Sample records for dna sequencing confirmed

  1. Demonstrating Interactions of Transcription Factors with DNA by Electrophoretic Mobility Shift Assay.

    PubMed

    Yousaf, Nasim; Gould, David

    2017-01-01

    Confirming the binding of a transcription factor with a particular DNA sequence may be important in characterizing interactions with a synthetic promoter. Electrophoretic mobility shift assay is a powerful approach to demonstrate the specific DNA sequence that is bound by a transcription factor and also to confirm the specific transcription factor involved in the interaction. In this chapter we describe a method we have successfully used to demonstrate interactions of endogenous transcription factors with sequences derived from endogenous and synthetic promoters.

  2. Integrated in silico and biological validation of the blocking effect of Cot-1 DNA on Microarray-CGH.

    PubMed

    Kang, Seung-Hui; Park, Chan Hee; Jeung, Hei Cheul; Kim, Ki-Yeol; Rha, Sun Young; Chung, Hyun Cheol

    2007-06-01

    In array-CGH, various factors may act as variables influencing the result of experiments. Among them, Cot-1 DNA, which has been used as a repetitive sequence-blocking agent, may become an artifact-inducing factor in BAC array-CGH. To identify the effect of Cot-1 DNA on Microarray-CGH experiments, Cot-1 DNA was labeled directly and Microarray-CGH experiments were performed. The results confirmed that probes which hybridized more completely with Cot-1 DNA had a higher sequence similarity to the Alu element. Further, in the sex-mismatched Microarray-CGH experiments, the variation and intensity in the fluorescent signal were reduced in the high intensity probe group in which probes were better hybridized with Cot-1 DNA. Otherwise, those of the low intensity probe group showed no alterations regardless of Cot-1 DNA. These results confirmed by in silico methods that Cot-1 DNA could block repetitive sequences in gDNA and probes. In addition, it was confirmed biologically that the blocking effect of Cot-1 DNA could be presented via its repetitive sequences, especially Alu elements. Thus, in contrast to BAC-array CGH, the use of Cot-1 DNA is advantageous in controlling experimental variation in Microarray-CGH.

  3. Ordered shotgun sequencing of a 135 kb Xq25 YAC containing ANT2 and four possible genes, including three confirmed by EST matches.

    PubMed Central

    Chen, C N; Su, Y; Baybayan, P; Siruno, A; Nagaraja, R; Mazzarella, R; Schlessinger, D; Chen, E

    1996-01-01

    Ordered shotgun sequencing (OSS) has been successfully carried out with an Xq25 YAC substrate. yWXD703 DNA was subcloned into lambda phage and sequences of insert ends of the lambda subclones were used to generate a map to select a minimum tiling path of clones to be completely sequenced. The sequence of 135 038 nt contains the entire ANT2 cDNA as well as four other candidates suggested by computer-assisted analyses. One of the putative genes is homologous to a gene implicated in Graves' disease and it, ANT2 and two others are confirmed by EST matches. The results suggest that OSS can be applied to YACs in accord with earlier simulations and further indicate that the sequence of the YAC accurately reflects the sequence of uncloned human DNA. PMID:8918809

  4. A hybrid swarm population of Pinus densiflora x P. sylvestris hybrids inferred from sequence analysis of chloroplast DNA and morphological characters

    USDA-ARS?s Scientific Manuscript database

    To confirm a hybrid swarm population of Pinus densiflora × P. sylvestris in Jilin, China and to study whether shoot apex morphology of 4-year old seedlings can be correlated with the sequence of a chloroplast DNA simple sequence repeat marker (cpDNA SSR), needles and seeds from P. densiflora, P. syl...

  5. Biological nanopore MspA for DNA sequencing

    NASA Astrophysics Data System (ADS)

    Manrao, Elizabeth A.

    Unlocking the information hidden in the human genome provides insight into the inner workings of complex biological systems and can be used to greatly improve health-care. In order to allow for widespread sequencing, new technologies are required that provide fast and inexpensive readings of DNA. Nanopore sequencing is a third generation DNA sequencing technology that is currently being developed to fulfill this need. In nanopore sequencing, a voltage is applied across a small pore in an electrolyte solution and the resulting ionic current is recorded. When DNA passes through the channel, the ionic current is partially blocked. If the DNA bases uniquely modulate the ionic current flowing through the channel, the time trace of the current can be related to the sequence of DNA passing through the pore. There are two main challenges to realizing nanopore sequencing: identifying a pore with sensitivity to single nucleotides and controlling the translocation of DNA through the pore so that the small single nucleotide current signatures are distinguishable from background noise. In this dissertation, I explore the use of Mycobacterium smegmatis porin A (MspA) for nanopore sequencing. In order to determine MspA's sensitivity to single nucleotides, DNA strands of various compositions are held in the pore as the resulting ionic current is measured. DNA is immobilized in MspA by attaching it to a large molecule which acts as an anchor. This technique confirms the single nucleotide resolution of the pore and additionally shows that MspA is sensitive to epigenetic modifications and single nucleotide polymorphisms. The forces from the electric field within MspA, the effective charge of nucleotides, and elasticity of DNA are estimated using a Freely Jointed Chain model of single stranded DNA. These results offer insight into the interactions of DNA within the pore. With the nucleotide sensitivity of MspA confirmed, a method is introduced to controllably pass DNA through the pore. Using a DNA polymerase, DNA strands are stepped through MspA one nucleotide at a time. The steps are observable as distinct levels on the ionic-current time-trace and are related to the DNA sequence. These experiments overcome the two fundamental challenges to realizing MspA nanopore sequencing and pave the way to the development of a commercial technology.

  6. Development of a reference material of a single DNA molecule for the quality control of PCR testing.

    PubMed

    Mano, Junichi; Hatano, Shuko; Futo, Satoshi; Yoshii, Junji; Nakae, Hiroki; Naito, Shigehiro; Takabatake, Reona; Kitta, Kazumi

    2014-09-02

    We developed a reference material of a single DNA molecule with a specific nucleotide sequence. The double-strand linear DNA which has PCR target sequences at the both ends was prepared as a reference DNA molecule, and we named the PCR targets on each side as confirmation sequence and standard sequence. The highly diluted solution of the reference molecule was dispensed into 96 wells of a plastic PCR plate to make the average number of molecules in a well below one. Subsequently, the presence or absence of the reference molecule in each well was checked by real-time PCR targeting for the confirmation sequence. After an enzymatic treatment of the reaction mixture in the positive wells for the digestion of PCR products, the resultant solution was used as the reference material of a single DNA molecule with the standard sequence. PCR analyses revealed that the prepared samples included only one reference molecule with high probability. The single-molecule reference material developed in this study will be useful for the absolute evaluation of a detection limit of PCR-based testing methods, the quality control of PCR analyses, performance evaluations of PCR reagents and instruments, and the preparation of an accurate calibration curve for real-time PCR quantitation.

  7. Sequence verification as quality-control step for production of cDNA microarrays.

    PubMed

    Taylor, E; Cogdell, D; Coombes, K; Hu, L; Ramdas, L; Tabor, A; Hamilton, S; Zhang, W

    2001-07-01

    To generate cDNA arrays in our core laboratory, we amplified about 2300 PCR products from a human, sequence-verified cDNA clone library. As a quality-control step, we sequenced the PCR products immediately before printing. The sequence information was used to search the GenBank database to confirm the identities. Although these clones were previously sequence verified by the company, we found that only 79% of the clones matched the original database after handling. Our experience strongly indicates the necessity to sequence verify the clones at the final stage before printing on microarray slides and to modify the gene list accordingly.

  8. Analysis of a library of macaque nuclear mitochondrial sequences confirms macaque origin of divergent sequences from old oral polio vaccine samples.

    PubMed

    Vartanian, Jean-Pierre; Wain-Hobson, Simon

    2002-05-28

    Nuclear mtDNA sequences (numts) are a widespread family of paralogs evolving as pseudogenes in chromosomal DNA [Zhang, D. E. & Hewitt, G. M. (1996) TREE 11, 247-251 and Bensasson, D., Zhang, D., Hartl, D. L. & Hewitt, G. M. (2001) TREE 16, 314-321]. When trying to identify the species origin of an unknown DNA sample by way of an mtDNA locus, PCR may amplify both mtDNA and numts. Indeed, occasionally numts dominate confounding attempts at species identification [Bensasson, D., Zhang, D. X. & Hewitt, G. M. (2000) Mol. Biol. Evol. 17, 406-415; Wallace, D. C., et al. (1997) Proc. Natl. Acad. Sci. USA 94, 14900-14905]. Rhesus and cynomolgus macaque mtDNA haplotypes were identified in a study of oral polio vaccine samples dating from the late 1950s [Blancou, P., et al. (2001) Nature (London) 410, 1045-1046]. They were accompanied by a number of putative numts. To confirm that these putative numts were of macaque origin, a library of numts corresponding to a small segment of 12S rDNA locus has been made by using DNA from a Chinese rhesus macaque. A broad distribution was found with up to 30% sequence variation. Phylogenetic analysis showed that the evolutionary trajectories of numts and bona fide mtDNA haplotypes do not overlap with the signal exception of the host species; mtDNA fragments are continually crossing over into the germ line. In the case of divergent mtDNA sequences from old oral polio vaccine samples [Blancou, P., et al. (2001) Nature (London) 410, 1045-1046], all were closely related to numts in the Chinese macaque library.

  9. Detection of a putative novel adenovirus by PCR amplification, sequencing and phylogenetic characterisation of two gene fragments from formalin-fixed paraffin-embedded tissues of a cat diagnosed with disseminated adenovirus disease.

    PubMed

    Lakatos, Béla; Hornyák, Ákos; Demeter, Zoltán; Forgách, Petra; Kennedy, Frances; Rusvai, Miklós

    2017-12-01

    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in formalin-fixed paraffin-embedded tissue samples of a cat that had suffered from disseminated adenovirus infection. The identity of the amplified products from the hexon and DNA-dependent DNA polymerase genes was confirmed by DNA sequencing. The sequences were clearly distinguishable from corresponding hexon and polymerase sequences of other mastadenoviruses, including human adenoviruses. These results suggest the possible existence of a distinct feline adenovirus.

  10. Fusion of GFP to the M.EcoKI DNA methyltransferase produces a new probe of Type I DNA restriction and modification enzymes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Kai; Roberts, Gareth A.; Stephanou, Augoustinos S.

    2010-07-23

    Research highlights: {yields} Successful fusion of GFP to M.EcoKI DNA methyltransferase. {yields} GFP located at C-terminal of sequence specificity subunit does not later enzyme activity. {yields} FRET confirms structural model of M.EcoKI bound to DNA. -- Abstract: We describe the fusion of enhanced green fluorescent protein to the C-terminus of the HsdS DNA sequence-specificity subunit of the Type I DNA modification methyltransferase M.EcoKI. The fusion expresses well in vivo and assembles with the two HsdM modification subunits. The fusion protein functions as a sequence-specific DNA methyltransferase protecting DNA against digestion by the EcoKI restriction endonuclease. The purified enzyme shows Foerstermore » resonance energy transfer to fluorescently-labelled DNA duplexes containing the target sequence and to fluorescently-labelled ocr protein, a DNA mimic that binds to the M.EcoKI enzyme. Distances determined from the energy transfer experiments corroborate the structural model of M.EcoKI.« less

  11. The primary structures of two yeast enolase genes. Homology between the 5' noncoding flanking regions of yeast enolase and glyceraldehyde-3-phosphate dehydrogenase genes.

    PubMed

    Holland, M J; Holland, J P; Thill, G P; Jackson, K A

    1981-02-10

    Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5- noncoding portions of these glycolytic genes.

  12. Hammondia heydorni oocysts in the faeces of a greyhound in New Zealand.

    PubMed

    Ellis, J T; Pomroy, W E

    2003-02-01

    To identify oocysts found in faecal material of a greyhound. Polymerase chain reaction (PCR) and DNA sequencing were used to study genomic DNA isolated from oocysts purified from faeces of a greyhound. Database searches with the DNA sequences obtained showed they were derived from Hammondia heydorni. A species-specific PCR was developed to detect H. heydorni DNA. Light microscopy in conjunction with PCR and DNA sequencing definitively identified the presence of H. heydorni oocysts in faeces of a greyhound. This study confirms the presence of H. heydorni in New Zealand and indicates the need to correctly identify similar oocysts from dogs, rather than assume they are Neospora caninum.

  13. Identification of Delta5-fatty acid desaturase from the cellular slime mold dictyostelium discoideum.

    PubMed

    Saito, T; Ochiai, H

    1999-10-01

    cDNA fragments putatively encoding amino acid sequences characteristic of the fatty acid desaturase were obtained using expressed sequence tag (EST) information of the Dictyostelium cDNA project. Using this sequence, we have determined the cDNA sequence and genomic sequence of a desaturase. The cloned cDNA is 1489 nucleotides long and the deduced amino acid sequence comprised 464 amino acid residues containing an N-terminal cytochrome b5 domain. The whole sequence was 38.6% identical to the initially identified Delta5-desaturase of Mortierella alpina. We have confirmed its function as Delta5-desaturase by over expression mutation in D. discoideum and also the gain of function mutation in the yeast Saccharomyces cerevisiae. Analysis of the lipids from transformed D. discoideum and yeast demonstrated the accumulation of Delta5-desaturated products. This is the first report concering fatty acid desaturase in cellular slime molds.

  14. First Molecular Identification and Phylogeny of Moroccan Anopheles sergentii (Diptera: Culicidae) Based on Second Internal Transcribed Spencer (ITS2) and Cytochrome c Oxidase I (COI) Sequences.

    PubMed

    Benabdelkrim Filali, Oumama; Kabine, Mostafa; El Hamouchi, Adil; Lemrani, Meryem; Debboun, Mustapha; Sarih, M'hammed

    2018-06-05

    Anopheles sergentii known as the "oasis vector" or the "desert malaria vector" is considered the main vector of malaria in the southern parts of Morocco. Its presence in Morocco is confirmed for the first time through sequencing of mitochondrial DNA (mDNA) cytochrome c oxidase subunit I (COI) barcodes and nuclear ribosomal DNA (rDNA) second internal transcribed spacer (ITS2) sequences and direct comparison with specimens of A. sergentii of other countries. The DNA barcodes (n = 39) obtained from A. sergentii collected in 2015 and 2016 showed more diversity with 10 haplotypes, compared with 3 haplotypes obtained from ITS2 sequences (n = 59). Moreover, the comparison using the ITS2 sequences showed closer evolutionary relationship between the Moroccan and Egyptian strains than the Iranian strain. Nevertheless, genetic differences due to geographical segregation were also observed. This study provides the first report on the sequence of rDNA-ITS2 and mtDNA COI, which could be used to better understand the biodiversity of A. sergentii.

  15. Composition and immuno-stimulatory properties of extracellular DNA from mouse gut flora.

    PubMed

    Qi, Ce; Li, Ya; Yu, Ren-Qiang; Zhou, Sheng-Li; Wang, Xing-Guo; Le, Guo-Wei; Jin, Qing-Zhe; Xiao, Hang; Sun, Jin

    2017-11-28

    To demonstrate that specific bacteria might release bacterial extracellular DNA (eDNA) to exert immunomodulatory functions in the mouse small intestine. Extracellular DNA was extracted using phosphate buffered saline with 0.5 mmol/L dithiothreitol combined with two phenol extractions. TOTO-1 iodide, a cell-impermeant and high-affinity nucleic acid stain, was used to confirm the existence of eDNA in the mucus layers of the small intestine and colon in healthy Male C57BL/6 mice. Composition difference of eDNA and intracellular DNA (iDNA) of the small intestinal mucus was studied by Illumina sequencing and terminal restriction fragment length polymorphism (T-RFLP). Stimulation of cytokine production by eDNA was studied in RAW264.7 cells in vitro . TOTO-1 iodide staining confirmed existence of eDNA in loose mucus layer of the mouse colon and thin surface mucus layer of the small intestine. Illumina sequencing analysis and T-RFLP revealed that the composition of the eDNA in the small intestinal mucus was significantly different from that of the iDNA of the small intestinal mucus bacteria. Illumina Miseq sequencing showed that the eDNA sequences came mainly from Gram-negative bacteria of Bacteroidales S24-7. By contrast, predominant bacteria of the small intestinal flora comprised Gram-positive bacteria. Both eDNA and iDNA were added to native or lipopolysaccharide-stimulated Raw267.4 macrophages, respectively. The eDNA induced significantly lower tumor necrosis factor-α/interleukin-10 (IL-10) and IL-6/IL-10 ratios than iDNA, suggesting the predominance for maintaining immune homeostasis of the gut. Our results indicated that degraded bacterial genomic DNA was mainly released by Gram-negative bacteria, especially Bacteroidales-S24-7 and Stenotrophomonas genus in gut mucus of mice. They decreased pro-inflammatory activity compared to total gut flora genomic DNA.

  16. Combined Targeted DNA Sequencing in Non-Small Cell Lung Cancer (NSCLC) Using UNCseq and NGScopy, and RNA Sequencing Using UNCqeR for the Detection of Genetic Aberrations in NSCLC

    PubMed Central

    Walter, Vonn; Patel, Nirali M.; Eberhard, David A.; Hayward, Michele C.; Salazar, Ashley H.; Jo, Heejoon; Soloway, Matthew G.; Wilkerson, Matthew D.; Parker, Joel S.; Yin, Xiaoying; Zhang, Guosheng; Siegel, Marni B.; Rosson, Gary B.; Earp, H. Shelton; Sharpless, Norman E.; Gulley, Margaret L.; Weck, Karen E.

    2015-01-01

    The recent FDA approval of the MiSeqDx platform provides a unique opportunity to develop targeted next generation sequencing (NGS) panels for human disease, including cancer. We have developed a scalable, targeted panel-based assay termed UNCseq, which involves a NGS panel of over 200 cancer-associated genes and a standardized downstream bioinformatics pipeline for detection of single nucleotide variations (SNV) as well as small insertions and deletions (indel). In addition, we developed a novel algorithm, NGScopy, designed for samples with sparse sequencing coverage to detect large-scale copy number variations (CNV), similar to human SNP Array 6.0 as well as small-scale intragenic CNV. Overall, we applied this assay to 100 snap-frozen lung cancer specimens lacking same-patient germline DNA (07–0120 tissue cohort) and validated our results against Sanger sequencing, SNP Array, and our recently published integrated DNA-seq/RNA-seq assay, UNCqeR, where RNA-seq of same-patient tumor specimens confirmed SNV detected by DNA-seq, if RNA-seq coverage depth was adequate. In addition, we applied the UNCseq assay on an independent lung cancer tumor tissue collection with available same-patient germline DNA (11–1115 tissue cohort) and confirmed mutations using assays performed in a CLIA-certified laboratory. We conclude that UNCseq can identify SNV, indel, and CNV in tumor specimens lacking germline DNA in a cost-efficient fashion. PMID:26076459

  17. Mitochondrial Mutations in Subjects with Psychiatric Disorders

    PubMed Central

    Magnan, Christophe; van Oven, Mannis; Baldi, Pierre; Myers, Richard M.; Barchas, Jack D.; Schatzberg, Alan F.; Watson, Stanley J.; Akil, Huda; Bunney, William E.; Vawter, Marquis P.

    2015-01-01

    A considerable body of evidence supports the role of mitochondrial dysfunction in psychiatric disorders and mitochondrial DNA (mtDNA) mutations are known to alter brain energy metabolism, neurotransmission, and cause neurodegenerative disorders. Genetic studies focusing on common nuclear genome variants associated with these disorders have produced genome wide significant results but those studies have not directly studied mtDNA variants. The purpose of this study is to investigate, using next generation sequencing, the involvement of mtDNA variation in bipolar disorder, schizophrenia, major depressive disorder, and methamphetamine use. MtDNA extracted from multiple brain regions and blood were sequenced (121 mtDNA samples with an average of 8,800x coverage) and compared to an electronic database containing 26,850 mtDNA genomes. We confirmed novel and rare variants, and confirmed next generation sequencing error hotspots by traditional sequencing and genotyping methods. We observed a significant increase of non-synonymous mutations found in individuals with schizophrenia. Novel and rare non-synonymous mutations were found in psychiatric cases in mtDNA genes: ND6, ATP6, CYTB, and ND2. We also observed mtDNA heteroplasmy in brain at a locus previously associated with schizophrenia (T16519C). Large differences in heteroplasmy levels across brain regions within subjects suggest that somatic mutations accumulate differentially in brain regions. Finally, multiplasmy, a heteroplasmic measure of repeat length, was observed in brain from selective cases at a higher frequency than controls. These results offer support for increased rates of mtDNA substitutions in schizophrenia shown in our prior results. The variable levels of heteroplasmic/multiplasmic somatic mutations that occur in brain may be indicators of genetic instability in mtDNA. PMID:26011537

  18. Single Cell Transcriptomics of Hypothalamic Warm Sensitive Neurons that Control Core Body Temperature and Fever Response

    PubMed Central

    Eberwine, James; Bartfai, Tamas

    2011-01-01

    We report on an ‘unbiased’ molecular characterization of individual, adult neurons, active in a central, anterior hypothalamic neuronal circuit, by establishing cDNA libraries from each individual, electrophysiologically identified warm sensitive neuron (WSN). The cDNA libraries were analyzed by Affymetrix microarray. The presence and frequency of cDNAs was confirmed and enhanced with Illumina sequencing of each single cell cDNA library. cDNAs encoding the GABA biosynthetic enzyme. GAD1 and of adrenomedullin, galanin, prodynorphin, somatostatin, and tachykinin were found in the WSNs. The functional cellular and in vivo studies on dozens of the more than 500 neurotransmitter -, hormone- receptors and ion channels, whose cDNA was identified and sequence confirmed, suggest little or no discrepancy between the transcriptional and functional data in WSNs; whenever agonists were available for a receptor whose cDNA was identified, a functional response was found.. Sequencing single neuron libraries permitted identification of rarely expressed receptors like the insulin receptor, adiponectin receptor2 and of receptor heterodimers; information that is lost when pooling cells leads to dilution of signals and mixing signals. Despite the common electrophysiological phenotype and uniform GAD1 expression, WSN- transcriptomes show heterogenity, suggesting strong epigenetic influence on the transcriptome. Our study suggests that it is well-worth interrogating the cDNA libraries of single neurons by sequencing and chipping. PMID:20970451

  19. Mechanism of degradation of 2'-deoxycytidine by formamide: implications for chemical DNA sequencing procedures.

    PubMed

    Saladino, R; Crestini, C; Mincione, E; Costanzo, G; Di Mauro, E; Negri, R

    1997-11-01

    We describe the reaction of formamide with 2'-deoxycytidine to give pyrimidine ring opening by nucleophilic addition on the electrophilic C(6) and C(4) positions. This information is confirmed by the analysis of the products of formamide attack on 2'-deoxycytidine, 5-methyl-2'-deoxycytidine, and 5-bromo-2'-deoxycytidine, residues when the latter are incorporated into oligonucleotides by DNA polymerase-driven polymerization and solid-phase phosphoramidite procedure. The increased sensitivity of 5-bromo-2'-deoxycytidine relative to that of 2'-deoxycytidine is pivotal for the improvement of the one-lane chemical DNA sequencing procedure based on the base-selective reaction of formamide with DNA. In many DNA sequencing cases it will in fact be possible to incorporate this base analogue into the DNA to be sequenced, thus providing a complete discrimination between its UV absorption signal and that of the thymidine residues. The wide spectrum of different sensitivities to formamide displayed by the 2'-deoxycytidine analogues solves, in the DNA single-lane chemical sequencing procedure, the possible source of errors due to low discrimination between C and T residues.

  20. Confirmation of a novel siadenovirus species detected in raptors: partial sequence and phylogenetic analysis.

    PubMed

    Kovács, Endre R; Benko, Mária

    2009-03-01

    Partial genome characterisation of a novel adenovirus, found recently in organ samples of multiple species of dead birds of prey, was carried out by sequence analysis of PCR-amplified DNA fragments. The virus, named as raptor adenovirus 1 (RAdV-1), has originally been detected by a nested PCR method with consensus primers targeting the adenoviral DNA polymerase gene. Phylogenetic analysis with the deduced amino acid sequence of the small PCR product has implied a new siadenovirus type present in the samples. Since virus isolation attempts remained unsuccessful, further characterisation of this putative novel siadenovirus was carried out with the use of PCR on the infected organ samples. The DNA sequence of the central genome part of RAdV-1, encompassing nine full (pTP, 52K, pIIIa, III, pVII, pX, pVI, hexon, protease) and two partial (DNA polymerase and DBP) genes and exceeding 12 kb pairs in size, was determined. Phylogenetic tree reconstructions, based on several genes, unambiguously confirmed the preliminary classification of RAdV-1 as a new species within the genus Siadenovirus. Further study of RAdV-1 is of interest since it represents a rare adenovirus genus of yet undetermined host origin.

  1. Mitochondrial DNA and retroviral RNA analyses of archival oral polio vaccine (OPV CHAT) materials: evidence of macaque nuclear sequences confirms substrate identity.

    PubMed

    Berry, Neil; Jenkins, Adrian; Martin, Javier; Davis, Clare; Wood, David; Schild, Geoffrey; Bottiger, Margareta; Holmes, Harvey; Minor, Philip; Almond, Neil

    2005-02-25

    Inoculation of live experimental oral poliovirus vaccines (OPV CHAT) during the 1950s in central Africa has been proposed to account for the introduction of HIV into human populations. For this to have occurred, it would have been necessary for chimpanzee rather than macaque kidney epithelial cells to have been included in the preparation of early OPV materials. Theoretically, this could have led to contamination with a progenitor of HIV-1 derived from a related simian immunodeficiency virus of chimpanzees (SIVCPZ). In this article we present further detailed analyses of two samples of OPV, CHAT 10A-11 and CHAT 6039/Yugo, which were used in early human trials of poliovirus vaccination. Recovery of poliovirus by culture techniques confirmed the biological viability of the vaccines and sequence analysis of poliovirus RNA specifically identified the presence of the CHAT strain. Independent nested sets of oligonucleotide primers specific for HIV-1/SIVCPZ and HIV-2/SIVMAC/SIVSM phylogenetic lineages, respectively, indicated no evidence of HIV/SIV RNA in either vaccine preparation, at a sensitivity of 100 RNA equivalents/ml. Analysis of cellular substrate by the amplification of two distinct regions of mitochondrial DNA (D-loop control region and 12S ribosomal sequences) revealed no evidence of chimpanzee cellular sequences. However, this approach positively identified rhesus and cynomolgus macaque DNA for the CHAT 10A-11 and CHAT 6039/Yugo vaccine preparations, respectively. Analysis of multiple clones of mtDNA 12S rDNA indicated a relatively high number of nuclear mitochondrial DNA sequences (numts) in the CHAT 10A-11 material, but confirmed the macaque origin of cellular substrate used in vaccine preparation. These data reinforce earlier findings on this topic providing no evidence to support the contention that poliovirus vaccination was responsible for the introduction of HIV into humans and sparking the AIDS pandemic.

  2. DNA methylation polymorphism in a set of elite rice cultivars and its possible contribution to inter-cultivar differential gene expression.

    PubMed

    Wang, Yongming; Lin, Xiuyun; Dong, Bo; Wang, Yingdian; Liu, Bao

    2004-01-01

    RAPD (randomly amplified polymorphic DNA) and ISSR (inter-simple sequence repeat) fingerprinting on HpaII/MspI-digested genomic DNA of nine elite japonica rice cultivars implies inter-cultivar DNA methylation polymorphism. Using both DNA fragments isolated from RAPD or ISSR gels and selected low-copy sequences as probes, methylation-sensitive Southern blot analysis confirms the existence of extensive DNA methylation polymorphism in both genes and DNA repeats among the rice cultivars. The cultivar-specific methylation patterns are stably maintained, and can be used as reliable molecular markers. Transcriptional analysis of four selected sequences (RdRP, AC9, HSP90 and MMR) on leaves and roots from normal and 5-azacytidine-treated seedlings of three representative cultivars shows an association between the transcriptional activity of one of the genes, the mismatch repair (MMR) gene, and its CG methylation patterns.

  3. mtDNAmanager: a Web-based tool for the management and quality analysis of mitochondrial DNA control-region sequences

    PubMed Central

    Lee, Hwan Young; Song, Injee; Ha, Eunho; Cho, Sung-Bae; Yang, Woo Ick; Shin, Kyoung-Jin

    2008-01-01

    Background For the past few years, scientific controversy has surrounded the large number of errors in forensic and literature mitochondrial DNA (mtDNA) data. However, recent research has shown that using mtDNA phylogeny and referring to known mtDNA haplotypes can be useful for checking the quality of sequence data. Results We developed a Web-based bioinformatics resource "mtDNAmanager" that offers a convenient interface supporting the management and quality analysis of mtDNA sequence data. The mtDNAmanager performs computations on mtDNA control-region sequences to estimate the most-probable mtDNA haplogroups and retrieves similar sequences from a selected database. By the phased designation of the most-probable haplogroups (both expected and estimated haplogroups), mtDNAmanager enables users to systematically detect errors whilst allowing for confirmation of the presence of clear key diagnostic mutations and accompanying mutations. The query tools of mtDNAmanager also facilitate database screening with two options of "match" and "include the queried nucleotide polymorphism". In addition, mtDNAmanager provides Web interfaces for users to manage and analyse their own data in batch mode. Conclusion The mtDNAmanager will provide systematic routines for mtDNA sequence data management and analysis via easily accessible Web interfaces, and thus should be very useful for population, medical and forensic studies that employ mtDNA analysis. mtDNAmanager can be accessed at . PMID:19014619

  4. Genome organization and DNA methylation patterns of B chromosomes in the red fox and Chinese raccoon dogs.

    PubMed

    Bugno-Poniewierska, Monika; Solek, Przemysław; Wronski, Mariusz; Potocki, Leszek; Jezewska-Witkowska, Grażyna; Wnuk, Maciej

    2014-12-01

    The molecular structure of B chromosomes (Bs) is relatively well studied. Previous research demonstrates that Bs of various species usually contain two types of repetitive DNA sequences, satellite DNA and ribosomal DNA, but Bs also contain genes encoding histone proteins and many others. However, many questions remain regarding the origin and function of these chromosomes. Here, we focused on the comparative cytogenetic characteristics of the red fox and Chinese raccoon dog B chromosomes with particular attention to the distribution of repetitive DNA sequences and their methylation status. We confirmed that the small Bs of the red fox show a typical fluorescent telomeric distal signal, whereas medium-sized Bs of the Chinese raccoon dog were characterized by clusters of telomeric sequences along their length. We also found different DNA methylation patterns for the B chromosomes of both species. Therefore, we concluded that DNA methylation may maintain the transcriptional inactivation of DNA sequences localized to B chromosomes and may prevent genetic unbalancing and several negative phenotypic effects. © 2014 The Authors.

  5. Application of rDNA-PCR amplification and DGGE fingerprinting for detection of microbial diversity in a Malaysian crude oil.

    PubMed

    Liew, Pauline Woanying; Jong, Bor Chyan

    2008-05-01

    Two culture-independent methods, namely ribosomal DNA libraries and denaturing gradient gel electrophoresis (DGGE), were adopted to examine the microbial community of a Malaysian light crude oil. In this study, both 16S and 18S rDNAs were PCR-amplified from bulk DNA of crude oil samples, cloned, and sequenced. Analyses of restriction fragment length polymorphism (RFLP) and phylogenetics clustered the 16S and 18S rDNA sequences into seven and six groups, respectively. The ribosomal DNA sequences obtained showed sequence similarity between 90 to 100% to those available in the GenBank database. The closest relatives documented for the 16S rDNAs include member species of Thermoincola and Rhodopseudomonas, whereas the closest fungal relatives include Acremonium, Ceriporiopsis, Xeromyces, Lecythophora, and Candida. Others were affiliated to uncultured bacteria and uncultured ascomycete. The 16S rDNA library demonstrated predomination by a single uncultured bacterial type by >80% relative abundance. The predomination was confirmed by DGGE analysis.

  6. Application of real-time PCR of sex-independent insertion-deletion polymorphisms to determine fetal sex using cell-free fetal DNA from maternal plasma.

    PubMed

    Ho, Sherry Sze Yee; Barrett, Angela; Thadani, Henna; Asibal, Cecille Laureano; Koay, Evelyn Siew-Chuan; Choolani, Mahesh

    2015-07-01

    Prenatal diagnosis of sex-linked disorders requires invasive procedures, carrying a risk of miscarriage of up to 1%. Cell-free fetal DNA (cffDNA) present in cell-free DNA (cfDNA) from maternal plasma offers a non-invasive source of fetal genetic material for analysis. Detection of Y-chromosome sequences in cfDNA indicates presence of a male fetus; in the absence of a Y-chromosome signal a female fetus is inferred. We aimed to validate the clinical utility of insertion-deletion polymorphisms (INDELs) to confirm presence of a female fetus using cffDNA. Quantitative real-time PCR (qPCR) for the Y-chromosome-specific sequence, SRY, was performed on cfDNA from 82 samples at 6-39 gestational weeks. In samples without detectable SRY, qPCRs for eight INDELs were performed on maternal genomic DNA and cfDNA. Detection of paternally inherited fetal alleles in cfDNA negative for SRY confirmed a female fetus. Fetal sex was correctly determined in 77/82 (93.9%) cfDNA samples. SRY was detected in all 39 samples from male-bearing pregnancies, and none of the 43 female-bearing pregnancies (sensitivity and specificity of SRY qPCR is therefore 100%; 95% CI 91%-100%). Paternally inherited fetal alleles were detected in 38/43 samples with no SRY signal, confirming the presence of a female fetus (INDEL assay sensitivity is therefore 88.4%; 95% CI 74.1%-95.6%). Since paternally inherited fetal INDELs were not used in women bearing male fetuses, the specificity of INDELs cannot be calculated. Five cfDNA samples were negative for both SRY and INDELS. We have validated a non-invasive prenatal test to confirm fetal sex as early as 6 gestational weeks using cffDNA from maternal plasma.

  7. On site DNA barcoding by nanopore sequencing

    PubMed Central

    Menegon, Michele; Cantaloni, Chiara; Rodriguez-Prieto, Ana; Centomo, Cesare; Abdelfattah, Ahmed; Rossato, Marzia; Bernardi, Massimo; Xumerle, Luciano; Loader, Simon; Delledonne, Massimo

    2017-01-01

    Biodiversity research is becoming increasingly dependent on genomics, which allows the unprecedented digitization and understanding of the planet’s biological heritage. The use of genetic markers i.e. DNA barcoding, has proved to be a powerful tool in species identification. However, full exploitation of this approach is hampered by the high sequencing costs and the absence of equipped facilities in biodiversity-rich countries. In the present work, we developed a portable sequencing laboratory based on the portable DNA sequencer from Oxford Nanopore Technologies, the MinION. Complementary laboratory equipment and reagents were selected to be used in remote and tough environmental conditions. The performance of the MinION sequencer and the portable laboratory was tested for DNA barcoding in a mimicking tropical environment, as well as in a remote rainforest of Tanzania lacking electricity. Despite the relatively high sequencing error-rate of the MinION, the development of a suitable pipeline for data analysis allowed the accurate identification of different species of vertebrates including amphibians, reptiles and mammals. In situ sequencing of a wild frog allowed us to rapidly identify the species captured, thus confirming that effective DNA barcoding in the field is possible. These results open new perspectives for real-time-on-site DNA sequencing thus potentially increasing opportunities for the understanding of biodiversity in areas lacking conventional laboratory facilities. PMID:28977016

  8. Isolation of centromeric-tandem repetitive DNA sequences by chromatin affinity purification using a HaloTag7-fused centromere-specific histone H3 in tobacco.

    PubMed

    Nagaki, Kiyotaka; Shibata, Fukashi; Kanatani, Asaka; Kashihara, Kazunari; Murata, Minoru

    2012-04-01

    The centromere is a multi-functional complex comprising centromeric DNA and a number of proteins. To isolate unidentified centromeric DNA sequences, centromere-specific histone H3 variants (CENH3) and chromatin immunoprecipitation (ChIP) have been utilized in some plant species. However, anti-CENH3 antibody for ChIP must be raised in each species because of its species specificity. Production of the antibodies is time-consuming and costly, and it is not easy to produce ChIP-grade antibodies. In this study, we applied a HaloTag7-based chromatin affinity purification system to isolate centromeric DNA sequences in tobacco. This system required no specific antibody, and made it possible to apply a highly stringent wash to remove contaminated DNA. As a result, we succeeded in isolating five tandem repetitive DNA sequences in addition to the centromeric retrotransposons that were previously identified by ChIP. Three of the tandem repeats were centromere-specific sequences located on different chromosomes. These results confirm the validity of the HaloTag7-based chromatin affinity purification system as an alternative method to ChIP for isolating unknown centromeric DNA sequences. The discovery of more than two chromosome-specific centromeric DNA sequences indicates the mosaic structure of tobacco centromeres. © Springer-Verlag 2011

  9. A High-Throughput Arabidopsis Reverse Genetics System

    PubMed Central

    Sessions, Allen; Burke, Ellen; Presting, Gernot; Aux, George; McElver, John; Patton, David; Dietrich, Bob; Ho, Patrick; Bacwaden, Johana; Ko, Cynthia; Clarke, Joseph D.; Cotton, David; Bullis, David; Snell, Jennifer; Miguel, Trini; Hutchison, Don; Kimmerly, Bill; Mitzel, Theresa; Katagiri, Fumiaki; Glazebrook, Jane; Law, Marc; Goff, Stephen A.

    2002-01-01

    A collection of Arabidopsis lines with T-DNA insertions in known sites was generated to increase the efficiency of functional genomics. A high-throughput modified thermal asymetric interlaced (TAIL)-PCR protocol was developed and used to amplify DNA fragments flanking the T-DNA left borders from ∼100,000 transformed lines. A total of 85,108 TAIL-PCR products from 52,964 T-DNA lines were sequenced and compared with the Arabidopsis genome to determine the positions of T-DNAs in each line. Predicted T-DNA insertion sites, when mapped, showed a bias against predicted coding sequences. Predicted insertion mutations in genes of interest can be identified using Arabidopsis Gene Index name searches or by BLAST (Basic Local Alignment Search Tool) search. Insertions can be confirmed by simple PCR assays on individual lines. Predicted insertions were confirmed in 257 of 340 lines tested (76%). This resource has been named SAIL (Syngenta Arabidopsis Insertion Library) and is available to the scientific community at www.tmri.org. PMID:12468722

  10. Low-Energy Electron-Induced Strand Breaks in Telomere-Derived DNA Sequences-Influence of DNA Sequence and Topology.

    PubMed

    Rackwitz, Jenny; Bald, Ilko

    2018-03-26

    During cancer radiation therapy high-energy radiation is used to reduce tumour tissue. The irradiation produces a shower of secondary low-energy (<20 eV) electrons, which are able to damage DNA very efficiently by dissociative electron attachment. Recently, it was suggested that low-energy electron-induced DNA strand breaks strongly depend on the specific DNA sequence with a high sensitivity of G-rich sequences. Here, we use DNA origami platforms to expose G-rich telomere sequences to low-energy (8.8 eV) electrons to determine absolute cross sections for strand breakage and to study the influence of sequence modifications and topology of telomeric DNA on the strand breakage. We find that the telomeric DNA 5'-(TTA GGG) 2 is more sensitive to low-energy electrons than an intermixed sequence 5'-(TGT GTG A) 2 confirming the unique electronic properties resulting from G-stacking. With increasing length of the oligonucleotide (i.e., going from 5'-(GGG ATT) 2 to 5'-(GGG ATT) 4 ), both the variety of topology and the electron-induced strand break cross sections increase. Addition of K + ions decreases the strand break cross section for all sequences that are able to fold G-quadruplexes or G-intermediates, whereas the strand break cross section for the intermixed sequence remains unchanged. These results indicate that telomeric DNA is rather sensitive towards low-energy electron-induced strand breakage suggesting significant telomere shortening that can also occur during cancer radiation therapy. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Single cell transcriptomics of hypothalamic warm sensitive neurons that control core body temperature and fever response Signaling asymmetry and an extension of chemical neuroanatomy.

    PubMed

    Eberwine, James; Bartfai, Tamas

    2011-03-01

    We report on an 'unbiased' molecular characterization of individual, adult neurons, active in a central, anterior hypothalamic neuronal circuit, by establishing cDNA libraries from each individual, electrophysiologically identified warm sensitive neuron (WSN). The cDNA libraries were analyzed by Affymetrix microarray. The presence and frequency of cDNAs were confirmed and enhanced with Illumina sequencing of each single cell cDNA library. cDNAs encoding the GABA biosynthetic enzyme Gad1 and of adrenomedullin, galanin, prodynorphin, somatostatin, and tachykinin were found in the WSNs. The functional cellular and in vivo studies on dozens of the more than 500 neurotransmitters, hormone receptors and ion channels, whose cDNA was identified and sequence confirmed, suggest little or no discrepancy between the transcriptional and functional data in WSNs; whenever agonists were available for a receptor whose cDNA was identified, a functional response was found. Sequencing single neuron libraries permitted identification of rarely expressed receptors like the insulin receptor, adiponectin receptor 2 and of receptor heterodimers; information that is lost when pooling cells leads to dilution of signals and mixing signals. Despite the common electrophysiological phenotype and uniform Gad1 expression, WSN transcriptomes show heterogeneity, suggesting strong epigenetic influence on the transcriptome. Our study suggests that it is well-worth interrogating the cDNA libraries of single neurons by sequencing and chipping. Copyright © 2010 Elsevier Inc. All rights reserved.

  12. A novel, highly divergent ssDNA virus identified in Brazil infecting apple, pear and grapevine.

    PubMed

    Basso, Marcos Fernando; da Silva, José Cleydson Ferreira; Fajardo, Thor Vinícius Martins; Fontes, Elizabeth Pacheco Batista; Zerbini, Francisco Murilo

    2015-12-02

    Fruit trees of temperate and tropical climates are of great economical importance worldwide and several viruses have been reported affecting their productivity and longevity. Fruit trees of different Brazilian regions displaying virus-like symptoms were evaluated for infection by circular DNA viruses. Seventy-four fruit trees were sampled and a novel, highly divergent, monopartite circular ssDNA virus was cloned from apple, pear and grapevine trees. Forty-five complete viral genomes were sequenced, with a size of approx. 3.4 kb and organized into five ORFs. Deduced amino acid sequences showed identities in the range of 38% with unclassified circular ssDNA viruses, nanoviruses and alphasatellites (putative Replication-associated protein, Rep), and begomo-, curto- and mastreviruses (putative coat protein, CP, and movement protein, MP). A large intergenic region contains a short palindromic sequence capable of forming a hairpin-like structure with the loop sequence TAGTATTAC, identical to the conserved nonanucleotide of circoviruses, nanoviruses and alphasatellites. Recombination events were not detected and phylogenetic analysis showed a relationship with circo-, nano- and geminiviruses. PCR confirmed the presence of this novel ssDNA virus in field plants. Infectivity tests using the cloned viral genome confirmed its ability to infect apple and pear tree seedlings, but not Nicotiana benthamiana. The name "Temperate fruit decay-associated virus" (TFDaV) is proposed for this novel virus. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Presence of DNA methyltransferase activity and CpC methylation in Drosophila melanogaster.

    PubMed

    Panikar, Chitra S; Rajpathak, Shriram N; Abhyankar, Varada; Deshmukh, Saniya; Deobagkar, Deepti D

    2015-12-01

    Drosophila melanogaster lacks DNMT1/DNMT3 based methylation machinery. Despite recent reports confirming the presence of low DNA methylation in Drosophila; little is known about the methyltransferase. Therefore, in this study, we have aimed to investigate the possible functioning of DNA methyltransferase in Drosophila. The 14 K oligo microarray slide was incubated with native cell extract from adult Drosophila to check the presence of the methyltransferase activity. After incubation under appropriate conditions, the methylated oligo sequences were identified by the binding of anti 5-methylcytosine monoclonal antibody. The antibody bound to the methylated oligos was detected using Cy3 labeled secondary antibody. Methylation sensitive restriction enzyme mediated PCR was used to assess the methylation at a few selected loci identified on the array. It could be seen that a few of the total oligos got methylated under the assay conditions. Analysis of methylated oligo sequences provides evidence for the presence of de novo methyltransferase activity and allows identification of its sequence specificity in adult Drosophila. With the help of methylation sensitive enzymes we could detect presence of CpC methylation in the selected genomic regions. This study reports presence of an active DNA methyltransferase in adult Drosophila, which exhibits sequence specificity confirmed by presence of asymmetric methylation at corresponding sites in the genomic DNA. It also provides an innovative approach to investigate methylation specificity of a native methyltransferase.

  14. First report of Echinococcus shiquicus in dogs from eastern Qinghai-Tibet plateau region, China.

    PubMed

    Boufana, Belgees; Qiu, Jiamin; Chen, Xinwang; Budke, Christine M; Campos-Ponce, Maiza; Craig, Philip S

    2013-07-01

    Echinococcus shiquicus was discovered in foxes and pika wildlife hosts in Sichuan Province, China in 2005. Faecal samples from dogs collected in a previous echinococcosis purgation survey from Shiqu County, Ganzi Tibetan Autonomous Prefecture (Sichuan) were screened by coproPCR to investigate the possible occurrence of E. shiquicus. In addition, coproDNA extracted from 8 necropsied Tibetan foxes (Vulpes ferrilata), the natural host of E. shiquicus, were also included. Thirty (6/20) percent of faecal samples from dogs were positive for E. shiquicus DNA after PCR amplification of a fragment within the ND1 mitochondrial gene. Echinococcus shiquicus was confirmed by sequencing in four dogs and 3 of the 6 dogs were concurrently infected with E. multilocularis. These were also verified by sequencing. Faecal samples from two Tibetan foxes were shown by PCR to harbour both E. multilocularis and E. shiquicus DNA. One of these dual E. multilocularis and E. shiquicus infections in a Tibetan fox was confirmed by sequencing. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Evolution of EF-hand calcium-modulated proteins. III. Exon sequences confirm most dendrograms based on protein sequences: calmodulin dendrograms show significant lack of parallelism

    NASA Technical Reports Server (NTRS)

    Nakayama, S.; Kretsinger, R. H.

    1993-01-01

    In the first report in this series we presented dendrograms based on 152 individual proteins of the EF-hand family. In the second we used sequences from 228 proteins, containing 835 domains, and showed that eight of the 29 subfamilies are congruent and that the EF-hand domains of the remaining 21 subfamilies have diverse evolutionary histories. In this study we have computed dendrograms within and among the EF-hand subfamilies using the encoding DNA sequences. In most instances the dendrograms based on protein and on DNA sequences are very similar. Significant differences between protein and DNA trees for calmodulin remain unexplained. In our fourth report we evaluate the sequences and the distribution of introns within the EF-hand family and conclude that exon shuffling did not play a significant role in its evolution.

  16. High Resolution Size Analysis of Fetal DNA in the Urine of Pregnant Women by Paired-End Massively Parallel Sequencing

    PubMed Central

    Tsui, Nancy B. Y.; Jiang, Peiyong; Chow, Katherine C. K.; Su, Xiaoxi; Leung, Tak Y.; Sun, Hao; Chan, K. C. Allen; Chiu, Rossa W. K.; Lo, Y. M. Dennis

    2012-01-01

    Background Fetal DNA in maternal urine, if present, would be a valuable source of fetal genetic material for noninvasive prenatal diagnosis. However, the existence of fetal DNA in maternal urine has remained controversial. The issue is due to the lack of appropriate technology to robustly detect the potentially highly degraded fetal DNA in maternal urine. Methodology We have used massively parallel paired-end sequencing to investigate cell-free DNA molecules in maternal urine. Catheterized urine samples were collected from seven pregnant women during the third trimester of pregnancies. We detected fetal DNA by identifying sequenced reads that contained fetal-specific alleles of the single nucleotide polymorphisms. The sizes of individual urinary DNA fragments were deduced from the alignment positions of the paired reads. We measured the fractional fetal DNA concentration as well as the size distributions of fetal and maternal DNA in maternal urine. Principal Findings Cell-free fetal DNA was detected in five of the seven maternal urine samples, with the fractional fetal DNA concentrations ranged from 1.92% to 4.73%. Fetal DNA became undetectable in maternal urine after delivery. The total urinary cell-free DNA molecules were less intact when compared with plasma DNA. Urinary fetal DNA fragments were very short, and the most dominant fetal sequences were between 29 bp and 45 bp in length. Conclusions With the use of massively parallel sequencing, we have confirmed the existence of transrenal fetal DNA in maternal urine, and have shown that urinary fetal DNA was heavily degraded. PMID:23118982

  17. Sphaeridiotrema globulus and Sphaeridiotrema pseudoglobulus (Digenea): Species Differentiation Based On mtDNA (Barcode) and Partial LSU–rDNA Sequences

    USGS Publications Warehouse

    Bergmame, Laura; Huffman, Jane; Cole, Rebecca; Dayanandan, Selvadurai; Tkach, Vasyl; McLaughlin, J. Daniel

    2011-01-01

    Flukes belonging to Sphaeridiotrema are important parasites of waterfowl, and 2 morphologically similar species Sphaeridiotrema globulus and Sphaeridiotrema pseudoglobulus, have been implicated in waterfowl mortality in North America. Cytochrome oxidase I (barcode region) and partial LSU-rDNA sequences from specimens of S. globulus and S. pseudoglobulus, obtained from naturally and experimentally infected hosts from New Jersey and Quebec, respectively, confirmed that these species were distinct. Barcode sequences of the 2 species differed at 92 of 590 nucleotide positions (15.6%) and the translated sequences differed by 13 amino acid residues. Partial LSU-rDNA sequences differed at 29 of 1,208 nucleotide positions (2.4%). Additional barcode sequences from specimens collected from waterfowl in Wisconsin and Minnesota and morphometric data obtained from specimens acquired along the north shore of Lake Superior revealed the presence of S. pseudoglobulus in these areas. Although morphometric data suggested the presence of S. globulus in the Lake Superior sample, it was not found among the specimens sequenced from Wisconsin or Minnesota.

  18. Sphaeridiotrema globulus and Sphaeridiotrema pseudoglobulus (Digenea): Species Differentiation Based on mtDNA (Barcode) and Partial LSUrDNA Sequences

    USGS Publications Warehouse

    Bergmame, L.; Huffman, J.; Cole, R.; Dayanandan, S.; Tkach, V.; McLaughlin, J.D.

    2011-01-01

    Flukes belonging to Sphaeridiotrema are important parasites of waterfowl, and 2 morphologically similar species Sphaeridiotrema globulus and Sphaeridiotrema pseudoglobulus, have been implicated in waterfowl mortality in North America. Cytochrome oxidase I (barcode region) and partial LSU-rDNA sequences from specimens of S. globulus and S. pseudoglobulus, obtained from naturally and experimentally infected hosts from New Jersey and Quebec, respectively, confirmed that these species were distinct. Barcode sequences of the 2 species differed at 92 of 590 nucleotide positions (15.6%) and the translated sequences differed by 13 amino acid residues. Partial LSU-rDNA sequences differed at 29 of 1,208 nucleotide positions (2.4%). Additional barcode sequences from specimens collected from waterfowl in Wisconsin and Minnesota and morphometric data obtained from specimens acquired along the north shore of Lake Superior revealed the presence of S. pseudoglobulus in these areas. Although morphometric data suggested the presence of S. globulus in the Lake Superior sample, it was not found among the specimens sequenced from Wisconsin or Minnesota. ?? 2011 American Society of Parasitologists.

  19. Ecological niche modelling and nDNA sequencing support a new, morphologically cryptic beetle species unveiled by DNA barcoding.

    PubMed

    Hawlitschek, Oliver; Porch, Nick; Hendrich, Lars; Balke, Michael

    2011-02-09

    DNA sequencing techniques used to estimate biodiversity, such as DNA barcoding, may reveal cryptic species. However, disagreements between barcoding and morphological data have already led to controversy. Species delimitation should therefore not be based on mtDNA alone. Here, we explore the use of nDNA and bioclimatic modelling in a new species of aquatic beetle revealed by mtDNA sequence data. The aquatic beetle fauna of Australia is characterised by high degrees of endemism, including local radiations such as the genus Antiporus. Antiporus femoralis was previously considered to exist in two disjunct, but morphologically indistinguishable populations in south-western and south-eastern Australia. We constructed a phylogeny of Antiporus and detected a deep split between these populations. Diagnostic characters from the highly variable nuclear protein encoding arginine kinase gene confirmed the presence of two isolated populations. We then used ecological niche modelling to examine the climatic niche characteristics of the two populations. All results support the status of the two populations as distinct species. We describe the south-western species as Antiporus occidentalis sp.n. In addition to nDNA sequence data and extended use of mitochondrial sequences, ecological niche modelling has great potential for delineating morphologically cryptic species.

  20. Ecological Niche Modelling and nDNA Sequencing Support a New, Morphologically Cryptic Beetle Species Unveiled by DNA Barcoding

    PubMed Central

    Hawlitschek, Oliver; Porch, Nick; Hendrich, Lars; Balke, Michael

    2011-01-01

    Background DNA sequencing techniques used to estimate biodiversity, such as DNA barcoding, may reveal cryptic species. However, disagreements between barcoding and morphological data have already led to controversy. Species delimitation should therefore not be based on mtDNA alone. Here, we explore the use of nDNA and bioclimatic modelling in a new species of aquatic beetle revealed by mtDNA sequence data. Methodology/Principal Findings The aquatic beetle fauna of Australia is characterised by high degrees of endemism, including local radiations such as the genus Antiporus. Antiporus femoralis was previously considered to exist in two disjunct, but morphologically indistinguishable populations in south-western and south-eastern Australia. We constructed a phylogeny of Antiporus and detected a deep split between these populations. Diagnostic characters from the highly variable nuclear protein encoding arginine kinase gene confirmed the presence of two isolated populations. We then used ecological niche modelling to examine the climatic niche characteristics of the two populations. All results support the status of the two populations as distinct species. We describe the south-western species as Antiporus occidentalis sp.n. Conclusion/Significance In addition to nDNA sequence data and extended use of mitochondrial sequences, ecological niche modelling has great potential for delineating morphologically cryptic species. PMID:21347370

  1. Estimating Genomic Distance from DNA Sequence Location in Cell Nuclei by a Random Walk Model

    NASA Astrophysics Data System (ADS)

    van den Engh, Ger; Sachs, Rainer; Trask, Barbara J.

    1992-09-01

    The folding of chromatin in interphase cell nuclei was studied by fluorescent in situ hybridization with pairs of unique DNA sequence probes. The sites of DNA sequences separated by 100 to 2000 kilobase pairs (kbp) are distributed in interphase chromatin according to a random walk model. This model provides the basis for calculating the spacing of sequences along the linear DNA molecule from interphase distance measurements. An interphase mapping strategy based on this model was tested with 13 probes from a 4-megabase pair (Mbp) region of chromosome 4 containing the Huntington disease locus. The results confirmed the locations of the probes and showed that the remaining gap in the published maps of this region is negligible in size. Interphase distance measurements should facilitate construction of chromosome maps with an average marker density of one per 100 kbp, approximately ten times greater than that achieved by hybridization to metaphase chromosomes.

  2. Characterization of proviruses cloned from mink cell focus-forming virus-infected cellular DNA.

    PubMed Central

    Khan, A S; Repaske, R; Garon, C F; Chan, H W; Rowe, W P; Martin, M A

    1982-01-01

    Two proviruses were cloned from EcoRI-digested DNA extracted from mink cells chronically infected with AKR mink cell focus-forming (MCF) 247 murine leukemia virus (MuLV), using a lambda phage host vector system. One cloned MuLV DNA fragment (designated MCF 1) contained sequences extending 6.8 kilobases from an EcoRI restriction site in the 5' long terminal repeat (LTR) to an EcoRI site located in the envelope (env) region and was indistinguishable by restriction endonuclease mapping for 5.1 kilobases (except for the EcoRI site in the LTR) from the 5' end of AKR ecotropic proviral DNA. The DNA segment extending from 5.1 to 6.8 kilobases contained several restriction sites that were not present in the AKR ecotropic provirus. A 0.5-kilobase DNA segment located at the 3' end of MCF 1 DNA contained sequences which hybridized to a xenotropic env-specific DNA probe but not to labeled ecotropic env-specific DNA. This dual character of MCF 1 proviral DNA was also confirmed by analyzing heteroduplex molecules by electron microscopy. The second cloned proviral DNA (designated MCF 2) was a 6.9-kilobase EcoRI DNA fragment which contained LTR sequences at each end and a 2.0-kilobase deletion encompassing most of the env region. The MCF 2 proviral DNA proved to be a useful reagent for detecting LTRs electron microscopically due to the presence of nonoverlapping, terminally located LTR sequences which effected its circularization with DNAs containing homologous LTR sequences. Nucleotide sequence analysis demonstrated the presence of a 104-base-pair direct repeat in the LTR of MCF 2 DNA. In contrast, only a single copy of the reiterated component of the direct repeat was present in MCF 1 DNA. Images PMID:6281459

  3. Myopathic mtDNA Depletion Syndrome Due to Mutation in TK2 Gene.

    PubMed

    Martín-Hernández, Elena; García-Silva, María Teresa; Quijada-Fraile, Pilar; Rodríguez-García, María Elena; Rivera, Henry; Hernández-Laín, Aurelio; Coca-Robinot, David; Fernández-Toral, Joaquín; Arenas, Joaquín; Martín, Miguel A; Martínez-Azorín, Francisco

    2017-01-01

    Whole-exome sequencing was used to identify the disease gene(s) in a Spanish girl with failure to thrive, muscle weakness, mild facial weakness, elevated creatine kinase, deficiency of mitochondrial complex III and depletion of mtDNA. With whole-exome sequencing data, it was possible to get the whole mtDNA sequencing and discard any pathogenic variant in this genome. The analysis of whole exome uncovered a homozygous pathogenic mutation in thymidine kinase 2 gene ( TK2; NM_004614.4:c.323 C>T, p.T108M). TK2 mutations have been identified mainly in patients with the myopathic form of mtDNA depletion syndromes. This patient presents an atypical TK2-related myopathic form of mtDNA depletion syndromes, because despite having a very low content of mtDNA (<20%), she presents a slower and less severe evolution of the disease. In conclusion, our data confirm the role of TK2 gene in mtDNA depletion syndromes and expanded the phenotypic spectrum.

  4. PCR tools for the verification of the specific identity of ascaridoid nematodes from dogs and cats.

    PubMed

    Li, M W; Lin, R Q; Chen, H H; Sani, R A; Song, H Q; Zhu, X Q

    2007-01-01

    Based on the sequences of the internal transcribed spacers (ITS-1 and ITS-2) of nuclear ribosomal DNA (rDNA) of Toxocara canis, Toxocara cati, Toxocara malaysiensis and Toxascaris leonina, specific forward primers were designed in the ITS-1 or ITS-2 for each of the four ascaridoid species of dogs and cats. These primers were used individually together with a conserved primer in the large subunit of rDNA to amplify partial ITS-1 and/or ITS-2 of rDNA from 107 DNA samples from ascaridoids from dogs and cats in China, Australia, Malaysia, England and the Netherlands. This approach allowed their specific identification, with no amplicons being amplified from heterogeneous DNA samples, and sequencing confirmed the identity of the sequences amplified. The minimum amounts of DNA detectable using the PCR assays were 0.13-0.54ng. These PCR assays should provide useful tools for the diagnosis and molecular epidemiological investigations of toxocariasis in humans and animals.

  5. Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

    PubMed

    Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

    2010-05-07

    Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

  6. Identification of Genomic Insertion and Flanking Sequence of G2-EPSPS and GAT Transgenes in Soybean Using Whole Genome Sequencing Method.

    PubMed

    Guo, Bingfu; Guo, Yong; Hong, Huilong; Qiu, Li-Juan

    2016-01-01

    Molecular characterization of sequence flanking exogenous fragment insertion is essential for safety assessment and labeling of genetically modified organism (GMO). In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS) method. More than 22.4 Gb sequence data (∼21 × coverage) for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundaries of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of genomic insertion sites of G2-EPSPS and GAT transgenes will facilitate the utilization of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS was a cost-effective and rapid method for identifying sites of T-DNA insertions and flanking sequences in soybean.

  7. Complete sequence analysis of 18S rDNA based on genomic DNA extraction from individual Demodex mites (Acari: Demodicidae).

    PubMed

    Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang

    2012-05-01

    The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs. Copyright © 2012 Elsevier Inc. All rights reserved.

  8. Enhancing the GABI-Kat Arabidopsis thaliana T-DNA Insertion Mutant Database by Incorporating Araport11 Annotation.

    PubMed

    Kleinboelting, Nils; Huep, Gunnar; Weisshaar, Bernd

    2017-01-01

    SimpleSearch provides access to a database containing information about T-DNA insertion lines of the GABI-Kat collection of Arabidopsis thaliana mutants. These mutants are an important tool for reverse genetics, and GABI-Kat is the second largest collection of such T-DNA insertion mutants. Insertion sites were deduced from flanking sequence tags (FSTs), and the database contains information about mutant plant lines as well as insertion alleles. Here, we describe improvements within the interface (available at http://www.gabi-kat.de/db/genehits.php) and with regard to the database content that have been realized in the last five years. These improvements include the integration of the Araport11 genome sequence annotation data containing the recently updated A. thaliana structural gene descriptions, an updated visualization component that displays groups of insertions with very similar insertion positions, mapped confirmation sequences, and primers. The visualization component provides a quick way to identify insertions of interest, and access to improved data about the exact structure of confirmed insertion alleles. In addition, the database content has been extended by incorporating additional insertion alleles that were detected during the confirmation process, as well as by adding new FSTs that have been produced during continued efforts to complement gaps in FST availability. Finally, the current database content regarding predicted and confirmed insertion alleles as well as primer sequences has been made available as downloadable flat files. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.

  9. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing.

    PubMed

    Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P; Panitz, Frank; Bendixen, Christian; Nielsen, Rasmus; Willerslev, Eske

    2007-02-14

    The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources. We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences). Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis. We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%). Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial analyses, population genetics, and phylogenetics.

  10. [Integrated DNA barcoding database for identifying Chinese animal medicine].

    PubMed

    Shi, Lin-Chun; Yao, Hui; Xie, Li-Fang; Zhu, Ying-Jie; Song, Jing-Yuan; Zhang, Hui; Chen, Shi-Lin

    2014-06-01

    In order to construct an integrated DNA barcoding database for identifying Chinese animal medicine, the authors and their cooperators have completed a lot of researches for identifying Chinese animal medicines using DNA barcoding technology. Sequences from GenBank have been analyzed simultaneously. Three different methods, BLAST, barcoding gap and Tree building, have been used to confirm the reliabilities of barcode records in the database. The integrated DNA barcoding database for identifying Chinese animal medicine has been constructed using three different parts: specimen, sequence and literature information. This database contained about 800 animal medicines and the adulterants and closely related species. Unknown specimens can be identified by pasting their sequence record into the window on the ID page of species identification system for traditional Chinese medicine (www. tcmbarcode. cn). The integrated DNA barcoding database for identifying Chinese animal medicine is significantly important for animal species identification, rare and endangered species conservation and sustainable utilization of animal resources.

  11. Mapping the Space of Genomic Signatures

    PubMed Central

    Kari, Lila; Hill, Kathleen A.; Sayem, Abu S.; Karamichalis, Rallis; Bryans, Nathaniel; Davis, Katelyn; Dattani, Nikesh S.

    2015-01-01

    We propose a computational method to measure and visualize interrelationships among any number of DNA sequences allowing, for example, the examination of hundreds or thousands of complete mitochondrial genomes. An "image distance" is computed for each pair of graphical representations of DNA sequences, and the distances are visualized as a Molecular Distance Map: Each point on the map represents a DNA sequence, and the spatial proximity between any two points reflects the degree of structural similarity between the corresponding sequences. The graphical representation of DNA sequences utilized, Chaos Game Representation (CGR), is genome- and species-specific and can thus act as a genomic signature. Consequently, Molecular Distance Maps could inform species identification, taxonomic classifications and, to a certain extent, evolutionary history. The image distance employed, Structural Dissimilarity Index (DSSIM), implicitly compares the occurrences of oligomers of length up to k (herein k = 9) in DNA sequences. We computed DSSIM distances for more than 5 million pairs of complete mitochondrial genomes, and used Multi-Dimensional Scaling (MDS) to obtain Molecular Distance Maps that visually display the sequence relatedness in various subsets, at different taxonomic levels. This general-purpose method does not require DNA sequence alignment and can thus be used to compare similar or vastly different DNA sequences, genomic or computer-generated, of the same or different lengths. We illustrate potential uses of this approach by applying it to several taxonomic subsets: phylum Vertebrata, (super)kingdom Protista, classes Amphibia-Insecta-Mammalia, class Amphibia, and order Primates. This analysis of an extensive dataset confirms that the oligomer composition of full mtDNA sequences can be a source of taxonomic information. This method also correctly finds the mtDNA sequences most closely related to that of the anatomically modern human (the Neanderthal, the Denisovan, and the chimp), and that the sequence most different from it in this dataset belongs to a cucumber. PMID:26000734

  12. Characterization of NIST human mitochondrial DNA SRM-2392 and SRM-2392-I standard reference materials by next generation sequencing.

    PubMed

    Riman, Sarah; Kiesler, Kevin M; Borsuk, Lisa A; Vallone, Peter M

    2017-07-01

    Standard Reference Materials SRM 2392 and 2392-I are intended to provide quality control when amplifying and sequencing human mitochondrial genome sequences. The National Institute of Standards and Technology (NIST) offers these SRMs to laboratories performing DNA-based forensic human identification, molecular diagnosis of mitochondrial diseases, mutation detection, evolutionary anthropology, and genetic genealogy. The entire mtGenome (∼16569bp) of SRM 2392 and 2392-I have previously been characterized at NIST by Sanger sequencing. Herein, we used the sensitivity, specificity, and accuracy offered by next generation sequencing (NGS) to: (1) re-sequence the certified values of the SRM 2392 and 2392-I; (2) confirm Sanger data with a high coverage new sequencing technology; (3) detect lower level heteroplasmies (<20%); and thus (4) support mitochondrial sequencing communities in the adoption of NGS methods. To obtain a consensus sequence for the SRMs as well as identify and control any bias, sequencing was performed using two NGS platforms and data was analyzed using different bioinformatics pipelines. Our results confirm five low level heteroplasmy sites that were not previously observed with Sanger sequencing: three sites in the GM09947A template in SRM 2392 and two sites in the HL-60 template in SRM 2392-I. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Molecular Analysis of Dehalococcoides 16S Ribosomal DNA from Chloroethene-Contaminated Sites throughout North America and Europe

    PubMed Central

    Hendrickson, Edwin R.; Payne, Jo Ann; Young, Roslyn M.; Starr, Mark G.; Perry, Michael P.; Fahnestock, Stephen; Ellis, David E.; Ebersole, Richard C.

    2002-01-01

    The environmental distribution of Dehalococcoides group organisms and their association with chloroethene-contaminated sites were examined. Samples from 24 chloroethene-dechlorinating sites scattered throughout North America and Europe were tested for the presence of members of the Dehalococcoides group by using a PCR assay developed to detect Dehalococcoides 16S rRNA gene (rDNA) sequences. Sequences identified by sequence analysis as sequences of members of the Dehalococcoides group were detected at 21 sites. Full dechlorination of chloroethenes to ethene occurred at these sites. Dehalococcoides sequences were not detected in samples from three sites at which partial dechlorination of chloroethenes occurred, where dechlorination appeared to stop at 1,2-cis-dichloroethene. Phylogenetic analysis of the 16S rDNA amplicons confirmed that Dehalococcoides sequences formed a unique 16S rDNA group. These 16S rDNA sequences were divided into three subgroups based on specific base substitution patterns in variable regions 2 and 6 of the Dehalococcoides 16S rDNA sequence. Analyses also demonstrated that specific base substitution patterns were signature patterns. The specific base substitutions distinguished the three sequence subgroups phylogenetically. These results demonstrated that members of the Dehalococcoides group are widely distributed in nature and can be found in a variety of geological formations and in different climatic zones. Furthermore, the association of these organisms with full dechlorination of chloroethenes suggests that they are promising candidates for engineered bioremediation and may be important contributors to natural attenuation of chloroethenes. PMID:11823182

  14. Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

    PubMed

    Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

    2007-09-15

    We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

  15. Promoter Sequences Prediction Using Relational Association Rule Mining

    PubMed Central

    Czibula, Gabriela; Bocicor, Maria-Iuliana; Czibula, Istvan Gergely

    2012-01-01

    In this paper we are approaching, from a computational perspective, the problem of promoter sequences prediction, an important problem within the field of bioinformatics. As the conditions for a DNA sequence to function as a promoter are not known, machine learning based classification models are still developed to approach the problem of promoter identification in the DNA. We are proposing a classification model based on relational association rules mining. Relational association rules are a particular type of association rules and describe numerical orderings between attributes that commonly occur over a data set. Our classifier is based on the discovery of relational association rules for predicting if a DNA sequence contains or not a promoter region. An experimental evaluation of the proposed model and comparison with similar existing approaches is provided. The obtained results show that our classifier overperforms the existing techniques for identifying promoter sequences, confirming the potential of our proposal. PMID:22563233

  16. Simultaneous detection of human mitochondrial DNA and nuclear-inserted mitochondrial-origin sequences (NumtS) using forensic mtDNA amplification strategies and pyrosequencing technology.

    PubMed

    Bintz, Brittania J; Dixon, Groves B; Wilson, Mark R

    2014-07-01

    Next-generation sequencing technologies enable the identification of minor mitochondrial DNA variants with higher sensitivity than Sanger methods, allowing for enhanced identification of minor variants. In this study, mixtures of human mtDNA control region amplicons were subjected to pyrosequencing to determine the detection threshold of the Roche GS Junior(®) instrument (Roche Applied Science, Indianapolis, IN). In addition to expected variants, a set of reproducible variants was consistently found in reads from one particular amplicon. A BLASTn search of the variant sequence revealed identity to a segment of a 611-bp nuclear insertion of the mitochondrial control region (NumtS) spanning the primer-binding sites of this amplicon (Nature 1995;378:489). Primers (Hum Genet 2012;131:757; Hum Biol 1996;68:847) flanking the insertion were used to confirm the presence or absence of the NumtS in buccal DNA extracts from twenty donors. These results further our understanding of human mtDNA variation and are expected to have a positive impact on the interpretation of mtDNA profiles using deep-sequencing methods in casework. © 2014 American Academy of Forensic Sciences.

  17. Singular over-representation of an octameric palindrome, HIP1, in DNA from many cyanobacteria.

    PubMed

    Robinson, N J; Robinson, P J; Gupta, A; Bleasby, A J; Whitton, B A; Morby, A P

    1995-03-11

    An octameric palindrome (5'-GCGATCGC-3') is abundant in cyanobacterial sequences within databases (GenBank/EMBL) and was designated HIP1 (highly iterated palindrome). The frequency of occurrence of all 256 octameric palindromes has now been determined in sub-databases revealing large and unique over-representation of HIP1 in cyanobacterial entries. DNA sequences from other bacteria were searched for any over-represented octameric palindromes analogous to HIP1. Only two sequences were identified, in the genomes of a thermophile and halophilic archaebacteria, although these were less abundant than HIP1 in cyanobacteria and relate to codon usage. To test the proposed widespread distribution of HIP1 in DNA from the cyanobacterium Synechococcus PCC 6301, randomly selected genomic clones were partly sequenced. HIP1 constituted 2.5% of the novel sequences, equivalent to a site on average once every 320 nucleotides. An oligonucleotide including HIP1 was also tested in PCR. Multiple products were obtained using template DNA from cyanobacterial strains in which HIP1 is abundant in known sequences, and some strains generated characteristic HIP-PCR banding patterns. However, analysis of DNA from one strain (not previously represented in databases) by random sequencing, HIP-PCR and Pvul digestion, confirms that not all cyanobacterial genomes are rich in HIP1.

  18. Genome-Wide Mutational Signature of the Chemotherapeutic Agent Mitomycin C in Caenorhabditis elegans.

    PubMed

    Tam, Annie S; Chu, Jeffrey S C; Rose, Ann M

    2015-11-12

    Cancer therapy largely depends on chemotherapeutic agents that generate DNA lesions. However, our understanding of the nature of the resulting lesions as well as the mutational profiles of these chemotherapeutic agents is limited. Among these lesions, DNA interstrand crosslinks are among the more toxic types of DNA damage. Here, we have characterized the mutational spectrum of the commonly used DNA interstrand crosslinking agent mitomycin C (MMC). Using a combination of genetic mapping, whole genome sequencing, and genomic analysis, we have identified and confirmed several genomic lesions linked to MMC-induced DNA damage in Caenorhabditis elegans. Our data indicate that MMC predominantly causes deletions, with a 5'-CpG-3' sequence context prevalent in the deleted regions of DNA. Furthermore, we identified microhomology flanking the deletion junctions, indicative of DNA repair via nonhomologous end joining. Based on these results, we propose a general repair mechanism that is likely to be involved in the biological response to this highly toxic agent. In conclusion, the systematic study we have described provides insight into potential sequence specificity of MMC with DNA. Copyright © 2016 Tam et al.

  19. Whole exome sequencing for determination of tumor mutation load in liquid biopsy from advanced cancer patients.

    PubMed

    Koeppel, Florence; Blanchard, Steven; Jovelet, Cécile; Genin, Bérengère; Marcaillou, Charles; Martin, Emmanuel; Rouleau, Etienne; Solary, Eric; Soria, Jean-Charles; André, Fabrice; Lacroix, Ludovic

    2017-01-01

    Tumor mutation load (TML) has been proposed as a biomarker of patient response to immunotherapy in several studies. TML is usually determined by tumor biopsy DNA (tDNA) whole exome sequencing (WES), therefore TML evaluation is limited by informative biopsy availability. Circulating cell free DNA (cfDNA) provided by liquid biopsy is a surrogate specimen to biopsy for molecular profiling. Nevertheless performing WES on DNA from plasma is technically challenging and the ability to determine tumor mutation load from liquid biopsies remains to be demonstrated. In the current study, WES was performed on cfDNA from 32 metastatic patients of various cancer types included into MOSCATO 01 (NCT01566019) and/or MATCHR (NCT02517892) molecular triage trials. Results from targeted gene sequencing (TGS) and WES performed on cfDNA were compared to results from tumor tissue biopsy. In cfDNA samples, WES mutation detection sensitivity was 92% compared to targeted sequencing (TGS). When comparing cfDNA-WES to tDNA-WES, mutation detection sensitivity was 53%, consistent with previously published prospective study comparing cfDNA-TGS to tDNA-TGS. For samples in which presence of tumor DNA was confirmed in cfDNA, tumor mutation load from liquid biopsy was correlated with tumor biopsy. Taken together, this study demonstrated that liquid biopsy may be applied to determine tumor mutation load. Qualification of liquid biopsy for interpretation is a crucial point to use cfDNA for mutational load estimation.

  20. Whole exome sequencing for determination of tumor mutation load in liquid biopsy from advanced cancer patients

    PubMed Central

    Blanchard, Steven; Jovelet, Cécile; Genin, Bérengère; Marcaillou, Charles; Martin, Emmanuel; Rouleau, Etienne; Solary, Eric; Soria, Jean-Charles; André, Fabrice; Lacroix, Ludovic

    2017-01-01

    Tumor mutation load (TML) has been proposed as a biomarker of patient response to immunotherapy in several studies. TML is usually determined by tumor biopsy DNA (tDNA) whole exome sequencing (WES), therefore TML evaluation is limited by informative biopsy availability. Circulating cell free DNA (cfDNA) provided by liquid biopsy is a surrogate specimen to biopsy for molecular profiling. Nevertheless performing WES on DNA from plasma is technically challenging and the ability to determine tumor mutation load from liquid biopsies remains to be demonstrated. In the current study, WES was performed on cfDNA from 32 metastatic patients of various cancer types included into MOSCATO 01 (NCT01566019) and/or MATCHR (NCT02517892) molecular triage trials. Results from targeted gene sequencing (TGS) and WES performed on cfDNA were compared to results from tumor tissue biopsy. In cfDNA samples, WES mutation detection sensitivity was 92% compared to targeted sequencing (TGS). When comparing cfDNA-WES to tDNA-WES, mutation detection sensitivity was 53%, consistent with previously published prospective study comparing cfDNA-TGS to tDNA-TGS. For samples in which presence of tumor DNA was confirmed in cfDNA, tumor mutation load from liquid biopsy was correlated with tumor biopsy. Taken together, this study demonstrated that liquid biopsy may be applied to determine tumor mutation load. Qualification of liquid biopsy for interpretation is a crucial point to use cfDNA for mutational load estimation. PMID:29161279

  1. Identification and DNA annotation of a plasmid isolated from Chromobacterium violaceum.

    PubMed

    Lima, Daniel C; Nyberg, Lena K; Westerlund, Fredrik; Batistuzzo de Medeiros, Silvia R

    2018-03-28

    Chromobacterium violaceum is a ß-proteobacterium found widely worldwide with important biotechnological properties and is associated to lethal sepsis in immune-depressed individuals. In this work, we report the discover, complete sequence and annotation of a plasmid detected in C. violaceum that has been unnoticed until now. We used DNA single-molecule analysis to confirm that the episome found was a circular molecule and then proceeded with NGS sequencing. After DNA annotation, we found that this extra-chromosomal DNA is probably a defective bacteriophage of approximately 44 kilobases, with 39 ORFs comprising, mostly hypothetical proteins. We also found DNA sequences that ensure proper plasmid replication and partitioning as well as a toxin addiction system. This report sheds light on the biology of this important species, helping us to understand the mechanisms by which C. violaceum endures to several harsh conditions. This discovery could also be a first step in the development of a DNA manipulation tool in this bacterium.

  2. Revision of the species complex Amidostomum acutum (Lundahl, 1848) (Nematoda: Amidostomatidae) by use of molecular techniques.

    PubMed

    Kavetska, Katarzyna M; Polasik, Daniel; Dzierzba, Emil; Jędrzejczak, Małgorzata; Kalisińska, Elżbieta; Rząd, Izabella

    2015-01-01

    The aim of the work is to confirm the species differentiation of the nematodes of the Amidostomatidae family: Amidostomoides acutum (Lundahl, 1848) Lomakin, 1991; Amidostomoides monodon (Linstow, 1882) Lomakin, 1991, and Amidostomoides petrovi (Shakhtahtinskaya, 1956) Lomakin, 1991, which still are used in the parasitological literature as synonyms of Amidostomum acutum (Lundahl, 1848). The research material consisted of nematodes isolated from gizzards of dabbling ducks from the north-west of Poland. To confirm the species differentiation, DNA from the nematodes was isolated and approximately 630bp of the 28S rRNA gene were sequenced. The obtained DNA sequences were tabulated and then phylogenetic analysis were conducted using the UPGMA method. The results of the research distinctly diversify the nematodes of the genus Amidostomoides at the DNA level, which together with morphological and ecological differences among them (hosts from different systematic groups) enables to classify them into the separate species.

  3. The cDNA sequence of mouse Pgp-1 and homology to human CD44 cell surface antigen and proteoglycan core/link proteins.

    PubMed

    Wolffe, E J; Gause, W C; Pelfrey, C M; Holland, S M; Steinberg, A D; August, J T

    1990-01-05

    We describe the isolation and sequencing of a cDNA encoding mouse Pgp-1. An oligonucleotide probe corresponding to the NH2-terminal sequence of the purified protein was synthesized by the polymerase chain reaction and used to screen a mouse macrophage lambda gt11 library. A cDNA clone with an insert of 1.2 kilobases was selected and sequenced. In Northern blot analysis, only cells expressing Pgp-1 contained mRNA species that hybridized with this Pgp-1 cDNA. The nucleotide sequence of the cDNA has a single open reading frame that yields a protein-coding sequence of 1076 base pairs followed by a 132-base pair 3'-untranslated sequence that includes a putative polyadenylation signal but no poly(A) tail. The translated sequence comprises a 13-amino acid signal peptide followed by a polypeptide core of 345 residues corresponding to an Mr of 37,800. Portions of the deduced amino acid sequence were identical to those obtained by amino acid sequence analysis from the purified glycoprotein, confirming that the cDNA encodes Pgp-1. The predicted structure of Pgp-1 includes an NH2-terminal extracellular domain (residues 14-265), a transmembrane domain (residues 266-286), and a cytoplasmic tail (residues 287-358). Portions of the mouse Pgp-1 sequence are highly similar to that of the human CD44 cell surface glycoprotein implicated in cell adhesion. The protein also shows sequence similarity to the proteoglycan tandem repeat sequences found in cartilage link protein and cartilage proteoglycan core protein which are thought to be involved in binding to hyaluronic acid.

  4. Cost-Effective Sequencing of Full-Length cDNA Clones Powered by a De Novo-Reference Hybrid Assembly

    PubMed Central

    Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka

    2010-01-01

    Background Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. Methodology We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence ∼800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. Conclusions The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only ∼US$3 per clone, demonstrating a significant advantage over previous approaches. PMID:20479877

  5. Strongylus asini (Nematoda, Strongyloidea): genetic relationships with other Strongylus species determined by ribosomal DNA.

    PubMed

    Hung, G C; Jacobs, D E; Krecek, R C; Gasser, R B; Chilton, N B

    1996-12-01

    Genomic DNA was isolated from adult Strongylus asini collected from zebra. The second ribosomal transcribed spacer (ITS-2) was amplified and sequenced using polymerase chain reaction (PCR) based techniques. The DNA sequence was compared with previously published data for 3 related Strongylus species. A PCR-linked restriction fragment length polymorphism method allowed the 4 species to be differentiated unequivocally. The ITS-2 sequence of S. asini was found to be more similar to those of S. edentatus (87.1%) and S. equinus (95.3%) than to that of S vulgaris (73.9%). This result confirms that S. Asini and S vulgaris represent separate species and supports the retention of the 4 species within 1 genus.

  6. A novel chaotic based image encryption using a hybrid model of deoxyribonucleic acid and cellular automata

    NASA Astrophysics Data System (ADS)

    Enayatifar, Rasul; Sadaei, Hossein Javedani; Abdullah, Abdul Hanan; Lee, Malrey; Isnin, Ismail Fauzi

    2015-08-01

    Currently, there are many studies have conducted on developing security of the digital image in order to protect such data while they are sending on the internet. This work aims to propose a new approach based on a hybrid model of the Tinkerbell chaotic map, deoxyribonucleic acid (DNA) and cellular automata (CA). DNA rules, DNA sequence XOR operator and CA rules are used simultaneously to encrypt the plain-image pixels. To determine rule number in DNA sequence and also CA, a 2-dimension Tinkerbell chaotic map is employed. Experimental results and computer simulations, both confirm that the proposed scheme not only demonstrates outstanding encryption, but also resists various typical attacks.

  7. Characterization of kinetoplast DNA from Phytomonas serpens.

    PubMed

    Sá-Carvalho, D; Perez-Morga, D; Traub-Cseko, Y M

    1993-01-01

    The restriction enzyme digestion of kinetoplast DNA from four Phytomonas serpens isolates shows an overall similar band pattern. One minicircle from isolate 30T was cloned and sequenced, showing low levels of homology but the same general features and organization as described for minicircles of other trypanosomatids. Extensive regions of the minicircle are composed by G and T on the H strand. These regions are very repetitive and similar to regions in a minicircle of Crithidia oncopelti and to telomeric sequences of Saccharomyces cerevisiae. Conserved Sequence Block 3, present in all trypanosomatids, is one nucleotide different from the consensus in P. serpens and provides a basis to differentiate P. serpens from other trypanosomatids. Electron microscopy of kinetoplast DNA evidenced a network with organization similar to other trypanosomatids and the measurement of minicircles confirmed the size of about 1.45 kb of the sequenced minicircle.

  8. The twilight zone of cis element alignments.

    PubMed

    Sebastian, Alvaro; Contreras-Moreira, Bruno

    2013-02-01

    Sequence alignment of proteins and nucleic acids is a routine task in bioinformatics. Although the comparison of complete peptides, genes or genomes can be undertaken with a great variety of tools, the alignment of short DNA sequences and motifs entails pitfalls that have not been fully addressed yet. Here we confront the structural superposition of transcription factors with the sequence alignment of their recognized cis elements. Our goals are (i) to test TFcompare (http://floresta.eead.csic.es/tfcompare), a structural alignment method for protein-DNA complexes; (ii) to benchmark the pairwise alignment of regulatory elements; (iii) to define the confidence limits and the twilight zone of such alignments and (iv) to evaluate the relevance of these thresholds with elements obtained experimentally. We find that the structure of cis elements and protein-DNA interfaces is significantly more conserved than their sequence and measures how this correlates with alignment errors when only sequence information is considered. Our results confirm that DNA motifs in the form of matrices produce better alignments than individual sequences. Finally, we report that empirical and theoretically derived twilight thresholds are useful for estimating the natural plasticity of regulatory sequences, and hence for filtering out unreliable alignments.

  9. The twilight zone of cis element alignments

    PubMed Central

    Sebastian, Alvaro; Contreras-Moreira, Bruno

    2013-01-01

    Sequence alignment of proteins and nucleic acids is a routine task in bioinformatics. Although the comparison of complete peptides, genes or genomes can be undertaken with a great variety of tools, the alignment of short DNA sequences and motifs entails pitfalls that have not been fully addressed yet. Here we confront the structural superposition of transcription factors with the sequence alignment of their recognized cis elements. Our goals are (i) to test TFcompare (http://floresta.eead.csic.es/tfcompare), a structural alignment method for protein–DNA complexes; (ii) to benchmark the pairwise alignment of regulatory elements; (iii) to define the confidence limits and the twilight zone of such alignments and (iv) to evaluate the relevance of these thresholds with elements obtained experimentally. We find that the structure of cis elements and protein–DNA interfaces is significantly more conserved than their sequence and measures how this correlates with alignment errors when only sequence information is considered. Our results confirm that DNA motifs in the form of matrices produce better alignments than individual sequences. Finally, we report that empirical and theoretically derived twilight thresholds are useful for estimating the natural plasticity of regulatory sequences, and hence for filtering out unreliable alignments. PMID:23268451

  10. Development and validation of a D-loop mtDNA SNP assay for the screening of specimens in forensic casework.

    PubMed

    Chemale, Gustavo; Paneto, Greiciane Gaburro; Menezes, Meiga Aurea Mendes; de Freitas, Jorge Marcelo; Jacques, Guilherme Silveira; Cicarelli, Regina Maria Barretto; Fagundes, Paulo Roberto

    2013-05-01

    Mitochondrial DNA (mtDNA) analysis is usually a last resort in routine forensic DNA casework. However, it has become a powerful tool for the analysis of highly degraded samples or samples containing too little or no nuclear DNA, such as old bones and hair shafts. The gold standard methodology still constitutes the direct sequencing of polymerase chain reaction (PCR) products or cloned amplicons from the HVS-1 and HVS-2 (hypervariable segment) control region segments. Identifications using mtDNA are time consuming, expensive and can be very complex, depending on the amount and nature of the material being tested. The main goal of this work is to develop a less labour-intensive and less expensive screening method for mtDNA analysis, in order to aid in the exclusion of non-matching samples and as a presumptive test prior to final confirmatory DNA sequencing. We have selected 14 highly discriminatory single nucleotide polymorphisms (SNPs) based on simulations performed by Salas and Amigo (2010) to be typed using SNaPShot(TM) (Applied Biosystems, Foster City, CA, USA). The assay was validated by typing more than 100 HVS-1/HVS-2 sequenced samples. No differences were observed between the SNP typing and DNA sequencing when results were compared, with the exception of allelic dropouts observed in a few haplotypes. Haplotype diversity simulations were performed using 172 mtDNA sequences representative of the Brazilian population and a score of 0.9794 was obtained when the 14 SNPs were used, showing that the theoretical prediction approach for the selection of highly discriminatory SNPs suggested by Salas and Amigo (2010) was confirmed in the population studied. As the main goal of the work is to develop a screening assay to skip the sequencing of all samples in a particular case, a pair-wise comparison of the sequences was done using the selected SNPs. When both HVS-1/HVS-2 SNPs were used for simulations, at least two differences were observed in 93.2% of the comparisons performed. The assay was validated with casework samples. Results show that the method is straightforward and can be used for exclusionary purposes, saving time and laboratory resources. The assay confirms the theoretic prediction suggested by Salas and Amigo (2010). All forensic advantages, such as high sensitivity and power of discrimination, as also the disadvantages, such as the occurrence of allele dropouts, are discussed throughout the article. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  11. Identification and chromosome mapping of repetitive elements in the Astyanax scabripinnis (Teleostei: Characidae) species complex.

    PubMed

    Barbosa, Patrícia; de Oliveira, Luiz Antonio; Pucci, Marcela Baer; Santos, Mateus Henrique; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo; Nogaroto, Viviane; de Almeida, Mara Cristina; Artoni, Roberto Ferreira

    2015-02-01

    Most part of the eukaryotic genome is composed of repeated sequences or multiple copies of DNA, which were considered as "junk DNA", and may be associated to the heterochromatin. In this study, three populations of Astyanax aff. scabripinnis from Brazilian rivers of Guaratinguetá and Pindamonhangaba (São Paulo) and a population from Maringá (Paraná) were analyzed concerning the localization of the nucleolar organizer regions (Ag-NORs), the As51 satellite DNA, the 18S ribosomal DNA (rDNA), and the 5S rDNA. Repeated sequences were also isolated and identified by the Cot - 1 method, which indicated similarity (90%) with the LINE UnaL2 retrotransposon. The fluorescence in situ hybridization (FISH) showed the retrotransposon dispersed and more concentrated markers in centromeric and telomeric chromosomal regions. These sequences were co-localized and interspaced with 18S and 5S rDNA and As51, confirmed by fiber-FISH essay. The B chromosome found in these populations pointed to a conspicuous hybridization with LINE probe, which is also co-located in As51 sequences. The NORs were active at unique sites of a homologous pair in the three populations. There were no evidences that transposable elements and repetitive DNA had influence in the transcriptional regulation of ribosomal genes in our analyses.

  12. Lactobacillus cypricasei Lawson et al. 2001 is a later heterotypic synonym of Lactobacillus acidipiscis Tanasupawat et al. 2000.

    PubMed

    Naser, Sabri M; Vancanneyt, Marc; Hoste, Bart; Snauwaert, Cindy; Swings, Jean

    2006-07-01

    The applicability of a multilocus sequence analysis (MLSA)-based identification system for lactobacilli was evaluated. Two housekeeping genes that code for the phenylalanyl-tRNA synthase alpha-subunit (pheS) and RNA polymerase alpha-subunit (rpoA) were sequenced and analysed for members of the Lactobacillus salivarius species group. The type strains of Lactobacillus acidipiscis and Lactobacillus cypricasei were investigated further using a third gene that encodes the alpha-subunit of ATP synthase (atpA). The MLSA data revealed close relatedness between L. acidipiscis and L. cypricasei, with 99.8-100 % pheS, rpoA and atpA gene sequence similarities. Comparison of the 16S rRNA gene sequences of the type strains of the two species confirmed the close relatedness (99.8 % gene sequence similarity) between the two taxa. Similar phenotypes and high DNA-DNA binding values in the range of 84 to 97.5 % confirmed that L. acidipiscis and L. cypricasei are synonymous species. On the basis of the present study, it is proposed that Lactobacillus cypricasei is a later heterotypic synonym of Lactobacillus acidipiscis.

  13. DNA sequence responsible for the amplification of adjacent genes.

    PubMed

    Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K

    1987-10-01

    A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.

  14. Genomic characterization reconfirms the taxonomic status of Lactobacillus parakefiri

    PubMed Central

    TANIZAWA, Yasuhiro; KOBAYASHI, Hisami; KAMINUMA, Eli; SAKAMOTO, Mitsuo; OHKUMA, Moriya; NAKAMURA, Yasukazu; ARITA, Masanori; TOHNO, Masanori

    2017-01-01

    Whole-genome sequencing was performed for Lactobacillus parakefiri JCM 8573T to confirm its hitherto controversial taxonomic position. Here, we report its first reliable reference genome. Genome-wide metrics, such as average nucleotide identity and digital DNA-DNA hybridization, and phylogenomic analysis based on multiple genes supported its taxonomic status as a distinct species in the genus Lactobacillus. The availability of a reliable genome sequence will aid future investigations on the industrial applications of L. parakefiri in functional foods such as kefir grains. PMID:28748134

  15. Bisulfite Conversion of DNA: Performance Comparison of Different Kits and Methylation Quantitation of Epigenetic Biomarkers that Have the Potential to Be Used in Non-Invasive Prenatal Testing

    PubMed Central

    Leontiou, Chrysanthia A.; Hadjidaniel, Michael D.; Mina, Petros; Antoniou, Pavlos; Ioannides, Marios; Patsalis, Philippos C.

    2015-01-01

    Introduction Epigenetic alterations, including DNA methylation, play an important role in the regulation of gene expression. Several methods exist for evaluating DNA methylation, but bisulfite sequencing remains the gold standard by which base-pair resolution of CpG methylation is achieved. The challenge of the method is that the desired outcome (conversion of unmethylated cytosines) positively correlates with the undesired side effects (DNA degradation and inappropriate conversion), thus several commercial kits try to adjust a balance between the two. The aim of this study was to compare the performance of four bisulfite conversion kits [Premium Bisulfite kit (Diagenode), EpiTect Bisulfite kit (Qiagen), MethylEdge Bisulfite Conversion System (Promega) and BisulFlash DNA Modification kit (Epigentek)] regarding conversion efficiency, DNA degradation and conversion specificity. Methods Performance was tested by combining fully methylated and fully unmethylated λ-DNA controls in a series of spikes by means of Sanger sequencing (0%, 25%, 50% and 100% methylated spikes) and Next-Generation Sequencing (0%, 3%, 5%, 7%, 10%, 25%, 50% and 100% methylated spikes). We also studied the methylation status of two of our previously published differentially methylated regions (DMRs) at base resolution by using spikes of chorionic villus sample in whole blood. Results The kits studied showed different but comparable results regarding DNA degradation, conversion efficiency and conversion specificity. However, the best performance was observed with the MethylEdge Bisulfite Conversion System (Promega) followed by the Premium Bisulfite kit (Diagenode). The DMRs, EP6 and EP10, were confirmed to be hypermethylated in the CVS and hypomethylated in whole blood. Conclusion Our findings indicate that the MethylEdge Bisulfite Conversion System (Promega) was shown to have the best performance among the kits. In addition, the methylation level of two of our DMRs, EP6 and EP10, was confirmed. Finally, we showed that bisulfite amplicon sequencing is a suitable approach for methylation analysis of targeted regions. PMID:26247357

  16. Bisulfite Conversion of DNA: Performance Comparison of Different Kits and Methylation Quantitation of Epigenetic Biomarkers that Have the Potential to Be Used in Non-Invasive Prenatal Testing.

    PubMed

    Leontiou, Chrysanthia A; Hadjidaniel, Michael D; Mina, Petros; Antoniou, Pavlos; Ioannides, Marios; Patsalis, Philippos C

    2015-01-01

    Epigenetic alterations, including DNA methylation, play an important role in the regulation of gene expression. Several methods exist for evaluating DNA methylation, but bisulfite sequencing remains the gold standard by which base-pair resolution of CpG methylation is achieved. The challenge of the method is that the desired outcome (conversion of unmethylated cytosines) positively correlates with the undesired side effects (DNA degradation and inappropriate conversion), thus several commercial kits try to adjust a balance between the two. The aim of this study was to compare the performance of four bisulfite conversion kits [Premium Bisulfite kit (Diagenode), EpiTect Bisulfite kit (Qiagen), MethylEdge Bisulfite Conversion System (Promega) and BisulFlash DNA Modification kit (Epigentek)] regarding conversion efficiency, DNA degradation and conversion specificity. Performance was tested by combining fully methylated and fully unmethylated λ-DNA controls in a series of spikes by means of Sanger sequencing (0%, 25%, 50% and 100% methylated spikes) and Next-Generation Sequencing (0%, 3%, 5%, 7%, 10%, 25%, 50% and 100% methylated spikes). We also studied the methylation status of two of our previously published differentially methylated regions (DMRs) at base resolution by using spikes of chorionic villus sample in whole blood. The kits studied showed different but comparable results regarding DNA degradation, conversion efficiency and conversion specificity. However, the best performance was observed with the MethylEdge Bisulfite Conversion System (Promega) followed by the Premium Bisulfite kit (Diagenode). The DMRs, EP6 and EP10, were confirmed to be hypermethylated in the CVS and hypomethylated in whole blood. Our findings indicate that the MethylEdge Bisulfite Conversion System (Promega) was shown to have the best performance among the kits. In addition, the methylation level of two of our DMRs, EP6 and EP10, was confirmed. Finally, we showed that bisulfite amplicon sequencing is a suitable approach for methylation analysis of targeted regions.

  17. Decoding DNA labels by melting curve analysis using real-time PCR.

    PubMed

    Balog, József A; Fehér, Liliána Z; Puskás, László G

    2017-12-01

    Synthetic DNA has been used as an authentication code for a diverse number of applications. However, existing decoding approaches are based on either DNA sequencing or the determination of DNA length variations. Here, we present a simple alternative protocol for labeling different objects using a small number of short DNA sequences that differ in their melting points. Code amplification and decoding can be done in two steps using quantitative PCR (qPCR). To obtain a DNA barcode with high complexity, we defined 8 template groups, each having 4 different DNA templates, yielding 158 (>2.5 billion) combinations of different individual melting temperature (Tm) values and corresponding ID codes. The reproducibility and specificity of the decoding was confirmed by using the most complex template mixture, which had 32 different products in 8 groups with different Tm values. The industrial applicability of our protocol was also demonstrated by labeling a drone with an oil-based paint containing a predefined DNA code, which was then successfully decoded. The method presented here consists of a simple code system based on a small number of synthetic DNA sequences and a cost-effective, rapid decoding protocol using a few qPCR reactions, enabling a wide range of authentication applications.

  18. Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense.

    PubMed

    Bakhori, Noremylia Mohd; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

    2013-12-12

    An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10-9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.

  19. Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense.

    PubMed

    Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

    2013-12-01

    An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10(-9) M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.

  20. A next generation semiconductor based sequencing approach for the identification of meat species in DNA mixtures.

    PubMed

    Bertolini, Francesca; Ghionda, Marco Ciro; D'Alessandro, Enrico; Geraci, Claudia; Chiofalo, Vincenzo; Fontanesi, Luca

    2015-01-01

    The identification of the species of origin of meat and meat products is an important issue to prevent and detect frauds that might have economic, ethical and health implications. In this paper we evaluated the potential of the next generation semiconductor based sequencing technology (Ion Torrent Personal Genome Machine) for the identification of DNA from meat species (pig, horse, cattle, sheep, rabbit, chicken, turkey, pheasant, duck, goose and pigeon) as well as from human and rat in DNA mixtures through the sequencing of PCR products obtained from different couples of universal primers that amplify 12S and 16S rRNA mitochondrial DNA genes. Six libraries were produced including PCR products obtained separately from 13 species or from DNA mixtures containing DNA from all species or only avian or only mammalian species at equimolar concentration or at 1:10 or 1:50 ratios for pig and horse DNA. Sequencing obtained a total of 33,294,511 called nucleotides of which 29,109,688 with Q20 (87.43%) in a total of 215,944 reads. Different alignment algorithms were used to assign the species based on sequence data. Error rate calculated after confirmation of the obtained sequences by Sanger sequencing ranged from 0.0003 to 0.02 for the different species. Correlation about the number of reads per species between different libraries was high for mammalian species (0.97) and lower for avian species (0.70). PCR competition limited the efficiency of amplification and sequencing for avian species for some primer pairs. Detection of low level of pig and horse DNA was possible with reads obtained from different primer pairs. The sequencing of the products obtained from different universal PCR primers could be a useful strategy to overcome potential problems of amplification. Based on these results, the Ion Torrent technology can be applied for the identification of meat species in DNA mixtures.

  1. A Next Generation Semiconductor Based Sequencing Approach for the Identification of Meat Species in DNA Mixtures

    PubMed Central

    Bertolini, Francesca; Ghionda, Marco Ciro; D’Alessandro, Enrico; Geraci, Claudia; Chiofalo, Vincenzo; Fontanesi, Luca

    2015-01-01

    The identification of the species of origin of meat and meat products is an important issue to prevent and detect frauds that might have economic, ethical and health implications. In this paper we evaluated the potential of the next generation semiconductor based sequencing technology (Ion Torrent Personal Genome Machine) for the identification of DNA from meat species (pig, horse, cattle, sheep, rabbit, chicken, turkey, pheasant, duck, goose and pigeon) as well as from human and rat in DNA mixtures through the sequencing of PCR products obtained from different couples of universal primers that amplify 12S and 16S rRNA mitochondrial DNA genes. Six libraries were produced including PCR products obtained separately from 13 species or from DNA mixtures containing DNA from all species or only avian or only mammalian species at equimolar concentration or at 1:10 or 1:50 ratios for pig and horse DNA. Sequencing obtained a total of 33,294,511 called nucleotides of which 29,109,688 with Q20 (87.43%) in a total of 215,944 reads. Different alignment algorithms were used to assign the species based on sequence data. Error rate calculated after confirmation of the obtained sequences by Sanger sequencing ranged from 0.0003 to 0.02 for the different species. Correlation about the number of reads per species between different libraries was high for mammalian species (0.97) and lower for avian species (0.70). PCR competition limited the efficiency of amplification and sequencing for avian species for some primer pairs. Detection of low level of pig and horse DNA was possible with reads obtained from different primer pairs. The sequencing of the products obtained from different universal PCR primers could be a useful strategy to overcome potential problems of amplification. Based on these results, the Ion Torrent technology can be applied for the identification of meat species in DNA mixtures. PMID:25923709

  2. Delimitation of some neotropical laccate Ganoderma (Ganodermataceae): molecular phylogeny and morphology.

    PubMed

    De Lima Júnior, Nelson Correia; Baptista Gibertone, Tatiana; Malosso, Elaine

    2014-09-01

    Ganoderma includes species of great economic and ecological importance, but taxonomists judge the current nomenclatural situation as chaotic and poorly studied in the neotropics. From this perspective, phylogenetic analyses inferred from ribosomal DNA sequences have aided the clarification of the genus status. In this study, 14 specimens of Ganoderma and two of Tomophagus collected in Brazil were used for DNA extraction, amplification and sequencing of the ITS and LSU regions (rDNA). The phylogenetic delimitation of six neotropical taxa (G. chalceum, G. multiplicatum, G. orbiforme, G. parvulum, G. aff. oerstedtii and Tomophagus colossus) was determined based on these Brazilian specimens and found to be distinct from the laccate Ganoderma from Asia, Europe, North America and from some specimens from Argentina. Phylogenetic reconstructions confirmed that the laccate Ganoderna is distinct from Tomophagus, although they belong to the same group. The use of taxonomic synonyms Ganoderma subamboinense for G. multiplicatumnz, G. boninense for G. orbiforme and G. chalceum for G. cupreum was not confirmed. However, Ganoderma parvulum was confirmed as the correct name for specimens called G. stipitatu. Furthermore, the name G. hucidumn should be used only for European species. The use of valid published names is proposed according to the specimen geographical distribution, their morphological characteristics and rDNA analysis. 1208. Epub 2014 September 01.

  3. Genetic Confirmation of Mungbean (Vigna radiata) and Mashbean (Vigna mungo) Interspecific Recombinants using Molecular Markers.

    PubMed

    Abbas, Ghulam; Hameed, Amjad; Rizwan, Muhammad; Ahsan, Muhammad; Asghar, Muhammad J; Iqbal, Nayyer

    2015-01-01

    Molecular confirmation of interspecific recombinants is essential to overcome the issues like self-pollination, environmental influence, and inadequacy of morphological characteristics during interspecific hybridization. The present study was conducted for genetic confirmation of mungbean (female) and mashbean (male) interspecific crosses using molecular markers. Initially, polymorphic random amplified polymorphic DNA (RAPD), universal rice primers (URP), and simple sequence repeats (SSR) markers differentiating parent genotypes were identified. Recombination in hybrids was confirmed using these polymorphic DNA markers. The NM 2006 × Mash 88 was most successful interspecific cross. Most of true recombinants confirmed by molecular markers were from this cross combination. SSR markers were efficient in detecting genetic variability and recombination with reference to specific chromosomes and particular loci. SSR (RIS) and RAPD identified variability dispersed throughout the genome. In conclusion, DNA based marker assisted selection (MAS) efficiently confirmed the interspecific recombinants. The results provided evidence that MAS can enhance the authenticity of selection in mungbean improvement program.

  4. Unlinking the methylome pattern from nucleotide sequence, revealed by large-scale in vivo genome engineering and methylome editing in medaka fish

    PubMed Central

    Nakamura, Ryohei; Uno, Ayako; Kumagai, Masahiko; Fukushima, Hiroto S.; Morishita, Shinichi; Takeda, Hiroyuki

    2017-01-01

    The heavily methylated vertebrate genomes are punctuated by stretches of poorly methylated DNA sequences that usually mark gene regulatory regions. It is known that the methylation state of these regions confers transcriptional control over their associated genes. Given its governance on the transcriptome, cellular functions and identity, genome-wide DNA methylation pattern is tightly regulated and evidently predefined. However, how is the methylation pattern determined in vivo remains enigmatic. Based on in silico and in vitro evidence, recent studies proposed that the regional hypomethylated state is primarily determined by local DNA sequence, e.g., high CpG density and presence of specific transcription factor binding sites. Nonetheless, the dependency of DNA methylation on nucleotide sequence has not been carefully validated in vertebrates in vivo. Herein, with the use of medaka (Oryzias latipes) as a model, the sequence dependency of DNA methylation was intensively tested in vivo. Our statistical modeling confirmed the strong statistical association between nucleotide sequence pattern and methylation state in the medaka genome. However, by manipulating the methylation state of a number of genomic sequences and reintegrating them into medaka embryos, we demonstrated that artificially conferred DNA methylation states were predominantly and robustly maintained in vivo, regardless of their sequences and endogenous states. This feature was also observed in the medaka transgene that had passed across generations. Thus, despite the observed statistical association, nucleotide sequence was unable to autonomously determine its own methylation state in medaka in vivo. Our results apparently argue against the notion of the governance on the DNA methylation by nucleotide sequence, but instead suggest the involvement of other epigenetic factors in defining and maintaining the DNA methylation landscape. Further investigation in other vertebrate models in vivo will be needed for the generalization of our observations made in medaka. PMID:29267279

  5. Successful isolation and PCR amplification of DNA from National Institute of Standards and Technology herbal dietary supplement standard reference material powders and extracts.

    PubMed

    Cimino, Matthew T

    2010-03-01

    Twenty-four herbal dietary supplement powder and extract reference standards provided by the National Institute of Standards and Technology (NIST) were investigated using three different commercially available DNA extraction kits to evaluate DNA availability for downstream nucleotide-based applications. The material included samples of Camellia, Citrus, Ephedra, Ginkgo, Hypericum, Serenoa, And Vaccinium. Protocols from Qiagen, MoBio, and Phytopure were used to isolate and purify DNA from the NIST standards. The resulting DNA concentration was quantified using SYBR Green fluorometry. Each of the 24 samples yielded DNA, though the concentration of DNA from each approach was notably different. The Phytopure method consistently yielded more DNA. The average yield ratio was 22 : 3 : 1 (ng/microL; Phytopure : Qiagen : MoBio). Amplification of the internal transcribed spacer II region using PCR was ultimately successful in 22 of the 24 samples. Direct sequencing chromatograms of the amplified material suggested that most of the samples were comprised of mixtures. However, the sequencing chromatograms of 12 of the 24 samples were sufficient to confirm the identity of the target material. The successful extraction, amplification, and sequencing of DNA from these herbal dietary supplement extracts and powders supports a continued effort to explore nucleotide sequence-based tools for the authentication and identification of plants in dietary supplements. (c) Georg Thieme Verlag KG Stuttgart . New York.

  6. Paging through history: parchment as a reservoir of ancient DNA for next generation sequencing

    PubMed Central

    Teasdale, M. D.; van Doorn, N. L.; Fiddyment, S.; Webb, C. C.; O'Connor, T.; Hofreiter, M.; Collins, M. J.; Bradley, D. G.

    2015-01-01

    Parchment represents an invaluable cultural reservoir. Retrieving an additional layer of information from these abundant, dated livestock-skins via the use of ancient DNA (aDNA) sequencing has been mooted by a number of researchers. However, prior PCR-based work has indicated that this may be challenged by cross-individual and cross-species contamination, perhaps from the bulk parchment preparation process. Here we apply next generation sequencing to two parchments of seventeenth and eighteenth century northern English provenance. Following alignment to the published sheep, goat, cow and human genomes, it is clear that the only genome displaying substantial unique homology is sheep and this species identification is confirmed by collagen peptide mass spectrometry. Only 4% of sequence reads align preferentially to a different species indicating low contamination across species. Moreover, mitochondrial DNA sequences suggest an upper bound of contamination at 5%. Over 45% of reads aligned to the sheep genome, and even this limited sequencing exercise yield 9 and 7% of each sampled sheep genome post filtering, allowing the mapping of genetic affinity to modern British sheep breeds. We conclude that parchment represents an excellent substrate for genomic analyses of historical livestock. PMID:25487331

  7. Noninvasive prenatal testing of trisomies 21 and 18 by massively parallel sequencing of maternal plasma DNA in twin pregnancies.

    PubMed

    Huang, Xuan; Zheng, Jing; Chen, Min; Zhao, Yangyu; Zhang, Chunlei; Liu, Lifu; Xie, Weiwei; Shi, Shuqiong; Wei, Yuan; Lei, Dongzhu; Xu, Chenming; Wu, Qichang; Guo, Xiaoling; Shi, Xiaomei; Zhou, Yi; Liu, Qiufang; Gao, Ya; Jiang, Fuman; Zhang, Hongyun; Su, Fengxia; Ge, Huijuan; Li, Xuchao; Pan, Xiaoyu; Chen, Shengpei; Chen, Fang; Fang, Qun; Jiang, Hui; Lau, Tze Kin; Wang, Wei

    2014-04-01

    The objective of this study is to assess the performance of noninvasive prenatal testing for trisomies 21 and 18 on the basis of massively parallel sequencing of cell-free DNA from maternal plasma in twin pregnancies. A double-blind study was performed over 12 months. A total of 189 pregnant women carrying twins were recruited from seven hospitals. Maternal plasma DNA sequencing was performed to detect trisomies 21 and 18. The fetal karyotype was used as gold standard to estimate the sensitivity and specificity of sequencing-based noninvasive prenatal test. There were nine cases of trisomy 21 and two cases of trisomy 18 confirmed by karyotyping. Plasma DNA sequencing correctly identified nine cases of trisomy 21 and one case of trisomy 18. The discordant case of trisomy 18 was an unusual case of monozygotic twin with discordant fetal karyotype (one normal and the other trisomy 18). The sensitivity and specificity of maternal plasma DNA sequencing for fetal trisomy 21 were both 100% and for fetal trisomy 18 were 50% and 100%, respectively. Our study further supported that sequencing-based noninvasive prenatal testing of trisomy 21 in twin pregnancies could be achieved with a high accuracy, which could effectively avoid almost 95% of invasive prenatal diagnosis procedures. © 2013 John Wiley & Sons, Ltd.

  8. Intron loss from the NADH dehydrogenase subunit 4 gene of lettuce mitochondrial DNA: evidence for homologous recombination of a cDNA intermediate.

    PubMed

    Geiss, K T; Abbas, G M; Makaroff, C A

    1994-04-01

    The mitochondrial gene coding for subunit 4 of the NADH dehydrogenase complex I (nad4) has been isolated and characterized from lettuce, Lactuca sativa. Analysis of nad4 genes in a number of plants by Southern hybridization had previously suggested that the intron content varied between species. Characterization of the lettuce gene confirms this observation. Lettuce nad4 contains two exons and one group IIA intron, whereas previously sequenced nad4 genes from turnip and wheat contain three group IIA introns. Northern analysis identified a transcript of 1600 nucleotides, which represents the mature nad4 mRNA and a primary transcript of 3200 nucleotides. Sequence analysis of lettuce and turnip nad4 cDNAs was used to confirm the intron/exon border sequences and to examine RNA editing patterns. Editing is observed at the 5' and 3' ends of the lettuce transcript, but is absent from sequences that correspond to exons two, three and the 5' end of exon four in turnip and wheat. In contrast, turnip transcripts are highly edited in this region, suggesting that homologous recombination of an edited and spliced cDNA intermediate was involved in the loss of introns two and three from an ancestral lettuce nad4 gene.

  9. Tissue-specific DNA methylation is conserved across human, mouse, and rat, and driven by primary sequence conservation.

    PubMed

    Zhou, Jia; Sears, Renee L; Xing, Xiaoyun; Zhang, Bo; Li, Daofeng; Rockweiler, Nicole B; Jang, Hyo Sik; Choudhary, Mayank N K; Lee, Hyung Joo; Lowdon, Rebecca F; Arand, Jason; Tabers, Brianne; Gu, C Charles; Cicero, Theodore J; Wang, Ting

    2017-09-12

    Uncovering mechanisms of epigenome evolution is an essential step towards understanding the evolution of different cellular phenotypes. While studies have confirmed DNA methylation as a conserved epigenetic mechanism in mammalian development, little is known about the conservation of tissue-specific genome-wide DNA methylation patterns. Using a comparative epigenomics approach, we identified and compared the tissue-specific DNA methylation patterns of rat against those of mouse and human across three shared tissue types. We confirmed that tissue-specific differentially methylated regions are strongly associated with tissue-specific regulatory elements. Comparisons between species revealed that at a minimum 11-37% of tissue-specific DNA methylation patterns are conserved, a phenomenon that we define as epigenetic conservation. Conserved DNA methylation is accompanied by conservation of other epigenetic marks including histone modifications. Although a significant amount of locus-specific methylation is epigenetically conserved, the majority of tissue-specific DNA methylation is not conserved across the species and tissue types that we investigated. Examination of the genetic underpinning of epigenetic conservation suggests that primary sequence conservation is a driving force behind epigenetic conservation. In contrast, evolutionary dynamics of tissue-specific DNA methylation are best explained by the maintenance or turnover of binding sites for important transcription factors. Our study extends the limited literature of comparative epigenomics and suggests a new paradigm for epigenetic conservation without genetic conservation through analysis of transcription factor binding sites.

  10. Flow cytometry sorting of nuclei enables the first global characterization of Paramecium germline DNA and transposable elements.

    PubMed

    Guérin, Frédéric; Arnaiz, Olivier; Boggetto, Nicole; Denby Wilkes, Cyril; Meyer, Eric; Sperling, Linda; Duharcourt, Sandra

    2017-04-26

    DNA elimination is developmentally programmed in a wide variety of eukaryotes, including unicellular ciliates, and leads to the generation of distinct germline and somatic genomes. The ciliate Paramecium tetraurelia harbors two types of nuclei with different functions and genome structures. The transcriptionally inactive micronucleus contains the complete germline genome, while the somatic macronucleus contains a reduced genome streamlined for gene expression. During development of the somatic macronucleus, the germline genome undergoes massive and reproducible DNA elimination events. Availability of both the somatic and germline genomes is essential to examine the genome changes that occur during programmed DNA elimination and ultimately decipher the mechanisms underlying the specific removal of germline-limited sequences. We developed a novel experimental approach that uses flow cell imaging and flow cytometry to sort subpopulations of nuclei to high purity. We sorted vegetative micronuclei and macronuclei during development of P. tetraurelia. We validated the method by flow cell imaging and by high throughput DNA sequencing. Our work establishes the proof of principle that developing somatic macronuclei can be sorted from a complex biological sample to high purity based on their size, shape and DNA content. This method enabled us to sequence, for the first time, the germline DNA from pure micronuclei and to identify novel transposable elements. Sequencing the germline DNA confirms that the Pgm domesticated transposase is required for the excision of all ~45,000 Internal Eliminated Sequences. Comparison of the germline DNA and unrearranged DNA obtained from PGM-silenced cells reveals that the latter does not provide a faithful representation of the germline genome. We developed a flow cytometry-based method to purify P. tetraurelia nuclei to high purity and provided quality control with flow cell imaging and high throughput DNA sequencing. We identified 61 germline transposable elements including the first Paramecium retrotransposons. This approach paves the way to sequence the germline genomes of P. aurelia sibling species for future comparative genomic studies.

  11. Monitoring of organ transplants through genomic analyses of circulating cell-free DNA

    NASA Astrophysics Data System (ADS)

    de Vlaminck, Iwijn

    Solid-organ transplantation is the preferred treatment for patients with end-stage organ diseases, but complications due to infection and acute rejection undermine its long-term benefits. While clinicians strive to carefully monitor transplant patients, diagnostic options are currently limited. My colleagues and I in the lab of Stephen Quake have found that a combination of next-generation sequencing with a phenomenon called circulating cell-free DNA enables non-invasive diagnosis of both infection and rejection in transplantation. A substantial amount of small fragments of cell-free DNA circulate in blood that are the debris of dead cells. We discovered that donor specific DNA is released in circulation during injury to the transplant organ and we show that the proportion of donor DNA in plasma is predictive of acute rejection in heart and lung transplantation. We profiled viral and bacterial DNA sequences in plasma of transplant patients and discovered that the relative representation of different viruses and bacteria is informative of immunosuppression. This discovery suggested a novel biological measure of a person's immune strength, a finding that we have more recently confirmed via B-cell repertoire sequencing. Lastly, our studies highlight applications of shotgun sequencing of cell-free DNA in the broad, hypothesis free diagnosis of infection.

  12. NGS-based likelihood ratio for identifying contributors in two- and three-person DNA mixtures.

    PubMed

    Chan Mun Wei, Joshua; Zhao, Zicheng; Li, Shuai Cheng; Ng, Yen Kaow

    2018-06-01

    DNA fingerprinting, also known as DNA profiling, serves as a standard procedure in forensics to identify a person by the short tandem repeat (STR) loci in their DNA. By comparing the STR loci between DNA samples, practitioners can calculate a probability of match to identity the contributors of a DNA mixture. Most existing methods are based on 13 core STR loci which were identified by the Federal Bureau of Investigation (FBI). Analyses based on these loci of DNA mixture for forensic purposes are highly variable in procedures, and suffer from subjectivity as well as bias in complex mixture interpretation. With the emergence of next-generation sequencing (NGS) technologies, the sequencing of billions of DNA molecules can be parallelized, thus greatly increasing throughput and reducing the associated costs. This allows the creation of new techniques that incorporate more loci to enable complex mixture interpretation. In this paper, we propose a computation for likelihood ratio that uses NGS (next generation sequencing) data for DNA testing on mixed samples. We have applied the method to 4480 simulated DNA mixtures, which consist of various mixture proportions of 8 unrelated whole-genome sequencing data. The results confirm the feasibility of utilizing NGS data in DNA mixture interpretations. We observed an average likelihood ratio as high as 285,978 for two-person mixtures. Using our method, all 224 identity tests for two-person mixtures and three-person mixtures were correctly identified. Copyright © 2018 Elsevier Ltd. All rights reserved.

  13. Effective DNA Inhibitors of Cathepsin G by In Vitro Selection

    PubMed Central

    Gatto, Barbara; Vianini, Elena; Lucatello, Lorena; Sissi, Claudia; Moltrasio, Danilo; Pescador, Rodolfo; Porta, Roberto; Palumbo, Manlio

    2008-01-01

    Cathepsin G (CatG) is a chymotrypsin-like protease released upon degranulation of neutrophils. In several inflammatory and ischaemic diseases the impaired balance between CatG and its physiological inhibitors leads to tissue destruction and platelet aggregation. Inhibitors of CatG are suitable for the treatment of inflammatory diseases and procoagulant conditions. DNA released upon the death of neutrophils at injury sites binds CatG. Moreover, short DNA fragments are more inhibitory than genomic DNA. Defibrotide, a single stranded polydeoxyribonucleotide with antithrombotic effect is also a potent CatG inhibitor. Given the above experimental evidences we employed a selection protocol to assess whether DNA inhibition of CatG may be ascribed to specific sequences present in defibrotide DNA. A Selex protocol was applied to identify the single-stranded DNA sequences exhibiting the highest affinity for CatG, the diversity of a combinatorial pool of oligodeoxyribonucleotides being a good representation of the complexity found in defibrotide. Biophysical and biochemical studies confirmed that the selected sequences bind tightly to the target enzyme and also efficiently inhibit its catalytic activity. Sequence analysis carried out to unveil a motif responsible for CatG recognition showed a recurrence of alternating TG repeats in the selected CatG binders, adopting an extended conformation that grants maximal interaction with the highly charged protein surface. This unprecedented finding is validated by our results showing high affinity and inhibition of CatG by specific DNA sequences of variable length designed to maximally reduce pairing/folding interactions. PMID:19325843

  14. Confirmed detection of Cyclospora cayetanesis, Encephalitozoon intestinalis and Cryptosporidium parvum in water used for drinking.

    PubMed

    Dowd, Scot E; John, David; Eliopolus, James; Gerba, Charles P; Naranjo, Jaime; Klein, Robert; López, Beatriz; de Mejía, Maricruz; Mendoza, Carlos E; Pepper, Ian L

    2003-09-01

    Human enteropathogenic microsporidia (HEM), Cryptosporidium parvum, Cyclospora cayetanesis, and Giardia lamblia are associated with gastrointestinal disease in humans. To date, the mode of transmission and environmental occurrence of HEM (Encephalitozoon intestinalis and Enterocytozoon bieneusi) and Cyclospora cayetanesis have not been fully elucidated due to lack of sensitive and specific environmental screening methods. The present study was undertaken with recently developed methods, to screen various water sources used for public consumption in rural areas around the city of Guatemala. Water concentrates collected in these areas were subjected to community DNA extraction followed by PCR amplification, PCR sequencing and computer database homology comparison (CDHC). All water samples screened in this study had been previously confirmed positive for Giardia spp. by immunofluorescent assay (IFA). Of the 12 water concentrates screened, 6 showed amplification of microsporidial SSU-rDNA and were subsequently confirmed to be Encephalitozoon intestinalis. Five of the samples allowed for amplification of Cyclospora 18S-rDNA; three of these were confirmed to be Cyclospora cayetanesis while two could not be identified because of inadequate sequence information. Thus, this study represents the first confirmed identification of Cyclospora cayetanesis and Encephalitozoon intestinalis in source water used for consumption. The fact that the waters tested may be used for human consumption indicates that these emerging protozoa may be transmitted by ingestion of contaminated water.

  15. Use of Lambda Phage DNA as a Hybrid Internal Control in a PCR-Enzyme Immunoassay To Detect Chlamydia pneumoniae

    PubMed Central

    Pham, Dien G.; Madico, Guillermo E.; Quinn, Thomas C.; Enzler, Mark J.; Smith, Thomas F.; Gaydos, Charlotte A.

    1998-01-01

    An inherent problem in the diagnostic PCR assay is the presence of ill-defined inhibitors of amplification which may cause false-negative results. Addition of an amplifiable fragment of foreign DNA in the PCR to serve as a hybrid internal control (HIC) would allow for a simple way to identify specimens containing inhibitors. Two oligonucleotide hybrid primers were synthesized to contain nucleic acid sequences of the Chlamydia pneumoniae 16S rRNA primers in a position flanking two primers that target the sequences of a 650-bp lambda phage DNA segment. By using the hybrid primers, hybrid DNA comprising a large sequence of lambda phage DNA flanked by short pieces of chlamydia DNA was subsequently generated by PCR, cloned into a plasmid vector, and purified. Plasmids containing the hybrid DNA were diluted and used as a HIC by adding them to each C. pneumoniae PCR test. Consequently, C. pneumoniae primers were able to amplify both chlamydia DNA and the HIC DNA. The production of a 689-bp HIC DNA band on an acrylamide gel indicated that the specimen contained no inhibitors and that internal conditions were compatible with PCR. Subsequently, a biotinylated RNA probe for the HIC was transcribed from a nested sequence of the HIC and was used for its hybridization. Detection of the HIC DNA-RNA hybrid was achieved by enzyme immunoassay (EIA). This PCR-EIA system with a HIC was initially tested with 12 previously PCR-positive and 14 previously PCR-negative specimens. Of the 12 PCR-positive specimens, 11 were reconfirmed as positive; 1 had a negative HIC value, indicating inhibition. Of the 14 previously PCR-negative specimens, 13 were confirmed as true negative; 1 had a negative HIC value, indicating inhibition. The assay was then used with 237 nasopharyngeal specimens from patients with pneumonia. Twenty-one of 237 (8.9%) were positive for C. pneumoniae, and 42 (17.7%) were found to inhibit the PCR. Specimens showing inhibitory activity were diluted 1:10 and were retested. Ten specimens were still inhibitory to the PCR and required further DNA purification. No additional positive samples were detected and 3 nasopharyngeal specimens remained inhibitory to PCR. Coamplification of a HIC DNA can help confirm true-negative PCR results by ruling out the presence of inhibitors of DNA amplification. PMID:9650936

  16. Development and cross-species/genera transferability of microsatellite markers discovered using 454 genome sequencing in chokecherry (Prunus virginiana L.).

    PubMed

    Wang, Hongxia; Walla, James A; Zhong, Shaobin; Huang, Danqiong; Dai, Wenhao

    2012-11-01

    Chokecherry (Prunus virginiana L.) (2n = 4x = 32) is a unique Prunus species for both genetics and disease-resistance research due to its tetraploid nature and X-disease resistance. However, no genetic and genomic information on chokecherry is available. A partial chokecherry genome was sequenced using Roche 454 sequencing technology. A total of 145,094 reads covering 4.8 Mbp of the chokecherry genome were generated and 15,113 contigs were assembled, of which 11,675 contigs were larger than 100 bp in size. A total of 481 SSR loci were identified from 234 (out of 11,675) contigs and 246 polymerase chain reaction (PCR) primer pairs were designed. Of 246 primers, 212 (86.2 %) effectively produced amplification from the genomic DNA of chokecherry. All 212 amplifiable chokecherry primers were used to amplify genomic DNA from 11 other rosaceous species (sour cherry, sweet cherry, black cherry, peach, apricot, plum, apple, crabapple, pear, juneberry, and raspberry). Thus, chokecherry SSR primers can be transferable across Prunus species and other rosaceous species. An average of 63.2 and 58.7 % of amplifiable chokecherry primers amplified DNA from cherry and other Prunus species, respectively, while 47.2 % of amplifiable chokecherry primers amplified DNA from other rosaceous species. Using random genome sequence data generated from next-generation sequencing technology to identify microsatellite loci appears to be rapid and cost-efficient, particularly for species with no sequence information available. Sequence information and confirmed transferability of the identified chokecherry SSRs among species will be valuable for genetic research in Prunus and other rosaceous species. Key message A total of 246 SSR primers were identified from chokecherry genome sequences. Of which, 212 were confirmed amplifiable both in chokecherry and other 11 other rosaceous species.

  17. PCR amplification and DNA sequencing of Demodex injai from otic secretions of a dog.

    PubMed

    Milosevic, Milivoj A; Frank, Linda A; Brahmbhatt, Rupal A; Kania, Stephen A

    2013-04-01

    The identification of Demodex mites from dogs is usually based on morphology and location. Mites with uncharacteristic features or from unusual locations, hosts or disease manifestations could represent new species not previously described; however, this is difficult to determine based on morphology alone. The goal of this study was to identify and confirm Demodex injai in association with otitis externa in a dog using PCR amplification and DNA sequencing. Otic samples were obtained from a beagle in which a long-bodied Demodex mite was identified. For comparison, Demodex mite samples were collected from a swab and scraping of the dorsal skin of a wire-haired fox terrier and an otic sample from a dog with generalized and otic demodicosis. To identify the Demodex mite, DNA was extracted, and 16S rRNA was amplified by PCR, sequenced and compared with Demodex sequences available in public databases and from separate samples morphologically diagnosed as D. injai and Demodex canis. PCR amplification of the long-bodied mite rRNA DNA obtained from otic samples was approximately 330 bp and was identical to that from the mite morphologically identified as D. injai obtained from the dorsal skin of a dog. Furthermore, the examined mite did not have any significant homology to any of the reported genes from Demodex spp. These results confirmed that the demodex mites in this case were D. injai. © 2013 The Authors. Veterinary Dermatology © 2013 ESVD and ACVD.

  18. Identifying active foraminifera in the Sea of Japan using metatranscriptomic approach

    NASA Astrophysics Data System (ADS)

    Lejzerowicz, Franck; Voltsky, Ivan; Pawlowski, Jan

    2013-02-01

    Metagenetics represents an efficient and rapid tool to describe environmental diversity patterns of microbial eukaryotes based on ribosomal DNA sequences. However, the results of metagenetic studies are often biased by the presence of extracellular DNA molecules that are persistent in the environment, especially in deep-sea sediment. As an alternative, short-lived RNA molecules constitute a good proxy for the detection of active species. Here, we used a metatranscriptomic approach based on RNA-derived (cDNA) sequences to study the diversity of the deep-sea benthic foraminifera and compared it to the metagenetic approach. We analyzed 257 ribosomal DNA and cDNA sequences obtained from seven sediments samples collected in the Sea of Japan at depths ranging from 486 to 3665 m. The DNA and RNA-based approaches gave a similar view of the taxonomic composition of foraminiferal assemblage, but differed in some important points. First, the cDNA dataset was dominated by sequences of rotaliids and robertiniids, suggesting that these calcareous species, some of which have been observed in Rose Bengal stained samples, are the most active component of foraminiferal community. Second, the richness of monothalamous (single-chambered) foraminifera was particularly high in DNA extracts from the deepest samples, confirming that this group of foraminifera is abundant but not necessarily very active in the deep-sea sediments. Finally, the high divergence of undetermined sequences in cDNA dataset indicate the limits of our database and lack of knowledge about some active but possibly rare species. Our study demonstrates the capability of the metatranscriptomic approach to detect active foraminiferal species and prompt its use in future high-throughput sequencing-based environmental surveys.

  19. Escaping introns in COI through cDNA barcoding of mushrooms: Pleurotus as a test case.

    PubMed

    Avin, Farhat A; Subha, Bhassu; Tan, Yee-Shin; Braukmann, Thomas W A; Vikineswary, Sabaratnam; Hebert, Paul D N

    2017-09-01

    DNA barcoding involves the use of one or more short, standardized DNA fragments for the rapid identification of species. A 648-bp segment near the 5' terminus of the mitochondrial cytochrome c oxidase subunit I (COI) gene has been adopted as the universal DNA barcode for members of the animal kingdom, but its utility in mushrooms is complicated by the frequent occurrence of large introns. As a consequence, ITS has been adopted as the standard DNA barcode marker for mushrooms despite several shortcomings. This study employed newly designed primers coupled with cDNA analysis to examine COI sequence diversity in six species of Pleurotus and compared these results with those for ITS. The ability of the COI gene to discriminate six species of Pleurotus , the commonly cultivated oyster mushroom, was examined by analysis of cDNA. The amplification success, sequence variation within and among species, and the ability to design effective primers was tested. We compared ITS sequences to their COI cDNA counterparts for all isolates. ITS discriminated between all six species, but some sequence results were uninterpretable, because of length variation among ITS copies. By comparison, a complete COI sequences were recovered from all but three individuals of Pleurotus giganteus where only the 5' region was obtained. The COI sequences permitted the resolution of all species when partial data was excluded for P. giganteus . Our results suggest that COI can be a useful barcode marker for mushrooms when cDNA analysis is adopted, permitting identifications in cases where ITS cannot be recovered or where it offers higher resolution when fresh tissue is. The suitability of this approach remains to be confirmed for other mushrooms.

  20. Nanoliter reactors improve multiple displacement amplification of genomes from single cells.

    PubMed

    Marcy, Yann; Ishoey, Thomas; Lasken, Roger S; Stockwell, Timothy B; Walenz, Brian P; Halpern, Aaron L; Beeson, Karen Y; Goldberg, Susanne M D; Quake, Stephen R

    2007-09-01

    Since only a small fraction of environmental bacteria are amenable to laboratory culture, there is great interest in genomic sequencing directly from single cells. Sufficient DNA for sequencing can be obtained from one cell by the Multiple Displacement Amplification (MDA) method, thereby eliminating the need to develop culture methods. Here we used a microfluidic device to isolate individual Escherichia coli and amplify genomic DNA by MDA in 60-nl reactions. Our results confirm a report that reduced MDA reaction volume lowers nonspecific synthesis that can result from contaminant DNA templates and unfavourable interaction between primers. The quality of the genome amplification was assessed by qPCR and compared favourably to single-cell amplifications performed in standard 50-microl volumes. Amplification bias was greatly reduced in nanoliter volumes, thereby providing a more even representation of all sequences. Single-cell amplicons from both microliter and nanoliter volumes provided high-quality sequence data by high-throughput pyrosequencing, thereby demonstrating a straightforward route to sequencing genomes from single cells.

  1. Molecular characterization of Hepatozoon sp. from Brazilian dogs and its phylogenetic relationship with other Hepatozoon spp.

    PubMed

    Forlano, M D; Teixeira, K R S; Scofield, A; Elisei, C; Yotoko, K S C; Fernandes, K R; Linhares, G F C; Ewing, S A; Massard, C L

    2007-04-10

    To characterize phylogenetically the species which causes canine hepatozoonosis at two rural areas of Rio de Janeiro State, Brazil, we used universal or Hepatozoon spp. primer sets for the 18S SSU rRNA coding region. DNA extracts were obtained from blood samples of thirteen dogs naturally infected, from four experimentally infected, and from five puppies infected by vertical transmission from a dam, that was experimentally infected. DNA of sporozoites of Hepatozoon americanum was used as positive control. The amplification of DNA extracts from blood of dogs infected with sporozoites of Hepatozoon spp. was observed in the presence of primers to 18S SSU rRNA gene of Hepatozoon spp., whereas DNA of H. americanum sporozoites was amplified in the presence of either universal or Hepatozoon spp.-specific primer sets; the amplified products were approximately 600bp in size. Cloned PCR products obtained from DNA extracts of blood from two dogs experimentally infected with Hepatozoon sp. were sequenced. The consensus sequence, derived from six sequence data sets, were blasted against sequences of 18S SSU rRNA of Hepatozoon spp. available at GenBank and aligned to homologous sequences to perform the phylogenetic analysis. This analysis clearly showed that our sequence clustered, independently of H. americanum sequences, within a group comprising other Hepatozoon canis sequences. Our results confirmed the hypothesis that the agent causing hepatozoonosis in the areas studied in Brazil is H. canis, supporting previous reports that were based on morphological and morphometric analyses.

  2. Molecular studies on larvae of Pseudoterranova parasite of Trichiurus lepturus Linnaeus, 1758 and Pomatomus saltatrix (Linnaeus, 1766) off Brazilian waters.

    PubMed

    Borges, Juliana N; Cunha, Luiz F G; Miranda, Daniele F; Monteiro-Neto, Cassiano; Santos, Cláudia P

    2015-12-01

    Pseudoterranova larvae parasitizing cutlassfish Trichiurus lepturus and bluefish Pomatomus saltatrix from Southwest Atlantic coast of Brazil were studied in this work by morphological, ultrastructural and molecular approaches. The genetic analysis were performed for the ITS2 intergenic region specific for Pseudoterranova decipiens, the partial 28S (LSU) of ribosomal DNA and the mtDNA cox-1 region. We obtained results for the 28S region and mtDNA cox-1 that was amplified using the polymerase chain reaction and sequenced to evaluate the phylogenetic relationships between sequences of this study and sequences from the GenBank. The morphological profile indicated that all the nine specimens collected from both fish were L3 larvae of Pseudoterranova sp. The genetic profile confirmed the generic level but due to the absence of similar sequences for adult parasites on GenBank for the regions amplifyied, it was not possible to identify them to the species level. The sequences obtained presented 89% of similarity with Pseudoterranova decipiens (28S sequences) and Contracaecum osculatum B (mtDNA cox-1). The low similarity allied to the fact that the amplification with the specific primer for P. decipiens didn't occur, lead us to conclude that our sequences don't belong to P. decipiens complex.

  3. The DNA-encoded nucleosome organization of a eukaryotic genome.

    PubMed

    Kaplan, Noam; Moore, Irene K; Fondufe-Mittendorf, Yvonne; Gossett, Andrea J; Tillo, Desiree; Field, Yair; LeProust, Emily M; Hughes, Timothy R; Lieb, Jason D; Widom, Jonathan; Segal, Eran

    2009-03-19

    Nucleosome organization is critical for gene regulation. In living cells this organization is determined by multiple factors, including the action of chromatin remodellers, competition with site-specific DNA-binding proteins, and the DNA sequence preferences of the nucleosomes themselves. However, it has been difficult to estimate the relative importance of each of these mechanisms in vivo, because in vivo nucleosome maps reflect the combined action of all influencing factors. Here we determine the importance of nucleosome DNA sequence preferences experimentally by measuring the genome-wide occupancy of nucleosomes assembled on purified yeast genomic DNA. The resulting map, in which nucleosome occupancy is governed only by the intrinsic sequence preferences of nucleosomes, is similar to in vivo nucleosome maps generated in three different growth conditions. In vitro, nucleosome depletion is evident at many transcription factor binding sites and around gene start and end sites, indicating that nucleosome depletion at these sites in vivo is partly encoded in the genome. We confirm these results with a micrococcal nuclease-independent experiment that measures the relative affinity of nucleosomes for approximately 40,000 double-stranded 150-base-pair oligonucleotides. Using our in vitro data, we devise a computational model of nucleosome sequence preferences that is significantly correlated with in vivo nucleosome occupancy in Caenorhabditis elegans. Our results indicate that the intrinsic DNA sequence preferences of nucleosomes have a central role in determining the organization of nucleosomes in vivo.

  4. Amplification of Mitochondrial DNA for detection of Plasmodiumvivax in Balochistan.

    PubMed

    Shahwani, Muhammad Naeem; Nisar, Samia; Aleem, Abdul; Panezai, Marina; Afridi, Sarwat; Malik, Shaukat Iqbal

    2017-05-01

    To access a new step using PCR to amplify the targeted mtDNA sequence for detecting specifically Plasmodium vivax and its co-infections, false positive and false negative results with Plasmodium falciparum. In this study we have standardized a new technical approach in which the target mitochondrial DNA sequence (mtDNA) was amplified by using a PCR technique as a tool to detect Plasmodium spp. Species specific primers were designed to hybridize with cytochrome c oxidase gene of P. vivax (cox I) and P. falciparum (cox III). Two hundred blood samples were collected on the basis of clinical symptoms which were initially examined through microscopic analysis after preparing Giemsa stained thick and thin blood smears. Afterwards genomic DNA was extracted from all samples and was then subjected to PCR amplification by using species specific primers and amplified segments were sequenced for confirmation of results. One-hundred and thirty-two blood samples were detected as positive for malaria by PCR, out of which 64 were found to be positive by PCR and 53 by both microscopy and PCR for P.vivax infection. Nine samples were found to be false negative, one P.vivax mono infection was declared as co infection by PCR and 3 samples identified as having P.falciparum gametes were confirmed as P.vivax by PCR amplification. Sensitivity and specificity were found to be 85% and 92% respectively. Results obtained through PCR method were comparatively better and reliable than microscopy.

  5. Phylogenetic relationships in Demodex mites (Acari: Demodicidae) based on mitochondrial 16S rDNA partial sequences.

    PubMed

    Zhao, Ya-E; Wu, Li-Ping

    2012-09-01

    To confirm phylogenetic relationships in Demodex mites based on mitochondrial 16S rDNA partial sequences, mtDNA 16S partial sequences of ten isolates of three Demodex species from China were amplified, recombined, and sequenced and then analyzed with two Demodex folliculorum isolates from Spain. Lastly, genetic distance was computed, and phylogenetic tree was reconstructed. MEGA 4.0 analysis showed high sequence identity among 16S rDNA partial sequences of three Demodex species, which were 95.85 % in D. folliculorum, 98.53 % in Demodex canis, and 99.71 % in Demodex brevis. The divergence, genetic distance, and transition/transversions of the three Demodex species reached interspecies level, whereas there was no significant difference of the divergence (1.1 %), genetic distance (0.011), and transition/transversions (3/1) of the two geographic D. folliculorum isolates (Spain and China). Phylogenetic trees reveal that the three Demodex species formed three separate branches of one clade, where D. folliculorum and D. canis gathered first, and then gathered with D. brevis. The two Spain and five China D. folliculorum isolates did not form sister clades. In conclusion, 16S mtDNA are suitable for phylogenetic relationship analysis in low taxa (genus or species), but not for intraspecies determination of Demodex. The differentiation among the three Demodex species has reached interspecies level.

  6. Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense

    PubMed Central

    Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

    2013-01-01

    An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10−9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense. PMID:25587406

  7. DEPPDB - DNA electrostatic potential properties database. Electrostatic properties of genome DNA elements.

    PubMed

    Osypov, Alexander A; Krutinin, Gleb G; Krutinina, Eugenia A; Kamzolova, Svetlana G

    2012-04-01

    Electrostatic properties of genome DNA are important to its interactions with different proteins, in particular, related to transcription. DEPPDB - DNA Electrostatic Potential (and other Physical) Properties Database - provides information on the electrostatic and other physical properties of genome DNA combined with its sequence and annotation of biological and structural properties of genomes and their elements. Genomes are organized on taxonomical basis, supporting comparative and evolutionary studies. Currently, DEPPDB contains all completely sequenced bacterial, viral, mitochondrial, and plastids genomes according to the NCBI RefSeq, and some model eukaryotic genomes. Data for promoters, regulation sites, binding proteins, etc., are incorporated from established DBs and literature. The database is complemented by analytical tools. User sequences calculations are available. Case studies discovered electrostatics complementing DNA bending in E.coli plasmid BNT2 promoter functioning, possibly affecting host-environment metabolic switch. Transcription factors binding sites gravitate to high potential regions, confirming the electrostatics universal importance in protein-DNA interactions beyond the classical promoter-RNA polymerase recognition and regulation. Other genome elements, such as terminators, also show electrostatic peculiarities. Most intriguing are gene starts, exhibiting taxonomic correlations. The necessity of the genome electrostatic properties studies is discussed.

  8. A novel chaos-based image encryption algorithm using DNA sequence operations

    NASA Astrophysics Data System (ADS)

    Chai, Xiuli; Chen, Yiran; Broyde, Lucie

    2017-01-01

    An image encryption algorithm based on chaotic system and deoxyribonucleic acid (DNA) sequence operations is proposed in this paper. First, the plain image is encoded into a DNA matrix, and then a new wave-based permutation scheme is performed on it. The chaotic sequences produced by 2D Logistic chaotic map are employed for row circular permutation (RCP) and column circular permutation (CCP). Initial values and parameters of the chaotic system are calculated by the SHA 256 hash of the plain image and the given values. Then, a row-by-row image diffusion method at DNA level is applied. A key matrix generated from the chaotic map is used to fuse the confused DNA matrix; also the initial values and system parameters of the chaotic system are renewed by the hamming distance of the plain image. Finally, after decoding the diffused DNA matrix, we obtain the cipher image. The DNA encoding/decoding rules of the plain image and the key matrix are determined by the plain image. Experimental results and security analyses both confirm that the proposed algorithm has not only an excellent encryption result but also resists various typical attacks.

  9. How good are indirect tests at detecting recombination in human mtDNA?

    PubMed

    White, Daniel James; Bryant, David; Gemmell, Neil John

    2013-07-08

    Empirical proof of human mitochondrial DNA (mtDNA) recombination in somatic tissues was obtained in 2004; however, a lack of irrefutable evidence exists for recombination in human mtDNA at the population level. Our inability to demonstrate convincingly a signal of recombination in population data sets of human mtDNA sequence may be due, in part, to the ineffectiveness of current indirect tests. Previously, we tested some well-established indirect tests of recombination (linkage disequilibrium vs. distance using D' and r(2), Homoplasy Test, Pairwise Homoplasy Index, Neighborhood Similarity Score, and Max χ(2)) on sequence data derived from the only empirically confirmed case of human mtDNA recombination thus far and demonstrated that some methods were unable to detect recombination. Here, we assess the performance of these six well-established tests and explore what characteristics specific to human mtDNA sequence may affect their efficacy by simulating sequence under various parameters with levels of recombination (ρ) that vary around an empirically derived estimate for human mtDNA (population parameter ρ = 5.492). No test performed infallibly under any of our scenarios, and error rates varied across tests, whereas detection rates increased substantially with ρ values > 5.492. Under a model of evolution that incorporates parameters specific to human mtDNA, including rate heterogeneity, population expansion, and ρ = 5.492, successful detection rates are limited to a range of 7-70% across tests with an acceptable level of false-positive results: the neighborhood similarity score incompatibility test performed best overall under these parameters. Population growth seems to have the greatest impact on recombination detection probabilities across all models tested, likely due to its impact on sequence diversity. The implications of our findings on our current understanding of mtDNA recombination in humans are discussed.

  10. How Good Are Indirect Tests at Detecting Recombination in Human mtDNA?

    PubMed Central

    White, Daniel James; Bryant, David; Gemmell, Neil John

    2013-01-01

    Empirical proof of human mitochondrial DNA (mtDNA) recombination in somatic tissues was obtained in 2004; however, a lack of irrefutable evidence exists for recombination in human mtDNA at the population level. Our inability to demonstrate convincingly a signal of recombination in population data sets of human mtDNA sequence may be due, in part, to the ineffectiveness of current indirect tests. Previously, we tested some well-established indirect tests of recombination (linkage disequilibrium vs. distance using D′ and r2, Homoplasy Test, Pairwise Homoplasy Index, Neighborhood Similarity Score, and Max χ2) on sequence data derived from the only empirically confirmed case of human mtDNA recombination thus far and demonstrated that some methods were unable to detect recombination. Here, we assess the performance of these six well-established tests and explore what characteristics specific to human mtDNA sequence may affect their efficacy by simulating sequence under various parameters with levels of recombination (ρ) that vary around an empirically derived estimate for human mtDNA (population parameter ρ = 5.492). No test performed infallibly under any of our scenarios, and error rates varied across tests, whereas detection rates increased substantially with ρ values > 5.492. Under a model of evolution that incorporates parameters specific to human mtDNA, including rate heterogeneity, population expansion, and ρ = 5.492, successful detection rates are limited to a range of 7−70% across tests with an acceptable level of false-positive results: the neighborhood similarity score incompatibility test performed best overall under these parameters. Population growth seems to have the greatest impact on recombination detection probabilities across all models tested, likely due to its impact on sequence diversity. The implications of our findings on our current understanding of mtDNA recombination in humans are discussed. PMID:23665874

  11. Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer).

    PubMed

    Chelomina, Galina N; Rozhkovan, Konstantin V; Voronova, Anastasia N; Burundukova, Olga L; Muzarok, Tamara I; Zhuravlev, Yuri N

    2016-04-01

    Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440-640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine.

  12. Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer)

    PubMed Central

    Chelomina, Galina N.; Rozhkovan, Konstantin V.; Voronova, Anastasia N.; Burundukova, Olga L.; Muzarok, Tamara I.; Zhuravlev, Yuri N.

    2015-01-01

    Background Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. Methods The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. Results In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440–640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. Conclusion This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine. PMID:27158239

  13. 'Candidatus pasteuria usgae' sp. nov., an obligate endoparasite of the phytoparasitic nematode Belonolaimus longicaudatus.

    PubMed

    Giblin-Davis, R M; Williams, D S; Bekal, S; Dickson, D W; Brito, J A; Becker, J O; Preston, J F

    2003-01-01

    Taxonomically relevant characteristics of a fastidiously Gram-positive, obligately endoparasitic prokaryote (strain S-1) that uses the phytoparasitic sting nematode Belonolaimus longicaudatus as its host are reviewed. 16S rDNA sequence similarity (> or = 93%) confirms its congeneric ranking with other Pasteuria species and strains from nematodes and cladocerans and corroborates morphological, morphometric and host range evidence suggesting a novel taxon. The 16S rDNA sequence of strain S-1 has greatest similarity (96%) to the 16S rDNA sequences of both Pasteuria penetrans from root-knot nematodes (Meloidogyne species) and the recently reported strain of Pasteuria isolated from the soybean cyst nematode Heterodera glycines. Because the obligately endoparasitic nature of prokaryotes in the genus Pasteuria prevents isolation of definitive type strains, strain S-1 is proposed as 'Candidatus Pasteuria usgae' sp. nov.

  14. p53 Specifically Binds Triplex DNA In Vitro and in Cells

    PubMed Central

    Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej

    2016-01-01

    Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175

  15. Microaspiration of esophageal gland cells and cDNA library construction for identifying parasitism genes of plant-parasitic nematodes.

    PubMed

    Hussey, Richard S; Huang, Guozhong; Allen, Rex

    2011-01-01

    Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.

  16. Comparative analysis of Campylobacter isolates from wild birds and chickens using MALDI-TOF MS, biochemical testing, and DNA sequencing.

    PubMed

    Lawton, Samantha J; Weis, Allison M; Byrne, Barbara A; Fritz, Heather; Taff, Conor C; Townsend, Andrea K; Weimer, Bart C; Mete, Aslı; Wheeler, Sarah; Boyce, Walter M

    2018-05-01

    Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) was compared to conventional biochemical testing methods and nucleic acid analyses (16S rDNA sequencing, hippurate hydrolysis gene testing, whole genome sequencing [WGS]) for species identification of Campylobacter isolates obtained from chickens ( Gallus gallus domesticus, n = 8), American crows ( Corvus brachyrhynchos, n = 17), a mallard duck ( Anas platyrhynchos, n = 1), and a western scrub-jay ( Aphelocoma californica, n = 1). The test results for all 27 isolates were in 100% agreement between MALDI-TOF MS, the combined results of 16S rDNA sequencing, and the hippurate hydrolysis gene PCR ( p = 0.0027, kappa = 1). Likewise, the identifications derived from WGS from a subset of 14 isolates were in 100% agreement with the MALDI-TOF MS identification. In contrast, biochemical testing misclassified 5 isolates of C. jejuni as C. coli, and 16S rDNA sequencing alone was not able to differentiate between C. coli and C. jejuni for 11 sequences ( p = 0.1573, kappa = 0.0857) when compared to MALDI-TOF MS and WGS. No agreement was observed between MALDI-TOF MS dendrograms and the phylogenetic relationships revealed by rDNA sequencing or WGS. Our results confirm that MALDI-TOF MS is a fast and reliable method for identifying Campylobacter isolates to the species level from wild birds and chickens, but not for elucidating phylogenetic relationships among Campylobacter isolates.

  17. XX/XY System of Sex Determination in the Geophilomorph Centipede Strigamia maritima

    PubMed Central

    Green, Jack E.; Dalíková, Martina; Sahara, Ken; Marec, František; Akam, Michael

    2016-01-01

    We show that the geophilomorph centipede Strigamia maritima possesses an XX/XY system of sex chromosomes, with males being the heterogametic sex. This is, to our knowledge, the first report of sex chromosomes in any geophilomorph centipede. Using the recently assembled Strigamia genome sequence, we identified a set of scaffolds differentially represented in male and female DNA sequence. Using quantitative real-time PCR, we confirmed that three candidate X chromosome-derived scaffolds are present at approximately twice the copy number in females as in males. Furthermore, we confirmed that six candidate Y chromosome-derived scaffolds contain male-specific sequences. Finally, using this molecular information, we designed an X chromosome-specific DNA probe and performed fluorescent in situ hybridization against mitotic and meiotic chromosome spreads to identify the Strigamia XY sex-chromosome pair cytologically. We found that the X and Y chromosomes are recognizably different in size during the early pachytene stage of meiosis, and exhibit incomplete and delayed pairing. PMID:26919730

  18. Biochemical Characterization of a Mycobacteriophage Derived DnaB Ortholog Reveals New Insight into the Evolutionary Origin of DnaB Helicases

    PubMed Central

    Bhowmik, Priyanka; Das Gupta, Sujoy K.

    2015-01-01

    The bacterial replicative helicases known as DnaB are considered to be members of the RecA superfamily. All members of this superfamily, including DnaB, have a conserved C- terminal domain, known as the RecA core. We unearthed a series of mycobacteriophage encoded proteins in which the RecA core domain alone was present. These proteins were phylogenetically related to each other and formed a distinct clade within the RecA superfamily. A mycobacteriophage encoded protein, Wildcat Gp80 that roots deep in the DnaB family, was found to possess a core domain having significant sequence homology (Expect value < 10-5) with members of this novel cluster. This indicated that Wildcat Gp80, and by extrapolation, other members of the DnaB helicase family, may have evolved from a single domain RecA core polypeptide belonging to this novel group. Biochemical investigations confirmed that Wildcat Gp80 was a helicase. Surprisingly, our investigations also revealed that a thioredoxin tagged truncated version of the protein in which the N-terminal sequences were removed was fully capable of supporting helicase activity, although its ATP dependence properties were different. DnaB helicase activity is thus, primarily a function of the RecA core although additional N-terminal sequences may be necessary for fine tuning its activity and stability. Based on sequence comparison and biochemical studies we propose that DnaB helicases may have evolved from single domain RecA core proteins having helicase activities of their own, through the incorporation of additional N-terminal sequences. PMID:26237048

  19. Molecular detection of fungal pathogens in clinical specimens by 18S rDNA high-throughput screening in comparison to ITS PCR and culture.

    PubMed

    Wagner, K; Springer, B; Pires, V P; Keller, P M

    2018-05-03

    The rising incidence of invasive fungal infections and the expanding spectrum of fungal pathogens makes early and accurate identification of the causative pathogen a daunting task. Diagnostics using molecular markers enable rapid identification of fungi, offer new insights into infectious disease dynamics, and open new possibilities for infectious disease control and prevention. We performed a retrospective study using clinical specimens (N = 233) from patients with suspected fungal infection previously subjected to culture and/or internal transcribed spacer (ITS) PCR. We used these specimens to evaluate a high-throughput screening method for fungal detection using automated DNA extraction (QIASymphony), fungal ribosomal small subunit (18S) rDNA RT-PCR and amplicon sequencing. Fungal sequences were compared with sequences from the curated, commercially available SmartGene IDNS database for pathogen identification. Concordance between 18S rDNA RT-PCR and culture results was 91%, and congruence between 18S rDNA RT-PCR and ITS PCR results was 94%. In addition, 18S rDNA RT-PCR and Sanger sequencing detected fungal pathogens in culture negative (N = 13) and ITS PCR negative specimens (N = 12) from patients with a clinically confirmed fungal infection. Our results support the use of the 18S rDNA RT-PCR diagnostic workflow for rapid and accurate identification of fungal pathogens in clinical specimens.

  20. B-DNA to Z-DNA structural transitions in the SV40 enhancer: stabilization of Z-DNA in negatively supercoiled DNA minicircles

    NASA Technical Reports Server (NTRS)

    Gruskin, E. A.; Rich, A.

    1993-01-01

    During replication and transcription, the SV40 control region is subjected to significant levels of DNA unwinding. There are three, alternating purine-pyrimidine tracts within this region that can adopt the Z-DNA conformation in response to negative superhelix density: a single copy of ACACACAT and two copies of ATGCATGC. Since the control region is essential for both efficient transcription and replication, B-DNA to Z-DNA transitions in these vital sequence tracts may have significant biological consequences. We have synthesized DNA minicircles to detect B-DNA to Z-DNA transitions in the SV40 enhancer, and to determine the negative superhelix density required to stabilize the Z-DNA. A variety of DNA sequences, including the entire SV40 enhancer and the two segments of the enhancer with alternating purine-pyrimidine tracts, were incorporated into topologically relaxed minicircles. Negative supercoils were generated, and the resulting topoisomers were resolved by electrophoresis. Using an anti-Z-DNA Fab and an electrophoretic mobility shift assay, Z-DNA was detected in the enhancer-containing minicircles at a superhelix density of -0.05. Fab saturation binding experiments demonstrated that three, independent Z-DNA tracts were stabilized in the supercoiled minicircles. Two other minicircles, each with one of the two alternating purine-pyrimidine tracts, also contained single Z-DNA sites. These results confirm the identities of the Z-DNA-forming sequences within the control region. Moreover, the B-DNA to Z-DNA transitions were detected at superhelix densities observed during normal replication and transcription processes in the SV40 life cycle.

  1. Strong spurious transcription likely contributes to DNA insert bias in typical metagenomic clone libraries.

    PubMed

    Lam, Kathy N; Charles, Trevor C

    2015-01-01

    Clone libraries provide researchers with a powerful resource to study nucleic acid from diverse sources. Metagenomic clone libraries in particular have aided in studies of microbial biodiversity and function, and allowed the mining of novel enzymes. Libraries are often constructed by cloning large inserts into cosmid or fosmid vectors. Recently, there have been reports of GC bias in fosmid metagenomic libraries, and it was speculated to be a result of fragmentation and loss of AT-rich sequences during cloning. However, evidence in the literature suggests that transcriptional activity or gene product toxicity may play a role. To explore possible mechanisms responsible for sequence bias in clone libraries, we constructed a cosmid library from a human microbiome sample and sequenced DNA from different steps during library construction: crude extract DNA, size-selected DNA, and cosmid library DNA. We confirmed a GC bias in the final cosmid library, and we provide evidence that the bias is not due to fragmentation and loss of AT-rich sequences but is likely occurring after DNA is introduced into Escherichia coli. To investigate the influence of strong constitutive transcription, we searched the sequence data for promoters and found that rpoD/σ(70) promoter sequences were underrepresented in the cosmid library. Furthermore, when we examined the genomes of taxa that were differentially abundant in the cosmid library relative to the original sample, we found the bias to be more correlated with the number of rpoD/σ(70) consensus sequences in the genome than with simple GC content. The GC bias of metagenomic libraries does not appear to be due to DNA fragmentation. Rather, analysis of promoter sequences provides support for the hypothesis that strong constitutive transcription from sequences recognized as rpoD/σ(70) consensus-like in E. coli may lead to instability, causing loss of the plasmid or loss of the insert DNA that gives rise to the transcription. Despite widespread use of E. coli to propagate foreign DNA in metagenomic libraries, the effects of in vivo transcriptional activity on clone stability are not well understood. Further work is required to tease apart the effects of transcription from those of gene product toxicity.

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Damian, Luminita, E-mail: luminitadamian@microcal.eu.com; Universite de Toulouse, UPS, IPBS, F-31077 Toulouse; IUB, School of Engineering and Science, D-28727 Bremen

    Is single-strand DNA translatable? Since the 60s, the question still remains whether or not DNA could be directly translated into protein. Some discrepancies in the results were reported about functional translation of single-strand DNA but all results converged on a similar behavior of RNA and ssDNA in the initiation step. Isothermal Titration Calorimetry method was used to determine thermodynamic constants of interaction between single-strand DNA and S30 extract of Escherichia coli. Our results showed that the binding was not affected by the nature of the template tested and the dissociation constants were in the same range when ssDNA (K{sub d}more » = 3.62 {+-} 2.1 x 10{sup -8} M) or the RNA corresponding sequence (K{sub d} = 2.7 {+-} 0.82 x 10{sup -8} M) bearing SD/ATG sequences were used. The binding specificity was confirmed by antibiotic interferences which block the initiation complex formation. These results suggest that the limiting step in translation of ssDNA is the elongation process.« less

  3. Parasitological Confirmation and Analysis of Leishmania Diversity in Asymptomatic and Subclinical Infection following Resolution of Cutaneous Leishmaniasis.

    PubMed

    Rosales-Chilama, Mariana; Gongora, Rafael E; Valderrama, Liliana; Jojoa, Jimena; Alexander, Neal; Rubiano, Luisa C; Cossio, Alexandra; Adams, Emily R; Saravia, Nancy G; Gomez, María Adelaida

    2015-12-01

    The contribution of individuals with subclinical infection to the transmission and endemicity of cutaneous leishmaniasis (CL) is unknown. Immunological evidence of exposure to Leishmania in residents of endemic areas has been the basis for defining the human population with asymptomatic infection. However, parasitological confirmation of subclinical infection is lacking. We investigated the presence and viability of Leishmania in blood and non-invasive mucosal tissue samples from individuals with immunological evidence of subclinical infection in endemic areas for CL caused by Leishmania (Viannia) in Colombia. Detection of Leishmania kDNA was conducted by PCR-Southern Blot, and parasite viability was confirmed by amplification of parasite 7SLRNA gene transcripts. A molecular tool for genetic diversity analysis of parasite populations causing persistent subclinical infection based on PCR amplification and sequence analysis of an 82bp region between kDNA conserved blocks 1 and 2 was developed. Persistent Leishmania infection was demonstrated in 40% (46 of 114) of leishmanin skin test (LST) positive individuals without active disease; parasite viability was established in 59% of these (27 of 46; 24% of total). Parasite burden quantified from circulating blood monocytes, nasal, conjunctival or tonsil mucosal swab samples was comparable, and ranged between 0.2 to 22 parasites per reaction. kDNA sequences were obtained from samples from 2 individuals with asymptomatic infection and from 26 with history of CL, allowing genetic distance analysis that revealed diversity among sequences and clustering within the L. (Viannia) subgenus. Our results provide parasitological confirmation of persistent infection among residents of endemic areas of L. (Viannia) transmission who have experienced asymptomatic infection or recovered from CL, revealing a reservoir of infection that potentially contributes to the endemicity and transmission of disease. kDNA genotyping establishes proof-of-principle of the feasibility of genetic diversity analysis in previously inaccessible and unexplored parasite populations in subclinically infected individuals.

  4. Biochip-Based Detection of KRAS Mutation in Non-Small Cell Lung Cancer

    PubMed Central

    Kriegshäuser, Gernot; Fabjani, Gerhild; Ziegler, Barbara; Zöchbauer-Müller, Sabine; End, Adelheid; Zeillinger, Robert

    2011-01-01

    This study is aimed at evaluating the potential of a biochip assay to sensitively detect KRAS mutation in DNA from non-small cell lung cancer (NSCLC) tissue samples. The assay covers 10 mutations in codons 12 and 13 of the KRAS gene, and is based on mutant-enriched PCR followed by reverse-hybridization of biotinylated amplification products to an array of sequence-specific probes immobilized on the tip of a rectangular plastic stick (biochip). Biochip hybridization identified 17 (21%) samples to carry a KRAS mutation of which 16 (33%) were adenocarcinomas and 1 (3%) was a squamous cell carcinoma. All mutations were confirmed by DNA sequencing. Using 10 ng of starting DNA, the biochip assay demonstrated a detection limit of 1% mutant sequence in a background of wild-type DNA. Our results suggest that the biochip assay is a sensitive alternative to protocols currently in use for KRAS mutation testing on limited quantity samples. PMID:22272089

  5. Efficient generation of transgenic cattle using the DNA transposon and their analysis by next-generation sequencing

    PubMed Central

    Yum, Soo-Young; Lee, Song-Jeon; Kim, Hyun-Min; Choi, Woo-Jae; Park, Ji-Hyun; Lee, Won-Wu; Kim, Hee-Soo; Kim, Hyeong-Jong; Bae, Seong-Hun; Lee, Je-Hyeong; Moon, Joo-Yeong; Lee, Ji-Hyun; Lee, Choong-Il; Son, Bong-Jun; Song, Sang-Hoon; Ji, Su-Min; Kim, Seong-Jin; Jang, Goo

    2016-01-01

    Here, we efficiently generated transgenic cattle using two transposon systems (Sleeping Beauty and Piggybac) and their genomes were analyzed by next-generation sequencing (NGS). Blastocysts derived from microinjection of DNA transposons were selected and transferred into recipient cows. Nine transgenic cattle have been generated and grown-up to date without any health issues except two. Some of them expressed strong fluorescence and the transgene in the oocytes from a superovulating one were detected by PCR and sequencing. To investigate genomic variants by the transgene transposition, whole genomic DNA were analyzed by NGS. We found that preferred transposable integration (TA or TTAA) was identified in their genome. Even though multi-copies (i.e. fifteen) were confirmed, there was no significant difference in genome instabilities. In conclusion, we demonstrated that transgenic cattle using the DNA transposon system could be efficiently generated, and all those animals could be a valuable resource for agriculture and veterinary science. PMID:27324781

  6. Evidence for recombination in scorpion mitochondrial DNA (Scorpiones: Buthidae).

    PubMed

    Gantenbein, Benjamin; Fet, Victor; Gantenbein-Ritter, Iris A; Balloux, François

    2005-04-07

    There has been very little undisputed evidence for recombination in animal mitochondrial DNA (mtDNA) provided so far. Previous unpublished results suggestive of mtDNA recombination in the scorpion family Buthidae, together with cytological evidence for a unique mechanism of mitochondrial fusion in that family, prompted us to investigate this group in more details. First, we sequenced the complete mtDNA genome of Mesobuthus gibbosus, and chose two genes opposing each other (16S and coxI). We then sequenced 150 individuals from the natural populations of four species of Buthidae (Old World genera Buthus and Mesobuthus). We observed strong evidence for widespread recombination through highly significant negative correlations between linkage disequilibrium and physical distance in three out of four species. The evidence is further confirmed when using five other tests for recombination and by the presence of a high amount of homoplasy in phylogenetic trees.

  7. Functional blaKPC-2 sequences are present in United States beef cattle feces regardless of antibiotic use

    USDA-ARS?s Scientific Manuscript database

    Recently, using quantitative PCR (qPCR) we detected blaKPC-2 in metagenomic DNA (mgDNA) prepared from the feces of 36 lots beef cattle "raised without antibiotics" (RWA) and 36 lots raised "conventionally" (CONV). Since a small internal fragment of the blaKPC-2 gene was targeted we sought to confirm...

  8. Draft Genome Sequence of Mycobacterium boenickei CIP 107829.

    PubMed

    Bouam, Amar; Robert, Catherine; Croce, Olivier; Levasseur, Anthony; Drancourt, Michel

    2017-05-04

    Mycobacterium boenickei is a rapidly growing mycobacterium isolated for the first time from a leg wound in the United States. Its 6,506,908-bp draft genome exhibits a 66.77% G+C content, 6,279 protein-coding genes, and 59 predicted RNA genes. In silico DNA-DNA hybridization confirms its assignment to the Mycobacterium fortuitum complex. Copyright © 2017 Bouam et al.

  9. Reclassification of Lactobacillus kimchii and Lactobacillus bobalius as later subjective synonyms of Lactobacillus paralimentarius.

    PubMed

    Pang, Huili; Kitahara, Maki; Tan, Zhongfang; Wang, Yanping; Qin, Guangyong; Ohkuma, Moriya; Cai, Yimin

    2012-10-01

    Characterization and identification of strain CW 1 ( = JCM 17161) isolated from corn silage were performed. Strain CW 1 was a Gram-positive, catalase-negative and homofermentative rod that produced the DL-form of lactic acid. This strain exhibited more than 99.6% 16S rRNA gene sequence similarity and greater than 82% DNA-DNA reassociation with type strains of Lactobacillus kimchii, L. bobalius and L. paralimentarius. To clarify the taxonomic positions of these type strains, phenotypic characterization, 16S rRNA gene sequencing, ribotyping and DNA-DNA relatedness were examined. The three type strains displayed different L-arabinose, lactose, melibiose, melezitose, raffinose and N-acetyl-β-glucosaminidase fermentation patterns. Phylogenetic analysis showed that L. paralimentarius is a closer neighbour of L. kimchii and L. bobalius, sharing 99.5-99.9% 16S rRNA gene sequence similarity, which was confirmed by the high DNA-DNA relatedness (≥82%) between L. paralimentarius JCM 10415(T), L. bobalius JCM 16180(T) and L. kimchii JCM 10707(T). Therefore, it is proposed that L. kimchii and L. bobalius should be reclassified as later synonyms of L. paralimentarius.

  10. Mimosa caesalpiniifolia rhizobial isolates from different origins of the Brazilian Northeast.

    PubMed

    Martins, Paulo Geovani Silva; Junior, Mario Andrade Lira; Fracetto, Giselle Gomes Monteiro; da Silva, Maria Luiza Ribeiro Bastos; Vincentin, Rayssa Pereira; de Lyra, Maria do Carmo Catanho Pereira

    2015-04-01

    Biological nitrogen fixation from the legume-rhizobia symbiosis is one of the main sources of fixed nitrogen on land environments. Diazotrophic bacteria taxonomy has been substantially modified by the joint use of phenotypic, physiological and molecular aspects. Among these molecular tools, sequencing and genotyping of genomic regions such as 16S rDNA and repetitive conserved DNA regions have boosted the accuracy of species identification. This research is a phylogenetic study of diazotrophic bacteria from sabiá (Mimosa caesalpiniifolia Benth.), inoculated with soils from five municipalities of the Brazilian Northeast. After bacterial isolation and morphophysiological characterization, genotyping was performed using REP, ERIC and BOX oligonucleotides and 16S rDNA sequencing for genetic diversity identification. A 1.5b Kb fragment of the 16S rDNA was amplified from each isolate. Morphophysiological characterization of the 47 isolates created a dendrogram, where isolate PE-GR02 formed a monophyletic branch. The fingerprinting conducted with BOX, ERIC and REP shows distinct patterns, and their compilation created a dendrogram with diverse groups and, after blasting in GenBank, resulted in genetic identities ranging from 77 to 99 % with Burkholderia strains. The 16S rDNA phylogenetic tree constructed with these isolates and GenBank deposits of strains recommended for inoculant production confirm these isolates are distinct from the previously deposited strains, whereas isolates PE-CR02, PE-CR4, PE-CR07, PE-CR09 and PE-GE06 were the most distinct within the group. Morphophysiological characterization and BOX, ERIC and REP compilation enhanced the discrimination of the isolates, and the 16S rDNA sequences compared with GenBank confirmed the preference of Mimosa for Burkholderia diazotrophic bacteria.

  11. Isolation and Characterization of Burkholderia rinojensis sp. nov., a Non-Burkholderia cepacia Complex Soil Bacterium with Insecticidal and Miticidal Activities

    PubMed Central

    Fernandez, Lorena E.; Koivunen, Marja; Yang, April; Flor-Weiler, Lina; Marrone, Pamela G.

    2013-01-01

    Isolate A396, a bacterium isolated from a Japanese soil sample demonstrated strong insecticidal and miticidal activities in laboratory bioassays. The isolate was characterized through biochemical methods, fatty acid methyl ester (FAME) analysis, sequencing of 16S rRNA, multilocus sequence typing and analysis, and DNA-DNA hybridization. FAME analysis matched A396 to Burkholderia cenocepacia, but this result was not confirmed by 16S rRNA or DNA-DNA hybridization. 16S rRNA sequencing indicated closest matches with B. glumae and B. plantarii. DNA-DNA hybridization experiments with B. plantarii, B. glumae, B. multivorans, and B. cenocepacia confirmed the low genetic similarity (11.5 to 37.4%) with known members of the genus. PCR-based screening showed that A396 lacks markers associated with members of the B. cepacia complex. Bioassay results indicated two mechanisms of action: through ingestion and contact. The isolate effectively controlled beet armyworms (Spodoptera exigua; BAW) and two-spotted spider mites (Tetranychus urticae; TSSM). In diet overlay bioassays with BAW, 1% to 4% (vol/vol) dilution of the whole-cell broth caused 97% to 100% mortality 4 days postexposure, and leaf disc treatment bioassays attained 75% ± 22% mortality 3 days postexposure. Contact bioassays led to 50% larval mortality, as well as discoloration, stunting, and failure to molt. TSSM mortality reached 93% in treated leaf discs. Activity was maintained in cell-free supernatants and after heat treatment (60°C for 2 h), indicating that a secondary metabolite or excreted thermostable enzyme might be responsible for the activity. Based on these results, we describe the novel species Burkholderia rinojensis, a good candidate for the development of a biocontrol product against insect and mite pests. PMID:24096416

  12. Clarification of the Concept of Ganoderma orbiforme with High Morphological Plasticity

    PubMed Central

    Wang, Dong-Mei; Wu, Sheng-Hua; Yao, Yi-Jian

    2014-01-01

    Ganoderma has been considered a very difficult genus among the polypores to classify and is currently in a state of taxonomic chaos. In a study of Ganoderma collections including numerous type specimens, we found that six species namely G. cupreum, G. densizonatum, G. limushanense, G. mastoporum, G. orbiforme, G. subtornatum, and records of G. fornicatum from Mainland China and Taiwan are very similar to one another in basidiocarp texture, pilear cuticle structure, context color, pore color and basidiospore characteristics. Further, we sequenced the nrDNA ITS region (ITS1 and ITS2) and partial mtDNA SSU region of the studied materials, and performed phylogenetic analyses based on these sequence data. The nrDNA ITS sequence analysis results show that the eight nrDNA ITS sequences derived from this study have single-nucleotide polymorphisms in ITS1 and/or ITS2 at inter- and intra-individual levels. In the nrDNA ITS phylogenetic trees, all the sequences from this study are grouped together with those of G. cupreum and G. mastoporum retrieved from GenBank to form a distinct clade. The mtDNA SSU sequence analysis results reveal that the five mtDNA SSU sequences derived from this study are clustered together with those of G. cupreum retrieved from GenBank and also form a distinct clade in the mtDNA SSU phylogenetic trees. Based on morphological and molecular data, we conclude that the studied taxa are conspecific. Among the names assigned to this species, G. fornicatum given to Asian collections has nomenclatural priority over the others. However, the type of G. fornicatum from Brazil is probably lost and a modern description based on the type lacks. The identification of the Asian collections to G. fornicatum therefore cannot be confirmed. To the best of our knowledge, G. orbiforme is the earliest valid name for use. PMID:24875218

  13. Quick identification of acetic acid bacteria based on nucleotide sequences of the 16S-23S rDNA internal transcribed spacer region and of the PQQ-dependent alcohol dehydrogenase gene.

    PubMed

    Trcek, Janja

    2005-10-01

    Acetic acid bacteria (AAB) are well known for oxidizing different ethanol-containing substrates into various types of vinegar. They are also used for production of some biotechnologically important products, such as sorbose and gluconic acids. However, their presence is not always appreciated since certain species also spoil wine, juice, beer and fruits. To be able to follow AAB in all these processes, the species involved must be identified accurately and quickly. Because of inaccuracy and very time-consuming phenotypic analysis of AAB, the application of molecular methods is necessary. Since the pairwise comparison among the 16S rRNA gene sequences of AAB shows very high similarity (up to 99.9%) other DNA-targets should be used. Our previous studies showed that the restriction analysis of 16S-23S rDNA internal transcribed spacer region is a suitable approach for quick affiliation of an acetic acid bacterium to a distinct group of restriction types and also for quick identification of a potentially novel species of acetic acid bacterium (Trcek & Teuber 2002; Trcek 2002). However, with the exception of two conserved genes, encoding tRNAIle and tRNAAla, the sequences of 16S-23S rDNA are highly divergent among AAB species. For this reason we analyzed in this study a gene encoding PQQ-dependent ADH as a possible DNA-target. First we confirmed the expression of subunit I of PQQ-dependent ADH (AdhA) also in Asaia, the only genus of AAB which exhibits little or no ADH-activity. Further we analyzed the partial sequences of adhA among some representative species of the genera Acetobacter, Gluconobacter and Gluconacetobacter. The conserved and variable regions in these sequences made possible the construction of A. acetispecific oligonucleotide the specificity of which was confirmed in PCR-reaction using 45 well-defined strains of AAB as DNA-templates. The primer was also successfully used in direct identification of A. aceti from home made cider vinegar as well as for revealing the misclassification of strain IFO 3283 into the species A. aceti.

  14. Technical adequacy of bisulfite sequencing and pyrosequencing for detection of mitochondrial DNA methylation: Sources and avoidance of false-positive detection.

    PubMed

    Owa, Chie; Poulin, Matthew; Yan, Liying; Shioda, Toshi

    2018-01-01

    The existence of cytosine methylation in mammalian mitochondrial DNA (mtDNA) is a controversial subject. Because detection of DNA methylation depends on resistance of 5'-modified cytosines to bisulfite-catalyzed conversion to uracil, examined parameters that affect technical adequacy of mtDNA methylation analysis. Negative control amplicons (NCAs) devoid of cytosine methylation were amplified to cover the entire human or mouse mtDNA by long-range PCR. When the pyrosequencing template amplicons were gel-purified after bisulfite conversion, bisulfite pyrosequencing of NCAs did not detect significant levels of bisulfite-resistant cytosines (brCs) at ND1 (7 CpG sites) or CYTB (8 CpG sites) genes (CI95 = 0%-0.94%); without gel-purification, significant false-positive brCs were detected from NCAs (CI95 = 4.2%-6.8%). Bisulfite pyrosequencing of highly purified, linearized mtDNA isolated from human iPS cells or mouse liver detected significant brCs (~30%) in human ND1 gene when the sequencing primer was not selective in bisulfite-converted and unconverted templates. However, repeated experiments using a sequencing primer selective in bisulfite-converted templates almost completely (< 0.8%) suppressed brC detection, supporting the false-positive nature of brCs detected using the non-selective primer. Bisulfite-seq deep sequencing of linearized, gel-purified human mtDNA detected 9.4%-14.8% brCs for 9 CpG sites in ND1 gene. However, because all these brCs were associated with adjacent non-CpG brCs showing the same degrees of bisulfite resistance, DNA methylation in this mtDNA-encoded gene was not confirmed. Without linearization, data generated by bisulfite pyrosequencing or deep sequencing of purified mtDNA templates did not pass the quality control criteria. Shotgun bisulfite sequencing of human mtDNA detected extremely low levels of CpG methylation (<0.65%) over non-CpG methylation (<0.55%). Taken together, our study demonstrates that adequacy of mtDNA methylation analysis using methods dependent on bisulfite conversion needs to be established for each experiment, taking effects of incomplete bisulfite conversion and template impurity or topology into consideration.

  15. High density FTA plates serve as efficient long-term sample storage for HLA genotyping.

    PubMed

    Lange, V; Arndt, K; Schwarzelt, C; Boehme, I; Giani, A S; Schmidt, A H; Ehninger, G; Wassmuth, R

    2014-02-01

    Storage of dried blood spots (DBS) on high-density FTA(®) plates could constitute an appealing alternative to frozen storage. However, it remains controversial whether DBS are suitable for high-resolution sequencing of human leukocyte antigen (HLA) alleles. Therefore, we extracted DNA from DBS that had been stored for up to 4 years, using six different methods. We identified those extraction methods that recovered sufficient high-quality DNA for reliable high-resolution HLA sequencing. Further, we confirmed that frozen whole blood samples that had been stored for several years can be transferred to filter paper without compromising HLA genotyping upon extraction. Concluding, DNA derived from high-density FTA(®) plates is suitable for high-resolution HLA sequencing, provided that appropriate extraction protocols are employed. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. Reduced-median-network analysis of complete mitochondrial DNA coding-region sequences for the major African, Asian, and European haplogroups.

    PubMed

    Herrnstadt, Corinna; Elson, Joanna L; Fahy, Eoin; Preston, Gwen; Turnbull, Douglass M; Anderson, Christen; Ghosh, Soumitra S; Olefsky, Jerrold M; Beal, M Flint; Davis, Robert E; Howell, Neil

    2002-05-01

    The evolution of the human mitochondrial genome is characterized by the emergence of ethnically distinct lineages or haplogroups. Nine European, seven Asian (including Native American), and three African mitochondrial DNA (mtDNA) haplogroups have been identified previously on the basis of the presence or absence of a relatively small number of restriction-enzyme recognition sites or on the basis of nucleotide sequences of the D-loop region. We have used reduced-median-network approaches to analyze 560 complete European, Asian, and African mtDNA coding-region sequences from unrelated individuals to develop a more complete understanding of sequence diversity both within and between haplogroups. A total of 497 haplogroup-associated polymorphisms were identified, 323 (65%) of which were associated with one haplogroup and 174 (35%) of which were associated with two or more haplogroups. Approximately one-half of these polymorphisms are reported for the first time here. Our results confirm and substantially extend the phylogenetic relationships among mitochondrial genomes described elsewhere from the major human ethnic groups. Another important result is that there were numerous instances both of parallel mutations at the same site and of reversion (i.e., homoplasy). It is likely that homoplasy in the coding region will confound evolutionary analysis of small sequence sets. By a linkage-disequilibrium approach, additional evidence for the absence of human mtDNA recombination is presented here.

  17. Novel division level bacterial diversity in a Yellowstone hot spring.

    PubMed

    Hugenholtz, P; Pitulle, C; Hershberger, K L; Pace, N R

    1998-01-01

    A culture-independent molecular phylogenetic survey was carried out for the bacterial community in Obsidian Pool (OP), a Yellowstone National Park hot spring previously shown to contain remarkable archaeal diversity (S. M. Barns, R. E. Fundyga, M. W. Jeffries, and N. R. Page, Proc. Natl. Acad. Sci. USA 91:1609-1613, 1994). Small-subunit rRNA genes (rDNA) were amplified directly from OP sediment DNA by PCR with universally conserved or Bacteria-specific rDNA primers and cloned. Unique rDNA types among > 300 clones were identified by restriction fragment length polymorphism, and 122 representative rDNA sequences were determined. These were found to represent 54 distinct bacterial sequence types or clusters (> or = 98% identity) of sequences. A majority (70%) of the sequence types were affiliated with 14 previously recognized bacterial divisions (main phyla; kingdoms); 30% were unaffiliated with recognized bacterial divisions. The unaffiliated sequence types (represented by 38 sequences) nominally comprise 12 novel, division level lineages termed candidate divisions. Several OP sequences were nearly identical to those of cultivated chemolithotrophic thermophiles, including the hydrogen-oxidizing Calderobacterium and the sulfate reducers Thermodesulfovibrio and Thermodesulfobacterium, or belonged to monophyletic assemblages recognized for a particular type of metabolism, such as the hydrogen-oxidizing Aquificales and the sulfate-reducing delta-Proteobacteria. The occurrence of such organisms is consistent with the chemical composition of OP (high in reduced iron and sulfur) and suggests a lithotrophic base for primary productivity in this hot spring, through hydrogen oxidation and sulfate reduction. Unexpectedly, no archaeal sequences were encountered in OP clone libraries made with universal primers. Hybridization analysis of amplified OP DNA with domain-specific probes confirmed that the analyzed community rDNA from OP sediment was predominantly bacterial. These results expand substantially our knowledge of the extent of bacterial diversity and call into question the commonly held notion that Archaea dominate hydrothermal environments. Finally, the currently known extent of division level bacterial phylogenetic diversity is collated and summarized.

  18. Biomarker Discovery and Mechanistic Studies of Prostate Cancer using Targeted Proteomic Approaches

    DTIC Science & Technology

    2012-07-01

    basigin in Drosophila ) tightly regulates cytoskeleton rearrangement in Drosophila melanogaster [23]. Based on the present results and the existing...from OligoEngine according to the manufac- turer’s instruction. Plasmids were amplified in DH5a cell and confirmed by sequencing . Subconfluent cell...electrophoresis and the results are shown in Figure 1 (Panel C). The RT-PCR products were cloned and subjected to DNA sequenc - ing. The sequencing

  19. New progress in snake mitochondrial gene rearrangement.

    PubMed

    Chen, Nian; Zhao, Shujin

    2009-08-01

    To further understand the evolution of snake mitochondrial genomes, the complete mitochondrial DNA (mtDNA) sequences were determined for representative species from two snake families: the Many-banded krait, the Banded krait, the Chinese cobra, the King cobra, the Hundred-pace viper, the Short-tailed mamushi, and the Chain viper. Thirteen protein-coding genes, 22-23 tRNA genes, 2 rRNA genes, and 2 control regions were identified in these mtDNAs. Duplication of the control region and translocation of the tRNAPro gene were two notable features of the snake mtDNAs. These results from the gene rearrangement comparisons confirm the correctness of traditional classification schemes and validate the utility of comparing complete mtDNA sequences for snake phylogeny reconstruction.

  20. Paratylenchus shenzhenensis n. sp. (Nematoda: Paratylenchinae) from the rhizosphere soil of Anthurium andraeanum in China.

    PubMed

    Wang, Ke; Xie, Hui; Li, Yu; Xu, Chun-Ling; Yu, Lu; Wang, Dong-Wei

    2013-12-18

    Paratylenchus shenzhenensis n. sp. was collected from the rhizosphere soil of Anthurium andraeanum in Shenzhen, Guangdong Province, China. The new species is characterized by having a female with a small body (249-302 μm), well developed stylet (17-21 μm), rounded head with four submedian lobes and lip-region with a slight depression at the oral area, small post-vulval uterine sac with a few vestigial cells; male with body dorsally curved behind the cloacal opening, stylet absent, pharynx degenerate, prominent penial sheath; and juveniles with a stylet. It is morphologically similar to P. minutus. The internal transcribed spacer sequences of ribosomal DNA (ITS-rDNA) of the new species only have 72-73% identity with P. minutus, confirming its status as a separate species. The D2/D3 region of 28S ribosomal DNA (28S rDNA) and 18S small subunit ribosomal DNA (18S rDNA) from P. shenzhenensis n. sp. were also amplified and sequenced in this study. 

  1. Molecular identification and phylogenetic analysis of Wuchereria bancrofti from human blood samples in Egypt.

    PubMed

    Abdel-Shafi, Iman R; Shoieb, Eman Y; Attia, Samar S; Rubio, José M; Ta-Tang, Thuy-Huong; El-Badry, Ayman A

    2017-03-01

    Lymphatic filariasis (LF) is a serious vector-borne health problem, and Wuchereria bancrofti (W.b) is the major cause of LF worldwide and is focally endemic in Egypt. Identification of filarial infection using traditional morphologic and immunological criteria can be difficult and lead to misdiagnosis. The aim of the present study was molecular detection of W.b in residents in endemic areas in Egypt, sequence variance analysis, and phylogenetic analysis of W.b DNA. Collected blood samples from residents in filariasis endemic areas in five governorates were subjected to semi-nested PCR targeting repeated DNA sequence, for detection of W.b DNA. PCR products were sequenced; subsequently, a phylogenetic analysis of the obtained sequences was performed. Out of 300 blood samples, W.b DNA was identified in 48 (16%). Sequencing analysis confirmed PCR results identifying only W.b species. Sequence alignment and phylogenetic analysis indicated genetically distinct clusters of W.b among the study population. Study results demonstrated that the semi-nested PCR proved to be an effective diagnostic tool for accurate and rapid detection of W.b infections in nano-epidemics and is applicable for samples collected in the daytime as well as the night time. PCR products sequencing and phylogenitic analysis revealed three different nucleotide sequences variants. Further genetic studies of W.b in Egypt and other endemic areas are needed to distinguish related strains and the various ecological as well as drug effects exerted on them to support W.b elimination.

  2. Mycobacterium tuberculosis Infection of Domesticated Asian Elephants, Thailand

    PubMed Central

    Angkawanish, Taweepoke; Sirimalaisuwan, Anucha; Kaewsakhorn, Thattawan; Boonsri, Kittikorn; Rutten, Victor P.M.G.

    2010-01-01

    Four Asian elephants were confirmed to be infected with Mycobacterium tuberculosis by bacterial culture, other diagnostic procedures, and sequencing of 16S–23S rDNA internal transcribed spacer region, 16S rRNA, and gyrase B gene sequences. Genotyping showed that the infectious agents originated from 4 sources in Thailand. To identify infections, a combination of diagnostic assays is essential. PMID:21122228

  3. Genetic Diversity and Phylogenetic Analysis of South-East Asian Duck Populations Based on the mtDNA D-loop Sequences

    PubMed Central

    Sultana, H.; Seo, D. W.; Bhuiyan, M. S. A.; Choi, N. R.; Hoque, M. R.; Heo, K. N.; Lee, J. H.

    2016-01-01

    The maternally inherited mitochondrial DNA (mtDNA) D–loop region is widely used for exploring genetic relationships and for investigating the origin of various animal species. Currently, domestic ducks play an important role in animal protein supply. In this study, partial mtDNA D–loop sequences were obtained from 145 samples belonging to six South-East Asian duck populations and commercial duck population. All these populations were closely related to the mallard duck (Anas platyrhynchos), as indicated by their mean overall genetic distance. Sixteen nucleotide substitutions were identified in sequence analyses allowing the distinction of 28 haplotypes. Around 42.76% of the duck sequences were classified as Hap_02, which completely matched with Anas platyrhynchos duck species. The neighbor-joining phylogenetic tree also revealed that South-East Asian duck populations were closely related to Anas platyrhynchos. Network profiles were also traced using the 28 haplotypes. Overall, results showed that those duck populations D-loop haplotypes were shared between several duck breeds from Korea and Bangladesh sub continental regions. Therefore, these results confirmed that South-East Asian domestic duck populations have been domesticated from Anas platyrhynchos duck as the maternal origins. PMID:27004808

  4. Sequence-selective binding of C8-conjugated pyrrolobenzodiazepines (PBDs) to DNA.

    PubMed

    Basher, Mohammad A; Rahman, Khondaker Miraz; Jackson, Paul J M; Thurston, David E; Fox, Keith R

    2017-11-01

    DNA footprinting and melting experiments have been used to examine the sequence-specific binding of C8-conjugates of pyrrolobenzodiazepines (PBDs) and benzofused rings including benzothiophene and benzofuran, which are attached using pyrrole- or imidazole-containing linkers. The conjugates modulate the covalent attachment points of the PBDs, so that they bind best to guanines flanked by A/T-rich sequences on either the 5'- or 3'-side. The linker affects the binding, and pyrrole produces larger changes than imidazole. Melting studies with 14-mer oligonucleotide duplexes confirm covalent attachment of the conjugates, which show a different selectivity to anthramycin and reveal that more than one ligand molecule can bind to each duplex. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. [Hydrophidae identification through analysis on Cyt b gene barcode].

    PubMed

    Liao, Li-xi; Zeng, Ke-wu; Tu, Peng-fei

    2015-08-01

    Hydrophidae, one of the precious traditional Chinese medicines, is generally drily preserved to prevent corruption, but it is hard to identify the species of Hydrophidae through the appearance because of the change due to the drying process. The identification through analysis on gene barcode, a new technique in species identification, can avoid the problem. The gene barcodes of the 6 species of Hydrophidae like Lapemis hardwickii were aquired through DNA extraction and gene sequencing. These barcodes were then in sequence alignment and test the identification efficency by BLAST. Our results revealed that the barcode sequences performed high identification efficiency, and had obvious difference between intra- and inter-species. These all indicated that Cyt b DNA barcoding can confirm the Hydrophidae identification.

  6. Molecular genetic characterization of the RD-114 gene family of endogenous feline retroviral sequences.

    PubMed Central

    Reeves, R H; O'Brien, S J

    1984-01-01

    RD-114 is a replication-competent, xenotropic retrovirus which is homologous to a family of moderately repetitive DNA sequences present at ca. 20 copies in the normal cellular genome of domestic cats. To examine the extent and character of genomic divergence of the RD-114 gene family as well as to assess their positional association within the cat genome, we have prepared a series of molecular clones of endogenous RD-114 DNA segments from a genomic library of cat cellular DNA. Their restriction endonuclease maps were compared with each other as well as to that of the prototype-inducible RD-114 which was molecularly cloned from a chronically infected human cell line. The endogenous sequences analyzed were similar to each other in that they were colinear with RD-114 proviral DNA, were bounded by long terminal redundancies, and conserved many restriction sites in the gag and pol regions. However, the env regions of many of the sequences examined were substantially deleted. Several of the endogenous RD-114 genomes contained a novel envelope sequence which was unrelated to the env gene of the prototype RD-114 env gene but which, like RD-114 and endogenous feline leukemia virus provirus, was found only in species of the genus Felis, and not in other closely related Felidae genera. The endogenous RD-114 sequences each had a distinct cellular flank which indicates that these sequences are not tandem but dispersed nonspecifically throughout the genome. Southern analysis of cat cellular DNA confirmed the conclusions about conserved restriction sites in endogenous sequences and indicated that a single locus may be responsible for the production of the major inducible form of RD-114. Images PMID:6090693

  7. All gene-sized DNA molecules in four species of hypotrichs have the same terminal sequence and an unusual 3' terminus.

    PubMed Central

    Klobutcher, L A; Swanton, M T; Donini, P; Prescott, D M

    1981-01-01

    In hypotrichous ciliates, all of the macronuclear DNA is in the form of low molecular weight molecules with an average size of approximately 2200 base pairs. Total macronuclear DNA from four hypotrichs has been shown to have inverted terminal repeats by direct sequence analysis. In Oxytricha nova, Oxytricha sp., and Stylonychia pustulata, this terminal sequence may be written as 5'-C4A4C4A4C4 ... 3'-G4T4G4T4G4T4G4T4G4 ... In Euplotes aediculatus, the sequences is similar but differs in the lengths of the duplex region (28 base pairs) and of the putative 3' extension (14 base pairs). Also in Euplotes, a second common sequence of 5 base pairs (A-A-C-T-T-T-T-G-A-A) occurs internal to the terminal repeat and a 17-base-pair heterogeneous region: 5'-C4A4C4A4C4A4C4(X)17T-T-G-A-A ... 3'-G2T4G4T4G4T4G4T4G4T4G4(X)17A-A-C-T-T ... The length of the terminal repeat sequence for O. nova was confirmed in cloned macronuclear DNA molecules. Images PMID:6265931

  8. Correlation of Local Effects of DNA Sequence and Position of Beta-Alanine Inserts with Polyamide-DNA Complex Binding Affinities and Kinetics

    PubMed Central

    Wang, Shuo; Nanjunda, Rupesh; Aston, Karl; Bashkin, James K.; Wilson, W. David

    2012-01-01

    In order to better understand the effects of β-alanine (β) substitution and the number of heterocycles on DNA binding affinity and selectivity, the interactions of an eight-ring hairpin polyamide (PA) and two β derivatives as well as a six-heterocycle analog have been investigated with their cognate DNA sequence, 5′-TGGCTT-3′. Binding selectivity and the effects of β have been investigated with the cognate and five mutant DNAs. A set of powerful and complementary methods have been employed for both energetic and structural evaluations: UV-melting, biosensor-surface plasmon resonance, isothermal titration calorimetry, circular dichroism and a DNA ligation ladder global structure assay. The reduced number of heterocycles in the six-ring PA weakens the binding affinity; however, the smaller PA aggregates significantly less than the larger PAs, and allows us to obtain the binding thermodynamics. The PA-DNA binding enthalpy is large and negative with a large negative ΔCp, and is the primary driving component of the Gibbs free energy. The complete SPR binding results clearly show that β substitutions can substantially weaken the binding affinity of hairpin PAs in a position-dependent manner. More importantly, the changes in PA binding to the mutant DNAs further confirm the position-dependent effects on PA-DNA interaction affinity. Comparison of mutant DNA sequences also shows a different effect in recognition of T•A versus A•T base pairs. The effects of DNA mutations on binding of a single PA as well as the effects of the position of β substitution on binding tell a clear and very important story about sequence dependent binding of PAs to DNA. PMID:23167504

  9. copia-like retrotransposons are ubiquitous among plants.

    PubMed Central

    Voytas, D F; Cummings, M P; Koniczny, A; Ausubel, F M; Rodermel, S R

    1992-01-01

    Transposable genetic elements are assumed to be a feature of all eukaryotic genomes. Their identification, however, has largely been haphazard, limited principally to organisms subjected to molecular or genetic scrutiny. We assessed the phylogenetic distribution of copia-like retrotransposons, a class of transposable element that proliferates by reverse transcription, using a polymerase chain reaction assay designed to detect copia-like element reverse transcriptase sequences. copia-like retrotransposons were identified in 64 plant species as well as the photosynthetic protist Volvox carteri. The plant species included representatives from 9 of 10 plant divisions, including bryophytes, lycopods, ferns, gymnosperms, and angiosperms. DNA sequence analysis of 29 cloned PCR products and of a maize retrotransposon cDNA confirmed the identity of these sequences as copia-like reverse transcriptase sequences, thereby demonstrating that this class of retrotransposons is a ubiquitous component of plant genomes. Images PMID:1379734

  10. Weissella fabaria sp. nov., from a Ghanaian cocoa fermentation.

    PubMed

    De Bruyne, Katrien; Camu, Nicholas; De Vuyst, Luc; Vandamme, Peter

    2010-09-01

    Two lactic acid bacteria, strains 257(T) and 252, were isolated from traditional heap fermentations of Ghanaian cocoa beans. 16S rRNA gene sequence analysis of these strains allocated them to the genus Weissella, showing 99.5 % 16S rRNA gene sequence similarity towards Weissella ghanensis LMG 24286(T). Whole-cell protein electrophoresis, fluorescent amplified fragment length polymorphism fingerprinting of whole genomes and biochemical tests confirmed their unique taxonomic position. DNA-DNA hybridization experiments towards their nearest phylogenetic neighbour demonstrated that the two strains represent a novel species, for which we propose the name Weissella fabaria sp. nov., with strain 257(T) (=LMG 24289(T) =DSM 21416(T)) as the type strain. Additional sequence analysis using pheS gene sequences proved useful for identification of all Weissella-Leuconostoc-Oenococcus species and for the recognition of the novel species.

  11. Identification of the Quorum-Sensing Target DNA Sequence and N-Acyl Homoserine Lactone Responsiveness of the Brucella abortus virB promoter▿

    PubMed Central

    Arocena, Gastón M.; Sieira, Rodrigo; Comerci, Diego J.; Ugalde, Rodolfo A.

    2010-01-01

    VjbR is a LuxR-type quorum-sensing (QS) regulator that plays an essential role in the virulence of the intracellular facultative pathogen Brucella, the causative agent of brucellosis. It was previously described that VjbR regulates a diverse group of genes, including the virB operon. The latter codes for a type IV secretion system (T4SS) that is central for the pathogenesis of Brucella. Although the regulatory role of VjbR on the virB promoter (PvirB) was extensively studied by different groups, the VjbR-binding site had not been identified so far. Here, we identified the target DNA sequence of VjbR in PvirB by DNase I footprinting analyses. Surprisingly, we observed that VjbR specifically recognizes a sequence that is identical to a half-binding site of the QS-related regulator MrtR of Mesorhizobium tianshanense. As shown by DNase I footprinting and electrophoretic mobility shift assays, generation of a palindromic MrtR-like-binding site in PvirB increased both the affinity and the stability of the VjbR-DNA complex, which confirmed that the QS regulator of Brucella is highly related to that of M. tianshanense. The addition of N-dodecanoyl homoserine lactone dissociated VjbR from the promoter, which confirmed previous reports that indicated a negative effect of this signal on the VjbR-mediated activation of PvirB. Our results provide new molecular evidence for the structure of the virB promoter and reveal unusual features of the QS target DNA sequence of the main regulator of virulence in Brucella. PMID:20400542

  12. Cryopyrin-associated Periodic Syndrome Caused by a Myeloid-Restricted Somatic NLRP3 Mutation

    PubMed Central

    Zhou, Qing; Aksentijevich, Ivona; Wood, Geryl M.; Walts, Avram D.; Hoffmann, Patrycja; Remmers, Elaine F.; Kastner, Daniel L.; Ombrello, Amanda K.

    2015-01-01

    Objective To identify the cause of disease in an adult patient presenting with recent onset fevers, chills, urticaria, fatigue, and profound myalgia, who was negative for cryopyrin-associated periodic syndrome (CAPS) NLRP3 mutations by conventional Sanger DNA sequencing. Methods We performed whole-exome sequencing and targeted deep sequencing using DNA from the patient’s whole blood to identify a possible NLRP3 somatic mutation. We then screened for this mutation in subcloned NLRP3 amplicons from fibroblasts, buccal cells, granulocytes, negatively-selected monocytes, and T and B lymphocytes and further confirmed the somatic mutation by targeted sequencing of exon 3. Results We identified a previously reported CAPS-associated mutation, p.Tyr570Cys, with a mutant allele frequency of 15% based on exome data. Targeted sequencing and subcloning of NLRP3 amplicons confirmed the presence of the somatic mutation in whole blood at a ratio similar to the exome data. The mutant allele frequency was in the range of 13.3%–16.8% in monocytes and 15.2%–18% in granulocytes; Notably, this mutation was either absent or present at a very low frequency in B and T lymphocytes, buccal cells, and in the patient’s cultured fibroblasts. Conclusion These data document the possibility of myeloid-restricted somatic mosaicism in the pathogenesis of CAPS, underscoring the emerging role of massively-parallel sequencing in clinical diagnosis. PMID:25988971

  13. Babesia canis and tick-borne encephalitis virus (TBEV) co-infection in a sled dog.

    PubMed

    Bajer, Anna; Rodo, Anna; Bednarska, Malgorzata; Mierzejewska, Ewa; Welc-Falęciak, Renata

    2013-01-01

    Sporting dogs, including sled dogs, are particularly prone to tick-borne infection either due to training/racing in forest areas or through visits to endemic areas. The aim was to present tick-borne infections in a 6-dog racing team after a race in Estonia. On the 4th day after return to Poland, the first dog presented with babesiosis symptoms and was diagnosed and treated accordingly. Next morning, the dog showed neurological symptoms and was diagnosed with tick-borne encephalitis (TBE). Diagnosis was confirmed by a high level of IgG antibodies (922 IU/ml), detected in serum 3 months later. The second dog presented with babesiosis symptoms on the 7th day after return. Babesia DNA was extracted from blood, amplified and sequenced to answer the question of whether the dogs became infected during the race in Estonia or in Poland. Sequencing of a fragment of Babesia 18S rDNA revealed that these two isolates were identical to one another and closely related to the B. canis sequence originally isolated from the dog and Dermacentor reticulatus ticks in Poland. Thus, this is the first confirmed case of B.canis and TBEV co-infection and first confirmed case of TBE in a dog in Poland.

  14. Surface-assisted DNA self-assembly: An enzyme-free strategy towards formation of branched DNA lattice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bhanjadeo, Madhabi M.; Academy of Scientific and Innovative Research; Nayak, Ashok K.

    DNA based self-assembled nanostructures and DNA origami has proven useful for organizing nanomaterials with firm precision. However, for advanced applications like nanoelectronics and photonics, large-scale organization of self-assembled branched DNA (bDNA) into periodic lattices is desired. In this communication for the first time we report a facile method of self-assembly of Y-shaped bDNA nanostructures on the cationic surface of Aluminum (Al) foil to prepare periodic two dimensional (2D) bDNA lattice. Particularly those Y-shaped bDNA structures having smaller overhangs and unable to self-assemble in solution, they are easily assembled on the surface of Al foil in the absence of ligase. Fieldmore » emission scanning electron microscopy (FESEM) analysis shows homogenous distribution of two-dimensional bDNA lattices across the Al foil. When the assembled bDNA structures were recovered from the Al foil and electrophoresed in nPAGE only higher order polymeric bDNA structures were observed without a trace of monomeric structures which confirms the stability and high yield of the bDNA lattices. Therefore, this enzyme-free economic and efficient strategy for developing bDNA lattices can be utilized in assembling various nanomaterials for functional molecular components towards development of DNA based self-assembled nanodevices. - Highlights: • Al foil surface-assisted self-assembly of monomeric structures into larger branched DNA lattice. • FESEM study confirms the uniform distribution of two-dimensional bDNA lattice structures across the surface of Al foil. • Enzyme-free and economic strategy to prepare higher order structures from simpler DNA nanostructures have been confirmed by recovery assay. • Use of well proven sequences for the preparation of pure Y-shaped monomeric DNA nanostructure with high yield.« less

  15. Chromosomal characteristics and distribution of rDNA sequences in the brook trout Salvelinus fontinalis (Mitchill, 1814).

    PubMed

    Śliwińska-Jewsiewicka, A; Kuciński, M; Kirtiklis, L; Dobosz, S; Ocalewicz, K; Jankun, Malgorzata

    2015-08-01

    Brook trout Salvelinus fontinalis (Mitchill, 1814) chromosomes have been analyzed using conventional and molecular cytogenetic techniques enabling characteristics and chromosomal location of heterochromatin, nucleolus organizer regions (NORs), ribosomal RNA-encoding genes and telomeric DNA sequences. The C-banding and chromosome digestion with the restriction endonucleases demonstrated distribution and heterogeneity of the heterochromatin in the brook trout genome. DNA sequences of the ribosomal RNA genes, namely the nucleolus-forming 28S (major) and non-nucleolus-forming 5S (minor) rDNAs, were physically mapped using fluorescence in situ hybridization (FISH) and primed in situ labelling. The minor rDNA locus was located on the subtelo-acrocentric chromosome pair No. 9, whereas the major rDNA loci were dispersed on 14 chromosome pairs, showing a considerable inter-individual variation in the number and location. The major and minor rDNA loci were located at different chromosomes. Multichromosomal location (3-6 sites) of the NORs was demonstrated by silver nitrate (AgNO3) impregnation. All Ag-positive i.e. active NORs corresponded to the GC-rich blocks of heterochromatin. FISH with telomeric probe showed the presence of the interstitial telomeric site (ITS) adjacent to the NOR/28S rDNA site on the chromosome 11. This ITS was presumably remnant of the chromosome rearrangement(s) leading to the genomic redistribution of the rDNA sequences. Comparative analysis of the cytogenetic data among several related salmonid species confirmed huge variation in the number and the chromosomal location of rRNA gene clusters in the Salvelinus genome.

  16. Next-Generation Sequencing-Based Detection of Circulating Tumour DNA After Allogeneic Stem Cell Transplantation for Lymphoma

    PubMed Central

    Herrera, Alex F.; Kim, Haesook T.; Kong, Katherine A.; Faham, Malek; Sun, Heather; Sohani, Aliyah R.; Alyea, Edwin P.; Carlton, Victoria E.; Chen, Yi-Bin; Cutler, Corey S.; Ho, Vincent T.; Koreth, John; Kotwaliwale, Chitra; Nikiforow, Sarah; Ritz, Jerome; Rodig, Scott J.; Soiffer, Robert J.; Antin, Joseph H.; Armand, Philippe

    2016-01-01

    Summary Next-generation sequencing (NGS)-based circulating tumour DNA (ctDNA) detection is a promising monitoring tool for lymphoid malignancies. We evaluated whether the presence of ctDNA was associated with outcome after allogeneic haematopoietic stem cell transplantation (HSCT) in lymphoma patients. We studied 88 patients drawn from a phase 3 clinical trial of reduced-intensity conditioning HSCT in lymphoma. Conventional restaging and collection of peripheral blood samples occurred at pre-specified time points before and after HSCT and were assayed for ctDNA by sequencing of the immunoglobulin or T-cell receptor genes. Tumour clonotypes were identified in 87% of patients with adequate tumour samples. Sixteen of 19 (84%) patients with disease progression after HSCT had detectable ctDNA prior to progression at a median of 3.7 months prior to relapse/progression. Patients with detectable ctDNA 3 months after HSCT had inferior progression-free survival (PFS) (2-year PFS 58% versus 84% in ctDNA-negative patients, p=0.033). In multivariate models, detectable ctDNA was associated with increased risk of progression/death (Hazard ratio 3.9, p=0.003) and increased risk of relapse/progression (Hazard ratio 10.8, p=0.0006). Detectable ctDNA is associated with an increased risk of relapse/progression, but further validation studies are necessary to confirm these findings and determine the clinical utility of NGS-based minimal residual disease monitoring in lymphoma patients after HSCT. PMID:27711974

  17. Archaebacterial rhodopsin sequences: Implications for evolution

    NASA Technical Reports Server (NTRS)

    Lanyi, J. K.

    1991-01-01

    It was proposed over 10 years ago that the archaebacteria represent a separate kingdom which diverged very early from the eubacteria and eukaryotes. It follows that investigations of archaebacterial characteristics might reveal features of early evolution. So far, two genes, one for bacteriorhodopsin and another for halorhodopsin, both from Halobacterium halobium, have been sequenced. We cloned and sequenced the gene coding for the polypeptide of another one of these rhodopsins, a halorhodopsin in Natronobacterium pharaonis. Peptide sequencing of cyanogen bromide fragments, and immuno-reactions of the protein and synthetic peptides derived from the C-terminal gene sequence, confirmed that the open reading frame was the structural gene for the pharaonis halorhodopsin polypeptide. The flanking DNA sequences of this gene, as well as those of other bacterial rhodopsins, were compared to previously proposed archaebacterial consensus sequences. In pairwise comparisons of the open reading frame with DNA sequences for bacterio-opsin and halo-opsin from Halobacterium halobium, silent divergences were calculated. These indicate very considerable evolutionary distance between each pair of genes, even in the dame organism. In spite of this, three protein sequences show extensive similarities, indicating strong selective pressures.

  18. Environmental DNA sequencing primers for eutardigrades and bdelloid rotifers

    PubMed Central

    2009-01-01

    Background The time it takes to isolate individuals from environmental samples and then extract DNA from each individual is one of the problems with generating molecular data from meiofauna such as eutardigrades and bdelloid rotifers. The lack of consistent morphological information and the extreme abundance of these classes makes morphological identification of rare, or even common cryptic taxa a large and unwieldy task. This limits the ability to perform large-scale surveys of the diversity of these organisms. Here we demonstrate a culture-independent molecular survey approach that enables the generation of large amounts of eutardigrade and bdelloid rotifer sequence data directly from soil. Our PCR primers, specific to the 18s small-subunit rRNA gene, were developed for both eutardigrades and bdelloid rotifers. Results The developed primers successfully amplified DNA of their target organism from various soil DNA extracts. This was confirmed by both the BLAST similarity searches and phylogenetic analyses. Tardigrades showed much better phylogenetic resolution than bdelloids. Both groups of organisms exhibited varying levels of endemism. Conclusion The development of clade-specific primers for characterizing eutardigrades and bdelloid rotifers from environmental samples should greatly increase our ability to characterize the composition of these taxa in environmental samples. Environmental sequencing as shown here differs from other molecular survey methods in that there is no need to pre-isolate the organisms of interest from soil in order to amplify their DNA. The DNA sequences obtained from methods that do not require culturing can be identified post-hoc and placed phylogenetically as additional closely related sequences are obtained from morphologically identified conspecifics. Our non-cultured environmental sequence based approach will be able to provide a rapid and large-scale screening of the presence, absence and diversity of Bdelloidea and Eutardigrada in a variety of soils. PMID:20003362

  19. Target Site Recognition by a Diversity-Generating Retroelement

    PubMed Central

    Guo, Huatao; Tse, Longping V.; Nieh, Angela W.; Czornyj, Elizabeth; Williams, Steven; Oukil, Sabrina; Liu, Vincent B.; Miller, Jeff F.

    2011-01-01

    Diversity-generating retroelements (DGRs) are in vivo sequence diversification machines that are widely distributed in bacterial, phage, and plasmid genomes. They function to introduce vast amounts of targeted diversity into protein-encoding DNA sequences via mutagenic homing. Adenine residues are converted to random nucleotides in a retrotransposition process from a donor template repeat (TR) to a recipient variable repeat (VR). Using the Bordetella bacteriophage BPP-1 element as a prototype, we have characterized requirements for DGR target site function. Although sequences upstream of VR are dispensable, a 24 bp sequence immediately downstream of VR, which contains short inverted repeats, is required for efficient retrohoming. The inverted repeats form a hairpin or cruciform structure and mutational analysis demonstrated that, while the structure of the stem is important, its sequence can vary. In contrast, the loop has a sequence-dependent function. Structure-specific nuclease digestion confirmed the existence of a DNA hairpin/cruciform, and marker coconversion assays demonstrated that it influences the efficiency, but not the site of cDNA integration. Comparisons with other phage DGRs suggested that similar structures are a conserved feature of target sequences. Using a kanamycin resistance determinant as a reporter, we found that transplantation of the IMH and hairpin/cruciform-forming region was sufficient to target the DGR diversification machinery to a heterologous gene. In addition to furthering our understanding of DGR retrohoming, our results suggest that DGRs may provide unique tools for directed protein evolution via in vivo DNA diversification. PMID:22194701

  20. Diagnosis of Lung Cancer by Fractal Analysis of Damaged DNA

    PubMed Central

    Namazi, Hamidreza; Kiminezhadmalaie, Mona

    2015-01-01

    Cancer starts when cells in a part of the body start to grow out of control. In fact cells become cancer cells because of DNA damage. A DNA walk of a genome represents how the frequency of each nucleotide of a pairing nucleotide couple changes locally. In this research in order to study the cancer genes, DNA walk plots of genomes of patients with lung cancer were generated using a program written in MATLAB language. The data so obtained was checked for fractal property by computing the fractal dimension using a program written in MATLAB. Also, the correlation of damaged DNA was studied using the Hurst exponent measure. We have found that the damaged DNA sequences are exhibiting higher degree of fractality and less correlation compared with normal DNA sequences. So we confirmed this method can be used for early detection of lung cancer. The method introduced in this research not only is useful for diagnosis of lung cancer but also can be applied for detection and growth analysis of different types of cancers. PMID:26539245

  1. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

    PubMed

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

    2011-03-01

    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  2. Investigation of the nanoviscosity effect of a G-quadruplex and single-strand DNA using fluorescence correlation spectroscopy

    NASA Astrophysics Data System (ADS)

    Lee, Dongkeun; Kim, Minjung; Kim, Soo Yong; Shin, Hyosup; Kim, Sok Won; Park, Inho

    2015-01-01

    Guanine (G)-quadruplexes are of interest because of their presence in the telomere sequence and the oncogene promoter region. Their diffusion and change of structure, especially in high viscosity solutions, are important for understanding their dynamics. G-quadruplexes may have less effective viscosity (nanoviscosity) when they are smaller than the solvent molecules. In this paper, we report the difference in the diffusion dynamics of the G-rich DNA sequences of single-strand DNA (ssDNA) and the G-quadruplex in aqueous, sucrose, and polyethylene glycol (PEG) solutions. From experiments with aqueous and sucrose solutions, we confirm that a simple diffusion model according to the viscosity is appropriate. In the PEG experiments, the nanoviscosity effect is observed according to PEG's molecular weight. In the PEG 200 solution, both the ssDNA and the G-quadruplex possess macroviscosity. In the PEG 10 000 solution, the G-quadruplex possesses nanoviscosity and the ssDNA possesses macroviscosity, whereas, in the PEG 35 000 solution, both ssDNA and the G-quadruplex possess nanoviscosity. The experimental results are consistent with the theoretical predictions.

  3. Parvovirus B19 infection transmitted by transfusion of red blood cells confirmed by molecular analysis of linked donor and recipient samples.

    PubMed

    Yu, Mei-Ying W; Alter, Harvey J; Virata-Theimer, Maria Luisa A; Geng, Yansheng; Ma, Li; Schechterly, Cathy A; Colvin, Camilla A; Luban, Naomi L C

    2010-08-01

    Extremely high viremic levels of parvovirus B19 (B19V) can be found in acutely infected, but asymptomatic donors. However, reports of transmission by single-donor blood components are rare. In this prospective study, paired donor-recipient samples were used to investigate the transfusion risk. Posttransfusion plasma or blood samples from recipients were tested for B19V DNA by polymerase chain reaction, generally at 4 and 8 weeks, and for anti-B19V immunoglobulin (Ig)G by enzyme immunoassay, at 12 and 24 weeks. To rule out infection unrelated to transfusion, pretransfusion samples and linked donor's samples for each B19V DNA-positive recipient were assayed for B19V DNA and anti-B19V IgG and IgM. To confirm transmission, sequencing and phylogenetic analysis were performed. A total of 14 of 869 (1.6%) recipients were B19V DNA positive, but only 1 of 869 (0.12%; 95% confidence interval, 0.0029%-0.6409%) was negative for B19V DNA and anti-B19V IgG before transfusion and seroconverted posttransfusion. This newly infected patient received 5 × 10(10) IU B19V DNA in one red blood cell (RBC) unit from an acutely infected anti-B19V-negative donor in addition to RBCs from three other donors that cumulatively contained 1320 IU of anti-B19V IgG. DNA sequencing and phylogenetic analysis showed that sequences from the linked donor and recipient were identical (Genotype 1), thus establishing transfusion transmission. The 0.12% transmission rate documented here, although low, could nonetheless result in hundreds or thousands of infections annually in the United States based on calculated confidence limits. Although most would be asymptomatic, some could have severe clinical outcomes, especially in neonates and those with immunocompromised or hemolytic states. © 2010 American Association of Blood Banks.

  4. Uncommonly isolated clinical Pseudomonas: identification and phylogenetic assignation.

    PubMed

    Mulet, M; Gomila, M; Ramírez, A; Cardew, S; Moore, E R B; Lalucat, J; García-Valdés, E

    2017-02-01

    Fifty-two Pseudomonas strains that were difficult to identify at the species level in the phenotypic routine characterizations employed by clinical microbiology laboratories were selected for genotypic-based analysis. Species level identifications were done initially by partial sequencing of the DNA dependent RNA polymerase sub-unit D gene (rpoD). Two other gene sequences, for the small sub-unit ribosonal RNA (16S rRNA) and for DNA gyrase sub-unit B (gyrB) were added in a multilocus sequence analysis (MLSA) study to confirm the species identifications. These sequences were analyzed with a collection of reference sequences from the type strains of 161 Pseudomonas species within an in-house multi-locus sequence analysis database. Whole-cell matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) analyses of these strains complemented the DNA sequenced-based phylogenetic analyses and were observed to be in accordance with the results of the sequence data. Twenty-three out of 52 strains were assigned to 12 recognized species not commonly detected in clinical specimens and 29 (56 %) were considered representatives of at least ten putative new species. Most strains were distributed within the P. fluorescens and P. aeruginosa lineages. The value of rpoD sequences in species-level identifications for Pseudomonas is emphasized. The correct species identifications of clinical strains is essential for establishing the intrinsic antibiotic resistance patterns and improved treatment plans.

  5. Characterization of rpoB mutations in rifampin-resistant clinical Mycobacterium tuberculosis isolates from Kuwait and Dubai.

    PubMed

    Ahmad, Suhail; Mokaddas, Eiman; Fares, Esther

    2002-11-01

    Mutations conferring resistance to rifampin in rifampin-resistant clinical Mycobacterium tuberculosis isolates occur mostly in the 81 bp rifampin-resistance-determining region (RRDR) of the rpoB gene. In this study, 29 rifampin-resistant and 12 -susceptible clinical M. tuberculosis isolates were tested for characterization of mutations in the rpoB gene by line probe (INNO-LiPA Rif. TB) assay and the results were confirmed and extended by DNA sequencing of the PCR amplified target DNA. The line probe assay identified all 12 susceptible strains as rifampin-sensitive and the DNA sequence of RRDR in the amplified rpoB gene from two isolates matched perfectly with the wild-type sequence. The line probe assay identified 28 resistant isolates as rifampin-resistant with specific detection of mutation in 22 isolates including one isolate that exhibited hetro-resistance containing both the wild-type pattern as well as a specific mutation within RRDR while one of the rifampin-resistant strain was identified as rifampin-susceptible. DNA sequencing confirmed these results and, in addition, led to the specific detection of mutations in 5 rifampin-resistant isolates in which specific base changes within RRDR could not be determined by the line probe assay. These analyses identified 8 different mutations within RRDR of the rpoB gene including one novel mutation (S522W) that has not been reported so far. The genotyping performed on the isolates carrying similar mutations showed that majority of these isolates were unique as they exhibited varying DNA banding patterns. Correlating the ethnic origin of the infected TB patients with the occurrence of specific mutations at three main codon positions (516, 526 and 531) in the rpoB gene showed that most patients (11 of 15) from South Asian region contained mutations at codon 526 while majority of isolates from patients (6 of 11) of Middle Eastern origin contained mutations at codon 531.

  6. Characterization of Satellite DNA Sequences from the Commercially Important Marine Rotifers Brachionus rotundiformis and Brachionus plicatilis.

    PubMed

    Boehm; Gibson; Lubzens

    2000-01-01

    This study was initiated to search for species-specific and strain-specific satellite DNA sequences for which oligonucleotide primers could be designed to differentiate between various commercially important strains of the marine monogonont rotifers Brachionus rotundiformis and Brachionus plicatilis. Two unrelated, highly reiterated satellite sequences were cloned and characterized. The eight sequenced monomers from B. rotundiformis and six from B. plicatilis had low intrarepeat variability and were similar in their overall lengths, A + T compositions, and high degrees of repeated motif substructure. However, hybridizations to 19 representative strains, sequence characterizations, and GenBank searches indicated that these two satellites are morphotype-specific and population-specific, respectively, and share little homology to each other or to other characterized sequences in the database. Primer pairs designed for the B. rotundiformis satellite confirmed hybridization specificities on polymerase chain reaction and could serve as a useful molecular diagnostic tool to identify strains belonging to the SS morphotype, which are gaining widespread usage as first feeds for marine fish in commercial production.

  7. Reanalysis of RNA-Sequencing Data Reveals Several Additional Fusion Genes with Multiple Isoforms

    PubMed Central

    Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli

    2012-01-01

    RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts. PMID:23119097

  8. Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.

    PubMed

    Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli

    2012-01-01

    RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.

  9. Characterization of a cDNA encoding a protein involved in formation of the skeleton during development of the sea urchin Lytechinus pictus.

    PubMed

    Livingston, B T; Shaw, R; Bailey, A; Wilt, F

    1991-12-01

    In order to investigate the role of proteins in the formation of mineralized tissues during development, we have isolated a cDNA that encodes a protein that is a component of the organic matrix of the skeletal spicule of the sea urchin, Lytechinus pictus. The expression of the RNA encoding this protein is regulated over development and is localized to the descendents of the micromere lineage. Comparison of the sequence of this cDNA to homologous cDNAs from other species of urchin reveal that the protein is basic and contains three conserved structural motifs: a signal peptide, a proline-rich region, and an unusual region composed of a series of direct repeats. Studies on the protein encoded by this cDNA confirm the predicted reading frame deduced from the nucleotide sequence and show that the protein is secreted and not glycosylated. Comparison of the amino acid sequence to databases reveal that the repeat domain is similar to proteins that form a unique beta-spiral supersecondary structure.

  10. The genomes of many yam species contain transcriptionally active endogenous geminiviral sequences that may be functionally expressed

    PubMed Central

    Filloux, Denis; Murrell, Sasha; Koohapitagtam, Maneerat; Golden, Michael; Julian, Charlotte; Galzi, Serge; Uzest, Marilyne; Rodier-Goud, Marguerite; D’Hont, Angélique; Vernerey, Marie Stephanie; Wilkin, Paul; Peterschmitt, Michel; Winter, Stephan; Murrell, Ben; Martin, Darren P.; Roumagnac, Philippe

    2015-01-01

    Endogenous viral sequences are essentially ‘fossil records’ that can sometimes reveal the genomic features of long extinct virus species. Although numerous known instances exist of single-stranded DNA (ssDNA) genomes becoming stably integrated within the genomes of bacteria and animals, there remain very few examples of such integration events in plants. The best studied of these events are those which yielded the geminivirus-related DNA elements found within the nuclear genomes of various Nicotiana species. Although other ssDNA virus-like sequences are included within the draft genomes of various plant species, it is not entirely certain that these are not contaminants. The Nicotiana geminivirus-related DNA elements therefore remain the only definitively proven instances of endogenous plant ssDNA virus sequences. Here, we characterize two new classes of endogenous plant virus sequence that are also apparently derived from ancient geminiviruses in the genus Begomovirus. These two endogenous geminivirus-like elements (EGV1 and EGV2) are present in the Dioscorea spp. of the Enantiophyllum clade. We used fluorescence in situ hybridization to confirm that the EGV1 sequences are integrated in the D. alata genome and showed that one or two ancestral EGV sequences likely became integrated more than 1.4 million years ago during or before the diversification of the Asian and African Enantiophyllum Dioscorea spp. Unexpectedly, we found evidence of natural selection actively favouring the maintenance of EGV-expressed replication-associated protein (Rep) amino acid sequences, which clearly indicates that functional EGV Rep proteins were probably expressed for prolonged periods following endogenization. Further, the detection in D. alata of EGV gene transcripts, small 21–24 nt RNAs that are apparently derived from these transcripts, and expressed Rep proteins, provides evidence that some EGV genes are possibly still functionally expressed in at least some of the Enantiophyllum clade species. PMID:27774276

  11. Comprehensive red blood cell and platelet antigen prediction from whole genome sequencing: proof of principle

    PubMed Central

    Westhoff, Connie M.; Uy, Jon Michael; Aguad, Maria; Smeland‐Wagman, Robin; Kaufman, Richard M.; Rehm, Heidi L.; Green, Robert C.; Silberstein, Leslie E.

    2015-01-01

    BACKGROUND There are 346 serologically defined red blood cell (RBC) antigens and 33 serologically defined platelet (PLT) antigens, most of which have known genetic changes in 45 RBC or six PLT genes that correlate with antigen expression. Polymorphic sites associated with antigen expression in the primary literature and reference databases are annotated according to nucleotide positions in cDNA. This makes antigen prediction from next‐generation sequencing data challenging, since it uses genomic coordinates. STUDY DESIGN AND METHODS The conventional cDNA reference sequences for all known RBC and PLT genes that correlate with antigen expression were aligned to the human reference genome. The alignments allowed conversion of conventional cDNA nucleotide positions to the corresponding genomic coordinates. RBC and PLT antigen prediction was then performed using the human reference genome and whole genome sequencing (WGS) data with serologic confirmation. RESULTS Some major differences and alignment issues were found when attempting to convert the conventional cDNA to human reference genome sequences for the following genes: ABO, A4GALT, RHD, RHCE, FUT3, ACKR1 (previously DARC), ACHE, FUT2, CR1, GCNT2, and RHAG. However, it was possible to create usable alignments, which facilitated the prediction of all RBC and PLT antigens with a known molecular basis from WGS data. Traditional serologic typing for 18 RBC antigens were in agreement with the WGS‐based antigen predictions, providing proof of principle for this approach. CONCLUSION Detailed mapping of conventional cDNA annotated RBC and PLT alleles can enable accurate prediction of RBC and PLT antigens from whole genomic sequencing data. PMID:26634332

  12. Partial nucleotide sequences, and routine typing by polymerase chain reaction-restriction fragment length polymorphism, of the brown trout (Salmo trutta) lactate dehydrogenase, LDH-C1*90 and *100 alleles.

    PubMed

    McMeel, O M; Hoey, E M; Ferguson, A

    2001-01-01

    The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.

  13. Mitochondrial gene rearrangements confirm the parallel evolution of the crab-like form.

    PubMed Central

    Morrison, C L; Harvey, A W; Lavery, S; Tieu, K; Huang, Y; Cunningham, C W

    2002-01-01

    The repeated appearance of strikingly similar crab-like forms in independent decapod crustacean lineages represents a remarkable case of parallel evolution. Uncertainty surrounding the phylogenetic relationships among crab-like lineages has hampered evolutionary studies. As is often the case, aligned DNA sequences by themselves were unable to fully resolve these relationships. Four nested mitochondrial gene rearrangements--including one of the few reported movements of an arthropod protein-coding gene--are congruent with the DNA phylogeny and help to resolve a crucial node. A phylogenetic analysis of DNA sequences, and gene rearrangements, supported five independent origins of the crab-like form, and suggests that the evolution of the crab-like form may be irreversible. This result supports the utility of mitochondrial gene rearrangements in phylogenetic reconstruction. PMID:11886621

  14. Validation and application of quantitative PCR assays using host-specific Bacteroidales genetic markers for swine fecal pollution tracking.

    PubMed

    Fan, Lihua; Shuai, Jiangbing; Zeng, Ruoxue; Mo, Hongfei; Wang, Suhua; Zhang, Xiaofeng; He, Yongqiang

    2017-12-01

    Genome fragment enrichment (GFE) method was applied to identify host-specific bacterial genetic markers that differ among different fecal metagenomes. To enrich for swine-specific DNA fragments, swine fecal DNA composite (n = 34) was challenged against a DNA composite consisting of cow, human, goat, sheep, chicken, duck and goose fecal DNA extracts (n = 83). Bioinformatic analyses of 384 non-redundant swine enriched metagenomic sequences indicated a preponderance of Bacteroidales-like regions predicted to encode metabolism-associated, cellular processes and information storage and processing. After challenged against fecal DNA extracted from different animal sources, four sequences from the clone libraries targeting two Bacteroidales- (genes 1-38 and 3-53), a Clostridia- (gene 2-109) as well as a Bacilli-like sequence (gene 2-95), respectively, showed high specificity to swine feces based on PCR analysis. Host-specificity and host-sensitivity analysis confirmed that oligonucleotide primers and probes capable of annealing to select Bacteroidales-like sequences (1-38 and 3-53) exhibited high specificity (>90%) in quantitative PCR assays with 71 fecal DNAs from non-target animal sources. The two assays also demonstrated broad distributions of corresponding genetic markers (>94% positive) among 72 swine feces. After evaluation with environmental water samples from different areas, swine-targeted assays based on two Bacteroidales-like GFE sequences appear to be suitable quantitative tracing tools for swine fecal pollution. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Ancestral chloroplast polymorphism and historical secondary contact in a broad hybrid zone of Aesculus (Sapindaceae).

    PubMed

    Modliszewski, Jennifer L; Thomas, David T; Fan, Chuanzhu; Crawford, Daniel J; Depamphilis, Claude W; Xiang, Qiu-Yun Jenny

    2006-03-01

    Knowledge regarding the origin and maintenance of hybrid zones is critical for understanding the evolutionary outcomes of natural hybridization. To evaluate the contribution of historical contact vs. long-distance gene flow in the formation of a broad hybrid zone in central and northern Georgia that involves Aesculus pavia, A. sylvatica, and A. flava, three cpDNA regions (matK, trnD-trnT, and trnH-trnK) were analyzed. The maternal inheritance of cpDNA in Aesculus was confirmed via sequencing of matK from progeny of controlled crosses. Restriction site analyses identified 21 unique haplotypes among 248 individuals representing 29 populations from parental species and hybrids. Haplotypes were sequenced for all cpDNA regions. Restriction site and sequence data were subjected to phylogeographic and population genetic analyses. Considerable cpDNA variation was detected in the hybrid zone, as well as ancestral cpDNA polymorphism; furthermore, the distribution of haplotypes indicates limited interpopulation gene flow via seeds. The genealogy and structure of genetic variation further support the historical presence of A. pavia in the Piedmont, although they are at present locally extinct. In conjunction with previous allozyme studies, the cpDNA data suggest that the hybrid zone originated through historical local gene flow, yet is maintained by periodic long-distance pollen dispersal.

  16. Substitution of human for horse urine disproves an accusation of doping*.

    PubMed

    Díaz, Silvina; Kienast, Mariana E; Villegas-Castagnasso, Egle E; Pena, Natalia L; Manganare, Marcos M; Posik, Diego; Peral-García, Pilar; Giovambattista, Guillermo

    2008-09-01

    In order to detect switching and/or manipulation of samples, the owner of a stallion asked our lab to perform a DNA test on a positive doping urine sample. The objective was to compare the urine DNA profile versus blood and hair DNA profiles from the same stallion. At first, 10 microsatellite markers were investigated to determine the horse identity. No results were obtained when horse specific markers were typed in the urine sample. In order to confirm the species origin of this sample we analyzed the mitochondrial cytochrome b gene. This analysis from blood and hair samples produced reproducible and clear PCR-RFLP patterns and DNA sequence match with those expected for horse, while the urine sample results were coincident with human. These results allowed us to exclude the urine sample from the questioned stallion and determine its human species origin, confirming the manipulation of urine sample.

  17. Confirming the 3D Solution Structure of a Short Double-Stranded DNA Sequence Using NMR Spectroscopy

    ERIC Educational Resources Information Center

    Ruhayel, Rasha A.; Berners-Price, Susan J.

    2010-01-01

    2D [superscript 1]H NOESY NMR spectroscopy is routinely used to give information on the closeness of hydrogen atoms through space. This work is based on a 2D [superscript 1]H NOESY NMR spectrum of a 12 base-pair DNA duplex. This 6-h laboratory workshop aims to provide advanced-level chemistry students with a basic, yet solid, understanding of how…

  18. Myopathic mtDNA Depletion Syndrome Due to Mutation in TK2 Gene.

    PubMed

    Martín-Hernández, Elena; García-Silva, María Teresa; Quijada-Fraile, Pilar; Rodríguez-García, María Elena; Hernández-Laín, Aurelio; Coca-Robinot, David; Rivera, Henry; Fernández-Toral, Joaquín; Arenas, Joaquín; Martín, MiguelÁngel; Martínez-Azorín, Francisco

    2016-02-29

    Whole-exome sequencing (WES) was used to identify the disease gene(s) in a Spanish girl with failure to thrive, muscle weakness, mild facial weakness, elevated creatine kinase (CK), deficiency of mitochondrial complex III and depletion of mtDNA. With WES data, it was possible to get the whole mtDNA sequencing and discard any pathogenic variant in this genome. The analysis of whole exome uncovered a homozygous pathogenic mutation in Thymidine kinase 2 gene (TK2; NM_004614.4:c.323C>T, p.T108M). TK2 mutations have been identified mainly in patients with the myopathic form of mtDNA depletion syndromes (MDS). This patient presents an atypical TK2 related-myopathic form of MDS, because despite having a very low content of mtDNA (<20%), she presents a slower and less severe evolution of the disease. In conclusion, our data confirm the role of TK2 gene in MDS and expanded the phenotypic spectrum.

  19. Molecular Analysis of Spinal Muscular Atrophy: A genotyping protocol based on TaqMan(®) real-time PCR.

    PubMed

    de Souza Godinho, Fernanda Marques; Bock, Hugo; Gheno, Tailise Conte; Saraiva-Pereira, Maria Luiza

    2012-12-01

    Spinal muscular atrophy (SMA) is an autosomal recessive inherited disorder caused by alterations in the survival motor neuron I (SMN1) gene. SMA patients are classified as type I-IV based on severity of symptoms and age of onset. About 95% of SMA cases are caused by the homozygous absence of SMN1 due to gene deletion or conversion into SMN2. PCR-based methods have been widely used in genetic testing for SMA. In this work, we introduce a new approach based on TaqMan(®)real-time PCR for research and diagnostic settings. DNA samples from 100 individuals with clinical signs and symptoms suggestive of SMA were analyzed. Mutant DNA samples as well as controls were confirmed by DNA sequencing. We detected 58 SMA cases (58.0%) by showing deletion of SMN1 exon 7. Considering clinical information available from 56 of them, the patient distribution was 26 (46.4%) SMA type I, 16 (28.6%) SMA type II and 14 (25.0%) SMA type III. Results generated by the new method was confirmed by PCR-RFLP and by DNA sequencing when required. In conclusion, a protocol based on real-time PCR was shown to be effective and specific for molecular analysis of SMA patients.

  20. Identification of Medically Important Yeasts Using PCR-Based Detection of DNA Sequence Polymorphisms in the Internal Transcribed Spacer 2 Region of the rRNA Genes

    PubMed Central

    Chen, Y. C.; Eisner, J. D.; Kattar, M. M.; Rassoulian-Barrett, S. L.; LaFe, K.; Yarfitz, S. L.; Limaye, A. P.; Cookson, B. T.

    2000-01-01

    Identification of medically relevant yeasts can be time-consuming and inaccurate with current methods. We evaluated PCR-based detection of sequence polymorphisms in the internal transcribed spacer 2 (ITS2) region of the rRNA genes as a means of fungal identification. Clinical isolates (401), reference strains (6), and type strains (27), representing 34 species of yeasts were examined. The length of PCR-amplified ITS2 region DNA was determined with single-base precision in less than 30 min by using automated capillary electrophoresis. Unique, species-specific PCR products ranging from 237 to 429 bp were obtained from 92% of the clinical isolates. The remaining 8%, divided into groups with ITS2 regions which differed by ≤2 bp in mean length, all contained species-specific DNA sequences easily distinguishable by restriction enzyme analysis. These data, and the specificity of length polymorphisms for identifying yeasts, were confirmed by DNA sequence analysis of the ITS2 region from 93 isolates. Phenotypic and ITS2-based identification was concordant for 427 of 434 yeast isolates examined using sequence identity of ≥99%. Seven clinical isolates contained ITS2 sequences that did not agree with their phenotypic identification, and ITS2-based phylogenetic analyses indicate the possibility of new or clinically unusual species in the Rhodotorula and Candida genera. This work establishes an initial database, validated with over 400 clinical isolates, of ITS2 length and sequence polymorphisms for 34 species of yeasts. We conclude that size and restriction analysis of PCR-amplified ITS2 region DNA is a rapid and reliable method to identify clinically significant yeasts, including potentially new or emerging pathogenic species. PMID:10834993

  1. Analysis of the regulatory region of the protease III (ptr) gene of Escherichia coli K-12.

    PubMed

    Claverie-Martin, F; Diaz-Torres, M R; Kushner, S R

    1987-01-01

    The ptr gene of Escherichia coli encodes protease III (Mr 110,000) and a 50-kDa polypeptide, both of which are found in the periplasmic space. The gene is physically located between the recC and recB loci on the E. coli chromosome. The nucleotide sequence of a 1167-bp EcoRV-ClaI fragment of chromosomal DNA containing the promoter region and 885 bp of the ptr coding sequence has been determined. S1 nuclease mapping analysis showed that the major 5' end of the ptr mRNA was localized 127 bp upstream from the ATG start codon. The open reading frame (ORF), preceded by a Shine-Dalgarno sequence, extends to the end of the sequenced DNA. Downstream from the -35 and -10 regions is a sequence that strongly fits the consensus sequence of known nitrogen-regulated promoters. A signal peptide of 23 amino acids residues is present at the N terminus of the derived amino acid sequence. The cleavage site as well as the ORF were confirmed by sequencing the N terminus of mature protease III.

  2. The ectomycorrhizas of Lactarius cuspidoaurantiacus and Lactarius herrerae associated with Alnus acuminata in Central Mexico.

    PubMed

    Montoya, Leticia; Bandala, Victor M; Garay-Serrano, Edith

    2015-08-01

    Two pure Alnus acuminata stands established in a montane forest in central Mexico (Puebla State) were monitored between 2010 and 2013 to confirm and recognize the ectomycorrhizal (EcM) systems of A. acuminata with Lactarius cuspidoaurantiacus and Lactarius herrerae, two recently described species. Through comparison of internal transcribed spacer (ITS) of nuclear ribosomal DNA sequences from basidiomes and ectomycorrhizas sampled in the forest stands, we confirmed their ectomycorrhizal association. The phytobiont was corroborated by comparing ITS sequences obtained from EcM root tips and leaves collected in the study site and from other sequences of A. acuminata available in Genbank. Detailed morphological and anatomical descriptions of the ectomycorrhizal systems are presented and complemented with photographs.

  3. Non-invasive prenatal testing for fetal chromosomal abnormalities by low-coverage whole-genome sequencing of maternal plasma DNA: review of 1982 consecutive cases in a single center.

    PubMed

    Lau, T K; Cheung, S W; Lo, P S S; Pursley, A N; Chan, M K; Jiang, F; Zhang, H; Wang, W; Jong, L F J; Yuen, O K C; Chan, H Y C; Chan, W S K; Choy, K W

    2014-03-01

    To review the performance of non-invasive prenatal testing (NIPT) by low-coverage whole-genome sequencing of maternal plasma DNA at a single center. The NIPT result and pregnancy outcome of 1982 consecutive cases were reviewed. NIPT was based on low coverage (0.1×) whole-genome sequencing of maternal plasma DNA. All subjects were contacted for pregnancy and fetal outcome. Of the 1982 NIPT tests, a repeat blood sample was required in 23 (1.16%). In one case, a conclusive report could not be issued, probably because of an abnormal vanished twin fetus. NIPT was positive for common trisomies in 29 cases (23 were trisomy 21, four were trisomy 18 and two were trisomy 13); all were confirmed by prenatal karyotyping (specificity=100%). In addition, 11 cases were positive for sex-chromosomal abnormalities (SCA), and nine cases were positive for other aneuploidies or deletion/duplication. Fourteen of these 20 subjects agreed to undergo further investigations, and the abnormality was found to be of fetal origin in seven, confined placental mosaicism (CPM) in four, of maternal origin in two and not confirmed in one. Overall, 85.7% of the NIPT-suspected SCA were of fetal origin, and 66.7% of the other abnormalities were caused by CPM. Two of the six cases suspected or confirmed to have CPM were complicated by early-onset growth restriction requiring delivery before 34 weeks. Fetal outcome of the NIPT-negative cases was ascertained in 1645 (85.15%). Three chromosomal abnormalities were not detected by NIPT, including one case each of a balanced translocation, unbalanced translocation and triploidy. There were no known false negatives involving the common trisomies (sensitivity=100%). Low-coverage whole-genome sequencing of maternal plasma DNA was highly accurate in detecting common trisomies. It also enabled the detection of other aneuploidies and structural chromosomal abnormalities with high positive predictive value. Copyright © 2013 ISUOG. Published by John Wiley & Sons Ltd.

  4. Pantoea hericii sp. nov., Isolated from the Fruiting Bodies of Hericium erinaceus.

    PubMed

    Rong, Chengbo; Ma, Yuanwei; Wang, Shouxian; Liu, Yu; Chen, Sanfeng; Huang, Bin; Wang, Jing; Xu, Feng

    2016-06-01

    Three Gram-negative, facultatively anaerobic bacterial isolates were obtained from the fruiting bodies of the edible mushroom Hericium erinaceus showing symptoms of soft rot disease in Beijing, China. Sequences of partial 16S rRNA gene placed these isolates in the genus Pantoea. Multilocus sequence analysis based on the partial sequences of atpD, gyrB, infB and rpoB revealed P. eucalypti and P. anthophila as their closest phylogenetic relatives and indicated that these isolates constituted a possible novel species. DNA-DNA hybridization studies confirmed the classification of these isolates as a novel species and phenotypic tests allowed for differentiation from the closest phylogenetic neighbours. The name Pantoea hericii sp. nov. [Type strain LMG 28847(T) = CGMCC 1.15224(T) = JZB 2120024(T)] is proposed.

  5. Seasonal distribution of Legionella spp. and L. pneumophila in a river in Taiwan evaluated with culture-confirmed and direct DNA extraction methods

    NASA Astrophysics Data System (ADS)

    Tung, Min-Che; Chang, Tien-Yu; Hsu, Bing-Mu; Shen, Shu-Min; Huang, Jen-Te; Kao, Po-Min; Chiu, Yi-Chou; Fan, Cheng-Wei; Huang, Yu-Li

    2013-07-01

    In this study, we evaluated the presence and amount of Legionella in along a river in Taiwan, and the relations between seasonal distribution of Legionella spp. and geographic characteristics in the watershed were also evaluated. Water samples were pre-treated and analyzed with culture-confirmed and direct DNA extraction methods. For culture-confirmed method, water samples were cultivated through a series of selective media, and candidate colonies were confirmed by PCR. For direct DNA extraction method, direct DNA extraction was performed from pre-treated water samples. The DNA extracts were analyzed with PCR and DNA sequence analysis for species determination, quantitative PCR (qPCR) was performed to quantify Legionella concentration in the water sample. In all, 150 water samples were included in this study, with 73 (48.6%) water samples detected with Legionella spp., and 17 with L. pneumophila. Over 80% Legionella spp. detections were through direct DNA extraction method, but more than 80% L. pneumophila detections were through culture-confirmed method. While detection of Legionella spp. was done with two methods, positive results were found through only one method. Legionella spp. was detected in all seasons with detection rate ranging between 34.3-58.8% and seasonal average concentration from 1.9 × 102 to 7.1 × 103 CFU/L. Most of the L. pneumophila detections were from samples collected in fall (38.2%) and summer (6.0%), which also coincided with increased cases of Legionellosis reported through Center of Disease Control in Taiwan. The high prevalence and concentration of Legionella spp. and L. pneumophila in the surface waters should be further evaluated for potential health risks.

  6. Modification-dependent restriction endonuclease, MspJI, flips 5-methylcytosine out of the DNA helix

    DOE PAGES

    Horton, J. R.; Wang, H.; Mabuchi, M. Y.; ...

    2014-09-27

    MspJI belongs to a family of restriction enzymes that cleave DNA containing 5-methylcytosine (5mC) or 5-hydroxymethylcytosine (5hmC). MspJI is specific for the sequence 5(h)mC-N-N-G or A and cleaves with some variability 9/13 nucleotides downstream. Earlier, we reported the crystal structure of MspJI without DNA and proposed how it might recognize this sequence and catalyze cleavage. Here we report its co-crystal structure with a 27-base pair oligonucleotide containing 5mC. This structure confirms that MspJI acts as a homotetramer and that the modified cytosine is flipped from the DNA helix into an SRA-like-binding pocket. We expected the structure to reveal two DNAmore » molecules bound specifically to the tetramer and engaged with the enzyme's two DNA-cleavage sites. A coincidence of crystal packing precluded this organization, however. We found that each DNA molecule interacted with two adjacent tetramers, binding one specifically and the other non-specifically. The latter interaction, which prevented cleavage-site engagement, also involved base flipping and might represent the sequence-interrogation phase that precedes specific recognition. MspJI is unusual in that DNA molecules are recognized and cleaved by different subunits. Such interchange of function might explain how other complex multimeric restriction enzymes act.« less

  7. Isolation of Onchocerca lupi in Dogs and Black Flies, California, USA

    PubMed Central

    Hassan, Hassan K.; Bolcen, Shanna; Kubofcik, Joseph; Nutman, Thomas B.; Eberhard, Mark L.; Middleton, Kelly; Wekesa, Joseph Wakoli; Ruedas, Gimena; Nelson, Kimberly J.; Dubielzig, Richard; De Lombaert, Melissa; Silverman, Bruce; Schorling, Jamie J.; Adler, Peter H.; Beeler, Emily S.

    2015-01-01

    In southern California, ocular infections caused by Onchocerca lupi were diagnosed in 3 dogs (1 in 2006, 2 in 2012). The infectious agent was confirmed through morphologic analysis of fixed parasites in tissues and by PCR and sequencing of amplicons derived from 2 mitochondrially encoded genes and 1 nuclear-encoded gene. A nested PCR based on the sequence of the cytochrome oxidase subunit 1 gene of the parasite was developed and used to screen Simulium black flies collected from southern California for O. lupi DNA. Six (2.8%; 95% CI 0.6%–5.0%) of 213 black flies contained O. lupi DNA. Partial mitochondrial16S rRNA gene sequences from the infected flies matched sequences derived from black fly larvae cytotaxonomically identified as Simulium tribulatum. These data implicate S. tribulatum flies as a putative vector for O. lupi in southern California. PMID:25897954

  8. Burkholderia cordobensis sp. nov., from agricultural soils.

    PubMed

    Draghi, Walter O; Peeters, Charlotte; Cnockaert, Margo; Snauwaert, Cindy; Wall, Luis G; Zorreguieta, Angeles; Vandamme, Peter

    2014-06-01

    Two Gram-negative, rod-shaped bacteria were isolated from agricultural soils in Córdoba province in central Argentina. Their 16S rRNA gene sequences demonstrated that they belong to the genus Burkholderia, with Burkholderia zhejiangensis as most closely related formally named species; this relationship was confirmed through comparative gyrB sequence analysis. Whole-cell fatty acid analysis supported their assignment to the genus Burkholderia. Burkholderia sp. strain YI23, for which a whole-genome sequence is available, represents the same taxon, as demonstrated by its highly similar 16S rRNA (100% similarity) and gyrB (99.1-99.7%) gene sequences. The results of DNA-DNA hybridization experiments and physiological and biochemical characterization further substantiated the genotypic and phenotypic distinctiveness of the Argentinian soil isolates, for which the name Burkholderia cordobensis sp. nov. is proposed, with strain MMP81(T) ( = LMG 27620(T) = CCUG 64368(T)) as the type strain. © 2014 IUMS.

  9. DNA microarrays for identifying fishes.

    PubMed

    Kochzius, M; Nölte, M; Weber, H; Silkenbeumer, N; Hjörleifsdottir, S; Hreggvidsson, G O; Marteinsson, V; Kappel, K; Planes, S; Tinti, F; Magoulas, A; Garcia Vazquez, E; Turan, C; Hervet, C; Campo Falgueras, D; Antoniou, A; Landi, M; Blohm, D

    2008-01-01

    In many cases marine organisms and especially their diverse developmental stages are difficult to identify by morphological characters. DNA-based identification methods offer an analytically powerful addition or even an alternative. In this study, a DNA microarray has been developed to be able to investigate its potential as a tool for the identification of fish species from European seas based on mitochondrial 16S rDNA sequences. Eleven commercially important fish species were selected for a first prototype. Oligonucleotide probes were designed based on the 16S rDNA sequences obtained from 230 individuals of 27 fish species. In addition, more than 1200 sequences of 380 species served as sequence background against which the specificity of the probes was tested in silico. Single target hybridisations with Cy5-labelled, PCR-amplified 16S rDNA fragments from each of the 11 species on microarrays containing the complete set of probes confirmed their suitability. True-positive, fluorescence signals obtained were at least one order of magnitude stronger than false-positive cross-hybridisations. Single nontarget hybridisations resulted in cross-hybridisation signals at approximately 27% of the cases tested, but all of them were at least one order of magnitude lower than true-positive signals. This study demonstrates that the 16S rDNA gene is suitable for designing oligonucleotide probes, which can be used to differentiate 11 fish species. These data are a solid basis for the second step to create a "Fish Chip" for approximately 50 fish species relevant in marine environmental and fisheries research, as well as control of fisheries products.

  10. FragIdent--automatic identification and characterisation of cDNA-fragments.

    PubMed

    Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

    2009-03-02

    Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

  11. The recognition and modification sites for the bacterial type I restriction systems KpnAI, StySEAI, StySENI and StySGI

    PubMed Central

    Kasarjian, Julie K. A.; Hidaka, Masumi; Horiuchi, Takashi; Iida, Masatake; Ryu, Junichi

    2004-01-01

    Using an in vivo plasmid transformation method, we have determined the DNA sequences recognized by the KpnAI, StySEAI, StySENI and StySGI R-M systems from Klebsiella oxytoca strain M5a1, Salmonella eastbourne, Salmonella enteritidis and Salmonella gelsenkirchen, respectively. These type I restriction-modification systems were originally identified using traditional phage assay, and described here is the plasmid transformation test and computer program used to determine their DNA recognition sequences. For this test, we constructed two sets of plasmids, pL and pE, that contain phage lambda and Escherichia coli K-12 chromosomal DNA fragments, respectively. Further, using the methylation sensitivities of various known type II restriction enzymes, we identified the target adenines for methylation (listed in bold italics below as A or T in case of the complementary strand). The recognition sequence and methylation sites are GAA(6N)TGCC (KpnAI), ACA(6N)TYCA (StySEAI), CGA(6N)TACC (StySENI) and TAAC(7N)RTCG (StySGI). These DNA recognition sequences all have a typical type I bipartite pattern and represent three novel specificities and one isoschizomer (StySENI). For confirmation, oligonucleotides containing each of the predicted sequences were synthesized, cloned into plasmid pMECA and transformed into each strain, resulting in a large reduction in efficiency of transformation (EOT). PMID:15199175

  12. High-throughput engineering of a mammalian genome reveals building principles of methylation states at CG rich regions.

    PubMed

    Krebs, Arnaud R; Dessus-Babus, Sophie; Burger, Lukas; Schübeler, Dirk

    2014-09-26

    The majority of mammalian promoters are CpG islands; regions of high CG density that require protection from DNA methylation to be functional. Importantly, how sequence architecture mediates this unmethylated state remains unclear. To address this question in a comprehensive manner, we developed a method to interrogate methylation states of hundreds of sequence variants inserted at the same genomic site in mouse embryonic stem cells. Using this assay, we were able to quantify the contribution of various sequence motifs towards the resulting DNA methylation state. Modeling of this comprehensive dataset revealed that CG density alone is a minor determinant of their unmethylated state. Instead, these data argue for a principal role for transcription factor binding sites, a prediction confirmed by testing synthetic mutant libraries. Taken together, these findings establish the hierarchy between the two cis-encoded mechanisms that define the DNA methylation state and thus the transcriptional competence of CpG islands.

  13. The occurrence of Toxocara malaysiensis in cats in China, confirmed by sequence-based analyses of ribosomal DNA.

    PubMed

    Li, Ming-Wei; Zhu, Xing-Quan; Gasser, Robin B; Lin, Rui-Qing; Sani, Rehana A; Lun, Zhao-Rong; Jacobs, Dennis E

    2006-10-01

    Non-isotopic polymerase chain reaction (PCR)-based single-strand conformation polymorphism and sequence analyses of the second internal transcribed spacer (ITS-2) of nuclear ribosomal DNA (rDNA) were utilized to genetically characterise ascaridoids from dogs and cats from China by comparison with those from other countries. The study showed that Toxocara canis, Toxocara cati, and Toxascaris leonina from China were genetically the same as those from other geographical origins. Specimens from cats from Guangzhou, China, which were morphologically consistent with Toxocara malaysiensis, were the same genetically as those from Malaysia, with the exception of a polymorphism in the ITS-2 but no unequivocal sequence difference. This is the first report of T. malaysiensis in cats outside of Malaysia (from where it was originally described), supporting the proposal that this species has a broader geographical distribution. The molecular approach employed provides a powerful tool for elucidating the biology, epidemiology, and zoonotic significance of T. malaysiensis.

  14. [Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

    PubMed

    Harano, K; Harano, T; Kushida, Y; Ueda, S

    1991-08-01

    Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

  15. Pyrosequencing analysis for detection of a BRAFV600E mutation in an FNAB specimen of thyroid nodules.

    PubMed

    Kim, Suk Kyeong; Kim, Dong-Lim; Han, Hye Seung; Kim, Wan Seop; Kim, Seung Ja; Moon, Won Jin; Oh, Seo Young; Hwang, Tae Sook

    2008-06-01

    Fine-needle aspiration biopsy (FNAB) is the primary means of distinguishing benign from malignant and of guiding therapeutic intervention in thyroid nodules. However, 10% to 30% of cases with indeterminate cytology in FNAB need other diagnostic tools to refine diagnosis. We compared the pyrosequencing method with the conventional direct DNA sequencing analysis and investigated the usefulness of preoperative BRAF mutation analysis as an adjunct diagnostic tool with routine FNAB. A total of 103 surgically confirmed patients' FNA slides were recruited and DNA was extracted after atypical cells were scraped from the slides. BRAF mutation was analyzed by pyrosequencing and direct DNA sequencing. Sixty-three (77.8%) of 81 histopathologically diagnosed malignant nodules revealed positive BRAF mutation on pyrosequencing analysis. In detail, 63 (84.0%) of 75 papillary thyroid carcinoma (PTC) samples showed positive BRAF mutation, whereas 3 follicular thyroid carcinomas, 1 anaplastic carcinoma, 1 medullary thyroid carcinoma, and 1 metastatic lung carcinoma did not show BRAF mutation. None of 22 benign nodules had BRAF mutation in both pyrosequencing and direct DNA sequencing. Out of 27 thyroid nodules classified as 'indeterminate' on cytologic examination preoperatively, 21 (77.8%) cases turned out to be malignant: 18 PTCs (including 2 follicular variant types) and 3 follicular thyroid carcinomas. Among these, 13 (61.9%) classic PTCs had BRAF mutation. None of 6 benign nodules, including 3 follicular adenomas and 3 nodular hyperplasias, had BRAF mutation. Among 63 PTCs with positive BRAF mutation detected by pyrosequencing analysis, 3 cases did not show BRAF mutation by direct DNA sequencing. Although it was not statistically significant, pyrosequencing was superior to direct DNA sequencing in detecting the BRAF mutation of thyroid nodules (P=0.25). Detecting BRAF mutation by pyrosequencing is more sensitive, faster, and less expensive than direct DNA sequencing and is proposed as an adjunct diagnostic tool in evaluating thyroid nodules of indeterminate cytology.

  16. A Thiazole Coumarin (TC) Turn-On Fluorescence Probe for AT-Base Pair Detection and Multipurpose Applications in Different Biological Systems

    NASA Astrophysics Data System (ADS)

    Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.

    2014-09-01

    Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology.

  17. Impact of Somatic Mutations in the D-Loop of Mitochondrial DNA on the Survival of Oral Squamous Cell Carcinoma Patients

    PubMed Central

    Lin, Jin-Ching; Wang, Chen-Chi; Jiang, Rong-San; Wang, Wen-Yi; Liu, Shih-An

    2015-01-01

    Objectives The aim of this study was to investigate somatic mutations in the D-loop of mitochondrial DNA (mtDNA) and their impact on survival in oral squamous cell carcinoma patients. Materials and Methods Surgical specimen confirmed by pathological examination and corresponding non-cancerous tissues were collected from 120 oral squamous cell carcinoma patients. The sequence in the D-loop of mtDNA from non-cancerous tissues was compared with that from paired cancer samples and any sequence differences were recognized as somatic mutations. Results Somatic mutations in the D-loop of mtDNA were identified in 75 (62.5%) oral squamous cell carcinoma patients and most of them occurred in the poly-C tract. Although there were no significant differences in demographic and tumor-related features between participants with and without somatic mutation, the mutation group had a better survival rate (5 year disease-specific survival rate: 64.0% vs. 43.0%, P = 0.0266). Conclusion Somatic mutation in D-loop of mtDNA was associated with a better survival in oral squamous cell carcinoma patients. PMID:25906372

  18. A Thiazole Coumarin (TC) Turn-On Fluorescence Probe for AT-Base Pair Detection and Multipurpose Applications in Different Biological Systems

    PubMed Central

    Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.

    2014-01-01

    Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology. PMID:25252596

  19. Characterization of mtDNA variation in a cohort of South African paediatric patients with mitochondrial disease.

    PubMed

    van der Walt, Elizna M; Smuts, Izelle; Taylor, Robert W; Elson, Joanna L; Turnbull, Douglass M; Louw, Roan; van der Westhuizen, Francois H

    2012-06-01

    Mitochondrial disease can be attributed to both mitochondrial and nuclear gene mutations. It has a heterogeneous clinical and biochemical profile, which is compounded by the diversity of the genetic background. Disease-based epidemiological information has expanded significantly in recent decades, but little information is known that clarifies the aetiology in African patients. The aim of this study was to investigate mitochondrial DNA variation and pathogenic mutations in the muscle of diagnosed paediatric patients from South Africa. A cohort of 71 South African paediatric patients was included and a high-throughput nucleotide sequencing approach was used to sequence full-length muscle mtDNA. The average coverage of the mtDNA genome was 81±26 per position. After assigning haplogroups, it was determined that although the nature of non-haplogroup-defining variants was similar in African and non-African haplogroup patients, the number of substitutions were significantly higher in African patients. We describe previously reported disease-associated and novel variants in this cohort. We observed a general lack of commonly reported syndrome-associated mutations, which supports clinical observations and confirms general observations in African patients when using single mutation screening strategies based on (predominantly non-African) mtDNA disease-based information. It is finally concluded that this first extensive report on muscle mtDNA sequences in African paediatric patients highlights the need for a full-length mtDNA sequencing strategy, which applies to all populations where specific mutations is not present. This, in addition to nuclear DNA gene mutation and pathogenicity evaluations, will be required to better unravel the aetiology of these disorders in African patients.

  20. Classification of Plant Associated Bacteria Using RIF, a Computationally Derived DNA Marker

    PubMed Central

    Schneider, Kevin L.; Marrero, Glorimar; Alvarez, Anne M.; Presting, Gernot G.

    2011-01-01

    A DNA marker that distinguishes plant associated bacteria at the species level and below was derived by comparing six sequenced genomes of Xanthomonas, a genus that contains many important phytopathogens. This DNA marker comprises a portion of the dnaA replication initiation factor (RIF). Unlike the rRNA genes, dnaA is a single copy gene in the vast majority of sequenced bacterial genomes, and amplification of RIF requires genus-specific primers. In silico analysis revealed that RIF has equal or greater ability to differentiate closely related species of Xanthomonas than the widely used ribosomal intergenic spacer region (ITS). Furthermore, in a set of 263 Xanthomonas, Ralstonia and Clavibacter strains, the RIF marker was directly sequenced in both directions with a success rate approximately 16% higher than that for ITS. RIF frameworks for Xanthomonas, Ralstonia and Clavibacter were constructed using 682 reference strains representing different species, subspecies, pathovars, races, hosts and geographic regions, and contain a total of 109 different RIF sequences. RIF sequences showed subspecific groupings but did not place strains of X. campestris or X. axonopodis into currently named pathovars nor R. solanacearum strains into their respective races, confirming previous conclusions that pathovar and race designations do not necessarily reflect genetic relationships. The RIF marker also was sequenced for 24 reference strains from three genera in the Enterobacteriaceae: Pectobacterium, Pantoea and Dickeya. RIF sequences of 70 previously uncharacterized strains of Ralstonia, Clavibacter, Pectobacterium and Dickeya matched, or were similar to, those of known reference strains, illustrating the utility of the frameworks to classify bacteria below the species level and rapidly match unknown isolates to reference strains. The RIF sequence frameworks are available at the online RIF database, RIFdb, and can be queried for diagnostic purposes with RIF sequences obtained from unknown strains in both chromatogram and FASTA format. PMID:21533033

  1. A Novel Locomotion-based Validation Assay for Candidate Drugs Using Drosophila DYT1 Disease Model

    DTIC Science & Technology

    2013-11-01

    the genome using the same parental fly line, minimizing the effect of surrounding sequences and genetic variations on the ...locomotion and GTPC cyclrohydolase protein levels; (3) supplementation of dopamine can partially rescue the locomotion defects of Drosophila larvae...8217- GCGAACAACCAAAAAATCATTGAGATAATAAACTCCTCCATTAG-3’) to make dtorsin cDNA that lacks GAC (D307) (Fig. 1) respectively. After confirming mutated sequences , the insert was again

  2. Pantoea allii sp. nov., isolated from onion plants and seed.

    PubMed

    Brady, Carrie L; Goszczynska, Teresa; Venter, Stephanus N; Cleenwerck, Ilse; De Vos, Paul; Gitaitis, Ronald D; Coutinho, Teresa A

    2011-04-01

    Eight yellow-pigmented, Gram-negative, rod-shaped, oxidase-negative, motile, facultatively anaerobic bacteria were isolated from onion seed in South Africa and from an onion plant exhibiting centre rot symptoms in the USA. The isolates were assigned to the genus Pantoea on the basis of phenotypic and biochemical tests. 16S rRNA gene sequence analysis and multilocus sequence analysis (MLSA), based on gyrB, rpoB, infB and atpD sequences, confirmed the allocation of the isolates to the genus Pantoea. MLSA further indicated that the isolates represented a novel species, which was phylogenetically most closely related to Pantoea ananatis and Pantoea stewartii. Amplified fragment length polymorphism analysis also placed the isolates into a cluster separate from P. ananatis and P. stewartii. Compared with type strains of species of the genus Pantoea that showed >97 % 16S rRNA gene sequence similarity with strain BD 390(T), the isolates exhibited 11-55 % whole-genome DNA-DNA relatedness, which confirmed the classification of the isolates in a novel species. The most useful phenotypic characteristics for the differentiation of the isolates from their closest phylogenetic neighbours are production of acid from amygdalin and utilization of adonitol and sorbitol. A novel species, Pantoea allii sp. nov., is proposed, with type strain BD 390(T) ( = LMG 24248(T)).

  3. The perils of pathogen discovery: origin of a novel parvovirus-like hybrid genome traced to nucleic acid extraction spin columns.

    PubMed

    Naccache, Samia N; Greninger, Alexander L; Lee, Deanna; Coffey, Lark L; Phan, Tung; Rein-Weston, Annie; Aronsohn, Andrew; Hackett, John; Delwart, Eric L; Chiu, Charles Y

    2013-11-01

    Next-generation sequencing was used for discovery and de novo assembly of a novel, highly divergent DNA virus at the interface between the Parvoviridae and Circoviridae. The virus, provisionally named parvovirus-like hybrid virus (PHV), is nearly identical by sequence to another DNA virus, NIH-CQV, previously detected in Chinese patients with seronegative (non-A-E) hepatitis. Although we initially detected PHV in a wide range of clinical samples, with all strains sharing ∼99% nucleotide and amino acid identity with each other and with NIH-CQV, the exact origin of the virus was eventually traced to contaminated silica-binding spin columns used for nucleic acid extraction. Definitive confirmation of the origin of PHV, and presumably NIH-CQV, was obtained by in-depth analyses of water eluted through contaminated spin columns. Analysis of environmental metagenome libraries detected PHV sequences in coastal marine waters of North America, suggesting that a potential association between PHV and diatoms (algae) that generate the silica matrix used in the spin columns may have resulted in inadvertent viral contamination during manufacture. The confirmation of PHV/NIH-CQV as laboratory reagent contaminants and not bona fide infectious agents of humans underscores the rigorous approach needed to establish the validity of new viral genomes discovered by next-generation sequencing.

  4. Next-generation sequencing-based detection of circulating tumour DNA After allogeneic stem cell transplantation for lymphoma.

    PubMed

    Herrera, Alex F; Kim, Haesook T; Kong, Katherine A; Faham, Malek; Sun, Heather; Sohani, Aliyah R; Alyea, Edwin P; Carlton, Victoria E; Chen, Yi-Bin; Cutler, Corey S; Ho, Vincent T; Koreth, John; Kotwaliwale, Chitra; Nikiforow, Sarah; Ritz, Jerome; Rodig, Scott J; Soiffer, Robert J; Antin, Joseph H; Armand, Philippe

    2016-12-01

    Next-generation sequencing (NGS)-based circulating tumour DNA (ctDNA) detection is a promising monitoring tool for lymphoid malignancies. We evaluated whether the presence of ctDNA was associated with outcome after allogeneic haematopoietic stem cell transplantation (HSCT) in lymphoma patients. We studied 88 patients drawn from a phase 3 clinical trial of reduced-intensity conditioning HSCT in lymphoma. Conventional restaging and collection of peripheral blood samples occurred at pre-specified time points before and after HSCT and were assayed for ctDNA by sequencing of the immunoglobulin or T-cell receptor genes. Tumour clonotypes were identified in 87% of patients with adequate tumour samples. Sixteen of 19 (84%) patients with disease progression after HSCT had detectable ctDNA prior to progression at a median of 3·7 months prior to relapse/progression. Patients with detectable ctDNA 3 months after HSCT had inferior progression-free survival (PFS) (2-year PFS 58% vs. 84% in ctDNA-negative patients, P = 0·033). In multivariate models, detectable ctDNA was associated with increased risk of progression/death (Hazard ratio 3·9, P = 0·003) and increased risk of relapse/progression (Hazard ratio 10·8, P = 0·0006). Detectable ctDNA is associated with an increased risk of relapse/progression, but further validation studies are necessary to confirm these findings and determine the clinical utility of NGS-based minimal residual disease monitoring in lymphoma patients after HSCT. © 2016 John Wiley & Sons Ltd.

  5. Antibody recognition of melphalan adducts characterized using immobilized DNA: enhanced alkylation of G-Rich regions in cells compared to in vitro.

    PubMed

    McCartney, H; Martin, A M; Middleton, P G; Tilby, M J

    2001-01-01

    The bifunctional alkylating agent, melphalan, forms adducts on DNA that are recognized by two previously described monoclonal antibodies, MP5/73 and Amp4/42. Immunoreactivity to MP5/73 was lost when alkylated DNA was exposed to alkaline pH, while Amp4/42 only recognized the structures formed after the alkali treatment. Competitive enzyme-linked immunoadsorbent assays (ELISAs) indicated that in 0.01 and 0.1 M NaOH, loss of immunoreactivity to MP5/73 occurred with half-lives that were at least 2-fold longer than half-lives for gain of immunoreactivity to Amp4/42. This supported previously published evidence that Amp4/42 did not simply recognize all the products formed by alkali treatment of adducts that were initially recognized by MP5/73. Adducts recognized by MP5/73 on RNA were considerably more stable at 100 degrees C and pH 7 than adducts on DNA. This was consistent with the hypothesis that immunorecognition involved N7 guanine adducts and ruled out the involvement of phosphotriesters in immunoreactivity. Synthetic oligodeoxyribonucleotides, covalently immobilized onto 96-well plates, were reacted with melphalan and incubated for various periods with alkali, and then the levels of adducts recognized by each antibody in replicate wells were assayed by a direct binding ELISA. Adducts formed on oligodeoxyguanylic acid were recognized very weakly by Amp4/42, unlike other DNA sequences that were tested. Retention of immobilized DNA during alkali treatment was confirmed by immunoassay of cisplatin adducts. Poor recognition by Amp4/42 of adducts in oligodeoxyguanylic acid was confirmed by a competitive ELISA. Amp4/42, unlike MP5/73, efficiently recognized adducts resulting from alkylation of DNA with chlorambucil. It is concluded that the two antibodies recognized melphalan adducts in different DNA sequence environments and that this explains (a) the different alkali stability of immunoreactive adducts and (b) previous results which showed that, in DNA from melphalan-treated cells, adducts recognized by Amp4/42 formed a smaller proportion of total adducts compared to DNA alkylated in vitro. The results presented here indicate that this was caused by a marked cellular influence on the overall sequence-dependent pattern of DNA alkylation or repair.

  6. [The use of 16S rDNA sequencing in species diversity analysis for sputum of patients with ventilator-associated pneumonia].

    PubMed

    Yang, Xiaojun; Wang, Xiaohong; Liang, Zhijuan; Zhang, Xiaoya; Wang, Yanbo; Wang, Zhenhai

    2014-05-01

    To study the species and amount of bacteria in sputum of patients with ventilator-associated pneumonia (VAP) by using 16S rDNA sequencing analysis, and to explore the new method for etiologic diagnosis of VAP. Bronchoalveolar lavage sputum samples were collected from 31 patients with VAP. Bacterial DNA of the samples were extracted and identified by polymerase chain reaction (PCR). At the same time, sputum specimens were processed for routine bacterial culture. The high flux sequencing experiment was conducted on PCR positive samples with 16S rDNA macro genome sequencing technology, and sequencing results were analyzed using bioinformatics, then the results between the sequencing and bacteria culture were compared. (1) 550 bp of specific DNA sequences were amplified in sputum specimens from 27 cases of the 31 patients with VAP, and they were used for sequencing analysis. 103 856 sequences were obtained from those sputum specimens using 16S rDNA sequencing, yielding approximately 39 Mb of raw data. Tag sequencing was able to inform genus level in all 27 samples. (2) Alpha-diversity analysis showed that sputum samples of patients with VAP had significantly higher variability and richness in bacterial species (Shannon index values 1.20, Simpson index values 0.48). Rarefaction curve analysis showed that there were more species that were not detected by sequencing from some VAP sputum samples. (3) Analysis of 27 sputum samples with VAP by using 16S rDNA sequences yielded four phyla: namely Acitinobacteria, Bacteroidetes, Firmicutes, Proteobacteria. With genus as a classification, it was found that the dominant species included Streptococcus 88.9% (24/27), Limnohabitans 77.8% (21/27), Acinetobacter 70.4% (19/27), Sphingomonas 63.0% (17/27), Prevotella 63.0% (17/27), Klebsiella 55.6% (15/27), Pseudomonas 55.6% (15/27), Aquabacterium 55.6% (15/27), and Corynebacterium 55.6% (15/27). (4) Pyrophosphate sequencing discovered that Prevotella, Limnohabitans, Aquabacterium, Sphingomonas might not be detected by routine bacteria culture. Among seven species which were identified by both methods, pyrophosphate sequencing yielded higher positive rate than that of ordinary bacteria culture [Streptococcus: 88.9% (24/27) vs. 18.5% (5/27), Klebsiella: 55.6% (15/27) vs. 18.5% (5/27), Acinetobacter: 70.4% (19/27) vs. 37.0% (10/27), Corynebacterium: 55.6% (15/27) vs. 7.4% (2/27), P<0.05 or P<0.01]. Sequencing positive rate was found to increase positive rate for culture of Pseudomonas [55.6% (15/27) vs. 25.9% (7/27), P=0.050]. No significant differences were observed between sequencing and ordinary bacteria culture for detection Staphylococcus [7.4% (2/27) vs. 11.1% (3/27)] and Neisseria bacteria genera [18.5% (5/27) vs. 3.7% (1/27), both P>0.05]. 16S rDNA sequencing analysis confirmed that pathogenic bacteria in sputum of VAP were complicated with multiple drug resistant strains. Compared with routine bacterial culture, pyrophosphate sequencing had higher positive rate in detecting pathogens. 16S rDNA gene sequencing technology may become a new method for etiological diagnosis of VAP.

  7. Single-molecule dilution and multiple displacement amplification for molecular haplotyping.

    PubMed

    Paul, Philip; Apgar, Josh

    2005-04-01

    Separate haploid analysis is frequently required for heterozygous genotyping to resolve phase ambiguity or confirm allelic sequence. We demonstrate a technique of single-molecule dilution followed by multiple strand displacement amplification to haplotype polymorphic alleles. Dilution of DNA to haploid equivalency, or a single molecule, is a simple method for separating di-allelic DNA. Strand displacement amplification is a robust method for non-specific DNA expansion that employs random hexamers and phage polymerase Phi29 for double-stranded DNA displacement and primer extension, resulting in high processivity and exceptional product length. Single-molecule dilution was followed by strand displacement amplification to expand separated alleles to microgram quantities of DNA for more efficient haplotype analysis of heterozygous genes.

  8. Application of High-Throughput Next-Generation Sequencing for HLA Typing on Buccal Extracted DNA: Results from over 10,000 Donor Recruitment Samples

    PubMed Central

    Nguyen, David; Valenzuela, Nicole; Takemura, Ping; Bolon, Yung-Tsi; Springer, Brianna; Saito, Katsuyuki; Zheng, Ying; Hague, Tim; Pasztor, Agnes; Horvath, Gyorgy; Rigo, Krisztina; Reed, Elaine F.; Zhang, Qiuheng

    2016-01-01

    Background Unambiguous HLA typing is important in hematopoietic stem cell transplantation (HSCT), HLA disease association studies, and solid organ transplantation. However, current molecular typing methods only interrogate the antigen recognition site (ARS) of HLA genes, resulting in many cis-trans ambiguities that require additional typing methods to resolve. Here we report high-resolution HLA typing of 10,063 National Marrow Donor Program (NMDP) registry donors using long-range PCR by next generation sequencing (NGS) approach on buccal swab DNA. Methods Multiplex long-range PCR primers amplified the full-length of HLA class I genes (A, B, C) from promotor to 3’ UTR. Class II genes (DRB1, DQB1) were amplified from exon 2 through part of exon 4. PCR amplicons were pooled and sheared using Covaris fragmentation. Library preparation was performed using the Illumina TruSeq Nano kit on the Beckman FX automated platform. Each sample was tagged with a unique barcode, followed by 2×250 bp paired-end sequencing on the Illumina MiSeq. HLA typing was assigned using Omixon Twin software that combines two independent computational algorithms to ensure high confidence in allele calling. Consensus sequence and typing results were reported in Histoimmunogenetics Markup Language (HML) format. All homozygous alleles were confirmed by Luminex SSO typing and exon novelties were confirmed by Sanger sequencing. Results Using this automated workflow, over 10,063 NMDP registry donors were successfully typed under high-resolution by NGS. Despite known challenges of nucleic acid degradation and low DNA concentration commonly associated with buccal-based specimens, 97.8% of samples were successfully amplified using long-range PCR. Among these, 98.2% were successfully reported by NGS, with an accuracy rate of 99.84% in an independent blind Quality Control audit performed by the NDMP. In this study, NGS-HLA typing identified 23 null alleles (0.023%), 92 rare alleles (0.091%) and 42 exon novelties (0.042%). Conclusion Long-range, unambiguous HLA genotyping is achievable on clinical buccal swab-extracted DNA. Importantly, full-length gene sequencing and the ability to curate full sequence data will permit future interrogation of the impact of introns, expanded exons, and other gene regulatory sequences on clinical outcomes in transplantation. PMID:27798706

  9. Application of High-Throughput Next-Generation Sequencing for HLA Typing on Buccal Extracted DNA: Results from over 10,000 Donor Recruitment Samples.

    PubMed

    Yin, Yuxin; Lan, James H; Nguyen, David; Valenzuela, Nicole; Takemura, Ping; Bolon, Yung-Tsi; Springer, Brianna; Saito, Katsuyuki; Zheng, Ying; Hague, Tim; Pasztor, Agnes; Horvath, Gyorgy; Rigo, Krisztina; Reed, Elaine F; Zhang, Qiuheng

    2016-01-01

    Unambiguous HLA typing is important in hematopoietic stem cell transplantation (HSCT), HLA disease association studies, and solid organ transplantation. However, current molecular typing methods only interrogate the antigen recognition site (ARS) of HLA genes, resulting in many cis-trans ambiguities that require additional typing methods to resolve. Here we report high-resolution HLA typing of 10,063 National Marrow Donor Program (NMDP) registry donors using long-range PCR by next generation sequencing (NGS) approach on buccal swab DNA. Multiplex long-range PCR primers amplified the full-length of HLA class I genes (A, B, C) from promotor to 3' UTR. Class II genes (DRB1, DQB1) were amplified from exon 2 through part of exon 4. PCR amplicons were pooled and sheared using Covaris fragmentation. Library preparation was performed using the Illumina TruSeq Nano kit on the Beckman FX automated platform. Each sample was tagged with a unique barcode, followed by 2×250 bp paired-end sequencing on the Illumina MiSeq. HLA typing was assigned using Omixon Twin software that combines two independent computational algorithms to ensure high confidence in allele calling. Consensus sequence and typing results were reported in Histoimmunogenetics Markup Language (HML) format. All homozygous alleles were confirmed by Luminex SSO typing and exon novelties were confirmed by Sanger sequencing. Using this automated workflow, over 10,063 NMDP registry donors were successfully typed under high-resolution by NGS. Despite known challenges of nucleic acid degradation and low DNA concentration commonly associated with buccal-based specimens, 97.8% of samples were successfully amplified using long-range PCR. Among these, 98.2% were successfully reported by NGS, with an accuracy rate of 99.84% in an independent blind Quality Control audit performed by the NDMP. In this study, NGS-HLA typing identified 23 null alleles (0.023%), 92 rare alleles (0.091%) and 42 exon novelties (0.042%). Long-range, unambiguous HLA genotyping is achievable on clinical buccal swab-extracted DNA. Importantly, full-length gene sequencing and the ability to curate full sequence data will permit future interrogation of the impact of introns, expanded exons, and other gene regulatory sequences on clinical outcomes in transplantation.

  10. Brief Report: Cryopyrin-Associated Periodic Syndrome Caused by a Myeloid-Restricted Somatic NLRP3 Mutation.

    PubMed

    Zhou, Qing; Aksentijevich, Ivona; Wood, Geryl M; Walts, Avram D; Hoffmann, Patrycja; Remmers, Elaine F; Kastner, Daniel L; Ombrello, Amanda K

    2015-09-01

    To identify the cause of disease in an adult patient presenting with recent-onset fevers, chills, urticaria, fatigue, and profound myalgia, who was found to be negative for cryopyrin-associated periodic syndrome (CAPS) NLRP3 mutations by conventional Sanger DNA sequencing. We performed whole-exome sequencing and targeted deep sequencing using DNA from the patient's whole blood to identify a possible NLRP3 somatic mutation. We then screened for this mutation in subcloned NLRP3 amplicons from fibroblasts, buccal cells, granulocytes, negatively selected monocytes, and T and B lymphocytes and further confirmed the somatic mutation by targeted sequencing of exon 3. We identified a previously reported CAPS-associated mutation, p.Tyr570Cys, with a mutant allele frequency of 15% based on exome data. Targeted sequencing and subcloning of NLRP3 amplicons confirmed the presence of the somatic mutation in whole blood at a ratio similar to the exome data. The mutant allele frequency was in the range of 13.3-16.8% in monocytes and 15.2-18% in granulocytes. Notably, this mutation was either absent or present at a very low frequency in B and T lymphocytes, in buccal cells, and in the patient's cultured fibroblasts. Our findings indicate the possibility of myeloid-restricted somatic mosaicism in the pathogenesis of CAPS, underscoring the emerging role of massively parallel sequencing in clinical diagnosis. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.

  11. Whole-loop mitochondrial DNA D-loop sequence variability in Egyptian Arabian equine matrilines

    PubMed Central

    Hudson, William

    2017-01-01

    Background Egyptian Arabian horses have been maintained in a state of genetic isolation for over a hundred years. There is only limited genetic proof that the studbook records of female lines of Egyptian Arabian pedigrees are reliable. This study characterized the mitochondrial DNA (mtDNA) signatures of 126 horses representing 14 matrilines in the Egyptian Agricultural Organization (EAO) horse-breeding program. Findings Analysis of the whole D-loop sequence yielded additional information compared to hypervariable region-1 (HVR1) analysis alone, with 42 polymorphic sites representing ten haplotypes compared to 16 polymorphic sites representing nine haplotypes, respectively. Most EAO haplotypes belonged to ancient haplogroups, suggesting origin from a wide geographical area over many thousands of years, although one haplotype was novel. Conclusions Historical families share haplotypes and some individuals from different strains belonged to the same haplogroup: the classical EAO strain designation is not equivalent to modern monophyletic matrilineal groups. Phylogenetic inference showed that the foundation mares of the historical haplotypes were highly likely to have the same haplotypes as the animals studied (p > 0.998 in all cases), confirming the reliability of EAO studbook records and providing the opportunity for breeders to confirm the ancestry of their horses. PMID:28859174

  12. Brief communication: the Australian Barrineans and their relationship to Southeast Asian negritos: an investigation using mitochondrial genomics.

    PubMed

    McAllister, Peter; Nagle, Nano; Mitchell, Robert John

    2013-01-01

    The existence of a short-statured Aboriginal population in the Far North Queensland (FNQ) rainforest zone of Australia's northeast coast and Tasmania has long been an enigma in Australian anthropology. Based on their reduced stature and associated morphological traits such as tightly curled hair, Birdsell and Tindale proposed that these "Barrinean" peoples were closely related to "negrito" peoples of Southeast Asia and that their ancestors had been the original Pleistocene settlers of Sahul, eventually displaced by taller invaders. Subsequent craniometric and blood protein studies, however, have suggested an overall homogeneity of indigenous Australians, including Barrineans. To confirm this finding and determine the degree of relatedness between Barrinean people and Southeast Asian negritos, we compared indigenous Australian mitochondrial DNA (mtDNA) sequences in populations from the FNQ rainforest ecozone and Tasmania with sequences from other Australian Aboriginal populations and from Southeast Asian negrito populations (Philippines Batek and Mamanwa, and mainland Southeast Asian Jahai, Mendriq, and Batak). The results confirm that FNQ and Tasmanian mtDNA haplogroups cluster with those of other Australian Aboriginal populations and are only very distantly related to Southeast Asian negrito haplogroups. Copyright © 2013 Wayne State University Press, Detroit, Michigan 48201-1309.

  13. Detection of the Amphibian Chytrid Fungus Batrachochytrium dendrobatidis in Museum Specimens of Andean Aquatic Birds: Implications for Pathogen Dispersal.

    PubMed

    Burrowes, Patricia A; De la Riva, Ignacio

    2017-04-01

    The occurrence of the pathogenic chytrid fungus Batrachochytrium dendrobatidis (Bd) in the feet of live waterfowl has been documented, but the potential role of birds as dispersers has not been studied. We report the presence of Bd in the feet of preserved aquatic birds in the Bolivian high Andes during the time of drastic amphibian declines in the country. We sampled 48 aquatic birds from the Bolivian Andes that were preserved in museum collections. Birds were sampled for the presence of Bd DNA by swabbing, taking small pieces of tissue from toe webbing, or both. We detected Bd by DNA using quantitative PCR in 42% of the birds sampled via toe tissue pieces. This method was significantly better than swabbing at detecting Bd from bird feet. We confirmed Bd presence by sequencing Bd -positive samples and found 91-98% homology with Bd sequences from GenBank. Our study confirms that aquatic birds can carry Bd and thus may serve as potential vectors of this pathogen across large distances and complex landscapes. In addition, we recommend using DNA from preserved birds as a novel source of data to test hypotheses on the spread of chytridiomycosis in amphibians.

  14. GM2 Gangliosidosis in Shiba Inu Dogs with an In-Frame Deletion in HEXB.

    PubMed

    Kolicheski, A; Johnson, G S; Villani, N A; O'Brien, D P; Mhlanga-Mutangadura, T; Wenger, D A; Mikoloski, K; Eagleson, J S; Taylor, J F; Schnabel, R D; Katz, M L

    2017-09-01

    Consistent with a tentative diagnosis of neuronal ceroid lipofuscinosis (NCL), autofluorescent cytoplasmic storage bodies were found in neurons from the brains of 2 related Shiba Inu dogs with a young-adult onset, progressive neurodegenerative disease. Unexpectedly, no potentially causal NCL-related variants were identified in a whole-genome sequence generated with DNA from 1 of the affected dogs. Instead, the whole-genome sequence contained a homozygous 3 base pair (bp) deletion in a coding region of HEXB. The other affected dog also was homozygous for this 3-bp deletion. Mutations in the human HEXB ortholog cause Sandhoff disease, a type of GM2 gangliosidosis. Thin-layer chromatography confirmed that GM2 ganglioside had accumulated in an affected Shiba Inu brain. Enzymatic analysis confirmed that the GM2 gangliosidosis resulted from a deficiency in the HEXB encoded protein and not from a deficiency in products from HEXA or GM2A, which are known alternative causes of GM2 gangliosidosis. We conclude that the homozygous 3-bp deletion in HEXB is the likely cause of the Shiba Inu neurodegenerative disease and that whole-genome sequencing can lead to the early identification of potentially disease-causing DNA variants thereby refocusing subsequent diagnostic analyses toward confirming or refuting candidate variant causality. Copyright © 2017 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

  15. Cloning and expression of a nuclear encoded plastid specific 33 kDa ribonucleoprotein gene (33RNP) from pea that is light stimulated.

    PubMed

    Reddy, M K; Nair, S; Singh, B N; Mudgil, Y; Tewari, K K; Sopory, S K

    2001-01-24

    We report the cloning and sequencing of both cDNA and genomic DNA of a 33 kDa chloroplast ribonucleoprotein (33RNP) from pea. The analysis of the predicted amino acid sequence of the cDNA clone revealed that the encoded protein contains two RNA binding domains, including the conserved consensus ribonucleoprotein sequences CS-RNP1 and CS-RNP2, on the C-terminus half and the presence of a putative transit peptide sequence in the N-terminus region. The phylogenetic and multiple sequence alignment analysis of pea chloroplast RNP along with RNPs reported from the other plant sources revealed that the pea 33RNP is very closely related to Nicotiana sylvestris 31RNP and 28RNP and also to 31RNP and 28RNP of Arabidopsis and spinach, respectively. The pea 33RNP was expressed in Escherichia coli and purified to homogeneity. The in vitro import of precursor protein into chloroplasts confirmed that the N-terminus putative transit peptide is a bona fide transit peptide and 33RNP is localized in the chloroplast. The nucleic acid-binding properties of the recombinant protein, as revealed by South-Western analysis, showed that 33RNP has higher binding affinity for poly (U) and oligo dT than for ssDNA and dsDNA. The steady state transcript level was higher in leaves than in roots and the expression of this gene is light stimulated. Sequence analysis of the genomic clone revealed that the gene contains four exons and three introns. We have also isolated and analyzed the 5' flanking region of the pea 33RNP gene.

  16. TRX-LOGOS - a graphical tool to demonstrate DNA information content dependent upon backbone dynamics in addition to base sequence.

    PubMed

    Fortin, Connor H; Schulze, Katharina V; Babbitt, Gregory A

    2015-01-01

    It is now widely-accepted that DNA sequences defining DNA-protein interactions functionally depend upon local biophysical features of DNA backbone that are important in defining sites of binding interaction in the genome (e.g. DNA shape, charge and intrinsic dynamics). However, these physical features of DNA polymer are not directly apparent when analyzing and viewing Shannon information content calculated at single nucleobases in a traditional sequence logo plot. Thus, sequence logos plots are severely limited in that they convey no explicit information regarding the structural dynamics of DNA backbone, a feature often critical to binding specificity. We present TRX-LOGOS, an R software package and Perl wrapper code that interfaces the JASPAR database for computational regulatory genomics. TRX-LOGOS extends the traditional sequence logo plot to include Shannon information content calculated with regard to the dinucleotide-based BI-BII conformation shifts in phosphate linkages on the DNA backbone, thereby adding a visual measure of intrinsic DNA flexibility that can be critical for many DNA-protein interactions. TRX-LOGOS is available as an R graphics module offered at both SourceForge and as a download supplement at this journal. To demonstrate the general utility of TRX logo plots, we first calculated the information content for 416 Saccharomyces cerevisiae transcription factor binding sites functionally confirmed in the Yeastract database and matched to previously published yeast genomic alignments. We discovered that flanking regions contain significantly elevated information content at phosphate linkages than can be observed at nucleobases. We also examined broader transcription factor classifications defined by the JASPAR database, and discovered that many general signatures of transcription factor binding are locally more information rich at the level of DNA backbone dynamics than nucleobase sequence. We used TRX-logos in combination with MEGA 6.0 software for molecular evolutionary genetics analysis to visually compare the human Forkhead box/FOX protein evolution to its binding site evolution. We also compared the DNA binding signatures of human TP53 tumor suppressor determined by two different laboratory methods (SELEX and ChIP-seq). Further analysis of the entire yeast genome, center aligned at the start codon, also revealed a distinct sequence-independent 3 bp periodic pattern in information content, present only in coding region, and perhaps indicative of the non-random organization of the genetic code. TRX-LOGOS is useful in any situation in which important information content in DNA can be better visualized at the positions of phosphate linkages (i.e. dinucleotides) where the dynamic properties of the DNA backbone functions to facilitate DNA-protein interaction.

  17. Synchronous detection of ebolavirus conserved RNA sequences and ebolavirus-encoded miRNA-like fragment based on a zwitterionic copper (II) metal-organic framework.

    PubMed

    Qiu, Gui-Hua; Weng, Zi-Hua; Hu, Pei-Pei; Duan, Wen-Jun; Xie, Bao-Ping; Sun, Bin; Tang, Xiao-Yan; Chen, Jin-Xiang

    2018-04-01

    From a three-dimensional (3D) metal-organic framework (MOF) of {[Cu(Cmdcp)(phen)(H 2 O)] 2 ·9H 2 O} n (1, H 3 CmdcpBr = N-carboxymethyl-(3,5-dicarboxyl)pyridinium bromide, phen = phenanthroline), a sensitive and selective fluorescence sensor has been developed for the simultaneous detection of ebolavirus conserved RNA sequences and ebolavirus-encoded microRNA-like (miRNA-like) fragment. The results from molecular dynamics simulation confirmed that MOF 1 absorbs carboxyfluorescein (FAM)-tagged and 5(6)-carboxyrhodamine, triethylammonium salt (ROX)-tagged probe ss-DNA (probe DNA, P-DNA) by π … π stacking and hydrogen bonding, as well as additional electrostatic interactions to form a sensing platform of P-DNAs@1 with quenched FAM and ROX fluorescence. In the presence of targeted ebolavirus conserved RNA sequences or ebolavirus-encoded miRNA-like fragment, the fluorophore-labeled P-DNA hybridizes with the analyte to give a P-DNA@RNA duplex and released from MOF 1, triggering a fluorescence recovery. Simultaneous detection of two target RNAs has also been realized by single and synchronous fluorescence analysis. The formed sensing platform shows high sensitivity for ebolavirus conserved RNA sequences and ebolavirus-encoded miRNA-like fragment with detection limits at the picomolar level and high selectivity without cross-reaction between the two probes. MOF 1 thus shows the potential as an effective fluorescent sensing platform for the synchronous detection of two ebolavirus-related sequences, and offer improved diagnostic accuracy of Ebola virus disease. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Formation of cis-diamminedichloroplatinum(II) 1,2-intrastrand cross-links on DNA is flanking-sequence independent.

    PubMed

    Burstyn, J N; Heiger-Bernays, W J; Cohen, S M; Lippard, S J

    2000-11-01

    Mapping of cis-diamminedichloroplatinum(II) (cis-DDP, cisplatin) DNA adducts over >3000 nucleotides was carried out using a replication blockage assay. The sites of inhibition of modified T4 DNA polymerase, also referred to as stop sites, were analyzed to determine the effects of local sequence context on the distribution of intrastrand cisplatin cross-links. In a 3120 base fragment from replicative form M13mp18 DNA containing 24.6% guanine, 25.5% thymine, 26.9% adenine and 23.0% cytosine, 166 individual stop sites were observed at a bound platinum/nucleotide ratio of 1-2 per thousand. The majority of stop sites (90%) occurred at G(n>2) sequences and the remainder were located at sites containing an AG dinucleotide. For all of the GG sites present in the mapped sequences, including those with Gn(>)2, 89% blocked replication, whereas for the AG sites only 17% blocked replication. These blockage sites were independent of flanking nucleotides in a sequence of N(1)G*G*N(2) where N(1), N(2) = A, C, G, T and G*G* indicates a 1,2-intrastrand platinum cross-link. The absence of long-range sequence dependence was confirmed by monitoring the reaction of cisplatin with a plasmid containing an 800 bp insert of the human telomere repeat sequence (TTAGGG)(n). Platination reactions monitored at several formal platinum/nucleotide ratios or as a function of time reveal that the telomere insert was not preferentially damaged by cisplatin. Both replication blockage and telomere-insert plasmid platination experiments indicate that cisplatin 1,2-intrastrand adducts do not form preferentially at G-rich sequences in vitro.

  19. Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1).

    PubMed

    Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

    2017-12-01

    A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.

  20. Cytomegalovirus and BK-Virus co-infection of a clinically non-functioning adrenal adenoma: innocent bystanders or new pathogenetic agents?

    PubMed

    Pomara, G; Cappello, F; Barzon, L; Morelli, G; Rappa, F; Benvegna, L; Giannarini, G; Palù, G; Selli, C

    2006-01-01

    We report a case of a 64-year-old woman who underwent left adrenalectomy with removal of a 8,5 cm clinically non-functioning adrenocortical adenoma and a 4-cm myelolipoma. Molecular testing for viral infection demonstrated the presence of cytomegalovirus (CMV) DNA sequences in the adrenal adenoma, but not in the myelolipoma (confirmed by immunohistochemistry). Moreover, the adrenal adenoma was also positive for parvovirus B19, and both adrenal tumor samples were positive for polyomavirus BK (BKV) and adenovirus DNA sequences. This is the first report of co-infection of an adrenocortical adenoma by CMV and BKV. The role of these viruses in adrenal tumorigenesis was postulated.

  1. Integrating De Novo Transcriptome Assembly and Cloning to Obtain Chicken Ovocleidin-17 Full-Length cDNA

    PubMed Central

    Ning, ZhongHua; Hincke, Maxwell T.; Yang, Ning; Hou, ZhuoCheng

    2014-01-01

    Efficiently obtaining full-length cDNA for a target gene is the key step for functional studies and probing genetic variations. However, almost all sequenced domestic animal genomes are not ‘finished’. Many functionally important genes are located in these gapped regions. It can be difficult to obtain full-length cDNA for which only partial amino acid/EST sequences exist. In this study we report a general pipeline to obtain full-length cDNA, and illustrate this approach for one important gene (Ovocleidin-17, OC-17) that is associated with chicken eggshell biomineralization. Chicken OC-17 is one of the best candidates to control and regulate the deposition of calcium carbonate in the calcified eggshell layer. OC-17 protein has been purified, sequenced, and has had its three-dimensional structure solved. However, researchers still cannot conduct OC-17 mRNA related studies because the mRNA sequence is unknown and the gene is absent from the current chicken genome. We used RNA-Seq to obtain the entire transcriptome of the adult hen uterus, and then conducted de novo transcriptome assembling with bioinformatics analysis to obtain candidate OC-17 transcripts. Based on this sequence, we used RACE and PCR cloning methods to successfully obtain the full-length OC-17 cDNA. Temporal and spatial OC-17 mRNA expression analyses were also performed to demonstrate that OC-17 is predominantly expressed in the adult hen uterus during the laying cycle and barely at immature developmental stages. Differential uterine expression of OC-17 was observed in hens laying eggs with weak versus strong eggshell, confirming its important role in the regulation of eggshell mineralization and providing a new tool for genetic selection for eggshell quality parameters. This study is the first one to report the full-length OC-17 cDNA sequence, and builds a foundation for OC-17 mRNA related studies. We provide a general method for biologists experiencing difficulty in obtaining candidate gene full-length cDNA sequences. PMID:24676480

  2. Integrating de novo transcriptome assembly and cloning to obtain chicken Ovocleidin-17 full-length cDNA.

    PubMed

    Zhang, Quan; Liu, Long; Zhu, Feng; Ning, ZhongHua; Hincke, Maxwell T; Yang, Ning; Hou, ZhuoCheng

    2014-01-01

    Efficiently obtaining full-length cDNA for a target gene is the key step for functional studies and probing genetic variations. However, almost all sequenced domestic animal genomes are not 'finished'. Many functionally important genes are located in these gapped regions. It can be difficult to obtain full-length cDNA for which only partial amino acid/EST sequences exist. In this study we report a general pipeline to obtain full-length cDNA, and illustrate this approach for one important gene (Ovocleidin-17, OC-17) that is associated with chicken eggshell biomineralization. Chicken OC-17 is one of the best candidates to control and regulate the deposition of calcium carbonate in the calcified eggshell layer. OC-17 protein has been purified, sequenced, and has had its three-dimensional structure solved. However, researchers still cannot conduct OC-17 mRNA related studies because the mRNA sequence is unknown and the gene is absent from the current chicken genome. We used RNA-Seq to obtain the entire transcriptome of the adult hen uterus, and then conducted de novo transcriptome assembling with bioinformatics analysis to obtain candidate OC-17 transcripts. Based on this sequence, we used RACE and PCR cloning methods to successfully obtain the full-length OC-17 cDNA. Temporal and spatial OC-17 mRNA expression analyses were also performed to demonstrate that OC-17 is predominantly expressed in the adult hen uterus during the laying cycle and barely at immature developmental stages. Differential uterine expression of OC-17 was observed in hens laying eggs with weak versus strong eggshell, confirming its important role in the regulation of eggshell mineralization and providing a new tool for genetic selection for eggshell quality parameters. This study is the first one to report the full-length OC-17 cDNA sequence, and builds a foundation for OC-17 mRNA related studies. We provide a general method for biologists experiencing difficulty in obtaining candidate gene full-length cDNA sequences.

  3. Sequence of the cDNA of a human dihydrodiol dehydrogenase isoform (AKR1C2) and tissue distribution of its mRNA.

    PubMed Central

    Shiraishi, H; Ishikura, S; Matsuura, K; Deyashiki, Y; Ninomiya, M; Sakai, S; Hara, A

    1998-01-01

    Human liver contains three isoforms (DD1, DD2 and DD4) of dihydrodiol dehydrogenase with 20alpha- or 3alpha-hydroxysteroid dehydrogenase activity; the dehydrogenases belong to the aldo-oxo reductase (AKR) superfamily. cDNA species encoding DD1 and DD4 have been identified. However, four cDNA species with more than 99% sequence identity have been cloned and are compatible with a partial amino acid sequence of DD2. In this study we have isolated a cDNA clone encoding DD2, which was confirmed by comparison of the properties of the recombinant and hepatic enzymes. This cDNA showed differences of one, two, four and five nucleotides from the previously reported four cDNA species for a dehydrogenase of human colon carcinoma HT29 cells, human prostatic 3alpha-hydroxysteroid dehydrogenase, a human liver 3alpha-hydroxysteroid dehydrogenase-like protein and chlordecone reductase-like protein respectively. Expression of mRNA species for the five similar cDNA species in 20 liver samples and 10 other different tissue samples was examined by reverse transcriptase-mediated PCR with specific primers followed by diagnostic restriction with endonucleases. All the tissues expressed only one mRNA species corresponding to the newly identified cDNA for DD2: mRNA transcripts corresponding to the other cDNA species were not detected. We suggest that the new cDNA is derived from the principal gene for DD2, which has been named AKR1C2 by a new nomenclature for the AKR superfamily. It is possible that some of the other cDNA species previously reported are rare allelic variants of this gene. PMID:9716498

  4. Genome sequence determination and metagenomic characterization of a Dehalococcoides mixed culture grown on cis-1,2-dichloroethene.

    PubMed

    Yohda, Masafumi; Yagi, Osami; Takechi, Ayane; Kitajima, Mizuki; Matsuda, Hisashi; Miyamura, Naoaki; Aizawa, Tomoko; Nakajima, Mutsuyasu; Sunairi, Michio; Daiba, Akito; Miyajima, Takashi; Teruya, Morimi; Teruya, Kuniko; Shiroma, Akino; Shimoji, Makiko; Tamotsu, Hinako; Juan, Ayaka; Nakano, Kazuma; Aoyama, Misako; Terabayashi, Yasunobu; Satou, Kazuhito; Hirano, Takashi

    2015-07-01

    A Dehalococcoides-containing bacterial consortium that performed dechlorination of 0.20 mM cis-1,2-dichloroethene to ethene in 14 days was obtained from the sediment mud of the lotus field. To obtain detailed information of the consortium, the metagenome was analyzed using the short-read next-generation sequencer SOLiD 3. Matching the obtained sequence tags with the reference genome sequences indicated that the Dehalococcoides sp. in the consortium was highly homologous to Dehalococcoides mccartyi CBDB1 and BAV1. Sequence comparison with the reference sequence constructed from 16S rRNA gene sequences in a public database showed the presence of Sedimentibacter, Sulfurospirillum, Clostridium, Desulfovibrio, Parabacteroides, Alistipes, Eubacterium, Peptostreptococcus and Proteocatella in addition to Dehalococcoides sp. After further enrichment, the members of the consortium were narrowed down to almost three species. Finally, the full-length circular genome sequence of the Dehalococcoides sp. in the consortium, D. mccartyi IBARAKI, was determined by analyzing the metagenome with the single-molecule DNA sequencer PacBio RS. The accuracy of the sequence was confirmed by matching it to the tag sequences obtained by SOLiD 3. The genome is 1,451,062 nt and the number of CDS is 1566, which includes 3 rRNA genes and 47 tRNA genes. There exist twenty-eight RDase genes that are accompanied by the genes for anchor proteins. The genome exhibits significant sequence identity with other Dehalococcoides spp. throughout the genome, but there exists significant difference in the distribution RDase genes. The combination of a short-read next-generation DNA sequencer and a long-read single-molecule DNA sequencer gives detailed information of a bacterial consortium. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  5. Developmentally programmed DNA splicing in Paramecium reveals short-distance crosstalk between DNA cleavage sites

    PubMed Central

    Gratias, Ariane; Lepère, Gersende; Garnier, Olivier; Rosa, Sarah; Duharcourt, Sandra; Malinsky, Sophie; Meyer, Eric; Bétermier, Mireille

    2008-01-01

    Somatic genome assembly in the ciliate Paramecium involves the precise excision of thousands of short internal eliminated sequences (IESs) that are scattered throughout the germline genome and often interrupt open reading frames. Excision is initiated by double-strand breaks centered on the TA dinucleotides that are conserved at each IES boundary, but the factors that drive cleavage site recognition remain unknown. A degenerate consensus was identified previously at IES ends and genetic analyses confirmed the participation of their nucleotide sequence in efficient excision. Even for wild-type IESs, however, variant excision patterns (excised or nonexcised) may be inherited maternally through sexual events, in a homology-dependent manner. We show here that this maternal epigenetic control interferes with the targeting of DNA breaks at IES ends. Furthermore, we demonstrate that a mutation in the TA at one end of an IES impairs DNA cleavage not only at the mutant end but also at the wild-type end. We conclude that crosstalk between both ends takes place prior to their cleavage and propose that the ability of an IES to adopt an excision-prone conformation depends on the combination of its nucleotide sequence and of additional determinants. PMID:18420657

  6. A comparative study on the interaction of acridine and synthetic bis-acridine with G-quadruplex structure.

    PubMed

    Nagesh, Narayana; Krishnaiah, Abburi

    2003-07-31

    DNA from the telomeres contains a stretch of simple tandemly repeated sequences in which clusters of G residues alternate with clusters of T/A sequences along one DNA strand. Model telomeric G-clusters form four-stranded structures in presence of Na(I), K(I) and NH(4)(I) ions. Electrophoretic and spectroscopic studies were made with the telomeric related sequences d(T6G16) or d(G4T2G4T2G4T2G4). It was noticed earlier that G-quadruplex may either be inter-molecular, or intra-molecular, or a mixture of both. CD spectral characteristics of various G-quadruplex DNA suggests that the CD maximum at 293 nm corresponds to that of an intra-molecular G-quadruplex structure or hairpin dimers. Fluorescence titration studies also show that acridine and the bis-acridine are interacting with G-quadruplex DNA and destabilize the K(I)-quadruplex structure more efficiently than the quadruplex formed by NH(4)(I) ion. Among the two drugs studied, acridine is more capable of breaking the G-quadruplex structure than bis-acridine. This result is further confirmed by the CD experiments.

  7. First detection of bovine papillomavirus type 2 in cutaneous wart lesions from ovines.

    PubMed

    Mazzuchelli-de-Souza, J; de Carvalho, R F; Módolo, D G; Thompson, C E; Araldi, R P; Stocco, R C

    2018-05-03

    This study diagnosed cutaneous wart lesions excised from three rams from a sheep farm in São Paulo State, Brazil. Histopathologically, these cases were diagnosed as papilloma. The amplification by PCR, sequencing and bioinformatics analysis showed that all the lesions presented DNA sequences of bovine papillomavirus type 2. This is the first report confirming the detection of BPV2 in papilloma warts from ovines. © 2018 Blackwell Verlag GmbH.

  8. Accurate and sensitive quantification of protein-DNA binding affinity.

    PubMed

    Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J

    2018-04-17

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.

  9. Accurate and sensitive quantification of protein-DNA binding affinity

    PubMed Central

    Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.

    2018-01-01

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332

  10. Fine Dissection of Human Mitochondrial DNA Haplogroup HV Lineages Reveals Paleolithic Signatures from European Glacial Refugia

    PubMed Central

    Sarno, Stefania; Sevini, Federica; Vianello, Dario; Tamm, Erika; Metspalu, Ene; van Oven, Mannis; Hübner, Alexander; Sazzini, Marco; Franceschi, Claudio; Pettener, Davide; Luiselli, Donata

    2015-01-01

    Genetic signatures from the Paleolithic inhabitants of Eurasia can be traced from the early divergent mitochondrial DNA lineages still present in contemporary human populations. Previous studies already suggested a pre-Neolithic diffusion of mitochondrial haplogroup HV*(xH,V) lineages, a relatively rare class of mtDNA types that includes parallel branches mainly distributed across Europe and West Asia with a certain degree of structure. Up till now, variation within haplogroup HV was addressed mainly by analyzing sequence data from the mtDNA control region, except for specific sub-branches, such as HV4 or the widely distributed haplogroups H and V. In this study, we present a revised HV topology based on full mtDNA genome data, and we include a comprehensive dataset consisting of 316 complete mtDNA sequences including 60 new samples from the Italian peninsula, a previously underrepresented geographic area. We highlight points of instability in the particular topology of this haplogroup, reconstructed with BEAST-generated trees and networks. We also confirm a major lineage expansion that probably followed the Late Glacial Maximum and preceded Neolithic population movements. We finally observe that Italy harbors a reservoir of mtDNA diversity, with deep-rooting HV lineages often related to sequences present in the Caucasus and the Middle East. The resulting hypothesis of a glacial refugium in Southern Italy has implications for the understanding of late Paleolithic population movements and is discussed within the archaeological cultural shifts occurred over the entire continent. PMID:26640946

  11. Chromosomal organization of four classes of repetitive DNA sequences in killifish Orestias ascotanensis Parenti, 1984 (Cyprinodontiformes, Cyprinodontidae)

    PubMed Central

    Araya-Jaime, Cristian; Lam, Natalia; Pinto, Irma Vila; Méndez, Marco A.; Iturra, Patricia

    2017-01-01

    Abstract Orestias Valenciennes, 1839 is a genus of freshwater fish endemic to the South American Altiplano. Cytogenetic studies of these species have focused on conventional karyotyping. The aim of this study was to use classical and molecular cytogenetic methods to identify the constitutive heterochromatin distribution and chromosome organization of four classes of repetitive DNA sequences (histone H3 DNA, U2 snRNA, 18S rDNA and 5S rDNA) in the chromosomes of O. ascotanensis Parenti, 1984, an endemic species restricted to the Salar de Ascotán in the Chilean Altiplano. All individuals analyzed had a diploid number of 48 chromosomes. C-banding identified constitutive heterochromatin mainly in the pericentromeric region of most chromosomes, especially a GC-rich heterochromatic block of the short arm of pair 3. FISH assay with an 18S probe confirmed the location of the NOR in pair 3 and revealed that the minor rDNA cluster occurs interstitially on the long arm of pair 2. Dual FISH identified a single block of U2 snDNA sequences in the pericentromeric regions of a subtelocentric chromosome pair, while histone H3 sites were observed as small signals scattered in throughout the all chromosomes. This work represents the first effort to document the physical organization of the repetitive fraction of the Orestias genome. These data will improve our understanding of the chromosomal evolution of a genus facing serious conservation problems. PMID:29093798

  12. The campaign to DNA barcode all fishes, FISH-BOL.

    PubMed

    Ward, R D; Hanner, R; Hebert, P D N

    2009-02-01

    FISH-BOL, the Fish Barcode of Life campaign, is an international research collaboration that is assembling a standardized reference DNA sequence library for all fishes. Analysis is targeting a 648 base pair region of the mitochondrial cytochrome c oxidase I (COI) gene. More than 5000 species have already been DNA barcoded, with an average of five specimens per species, typically vouchers with authoritative identifications. The barcode sequence from any fish, fillet, fin, egg or larva can be matched against these reference sequences using BOLD; the Barcode of Life Data System (http://www.barcodinglife.org). The benefits of barcoding fishes include facilitating species identification, highlighting cases of range expansion for known species, flagging previously overlooked species and enabling identifications where traditional methods cannot be applied. Results thus far indicate that barcodes separate c. 98 and 93% of already described marine and freshwater fish species, respectively. Several specimens with divergent barcode sequences have been confirmed by integrative taxonomic analysis as new species. Past concerns in relation to the use of fish barcoding for species discrimination are discussed. These include hybridization, recent radiations, regional differentiation in barcode sequences and nuclear copies of the barcode region. However, current results indicate these issues are of little concern for the great majority of specimens.

  13. Identification of the sequence variations of 15 autosomal STR loci in a Chinese population.

    PubMed

    Chen, Wenjing; Cheng, Jianding; Ou, Xueling; Chen, Yong; Tong, Dayue; Sun, Hongyu

    2014-01-01

    DNA sequence variation including base(s) changes and insertion or deletion in the primer binding region may cause a null allele and, if this changes the length of the amplified fragment out of the allelic ladder, off-ladder (OL) alleles may be detected. In order to provide accurate and reliable DNA evidence for forensic DNA analysis, it is essential to clarify sequence variations in prevalently used STR loci. Suspected null alleles and OL alleles of PlowerPlex16® System from 21,934 unrelated Chinese individuals were verified by alternative systems and sequenced. A total of 17 cases with null alleles were identified, including 12 kinds of point mutations in 16 cases and a 19-base deletion in one case. The total frequency of null alleles was 7.751 × 10(-4). Eight hundred and forty-four OL alleles classified as being of 97 different kinds were observed at 15 STR loci of the PowerPlex®16 system except vWA. All the frequencies of OL alleles were under 0.01. Null alleles should be confirmed by alternative primers and OL alleles should be named appropriately. Particular attention should be paid to sequence variation, since incorrect designation could lead to false conclusions.

  14. Validation of the high-throughput marker technology DArT using the model plant Arabidopsis thaliana.

    PubMed

    Wittenberg, Alexander H J; van der Lee, Theo; Cayla, Cyril; Kilian, Andrzej; Visser, Richard G F; Schouten, Henk J

    2005-08-01

    Diversity Arrays Technology (DArT) is a microarray-based DNA marker technique for genome-wide discovery and genotyping of genetic variation. DArT allows simultaneous scoring of hundreds of restriction site based polymorphisms between genotypes and does not require DNA sequence information or site-specific oligonucleotides. This paper demonstrates the potential of DArT for genetic mapping by validating the quality and molecular basis of the markers, using the model plant Arabidopsis thaliana. Restriction fragments from a genomic representation of the ecotype Landsberg erecta (Ler) were amplified by PCR, individualized by cloning and spotted onto glass slides. The arrays were then hybridized with labeled genomic representations of the ecotypes Columbia (Col) and Ler and of individuals from an F(2) population obtained from a Col x Ler cross. The scoring of markers with specialized software was highly reproducible and 107 markers could unambiguously be ordered on a genetic linkage map. The marker order on the genetic linkage map coincided with the order on the DNA sequence map. Sequencing of the Ler markers and alignment with the available Col genome sequence confirmed that the polymorphism in DArT markers is largely a result of restriction site polymorphisms.

  15. The importance of multilocus sequence typing: cautionary tales from the bacterium Xylella fastidiosa.

    PubMed

    Nunney, L; Elfekih, S; Stouthamer, R

    2012-05-01

    Microbial identification methods have evolved rapidly over the last few decades. One such method is multilocus sequence typing (MLST). MLST is a powerful tool for understanding the evolutionary dynamics of pathogens and to gain insight into their genetic diversity. We illustrate the importance of accurate typing by reporting on three problems that have arisen in the study of a single bacterial species, the plant pathogen Xylella fastidiosa. Two of these were particularly serious since they concerned contamination of important research material that has had detrimental consequences for Xylella research: the contamination of DNA used in the sequencing of an X. fastidiosa genome (Ann-1) with DNA from another X. fastidiosa strain, and the unrecognized mislabeling of a strain (Temecula1) distributed from a culture collection (ATCC). We advocate the routine use of MLST to define strains maintained in culture collections and emphasize the importance of confirming the purity of DNA submitted for sequencing. We also present a third example that illustrates the value of MLST in guiding the choice of taxonomic types. Beyond these situations, there is a strong case for MLST whenever an isolate is used experimentally, especially where genotypic differences are suspected to influence the outcome.

  16. ☆DNA assembly technique simplifies the construction of infectious clone of fowl adenovirus.

    PubMed

    Zou, Xiao-Hui; Bi, Zhi-Xiang; Guo, Xiao-Juan; Zhang, Zun; Zhao, Yang; Wang, Min; Zhu, Ya-Lu; Jie, Hong-Ying; Yu, Yang; Hung, Tao; Lu, Zhuo-Zhuang

    2018-07-01

    Plasmid bearing adenovirus genome is generally constructed with the method of homologous recombination in E. coli BJ5183 strain. Here, we utilized Gibson gene assembly technique to generate infectious clone of fowl adenovirus 4 (FAdV-4). Primers flanked with partial inverted terminal repeat (ITR) sequence of FAdV-4 were synthesized to amplify a plasmid backbone containing kanamycin-resistant gene and pBR322 origin (KAN-ORI). DNA assembly was carried out by combining the KAN-ORI fragment, virus genomic DNA and DNA assembly master mix. E. coli competent cells were transformed with the assembled product, and plasmids (pKFAV4) were extracted and confirmed to contain viral genome by restriction analysis and sequencing. Virus was successfully rescued from linear pKFAV4-transfected chicken LMH cells. This approach was further verified in cloning of human adenovirus 5 genome. Our results indicated that DNA assembly technique simplified the construction of infectious clone of adenovirus, suggesting its possible application in virus traditional or reverse genetics. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

    PubMed

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

    2010-08-18

    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  18. CaMV-35S promoter sequence-specific DNA methylation in lettuce.

    PubMed

    Okumura, Azusa; Shimada, Asahi; Yamasaki, Satoshi; Horino, Takuya; Iwata, Yuji; Koizumi, Nozomu; Nishihara, Masahiro; Mishiba, Kei-ichiro

    2016-01-01

    We found 35S promoter sequence-specific DNA methylation in lettuce. Additionally, transgenic lettuce plants having a modified 35S promoter lost methylation, suggesting the modified sequence is subjected to the methylation machinery. We previously reported that cauliflower mosaic virus 35S promoter-specific DNA methylation in transgenic gentian (Gentiana triflora × G. scabra) plants occurs irrespective of the copy number and the genomic location of T-DNA, and causes strong gene silencing. To confirm whether 35S-specific methylation can occur in other plant species, transgenic lettuce (Lactuca sativa L.) plants with a single copy of the 35S promoter-driven sGFP gene were produced and analyzed. Among 10 lines of transgenic plants, 3, 4, and 3 lines showed strong, weak, and no expression of sGFP mRNA, respectively. Bisulfite genomic sequencing of the 35S promoter region showed hypermethylation at CpG and CpWpG (where W is A or T) sites in 9 of 10 lines. Gentian-type de novo methylation pattern, consisting of methylated cytosines at CpHpH (where H is A, C, or T) sites, was also observed in the transgenic lettuce lines, suggesting that lettuce and gentian share similar methylation machinery. Four of five transgenic lettuce lines having a single copy of a modified 35S promoter, which was modified in the proposed core target of de novo methylation in gentian, exhibited 35S hypomethylation, indicating that the modified sequence may be the target of the 35S-specific methylation machinery.

  19. Filling reference gaps via assembling DNA barcodes using high-throughput sequencing-moving toward barcoding the world.

    PubMed

    Liu, Shanlin; Yang, Chentao; Zhou, Chengran; Zhou, Xin

    2017-12-01

    Over the past decade, biodiversity researchers have dedicated tremendous efforts to constructing DNA reference barcodes for rapid species registration and identification. Although analytical cost for standard DNA barcoding has been significantly reduced since early 2000, further dramatic reduction in barcoding costs is unlikely because Sanger sequencing is approaching its limits in throughput and chemistry cost. Constraints in barcoding cost not only led to unbalanced barcoding efforts around the globe, but also prevented high-throughput sequencing (HTS)-based taxonomic identification from applying binomial species names, which provide crucial linkages to biological knowledge. We developed an Illumina-based pipeline, HIFI-Barcode, to produce full-length Cytochrome c oxidase subunit I (COI) barcodes from pooled polymerase chain reaction amplicons generated by individual specimens. The new pipeline generated accurate barcode sequences that were comparable to Sanger standards, even for different haplotypes of the same species that were only a few nucleotides different from each other. Additionally, the new pipeline was much more sensitive in recovering amplicons at low quantity. The HIFI-Barcode pipeline successfully recovered barcodes from more than 78% of the polymerase chain reactions that didn't show clear bands on the electrophoresis gel. Moreover, sequencing results based on the single molecular sequencing platform Pacbio confirmed the accuracy of the HIFI-Barcode results. Altogether, the new pipeline can provide an improved solution to produce full-length reference barcodes at about one-tenth of the current cost, enabling construction of comprehensive barcode libraries for local fauna, leading to a feasible direction for DNA barcoding global biomes. © The Authors 2017. Published by Oxford University Press.

  20. Interaction of the E. coli DNA G:T-mismatch endonuclease (vsr protein) with oligonucleotides containing its target sequence.

    PubMed

    Turner, D P; Connolly, B A

    2000-12-15

    The Escherichia coli vsr endonuclease recognises G:T base-pair mismatches in double-stranded DNA and initiates a repair pathway by hydrolysing the phosphate group 5' to the incorrectly paired T. The enzyme shows a preference for G:T mismatches within a particular sequence context, derived from the recognition site of the E. coli dcm DNA-methyltransferase (CC[A/T]GG). Thus, the preferred substrate for the vsr protein is (CT[A/T]GG), where the underlined T is opposed by a dG base. This paper provides quantitative data for the interaction of the vsr protein with a number of oligonucleotides containing G:T mismatches. Evaluation of specificity constant (k(st)/K(D); k(st)=rate constant for single turnover, K(D)=equilibrium dissociation constant) confirms vsr's preference for a G:T mismatch within a hemi-methylated dcm sequence, i.e. the best substrate is a duplex (both strands written in the 5'-3' orientation) composed of CT[A/T]GG and C(5Me)C[T/A]GG. Conversion of the mispaired T (underlined) to dU or the d(5Me)C to dC gave poorer substrates. No interaction was observed with oligonucleotides that lacked a G:T mismatch or did not possess a dcm sequence. An analysis of the fraction of active protein, by "reverse-titration" (i.e. adding increasing amounts of DNA to a fixed amount of protein followed by gel-mobility shift analysis) showed that less than 1% of the vsr endonuclease was able to bind to the substrate. This was confirmed using "competitive titrations" (where competitor oligonucleotides are used to displace a (32)P-labelled nucleic acid from the vsr protein) and burst kinetic analysis. This result is discussed in the light of previous in vitro and in vivo data which indicate that the MutL protein may be needed for full vsr activity. Copyright 2000 Academic Press.

  1. Constructing and detecting a cDNA library for mites.

    PubMed

    Hu, Li; Zhao, YaE; Cheng, Juan; Yang, YuanJun; Li, Chen; Lu, ZhaoHui

    2015-10-01

    RNA extraction and construction of complementary DNA (cDNA) library for mites have been quite challenging due to difficulties in acquiring tiny living mites and breaking their hard chitin. The present study is to explore a better method to construct cDNA library for mites that will lay the foundation on transcriptome and molecular pathogenesis research. We selected Psoroptes cuniculi as an experimental subject and took the following steps to construct and verify cDNA library. First, we combined liquid nitrogen grinding with TRIzol for total RNA extraction. Then, switching mechanism at 5' end of the RNA transcript (SMART) technique was used to construct full-length cDNA library. To evaluate the quality of cDNA library, the library titer and recombination rate were calculated. The reliability of cDNA library was detected by sequencing and analyzing positive clones and genes amplified by specific primers. The results showed that the RNA concentration was 836 ng/μl and the absorbance ratio at 260/280 nm was 1.82. The library titer was 5.31 × 10(5) plaque-forming unit (PFU)/ml and the recombination rate was 98.21%, indicating that the library was of good quality. In the 33 expressed sequence tags (ESTs) of P. cuniculi, two clones of 1656 and 1658 bp were almost identical with only three variable sites detected, which had an identity of 99.63% with that of Psoroptes ovis, indicating that the cDNA library was reliable. Further detection by specific primers demonstrated that the 553-bp Pso c II gene sequences of P. cuniculi had an identity of 98.56% with those of P. ovis, confirming that the cDNA library was not only reliable but also feasible.

  2. A Crystallographic Study of the Role of Sequence Context in Thymine Glycol Bypass by a Replicative DNA Polymerase Serendipitously Sheds Light on the Exonuclease Complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aller, Pierre; Duclos, Stéphanie; Wallace, Susan S.

    2012-06-27

    Thymine glycol (Tg) is the most common oxidation product of thymine and is known to be a strong block to replicative DNA polymerases. A previously solved structure of the bacteriophage RB69 DNA polymerase (RB69 gp43) in complex with Tg in the sequence context 5'-G-Tg-G shed light on how Tg blocks primer elongation: The protruding methyl group of the oxidized thymine displaces the adjacent 5'-G, which can no longer serve as a template for primer elongation [Aller, P., Rould, M. A., Hogg, M, Wallace, S. S. and Doublie S. (2007). A structural rationale for stalling of a replicative DNA polymerase atmore » the most common oxidative thymine lesion, thymine glycol. Proc. Natl. Acad. Sci. USA, 104, 814-818.]. Several studies showed that in the sequence context 5'-C-Tg-purine, Tg is more likely to be bypassed by Klenow fragment, an A-family DNA polymerase. We set out to investigate the role of sequence context in Tg bypass in a B-family polymerase and to solve the crystal structures of the bacteriophage RB69 DNA polymerase in complex with Tg-containing DNA in the three remaining sequence contexts: 5'-A-Tg-G, 5'-T-Tg-G, and 5'-C-Tg-G. A combination of several factors - including the associated exonuclease activity, the nature of the 3' and 5' bases surrounding Tg, and the cis-trans interconversion of Tg - influences Tg bypass. We also visualized for the first time the structure of a well-ordered exonuclease complex, allowing us to identify and confirm the role of key residues (Phe123, Met256, and Tyr257) in strand separation and in the stabilization of the primer strand in the exonuclease site.« less

  3. Mycobacterium smegmatis strain for detection of Mycobacterium tuberculosis by PCR used as internal control for inhibition of amplification and for quantification of bacteria.

    PubMed Central

    Kolk, A H; Noordhoek, G T; de Leeuw, O; Kuijper, S; van Embden, J D

    1994-01-01

    For the detection of Mycobacterium tuberculosis by PCR, the IS6110 sequence was used. A modified target was constructed by insertion of 56 nucleotides in the IS6110 insertion element of Mycobacterium bovis BCG. This modified insertion sequence was integrated into the genome of Mycobacterium smegmatis, a mycobacterium species which does not contain the IS6110 element. When DNA from the modified M. smegmatis 1008 strain was amplified with IS6110-specific primers INS1 and INS2, a band of 301 bp was seen on agarose gel, whereas the PCR product of M. tuberculosis complex DNA was a 245-bp fragment with these primers. The addition of a small number of M. smegmatis 1008 cells to clinical samples before DNA purification enables the detection of problems which may be due to the loss of DNA in the isolation procedure or to the presence of inhibitors. The presence of inhibitors of the amplification reaction can be confirmed by the addition of M. smegmatis 1008 DNA after the DNA isolation procedure. Furthermore, competition between the different target DNAs of M. smegmatis 1008 DNA and M. tuberculosis complex DNA enables the estimation of the number of IS6110 elements in the clinical sample. Images PMID:8051267

  4. First Detection of Leishmania tropica DNA and Trypanosoma Species in Sergentomyia Sand Flies (Diptera: Psychodidae) from an Outbreak Area of Cutaneous Leishmaniasis in Ghana

    PubMed Central

    Nzelu, Chukwunonso O.; Kato, Hirotomo; Puplampu, Naiki; Desewu, Kwame; Odoom, Shirley; Wilson, Michael D.; Sakurai, Tatsuya; Katakura, Ken; Boakye, Daniel A.

    2014-01-01

    Background Leishmania major and an uncharacterized species have been reported from human patients in a cutaneous leishmaniasis (CL) outbreak area in Ghana. Reports from the area indicate the presence of anthropophilic Sergentomyia species that were found with Leishmania DNA. Methodology/Principal Findings In this study, we analyzed the Leishmania DNA positive sand fly pools by PCR-RFLP and ITS1 gene sequencing. The trypanosome was determined using the SSU rRNA gene sequence. We observed DNA of L. major, L. tropica and Trypanosoma species to be associated with the sand fly infections. This study provides the first detection of L. tropica DNA and Trypanosoma species as well as the confirmation of L. major DNA within Sergentomyia sand flies in Ghana and suggests that S. ingrami and S. hamoni are possible vectors of CL in the study area. Conclusions/Significance The detection of L. tropica DNA in this CL focus is a novel finding in Ghana as well as West Africa. In addition, the unexpected infection of Trypanosoma DNA within S. africana africana indicates that more attention is necessary when identifying parasitic organisms by PCR within sand fly vectors in Ghana and other areas where leishmaniasis is endemic. PMID:24516676

  5. Structure of the Mecl Repressor from Staphylococcus aureus in Complex with the Cognate DNA Operator of mec

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Safo,M.; Ko, T.; Musayev, F.

    The dimeric repressor MecI regulates the mecA gene that encodes the penicillin-binding protein PBP-2a in methicillin-resistant Staphylococcus aureus (MRSA). MecI is similar to BlaI, the repressor for the blaZ gene of {beta}-lactamase. MecI and BlaI can bind to both operator DNA sequences. The crystal structure of MecI in complex with the 32 base-pair cognate DNA of mec was determined to 3.8 Angstroms resolution. MecI is a homodimer and each monomer consists of a compact N-terminal winged-helix domain, which binds to DNA, and a loosely packed C-terminal helical domain, which intertwines with its counter-monomer. The crystal contains horizontal layers of virtualmore » DNA double helices extending in three directions, which are separated by perpendicular DNA segments. Each DNA segment is bound to two MecI dimers. Similar to the BlaI-mec complex, but unlike the MecI-bla complex, the MecI repressors bind to both sides of the mec DNA dyad that contains four conserved sequences of TACA/TGTA. The results confirm the up-and-down binding to the mec operator, which may account for cooperative effect of the repressor.« less

  6. Stable isotope probing of acetate fed anaerobic batch incubations shows a partial resistance of acetoclastic methanogenesis catalyzed by Methanosarcina to sudden increase of ammonia level.

    PubMed

    Hao, Liping; Lü, Fan; Mazéas, Laurent; Desmond-Le Quéméner, Elie; Madigou, Céline; Guenne, Angéline; Shao, Liming; Bouchez, Théodore; He, Pinjing

    2015-02-01

    Ammonia inhibition represents a major operational issue for anaerobic digestion. In order to refine our understanding of the terminal catabolic steps in thermophilic anaerobic digestion under ammonia stress, we studied batch thermophilic acetate fed experiments at low (0.26 g L(-1)) and high (7.00 g L(-1)) Total Ammonia Nitrogen concentrations (TAN). Although methane production started immediately for all incubations and resulted in methane yields close to stoichiometric expectations, a 62-72% decrease of methanogenic rate was observed throughout the incubation at 7.00 g L(-1) of TAN compared to 0.26 g L(-1). Stable Isotope Probing analysis of active microbial communities in (13)C-acetate fed experiments coupled to automated ribosomal intergenic spacer analysis and 16S rDNA pyrotag sequencing confirmed that microbial communities were similar for both TAN conditions. At both TAN levels, the (13)C-labeled bacterial community was mainly affiliated to Clostridia-relatives, with OPB54 bacteria being the most abundant sequence in the heavy DNA 16S rDNA pyrotag library. Sequences closely related to Methanosarcina thermophila were also abundantly retrieved in the heavy DNA fractions, showing that this methanogen was still actively assimilating labeled carbon from acetate at free ammonia nitrogen concentrations up to 916 mg L(-1). Stable isotopic signature analysis of biogas, measured in unlabeled acetate fed experiments that were conducted in parallel, confirmed that acetoclastic methanogenic pathway was dominant at both ammonia concentrations. Our work demonstrates that, besides the syntrophic acetate oxidation pathway, acetoclastic methanogenesis catalyzed by Methanosarcina can also play a major role in methane production at high ammonia levels. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Universal multiplex PCR and CE for quantification of SMN1/SMN2 genes in spinal muscular atrophy.

    PubMed

    Wang, Chun-Chi; Chang, Jan-Gowth; Jong, Yuh-Jyh; Wu, Shou-Mei

    2009-04-01

    We established a universal multiplex PCR and CE to calculate the copy number of survival motor neuron (SMN1 and SMN2) genes for clinical screening of spinal muscular atrophy (SMA). In this study, one universal fluorescent primer was designed and applied for multiplex PCR of SMN1, SMN2 and two internal standards (CYBB and KRIT1). These amplicons were separated by conformation sensitive CE. Mixture of hydroxyethyl cellulose and hydroxypropyl cellulose were used in this CE system. Our method provided the potential to separate two 390-bp PCR products that differ in a single nucleotide. Differentiation and quantification of SMN1 and SMN2 are essential for clinical screening of SMA patients and carriers. The DNA samples included 22 SMA patients, 45 parents of SMA patients (obligatory carriers) and 217 controls. For evaluating accuracy, those 284 samples were blind-analyzed by this method and denaturing high pressure liquid chromatography (DHPLC). Eight of the total samples showed different results. Among them, two samples were diagnosed as having only SMN2 gene by DHPLC, however, they contained both SMN1 and SMN2 by our method. They were further confirmed by DNA sequencing. Our method showed good agreement with the DNA sequencing. The multiplex ligation-dependent probe amplification (MLPA) was used for confirming the other five samples, and showed the same results with our CE method. For only one sample, our CE showed different results with MLPA and DNA sequencing. One out of 284 samples (0.35%) belonged to mismatching. Our method provided a better accurate method and convenient method for clinical genotyping of SMA disease.

  8. Aberrant DNA methylation of WNT pathway genes in the development and progression of CIMP-negative colorectal cancer.

    PubMed

    Galamb, Orsolya; Kalmár, Alexandra; Péterfia, Bálint; Csabai, István; Bodor, András; Ribli, Dezső; Krenács, Tibor; Patai, Árpád V; Wichmann, Barnabás; Barták, Barbara Kinga; Tóth, Kinga; Valcz, Gábor; Spisák, Sándor; Tulassay, Zsolt; Molnár, Béla

    2016-08-02

    The WNT signaling pathway has an essential role in colorectal carcinogenesis and progression, which involves a cascade of genetic and epigenetic changes. We aimed to analyze DNA methylation affecting the WNT pathway genes in colorectal carcinogenesis in promoter and gene body regions using whole methylome analysis in 9 colorectal cancer, 15 adenoma, and 6 normal tumor adjacent tissue (NAT) samples by methyl capture sequencing. Functional methylation was confirmed on 5-aza-2'-deoxycytidine-treated colorectal cancer cell line datasets. In parallel with the DNA methylation analysis, mutations of WNT pathway genes (APC, β-catenin/CTNNB1) were analyzed by 454 sequencing on GS Junior platform. Most differentially methylated CpG sites were localized in gene body regions (95% of WNT pathway genes). In the promoter regions, 33 of the 160 analyzed WNT pathway genes were differentially methylated in colorectal cancer vs. normal, including hypermethylated AXIN2, CHP1, PRICKLE1, SFRP1, SFRP2, SOX17, and hypomethylated CACYBP, CTNNB1, MYC; 44 genes in adenoma vs. NAT; and 41 genes in colorectal cancer vs. adenoma comparisons. Hypermethylation of AXIN2, DKK1, VANGL1, and WNT5A gene promoters was higher, while those of SOX17, PRICKLE1, DAAM2, and MYC was lower in colon carcinoma compared to adenoma. Inverse correlation between expression and methylation was confirmed in 23 genes, including APC, CHP1, PRICKLE1, PSEN1, and SFRP1. Differential methylation affected both canonical and noncanonical WNT pathway genes in colorectal normal-adenoma-carcinoma sequence. Aberrant DNA methylation appears already in adenomas as an early event of colorectal carcinogenesis.

  9. The virome of the arbuscular mycorrhizal fungus Gigaspora margarita reveals the first report of DNA fragments corresponding to replicating non-retroviral RNA viruses in fungi.

    PubMed

    Turina, Massimo; Ghignone, Stefano; Astolfi, Nausicaa; Silvestri, Alessandro; Bonfante, Paola; Lanfranco, Luisa

    2018-02-02

    Arbuscular Mycorrhizal Fungi (AMF) are key components of the plant microbiota. AMF genetic complexity is increased by the presence of endobacteria, which live inside many species. A further component of such complexity is the virome associated to AMF, whose knowledge is still very limited. Here, by exploiting transcriptomic data we describe the virome of Gigaspora margarita. A BLAST search for viral RNA-dependent RNA polymerases sequences allowed the identification of four mitoviruses, one Ourmia-like narnavirus, one Giardia-like virus, and two sequences related to Fusarium graminearum mycoviruses. Northern blot and RT-PCR confirmed the authenticity of all the sequences with the exception of the F. graminearum-related ones. All the mitoviruses are replicative and functional since both positive strand and negative strand RNA are present. The abundance of the viral RNA molecules is not regulated by the presence or absence of Candidatus Glomeribacter gigasporarum, the endobacterium hosted by G. margarita, with the exception of the Ourmia-like sequence which is absent in bacteria-cured spores. In addition, we report, for the first time, DNA fragments corresponding to mitovirus sequences associated to the presence of viral RNA. These sequences are not integrated in the mitochondrial DNA and preliminary evidence seems to exclude integration in the nuclear genome. © 2018 Society for Applied Microbiology and John Wiley & Sons Ltd.

  10. Sequence preservation of osteocalcin protein and mitochondrial DNA in bison bones older than 55 ka

    NASA Astrophysics Data System (ADS)

    Nielsen-Marsh, Christina M.; Ostrom, Peggy H.; Gandhi, Hasand; Shapiro, Beth; Cooper, Alan; Hauschka, Peter V.; Collins, Matthew J.

    2002-12-01

    We report the first complete sequences of the protein osteocalcin from small amounts (20 mg) of two bison bone (Bison priscus) dated to older than 55.6 ka and older than 58.9 ka. Osteocalcin was purified using new gravity columns (never exposed to protein) followed by microbore reversed-phase high-performance liquid chromatography. Sequencing of osteocalcin employed two methods of matrix-assisted laser desorption ionization mass spectrometry (MALDI-MS): peptide mass mapping (PMM) and post-source decay (PSD). The PMM shows that ancient and modern bison osteocalcin have the same mass to charge (m/z) distribution, indicating an identical protein sequence and absence of diagenetic products. This was confirmed by PSD of the m/z 2066 tryptic peptide (residues 1 19); the mass spectra from ancient and modern peptides were identical. The 129 mass unit difference in the molecular ion between cow (Bos taurus) and bison is caused by a single amino-acid substitution between the taxa (Trp in cow is replaced by Gly in bison at residue 5). Bison mitochondrial control region DNA sequences were obtained from the older than 55.6 ka fossil. These results suggest that DNA and protein sequences can be used to directly investigate molecular phylogenies over a considerable time period, the absolute limit of which is yet to be determined.

  11. GST-PRIME: an algorithm for genome-wide primer design.

    PubMed

    Leister, Dario; Varotto, Claudio

    2007-01-01

    The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

  12. Lactobacillus apodemi sp. nov., a tannase-producing species isolated from wild mouse faeces.

    PubMed

    Osawa, Ro; Fujisawa, Tomohiko; Pukall, Rüdiger

    2006-07-01

    A Gram-positive, rod-shaped, non-endospore-forming bacterium, strain ASB1(T), able to degrade tannin, was isolated from faeces of the Japanese large wood mouse, Apodemus speciosus. Comparative analysis of the 16S rRNA gene sequence revealed that the strain could be assigned as a member of the genus Lactobacillus. The nearest phylogenetic neighbours were determined as Lactobacillus animalis DSM 20602(T) (98.9 % 16S rRNA gene sequence similarity) and Lactobacillus murinus ASF 361 (98.9 %). Subsequent polyphasic analysis, including automated ribotyping and DNA-DNA hybridization experiments, confirmed that the isolate represents a novel species, for which the name Lactobacillus apodemi sp. nov. is proposed. The DNA G+C content of the novel strain is 38.5 mol%. The cell-wall peptidoglycan is of type A4alpha L-lys-D-asp. The type strain is ASB1(T) (=DSM 16634(T)=CIP 108913(T)).

  13. Phylogenetic patterns in populations of Chilean species of the genus Orestias (Teleostei: Cyprinodontidae): results of mitochondrial DNA analysis.

    PubMed

    Lüssen, Arne; Falk, Thomas M; Villwock, Wolfgang

    2003-10-01

    Patterns of molecular genetic differentiation among taxa of the "agassii species complex" (Parenti, 1984) were analysed based on partial mtDNA control region sequences. Special attention has been paid to Chilean populations of Orestias agassii and species from isolated lakes of northern Chile, e.g., O. agassii, Orestias chungarensis, Orestias parinacotensis, Orestias laucaensis, and Orestias ascotanensis. Orestias tschudii, Orestias luteus, and Orestias ispi were analysed comparatively. Our findings support the utility of mtDNA control region sequences for phylogenetic studies within the "agassii species complex" and confirmed the monophyly of this particular lineage, excluding O. luteus. However, the monophyly of further morphologically defined lineages within the "agassii complex" appears doubtful. No support was found for the utility of these data sets for inferring phylogenetic relationships between more distantly related taxa originating from Lake Titicaca.

  14. Whole-comparative genomic hybridization in domestic sheep (Ovis aries) breeds.

    PubMed

    Dávila-Rodríguez, M I; Cortés-Gutiérrez, E I; López-Fernández, C; Pita, M; Mezzanotte, R; Gosálvez, J

    2009-01-01

    Whole-comparative genomic hybridization (W-CGH) allows identification of chromosomal polymorphisms related to highly repetitive DNA sequences localized in constitutive heterochromatin. Such polymorphisms are detected establishing competition between genomic DNAs in an in situ hybridization environment without subtraction of highly repetitive DNA sequences, when comparing two species from closely related taxa (same species, sub-species, or breeds) or somewhat related taxa. This experimental approach was applied to investigating differences in highly repetitive sequences of three sheep breeds (Castellana, Ojalada, and Assaf). To this end, W-CGH was carried out using mouflon (sheep ancestor) chromosomes as a common target to co-hybridize equimolar quantities of two genomic DNAs obtained from either Castellana, Ojalada or Assaf sheep breeds. The results showed that the amount of constitutive heterochromatin is greater in all pericentromeric heterochromatin regions of acrocentric chromosomes than in metacentric or sex chromosomes. Additionally, when W-CGH was performed using DNAs from the Iberian breeds Castellana and Ojalada, chromosomal pericentromeric regions revealed quantitatively and qualitatively a presence of DNA families similar to that obtained from any of the above-cited breeds. On the contrary, when the DNA used in W-CGH experiments was obtained from Assaf, as compared to either Castellana or Ojalada, two different pericentromeric DNA families of highly repetitive sequences could be detected. Lastly, sex chromosomes were shown to be homogeneous among all breeds and thus revealed no detectable constitutive heterochromatin. W-CGH results were confirmed using DNA breakage detection-FISH experiments (DBD-FISH) carried out on lymphocytes. As a whole, the results showed that two different repetitive DNA families are present in the pericentromeric heterochromatin of the sheep breeds studied here. Additionally, they suggest a differential presence of these distinct repetitive DNA families in Castellana and Ojalada breeds as compared to the Assaf breed. Finally, the results of W-CGH after using mouflon as the targeted chromosomes also show that the two DNA families are present in the ancestor. Copyright 2009 S. Karger AG, Basel.

  15. Comparison of a conventional and nested PCR for diagnostic confirmation and genotyping of Orientia tsutsugamushi.

    PubMed

    Janardhanan, Jeshina; Prakash, John Antony Jude; Abraham, Ooriapadickal C; Varghese, George M

    2014-05-01

    A nested polymerase chain reaction (PCR) targeting the 56-kDa antigen gene is currently the most commonly used molecular technique for confirmation of scrub typhus and genotyping of Orientia tsutsugamushi. In this study, we have compared the commonly used nested PCR (N-PCR) with a single-step conventional PCR (C-PCR) for amplification and genotyping. Eschar samples collected from 24 patients with scrub typhus confirmed by IgM enzyme-linked immunosorbent assay were used for DNA extraction following which amplifications were carried out using nested and C-PCR methods. The amplicons were sequenced and compared to other sequences in the database using BLAST. Conventional PCR showed a high positivity rate of 95.8% compared to the 75% observed using N-PCR. On sequence analysis, the N-PCR amplified region showed more variation among strains than the C-PCR amplified region. The C-PCR, which is more economical, provided faster and better results compared to N-PCR. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. footprintDB: a database of transcription factors with annotated cis elements and binding interfaces.

    PubMed

    Sebastian, Alvaro; Contreras-Moreira, Bruno

    2014-01-15

    Traditional and high-throughput techniques for determining transcription factor (TF) binding specificities are generating large volumes of data of uneven quality, which are scattered across individual databases. FootprintDB integrates some of the most comprehensive freely available libraries of curated DNA binding sites and systematically annotates the binding interfaces of the corresponding TFs. The first release contains 2422 unique TF sequences, 10 112 DNA binding sites and 3662 DNA motifs. A survey of the included data sources, organisms and TF families was performed together with proprietary database TRANSFAC, finding that footprintDB has a similar coverage of multicellular organisms, while also containing bacterial regulatory data. A search engine has been designed that drives the prediction of DNA motifs for input TFs, or conversely of TF sequences that might recognize input regulatory sequences, by comparison with database entries. Such predictions can also be extended to a single proteome chosen by the user, and results are ranked in terms of interface similarity. Benchmark experiments with bacterial, plant and human data were performed to measure the predictive power of footprintDB searches, which were able to correctly recover 10, 55 and 90% of the tested sequences, respectively. Correctly predicted TFs had a higher interface similarity than the average, confirming its diagnostic value. Web site implemented in PHP,Perl, MySQL and Apache. Freely available from http://floresta.eead.csic.es/footprintdb.

  17. Cell-free circulating tumour DNA as a liquid biopsy in breast cancer.

    PubMed

    De Mattos-Arruda, Leticia; Caldas, Carlos

    2016-03-01

    Recent developments in massively parallel sequencing and digital genomic techniques support the clinical validity of cell-free circulating tumour DNA (ctDNA) as a 'liquid biopsy' in human cancer. In breast cancer, ctDNA detected in plasma can be used to non-invasively scan tumour genomes and quantify tumour burden. The applications for ctDNA in plasma include identifying actionable genomic alterations, monitoring treatment responses, unravelling therapeutic resistance, and potentially detecting disease progression before clinical and radiological confirmation. ctDNA may be used to characterise tumour heterogeneity and metastasis-specific mutations providing information to adapt the therapeutic management of patients. In this article, we review the current status of ctDNA as a 'liquid biopsy' in breast cancer. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  18. Massively Parallel Sequencing Detected a Mutation in the MFN2 Gene Missed by Sanger Sequencing Due to a Primer Mismatch on an SNP Site.

    PubMed

    Neupauerová, Jana; Grečmalová, Dagmar; Seeman, Pavel; Laššuthová, Petra

    2016-05-01

    We describe a patient with early onset severe axonal Charcot-Marie-Tooth disease (CMT2) with dominant inheritance, in whom Sanger sequencing failed to detect a mutation in the mitofusin 2 (MFN2) gene because of a single nucleotide polymorphism (rs2236057) under the PCR primer sequence. The severe early onset phenotype and the family history with severely affected mother (died after delivery) was very suggestive of CMT2A and this suspicion was finally confirmed by a MFN2 mutation. The mutation p.His361Tyr was later detected in the patient by massively parallel sequencing with a gene panel for hereditary neuropathies. According to this information, new primers for amplification and sequencing were designed which bind away from the polymorphic sites of the patient's DNA. Sanger sequencing with these new primers then confirmed the heterozygous mutation in the MFN2 gene in this patient. This case report shows that massively parallel sequencing may in some rare cases be more sensitive than Sanger sequencing and highlights the importance of accurate primer design which requires special attention. © 2016 John Wiley & Sons Ltd/University College London.

  19. Molecular characterization of Fasciola gigantica from Mauritania based on mitochondrial and nuclear ribosomal DNA sequences.

    PubMed

    Amor, Nabil; Farjallah, Sarra; Salem, Mohamed; Lamine, Dia Mamadou; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine

    2011-10-01

    Fasciolosis caused by Fasciola hepatica and Fasciola gigantica (Platyhelminthes: Trematoda: Digenea) is considered the most important helminth infection of ruminants in tropical countries, causing considerable socioeconomic problems. From Africa, F. gigantica has been previously characterized from Burkina Faso, Senegal, Kenya, Zambia and Mali, while F. hepatica has been reported from Morocco and Tunisia, and both species have been observed from Ethiopia and Egypt on the basis of morphometric differences, while the use of molecular markers is necessary to distinguish exactly between species. Samples identified morphologically as F. gigantica (n=60) from sheep and cattle from different geographical localities of Mauritania were genetically characterized by sequences of the first (ITS-1), the 5.8S, and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA) genes and the mitochondrial Cytochrome c Oxidase I (COI) gene. Comparison of the sequences of the Mauritanian samples with sequences of Fasciola spp. from GenBank confirmed that all samples belong to the species F. gigantica. The nucleotide sequencing of ITS rDNA of F. gigantica showed no nucleotide variation in the ITS-1, 5.8S, and ITS-2 rDNA sequences among all samples examined and those from Burkina Faso, Kenya, Egypt and Iran. The phylogenetic trees based on the ITS-1 and ITS-2 sequences showed a close relationship of the Mauritanian samples with isolates of F. gigantica from different localities of Africa and Asia. The COI genotypes of the Mauritanian specimens of F. gigantica had a high level of diversity, and they belonged to the F. gigantica phylogenically distinguishable clade. The present study is the first molecular characterization of F. gigantica in sheep and cattle from Mauritania, allowing a reliable approach for the genetic differentiation of Fasciola spp. and providing basis for further studies on liver flukes in the African countries. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. “Candidatus Neoehrlichia mikurensis” Infection in a Dog from Germany▿

    PubMed Central

    Diniz, Pedro Paulo V. P.; Schulz, Bianka S.; Hartmann, Katrin; Breitschwerdt, Edward B.

    2011-01-01

    “Candidatus Neoehrlichia mikurensis” is a new intracellular pathogen associated with human infection and death. “Candidatus Neoehrlichia mikurensis” infection in a chronically neutropenic dog from Germany was confirmed by DNA sequencing. The same organism was previously described from ticks and two sick human beings from Germany. PMID:21367991

  1. Lactobacillus nantensis sp. nov., isolated from French wheat sourdough.

    PubMed

    Valcheva, Rosica; Ferchichi, Mounir F; Korakli, Maher; Ivanova, Iskra; Gänzle, Michael G; Vogel, Rudi F; Prévost, Hervé; Onno, Bernard; Dousset, Xavier

    2006-03-01

    A polyphasic taxonomic study of the bacterial flora isolated from traditional French wheat sourdough, using phenotypic characterization and phylogenetic as well as genetic methods, revealed a consistent group of isolates that could not be assigned to any recognized species. These results were confirmed by randomly amplified polymorphic DNA and amplified fragment length polymorphism fingerprinting analyses. Cells were Gram-positive, homofermentative rods. Comparative 16S rRNA gene sequence analysis of the representative strain LP33T indicated that these strains belong to the genus Lactobacillus and that they formed a branch distinct from their closest relatives Lactobacillus farciminis, Lactobacillus alimentarius, Lactobacillus paralimentarius and Lactobacillus mindensis. DNA-DNA reassociation experiments with the three phylogenetically closest Lactobacillus species confirmed that LP33T (= DSM 16982T = CIP 108546T = TMW 1.1265T) represents the type strain of a novel species, for which the name Lactobacillus nantensis sp. nov. is proposed.

  2. Oxidative damage and cell-programmed death induced in Zea mays L. by allelochemical stress.

    PubMed

    Ciniglia, Claudia; Mastrobuoni, Francesco; Scortichini, Marco; Petriccione, Milena

    2015-05-01

    The allelochemical stress on Zea mays was analyzed by using walnut husk washing waters (WHWW), a by-product of Juglans regia post-harvest process, which possesses strong allelopathic potential and phytotoxic effects. Oxidative damage and cell-programmed death were induced by WHWW in roots of maize seedlings. Treatment induced ROS burst, with excess of H2O2 content. Enzymatic activities of catalase were strongly increased during the first hours of exposure. The excess in malonildialdehyde following exposure to WHWW confirmed that oxidative stress severely damaged maize roots. Membrane alteration caused a decrease in NADPH oxidase activity along with DNA damage as confirmed by DNA laddering. The DNA instability was also assessed through sequence-related amplified polymorphism assay, thus suggesting the danger of walnut processing by-product and focusing the attention on the necessity of an efficient treatment of WHWW.

  3. A novel recessive mutation in the gene ELOVL4 causes a neuro-ichthyotic disorder with variable expressivity

    PubMed Central

    2014-01-01

    Background A rare neuro-ichthyotic disorder characterized by ichthyosis, spastic quadriplegia and intellectual disability and caused by recessive mutations in ELOVL4, encoding elongase-4 protein has recently been described. The objective of the study was to search for sequence variants in the gene ELOVL4 in three affected individuals of a consanguineous Pakistani family exhibiting features of neuro-ichthyotic disorder. Methods Linkage in the family was searched by genotyping microsatellite markers linked to the gene ELOVL4, mapped at chromosome 6p14.1. Exons and splice junction sites of the gene ELOVL4 were polymerase chain reaction amplified and sequenced in an automated DNA sequencer. Results DNA sequence analysis revealed a novel homozygous nonsense mutation (c.78C > G; p.Tyr26*). Conclusions Our report further confirms the recently described ELOVL4-related neuro-ichthyosis and shows that the neurological phenotype can be absent in some individuals. PMID:24571530

  4. Isolation and cloning of a metalloproteinase from king cobra snake venom.

    PubMed

    Guo, Xiao-Xi; Zeng, Lin; Lee, Wen-Hui; Zhang, Yun; Jin, Yang

    2007-06-01

    A 50 kDa fibrinogenolytic protease, ohagin, from the venom of Ophiophagus hannah was isolated by a combination of gel filtration, ion-exchange and heparin affinity chromatography. Ohagin specifically degraded the alpha-chain of human fibrinogen and the proteolytic activity was completely abolished by EDTA, but not by PMSF, suggesting it is a metalloproteinase. It dose-dependently inhibited platelet aggregation induced by ADP, TMVA and stejnulxin. The full sequence of ohagin was deduced by cDNA cloning and confirmed by protein sequencing and peptide mass fingerprinting. The full-length cDNA sequence of ohagin encodes an open reading frame of 611 amino acids that includes signal peptide, proprotein and mature protein comprising metalloproteinase, disintegrin-like and cysteine-rich domains, suggesting it belongs to P-III class metalloproteinase. In addition, P-III class metalloproteinases from the venom glands of Naja atra, Bungarus multicinctus and Bungarus fasciatus were also cloned in this study. Sequence analysis and phylogenetic analysis indicated that metalloproteinases from elapid snake venoms form a new subgroup of P-III SVMPs.

  5. Complete Nucleotide Sequence of Watermelon Chlorotic Stunt Virus Originating from Oman

    PubMed Central

    Khan, Akhtar J.; Akhtar, Sohail; Briddon, Rob W.; Ammara, Um; Al-Matrooshi, Abdulrahman M.; Mansoor, Shahid

    2012-01-01

    Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6–99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93–98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed. PMID:22852046

  6. Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman.

    PubMed

    Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid

    2012-07-01

    Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.

  7. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  8. Chloroplast DNA analysis of Tunisian cork oak populations (Quercus suber L.): sequence variations and molecular evolution of the trnL (UAA)-trnF (GAA) region.

    PubMed

    Abdessamad, A; Baraket, G; Sakka, H; Ammari, Y; Ksontini, M; Hannachi, A Salhi

    2016-10-24

    Sequences of the trnL-trnF spacer and combined trnL-trnF region in chloroplast DNA of cork oak (Quercus suber L.) were analyzed to detect polymorphisms and to elucidate molecular evolution and demographic history. The aligned sequences varied in length and nucleotide composition. The overall ratio of transition/transversion (ti/tv) of 0.724 for the intergenic spacer and 0.258 for the pooled sequences were estimated, and indicated that transversions are more frequent than transitions. The molecular evolution and demographic history of Q. suber were investigated. Neutrality tests (Tajima's D and Fu and Li) ruled out the null hypothesis of a strictly neutral model, and Fu's Fs and Ramos-Onsins and Rozas' R2 confirmed the recent expansion of cork oak trees, validating its persistency in North Africa since the last glaciation during the Quaternary. The observed uni-modal mismatch distribution and the Harpending's raggedness index confirmed the demographic history model for cork oak. A phylogenetic dendrogram showed that the distribution of Q. suber trees occurs independently of geographical origin, the relief of the population site, and the bioclimatic stages. The molecular history and cytoplasmic diversity suggest that in situ and ex situ conservation strategies can be recommended for preserving landscape value and facing predictable future climatic changes.

  9. The Perils of Pathogen Discovery: Origin of a Novel Parvovirus-Like Hybrid Genome Traced to Nucleic Acid Extraction Spin Columns

    PubMed Central

    Naccache, Samia N.; Greninger, Alexander L.; Lee, Deanna; Coffey, Lark L.; Phan, Tung; Rein-Weston, Annie; Aronsohn, Andrew; Hackett, John; Delwart, Eric L.

    2013-01-01

    Next-generation sequencing was used for discovery and de novo assembly of a novel, highly divergent DNA virus at the interface between the Parvoviridae and Circoviridae. The virus, provisionally named parvovirus-like hybrid virus (PHV), is nearly identical by sequence to another DNA virus, NIH-CQV, previously detected in Chinese patients with seronegative (non-A-E) hepatitis. Although we initially detected PHV in a wide range of clinical samples, with all strains sharing ∼99% nucleotide and amino acid identity with each other and with NIH-CQV, the exact origin of the virus was eventually traced to contaminated silica-binding spin columns used for nucleic acid extraction. Definitive confirmation of the origin of PHV, and presumably NIH-CQV, was obtained by in-depth analyses of water eluted through contaminated spin columns. Analysis of environmental metagenome libraries detected PHV sequences in coastal marine waters of North America, suggesting that a potential association between PHV and diatoms (algae) that generate the silica matrix used in the spin columns may have resulted in inadvertent viral contamination during manufacture. The confirmation of PHV/NIH-CQV as laboratory reagent contaminants and not bona fide infectious agents of humans underscores the rigorous approach needed to establish the validity of new viral genomes discovered by next-generation sequencing. PMID:24027301

  10. Combined Use of 16S Ribosomal DNA and 16S rRNA To Study the Bacterial Community of Polychlorinated Biphenyl-Polluted Soil

    PubMed Central

    Nogales, Balbina; Moore, Edward R. B.; Llobet-Brossa, Enrique; Rossello-Mora, Ramon; Amann, Rudolf; Timmis, Kenneth N.

    2001-01-01

    The bacterial diversity assessed from clone libraries prepared from rRNA (two libraries) and ribosomal DNA (rDNA) (one library) from polychlorinated biphenyl (PCB)-polluted soil has been analyzed. A good correspondence of the community composition found in the two types of library was observed. Nearly 29% of the cloned sequences in the rDNA library were identical to sequences in the rRNA libraries. More than 60% of the total cloned sequence types analyzed were grouped in phylogenetic groups (a clone group with sequence similarity higher than 97% [98% for Burkholderia and Pseudomonas-type clones]) represented in both types of libraries. Some of those phylogenetic groups, mostly represented by a single (or pair) of cloned sequence type(s), were observed in only one of the types of library. An important difference between the libraries was the lack of clones representative of the Actinobacteria in the rDNA library. The PCB-polluted soil exhibited a high bacterial diversity which included representatives of two novel lineages. The apparent abundance of bacteria affiliated to the beta-subclass of the Proteobacteria, and to the genus Burkholderia in particular, was confirmed by fluorescence in situ hybridization analysis. The possible influence on apparent diversity of low template concentrations was assessed by dilution of the RNA template prior to amplification by reverse transcription-PCR. Although differences in the composition of the two rRNA libraries obtained from high and low RNA concentrations were observed, the main components of the bacterial community were represented in both libraries, and therefore their detection was not compromised by the lower concentrations of template used in this study. PMID:11282645

  11. Capturing chloroplast variation for molecular ecology studies: a simple next generation sequencing approach applied to a rainforest tree

    PubMed Central

    2013-01-01

    Background With high quantity and quality data production and low cost, next generation sequencing has the potential to provide new opportunities for plant phylogeographic studies on single and multiple species. Here we present an approach for in silicio chloroplast DNA assembly and single nucleotide polymorphism detection from short-read shotgun sequencing. The approach is simple and effective and can be implemented using standard bioinformatic tools. Results The chloroplast genome of Toona ciliata (Meliaceae), 159,514 base pairs long, was assembled from shotgun sequencing on the Illumina platform using de novo assembly of contigs. To evaluate its practicality, value and quality, we compared the short read assembly with an assembly completed using 454 data obtained after chloroplast DNA isolation. Sanger sequence verifications indicated that the Illumina dataset outperformed the longer read 454 data. Pooling of several individuals during preparation of the shotgun library enabled detection of informative chloroplast SNP markers. Following validation, we used the identified SNPs for a preliminary phylogeographic study of T. ciliata in Australia and to confirm low diversity across the distribution. Conclusions Our approach provides a simple method for construction of whole chloroplast genomes from shotgun sequencing of whole genomic DNA using short-read data and no available closely related reference genome (e.g. from the same species or genus). The high coverage of Illumina sequence data also renders this method appropriate for multiplexing and SNP discovery and therefore a useful approach for landscape level studies of evolutionary ecology. PMID:23497206

  12. Intestinal flora of FAP patients containing APC-like sequences.

    PubMed

    Hainova, K; Adamcikova, Z; Ciernikova, S; Stevurkova, V; Tyciakova, S; Zajac, V

    2014-01-01

    Colorectal cancer mortality is one of the most common cause of cancer-related mortality. A multiple risk factors are associated with colorectal cancer, including hereditary, enviromental and inflammatory syndromes affecting the gastrointestinal tract. Familial adenomatous polyposis (FAP) is characterized by the emergence of hundreds to thousands of colorectal adenomatous polyps and FAP syndrome is caused by mutations within the adenomatous polyposis coli (APC) tumor suppressor gene. We analyzed 21 rectal bacterial subclones isolated from FAP patient 41-1 with confirmed 5bp ACAAA deletion within codons 1060-1063 for the presence of APC-like sequences in longest exon 15. The studied section was defined by primers 15Efor-15Erev, what correlates with mutation cluster region (MCR) in which the 75% of all APC germline mutations were detected. More than 90% homology was showed by sequencing and subsequent software comparison. The expression of APC-like sequences was demostrated by Western blot analysis using monoclonal and polyclonal antibodies against APC protein. To study missing link between the DNA analysis (PCR, DNA sequencing) and protein expresion experiments (Western blotting) we analyzed bacterial transcripts containing the 15Efor-15Erev sequence of APC gene by reverse transcription-PCR, what indicated that an APC gene derived fragment may be produced. We observed 97-100 % homology after computer comparison of cDNA PCR products. Our results suggest that presence of APC-like sequences in intestinal/rectal bacteria is enrichment of bacterial genetic information in which horizontal gene transfer between humans and microflora play an important role.

  13. Identification and characterization of ARS-like sequences as putative origin(s) of replication in human malaria parasite Plasmodium falciparum.

    PubMed

    Agarwal, Meetu; Bhowmick, Krishanu; Shah, Kushal; Krishnamachari, Annangarachari; Dhar, Suman Kumar

    2017-08-01

    DNA replication is a fundamental process in genome maintenance, and initiates from several genomic sites (origins) in eukaryotes. In Saccharomyces cerevisiae, conserved sequences known as autonomously replicating sequences (ARSs) provide a landing pad for the origin recognition complex (ORC), leading to replication initiation. Although origins from higher eukaryotes share some common sequence features, the definitive genomic organization of these sites remains elusive. The human malaria parasite Plasmodium falciparum undergoes multiple rounds of DNA replication; therefore, control of initiation events is crucial to ensure proper replication. However, the sites of DNA replication initiation and the mechanism by which replication is initiated are poorly understood. Here, we have identified and characterized putative origins in P. falciparum by bioinformatics analyses and experimental approaches. An autocorrelation measure method was initially used to search for regions with marked fluctuation (dips) in the chromosome, which we hypothesized might contain potential origins. Indeed, S. cerevisiae ARS consensus sequences were found in dip regions. Several of these P. falciparum sequences were validated with chromatin immunoprecipitation-quantitative PCR, nascent strand abundance and a plasmid stability assay. Subsequently, the same sequences were used in yeast to confirm their potential as origins in vivo. Our results identify the presence of functional ARSs in P. falciparum and provide meaningful insights into replication origins in these deadly parasites. These data could be useful in designing transgenic vectors with improved stability for transfection in P. falciparum. © 2017 Federation of European Biochemical Societies.

  14. DNA analysis in perpetrator identification of terrorism-related disaster: suicide bombing of the Australian Embassy in Jakarta 2004.

    PubMed

    Sudoyo, Herawati; Widodo, Putut T; Suryadi, Helena; Lie, Yuliana S; Safari, Dodi; Widjajanto, Agung; Kadarmo, D Aji; Hidayat, Soegeng; Marzuki, Sangkot

    2008-06-01

    We report the strategy that we employed to identify the perpetrator of a suicide car bombing in front of the Australian Embassy in Jakarta, Indonesia, on 9 September 2004. The bomb was so massive that only small tissue pieces of the perpetrator could be recovered, preventing conventional approach to the identification of the bomber, necessitating the introduction of DNA analysis as the primary means for perpetrator identification. Crime scene investigation revealed the trajectory of the bomb blast, which was used to guide the collection of charred tissue fragments of the perpetrator. Mitochondrial DNA analysis was first conducted on 17 tissue fragments, recovered over large areas of the trajectory to, (a) confirm that they are of a common source, i.e. the perpetrator, and thus (b) establish the mtDNA HV1 sequence profile of the perpetrator. The mtDNA of the perpetrator matches that of a maternally related family member of one of four suspects. Standard autosomal STR analysis confirmed the identification. This case is of interest as an illustration of a successful application of DNA analysis as the primary means of disaster perpetrator identification.

  15. Tziminema unachi n. gen., n. sp. (Nematoda: Strongylidae: Strongylinae) parasite of Baird's tapir Tapirus bairdii from Mexico.

    PubMed

    Güiris-Andrade, D M; Oceguera-Figueroa, A; Osorio-Sarabia, D; Pérez-Escobar, M E; Nieto-López, M G; Rojas-Hernández, N M; García-Prieto, L

    2017-11-20

    A new genus and species of nematode, Tziminema unachi n. gen., n. sp. is described from the caecum and colon of Baird's tapir Tapirus bairdii (Gill, 1865), found dead in the Reserva de la Biósfera El Triunfo, Chiapas State, in the Neotropical realm of Mexico. Tziminema n. gen. differs from the other nine genera included in the Strongylinae by two main characteristics: having 7-9 posteriorly directed tooth-like structures at the anterior end of the buccal capsule, and the external surface of the buccal capsule being heavily striated. Phylogenetic analyses of the DNA sequences of the mitochondrial cytochrome c oxidase and nuclear DNA, including a partial sequence of the internal transcribed spacer 1, 5.8S and a partial sequence of the internal transcribed spacer 2 of the new taxon, confirmed its inclusion in Strongylinae and its rank as a new genus.

  16. Hybrid Origins of Citrus Varieties Inferred from DNA Marker Analysis of Nuclear and Organelle Genomes.

    PubMed

    Shimizu, Tokurou; Kitajima, Akira; Nonaka, Keisuke; Yoshioka, Terutaka; Ohta, Satoshi; Goto, Shingo; Toyoda, Atsushi; Fujiyama, Asao; Mochizuki, Takako; Nagasaki, Hideki; Kaminuma, Eli; Nakamura, Yasukazu

    2016-01-01

    Most indigenous citrus varieties are assumed to be natural hybrids, but their parentage has so far been determined in only a few cases because of their wide genetic diversity and the low transferability of DNA markers. Here we infer the parentage of indigenous citrus varieties using simple sequence repeat and indel markers developed from various citrus genome sequence resources. Parentage tests with 122 known hybrids using the selected DNA markers certify their transferability among those hybrids. Identity tests confirm that most variant strains are selected mutants, but we find four types of kunenbo (Citrus nobilis) and three types of tachibana (Citrus tachibana) for which we suggest different origins. Structure analysis with DNA markers that are in Hardy-Weinberg equilibrium deduce three basic taxa coinciding with the current understanding of citrus ancestors. Genotyping analysis of 101 indigenous citrus varieties with 123 selected DNA markers infers the parentages of 22 indigenous citrus varieties including Satsuma, Temple, and iyo, and single parents of 45 indigenous citrus varieties, including kunenbo, C. ichangensis, and Ichang lemon by allele-sharing and parentage tests. Genotyping analysis of chloroplast and mitochondrial genomes using 11 DNA markers classifies their cytoplasmic genotypes into 18 categories and deduces the combination of seed and pollen parents. Likelihood ratio analysis verifies the inferred parentages with significant scores. The reconstructed genealogy identifies 12 types of varieties consisting of Kishu, kunenbo, yuzu, koji, sour orange, dancy, kobeni mikan, sweet orange, tachibana, Cleopatra, willowleaf mandarin, and pummelo, which have played pivotal roles in the occurrence of these indigenous varieties. The inferred parentage of the indigenous varieties confirms their hybrid origins, as found by recent studies.

  17. Hybrid Origins of Citrus Varieties Inferred from DNA Marker Analysis of Nuclear and Organelle Genomes

    PubMed Central

    Kitajima, Akira; Nonaka, Keisuke; Yoshioka, Terutaka; Ohta, Satoshi; Goto, Shingo; Toyoda, Atsushi; Fujiyama, Asao; Mochizuki, Takako; Nagasaki, Hideki; Kaminuma, Eli; Nakamura, Yasukazu

    2016-01-01

    Most indigenous citrus varieties are assumed to be natural hybrids, but their parentage has so far been determined in only a few cases because of their wide genetic diversity and the low transferability of DNA markers. Here we infer the parentage of indigenous citrus varieties using simple sequence repeat and indel markers developed from various citrus genome sequence resources. Parentage tests with 122 known hybrids using the selected DNA markers certify their transferability among those hybrids. Identity tests confirm that most variant strains are selected mutants, but we find four types of kunenbo (Citrus nobilis) and three types of tachibana (Citrus tachibana) for which we suggest different origins. Structure analysis with DNA markers that are in Hardy–Weinberg equilibrium deduce three basic taxa coinciding with the current understanding of citrus ancestors. Genotyping analysis of 101 indigenous citrus varieties with 123 selected DNA markers infers the parentages of 22 indigenous citrus varieties including Satsuma, Temple, and iyo, and single parents of 45 indigenous citrus varieties, including kunenbo, C. ichangensis, and Ichang lemon by allele-sharing and parentage tests. Genotyping analysis of chloroplast and mitochondrial genomes using 11 DNA markers classifies their cytoplasmic genotypes into 18 categories and deduces the combination of seed and pollen parents. Likelihood ratio analysis verifies the inferred parentages with significant scores. The reconstructed genealogy identifies 12 types of varieties consisting of Kishu, kunenbo, yuzu, koji, sour orange, dancy, kobeni mikan, sweet orange, tachibana, Cleopatra, willowleaf mandarin, and pummelo, which have played pivotal roles in the occurrence of these indigenous varieties. The inferred parentage of the indigenous varieties confirms their hybrid origins, as found by recent studies. PMID:27902727

  18. Label-free detection of DNA hybridization using carbon nanotube network field-effect transistors

    NASA Astrophysics Data System (ADS)

    Star, Alexander; Tu, Eugene; Niemann, Joseph; Gabriel, Jean-Christophe P.; Joiner, C. Steve; Valcke, Christian

    2006-01-01

    We report carbon nanotube network field-effect transistors (NTNFETs) that function as selective detectors of DNA immobilization and hybridization. NTNFETs with immobilized synthetic oligonucleotides have been shown to specifically recognize target DNA sequences, including H63D single-nucleotide polymorphism (SNP) discrimination in the HFE gene, responsible for hereditary hemochromatosis. The electronic responses of NTNFETs upon single-stranded DNA immobilization and subsequent DNA hybridization events were confirmed by using fluorescence-labeled oligonucleotides and then were further explored for label-free DNA detection at picomolar to micromolar concentrations. We have also observed a strong effect of DNA counterions on the electronic response, thus suggesting a charge-based mechanism of DNA detection using NTNFET devices. Implementation of label-free electronic detection assays using NTNFETs constitutes an important step toward low-cost, low-complexity, highly sensitive and accurate molecular diagnostics. hemochromatosis | SNP | biosensor

  19. Titanium Dioxide Nanoparticle-Based Interdigitated Electrodes: A Novel Current to Voltage DNA Biosensor Recognizes E. coli O157:H7.

    PubMed

    Nadzirah, Sh; Azizah, N; Hashim, Uda; Gopinath, Subash C B; Kashif, Mohd

    2015-01-01

    Nanoparticle-mediated bio-sensing promoted the development of novel sensors in the front of medical diagnosis. In the present study, we have generated and examined the potential of titanium dioxide (TiO2) crystalline nanoparticles with aluminium interdigitated electrode biosensor to specifically detect single-stranded E.coli O157:H7 DNA. The performance of this novel DNA biosensor was measured the electrical current response using a picoammeter. The sensor surface was chemically functionalized with (3-aminopropyl) triethoxysilane (APTES) to provide contact between the organic and inorganic surfaces of a single-stranded DNA probe and TiO2 nanoparticles while maintaining the sensing system's physical characteristics. The complement of the target DNA of E. coli O157:H7 to the carboxylate-probe DNA could be translated into electrical signals and confirmed by the increased conductivity in the current-to-voltage curves. The specificity experiments indicate that the biosensor can discriminate between the complementary sequences from the base-mismatched and the non-complementary sequences. After duplex formation, the complementary target sequence can be quantified over a wide range with a detection limit of 1.0 x 10(-13)M. With target DNA from the lysed E. coli O157:H7, we could attain similar sensitivity. Stability of DNA immobilized surface was calculated with the relative standard deviation (4.6%), displayed the retaining with 99% of its original response current until 6 months. This high-performance interdigitated DNA biosensor with high sensitivity, stability and non-fouling on a novel sensing platform is suitable for a wide range of biomolecular interactive analyses.

  20. Titanium Dioxide Nanoparticle-Based Interdigitated Electrodes: A Novel Current to Voltage DNA Biosensor Recognizes E. coli O157:H7

    PubMed Central

    Nadzirah, Sh.; Azizah, N.; Hashim, Uda; Gopinath, Subash C. B.; Kashif, Mohd

    2015-01-01

    Nanoparticle-mediated bio-sensing promoted the development of novel sensors in the front of medical diagnosis. In the present study, we have generated and examined the potential of titanium dioxide (TiO2) crystalline nanoparticles with aluminium interdigitated electrode biosensor to specifically detect single-stranded E.coli O157:H7 DNA. The performance of this novel DNA biosensor was measured the electrical current response using a picoammeter. The sensor surface was chemically functionalized with (3-aminopropyl) triethoxysilane (APTES) to provide contact between the organic and inorganic surfaces of a single-stranded DNA probe and TiO2 nanoparticles while maintaining the sensing system’s physical characteristics. The complement of the target DNA of E. coli O157:H7 to the carboxylate-probe DNA could be translated into electrical signals and confirmed by the increased conductivity in the current-to-voltage curves. The specificity experiments indicate that the biosensor can discriminate between the complementary sequences from the base-mismatched and the non-complementary sequences. After duplex formation, the complementary target sequence can be quantified over a wide range with a detection limit of 1.0 x 10-13M. With target DNA from the lysed E. coli O157:H7, we could attain similar sensitivity. Stability of DNA immobilized surface was calculated with the relative standard deviation (4.6%), displayed the retaining with 99% of its original response current until 6 months. This high-performance interdigitated DNA biosensor with high sensitivity, stability and non-fouling on a novel sensing platform is suitable for a wide range of biomolecular interactive analyses. PMID:26445455

  1. cDNA-AFLP analysis reveals differential gene expression in compatible interaction of wheat challenged with Puccinia striiformis f. sp. tritici

    PubMed Central

    Wang, Xiaojie; Tang, Chunlei; Zhang, Gang; Li, Yingchun; Wang, Chenfang; Liu, Bo; Qu, Zhipeng; Zhao, Jie; Han, Qingmei; Huang, Lili; Chen, Xianming; Kang, Zhensheng

    2009-01-01

    Background Puccinia striiformis f. sp. tritici is a fungal pathogen causing stripe rust, one of the most important wheat diseases worldwide. The fungus is strictly biotrophic and thus, completely dependent on living host cells for its reproduction, which makes it difficult to study genes of the pathogen. In spite of its economic importance, little is known about the molecular basis of compatible interaction between the pathogen and wheat host. In this study, we identified wheat and P. striiformis genes associated with the infection process by conducting a large-scale transcriptomic analysis using cDNA-AFLP. Results Of the total 54,912 transcript derived fragments (TDFs) obtained using cDNA-AFLP with 64 primer pairs, 2,306 (4.2%) displayed altered expression patterns after inoculation, of which 966 showed up-regulated and 1,340 down-regulated. 186 TDFs produced reliable sequences after sequencing of 208 TDFs selected, of which 74 (40%) had known functions through BLAST searching the GenBank database. Majority of the latter group had predicted gene products involved in energy (13%), signal transduction (5.4%), disease/defence (5.9%) and metabolism (5% of the sequenced TDFs). BLAST searching of the wheat stem rust fungus genome database identified 18 TDFs possibly from the stripe rust pathogen, of which 9 were validated of the pathogen origin using PCR-based assays followed by sequencing confirmation. Of the 186 reliable TDFs, 29 homologous to genes known to play a role in disease/defense, signal transduction or uncharacterized genes were further selected for validation of cDNA-AFLP expression patterns using qRT-PCR analyses. Results confirmed the altered expression patterns of 28 (96.5%) genes revealed by the cDNA-AFLP technique. Conclusion The results show that cDNA-AFLP is a reliable technique for studying expression patterns of genes involved in the wheat-stripe rust interactions. Genes involved in compatible interactions between wheat and the stripe rust pathogen were identified and their expression patterns were determined. The present study should be helpful in elucidating the molecular basis of the infection process, and identifying genes that can be targeted for inhibiting the growth and reproduction of the pathogen. Moreover, this study can also be used to elucidate the defence responses of the genes that were of plant origin. PMID:19566949

  2. A new double digestion ligation mediated suppression PCR method for simultaneous bacteria DNA-typing and confirmation of species: an Acinetobacter sp. model.

    PubMed

    Stojowska, Karolina; Krawczyk, Beata

    2014-01-01

    We have designed a new ddLMS PCR (double digestion Ligation Mediated Suppression PCR) method based on restriction site polymorphism upstream from the specific target sequence for the simultaneous identification and differentiation of bacterial strains. The ddLMS PCR combines a simple PCR used for species or genus identification and the LM PCR strategy for strain differentiation. The bacterial identification is confirmed in the form of the PCR product(s), while the length of the PCR product makes it possible to differentiate between bacterial strains. If there is a single copy of the target sequence within genomic DNA, one specific PCR product is created (simplex ddLMS PCR), whereas for multiple copies of the gene the fingerprinting patterns can be obtained (multiplex ddLMS PCR). The described ddLMS PCR method is designed for rapid and specific strain differentiation in medical and microbiological studies. In comparison to other LM PCR it has substantial advantages: enables specific species' DNA-typing without the need for pure bacterial culture selection, is not sensitive to contamination with other cells or genomic DNA, and gives univocal "band-based" results, which are easy to interpret. The utility of ddLMS PCR was shown for Acinetobacter calcoaceticus-baumannii (Acb) complex, the genetically closely related and phenotypically similar species and also important nosocomial pathogens, for which currently, there are no recommended methods for screening, typing and identification. In this article two models are proposed: 3' recA-ddLMS PCR-MaeII/RsaI for Acb complex interspecific typing and 5' rrn-ddLMS PCR-HindIII/ApaI for Acinetobacter baumannii intraspecific typing. ddLMS PCR allows not only for DNA-typing but also for confirmation of species in one reaction. Also, practical guidelines for designing a diagnostic test based on ddLMS PCR for genotyping different species of bacteria are provided.

  3. Strategy for Sensitive and Specific Detection of Yersinia pestis in Skeletons of the Black Death Pandemic

    PubMed Central

    Seifert, Lisa; Harbeck, Michaela; Thomas, Astrid; Hoke, Nadja; Zöller, Lothar; Wiechmann, Ingrid; Grupe, Gisela; Scholz, Holger C.; Riehm, Julia M.

    2013-01-01

    Yersinia pestis has been identified as the causative agent of the Black Death pandemic in the 14th century. However, retrospective diagnostics in human skeletons after more than 600 years are critical. We describe a strategy following a modern diagnostic algorithm and working under strict ancient DNA regime for the identification of medieval human plague victims. An initial screening and DNA quantification assay detected the Y. pestis specific pla gene of the high copy number plasmid pPCP1. Results were confirmed by conventional PCR and sequence analysis targeting both Y. pestis specific virulence plasmids pPCP1 and pMT1. All assays were meticulously validated according to human clinical diagnostics requirements (ISO 15189) regarding efficiency, sensitivity, specificity, and limit of detection (LOD). Assay specificity was 100% tested on 41 clinically relevant bacteria and 29 Y. pseudotuberculosis strains as well as for DNA of 22 Y. pestis strains and 30 previously confirmed clinical human plague samples. The optimized LOD was down to 4 gene copies. 29 individuals from three different multiple inhumations were initially assessed as possible victims of the Black Death pandemic. 7 samples (24%) were positive in the pPCP1 specific screening assay. Confirmation through second target pMT1 specific PCR was successful for 4 of the positive individuals (14%). A maximum of 700 and 560 copies per µl aDNA were quantified in two of the samples. Those were positive in all assays including all repetitions, and are candidates for future continuative investigations such as whole genome sequencing. We discuss that all precautions taken here for the work with aDNA are sufficient to prevent external sample contamination and fulfill the criteria of authenticity. With regard to retrospective diagnostics of a human pathogen and the uniqueness of ancient material we strongly recommend using a careful strategy and validated assays as presented in our study. PMID:24069445

  4. Strategy for sensitive and specific detection of Yersinia pestis in skeletons of the black death pandemic.

    PubMed

    Seifert, Lisa; Harbeck, Michaela; Thomas, Astrid; Hoke, Nadja; Zöller, Lothar; Wiechmann, Ingrid; Grupe, Gisela; Scholz, Holger C; Riehm, Julia M

    2013-01-01

    Yersinia pestis has been identified as the causative agent of the Black Death pandemic in the 14(th) century. However, retrospective diagnostics in human skeletons after more than 600 years are critical. We describe a strategy following a modern diagnostic algorithm and working under strict ancient DNA regime for the identification of medieval human plague victims. An initial screening and DNA quantification assay detected the Y. pestis specific pla gene of the high copy number plasmid pPCP1. Results were confirmed by conventional PCR and sequence analysis targeting both Y. pestis specific virulence plasmids pPCP1 and pMT1. All assays were meticulously validated according to human clinical diagnostics requirements (ISO 15189) regarding efficiency, sensitivity, specificity, and limit of detection (LOD). Assay specificity was 100% tested on 41 clinically relevant bacteria and 29 Y. pseudotuberculosis strains as well as for DNA of 22 Y. pestis strains and 30 previously confirmed clinical human plague samples. The optimized LOD was down to 4 gene copies. 29 individuals from three different multiple inhumations were initially assessed as possible victims of the Black Death pandemic. 7 samples (24%) were positive in the pPCP1 specific screening assay. Confirmation through second target pMT1 specific PCR was successful for 4 of the positive individuals (14%). A maximum of 700 and 560 copies per µl aDNA were quantified in two of the samples. Those were positive in all assays including all repetitions, and are candidates for future continuative investigations such as whole genome sequencing. We discuss that all precautions taken here for the work with aDNA are sufficient to prevent external sample contamination and fulfill the criteria of authenticity. With regard to retrospective diagnostics of a human pathogen and the uniqueness of ancient material we strongly recommend using a careful strategy and validated assays as presented in our study.

  5. A New Double Digestion Ligation Mediated Suppression PCR Method for Simultaneous Bacteria DNA-Typing and Confirmation of Species: An Acinetobacter sp. Model

    PubMed Central

    Stojowska, Karolina; Krawczyk, Beata

    2014-01-01

    We have designed a new ddLMS PCR (double digestion Ligation Mediated Suppression PCR) method based on restriction site polymorphism upstream from the specific target sequence for the simultaneous identification and differentiation of bacterial strains. The ddLMS PCR combines a simple PCR used for species or genus identification and the LM PCR strategy for strain differentiation. The bacterial identification is confirmed in the form of the PCR product(s), while the length of the PCR product makes it possible to differentiate between bacterial strains. If there is a single copy of the target sequence within genomic DNA, one specific PCR product is created (simplex ddLMS PCR), whereas for multiple copies of the gene the fingerprinting patterns can be obtained (multiplex ddLMS PCR). The described ddLMS PCR method is designed for rapid and specific strain differentiation in medical and microbiological studies. In comparison to other LM PCR it has substantial advantages: enables specific species' DNA-typing without the need for pure bacterial culture selection, is not sensitive to contamination with other cells or genomic DNA, and gives univocal “band-based” results, which are easy to interpret. The utility of ddLMS PCR was shown for Acinetobacter calcoaceticus-baumannii (Acb) complex, the genetically closely related and phenotypically similar species and also important nosocomial pathogens, for which currently, there are no recommended methods for screening, typing and identification. In this article two models are proposed: 3′ recA-ddLMS PCR-MaeII/RsaI for Acb complex interspecific typing and 5′ rrn-ddLMS PCR-HindIII/ApaI for Acinetobacter baumannii intraspecific typing. ddLMS PCR allows not only for DNA-typing but also for confirmation of species in one reaction. Also, practical guidelines for designing a diagnostic test based on ddLMS PCR for genotyping different species of bacteria are provided. PMID:25522278

  6. Identification of Clinical Isolates of Actinomyces Species by Amplified 16S Ribosomal DNA Restriction Analysis

    PubMed Central

    Hall, Val; Talbot, P. R.; Stubbs, S. L.; Duerden, B. I.

    2001-01-01

    Amplified 16S ribosomal DNA (rDNA) restriction analysis (ARDRA), using enzymes HaeIII and HpaII, was applied to 176 fresh and 299 stored clinical isolates of putative Actinomyces spp. referred to the Anaerobe Reference Unit of the Public Health Laboratory Service for confirmation of identity. Results were compared with ARDRA results obtained previously for reference strains and with conventional phenotypic reactions. Identities of some strains were confirmed by analysis of partial 16S rDNA sequences. Of the 475 isolates, 331 (70%) were clearly assigned to recognized Actinomyces species, including 94 isolates assigned to six recently described species. A further 52 isolates in 12 ARDRA profiles were designated as apparently resembling recognized species, and 44 isolates, in 18 novel profiles, were confirmed as members of genera other than Actinomyces. The identities of 48 isolates in nine profiles remain uncertain, and they may represent novel species of Actinomyces. For the majority of species, phenotypic results, published reactions for the species, and ARDRA profiles concurred. However, of 113 stored isolates originally identified as A. meyeri or resembling A. meyeri by phenotypic tests, only 21 were confirmed as A. meyeri by ARDRA; 63 were reassigned as A. turicensis, 7 as other recognized species, and 22 as unidentified actinomycetes. Analyses of incidence and clinical associations of Actinomyces spp. add to the currently sparse knowledge of some recently described species. PMID:11574572

  7. Molecular Characterization of Transgenic Events Using Next Generation Sequencing Approach.

    PubMed

    Guttikonda, Satish K; Marri, Pradeep; Mammadov, Jafar; Ye, Liang; Soe, Khaing; Richey, Kimberly; Cruse, James; Zhuang, Meibao; Gao, Zhifang; Evans, Clive; Rounsley, Steve; Kumpatla, Siva P

    2016-01-01

    Demand for the commercial use of genetically modified (GM) crops has been increasing in light of the projected growth of world population to nine billion by 2050. A prerequisite of paramount importance for regulatory submissions is the rigorous safety assessment of GM crops. One of the components of safety assessment is molecular characterization at DNA level which helps to determine the copy number, integrity and stability of a transgene; characterize the integration site within a host genome; and confirm the absence of vector DNA. Historically, molecular characterization has been carried out using Southern blot analysis coupled with Sanger sequencing. While this is a robust approach to characterize the transgenic crops, it is both time- and resource-consuming. The emergence of next-generation sequencing (NGS) technologies has provided highly sensitive and cost- and labor-effective alternative for molecular characterization compared to traditional Southern blot analysis. Herein, we have demonstrated the successful application of both whole genome sequencing and target capture sequencing approaches for the characterization of single and stacked transgenic events and compared the results and inferences with traditional method with respect to key criteria required for regulatory submissions.

  8. Characterization of complete genome sequence of the spring viremia of carp virus isolated from common carp (Cyprinus carpio) in China.

    PubMed

    Teng, Y; Liu, H; Lv, J Q; Fan, W H; Zhang, Q Y; Qin, Q W

    2007-01-01

    The complete genome of spring viraemia of carp virus (SVCV) strain A-1 isolated from cultured common carp (Cyprinus carpio) in China was sequenced and characterized. Reverse transcription-polymerase chain reaction (RT-PCR) derived clones were constructed and the DNA was sequenced. It showed that the entire genome of SVCV A-1 consists of 11,100 nucleotide base pairs, the predicted size of the viral RNA of rhabdoviruses. However, the additional insertions in bp 4633-4676 and bp 4684-4724 of SVCV A-1 were different from the other two published SVCV complete genomes. Five open reading frames (ORFs) of SVCV A-1 were identified and further confirmed by RT-PCR and DNA sequencing of their respective RT-PCR products. The 5 structural proteins encoded by the viral RNA were ordered 3'-N-P-M-G-L-5'. This is the first report of a complete genome sequence of SVCV isolated from cultured carp in China. Phylogenetic analysis indicates that SVCV A-1 is closely related to the members of the genus Vesiculovirus, family Rhabdoviridae.

  9. Molecular Microbial Analysis of Lactobacillus Strains Isolated from the Gut of Calves for Potential Probiotic Use

    PubMed Central

    Soto, Lorena P.; Frizzo, Laureano S.; Bertozzi, Ezequiel; Avataneo, Elizabeth; Sequeira, Gabriel J.; Rosmini, Marcelo R.

    2010-01-01

    The intestinal microbiota has an influence on the growth and health status of the hosts. This is of particular interest in animals reared using intensive farming practices. Hence, it is necessary to know more about complexity of the beneficial intestinal microbiota. The use of molecular methods has revolutionized microbial identification by improving its quality and effectiveness. The specific aim of the study was to analyze predominant species of Lactobacillus in intestinal microbial ecosystem of young calves. Forty-two lactic acid bacteria (LAB) isolated from intestinal tract of young calves were characterized by: Amplified Ribosomal DNA Restriction Analysis (ARDRA), by using Hae III, Msp I, and Hinf I restriction enzymes, and 16S rDNA gene sequencing. ARDRA screening revealed nine unique patterns among 42 isolates, with the same pattern for 29 of the isolates. Gene fragments of 16S rDNA of 19 strains representing different patterns were sequenced to confirm the identification of these species. These results confirmed that ARDRA is a good tool for identification and discrimination of bacterial species isolated from complex ecosystem and between closely related groups. This paper provides information about the LAB species predominant in intestinal tract of young calves that could provide beneficial effects when administered as probiotic. PMID:20445780

  10. Food isolate Listeria monocytogenes harboring tetM gene plasmid-mediated exchangeable to Enterococcus faecalis on the surface of processed cheese.

    PubMed

    Haubert, Louise; Cunha, Carlos Eduardo Pouey da; Lopes, Graciela Völz; Silva, Wladimir Padilha da

    2018-05-01

    The genetic basis of tetracycline resistance in a food isolate Listeria monocytogenes (Lm16) was evaluated. Resistance to tetracycline was associated with the presence of the tetM gene in plasmid DNA. The sequence of tetM showed 100% of similarity with the Enterococcus faecalis sequences found in the EMBL database, suggesting that Lm16 received this gene from E. faecalis. Various size bands were detected in the DNA plasmid analysis, the largest being approximately 54.38 kb. Transferability of the tetM gene was achieved in vitro by agar matings between Lm16 and E. faecalis JH2-2, proving the potential for the spread of tetM by horizontal gene transfer. Furthermore, the conjugation experiments were performed on the surface of processed cheese, confirming the transferability in a food matrix. PCR assays were used to confirm the identity of E. faecalis and to detect the tetM gene in transconjugant bacteria. Additionally, the minimal inhibitory concentration for tetracycline and rifampicin and plasmid profiling were performed. This is the first report of a food isolate L. monocytogenes carrying the tetM gene in plasmid DNA, and it highlights the potential risk of spreading antimicrobial resistance genes between different bacteria. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. Repetitive transpositions of mitochondrial DNA sequences to the nucleus during the radiation of horseshoe bats (Rhinolophus, Chiroptera).

    PubMed

    Shi, Huizhen; Dong, Ji; Irwin, David M; Zhang, Shuyi; Mao, Xiuguang

    2016-05-01

    Transposition of mitochondrial DNA into the nucleus, which gives rise to nuclear mitochondrial DNAs (NUMTs), has been well documented in eukaryotes. However, very few studies have assessed the frequency of these transpositions during the evolutionary history of a specific taxonomic group. Here we used the horseshoe bats (Rhinolophus) as a case study to determine the frequency and relative timing of nuclear transfers of mitochondrial control region sequences. For this, phylogenetic and coalescent analyzes were performed on NUMTs and authentic mtDNA sequences generated from eight horseshoe bat species. Our results suggest at least three independent transpositions, including two ancient and one more recent, during the evolutionary history of Rhinolophus. The two ancient transpositions are represented by the NUMT-1 and -2 clades, with each clade consisting of NUMTs from almost all studied species but originating from different portions of the mtDNA genome. Furthermore, estimates of the most recent common ancestor for each clade corresponded to the time of the initial diversification of this genus. The recent transposition is represented by NUMT-3, which was discovered only in a specific subgroup of Rhinolophus and exhibited a close relationship to its mitochondrial counterpart. Our similarity searches of mtDNA in the R. ferrumequinum genome confirmed the presence of NUMT-1 and NUMT-2 clade sequences and, for the first time, assessed the extent of NUMTs in a bat genome. To our knowledge, this is the first study to report on the frequency of transpositions of mtDNA occurring before the common ancestry of a genus. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Characterization of a periplasmic S1-like nuclease coded by the Mesorhizobium loti symbiosis island

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pimkin, Maxim; Miller, C. Glenn; Blakesley, Lauryn

    DNA sequences encoding hypothetical proteins homologous to S1 nuclease from Aspergillus oryzae are found in many organisms including fungi, plants, pathogenic bacteria, and eukaryotic parasites. One of these is the M1 nuclease of Mesorhizobium loti which we demonstrate herein to be an enzymatically active, soluble, and stable S1 homolog that lacks the extensive mannosyl-glycosylation found in eukaryotic S1 nuclease homologs. We have expressed the cloned M1 protein in M. loti and purified recombinant native M1 to near homogeneity and have also isolated a homogeneous M1 carboxy-terminal hexahistidine tag fusion protein. Mass spectrometry and N-terminal Edman degradation sequencing confirmed the proteinmore » identity. The enzymatic properties of the purified M1 nuclease are similar to those of S1. At acidic pH M1 is 25 times more active on single-stranded DNA than on double-stranded DNA and 3 times more active on single-stranded DNA than on single-stranded RNA. At neutral pH the RNase activity of M1 exceeds the DNase activity. M1 nicks supercoiled RF-I plasmid DNA and rapidly cuts the phosphodiester bond across from the nick in the resultant relaxed RF-II plasmid DNA. Therefore, M1 represents an active bacterial S1 homolog in spite of great sequence divergence. The biochemical characterization of M1 nuclease supports our sequence alignment that reveals the minimal 21 amino acid residues that are necessarily conserved for the structure and functions of this enzyme family. The ability of M1 to degrade RNA at neutral pH implies previously unappreciated roles of these nucleases in biological systems.« less

  13. Enzymic colorimetry-based DNA chip: a rapid and accurate assay for detecting mutations for clarithromycin resistance in the 23S rRNA gene of Helicobacter pylori.

    PubMed

    Xuan, Shi-Hai; Zhou, Yu-Gui; Shao, Bo; Cui, Ya-Lin; Li, Jian; Yin, Hong-Bo; Song, Xiao-Ping; Cong, Hui; Jing, Feng-Xiang; Jin, Qing-Hui; Wang, Hui-Min; Zhou, Jie

    2009-11-01

    Macrolide drugs, such as clarithromycin (CAM), are a key component of many combination therapies used to eradicate Helicobacter pylori. However, resistance to CAM is increasing in H. pylori and is becoming a serious problem in H. pylori eradication therapy. CAM resistance in H. pylori is mostly due to point mutations (A2142G/C, A2143G) in the peptidyltransferase-encoding region of the 23S rRNA gene. In this study an enzymic colorimetry-based DNA chip was developed to analyse single-nucleotide polymorphisms of the 23S rRNA gene to determine the prevalence of mutations in CAM-related resistance in H. pylori-positive patients. The results of the colorimetric DNA chip were confirmed by direct DNA sequencing. In 63 samples, the incidence of the A2143G mutation was 17.46 % (11/63). The results of the colorimetric DNA chip were concordant with DNA sequencing in 96.83 % of results (61/63). The colorimetric DNA chip could detect wild-type and mutant signals at every site, even at a DNA concentration of 1.53 x 10(2) copies microl(-1). Thus, the colorimetric DNA chip is a reliable assay for rapid and accurate detection of mutations in the 23S rRNA gene of H. pylori that lead to CAM-related resistance, directly from gastric tissues.

  14. Structure of the MecI repressor from Staphylococcus aureus in complex with the cognate DNA operator of mec

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Safo, Martin K., E-mail: msafo@vcu.edu; Ko, Tzu-Ping; Musayev, Faik N.

    The up-and-down binding of dimeric MecI to mecA dyad DNA may account for the cooperative effect of the repressor. The dimeric repressor MecI regulates the mecA gene that encodes the penicillin-binding protein PBP-2a in methicillin-resistant Staphylococcus aureus (MRSA). MecI is similar to BlaI, the repressor for the blaZ gene of β-lactamase. MecI and BlaI can bind to both operator DNA sequences. The crystal structure of MecI in complex with the 32 base-pair cognate DNA of mec was determined to 3.8 Å resolution. MecI is a homodimer and each monomer consists of a compact N-terminal winged-helix domain, which binds to DNA,more » and a loosely packed C-terminal helical domain, which intertwines with its counter-monomer. The crystal contains horizontal layers of virtual DNA double helices extending in three directions, which are separated by perpendicular DNA segments. Each DNA segment is bound to two MecI dimers. Similar to the BlaI–mec complex, but unlike the MecI–bla complex, the MecI repressors bind to both sides of the mec DNA dyad that contains four conserved sequences of TACA/TGTA. The results confirm the up-and-down binding to the mec operator, which may account for cooperative effect of the repressor.« less

  15. Isolation of a complementary DNA clone for thyroid microsomal antigen. Homology with the gene for thyroid peroxidase.

    PubMed Central

    Seto, P; Hirayu, H; Magnusson, R P; Gestautas, J; Portmann, L; DeGroot, L J; Rapoport, B

    1987-01-01

    The thyroid microsomal antigen (MSA) in autoimmune thyroid disease is a protein of approximately 107 kD. We screened a human thyroid cDNA library constructed in the expression vector lambda gt11 with anti-107-kD monoclonal antibodies. Of five clones obtained, the recombinant beta-galactosidase fusion protein from one clone (PM-5) was confirmed to react with the monoclonal antiserum. The complementary DNA (cDNA) insert from PM-5 (0.8 kb) was used as a probe on Northern blot analysis to estimate the size of the mRNA coding for the MSA. The 2.9-kb messenger RNA (mRNA) species observed was the same size as that coding for human thyroid peroxidase (TPO). The probe did not bind to human liver mRNA, indicating the thyroid-specific nature of the PM-5-related mRNA. The nucleotide sequence of PM-5 (842 bp) was determined and consisted of a single open reading frame. Comparison of the nucleotide sequence of PM-5 with that presently available for pig TPO indicates 84% homology. In conclusion, a cDNA clone representing part of the microsomal antigen has been isolated. Sequence homology with porcine TPO, as well as identity in the size of the mRNA species for both the microsomal antigen and TPO, indicate that the microsomal antigen is, at least in part, TPO. Images PMID:3654979

  16. Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1)

    PubMed Central

    Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

    2017-01-01

    Background A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. Methods The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3′end of the reporter gene and the VP2 start sequence to allow co-translational ‘cleavage’ of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Results Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. Conclusion NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication. PMID:29379384

  17. Lactobacillus hayakitensis sp. nov., isolated from intestines of healthy thoroughbreds.

    PubMed

    Morita, Hidetoshi; Shiratori, Chiharu; Murakami, Masaru; Takami, Hideto; Kato, Yukio; Endo, Akihito; Nakajima, Fumihiko; Takagi, Misako; Akita, Hiroaki; Okada, Sanae; Masaoka, Toshio

    2007-12-01

    Two strains, KBL13(T) and GBL13, were isolated as one of intestinal lactobacilli from the faecal specimens from different thoroughbreds of the same farm where they were born in Hokkaido, Japan. They were Gram-positive, facultatively anaerobic, catalase-negative, non-spore-forming and non-motile rods. KBL13(T) and GBL13 homofermentatively metabolize glucose, and produce lactate as the sole final product from glucose. The 16S rRNA gene sequence, DNA-DNA hybridization, DNA G+C content and biochemical characterization indicated that these two strains, KBL13(T) and GBL13, belong to the same species. In the representative strain, KBL13(T), the DNA G+C content was 34.3 mol%. Lactobacillus salivarius JCM 1231(T) (=ATCC 11741(T); AF089108) is the type strain most closely related to the strain KBL13(T) as shown in the phylogenetic tree, and the 16S rRNA gene sequence identity showed 96.0 % (1425/1484 bp). Comparative 16S rRNA gene sequence analysis of this strain indicated that the two isolated strains belong to the genus Lactobacillus and that they formed a branch distinct from their closest relatives, L. salivarius, Lactobacillus aviarius, Lactobacillus saerimneri and Lactobacillus acidipiscis. DNA-DNA reassociation experiments with L. salivarius and L. aviarius confirmed that KBL13(T) represents a novel species, for which the name Lactobacillus hayakitensis sp. nov. is proposed. The type strain is KBL13(T) (=JCM 14209(T)=DSM 18933(T)).

  18. Diagnosis of skin cancer by correlation and complexity analyses of damaged DNA

    PubMed Central

    Namazi, Hamidreza; Kulish, Vladimir V.; Delaviz, Fatemeh; Delaviz, Ali

    2015-01-01

    Skin cancer is a common, low-grade cancerous (malignant) growth of the skin. It starts from cells that begin as normal skin cells and transform into those with the potential to reproduce in an out-of-control manner. Cancer develops when DNA, the molecule found in cells that encodes genetic information, becomes damaged and the body cannot repair the damage. A DNA walk of a genome represents how the frequency of each nucleotide of a pairing nucleotide couple changes locally. In this research in order to diagnose the skin cancer, first DNA walk plots of genomes of patients with skin cancer were generated. Then, the data so obtained was checked for complexity by computing the fractal dimension. Furthermore, the Hurst exponent has been employed in order to study the correlation of damaged DNA. By analysing different samples it has been found that the damaged DNA sequences are exhibiting higher degree of complexity and less correlation compared to normal DNA sequences. This investigation confirms that this method can be used for diagnosis of skin cancer. The method discussed in this research is useful not only for diagnosis of skin cancer but can be applied for diagnosis and growth analysis of different types of cancers. PMID:26497203

  19. Cloning of a cDNA encoding 1-aminocyclopropane-1-carboxylate synthase and expression of its mRNA in ripening apple fruit.

    PubMed

    Dong, J G; Kim, W T; Yip, W K; Thompson, G A; Li, L; Bennett, A B; Yang, S F

    1991-08-01

    1-Aminocyclopropane-1-carboxylate (ACC) synthase (EC 4.4.1.14) purified from apple (Malus sylvestris Mill.) fruit was subjected to trypsin digestion. Following separation by reversed-phase high-pressure liquid chromatography, ten tryptic peptides were sequenced. Based on the sequences of three tryptic peptides, three sets of mixed oligonucleotide probes were synthesized and used to screen a plasmid cDNA library prepared from poly(A)(+) RNA of ripe apple fruit. A 1.5-kb (kilobase) cDNA clone which hybridized to all three probes were isolated. The clone contained an open reading frame of 1214 base pairs (bp) encoding a sequence of 404 amino acids. While the polyadenine tail at the 3'-end was intact, it lacked a portion of sequence at the 5'-end. Using the RNA-based polymerase chain reaction, an additional sequence of 148 bp was obtained at the 5'-end. Thus, 1362 bp were sequenced and they encode 454 amino acids. The deduced amino-acid sequence contained peptide sequences corresponding to all ten tryptic fragments, confirming the identity of the cDNA clone. Comparison of the deduced amino-acid sequence between ACC synthase from apple fruit and those from tomato (Lycopersicon esculentum Mill.) and winter squash (Cucurbita maxima Duch.) fruits demonstrated the presence of seven highly conserved regions, including the previously identified region for the active site. The size of the translation product of ACC-synthase mRNA was similar to that of the mature protein on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), indicating that apple ACC-synthase undergoes only minor, if any, post-translational proteolytic processing. Analysis of ACC-synthase mRNA by in-vitro translation-immunoprecipitation, and by Northern blotting indicates that the ACC-synthase mRNA was undetectable in unripe fruit, but was accumulated massively during the ripening proccess. These data demonstrate that the expression of the ACC-synthase gene is developmentally regulated.

  20. Detection of possible restriction sites for type II restriction enzymes in DNA sequences.

    PubMed

    Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L

    2011-01-01

    In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.

  1. A phytoplasma closely related to the pigeon pea witches'-broom phytoplasma (16Sr IX) is associated with citrus huanglongbing symptoms in the state of São Paulo, Brazil.

    PubMed

    Teixeira, D C; Wulff, N A; Martins, E C; Kitajima, E W; Bassanezi, R; Ayres, A J; Eveillard, S; Saillard, C; Bové, J M

    2008-09-01

    In February 2007, sweet orange trees with characteristic symptoms of huanglongbing (HLB) were encountered in a region of São Paulo state (SPs) hitherto free of HLB. These trees tested negative for the three liberibacter species associated with HLB. A polymerase chain reaction (PCR) product from symptomatic fruit columella DNA amplifications with universal primers fD1/rP1 was cloned and sequenced. The corresponding agent was found to have highest 16S rDNA sequence identity (99%) with the pigeon pea witches'-broom phytoplasma of group 16Sr IX. Sequences of PCR products obtained with phytoplasma 16S rDNA primer pairs fU5/rU3, fU5/P7 confirm these results. With two primers D7f2/D7r2 designed based on the 16S rDNA sequence of the cloned DNA fragment, positive amplifications were obtained from more than one hundred samples including symptomatic fruits and blotchy mottle leaves. Samples positive for phytoplasmas were negative for liberibacters, except for four samples, which were positive for both the phytoplasma and 'Candidatus Liberibacter asiaticus'. The phytoplasma was detected by electron microscopy in the sieve tubes of midribs from symptomatic leaves. These results show that a phytoplasma of group IX is associated with citrus HLB symptoms in northern, central, and southern SPs. This phytoplasma has very probably been transmitted to citrus from an external source of inoculum, but the putative insect vector is not yet known.

  2. Asian affinities and continental radiation of the four founding Native American mtDNAs.

    PubMed Central

    Torroni, A; Schurr, T G; Cabell, M F; Brown, M D; Neel, J V; Larsen, M; Smith, D G; Vullo, C M; Wallace, D C

    1993-01-01

    The mtDNA variation of 321 individuals from 17 Native American populations was examined by high-resolution restriction endonuclease analysis. All mtDNAs were amplified from a variety of sources by using PCR. The mtDNA of a subset of 38 of these individuals was also analyzed by D-loop sequencing. The resulting data were combined with previous mtDNA data from five other Native American tribes, as well as with data from a variety of Asian populations, and were used to deduce the phylogenetic relationships between mtDNAs and to estimate sequence divergences. This analysis revealed the presence of four haplotype groups (haplogroups A, B, C, and D) in the Amerind, but only one haplogroup (A) in the Na-Dene, and confirmed the independent origins of the Amerinds and the Na-Dene. Further, each haplogroup appeared to have been founded by a single mtDNA haplotype, a result which is consistent with a hypothesized founder effect. Most of the variation within haplogroups was tribal specific, that is, it occurred as tribal private polymorphisms. These observations suggest that the process of tribalization began early in the history of the Amerinds, with relatively little intertribal genetic exchange occurring subsequently. The sequencing of 341 nucleotides in the mtDNA D-loop revealed that the D-loop sequence variation correlated strongly with the four haplogroups defined by restriction analysis, and it indicated that the D-loop variation, like the haplotype variation, arose predominantly after the migration of the ancestral Amerinds across the Bering land bridge. Images Figure 4 PMID:7688932

  3. Multigene assessment of the species boundaries and sexual status of the basidiomycetous yeasts Cryptococcus flavescens and C. terrestris (Tremellales).

    PubMed

    Yurkov, Andrey; Guerreiro, Marco A; Sharma, Lav; Carvalho, Cláudia; Fonseca, Álvaro

    2015-01-01

    Cryptococcus flavescens and C. terrestris are phenotypically indistinguishable sister species that belong to the order Tremellales (Tremellomycetes, Basidiomycota) and which may be mistaken for C. laurentii based on phenotype. Phylogenetic separation between C. flavescens and C. terrestris was based on rDNA sequence analyses, but very little is known on their intraspecific genetic variability or propensity for sexual reproduction. We studied 59 strains from different substrates and geographic locations, and used a multilocus sequencing (MLS) approach complemented with the sequencing of mating type (MAT) genes to assess genetic variation and reexamine the boundaries of the two species, as well as their sexual status. The following five loci were chosen for MLS: the rDNA ITS-LSU region, the rDNA IGS1 spacer, and fragments of the genes encoding the largest subunit of RNA polymerase II (RPB1), the translation elongation factor 1 alpha (TEF1) and the p21-activated protein kinase (STE20). Phylogenetic network analyses confirmed the genetic separation of the two species and revealed two additional cryptic species, for which the names Cryptococcus baii and C. ruineniae are proposed. Further analyses of the data revealed a high degree of genetic heterogeneity within C. flavescens as well as evidence for recombination between lineages detected for this species. Strains of C. terrestris displayed higher levels of similarity in all analysed genes and appear to make up a single recombining group. The two MAT genes (STE3 and SXI1/SXI2) sequenced for C. flavescens strains confirmed the potential for sexual reproduction and suggest the presence of a tetrapolar mating system with a biallelic pheromone/receptor locus and a multiallelic HD locus. In C. terrestris we could only sequence STE3, which revealed a biallelic P/R locus. In spite of the strong evidence for sexual recombination in the two species, attempts at mating compatible strains of both species on culture media were unsuccessful.

  4. Multigene Assessment of the Species Boundaries and Sexual Status of the Basidiomycetous Yeasts Cryptococcus flavescens and C. terrestris (Tremellales)

    PubMed Central

    Sharma, Lav; Carvalho, Cláudia; Fonseca, Álvaro

    2015-01-01

    Cryptococcus flavescens and C. terrestris are phenotypically indistinguishable sister species that belong to the order Tremellales (Tremellomycetes, Basidiomycota) and which may be mistaken for C. laurentii based on phenotype. Phylogenetic separation between C. flavescens and C. terrestris was based on rDNA sequence analyses, but very little is known on their intraspecific genetic variability or propensity for sexual reproduction. We studied 59 strains from different substrates and geographic locations, and used a multilocus sequencing (MLS) approach complemented with the sequencing of mating type (MAT) genes to assess genetic variation and reexamine the boundaries of the two species, as well as their sexual status. The following five loci were chosen for MLS: the rDNA ITS-LSU region, the rDNA IGS1 spacer, and fragments of the genes encoding the largest subunit of RNA polymerase II (RPB1), the translation elongation factor 1 alpha (TEF1) and the p21-activated protein kinase (STE20). Phylogenetic network analyses confirmed the genetic separation of the two species and revealed two additional cryptic species, for which the names Cryptococcus baii and C. ruineniae are proposed. Further analyses of the data revealed a high degree of genetic heterogeneity within C. flavescens as well as evidence for recombination between lineages detected for this species. Strains of C. terrestris displayed higher levels of similarity in all analysed genes and appear to make up a single recombining group. The two MAT genes (STE3 and SXI1/SXI2) sequenced for C. flavescens strains confirmed the potential for sexual reproduction and suggest the presence of a tetrapolar mating system with a biallelic pheromone/receptor locus and a multiallelic HD locus. In C. terrestris we could only sequence STE3, which revealed a biallelic P/R locus. In spite of the strong evidence for sexual recombination in the two species, attempts at mating compatible strains of both species on culture media were unsuccessful. PMID:25811603

  5. Surveyor nuclease detection of mutations and polymorphisms of mtDNA in children.

    PubMed

    Pilch, Jacek; Asman, Marek; Jamroz, Ewa; Kajor, Maciej; Kotrys-Puchalska, Elżbieta; Goss, Małgorzata; Krzak, Maria; Witecka, Joanna; Gmiński, Jan; Sieroń, Aleksander L

    2010-11-01

    Mitochondrial encephalomyopathies are complex disorders with wide range of clinical manifestations. Particularly time-consuming is the identification of mutations in mitochondrial DNA. A group of 20 children with clinical manifestations of mitochondrial encephalomyopathies was selected for molecular studies. The aims were (a) to identify mutations in mtDNA isolated from muscle and (b) to verify detected mutations in DNA isolated from blood, in order to assess the utility of a Surveyor nuclease assay kit for patient screening. The most common changes found were polymorphisms, including a few missense mutations altering the amino acid sequence of mitochondrial proteins. In two boys with MELAS (i.e., mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes), a mutation A→G3243 was detected in the tRNALeu gene of mtDNA isolated from muscle and blood. In one boy, the carrier status of his mother was confirmed, based on molecular analysis of DNA isolated from blood. A method using Surveyor nuclease allows systematic screening for small mutations in mtDNA, using as its source blood of the patients and asymptomatic carriers. The method still requires confirmation studying a larger group. In some patients, the use of this method should precede and might limit indications for traumatic muscle and skin biopsy. Copyright © 2010 Elsevier Inc. All rights reserved.

  6. Application of environmental DNA to detect an endangered marine skate species in the wild.

    PubMed

    Weltz, Kay; Lyle, Jeremy M; Ovenden, Jennifer; Morgan, Jessica A T; Moreno, David A; Semmens, Jayson M

    2017-01-01

    Environmental DNA (eDNA) techniques have only recently been applied in the marine environment to detect the presence of marine species. Species-specific primers and probes were designed to detect the eDNA of the endangered Maugean skate (Zearaja maugeana) from as little as 1 L of water collected at depth (10-15 m) in Macquarie Harbour (MH), Tasmania. The identity of the eDNA was confirmed as Z. maugeana by sequencing the qPCR products and aligning these with the target sequence for a 100% match. This result has validated the use of this eDNA technique for detecting a rare species, Z. maugeana, in the wild. Being able to investigate the presence, and possibly the abundance, of Z. maugeana in MH and Bathurst harbour (BH), would be addressing a conservation imperative for the endangered Z. maugeana. For future application of this technique in the field, the rate of decay was determined for Z. maugeana eDNA under ambient dissolved oxygen (DO) levels (55% saturation) and lower DO (20% saturation) levels, revealing that the eDNA can be detected for 4 and 16 hours respectively, after which eDNA concentration drops below the detection threshold of the assay. With the rate of decay being influenced by starting eDNA concentrations, it is recommended that samples be filtered as soon as possible after collection to minimize further loss of eDNA prior to and during sample processing.

  7. Application of environmental DNA to detect an endangered marine skate species in the wild

    PubMed Central

    Morgan, Jessica A. T.; Moreno, David A.

    2017-01-01

    Environmental DNA (eDNA) techniques have only recently been applied in the marine environment to detect the presence of marine species. Species-specific primers and probes were designed to detect the eDNA of the endangered Maugean skate (Zearaja maugeana) from as little as 1 L of water collected at depth (10–15 m) in Macquarie Harbour (MH), Tasmania. The identity of the eDNA was confirmed as Z. maugeana by sequencing the qPCR products and aligning these with the target sequence for a 100% match. This result has validated the use of this eDNA technique for detecting a rare species, Z. maugeana, in the wild. Being able to investigate the presence, and possibly the abundance, of Z. maugeana in MH and Bathurst harbour (BH), would be addressing a conservation imperative for the endangered Z. maugeana. For future application of this technique in the field, the rate of decay was determined for Z. maugeana eDNA under ambient dissolved oxygen (DO) levels (55% saturation) and lower DO (20% saturation) levels, revealing that the eDNA can be detected for 4 and 16 hours respectively, after which eDNA concentration drops below the detection threshold of the assay. With the rate of decay being influenced by starting eDNA concentrations, it is recommended that samples be filtered as soon as possible after collection to minimize further loss of eDNA prior to and during sample processing. PMID:28591215

  8. High Mitochondrial DNA Stability in B-Cell Chronic Lymphocytic Leukemia

    PubMed Central

    Cerezo, María; Bandelt, Hans-Jürgen; Martín-Guerrero, Idoia; Ardanaz, Maite; Vega, Ana; Carracedo, Ángel; García-Orad, África; Salas, Antonio

    2009-01-01

    Background Chronic Lymphocytic Leukemia (CLL) leads to progressive accumulation of lymphocytes in the blood, bone marrow, and lymphatic tissues. Previous findings have suggested that the mtDNA could play an important role in CLL. Methodology/Principal Findings The mitochondrial DNA (mtDNA) control-region was analyzed in lymphocyte cell DNA extracts and compared with their granulocyte counterpart extract of 146 patients suffering from B-Cell CLL; B-CLL (all recruited from the Basque country). Major efforts were undertaken to rule out methodological artefacts that would render a high false positive rate for mtDNA instabilities and thus lead to erroneous interpretation of sequence instabilities. Only twenty instabilities were finally confirmed, most of them affecting the homopolymeric stretch located in the second hypervariable segment (HVS-II) around position 310, which is well known to constitute an extreme mutational hotspot of length polymorphism, as these mutations are frequently observed in the general human population. A critical revision of the findings in previous studies indicates a lack of proper methodological standards, which eventually led to an overinterpretation of the role of the mtDNA in CLL tumorigenesis. Conclusions/Significance Our results suggest that mtDNA instability is not the primary causal factor in B-CLL. A secondary role of mtDNA mutations cannot be fully ruled out under the hypothesis that the progressive accumulation of mtDNA instabilities could finally contribute to the tumoral process. Recommendations are given that would help to minimize erroneous interpretation of sequencing results in mtDNA studies in tumorigenesis. PMID:19924307

  9. Using next-generation sequencing for high resolution multiplex analysis of copy number variation from nanogram quantities of DNA from formalin-fixed paraffin-embedded specimens.

    PubMed

    Wood, Henry M; Belvedere, Ornella; Conway, Caroline; Daly, Catherine; Chalkley, Rebecca; Bickerdike, Melissa; McKinley, Claire; Egan, Phil; Ross, Lisa; Hayward, Bruce; Morgan, Joanne; Davidson, Leslie; MacLennan, Ken; Ong, Thian K; Papagiannopoulos, Kostas; Cook, Ian; Adams, David J; Taylor, Graham R; Rabbitts, Pamela

    2010-08-01

    The use of next-generation sequencing technologies to produce genomic copy number data has recently been described. Most approaches, however, reply on optimal starting DNA, and are therefore unsuitable for the analysis of formalin-fixed paraffin-embedded (FFPE) samples, which largely precludes the analysis of many tumour series. We have sought to challenge the limits of this technique with regards to quality and quantity of starting material and the depth of sequencing required. We confirm that the technique can be used to interrogate DNA from cell lines, fresh frozen material and FFPE samples to assess copy number variation. We show that as little as 5 ng of DNA is needed to generate a copy number karyogram, and follow this up with data from a series of FFPE biopsies and surgical samples. We have used various levels of sample multiplexing to demonstrate the adjustable resolution of the methodology, depending on the number of samples and available resources. We also demonstrate reproducibility by use of replicate samples and comparison with microarray-based comparative genomic hybridization (aCGH) and digital PCR. This technique can be valuable in both the analysis of routine diagnostic samples and in examining large repositories of fixed archival material.

  10. Structure of CARB-4 and AER-1 CarbenicillinHydrolyzing β-Lactamases

    PubMed Central

    Sanschagrin, François; Bejaoui, Noureddine; Levesque, Roger C.

    1998-01-01

    We determined the nucleotide sequences of blaCARB-4 encoding CARB-4 and deduced a polypeptide of 288 amino acids. The gene was characterized as a variant of group 2c carbenicillin-hydrolyzing β-lactamases such as PSE-4, PSE-1, and CARB-3. The level of DNA homology between the bla genes for these β-lactamases varied from 98.7 to 99.9%, while that between these genes and blaCARB-4 encoding CARB-4 was 86.3%. The blaCARB-4 gene was acquired from some other source because it has a G+C content of 39.1%, compared to a G+C content of 67% for typical Pseudomonas aeruginosa genes. DNA sequencing revealed that blaAER-1 shared 60.8% DNA identity with blaPSE-3 encoding PSE-3. The deduced AER-1 β-lactamase peptide was compared to class A, B, C, and D enzymes and had 57.6% identity with PSE-3, including an STHK tetrad at the active site. For CARB-4 and AER-1, conserved canonical amino acid boxes typical of class A β-lactamases were identified in a multiple alignment. Analysis of the DNA sequences flanking blaCARB-4 and blaAER-1 confirmed the importance of gene cassettes acquired via integrons in bla gene distribution. PMID:9687391

  11. DNA analysis in the case of Kaspar Hauser.

    PubMed

    Weichhold, G M; Bark, J E; Korte, W; Eisenmenger, W; Sullivan, K M

    1998-01-01

    In 1828 a mysterious young man appeared in Nürnberg, Germany, who was barely able to speak or walk but could write down his name, Kaspar Hauser. He quickly became the centre of social interest but also the victim of intrigue. His appearance, his origin and assassination in 1833 were, and still are, the source of much debate. The most widely accepted theory postulates that Kaspar Hauser was the son of Grand Duke Carl von Baden and his wife Stephanie de Beauharnais, an adopted daughter of Napoleon Bonaparte. To check this theory, DNA analysis was performed on the clothes most likely worn by Kaspar Hauser when he was stabbed on December 14th, 1833. A suitable bloodstain from the underpants was divided and analysed independently by the Institute of Legal Medicine, University of Munich (ILM) and the Forensic Science Service Laboratory, Birmingham (FSS). Mitochondrial DNA (mtDNA) was sequenced from the bloodstain and from blood samples obtained from two living maternal relatives of Stephanie de Beauharnais. The sequence from the bloodstained clothing differed from the sequence found in both reference blood samples at seven confirmed positions. This proves that the bloodstain does not originate from a son of Stephanie de Beauharnais. Thus, it is becoming clear that Kaspar Hauser was not the Prince of Baden.

  12. Cloning of human prourokinase cDNA without the signal peptide and expression in Escherichia coli.

    PubMed

    Hu, B; Li, J; Yu, W; Fang, J

    1993-01-01

    Human prourokinase (pro-UK) cDNA without the signal peptide was obtained using synthetic oligonucleotide and DNA recombination techniques and was successfully expressed in E. coli. The plasmid pMMUK which contained pro-UK cDNA (including both the entire coding sequence and the sequence for signal peptide) was digested with Hind III and PstI, so that the N-terminal 371-bp fragment could be recovered. A 304-bp fragment was collected from the 371-bp fragment after partial digestion with Fnu4HI in order to remove the signal peptide sequence. An intermediate plasmid was formed after this 304-bp fragment and the synthetic oligonucleotide was ligated with pUC18. Correctness of the ligation was confirmed by enzyme digestion and sequencing. By joining the PstI-PstI fragment of pro-UK to the plasmid we obtained the final plasmid which contained the entire coding sequence of pro-UK without the signal peptide. The coding sequence with correct orientation was inserted into pBV220 under the control of the temperature-induced promoter PRPL, and mature pro-UK was expressed in E. coli at 42 degrees C. Both sonicated supernatant and inclusion bodies of the bacterial host JM101 showed positive results by ELISA and FAPA assays. After renaturation, the biological activity of the expressed product was increased from 500-1000IU/L to about 60,000IU/L. The bacterial pro-UK showed a molecular weight of about 47,000 daltons by Western blot analysis. It can be completely inhibited by UK antiserum but not by t-PA antiserum nor by normal rabbit serum.

  13. Detection of Rickettsia felis in Wild Mammals from Three Municipalities in Yucatan, Mexico.

    PubMed

    Panti-May, Jesús Alonso; Torres-Castro, Marco; Hernández-Betancourt, Silvia; Dzul-Rosado, Karla; Zavala-Castro, Jorge; López-Avila, Karina; Tello-Martín, Raúl

    2015-09-01

    The aim of this study was to provide information of the occurrence of Rickettsia felis in wild mammals from three municipalities in Yucatan, Mexico. The reactivity of rodent serum to Rickettsia antigens was detected in 80.9% (17 of 21) samples using immunofluorescence assay. Polymerase chain reaction identified rickettsial DNA in spleens of 43.5% (10 of 23) rodents and 57.1% (4 of 7) opossums. The identification of the rickettsial DNA was confirmed as R. felis by restriction fragment length polymorphism and DNA sequencing. This study comprises the first report of R. felis detection in wild mammals in Yucatan.

  14. Morphological and molecular evidence supporting an arbutoid mycorrhizal relationship in the Costa Rican páramo.

    PubMed

    Osmundson, Todd W; Halling, Roy E; den Bakker, Henk C

    2007-05-01

    This study examines evidence for a particular arbutoid mycorrhizal interaction in páramo, a high-altitude neotropical ecosystem important in hydrological regulation but poorly known in terms of its fungal communities. Comarostaphylis arbutoides Lindley (Ericaceae) often forms dense thickets in Central American páramo habitats. Based on phylogenetic classification, it has been suggested that C. arbutoides forms arbutoid mycorrhizae with diverse Basidiomycetes and Ascomycetes; however, this assumption has not previously been confirmed. Based on field data, we hypothesized an arbutoid mycorrhizal association between C. arbutoides and the recently described bolete Leccinum monticola Halling & G.M. Mueller; in this study, we applied a rigorous approach using anatomical and molecular data to examine evidence for such an association. We examined root samples collected beneath L. monticola basidiomes for mycorrhizal structures, and we also compared rDNA internal transcribed spacer (ITS) sequences between mycorrhizal root tips and leaf or basidiome material of the suspected symbionts. Root cross sections showed a thin hyphal sheath and intracellular hyphal coils typical of arbutoid mycorrhizae. DNA sequence comparisons confirmed the identity of C. arbutoides and L. monticola as the mycorrhizal symbionts. In addition, this paper provides additional evidence for the widespread presence of minisatellite-like inserts in the ITS1 spacer in Leccinum species (including a characterization of the insert in L. monticola) and reports the use of an angiosperm-specific ITS primer pair useful for amplifying plant DNA from mycorrhizal roots without co-amplifying fungal DNA.

  15. Distribution of gene mutations in sporadic congenital cataract in a Han Chinese population

    PubMed Central

    Li, Dan; Wang, Siying; Ye, Hongfei; Tang, Yating; Qiu, Xiaodi; Fan, Qi; Rong, Xianfang; Liu, Xin; Chen, Yuhong; Yang, Jin

    2016-01-01

    Purpose This study aimed to investigate the genetic effects underlying non-familial sporadic congenital cataract (SCC). Methods We collected DNA samples from 74 patients with SCC and 20 patients with traumatic cataract (TC) in an age-matched group and performed genomic sequencing of 61 lens-related genes with target region capture and next-generation sequencing (NGS). The suspected SCC variants were validated with MassARRAY and Sanger sequencing. DNA samples from 103 healthy subjects were used as additional controls in the confirmation examination. Results By filtering against common variants in public databases and those associated with TC cases, we identified 23 SCC-specific variants in 17 genes from 19 patients, which were predicted to be functional. These mutations were further confirmed by examination of the 103 healthy controls. Among the mutated genes, CRYBB3 had the highest mutation frequency with mutations detected four times in four patients, followed by EPHA2, NHS, and WDR36, the mutation of which were detected two times in two patients. We observed that the four patients with CRYBB3 mutations had three different cataract phenotypes. Conclusions From this study, we concluded the clinical and genetic heterogeneity of SCC. This is the first study to report broad spectrum genotyping for patients with SCC. PMID:27307692

  16. Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides.

    PubMed

    Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M; Högberg, Björn

    2013-07-01

    Single-stranded oligonucleotides are important as research tools, as diagnostic probes, in gene therapy and in DNA nanotechnology. Oligonucleotides are typically produced via solid-phase synthesis, using polymer chemistries that are limited relative to what biological systems produce. The number of errors in synthetic DNA increases with oligonucleotide length, and the resulting diversity of sequences can be a problem. Here we present the 'monoclonal stoichiometric' (MOSIC) method for enzyme-mediated production of DNA oligonucleotides. We amplified oligonucleotides from clonal templates derived from single bacterial colonies and then digested cutter hairpins in the products, which released pools of oligonucleotides with precisely controlled relative stoichiometric ratios. We prepared 14-378-nucleotide MOSIC oligonucleotides either by in vitro rolling-circle amplification or by amplification of phagemid DNA in Escherichia coli. Analyses of the formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides.

  17. High-Resolution Melting (HRM) of Hypervariable Mitochondrial DNA Regions for Forensic Science.

    PubMed

    Dos Santos Rocha, Alípio; de Amorim, Isis Salviano Soares; Simão, Tatiana de Almeida; da Fonseca, Adenilson de Souza; Garrido, Rodrigo Grazinoli; Mencalha, Andre Luiz

    2018-03-01

    Forensic strategies commonly are proceeding by analysis of short tandem repeats (STRs); however, new additional strategies have been proposed for forensic science. Thus, this article standardized the high-resolution melting (HRM) of DNA for forensic analyzes. For HRM, mitochondrial DNA (mtDNA) from eight individuals were extracted from mucosa swabs by DNAzol reagent, samples were amplified by PCR and submitted to HRM analysis to identify differences in hypervariable (HV) regions I and II. To confirm HRM, all PCR products were DNA sequencing. The data suggest that is possible discriminate DNA from different samples by HRM curves. Also, uncommon dual-dissociation was identified in a single PCR product, increasing HRM analyzes by evaluation of melting peaks. Thus, HRM is accurate and useful to screening small differences in HVI and HVII regions from mtDNA and increase the efficiency of laboratory routines based on forensic genetics. © 2017 American Academy of Forensic Sciences.

  18. Screening and Characterization of RAPD Markers in Viscerotropic Leishmania Parasites

    PubMed Central

    Mkada–Driss, Imen; Talbi, Chiraz; Guerbouj, Souheila; Driss, Mehdi; Elamine, Elwaleed M.; Cupolillo, Elisa; Mukhtar, Moawia M.; Guizani, Ikram

    2014-01-01

    Visceral leishmaniasis (VL) is mainly due to the Leishmania donovani complex. VL is endemic in many countries worldwide including East Africa and the Mediterranean region where the epidemiology is complex. Taxonomy of these pathogens is under controversy but there is a correlation between their genetic diversity and geographical origin. With steady increase in genome knowledge, RAPD is still a useful approach to identify and characterize novel DNA markers. Our aim was to identify and characterize polymorphic DNA markers in VL Leishmania parasites in diverse geographic regions using RAPD in order to constitute a pool of PCR targets having the potential to differentiate among the VL parasites. 100 different oligonucleotide decamers having arbitrary DNA sequences were screened for reproducible amplification and a selection of 28 was used to amplify DNA from 12 L. donovani, L. archibaldi and L. infantum strains having diverse origins. A total of 155 bands were amplified of which 60.65% appeared polymorphic. 7 out of 28 primers provided monomorphic patterns. Phenetic analysis allowed clustering the parasites according to their geographical origin. Differentially amplified bands were selected, among them 22 RAPD products were successfully cloned and sequenced. Bioinformatic analysis allowed mapping of the markers and sequences and priming sites analysis. This study was complemented with Southern-blot to confirm assignment of markers to the kDNA. The bioinformatic analysis identified 16 nuclear and 3 minicircle markers. Analysis of these markers highlighted polymorphisms at RAPD priming sites with mainly 5′ end transversions, and presence of inter– and intra– taxonomic complex sequence and microsatellites variations; a bias in transitions over transversions and indels between the different sequences compared is observed, which is however less marked between L. infantum and L. donovani. The study delivers a pool of well-documented polymorphic DNA markers, to develop molecular diagnostics assays to characterize and differentiate VL causing agents. PMID:25313833

  19. Differences in expression of retinal pigment epithelium mRNA between normal canines

    PubMed Central

    2004-01-01

    Abstract A reference database of differences in mRNA expression in normal healthy canine retinal pigment epithelium (RPE) has been established. This database identifies non-informative differences in mRNA expression that can be used in screening canine RPE for mutations associated with clinical effects on vision. Complementary DNA (cDNA) pools were prepared from mRNA harvested from RPE, amplified by PCR, and used in a subtractive hybridization protocol (representational differential analysis) to identify differences in RPE mRNA expression between canines. The effect of relatedness of the test canines on the frequency of occurrence of differences was evaluated by using 2 unrelated canines for comparison with 2 female sibling canines of blue heeler/bull terrier lineage. Differentially expressed cDNA species were cloned, sequenced, and identified by comparison to public database entries. The most frequently observed differentially expressed sequence from the unrelated canine comparison was cDNA with 21 base pairs (bp) identical to the human epithelial membrane protein 1 gene (present in 8 of 20 clones). Different clones from the same-sex sibling RPE contained repetitions of several short sequence motifs including the human epithelial membrane protein 1 (4 of 25 clones). Other prevalent differences between sibling RPE included sequences similar to a chicken genetic marker sequence motif (5 of 25), and 6 clones with homology to porcine major histocompatibility loci. In addition to identifying several repetitively occurring, noninformative, differentially expressed RPE mRNA species, the findings confirm that fewer differences occurred between siblings, highlighting the importance of using closely related subjects in representational difference analysis studies. PMID:15352545

  20. Filling reference gaps via assembling DNA barcodes using high-throughput sequencing—moving toward barcoding the world

    PubMed Central

    Zhou, Chengran

    2017-01-01

    Abstract Over the past decade, biodiversity researchers have dedicated tremendous efforts to constructing DNA reference barcodes for rapid species registration and identification. Although analytical cost for standard DNA barcoding has been significantly reduced since early 2000, further dramatic reduction in barcoding costs is unlikely because Sanger sequencing is approaching its limits in throughput and chemistry cost. Constraints in barcoding cost not only led to unbalanced barcoding efforts around the globe, but also prevented high-throughput sequencing (HTS)–based taxonomic identification from applying binomial species names, which provide crucial linkages to biological knowledge. We developed an Illumina-based pipeline, HIFI-Barcode, to produce full-length Cytochrome c oxidase subunit I (COI) barcodes from pooled polymerase chain reaction amplicons generated by individual specimens. The new pipeline generated accurate barcode sequences that were comparable to Sanger standards, even for different haplotypes of the same species that were only a few nucleotides different from each other. Additionally, the new pipeline was much more sensitive in recovering amplicons at low quantity. The HIFI-Barcode pipeline successfully recovered barcodes from more than 78% of the polymerase chain reactions that didn’t show clear bands on the electrophoresis gel. Moreover, sequencing results based on the single molecular sequencing platform Pacbio confirmed the accuracy of the HIFI-Barcode results. Altogether, the new pipeline can provide an improved solution to produce full-length reference barcodes at about one-tenth of the current cost, enabling construction of comprehensive barcode libraries for local fauna, leading to a feasible direction for DNA barcoding global biomes. PMID:29077841

  1. Evolution of EF-hand calcium-modulated proteins. IV. Exon shuffling did not determine the domain compositions of EF-hand proteins

    NASA Technical Reports Server (NTRS)

    Kretsinger, R. H.; Nakayama, S.

    1993-01-01

    In the previous three reports in this series we demonstrated that the EF-hand family of proteins evolved by a complex pattern of gene duplication, transposition, and splicing. The dendrograms based on exon sequences are nearly identical to those based on protein sequences for troponin C, the essential light chain myosin, the regulatory light chain, and calpain. This validates both the computational methods and the dendrograms for these subfamilies. The proposal of congruence for calmodulin, troponin C, essential light chain, and regulatory light chain was confirmed. There are, however, significant differences in the calmodulin dendrograms computed from DNA and from protein sequences. In this study we find that introns are distributed throughout the EF-hand domain and the interdomain regions. Further, dendrograms based on intron type and distribution bear little resemblance to those based on protein or on DNA sequences. We conclude that introns are inserted, and probably deleted, with relatively high frequency. Further, in the EF-hand family exons do not correspond to structural domains and exon shuffling played little if any role in the evolution of this widely distributed homolog family. Calmodulin has had a turbulent evolution. Its dendrograms based on protein sequence, exon sequence, 3'-tail sequence, intron sequences, and intron positions all show significant differences.

  2. Characterisation of divergent flavivirus NS3 and NS5 protein sequences detected in Rhipicephalus microplus ticks from Brazil

    PubMed Central

    Maruyama, Sandra Regina; Castro-Jorge, Luiza Antunes; Ribeiro, José Marcos Chaves; Gardinassi, Luiz Gustavo; Garcia, Gustavo Rocha; Brandão, Lucinda Giampietro; Rodrigues, Aline Rezende; Okada, Marcos Ituo; Abrão, Emiliana Pereira; Ferreira, Beatriz Rossetti; da Fonseca, Benedito Antonio Lopes; de Miranda-Santos, Isabel Kinney Ferreira

    2013-01-01

    Transcripts similar to those that encode the nonstructural (NS) proteins NS3 and NS5 from flaviviruses were found in a salivary gland (SG) complementary DNA (cDNA) library from the cattle tick Rhipicephalus microplus. Tick extracts were cultured with cells to enable the isolation of viruses capable of replicating in cultured invertebrate and vertebrate cells. Deep sequencing of the viral RNA isolated from culture supernatants provided the complete coding sequences for the NS3 and NS5 proteins and their molecular characterisation confirmed similarity with the NS3 and NS5 sequences from other flaviviruses. Despite this similarity, phylogenetic analyses revealed that this potentially novel virus may be a highly divergent member of the genus Flavivirus. Interestingly, we detected the divergent NS3 and NS5 sequences in ticks collected from several dairy farms widely distributed throughout three regions of Brazil. This is the first report of flavivirus-like transcripts in R. microplus ticks. This novel virus is a potential arbovirus because it replicated in arthropod and mammalian cells; furthermore, it was detected in a cDNA library from tick SGs and therefore may be present in tick saliva. It is important to determine whether and by what means this potential virus is transmissible and to monitor the virus as a potential emerging tick-borne zoonotic pathogen. PMID:24626302

  3. Deep-sequencing to resolve complex diversity of apicomplexan parasites in platypuses and echidnas: Proof of principle for wildlife disease investigation.

    PubMed

    Šlapeta, Jan; Saverimuttu, Stefan; Vogelnest, Larry; Sangster, Cheryl; Hulst, Frances; Rose, Karrie; Thompson, Paul; Whittington, Richard

    2017-11-01

    The short-beaked echidna (Tachyglossus aculeatus) and the platypus (Ornithorhynchus anatinus) are iconic egg-laying monotremes (Mammalia: Monotremata) from Australasia. The aim of this study was to demonstrate the utility of diversity profiles in disease investigations of monotremes. Using small subunit (18S) rDNA amplicon deep-sequencing we demonstrated the presence of apicomplexan parasites and confirmed by direct and cloned amplicon gene sequencing Theileria ornithorhynchi, Theileria tachyglossi, Eimeria echidnae and Cryptosporidium fayeri. Using a combination of samples from healthy and diseased animals, we show a close evolutionary relationship between species of coccidia (Eimeria) and piroplasms (Theileria) from the echidna and platypus. The presence of E. echidnae was demonstrated in faeces and tissues affected by disseminated coccidiosis. Moreover, the presence of E. echidnae DNA in the blood of echidnas was associated with atoxoplasma-like stages in white blood cells, suggesting Hepatozoon tachyglossi blood stages are disseminated E. echidnae stages. These next-generation DNA sequencing technologies are suited to material and organisms that have not been previously characterised and for which the material is scarce. The deep sequencing approach supports traditional diagnostic methods, including microscopy, clinical pathology and histopathology, to better define the status quo. This approach is particularly suitable for wildlife disease investigation. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Functional Genomics Analysis of Singapore Grouper Iridovirus: Complete Sequence Determination and Proteomic Analysis

    PubMed Central

    Song, Wen Jun; Qin, Qi Wei; Qiu, Jin; Huang, Can Hua; Wang, Fan; Hew, Choy Leong

    2004-01-01

    Here we report the complete genome sequence of Singapore grouper iridovirus (SGIV). Sequencing of the random shotgun and restriction endonuclease genomic libraries showed that the entire SGIV genome consists of 140,131 nucleotide bp. One hundred sixty-two open reading frames (ORFs) from the sense and antisense DNA strands, coding for lengths varying from 41 to 1,268 amino acids, were identified. Computer-assisted analyses of the deduced amino acid sequences revealed that 77 of the ORFs exhibited homologies to known virus genes, 23 of which matched functional iridovirus proteins. Forty-two putative conserved domains or signatures were detected in the National Center for Biotechnology Information CD-Search database and PROSITE database. An assortment of enzyme activities involved in DNA replication, transcription, nucleotide metabolism, cell signaling, etc., were identified. Viruses were cultured on a cell line derived from the embryonated egg of the grouper Epinephelus tauvina, isolated, and purified by sucrose gradient ultracentrifugation. The protein extract from the purified virions was analyzed by polyacrylamide gel electrophoresis followed by in-gel digestion of protein bands. Matrix-assisted laser desorption ionization-time of flight mass spectrometry and database searching led to identification of 26 proteins. Twenty of these represented novel or previously unidentified genes, which were further confirmed by reverse transcription-PCR (RT-PCR) and DNA sequencing of their respective RT-PCR products. PMID:15507645

  5. West Nile virus infection in killer whale, Texas, USA, 2007.

    PubMed

    St Leger, Judy; Wu, Guang; Anderson, Mark; Dalton, Les; Nilson, Erika; Wang, David

    2011-08-01

    In 2007, nonsuppurative encephalitis was identified in a killer whale at a Texas, USA, marine park. Panviral DNA microarray of brain tissue suggested West Nile virus (WNV); WNV was confirmed by reverse transcription PCR and sequencing. Immunohistochemistry demonstrated WNV antigen within neurons. WNV should be considered in cases of encephalitis in cetaceans.

  6. Epigenetics: A Fascinating Field with Profound Research, Clinical, & Public Health Implications

    ERIC Educational Resources Information Center

    Stein, Richard A.; Davis, Devra Lee

    2012-01-01

    Epigenetics is emerging as one of the most dynamic and vibrant biomedical areas. Multiple lines of evidence confirm that inherited genetic changes alone cannot fully explain all phenotypic characteristics of live organisms, and additional factors, which are not encoded in the DNA sequence, are involved. The contribution of non-genetic factors is…

  7. Exobasidium ferrugineae sp. nov., associated with hypertrophied flowers of Lyonia ferruginea in the southeastern USA

    Treesearch

    Aaron H. Kennedy; Nisse A. Goldberg; Anderw M. Minnis

    2012-01-01

    Exobasidium ferrugineae, associated with hypertrophied flowers and less commonly leaves of Lyonia ferruginea (rusty staggerbush), is formally described here as a new species. Morphological and DNA sequence (ITS, nLSU) data are provided. Phylogenetic analyses confirm that it is not conspecific with any species of ...

  8. Identification of Arcanobacterium pyogenes isolated by post mortem examinations of a bearded dragon and a gecko by phenotypic and genotypic properties.

    PubMed

    Ulbegi-Mohyla, H; Hijazin, M; Alber, J; Lämmler, C; Hassan, A A; Abdulmawjood, A; Prenger-Berninghoff, E; Weiss, R; Zschöck, M

    2010-09-01

    The present study was designed to identify phenotypically and genotypically two Arcanobacterium (A.) pyogenes strains isolated by post mortem examinations of a bearded dragon and a gecko. The A. pyogenes strains showed the typical biochemical properties and displayed CAMP-like synergistic hemolytic activities with various indicator strains. The species identity could be confirmed genotypically by amplification and sequencing of the 16S rDNA gene and, as novel target gene, by sequencing of the beta subunit of RNA polymerase encoding gene rpoB, of both strains and of reference strains representing nine species of the genus Arcanobacterium. The species identity of the two A. pyogenes strains could additionally be confirmed by PCR mediated amplification of species specific parts of the 16S-23S rDNA intergenic spacer region, the pyolysin encoding gene plo and by amplification of the collagen-binding protein encoding gene cbpA. All these molecular targets might help to improve the future identification and further characterization of A. pyogenes which, as demonstrated in the present study, could also be isolated from reptile specimens.

  9. Novel strategy combining SYBR Green I with carbon nanotubes for highly sensitive detection of Salmonella typhimurium DNA.

    PubMed

    Mao, Pingdao; Ning, Yi; Li, Wenkai; Peng, Zhihui; Chen, Yongzhe; Deng, Le

    2014-01-10

    A simple, selective, sensitive and label-free fluorescent method for detecting trpS-harboring Salmonella typhimurium was developed in this study. This assay used the non-covalent interaction of single-stranded DNA (ssDNA) probes with SWNTs, since SWNTs can quench fluorescence. Fluorescence recovery (78% with 1.8 nM target DNA) was detected in the presence of target DNA as ssDNA probes detached from SWNTs hybridized with target DNA, and the resulting double-stranded DNA (dsDNA) intercalated with SYBR Green I (SG) dyes. The increasing fluorescence intensity reached 4.54-fold. In contrast, mismatched oligonucleotides (1- or 3-nt difference to the target DNA) did not contribute to significant fluorescent recovery, which demonstrated the specificity of the assay. The increasing fluorescence intensity increased 3.15-fold when purified PCR products containing complementary sequences of trpS gene were detected. These results confirmed the ability to use this assay for detecting real samples. Copyright © 2013 Elsevier Inc. All rights reserved.

  10. Fascioliasis transmission by Lymnaea neotropica confirmed by nuclear rDNA and mtDNA sequencing in Argentina.

    PubMed

    Mera y Sierra, Roberto; Artigas, Patricio; Cuervo, Pablo; Deis, Erika; Sidoti, Laura; Mas-Coma, Santiago; Bargues, Maria Dolores

    2009-12-03

    Fascioliasis is widespread in livestock in Argentina. Among activities included in a long-term initiative to ascertain which are the fascioliasis areas of most concern, studies were performed in a recreational farm, including liver fluke infection in different domestic animal species, classification of the lymnaeid vector and verification of natural transmission of fascioliasis by identification of the intramolluscan trematode larval stages found in naturally infected snails. The high prevalences in the domestic animals appeared related to only one lymnaeid species present. Lymnaeid and trematode classification was verified by means of nuclear ribosomal DNA and mitochondrial DNA marker sequencing. Complete sequences of 18S rRNA gene and rDNA ITS-2 and ITS-1, and a fragment of the mtDNA cox1 gene demonstrate that the Argentinian lymnaeid belongs to the species Lymnaea neotropica. Redial larval stages found in a L. neotropica specimen were ascribed to Fasciola hepatica after analysis of the complete ITS-1 sequence. The finding of L. neotropica is the first of this lymnaeid species not only in Argentina but also in Southern Cone countries. The total absence of nucleotide differences between the sequences of specimens from Argentina and the specimens from the Peruvian type locality at the levels of rDNA 18S, ITS-2 and ITS-1, and the only one mutation at the mtDNA cox1 gene suggest a very recent spread. The ecological characteristics of this lymnaeid, living in small, superficial water collections frequented by livestock, suggest that it may be carried from one place to another by remaining in dried mud stuck to the feet of transported animals. The presence of L. neotropica adds pronounced complexity to the transmission and epidemiology of fascioliasis in Argentina, due to the great difficulties in distinguishing, by traditional malacological methods, between the three similar lymnaeid species of the controversial Galba/Fossaria group present in this country: L. viatrix, Galba truncatula and L. neotropica. It also poses a problem with regard to the use, for lymnaeid vector species discrimination, of several molecular techniques which do not show sufficient accuracy, as those relying on the 18S rRNA gene or parts of it, because both L. neotropica and L. viatrix present identical 18S sequence.

  11. cDNA identification, comparison and phylogenetic aspects of lombricine kinase from two oligochaete species.

    PubMed

    Doumen, Chris

    2010-06-01

    Creatine kinase and arginine kinase are the typical representatives of an eight-member phosphagen kinase family, which play important roles in the cellular energy metabolism of animals. The phylum Annelida underwent a series of evolutionary processes that resulted in rapid divergence and radiation of these enzymes, producing the greatest diversity of the phosphagen kinases within this phylum. Lombricine kinase (EC 2.7.3.5) is one of such enzymes and sequence information is rather limited compared to other phosphagen kinases. This study presents data on the cDNA sequences of lombricine kinase from two oligochaete species, the California blackworm (Lumbriculus variegatus) and the sludge worm (Tubifex tubifex). The deduced amino acid sequences are analyzed and compared with other selected phosphagen kinases, including two additional lombricine kinase sequences extracted from DNA databases and provide further insights in the evolution and position of these enzymes within the phosphagen kinase family. The data confirms the presence of a deleted region within the flexible loop (the GS region) of all six examined lombricine kinases. A phylogenetic analysis of these six lombricine kinases clearly positions the enzymes together in a small subcluster within the larger creatine kinase (EC 2.7.3.2) clade. 2010. Published by Elsevier Inc.

  12. GABI-Kat SimpleSearch: new features of the Arabidopsis thaliana T-DNA mutant database.

    PubMed

    Kleinboelting, Nils; Huep, Gunnar; Kloetgen, Andreas; Viehoever, Prisca; Weisshaar, Bernd

    2012-01-01

    T-DNA insertion mutants are very valuable for reverse genetics in Arabidopsis thaliana. Several projects have generated large sequence-indexed collections of T-DNA insertion lines, of which GABI-Kat is the second largest resource worldwide. User access to the collection and its Flanking Sequence Tags (FSTs) is provided by the front end SimpleSearch (http://www.GABI-Kat.de). Several significant improvements have been implemented recently. The database now relies on the TAIRv10 genome sequence and annotation dataset. All FSTs have been newly mapped using an optimized procedure that leads to improved accuracy of insertion site predictions. A fraction of the collection with weak FST yield was re-analysed by generating new FSTs. Along with newly found predictions for older sequences about 20,000 new FSTs were included in the database. Information about groups of FSTs pointing to the same insertion site that is found in several lines but is real only in a single line are included, and many problematic FST-to-line links have been corrected using new wet-lab data. SimpleSearch currently contains data from ~71,000 lines with predicted insertions covering 62.5% of the 27,206 nuclear protein coding genes, and offers insertion allele-specific data from 9545 confirmed lines that are available from the Nottingham Arabidopsis Stock Centre.

  13. Allovahlkampfia spelaea Causing Keratitis in Humans

    PubMed Central

    Tolba, Mohammed Essa Marghany; Huseein, Enas Abdelhameed Mahmoud; Farrag, Haiam Mohamed Mahmoud; Mohamed, Hanan El Deek; Kobayashi, Seiki; Suzuki, Jun; Ali, Tarek Ahmed Mohamed; Sugano, Sumio

    2016-01-01

    Background Free-living amoebae are present worldwide. They can survive in different environment causing human diseases in some instances. Acanthamoeba sp. is known for causing sight-threatening keratitis in humans. Free-living amoeba keratitis is more common in developing countries. Amoebae of family Vahlkampfiidae are rarely reported to cause such affections. A new genus, Allovahlkampfia spelaea was recently identified from caves with no data about pathogenicity in humans. We tried to identify the causative free-living amoeba in a case of keratitis in an Egyptian patient using morphological and molecular techniques. Methods Pathogenic amoebae were culture using monoxenic culture system. Identification through morphological features and 18S ribosomal RNA subunit DNA amplification and sequencing was done. Pathogenicity to laboratory rabbits and ability to produce keratitis were assessed experimentally. Results Allovahlkampfia spelaea was identified as a cause of human keratitis. Whole sequence of 18S ribosomal subunit DNA was sequenced and assembled. The Egyptian strain was closely related to SK1 strain isolated in Slovenia. The ability to induce keratitis was confirmed using animal model. Conclusions This the first time to report Allovahlkampfia spelaea as a human pathogen. Combining both molecular and morphological identification is critical to correctly diagnose amoebae causing keratitis in humans. Use of different pairs of primers and sequencing amplified DNA is needed to prevent misdiagnosis. PMID:27415799

  14. [Identification of a HPGD mutation in three families affected with primary hypertrophic osteoarthropathy].

    PubMed

    Zhang, Wanying; Wang, Tao; Huang, Shuaiwu; Zhao, Xiuli

    2018-04-10

    To detect mutation of HPGD gene among three pedigrees affected with primary hypertrophic osteoarthropathy (PHO) by DNA sequencing and high-resolution melting (HRM) analysis. Genomic DNA was extracted from peripheral blood samples collected from the pedigrees. PCR and direct sequencing were carried out to identify potential mutations of the HPGD gene. Amplicons containing the mutation spot were generated by nested PCR. The products were then subjected to HRM analysis using the HR-1 instrument. Direct sequencing was carried out in family members and healthy individuals to confirm the result of HRM analysis. A homozygous mutation c.310_311delCT was detected in 2 affected probands, while a heterozygous mutation c.310_311delCT was detected in the third proband. HRM analysis of the fragments encompassing HPGD exon 3 showed 3 curve patterns representing three different genotypes, i.e., the wild type, the c.310_311delCT homozygote, and the c.310_311delCT heterozygote. Result of DNA sequencing was consistent with that of the HRM analysis and phenotype of the subjects. The c.310_311delCT mutation may be the most prevalent mutation among Chinese population. HRM analysis has provided an optimized method for genetic testing of HPGD mutation for its simplicity, rapid turnover and high sensitivity.

  15. Is "dried stool spots on filter paper method (DSSFP)" more sensitive and effective for detecting Blastocystis spp. and their subtypes by PCR and sequencing?

    PubMed

    Seyer, Ayse; Karasartova, Djursun; Ruh, Emrah; Güreser, Ayse Semra; Imir, Turgut; Taylan-Ozkan, Aysegul

    2016-12-01

    PCR and DNA sequencing are currently the diagnostic methods of choice for detection of Blastocystis spp. and their suptypes. Fresh or frozen stool samples have disadvantages in terms of several aspects such as transportation, storage, and existence of PCR inhibitors. Filter paper technology may provide a solution to these issues. The aim of the present study was to detect Blastocystis spp. and their subtypes by employing two different preservation methods: conventional frozen stool (FS) and dried stool spots on filter paper (DSSFP). Concentration and purity of DNA, sensitivity of PCR, and DNA sequencing results obtained from the two methods were also compared. A total of 230 fecal samples were included and separated into two parts: one part of the fecal samples were directly frozen and stored at -20 °C. The remaining portion of the specimens were homogenized with saline and spread onto the filter papers as thin layer with a diameter of approximately 3 cm. After air-dried, the filter papers were stored at room temperature. DSSFP samples were collected by scraping from the filter papers. DNA were extracted by EURx Stool DNA Extraction Kit from both samples. Concentration and purity were measured with Nano-Drop, then PCR and sequencing were conducted for detection of Blastocystis spp. and its genotypes. Pure DNA was obtained with a A260/A280 ratio of 1.7-2.2 in both methods. DNA yield from FS was 25-405 ng/μl and average DNA concentration was 151 ng/μl, while these were 7-339 and 122 ng/μl for DSSFP, respectively. No PCR inhibition was observed in two methods. DNA from DSSFP were found to be stable and PCR were reproducible for at least 1 year. FS-PCR- and DSSFP-PCR-positive samples were 49 (21.3 %) and 58 (25.3 %), respectively (p = 0.078). The 43 specimens were concordantly positive by both FS-PCR and DSSFP-PCR. When the microscopy was taken as the gold standard, sensitivity of DSSFP-PCR and FS-PCR was 95.5 and 86.4 %, while specificity of both tests was 99.4 and 98.3 %, respectively. DNA sequencing results of 19 microscopically confirmed cases were strictly identical (concordance 100 %) in both methods, and ST2:6, ST3:8, ST4:3, and ST6:2 were the detected subtypes. Among the 230 fecal samples, the most predominant subtypes were ST3, ST2, ST4, and ST1 by both FS and DSSFP methods. Concordance of DNA sequencing results obtained from the two methods was noted to be 90.7 %. To our knowledge, this is the first study that demonstrates DNA extraction from DSSFP is more sensitive and effective than the FS method for diagnosis of Blastocystis spp. and their subtypes by PCR and DNA sequencing.

  16. Evaluating manta ray mucus as an alternative DNA source for population genetics study: underwater-sampling, dry-storage and PCR success.

    PubMed

    Kashiwagi, Tom; Maxwell, Elisabeth A; Marshall, Andrea D; Christensen, Ana B

    2015-01-01

    Sharks and rays are increasingly being identified as high-risk species for extinction, prompting urgent assessments of their local or regional populations. Advanced genetic analyses can contribute relevant information on effective population size and connectivity among populations although acquiring sufficient regional sample sizes can be challenging. DNA is typically amplified from tissue samples which are collected by hand spears with modified biopsy punch tips. This technique is not always popular due mainly to a perception that invasive sampling might harm the rays, change their behaviour, or have a negative impact on tourism. To explore alternative methods, we evaluated the yields and PCR success of DNA template prepared from the manta ray mucus collected underwater and captured and stored on a Whatman FTA™ Elute card. The pilot study demonstrated that mucus can be effectively collected underwater using toothbrush. DNA stored on cards was found to be reliable for PCR-based population genetics studies. We successfully amplified mtDNA ND5, nuclear DNA RAG1, and microsatellite loci for all samples and confirmed sequences and genotypes being those of target species. As the yields of DNA with the tested method were low, further improvements are desirable for assays that may require larger amounts of DNA, such as population genomic studies using emerging next-gen sequencing.

  17. Evaluating manta ray mucus as an alternative DNA source for population genetics study: underwater-sampling, dry-storage and PCR success

    PubMed Central

    Maxwell, Elisabeth A.; Marshall, Andrea D.; Christensen, Ana B.

    2015-01-01

    Sharks and rays are increasingly being identified as high-risk species for extinction, prompting urgent assessments of their local or regional populations. Advanced genetic analyses can contribute relevant information on effective population size and connectivity among populations although acquiring sufficient regional sample sizes can be challenging. DNA is typically amplified from tissue samples which are collected by hand spears with modified biopsy punch tips. This technique is not always popular due mainly to a perception that invasive sampling might harm the rays, change their behaviour, or have a negative impact on tourism. To explore alternative methods, we evaluated the yields and PCR success of DNA template prepared from the manta ray mucus collected underwater and captured and stored on a Whatman FTA™ Elute card. The pilot study demonstrated that mucus can be effectively collected underwater using toothbrush. DNA stored on cards was found to be reliable for PCR-based population genetics studies. We successfully amplified mtDNA ND5, nuclear DNA RAG1, and microsatellite loci for all samples and confirmed sequences and genotypes being those of target species. As the yields of DNA with the tested method were low, further improvements are desirable for assays that may require larger amounts of DNA, such as population genomic studies using emerging next-gen sequencing. PMID:26413431

  18. Mobile Genome Express (MGE): A comprehensive automatic genetic analyses pipeline with a mobile device.

    PubMed

    Yoon, Jun-Hee; Kim, Thomas W; Mendez, Pedro; Jablons, David M; Kim, Il-Jin

    2017-01-01

    The development of next-generation sequencing (NGS) technology allows to sequence whole exomes or genome. However, data analysis is still the biggest bottleneck for its wide implementation. Most laboratories still depend on manual procedures for data handling and analyses, which translates into a delay and decreased efficiency in the delivery of NGS results to doctors and patients. Thus, there is high demand for developing an automatic and an easy-to-use NGS data analyses system. We developed comprehensive, automatic genetic analyses controller named Mobile Genome Express (MGE) that works in smartphones or other mobile devices. MGE can handle all the steps for genetic analyses, such as: sample information submission, sequencing run quality check from the sequencer, secured data transfer and results review. We sequenced an Actrometrix control DNA containing multiple proven human mutations using a targeted sequencing panel, and the whole analysis was managed by MGE, and its data reviewing program called ELECTRO. All steps were processed automatically except for the final sequencing review procedure with ELECTRO to confirm mutations. The data analysis process was completed within several hours. We confirmed the mutations that we have identified were consistent with our previous results obtained by using multi-step, manual pipelines.

  19. Molecular characterization of nucleopolyhedrovirus of three lepidopteran pests using late expression factor-8 gene.

    PubMed

    Jose, Jency; Jalali, S K; Shivalingaswamy, T M; Kumar, N K Krishna; Bhatnagar, R; Bandyopadhyay, A

    2013-06-01

    A PCR based method for detection of viral DNA in nucleopolyhedrovirus of three lepidopterans, Spodoptera litura, Amsacta albistriga and Helicoverpa armigera, was developed by employing the late expression factor-8 (lef-8) gene of three NPV using specific primers. The amplicons of 689, 699 and 665 bp were amplified, respectively, and the nucleotide sequences were submitted to GenBank and the accession numbers were obtained. The sequences of lef-8 gene of S. litura NPV and H. armigera NPV matched with those of their respective references in the GenBank database, thereby confirming their identity, however, the sequence of A. albistriga NPV was the first sequence submitted to the GenBank database. The sequence similarity analysis between the three lef-8 gene of NPV sequenced in the present study revealed that there was no significant similarity between them, however A. albistriga NPV and S. litura NPV were found to be closely related. CLUSTAL alignment of the sequences generated revealed general relatedness among NPVs lef-8 gene. The study confirmed that lef-8 gene can be used for quick and correct discriminatory identification of insect viruses.

  20. DNA Barcodes for the FIshes of the Narmada, One of India’s Longest Rivers

    PubMed Central

    Khedkar, Gulab Dattarao; Jamdade, Rahul; Naik, Suresh; David, Lior; Haymer, David

    2014-01-01

    This study describes the species diversity of fishes of the Narmada River in India. A total of 820 fish specimens were collected from 17 sampling locations across the whole river basin. Fish were taxonomically classified into one of 90 possible species based on morphological characters, and then DNA barcoding was employed using COI gene sequences as a supplemental identification method. A total of 314 different COI sequences were generated, and specimens were confirmed to belong to 85 species representing 63 genera, 34 families and 10 orders. Findings of this study include the identification of five putative cryptic or sibling species and 43 species not previously known from the Narmada River basin. Five species are endemic to India and three are introduced species that had not been previously reported to occur in the Narmada River. Conversely, 43 species previously reported to occur in the Narmada were not found. Genetic diversity and distance values were generated for all of the species within genera, families and orders using Kimura’s 2 parameter distance model followed by the construction of a Neighbor Joining tree. High resolution clusters generated in NJ trees aided the groupings of species corresponding to their genera and families which are in confirmation to the values generated by Automatic Barcode Gap Discovery bioinformatics platform. This aided to decide a threshold value for the discrimination of species boundary from the Narmada River. This study provides an important validation of the use of DNA barcode sequences for monitoring species diversity and changes within complex ecosystems such as the Narmada River. PMID:24991801

  1. DNA barcodes for the fishes of the Narmada, one of India's longest rivers.

    PubMed

    Khedkar, Gulab Dattarao; Jamdade, Rahul; Naik, Suresh; David, Lior; Haymer, David

    2014-01-01

    This study describes the species diversity of fishes of the Narmada River in India. A total of 820 fish specimens were collected from 17 sampling locations across the whole river basin. Fish were taxonomically classified into one of 90 possible species based on morphological characters, and then DNA barcoding was employed using COI gene sequences as a supplemental identification method. A total of 314 different COI sequences were generated, and specimens were confirmed to belong to 85 species representing 63 genera, 34 families and 10 orders. Findings of this study include the identification of five putative cryptic or sibling species and 43 species not previously known from the Narmada River basin. Five species are endemic to India and three are introduced species that had not been previously reported to occur in the Narmada River. Conversely, 43 species previously reported to occur in the Narmada were not found. Genetic diversity and distance values were generated for all of the species within genera, families and orders using Kimura's 2 parameter distance model followed by the construction of a Neighbor Joining tree. High resolution clusters generated in NJ trees aided the groupings of species corresponding to their genera and families which are in confirmation to the values generated by Automatic Barcode Gap Discovery bioinformatics platform. This aided to decide a threshold value for the discrimination of species boundary from the Narmada River. This study provides an important validation of the use of DNA barcode sequences for monitoring species diversity and changes within complex ecosystems such as the Narmada River.

  2. Sphingomonas azotifigens sp. nov., a nitrogen-fixing bacterium isolated from the roots of Oryza sativa.

    PubMed

    Xie, Cheng-Hui; Yokota, Akira

    2006-04-01

    Three yellow-pigmented strains associated with rice plants were characterized by using a polyphasic approach. The nitrogen-fixing abilities of these strains were confirmed by acetylene reduction assay and nifH gene detection. The three strains were found to be very closely related, with 99.9 % 16S rRNA gene sequence similarity and greater than 70 % DNA-DNA hybridization values, suggesting that the three strains represent a single species. 16S rRNA gene sequence analysis indicated that the strains were closely related to Sphingomonas trueperi, with 99.5 % similarity. The chemotaxonomic characteristics (G+C content of the DNA of 68.0 mol%, ubiquinone Q-10 system, 2-OH as the only hydroxy fatty acid and homospermidine as the sole polyamine) were similar to those of members of the genus Sphingomonas. Based on DNA-DNA hybridization values and physiological characteristics, the three novel strains could be differentiated from other recognized species of the genus Sphingomonas. The name Sphingomonas azotifigens sp. nov. is proposed to accommodate these bacterial strains; the type strain is Y39T (=NBRC 15497T = IAM 15283T = CCTCC AB205007T).

  3. A homozygous transthyretin variant associated with senile systemic amyloidosis: evidence for a late-onset disease of genetic etiology.

    PubMed Central

    Jacobson, D R; Gorevic, P D; Buxbaum, J N

    1990-01-01

    Senile systemic amyloidosis (SSA) is a late-onset disease characterized by deposition of amyloid fibrils containing transthyretin (TTR). Amino acid sequencing of protein isolated from the amyloid fibrils of a patient with SSA identified TTR containing a position - 122 isoleucine-for-valine substitution. This change led to the prediction of a genomic G-to-A transition, destroying an MaeIII restriction site. We confirmed the presence of the variant DNA fragment both by Southern blotting and by visualization of MaeIII digests of DNA amplified around codon 122, by using the polymerase chain reaction. The patient's DNA was entirely resistant to MaeIII cleavage; therefore, only the mutant sequence was present. DNA from none of either 24 controls or six other SSA patients contained the variant. Quantitative Southern blotting demonstrated that the patient's DNA contained two copies of the TTR gene per genome; the mutation was therefore homozygous rather than hemizygous. In the present case, the homozygous mutation TTR (122 Val----Ile) is associated with SSA, a finding which is consistent with autosomal recessive inheritance of this condition. Images Figure 2 Figure 4 Figure 5 Figure 6 Figure 7 PMID:2349941

  4. Discovery of DNA viruses in wild-caught mosquitoes using small RNA high throughput sequencing.

    PubMed

    Ma, Maijuan; Huang, Yong; Gong, Zhengda; Zhuang, Lu; Li, Cun; Yang, Hong; Tong, Yigang; Liu, Wei; Cao, Wuchun

    2011-01-01

    Mosquito-borne infectious diseases pose a severe threat to public health in many areas of the world. Current methods for pathogen detection and surveillance are usually dependent on prior knowledge of the etiologic agents involved. Hence, efficient approaches are required for screening wild mosquito populations to detect known and unknown pathogens. In this study, we explored the use of Next Generation Sequencing to identify viral agents in wild-caught mosquitoes. We extracted total RNA from different mosquito species from South China. Small 18-30 bp length RNA molecules were purified, reverse-transcribed into cDNA and sequenced using Illumina GAIIx instrumentation. Bioinformatic analyses to identify putative viral agents were conducted and the results confirmed by PCR. We identified a non-enveloped single-stranded DNA densovirus in the wild-caught Culex pipiens molestus mosquitoes. The majority of the viral transcripts (.>80% of the region) were covered by the small viral RNAs, with a few peaks of very high coverage obtained. The +/- strand sequence ratio of the small RNAs was approximately 7∶1, indicating that the molecules were mainly derived from the viral RNA transcripts. The small viral RNAs overlapped, enabling contig assembly of the viral genome sequence. We identified some small RNAs in the reverse repeat regions of the viral 5'- and 3' -untranslated regions where no transcripts were expected. Our results demonstrate for the first time that high throughput sequencing of small RNA is feasible for identifying viral agents in wild-caught mosquitoes. Our results show that it is possible to detect DNA viruses by sequencing the small RNAs obtained from insects, although the underlying mechanism of small viral RNA biogenesis is unclear. Our data and those of other researchers show that high throughput small RNA sequencing can be used for pathogen surveillance in wild mosquito vectors.

  5. Identification and Characterization of a Cis-Encoded Antisense RNA Associated with the Replication Process of Salmonella enterica Serovar Typhi

    PubMed Central

    Dadzie, Isaac; Xu, Shungao; Ni, Bin; Zhang, Xiaolei; Zhang, Haifang; Sheng, Xiumei; Xu, Huaxi; Huang, Xinxiang

    2013-01-01

    Antisense RNAs that originate from the complementary strand of protein coding genes are involved in the regulation of gene expression in all domains of life. In bacteria, some of these antisense RNAs are transcriptional noise whiles others play a vital role to adapt the cell to changing environmental conditions. By deep sequencing analysis of transcriptome of Salmonella enterica serovar Typhi, a partial RNA sequence encoded in-cis to the dnaA gene was revealed. Northern blot and RACE analysis confirmed the transcription of this antisense RNA which was expressed mostly in the stationary phase of the bacterial growth and also under iron limitation and osmotic stress. Pulse expression analysis showed that overexpression of the antisense RNA resulted in a significant increase in the mRNA levels of dnaA, which will ultimately enhance their translation. Our findings have revealed that antisense RNA of dnaA is indeed transcribed not merely as a by-product of the cell's transcription machinery but plays a vital role as far as stability of dnaA mRNA is concerned. PMID:23637809

  6. Multiple advanced logic gates made of DNA-Ag nanocluster and the application for intelligent detection of pathogenic bacterial genes† †Electronic supplementary information (ESI) available: Chemicals, materials and DNA sequences used in the investigation, the construction of YES, AND, OR, XOR and INH logic gates, CD and PAGE experimental results. See DOI: 10.1039/c7sc05246d

    PubMed Central

    Lin, Xiaodong; Deng, Jiankang; Lyu, Yanlong; Qian, Pengcheng; Li, Yunfei

    2018-01-01

    The integration of multiple DNA logic gates on a universal platform to implement advance logic functions is a critical challenge for DNA computing. Herein, a straightforward and powerful strategy in which a guanine-rich DNA sequence lighting up a silver nanocluster and fluorophore was developed to construct a library of logic gates on a simple DNA-templated silver nanoclusters (DNA-AgNCs) platform. This library included basic logic gates, YES, AND, OR, INHIBIT, and XOR, which were further integrated into complex logic circuits to implement diverse advanced arithmetic/non-arithmetic functions including half-adder, half-subtractor, multiplexer, and demultiplexer. Under UV irradiation, all the logic functions could be instantly visualized, confirming an excellent repeatability. The logic operations were entirely based on DNA hybridization in an enzyme-free and label-free condition, avoiding waste accumulation and reducing cost consumption. Interestingly, a DNA-AgNCs-based multiplexer was, for the first time, used as an intelligent biosensor to identify pathogenic genes, E. coli and S. aureus genes, with a high sensitivity. The investigation provides a prototype for the wireless integration of multiple devices on even the simplest single-strand DNA platform to perform diverse complex functions in a straightforward and cost-effective way. PMID:29675221

  7. Estimation of a Killer Whale (Orcinus orca) Population’s Diet Using Sequencing Analysis of DNA from Feces

    PubMed Central

    Ford, Michael J.; Hempelmann, Jennifer; Hanson, M. Bradley; Ayres, Katherine L.; Baird, Robin W.; Emmons, Candice K.; Lundin, Jessica I.; Schorr, Gregory S.; Wasser, Samuel K.; Park, Linda K.

    2016-01-01

    Estimating diet composition is important for understanding interactions between predators and prey and thus illuminating ecosystem function. The diet of many species, however, is difficult to observe directly. Genetic analysis of fecal material collected in the field is therefore a useful tool for gaining insight into wild animal diets. In this study, we used high-throughput DNA sequencing to quantitatively estimate the diet composition of an endangered population of wild killer whales (Orcinus orca) in their summer range in the Salish Sea. We combined 175 fecal samples collected between May and September from five years between 2006 and 2011 into 13 sample groups. Two known DNA composition control groups were also created. Each group was sequenced at a ~330bp segment of the 16s gene in the mitochondrial genome using an Illumina MiSeq sequencing system. After several quality controls steps, 4,987,107 individual sequences were aligned to a custom sequence database containing 19 potential fish prey species and the most likely species of each fecal-derived sequence was determined. Based on these alignments, salmonids made up >98.6% of the total sequences and thus of the inferred diet. Of the six salmonid species, Chinook salmon made up 79.5% of the sequences, followed by coho salmon (15%). Over all years, a clear pattern emerged with Chinook salmon dominating the estimated diet early in the summer, and coho salmon contributing an average of >40% of the diet in late summer. Sockeye salmon appeared to be occasionally important, at >18% in some sample groups. Non-salmonids were rarely observed. Our results are consistent with earlier results based on surface prey remains, and confirm the importance of Chinook salmon in this population’s summer diet. PMID:26735849

  8. Estimation of a Killer Whale (Orcinus orca) Population's Diet Using Sequencing Analysis of DNA from Feces.

    PubMed

    Ford, Michael J; Hempelmann, Jennifer; Hanson, M Bradley; Ayres, Katherine L; Baird, Robin W; Emmons, Candice K; Lundin, Jessica I; Schorr, Gregory S; Wasser, Samuel K; Park, Linda K

    2016-01-01

    Estimating diet composition is important for understanding interactions between predators and prey and thus illuminating ecosystem function. The diet of many species, however, is difficult to observe directly. Genetic analysis of fecal material collected in the field is therefore a useful tool for gaining insight into wild animal diets. In this study, we used high-throughput DNA sequencing to quantitatively estimate the diet composition of an endangered population of wild killer whales (Orcinus orca) in their summer range in the Salish Sea. We combined 175 fecal samples collected between May and September from five years between 2006 and 2011 into 13 sample groups. Two known DNA composition control groups were also created. Each group was sequenced at a ~330bp segment of the 16s gene in the mitochondrial genome using an Illumina MiSeq sequencing system. After several quality controls steps, 4,987,107 individual sequences were aligned to a custom sequence database containing 19 potential fish prey species and the most likely species of each fecal-derived sequence was determined. Based on these alignments, salmonids made up >98.6% of the total sequences and thus of the inferred diet. Of the six salmonid species, Chinook salmon made up 79.5% of the sequences, followed by coho salmon (15%). Over all years, a clear pattern emerged with Chinook salmon dominating the estimated diet early in the summer, and coho salmon contributing an average of >40% of the diet in late summer. Sockeye salmon appeared to be occasionally important, at >18% in some sample groups. Non-salmonids were rarely observed. Our results are consistent with earlier results based on surface prey remains, and confirm the importance of Chinook salmon in this population's summer diet.

  9. The female urinary microbiome in urgency urinary incontinence.

    PubMed

    Pearce, Meghan M; Zilliox, Michael J; Rosenfeld, Amy B; Thomas-White, Krystal J; Richter, Holly E; Nager, Charles W; Visco, Anthony G; Nygaard, Ingrid E; Barber, Matthew D; Schaffer, Joseph; Moalli, Pamela; Sung, Vivian W; Smith, Ariana L; Rogers, Rebecca; Nolen, Tracy L; Wallace, Dennis; Meikle, Susan F; Gai, Xiaowu; Wolfe, Alan J; Brubaker, Linda

    2015-09-01

    The purpose of this study was to characterize the urinary microbiota in women who are planning treatment for urgency urinary incontinence and to describe clinical associations with urinary symptoms, urinary tract infection, and treatment outcomes. Catheterized urine samples were collected from multisite randomized trial participants who had no clinical evidence of urinary tract infection; 16S ribosomal RNA gene sequencing was used to dichotomize participants as either DNA sequence-positive or sequence-negative. Associations with demographics, urinary symptoms, urinary tract infection risk, and treatment outcomes were determined. In sequence-positive samples, microbiotas were characterized on the basis of their dominant microorganisms. More than one-half (51.1%; 93/182) of the participants' urine samples were sequence-positive. Sequence-positive participants were younger (55.8 vs 61.3 years old; P = .0007), had a higher body mass index (33.7 vs 30.1 kg/m(2); P = .0009), had a higher mean baseline daily urgency urinary incontinence episodes (5.7 vs 4.2 episodes; P < .0001), responded better to treatment (decrease in urgency urinary incontinence episodes, -4.4 vs -3.3; P = .0013), and were less likely to experience urinary tract infection (9% vs 27%; P = .0011). In sequence-positive samples, 8 major bacterial clusters were identified; 7 clusters were dominated not only by a single genus, most commonly Lactobacillus (45%) or Gardnerella (17%), but also by other taxa (25%). The remaining cluster had no dominant genus (13%). DNA sequencing confirmed urinary bacterial DNA in many women with urgency urinary incontinence who had no signs of infection. Sequence status was associated with baseline urgency urinary incontinence episodes, treatment response, and posttreatment urinary tract infection risk. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Identification of Colletotrichum spp. isolated from strawberry in Zhejiang Province and Shanghai City, China*

    PubMed Central

    Xie, Liu; Zhang, Jing-ze; Wan, Yao; Hu, Dong-wei

    2010-01-01

    Strawberry anthracnose, caused by Colletotrichum spp., is a major disease of cultivated strawberry. This study identifies 31 isolates of Colletotrichum spp. which cause strawberry anthracnose in Zhejiang Province and Shanghai City, China. Eleven isolates were identified as C. acutatum, 10 as C. gloeosporioides and 10 as C. fragariae based on morphological characteristics, phylogenetic and sequence analyses. Species-specific polymerase chain reaction (PCR) and enzyme digestion further confirmed the identification of the Colletotrichum spp., demonstrating that these three species are currently the causal agents of strawberry anthracnose in the studied regions. Based on analysis of rDNA internal transcribed spacers (ITS) sequences, sequences of all C. acutatum were identical, and little genetic variability was observed between C. fragariae and C. gloeosporioides. However, the conservative nature of the MvnI specific site from isolates of C. gloeosporioides was confirmed, and this site could be used to differentiate C. gloeosporioides from C. fragariae. PMID:20043353

  11. Deep Sequencing to Identify the Causes of Viral Encephalitis

    PubMed Central

    Chan, Benjamin K.; Wilson, Theodore; Fischer, Kael F.; Kriesel, John D.

    2014-01-01

    Deep sequencing allows for a rapid, accurate characterization of microbial DNA and RNA sequences in many types of samples. Deep sequencing (also called next generation sequencing or NGS) is being developed to assist with the diagnosis of a wide variety of infectious diseases. In this study, seven frozen brain samples from deceased subjects with recent encephalitis were investigated. RNA from each sample was extracted, randomly reverse transcribed and sequenced. The sequence analysis was performed in a blinded fashion and confirmed with pathogen-specific PCR. This analysis successfully identified measles virus sequences in two brain samples and herpes simplex virus type-1 sequences in three brain samples. No pathogen was identified in the other two brain specimens. These results were concordant with pathogen-specific PCR and partially concordant with prior neuropathological examinations, demonstrating that deep sequencing can accurately identify viral infections in frozen brain tissue. PMID:24699691

  12. Molecular and Ecological Evidence for Species Specificity and Coevolution in a Group of Marine Algal-Bacterial Symbioses

    PubMed Central

    Ashen, Jon B.; Goff, Lynda J.

    2000-01-01

    The phylogenetic relationships of bacterial symbionts from three gall-bearing species in the marine red algal genus Prionitis (Rhodophyta) were inferred from 16S rDNA sequence analysis and compared to host phylogeny also inferred from sequence comparisons (nuclear ribosomal internal-transcribed-spacer region). Gall formation has been described previously on two species of Prionitis, P. lanceolata (from central California) and P. decipiens (from Peru). This investigation reports gall formation on a third related host, Prionitis filiformis. Phylogenetic analyses based on sequence comparisons place the bacteria as a single lineage within the Roseobacter grouping of the α subclass of the division Proteobacteria (99.4 to 98.25% sequence identity among phylotypes). Comparison of symbiont and host molecular phylogenies confirms the presence of three gall-bearing algal lineages and is consistent with the hypothesis that these red seaweeds and their bacterial symbionts are coevolving. The species specificity of these associations was investigated in nature by whole-cell hybridization of gall bacteria and in the laboratory by using cross-inoculation trials. Whole-cell in situ hybridization confirmed that a single bacterial symbiont phylotype is present in galls on each host. In laboratory trials, bacterial symbionts were incapable of inducing galls on alternate hosts (including two non-gall-bearing species). Symbiont-host specificity in Prionitis gall formation indicates an effective ecological separation between these closely related symbiont phylotypes and provides an example of a biological context in which to consider the organismic significance of 16S rDNA sequence variation. PMID:10877801

  13. Cloning and Characterization of the Pyrrolomycin Biosynthetic Gene Clusters from Actinosporangium vitaminophilum ATCC 31673 and Streptomyces sp. Strain UC 11065▿

    PubMed Central

    Zhang, Xiujun; Parry, Ronald J.

    2007-01-01

    The pyrrolomycins are a family of polyketide antibiotics, some of which contain a nitro group. To gain insight into the nitration mechanism associated with the formation of these antibiotics, the pyrrolomycin biosynthetic gene cluster from Actinosporangium vitaminophilum was cloned. Sequencing of ca. 56 kb of A. vitaminophilum DNA revealed 35 open reading frames (ORFs). Sequence analysis revealed a clear relationship between some of these ORFs and the biosynthetic gene cluster for pyoluteorin, a structurally related antibiotic. Since a gene transfer system could not be devised for A. vitaminophilum, additional proof for the identity of the cloned gene cluster was sought by cloning the pyrrolomycin gene cluster from Streptomyces sp. strain UC 11065, a transformable pyrrolomycin producer. Sequencing of ca. 26 kb of UC 11065 DNA revealed the presence of 17 ORFs, 15 of which exhibit strong similarity to ORFs in the A. vitaminophilum cluster as well as a nearly identical organization. Single-crossover disruption of two genes in the UC 11065 cluster abolished pyrrolomycin production in both cases. These results confirm that the genetic locus cloned from UC 11065 is essential for pyrrolomycin production, and they also confirm that the highly similar locus in A. vitaminophilum encodes pyrrolomycin biosynthetic genes. Sequence analysis revealed that both clusters contain genes encoding the two components of an assimilatory nitrate reductase. This finding suggests that nitrite is required for the formation of the nitrated pyrrolomycins. However, sequence analysis did not provide additional insights into the nitration process, suggesting the operation of a novel nitration mechanism. PMID:17158935

  14. Molecular Diagnostics in Autosomal Dominant Polycystic Kidney Disease: Utility and Limitations

    PubMed Central

    Zhao, Xiao; Paterson, Andrew D.; Zahirieh, Alireza; He, Ning; Wang, Kairong; Pei, York

    2008-01-01

    Background and objectives: Gene-based mutation screening is now available and has the potential to provide diagnostic confirmation or exclusion of autosomal dominant polycystic kidney disease. This study illustrates its utility and limitations in the clinical setting. Design, setting, participants, & measurements: Using a molecular diagnostic service, genomic DNA of one affected individual from each study family was screened for pathologic PKD1 and PKD2 mutations. Bidirectional sequencing was performed to identify sequence variants in all exons and splice junctions of both genes and to confirm the specific mutations in other family members. In two multiplex families, microsatellite markers were genotyped at both PDK1 and PKD2 loci, and pair-wise and multipoint linkage analysis was performed. Results: Three of five probands studied were referred for assessment of renal cystic disease without a family history of autosomal dominant polycystic kidney disease, and two others were younger at-risk members of families with autosomal dominant polycystic kidney disease being evaluated as living-related kidney donors. Gene-based mutation screening identified pathogenic mutations that provided confirmation or exclusion of disease in three probands, but in the other two, only unclassified variants were identified. In one proband in which mutation screening was indeterminate, DNA linkage studies provided strong evidence for disease exclusion. Conclusions: Gene-based mutation screening or DNA linkage analysis should be considered in individuals in whom the diagnosis of autosomal dominant polycystic kidney disease is uncertain because of a lack of family history or equivocal imaging results and in younger at-risk individuals who are being evaluated as living-related kidney donors. PMID:18077784

  15. Primary structure of Lep d I, the main Lepidoglyphus destructor allergen.

    PubMed

    Varela, J; Ventas, P; Carreira, J; Barbas, J A; Gimenez-Gallego, G; Polo, F

    1994-10-01

    The most relevant allergen of the storage mite Lepidoglyphus destructor (Lep d I) has been characterized. Lep d I is a monomer protein of 13273 Da. The primary structure of Lep d I was determined by N-terminal Edman degradation and partially confirmed by cDNA sequencing. Sequence polymorphism was observed at six positions, with non-conservative substitutions in three of them. No potential N-glycosylation site was revealed by peptide sequencing. The 125-residue sequence of Lep d I shows approximately 40% identity (including the six cysteines) with the overlapping regions of group II allergens from the genus Dermatophagoides, which, however, do not share common allergenic epitopes with Lep d I.

  16. Optimal Ancient DNA Yields from the Inner Ear Part of the Human Petrous Bone.

    PubMed

    Pinhasi, Ron; Fernandes, Daniel; Sirak, Kendra; Novak, Mario; Connell, Sarah; Alpaslan-Roodenberg, Songül; Gerritsen, Fokke; Moiseyev, Vyacheslav; Gromov, Andrey; Raczky, Pál; Anders, Alexandra; Pietrusewsky, Michael; Rollefson, Gary; Jovanovic, Marija; Trinhhoang, Hiep; Bar-Oz, Guy; Oxenham, Marc; Matsumura, Hirofumi; Hofreiter, Michael

    2015-01-01

    The invention and development of next or second generation sequencing methods has resulted in a dramatic transformation of ancient DNA research and allowed shotgun sequencing of entire genomes from fossil specimens. However, although there are exceptions, most fossil specimens contain only low (~ 1% or less) percentages of endogenous DNA. The only skeletal element for which a systematically higher endogenous DNA content compared to other skeletal elements has been shown is the petrous part of the temporal bone. In this study we investigate whether (a) different parts of the petrous bone of archaeological human specimens give different percentages of endogenous DNA yields, (b) there are significant differences in average DNA read lengths, damage patterns and total DNA concentration, and (c) it is possible to obtain endogenous ancient DNA from petrous bones from hot environments. We carried out intra-petrous comparisons for ten petrous bones from specimens from Holocene archaeological contexts across Eurasia dated between 10,000-1,800 calibrated years before present (cal. BP). We obtained shotgun DNA sequences from three distinct areas within the petrous: a spongy part of trabecular bone (part A), the dense part of cortical bone encircling the osseous inner ear, or otic capsule (part B), and the dense part within the otic capsule (part C). Our results confirm that dense bone parts of the petrous bone can provide high endogenous aDNA yields and indicate that endogenous DNA fractions for part C can exceed those obtained for part B by up to 65-fold and those from part A by up to 177-fold, while total endogenous DNA concentrations are up to 126-fold and 109-fold higher for these comparisons. Our results also show that while endogenous yields from part C were lower than 1% for samples from hot (both arid and humid) parts, the DNA damage patterns indicate that at least some of the reads originate from ancient DNA molecules, potentially enabling ancient DNA analyses of samples from hot regions that are otherwise not amenable to ancient DNA analyses.

  17. Detection of Marteilia refringens using nested PCR and in situ hybridisation in Chamelea gallina from the Balearic Islands (Spain).

    PubMed

    López-Flores, Inmaculada; Robles, Francisca; Valencia, José M; Grau, Amalia; Villalba, Antonio; de la Herrán, Roberto; Garrido-Ramos, Manuel A; Ruiz-Rejón, Carmelo; Ruiz-Rejón, Manuel; Navas, José I

    2008-10-16

    In the course of a histopathological survey performed to discover the cause of mass mortality of the striped clam Chamelea gallina in the Balearic Islands (Spain, Mediterranean Sea), we detected a Marteilia-like parasite in 3 clams. Molecular methods were applied to identify the parasite. DNA extracted from a paraffin block was used to carry out a PCR assay for Marteilia refringens detection based on a rDNA sequence of the parasite (the intergenic spacer of ribosomal genes, IGS). The nucleotide sequence of the IGS amplified fragment and the positive signal obtained by in situ hybridisation analysis with a M. refringens-specific probe allowed us to confirm the presence of this parasite in the digestive gland tissue of C. gallina.

  18. Impact of cultivation on characterisation of species composition of soil bacterial communities.

    PubMed

    McCaig, A E.; Grayston, S J.; Prosser, J I.; Glover, L A.

    2001-03-01

    The species composition of culturable bacteria in Scottish grassland soils was investigated using a combination of Biolog and 16S rDNA analysis for characterisation of isolates. The inclusion of a molecular approach allowed direct comparison of sequences from culturable bacteria with sequences obtained during analysis of DNA extracted directly from the same soil samples. Bacterial strains were isolated on Pseudomonas isolation agar (PIA), a selective medium, and on tryptone soya agar (TSA), a general laboratory medium. In total, 12 and 21 morphologically different bacterial cultures were isolated on PIA and TSA, respectively. Biolog and sequencing placed PIA isolates in the same taxonomic groups, the majority of cultures belonging to the Pseudomonas (sensu stricto) group. However, analysis of 16S rDNA sequences proved more efficient than Biolog for characterising TSA isolates due to limitations of the Microlog database for identifying environmental bacteria. In general, 16S rDNA sequences from TSA isolates showed high similarities to cultured species represented in sequence databases, although TSA-8 showed only 92.5% similarity to the nearest relative, Bacillus insolitus. In general, there was very little overlap between the culturable and uncultured bacterial communities, although two sequences, PIA-2 and TSA-13, showed >99% similarity to soil clones. A cloning step was included prior to sequence analysis of two isolates, TSA-5 and TSA-14, and analysis of several clones confirmed that these cultures comprised at least four and three sequence types, respectively. All isolate clones were most closely related to uncultured bacteria, with clone TSA-5.1 showing 99.8% similarity to a sequence amplified directly from the same soil sample. Interestingly, one clone, TSA-5.4, clustered within a novel group comprising only uncultured sequences. This group, which is associated with the novel, deep-branching Acidobacterium capsulatum lineage, also included clones isolated during direct analysis of the same soil and from a wide range of other sample types studied elsewhere. The study demonstrates the value of fine-scale molecular analysis for identification of laboratory isolates and indicates the culturability of approximately 1% of the total population but under a restricted range of media and cultivation conditions.

  19. DNA methylation biomarkers for head and neck squamous cell carcinoma.

    PubMed

    Zhou, Chongchang; Ye, Meng; Ni, Shumin; Li, Qun; Ye, Dong; Li, Jinyun; Shen, Zhishen; Deng, Hongxia

    2018-06-21

    DNA methylation plays an important role in the etiology and pathogenesis of head and neck squamous cell carcinoma (HNSCC). The current study aimed to identify aberrantly methylated-differentially expressed genes (DEGs) by a comprehensive bioinformatics analysis. In addition, we screened for DEGs affected by DNA methylation modification and further investigated their prognostic values for HNSCC. We included microarray data of DNA methylation (GSE25093 and GSE33202) and gene expression (GSE23036 and GSE58911) from Gene Expression Omnibus. Aberrantly methylated-DEGs were analyzed with R software. The Cancer Genome Atlas (TCGA) RNA sequencing and DNA methylation (Illumina HumanMethylation450) databases were utilized for validation. In total, 27 aberrantly methylated genes accompanied by altered expression were identified. After confirmation by The Cancer Genome Atlas (TCGA) database, 2 hypermethylated-low-expression genes (FAM135B and ZNF610) and 2 hypomethylated-high-expression genes (HOXA9 and DCC) were identified. A receiver operating characteristic (ROC) curve confirmed the diagnostic value of these four methylated genes for HNSCC. Multivariate Cox proportional hazards analysis showed that FAM135B methylation was a favorable independent prognostic biomarker for overall survival of HNSCC patients.

  20. Proposal of Xanthomonas translucens pv. pistaciae pv. nov., pathogenic to pistachio (Pistacia vera).

    PubMed

    Giblot-Ducray, Danièle; Marefat, Alireza; Gillings, Michael R; Parkinson, Neil M; Bowman, John P; Ophel-Keller, Kathy; Taylor, Cathy; Facelli, Evelina; Scott, Eileen S

    2009-12-01

    Strains of Xanthomonas translucens have caused dieback in the Australian pistachio industry for the last 15 years. Such pathogenicity to a dicotyledonous woody host contrasts with that of other pathovars of X. translucens, which are characterized by their pathogenicity to monocotyledonous plant families. Further investigations, using DNA-DNA hybridization, gyrB gene sequencing and integron screening, were conducted to confirm the taxonomic status of the X. translucens pathogenic to pistachio. DNA-DNA hybridization provided a clear classification, at the species level, of the pistachio pathogen as a X. translucens. In the gyrB-based phylogeny, strains of the pistachio pathogen clustered among the X. translucens pathovars as two distinct lineages. Integron screening revealed that the cassette arrays of strains of the pistachio pathogen were different from those of other Xanthomonas species, and again distinguished two groups. Together with previously reported pathogenicity data, these results confirm that the pistachio pathogen is a new pathovar of X. translucens and allow hypotheses about its origin. The proposed name is Xanthomonas translucens pv. pistaciae pv. nov.

  1. Fetal and Placental DNA Stimulation of TLR9: A Mechanism Possibly Contributing to the Pro-inflammatory Events During Parturition.

    PubMed

    Goldfarb, Ilona Telefus; Adeli, Sharareh; Berk, Tucker; Phillippe, Mark

    2018-05-01

    While there is evidence for a relationship between cell-free fetal DNA (cffDNA) and parturition, questions remain regarding whether cffDNA could trigger a pro-inflammatory response on the pathway to parturition. We hypothesized that placental and/or fetal DNA stimulates toll-like receptor 9 (TLR9) leading to secretion of pro-inflammatory cytokines by macrophage cells. Four in vitro DNA stimulation studies were performed using RAW 264.7 mouse peritoneal macrophage cells incubated in media containing the following DNA particles: an oligodeoxynucleotide (ODN2395), intact genomic DNA (from mouse placentas, fetuses and adult liver), mouse DNA complexed with DOTAP (a cationic liposome forming compound), and telomere-depleted mouse DNA. Interleukin 6 (IL6) secretion was measured in the media by enzyme-linked immunosorbent assay; and the cell pellet was homogenized for protein content (picograms IL6/mg protein). Robust IL6 secretion was observed in response to ODN2395 (a CpG-rich TLR9 agonist), mouse DNA-DOTAP complexes, and telomere-depleted mouse DNA in concentrations of 5 to 15 μg/mL. In contrast, ODN A151 (containing telomere sequence motifs), intact genomic mouse DNA, and restriction enzyme-digested DNA had no effect on IL6 secretion. The IL6 response was significantly inhibited by chloroquine (10 μg/mL), thereby confirming the important role for TLR9 in the response by macrophage cells. DNA derived from mouse placentas and fetuses, and depleted of telomeric sequences, stimulates a robust pro-inflammatory response by macrophage cells, thereby supporting the hypothesis that cffDNA is able to stimulate an innate immune response that could trigger the onset of parturition. These findings are of clinical importance, as we search for effective treatment/prevention of preterm parturition.

  2. Label-free DNA biosensor based on a peptide nucleic acid-functionalized microstructured optical fiber-Bragg grating

    NASA Astrophysics Data System (ADS)

    Candiani, Alessandro; Bertucci, Alessandro; Giannetti, Sara; Konstantaki, Maria; Manicardi, Alex; Pissadakis, Stavros; Cucinotta, Annamaria; Corradini, Roberto; Selleri, Stefano

    2013-05-01

    We describe a novel sensing approach based on a functionalized microstructured optical fiber-Bragg grating for specific DNA target sequences detection. The inner surface of a microstructured fiber, where a Bragg grating was previously inscribed, has been functionalized by covalent linking of a peptide nucleic acid probe targeting a DNA sequence bearing a single point mutation implicated in cystic fibrosis (CF) disease. A solution of an oligonucleotide (ON) corresponding to a tract of the CF gene containing the mutated DNA has been infiltrated inside the fiber capillaries and allowed to hybridize to the fiber surface according to the Watson-Crick pairing. In order to achieve signal amplification, ON-functionalized gold nanoparticles were then infiltrated and used in a sandwich-like assay. Experimental measurements show a clear shift of the reflected high order mode of a Bragg grating for a 100 nM DNA solution, and fluorescence measurements have confirmed the successful hybridization. Several experiments have been carried out on the same fiber using the identical concentration, showing the same modulation trend, suggesting the possibility of the reuse of the sensor. Measurements have also been made using a 100 nM mismatched DNA solution, containing a single nucleotide mutation and corresponding to the wild-type gene, and the results demonstrate the high selectivity of the sensor.

  3. Intraspecific differentiation of Paramecium novaurelia strains (Ciliophora, Protozoa) inferred from phylogenetic analysis of ribosomal and mitochondrial DNA variation.

    PubMed

    Tarcz, Sebastian

    2013-01-01

    Paramecium novaurelia Beale and Schneller, 1954, was first found in Scotland and is known to occur mainly in Europe, where it is the most common species of the P. aurelia complex. In recent years, two non-European localities have been described: Turkey and the United States of America. This article presents the analysis of intraspecific variability among 25 strains of P. novaurelia with the application of ribosomal and mitochondrial loci (ITS1-5.8S-ITS2, 5' large subunit rDNA (5'LSU rDNA) and cytochrome c oxidase subunit 1 (COI) mtDNA). The mean distance observed for all of the studied P. novaurelia sequence pairs was p=0.008/0.016/0.092 (ITS1-5.8S-ITS2/5'LSU rDNA/COI). Phylogenetic trees (NJ/MP/BI) based on a comparison of all of the analysed sequences show that the studied strains of P. novaurelia form a distinct clade, separate from the P. caudatum outgroup, and are divided into two clusters (A and B) and two branches (C and D). The occurrence of substantial genetic differentiation within P. novaurelia, confirmed by the analysed DNA fragments, indicates a rapid evolution of particular species within the Paramecium genus. Copyright © 2012 Elsevier GmbH. All rights reserved.

  4. A Novel Locomotion-based Validation Assay for Candidate Drugs Using Drosophila DYT1 Disease Model

    DTIC Science & Technology

    2014-06-01

    rescue the locomotion defects of Drosophila larvae caused by the expression of human torsinAΔE. These results demonstrated that human torsinA can... Drosophila dtorsin∆D transgenic lines dtorsin∆E and dtorsin∆D cDNA constructs were made from the wild type dtorsin cDNA using QuikChange II XL Site...After confirming mutated sequences , the insert was again cut out with EcoRI and NotI and inserted between EcoRI and NotI sites of pUAST [2] to produce

  5. Ascogregarina taiwanensis infection in Aedes aegypti and Aedes albopictus in Santa Catarina, South Brazil.

    PubMed

    Prophiro, Josiane Somariva; Pereira, Thiago Nunes; Oliveira, Joice Guilherme de; Dandolini, Guilherme Werner; Silva, Mario Antonio Navarro da; Silva, Onilda Santos da

    2017-01-01

    This study registers Ascogregarina spp. infection in field populations of Aedes aegypti and Aedes albopictus in a subtropical region of Brazil. Mosquito larvae collected in tires placed in four municipalities of Santa Catarina were identified morphologically and assessed for Ascogregarina sp. infection using morphological and molecular methods. Both mosquito species harbored Ascogregarina taiwanensis, whose genomic DNA was confirmed in both the Aedes species by PCR. DNA sequences were deposited in GenBank. Conclusion: Both Ae. albopictus e Ae. aegypti harbor Ascogregarina sp.

  6. Ostertagia circumcincta: isolation of a partial cDNA encoding an unusual member of the mitochondrial processing peptidase subfamily of M16 metallopeptidases.

    PubMed

    Walker, J; Tait, A

    1997-11-01

    A reverse-transcriptase polymerase chain reaction (PCR) procedure was used to isolate an Ostertagia circumcincta partial cDNA encoding a protein with general primary sequence features characteristic of members of the mitochondrial processing peptidase (MPP) subfamily of M16 metallopeptidases. The structural relationships of the predicted protein (Oc MPPX) with MPP subfamily proteins from other species (including the model free-living nematode Caenorhabditis elegans) were examined, and Northern analysis confirmed the expression of the Oc mppx gene in adult nematodes.

  7. Molecular and morphological analyses confirm Rhizopogon verii as a widely distributed ectomycorrhizal false truffle in Europe, and its presence in South America.

    PubMed

    Sulzbacher, Marcelo A; Grebenc, Tine; García, Miguel Á; Silva, Bianca D; Silveira, Andressa; Antoniolli, Zaida I; Marinho, Paulo; Münzenberger, Babette; Telleria, M Teresa; Baseia, Iuri G; Martín, María P

    2016-07-01

    The genus Rhizopogon includes species with hypogeous or subepigeus habit, forming ectomycorrhizae with naturally occurring or planted pines (Pinaceae). Species of the genus Rhizopogon can be distinguished easily from the other hypogeous basidiomycetes by their lacunose gleba without columella and their smooth elliptical spores; however, the limit between species is not always easy to establish. Rhizopogon luteolus, the type species of the genus, has been considered one of the species that are more abundant in Europe, as well as it has been cited in pine plantation of North and South America, different parts of Africa, Australia, and New Zealand. However, in this study, based on molecular analyses of the ITS nuclear ribosomal DNA (nrDNA) sequences (19 new sequences; 37 sequences from GenBank/UNITE, including those from type specimens), we prove that many GenBank sequences under R. luteolus were misidentified and correspond to Rhizopogon verii, a species described from Tunisia. Also, we confirm that basidiomes and ectomycorrhizae recently collected in Germany under Pinus sylvestris, as well as specimens from South of Brazil under Pinus taeda belong to R. verii. Thanks to the numerous ectomycorrhizal tips collected in Germany, a complete description of R. verii/P. sylvestris ectomycorrhiza is provided. Moreover, since in this paper the presence of R. verii in South America is here reported for the first time, a short description of basidiomes collected in Brazil, compared with collections located in different European herbaria, is included.

  8. The genome of Chelonid herpesvirus 5 harbors atypical genes

    USGS Publications Warehouse

    Ackermann, Mathias; Koriabine, Maxim; Hartmann-Fritsch, Fabienne; de Jong, Pieter J.; Lewis, Teresa D.; Schetle, Nelli; Work, Thierry M.; Dagenais, Julie; Balazs, George H.; Leong, Jo-Ann C.

    2012-01-01

    The Chelonid fibropapilloma-associated herpesvirus (CFPHV; ChHV5) is believed to be the causative agent of fibropapillomatosis (FP), a neoplastic disease of marine turtles. While clinical signs and pathology of FP are well known, research on ChHV5 has been impeded because no cell culture system for its propagation exists. We have cloned a BAC containing ChHV5 in pTARBAC2.1 and determined its nucleotide sequence. Accordingly, ChHV5 has a type D genome and its predominant gene order is typical for the varicellovirus genus within thealphaherpesvirinae. However, at least four genes that are atypical for an alphaherpesvirus genome were also detected, i.e. two members of the C-type lectin-like domain superfamily (F-lec1, F-lec2), an orthologue to the mouse cytomegalovirus M04 (F-M04) and a viral sialyltransferase (F-sial). Four lines of evidence suggest that these atypical genes are truly part of the ChHV5 genome: (1) the pTARBAC insertion interrupted the UL52 ORF, leaving parts of the gene to either side of the insertion and suggesting that an intact molecule had been cloned. (2) Using FP-associated UL52 (F-UL52) as an anchor and the BAC-derived sequences as a means to generate primers, overlapping PCR was performed with tumor-derived DNA as template, which confirmed the presence of the same stretch of “atypical” DNA in independent FP cases. (3) Pyrosequencing of DNA from independent tumors did not reveal previously undetected viral sequences, suggesting that no apparent loss of viral sequence had happened due to the cloning strategy. (4) The simultaneous presence of previously known ChHV5 sequences and F-sial as well as F-M04 sequences was also confirmed in geographically distinct Australian cases of FP. Finally, transcripts of F-sial and F-M04 but not transcripts of lytic viral genes were detected in tumors from Hawaiian FP-cases. Therefore, we suggest that F-sial and F-M04 may play a role in FP pathogenesis

  9. Molecular analysis of microbiota along the digestive tract of juvenile Atlantic salmon (Salmo salar L.).

    PubMed

    Navarrete, P; Espejo, R T; Romero, J

    2009-04-01

    Dominant bacterial microbiota of the gut of juvenile farmed Atlantic salmon was investigated using a combination of molecular approaches. Bacterial community composition from the stomach, the pyloric caeca, and the intestine was assessed by extracting DNA directly from each gut compartment. Temporal temperature gradient gel electrophoresis (TTGE) analysis of 16S ribosomal DNA (rDNA) amplicons showed very similar bacterial compositions throughout the digestive tract. Band sequencing revealed a narrow diversity of species with a dominance of Pseudomonas in the three compartments. However, cloning revealed more diversity among the Pseudomonas sequences. To confirm these results, we analyzed the bacterial community by amplifying the variable 16S-23S rDNA intergenic spacer region (ITS). Similar ITS profiles were observed among gastrointestinal compartments of salmon, confirming the TTGE results. Moreover, the dominant ITS band at 650 bp, identified as Pseudomonas, was observed in the ITS profile from fish collected in two seasons (July 2003 and 2004). In contrast, aerobic culture analysis revealed Shewanella spp. as the most prevalent isolate. This discrepancy was resolved by evaluating 16S rDNA and ITS polymerase chain reaction amplification efficiency from both Shewanella and Pseudomonas isolates. Very similar efficiencies were observed in the two bacteria. Hence, this discrepancy may be explained by preferential cultivation of Shewanella spp. under the experimental conditions. Also, we included analyses of pelleted feed and the water influent to explore environmental influences on the bacterial composition of the gut microbiota. Overall, these results indicate a homogeneous composition of the bacterial community composition along the gastrointestinal tract of reared juvenile salmon. This community is mainly composed of Pseudomonas spp., which could be derived from water influent and may be selectively associated with salmon in this hatchery.

  10. Enzymatic Production of Monoclonal Stoichiometric Single-Stranded DNA Oligonucleotides

    PubMed Central

    Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M.; Högberg, Björn

    2013-01-01

    Single-stranded oligonucleotides are important as research tools as probes for diagnostics and gene therapy. Today, production of oligonucleotides is done via solid-phase synthesis. However, the capabilities of current polymer chemistry are limited in comparison to what can be produced in biological systems. The errors in synthetic DNA increases with oligonucleotide length, and sequence diversity can often be a problem. Here, we present the Monoclonal Stoichiometric (MOSIC) method for enzymatic DNA oligonucleotide production. Using this method, we amplify oligonucleotides from clonal templates followed by digestion of a cutter-hairpin, resulting in pools of monoclonal oligonucleotides with precisely controlled relative stoichiometric ratios. We present data where MOSIC oligonucleotides, 14–378 nt long, were prepared either by in vitro rolling-circle amplification, or by amplification in Escherichia coli in the form of phagemid DNA. The formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides. PMID:23727986

  11. Application of next-generation sequencing for rapid marker development in molecular plant breeding: a case study on anthracnose disease resistance in Lupinus angustifolius L.

    PubMed Central

    2012-01-01

    Background In the last 30 years, a number of DNA fingerprinting methods such as RFLP, RAPD, AFLP, SSR, DArT, have been extensively used in marker development for molecular plant breeding. However, it remains a daunting task to identify highly polymorphic and closely linked molecular markers for a target trait for molecular marker-assisted selection. The next-generation sequencing (NGS) technology is far more powerful than any existing generic DNA fingerprinting methods in generating DNA markers. In this study, we employed a grain legume crop Lupinus angustifolius (lupin) as a test case, and examined the utility of an NGS-based method of RAD (restriction-site associated DNA) sequencing as DNA fingerprinting for rapid, cost-effective marker development tagging a disease resistance gene for molecular breeding. Results Twenty informative plants from a cross of RxS (disease resistant x susceptible) in lupin were subjected to RAD single-end sequencing by multiplex identifiers. The entire RAD sequencing products were resolved in two lanes of the 16-lanes per run sequencing platform Solexa HiSeq2000. A total of 185 million raw reads, approximately 17 Gb of sequencing data, were collected. Sequence comparison among the 20 test plants discovered 8207 SNP markers. Filtration of DNA sequencing data with marker identification parameters resulted in the discovery of 38 molecular markers linked to the disease resistance gene Lanr1. Five randomly selected markers were converted into cost-effective, simple PCR-based markers. Linkage analysis using marker genotyping data and disease resistance phenotyping data on a F8 population consisting of 186 individual plants confirmed that all these five markers were linked to the R gene. Two of these newly developed sequence-specific PCR markers, AnSeq3 and AnSeq4, flanked the target R gene at a genetic distance of 0.9 centiMorgan (cM), and are now replacing the markers previously developed by a traditional DNA fingerprinting method for marker-assisted selection in the Australian national lupin breeding program. Conclusions We demonstrated that more than 30 molecular markers linked to a target gene of agronomic trait of interest can be identified from a small portion (1/8) of one sequencing run on HiSeq2000 by applying NGS based RAD sequencing in marker development. The markers developed by the strategy described in this study are all co-dominant SNP markers, which can readily be converted into high throughput multiplex format or low-cost, simple PCR-based markers desirable for large scale marker implementation in plant breeding programs. The high density and closely linked molecular markers associated with a target trait help to overcome a major bottleneck for implementation of molecular markers on a wide range of germplasm in breeding programs. We conclude that application of NGS based RAD sequencing as DNA fingerprinting is a very rapid and cost-effective strategy for marker development in molecular plant breeding. The strategy does not require any prior genome knowledge or molecular information for the species under investigation, and it is applicable to other plant species. PMID:22805587

  12. Application of next-generation sequencing for rapid marker development in molecular plant breeding: a case study on anthracnose disease resistance in Lupinus angustifolius L.

    PubMed

    Yang, Huaan; Tao, Ye; Zheng, Zequn; Li, Chengdao; Sweetingham, Mark W; Howieson, John G

    2012-07-17

    In the last 30 years, a number of DNA fingerprinting methods such as RFLP, RAPD, AFLP, SSR, DArT, have been extensively used in marker development for molecular plant breeding. However, it remains a daunting task to identify highly polymorphic and closely linked molecular markers for a target trait for molecular marker-assisted selection. The next-generation sequencing (NGS) technology is far more powerful than any existing generic DNA fingerprinting methods in generating DNA markers. In this study, we employed a grain legume crop Lupinus angustifolius (lupin) as a test case, and examined the utility of an NGS-based method of RAD (restriction-site associated DNA) sequencing as DNA fingerprinting for rapid, cost-effective marker development tagging a disease resistance gene for molecular breeding. Twenty informative plants from a cross of RxS (disease resistant x susceptible) in lupin were subjected to RAD single-end sequencing by multiplex identifiers. The entire RAD sequencing products were resolved in two lanes of the 16-lanes per run sequencing platform Solexa HiSeq2000. A total of 185 million raw reads, approximately 17 Gb of sequencing data, were collected. Sequence comparison among the 20 test plants discovered 8207 SNP markers. Filtration of DNA sequencing data with marker identification parameters resulted in the discovery of 38 molecular markers linked to the disease resistance gene Lanr1. Five randomly selected markers were converted into cost-effective, simple PCR-based markers. Linkage analysis using marker genotyping data and disease resistance phenotyping data on a F8 population consisting of 186 individual plants confirmed that all these five markers were linked to the R gene. Two of these newly developed sequence-specific PCR markers, AnSeq3 and AnSeq4, flanked the target R gene at a genetic distance of 0.9 centiMorgan (cM), and are now replacing the markers previously developed by a traditional DNA fingerprinting method for marker-assisted selection in the Australian national lupin breeding program. We demonstrated that more than 30 molecular markers linked to a target gene of agronomic trait of interest can be identified from a small portion (1/8) of one sequencing run on HiSeq2000 by applying NGS based RAD sequencing in marker development. The markers developed by the strategy described in this study are all co-dominant SNP markers, which can readily be converted into high throughput multiplex format or low-cost, simple PCR-based markers desirable for large scale marker implementation in plant breeding programs. The high density and closely linked molecular markers associated with a target trait help to overcome a major bottleneck for implementation of molecular markers on a wide range of germplasm in breeding programs. We conclude that application of NGS based RAD sequencing as DNA fingerprinting is a very rapid and cost-effective strategy for marker development in molecular plant breeding. The strategy does not require any prior genome knowledge or molecular information for the species under investigation, and it is applicable to other plant species.

  13. Using CdTe/ZnSe core/shell quantum dots to detect DNA and damage to DNA

    PubMed Central

    Moulick, Amitava; Milosavljevic, Vedran; Vlachova, Jana; Podgajny, Robert; Hynek, David; Kopel, Pavel; Adam, Vojtech

    2017-01-01

    CdTe/ZnSe core/shell quantum dot (QD), one of the strongest and most highly luminescent nanoparticles, was directly synthesized in an aqueous medium to study its individual interactions with important nucleobases (adenine, guanine, cytosine, and thymine) in detail. The results obtained from the optical analyses indicated that the interactions of the QDs with different nucleobases were different, which reflected in different fluorescent emission maxima and intensities. The difference in the interaction was found due to the different chemical behavior and different sizes of the formed nanoconjugates. An electrochemical study also confirmed that the purines and pyrimidines show different interactions with the core/shell QDs. Based on these phenomena, a novel QD-based method is developed to detect the presence of the DNA, damage to DNA, and mutation. The QDs were successfully applied very easily to detect any change in the sequence (mutation) of DNA. The QDs also showed their ability to detect DNAs directly from the extracts of human cancer (PC3) and normal (PNT1A) cells (detection limit of 500 pM of DNA), which indicates the possibilities to use this easy assay technique to confirm the presence of living organisms in extreme environments. PMID:28243089

  14. Comprehensive methylome analysis of ovarian tumors reveals hedgehog signaling pathway regulators as prognostic DNA methylation biomarkers.

    PubMed

    Huang, Rui-Lan; Gu, Fei; Kirma, Nameer B; Ruan, Jianhua; Chen, Chun-Liang; Wang, Hui-Chen; Liao, Yu-Ping; Chang, Cheng-Chang; Yu, Mu-Hsien; Pilrose, Jay M; Thompson, Ian M; Huang, Hsuan-Cheng; Huang, Tim Hui-Ming; Lai, Hung-Cheng; Nephew, Kenneth P

    2013-06-01

    Women with advanced stage ovarian cancer (OC) have a five-year survival rate of less than 25%. OC progression is associated with accumulation of epigenetic alterations and aberrant DNA methylation in gene promoters acts as an inactivating "hit" during OC initiation and progression. Abnormal DNA methylation in OC has been used to predict disease outcome and therapy response. To globally examine DNA methylation in OC, we used next-generation sequencing technology, MethylCap-sequencing, to screen 75 malignant and 26 normal or benign ovarian tissues. Differential DNA methylation regions (DMRs) were identified, and the Kaplan-Meier method and Cox proportional hazard model were used to correlate methylation with clinical endpoints. Functional role of specific genes identified by MethylCap-sequencing was examined in in vitro assays. We identified 577 DMRs that distinguished (p < 0.001) malignant from non-malignant ovarian tissues; of these, 63 DMRs correlated (p < 0.001) with poor progression free survival (PFS). Concordant hypermethylation and corresponding gene silencing of sonic hedgehog pathway members ZIC1 and ZIC4 in OC tumors was confirmed in a panel of OC cell lines, and ZIC1 and ZIC4 repression correlated with increased proliferation, migration and invasion. ZIC1 promoter hypermethylation correlated (p < 0.01) with poor PFS. In summary, we identified functional DNA methylation biomarkers significantly associated with clinical outcome in OC and suggest our comprehensive methylome analysis has significant translational potential for guiding the design of future clinical investigations targeting the OC epigenome. Methylation of ZIC1, a putative tumor suppressor, may be a novel determinant of OC outcome.

  15. The Initial Evaluation of Patients After Positive Newborn Screening: Recommended Algorithms Leading to a Confirmed Diagnosis of Pompe Disease.

    PubMed

    Burton, Barbara K; Kronn, David F; Hwu, Wuh-Liang; Kishnani, Priya S

    2017-07-01

    Newborn screening (NBS) for Pompe disease is done through analysis of acid α-glucosidase (GAA) activity in dried blood spots. When GAA levels are below established cutoff values, then second-tier testing is required to confirm or refute a diagnosis of Pompe disease. This article in the "Newborn Screening, Diagnosis, and Treatment for Pompe Disease" guidance supplement provides recommendations for confirmatory testing after a positive NBS result indicative of Pompe disease is obtained. Two algorithms were developed by the Pompe Disease Newborn Screening Working Group, a group of international experts on both NBS and Pompe disease, based on whether DNA sequencing is performed as part of the screening method. Using the recommendations in either algorithm will lead to 1 of 3 diagnoses: classic infantile-onset Pompe disease, late-onset Pompe disease, or no disease/not affected/carrier. Mutation analysis of the GAA gene is essential for confirming the biochemical diagnosis of Pompe disease. For NBS laboratories that do not have DNA sequencing capabilities, the responsibility of obtaining sequencing of the GAA gene will fall on the referral center. The recommendations for confirmatory testing and the initial evaluation are intended for a broad global audience. However, the Working Group recognizes that clinical practices, standards of care, and resource capabilities vary not only regionally, but also by testing centers. Individual patient needs and health status as well as local/regional insurance reimbursement programs and regulations also must be considered. Copyright © 2017 by the American Academy of Pediatrics.

  16. The field effect transistor DNA biosensor based on ITO nanowires in label-free hepatitis B virus detecting compatible with CMOS technology.

    PubMed

    Shariati, Mohsen

    2018-05-15

    In this paper the field-effect transistor DNA biosensor for detecting hepatitis B virus (HBV) based on indium tin oxide nanowires (ITO NWs) in label free approach has been fabricated. Because of ITO nanowires intensive conductance and functional modified surface, the probe immobilization and target hybridization were increased strongly. The high resolution transmission electron microscopy (HRTEM) measurement showed that ITO nanowires were crystalline and less than 50nm in diameter. The single-stranded hepatitis B virus DNA (SS-DNA) was immobilized as probe on the Au-modified nanowires. The DNA targets were measured in a linear concentration range from 1fM to 10µM. The detection limit of the DNA biosensor was about 1fM. The time of the hybridization process for defined single strand was 90min. The switching ratio of the biosensor between "on" and "off" state was ~ 1.1 × 10 5 . For sensing the specificity of the biosensor, non-complementary, mismatch and complementary DNA oligonucleotide sequences were clearly discriminated. The HBV biosensor confirmed the highly satisfied specificity for differentiating complementary sequences from non-complementary and the mismatch oligonucleotides. The response time of the DNA sensor was 37s with a high reproducibility. The stability and repeatability of the DNA biosensor showed that the peak current of the biosensor retained 98% and 96% of its initial response for measurements after three and five weeks, respectively. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. First case of Plasmodium knowlesi infection in a Japanese traveller returning from Malaysia.

    PubMed

    Tanizaki, Ryutaro; Ujiie, Mugen; Kato, Yasuyuki; Iwagami, Moritoshi; Hashimoto, Aki; Kutsuna, Satoshi; Takeshita, Nozomi; Hayakawa, Kyoko; Kanagawa, Shuzo; Kano, Shigeyuki; Ohmagari, Norio

    2013-04-15

    This is the first case of Plasmodium knowlesi infection in a Japanese traveller returning from Malaysia. In September 2012, a previously healthy 35-year-old Japanese man presented to National Center for Global Health and Medicine in Tokyo with a two-day history of daily fever, mild headaches and mild arthralgia. Malaria parasites were found in the Giemsa-stained thin blood smear, which showed band forms similar to Plasmodium malariae. Although a nested PCR showed the amplification of the primer of Plasmodium vivax and Plasmodium knowlesi, he was finally diagnosed with P. knowlesi mono-infection by DNA sequencing. He was treated with mefloquine, and recovered without any complications. DNA sequencing of the PCR products is indispensable to confirm P. knowlesi infection, however there is limited access to DNA sequencing procedures in endemic areas. The extent of P. knowlesi transmission in Asia has not been clearly defined. There is limited availability of diagnostic tests and routine surveillance system for reporting an accurate diagnosis in the Asian endemic regions. Thus, reporting accurately diagnosed cases of P. knowlesi infection in travellers would be important for assessing the true nature of this emerging human infection.

  18. Morphological and Molecular Identification of Globodera pallida Associated with Potato in Idaho

    PubMed Central

    Skantar, A. M.; Handoo, Z. A.; Carta, L. K.; Chitwood, D. J.

    2007-01-01

    The identity of a newly discovered population of pale potato cyst nematode Globodera pallida associated with potato in eastern Idaho was established by morphological and molecular methods. Morphometrics of cysts and second-stage juveniles were generally within the expected ranges for G. pallida with some variations noted. The Idaho population and paratype material from Epworth, Lincolnshire, England, both showed variations in tail shape, with bluntly rounded to finely pointed tail termini. Compared to literature values for the paratypes, second-stage juveniles of the Idaho population had a somewhat shorter mean body length, and cysts had a slightly higher mean distance from the anus to the nearest edge of the fenestra. PCR-RFLP of the rDNA ITS region, sequence-specific multiplex PCR and DNA sequence comparisons all confirmed the identity of the Idaho population as G. pallida. The ITS rDNA sequence of the Idaho isolate was identical to those from York, England, and the Netherlands. Species-specific primers that can positively identify the tobacco cyst nematode Globodera tabacum were also developed, providing a new assay for distinguishing this species from G. pallida and the golden potato cyst nematode Globodera rostochiensis. PMID:19259482

  19. Staphylococcus petrasii subsp. pragensis subsp. nov., occurring in human clinical material.

    PubMed

    Švec, Pavel; De Bel, Annelies; Sedláček, Ivo; Petráš, Petr; Gelbíčová, Tereza; Černohlávková, Jitka; Mašlanˇová, Ivana; Cnockaert, Margo; Varbanovová, Ivana; Echahidi, Fedoua; Vandamme, Peter; Pantuček, Roman

    2015-07-01

    Seven coagulase-negative, oxidase-negative and novobiocin-susceptible staphylococci assigned tentatively as Staphylococcus petrasii were investigated in this study in order to elucidate their taxonomic position. All strains were initially shown to form a genetically homogeneous group separated from remaining species of the genus Staphylococcus by using a repetitive sequence-based PCR fingerprinting with the (GTG)5 primer. Phylogenetic analysis based on 16S rRNA gene, hsp60, rpoB, dnaJ, gap and tuf sequences showed that the group is closely related to Staphylococcus petrasii but separated from the three hitherto known subspecies, S. petrasii subsp. petrasii, S. petrasii subsp. croceilyticus and S. petrasii subsp. jettensis. Further investigation using automated ribotyping, MALDI-TOF mass spectrometry, fatty acid methyl ester analysis, DNA-DNA hybridization and extensive biotyping confirmed that the analysed group represents a novel subspecies within S. petrasii, for which the name Staphylococcus petrasii subsp. pragensis subsp. nov. is proposed. The type strain is NRL/St 12/356(T) ( = CCM 8529(T) = LMG 28327(T)).

  20. Characterization of mutations in the FOXE1 gene in a cohort of unrelated Malaysian patients with congenital hypothyroidism and thyroid dysgenesis.

    PubMed

    Kang, In-Nee; Musa, Maslinda; Harun, Fatimah; Junit, Sarni Mat

    2010-02-01

    The FOXE1 gene was screened for mutations in a cohort of 34 unrelated patients with congenital hypothyroidism, 14 of whom had thyroid dysgenesis and 18 were normal (the thyroid status for 2 patients was unknown). The entire coding region of the FOXE1 gene was PCR-amplified, then analyzed using single-stranded conformational polymorphism, followed by confirmation by direct DNA sequencing. DNA sequencing analysis revealed a heterozygous A>G transition at nucleotide position 394 in one of the patients. The nucleotide transition changed asparagine to aspartate at codon 132 in the highly conserved region of the forkhead DNA binding domain of the FOXE1 gene. This mutation was not detected in a total of 104 normal healthy individuals screened. The binding ability of the mutant FOXE1 protein to the human thyroperoxidase (TPO) promoter was slightly reduced compared with the wild-type FOXE1. The mutation also caused a 5% loss of TPO transcriptional activity.

  1. Development and evaluation of a quantitative PCR assay for detection of Hepatozoon sp.

    PubMed

    Criado-Fornelio, A; Buling, A; Cunha-Filho, N A; Ruas, J L; Farias, N A R; Rey-Valeiron, C; Pingret, J L; Etievant, M; Barba-Carretero, J C

    2007-12-25

    With the aim to improve current molecular diagnostic techniques of Hepatozoon sp. in carnivore mammals, we developed a quantitative PCR (qPCR) assay with SYBR Green I((R)). The method, consisting of amplification of a 235bp fragment of the 18S rRNA gene, is able to detect at least 0.1fg of parasite DNA. Reproducible quantitative results were obtained over a range of 0.1ng-0.1fg of Hepatozoon sp. DNA. To assess the performance of the qPCR assay, DNA samples from dogs (140) and cats (50) were tested with either standard PCR or qPCR. Positive samples were always confirmed by partial sequencing of the 18S rRNA gene. Quantitative PCR was 15.8% more sensitive than standard PCR to detect H. canis in dogs. In cats, no infections were detected by standard PCR, compared to two positives by qPCR (which were infected by H. canis as shown by sequencing).

  2. Generating an Open Reading Frame (ORF) Entry Clone and Destination Clone.

    PubMed

    Reece-Hoyes, John S; Walhout, Albertha J M

    2018-01-02

    This protocol describes using the Gateway recombinatorial cloning system to create an Entry clone carrying an open reading frame (ORF) and then to transfer the ORF into a Destination vector. In this example, BP recombination is used to clone an ORF from a cDNA source into the Donor vector pDONR 221. The ORF from the resulting Entry clone is then transferred into the Destination vector pDEST-15; the product (the Destination clone) will express the ORF as an amino-terminal GST-fusion. The technique can be used as a guide for cloning any other DNA fragment of interest-a promoter sequence or 3' untranslated region (UTR), for example-with substitutions of different genetic material such as genomic DNA, att sites, and vectors as required. The series of constructions and transformations requires 9-15 d, not including time that may be required for sequence confirmation, if desired/necessary. © 2018 Cold Spring Harbor Laboratory Press.

  3. A grass molecular identification system for forensic botany: a critical evaluation of the strengths and limitations.

    PubMed

    Ward, Jodie; Gilmore, Simon R; Robertson, James; Peakall, Rod

    2009-11-01

    Plant material is frequently encountered in criminal investigations but often overlooked as potential evidence. We designed a DNA-based molecular identification system for 100 Australian grasses that consisted of a series of polymerase chain reaction assays that enabled the progressive identification of grasses to different taxonomic levels. The identification system was based on DNA sequence variation at four chloroplast and two mitochondrial loci. Seventeen informative indels and 68 single-nucleotide polymorphisms were utilized as molecular markers for subfamily to species-level identification. To identify an unknown sample to subfamily level required a minimum of four markers or nine markers for species identification. The accuracy of the system was confirmed by blind tests. We have demonstrated "proof of concept" of a molecular identification system for trace botanical samples. Our evaluation suggests that the adoption of a system that combines this approach with DNA sequencing could assist the morphological identification of grasses found as forensic evidence.

  4. Complete Mitochondrial DNA Analysis of Eastern Eurasian Haplogroups Rarely Found in Populations of Northern Asia and Eastern Europe

    PubMed Central

    Derenko, Miroslava; Malyarchuk, Boris; Denisova, Galina; Perkova, Maria; Rogalla, Urszula; Grzybowski, Tomasz; Khusnutdinova, Elza; Dambueva, Irina; Zakharov, Ilia

    2012-01-01

    With the aim of uncovering all of the most basal variation in the northern Asian mitochondrial DNA (mtDNA) haplogroups, we have analyzed mtDNA control region and coding region sequence variation in 98 Altaian Kazakhs from southern Siberia and 149 Barghuts from Inner Mongolia, China. Both populations exhibit the prevalence of eastern Eurasian lineages accounting for 91.9% in Barghuts and 60.2% in Altaian Kazakhs. The strong affinity of Altaian Kazakhs and populations of northern and central Asia has been revealed, reflecting both influences of central Asian inhabitants and essential genetic interaction with the Altai region indigenous populations. Statistical analyses data demonstrate a close positioning of all Mongolic-speaking populations (Mongolians, Buryats, Khamnigans, Kalmyks as well as Barghuts studied here) and Turkic-speaking Sojots, thus suggesting their origin from a common maternal ancestral gene pool. In order to achieve a thorough coverage of DNA lineages revealed in the northern Asian matrilineal gene pool, we have completely sequenced the mtDNA of 55 samples representing haplogroups R11b, B4, B5, F2, M9, M10, M11, M13, N9a and R9c1, which were pinpointed from a massive collection (over 5000 individuals) of northern and eastern Asian, as well as European control region mtDNA sequences. Applying the newly updated mtDNA tree to the previously reported northern Asian and eastern Asian mtDNA data sets has resolved the status of the poorly classified mtDNA types and allowed us to obtain the coalescence age estimates of the nodes of interest using different calibrated rates. Our findings confirm our previous conclusion that northern Asian maternal gene pool consists of predominantly post-LGM components of eastern Asian ancestry, though some genetic lineages may have a pre-LGM/LGM origin. PMID:22363811

  5. Structure, inheritance, and expression of hybrid poplar (Populus trichocarpa x Populus deltoides) phenylalanine ammonia-lyase genes.

    PubMed Central

    Subramaniam, R; Reinold, S; Molitor, E K; Douglas, C J

    1993-01-01

    A heterologous probe encoding phenylalanine ammonia-lyase (PAL) was used to identify PAL clones in cDNA libraries made with RNA from young leaf tissue of two Populus deltoides x P. trichocarpa F1 hybrid clones. Sequence analysis of a 2.4-kb cDNA confirmed its identity as a full-length PAl clone. The predicted amino acid sequence is conserved in comparison with that of PAL genes from several other plants. Southern blot analysis of popular genomic DNA from parental and hybrid individuals, restriction site polymorphism in PAL cDNA clones, and sequence heterogeneity in the 3' ends of several cDNA clones suggested that PAL is encoded by at least two genes that can be distinguished by HindIII restriction site polymorphisms. Clones containing each type of PAL gene were isolated from a poplar genomic library. Analysis of the segregation of PAL-specific HindIII restriction fragment-length polymorphisms demonstrated the existence of two independently segregating PAL loci, one of which was mapped to a linkage group of the poplar genetic map. Developmentally regulated PAL expression in poplar was analyzed using RNA blots. Highest expression was observed in young stems, apical buds, and young leaves. Expression was lower in older stems and undetectable in mature leaves. Cellular localization of PAL expression by in situ hybridization showed very high levels of expression in subepidermal cells of leaves early during leaf development. In stems and petioles, expression was associated with subepidermal cells and vascular tissues. PMID:8108506

  6. Cloning and tissue distribution of rat hear fatty acid binding protein mRNA: identical forms in heart and skeletal muscle

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Claffey, K.P.; Herrera, V.L.; Brecher, P.

    1987-12-01

    A fatty acid binding protein (FABP) as been identified and characterized in rat heart, but the function and regulation of this protein are unclear. In this study the cDNA for rat heart FABP was cloned from a lambda gt11 library. Sequencing of the cDNA showed an open reading frame coding for a protein with 133 amino acids and a calculated size of 14,776 daltons. Several differences were found between the sequence determined from the cDNA and that reported previously by protein sequencing techniques. Northern blot analysis using rat heart FABP cDNA as a probe established the presence of an abundantmore » mRNA in rat heart about 0.85 kilobases in length. This mRNA was detected, but was not abundant, in fetal heart tissue. Tissue distribution studies showed a similar mRNA species in red, but not white, skeletal muscle. In general, the mRNA tissue distribution was similar to that of the protein detected by Western immunoblot analysis, suggesting that heart FABP expression may be regulated at the transcriptional level. S1 nuclease mapping studies confirmed that the mRNA hybridized to rat heart FABP cDNA was identical in heart and red skeletal muscle throughout the entire open reading frame. The structural differences between heart FABP and other members of this multigene family may be related to the functional requirements of oxidative muscle for fatty acids as a fuel source.« less

  7. Characterization of alanine to valine sequence variants in the Fc region of nivolumab biosimilar produced in Chinese hamster ovary cells.

    PubMed

    Li, Yantao; Fu, Tuo; Liu, Tao; Guo, Huaizu; Guo, Qingcheng; Xu, Jin; Zhang, Dapeng; Qian, Weizhu; Dai, Jianxin; Li, Bohua; Guo, Yajun; Hou, Sheng; Wang, Hao

    2016-07-01

    Nivolumab is a therapeutic fully human IgG4 antibody to programmed death 1 (PD-1). In this study, a nivolumab biosimilar, which was produced in our laboratory, was analyzed and characterized. Sequence variants that contain undesired amino acid sequences may cause concern during biosimilar bioprocess development. We found that low levels of sequence variants were detected in the heavy chain of the nivolumab biosimilar by ultra performance liquid chromatography (UPLC) and tandem mass spectrometry. It was further identified with UPLC-MS/MS by IdeS or trypsin digestion. The sequence variant was confirmed through addition of synthetic mutant peptide. Subsequently, the mixing base signal of normal and mutant sequence was detected through DNA sequencing. The relative levels of mutant A424V in the Fc region of the heavy chain have been detected and demonstrated to be 12.25% and 13.54%, via base peak intensity (BPI) and UV chromatography of the tryptic peptide mapping, respectively. A424V variant was also quantified by real-time PCR (RT-PCR) at the DNA and RNA level, which was 19.2% and 16.8%, respectively. The relative content of the mutant was consistent at the DNA, RNA and protein level, indicating that the A424V mutation may have little influence at transcriptional or translational levels. These results demonstrate that orthogonal state-of-the-art techniques such as LC- UV- MS and RT-PCR should be implemented to characterize recombinant proteins and cell lines for development of biosimilars. Our study suggests that it is important to establish an integrated and effective analytical method to monitor and characterize sequence variants during antibody drug development, especially for antibody biosimilar products.

  8. Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce.

    PubMed

    Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W

    1998-08-01

    The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

  9. Use of amplicon sequencing to improve sensitivity in PCR-based detection of microbial pathogen in environmental samples.

    PubMed

    Saingam, Prakit; Li, Bo; Yan, Tao

    2018-06-01

    DNA-based molecular detection of microbial pathogens in complex environments is still plagued by sensitivity, specificity and robustness issues. We propose to address these issues by viewing them as inadvertent consequences of requiring specific and adequate amplification (SAA) of target DNA molecules by current PCR methods. Using the invA gene of Salmonella as the model system, we investigated if next generation sequencing (NGS) can be used to directly detect target sequences in false-negative PCR reaction (PCR-NGS) in order to remove the SAA requirement from PCR. False-negative PCR and qPCR reactions were first created using serial dilutions of laboratory-prepared Salmonella genomic DNA and then analyzed directly by NGS. Target invA sequences were detected in all false-negative PCR and qPCR reactions, which lowered the method detection limits near the theoretical minimum of single gene copy detection. The capability of the PCR-NGS approach in correcting false negativity was further tested and confirmed under more environmentally relevant conditions using Salmonella-spiked stream water and sediment samples. Finally, the PCR-NGS approach was applied to ten urban stream water samples and detected invA sequences in eight samples that would be otherwise deemed Salmonella negative. Analysis of the non-target sequences in the false-negative reactions helped to identify primer dime-like short sequences as the main cause of the false negativity. Together, the results demonstrated that the PCR-NGS approach can significantly improve method sensitivity, correct false-negative detections, and enable sequence-based analysis for failure diagnostics in complex environmental samples. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Deep sequencing shows low-level oncogenic hepatitis B virus variants persists post-liver transplant despite potent anti-HBV prophylaxis.

    PubMed

    Lau, K C K; Osiowy, C; Giles, E; Lusina, B; van Marle, G; Burak, K W; Coffin, C S

    2018-06-01

    Recent studies suggest that withdrawal of hepatitis B immune globulin (HBIG) and nucleos(t)ide analogues (NA) prophylaxis may be considered in HBV surface antigen (HBsAg)-negative liver transplant (LT) recipients with a low risk of disease recurrence. However, the frequency of occult HBV infection (OBI) and HBV variants after LT in the current era of potent NA therapy is unknown. Twelve LT recipients on prophylaxis were tested in matched plasma and peripheral blood mononuclear cells (PBMCs) for HBV quasispecies by in-house nested PCR and next-generation sequencing of amplicons. HBV covalently closed circular DNA (cccDNA) was detected in Hirt DNA isolated from PBMCs with cccDNA-specific primers and confirmed by nucleic acid hybridization and Sanger sequencing. HBV mRNA in PBMC was detected with reverse-transcriptase nested PCR. In LT recipients on immunosuppressive therapy (10/12 male; median age 57.5 [IQR: 39.8-66.5]; median follow-up post-LT 60 months; 6 pre-LT hepatocellular carcinoma [HCC]), 9 were HBsAg-. HBV DNA was detected in all plasma and PBMC tested; cccDNA and/or mRNA was detected in the PBMC of 10/12 patients. Significant HBV quasispecies diversity (ie 143-2212 nonredundant HBV species) was noted in both sites, and single nucleotide polymorphisms associated with cirrhosis and HCC were detected at varying frequencies. In conclusion, OBI and HBV variants associated with severe liver disease persist in LT recipients on prophylaxis. Although HBV control and cccDNA transcriptional silencing may occur despite immunosuppression, complete virological eradication does not occur in LT recipients with a history of HBV-related end-stage liver disease. © 2018 John Wiley & Sons Ltd.

  11. Differentially expressed genes of Coptotermes formosanus (Isoptera: Rhinotermitidae) challenged by chemical insecticides.

    PubMed

    Zhang, Yi; Zhao, Yuanyuan; Qiu, Xuehong; Han, Richou

    2013-08-01

    Coptotermes formosanus Shiraki (Isoptera: Rhinotermitidae) termites are harmful social insects to wood constructions. The current control methods heavily depend on the chemical insecticides with increasing resistance. Analysis of the differentially expressed genes mediated by chemical insecticides will contribute to the understanding of the termite resistance to chemicals and to the establishment of alternative control measures. In the present article, a full-length cDNA library was constructed from the termites induced by a mixture of commonly used insecticides (0.01% sulfluramid and 0.01% triflumuron) for 24 h, by using the RNA ligase-mediated Rapid Amplification cDNA End method. Fifty-eight differentially expressed clones were obtained by polymerase chain reaction and confirmed by dot-blot hybridization. Forty-six known sequences were obtained, which clustered into 33 unique sequences grouped in 6 contigs and 27 singlets. Sixty-seven percent (22) of the sequences had counterpart genes from other organisms, whereas 33% (11) were undescribed. A Gene Ontology analysis classified 33 unique sequences into different functional categories. In general, most of the differential expression genes were involved in binding and catalytic activity.

  12. Different strategies for the detection of bioagents using electrochemical and photoelectrochemical genosensors

    NASA Astrophysics Data System (ADS)

    Voccia, Diego; Bettazi, Francesca; Palchetti, Ilaria

    2015-10-01

    In recent years various kinds of biosensors for the detection of pathogens have been developed. A genosensor consists in the immobilization, onto the surface of a chosen transducer, of an oligonucleotide with a specific base sequence called capture probe. The complementary sequence (the analytical target, i.e. a specific sequence of the DNA/RNA of the pathogen) present in the sample is recognized and captured by the probe through the hybridization reaction. The evaluation of the extent of the hybridization allows one to confirm whether the sample contains the complementary sequence of the probe or not. Electrochemical transducers have received considerable attention in connection with the detection of DNA hybridization. Moreover, recently, with the emergence of novel photoelectrochemically active species and new detection schemes, photoelectrochemistry has resulted in substantial progress in its analytical performance for biosensing applications. In this paper, some examples of electrochemical genosensors for multiplexed pathogen detection are shown. Moreover, the preliminary experiments towards the development of a photoelectrochemical genosensor using a TiO2 - nanocrystal-modified ITO electrode are discussed.

  13. MHC class II B diversity in blue tits: a preliminary study.

    PubMed

    Aguilar, Juan Rivero-de; Schut, Elske; Merino, Santiago; Martínez, Javier; Komdeur, Jan; Westerdahl, Helena

    2013-07-01

    In this study, we partly characterize major histocompatibility complex (MHC) class II B in the blue tit (Cyanistes caeruleus). A total of 22 individuals from three different European locations: Spain, The Netherlands, and Sweden were screened for MHC allelic diversity. The MHC genes were investigated using both PCR-based methods and unamplified genomic DNA with restriction fragment length polymorphism (RFLP) and southern blots. A total of 13 different exon 2 sequences were obtained independently from DNA and/or RNA, thus confirming gene transcription and likely functionality of the genes. Nine out of 13 alleles were found in more than one country, and two alleles appeared in all countries. Positive selection was detected in the region coding for the peptide binding region (PBR). A maximum of three alleles per individual was detected by sequencing and the RFLP pattern consisted of 4-7 fragments, indicating a minimum number of 2-4 loci per individual. A phylogenetic analysis, demonstrated that the blue tit sequences are divergent compared to sequences from other passerines resembling a different MHC lineage than those possessed by most passerines studied to date.

  14. MHC class II B diversity in blue tits: a preliminary study

    PubMed Central

    Aguilar, Juan Rivero-de; Schut, Elske; Merino, Santiago; Martínez, Javier; Komdeur, Jan; Westerdahl, Helena

    2013-01-01

    In this study, we partly characterize major histocompatibility complex (MHC) class II B in the blue tit (Cyanistes caeruleus). A total of 22 individuals from three different European locations: Spain, The Netherlands, and Sweden were screened for MHC allelic diversity. The MHC genes were investigated using both PCR-based methods and unamplified genomic DNA with restriction fragment length polymorphism (RFLP) and southern blots. A total of 13 different exon 2 sequences were obtained independently from DNA and/or RNA, thus confirming gene transcription and likely functionality of the genes. Nine out of 13 alleles were found in more than one country, and two alleles appeared in all countries. Positive selection was detected in the region coding for the peptide binding region (PBR). A maximum of three alleles per individual was detected by sequencing and the RFLP pattern consisted of 4–7 fragments, indicating a minimum number of 2–4 loci per individual. A phylogenetic analysis, demonstrated that the blue tit sequences are divergent compared to sequences from other passerines resembling a different MHC lineage than those possessed by most passerines studied to date. PMID:23919136

  15. Molecular identification of Ascaris lumbricoides and Ascaris suum recovered from humans and pigs in Thailand, Lao PDR, and Myanmar.

    PubMed

    Sadaow, Lakkhana; Sanpool, Oranuch; Phosuk, Issarapong; Rodpai, Rutchanee; Thanchomnang, Tongjit; Wijit, Adulsak; Anamnart, Witthaya; Laymanivong, Sakhone; Aung, Win Pa Pa; Janwan, Penchom; Maleewong, Wanchai; Intapan, Pewpan M

    2018-06-02

    Ascaris lumbricoides is the largest roundworm known from the human intestine while Ascaris suum is an internal parasite of pigs. Ascariasis, caused by Ascaris lumbricoides, has a worldwide distribution. Here, we have provided the first molecular identification of Ascaris eggs and adults recovered from humans and pigs in Thailand, Lao PDR, and Myanmar. We amplified and sequenced nuclear ribosomal DNA (ITS1 and ITS2 regions) and mitochondrial DNA (cox1 gene). Sequence chromatograms of PCR-amplified ITS1 region revealed a probable hybrid genotype from two human ascariasis cases from Chiang Mai Province, northern Thailand. All complete ITS2 sequences were identical and did not differ between the species. Phylogenetic trees and haplotype analysis of cox1 sequences showed three clusters with 99 haplotypes. Forty-seven samples from the present study represented 14 haplotypes, including 7 new haplotypes. To our knowledge, this is the first molecular confirmation of Ascaris species in Thailand, Lao PDR, and Myanmar. Zoonotic cross-transmission of Ascaris roundworm between pigs and humans probably occurs in these countries.

  16. Equine behavioral enrichment toys as tools for non-invasive recovery of viral and host DNA.

    PubMed

    Seeber, Peter A; Soilemetzidou, Sanatana E; East, Marion L; Walzer, Chris; Greenwood, Alex D

    2017-09-01

    Direct collection of samples from wildlife can be difficult and sometimes impossible. Non-invasive remote sampling for the purpose of DNA extraction is a potential tool for monitoring the presence of wildlife at the individual level, and for identifying the pathogens shed by wildlife. Equine herpesviruses (EHV) are common pathogens of equids that can be fatal if transmitted to other mammals. Transmission usually occurs by nasal aerosol discharge from virus-shedding individuals. The aim of this study was to validate a simple, non-invasive method to track EHV shedding in zebras and to establish an efficient protocol for genotyping individual zebras from environmental DNA (eDNA). A commercially available horse enrichment toy was deployed in captive Grévy's, mountain, and plains zebra enclosures and swabbed after 4-24 hr. Using eDNA extracted from these swabs four EHV strains (EHV-1, EHV-7, wild ass herpesvirus and zebra herpesvirus) were detected by PCR and confirmed by sequencing, and 12 of 16 zebras present in the enclosures were identified as having interacted with the enrichment toy by mitochondrial DNA amplification and sequencing. We conclude that, when direct sampling is difficult or prohibited, non-invasive sampling of eDNA can be a useful tool to determine the genetics of individuals or populations and for detecting pathogen shedding in captive wildlife. © 2017 Wiley Periodicals, Inc.

  17. Bridging two scholarly islands enriches both: COI DNA barcodes for species identification versus human mitochondrial variation for the study of migrations and pathologies.

    PubMed

    Thaler, David S; Stoeckle, Mark Y

    2016-10-01

    DNA barcodes for species identification and the analysis of human mitochondrial variation have developed as independent fields even though both are based on sequences from animal mitochondria. This study finds questions within each field that can be addressed by reference to the other. DNA barcodes are based on a 648-bp segment of the mitochondrially encoded cytochrome oxidase I. From most species, this segment is the only sequence available. It is impossible to know whether it fairly represents overall mitochondrial variation. For modern humans, the entire mitochondrial genome is available from thousands of healthy individuals. SNPs in the human mitochondrial genome are evenly distributed across all protein-encoding regions arguing that COI DNA barcode is representative. Barcode variation among related species is largely based on synonymous codons. Data on human mitochondrial variation support the interpretation that most - possibly all - synonymous substitutions in mitochondria are selectively neutral. DNA barcodes confirm reports of a low variance in modern humans compared to nonhuman primates. In addition, DNA barcodes allow the comparison of modern human variance to many other extant animal species. Birds are a well-curated group in which DNA barcodes are coupled with census and geographic data. Putting modern human variation in the context of intraspecies variation among birds shows humans to be a single breeding population of average variance.

  18. Analysis and Visualization Tool for Targeted Amplicon Bisulfite Sequencing on Ion Torrent Sequencers

    PubMed Central

    Pabinger, Stephan; Ernst, Karina; Pulverer, Walter; Kallmeyer, Rainer; Valdes, Ana M.; Metrustry, Sarah; Katic, Denis; Nuzzo, Angelo; Kriegner, Albert; Vierlinger, Klemens; Weinhaeusel, Andreas

    2016-01-01

    Targeted sequencing of PCR amplicons generated from bisulfite deaminated DNA is a flexible, cost-effective way to study methylation of a sample at single CpG resolution and perform subsequent multi-target, multi-sample comparisons. Currently, no platform specific protocol, support, or analysis solution is provided to perform targeted bisulfite sequencing on a Personal Genome Machine (PGM). Here, we present a novel tool, called TABSAT, for analyzing targeted bisulfite sequencing data generated on Ion Torrent sequencers. The workflow starts with raw sequencing data, performs quality assessment, and uses a tailored version of Bismark to map the reads to a reference genome. The pipeline visualizes results as lollipop plots and is able to deduce specific methylation-patterns present in a sample. The obtained profiles are then summarized and compared between samples. In order to assess the performance of the targeted bisulfite sequencing workflow, 48 samples were used to generate 53 different Bisulfite-Sequencing PCR amplicons from each sample, resulting in 2,544 amplicon targets. We obtained a mean coverage of 282X using 1,196,822 aligned reads. Next, we compared the sequencing results of these targets to the methylation level of the corresponding sites on an Illumina 450k methylation chip. The calculated average Pearson correlation coefficient of 0.91 confirms the sequencing results with one of the industry-leading CpG methylation platforms and shows that targeted amplicon bisulfite sequencing provides an accurate and cost-efficient method for DNA methylation studies, e.g., to provide platform-independent confirmation of Illumina Infinium 450k methylation data. TABSAT offers a novel way to analyze data generated by Ion Torrent instruments and can also be used with data from the Illumina MiSeq platform. It can be easily accessed via the Platomics platform, which offers a web-based graphical user interface along with sample and parameter storage. TABSAT is freely available under a GNU General Public License version 3.0 (GPLv3) at https://github.com/tadkeys/tabsat/ and http://demo.platomics.com/. PMID:27467908

  19. Analysis of mitochondrial DNA in Bolivian llama, alpaca and vicuna populations: a contribution to the phylogeny of the South American camelids.

    PubMed

    Barreta, J; Gutiérrez-Gil, B; Iñiguez, V; Saavedra, V; Chiri, R; Latorre, E; Arranz, J J

    2013-04-01

    The objectives of this work were to assess the mtDNA diversity of Bolivian South American camelid (SAC) populations and to shed light on the evolutionary relationships between the Bolivian camelids and other populations of SACs. We have analysed two different mtDNA regions: the complete coding region of the MT-CYB gene and 513 bp of the D-loop region. The populations sampled included Bolivian llamas, alpacas and vicunas, and Chilean guanacos. High levels of genetic diversity were observed in the studied populations. In general, MT-CYB was more variable than D-loop. On a species level, the vicunas showed the lowest genetic variability, followed by the guanacos, alpacas and llamas. Phylogenetic analyses performed by including additional available mtDNA sequences from the studied species confirmed the existence of the two monophyletic clades previously described by other authors for guanacos (G) and vicunas (V). Significant levels of mtDNA hybridization were found in the domestic species. Our sequence analyses revealed significant sequence divergence within clade G, and some of the Bolivian llamas grouped with the majority of the southern guanacos. This finding supports the existence of more than the one llama domestication centre in South America previously suggested on the basis of archaeozoological evidence. Additionally, analysis of D-loop sequences revealed two new matrilineal lineages that are distinct from the previously reported G and V clades. The results presented here represent the first report on the population structure and genetic variability of Bolivian camelids and may help to elucidate the complex and dynamic domestication process of SAC populations. © 2012 The Authors, Animal Genetics © 2012 Stichting International Foundation for Animal Genetics.

  20. A calmodulin-like protein (LCALA) is a new Leishmania amazonensis candidate for telomere end-binding protein.

    PubMed

    Morea, Edna G O; Viviescas, Maria Alejandra; Fernandes, Carlos A H; Matioli, Fabio F; Lira, Cristina B B; Fernandez, Maribel F; Moraes, Barbara S; da Silva, Marcelo S; Storti, Camila B; Fontes, Marcos R M; Cano, Maria Isabel N

    2017-11-01

    Leishmania spp. telomeres are composed of 5'-TTAGGG-3' repeats associated with proteins. We have previously identified LaRbp38 and LaRPA-1 as proteins that bind the G-rich telomeric strand. At that time, we had also partially characterized a protein: DNA complex, named LaGT1, but we could not identify its protein component. Using protein-DNA interaction and competition assays, we confirmed that LaGT1 is highly specific to the G-rich telomeric single-stranded DNA. Three protein bands, with LaGT1 activity, were isolated from affinity-purified protein extracts in-gel digested, and sequenced de novo using mass spectrometry analysis. In silico analysis of the digested peptide identified them as a putative calmodulin with sequences identical to the T. cruzi calmodulin. In the Leishmania genome, the calmodulin ortholog is present in three identical copies. We cloned and sequenced one of the gene copies, named it LCalA, and obtained the recombinant protein. Multiple sequence alignment and molecular modeling showed that LCalA shares homology to most eukaryotes calmodulin. In addition, we demonstrated that LCalA is nuclear, partially co-localizes with telomeres and binds in vivo the G-rich telomeric strand. Recombinant LCalA can bind specifically and with relative affinity to the G-rich telomeric single-strand and to a 3'G-overhang, and DNA binding is calcium dependent. We have described a novel candidate component of Leishmania telomeres, LCalA, a nuclear calmodulin that binds the G-rich telomeric strand with high specificity and relative affinity, in a calcium-dependent manner. LCalA is the first reported calmodulin that binds in vivo telomeric DNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Epigenomics of Development in Populus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strauss, Steve; Freitag, Michael; Mockler, Todd

    2013-01-10

    We conducted research to determine the role of epigenetic modifications during tree development using poplar (Populus trichocarpa), a model woody feedstock species. Using methylated DNA immunoprecipitation (MeDIP) or chromatin immunoprecipitation (ChIP), followed by high-throughput sequencing, we are analyzed DNA and histone methylation patterns in the P. trichocarpa genome in relation to four biological processes: bud dormancy and release, mature organ maintenance, in vitro organogenesis, and methylation suppression. Our project is now completed. We have 1) produced 22 transgenic events for a gene involved in DNA methylation suppression and studied its phenotypic consequences; 2) completed sequencing of methylated DNA from elevenmore » target tissues in wildtype P. trichocarpa; 3) updated our customized poplar genome browser using the open-source software tools (2.13) and (V2.2) of the P. trichocarpa genome; 4) produced summary data for genome methylation in P. trichocarpa, including distribution of methylation across chromosomes and in and around genes; 5) employed bioinformatic and statistical methods to analyze differences in methylation patterns among tissue types; and 6) used bisulfite sequencing of selected target genes to confirm bioinformatics and sequencing results, and gain a higher-resolution view of methylation at selected genes 7) compared methylation patterns to expression using available microarray data. Our main findings of biological significance are the identification of extensive regions of the genome that display developmental variation in DNA methylation; highly distinctive gene-associated methylation profiles in reproductive tissues, particularly male catkins; a strong whole genome/all tissue inverse association of methylation at gene bodies and promoters with gene expression; a lack of evidence that tissue specificity of gene expression is associated with gene methylation; and evidence that genome methylation is a significant impediment to tissue dedifferentiation and redifferentiation in vitro.« less

  2. Identification of Forensically Important Calliphoridae and Sarcophagidae Species Collected in Korea Using SNaPshot Multiplex System Targeting the Cytochrome c Oxidase Subunit I Gene

    PubMed Central

    Park, Ji Hye

    2018-01-01

    Estimation of postmortem interval (PMI) is paramount in modern forensic investigation. After the disappearance of the early postmortem phenomena conventionally used to estimate PMI, entomologic evidence provides important indicators for PMI estimation. The age of the oldest fly larvae or pupae can be estimated to pinpoint the time of oviposition, which is considered the minimum PMI (PMImin). The development rate of insects is usually temperature dependent and species specific. Therefore, species identification is mandatory for PMImin estimation using entomological evidence. The classical morphological identification method cannot be applied when specimens are damaged or have not yet matured. To overcome this limitation, some investigators employ molecular identification using mitochondrial cytochrome c oxidase subunit I (COI) nucleotide sequences. The molecular identification method commonly uses Sanger's nucleotide sequencing and molecular phylogeny, which are complex and time consuming and constitute another obstacle for forensic investigators. In this study, instead of using conventional Sanger's nucleotide sequencing, single-nucleotide polymorphisms (SNPs) in the COI gene region, which are unique between fly species, were selected and targeted for single-base extension (SBE) technology. These SNPs were genotyped using a SNaPshot® kit. Eleven Calliphoridae and seven Sarcophagidae species were covered. To validate this genotyping, fly DNA samples (103 adults, 84 larvae, and 4 pupae) previously confirmed by DNA barcoding were used. This method worked quickly with minimal DNA, providing a potential alternative to conventional DNA barcoding. Consisting of only a few simple electropherogram peaks, the results were more straightforward compared with those of the conventional DNA barcoding produced by Sanger's nucleotide sequencing. PMID:29682531

  3. Characterization of RAD9 of Saccharomyces cerevisiae and evidence that its function acts posttranslationally in cell cycle arrest after DNA damage.

    PubMed

    Weinert, T A; Hartwell, L H

    1990-12-01

    In eucaryotic cells, incompletely replicated or damaged chromosomes induce cell cycle arrest in G2 before mitosis, and in the yeast Saccharomyces cerevisiae the RAD9 gene is essential for the cell cycle arrest (T.A. Weinert and L. H. Hartwell, Science 241:317-322, 1988). In this report, we extend the analysis of RAD9-dependent cell cycle control. We found that both induction of RAD9-dependent arrest in G2 and recovery from arrest could occur in the presence of the protein synthesis inhibitor cycloheximide, showing that the mechanism of RAD9-dependent control involves a posttranslational mechanism(s). We have isolated and determined the DNA sequence of the RAD9 gene, confirming the DNA sequence reported previously (R. H. Schiestl, P. Reynolds, S. Prakash, and L. Prakash, Mol. Cell. Biol. 9:1882-1886, 1989). The predicted protein sequence for the Rad9 protein bears no similarity to sequences of known proteins. We also found that synthesis of the RAD9 transcript in the cell cycle was constitutive and not induced by X-irradiation. We constructed yeast cells containing a complete deletion of the RAD9 gene; the rad9 null mutants were viable, sensitive to X- and UV irradiation, and defective for cell cycle arrest after DNA damage. Although Rad+ and rad9 delta cells had similar growth rates and cell cycle kinetics in unirradiated cells, the spontaneous rate of chromosome loss (in unirradiated cells) was elevated 7- to 21-fold in rad9 delta cells. These studies show that in the presence of induced or endogenous DNA damage, RAD9 is a negative regulator that inhibits progression from G2 in order to preserve cell viability and to maintain the fidelity of chromosome transmission.

  4. West Nile Virus Infection in Killer Whale, Texas, USA, 2007

    PubMed Central

    Wu, Guang; Anderson, Mark; Dalton, Les; Nilson, Erika; Wang, David

    2011-01-01

    In 2007, nonsuppurative encephalitis was identified in a killer whale at a Texas, USA, marine park. Panviral DNA microarray of brain tissue suggested West Nile virus (WNV); WNV was confirmed by reverse transcription PCR and sequencing. Immunohistochemistry demonstrated WNV antigen within neurons. WNV should be considered in cases of encephalitis in cetaceans. PMID:21801643

  5. Scar-less multi-part DNA assembly design automation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hillson, Nathan J.

    The present invention provides a method of a method of designing an implementation of a DNA assembly. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding flanking homology sequences to each of the DNA oligos. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which tomore » assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding optimized overhang sequences to each of the DNA oligos.« less

  6. Desulfuromonas thiophila sp. nov., a new obligately sulfur-reducing bacterium from anoxic freshwater sediment.

    PubMed

    Finster, K; Coates, J D; Liesack, W; Pfennig, N

    1997-07-01

    A mesophilic, acetate-oxidizing, sulfur-reducing bacterium, strain NZ27T, was isolated from anoxic mud from a freshwater sulfur spring. The cells were ovoid, motile, and gram negative. In addition to acetate, the strain oxidized pyruvate, succinate, and fumarate. Sulfur flower could be replaced by polysulfide as an electron acceptor. Ferric nitrilotriacetic acid was reduced in the presence of pyruvate; however, this reduction did not sustain growth. These phenotypic characteristics suggested that strain NZ27T is affiliated with the genus Desulfuromonas. A phylogenetic analysis based on the results of comparative 16S ribosomal DNA sequencing confirmed that strain NZ27T belongs to the Desulfuromonas cluster in the recently proposed family "Geobacteracea" in the delta subgroup of the Proteobacteria. In addition, the results of DNA-DNA hybridization studies confirmed that strain NZ27T represents a novel species. Desulfuromonas thiophila, a name tentatively used in previous publication, is the name proposed for strain NZ27T in this paper.

  7. Desulfuromonas thiophila sp. nov., a new obligately sulfur-reducing bacterium from anoxic freshwater sediment

    USGS Publications Warehouse

    Finster, K.; Coates, J.D.; Liesack, W.; Pfennig, N.

    1997-01-01

    A mesophilic, acetate-oxidizing, sulfur-reducing bacterium, strain NZ27(T), was isolated from anoxic mud from a freshwater sulfur spring. The cells were ovoid, motile, and gram negative. In addition to acetate, the strain oxidized pyruvate, succinate, and fumarate. Sulfur flower could be replaced by polysulfide as an electron acceptor. Ferric nitrilotriacetic acid was reduced in the presence of pyruvate; however, this reduction did not sustain growth. These phenotypic characteristics suggested that strain NZ27(T) is affiliated with the genus Desulfuromonas. A phylogenetic analysis based on the results of comparative 16S ribosomal DNA sequencing confirmed that strain NZ27(T) belongs to the Desulfuromonas cluster in the recently proposed family 'Geobacteraceae' in the delta subgroup of the Proteobacteria. In addition, the results of DNA-DNA hybridization studies confirmed that strain NZ27(T) represents a novel species. Desulfuromonas thiophila, a name tentatively used in previous publications, is the name proposed for strain NZ27(T) in this paper.

  8. Phylogenetic and Structural Analysis of the Pluripotency Factor Sex-Determining Region Y box2 Gene of Camelus dromedarius (cSox2).

    PubMed

    Alawad, Abdullah; Alharbi, Sultan; Alhazzaa, Othman; Alagrafi, Faisal; Alkhrayef, Mohammed; Alhamdan, Ziyad; Alenazi, Abdullah; Al-Johi, Hasan; Alanazi, Ibrahim O; Hammad, Mohamed

    2016-01-01

    Although the sequencing information of Sox2 cDNA for many mammalian is available, the Sox2 cDNA of Camelus dromedaries has not yet been characterized. The objective of this study was to sequence and characterize Sox2 cDNA from the brain of C. dromedarius (also known as Arabian camel). A full coding sequence of the Sox2 gene from the brain of C. dromedarius was amplified by reverse transcription PCRjmc and then sequenced using the 3730XL series platform Sequencer (Applied Biosystem) for the first time. The cDNA sequence displayed an open reading frame of 822 nucleotides, encoding a protein of 273 amino acids. The molecular weight and the isoelectric point of the translated protein were calculated as 29.825 kDa and 10.11, respectively, using bioinformatics analysis. The predicted cSox2 protein sequence exhibited high identity: 99% for Homo sapiens, Mus musculus, Bos taurus, and Vicugna pacos; 98% for Sus scrofa and 93% for Camelus ferus. A 3D structure was built based on the available crystal structure of the HMG-box domain of human stem cell transcription factor Sox2 (PDB: 2 LE4) with 81 residues and predicting bioinformatics software for 273 amino acid residues. The comparison confirms the presence of the HMG-box domain in the cSox2 protein. The orthologous phylogenetic analysis showed that the Sox2 isoform from C. dromedarius was grouped with humans, alpacas, cattle, and pigs. We believe that this genetic and structural information will be a helpful source for the annotation. Furthermore, Sox2 is one of the transcription factors that contributes to the generation-induced pluripotent stem cells (iPSCs), which in turn will probably help generate camel induced pluripotent stem cells (CiPSCs).

  9. Human Ro60 (SSA2) genomic organization and sequence alterations, examined in cutaneous lupus erythematosus.

    PubMed

    Millard, T P; Ashton, G H S; Kondeatis, E; Vaughan, R W; Hughes, G R V; Khamashta, M A; Hawk, J L M; McGregor, J M; McGrath, J A

    2002-02-01

    The Ro 60 kDa protein (Ro60 or SSA2) is the major component of the Ro ribonucleoprotein (Ro RNP) complex, to which an immune response is a specific feature of several autoimmune diseases. The genomic organization and any sequence variation within the DNA encoding Ro60 are unknown. To characterize the Ro60 gene structure and to assess whether any sequence alterations might be associated with serum anti-Ro antibody in subacute cutaneous lupus erythematosus (SCLE), thus potentially providing new insight into disease pathogenesis. The cDNA sequence for Ro60 was obtained from the NCBI database and used for a BLAST search for a clone containing the entire genomic sequence. The intron-exon borders were confirmed by designing intronic primer pairs to flank each exon, which were then used to amplify genomic DNA for automated sequencing from 36 caucasian patients with SCLE (anti-Ro positive) and 49 with discoid LE (DLE, anti-Ro negative), in addition to 36 healthy caucasian controls. Heteroduplex analysis of polymerase chain reaction (PCR) products from patients and controls spanning all Ro60 exons (1-8) revealed a common bandshift in the PCR products spanning exon 7. Sequencing of the corresponding PCR products demonstrated an A > G substitution at nucleotide position 1318-7, within the consensus acceptor splice site of exon 7 (GenBank XM001901). The allele frequencies were major allele A (0.71) and minor allele G (0.29) in 72 control chromosomes, with no significant differences found between SCLE patients, DLE patients and controls. The genomic organization of the DNA encoding the Ro60 protein is described, including a common polymorphism within the consensus acceptor splice site of exon 7. Our delineation of a strategy for the genomic amplification of Ro60 forms a basis for further examination of the pathological functions of the Ro RNP in autoimmune disease.

  10. A rare variant of the mtDNA HVS1 sequence in the hairs of Napoléon's family.

    PubMed

    Lucotte, Gérard

    2010-10-04

    This paper describes the finding of a rare variant in the sequence of the hypervariable segment (HVS1) of mitochondrial (mtDNA) extracted from two preserved hairs, authenticated as belonging to the French Emperor Napoléon I (Napoléon Bonaparte). This rare variant is a mutation that changes the base C to T at position 16,184 (16184C→T), and it constitutes the only mutation found in this HVS1 sequence. This mutation is rare, because it was not found in a reference database (P < 0.05). In a personal database (M. Pala) comprising 37,000 different sequences, the 16184C→T mutation was found in only three samples, thus in this database the mutation frequency was 0.00008%. This mutation 16184C→T was also the only variant found subsequently in the HVS1 sequences of mtDNAs extracted from Napoléon's mother (Letizia) and from his youngest sister (Caroline), confirming that this mutation is maternally inherited. This 16184C→T variant could be used for genetic verification to authenticate any doubtful material and determine whether it should indeed be attributed to Napoléon.

  11. A rare variant of the mtDNA HVS1 sequence in the hairs of Napoléon's family

    PubMed Central

    2010-01-01

    This paper describes the finding of a rare variant in the sequence of the hypervariable segment (HVS1) of mitochondrial (mtDNA) extracted from two preserved hairs, authenticated as belonging to the French Emperor Napoléon I (Napoléon Bonaparte). This rare variant is a mutation that changes the base C to T at position 16,184 (16184C→T), and it constitutes the only mutation found in this HVS1 sequence. This mutation is rare, because it was not found in a reference database (P < 0.05). In a personal database (M. Pala) comprising 37,000 different sequences, the 16184C→T mutation was found in only three samples, thus in this database the mutation frequency was 0.00008%. This mutation 16184C→T was also the only variant found subsequently in the HVS1 sequences of mtDNAs extracted from Napoléon's mother (Letizia) and from his youngest sister (Caroline), confirming that this mutation is maternally inherited. This 16184C→T variant could be used for genetic verification to authenticate any doubtful material and determine whether it should indeed be attributed to Napoléon. PMID:21092341

  12. Selection of homeotic proteins for binding to a human DNA replication origin.

    PubMed

    de Stanchina, E; Gabellini, D; Norio, P; Giacca, M; Peverali, F A; Riva, S; Falaschi, A; Biamonti, G

    2000-06-09

    We have previously shown that a cell cycle-dependent nucleoprotein complex assembles in vivo on a 74 bp sequence within the human DNA replication origin associated to the Lamin B2 gene. Here, we report the identification, using a one-hybrid screen in yeast, of three proteins interacting with the 74 bp sequence. All of them, namely HOXA13, HOXC10 and HOXC13, are orthologues of the Abdominal-B gene of Drosophila melanogaster and are members of the homeogene family of developmental regulators. We describe the complete open reading frame sequence of HOXC10 and HOXC13 along with the structure of the HoxC13 gene. The specificity of binding of these two proteins to the Lamin B2 origin is confirmed by both band-shift and in vitro footprinting assays. In addition, the ability of HOXC10 and HOXC13 to increase the activity of a promoter containing the 74 bp sequence, as assayed by CAT-assay experiments, demonstrates a direct interaction of these homeoproteins with the origin sequence in mammalian cells. We also show that HOXC10 expression is cell-type-dependent and positively correlates with cell proliferation. Copyright 2000 Academic Press.

  13. Construction of a cDNA library from female adult of Toxocara canis, and analysis of EST and immune-related genes expressions.

    PubMed

    Zhou, Rongqiong; Xia, Qingyou; Huang, Hancheng; Lai, Min; Wang, Zhenxin

    2011-10-01

    Toxocara canis is a widespread intestinal nematode parasite of dogs, which can also cause disease in humans. We employed an expressed sequence tag (EST) strategy in order to study gene-expression including development, digestion and reproduction of T. canis. ESTs provided a rapid way to identify genes, particularly in organisms for which we have very little molecular information. In this study, a cDNA library was constructed from a female adult of T. canis and 215 high-quality ESTs from 5'-ends of the cDNA clones representing 79 unigenes were obtained. The titer of the primary cDNA library was 1.83×10(6)pfu/mL with a recombination rate of 99.33%. Most of the sequences ranged from 300 to 900bp with an average length of 656bp. Cluster analysis of these ESTs allowed identification of 79 unique sequences containing 28 contigs and 51 singletons. BLASTX searches revealed that 18 unigenes (22.78% of the total) or 70 ESTs (32.56% of the total) were novel genes that had no significant matches to any protein sequences in the public databases. The rest of the 61 unigenes (77.22% of the total) or 145 ESTs (67.44% of the total) were closely matched to the known genes or sequences deposited in the public databases. These genes were classified into seven groups based on their known or putative biological functions. We also confirmed the gene expression patterns of several immune-related genes using RT-PCR examination. This work will provide a valuable resource for the further investigations in the stage-, sex- and tissue-specific gene transcription or expression. Copyright © 2011. Published by Elsevier Inc.

  14. Prediction of constitutive A-to-I editing sites from human transcriptomes in the absence of genomic sequences

    PubMed Central

    2013-01-01

    Background Adenosine-to-inosine (A-to-I) RNA editing is recognized as a cellular mechanism for generating both RNA and protein diversity. Inosine base pairs with cytidine during reverse transcription and therefore appears as guanosine during sequencing of cDNA. Current approaches of RNA editing identification largely depend on the comparison between transcriptomes and genomic DNA (gDNA) sequencing datasets from the same individuals, and it has been challenging to identify editing candidates from transcriptomes in the absence of gDNA information. Results We have developed a new strategy to accurately predict constitutive RNA editing sites from publicly available human RNA-seq datasets in the absence of relevant genomic sequences. Our approach establishes new parameters to increase the ability to map mismatches and to minimize sequencing/mapping errors and unreported genome variations. We identified 695 novel constitutive A-to-I editing sites that appear in clusters (named “editing boxes”) in multiple samples and which exhibit spatial and dynamic regulation across human tissues. Some of these editing boxes are enriched in non-repetitive regions lacking inverted repeat structures and contain an extremely high conversion frequency of As to Is. We validated a number of editing boxes in multiple human cell lines and confirmed that ADAR1 is responsible for the observed promiscuous editing events in non-repetitive regions, further expanding our knowledge of the catalytic substrate of A-to-I RNA editing by ADAR enzymes. Conclusions The approach we present here provides a novel way of identifying A-to-I RNA editing events by analyzing only RNA-seq datasets. This method has allowed us to gain new insights into RNA editing and should also aid in the identification of more constitutive A-to-I editing sites from additional transcriptomes. PMID:23537002

  15. Cholera outbreaks (2012) in three districts of Nepal reveal clonal transmission of multi-drug resistant Vibrio cholerae O1

    PubMed Central

    2014-01-01

    Background Although endemic cholera causes significant morbidity and mortality each year in Nepal, lack of information about the causal bacterium often hinders cholera intervention and prevention. In 2012, diarrheal outbreaks affected three districts of Nepal with confirmed cases of mortality. This study was designed to understand the drug response patterns, source, and transmission of Vibrio cholerae associated with 2012 cholera outbreaks in Nepal. Methods V. cholerae (n = 28) isolated from 2012 diarrhea outbreaks {n = 22; Kathmandu (n = 12), Doti (n = 9), Bajhang (n = 1)}, and surface water (n = 6; Kathmandu) were tested for antimicrobial response. Virulence properties and DNA fingerprinting of the strains were determined by multi-locus genetic screening employing polymerase chain reaction, DNA sequencing, and pulsed-field gel electrophoresis (PFGE). Results All V. cholerae strains isolated from patients and surface water were confirmed to be toxigenic, belonging to serogroup O1, Ogawa serotype, biotype El Tor, and possessed classical biotype cholera toxin (CTX). Double-mismatch amplification mutation assay (DMAMA)-PCR revealed the V. cholerae strains to possess the B-7 allele of ctx subunit B. DNA sequencing of tcpA revealed a point mutation at amino acid position 64 (N → S) while the ctxAB promoter revealed four copies of the tandem heptamer repeat sequence 5'-TTTTGAT-3'. V. cholerae possessed all the ORFs of the Vibrio seventh pandemic island (VSP)-I but lacked the ORFs 498–511 of VSP-II. All strains were multidrug resistant with resistance to trimethoprim-sulfamethoxazole (SXT), nalidixic acid (NA), and streptomycin (S); all carried the SXT genetic element. DNA sequencing and deduced amino acid sequence of gyrA and parC of the NAR strains (n = 4) revealed point mutations at amino acid positions 83 (S → I), and 85 (S → L), respectively. Similar PFGE (NotI) pattern revealed the Nepalese V. cholerae to be clonal, and related closely with V. cholerae associated with cholera in Bangladesh and Haiti. Conclusions In 2012, diarrhea outbreaks in three districts of Nepal were due to transmission of multidrug resistant V. cholerae El Tor possessing cholera toxin (ctx) B-7 allele, which is clonal and related closely with V. cholerae associated with cholera in Bangladesh and Haiti. PMID:25022982

  16. Random-breakage mapping method applied to human DNA sequences

    NASA Technical Reports Server (NTRS)

    Lobrich, M.; Rydberg, B.; Cooper, P. K.; Chatterjee, A. (Principal Investigator)

    1996-01-01

    The random-breakage mapping method [Game et al. (1990) Nucleic Acids Res., 18, 4453-4461] was applied to DNA sequences in human fibroblasts. The methodology involves NotI restriction endonuclease digestion of DNA from irradiated calls, followed by pulsed-field gel electrophoresis, Southern blotting and hybridization with DNA probes recognizing the single copy sequences of interest. The Southern blots show a band for the unbroken restriction fragments and a smear below this band due to radiation induced random breaks. This smear pattern contains two discontinuities in intensity at positions that correspond to the distance of the hybridization site to each end of the restriction fragment. By analyzing the positions of those discontinuities we confirmed the previously mapped position of the probe DXS1327 within a NotI fragment on the X chromosome, thus demonstrating the validity of the technique. We were also able to position the probes D21S1 and D21S15 with respect to the ends of their corresponding NotI fragments on chromosome 21. A third chromosome 21 probe, D21S11, has previously been reported to be close to D21S1, although an uncertainty about a second possible location existed. Since both probes D21S1 and D21S11 hybridized to a single NotI fragment and yielded a similar smear pattern, this uncertainty is removed by the random-breakage mapping method.

  17. The time of appearance and disappearance of fetal DNA from the maternal circulation.

    PubMed

    Thomas, M R; Tutschek, B; Frost, A; Rodeck, C H; Yazdani, N; Craft, I; Williamson, R

    1995-07-01

    A single copy Y-chromosome DNA sequence was amplified using the polymerase chain reaction (PCR) from the peripheral blood of 30 women who had achieved a pregnancy through an in vitro fertilization (IVF) programme. The time of conception was known precisely and was confirmed by serial ultrasound scans. Conceptions were dated as the number of weeks after fertilization plus 2, to give a time equivalent to the obstetric menstrual dating of the pregnancy (LMP). Y-chromosome-specific DNA was detected in all pregnancies with a male fetus (18/30). The earliest detection was at 4 weeks and 5 days, and the latest at 7 weeks and 1 day. Y-chromosome-specific sequences were no longer detected in any of the male pregnancies 8 weeks after delivery. No Y-chromosome sequences were detected in any of the pregnancies where only female babies were delivered. This demonstrates that fetal DNA appears in the maternal circulation early in the first trimester, that it can be identified in all pregnancies tested by 7 weeks, that it continues to be present throughout pregnancy, and that it has been cleared from the maternal circulation 2 months after parturition. Early non-invasive prenatal diagnosis for aneuploidies and inherited disorders will be possible in all pregnancies if fetal cells can be isolated free from maternal contamination (or identified accurately in the presence of maternal cells) without problems of contamination from previous pregnancies.

  18. Synthesis of the human insulin gene. Part II. Further improvements in the modified phosphotriester method and the synthesis of seventeen deoxyribooligonucleotide fragments constituting human insulin chains B and mini-CDNA.

    PubMed Central

    Sung, W L; Hsiung, H M; Brousseau, R; Michniewicz, J; Wu, R; Narang, S A

    1979-01-01

    The purification of protected deoxyribooligonucleotides containing phosphotriester internucleotidic linkages has been improved by developing a deactivated silica gel chromatographic technique. The efficiency of this technique as applied in the modified phosphotriester approach has been demonstrated in the rapid synthesis of seventeen pure fragments constituting the sequence of human insulin B and mini-C DNA. The sequence of each oligomer was confirmed by the two-dimensional mobility shift method of fingerprinting. Images PMID:230464

  19. Whole exome sequencing identifies a homozygous nonsense variation in ALMS1 gene in a patient with syndromic obesity.

    PubMed

    Das Bhowmik, Aneek; Gupta, Neerja; Dalal, Ashwin; Kabra, Madhulika

    In the present study we report on genetic analysis in a patient with developmental delay, truncal obesity and vision problem, to find the causative mutation. Whole exome sequencing was performed on genomic DNA extracted from whole blood of the patient which revealed a homozygous nonsense variant (c.2816T>A) in exon 8 of ALMS1 gene that results in a stop codon and premature truncation at codon 939 (p.L939Ter) of the protein. The mutation was confirmed by Sanger sequencing. Exome sequencing was helpful in establishing diagnosis of Alstrom syndrome in this patient. This case highlights the utility of exome sequencing in clinical practice. Copyright © 2016 Asia Oceania Association for the Study of Obesity. Published by Elsevier Ltd. All rights reserved.

  20. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia.

    PubMed

    Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W

    2010-08-01

    The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  1. Complementary DNA sequencing and identification of mRNAs from the venomous gland of Agkistrodon piscivorus leucostoma.

    PubMed

    Jia, Ying; Cantu, Bruno A; Sánchez, Elda E; Pérez, John C

    2008-06-15

    To advance our knowledge on the snake venom composition and transcripts expressed in venom gland at the molecular level, we constructed a cDNA library from the venom gland of Agkistrodon piscivorus leucostoma for the generation of expressed sequence tags (ESTs) database. From the randomly sequenced 2112 independent clones, we have obtained ESTs for 1309 (62%) cDNAs, which showed significant deduced amino acid sequence similarity (scores >80) to previously characterized proteins in National Center for Biotechnology Information (NCBI) database. Ribosomal proteins make up 47 clones (2%) and the remaining 756 (36%) cDNAs represent either unknown identity or show BLASTX sequence identity scores of <80 with known GenBank accessions. The most highly expressed gene encoding phospholipase A(2) (PLA(2)) accounting for 35% of A. p. leucostoma venom gland cDNAs was identified and further confirmed by crude venom applied to sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS-PAGE) electrophoresis and protein sequencing. A total of 180 representative genes were obtained from the sequence assemblies and deposited to EST database. Clones showing sequence identity to disintegrins, thrombin-like enzymes, hemorrhagic toxins, fibrinogen clotting inhibitors and plasminogen activators were also identified in our EST database. These data can be used to develop a research program that will help us identify genes encoding proteins that are of medical importance or proteins involved in the mechanisms of the toxin venom.

  2. Identification of cDNAs encoding viper venom hyaluronidases: cross-generic sequence conservation of full-length and unusually short variant transcripts.

    PubMed

    Harrison, Robert A; Ibison, Frances; Wilbraham, Davina; Wagstaff, Simon C

    2007-05-01

    The immobilisation of prey by snakes is most efficiently achieved by the rapid dissemination of venom from its site of injection into the blood stream. Hyaluronidase is a common component of snake venoms and has been termed the "venom spreading factor". In the absence of nucleotide or protein sequence data to confirm the functional identity of this venom component, we interrogated a venom gland EST database for the saw-scaled viper, Echis ocellatus (Nigeria), using the gene ontology (GO) term "carbohydrate metabolism". A single hyalurononglucosaminadase-activity matching sequence (EOC00242) was found and used to design PCR primers to acquire the full-length cDNA sequence. Although very different from the bee venom and mammalian hyaluronidase sequences, the E. ocellatus sequence retained all the catalytic, positional and structural residues that characterise this class of carbohydrate metabolising hydrolases. An extraordinarily high level of sequence identity (>95%) was observed in analogous venom gland cDNA sequences isolated (by PCR) from another saw-scaled viper species, E. pyramidum leakeyi (Kenya), and from the sahara horned viper, Cerastes cerastes cerastes (Egypt) and the puff adder, Bitis arietans (Nigeria). Smaller amplicons, lacking hyaluronidase catalytic residues because of 768 bp or 855 bp central deletions, appear to encode either truncated peptides without hyaluronidase activity, or are non-translated transcripts because they lack consensus translation initiating motifs.

  3. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    DOEpatents

    Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S

    2013-06-25

    A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.

  4. Long-range correlation properties of coding and noncoding DNA sequences: GenBank analysis.

    PubMed

    Buldyrev, S V; Goldberger, A L; Havlin, S; Mantegna, R N; Matsa, M E; Peng, C K; Simons, M; Stanley, H E

    1995-05-01

    An open question in computational molecular biology is whether long-range correlations are present in both coding and noncoding DNA or only in the latter. To answer this question, we consider all 33301 coding and all 29453 noncoding eukaryotic sequences--each of length larger than 512 base pairs (bp)--in the present release of the GenBank to dtermine whether there is any statistically significant distinction in their long-range correlation properties. Standard fast Fourier transform (FFT) analysis indicates that coding sequences have practically no correlations in the range from 10 bp to 100 bp (spectral exponent beta=0.00 +/- 0.04, where the uncertainty is two standard deviations). In contrast, for noncoding sequences, the average value of the spectral exponent beta is positive (0.16 +/- 0.05) which unambiguously shows the presence of long-range correlations. We also separately analyze the 874 coding and the 1157 noncoding sequences that have more than 4096 bp and find a larger region of power-law behavior. We calculate the probability that these two data sets (coding and noncoding) were drawn from the same distribution and we find that it is less than 10(-10). We obtain independent confirmation of these findings using the method of detrended fluctuation analysis (DFA), which is designed to treat sequences with statistical heterogeneity, such as DNA's known mosaic structure ("patchiness") arising from the nonstationarity of nucleotide concentration. The near-perfect agreement between the two independent analysis methods, FFT and DFA, increases the confidence in the reliability of our conclusion.

  5. Long-range correlation properties of coding and noncoding DNA sequences: GenBank analysis

    NASA Technical Reports Server (NTRS)

    Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Matsa, M. E.; Peng, C. K.; Simons, M.; Stanley, H. E.

    1995-01-01

    An open question in computational molecular biology is whether long-range correlations are present in both coding and noncoding DNA or only in the latter. To answer this question, we consider all 33301 coding and all 29453 noncoding eukaryotic sequences--each of length larger than 512 base pairs (bp)--in the present release of the GenBank to dtermine whether there is any statistically significant distinction in their long-range correlation properties. Standard fast Fourier transform (FFT) analysis indicates that coding sequences have practically no correlations in the range from 10 bp to 100 bp (spectral exponent beta=0.00 +/- 0.04, where the uncertainty is two standard deviations). In contrast, for noncoding sequences, the average value of the spectral exponent beta is positive (0.16 +/- 0.05) which unambiguously shows the presence of long-range correlations. We also separately analyze the 874 coding and the 1157 noncoding sequences that have more than 4096 bp and find a larger region of power-law behavior. We calculate the probability that these two data sets (coding and noncoding) were drawn from the same distribution and we find that it is less than 10(-10). We obtain independent confirmation of these findings using the method of detrended fluctuation analysis (DFA), which is designed to treat sequences with statistical heterogeneity, such as DNA's known mosaic structure ("patchiness") arising from the nonstationarity of nucleotide concentration. The near-perfect agreement between the two independent analysis methods, FFT and DFA, increases the confidence in the reliability of our conclusion.

  6. Architecture of a Fur Binding Site: a Comparative Analysis

    PubMed Central

    Lavrrar, Jennifer L.; McIntosh, Mark A.

    2003-01-01

    Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

  7. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    DOEpatents

    Gardner, Shea N [San Leandro, CA; Mariella, Jr., Raymond P.; Christian, Allen T [Tracy, CA; Young, Jennifer A [Berkeley, CA; Clague, David S [Livermore, CA

    2011-01-18

    A method of fabricating a DNA molecule of user-defined sequence. The method comprises the steps of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an even or odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths. In one embodiment starting sequence fragments are of different lengths, n, n+1, n+2, etc.

  8. Multiple Origins of a Mitochondrial Mutation Conferring Deafness

    PubMed Central

    Hutchin, T. P.; Cortopassi, G. A.

    1997-01-01

    A point mutation (1555G) in the smaller ribosomal subunit of the mitochondrial DNA (mtDNA) has been associated with maternally inherited traits of hypersensitivity to streptomycin and sensorineural deafness in a number of families from China, Japan, Israel, and Africa. To determine whether this distribution was the result of a single or multiple mutational events, we carried out genetic distance analysis and phylogenetic analysis of 10 independent mtDNA D-loop sequences from Africa and Asia. The mtDNA sequence diversity was high (2.21%). Phylogenetic analysis assigned 1555G-bearing haplotypes at very divergent points in the human mtDNA evolutionary tree, and the 1555G mutations occur in many cases on race-specific mtDNA haplotypes, both facts are inconsistent with a recent introgression of the mutation into these races. The simplest interpretation of the available data is that there have been multiple origins of the 1555G mutation. The genetic distance among mtDNAs bearing the pathogenic 1555G mutation is much larger than among mtDNAs bearing either evolutionarily neutral or weakly deleterious nucleotide substitutions (such as the 4336G mutation). These results are consistent with the view that pathogenic mtDNA haplotypes such as 1555G arise on disparate mtDNA lineages which because of negative natural selection leave relatively few related descendants. The co-existence of the same mutation with deafness in individuals with very different nuclear and mitochondrial genetic backgrounds confirms the pathogenicity of the 1555G mutation. PMID:9055086

  9. Assessment of DNA degradation induced by thermal and UV radiation processing: implications for quantification of genetically modified organisms.

    PubMed

    Ballari, Rajashekhar V; Martin, Asha

    2013-12-01

    DNA quality is an important parameter for the detection and quantification of genetically modified organisms (GMO's) using the polymerase chain reaction (PCR). Food processing leads to degradation of DNA, which may impair GMO detection and quantification. This study evaluated the effect of various processing treatments such as heating, baking, microwaving, autoclaving and ultraviolet (UV) irradiation on the relative transgenic content of MON 810 maize using pRSETMON-02, a dual target plasmid as a model system. Amongst all the processing treatments examined, autoclaving and UV irradiation resulted in the least recovery of the transgenic (CaMV 35S promoter) and taxon-specific (zein) target DNA sequences. Although a profound impact on DNA degradation was seen during the processing, DNA could still be reliably quantified by Real-time PCR. The measured mean DNA copy number ratios of the processed samples were in agreement with the expected values. Our study confirms the premise that the final analytical value assigned to a particular sample is independent of the degree of DNA degradation since the transgenic and the taxon-specific target sequences possessing approximately similar lengths degrade in parallel. The results of our study demonstrate that food processing does not alter the relative quantification of the transgenic content provided the quantitative assays target shorter amplicons and the difference in the amplicon size between the transgenic and taxon-specific genes is minimal. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Successful isolation of Leishmania infantum from Rhipicephalus sanguineus sensu lato (Acari: Ixodidae) collected from naturally infected dogs.

    PubMed

    Medeiros-Silva, Viviane; Gurgel-Gonçalves, Rodrigo; Nitz, Nadjar; Morales, Lucia Emilia D' Anduraim; Cruz, Laurício Monteiro; Sobral, Isabele Gonçalves; Boité, Mariana Côrtes; Ferreira, Gabriel Eduardo Melim; Cupolillo, Elisa; Romero, Gustavo Adolfo Sierra

    2015-10-09

    The main transmission route of Leishmania infantum is through the bites of sand flies. However, alternative mechanisms are being investigated, such as through the bites of ticks, which could have epidemiological relevance. The objective of this work was to verify the presence of Leishmania spp. in Rhipicephalus sanguineus sensu lato collected from naturally infected dogs in the Federal District of Brazil. Ticks were dissected to remove their intestines and salivary glands for DNA extraction and the subsequent amplification of the conserved region of 120 bp of kDNA and 234 bp of the hsp70 gene of Leishmania spp. The amplified kDNA products were digested with endonucleases HaeIII and BstUI and were submitted to DNA sequencing. Isolated Leishmania parasites from these ticks were analyzed by multilocus enzyme electrophoresis, and the DNA obtained from this culture was subjected to microsatellite analyses. Overall, 130 specimens of R. sanguineus were collected from 27 dogs. Leishmania spp. were successfully isolated in culture from five pools of salivary glands and the intestines of ticks collected from four dogs. The amplified kDNA products from the dog blood samples and from the tick cultures, when digested by HaeIII and BstUI, revealed the presence of L. braziliensis and L. infantum. One strain was cultivated and characterized as L. infantum by enzyme electrophoresis. The amplified kDNA products from the blood of one dog showed a sequence homology with L. braziliensis; however, the amplified kDNA from the ticks collected from this dog showed a sequence homology to L. infantum. The results confirm that the specimens of R. sanguineus that feed on dogs naturally infected by L. infantum contain the parasite DNA in their intestines and salivary glands, and viable L. infantum can be successfully isolated from these ectoparasites.

  11. Identifications of captive and wild tilapia species existing in Hawaii by mitochondrial DNA control region sequence.

    PubMed

    Wu, Liang; Yang, Jinzeng

    2012-01-01

    The tilapia family of the Cichlidae includes many fish species, which live in freshwater and saltwater environments. Several species, such as O. niloticus, O. aureus, and O. mossambicus, are excellent for aquaculture because these fish are easily reproduced and readily adapt to diverse environments. Historically, tilapia species, including O. mossambicus, S. melanotheron, and O. aureus, were introduced to Hawaii many decades ago, and the state of Hawaii uses the import permit policy to prevent O. niloticus from coming into the islands. However, hybrids produced from O. niloticus may already be present in the freshwater and marine environments of the islands. The purpose of this study was to identify tilapia species that exist in Hawaii using mitochondrial DNA analysis. In this study, we analyzed 382 samples collected from 13 farm (captive) and wild tilapia populations in Oahu and the Hawaii Islands. Comparison of intraspecies variation between the mitochondrial DNA control region (mtDNA CR) and cytochrome c oxidase I (COI) gene from five populations indicated that mtDNA CR had higher nucleotide diversity than COI. A phylogenetic tree of all sampled tilapia was generated using mtDNA CR sequences. The neighbor-joining tree analysis identified seven distinctive tilapia species: O. aureus, O. mossambicus, O. niloticus, S. melanotheron, O. urolepies, T. redalli, and a hybrid of O. massambicus and O. niloticus. Of all the populations examined, 10 populations consisting of O. aureus, O. mossambicus, O. urolepis, and O. niloticus from the farmed sites were relatively pure, whereas three wild populations showed some degree of introgression and hybridization. This DNA-based tilapia species identification is the first report that confirmed tilapia species identities in the wild and captive populations in Hawaii. The DNA sequence comparisons of mtDNA CR appear to be a valid method for tilapia species identification. The suspected tilapia hybrids that consist of O. niloticus are present in captive and wild populations in Hawaii.

  12. Identifications of Captive and Wild Tilapia Species Existing in Hawaii by Mitochondrial DNA Control Region Sequence

    PubMed Central

    Wu, Liang; Yang, Jinzeng

    2012-01-01

    Background The tilapia family of the Cichlidae includes many fish species, which live in freshwater and saltwater environments. Several species, such as O. niloticus, O. aureus, and O. mossambicus, are excellent for aquaculture because these fish are easily reproduced and readily adapt to diverse environments. Historically, tilapia species, including O. mossambicus, S. melanotheron, and O. aureus, were introduced to Hawaii many decades ago, and the state of Hawaii uses the import permit policy to prevent O. niloticus from coming into the islands. However, hybrids produced from O. niloticus may already be present in the freshwater and marine environments of the islands. The purpose of this study was to identify tilapia species that exist in Hawaii using mitochondrial DNA analysis. Methodology/Principal Findings In this study, we analyzed 382 samples collected from 13 farm (captive) and wild tilapia populations in Oahu and the Hawaii Islands. Comparison of intraspecies variation between the mitochondrial DNA control region (mtDNA CR) and cytochrome c oxidase I (COI) gene from five populations indicated that mtDNA CR had higher nucleotide diversity than COI. A phylogenetic tree of all sampled tilapia was generated using mtDNA CR sequences. The neighbor-joining tree analysis identified seven distinctive tilapia species: O. aureus, O. mossambicus, O. niloticus, S. melanotheron, O. urolepies, T. redalli, and a hybrid of O. massambicus and O. niloticus. Of all the populations examined, 10 populations consisting of O. aureus, O. mossambicus, O. urolepis, and O. niloticus from the farmed sites were relatively pure, whereas three wild populations showed some degree of introgression and hybridization. Conclusions/Significance This DNA-based tilapia species identification is the first report that confirmed tilapia species identities in the wild and captive populations in Hawaii. The DNA sequence comparisons of mtDNA CR appear to be a valid method for tilapia species identification. The suspected tilapia hybrids that consist of O. niloticus are present in captive and wild populations in Hawaii. PMID:23251613

  13. Phenotypic and genotypic detection of Candida albicans and Candida dubliniensis strains isolated from oral mucosa of AIDS pediatric patients

    PubMed Central

    Livério, Harisson Oliveira; Ruiz, Luciana da Silva; de Freitas, Roseli Santos; Nishikaku, Angela; de Souza, Ana Clara; Paula, Claudete Rodrigues; Domaneschi, Carina

    2017-01-01

    ABSTRACT The aim of this study was to assess a collection of yeasts to verify the presence of Candida dubliniensis among strains isolated from the oral mucosa of AIDS pediatric patients which were initially characterized as Candida albicans by the traditional phenotypic method, as well as to evaluate the main phenotypic methods used in the discrimination between the two species and confirm the identification through genotypic techniques, i.e., DNA sequencing. Twenty-nine samples of C. albicans isolated from this population and kept in a fungi collection were evaluated and re-characterized. In order to differentiate the two species, phenotypic tests (Thermotolerance tests, Chromogenic medium, Staib agar, Tobacco agar, Hypertonic medium) were performed and genotypic techniques using DNA sequencing were employed for confirmation of isolated species. Susceptibility and specificity were calculated for each test. No phenotypic test alone was sufficient to provide definitive identification of C. dubliniensis or C. albicans, as opposed to results of molecular tests. After amplification and sequencing of specific regions of the 29 studied strains, 93.1% of the isolates were identified as C. albicans and 6.9% as C. dubliniensis. The Staib agar assay showed a higher susceptibility (96.3%) in comparison with other phenotypic techniques. Therefore, genotypic methods are indispensable for the conclusive identification and differentiation between these species. PMID:28423089

  14. Phenotypic and genotypic detection of Candida albicans and Candida dubliniensis strains isolated from oral mucosa of AIDS pediatric patients.

    PubMed

    Livério, Harisson Oliveira; Ruiz, Luciana da Silva; Freitas, Roseli Santos de; Nishikaku, Angela; Souza, Ana Clara de; Paula, Claudete Rodrigues; Domaneschi, Carina

    2017-04-13

    The aim of this study was to assess a collection of yeasts to verify the presence of Candida dubliniensis among strains isolated from the oral mucosa of AIDS pediatric patients which were initially characterized as Candida albicans by the traditional phenotypic method, as well as to evaluate the main phenotypic methods used in the discrimination between the two species and confirm the identification through genotypic techniques, i.e., DNA sequencing. Twenty-nine samples of C. albicans isolated from this population and kept in a fungi collection were evaluated and re-characterized. In order to differentiate the two species, phenotypic tests (Thermotolerance tests, Chromogenic medium, Staib agar, Tobacco agar, Hypertonic medium) were performed and genotypic techniques using DNA sequencing were employed for confirmation of isolated species. Susceptibility and specificity were calculated for each test. No phenotypic test alone was sufficient to provide definitive identification of C. dubliniensis or C. albicans, as opposed to results of molecular tests. After amplification and sequencing of specific regions of the 29 studied strains, 93.1% of the isolates were identified as C. albicans and 6.9% as C. dubliniensis. The Staib agar assay showed a higher susceptibility (96.3%) in comparison with other phenotypic techniques. Therefore, genotypic methods are indispensable for the conclusive identification and differentiation between these species.

  15. Yeast one-hybrid system used to identify the binding proteins for rat glutathione S-transferase P enhancer I.

    PubMed

    Liao, Ming-Xiang; Liu, Dong-Yuan; Zuo, Jin; Fang, Fu-De

    2002-03-01

    To detect the trans-factors specifically binding to the strong enhancer element (GPEI) in the upstream of rat glutathione S-transferase P (GST-P) gene. Yeast one-hybrid system was used to screen rat lung MATCHMAKER cDNA library to identify potential trans-factors that can interact with core sequence of GPEI(cGPEI). Electrophoresis mobility shift assay (EMSA) was used to analyze the binding of transfactors to cGPEI. cDNA fragments coding for the C-terminal part of the transcription factor c-Jun and rat adenine nucleotide translocator (ANT) were isolated. The binding of c-Jun and ANT to GPEI core sequence were confirmed. Rat c-jun transcriptional factor and ANT may interact with cGPEI. They could play an important role in the induced expression of GST-P gene.

  16. Isolation of Mycobacterium massiliense from a corneal biopsy in India.

    PubMed

    Kulandai, Lily Therese; Lakshmipathy, Dhanurekha; Ramasubban, Gayathri; Rao, Madhavan Hajib Narahari

    2014-12-01

    Rapidly growing mycobacteria (RGM) are ubiquitous and are usually considered as saprophytes, and have been recovered from the environment, particularly in dust, watery soil and water distribution systems. However, Mycobacterium massiliense is a rare causative agent of ocular infection. We report a case of M. massiliense in a 44-year-old female with signs and symptoms of a corneal ulcer. We carried out PCR-based DNA sequencing targeting the hsp 65 gene for the identification of M. massiliense . To confirm the identification, we also performed PCR-based RFLP targeting the hsp65 gene and PCR-based DNA sequencing targeting the internal transcribed spacer region, which showed 97 % nucleotide identity with M. massiliense . To the best of our knowledge, this is the first study in India to report the detection of M. massiliense from a corneal biopsy.

  17. Myoclonus epilepsy, retinitis pigmentosa, leukoencephalopathy and cerebral calcifications associated with a novel m.5513G>A mutation in the MT-TW gene.

    PubMed

    Cardaioli, Elena; Mignarri, Andrea; Cantisani, Teresa Anna; Malandrini, Alessandro; Nesti, Claudia; Rubegni, Anna; Funel, Niccola; Federico, Antonio; Santorelli, Filippo Maria; Dotti, Maria Teresa

    2018-06-02

    We sequenced the mitochondrial genome from a 40-year-old woman with myoclonus epilepsy, retinitis pigmentosa, leukoencephalopathy and cerebral calcifications. Histological and biochemical features of mitochondrial respiratory chain dysfunction were present. Direct sequencing showed a novel heteroplasmic mutation at nucleotide 5513 in the MT-TW gene that encodes tRNA Trp . Restriction Fragment Length Polymorphism analysis confirmed that about 80% of muscle mtDNA harboured the mutation while it was present in minor percentages in mtDNA from other tissues. The mutation is predicted to disrupt a highly conserved base pair within the aminoacyl acceptor stem of the tRNA. This is the 17° mutation in MT-TW gene and expands the known causes of late-onset mitochondrial diseases. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. Asexual-sexual morph connection in the type species of Berkleasmium.

    PubMed

    Tanney, Joey; Miller, Andrew N

    2017-06-01

    Berkleasmium is a polyphyletic genus comprising 37 dematiaceous hyphomycetous species. In this study, independent collections of the type species, B. concinnum , were made from Eastern North America. Nuclear internal transcribed spacer rDNA (ITS) and partial nuc 28S large subunit rDNA (LSU) sequences obtained from collections and subsequent cultures showed that Berkleasmium concinnum is the asexual morph of Neoacanthostigma septoconstrictum ( Tubeufiaceae , Tubeufiales ). Phylogenies inferred from Bayesian inference and maximum likelihood analyses of ITS-LSU sequence data confirmed this asexual-sexual morph connection and a re-examination of fungarium reference specimens also revealed the co-occurrence of N. septoconstrictum ascomata and B. concinnum sporodochia. Neoacanthostigma septoconstrictum is therefore synonymized under B. concinnum on the basis of priority. A specimen identified as N. septoconstrictum from Thailand is described as N. thailandicum sp. nov., based on morphological and genetic distinctiveness.

  19. The first genetically confirmed case of Dioctophyme renale (Nematoda: Dioctophymatida) in a patient with a subcutaneous nodule.

    PubMed

    Tokiwa, Toshihiro; Ueda, Wataru; Takatsuka, Satoshi; Okawa, Kiyotaka; Onodera, Masayuki; Ohta, Nobuo; Akao, Nobuaki

    2014-02-01

    We describe a nematode larva in a subcutaneous nodule excised from a 44-year-old Chinese male who had been living in Japan for 15 years. Morphological features suggested that the worm was a dioctophimatid nematode. PCR amplification and sequencing of small subunit ribosomal DNA and mitochondrial cytochrome subunit c oxidase genes allowed us to identify the larva as the giant kidney worm, Dioctophyme renale (Goeze, 1972). This is the first molecularly confirmed human case of a dermal D. renale infection. © 2013.

  20. Isolation of infectious microalga Prototheca wickerhamii from a carp (Cyprinus carpio) - a first confirmed case report of protothecosis in a fish.

    PubMed

    Jagielski, T; Dyląg, M; Roesler, U; Murugaiyan, J

    2017-10-01

    Protothecosis is a rare infection caused by environmentally ubiquitous achlorophyllic microalgae of the genus Prototheca. Here, we describe a first case of protothecosis in a carp (Cyprinus carpio), which is at the same time the first case of protothecosis in a fish, confirmed by phenotype- and molecular-based methods, including PCR sequencing of the rDNA cluster and protein profiling using matrix-assisted laser desorption ionization time-of-flight mass spectrometry. © 2017 John Wiley & Sons Ltd.

  1. Erwinia teleogrylli sp. nov., a Bacterial Isolate Associated with a Chinese Cricket

    PubMed Central

    Liu, Bo; Luo, Jin; Li, Wei; Long, Xiu-Feng; Zhang, Yu-Qin; Zeng, Zhi-Gang; Tian, Yong-Qiang

    2016-01-01

    A bacterial isolate (SCU-B244T) was obtained in China from crickets (Teleogryllus occipitalis) living in cropland deserted for approximately 10 years. The isolated bacteria were Gram-negative, facultatively anaerobic, oxidase-negative rods. A preliminary analysis of the 16S rRNA gene sequence indicated that the strain belongs to either the genus Erwinia or Pantoea. Analysis of multilocus sequence typing based on concatenated partial atpD, gyrB and infB gene sequences and physiological and biochemical characteristics indicated that the strain belonged to the genus Erwinia, as member of a new species as it was distinct from other known Erwinia species. Further analysis of the 16S rRNA gene showed SCU-B244T to have 94.71% identity to the closest species of that genus, Erwinia oleae (DSM 23398T), which is below the threshold of 97% used to discriminate bacterial species. DNA-DNA hybridization results (5.78±2.52%) between SCU-B244T and Erwinia oleae (DSM 23398T) confirmed that SCU-B244T and Erwinia oleae (DSM 23398T) represent different species combined with average nucleotide identity values which range from 72.42% to 74.41. The DNA G+C content of SCU-B244T was 55.32 mol%, which also differs from that of Erwinia oleae (54.7 to 54.9 mol%). The polyphasic taxonomic approach used here confirmed that the strain belongs to the Erwinia group and represents a novel species. The name Erwinia teleogrylli sp. nov. is proposed for this novel taxon, for which the type strain is SCU-B244T (= CGMCC 1.12772T = DSM 28222T = KCTC 42022T). PMID:26800121

  2. Fingerprinting of HLA class I genes for improved selection of unrelated bone marrow donors.

    PubMed

    Martinelli, G; Farabegoli, P; Buzzi, M; Panzica, G; Zaccaria, A; Bandini, G; Calori, E; Testoni, N; Rosti, G; Conte, R; Remiddi, C; Salvucci, M; De Vivo, A; Tura, S

    1996-02-01

    The degree of matching of HLA genes between the selected donor and recipient is an important aspect of the selection of unrelated donors for allogeneic bone marrow transplantation (UBMT). The most sensitive methods currently used are serological typing of HLA class I genes, mixed lymphocyte culture (MLC), IEF and molecular genotyping of HLA class II genes by direct sequencing of PCR products. Serological typing of class I antigenes (A, B and C) fails to detect minor differences demonstrated by direct sequencing of DNA polymorphic regions. Molecular genotyping of HLA class I genes by DNA analysis is costly and work-intensive. To improve compatibility between donor and recipient, we have set up a new rapid and non-radioisotopic application of the 'fingerprinting PCR' technique for the analysis of the polymorphic second exon of the HLA class I A, B and C genes. This technique is based on the formation of specific patterns (PCR fingerprints) of homoduplexes and heteroduplexes between heterologous amplified DNA sequences. After an electrophoretic run on non-denaturing polyacrylamide gel, different HLA class I types give allele-specific banding patterns. HLA class I matching is performed, after the gel has been soaked in ethidium bromide or silver-stained, by visual comparison of patients' fingerprints with those of donors. Identity can be confirmed by mixing donor and recipient DNAs in an amplification cross-match. To assess the technique, 10 normal samples, 22 related allogeneic bone marrow transplanted pairs and 10 unrelated HLA-A and HLA-B serologically matched patient-donor pairs were analysed for HLA class I polymorphic regions. In all the related pairs and in 1/10 unrelated pairs, matched donor-recipient patterns were identified. This new application of PCR fingerprinting may confirm the HLA class I serological selection of unrelated marrow donors.

  3. Molecular Detection of Plasmodium malariae/Plasmodium brasilianum in Non-Human Primates in Captivity in Costa Rica.

    PubMed

    Fuentes-Ramírez, Alicia; Jiménez-Soto, Mauricio; Castro, Ruth; Romero-Zuñiga, Juan José; Dolz, Gaby

    2017-01-01

    One hundred and fifty-two blood samples of non-human primates of thirteen rescue centers in Costa Rica were analyzed to determine the presence of species of Plasmodium using thick blood smears, semi-nested multiplex polymerase chain reaction (SnM-PCR) for species differentiation, cloning and sequencing for confirmation. Using thick blood smears, two samples were determined to contain the Plasmodium malariae parasite, with SnM-PCR, a total of five (3.3%) samples were positive to P. malariae, cloning and sequencing confirmed both smear samples as P. malariae. One sample amplified a larger and conserved region of 18S rDNA for the genus Plasmodium and sequencing confirmed the results obtained microscopically and through SnM-PCR tests. Sequencing and construction of a phylogenetic tree of this sample revealed that the P. malariae/P. brasilianum parasite (GenBank KU999995) found in a howler monkey (Alouatta palliata) is identical to that recently reported in humans in Costa Rica. The SnM-PCR detected P. malariae/P. brasilianum parasite in different non-human primate species in captivity and in various regions of the southern Atlantic and Pacific coast of Costa Rica. The similarity of the sequences of parasites found in humans and a monkey suggests that monkeys may be acting as reservoirs of P.malariae/P. brasilianum, for which reason it is important, to include them in control and eradication programs.

  4. The usefulness of DNA sequencing after extraction by Whatman FTA filter matrix technology and phenotypic tests for differentiation of Candida albicans and Candida dubliniensis.

    PubMed

    Kiraz, Nuri; Oz, Yasemin; Aslan, Huseyin; Muslumanoglu, Hamza

    2014-02-01

    Since C. dubliniensis is similar to C. albicans phenotypically, it can be misidentified as C. albicans. We aimed to investigate the prevalence of C. dubliniensis among isolates previously identified as C. albicans in our stocks and to compare the phenotypic methods and DNA sequencing of D1/D2 region on the ribosomal large subunit (rLSU) gene. A total of 850 isolates included in this study. Phenotypic identification was performed based on germ tube formation, chlamydospore production, colony colors on chromogenic agar, inability of growth at 45 °C and growth on hypertonic Sabouraud dextrose agar. Eighty isolates compatible with C. dubliniensis by at least one phenotypic test were included in the sequence analysis. Nested PCR amplification of D1/D2 region of the rLSU gene was performed after the fungal DNA extraction by Whatman FTA filter paper technology. The sequencing analysis of PCR products carried out by an automated capillary gel electrophoresis device. The rate of C. dubliniensis was 2.35 % (n = 20) among isolates previously described as C. albicans. Consequently, none of the phenotypic tests provided satisfactory performance alone in our study, and molecular methods required special equipment and high cost. Thus, at least two phenotypic methods can be used for identification of C. dubliniensis, and molecular methods can be used for confirmation.

  5. Is MMTV associated with human breast cancer? Maybe, but probably not.

    PubMed

    Perzova, Raisa; Abbott, Lynn; Benz, Patricia; Landas, Steve; Khan, Seema; Glaser, Jordan; Cunningham, Coleen K; Poiesz, Bernard

    2017-10-13

    Conflicting results regarding the association of MMTV with human breast cancer have been reported. Published sequence data have indicated unique MMTV strains in some human samples. However, concerns regarding contamination as a cause of false positive results have persisted. We performed PCR assays for MMTV on human breast cancer cell lines and fresh frozen and formalin fixed normal and malignant human breast epithelial samples. Assays were also performed on peripheral blood mononuclear cells from volunteer blood donors and subjects at risk for human retroviral infections. In addition, assays were performed on DNA samples from wild and laboratory mice. Sequencing of MMTV positive samples from both humans and mice were performed and phylogenetically compared. Using PCR under rigorous conditions to prevent and detect "carryover" contamination, we did detect MMTV DNA in human samples, including breast cancer. However, the results were not consistent and seemed to be an artifact. Further, experiments indicated that the probable source of false positives was murine DNA, containing endogenous MMTV, present in our building. However, comparison of published and, herein, newly described MMTV sequences with published data, indicates that there are some very unique human MMTV sequences in the literature. While we could not confirm the true presence of MMTV in our human breast cancer subjects, the data indicate that further, perhaps more traditional, retroviral studies are warranted to ascertain whether MMTV might rarely be the cause of human breast cancer.

  6. Detection of Theileria orientalis in mosquito blood meals in the United Kingdom.

    PubMed

    Fernández de Marco, M; Brugman, V A; Hernández-Triana, L M; Thorne, L; Phipps, L P; Nikolova, N I; Fooks, A R; Johnson, N

    2016-10-15

    Theileria spp. are tick-borne protozoan parasites that infect a wide range of wild and domestic animals. In this study, the utility of xenosurveillance of blood-fed specimens of Culiseta annulata for detecting the presence of piroplasms in livestock was investigated. Blood-fed mosquitoes were collected at Elmley National Nature Reserve, Kent, United Kingdom. All specimens were morphologically identified, and DNA barcoding was used to confirm the morphological identification. Both the vertebrate host species and Theileria genome was detected within the bloodmeal by real-time PCR. Sequencing was used to confirm the identity of all amplicons. In total, 105 blood-fed mosquitoes morphologically identified as Cs. annulata were collected. DNA barcoding revealed that 102 specimens were Cs. annulata (99%), while a single specimen was identified as Anopheles messeae. Two specimens could not be identified molecularly due to PCR amplification failure. Blood meal analysis revealed that Cs. annulata fed almost exclusively on cattle at the collection site (n=100). The application of a pan-piroplasm PCR detected 16 positive samples (15.2%) and sequence analysis of the amplicons demonstrated that the piroplasms present in the blood meal belonged to the Theileria orientalis group. This study demonstrates how xenosurveillance can be applied to detecting pathogens in livestock and confirms the presence of Theileria species in livestock from the United Kingdom. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

  7. Human cystic echinococcosis in Turkey: a preliminary study on DNA polymorphisms of hydatid cysts removed from confirmed patients.

    PubMed

    Orsten, Serra; Boufana, Belgees; Ciftci, Turkmen; Akinci, Devrim; Karaagaoglu, Ergun; Ozkuyumcu, Cumhur; Casulli, Adriano; Akhan, Okan

    2018-04-01

    Cystic echinococcosis caused by the larval stages of Echinococcus granulosus sensu lato s.l is endemic in Turkey with a high public health impact particularly in rural areas. The aim of this study was to investigate the genetic variation and population structure of E. granulosus s.s using metacestode isolates removed from surgically confirmed patients originating from several regions in Turkey and to investigate the occurrence of autochthonous transmission. Using DNA extracted from a total of 46 human-derived CE isolates, we successfully analysed an 827-bp fragment within the cox1 mitochondrial gene and confirmed the causative agent of human cystic echinococcosis in patients included in this study to be Echinococcus granulosus s.s (G1 and G3 genotypes). The haplotype parsimony network consisted of 28 haplotypes arranged within three main clusters and the neutrality indices were both negative and significant indicating negative selection or population expansion. The assessment carried out in this study using GenBank nucleotide sequence data from Turkey for sheep and cattle hosts demonstrated the importance of autochthonous transmission with sheep, cattle and humans harbouring the same haplotypes. Further studies are required to investigate the biological significance, if any, of E. granulosus s.s haplotypes and the genetic variability of CE from human patients using longer nucleotide sequences and a larger sample set.

  8. HDP2: a ribosomal DNA (NTS-ETS) sequence as a target for species-specific molecular diagnosis of intestinal taeniasis in humans.

    PubMed

    Flores, María D; Gonzalez, Luis M; Hurtado, Carolina; Motta, Yamileth Monje; Domínguez-Hidalgo, Cristina; Merino, Francisco Jesús; Perteguer, María J; Gárate, Teresa

    2018-02-27

    Taenia solium, T. asiatica and T. saginata tapeworms cause human taeniasis and are the origin of porcine and bovine cysticercosis. Furthermore, T. solium eggs can cause human cysticercosis, with neurocysticercosis being the most serious form of the disease. These helminth infections are neglected tropical diseases and are endemic in several countries in the Americas, Asia and Africa. As a result of globalization, migration in particular, the infections have been extending to non-endemic territories. Species-specific diagnosis of taeniasis is subject to drawbacks that could be resolved using molecular approaches. In the present study, conventional and real-time amplification protocols (cPCR and qPCR) based on the T. saginata HDP2 sequence were applied in the differential diagnosis of taeniasis (T. saginata, T. solium) in both fecal samples and proglottids expelled by patients. The HDP2 homolog in T. solium was cloned and characterized. Semi-nested cPCR and qPCR (Sn-HDP2 cPCR and Sn-HDP2 qPCR) amplified T. saginata and T. solium DNA, with an analytical sensitivity of 40 and 400 fg, respectively, and identically in both protocols. Eighteen taeniasis patients were diagnosed directly with T. saginata or T. solium, either from proglottids or fecal samples with/without eggs (detected using microscopy), based on the optimized Sn-HDP2 qPCR. After cloning, the T. solium HDP2 homolog sequence was confirmed to be a ribosomal sequence. The HDP2 fragment corresponded to a non-transcribed sequence/external transcribed repeat (NTS/ETS) of ribosomal DNA. Compared with the T. saginata HDP2 homolog, the T solium HDP2 sequence lacked the first 900 nt at the 5' end and showed nucleotide substitutions and small deletions. Sn-HDP2 cPCR and Sn-HDP2 qPCR were set up for the diagnosis of human taeniasis, using proglottids and fecal samples from affected patients. The new Sn-HDP2 qPCR protocol was the best option, as it directly differentiated T. saginata from T. solium. The diagnosis of an imported T. solium-taeniasis case and nine European T. saginata cases was relevant. Finally, the cloning and sequencing of the T. solium HDP2 fragment confirmed that HDP2 was part of a ribosomal unit.

  9. DNA analysis of an uncommon missense mutation in a Gaucher disease patient of Jewish-Polish-Russian descent

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Choy, F.Y.M.; Wei, C.; Applegarth, D.A.

    1994-06-01

    Gaucher disease is the most frequent lysosomal lipid storage disease. It results from deficient glucocerebrosidase activity and is transmitted as an autosomal recessive trait. Three clinical forms of Gaucher disease have been described: type 1, non-neuronopathic; type 2, acute neuronopathic; and type 3, subacute neuronopathic. We have sequenced the full length cDNA of the glucocerebrosidase gene and identified an uncommon mutation in nucleotide position 1604 (genoma DNA nucleotide position 6683) from a Gaucher disease patient of Jewish-Polish-Russian descent with type 1 Gaucher disease. It is a G{yields}A transition in exon 11 that results in {sup 496}Arg{yields}{sup 496}His of glucocerebrosidase. Thismore » missense mutation is present in the heterozygous form and creates a new cleavage site for the endonuclease HphI. We have developed a simple method to detect the presence of this mutation by using HphI restriction fragment length polymorphism analysis of glucocerebrosidase genomic DNA or cDNA. The mutation in the other Gaucher allele of this patient is an A{yields}G transition at cDNA nucleotide position 1226 which creates an XhoI cleavage site after PCR mismatch amplification. The presence of this mutation was also confirmed by sequence analysis. Based on previous reports that mutation 1226 is present only in type 1 Gaucher disease and the observation that there is no neurological involvement in this patient, we conclude that our patient with the 1226/1604 genotype is diagnosed as having type 1 Gaucher disease. Since it was also postulated that mutation 1226 in the homozygous form will usually result in a good prognosis, we speculate that the orthopedic complications and the unusual presence of glomerulosclerosis in this patient may be attributable to the mutation at nucleotide 1604. This speculation will require a description of more patients with this mutation for confirmation. 32 refs., 5 figs.« less

  10. Fungal Diversity in Field Mold-Damaged Soybean Fruits and Pathogenicity Identification Based on High-Throughput rDNA Sequencing

    PubMed Central

    Liu, Jiang; Deng, Jun-cai; Yang, Cai-qiong; Huang, Ni; Chang, Xiao-li; Zhang, Jing; Yang, Feng; Liu, Wei-guo; Wang, Xiao-chun; Yong, Tai-wen; Du, Jun-bo; Shu, Kai; Yang, Wen-yu

    2017-01-01

    Continuous rain and an abnormally wet climate during harvest can easily lead to soybean plants being damaged by field mold (FM), which can reduce seed yield and quality. However, to date, the underlying pathogen and its resistance mechanism have remained unclear. The objective of the present study was to investigate the fungal diversity of various soybean varieties and to identify and confirm the FM pathogenic fungi. A total of 62,382 fungal ITS1 sequences clustered into 164 operational taxonomic units (OTUs) with 97% sequence similarity; 69 taxa were recovered from the samples by internal transcribed spacer (ITS) region sequencing. The fungal community compositions differed among the tested soybeans, with 42 OTUs being amplified from all varieties. The quadratic relationships between fungal diversity and organ-specific mildew indexes were analyzed, confirming that mildew on soybean pods can mitigate FM damage to the seeds. In addition, four potentially pathogenic fungi were isolated from FM-damaged soybean fruits; morphological and molecular identification confirmed these fungi as Aspergillus flavus, A. niger, Fusarium moniliforme, and Penicillium chrysogenum. Further re-inoculation experiments demonstrated that F. moniliforme is dominant among these FM pathogenic fungi. These results lay the foundation for future studies on mitigating or preventing FM damage to soybean. PMID:28515718

  11. Hemoglobin Wayne Trait with Incidental Polycythemia.

    PubMed

    Ambelil, Manju; Nguyen, Nghia; Dasgupta, Amitava; Risin, Semyon; Wahed, Amer

    2017-01-01

    Hemoglobinopathies, caused by mutations in the globin genes, are one of the most common inherited disorders. Many of the hemoglobin variants can be identified by hemoglobin analysis using conventional electrophoresis and high performance liquid chromatography; however hemoglobin DNA analysis may be necessary in other cases for confirmation. Here, we report a case of a rare alpha chain hemoglobin variant, hemoglobin Wayne, in a 47-year-old man who presented with secondary polycythemia. Capillary zone electrophoresis and high performance liquid chromatography revealed a significant amount of a hemoglobin variant, which was further confirmed by hemoglobin DNA sequencing as hemoglobin Wayne. Since the patient was not homozygous for hemoglobin Wayne, which is associated with secondary polycythemia, the laboratory diagnosis in this case was critical in ruling out hemoglobinopathy as the etiology of his polycythemia. © 2017 by the Association of Clinical Scientists, Inc.

  12. MITOCHONDRIAL DNA DEPLETION SYNDROME DUE TO MUTATIONS IN THE RRM2B GENE

    PubMed Central

    Bornstein, Belén; Area, Estela; Flanigan, Kevin M.; Ganesh, Jaya; Jayakar, Parul; Swoboda, Kathryn J.; Coku, Jorida; Naini, Ali; Shanske, Sara; Tanji, Kurenai; Hirano, Michio; DiMauro, Salvatore

    2014-01-01

    Mitochondrial DNA depletion syndrome (MDS) is characterized by a reduction in mtDNA copy number and has been associated with mutations in eight nuclear genes, including enzymes involved in mitochondrial nucleotide metabolism (POLG, TK2, DGUOK, SUCLA2, SUCLG1, PEO1) and MPV17. Recently, mutations in The RRM2B gene, encoding the p53-controlled ribonucleotide reductase subunit, have been described in 7 infants from 4 families, who presented with various combinations of hypotonia, tubulopathy, seizures, respiratory distress, diarrhea, and lactic acidosis. All children died before 4 months of age. We sequenced the RRM2B gene in three unrelated cases with unexplained severe mtDNA depletion. The first patient developed intractable diarrhea, profound weakness, respiratory distress, and died at three months. The other two unrelated patients had a much milder phenotype and are still alive at ages 27 and 36 months. All three patients had lactic acidosis and severe depletion of mtDNA in muscle. Muscle histochemistry showed RRF and COX deficiency. Sequencing the RRM2B gene revealed three missense mutations and two single nucleotide deletions in exon 6, 8 and 9, confirming that RRM2B mutations are important causes of MDS and that the clinical phenotype is heterogeneous and not invariably fatal in infancy. PMID:18504129

  13. Mitochondrial DNA depletion syndrome due to mutations in the RRM2B gene.

    PubMed

    Bornstein, Belén; Area, Estela; Flanigan, Kevin M; Ganesh, Jaya; Jayakar, Parul; Swoboda, Kathryn J; Coku, Jorida; Naini, Ali; Shanske, Sara; Tanji, Kurenai; Hirano, Michio; DiMauro, Salvatore

    2008-06-01

    Mitochondrial DNA depletion syndrome (MDS) is characterized by a reduction in mtDNA copy number and has been associated with mutations in eight nuclear genes, including enzymes involved in mitochondrial nucleotide metabolism (POLG, TK2, DGUOK, SUCLA2, SUCLG1, PEO1) and MPV17. Recently, mutations in the RRM2B gene, encoding the p53-controlled ribonucleotide reductase subunit, have been described in seven infants from four families, who presented with various combinations of hypotonia, tubulopathy, seizures, respiratory distress, diarrhea, and lactic acidosis. All children died before 4 months of age. We sequenced the RRM2B gene in three unrelated cases with unexplained severe mtDNA depletion. The first patient developed intractable diarrhea, profound weakness, respiratory distress, and died at 3 months. The other two unrelated patients had a much milder phenotype and are still alive at ages 27 and 36 months. All three patients had lactic acidosis and severe depletion of mtDNA in muscle. Muscle histochemistry showed RRF and COX deficiency. Sequencing the RRM2B gene revealed three missense mutations and two single nucleotide deletions in exons 6, 8, and 9, confirming that RRM2B mutations are important causes of MDS and that the clinical phenotype is heterogeneous and not invariably fatal in infancy.

  14. Isolation of Mitochondrial DNA from Single, Short Hairs without Roots Using Pressure Cycling Technology.

    PubMed

    Harper, Kathryn A; Meiklejohn, Kelly A; Merritt, Richard T; Walker, Jessica; Fisher, Constance L; Robertson, James M

    2018-02-01

    Hairs are commonly submitted as evidence to forensic laboratories, but standard nuclear DNA analysis is not always possible. Mitochondria (mt) provide another source of genetic material; however, manual isolation is laborious. In a proof-of-concept study, we assessed pressure cycling technology (PCT; an automated approach that subjects samples to varying cycles of high and low pressure) for extracting mtDNA from single, short hairs without roots. Using three microscopically similar donors, we determined the ideal PCT conditions and compared those yields to those obtained using the traditional manual micro-tissue grinder method. Higher yields were recovered from grinder extracts, but yields from PCT extracts exceeded the requirements for forensic analysis, with the DNA quality confirmed through sequencing. Automated extraction of mtDNA from hairs without roots using PCT could be useful for forensic laboratories processing numerous samples.

  15. Loop-mediated isothermal amplification (LAMP) assay-A rapid detection tool for identifying red fox (Vulpes vulpes) DNA in the carcasses of harbour porpoises (Phocoena phocoena).

    PubMed

    Heers, Teresa; van Neer, Abbo; Becker, André; Grilo, Miguel Luca; Siebert, Ursula; Abdulmawjood, Amir

    2017-01-01

    Carcasses of wild animals are often visited by different scavengers. However, determining which scavenger caused certain types of bite marks is particularly difficult and knowledge thereof is lacking. Therefore, a loop-mediated isothermal amplification (LAMP) assay (target sequence cytochrome b) was developed to detect red fox DNA in carcasses of harbour porpoises. The MSwab™ method for direct testing without prior DNA isolation was validated. As a detection device, the portable real-time fluorometer Genie® II was used, which yields rapid results and can be used in field studies without huge laboratory equipment. In addition to in vitro evaluation and validation, a stranded and scavenged harbour porpoise carcass was successfully examined for red fox DNA residues. The developed LAMP method is a valuable diagnostic tool for confirming presumable red fox bite wounds in harbour porpoises without further DNA isolation steps.

  16. Expression, purification and biochemical characterization of a single-stranded DNA binding protein from Herbaspirillum seropedicae.

    PubMed

    Vernal, Javier; Serpa, Viviane I; Tavares, Carolina; Souza, Emanuel M; Pedrosa, Fábio O; Terenzi, Hernán

    2007-05-01

    An open reading frame encoding a protein similar in size and sequence to the Escherichia coli single-stranded DNA binding protein (SSB protein) was identified in the Herbaspirillum seropedicae genome. This open reading frame was cloned into the expression plasmid pET14b. The SSB protein from H. seropedicae, named Hs_SSB, was overexpressed in E. coli strain BL21(DE3) and purified to homogeneity. Mass spectrometry data confirmed the identity of this protein. The apparent molecular mass of the native Hs_SSB was estimated by gel filtration, suggesting that the native protein is a tetramer made up of four similar subunits. The purified protein binds to single-stranded DNA (ssDNA) in a similar manner to other SSB proteins. The production of this recombinant protein in good yield opens up the possibility of obtaining its 3D-structure and will help further investigations into DNA metabolism.

  17. Non-cultural detection and molecular genotyping of Neisseria gonorrhoeae from a piece of clothing.

    PubMed

    Martin, Iona M C; Foreman, Ellie; Hall, Vicky; Nesbitt, Anne; Forster, Greta; Ison, Catherine A

    2007-04-01

    Isolation of Neisseria gonorrhoeae is currently the gold standard for the definitive diagnosis of gonorrhoea and for use in medico-legal cases in the UK. Molecular detection methods are used increasingly but are untested as evidence of infection in a court of law. An isolate of N. gonorrhoeae was obtained from a child and an article of clothing from an adult male who was suspected of sexual abuse of the child. Biochemical and immunological tests were used to confirm the isolate as N. gonorrhoeae. Amplification by PCR using two targets, cppB and ompIII, was used both as further confirmation of the isolate and to detect the presence of gonococcal-specific DNA from the clothing. The relationship of the gonococcal DNA from the child and the adult was investigated using genotyping (N. gonorrhoeae multi-antigen sequence typing; NG-MAST), including a nested PCR for the por gene. Both samples were indistinguishable by NG-MAST and shared the same sequence type, 403. This is the first report of molecular detection and genotyping of N. gonorrhoeae on an article of clothing, which resulted in conviction of the man for sexual assault.

  18. Identification of Arcanobacterium pyogenes isolated by post mortem examinations of a bearded dragon and a gecko by phenotypic and genotypic properties

    PubMed Central

    Ülbegi-Mohyla, H.; Hijazin, M.; Alber, J.; Hassan, A. A.; Abdulmawjood, A.; Prenger-Berninghoff, E.; Weiß, R.; Zschöck, M.

    2010-01-01

    The present study was designed to identify phenotypically and genotypically two Arcanobacterium (A.) pyogenes strains isolated by post mortem examinations of a bearded dragon and a gecko. The A. pyogenes strains showed the typical biochemical properties and displayed CAMP-like synergistic hemolytic activities with various indicator strains. The species identity could be confirmed genotypically by amplification and sequencing of the 16S rDNA gene and, as novel target gene, by sequencing of the beta subunit of RNA polymerase encoding gene rpoB, of both strains and of reference strains representing nine species of the genus Arcanobacterium. The species identity of the two A. pyogenes strains could additionally be confirmed by PCR mediated amplification of species specific parts of the 16S-23S rDNA intergenic spacer region, the pyolysin encoding gene plo and by amplification of the collagen-binding protein encoding gene cbpA. All these molecular targets might help to improve the future identification and further characterization of A. pyogenes which, as demonstrated in the present study, could also be isolated from reptile specimens. PMID:20706035

  19. Application of Quaternion in improving the quality of global sequence alignment scores for an ambiguous sequence target in Streptococcus pneumoniae DNA

    NASA Astrophysics Data System (ADS)

    Lestari, D.; Bustamam, A.; Novianti, T.; Ardaneswari, G.

    2017-07-01

    DNA sequence can be defined as a succession of letters, representing the order of nucleotides within DNA, using a permutation of four DNA base codes including adenine (A), guanine (G), cytosine (C), and thymine (T). The precise code of the sequences is determined using DNA sequencing methods and technologies, which have been developed since the 1970s and currently become highly developed, advanced and highly throughput sequencing technologies. So far, DNA sequencing has greatly accelerated biological and medical research and discovery. However, in some cases DNA sequencing could produce any ambiguous and not clear enough sequencing results that make them quite difficult to be determined whether these codes are A, T, G, or C. To solve these problems, in this study we can introduce other representation of DNA codes namely Quaternion Q = (PA, PT, PG, PC), where PA, PT, PG, PC are the probability of A, T, G, C bases that could appear in Q and PA + PT + PG + PC = 1. Furthermore, using Quaternion representations we are able to construct the improved scoring matrix for global sequence alignment processes, by applying a dot product method. Moreover, this scoring matrix produces better and higher quality of the match and mismatch score between two DNA base codes. In implementation, we applied the Needleman-Wunsch global sequence alignment algorithm using Octave, to analyze our target sequence which contains some ambiguous sequence data. The subject sequences are the DNA sequences of Streptococcus pneumoniae families obtained from the Genebank, meanwhile the target DNA sequence are received from our collaborator database. As the results we found the Quaternion representations improve the quality of the sequence alignment score and we can conclude that DNA sequence target has maximum similarity with Streptococcus pneumoniae.

  20. Interbreeding among deeply divergent mitochondrial lineages in the American cockroach (Periplaneta americana)

    NASA Astrophysics Data System (ADS)

    von Beeren, Christoph; Stoeckle, Mark Y.; Xia, Joyce; Burke, Griffin; Kronauer, Daniel J. C.

    2015-02-01

    DNA barcoding promises to be a useful tool to identify pest species assuming adequate representation of genetic variants in a reference library. Here we examined mitochondrial DNA barcodes in a global urban pest, the American cockroach (Periplaneta americana). Our sampling effort generated 284 cockroach specimens, most from New York City, plus 15 additional U.S. states and six other countries, enabling the first large-scale survey of P. americana barcode variation. Periplaneta americana barcode sequences (n = 247, including 24 GenBank records) formed a monophyletic lineage separate from other Periplaneta species. We found three distinct P. americana haplogroups with relatively small differences within (<=0.6%) and larger differences among groups (2.4%-4.7%). This could be interpreted as indicative of multiple cryptic species. However, nuclear DNA sequences (n = 77 specimens) revealed extensive gene flow among mitochondrial haplogroups, confirming a single species. This unusual genetic pattern likely reflects multiple introductions from genetically divergent source populations, followed by interbreeding in the invasive range. Our findings highlight the need for comprehensive reference databases in DNA barcoding studies, especially when dealing with invasive populations that might be derived from multiple genetically distinct source populations.

  1. Using DNA barcodes to identify a bird involved in a birdstrike at a Chinese airport.

    PubMed

    Yang, Rong; Wu, Xiaobing; Yan, Peng; Li, Xiaoqiang

    2010-10-01

    One day at dusk in August, 200X, an airplane was struck by a bird at a Chinese airport (M Airport). After a careful check, some blades of the plane's engine were found to be out of shape and a few feathers and some bloodstains were found in the air intake of the engine. In order to know which species of bird was involved in the birdstrike, firstly we extracted DNA from the bloodstains; secondly, the DNA barcode (portion of COI gene) of the unknown species was amplified by PCR method; thirdly, sequence divergences (K2P differences) of the DNA barcode between the unknown species and a library of 59 common bird species distributed at the airport area were analyzed. Furthermore, a neighbor-joining (NJ) tree based on COI barcodes was created to provide graphic representation of sequence divergences among the species to confirm the identification. The result showed that red-rumped swallow (Hirundo daurica) was involved in the birdstrike incident. Some suggestions to avoid birdstrikes caused by red-rumped swallows were given to the administrative department of M Airport to ensure flying safety.

  2. Rapid Identification of Seven Waterborne Exophiala Species by RCA DNA Padlock Probes.

    PubMed

    Najafzadeh, M J; Vicente, V A; Feng, Peiying; Naseri, A; Sun, Jiufeng; Rezaei-Matehkolaei, A; de Hoog, G S

    2018-03-05

    The black yeast genus Exophiala includes numerous potential opportunistic species that potentially cause systematic and disseminated infections in immunocompetent individuals. Species causing systemic disease have ability to grow at 37-40 °C, while others consistently lack thermotolerance and are involved in diseases of cold-blooded, waterborne vertebrates and occasionally invertebrates. We explain a fast and sensitive assay for recognition and identification of waterborne Exophiala species without sequencing. The ITS rDNA region of seven Exophiala species (E. equina, E. salmonis, E. opportunistica, E. pisciphila, E. aquamarina, E. angulospora and E. castellanii) along with the close relative Veronaea botryosa was sequenced and aligned for the design of specific padlock probes for the detection of characteristic single-nucleotide polymorphisms. The assay demonstrated to successfully amplify DNA of target fungi, allowing detection at the species level. Amplification products were visualized on 1% agarose gels to confirm specificity of probe-template binding. Amounts of reagents were reduced to prevent the generation of false positive results. The simplicity, tenderness, robustness and low expenses provide padlock probe assay (RCA) a definite place as a very practical method among isothermal approaches for DNA diagnostics.

  3. Mosaic CREBBP mutation causes overlapping clinical features of Rubinstein-Taybi and Filippi syndromes.

    PubMed

    de Vries, Tamar I; Monroe, Glen R; van Belzen, Martine J; van der Lans, Christian A; Savelberg, Sanne Mc; Newman, William G; van Haaften, Gijs; Nievelstein, Rutger A; van Haelst, Mieke M

    2016-08-01

    Rubinstein-Taybi syndrome (RTS, OMIM 180849) and Filippi syndrome (FLPIS, OMIM 272440) are both rare syndromes, with multiple congenital anomalies and intellectual deficit (MCA/ID). We present a patient with intellectual deficit, short stature, bilateral syndactyly of hands and feet, broad thumbs, ocular abnormalities, and dysmorphic facial features. These clinical features suggest both RTS and FLPIS. Initial DNA analysis of DNA isolated from blood did not identify variants to confirm either of these syndrome diagnoses. Whole-exome sequencing identified a homozygous variant in C9orf173, which was novel at the time of analysis. Further Sanger sequencing analysis of FLPIS cases tested negative for CKAP2L variants did not, however, reveal any further variants. Subsequent analysis using DNA isolated from buccal mucosa revealed a mosaic variant in CREBBP. This report highlights the importance of excluding mosaic variants in patients with a strong but atypical clinical presentation of a MCA/ID syndrome if no disease-causing variants can be detected in DNA isolated from blood samples. As the striking syndactyly observed in the present case is typical for FLPIS, we suggest CREBBP analysis in saliva samples for FLPIS syndrome cases in which no causal CKAP2L variant is detected.

  4. Purification and DNA binding properties of the blaI gene product, repressor for the beta-lactamase gene, blaP, of Bacillus licheniformis.

    PubMed Central

    Grossman, M J; Lampen, J O

    1987-01-01

    The location of the repressor gene, blaI, for the beta-lactamase gene blaP of Bacillus licheniformis 749, on the 5' side of blaP, was confirmed by sequencing the bla region of the constitutive mutant 749/C. An amber stop codon, likely to result in a nonfunctional truncated repressor, was found at codon 32 of the 128 codon blaI open reading frame (ORF) located 5' to blaP. In order to study the DNA binding activity of the repressor, the structural gene for blaI, from strain 749, with its ribosome binding site was expressed using a two plasmid T7 RNA polymerase/promotor system (S. Tabor and C. C. Richardson. Proc. Natl. Acad. Sci. 82, 1074-1078 (1985). Heat induction of this system in Escherichia coli K38 resulted in the production of BlaI as 5-10% of the soluble cell protein. Repressor protein was then purified by ammonium sulfate fractionation and cation exchange chromatography. The sequence of the N-terminal 28 amino acid residues was determined and was as predicted from the DNA. Binding of BlaI to DNA was detected by the slower migration of protein DNA complexes during polyacrylamide gel electrophoresis. BlaI was shown to selectively bind DNA fragments carrying the promoter regions of blaI and blaP. Images PMID:3498148

  5. Crystal Structure of the Minimalist Max-E47 Protein Chimera

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ahmadpour, Faraz; Ghirlando, Rodolfo; De Jong, Antonia T.

    Max-E47 is a protein chimera generated from the fusion of the DNA-binding basic region of Max and the dimerization region of E47, both members of the basic region/helix-loop-helix (bHLH) superfamily of transcription factors. Like native Max, Max-E47 binds with high affinity and specificity to the E-box site, 5'-CACGTG, both in vivo and in vitro. We have determined the crystal structure of Max-E47 at 1.7 Å resolution, and found that it associates to form a well-structured dimer even in the absence of its cognate DNA. Analytical ultracentrifugation confirms that Max-E47 is dimeric even at low micromolar concentrations, indicating that the Max-E47more » dimer is stable in the absence of DNA. Circular dichroism analysis demonstrates that both non-specific DNA and the E-box site induce similar levels of helical secondary structure in Max-E47. These results suggest that Max-E47 may bind to the E-box following the two-step mechanism proposed for other bHLH proteins. In this mechanism, a rapid step where protein binds to DNA without sequence specificity is followed by a slow step where specific protein:DNA interactions are fine-tuned, leading to sequence-specific recognition. Collectively, these results show that the designed Max-E47 protein chimera behaves both structurally and functionally like its native counterparts.« less

  6. Intra-specific variation in genome size in maize: cytological and phenotypic correlates

    PubMed Central

    Realini, María Florencia; Poggio, Lidia; Cámara-Hernández, Julián; González, Graciela Esther

    2016-01-01

    Genome size variation accompanies the diversification and evolution of many plant species. Relationships between DNA amount and phenotypic and cytological characteristics form the basis of most hypotheses that ascribe a biological role to genome size. The goal of the present research was to investigate the intra-specific variation in the DNA content in maize populations from Northeastern Argentina and further explore the relationship between genome size and the phenotypic traits seed weight and length of the vegetative cycle. Moreover, cytological parameters such as the percentage of heterochromatin as well as the number, position and sequence composition of knobs were analysed and their relationships with 2C DNA values were explored. The populations analysed presented significant differences in 2C DNA amount, from 4.62 to 6.29 pg, representing 36.15 % of the inter-populational variation. Moreover, intra-populational genome size variation was found, varying from 1.08 to 1.63-fold. The variation in the percentage of knob heterochromatin as well as in the number, chromosome position and sequence composition of the knobs was detected among and within the populations. Although a positive relationship between genome size and the percentage of heterochromatin was observed, a significant correlation was not found. This confirms that other non-coding repetitive DNA sequences are contributing to the genome size variation. A positive relationship between DNA amount and the seed weight has been reported in a large number of species, this relationship was not found in the populations studied here. The length of the vegetative cycle showed a positive correlation with the percentage of heterochromatin. This result allowed attributing an adaptive effect to heterochromatin since the length of this cycle would be optimized via selection for an appropriate percentage of heterochromatin. PMID:26644343

  7. Large-Scale Concatenation cDNA Sequencing

    PubMed Central

    Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.

    1997-01-01

    A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174

  8. Fabrication of an electrochemical DNA-based biosensor for Bacillus cereus detection in milk and infant formula.

    PubMed

    Izadi, Zahra; Sheikh-Zeinoddin, Mahmoud; Ensafi, Ali A; Soleimanian-Zad, Sabihe

    2016-06-15

    This paper describes fabrication of a DNA-based Au-nanoparticle modified pencil graphite electrode (PGE) biosensor for detection of Bacillus cereus, causative agent of two types of food-borne disease, i.e., emetic and diarrheal syndrome. The sensing element of the biosensor was comprised of gold nanoparticles (GNPs) self-assembled with single-stranded DNA (ssDNA) of nheA gene immobilized with thiol linker on the GNPs modified PGE. The size, shape and dispersion of the GNPs were characterized by field emission scanning electron microscope (FESEM). Detection of B. cereus was carried out based on an increase in the charge transfer resistance (Rct) of the biosensor due to hybridization of the ss-DNA with target DNA. An Atomic force microscope (AFM) was used to confirm the hybridization. The biosensor sensitivity in pure cultures of B. cereus was found to be 10(0) colony forming units per milliliter (CFU/mL) with a detection limit of 9.4 × 10(-12) mol L(-1). The biosensor could distinguish complementary from mismatch DNA sequence. The proposed biosensor exhibited a rapid detection, low cost, high sensitivity to bacterial contamination and could exclusively and specifically detect the target DNA sequence of B. cereus from other bacteria that can be found in dairy products. Moreover, the DNA biosensor exhibited high reproducibility and stability, thus it may be used as a suitable biosensor to detect B. cereus and to become a portable system for food quality control. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Synthesis of DNA

    DOEpatents

    Mariella, Jr., Raymond P.

    2008-11-18

    A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

  10. Comparative oncology DNA sequencing of canine T cell lymphoma via human hotspot panel

    PubMed Central

    Beheshti, Afshin; Pilichowska, Monika; Burgess, Kristine; Ricks-Santi, Luisel; McNiel, Elizabeth; London, Cheryl B.; Ravi, Dashnamoorthy; Evens, Andrew M.

    2018-01-01

    T-cell lymphoma (TCL) is an uncommon and aggressive form of human cancer. Lymphoma is the most common hematopoietic tumor in canines (companion animals), with TCL representing approximately 30% of diagnoses. Collectively, the canine is an appealing model for cancer research given the spontaneous occurrence of cancer, intact immune system, and phytogenetic proximity to humans. We sought to establish mutational congruence of the canine with known human TCL mutations in order to identify potential actionable oncogenic pathways. Following pathologic confirmation, DNA was sequenced in 16 canine TCL (cTCL) cases using a custom Human Cancer Hotspot Panel of 68 genes commonly mutated in human TCL. Sequencing identified 4,527,638 total reads with average length of 229 bases containing 346 unique variants and 1,474 total variants; each sample had an average of 92 variants. Among these, there were 258 germline and 32 somatic variants. Among the 32 somatic variants there were 8 missense variants, 1 splice junction variant and the remaining were intron or synonymous variants. A frequency of 4 somatic mutations per sample were noted with >7 mutations detected in MET, KDR, STK11 and BRAF. Expression of these associated proteins were also detected via Western blot analyses. In addition, Sanger sequencing confirmed three variants of high quality (MYC, MET, and TP53 missense mutation). Taken together, the mutational spectrum and protein analyses showed mutations in signaling pathways similar to human TCL and also identified novel mutations that may serve as drug targets as well as potential biomarkers. PMID:29854308

  11. Phylogenetic analysis and molecular methods for the detection of lymphocystis disease virus from yellow perch, Perca flavescens (Mitchell).

    PubMed

    Palmer, L J; Hogan, N S; van den Heuvel, M R

    2012-09-01

    Lymphocystis disease is a prevalent, non-fatal disease that affects many teleost fish and is caused by the DNA virus lymphocystis disease virus (LCDV). Lymphocystis-like lesions have been observed in yellow perch, Perca flavescens (Mitchell), in lakes in northern Alberta, Canada. In an effort to confirm the identity of the virus causing these lesions, DNA was extracted from these lesions and PCR with genotype generic LCDV primers specific to the major capsid protein (MCP) gene was performed. A 1357-base pair nucleotide sequence corresponding to a peptide length of 452 amino acids of the MCP gene was sequenced, confirming the lesions as being lymphocystis disease lesions. Phylogenetic analysis of the generated amino acid sequence revealed the perch LCDV isolate to be a distinct and novel genotype. From the obtained sequence, a real-time PCR identification method was developed using fluorgenic LUX primers. The identification method was used to detect the presence/absence of LCDV in yellow perch from two lakes, one where lymphocystis disease was observed to occur and the other where the disease had not been observed. All samples of fin, spleen and liver tested negative for LCDV in the lake where lymphocystis disease had not been observed. The second lake had a 2.6% incidence of LCD, and virus was detected in tissue samples from all individuals tested regardless of whether they were expressing the disease or not. However, estimated viral copy number in spleen and liver of symptomatic perch was four orders of magnitude higher than that in asymptomatic perch. © 2012 Blackwell Publishing Ltd.

  12. Nanopore Technology: A Simple, Inexpensive, Futuristic Technology for DNA Sequencing.

    PubMed

    Gupta, P D

    2016-10-01

    In health care, importance of DNA sequencing has been fully established. Sanger's Capillary Electrophoresis DNA sequencing methodology is time consuming, cumbersome, hence become more expensive. Lately, because of its versatility DNA sequencing became house hold name, and therefore, there is an urgent need of simple, fast, inexpensive, DNA sequencing technology. In the beginning of this century efforts were made, and Nanopore DNA sequencing technology was developed; still it is infancy, nevertheless, it is the futuristic technology.

  13. The genome-wide DNA sequence specificity of the anti-tumour drug bleomycin in human cells.

    PubMed

    Murray, Vincent; Chen, Jon K; Tanaka, Mark M

    2016-07-01

    The cancer chemotherapeutic agent, bleomycin, cleaves DNA at specific sites. For the first time, the genome-wide DNA sequence specificity of bleomycin breakage was determined in human cells. Utilising Illumina next-generation DNA sequencing techniques, over 200 million bleomycin cleavage sites were examined to elucidate the bleomycin genome-wide DNA selectivity. The genome-wide bleomycin cleavage data were analysed by four different methods to determine the cellular DNA sequence specificity of bleomycin strand breakage. For the most highly cleaved DNA sequences, the preferred site of bleomycin breakage was at 5'-GT* dinucleotide sequences (where the asterisk indicates the bleomycin cleavage site), with lesser cleavage at 5'-GC* dinucleotides. This investigation also determined longer bleomycin cleavage sequences, with preferred cleavage at 5'-GT*A and 5'- TGT* trinucleotide sequences, and 5'-TGT*A tetranucleotides. For cellular DNA, the hexanucleotide DNA sequence 5'-RTGT*AY (where R is a purine and Y is a pyrimidine) was the most highly cleaved DNA sequence. It was striking that alternating purine-pyrimidine sequences were highly cleaved by bleomycin. The highest intensity cleavage sites in cellular and purified DNA were very similar although there were some minor differences. Statistical nucleotide frequency analysis indicated a G nucleotide was present at the -3 position (relative to the cleavage site) in cellular DNA but was absent in purified DNA.

  14. Immobilization and stretching of 5'-pyrene-terminated DNA on carbon film deposited on electron microscope grid.

    PubMed

    Loukanov, Alexandre; Filipov, Chavdar; Lecheva, Marta; Emin, Saim

    2015-11-01

    The immobilization and stretching of randomly coiled DNA molecules on hydrophobic carbon film is a challenging microscopic technique, which possess various applications, especially for genome sequencing. In this report the pyrenyl nucleus is used as an anchor moiety to acquire higher affinity of double stranded DNA to the graphite surface. DNA and pyrene are joined through a linker composed of four aliphatic methylene groups. For the preparation of pyrene-terminated DNA a multifunctional phosphoramidite monomer compound was designed. It contains pyrenylbutoxy group as an anchor moiety for π-stacking attachment to the carbon film, 2-cyanoethyloxy, and diisopropylamino as coupling groups for conjugation to activated oligonucleotide chain or DNA molecule. This monomer derivative was suitable for incorporation into automated solid-phase DNA synthesis and was attached to the 5' terminus of the DNA chain through a phosphodiester linkage. The successful immobilization and stretching of pyrene-terminated DNA was demonstrated by conventional 100 kV transmission electron microscope. The microscopic analysis confirmed the stretched shape of the negatively charged nucleic acid pieces on the hydrophobic carbon film. © 2015 Wiley Periodicals, Inc.

  15. The Application of Next-Generation Sequencing for Mutation Detection in Autosomal-Dominant Hereditary Hearing Impairment.

    PubMed

    Gürtler, Nicolas; Röthlisberger, Benno; Ludin, Katja; Schlegel, Christoph; Lalwani, Anil K

    2017-07-01

    Identification of the causative mutation using next-generation sequencing in autosomal-dominant hereditary hearing impairment, as mutation analysis in hereditary hearing impairment by classic genetic methods, is hindered by the high heterogeneity of the disease. Two Swiss families with autosomal-dominant hereditary hearing impairment. Amplified DNA libraries for next-generation sequencing were constructed from extracted genomic DNA, derived from peripheral blood, and enriched by a custom-made sequence capture library. Validated, pooled libraries were sequenced on an Illumina MiSeq instrument, 300 cycles and paired-end sequencing. Technical data analysis was performed with SeqMonk, variant analysis with GeneTalk or VariantStudio. The detection of mutations in genes related to hearing loss by next-generation sequencing was subsequently confirmed using specific polymerase-chain-reaction and Sanger sequencing. Mutation detection in hearing-loss-related genes. The first family harbored the mutation c.5383+5delGTGA in the TECTA-gene. In the second family, a novel mutation c.2614-2625delCATGGCGCCGTG in the WFS1-gene and a second mutation TCOF1-c.1028G>A were identified. Next-generation sequencing successfully identified the causative mutation in families with autosomal-dominant hereditary hearing impairment. The results helped to clarify the pathogenic role of a known mutation and led to the detection of a novel one. NGS represents a feasible approach with great potential future in the diagnostics of hereditary hearing impairment, even in smaller labs.

  16. Validation of Pooled Whole-Genome Re-Sequencing in Arabidopsis lyrata.

    PubMed

    Fracassetti, Marco; Griffin, Philippa C; Willi, Yvonne

    2015-01-01

    Sequencing pooled DNA of multiple individuals from a population instead of sequencing individuals separately has become popular due to its cost-effectiveness and simple wet-lab protocol, although some criticism of this approach remains. Here we validated a protocol for pooled whole-genome re-sequencing (Pool-seq) of Arabidopsis lyrata libraries prepared with low amounts of DNA (1.6 ng per individual). The validation was based on comparing single nucleotide polymorphism (SNP) frequencies obtained by pooling with those obtained by individual-based Genotyping By Sequencing (GBS). Furthermore, we investigated the effect of sample number, sequencing depth per individual and variant caller on population SNP frequency estimates. For Pool-seq data, we compared frequency estimates from two SNP callers, VarScan and Snape; the former employs a frequentist SNP calling approach while the latter uses a Bayesian approach. Results revealed concordance correlation coefficients well above 0.8, confirming that Pool-seq is a valid method for acquiring population-level SNP frequency data. Higher accuracy was achieved by pooling more samples (25 compared to 14) and working with higher sequencing depth (4.1× per individual compared to 1.4× per individual), which increased the concordance correlation coefficient to 0.955. The Bayesian-based SNP caller produced somewhat higher concordance correlation coefficients, particularly at low sequencing depth. We recommend pooling at least 25 individuals combined with sequencing at a depth of 100× to produce satisfactory frequency estimates for common SNPs (minor allele frequency above 0.05).

  17. Molecular Taxonomy of Anopheles (Nyssorhynchus) benarrochi (Diptera: Culicidae) and Malaria Epidemiology in Southern Amazonian Peru

    PubMed Central

    Conn, Jan E.; Moreno, Marta; Saavedra, Marlon; Bickersmith, Sara A.; Knoll, Elisabeth; Fernandez, Roberto; Vera, Hubert; Burrus, Roxanne G.; Lescano, Andres G.; Sanchez, Juan Francisco; Rivera, Esteban; Vinetz, Joseph M.

    2013-01-01

    Anopheline specimens were collected in 2011 by human landing catch, Shannon and CDC traps from the malaria endemic localities of Santa Rosa and San Pedro in Madre de Dios Department, Peru. Most specimens were either Anopheles (Nyssorhynchus) benarrochi B or An. (Nys.) rangeli, confirmed by polymerase chain reaction-restriction fragment length polymorphism-internal transcribed spacer 2 (PCR-RFLP-ITS2) and, for selected individuals, ITS2 sequences. A few specimens from Lupuna, Loreto Department, northern Amazonian Peru, were also identified as An. benarrochi B. A statistical parsimony network using ITS2 sequences confirmed that all Peruvian An. benarrochi B analyzed were identical to those in GenBank from Putumayo, southern Colombia. Sequences of the mtDNA COI BOLD region of specimens from all three Peruvian localities were connected using a statistical parsimony network, although there were multiple mutation steps between northern and southern Peruvian sequences. A Bayesian inference of concatenated Peruvian sequences of ITS2+COI detected a single clade with very high support for all An. benarrochi B except one individual from Lupuna that was excluded. No samples were positive for Plasmodium by CytB-PCR. PMID:23243107

  18. [Two novel pathogenic mutations of GAN gene identified in a patient with giant axonal neuropathy].

    PubMed

    Wang, Juan; Ma, Qingwen; Cai, Qin; Liu, Yanna; Wang, Wei; Ren, Zhaorui

    2016-06-01

    To explore the disease-causing mutations in a patient suspected for giant axonal neuropathy(GAN). Target sequence capture sequencing was used to screen potential mutations in genomic DNA extracted from peripheral blood sample of the patient. Sanger sequencing was applied to confirm the detected mutation. The mutation was verified among 400 GAN alleles from 200 healthy individuals by Sanger sequencing. The function of the mutations was predicted by bioinformatics analysis. The patient was identified as a compound heterozygote carrying two novel pathogenic GAN mutations, i.e., c.778G>T (p.Glu260Ter) and c.277G>A (p.Gly93Arg). Sanger sequencing confirmed that the c.778G>T (p.Glu260Ter) mutation was inherited from his father, while c.277G>A (p.Gly93Arg) was inherited from his mother. The same mutations was not found in the 200 healthy individuals. Bioinformatics analysis predicted that the two mutations probably caused functional abnormality of gigaxonin. Two novel GAN mutations were detected in a patient with GAN. Both mutations are pathogenic and can cause abnormalities of gigaxonin structure and function, leading to pathogenesis of GAN. The results may also offer valuable information for similar diseases.

  19. Determination of serum cholestane-3β,5α,6β-triol by gas chromatography-mass spectrometry for identification of Niemann-Pick type C (NPC) disease.

    PubMed

    Kannenberg, Frank; Nofer, Jerzy-Roch; Schulte, Erhard; Reunert, Janine; Marquardt, Thorsten; Fobker, Manfred

    2017-05-01

    Niemann-Pick type C (NPC) is a neurological disease caused by an intracellular cholesterol accumulation. Cholesterol oxidation product cholestane-3β,5α,6β-triol (C-triol) serves as diagnostic biomarker for NPC, but its measurement in the routine laboratory remains difficult. We developed an isotope dilution gas chromatography-mass spectrometry (GC-MS) method permitting screening for NPC in plasma. 1440 plasma samples obtained from clinically suspicious patients were subjected to alkaline saponification. C-triol was extracted with carbon tetrachloride, transformed into the trimethylsilylethers, separated on a fused silica capillary column with a nonpolar silicone stationary phase, and analyzed by GC-MS. NPC diagnosis was confirmed by DNA sequencing. The method was linear over a concentration range of 0.03-200ng/mL with a mean recovery rate of 98.6%. The intra- and inter-day variation coefficients assessed at two concentrations were below 15%. Limits of quantification (LOQ) and detection (LOD) were 0.03ng/mL and 0.01ng/mL, respectively. Receiver operating characteristic (ROC) analysis estimated that the area under curve was 0.997 implying a significant discriminatory power to identify subjects with NPC. Nevertheless, 13 NPC patients and 29 control subjects confirmed by sequencing showed false negative or positive results, respectively. Two patients with cerebrotendinous xanthomatosis showed a 5-10-fold increase in C-triol levels. We developed a quick and sensitive GC-MS method for determination of C-triol, which may serve as a simple and inexpensive diagnostic tool aiding NPC diagnosis in a routine hospital laboratory. As C-triol elevation is not limited to NPC, the NPC diagnosis has to be confirmed by DNA sequencing. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Haplogroup effects and recombination of mitochondrial DNA: novel clues from the analysis of Leber hereditary optic neuropathy pedigrees.

    PubMed

    Carelli, Valerio; Achilli, Alessandro; Valentino, Maria Lucia; Rengo, Chiara; Semino, Ornella; Pala, Maria; Olivieri, Anna; Mattiazzi, Marina; Pallotti, Francesco; Carrara, Franco; Zeviani, Massimo; Leuzzi, Vincenzo; Carducci, Carla; Valle, Giorgio; Simionati, Barbara; Mendieta, Luana; Salomao, Solange; Belfort, Rubens; Sadun, Alfredo A; Torroni, Antonio

    2006-04-01

    The mitochondrial DNA (mtDNA) of 87 index cases with Leber hereditary optic neuropathy (LHON) sequentially diagnosed in Italy, including an extremely large Brazilian family of Italian maternal ancestry, was evaluated in detail. Only seven pairs and three triplets of identical haplotypes were observed, attesting that the large majority of the LHON mutations were due to independent mutational events. Assignment of the mutational events into haplogroups confirmed that J1 and J2 play a role in LHON expression but narrowed the association to the subclades J1c and J2b, thus suggesting that two specific combinations of amino acid changes in the cytochrome b are the cause of the mtDNA background effect and that this may occur at the level of the supercomplex formed by respiratory-chain complexes I and III. The families with identical haplotypes were genealogically reinvestigated, which led to the reconnection into extended pedigrees of three pairs of families, including the Brazilian family with its Italian counterpart. The sequencing of entire mtDNA samples from the reconnected families confirmed the genealogical reconstruction but showed that the Brazilian family was heteroplasmic at two control-region positions. The survey of the two sites in 12 of the Brazilian subjects revealed triplasmy in most cases, but there was no evidence of the tetraplasmy that would be expected in the case of mtDNA recombination.

  1. Prevalence and persistence of male DNA identified in mixed saliva samples after intense kissing.

    PubMed

    Kamodyová, Natália; Durdiaková, Jaroslava; Celec, Peter; Sedláčková, Tatiana; Repiská, Gabriela; Sviežená, Barbara; Minárik, Gabriel

    2013-01-01

    Identification of foreign biological material by genetic profiling is widely used in forensic DNA testing in different cases of sexual violence, sexual abuse or sexual harassment. In all these kinds of sexual assaults, the perpetrator could constrain the victim to kissing. The value of the victim's saliva taken after such an assault has not been investigated in the past with currently widely used molecular methods of extremely high sensitivity (e.g. qPCR) and specificity (e.g. multiplex Y-STR PCR). In our study, 12 voluntary pairs were tested at various intervals after intense kissing and saliva samples were taken from the women to assess the presence of male DNA. Sensitivity-focused assays based on the SRY (single-copy gene) and DYS (multi-copy gene) sequence motifs confirmed the presence of male DNA in female saliva after 10 and even 60min after kissing, respectively. For specificity, standard multiplex Y-STR PCR profiling was performed and male DNA was found in female saliva samples, as the entire Y-STR profile, even after 30min in one sample. Our study confirms that foreign DNA tends to persist for a restricted period of time in the victim's mouth, can be isolated from saliva after prompt collection and can be used as a valuable source of evidence. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  2. Acidovorax valerianellae sp. nov., a novel pathogen of lamb's lettuce [Valerianella locusta (L.) Laterr].

    PubMed

    Gardan, Louis; Stead, David E; Dauga, Catherine; Gillis, Moniek

    2003-05-01

    Bacterial spot disease of lamb's lettuce [Valerianella locusta (L.) Laterr.] was first observed in fields in 1991. This new bacterial disease is localized in western France in high-technology field production of lamb's lettuce for the preparation of ready-to-use salad. Nineteen strains isolated in 1992 and 1993 from typical black leaf spots of naturally infected lamb's lettuce were characterized and compared with reference strains of Acidovorax and Delftia. The pathogenicity of the 19 strains was confirmed by artificial inoculation. Biochemical and physiological tests, fatty acid profiles, DNA-DNA hybridization and other nucleic acid-based tests were performed. A numerical taxonomic analysis of the 19 lamb's lettuce strains showed a single homogeneous phenon closely related to previously described phytopathogenic taxa of the genus Acidovorax. DNA-DNA hybridization studies showed that the lamb's lettuce strains were 91-100% related to a representative strain, strain CFBP 4730(T), and constituted a discrete DNA hybridization group, indicating that they belong to the same novel species. Results from DNA-rRNA hybridization, 16S rRNA sequence analysis and fatty acid analysis studies confirmed that this novel species belongs to the beta-subclass of the Proteobacteria and, more specifically, to the family Comamonadaceae and the genus Acidovorax. The name Acidovorax valerianellae sp. nov. is proposed for this novel taxon of phytopathogenic bacteria. The type strain is strain CFBP 4730(T) (= NCPPB 4283(T)).

  3. Eurasian golden jackal as host of canine vector-borne protists.

    PubMed

    Mitková, Barbora; Hrazdilová, Kristýna; D'Amico, Gianluca; Duscher, Georg Gerhard; Suchentrunk, Franz; Forejtek, Pavel; Gherman, Călin Mircea; Matei, Ioana Adriana; Ionică, Angela Monica; Daskalaki, Aikaterini Alexandra; Mihalca, Andrei Daniel; Votýpka, Jan; Hulva, Pavel; Modrý, David

    2017-04-14

    Jackals are medium-sized canids from the wolf-like clade, exhibiting a unique combination of ancestral morphotypes, broad trophic niches, and close phylogenetic relationships with the wolf and dog. Thus, they represent a potential host of several pathogens with diverse transmission routes. Recently, populations of the Eurasian golden jackal Canis aureus have expanded into the Western Palaearctic, including most of Europe. The aim of our study was to examine Eurasian golden jackals from Romania, Czech Republic and Austria for a wide spectrum of vector-borne protists and to evaluate the role of this species as a reservoir of disease for domestic dogs and/or humans. Diagnostic polymerase chain reaction (PCR) DNA amplifications revealed 70% of jackals to be positive for Hepatozoon, 12.5% positive for piroplasms, and one individual positive for Leishmania infantum. Phylogenetic analyses of partial 18S rDNA sequences invariably placed sequenced isolates of Hepatozoon into the H. canis clade. For piroplasms, both the 18S and cox1 sequences obtained confirmed the presence of Babesia canis and "Theileria annae" in 5 and 2 individuals, respectively, providing the first records of these two piroplasmids in Eurasian golden jackals. A single animal from Dolj County (Romania) was PCR-positive for L. infantum, as confirmed also by sequencing of ITS1-5.8S. Apparently, expanding populations of jackals can play a significant role in spreading and maintaining new Babesia canis foci in Central Europe. The role of jackals in the epidemiology of "Theileria annae" and H. canis is probably similar to that of red foxes and should be taken into account in further research on these parasites. Also the presence of L. infantum deserves attention. Our study confirms that once established, the populations of Eurasian golden jackals constitute natural reservoirs for many canine vector-borne diseases, analogous to the role of the coyotes in North America.

  4. The nucleotide sequence of HLA-B{sup *}2704 reveals a new amino acid substitution in exon 4 which is also present in HLA-B{sup *}2706

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rudwaleit, M.; Bowness, P.; Wordsworth, P.

    1996-12-31

    The HLA-B27 subtype HLA-B{sup *}2704 is virtually absent in Caucasians but common in Orientals, where it is associated with ankylosing spondylitis. The amino acid sequence of HLA-B{sup *}2704 has been established by peptide mapping and was shown to differ by two amino acids from HLA-B{sup *}2705, HLA-B{sup *}2704 is characterized by a serine for aspartic acid substitution at position 77 and glutamic acid for valine at position 152. To date, however, no nucleotide sequence confirming these changes at the DNA level has been published. 13 refs., 2 figs.

  5. High-throughput gene mapping in Caenorhabditis elegans.

    PubMed

    Swan, Kathryn A; Curtis, Damian E; McKusick, Kathleen B; Voinov, Alexander V; Mapa, Felipa A; Cancilla, Michael R

    2002-07-01

    Positional cloning of mutations in model genetic systems is a powerful method for the identification of targets of medical and agricultural importance. To facilitate the high-throughput mapping of mutations in Caenorhabditis elegans, we have identified a further 9602 putative new single nucleotide polymorphisms (SNPs) between two C. elegans strains, Bristol N2 and the Hawaiian mapping strain CB4856, by sequencing inserts from a CB4856 genomic DNA library and using an informatics pipeline to compare sequences with the canonical N2 genomic sequence. When combined with data from other laboratories, our marker set of 17,189 SNPs provides even coverage of the complete worm genome. To date, we have confirmed >1099 evenly spaced SNPs (one every 91 +/- 56 kb) across the six chromosomes and validated the utility of our SNP marker set and new fluorescence polarization-based genotyping methods for systematic and high-throughput identification of genes in C. elegans by cloning several proprietary genes. We illustrate our approach by recombination mapping and confirmation of the mutation in the cloned gene, dpy-18.

  6. Sequence and Structure Dependent DNA-DNA Interactions

    NASA Astrophysics Data System (ADS)

    Kopchick, Benjamin; Qiu, Xiangyun

    Molecular forces between dsDNA strands are largely dominated by electrostatics and have been extensively studied. Quantitative knowledge has been accumulated on how DNA-DNA interactions are modulated by varied biological constituents such as ions, cationic ligands, and proteins. Despite its central role in biology, the sequence of DNA has not received substantial attention and ``random'' DNA sequences are typically used in biophysical studies. However, ~50% of human genome is composed of non-random-sequence DNAs, particularly repetitive sequences. Furthermore, covalent modifications of DNA such as methylation play key roles in gene functions. Such DNAs with specific sequences or modifications often take on structures other than the canonical B-form. Here we present series of quantitative measurements of the DNA-DNA forces with the osmotic stress method on different DNA sequences, from short repeats to the most frequent sequences in genome, and to modifications such as bromination and methylation. We observe peculiar behaviors that appear to be strongly correlated with the incurred structural changes. We speculate the causalities in terms of the differences in hydration shell and DNA surface structures.

  7. Dissociation from DNA of Type III Restriction–Modification enzymes during helicase-dependent motion and following endonuclease activity

    PubMed Central

    Tóth, Júlia; van Aelst, Kara; Salmons, Hannah; Szczelkun, Mark D.

    2012-01-01

    DNA cleavage by the Type III Restriction–Modification (RM) enzymes requires the binding of a pair of RM enzymes at two distant, inversely orientated recognition sequences followed by helicase-catalysed ATP hydrolysis and long-range communication. Here we addressed the dissociation from DNA of these enzymes at two stages: during long-range communication and following DNA cleavage. First, we demonstrated that a communicating species can be trapped in a DNA domain without a recognition site, with a non-specific DNA association lifetime of ∼200 s. If free DNA ends were present the lifetime became too short to measure, confirming that ends accelerate dissociation. Secondly, we observed that Type III RM enzymes can dissociate upon DNA cleavage and go on to cleave further DNA molecules (they can ‘turnover’, albeit inefficiently). The relationship between the observed cleavage rate and enzyme concentration indicated independent binding of each site and a requirement for simultaneous interaction of at least two enzymes per DNA to achieve cleavage. In light of various mechanisms for helicase-driven motion on DNA, we suggest these results are most consistent with a thermally driven random 1D search model (i.e. ‘DNA sliding’). PMID:22523084

  8. Micromonospora halotolerans sp. nov., isolated from the rhizosphere of a Pisum sativum plant.

    PubMed

    Carro, Lorena; Pukall, Rüdiger; Spröer, Cathrin; Kroppenstedt, Reiner M; Trujillo, Martha E

    2013-06-01

    A filamentous actinomycete strain designated CR18(T) was isolated on humic acid agar from the rhizosphere of a Pisum sativum plant collected in Spain. This isolate was observed to grow optimally at 28 °C, pH 7.0 and in the presence of 5 % NaCl. Phylogenetic analyses based on the 16S rRNA gene sequence indicated a close relationship with the type strains of Micromonospora chersina and Micromonospora endolithica. A further analysis based on a concatenated DNA sequence stretch of 4,523 bp that included partial sequences of the atpD, gyrB, recA, rpoB and 16S rRNA genes clearly differentiated the new strain from recognized Micromonospora species compared. DNA-DNA hybridization studies further supported the taxonomic position of strain CR18(T) as a novel genomic species. Chemotaxonomic analyses which included whole cell sugars, polar lipids, fatty acid profiles and menaquinone composition confirmed the affiliation of the new strain to the genus Micromonospora and also highlighted differences at the species level. These studies were finally complemented with an array of physiological tests to help differentiate between the new strain and its phylogenetic neighbours. Consequently, strain CR18(T) (= CECT 7890(T) = DSM 45598(T)) is proposed as the type strain of a novel species, Micromonospora halotolerans sp. nov.

  9. Mapping the zebrafish brain methylome using reduced representation bisulfite sequencing

    PubMed Central

    Chatterjee, Aniruddha; Ozaki, Yuichi; Stockwell, Peter A; Horsfield, Julia A; Morison, Ian M; Nakagawa, Shinichi

    2013-01-01

    Reduced representation bisulfite sequencing (RRBS) has been used to profile DNA methylation patterns in mammalian genomes such as human, mouse and rat. The methylome of the zebrafish, an important animal model, has not yet been characterized at base-pair resolution using RRBS. Therefore, we evaluated the technique of RRBS in this model organism by generating four single-nucleotide resolution DNA methylomes of adult zebrafish brain. We performed several simulations to show the distribution of fragments and enrichment of CpGs in different in silico reduced representation genomes of zebrafish. Four RRBS brain libraries generated 98 million sequenced reads and had higher frequencies of multiple mapping than equivalent human RRBS libraries. The zebrafish methylome indicates there is higher global DNA methylation in the zebrafish genome compared with its equivalent human methylome. This observation was confirmed by RRBS of zebrafish liver. High coverage CpG dinucleotides are enriched in CpG island shores more than in the CpG island core. We found that 45% of the mapped CpGs reside in gene bodies, and 7% in gene promoters. This analysis provides a roadmap for generating reproducible base-pair level methylomes for zebrafish using RRBS and our results provide the first evidence that RRBS is a suitable technique for global methylation analysis in zebrafish. PMID:23975027

  10. Assessing the impact of fungicide enostroburin application on bacterial community in wheat phyllosphere.

    PubMed

    Gu, Likun; Bai, Zhihui; Jin, Bo; Hu, Qing; Wang, Huili; Zhuang, Guoqiang; Zhang, Hongxun

    2010-01-01

    Fungicides have been used extensively for controlling fungal pathogens of plants. However, little is known regarding the effects that fungicides upon the indigenous bacterial communities within the plant phyllosphere. The aims of this study were to assess the impact of fungicide enostroburin upon bacterial communities in wheat phyllosphere. Culture-independent methodologies of 16S rDNA clone library and 16S rDNA directed polymerase chain reaction with denaturing gradient gel electrophoresis (PCR-DGGE) were used for monitoring the change of bacterial community. The 16S rDNA clone library and PCR-DGGE analysis both confirmed the microbial community of wheat plant phyllosphere were predominantly of the gamma-Proteobacteria phyla. Results from PCR-DGGE analysis indicated a significant change in bacterial community structure within the phyllosphere following fungicide enostroburin application. Bands sequenced within control cultures were predominantly of Pseudomonas genus, but those bands sequenced in the treated samples were predominantly strains of Pantoea genus and Pseudomonas genus. Of interest was the appearance of two DGGE bands following fungicide treatment, one of which had sequence similarities (98%) to Pantoea sp. which might be a competitor of plant pathogens. This study revealed the wheat phyllosphere bacterial community composition and a shift in the bacterial community following fungicide enostroburin application.

  11. No evidence of genome editing activity from Natronobacterium gregoryi Argonaute (NgAgo) in human cells.

    PubMed

    Javidi-Parsijani, Parisa; Niu, Guoguang; Davis, Meghan; Lu, Pin; Atala, Anthony; Lu, Baisong

    2017-01-01

    The argonaute protein from the thermophilic bacterium Thermus thermophilus shows DNA-guided DNA interfering activity at high temperatures, complicating its application in mammalian cells. A recent work reported that the argonaute protein from Natronobacterium gregoryi (NgAgo) had DNA-guided genome editing activity in mammalian cells. We compared the genome editing activities of NgAgo and Staphylococcus aureus Cas9 (SaCas9) in human HEK293T cells side by side. EGFP reporter assays and DNA sequencing consistently revealed high genome editing activity from SaCas9. However, these assays did not demonstrate genome editing activity by NgAgo. We confirmed that the conditions allowed simultaneous transfection of the NgAgo expressing plasmid DNA and DNA guides, as well as heterologous expression of NgAgo in the HEK293T cells. Our data show that NgAgo is not a robust genome editing tool, although it may have such activity under other conditions.

  12. Integrated next-generation sequencing of 16S rDNA and metaproteomics differentiate the healthy urine microbiome from asymptomatic bacteriuria in neuropathic bladder associated with spinal cord injury

    PubMed Central

    2012-01-01

    Background Clinical dogma is that healthy urine is sterile and the presence of bacteria with an inflammatory response is indicative of urinary tract infection (UTI). Asymptomatic bacteriuria (ABU) represents the state in which bacteria are present but the inflammatory response is negligible. Differentiating ABU from UTI is diagnostically challenging, but critical because overtreatment of ABU can perpetuate antimicrobial resistance while undertreatment of UTI can result in increased morbidity and mortality. In this study, we describe key characteristics of the healthy and ABU urine microbiomes utilizing 16S rRNA gene (16S rDNA) sequencing and metaproteomics, with the future goal of utilizing this information to personalize the treatment of UTI based on key individual characteristics. Methods A cross-sectional study of 26 healthy controls and 27 healthy subjects at risk for ABU due to spinal cord injury-related neuropathic bladder (NB) was conducted. Of the 27 subjects with NB, 8 voided normally, 8 utilized intermittent catheterization, and 11 utilized indwelling Foley urethral catheterization for bladder drainage. Urine was obtained by clean catch in voiders, or directly from the catheter in subjects utilizing catheters. Urinalysis, urine culture and 16S rDNA sequencing were performed on all samples, with metaproteomic analysis performed on a subsample. Results A total of 589454 quality-filtered 16S rDNA sequence reads were processed through a NextGen 16S rDNA analysis pipeline. Urine microbiomes differ by normal bladder function vs. NB, gender, type of bladder catheter utilized, and duration of NB. The top ten bacterial taxa showing the most relative abundance and change among samples were Lactobacillales, Enterobacteriales, Actinomycetales, Bacillales, Clostridiales, Bacteroidales, Burkholderiales, Pseudomonadales, Bifidobacteriales and Coriobacteriales. Metaproteomics confirmed the 16S rDNA results, and functional human protein-pathogen interactions were noted in subjects where host defenses were initiated. Conclusions Counter to clinical belief, healthy urine is not sterile. The healthy urine microbiome is characterized by a preponderance of Lactobacillales in women and Corynebacterium in men. The presence and duration of NB and method of urinary catheterization alter the healthy urine microbiome. An integrated approach of 16S rDNA sequencing with metaproteomics improves our understanding of healthy urine and facilitates a more personalized approach to prevention and treatment of infection. PMID:22929533

  13. Is Malassezia nana the main species in horses' ear canal microbiome?

    PubMed

    Aldrovandi, Ana Lúcia; Osugui, Lika; Acqua Coutinho, Selene Dall'

    2016-01-01

    The objective of this study was to characterize genotypically Malassezia spp. isolated from the external ear canal of healthy horses. Fifty-five horses, 39 (70.9%) males and 16 (29.1%) females, from different breeds and adults were studied. External ear canals were cleaned and a sterile cotton swab was introduced to collect cerumen. A total of 110 samples were cultured into Dixon medium and were incubated at 32°C for up to 15 days. Macro- and micromorphology and phenotypic identification were performed. DNA was extracted, strains were submitted to polymerase chain reaction technique, and the products obtained were submitted to Restriction Fragment Length Polymorphism using the restriction enzymes BstCI and HhaI. Strains were sent off to genetic sequencing of the regions 26S rDNA D1/D2 and ITS1-5.8S-ITS2 rDNA. Malassezia spp. were isolated from 33/55 (60%) animals and 52/110 (47%) ear canals. No growth on Sabouraud dextrose agar was observed, confirming the lipid dependence of all strains. Polymerase chain reaction-Restriction fragment length polymorphism permitted the molecular identification of Malassezia nana - 42/52 (81%) and Malassezia slooffiae - 10/52 (19%). Sequencing confirmed RFLP identification. It was surprising that M. nana represented over 80% of the strains and no Malassezia equina was isolated in this study, differing from what was expected. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  14. Genomic and molecular analysis of phage CMP1 from Clavibacter michiganensis subspecies michiganensis

    PubMed Central

    Wittmann, Johannes; Gartemann, Karl-Heinz; Eichenlaub, Rudolf

    2011-01-01

    Bacteriophage CMP1 is a member of the Siphoviridae family that infects specifically the plant-pathogen Clavibacter michiganensis subsp. michiganensis. The linear double- stranded DNA is terminally redundant and not circularly permuted. The complete nucleotide sequence of the bacteriophage CMP1 genome consists of 58,652 bp including the terminal redundant ends of 791 bp. The G+C content of the phage (57%) is significantly lower than that of its host (72.66%). 74 potential open reading frames were identified and annotated by different bioinformatic tools. Two large clusters which encode the early and the late functions could be identified which are divergently transcribed. There are only a few hypothetical gene products with conserved domains and significant similarity to sequences from the databases. Functional analyses confirmed the activity of four gene products, an endonuclease, an exonuclease, a single-stranded DNA binding protein and a thymidylate synthase. Partial genomic sequences of CN77, a phage of Clavibacter michiganensis subsp. nebraskensis, revealed a similar genome structure and significant similarities on the level of deduced amino acid sequences. An endolysin with peptidase activity has been identified for both phages, which may be good tools for disease control of tomato plants against Clavibacter infections. PMID:21687530

  15. Genomic and molecular analysis of phage CMP1 from Clavibacter michiganensis subspecies michiganensis.

    PubMed

    Wittmann, Johannes; Gartemann, Karl-Heinz; Eichenlaub, Rudolf; Dreiseikelmann, Brigitte

    2011-01-01

    Bacteriophage CMP1 is a member of the Siphoviridae family that infects specifically the plant-pathogen Clavibacter michiganensis subsp. michiganensis. The linear double- stranded DNA is terminally redundant and not circularly permuted. The complete nucleotide sequence of the bacteriophage CMP1 genome consists of 58,652 bp including the terminal redundant ends of 791 bp. The G+C content of the phage (57%) is significantly lower than that of its host (72.66%). 74 potential open reading frames were identified and annotated by different bioinformatic tools. Two large clusters which encode the early and the late functions could be identified which are divergently transcribed. There are only a few hypothetical gene products with conserved domains and significant similarity to sequences from the databases. Functional analyses confirmed the activity of four gene products, an endonuclease, an exonuclease, a single-stranded DNA binding protein and a thymidylate synthase. Partial genomic sequences of CN77, a phage of Clavibacter michiganensis subsp. nebraskensis, revealed a similar genome structure and significant similarities on the level of deduced amino acid sequences. An endolysin with peptidase activity has been identified for both phages, which may be good tools for disease control of tomato plants against Clavibacter infections.

  16. Familial cleidocranial dysplasia misdiagnosed as rickets over three generations.

    PubMed

    Franceschi, Roberto; Maines, Evelina; Fedrizzi, Michela; Piemontese, Maria Rosaria; De Bonis, Patrizia; Agarwal, Nivedita; Bellizzi, Maria; Di Palma, Annunziata

    2015-10-01

    Cleidocranial dysplasia (CCD) is a rare autosomal dominant skeletal dysplasia characterized by hypoplastic clavicles, late closure of the fontanels, dental problems and other skeletal features. CCD is caused by mutations, deletions or duplications in runt-related transcription factor 2 (RUNX2), which encodes for a protein essential for osteoblast differentiation and chondrocyte maturation. We describe three familial cases of CCD, misdiagnosed as rickets over three generations. No mutations were detected on standard DNA sequencing of RUNX2, but a novel deletion was identified on quantitative polymerase chain reaction (qPCR) and multiple ligation-dependent probe amplification (MLPA). The present cases indicate that CCD could be misdiagnosed as rickets, leading to inappropriate treatment, and confirm that mutations in RUNX2 are not able to be identified on standard DNA sequencing in all CCD patients, but can be identified on qPCR and MLPA. © 2015 Japan Pediatric Society.

  17. Physical and genetic mapping of the dipeptidase gene DPEP1 to 16q24. 3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Austruy, E.; Jeanpierre, C.; Junien, C.

    1993-03-01

    The authors report the subregional physical and genetic mapping on chromosome 16q of a cDNA clone selected as a potential tumor/growth suppressor sequence. By DNA sequencing and RNA expression pattern, this clone was identified as part of the renal dipeptidase gene (DPEP1). Using somatic cell hybrids carrying either different human chromosomes or chromosome 16 segments, they confirm and refine the physical mapping of DPEP1 to the chromosome 16 subregion q24.3. Two RFLPs, a biallelic polymorphism detected by TaqI and a VNTR detected by BamHI, EcoRI, and BglII, are described. Using the VNTR polymorphism, DPEP1 was shown to be linked tomore » D16S7 with a maximum lod score of 5.8 at a recombination fraction of 0.03. 14 refs., 2 figs., 2 tabs.« less

  18. Cloning, annotation and expression analysis of mycoparasitism-related genes in Trichoderma harzianum 88.

    PubMed

    Yao, Lin; Yang, Qian; Song, Jinzhu; Tan, Chong; Guo, Changhong; Wang, Li; Qu, Lianhai; Wang, Yun

    2013-04-01

    Trichoderma harzianum 88, a filamentous soil fungus, is an effective biocontrol agent against several plant pathogens. High-throughput sequencing was used here to study the mycoparasitism mechanisms of T. harzianum 88. Plate confrontation tests of T. harzianum 88 against plant pathogens were conducted, and a cDNA library was constructed from T. harzianum 88 mycelia in the presence of plant pathogen cell walls. Randomly selected transcripts from the cDNA library were compared with eukaryotic plant and fungal genomes. Of the 1,386 transcripts sequenced, the most abundant Gene Ontology (GO) classification group was "physiological process". Differential expression of 19 genes was confirmed by real-time RT-PCR at different mycoparasitism stages against plant pathogens. Gene expression analysis revealed the transcription of various genes involved in mycoparasitism of T. harzianum 88. Our study provides helpful insights into the mechanisms of T. harzianum 88-plant pathogen interactions.

  19. Expression of ZmMET1, a gene encoding a DNA methyltransferase from maize, is associated not only with DNA replication in actively proliferating cells, but also with altered DNA methylation status in cold-stressed quiescent cells.

    PubMed

    Steward, N; Kusano, T; Sano, H

    2000-09-01

    A cDNA fragment encoding part of a DNA methyltransferase was isolated from maize. The putative amino acid sequence identically matched that deduced from a genomic sequence in the database (accession no. AF063403), and the corresponding gene was designated as ZmMET1. Bacterially expressed ZmMET1 actively methylated DNA in vitro. Transcripts of ZmMET1 could be shown to exclusively accumulate in actively proliferating cells of the meristems of mesocotyls and root apices, suggesting ZmMET1 expression to be associated with DNA replication. This was confirmed by simultaneous decrease of transcripts of ZmMET1 and histone H3, a marker for DNA replication, in seedlings exposed to wounding, desiccation and salinity, all of which suppress cell division. Cold stress also depressed both transcripts in root tissues. In contrast, however, accumulation of ZmMET1 transcripts in shoot mesocotyls was not affected by cold stress, whereas those for H3 sharply decreased. Such a differential accumulation of ZmMET1 transcripts was consistent with ZmMET1 protein levels as revealed by western blotting. Expression of ZmMET1 is thus coexistent, but not completely dependent on DNA replication. Southern hybridization analysis with a methylation-sensitive restriction enzyme revealed that cold treatment induced demethylation of DNA in the Ac/Ds transposon region, but not in other genes, and that such demethylation primarily occurred in roots. These results suggested that the methylation level was decreased selectively by cold treatment, and that ZmMET1 may, at least partly, prevent such demethylation.

  20. Molecular phylogeny, population genetics, and evolution of heterocystous cyanobacteria using nifH gene sequences.

    PubMed

    Singh, Prashant; Singh, Satya Shila; Elster, Josef; Mishra, Arun Kumar

    2013-06-01

    In order to assess phylogeny, population genetics, and approximation of future course of cyanobacterial evolution based on nifH gene sequences, 41 heterocystous cyanobacterial strains collected from all over India have been used in the present study. NifH gene sequence analysis data confirm that the heterocystous cyanobacteria are monophyletic while the stigonematales show polyphyletic origin with grave intermixing. Further, analysis of nifH gene sequence data using intricate mathematical extrapolations revealed that the nucleotide diversity and recombination frequency is much greater in Nostocales than the Stigonematales. Similarly, DNA divergence studies showed significant values of divergence with greater gene conversion tracts in the unbranched (Nostocales) than the branched (Stigonematales) strains. Our data strongly support the origin of true branching cyanobacterial strains from the unbranched strains.

Top