resolution of 0.1 Mb. Fetal chromosome anomalies including whole chromosome aneuploidy and segmental imbalances were independently confirmed by gold standard cytogenetic and molecular methods and their pathogenicity determined following guidelines of the American College of Medical Genetics for sequence variants. Clear interpretable CNV-Seq results were obtained for all 3429 amniocentesis samples. CNV-Seq identified 3293 (96%) samples with a normal molecular karyotype and 136 samples (4%) with an altered molecular karyotype. A total of 146 fetal chromosome anomalies were detected, comprising 46 whole chromosome aneuploidies (pathogenic), 29 submicroscopic microdeletions/microduplications with known or suspected associations with chromosome disease syndromes (pathogenic), 22 other microdeletions/microduplications (likely pathogenic) and 49 variants of uncertain significance (VUS). Overall, the cumulative frequency of pathogenic/likely pathogenic and VUS chromosome anomalies in the patient cohort was 2.83% and 1.43%, respectively. In the three high-risk AMA, HR-MSS and USM groups, the most common whole chromosome aneuploidy detected was trisomy 21, followed by sex chromosome aneuploidies, trisomy 18 and trisomy 13. Across all clinical indications, there was a similar incidence of submicroscopic CNVs, with approximately equal proportions of pathogenic/likely pathogenic and VUS CNVs. If karyotyping had been used as an alternate cytogenetics detection method, CNV-Seq would have returned a 1% higher yield of pathogenic or likely pathogenic CNVs. In a large prospective clinical study, CNV-Seq delivered high reliability and accuracy for identifying clinically significant fetal anomalies in prenatal samples. Based on key performance criteria, CNV-Seq appears to be a well-suited methodology for first tier diagnosis of pregnant women in the general population at risk of having a fetal chromosome abnormality. Copyright © 2018. Published by Elsevier Inc.

Sequencing of real-world samples using a microfabricated hybrid device having unconstrained straight separation channels.

PubMed

Liu, Shaorong; Elkin, Christopher; Kapur, Hitesh

2003-11-01

We describe a microfabricated hybrid device that consists of a microfabricated chip containing multiple twin-T injectors attached to an array of capillaries that serve as the separation channels. A new fabrication process was employed to create two differently sized round channels in a chip. Twin-T injectors were formed by the smaller round channels that match the bore of the separation capillaries and separation capillaries were incorporated to the injectors through the larger round channels that match the outer diameter of the capillaries. This allows for a minimum dead volume and provides a robust chip/capillary interface. This hybrid design takes full advantage, such as sample stacking and purification and uniform signal intensity profile, of the unique chip injection scheme for DNA sequencing while employing long straight capillaries for the separations. In essence, the separation channel length is optimized for both speed and resolution since it is unconstrained by chip size. To demonstrate the reliability and practicality of this hybrid device, we sequenced over 1000 real-world samples from Human Chromosome 5 and Ciona intestinalis, prepared at Joint Genome Institute. We achieved average Phred20 read of 675 bases in about 70 min with a success rate of 91%. For the similar type of samples on MegaBACE 1000, the average Phred20 read is about 550-600 bases in 120 min separation time with a success rate of about 80-90%.

Magic Pools: Parallel Assessment of Transposon Delivery Vectors in Bacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Hualan; Price, Morgan N.; Waters, Robert Jordan

Transposon mutagenesis coupled to next-generation sequencing (TnSeq) is a powerful approach for discovering the functions of bacterial genes. However, the development of a suitable TnSeq strategy for a given bacterium can be costly and time-consuming. To meet this challenge, we describe a part-based strategy for constructing libraries of hundreds of transposon delivery vectors, which we term “magic pools.” Within a magic pool, each transposon vector has a different combination of upstream sequences (promoters and ribosome binding sites) and antibiotic resistance markers as well as a random DNA barcode sequence, which allows the tracking of each vector during mutagenesis experiments. Tomore » identify an efficient vector for a given bacterium, we mutagenize it with a magic pool and sequence the resulting insertions; we then use this efficient vector to generate a large mutant library. We used the magic pool strategy to construct transposon mutant libraries in five genera of bacteria, including three genera of the phylumBacteroidetes. IMPORTANCEMolecular genetics is indispensable for interrogating the physiology of bacteria. However, the development of a functional genetic system for any given bacterium can be time-consuming. Here, we present a streamlined approach for identifying an effective transposon mutagenesis system for a new bacterium. Our strategy first involves the construction of hundreds of different transposon vector variants, which we term a “magic pool.” The efficacy of each vector in a magic pool is monitored in parallel using a unique DNA barcode that is introduced into each vector design. Using archived DNA “parts,” we next reassemble an effective vector for making a whole-genome transposon mutant library that is suitable for large-scale interrogation of gene function using competitive growth assays. Here, we demonstrate the utility of the magic pool system to make mutant libraries in five genera of bacteria.« less

Magic Pools: Parallel Assessment of Transposon Delivery Vectors in Bacteria

DOE PAGES

Liu, Hualan; Price, Morgan N.; Waters, Robert Jordan; ...

2018-01-16

Transposon mutagenesis coupled to next-generation sequencing (TnSeq) is a powerful approach for discovering the functions of bacterial genes. However, the development of a suitable TnSeq strategy for a given bacterium can be costly and time-consuming. To meet this challenge, we describe a part-based strategy for constructing libraries of hundreds of transposon delivery vectors, which we term “magic pools.” Within a magic pool, each transposon vector has a different combination of upstream sequences (promoters and ribosome binding sites) and antibiotic resistance markers as well as a random DNA barcode sequence, which allows the tracking of each vector during mutagenesis experiments. Tomore » identify an efficient vector for a given bacterium, we mutagenize it with a magic pool and sequence the resulting insertions; we then use this efficient vector to generate a large mutant library. We used the magic pool strategy to construct transposon mutant libraries in five genera of bacteria, including three genera of the phylumBacteroidetes. IMPORTANCEMolecular genetics is indispensable for interrogating the physiology of bacteria. However, the development of a functional genetic system for any given bacterium can be time-consuming. Here, we present a streamlined approach for identifying an effective transposon mutagenesis system for a new bacterium. Our strategy first involves the construction of hundreds of different transposon vector variants, which we term a “magic pool.” The efficacy of each vector in a magic pool is monitored in parallel using a unique DNA barcode that is introduced into each vector design. Using archived DNA “parts,” we next reassemble an effective vector for making a whole-genome transposon mutant library that is suitable for large-scale interrogation of gene function using competitive growth assays. Here, we demonstrate the utility of the magic pool system to make mutant libraries in five genera of bacteria.« less

Comparison of the Genome-Wide DNA Methylation Profiles between Fast-Growing and Slow-Growing Broilers

PubMed Central

Li, Zhenhui; Zheng, Xuejuan; Jia, Xinzheng; Nie, Qinghua; Zhang, Xiquan

2013-01-01

Introduction Growth traits are important in poultry production, however, little is known for its regulatory mechanism at epigenetic level. Therefore, in this study, we aim to compare DNA methylation profiles between fast- and slow-growing broilers in order to identify candidate genes for chicken growth. Methylated DNA immunoprecipitation-sequencing (MeDIP-seq) was used to investigate the genome-wide DNA methylation pattern in high and low tails of Recessive White Rock (WRRh; WRRl) and that of Xinhua Chickens (XHh; XHl) at 7 weeks of age. The results showed that the average methylation density was the lowest in CGIs followed by promoters. Within the gene body, the methylation density of introns was higher than that of UTRs and exons. Moreover, different methylation levels were observed in different repeat types with the highest in LINE/CR1. Methylated CGIs were prominently distributed in the intergenic regions and were enriched in the size ranging 200–300 bp. In total 13,294 methylated genes were found in four samples, including 4,085 differentially methylated genes of WRRh Vs. WRRl, 5,599 of XHh Vs. XHl, 4,204 of WRRh Vs. XHh, as well as 7,301 of WRRl Vs. XHl. Moreover, 132 differentially methylated genes related to growth and metabolism were observed in both inner contrasts (WRRh Vs. WRRl and XHh Vs. XHl), whereas 129 differentially methylated genes related to growth and metabolism were found in both across-breed contrasts (WRRh Vs. XHh and WRRl Vs. XHl). Further analysis showed that overall 75 genes exhibited altered DNA methylation in all four contrasts, which included some well-known growth factors of IGF1R, FGF12, FGF14, FGF18, FGFR2, and FGFR3. In addition, we validate the MeDIP-seq results by bisulfite sequencing in some regions. Conclusions This study revealed the global DNA methylation pattern of chicken muscle, and identified candidate genes that potentially regulate muscle development at 7 weeks of age at methylation level. PMID:23441189

Introduction to Single-Cell RNA Sequencing.

PubMed

Olsen, Thale Kristin; Baryawno, Ninib

2018-04-01

During the last decade, high-throughput sequencing methods have revolutionized the entire field of biology. The opportunity to study entire transcriptomes in great detail using RNA sequencing (RNA-seq) has fueled many important discoveries and is now a routine method in biomedical research. However, RNA-seq is typically performed in "bulk," and the data represent an average of gene expression patterns across thousands to millions of cells; this might obscure biologically relevant differences between cells. Single-cell RNA-seq (scRNA-seq) represents an approach to overcome this problem. By isolating single cells, capturing their transcripts, and generating sequencing libraries in which the transcripts are mapped to individual cells, scRNA-seq allows assessment of fundamental biological properties of cell populations and biological systems at unprecedented resolution. Here, we present the most common scRNA-seq protocols in use today and the basics of data analysis and discuss factors that are important to consider before planning and designing an scRNA-seq project. © 2018 by John Wiley & Sons, Inc. Copyright © 2018 John Wiley & Sons, Inc.

Polypeptide having or assisting in carbohydrate material degrading activity and uses thereof

DOEpatents

Schooneveld-Bergmans, Margot Elisabeth Francoise; Heijne, Wilbert Herman Marie; Los, Alrik Pieter

2016-02-16

The invention relates to a polypeptide which comprises the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 76% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 76% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

Polypeptide having beta-glucosidase activity and uses thereof

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schoonneveld-Bergmans, Margot Elisabeth Francoise; Heijne, Wilbert Herman Marie; De Jong, Rene Marcel

The invention relates to a polypeptide comprising the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 96% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 96% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well asmore » the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.« less

Polypeptide having swollenin activity and uses thereof

DOEpatents

Schoonneveld-Bergmans, Margot Elizabeth Francoise; Heijne, Wilbert Herman Marie; Vlasie, Monica D; Damveld, Robbertus Antonius

2015-11-04

The invention relates to a polypeptide comprising the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 73% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 73% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

Polypeptide having beta-glucosidase activity and uses thereof

DOEpatents

Schooneveld-Bergmans, Margot Elisabeth Francoise; Heijne, Wilbert Herman Marie; De Jong, Rene Marcel; Damveld, Robbertus Antonius

2015-09-01

The invention relates to a polypeptide comprising the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 70% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 70% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

Polypeptide having cellobiohydrolase activity and uses thereof

DOEpatents

Sagt, Cornelis Maria Jacobus; Schooneveld-Bergmans, Margot Elisabeth Francoise; Roubos, Johannes Andries; Los, Alrik Pieter

2015-09-15

The invention relates to a polypeptide comprising the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 93% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 93% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

Polypeptide having acetyl xylan esterase activity and uses thereof

DOEpatents

Schoonneveld-Bergmans, Margot Elisabeth Francoise; Heijne, Wilbert Herman Marie; Los, Alrik Pieter

2015-10-20

The invention relates to a polypeptide comprising the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 82% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 82% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

Polypeptide having carbohydrate degrading activity and uses thereof

DOEpatents

Schooneveld-Bergmans, Margot Elisabeth Francoise; Heijne, Wilbert Herman Marie; Vlasie, Monica Diana; Damveld, Robbertus Antonius

2015-08-18

The invention relates to a polypeptide comprising the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 73% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 73% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

A maximum entropy model for chromatin structure

NASA Astrophysics Data System (ADS)

Farre, Pau; Emberly, Eldon; Emberly Group Team

The DNA inside the nucleus of eukaryotic cells shows a variety of conserved structures at different length scales These structures are formed by interactions between protein complexes that bind to the DNA and regulate gene activity. Recent high throughput sequencing techniques allow for the measurement both of the genome wide contact map of the folded DNA within a cell (HiC) and where various proteins are bound to the DNA (ChIP-seq). In this talk I will present a maximum-entropy method capable of both predicting HiC contact maps from binding data, and binding data from HiC contact maps. This method results in an intuitive Ising-type model that is able to predict how altering the presence of binding factors can modify chromosome conformation, without the need of polymer simulations.

Comparison of the Predictive Accuracy of DNA Array-Based Multigene Classifiers across cDNA Arrays and Affymetrix GeneChips

PubMed Central

Stec, James; Wang, Jing; Coombes, Kevin; Ayers, Mark; Hoersch, Sebastian; Gold, David L.; Ross, Jeffrey S; Hess, Kenneth R.; Tirrell, Stephen; Linette, Gerald; Hortobagyi, Gabriel N.; Symmans, W. Fraser; Pusztai, Lajos

2005-01-01

We examined how well differentially expressed genes and multigene outcome classifiers retain their class-discriminating values when tested on data generated by different transcriptional profiling platforms. RNA from 33 stage I-III breast cancers was hybridized to both Affymetrix GeneChip and Millennium Pharmaceuticals cDNA arrays. Only 30% of all corresponding gene expression measurements on the two platforms had Pearson correlation coefficient r ≥ 0.7 when UniGene was used to match probes. There was substantial variation in correlation between different Affymetrix probe sets matched to the same cDNA probe. When cDNA and Affymetrix probes were matched by basic local alignment tool (BLAST) sequence identity, the correlation increased substantially. We identified 182 genes in the Affymetrix and 45 in the cDNA data (including 17 common genes) that accurately separated 91% of cases in supervised hierarchical clustering in each data set. Cross-platform testing of these informative genes resulted in lower clustering accuracy of 45 and 79%, respectively. Several sets of accurate five-gene classifiers were developed on each platform using linear discriminant analysis. The best 100 classifiers showed average misclassification error rate of 2% on the original data that rose to 19.5% when tested on data from the other platform. Random five-gene classifiers showed misclassification error rate of 33%. We conclude that multigene predictors optimized for one platform lose accuracy when applied to data from another platform due to missing genes and sequence differences in probes that result in differing measurements for the same gene. PMID:16049308

Technical adequacy of bisulfite sequencing and pyrosequencing for detection of mitochondrial DNA methylation: Sources and avoidance of false-positive detection.

PubMed

Owa, Chie; Poulin, Matthew; Yan, Liying; Shioda, Toshi

2018-01-01

The existence of cytosine methylation in mammalian mitochondrial DNA (mtDNA) is a controversial subject. Because detection of DNA methylation depends on resistance of 5'-modified cytosines to bisulfite-catalyzed conversion to uracil, examined parameters that affect technical adequacy of mtDNA methylation analysis. Negative control amplicons (NCAs) devoid of cytosine methylation were amplified to cover the entire human or mouse mtDNA by long-range PCR. When the pyrosequencing template amplicons were gel-purified after bisulfite conversion, bisulfite pyrosequencing of NCAs did not detect significant levels of bisulfite-resistant cytosines (brCs) at ND1 (7 CpG sites) or CYTB (8 CpG sites) genes (CI95 = 0%-0.94%); without gel-purification, significant false-positive brCs were detected from NCAs (CI95 = 4.2%-6.8%). Bisulfite pyrosequencing of highly purified, linearized mtDNA isolated from human iPS cells or mouse liver detected significant brCs (~30%) in human ND1 gene when the sequencing primer was not selective in bisulfite-converted and unconverted templates. However, repeated experiments using a sequencing primer selective in bisulfite-converted templates almost completely (< 0.8%) suppressed brC detection, supporting the false-positive nature of brCs detected using the non-selective primer. Bisulfite-seq deep sequencing of linearized, gel-purified human mtDNA detected 9.4%-14.8% brCs for 9 CpG sites in ND1 gene. However, because all these brCs were associated with adjacent non-CpG brCs showing the same degrees of bisulfite resistance, DNA methylation in this mtDNA-encoded gene was not confirmed. Without linearization, data generated by bisulfite pyrosequencing or deep sequencing of purified mtDNA templates did not pass the quality control criteria. Shotgun bisulfite sequencing of human mtDNA detected extremely low levels of CpG methylation (<0.65%) over non-CpG methylation (<0.55%). Taken together, our study demonstrates that adequacy of mtDNA methylation analysis using methods dependent on bisulfite conversion needs to be established for each experiment, taking effects of incomplete bisulfite conversion and template impurity or topology into consideration.

ANISEED 2017: extending the integrated ascidian database to the exploration and evolutionary comparison of genome-scale datasets

PubMed Central

Brozovic, Matija; Dantec, Christelle; Dardaillon, Justine; Dauga, Delphine; Faure, Emmanuel; Gineste, Mathieu; Louis, Alexandra; Naville, Magali; Nitta, Kazuhiro R; Piette, Jacques; Reeves, Wendy; Scornavacca, Céline; Simion, Paul; Vincentelli, Renaud; Bellec, Maelle; Aicha, Sameh Ben; Fagotto, Marie; Guéroult-Bellone, Marion; Haeussler, Maximilian; Jacox, Edwin; Lowe, Elijah K; Mendez, Mickael; Roberge, Alexis; Stolfi, Alberto; Yokomori, Rui; Cambillau, Christian; Christiaen, Lionel; Delsuc, Frédéric; Douzery, Emmanuel; Dumollard, Rémi; Kusakabe, Takehiro; Nakai, Kenta; Nishida, Hiroki; Satou, Yutaka; Swalla, Billie; Veeman, Michael; Volff, Jean-Nicolas

2018-01-01

Abstract ANISEED (www.aniseed.cnrs.fr) is the main model organism database for tunicates, the sister-group of vertebrates. This release gives access to annotated genomes, gene expression patterns, and anatomical descriptions for nine ascidian species. It provides increased integration with external molecular and taxonomy databases, better support for epigenomics datasets, in particular RNA-seq, ChIP-seq and SELEX-seq, and features novel interactive interfaces for existing and novel datatypes. In particular, the cross-species navigation and comparison is enhanced through a novel taxonomy section describing each represented species and through the implementation of interactive phylogenetic gene trees for 60% of tunicate genes. The gene expression section displays the results of RNA-seq experiments for the three major model species of solitary ascidians. Gene expression is controlled by the binding of transcription factors to cis-regulatory sequences. A high-resolution description of the DNA-binding specificity for 131 Ciona robusta (formerly C. intestinalis type A) transcription factors by SELEX-seq is provided and used to map candidate binding sites across the Ciona robusta and Phallusia mammillata genomes. Finally, use of a WashU Epigenome browser enhances genome navigation, while a Genomicus server was set up to explore microsynteny relationships within tunicates and with vertebrates, Amphioxus, echinoderms and hemichordates. PMID:29149270

ChIP-seq and ChIP-exo profiling of Pol II, H2A.Z, and H3K4me3 in human K562 cells.

PubMed

Mchaourab, Zenab F; Perreault, Andrea A; Venters, Bryan J

2018-03-06

The human K562 chronic myeloid leukemia cell line has long served as an experimental paradigm for functional genomic studies. To systematically and functionally annotate the human genome, the ENCODE consortium generated hundreds of functional genomic data sets, such as chromatin immunoprecipitation coupled to sequencing (ChIP-seq). While ChIP-seq analyses have provided tremendous insights into gene regulation, spatiotemporal insights were limited by a resolution of several hundred base pairs. ChIP-exonuclease (ChIP-exo) is a refined version of ChIP-seq that overcomes this limitation by providing higher precision mapping of protein-DNA interactions. To study the interplay of transcription initiation and chromatin, we profiled the genome-wide locations for RNA polymerase II (Pol II), the histone variant H2A.Z, and the histone modification H3K4me3 using ChIP-seq and ChIP-exo. In this Data Descriptor, we present detailed information on parallel experimental design, data generation, quality control analysis, and data validation. We discuss how these data lay the foundation for future analysis to understand the relationship between the occupancy of Pol II and nucleosome positions at near base pair resolution.

The genetic diversity of Epstein-Barr virus in the setting of transplantation relative to non-transplant settings: A feasibility study.

PubMed

Allen, Upton D; Hu, Pingzhao; Pereira, Sergio L; Robinson, Joan L; Paton, Tara A; Beyene, Joseph; Khodai-Booran, Nasser; Dipchand, Anne; Hébert, Diane; Ng, Vicky; Nalpathamkalam, Thomas; Read, Stanley

2016-02-01

This study examines EBV strains from transplant patients and patients with IM by sequencing major EBV genes. We also used NGS to detect EBV DNA within total genomic DNA, and to evaluate its genetic variation. Sanger sequencing of major EBV genes was used to compare SNVs from samples taken from transplant patients vs. patients with IM. We sequenced EBV DNA from a healthy EBV-seropositive individual on a HiSeq 2000 instrument. Data were mapped to the EBV reference genomes (AG876 and B95-8). The number of EBNA2 SNVs was higher than for EBNA1 and the other genes sequenced within comparable reference coordinates. For EBNA2, there was a median of 15 SNV among transplant samples compared with 10 among IM samples (p = 0.036). EBNA1 showed little variation between samples. For NGS, we identified 640 and 892 variants at an unadjusted p value of 5 × 10(-8) for AG876 and B95-8 genomes, respectively. We used complementary sequence strategies to examine EBV genetic diversity and its application to transplantation. The results provide the framework for further characterization of EBV strains and related outcomes after organ transplantation. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

RNA Editing During Sexual Development Occurs in Distantly Related Filamentous Ascomycetes

PubMed Central

Teichert, Ines; Dahlmann, Tim A.; Kück, Ulrich

2017-01-01

RNA editing is a post-transcriptional process that modifies RNA molecules leading to transcript sequences that differ from their template DNA. A-to-I editing was found to be widely distributed in nuclear transcripts of metazoa, but was detected in fungi only recently in a study of the filamentous ascomycete Fusarium graminearum that revealed extensive A-to-I editing of mRNAs in sexual structures (fruiting bodies). Here, we searched for putative RNA editing events in RNA-seq data from Sordaria macrospora and Pyronema confluens, two distantly related filamentous ascomycetes, and in data from the Taphrinomycete Schizosaccharomyces pombe. Like F. graminearum, S. macrospora is a member of the Sordariomycetes, whereas P. confluens belongs to the early-diverging group of Pezizomycetes. We found extensive A-to-I editing in RNA-seq data from sexual mycelium from both filamentous ascomycetes, but not in vegetative structures. A-to-I editing was not detected in different stages of meiosis of S. pombe. A comparison of A-to-I editing in S. macrospora with F. graminearum and P. confluens, respectively, revealed little conservation of individual editing sites. An analysis of RNA-seq data from two sterile developmental mutants of S. macrospora showed that A-to-I editing is strongly reduced in these strains. Sequencing of cDNA fragments containing more than one editing site from P. confluens showed that at the beginning of sexual development, transcripts were incompletely edited or unedited, whereas in later stages transcripts were more extensively edited. Taken together, these data suggest that A-to-I RNA editing is an evolutionary conserved feature during fruiting body development in filamentous ascomycetes. PMID:28338982

RNA Editing During Sexual Development Occurs in Distantly Related Filamentous Ascomycetes.

PubMed

Teichert, Ines; Dahlmann, Tim A; Kück, Ulrich; Nowrousian, Minou

2017-04-01

RNA editing is a post-transcriptional process that modifies RNA molecules leading to transcript sequences that differ from their template DNA. A-to-I editing was found to be widely distributed in nuclear transcripts of metazoa, but was detected in fungi only recently in a study of the filamentous ascomycete Fusarium graminearum that revealed extensive A-to-I editing of mRNAs in sexual structures (fruiting bodies). Here, we searched for putative RNA editing events in RNA-seq data from Sordaria macrospora and Pyronema confluens, two distantly related filamentous ascomycetes, and in data from the Taphrinomycete Schizosaccharomyces pombe. Like F. graminearum, S. macrospora is a member of the Sordariomycetes, whereas P. confluens belongs to the early-diverging group of Pezizomycetes. We found extensive A-to-I editing in RNA-seq data from sexual mycelium from both filamentous ascomycetes, but not in vegetative structures. A-to-I editing was not detected in different stages of meiosis of S. pombe. A comparison of A-to-I editing in S. macrospora with F. graminearum and P. confluens, respectively, revealed little conservation of individual editing sites. An analysis of RNA-seq data from two sterile developmental mutants of S. macrospora showed that A-to-I editing is strongly reduced in these strains. Sequencing of cDNA fragments containing more than one editing site from P. confluens showed that at the beginning of sexual development, transcripts were incompletely edited or unedited, whereas in later stages transcripts were more extensively edited. Taken together, these data suggest that A-to-I RNA editing is an evolutionary conserved feature during fruiting body development in filamentous ascomycetes. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Seq2Logo: a method for construction and visualization of amino acid binding motifs and sequence profiles including sequence weighting, pseudo counts and two-sided representation of amino acid enrichment and depletion

PubMed Central

Thomsen, Martin Christen Frølund; Nielsen, Morten

2012-01-01

Seq2Logo is a web-based sequence logo generator. Sequence logos are a graphical representation of the information content stored in a multiple sequence alignment (MSA) and provide a compact and highly intuitive representation of the position-specific amino acid composition of binding motifs, active sites, etc. in biological sequences. Accurate generation of sequence logos is often compromised by sequence redundancy and low number of observations. Moreover, most methods available for sequence logo generation focus on displaying the position-specific enrichment of amino acids, discarding the equally valuable information related to amino acid depletion. Seq2logo aims at resolving these issues allowing the user to include sequence weighting to correct for data redundancy, pseudo counts to correct for low number of observations and different logotype representations each capturing different aspects related to amino acid enrichment and depletion. Besides allowing input in the format of peptides and MSA, Seq2Logo accepts input as Blast sequence profiles, providing easy access for non-expert end-users to characterize and identify functionally conserved/variable amino acids in any given protein of interest. The output from the server is a sequence logo and a PSSM. Seq2Logo is available at http://www.cbs.dtu.dk/biotools/Seq2Logo (14 May 2012, date last accessed). PMID:22638583

Barcoded NS31/AML2 primers for sequencing of arbuscular mycorrhizal communities in environmental samples1

PubMed Central

Morgan, Benjamin S. T.; Egerton-Warburton, Louise M.

2017-01-01

Premise of the study: Arbuscular mycorrhizal fungi (AMF) are globally important root symbioses that enhance plant growth and nutrition and influence ecosystem structure and function. To better characterize levels of AMF diversity relevant to ecosystem function, deeper sequencing depth in environmental samples is needed. In this study, Illumina barcoded primers and a bioinformatics pipeline were developed and applied to study AMF diversity and community structure in environmental samples. Methods: Libraries of small subunit ribosomal RNA fragment amplicons were amplified from environmental DNA using a single-step PCR reaction with barcoded NS31/AML2 primers. Amplicons were sequenced on an Illumina MiSeq sequencer using version 2, 2 × 250-bp paired-end chemistry, and analyzed using QIIME and RDP Classifier. Results: Sequencing captured 196 to 6416 operational taxonomic units (OTUs; depending on clustering parameters) representing nine AMF genera. Regardless of clustering parameters, ∼20 OTUs dominated AMF communities (78–87% reads) with the remaining reads distributed among other OTUs. Analyses also showed significant biogeographic differences in AMF communities and that community composition could be linked to specific edaphic factors. Discussion: Barcoded NS31/AML2 primers and Illumina MiSeq sequencing provide a powerful approach to address AMF diversity and variations in fungal assemblages across host plants, ecosystems, and responses to environmental drivers including global change. PMID:28924511

Sequencing and comparative analyses of the genomes of zoysiagrasses.

PubMed

Tanaka, Hidenori; Hirakawa, Hideki; Kosugi, Shunichi; Nakayama, Shinobu; Ono, Akiko; Watanabe, Akiko; Hashiguchi, Masatsugu; Gondo, Takahiro; Ishigaki, Genki; Muguerza, Melody; Shimizu, Katsuya; Sawamura, Noriko; Inoue, Takayasu; Shigeki, Yuichi; Ohno, Naoki; Tabata, Satoshi; Akashi, Ryo; Sato, Shusei

2016-04-01

Zoysiais a warm-season turfgrass, which comprises 11 allotetraploid species (2n= 4x= 40), each possessing different morphological and physiological traits. To characterize the genetic systems of Zoysia plants and to analyse their structural and functional differences in individual species and accessions, we sequenced the genomes of Zoysia species using HiSeq and MiSeq platforms. As a reference sequence of Zoysia species, we generated a high-quality draft sequence of the genome of Z. japonica accession 'Nagirizaki' (334 Mb) in which 59,271 protein-coding genes were predicted. In parallel, draft genome sequences of Z. matrella 'Wakaba' and Z. pacifica 'Zanpa' were also generated for comparative analyses. To investigate the genetic diversity among the Zoysia species, genome sequence reads of three additional accessions, Z. japonica'Kyoto', Z. japonica'Miyagi' and Z. matrella'Chiba Fair Green', were accumulated, and aligned against the reference genome of 'Nagirizaki' along with those from 'Wakaba' and 'Zanpa'. As a result, we detected 7,424,163 single-nucleotide polymorphisms and 852,488 short indels among these species. The information obtained in this study will be valuable for basic studies on zoysiagrass evolution and genetics as well as for the breeding of zoysiagrasses, and is made available in the 'Zoysia Genome Database' at http://zoysia.kazusa.or.jp. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

w4CSeq: software and web application to analyze 4C-seq data.

PubMed

Cai, Mingyang; Gao, Fan; Lu, Wange; Wang, Kai

2016-11-01

Circularized Chromosome Conformation Capture followed by deep sequencing (4C-Seq) is a powerful technique to identify genome-wide partners interacting with a pre-specified genomic locus. Here, we present a computational and statistical approach to analyze 4C-Seq data generated from both enzyme digestion and sonication fragmentation-based methods. We implemented a command line software tool and a web interface called w4CSeq, which takes in the raw 4C sequencing data (FASTQ files) as input, performs automated statistical analysis and presents results in a user-friendly manner. Besides providing users with the list of candidate interacting sites/regions, w4CSeq generates figures showing genome-wide distribution of interacting regions, and sketches the enrichment of key features such as TSSs, TTSs, CpG sites and DNA replication timing around 4C sites. Users can establish their own web server by downloading source codes at https://github.com/WGLab/w4CSeq Additionally, a demo web server is available at http://w4cseq.wglab.org CONTACT: kaiwang@usc.edu or wangelu@usc.eduSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Toxicity and Transcriptome Sequencing (RNA-seq) Analyses of Adult Zebrafish in Response to Exposure Carboxymethyl Cellulose Stabilized Iron Sulfide Nanoparticles.

PubMed

Zheng, Min; Lu, Jianguo; Zhao, Dongye

2018-05-24

Increasing utilization of stabilized iron sulfides (FeS) nanoparticles implies an elevated release of the materials into the environment. To understand potential impacts and underlying mechanisms of nanoparticle-induced stress, we used the transcriptome sequencing (RNA-seq) technique to characterize the transcriptomes from adult zebrafish exposed to 10 mg/L carboxymethyl cellulose (CMC) stabilized FeS nanoparticles for 96 h, demonstrating striking differences in the gene expression profiles in liver. The exposure caused significant expression alterations in genes related to immune and inflammatory responses, detoxification, oxidative stress and DNA damage/repair. The complement and coagulation cascades Kyoto encyclopedia of genes and genomes (KEGG) pathway was found significantly up-regulated under nanoparticle exposure. The quantitative real-time polymerase chain reaction using twelve genes confirmed the RNA-seq results. We identified several candidate genes commonly regulated in liver, which may serve as gene indicators when exposed to the nanoparticles. Hepatic inflammation was further confirmed by histological observation of pyknotic nuclei, and vacuole formation upon exposure. Tissue accumulation tests showed a 2.2 times higher iron concentration in the fish tissue upon exposure. This study provides preliminary mechanistic insights into potential toxic effects of organic matter stabilized FeS nanoparticles, which will improve our understanding of the genotoxicity caused by stabilized nanoparticles.

The effects of cytosine methylation on general transcription factors

NASA Astrophysics Data System (ADS)

Jin, Jianshi; Lian, Tengfei; Gu, Chan; Yu, Kai; Gao, Yi Qin; Su, Xiao-Dong

2016-07-01

DNA methylation on CpG sites is the most common epigenetic modification. Recently, methylation in a non-CpG context was found to occur widely on genomic DNA. Moreover, methylation of non-CpG sites is a highly controlled process, and its level may vary during cellular development. To study non-CpG methylation effects on DNA/protein interactions, we have chosen three human transcription factors (TFs): glucocorticoid receptor (GR), brain and muscle ARNT-like 1 (BMAL1) - circadian locomotor output cycles kaput (CLOCK) and estrogen receptor (ER) with methylated or unmethylated DNA binding sequences, using single-molecule and isothermal titration calorimetry assays. The results demonstrated that these TFs interact with methylated DNA with different effects compared with their cognate DNA sequences. The effects of non-CpG methylation on transcriptional regulation were validated by cell-based luciferase assay at protein level. The mechanisms of non-CpG methylation influencing DNA-protein interactions were investigated by crystallographic analyses and molecular dynamics simulation. With BisChIP-seq assays in HEK-293T cells, we found that GR can recognize highly methylated sites within chromatin in cells. Therefore, we conclude that non-CpG methylation of DNA can provide a mechanism for regulating gene expression through directly affecting the binding of TFs.

In silico site-directed mutagenesis informs species-specific predictions of chemical susceptibility derived from the Sequence Alignment to Predict Across Species Susceptibility (SeqAPASS) tool

EPA Science Inventory

The Sequence Alignment to Predict Across Species Susceptibility (SeqAPASS) tool was developed to address needs for rapid, cost effective methods of species extrapolation of chemical susceptibility. Specifically, the SeqAPASS tool compares the primary sequence (Level 1), functiona...

Read clouds uncover variation in complex regions of the human genome.

PubMed

Bishara, Alex; Liu, Yuling; Weng, Ziming; Kashef-Haghighi, Dorna; Newburger, Daniel E; West, Robert; Sidow, Arend; Batzoglou, Serafim

2015-10-01

Although an increasing amount of human genetic variation is being identified and recorded, determining variants within repeated sequences of the human genome remains a challenge. Most population and genome-wide association studies have therefore been unable to consider variation in these regions. Core to the problem is the lack of a sequencing technology that produces reads with sufficient length and accuracy to enable unique mapping. Here, we present a novel methodology of using read clouds, obtained by accurate short-read sequencing of DNA derived from long fragment libraries, to confidently align short reads within repeat regions and enable accurate variant discovery. Our novel algorithm, Random Field Aligner (RFA), captures the relationships among the short reads governed by the long read process via a Markov Random Field. We utilized a modified version of the Illumina TruSeq synthetic long-read protocol, which yielded shallow-sequenced read clouds. We test RFA through extensive simulations and apply it to discover variants on the NA12878 human sample, for which shallow TruSeq read cloud sequencing data are available, and on an invasive breast carcinoma genome that we sequenced using the same method. We demonstrate that RFA facilitates accurate recovery of variation in 155 Mb of the human genome, including 94% of 67 Mb of segmental duplication sequence and 96% of 11 Mb of transcribed sequence, that are currently hidden from short-read technologies. © 2015 Bishara et al.; Published by Cold Spring Harbor Laboratory Press.