Sample records for dna transfer methods
-
Brown, T
2001-05-01
Southern blotting is the transfer of DNA fragments from an electrophoresis gel to a membrane support (the properties and advantages of the different types of membrane, transfer buffer, and transfer method are discussed in detail), resulting in immobilization of the DNA fragments, so the membrane carries a semipermanent reproduction of the banding pattern of the gel. After immobilization, the DNA can be subjected to hybridization analysis, enabling bands with sequence similarity to a labeled probe to be identified. This appendix describes Southern blotting via upward capillary transfer of DNA from an agarose gel onto a nylon or nitrocellulose membrane, using a high-salt transfer buffer to promote binding of DNA to the membrane. With the high-salt buffer, the DNA becomes bound to the membrane during transfer but not permanently immobilized. Immobilization is achieved by UV irradiation (for nylon) or baking (for nitrocellulose). A Support Protocol describes how to calibrate a UV transilluminator for optimal UV irradiation of a nylon membrane. An alternate protocol details transfer using nylon membranes and an alkaline buffer, and is primarily used with positively charged nylon membranes. The advantage of this combination is that no post-transfer immobilization step is required, as the positively charged membrane binds DNA irreversibly under alkaline transfer conditions. The method can also be used with neutral nylon membranes but less DNA will be retained. A second alternate protocol describes a transfer method based on a different transfer-stack setup. The traditional method of upward capillary transfer of DNA from gel to membrane described in the first basic and alternate protocols has certain disadvantages, notably the fact that the gel can become crushed by the weighted filter papers and paper towels that are laid on top of it. This slows down the blotting process and may reduce the amount of DNA that can be transferred. The downward capillary method described in the second alternate protocol is therefore more rapid than the basic protocol and can result in more complete transfer. Although the ease and reliability of capillary transfer methods makes this far and away the most popular system for Southern blotting with agarose gels, it unfortunately does not work with polyacrylamide gels, whose smaller pore size impedes the transverse movement of the DNA molecules. The third alternate protocol describes an electroblotting procedure that is currently the most reliable method for transfer of DNA from a polyacrylamide gel. Dot and slot blotting are also described.
-
van Grinsven, Bart; Vanden Bon, Natalie; Strauven, Hannelore; Grieten, Lars; Murib, Mohammed; Monroy, Kathia L Jiménez; Janssens, Stoffel D; Haenen, Ken; Schöning, Michael J; Vermeeren, Veronique; Ameloot, Marcel; Michiels, Luc; Thoelen, Ronald; De Ceuninck, Ward; Wagner, Patrick
2012-03-27
In this article, we report on the heat-transfer resistance at interfaces as a novel, denaturation-based method to detect single-nucleotide polymorphisms in DNA. We observed that a molecular brush of double-stranded DNA grafted onto synthetic diamond surfaces does not notably affect the heat-transfer resistance at the solid-to-liquid interface. In contrast to this, molecular brushes of single-stranded DNA cause, surprisingly, a substantially higher heat-transfer resistance and behave like a thermally insulating layer. This effect can be utilized to identify ds-DNA melting temperatures via the switching from low- to high heat-transfer resistance. The melting temperatures identified with this method for different DNA duplexes (29 base pairs without and with built-in mutations) correlate nicely with data calculated by modeling. The method is fast, label-free (without the need for fluorescent or radioactive markers), allows for repetitive measurements, and can also be extended toward array formats. Reference measurements by confocal fluorescence microscopy and impedance spectroscopy confirm that the switching of heat-transfer resistance upon denaturation is indeed related to the thermal on-chip denaturation of DNA. © 2012 American Chemical Society
-
Brown, T
2001-05-01
Southern blotting is the transfer of DNA fragments from an electrophoresis gel to a membrane support, resulting in immobilization of the DNA fragments, so the membrane carries a semipermanent reproduction of the banding pattern of the gel. After immobilization, the DNA can be subjected to hybridization analysis, enabling bands with sequence similarity to a labeled probe to be identified. This unit describes Southern blotting via upward capillary transfer of DNA from an agarose gel onto a nylon or nitrocellulose membrane, and subsequent immobilization by UV irradiation (for nylon) or baking (for nitrocellulose). A Support Protocol describes how to calibrate a UV transilluminator for optimal UV irradiation of a nylon membrane. An alternate protocol details transfer using nylon membranes and an alkaline buffer, and is primarily used with positively charged nylon membranes. A second alternate protocol describes a transfer method based on a different transfer-stack setup. The traditional method of upward capillary transfer of DNA from gel to membrane has certain disadvantages, notably the fact that the gel can become crushed by the weighted filter papers and paper towels that are laid on top of it. This slows down the blotting process and may reduce the amount of DNA that can be transferred. The downward capillary method described in the second alternate protocol is therefore more rapid and can result in more complete transfer.
-
Gene Transfer in Eukaryotic Cells Using Activated Dendrimers
NASA Astrophysics Data System (ADS)
Dennig, Jörg
Gene transfer into eukaryotic cells plays an important role in cell biology. Over the last 30 years a number of transfection methods have been developed to mediate gene transfer into eukaryotic cells. Classical methods include co-precipitation of DNA with calcium phosphate, charge-dependent precipitation of DNA with DEAE-dextran, electroporation of nucleic acids, and formation of transfection complexes between DNA and cationic liposomes. Gene transfer technologies based on activated PAMAM-dendrimers provide another class of transfection reagents. PAMAM-dendrimers are highly branched, spherical molecules. Activation of newly synthesized dendrimers involves hydrolytic removal of some of the branches, and results in a molecule with a higher degree of flexibility. Activated dendrimers assemble DNA into compact structures via charge interactions. Activated dendrimer - DNA complexes bind to the cell membrane of eukaryotic cells, and are transported into the cell by non-specific endocytosis. A structural model of the activated dendrimer - DNA complex and a potential mechanism for its uptake into cells will be discussed.
-
Flavin Charge Transfer Transitions Assist DNA Photolyase Electron Transfer
NASA Astrophysics Data System (ADS)
Skourtis, Spiros S.; Prytkova, Tatiana; Beratan, David N.
2007-12-01
This contribution describes molecular dynamics, semi-empirical and ab-initio studies of the primary photo-induced electron transfer reaction in DNA photolyase. DNA photolyases are FADH--containing proteins that repair UV-damaged DNA by photo-induced electron transfer. A DNA photolyase recognizes and binds to cyclobutatne pyrimidine dimer lesions of DNA. The protein repairs a bound lesion by transferring an electron to the lesion from FADH-, upon photo-excitation of FADH- with 350-450 nm light. We compute the lowest singlet excited states of FADH- in DNA photolyase using INDO/S configuration interaction, time-dependent density-functional, and time-dependent Hartree-Fock methods. The calculations identify the lowest singlet excited state of FADH- that is populated after photo-excitation and that acts as the electron donor. For this donor state we compute conformationally-averaged tunneling matrix elements to empty electron-acceptor states of a thymine dimer bound to photolyase. The conformational averaging involves different FADH--thymine dimer confromations obtained from molecular dynamics simulations of the solvated protein with a thymine dimer docked in its active site. The tunneling matrix element computations use INDO/S-level Green's function, energy splitting, and Generalized Mulliken-Hush methods. These calculations indicate that photo-excitation of FADH- causes a π→π* charge-transfer transition that shifts electron density to the side of the flavin isoalloxazine ring that is adjacent to the docked thymine dimer. This shift in electron density enhances the FADH--to-dimer electronic coupling, thus inducing rapid electron transfer.
-
Modeling hole transport in wet and dry DNA.
Pavanello, Michele; Adamowicz, Ludwik; Volobuyev, Maksym; Mennucci, Benedetta
2010-04-08
We present a DFT/classical molecular dynamics model of DNA charge conductivity. The model involves a temperature-driven, hole-hopping charge transfer and includes the time-dependent nonequilibrium interaction of DNA with its molecular environment. We validate our method against a variety of hole transport experiments. The method predicts a significant hole-transfer slowdown of approximately 35% from dry to wet DNA with and without electric field bias. In addition, in agreement with experiments, it also predicts an insulating behavior of (GC)(N) oligomers for 40 < N < 1000, depending on the experimental setup.
-
Bredenoord, A L; Dondorp, W; Pennings, G; De Wert, G
2011-02-01
Preclinical experiments are currently performed to examine the feasibility of several types of nuclear transfer to prevent mitochondrial DNA (mtDNA) disorders. Whereas the two most promising types of nuclear transfer to prevent mtDNA disorders, spindle transfer and pronuclear transfer, do not amount to reproductive cloning, one theoretical variant, blastomere transfer does. This seems the most challenging both technically and ethically. It is prohibited by many jurisdictions and also the scientific community seems to avoid it. Nevertheless, this paper examines the moral acceptability of blastomere transfer as a method to prevent mtDNA disorders. The reason for doing so is that most objections against reproductive cloning refer to reproductive adult cloning, while blastomere transfer would amount to reproductive embryo cloning. After clarifying this conceptual difference, this paper examines whether the main non-safety objections brought forward against reproductive cloning also apply in the context of blastomere transfer. The conclusion is that if this variant were to become safe and effective, dismissing it because it would involve reproductive cloning is unjustified. Nevertheless, as it may lead to more complex ethical appraisals than the other variants, researchers should initially focus on the development of the other types of nuclear transfer to prevent mtDNA disorders. Copyright © 2010 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.
-
What Hinders Electron Transfer Dissociation (ETD) of DNA Cations?
NASA Astrophysics Data System (ADS)
Hari, Yvonne; Leumann, Christian J.; Schürch, Stefan
2017-12-01
Radical activation methods, such as electron transfer dissociation (ETD), produce structural information complementary to collision-induced dissociation. Herein, electron transfer dissociation of 3-fold protonated DNA hexamers was studied to gain insight into the fragmentation mechanism. The fragmentation patterns of a large set of DNA hexamers confirm cytosine as the primary target of electron transfer. The reported data reveal backbone cleavage by internal electron transfer from the nucleobase to the phosphate linker leading either to a•/ w or d/ z• ion pairs. This reaction pathway contrasts with previous findings on the dissociation processes after electron capture by DNA cations, suggesting multiple, parallel dissociation channels. However, all these channels merely result in partial fragmentation of the precursor ion because the charge-reduced DNA radical cations are quite stable. Two hypotheses are put forward to explain the low dissociation yield of DNA radical cations: it is either attributed to non-covalent interactions between complementary fragments or to the stabilization of the unpaired electron in stacked nucleobases. MS3 experiments suggest that the charge-reduced species is the intact oligonucleotide. Moreover, introducing abasic sites significantly increases the dissociation yield of DNA cations. Consequently, the stabilization of the unpaired electron by π-π-stacking provides an appropriate rationale for the high intensity of DNA radical cations after electron transfer. [Figure not available: see fulltext.
-
Greenspoon, S A; Sykes, K L V; Ban, J D; Pollard, A; Baisden, M; Farr, M; Graham, N; Collins, B L; Green, M M; Christenson, C C
2006-12-20
Human genome, pharmaceutical and research laboratories have long enjoyed the application of robotics to performing repetitive laboratory tasks. However, the utilization of robotics in forensic laboratories for processing casework samples is relatively new and poses particular challenges. Since the quantity and quality (a mixture versus a single source sample, the level of degradation, the presence of PCR inhibitors) of the DNA contained within a casework sample is unknown, particular attention must be paid to procedural susceptibility to contamination, as well as DNA yield, especially as it pertains to samples with little biological material. The Virginia Department of Forensic Science (VDFS) has successfully automated forensic casework DNA extraction utilizing the DNA IQ(trade mark) System in conjunction with the Biomek 2000 Automation Workstation. Human DNA quantitation is also performed in a near complete automated fashion utilizing the AluQuant Human DNA Quantitation System and the Biomek 2000 Automation Workstation. Recently, the PCR setup for casework samples has been automated, employing the Biomek 2000 Automation Workstation and Normalization Wizard, Genetic Identity version, which utilizes the quantitation data, imported into the software, to create a customized automated method for DNA dilution, unique to that plate of DNA samples. The PCR Setup software method, used in conjunction with the Normalization Wizard method and written for the Biomek 2000, functions to mix the diluted DNA samples, transfer the PCR master mix, and transfer the diluted DNA samples to PCR amplification tubes. Once the process is complete, the DNA extracts, still on the deck of the robot in PCR amplification strip tubes, are transferred to pre-labeled 1.5 mL tubes for long-term storage using an automated method. The automation of these steps in the process of forensic DNA casework analysis has been accomplished by performing extensive optimization, validation and testing of the software methods.
-
Theory of electron transfer and molecular state in DNA
NASA Astrophysics Data System (ADS)
Endres, Robert Gunter
2002-09-01
In this thesis, a mechanism for long-range electron transfer in DNA and a systematic search for high conductance DNA are developed. DNA is well known for containing the genetic code of all living species. On the other hand, there are some experimental indications that DNA can mediate effectively long-range electron transfer leading to the concept of chemistry at a distance. This can be important for DNA damage and healing. In the first part of the thesis, a possible mechanism for long-range electron transfer is introduced. The weak distance dependent electron transfer was experimentally observed using transition metal intercalators for donor and acceptor. In our model calculations, the transfer is mediated by the molecular analogue of a Kondo bound state well known from solid state physics of mixed-valence rare-earth compounds. We believe this is quite realistic, since localized d orbitals of the transition metal ions could function as an Anderson impurity embedded in a reservoir of rather delocalized molecular orbitals of the intercalator ligands and DNA pi orbitals. The effective Anderson model is solved with a physically intuitive variational ansatz as well as with the essentially exact DMRG method. The electronic transition matrix element, which is important because it contains the donor-acceptor distance dependence, is obtained with the Mulliken-Hush algorithm as well as from Born-Oppenheimer potential energy surfaces. Our possible explanation of long-range electron transfer is put in context to other more conventional mechanisms which also could lead to similar behavior. Another important issue of DNA is its possible use for nano-technology. Although DNA's mechanical properties are excellent, the question whether it can be conducting and be used for nano-wires is highly controversial. Experimentally, DNA shows conducting, semi-conducting and insulating properties. Motivated by these wide ranging experimental results on the conductivity of DNA, we have embarked on a theoretical effort to ascertain what conditions might induce such remarkable behavior. We use a combination of an ab initio density functional theory method and a parameterized Huckel-Slater-Koster model. Our focus here is to examine whether any likely DNA structures or environments can yield reduced activation gaps to conduction or enhanced electronic overlaps. In particular, we study a hypothetical stretched ribbon structure, A-, and B-form DNA, and the effects of counterions and humidity. Unlike solids, DNA and other molecules are considered soft condensed matter. Hence, we study the influence of vibrations upon the electronic structure of DNA. We calculate parameters for charge transfer rates between adjacent bases. We find good agreement between our estimated rates and recent experimental data assuming that torsional vibrations limit the charge transfer most significantly.
-
Samuels, David C; Wonnapinij, Passorn; Chinnery, Patrick F
2013-03-01
Mitochondrial medicine is one of the few areas of genetic disease where germ-line transfer is being actively pursued as a treatment option. All of the germ-line transfer methods currently under development involve some carry-over of the maternal mitochondrial DNA (mtDNA) heteroplasmy, potentially delivering the pathogenic mutation to the offspring. Rapid changes in mtDNA heteroplasmy have been observed within a single generation, and so any 'leakage' of mutant mtDNA could lead to mtDNA disease in future generations, compromising the reproductive health of the first generation, and leading to repeated interventions in subsequent generations. To determine whether this is a real concern, we developed a model of mtDNA heteroplasmy inheritance by studying 87 mother-child pairs, and predicted the likely outcome of different levels of 'mutant mtDNA leakage' on subsequent maternal generations. This showed that, for a clinical threshold of 60%, reducing the proportion of mutant mtDNA to <5% dramatically reduces the chance of disease recurrence in subsequent generations, but transmitting >5% mutant mtDNA was associated with a significant chance of disease recurrence. Mutations with a lower clinical threshold were associated with a higher risk of recurrence. Our findings provide reassurance that, at least from an mtDNA perspective, methods currently under development have the potential to effectively eradicate pathogenic mtDNA mutations from subsequent generations.
-
Multiplexed Sequence Encoding: A Framework for DNA Communication.
Zakeri, Bijan; Carr, Peter A; Lu, Timothy K
2016-01-01
Synthetic DNA has great propensity for efficiently and stably storing non-biological information. With DNA writing and reading technologies rapidly advancing, new applications for synthetic DNA are emerging in data storage and communication. Traditionally, DNA communication has focused on the encoding and transfer of complete sets of information. Here, we explore the use of DNA for the communication of short messages that are fragmented across multiple distinct DNA molecules. We identified three pivotal points in a communication-data encoding, data transfer & data extraction-and developed novel tools to enable communication via molecules of DNA. To address data encoding, we designed DNA-based individualized keyboards (iKeys) to convert plaintext into DNA, while reducing the occurrence of DNA homopolymers to improve synthesis and sequencing processes. To address data transfer, we implemented a secret-sharing system-Multiplexed Sequence Encoding (MuSE)-that conceals messages between multiple distinct DNA molecules, requiring a combination key to reveal messages. To address data extraction, we achieved the first instance of chromatogram patterning through multiplexed sequencing, thereby enabling a new method for data extraction. We envision these approaches will enable more widespread communication of information via DNA.
-
Nano-ranged low-energy ion-beam-induced DNA transfer in biological cells
NASA Astrophysics Data System (ADS)
Yu, L. D.; Wongkham, W.; Prakrajang, K.; Sangwijit, K.; Inthanon, K.; Thongkumkoon, P.; Wanichapichart, P.; Anuntalabhochai, S.
2013-06-01
Low-energy ion beams at a few tens of keV were demonstrated to be able to induce exogenous macromolecules to transfer into plant and bacterial cells. In the process, the ion beam with well controlled energy and fluence bombarded living cells to cause certain degree damage in the cell envelope in nanoscales to facilitate the macromolecules such as DNA to pass through the cell envelope and enter the cell. Consequently, the technique was applied for manipulating positive improvements in the biological species. This physical DNA transfer method was highly efficient and had less risk of side-effects compared with chemical and biological methods. For better understanding of mechanisms involved in the process, a systematic study on the mechanisms was carried out. Applications of the technique were also expanded from DNA transfer in plant and bacterial cells to DNA transfection in human cancer cells potentially for the stem cell therapy purpose. Low-energy nitrogen and argon ion beams that were applied in our experiments had ranges of 100 nm or less in the cell envelope membrane which was majorly composed of polymeric cellulose. The ion beam bombardment caused chain-scission dominant damage in the polymer and electrical property changes such as increase in the impedance in the envelope membrane. These nano-modifications of the cell envelope eventually enhanced the permeability of the envelope membrane to favor the DNA transfer. The paper reports details of our research in this direction.
-
Effect of proton transfer on the electronic coupling in DNA
NASA Astrophysics Data System (ADS)
Rak, Janusz; Makowska, Joanna; Voityuk, Alexander A.
2006-06-01
The effects of single and double proton transfer within Watson-Crick base pairs on donor-acceptor electronic couplings, Vda, in DNA are studied on the bases of quantum chemical calculations. Four dimers [AT,AT], [GC,GC], [GC,AT] and [GC,TA)] are considered. Three techniques - the generalized Mulliken-Hush scheme, the fragment charge method and the diabatic states method - are employed to estimate Vda for hole transfer between base pairs. We show that both single- and double proton transfer (PT) reactions may substantially affect the electronic coupling in DNA. The electronic coupling in [AT,AT] is predicted to be most sensitive to PT. Single PT within the first base pair in the dimer leads to increase in the hole transfer efficiency by a factor of 4, while proton transfer within the second pair should substantially, by 2.7 times, decrease the rate of charge transfer. Thus, directional asymmetry of the PT effects on the electronic coupling is predicted. The changes in the Vda matrix elements correlate with the topological properties of orbitals of donor and acceptor and can be qualitatively rationalized in terms of resonance structures of donor and acceptor. Atomic pair contributions to the Vda matrix elements are also analyzed.
-
Samuels, David C.; Wonnapinij, Passorn; Chinnery, Patrick F.
2013-01-01
Mitochondrial medicine is one of the few areas of genetic disease where germ-line transfer is being actively pursued as a treatment option. All of the germ-line transfer methods currently under development involve some carry-over of the maternal mitochondrial DNA (mtDNA) heteroplasmy, potentially delivering the pathogenic mutation to the offspring. Rapid changes in mtDNA heteroplasmy have been observed within a single generation, and so any ‘leakage’ of mutant mtDNA could lead to mtDNA disease in future generations, compromising the reproductive health of the first generation, and leading to repeated interventions in subsequent generations. To determine whether this is a real concern, we developed a model of mtDNA heteroplasmy inheritance by studying 87 mother–child pairs, and predicted the likely outcome of different levels of ‘mutant mtDNA leakage’ on subsequent maternal generations. This showed that, for a clinical threshold of 60%, reducing the proportion of mutant mtDNA to <5% dramatically reduces the chance of disease recurrence in subsequent generations, but transmitting >5% mutant mtDNA was associated with a significant chance of disease recurrence. Mutations with a lower clinical threshold were associated with a higher risk of recurrence. Our findings provide reassurance that, at least from an mtDNA perspective, methods currently under development have the potential to effectively eradicate pathogenic mtDNA mutations from subsequent generations. PMID:23297368
-
Multiplexed Sequence Encoding: A Framework for DNA Communication
Zakeri, Bijan; Carr, Peter A.; Lu, Timothy K.
2016-01-01
Synthetic DNA has great propensity for efficiently and stably storing non-biological information. With DNA writing and reading technologies rapidly advancing, new applications for synthetic DNA are emerging in data storage and communication. Traditionally, DNA communication has focused on the encoding and transfer of complete sets of information. Here, we explore the use of DNA for the communication of short messages that are fragmented across multiple distinct DNA molecules. We identified three pivotal points in a communication—data encoding, data transfer & data extraction—and developed novel tools to enable communication via molecules of DNA. To address data encoding, we designed DNA-based individualized keyboards (iKeys) to convert plaintext into DNA, while reducing the occurrence of DNA homopolymers to improve synthesis and sequencing processes. To address data transfer, we implemented a secret-sharing system—Multiplexed Sequence Encoding (MuSE)—that conceals messages between multiple distinct DNA molecules, requiring a combination key to reveal messages. To address data extraction, we achieved the first instance of chromatogram patterning through multiplexed sequencing, thereby enabling a new method for data extraction. We envision these approaches will enable more widespread communication of information via DNA. PMID:27050646
-
DNA decontamination of fingerprint brushes.
Szkuta, Bianca; Oorschot, Roland A H van; Ballantyne, Kaye N
2017-08-01
Genetic profiling of DNA collected from fingerprints that have been exposed to various enhancement techniques is routine in many forensic laboratories. As a result of direct contact with fingermark residues during treatment, there is concern around the DNA contamination risk of dusting fingermarks with fingerprint brushes. Previous studies have demonstrated the potential for cross-contamination between evidentiary items through various mechanisms, highlighting the risk of using the same fingerprint brush to powder multiple surfaces within and between crime-scenes. Experiments were performed to assess the contamination risk of reused fingerprint brushes through the transfer of dried saliva and skin deposits from and to glass surfaces with new unused squirrel hair and fiberglass brushes. Additional new unused brushes and brushes previously used in casework were also tested for their ability to contaminate samples. In addition, the ability to eradicate DNA from used squirrel hair and fiberglass fingerprint brushes was assessed using a 1% sodium hypochlorite solution and a 5% solution of a commercially available alternative, Virkon. DNA profiling results from surfaces contacted by treated and untreated brushes were compared to determine the effectiveness of the devised cleaning protocol. Brush durability was also assessed over multiple wash/rinse/dry cycles with both agents. Varying amounts of DNA-containing material were collected and transferred by squirrel hair and fiberglass brushes, with detectability on the secondary surface dependent on the biological nature of the material being transferred. The impact of DNA contamination from dirty fingerprint brushes was most apparent in simulations involving the transfer of dried saliva and brushes previously used in casework, while minimal transfer of touch DNA was observed. Alarmingly, large quantities of DNA were found to reside on new unused squirrel hair brushes, while no DNA was detected on new unused fiberglass brushes or brushes sold as DNA-free. Squirrel hair brushes were easily and effectively cleaned with both hypochlorite and Virkon, with no evidence of DNA transfer between exhibits by treated brushes. Brushes were still deemed useable after multiple cleaning cycles with either agent. In contrast, fiberglass bristles became tangled and matted when wet and could not be cleaned effectively using either method. It is recommended they are disposed of following use. Each laboratory should consider their current circumstances before adapting a cleaning method. The implementation of a program to monitor the effectiveness of the cleaning regime is also advised. Copyright © 2017 Elsevier B.V. All rights reserved.
-
NASA Astrophysics Data System (ADS)
Voityuk, Alexander A.; Rösch, Notker
2002-09-01
The purpose of this communication is two-fold. We introduce the fragment charge difference (FCD) method to estimate the electron transfer matrix element HDA between a donor D and an acceptor A, and we apply this method to several aspects of hole transfer electronic couplings in π-stacks of DNA, including systems with several donor-acceptor sites. Within the two-state model, our scheme can be simplified to recover a convenient estimate of the electron transfer matrix element HDA=(1-Δq2)1/2(E2-E1)/2 based on the vertical excitation energy E2-E1 and the charge difference Δq between donor and acceptor. For systems with strong charge separation, Δq≳0.95, one should resort to the FCD method. As favorable feature, we demonstrate the stability of the FCD approach for systems which require an approach beyond the two-state model. On the basis of ab initio calculations of various DNA related systems, we compared three approaches for estimating the electronic coupling: the minimum splitting method, the generalized Mulliken-Hush (GMH) scheme, and the FCD approach. We studied the sensitivity of FCD and GMH couplings to the donor-acceptor energy gap and found both schemes to be quite robust; they are applicable also in cases where donor and acceptor states are off resonance. In the application to π-stacks of DNA, we demonstrated for the Watson-Crick pair dimer [(GC),(GC)] how structural changes considerably affect the coupling strength of electron hole transfer. For models of three Watson-Crick pairs, we showed that the two-state model significantly overestimates the hole transfer coupling whereas simultaneous treatment of several states leads to satisfactory results.
-
Teif, Vladimir B
2007-01-01
The transfer matrix methodology is proposed as a systematic tool for the statistical-mechanical description of DNA-protein-drug binding involved in gene regulation. We show that a genetic system of several cis-regulatory modules is calculable using this method, considering explicitly the site-overlapping, competitive, cooperative binding of regulatory proteins, their multilayer assembly and DNA looping. In the methodological section, the matrix models are solved for the basic types of short- and long-range interactions between DNA-bound proteins, drugs and nucleosomes. We apply the matrix method to gene regulation at the O(R) operator of phage lambda. The transfer matrix formalism allowed the description of the lambda-switch at a single-nucleotide resolution, taking into account the effects of a range of inter-protein distances. Our calculations confirm previously established roles of the contact CI-Cro-RNAP interactions. Concerning long-range interactions, we show that while the DNA loop between the O(R) and O(L) operators is important at the lysogenic CI concentrations, the interference between the adjacent promoters P(R) and P(RM) becomes more important at small CI concentrations. A large change in the expression pattern may arise in this regime due to anticooperative interactions between DNA-bound RNA polymerases. The applicability of the matrix method to more complex systems is discussed.
-
Multiple Pathways of Plasmid DNA Transfer in Helicobacter pylori
Rohrer, Stefanie; Holsten, Lea; Weiss, Evelyn; Benghezal, Mohammed; Fischer, Wolfgang; Haas, Rainer
2012-01-01
Many Helicobacter pylori (Hp) strains carry cryptic plasmids of different size and gene content, the function of which is not well understood. A subgroup of these plasmids (e.g. pHel4, pHel12), contain a mobilisation region, but no cognate type IV secretion system (T4SS) for conjugative transfer. Instead, certain H. pylori strains (e.g. strain P12 carrying plasmid pHel12) can harbour up to four T4SSs in their genome (cag-T4SS, comB, tfs3, tfs4). Here, we show that such indigenous plasmids can be efficiently transferred between H. pylori strains, even in the presence of extracellular DNaseI eliminating natural transformation. Knockout of a plasmid-encoded mobA relaxase gene significantly reduced plasmid DNA transfer in the presence of DNaseI, suggesting a DNA conjugation or mobilisation process. To identify the T4SS involved in this conjugative DNA transfer, each individual T4SS was consecutively deleted from the bacterial chromosome. Using a marker-free counterselectable gene deletion procedure (rpsL counterselection method), a P12 mutant strain was finally obtained with no single T4SS (P12ΔT4SS). Mating experiments using these mutants identified the comB T4SS in the recipient strain as the major mediator of plasmid DNA transfer between H. pylori strains, both in a DNaseI-sensitive (natural transformation) as well as a DNaseI-resistant manner (conjugative transfer). However, transfer of a pHel12::cat plasmid from a P12ΔT4SS donor strain into a P12ΔT4SS recipient strain provided evidence for the existence of a third, T4SS-independent mechanism of DNA transfer. This novel type of plasmid DNA transfer, designated as alternate DNaseI-Resistant (ADR) mechanism, is observed at a rather low frequency under in vitro conditions. Taken together, our study describes for the first time the existence of three distinct pathways of plasmid DNA transfer between H. pylori underscoring the importance of horizontal gene transfer for this species. PMID:23029142
-
Multiple pathways of plasmid DNA transfer in Helicobacter pylori.
Rohrer, Stefanie; Holsten, Lea; Weiss, Evelyn; Benghezal, Mohammed; Fischer, Wolfgang; Haas, Rainer
2012-01-01
Many Helicobacter pylori (Hp) strains carry cryptic plasmids of different size and gene content, the function of which is not well understood. A subgroup of these plasmids (e.g. pHel4, pHel12), contain a mobilisation region, but no cognate type IV secretion system (T4SS) for conjugative transfer. Instead, certain H. pylori strains (e.g. strain P12 carrying plasmid pHel12) can harbour up to four T4SSs in their genome (cag-T4SS, comB, tfs3, tfs4). Here, we show that such indigenous plasmids can be efficiently transferred between H. pylori strains, even in the presence of extracellular DNaseI eliminating natural transformation. Knockout of a plasmid-encoded mobA relaxase gene significantly reduced plasmid DNA transfer in the presence of DNaseI, suggesting a DNA conjugation or mobilisation process. To identify the T4SS involved in this conjugative DNA transfer, each individual T4SS was consecutively deleted from the bacterial chromosome. Using a marker-free counterselectable gene deletion procedure (rpsL counterselection method), a P12 mutant strain was finally obtained with no single T4SS (P12ΔT4SS). Mating experiments using these mutants identified the comB T4SS in the recipient strain as the major mediator of plasmid DNA transfer between H. pylori strains, both in a DNaseI-sensitive (natural transformation) as well as a DNaseI-resistant manner (conjugative transfer). However, transfer of a pHel12::cat plasmid from a P12ΔT4SS donor strain into a P12ΔT4SS recipient strain provided evidence for the existence of a third, T4SS-independent mechanism of DNA transfer. This novel type of plasmid DNA transfer, designated as alternate DNaseI-Resistant (ADR) mechanism, is observed at a rather low frequency under in vitro conditions. Taken together, our study describes for the first time the existence of three distinct pathways of plasmid DNA transfer between H. pylori underscoring the importance of horizontal gene transfer for this species.
-
Novel recA-Independent Horizontal Gene Transfer in Escherichia coli K-12.
Kingston, Anthony W; Roussel-Rossin, Chloé; Dupont, Claire; Raleigh, Elisabeth A
2015-01-01
In bacteria, mechanisms that incorporate DNA into a genome without strand-transfer proteins such as RecA play a major role in generating novelty by horizontal gene transfer. We describe a new illegitimate recombination event in Escherichia coli K-12: RecA-independent homologous replacements, with very large (megabase-length) donor patches replacing recipient DNA. A previously uncharacterized gene (yjiP) increases the frequency of RecA-independent replacement recombination. To show this, we used conjugal DNA transfer, combining a classical conjugation donor, HfrH, with modern genome engineering methods and whole genome sequencing analysis to enable interrogation of genetic dependence of integration mechanisms and characterization of recombination products. As in classical experiments, genomic DNA transfer begins at a unique position in the donor, entering the recipient via conjugation; antibiotic resistance markers are then used to select recombinant progeny. Different configurations of this system were used to compare known mechanisms for stable DNA incorporation, including homologous recombination, F'-plasmid formation, and genome duplication. A genome island of interest known as the immigration control region was specifically replaced in a minority of recombinants, at a frequency of 3 X 10(-12) CFU/recipient per hour.
-
Ma, Jin-Liang; Yin, Bin-Cheng; Le, Huynh-Nhu; Ye, Bang-Ce
2015-06-17
We have developed a label-free method for sequence-specific DNA detection based on surface plasmon enhanced energy transfer (SPEET) process between fluorescent DNA/AgNC string and gold nanoparticles (AuNPs). DNA/AgNC string, prepared by a single-stranded DNA template encoded two emitter-nucleation sequences at its termini and an oligo spacer in the middle, was rationally designed to produce bright fluorescence emission. The proposed method takes advantage of two strategies. The first one is the difference in binding properties of single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) toward AuNPs. The second one is SPEET process between fluorescent DNA/AgNC string and AuNPs, in which fluorescent DNA/AgNC string can be spontaneously adsorbed onto the surface of AuNPs and correspondingly AuNPs serve as "nanoquencher" to quench the fluorescence of DNA/AgNC string. In the presence of target DNA, the sensing probe hybridized with target DNA to form duplex DNA, leading to a salt-induced AuNP aggregation and subsequently weakened SPEET process between fluorescent DNA/AgNC string and AuNPs. A red-to-blue color change of AuNPs and a concomitant fluorescence increase were clearly observed in the sensing system, which had a concentration dependent manner with specific DNA. The proposed method achieved a detection limit of ∼2.5 nM, offering the following merits of simple design, convenient operation, and low experimental cost because of no chemical modification, organic dye, enzymatic reaction, or separation procedure involved.
-
Bi, Lin; Yu, Yuan-Hua
2015-04-05
Mercaptopropionic acid-capped Mn-doped ZnS quantum dots/ethidium bromide (EB) nanohybrids were constructed for photoinduced electron transfer (PIET) and then used as a room-temperature phosphorescence (RTP) probe for DNA detection. EB could quench the RTP of Mn-doped ZnS QDs by PIET, thereby forming Mn-doped ZnS QDs/EB nanohybrids and storing RTP. Meanwhile, EB could be inserted into DNA and EB could be competitively desorbed from the surface of Mn-doped ZnS QDs by DNA, thereby releasing the RTP of Mn-doped ZnS QDs. Based on this mechanism, a RTP sensor for DNA detection was developed. Under optimal conditions, the detection limit for DNA was 0.045 mg L(-1), the relative standard deviation was 1.7%, and the method linear ranged from 0.2 to 20 mg L(-1). The proposed method was applied to biological fluids, in which satisfactory results were obtained. Copyright © 2015 Elsevier B.V. All rights reserved.
-
Estimates of electronic coupling for excess electron transfer in DNA
NASA Astrophysics Data System (ADS)
Voityuk, Alexander A.
2005-07-01
Electronic coupling Vda is one of the key parameters that determine the rate of charge transfer through DNA. While there have been several computational studies of Vda for hole transfer, estimates of electronic couplings for excess electron transfer (ET) in DNA remain unavailable. In the paper, an efficient strategy is established for calculating the ET matrix elements between base pairs in a π stack. Two approaches are considered. First, we employ the diabatic-state (DS) method in which donor and acceptor are represented with radical anions of the canonical base pairs adenine-thymine (AT) and guanine-cytosine (GC). In this approach, similar values of Vda are obtained with the standard 6-31G* and extended 6-31++G** basis sets. Second, the electronic couplings are derived from lowest unoccupied molecular orbitals (LUMOs) of neutral systems by using the generalized Mulliken-Hush or fragment charge methods. Because the radical-anion states of AT and GC are well reproduced by LUMOs of the neutral base pairs calculated without diffuse functions, the estimated values of Vda are in good agreement with the couplings obtained for radical-anion states using the DS method. However, when the calculation of a neutral stack is carried out with diffuse functions, LUMOs of the system exhibit the dipole-bound character and cannot be used for estimating electronic couplings. Our calculations suggest that the ET matrix elements Vda for models containing intrastrand thymine and cytosine bases are essentially larger than the couplings in complexes with interstrand pyrimidine bases. The matrix elements for excess electron transfer are found to be considerably smaller than the corresponding values for hole transfer and to be very responsive to structural changes in a DNA stack.
-
Low-energy plasma immersion ion implantation to induce DNA transfer into bacterial E. coli
NASA Astrophysics Data System (ADS)
Sangwijit, K.; Yu, L. D.; Sarapirom, S.; Pitakrattananukool, S.; Anuntalabhochai, S.
2015-12-01
Plasma immersion ion implantation (PIII) at low energy was for the first time applied as a novel biotechnology to induce DNA transfer into bacterial cells. Argon or nitrogen PIII at low bias voltages of 2.5, 5 and 10 kV and fluences ranging from 1 × 1012 to 1 × 1017 ions/cm2 treated cells of Escherichia coli (E. coli). Subsequently, DNA transfer was operated by mixing the PIII-treated cells with DNA. Successes in PIII-induced DNA transfer were demonstrated by marker gene expressions. The induction of DNA transfer was ion-energy, fluence and DNA-size dependent. The DNA transferred in the cells was confirmed functioning. Mechanisms of the PIII-induced DNA transfer were investigated and discussed in terms of the E. coli cell envelope anatomy. Compared with conventional ion-beam-induced DNA transfer, PIII-induced DNA transfer was simpler with lower cost but higher efficiency.
-
Delplanque, Aleksandra; Wawrzynczyk, Dominika; Jaworski, Pawel; Matczyszyn, Katarzyna; Pawlik, Krzysztof; Buckle, Malcolm; Nyk, Marcin; Nogues, Claude; Samoc, Marek
2015-01-01
Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio) probes in Förster Resonance Energy Transfer (FRET) where trivalent lanthanide ions (La3+) act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm) NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA) by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5) modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+) and the acceptor (Cy5) with sensitivity at a nanometre scale.
-
DNA Based Molecular Scale Nanofabrication
2015-12-04
structure. We developed a method to produce nanoscale patterns on SAM. (d) Studied the molecular imprinting of DNA origami structure using polymer...to produce nanoscale patterns on SAM. (d) Studied the molecular imprinting of DNA origami structure using polymer substrates. Developed a high... imprinting using DNA nanostructure templates. Soft lithography uses polymeric stamps with certain features to transfer the pattern for printing
-
Miao, Yanming; Zhang, Zhifeng; Gong, Yan; Yan, Guiqin
2014-09-15
MPA-capped Mn-doped ZnS QDs/DXR nanohybrids (MPA: 3-mercaptopropionic acid; QDs: quantum dots; DXR: cetyltrimethyl ammonium bromide) were constructed via photoinduced electron transfer (PIET) and then used as a room-temperature phosphorescence (RTP) probe for detection of DNA. DXR as a quencher will quench the RTP of Mn-doped ZnS QDs via PIET, thereby forming Mn-doped ZnS QDs/DXR nanohybrids and storing RTP. With the addition of DNA, it will be inserted into DXR and thus DXR will be competitively desorbed from the surface of Mn-doped ZnS QDs, thereby releasing the RTP of Mn-doped ZnS QDs. Based on this, a new method for DNA detection was built. The sensor for DNA has a detection limit of 0.039 mg L(-1) and a linear range from 0.1 to 14 mg L(-1). The present QDs-based RTP method does not need deoxidants or other inducers as required by conventional RTP detection methods, and avoids interference from autofluorescence and the scattering light of the matrix that are encountered in spectrofluorometry. Therefore, this method can be used to detect the DNA content in body fluid. Copyright © 2014 Elsevier B.V. All rights reserved.
-
HIRAYAMA, Hiroki; KAGEYAMA, Soichi; MORIYASU, Satoru; SAWAI, Ken; MINAMIHASHI, Akira
2013-01-01
Abstract In domestic animals of the family Bovidae, sex preselection of offspring has been demanded for convenience of milk/beef production and animal breeding. Development of the nonsurgical embryo transfer technique and sexing methods of preimplantation embryos made it possible. Sexing based on detection of Y chromosome-specific DNA sequences is considered the most reliable method to date. PCR enables amplification of a target sequence from a small number of blastomeres. However, it requires technical skill and is time consuming. Furthermore, PCR has the risk of false positives because of DNA contamination during handling of the PCR products in duplicate PCR procedures and/or electrophoresis. Therefore, for embryo sexing to become widely used in the cattle embryo transfer industry, a simple, rapid and precise sexing method needs to be developed. Loop-mediated isothermal amplification (LAMP) is a novel DNA amplification method, and the reaction is carried out under isothermal conditions (range, 60 to 65 C) using DNA polymerase with strand displacement activity. When the target DNA is amplified by LAMP, a white precipitate derived from magnesium pyrophosphate (a by-product of the LAMP reaction) is observed. It is noteworthy that LAMP does not need special reagents or electrophoresis to detect the amplified DNA. This review describes the development and application of an embryo sexing method using LAMP in cattle and water buffaloes. PMID:23965599
-
Generation of Leishmania Hybrids by Whole Genomic DNA Transformation
Coelho, Adriano C.; Leprohon, Philippe; Ouellette, Marc
2012-01-01
Genetic exchange is a powerful tool to study gene function in microorganisms. Here, we tested the feasibility of generating Leishmania hybrids by electroporating genomic DNA of donor cells into recipient Leishmania parasites. The donor DNA was marked with a drug resistance marker facilitating the selection of DNA transfer into the recipient cells. The transferred DNA was integrated exclusively at homologous locus and was as large as 45 kb. The independent generation of L. infantum hybrids with L. major sequences was possible for several chromosomal regions. Interfering with the mismatch repair machinery by inactivating the MSH2 gene enabled an increased efficiency of recombination between divergent sequences, hence favouring the selection of hybrids between species. Hybrids were shown to acquire the phenotype derived from the donor cells, as demonstrated for the transfer of drug resistance genes from L. major into L. infantum. The described method is a first step allowing the generation of in vitro hybrids for testing gene functions in a natural genomic context in the parasite Leishmania. PMID:23029579
-
NASA Astrophysics Data System (ADS)
Xu, Shicai; Jiang, Shouzhen; Zhang, Chao; Yue, Weiwei; Zou, Yan; Wang, Guiying; Liu, Huilan; Zhang, Xiumei; Li, Mingzhen; Zhu, Zhanshou; Wang, Jihua
2018-01-01
Graphene has attracted much attention in biosensing applications for its unique properties. Because of one-atom layer structure, every atom of graphene is exposed to the environment, making the electronic properties of graphene are very sensitive to charged analytes. Therefore, graphene is an ideal material for transistors in high-performance sensors. Chemical vapor deposition (CVD) method has been demonstrated the most successful method for fabricating large area graphene. However, the conventional CVD methods can only grow graphene on metallic substrate and the graphene has to be transferred to the insulating substrate for further device fabrication. The transfer process creates wrinkles, cracks, or tears on the graphene, which severely degrade electrical properties of graphene. These factors severely degrade the sensing performance of graphene. Here, we directly fabricated graphene on sapphire substrate by high temperature CVD without the use of metal catalysts. The sapphire-based graphene was patterned and make into a DNA biosensor in the configuration of field-effect transistor. The sensors show high performance and achieve the DNA detection sensitivity as low as 100 fM (10-13 M), which is at least 10 times lower than prior transferred CVD G-FET DNA sensors. The use of the sapphire-based G-FETs suggests a promising future for biosensing applications.
-
A magnetic bead-based method for concentrating DNA from human urine for downstream detection.
Bordelon, Hali; Russ, Patricia K; Wright, David W; Haselton, Frederick R
2013-01-01
Due to the presence of PCR inhibitors, PCR cannot be used directly on most clinical samples, including human urine, without pre-treatment. A magnetic bead-based strategy is one potential method to collect biomarkers from urine samples and separate the biomarkers from PCR inhibitors. In this report, a 1 mL urine sample was mixed within the bulb of a transfer pipette containing lyophilized nucleic acid-silica adsorption buffer and silica-coated magnetic beads. After mixing, the sample was transferred from the pipette bulb to a small diameter tube, and captured biomarkers were concentrated using magnetic entrainment of beads through pre-arrayed wash solutions separated by small air gaps. Feasibility was tested using synthetic segments of the 140 bp tuberculosis IS6110 DNA sequence spiked into pooled human urine samples. DNA recovery was evaluated by qPCR. Despite the presence of spiked DNA, no DNA was detectable in unextracted urine samples, presumably due to the presence of PCR inhibitors. However, following extraction with the magnetic bead-based method, we found that ∼50% of spiked TB DNA was recovered from human urine containing roughly 5×10(3) to 5×10(8) copies of IS6110 DNA. In addition, the DNA was concentrated approximately ten-fold into water. The final concentration of DNA in the eluate was 5×10(6), 14×10(6), and 8×10(6) copies/µL for 1, 3, and 5 mL urine samples, respectively. Lyophilized and freshly prepared reagents within the transfer pipette produced similar results, suggesting that long-term storage without refrigeration is possible. DNA recovery increased with the length of the spiked DNA segments from 10±0.9% for a 75 bp DNA sequence to 42±4% for a 100 bp segment and 58±9% for a 140 bp segment. The estimated LOD was 77 copies of DNA/µL of urine. The strategy presented here provides a simple means to achieve high nucleic acid recovery from easily obtained urine samples, which does not contain inhibitors of PCR.
-
A Magnetic Bead-Based Method for Concentrating DNA from Human Urine for Downstream Detection
Bordelon, Hali; Russ, Patricia K.; Wright, David W.; Haselton, Frederick R.
2013-01-01
Due to the presence of PCR inhibitors, PCR cannot be used directly on most clinical samples, including human urine, without pre-treatment. A magnetic bead-based strategy is one potential method to collect biomarkers from urine samples and separate the biomarkers from PCR inhibitors. In this report, a 1 mL urine sample was mixed within the bulb of a transfer pipette containing lyophilized nucleic acid-silica adsorption buffer and silica-coated magnetic beads. After mixing, the sample was transferred from the pipette bulb to a small diameter tube, and captured biomarkers were concentrated using magnetic entrainment of beads through pre-arrayed wash solutions separated by small air gaps. Feasibility was tested using synthetic segments of the 140 bp tuberculosis IS6110 DNA sequence spiked into pooled human urine samples. DNA recovery was evaluated by qPCR. Despite the presence of spiked DNA, no DNA was detectable in unextracted urine samples, presumably due to the presence of PCR inhibitors. However, following extraction with the magnetic bead-based method, we found that ∼50% of spiked TB DNA was recovered from human urine containing roughly 5×103 to 5×108 copies of IS6110 DNA. In addition, the DNA was concentrated approximately ten-fold into water. The final concentration of DNA in the eluate was 5×106, 14×106, and 8×106 copies/µL for 1, 3, and 5 mL urine samples, respectively. Lyophilized and freshly prepared reagents within the transfer pipette produced similar results, suggesting that long-term storage without refrigeration is possible. DNA recovery increased with the length of the spiked DNA segments from 10±0.9% for a 75 bp DNA sequence to 42±4% for a 100 bp segment and 58±9% for a 140 bp segment. The estimated LOD was 77 copies of DNA/µL of urine. The strategy presented here provides a simple means to achieve high nucleic acid recovery from easily obtained urine samples, which does not contain inhibitors of PCR. PMID:23861895
-
Loan, Phan Thi Kim; Wu, Dongqin; Ye, Chen; Li, Xiaoqing; Tra, Vu Thanh; Wei, Qiuping; Fu, Li; Yu, Aimin; Li, Lain-Jong; Lin, Cheng-Te
2018-01-15
The quality of graphene strongly affects the performance of graphene-based biosensors which are highly demanded for the sensitive and selective detection of biomolecules, such as DNA. This work reported a novel transfer process for preparing a residue-free graphene film using a thin gold supporting layer. A Hall effect device made of this gold-transferred graphene was demonstrated to significantly enhance the sensitivity (≈ 5 times) for hybridization detection, with a linear detection range of 1pM to 100nM for DNA target. Our findings provide an efficient method to boost the sensitivity of graphene-based biosensors for DNA recognition. Copyright © 2017 Elsevier B.V. All rights reserved.
-
Weiss, Julia; Ros-Chumillas, Maria; Peña, Leandro; Egea-Cortines, Marcos
2007-01-30
Recombinant DNA technology is an important tool in the development of plant varieties with new favourable features. There is strong opposition towards this technology due to the potential risk of horizontal gene transfer between genetically modified plant material and food-associated bacteria, especially if genes for antibiotic resistance are involved. Since horizontal transfer efficiency depends on size and length of homologous sequences, we investigated the effect of conditions required for orange juice processing on the stability of DNA from three different origins: plasmid DNA, yeast genomic DNA and endogenous genomic DNA from transgenic sweet orange (C. sinensis L. Osb.). Acidic orange juice matrix had a strong degrading effect on plasmid DNA which becomes apparent in a conformation change from supercoiled structure to nicked, linear structure within 5h of storage at 4 degrees C. Genomic yeast DNA was degraded during exposure to acidic orange juice matrix within 4 days, and also the genomic DNA of C. sinensis suffered degradation within 2 days of storage as indicated by amplification results from transgene markers. Standard pasteurization procedures affected DNA integrity depending on the method and time used. Our data show that the current standard industrial procedures to pasteurize orange juice as well as its acidic nature causes a strong degradation of both yeast and endogenous genomic DNA below sizes reported to be suitable for horizontal gene transfer.
-
Zhang, Xuncai; Ying, Niu; Shen, Chaonan; Cui, Guangzhao
2017-02-01
Structural DNA nanotechnology has great potential in the fabrication of complicated nanostructures and devices capable of bio-sensing and logic function. A variety of nanostructures with desired shapes have been created in the past few decades. But the application of nanostructures remains to be fully studied. Here, we present a novel biological information processing system constructed on a self-assembled, spatially addressable single-stranded tile (SST) nanostructure as DNA nano-manipulation platform that created by SST self-assembly technology. Utilizing DNA strand displacement technology, the fluorescent dye that is pre-assembled in the nano-manipulation platform is transferred from the original position to the destination, which can achieve photonic logic circuits by FRET signal cascades, including logic AND, OR, and NOT gates. And this transfer process is successfully validated by visual DSD software. The transfer process proposed in this study may provide a novel method to design complicated biological information processing system constructed on a SST nanostructure, and can be further used to develop intelligent delivery of drug molecules in vivo.
-
Fis protein induced λF-DNA bending observed by single-pair fluorescence resonance energy transfer
NASA Astrophysics Data System (ADS)
Chi-Cheng, Fu; Wunshain, Fann; Yuan Hanna, S.
2006-03-01
Fis, a site-specific DNA binding protein, regulates many biological processes including recombination, transcription, and replication in E.coli. Fis induced DNA bending plays an important role in regulating these functions and bending angle range from ˜50 to 95 dependent on the DNA sequence. For instance, the average bending angle of λF-DNA (26 bp, 8.8nm long, contained λF binding site on the center) measured by gel mobility shift assays was ˜ 94 . But the traditional method cannot provide information about the dynamics and the angle distribution. In this study, λF-DNA was labeled with donor (Alexa Fluor 546) and acceptor (Alexa Fluor 647) dyes on its two 5' ends and the donor-acceptor distances were measured using single-pair fluorescence resonance energy transfer (sp-FRET) with and without the present of Fis protein. Combing with structure information of Fis-DNA complex, the sp-FRET results are used to estimate the protein induced DNA bending angle distribution and dynamics.
-
Teif, Vladimir B.
2007-01-01
The transfer matrix methodology is proposed as a systematic tool for the statistical–mechanical description of DNA–protein–drug binding involved in gene regulation. We show that a genetic system of several cis-regulatory modules is calculable using this method, considering explicitly the site-overlapping, competitive, cooperative binding of regulatory proteins, their multilayer assembly and DNA looping. In the methodological section, the matrix models are solved for the basic types of short- and long-range interactions between DNA-bound proteins, drugs and nucleosomes. We apply the matrix method to gene regulation at the OR operator of phage λ. The transfer matrix formalism allowed the description of the λ-switch at a single-nucleotide resolution, taking into account the effects of a range of inter-protein distances. Our calculations confirm previously established roles of the contact CI–Cro–RNAP interactions. Concerning long-range interactions, we show that while the DNA loop between the OR and OL operators is important at the lysogenic CI concentrations, the interference between the adjacent promoters PR and PRM becomes more important at small CI concentrations. A large change in the expression pattern may arise in this regime due to anticooperative interactions between DNA-bound RNA polymerases. The applicability of the matrix method to more complex systems is discussed. PMID:17526526
-
Phylogeny and temporal diversification of darters (Percidae: Etheostomatinae).
Near, Thomas J; Bossu, Christen M; Bradburd, Gideon S; Carlson, Rose L; Harrington, Richard C; Hollingsworth, Phillip R; Keck, Benjamin P; Etnier, David A
2011-10-01
Discussions aimed at resolution of the Tree of Life are most often focused on the interrelationships of major organismal lineages. In this study, we focus on the resolution of some of the most apical branches in the Tree of Life through exploration of the phylogenetic relationships of darters, a species-rich clade of North American freshwater fishes. With a near-complete taxon sampling of close to 250 species, we aim to investigate strategies for efficient multilocus data sampling and the estimation of divergence times using relaxed-clock methods when a clade lacks a fossil record. Our phylogenetic data set comprises a single mitochondrial DNA (mtDNA) gene and two nuclear genes sampled from 245 of the 248 darter species. This dense sampling allows us to determine if a modest amount of nuclear DNA sequence data can resolve relationships among closely related animal species. Darters lack a fossil record to provide age calibration priors in relaxed-clock analyses. Therefore, we use a near-complete species-sampled phylogeny of the perciform clade Centrarchidae, which has a rich fossil record, to assess two distinct strategies of external calibration in relaxed-clock divergence time estimates of darters: using ages inferred from the fossil record and molecular evolutionary rate estimates. Comparison of Bayesian phylogenies inferred from mtDNA and nuclear genes reveals that heterospecific mtDNA is present in approximately 12.5% of all darter species. We identify three patterns of mtDNA introgression in darters: proximal mtDNA transfer, which involves the transfer of mtDNA among extant and sympatric darter species, indeterminate introgression, which involves the transfer of mtDNA from a lineage that cannot be confidently identified because the introgressed haplotypes are not clearly referable to mtDNA haplotypes in any recognized species, and deep introgression, which is characterized by species diversification within a recipient clade subsequent to the transfer of heterospecific mtDNA. The results of our analyses indicate that DNA sequences sampled from single-copy nuclear genes can provide appreciable phylogenetic resolution for closely related animal species. A well-resolved near-complete species-sampled phylogeny of darters was estimated with Bayesian methods using a concatenated mtDNA and nuclear gene data set with all identified heterospecific mtDNA haplotypes treated as missing data. The relaxed-clock analyses resulted in very similar posterior age estimates across the three sampled genes and methods of calibration and therefore offer a viable strategy for estimating divergence times for clades that lack a fossil record. In addition, an informative rank-free clade-based classification of darters that preserves the rich history of nomenclature in the group and provides formal taxonomic communication of darter clades was constructed using the mtDNA and nuclear gene phylogeny. On the whole, the appeal of mtDNA for phylogeny inference among closely related animal species is diminished by the observations of extensive mtDNA introgression and by finding appreciable phylogenetic signal in a modest sampling of nuclear genes in our phylogenetic analyses of darters.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pater, P
Purpose: To analyse the sensitivity of the creation of strand breaks (SB) to the threshold energy (Eth) and thresholding method and to quantify the impact of clustering conditions on single strand break (SSB) and double strand break (DSB) yields. Methods: Monte Carlo simulations using Geant4-DNA were conducted for electron tracks of 280 eV to 220 keV in a geometrical DNA model composed of nucleosomes of 396 phospho-diester groups (PDGs) each. A strand break was created inside a PDG when the sum of all energy deposits (method 1) or energy transfers (method 2) was higher than Eth or when at leastmore » one interaction deposited (method 3) or transferred (method 4) an energy higher than Eth. SBs were then clustered into SSBs and DSBs using clustering scoring criteria from the literature and compared to our own. Results: The total number of SBs decreases as Eth is increased. In addition, thresholding on the energy transfers (methods 2 and 4) produces a higher SB count than when thresholding on energy deposits (methods 1 and 3). Method 2 produces a step-like function and should be avoided when attempting to optimize Eth. When SBs are grouped into damage patterns, clustering conditions can underestimated SSBs by up to 18 % and DSBs can be overestimated by up to 12 % compared to our own implementation. Conclusion: We show that two often underreported simulation parameters have a non-negligible effect on overall DNA damage yields. First more SBs are counted when using energy transfers to the PDG rather than energy deposits. Also, SBs grouped according to different clustering conditions can influence reported SSB and DSB by as much as 20%. Careful handling of these parameters is required when trying to compare DNA damage yields from different authors. Research funding from the governments of Canada and Quebec. PP acknowledges partial support by the CREATE Medical Physics Research Training Network grant of the Natural Sciences and Engineering Research Council (Grant number: 432290)« less
-
Kubař, Tomáš; Elstner, Marcus
2013-04-28
In this work, a fragment-orbital density functional theory-based method is combined with two different non-adiabatic schemes for the propagation of the electronic degrees of freedom. This allows us to perform unbiased simulations of electron transfer processes in complex media, and the computational scheme is applied to the transfer of a hole in solvated DNA. It turns out that the mean-field approach, where the wave function of the hole is driven into a superposition of adiabatic states, leads to over-delocalization of the hole charge. This problem is avoided using a surface hopping scheme, resulting in a smaller rate of hole transfer. The method is highly efficient due to the on-the-fly computation of the coarse-grained DFT Hamiltonian for the nucleobases, which is coupled to the environment using a QM/MM approach. The computational efficiency and partial parallel character of the methodology make it possible to simulate electron transfer in systems of relevant biochemical size on a nanosecond time scale. Since standard non-polarizable force fields are applied in the molecular-mechanics part of the calculation, a simple scaling scheme was introduced into the electrostatic potential in order to simulate the effect of electronic polarization. It is shown that electronic polarization has an important effect on the features of charge transfer. The methodology is applied to two kinds of DNA sequences, illustrating the features of transfer along a flat energy landscape as well as over an energy barrier. The performance and relative merit of the mean-field scheme and the surface hopping for this application are discussed.
-
Quantifying Environmental Effects on the Decay of Hole Transfer Couplings in Biosystems.
Ramos, Pablo; Pavanello, Michele
2014-06-10
In the past two decades, many research groups worldwide have tried to understand and categorize simple regimes in the charge transfer of such biological systems as DNA. Theoretically speaking, the lack of exact theories for electron-nuclear dynamics on one side and poor quality of the parameters needed by model Hamiltonians and nonadiabatic dynamics alike (such as couplings and site energies) on the other are the two main difficulties for an appropriate description of the charge transfer phenomena. In this work, we present an application of a previously benchmarked and linear-scaling subsystem density functional theory (DFT) method for the calculation of couplings, site energies, and superexchange decay factors (β) of several biological donor-acceptor dyads, as well as double stranded DNA oligomers composed of up to five base pairs. The calculations are all-electron and provide a clear view of the role of the environment on superexchange couplings in DNA-they follow experimental trends and confirm previous semiempirical calculations. The subsystem DFT method is proven to be an excellent tool for long-range, bridge-mediated coupling and site energy calculations of embedded molecular systems.
-
Bettio, Daniela; Capalbo, Antonio; Albani, Elena; Rienzi, Laura; Achille, Valentina; Venci, Anna; Ubaldi, Filippo Maria; Levi Setti, Paolo Emanuele
2016-09-06
Preimplantation genetic screening (PGS) provides an opportunity to eliminate a potential implantation failure due to aneuploidy in infertile couples. Some studies clearly show that twins following single embryo transfer (SET) can be the result of a concurrent natural conception and an incidence as high as 1 in 5 twins has been reported. In our case PGS was performed on trophectoderm (TE) biopsies by quantitative polymerase chain reaction (qPCR). The product of conception (POC) was cytogenetically investigated after selection of the placental villi by means of the direct method. Molecular cytogenetic characterization of the POC was performed by fluorescence in situ hybridization (FISH) and array-comparative genomic hybridization (a-CGH) analyses. To investigate the possibility of a spontaneous conception, a panel of 40 single nucleotide polymorphisms (SNPs) was used to compare genetic similarity between the DNA of the POC and the DNA leftover of the TE biopsy. We describe a 36-year old infertile woman undergoing PGS who had a spontaneous abortion after a single euploid embryo transfer on a spontaneous cycle. The POC showed a 45,X karyotype confirmed by FISH and a-CGH. DNA fingerprinting demonstrated a genetic similarity of 75 % between the DNA of the POC and TE biopsy, consistent with a sibling status. All supernumerary euploid embryos were also tested showing a non-self relationship with the POC, excluding a mix-up event at the time of fetal embryo transfer. DNA fingerprinting of the transferred blastocyst and POC, confirmed the occurrence of a spontaneous conception. This case challenges the assumption that a pregnancy after assisted reproductive technology (ART) is always a result of ART, and strengthens the importance to avoid intercourses during PGS and natural transfer cycles. Moreover, cytogenetic analysis of the POCs is strongly recommended along with fingerprinting children born after PGS to see what the concordance is between the embryo transferred and the resultant child.
-
PCR-based detection of gene transfer vectors: application to gene doping surveillance.
Perez, Irene C; Le Guiner, Caroline; Ni, Weiyi; Lyles, Jennifer; Moullier, Philippe; Snyder, Richard O
2013-12-01
Athletes who illicitly use drugs to enhance their athletic performance are at risk of being banned from sports competitions. Consequently, some athletes may seek new doping methods that they expect to be capable of circumventing detection. With advances in gene transfer vector design and therapeutic gene transfer, and demonstrations of safety and therapeutic benefit in humans, there is an increased probability of the pursuit of gene doping by athletes. In anticipation of the potential for gene doping, assays have been established to directly detect complementary DNA of genes that are top candidates for use in doping, as well as vector control elements. The development of molecular assays that are capable of exposing gene doping in sports can serve as a deterrent and may also identify athletes who have illicitly used gene transfer for performance enhancement. PCR-based methods to detect foreign DNA with high reliability, sensitivity, and specificity include TaqMan real-time PCR, nested PCR, and internal threshold control PCR.
-
Recent patents on self-quenching DNA probes.
Knemeyer, Jens-Peter; Marmé, Nicole
2007-01-01
In this review, we report on patents concerning self-quenching DNA probes for assaying DNA during or after amplification as well as for direct assaying DNA or RNA, for example in living cells. Usually the probes consist of fluorescently labeled oligonucleotides whose fluorescence is quenched in the absence of the matching target DNA. Thereby the fluorescence quenching is based on fluorescence resonance energy transfer (FRET), photoinduced electron transfer (PET), or electronically interactions between dye and quencher. However, upon hybridization to the target or after the degradation during a PCR, the fluorescence of the dye is restored. Although the presented probes were originally developed for use in homogeneous assay formats, most of them are also appropriate to improve surface-based assay methods. In particular we describe patents for self-quenching primers, self-quenching probes for TaqMan assays, probes based on G-quartets, Molecular Beacons, Smart Probes, and Pleiades Probes.
-
Fonneløp, Ane Elida; Ramse, Merete; Egeland, Thore; Gill, Peter
2017-07-01
In court questions are often raised related to how trace DNA was deposited, directly during the crime or innocently for instance by secondary transfer. It is therefore of interest to have knowledge of the probability of transfer or secondary transfer in different situations. Factors that could influence transfer probabilities are background DNA and the shedder status of the involved persons. In this study, we have classified participants as high or low DNA shedders. We observed DNA transfer in a simulated attack scenario, and demonstrated that shedder status has a significant influence of transfer rates. We have examined the background DNA in samples from T-shirts worn in an area with frequent human traffic and detected multiple contributors. We further demonstrated that DNA from co-workers of a T-shirt wearer can be secondarily transferred from the environment and detected in samples, and that the composition of background DNA is correlated with the shedder status of the wearer. Finally, we have illustrated the inference with the results of transfer probabilities and a fictive case with the use of a Bayesian network. Copyright © 2017 Elsevier B.V. All rights reserved.
-
The complexities of DNA transfer during a social setting.
Goray, Mariya; van Oorschot, Roland A H
2015-03-01
When questions relating to how a touch DNA sample from a specific individual got to where it was sampled from, one has limited data available to provide an assessment on the likelihood of specific transfer events within a proposed scenario. This data is mainly related to the impact of some key variables affecting transfer that are derived from structured experiments. Here we consider the effects of unstructured social interactions on the transfer of touch DNA. Unscripted social exchanges of three individuals having a drink together while sitting at a table were video recorded and DNA samples were collected and profiled from all relevant items touched during each sitting. Attempts were made to analyze when and how DNA was transferred from one object to another. The analyses demonstrate that simple minor everyday interactions involving only a few items in some instances lead to detectable DNA being transferred among individuals and objects without them having contacted each other through secondary and further transfer. Transfer was also observed to be bi-directional. Furthermore, DNA of unknown source on hands or objects can be transferred and interfere with the interpretation of profiles generated from targeted touched surfaces. This study provides further insight into the transfer of DNA that may be useful when considering the likelihood of alternate scenarios of how a DNA sample got to where it was found. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
-
[Development of a hepatitis B virus carrier transgenic mice model].
Caner, Müge; Arat, Sezen; Bircan, Rifat
2008-01-01
The studies for the development of transgenic mice models which provide important profits for the studies concerning immunopathogenesis of hepatitis B virus (HBV) infections are in progress since 20 years. For this purpose different lineages bearing whole HBV genome or selected viral genes have been developed and their usage in clarifying the HBV replication and pathogenesis mechanisms have been emphasized. The aim of this study was to develop and breed a HBV carrier mice model. In the study the full HBV genome has been transferred to mouse embryos by microinjection procedure. Following transgenic manipulation, the HBV carriers among the daughter mice have been detected by molecular methods in which HBV-DNA replication and expression have been shown. The manipulations for transgene transfers have been performed in TUBITAK Marmara Research Center Transgene Laboratory, Gebze, Istanbul. The HBV-DNA carrier mice have been demonstrated by polymerase chain reaction (PCR) using the DNA samples obtained from tail tissues and also by dot-blot hybridization of the mice sera. Integrated HBV-DNA has been detected by applying in-situ hybridization to the liver tissue sections. HBV-DNA expression has been shown by reverse transcriptase PCR method with total RNA molecules that have been isolated from the liver tissues of the HBV-DNA carrier mice. HBsAg has been detected in the liver by immunohistochemical method, and HBsAg and HBeAg have additionally been demonstrated by ELISA. HBV genome, expression of the genome and the expression products have been determined in approximately 10% of the mice of which HBV-DNA have been transferred. By inbreeding heterozygote carrier mice, homozygote HBV transgenic mice line have been obtained. These HBV transgenic mice are the first lineages developed in our country. It is hopefully thought that this HBV carrier transgenic mouse model may contribute to the studies on the pathogenesis of HBV infections which are important health problems in the world as well as in Turkey.
-
NASA Astrophysics Data System (ADS)
Voityuk, Alexander A.
2008-03-01
The electron hole transfer (HT) properties of DNA are substantially affected by thermal fluctuations of the π stack structure. Depending on the mutual position of neighboring nucleobases, electronic coupling V may change by several orders of magnitude. In the present paper, we report the results of systematic QM/molecular dynamic (MD) calculations of the electronic couplings and on-site energies for the hole transfer. Based on 15ns MD trajectories for several DNA oligomers, we calculate the average coupling squares ⟨V2⟩ and the energies of basepair triplets XG +Y and XA +Y, where X, Y =G, A, T, and C. For each of the 32 systems, 15 000 conformations separated by 1ps are considered. The three-state generalized Mulliken-Hush method is used to derive electronic couplings for HT between neighboring basepairs. The adiabatic energies and dipole moment matrix elements are computed within the INDO/S method. We compare the rms values of V with the couplings estimated for the idealized B-DNA structure and show that in several important cases the couplings calculated for the idealized B-DNA structure are considerably underestimated. The rms values for intrastrand couplings G-G, A-A, G-A, and A-G are found to be similar, ˜0.07eV, while the interstrand couplings are quite different. The energies of hole states G+ and A+ in the stack depend on the nature of the neighboring pairs. The XG +Y are by 0.5eV more stable than XA +Y. The thermal fluctuations of the DNA structure facilitate the HT process from guanine to adenine. The tabulated couplings and on-site energies can be used as reference parameters in theoretical and computational studies of HT processes in DNA.
-
Butchosa, C; Simon, S; Blancafort, L; Voityuk, A
2012-07-12
Because hole transfer from nucleobases to amino acid residues in DNA-protein complexes can prevent oxidative damage of DNA in living cells, computational modeling of the process is of high interest. We performed MS-CASPT2 calculations of several model structures of π-stacked guanine and indole and derived electron-transfer (ET) parameters for these systems using the generalized Mulliken-Hush (GMH) method. We show that the two-state model commonly applied to treat thermal ET between adjacent donor and acceptor is of limited use for the considered systems because of the small gap between the ground and first excited states in the indole radical cation. The ET parameters obtained within the two-state GMH scheme can deviate significantly from the corresponding matrix elements of the two-state effective Hamiltonian based on the GMH treatment of three adiabatic states. The computed values of diabatic energies and electronic couplings provide benchmarks to assess the performance of less sophisticated computational methods.
-
Theoretical rate constants of super-exchange hole transfer and thermally induced hopping in DNA.
Shimazaki, Tomomi; Asai, Yoshihiro; Yamashita, Koichi
2005-01-27
Recently, the electronic properties of DNA have been extensively studied, because its conductivity is important not only to the study of fundamental biological problems, but also in the development of molecular-sized electronics and biosensors. We have studied theoretically the reorganization energies, the activation energies, the electronic coupling matrix elements, and the rate constants of hole transfer in B-form double-helix DNA in water. To accommodate the effects of DNA nuclear motions, a subset of reaction coordinates for hole transfer was extracted from classical molecular dynamics (MD) trajectories of DNA in water and then used for ab initio quantum chemical calculations of electron coupling constants based on the generalized Mulliken-Hush model. A molecular mechanics (MM) method was used to determine the nuclear Franck-Condon factor. The rate constants for two types of mechanisms of hole transfer-the thermally induced hopping (TIH) and the super-exchange mechanisms-were determined based on Marcus theory. We found that the calculated matrix elements are strongly dependent on the conformations of the nucleobase pairs of hole-transferable DNA and extend over a wide range of values for the "rise" base-step parameter but cluster around a particular value for the "twist" parameter. The calculated activation energies are in good agreement with experimental results. Whereas the rate constant for the TIH mechanism is not dependent on the number of A-T nucleobase pairs that act as a bridge, the rate constant for the super-exchange process rapidly decreases when the length of the bridge increases. These characteristic trends in the calculated rate constants effectively reproduce those in the experimental data of Giese et al. [Nature 2001, 412, 318]. The calculated rate constants were also compared with the experimental results of Lewis et al. [Nature 2000, 406, 51].
-
A method for tracing exogenous DNA uptake in live spermatozoa and embryos.
Mu, Y; Jiao, M; Zhao, Y; Lv, J; Wang, J; Hao, J; Zhang, X; Kong, Q; Liu, Z
2018-03-01
Sperm-mediated gene transfer(SMGT) is a simple method for producing transgenic animals. Due to the lack of repeatability in spermatozoa binding and internalization of exogenous DNA, the efficiency of SMGT is still low. Considering this point, the present work aims to develop a method for evaluating the spermatozoa capacity of binding exogenous DNA after co-incubation with DNA. The main approach is using a Cy5-labelled DNA to trace the exogenous DNA and assess the ability of spermatozoa to take up exogenous DNA. Using this technique, we found that the percentage of spermatozoa that are binding and uptaking DNA is higher at concentration of 10 μg/mL and 100 μg/mL than 5 μg/mL, 1 μg/mL and 0 μg/mL after incubation with Cy5-DNA for 30min at 37oC. After fertilization, the DNA fluorescence signal was also detected in zygotes in groups where spermatozoa were incubated with 10 μg/mL and 100 μg/mL of Cy5-DNA. These results showed a simple and convenient method to trace the exogenous DNA in spermatozoa and zygote when compared to conventional methods of labeling DNA during fertilization, resulting in a real-time observation of the exogenous DNA in spermatozoa and zygote. Copyright© by the Polish Academy of Sciences.
-
METHODS FOR STUDYING BACTERIAL GENE TRANSFER IN SOIL BY CONJUGATION AND TRANSDUCTION
The purpose of this document is to provide a series of protocols by which a trained technician can conduct studies on the transfer of genetic information by conjugation or transduction in soil, with emphasis on bacteria containing recombinant DNA. The level of the document is gea...
-
Mao, Huihui; Luo, Guanghua; Zhan, Yuxia; Zhang, Jun; Yao, Shuang; Yu, Yang
2018-04-30
The base-quenched probe method for detecting single nucleotide polymorphisms (SNPs) relies on real-time PCR and melting-curve analysis, which might require only one pair of primers and one probe. At present, it has been successfully applied to detect SNPs of multiple genes. However, the mechanism of the base-quenched probe method remains unclear. Therefore, we investigated the possible mechanism of fluorescence quenching by DNA bases in aqueous solution using spectroscopic techniques. It showed that the possible mechanism might be photo-induced electron transfer. We next analyzed electron transfer or transmission between DNA bases and fluorophores. The data suggested that in single-stranded DNA, the electrons of the fluorophore are transferred to the orbital of pyrimidine bases (thymine (T) and cytosine (C)), or that the electron orbitals of the fluorophore are occupied by electrons from purine bases (guanine (G) and adenine (A)), which lead to fluorescence quenching. In addition, the electrons of a fluorophore excited by light can be transmitted along double-stranded DNA, which gives rise to stronger fluorescence quenching. Furthermore, we demonstrated that the quenching efficiency of bases is in the order of G > C ≥ A ≥ T and the capability of electron transmission of base-pairs in double-stranded DNA is in the order of CG[combining low line] ≥ GC[combining low line] > TA[combining low line] ≥ AT[combining low line] (letters representing bases on the complementary strand of the probe are bold and underlined), and the most common commercial fluorophores including FAM, HEX, TET, JOE, and TAMRA could be influenced by bases and are in line with this mechanism and regularity.
-
Bakhori, Noremylia Mohd; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir
2013-12-12
An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10-9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.
-
Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir
2013-12-01
An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10(-9) M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.
-
Bustamante, Paula; Covarrubias, Paulo C; Levicán, Gloria; Katz, Assaf; Tapia, Pablo; Holmes, David; Quatrini, Raquel; Orellana, Omar
2012-01-01
Integrative conjugative elements (ICEs) are self-transferred mobile genetic elements that contribute to horizontal gene transfer. An ICE (ICEAfe1) was identified in the genome of Acidithiobacillus ferrooxidans ATCC 23270. Excision of the element and expression of relevant genes under normal and DNA-damaging growth conditions was analyzed. Bioinformatic tools and DNA amplification methods were used to identify and to assess the excision and expression of genes related to the mobility of the element. Both basal and mitomycin C-inducible excision as well as expression and induction of the genes for integration/excision are demonstrated, suggesting that ICEAfe1 is an actively excising SOS-regulated mobile genetic element. The presence of a complete set of genes encoding self-transfer functions that are induced in response to DNA damage caused by mitomycin C additionally suggests that this element is capable of conjugative transfer to suitable recipient strains. Transfer of ICEAfe1 may provide selective advantages to other acidophiles in this ecological niche through dissemination of gene clusters expressing transfer RNAs, CRISPRs, and exopolysaccharide biosynthesis enzymes, probably by modification of translation efficiency, resistance to bacteriophage infection and biofilm formation, respectively. These data open novel avenues of research on conjugative transformation of biotechnologically relevant microorganisms recalcitrant to genetic manipulation. Copyright © 2013 S. Karger AG, Basel.
-
Method for detecting point mutations in DNA utilizing fluorescence energy transfer
Parkhurst, Lawrence J.; Parkhurst, Kay M.; Middendorf, Lyle
2001-01-01
A method for detecting point mutations in DNA using a fluorescently labeled oligomeric probe and Forster resonance energy transfer (FRET) is disclosed. The selected probe is initially labeled at each end with a fluorescence dye, which act together as a donor/acceptor pair for FRET. The fluorescence emission from the dyes changes dramatically from the duplex stage, wherein the probe is hybridized to the complementary strand of DNA, to the single strand stage, when the probe is melted to become detached from the DNA. The change in fluorescence is caused by the dyes coming into closer proximity after melting occurs and the probe becomes detached from the DNA strand. The change in fluorescence emission as a function of temperature is used to calculate the melting temperature of the complex or T.sub.m. In the case where there is a base mismatch between the probe and the DNA strand, indicating a point mutation, the T.sub.m has been found to be significantly lower than the T.sub.m for a perfectly match probelstand duplex. The present invention allows for the detection of the existence and magnitude of T.sub.m, which allows for the quick and accurate detection of a point mutation in the DNA strand and, in some applications, the determination of the approximate location of the mutation within the sequence.
-
NASA Astrophysics Data System (ADS)
Wang, Xin; Liang, Shi-Dong
2013-02-01
We explore the charge transfer in the telomere G-Quadruplex (TG4) DNA theoretically by the nonequilibrium Green's function method, and reveal the topological effect of the charge transport in TG4 DNA. The consecutive TG4 (CTG4) is semiconducting with 0.2 0.3 eV energy gap. Charges transfer favorably in the CTG4, but are trapped in the nonconsecutive TG4 (NCTG4). The global conductance is inversely proportional to the local conductance for NCTG4. The topological structure transition from NCTG4 to CTG4 induces abruptly 3nA charge current, which provide a microscopic clue to understand the telomerase activated or inhibited by TG4. Our findings reveal the fundamental property of charge transfer in TG4 and its relationship with the topological structure of TG4.
-
Electron-transfer oxidation properties of DNA bases and DNA oligomers.
Fukuzumi, Shunichi; Miyao, Hiroshi; Ohkubo, Kei; Suenobu, Tomoyoshi
2005-04-21
Kinetics for the thermal and photoinduced electron-transfer oxidation of a series of DNA bases with various oxidants having the known one-electron reduction potentials (E(red)) in an aqueous solution at 298 K were examined, and the resulting electron-transfer rate constants (k(et)) were evaluated in light of the free energy relationship of electron transfer to determine the one-electron oxidation potentials (E(ox)) of DNA bases and the intrinsic barrier of the electron transfer. Although the E(ox) value of GMP at pH 7 is the lowest (1.07 V vs SCE) among the four DNA bases, the highest E(ox) value (CMP) is only 0.19 V higher than that of GMP. The selective oxidation of GMP in the thermal electron-transfer oxidation of GMP results from a significant decrease in the pH dependent oxidation potential due to the deprotonation of GMP*+. The one-electron reduced species of the photosensitizer produced by photoinduced electron transfer are observed as the transient absorption spectra when the free energy change of electron transfer is negative. The rate constants of electron-transfer oxidation of the guanine moieties in DNA oligomers with Fe(bpy)3(3+) and Ru(bpy)3(3+) were also determined using DNA oligomers containing different guanine (G) sequences from 1 to 10 G. The rate constants of electron-transfer oxidation of the guanine moieties in single- and double-stranded DNA oligomers with Fe(bpy)3(2+) and Ru(bpy)3(3+) are dependent on the number of sequential guanine molecules as well as on pH.
-
Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir
2013-01-01
An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10−9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense. PMID:25587406
-
Helicase Stepping Investigated with One-Nucleotide Resolution Fluorescence Resonance Energy Transfer
NASA Astrophysics Data System (ADS)
Lin, Wenxia; Ma, Jianbing; Nong, Daguan; Xu, Chunhua; Zhang, Bo; Li, Jinghua; Jia, Qi; Dou, Shuoxing; Ye, Fangfu; Xi, Xuguang; Lu, Ying; Li, Ming
2017-09-01
Single-molecule Förster resonance energy transfer is widely applied to study helicases by detecting distance changes between a pair of dyes anchored to overhangs of a forked DNA. However, it has been lacking single-base pair (1-bp) resolution required for revealing stepping kinetics of helicases. We designed a nanotensioner in which a short DNA is bent to exert force on the overhangs, just as in optical or magnetic tweezers. The strategy improved the resolution of Förster resonance energy transfer to 0.5 bp, high enough to uncover differences in DNA unwinding by yeast Pif1 and E. coli RecQ whose unwinding behaviors cannot be differentiated by currently practiced methods. We found that Pif1 exhibits 1-bp-stepping kinetics, while RecQ breaks 1 bp at a time but sequesters the nascent nucleotides and releases them randomly. The high-resolution data allowed us to propose a three-parameter model to quantitatively interpret the apparently different unwinding behaviors of the two helicases which belong to two superfamilies.
-
Serrating Nozzle Surfaces for Complete Transfer of Droplets
NASA Technical Reports Server (NTRS)
Kim, Chang-Jin " CJ"
; Yi, Uichong 2010-01-01
A method of ensuring the complete transfer of liquid droplets from nozzles in microfluidic devices to nearby surfaces involves relatively simple geometric modification of the nozzle surfaces. The method is especially applicable to nozzles in print heads and similar devices required to dispense liquid droplets having precise volumes. Examples of such devices include heads for soft printing of ink on paper and heads for depositing droplets of deoxyribonucleic acid (DNA) or protein solutions on glass plates to form microarrays of spots for analysis. The main purpose served by the present method is to ensure that droplets transferred from a nozzle have consistent volume, as needed to ensure accuracy in microarray analysis or consistent appearance of printed text and images. In soft printing, droplets having consistent volume are generated inside a print head, but in the absence of the present method, the consistency is lost in printing because after each printing action (in which a drop is ejected from a nozzle), a small residual volume of liquid remains attached to the nozzle. By providing for complete transfer of droplets (and thus eliminating residual liquid attached to the nozzle) the method ensures consistency of volume of transferred droplets. An additional benefit of elimination of residue is prevention of cross-contamination among different liquids printed through the same nozzle a major consideration in DNA microarray analysis. The method also accelerates the printing process by minimizing the need to clean a printing head to prevent cross-contamination. Soft printing involves a hydrophobic nozzle surface and a hydrophilic print surface. When the two surfaces are brought into proximity such that a droplet in the nozzle makes contact with the print surface, a substantial portion of the droplet becomes transferred to the print surface. Then as the nozzle and the print surface are pulled apart, the droplet is pulled apart and most of the droplet remains on the print surface. The basic principle of the present method is to reduce the liquid-solid surface energy of the nozzle to a level sufficiently below the intrinsic solid-liquid surface energy of the nozzle material so that the droplet is not pulled apart and, instead, the entire droplet volume becomes transferred to the print surface. In this method, the liquid-solid surface energy is reduced by introducing artificial surface roughness in the form of micromachined serrations on the inner nozzle surface (see figure). The method was tested in experiments on soft printing of DNA solutions and of deionized water through 0.5-mm-diameter nozzles, of which some were not serrated, some were partially serrated, and some were fully serrated. In the nozzles without serrations, transfer was incomplete; that is, residual liquids remained in the nozzles after printing. However, in every nozzle in which at least half the inner surface was serrated, complete transfer of droplets to the print surface was achieved.
-
Ab initio treatment of ion-induced charge transfer dynamics of isolated 2-deoxy-D-ribose.
Bacchus-Montabonel, Marie-Christine
2014-08-21
Modeling-induced radiation damage in biological systems, in particular, in DNA building blocks, is of major concern in cancer therapy studies. Ion-induced charge-transfer dynamics may indeed be involved in proton and hadrontherapy treatments. We have thus performed a theoretical approach of the charge-transfer dynamics in collision of C(4+) ions and protons with isolated 2-deoxy-D-ribose in a wide collision energy range by means of ab initio quantum chemistry molecular methods. The comparison of both projectile ions has been performed with regard to previous theoretical and experimental results. The charge transfer appears markedly less efficient with the 2-deoxy-D-ribose target than that with pyrimidine nucleobases, which would induce an enhancement of the fragmentation process in agreement with experimental measurements. The mechanism has been analyzed with regard to inner orbital excitations, and qualitative tendencies have been pointed out for studies on DNA buiding block damage.
-
Zhang, Hongyan; Lv, Jie; Jia, Zhenhong
2017-05-10
A novel assembled biosensor was prepared for detecting 16S rRNA, a small-size persistent specific for Actinobacteria. The mechanism of the porous silicon (PS) photonic crystal biosensor is based on the fluorescence resonance energy transfer (FRET) between quantum dots (QDs) and gold nanoparticles (AuNPs) through DNA hybridization, where QDs act as an emission donor and AuNPs serve as a fluorescence quencher. Results showed that the photoluminescence (PL) intensity of PS photonic crystal was drastically increased when the QDs-conjugated probe DNA was adhered to the PS layer by surface modification using a standard cross-link chemistry method. The PL intensity of QDs was decreased when the addition of AuNPs-conjugated complementary 16S rRNA was dropped onto QDs-conjugated PS. Based on the analysis of different target DNA concentration, it was found that the decrease of the PL intensity showed a good linear relationship with complementary DNA concentration in a range from 0.25 to 10 μM, and the detection limit was 328.7 nM. Such an optical FRET biosensor functions on PS-based photonic crystal for DNA detection that differs from the traditional FRET, which is used only in liquid. This method will benefit the development of a new optical FRET label-free biosensor on Si substrate and has great potential in biochips based on integrated optical devices.
-
Xia, Jixiang; Martinez, Angela; Daniell, Henry; Ebert, Steven N
2011-06-02
Gene therapy continues to hold great potential for treating many different types of disease and dysfunction. Safe and efficient techniques for gene transfer and expression in vivo are needed to enable gene therapeutic strategies to be effective in patients. Currently, the most commonly used methods employ replication-defective viral vectors for gene transfer, while physical gene transfer methods such as biolistic-mediated ("gene-gun") delivery to target tissues have not been as extensively explored. In the present study, we evaluated the efficacy of biolistic gene transfer techniques in vivo using non-invasive bioluminescent imaging (BLI) methods. Plasmid DNA carrying the firefly luciferase (LUC) reporter gene under the control of the human Cytomegalovirus (CMV) promoter/enhancer was transfected into mouse skin and liver using biolistic methods. The plasmids were coupled to gold microspheres (1 μm diameter) using different DNA Loading Ratios (DLRs), and "shot" into target tissues using a helium-driven gene gun. The optimal DLR was found to be in the range of 4-10. Bioluminescence was measured using an In Vivo Imaging System (IVIS-50) at various time-points following transfer. Biolistic gene transfer to mouse skin produced peak reporter gene expression one day after transfer. Expression remained detectable through four days, but declined to undetectable levels by six days following gene transfer. Maximum depth of tissue penetration following biolistic transfer to abdominal skin was 200-300 μm. Similarly, biolistic gene transfer to mouse liver in vivo also produced peak early expression followed by a decline over time. In contrast to skin, however, liver expression of the reporter gene was relatively stable 4-8 days post-biolistic gene transfer, and remained detectable for nearly two weeks. The use of bioluminescence imaging techniques enabled efficient evaluation of reporter gene expression in vivo. Our results demonstrate that different tissues show different expression kinetics following gene transfer of the same reporter plasmid to different mouse tissues in vivo. We evaluated superficial (skin) and abdominal organ (liver) targets, and found that reporter gene expression peaked within the first two days post-transfer in each case, but declined most rapidly in the skin (3-4 days) compared to liver (10-14 days). This information is essential for designing effective gene therapy strategies in different target tissues.
-
[Genome-scale sequence data processing and epigenetic analysis of DNA methylation].
Wang, Ting-Zhang; Shan, Gao; Xu, Jian-Hong; Xue, Qing-Zhong
2013-06-01
A new approach recently developed for detecting cytosine DNA methylation (mC) and analyzing the genome-scale DNA methylation profiling, is called BS-Seq which is based on bisulfite conversion of genomic DNA combined with next-generation sequencing. The method can not only provide an insight into the difference of genome-scale DNA methylation among different organisms, but also reveal the conservation of DNA methylation in all contexts and nucleotide preference for different genomic regions, including genes, exons, and repetitive DNA sequences. It will be helpful to under-stand the epigenetic impacts of cytosine DNA methylation on the regulation of gene expression and maintaining silence of repetitive sequences, such as transposable elements. In this paper, we introduce the preprocessing steps of DNA methylation data, by which cytosine (C) and guanine (G) in the reference sequence are transferred to thymine (T) and adenine (A), and cytosine in reads is transferred to thymine, respectively. We also comprehensively review the main content of the DNA methylation analysis on the genomic scale: (1) the cytosine methylation under the context of different sequences; (2) the distribution of genomic methylcytosine; (3) DNA methylation context and the preference for the nucleotides; (4) DNA- protein interaction sites of DNA methylation; (5) degree of methylation of cytosine in the different structural elements of genes. DNA methylation analysis technique provides a powerful tool for the epigenome study in human and other species, and genes and environment interaction, and founds the theoretical basis for further development of disease diagnostics and therapeutics in human.
-
Arias, María Elena; Sánchez-Villalba, Esther; Delgado, Andrea; Felmer, Ricardo
2017-02-01
Sperm-mediated gene transfer (SMGT) is based on the capacity of sperm to bind exogenous DNA and transfer it into the oocyte during fertilization. In bovines, the progress of this technology has been slow due to the poor reproducibility and efficiency of the production of transgenic embryos. The aim of the present study was to evaluate the effects of different sperm transfection systems on the quality and functional parameters of sperm. Additionally, the ability of sperm to bind and incorporate exogenous DNA was assessed. These analyses were carried out by flow cytometry and confocal fluorescence microscopy, and motility parameters were also evaluated by computer-assisted sperm analysis (CASA). Transfection was carried out using complexes of plasmid DNA with Lipofectamine, SuperFect and TurboFect for 0.5, 1, 2 or 4 h. The results showed that all of the transfection treatments promoted sperm binding and incorporation of exogenous DNA, similar to sperm incorporation of DNA alone, without affecting the viability. Nevertheless, the treatments and incubation times significantly affected the motility parameters, although no effect on the integrity of DNA or the levels of reactive oxygen species (ROS) was observed. Additionally, we observed that transfection using SuperFect and TurboFect negatively affected the acrosome integrity, and TurboFect affected the mitochondrial membrane potential of sperm. In conclusion, we demonstrated binding and incorporation of exogenous DNA by sperm after transfection and confirmed the capacity of sperm to spontaneously incorporate exogenous DNA. These findings will allow the establishment of the most appropriate method [intracytoplasmic sperm injection (ICSI) or in vitro fertilization (IVF)] of generating transgenic embryos via SMGT based on the fertilization capacity of transfected sperm.
-
NASA Astrophysics Data System (ADS)
Prakrajang, K.; Sangwijit, K.; Anuntalabhochai, S.; Wanichapichart, P.; Yu, L. D.
2012-02-01
Low-energy ion beam biotechnology (IBBT) has recently been rapidly developed worldwide. Ion-beam-induced DNA transfer is one of the important applications of IBBT. However, mechanisms involved in this application are not yet well understood. In this study plasma-neutralized ion beam was applied to investigate ion charge effect on induction of DNA transfer. Argon ion beam at 7.5 keV was neutralized by RF-driven plasma in the beam path and then bombarded cellulose membranes which were used as the mimetic plant cell envelope. Electrical properties such as impedance and capacitance of the membranes were measured after the bombardment. An in vitro experiment on plasmid DNA transfer through the cellulose membrane was followed up. The results showed that the ion charge input played an important role in the impedance and capacitance changes which would affect DNA transfer. Generally speaking, neutral particle beam bombardment of biologic cells was more effective in inducing DNA transfer than charged ion beam bombardment.
-
Hara, Shintaro; Saito, Masanori
2016-01-01
Phytate (inositol hexaphosphate; IHP)-degrading microbes have been suggested to contribute to arbuscular mycorrhizal fungi (AMF)-mediated P transfer from IHP to plants; however, no IHP degrader involved in AMF-mediated P transfer has been isolated to date. We herein report the isolation of IHP-degrading bacteria using a modified baiting method. We applied alginate beads as carriers of IHP powder, and used them as recoverable IHP in the AM fungal compartment of plant cultivation experiments. P transfer from IHP in alginate beads via AMF was confirmed, and extracted DNA from alginate beads was analyzed by denaturing gradient gel electrophoresis targeting the 16S rRNA gene and a clone library method for the beta-propeller phytase (BPP) gene. The diversities of the 16S rRNA and BPP genes of microbes growing on IHP beads were simple and those of Sphingomonas spp. and Caulobacter spp. dominated. A total of 187 IHP-utilizing bacteria were isolated and identified, and they were consistent with the results of DNA analysis. Furthermore, some isolated Sphingomonas spp. and Caulobacter sp. showed IHP-degrading activity. Therefore, we successfully isolated dominant IHP-degrading bacteria from IHP in an AMF hyphal compartment. These strains may contribute to P transfer from IHP via AMF. PMID:27383681
-
The Conjugative Relaxase TrwC Promotes Integration of Foreign DNA in the Human Genome.
González-Prieto, Coral; Gabriel, Richard; Dehio, Christoph; Schmidt, Manfred; Llosa, Matxalen
2017-06-15
Bacterial conjugation is a mechanism of horizontal DNA transfer. The relaxase TrwC of the conjugative plasmid R388 cleaves one strand of the transferred DNA at the oriT gene, covalently attaches to it, and leads the single-stranded DNA (ssDNA) into the recipient cell. In addition, TrwC catalyzes site-specific integration of the transferred DNA into its target sequence present in the genome of the recipient bacterium. Here, we report the analysis of the efficiency and specificity of the integrase activity of TrwC in human cells, using the type IV secretion system of the human pathogen Bartonella henselae to introduce relaxase-DNA complexes. Compared to Mob relaxase from plasmid pBGR1, we found that TrwC mediated a 10-fold increase in the rate of plasmid DNA transfer to human cells and a 100-fold increase in the rate of chromosomal integration of the transferred DNA. We used linear amplification-mediated PCR and plasmid rescue to characterize the integration pattern in the human genome. DNA sequence analysis revealed mostly reconstituted oriT sequences, indicating that TrwC is active and recircularizes transferred DNA in human cells. One TrwC-mediated site-specific integration event was detected, proving that TrwC is capable of mediating site-specific integration in the human genome, albeit with very low efficiency compared to the rate of random integration. Our results suggest that TrwC may stabilize the plasmid DNA molecules in the nucleus of the human cell, probably by recircularization of the transferred DNA strand. This stabilization would increase the opportunities for integration of the DNA by the host machinery. IMPORTANCE Different biotechnological applications, including gene therapy strategies, require permanent modification of target cells. Long-term expression is achieved either by extrachromosomal persistence or by integration of the introduced DNA. Here, we studied the utility of conjugative relaxase TrwC, a bacterial protein with site-specific integrase activity in bacteria, as an integrase in human cells. Although it is not efficient as a site-specific integrase, we found that TrwC is active in human cells and promotes random integration of the transferred DNA in the human genome, probably acting as a DNA chaperone until it is integrated by host mechanisms. TrwC-DNA complexes can be delivered to human cells through a type IV secretion system involved in pathogenesis. Thus, TrwC could be used in vivo to transfer the DNA of interest into the appropriate cell and promote its integration. If used in combination with a site-specific nuclease, it could lead to site-specific integration of the incoming DNA by homologous recombination. Copyright © 2017 American Society for Microbiology.
-
The Conjugative Relaxase TrwC Promotes Integration of Foreign DNA in the Human Genome
González-Prieto, Coral; Gabriel, Richard; Dehio, Christoph; Schmidt, Manfred
2017-01-01
ABSTRACT Bacterial conjugation is a mechanism of horizontal DNA transfer. The relaxase TrwC of the conjugative plasmid R388 cleaves one strand of the transferred DNA at the oriT gene, covalently attaches to it, and leads the single-stranded DNA (ssDNA) into the recipient cell. In addition, TrwC catalyzes site-specific integration of the transferred DNA into its target sequence present in the genome of the recipient bacterium. Here, we report the analysis of the efficiency and specificity of the integrase activity of TrwC in human cells, using the type IV secretion system of the human pathogen Bartonella henselae to introduce relaxase-DNA complexes. Compared to Mob relaxase from plasmid pBGR1, we found that TrwC mediated a 10-fold increase in the rate of plasmid DNA transfer to human cells and a 100-fold increase in the rate of chromosomal integration of the transferred DNA. We used linear amplification-mediated PCR and plasmid rescue to characterize the integration pattern in the human genome. DNA sequence analysis revealed mostly reconstituted oriT sequences, indicating that TrwC is active and recircularizes transferred DNA in human cells. One TrwC-mediated site-specific integration event was detected, proving that TrwC is capable of mediating site-specific integration in the human genome, albeit with very low efficiency compared to the rate of random integration. Our results suggest that TrwC may stabilize the plasmid DNA molecules in the nucleus of the human cell, probably by recircularization of the transferred DNA strand. This stabilization would increase the opportunities for integration of the DNA by the host machinery. IMPORTANCE Different biotechnological applications, including gene therapy strategies, require permanent modification of target cells. Long-term expression is achieved either by extrachromosomal persistence or by integration of the introduced DNA. Here, we studied the utility of conjugative relaxase TrwC, a bacterial protein with site-specific integrase activity in bacteria, as an integrase in human cells. Although it is not efficient as a site-specific integrase, we found that TrwC is active in human cells and promotes random integration of the transferred DNA in the human genome, probably acting as a DNA chaperone until it is integrated by host mechanisms. TrwC-DNA complexes can be delivered to human cells through a type IV secretion system involved in pathogenesis. Thus, TrwC could be used in vivo to transfer the DNA of interest into the appropriate cell and promote its integration. If used in combination with a site-specific nuclease, it could lead to site-specific integration of the incoming DNA by homologous recombination. PMID:28411218
-
Highly sensitive detection of DNA methylation levels by using a quantum dot-based FRET method
NASA Astrophysics Data System (ADS)
Ma, Yunfei; Zhang, Honglian; Liu, Fangming; Wu, Zhenhua; Lu, Shaohua; Jin, Qinghui; Zhao, Jianlong; Zhong, Xinhua; Mao, Hongju
2015-10-01
DNA methylation is the most frequently studied epigenetic modification that is strongly involved in genomic stability and cellular plasticity. Aberrant changes in DNA methylation status are ubiquitous in human cancer and the detection of these changes can be informative for cancer diagnosis. Herein, we reported a facile quantum dot-based (QD-based) fluorescence resonance energy transfer (FRET) technique for the detection of DNA methylation. The method relies on methylation-sensitive restriction enzymes for the differential digestion of genomic DNA based on its methylation status. Digested DNA is then subjected to PCR amplification for the incorporation of Alexa Fluor-647 (A647) fluorophores. DNA methylation levels can be detected qualitatively through gel analysis and quantitatively by the signal amplification from QDs to A647 during FRET. Furthermore, the methylation levels of three tumor suppressor genes, PCDHGB6, HOXA9 and RASSF1A, in 20 lung adenocarcinoma and 20 corresponding adjacent nontumorous tissue (NT) samples were measured to verify the feasibility of the QD-based FRET method and a high sensitivity for cancer detection (up to 90%) was achieved. Our QD-based FRET method is a convenient, continuous and high-throughput method, and is expected to be an alternative for detecting DNA methylation as a biomarker for certain human cancers.DNA methylation is the most frequently studied epigenetic modification that is strongly involved in genomic stability and cellular plasticity. Aberrant changes in DNA methylation status are ubiquitous in human cancer and the detection of these changes can be informative for cancer diagnosis. Herein, we reported a facile quantum dot-based (QD-based) fluorescence resonance energy transfer (FRET) technique for the detection of DNA methylation. The method relies on methylation-sensitive restriction enzymes for the differential digestion of genomic DNA based on its methylation status. Digested DNA is then subjected to PCR amplification for the incorporation of Alexa Fluor-647 (A647) fluorophores. DNA methylation levels can be detected qualitatively through gel analysis and quantitatively by the signal amplification from QDs to A647 during FRET. Furthermore, the methylation levels of three tumor suppressor genes, PCDHGB6, HOXA9 and RASSF1A, in 20 lung adenocarcinoma and 20 corresponding adjacent nontumorous tissue (NT) samples were measured to verify the feasibility of the QD-based FRET method and a high sensitivity for cancer detection (up to 90%) was achieved. Our QD-based FRET method is a convenient, continuous and high-throughput method, and is expected to be an alternative for detecting DNA methylation as a biomarker for certain human cancers. Electronic supplementary information (ESI) available: Synthesis of CdSe/CdS/ZnS core/shell/shell QDs. Sequences of primers used for amplifying the promoter regions in bisulfate-modified DNA. Comparison of detected methylation levels in different gene promoters using the QD-based FRET method versus bisulfite pyrosequencing. Methylation levels of the RASSF1A gene in one pair of NT and cancer samples as indicated by pyrosequencing. Theoretical calculation of the Förster distance R0. See DOI: 10.1039/c5nr04956c
-
Chen, Jia; Huang, Yong; Vdovenko, Marina; Sakharov, Ivan Yu; Su, Guifa; Zhao, Shulin
2015-06-01
An enhanced chemiluminescence resonance energy transfer (CRET) system based on target recycling G-guadruplexes/hemin DNAzyme catalysis was developed for ultrasensitive detection of DNA. CRET system consists of luminol as chemiluminescent donor, and fluorescein isothiocyanate (FITC) as acceptor. The sensitive detection was achieved by using the system consisted of G-riched DNA, blocker DNA, and the Nb.BbvCI biocatalyst. Upon addition of target DNA to the system, target DNA hybridizes with the quasi-circular DNA structure, and forms a DNA duplex. The formation of DNA duplex triggers selective enzymatic cleavage of quasi-circular DNA by Nb.BbvCI, resulting in the release of target DNA and two G-riched DNAzyme segments. Released target DNA then hybridizes with another quasi-circular DNA structure to initiate the cleavage of the quasi-circular DNA structure. Eventually, each target DNA can go through many cycles, resulting in the digestion of many quasi-circular DNA structures, generating many G-riched DNAzyme segments. G-riched DNAzyme segment products assemble with hemin to form stable hemin/G-quadruplexes that exhibit peroxidase-like activity which can catalyze the oxidation of luminol by H2O2 to produce CL signals. In the presence of FITC, CL of luminol can excite FITC molecules, and thus produced CRET between the luminol and FITC. This unique analysis strategy gives a detection limit down to 80 fM, which is at least four orders of magnitude lower than that of unamplified DNA detection methods. Copyright © 2015 Elsevier B.V. All rights reserved.
-
Gene transfer and gene mapping in mammalian cells in culture.
Shows, T B; Sakaguchi, A Y
1980-01-01
The ability to transfer mammalian genes parasexually has opened new possibilities for gene mapping and fine structure mapping and offers great potential for contributing to several aspects of mammalian biology, including gene expression and genetic engineering. The DNA transferred has ranged from whole genomes to single genes and smaller segments of DNA. The transfer of whole genomes by cell fusion forms cell hybrids, which has promoted the extensive mapping of human and mouse genes. Transfer, by cell fusion, of rearranged chromosomes has contributed significantly to determining close linkage and the assignment of genes to specific chromosomal regions. Transfer of single chromosomes has been achieved utilizing microcells fused to recipient cells. Metaphase chromosomes have been isolated and used to transfer single-to-multigenic DNA segments. DNA-mediated gene transfer, simulating bacterial transformation, has achieved transfer of single-copy genes. By utilizing DNA cleaved with restriction endonucleases, gene transfer is being empolyed as a bioassay for the purification of genes. Gene mapping and the fate of transferred genes can be examined now at the molecular level using sequence-specific probles. Recently, single genes have been cloned into eucaryotic and procaryotic vectors for transfer into mammalian cells. Moreover, recombinant libraries in which entire mammalian genomes are represented collectively are a rich new source of transferable genes. Methodology for transferring mammalian genetic information and applications for mapping mammalian genes is presented and prospects for the future discussed.
-
Tepper, Armand W J W
2010-05-12
A method for the electrical contacting of redox enzymes that obtain oxidizing or reducing equivalents from small electron-transfer proteins is demonstrated. The electrochemical contacting of redox enzymes through their immobilization onto electrode supports offers great potential for technological applications and for fundamental studies, but finding appropriate methods to immobilize the enzymes in an orientation allowing rapid electron transfer with the electrode has proven difficult. The copper enzyme nitrite reductase (NiR) and its natural electron-exchange partner pseudoazurin (Paz) are conjugated to a specific DNA tag and immobilized to a gold electrode into a stoichiometrically defined assembly. The DNA tethered to the electrode surface acts as flexible place-holder for the protein components, allowing both proteins to move within the construct. It is shown that Paz efficiently shuttles electrons between the electrode and the NiR enzyme, allowing the electrochemically driven NiR catalysis to be monitored. The activity of the NiR enzyme remains unperturbed by the immobilization. The rate-limiting step of the system is tentatively ascribed to the dissociation of the Paz/NiR complex. The electrochemical response of the system reports not only on the NiR catalysis and on interfacial electron transfer but also on the interaction between NiR and Paz.
-
Profile of Roche's Ariosa Harmony prenatal test.
Bevilacqua, Elisa; Resta, Serena; Carlin, Andrew; Kang, Xin; Cos Sanchez, Teresa; de Marchin, Jérôme; Jani, Jacques C
2018-06-18
Roche's Ariosa Harmony TM Prenatal Test, a noninvasive cfDNA (cell-free DNA) method for major trisomies has been available since January-2013 at the authors unit and tests were sent to California. From July-2017 onwards, prenatal cfDNA has been reimbursed in Belgium for all pregnancies, however since then samples are sent to a local technology transfer center. Little data are available on patient's profile and choices towards cfDNA and on the performance of local technology transfer centers. Areas covered: The profiles and choices of women regarding this test were evaluated. Further, the performance of cfDNA at the local center was compared to the one in California. The results showed that women from the Netherlands, as compared to Belgium, were more likely to undergo cfDNA testing for maternal request and would be less likely to undergo karyotyping if cfDNA were unavailable, and therefore are better candidates for cfDNA testing, when this is used as first-line screening. The local test failure rate was nearly twice that of the main laboratory in California, however when repeated, the success rate was quite high. Expert commentary: The findings highlight the importance of conducting these types of studies, before decisions about clinical implementation are made by national governments and ministries of health.
-
Helping to distinguish primary from secondary transfer events for trace DNA.
Taylor, Duncan; Biedermann, Alex; Samie, Lydie; Pun, Ka-Man; Hicks, Tacha; Champod, Christophe
2017-05-01
DNA is routinely recovered in criminal investigations. The sensitivity of laboratory equipment and DNA profiling kits means that it is possible to generate DNA profiles from very small amounts of cellular material. As a consequence, it has been shown that DNA we detect may not have arisen from a direct contact with an item, but rather through one or more intermediaries. Naturally the questions arising in court, particularly when considering trace DNA, are of how DNA may have come to be on an item. While scientists cannot directly answer this question, forensic biological results can help in discriminating between alleged activities. Much experimental research has been published showing the transfer and persistence of DNA under varying conditions, but as of yet the results of these studies have not been combined to deal with broad questions about transfer mechanisms. In this work we use published data and Bayesian networks to develop a statistical logical framework by which questions of transfer mechanism can be approached probabilistically. We also identify a number of areas where further work could be carried out in order to improve our knowledge base when helping to address questions about transfer mechanisms. Finally, we apply the constructed Bayesian network to ground truth known data to determine if, with current knowledge, there is any power in DNA quantities to distinguish primary and secondary transfer events. Copyright © 2017 Elsevier B.V. All rights reserved.
-
Darlix, J L; Vincent, A; Gabus, C; de Rocquigny, H; Roques, B
1993-08-01
Two DNA strand transfer reactions take place during reverse transcription of the retroviral genome. The first transfer, that of the minus-strand strong stop DNA from the 5' end of the viral RNA to the 3' end, has been studied in vitro with two RNAs mimicking the 5' and 3' regions of the HIV1 genome and with nucleocapsid protein, NCp7, and reverse transcriptase. The results show that NCp7 strongly activates the 5' to 3' DNA strand transfer during reverse transcription while a basic peptide resembling NCp7 is inactive. Activation of the first transfer by several NCp7 derived peptides and the influence of the terminal redundancies (R) present at the 5' and 3' ends of HIV1 RNA were also examined. The first transfer is optimal in the presence of intact NCp7 and necessitates R on both the 5' and 3' RNAs. Sequencing of full length viral DNA products reveals approximately 40% misincorporations at the first nucleotide beyond the transfer point. If such base misincorporations occur during proviral DNA synthesis with possible homologous recombinations it may well contribute to the high level of genetic variability of HIV.
-
DNA nanosensor based on biocompatible graphene quantum dots and carbon nanotubes.
Qian, Zhao Sheng; Shan, Xiao Yue; Chai, Lu Jing; Ma, Juan Juan; Chen, Jian Rong; Feng, Hui
2014-10-15
An ultrasensitive nanosensor based on fluorescence resonance energy transfer (FRET) between biocompatible graphene quantum dots and carbon nanotubes for DNA detection was reported. We take advantage of good biocompatibility and strong fluorescence of graphene quantum dots, base pairing specificity of DNA and unique fluorescence resonance energy transfer between graphene quantum dots and carbon nanotubes to achieve the analysis of low concentrations of DNA. Graphene quantum dots with high quantum yield up to 0.20 were prepared and served as the fluorophore of DNA probe. FRET process between graphene quantum dots-labeled probe and oxidized carbon nanotubes is easily achieved due to their efficient self-assembly through specific π-π interaction. This nanosensor can distinguish complementary and mismatched nucleic acid sequences with high sensitivity and good reproducibility. The detection method based on this nanosensor possesses a broad linear span of up to 133.0 nM and ultralow detection limit of 0.4 nM. The constructed nanosensor is expected to be highly biocompatible because of all its components with excellent biocompatibility. Copyright © 2014 Elsevier B.V. All rights reserved.
-
NASA Astrophysics Data System (ADS)
Fu, Jinglin; Yang, Yuhe Renee; Johnson-Buck, Alexander; Liu, Minghui; Liu, Yan; Walter, Nils G.; Woodbury, Neal W.; Yan, Hao
2014-07-01
Swinging arms are a key functional component of multistep catalytic transformations in many naturally occurring multi-enzyme complexes. This arm is typically a prosthetic chemical group that is covalently attached to the enzyme complex via a flexible linker, allowing the direct transfer of substrate molecules between multiple active sites within the complex. Mimicking this method of substrate channelling outside the cellular environment requires precise control over the spatial parameters of the individual components within the assembled complex. DNA nanostructures can be used to organize functional molecules with nanoscale precision and can also provide nanomechanical control. Until now, protein-DNA assemblies have been used to organize cascades of enzymatic reactions by controlling the relative distance and orientation of enzymatic components or by facilitating the interface between enzymes/cofactors and electrode surfaces. Here, we show that a DNA nanostructure can be used to create a multi-enzyme complex in which an artificial swinging arm facilitates hydride transfer between two coupled dehydrogenases. By exploiting the programmability of DNA nanostructures, key parameters including position, stoichiometry and inter-enzyme distance can be manipulated for optimal activity.
-
Fu, Jinglin; Yang, Yuhe Renee; Johnson-Buck, Alexander; Liu, Minghui; Liu, Yan; Walter, Nils G; Woodbury, Neal W; Yan, Hao
2014-07-01
Swinging arms are a key functional component of multistep catalytic transformations in many naturally occurring multi-enzyme complexes. This arm is typically a prosthetic chemical group that is covalently attached to the enzyme complex via a flexible linker, allowing the direct transfer of substrate molecules between multiple active sites within the complex. Mimicking this method of substrate channelling outside the cellular environment requires precise control over the spatial parameters of the individual components within the assembled complex. DNA nanostructures can be used to organize functional molecules with nanoscale precision and can also provide nanomechanical control. Until now, protein-DNA assemblies have been used to organize cascades of enzymatic reactions by controlling the relative distance and orientation of enzymatic components or by facilitating the interface between enzymes/cofactors and electrode surfaces. Here, we show that a DNA nanostructure can be used to create a multi-enzyme complex in which an artificial swinging arm facilitates hydride transfer between two coupled dehydrogenases. By exploiting the programmability of DNA nanostructures, key parameters including position, stoichiometry and inter-enzyme distance can be manipulated for optimal activity.
-
Mitochondrial Transfer by Photothermal Nanoblade Restores Metabolite Profile in Mammalian Cells.
Wu, Ting-Hsiang; Sagullo, Enrico; Case, Dana; Zheng, Xin; Li, Yanjing; Hong, Jason S; TeSlaa, Tara; Patananan, Alexander N; McCaffery, J Michael; Niazi, Kayvan; Braas, Daniel; Koehler, Carla M; Graeber, Thomas G; Chiou, Pei-Yu; Teitell, Michael A
2016-05-10
mtDNA sequence alterations are challenging to generate but desirable for basic studies and potential correction of mtDNA diseases. Here, we report a new method for transferring isolated mitochondria into somatic mammalian cells using a photothermal nanoblade, which bypasses endocytosis and cell fusion. The nanoblade rescued the pyrimidine auxotroph phenotype and respiration of ρ0 cells that lack mtDNA. Three stable isogenic nanoblade-rescued clones grown in uridine-free medium showed distinct bioenergetics profiles. Rescue lines 1 and 3 reestablished nucleus-encoded anapleurotic and catapleurotic enzyme gene expression patterns and had metabolite profiles similar to the parent cells from which the ρ0 recipient cells were derived. By contrast, rescue line 2 retained a ρ0 cell metabolic phenotype despite growth in uridine-free selection. The known influence of metabolite levels on cellular processes, including epigenome modifications and gene expression, suggests metabolite profiling can help assess the quality and function of mtDNA-modified cells. Copyright © 2016 Elsevier Inc. All rights reserved.
-
Optimisation of intradermal DNA electrotransfer for immunisation.
Vandermeulen, Gaëlle; Staes, Edith; Vanderhaeghen, Marie Lise; Bureau, Michel Francis; Scherman, Daniel; Préat, Véronique
2007-12-04
The development of DNA vaccines requires appropriate delivery technologies. Electrotransfer is one of the most efficient methods of non-viral gene transfer. In the present study, intradermal DNA electrotransfer was first optimised. Strong effects of the injection method and the dose of DNA on luciferase expression were demonstrated. Pre-treatments were evaluated to enhance DNA diffusion in the skin but neither hyaluronidase injection nor iontophoresis improved efficiency of intradermal DNA electrotransfer. Then, DNA immunisation with a weakly immunogenic model antigen, luciferase, was investigated. After intradermal injection of the plasmid encoding luciferase, electrotransfer (HV 700 V/cm 100 micros, LV 200 V/cm 400 ms) was required to induce immune response. The response was Th1-shifted compared to immunisation with the luciferase recombinant protein. Finally, DNA electrotransfer in the skin, the muscle or the ear pinna was compared. Muscle DNA electrotransfer resulted in the highest luciferase expression and the best IgG response. Nevertheless electrotransfer into the skin, the muscle and the ear pinna all resulted in IFN-gamma secretion by luciferase-stimulated splenocytes suggesting that an efficient Th1 response was induced in all case.
-
Zhang, Hongyan; Lv, Jie; Jia, Zhenhong
2017-01-01
A novel assembled biosensor was prepared for detecting 16S rRNA, a small-size persistent specific for Actinobacteria. The mechanism of the porous silicon (PS) photonic crystal biosensor is based on the fluorescence resonance energy transfer (FRET) between quantum dots (QDs) and gold nanoparticles (AuNPs) through DNA hybridization, where QDs act as an emission donor and AuNPs serve as a fluorescence quencher. Results showed that the photoluminescence (PL) intensity of PS photonic crystal was drastically increased when the QDs-conjugated probe DNA was adhered to the PS layer by surface modification using a standard cross-link chemistry method. The PL intensity of QDs was decreased when the addition of AuNPs-conjugated complementary 16S rRNA was dropped onto QDs-conjugated PS. Based on the analysis of different target DNA concentration, it was found that the decrease of the PL intensity showed a good linear relationship with complementary DNA concentration in a range from 0.25 to 10 μM, and the detection limit was 328.7 nM. Such an optical FRET biosensor functions on PS-based photonic crystal for DNA detection that differs from the traditional FRET, which is used only in liquid. This method will benefit the development of a new optical FRET label-free biosensor on Si substrate and has great potential in biochips based on integrated optical devices. PMID:28489033
-
Dang, Que; Hu, Wei-Shau
2001-01-01
Homology between the two repeat (R) regions in the retroviral genome mediates minus-strand DNA transfer during reverse transcription. We sought to define the effects of R homology lengths on minus-strand DNA transfer. We generated five murine leukemia virus (MLV)-based vectors that contained identical sequences but different lengths of the 3′ R (3, 6, 12, 24 and 69 nucleotides [nt]); 69 nt is the full-length MLV R. After one round of replication, viral titers from the vector with a full-length downstream R were compared with viral titers generated from the other four vectors with reduced R lengths. Viral titers generated from vectors with R lengths reduced to one-third (24 nt) or one-sixth (12 nt) that of the wild type were not significantly affected; however, viral titers generated from vectors with only 3- or 6-nt homology in the R region were significantly lower. Because expression and packaging of the RNA were similar among all the vectors, the differences in the viral titers most likely reflected the impact of the homology lengths on the efficiency of minus-strand DNA transfer. The molecular nature of minus-strand DNA transfer was characterized in 63 proviruses. Precise R-to-R transfer was observed in most proviruses generated from vectors with 12-, 24-, or 69-nt homology in R, whereas aberrant transfers were predominantly used to generate proviruses from vectors with 3- or 6-nt homology. Reverse transcription using RNA transcribed from an upstream promoter, termed read-in RNA transcripts, resulted in most of the aberrant transfers. These data demonstrate that minus-strand DNA transfer is homology driven and a minimum homology length is required for accurate and efficient minus-strand DNA transfer. PMID:11134294
-
Elbeik, Tarek; Markowitz, Norman; Nassos, Patricia; Kumar, Uday; Beringer, Scott; Haller, Barbara; Ng, Valerie
2004-01-01
Branched DNA (bDNA) assays to quantify human immunodeficiency virus type 1 (HIV-1) and hepatitis C virus (HCV) consist of three distinct steps, including sample processing, hybridization, and detection, and utilize the System 340 platform for plate incubation and washing. Sample processing differs: HIV-1 from 1 ml of plasma is concentrated by high-speed centrifugation, whereas HCV plasma or serum samples are used without concentration. The first step of hybridization involves viral lysis at 63°C: HIV-1 is performed in a heat block, whereas HCV is performed in System 340. The remaining hybridization and detection steps are similar for HIV-1 and HCV and executed on System 340. In the present study, the HIV-1 bDNA assay was adapted for viral lysis in the System 340 platform. The adaptation, test method 2, includes a 20-s vortex of concentrated viral pellet and lysis working solution, transfer of viral lysate to the 96-well capture plate, and transfer to System 340 programmed for HCV assay specifications. With test method 2, specificity and quantification were within assay specifications. HCV bDNA methodology remains unchanged. Hence, an HIV-1 and an HCV bDNA can be run simultaneously on System 340. With simultaneous testing, laboratories can run full plates, as well as combinations of full and partial plates. Also, simultaneous HIV-1 and HCV bDNA permits labor consolidation and improved workflow while maintaining multitasking and rapid patient result turnaround. PMID:15243070
-
Elbeik, Tarek; Markowitz, Norman; Nassos, Patricia; Kumar, Uday; Beringer, Scott; Haller, Barbara; Ng, Valerie
2004-07-01
Branched DNA (bDNA) assays to quantify human immunodeficiency virus type 1 (HIV-1) and hepatitis C virus (HCV) consist of three distinct steps, including sample processing, hybridization, and detection, and utilize the System 340 platform for plate incubation and washing. Sample processing differs: HIV-1 from 1 ml of plasma is concentrated by high-speed centrifugation, whereas HCV plasma or serum samples are used without concentration. The first step of hybridization involves viral lysis at 63 degrees C: HIV-1 is performed in a heat block, whereas HCV is performed in System 340. The remaining hybridization and detection steps are similar for HIV-1 and HCV and executed on System 340. In the present study, the HIV-1 bDNA assay was adapted for viral lysis in the System 340 platform. The adaptation, test method 2, includes a 20-s vortex of concentrated viral pellet and lysis working solution, transfer of viral lysate to the 96-well capture plate, and transfer to System 340 programmed for HCV assay specifications. With test method 2, specificity and quantification were within assay specifications. HCV bDNA methodology remains unchanged. Hence, an HIV-1 and an HCV bDNA can be run simultaneously on System 340. With simultaneous testing, laboratories can run full plates, as well as combinations of full and partial plates. Also, simultaneous HIV-1 and HCV bDNA permits labor consolidation and improved workflow while maintaining multitasking and rapid patient result turnaround.
-
Martinez-Serra, Jordi; Robles, Juan; Nicolàs, Antoni; Gutierrez, Antonio; Ros, Teresa; Amat, Juan Carlos; Alemany, Regina; Vögler, Oliver; Abelló, Aina; Noguera, Aina; Besalduch, Joan
2014-01-01
Blood samples are extensively used for the molecular diagnosis of many hematological diseases. The daily practice in a clinical laboratory of molecular diagnosis in hematology involves using a variety of techniques, based on the amplification of nucleic acids. Current methods for polymerase chain reaction (PCR) use purified genomic DNA, mostly isolated from total peripheral blood cells or white blood cells (WBC). In this paper we describe a real-time fluorescence resonance energy transfer-based method for genotyping directly from blood cells. Our strategy is based on an initial isolation of the WBCs, allowing the removal of PCR inhibitors, such as the heme group, present in the erythrocytes. Once the erythrocytes have been lysed, in the LightCycler(®) 2.0 Instrument, we perform a real-time PCR followed by a melting curve analysis for different genes (Factors 2, 5, 12, MTHFR, and HFE). After testing 34 samples comparing the real-time crossing point (CP) values between WBC (5×10(6) WBC/mL) and purified DNA (20 ng/μL), the results for F5 Leiden were as follows: CP mean value for WBC was 29.26±0.566 versus purified DNA 24.79±0.56. Thus, when PCR was performed from WBC (5×10(6) WBC/mL) instead of DNA (20 ng/μL), we observed a delay of about 4 cycles. These small differences in CP values were similar for all genes tested and did not significantly affect the subsequent analysis by melting curves. In both cases the fluorescence values were high enough, allowing a robust genotyping of all these genes without a previous DNA purification/extraction.
-
NASA Astrophysics Data System (ADS)
Reddy, M. Siva Pratap; Park, Herie; Lee, Jung-Hee
2018-02-01
In this work, we present a residue-and-polymer-free graphene transfer method by using the adhesive force between graphene and a target substrate, the hydrophobic property of graphene, and the surface tension of the solutions. We used an n-type GaN substrate as the target substrate to make a photodiode (PD). Recently, the inclusion of biomolecules in photodetection technology has attracted considerable attention in the electronics and photonics research, particularly due to the rapid evolution of organic-inorganic bio-hybrid PDs (Bio-HPDs). This report presents a significant photoresponse of the bioinspired graphene-based PD fabricated with deoxyribonucleic acid-cetyltrimetylammonium chloride (DNA-CTMA) biomolecules on the n-type GaN substrate. Bio-HPDs respond to the infrared, visible, and ultraviolet wavelengths. Moreover, the Bio-HPDs show photosensitivities (Iphoto/Idark) of 21, 143, and 1194 for infrared, visible, and ultraviolet wavebands, respectively, which can be attributed to the integration of high-mobility graphene and photosensitive DNA-CTMA biomolecules. In addition, the corresponding charge transfer mechanisms in the PDs are explained by energy band diagrams.
-
NASA Astrophysics Data System (ADS)
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
-
Long-range energy transfer in self-assembled quantum dot-DNA cascades
NASA Astrophysics Data System (ADS)
Goodman, Samuel M.; Siu, Albert; Singh, Vivek; Nagpal, Prashant
2015-11-01
The size-dependent energy bandgaps of semiconductor nanocrystals or quantum dots (QDs) can be utilized in converting broadband incident radiation efficiently into electric current by cascade energy transfer (ET) between layers of different sized quantum dots, followed by charge dissociation and transport in the bottom layer. Self-assembling such cascade structures with angstrom-scale spatial precision is important for building realistic devices, and DNA-based QD self-assembly can provide an important alternative. Here we show long-range Dexter energy transfer in QD-DNA self-assembled single constructs and ensemble devices. Using photoluminescence, scanning tunneling spectroscopy, current-sensing AFM measurements in single QD-DNA cascade constructs, and temperature-dependent ensemble devices using TiO2 nanotubes, we show that Dexter energy transfer, likely mediated by the exciton-shelves formed in these QD-DNA self-assembled structures, can be used for efficient transport of energy across QD-DNA thin films.The size-dependent energy bandgaps of semiconductor nanocrystals or quantum dots (QDs) can be utilized in converting broadband incident radiation efficiently into electric current by cascade energy transfer (ET) between layers of different sized quantum dots, followed by charge dissociation and transport in the bottom layer. Self-assembling such cascade structures with angstrom-scale spatial precision is important for building realistic devices, and DNA-based QD self-assembly can provide an important alternative. Here we show long-range Dexter energy transfer in QD-DNA self-assembled single constructs and ensemble devices. Using photoluminescence, scanning tunneling spectroscopy, current-sensing AFM measurements in single QD-DNA cascade constructs, and temperature-dependent ensemble devices using TiO2 nanotubes, we show that Dexter energy transfer, likely mediated by the exciton-shelves formed in these QD-DNA self-assembled structures, can be used for efficient transport of energy across QD-DNA thin films. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr04778a
-
Weiskirchen, Ralf; Kneifel, Jens; Weiskirchen, Sabine; van de Leur, Eddy; Kunz, Dagmar; Gressner, Axel M
2000-01-01
Background The hepatic stellate cell is the primary cell type responsible for the excessive formation and deposition of connective tissue elements during the development of hepatic fibrosis in chronically injured liver. Culturing quiescent hepatic stellate cells on plastic causes spontaneous activation leading to a myofibroblastic phenotype similar to that seen in vivo. This provides a simple model system for studying activation and transdifferentiation of these cells. The introduction of exogenous DNA into these cells is discussed controversially mainly due to the lack of systematic analysis. Therefore, we examined comparatively five nonviral, lipid-mediated gene transfer methods and adenoviral based infection, as potential tools for efficient delivery of DNA to rat hepatic stellate cells and their transdifferentiated counterpart, i.e. myofibroblasts. Transfection conditions were determined using enhanced green fluorescent protein as a reporter expressed under the transcriptional control of the human cytomegalovirus immediate early gene 1 promoter/enhancer. Results With the use of chemically enhanced transfection methods, the highest relative efficiency was obtained with FuGENE™6 gene mediated DNA transfer. Quantitative evaluation of representative transfection experiments by flow cytometry revealed that approximately 6% of the rat hepatic stellate cells were transfected. None of the transfection methods tested was able to mediate gene delivery to rat myofibroblasts. To analyze if rat hepatic stellate cells and myofibroblasts are susceptible to adenoviral infection, we have inserted the transgenic expression cassette into a recombinant adenoviral type 5 genome as replacement for the E1 region. Viral particles of this replication-deficient Ad5-based reporter are able to infect 100% of rat hepatic stellate cells and myofibroblasts, respectively. Conclusions Our results indicate that FuGENE™6-based methods may be optimized sufficiently to offer a feasible approach for gene transfer into rat hepatic stellate cells. The data further demonstrate that adenoviral mediated transfer is a promising approach for gene delivery to these hepatic cells. PMID:11178102
-
Characterization of Adipose Tissue Product Quality Using Measurements of Oxygen Consumption Rate.
Suszynski, Thomas M; Sieber, David A; Mueller, Kathryn; Van Beek, Allen L; Cunningham, Bruce L; Kenkel, Jeffrey M
2018-03-14
Fat grafting is a common procedure in plastic surgery but associated with unpredictable graft retention. Adipose tissue (AT) "product" quality is affected by the methods used for harvest, processing and transfer, which vary widely amongst surgeons. Currently, there is no method available to accurately assess the quality of AT. In this study, we present a novel method for the assessment of AT product quality through direct measurements of oxygen consumption rate (OCR). OCR has exhibited potential in predicting outcomes following pancreatic islet transplant. Our study aim was to reapportion existing technology for its use with AT preparations and to confirm that these measurements are feasible. OCR was successfully measured for en bloc and postprocessed AT using a stirred microchamber system. OCR was then normalized to DNA content (OCR/DNA), which represents the AT product quality. Mean (±SE) OCR/DNA values for fresh en bloc and post-processed AT were 149.8 (± 9.1) and 61.1 (± 6.1) nmol/min/mg DNA, respectively. These preliminary data suggest that: (1) OCR and OCR/DNA measurements of AT harvested using conventional protocol are feasible; and (2) standard AT processing results in a decrease in overall AT product quality. OCR measurements of AT using existing technology can be done and enables accurate, real-time, quantitative assessment of the quality of AT product prior to transfer. The availability and further validation of this type of assay could enable optimization of fat grafting protocol by providing a tool for the more detailed study of procedural variables that affect AT product quality.
-
NASA Astrophysics Data System (ADS)
Yunfang, Jia; Cheng, Ju
2016-01-01
The graphene field effect transistor (GFET) has been widely studied and developed as sensors and functional devices. The first report about GFET sensing simulation on the device level is proposed. The GFET's characteristics, its responding for single strand DNA (ssDNA) and hybridization with the complimentary DNA (cDNA) are simulated based on Sentaurus, a popular CAD tool for electronic devices. The agreement between the simulated blank GFET feature and the reported experimental data suggests the feasibility of the presented simulation method. Then the simulations of ssDNA immobilization on GFET and hybridization with its cDNA are performed, the results are discussed based on the electron transfer (ET) mechanism between DNA and graphene. Project supported by the National Natural Science Foundation of China (No. 61371028) and the Tianjin Natural Science Foundation (No. 12JCZDJC22400).
-
Horizontal Gene Transfer and the History of Life
Daubin, Vincent; Szöllősi, Gergely J.
2016-01-01
Microbes acquire DNA from a variety of sources. The last decades, which have seen the development of genome sequencing, have revealed that horizontal gene transfer has been a major evolutionary force that has constantly reshaped genomes throughout evolution. However, because the history of life must ultimately be deduced from gene phylogenies, the lack of methods to account for horizontal gene transfer has thrown into confusion the very concept of the tree of life. As a result, many questions remain open, but emerging methodological developments promise to use information conveyed by horizontal gene transfer that remains unexploited today. PMID:26801681
-
Grote, Mathias
2008-01-01
Plasmids are non-chromosomal hereditary determinants, mostly found in prokaryotes. Whereas Joshua Lederberg coined the term "plasmid" as early as 1952, today's concept was not established until the early 1970s. In this eclipse period, the plasmid's place was taken by the episome, following the 1958 publication of Elie Wollman and François Jacob. This paper analyzes the transition from the episome to a renewed plasmid concept both on the experimental and the conceptual level. It will become clear that intergeneric transfer experiments were central to this development. These studies rely on conjugational transfer of extrachromosomal hereditary determinants between different bacterial genera. First, experimental systems employing intergeneric transfer shaped the new plasmid by enabling its representation as a species of circular DNA. Moreover, they had a destabilizing effect on the episome, leading to a crisis in the concepts of microbial genetics towards the end of the 1960s. The new plasmid then became one of the cornerstones of recombinant DNA technologies. In an historic perspective, intergeneric transfer experiments indicate a gradual transition of molecular biology from its early "analytic" to the "synthetic" phase of genetic engineering. Hence, the construction of genetic hybrids in vivo as epitomized in the studies shown here marks an intermediate state that one could designate as "recombinant DNA avant la lettre".
-
Single cells for forensic DNA analysis--from evidence material to test tube.
Brück, Simon; Evers, Heidrun; Heidorn, Frank; Müller, Ute; Kilper, Roland; Verhoff, Marcel A
2011-01-01
The purpose of this project was to develop a method that, while providing morphological quality control, allows single cells to be obtained from the surfaces of various evidence materials and be made available for DNA analysis in cases where only small amounts of cell material are present or where only mixed traces are found. With the SteREO Lumar.V12 stereomicroscope and UV unit from Zeiss, it was possible to detect and assess single epithelial cells on the surfaces of various objects (e.g., glass, plastic, metal). A digitally operated micromanipulator developed by aura optik was used to lift a single cell from the surface of evidence material and to transfer it to a conventional PCR tube or to an AmpliGrid(®) from Advalytix. The actual lifting of the cells was performed with microglobes that acted as carriers. The microglobes were held with microtweezers and were transferred to the DNA analysis receptacles along with the adhering cells. In a next step, the PCR can be carried out in this receptacle without removing the microglobe. Our method allows a single cell to be isolated directly from evidence material and be made available for forensic DNA analysis. © 2010 American Academy of Forensic Sciences.
-
Dong, Lan-Feng; Kovarova, Jaromira; Bajzikova, Martina; Bezawork-Geleta, Ayenachew; Svec, David; Endaya, Berwini; Sachaphibulkij, Karishma; Coelho, Ana R; Sebkova, Natasa; Ruzickova, Anna; Tan, An S; Kluckova, Katarina; Judasova, Kristyna; Zamecnikova, Katerina; Rychtarcikova, Zuzana; Gopalan, Vinod; Andera, Ladislav; Sobol, Margarita; Yan, Bing; Pattnaik, Bijay; Bhatraju, Naveen; Truksa, Jaroslav; Stopka, Pavel; Hozak, Pavel; Lam, Alfred K; Sedlacek, Radislav; Oliveira, Paulo J; Kubista, Mikael; Agrawal, Anurag; Dvorakova-Hortova, Katerina; Rohlena, Jakub; Berridge, Michael V; Neuzil, Jiri
2017-02-15
Recently, we showed that generation of tumours in syngeneic mice by cells devoid of mitochondrial (mt) DNA (ρ 0 cells) is linked to the acquisition of the host mtDNA. However, the mechanism of mtDNA movement between cells remains unresolved. To determine whether the transfer of mtDNA involves whole mitochondria, we injected B16ρ 0 mouse melanoma cells into syngeneic C57BL/6N su9-DsRed2 mice that express red fluorescent protein in their mitochondria. We document that mtDNA is acquired by transfer of whole mitochondria from the host animal, leading to normalisation of mitochondrial respiration. Additionally, knockdown of key mitochondrial complex I (NDUFV1) and complex II (SDHC) subunits by shRNA in B16ρ 0 cells abolished or significantly retarded their ability to form tumours. Collectively, these results show that intact mitochondria with their mtDNA payload are transferred in the developing tumour, and provide functional evidence for an essential role of oxidative phosphorylation in cancer.
-
Quantitative Analysis of HIV-1 Preintegration Complexes
Engelman, Alan; Oztop, Ilker; Vandegraaff, Nick; Raghavendra, Nidhanapati K.
2009-01-01
Retroviral replication proceeds through the formation of a provirus, an integrated DNA copy of the viral RNA genome. The linear cDNA product of reverse transcription is the integration substrate and two different integrase activities, 3′ processing and DNA strand transfer, are required for provirus formation. Integrase nicks the cDNA ends adjacent to phylogenetically-conserved CA dinucleotides during 3′ processing. After nuclear entry and locating a suitable chromatin acceptor site, integrase joins the recessed 3′-OHs to the 5′-phosphates of a double-stranded staggered cut in the DNA target. Integrase functions in the context of a large nucleoprotein complex, called the preintegration complex (PIC), and PICs are analyzed to determine levels of integrase 3′ processing and DNA strand transfer activities that occur during acute virus infection. Denatured cDNA end regions are monitored by indirect end-labeling to measure the extent of 3′ processing. Native PICs can efficiently integrate their viral cDNA into exogenously added target DNA in vitro, and Southern blotting or nested PCR assays are used to quantify the resultant DNA strand transfer activity. This study details HIV-1 infection, PIC extraction, partial purification, and quantitative analyses of integrase 3′ processing and DNA strand transfer activities. PMID:19233280
-
Pornruseetriratn, Siritavee; Maipanich, Wanna; Sa-nguankiat, Surapol; Pubampen, Somchit; Poodeepiyasawat, Akkarin; Thaenkham, Urusa
2017-01-01
Taenia solium, T. saginata, and T. asiatica are cestode pathogens causing taeniasis in humans. Houseflies can transfer Taenia eggs to food. However, houseflies are thought to carry only small numbers of Taenia eggs, sometimes fewer than 10. Although several PCR-based methods have been developed to detect Taenia DNA, these require more than 10 eggs for adequate detection. We developed a multiplex PCR method with high specificity for the discrimination among the eggs of the three Taenia species, T. solium, T. saginata, and T. asiatica, using 18S ribosomal DNA (rDNA) as a genetic marker. This technique was found to be highly sensitive, capable of identifying the Taenia species from only one egg. This multiplex PCR technique using 18S rDNA specific primers should be suitable to diagnose Taenia eggs.
-
Kuznetsova, Alexandra A; Kuznetsov, Nikita A; Ishchenko, Alexander A; Saparbaev, Murat K; Fedorova, Olga S
2014-10-01
DNA glycosylases remove the modified, damaged or mismatched bases from the DNA by hydrolyzing the N-glycosidic bonds. Some enzymes can further catalyze the incision of a resulting abasic (apurinic/apyrimidinic, AP) site through β- or β,δ-elimination mechanisms. In most cases, the incision reaction of the AP-site is catalyzed by special enzymes called AP-endonucleases. Here, we report the kinetic analysis of the mechanisms of modified DNA transfer from some DNA glycosylases to the AP endonuclease, APE1. The modified DNA contained the tetrahydrofurane residue (F), the analogue of the AP-site. DNA glycosylases AAG, OGG1, NEIL1, MBD4(cat) and UNG from different structural superfamilies were used. We found that all DNA glycosylases may utilise direct protein-protein interactions in the transient ternary complex for the transfer of the AP-containing DNA strand to APE1. We hypothesize a fast "flip-flop" exchange mechanism of damaged and undamaged DNA strands within this complex for monofunctional DNA glycosylases like MBD4(cat), AAG and UNG. Bifunctional DNA glycosylase NEIL1 creates tightly specific complex with DNA containing F-site thereby efficiently competing with APE1. Whereas APE1 fast displaces other bifunctional DNA glycosylase OGG1 on F-site thereby induces its shifts to undamaged DNA regions. Kinetic analysis of the transfer of DNA between human DNA glycosylases and APE1 allows us to elucidate the critical step in the base excision repair pathway. Copyright © 2014 Elsevier B.V. All rights reserved.
-
SigHunt: horizontal gene transfer finder optimized for eukaryotic genomes.
Jaron, Kamil S; Moravec, Jiří C; Martínková, Natália
2014-04-15
Genomic islands (GIs) are DNA fragments incorporated into a genome through horizontal gene transfer (also called lateral gene transfer), often with functions novel for a given organism. While methods for their detection are well researched in prokaryotes, the complexity of eukaryotic genomes makes direct utilization of these methods unreliable, and so labour-intensive phylogenetic searches are used instead. We present a surrogate method that investigates nucleotide base composition of the DNA sequence in a eukaryotic genome and identifies putative GIs. We calculate a genomic signature as a vector of tetranucleotide (4-mer) frequencies using a sliding window approach. Extending the neighbourhood of the sliding window, we establish a local kernel density estimate of the 4-mer frequency. We score the number of 4-mer frequencies in the sliding window that deviate from the credibility interval of their local genomic density using a newly developed discrete interval accumulative score (DIAS). To further improve the effectiveness of DIAS, we select informative 4-mers in a range of organisms using the tetranucleotide quality score developed herein. We show that the SigHunt method is computationally efficient and able to detect GIs in eukaryotic genomes that represent non-ameliorated integration. Thus, it is suited to scanning for change in organisms with different DNA composition. Source code and scripts freely available for download at http://www.iba.muni.cz/index-en.php?pg=research-data-analysis-tools-sighunt are implemented in C and R and are platform-independent. 376090@mail.muni.cz or martinkova@ivb.cz. © The Author 2013. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
-
Cai, Jin; Han, Yu; Ren, Hongmei; Chen, Caiyu; He, Duofen; Zhou, Lin; Eisner, Gilbert M.; Asico, Laureano D.; Jose, Pedro A.; Zeng, Chunyu
2013-01-01
Extracellular vesicles (EVs) carry signals within or at their limiting membranes, providing a mechanism by which cells can exchange more complex information than what was previously thought. In addition to mRNAs and microRNAs, there are DNA fragments in EVs. Solexa sequencing indicated the presence of at least 16434 genomic DNA (gDNA) fragments in the EVs from human plasma. Immunofluorescence study showed direct evidence that acridine orange-stained EV DNAs could be transferred into the cells and localize to and inside the nuclear membrane. However, whether the transferred EV DNAs are functional or not is not clear. We found that EV gDNAs could be homologously or heterologously transferred from donor cells to recipient cells, and increase gDNA-coding mRNA, protein expression, and function (e.g. AT1 receptor). An endogenous promoter of the AT1 receptor, NF-κB, could be recruited to the transferred DNAs in the nucleus, and increase the transcription of AT1 receptor in the recipient cells. Moreover, the transferred EV gDNAs have pathophysiological significance. BCR/ABL hybrid gene, involved in the pathogenesis of chronic myeloid leukemia, could be transferred from K562 EVs to HEK293 cells or neutrophils. Our present study shows that the gDNAs transferred from EVs to cells have physiological significance, not only to increase the gDNA-coding mRNA and protein levels, but also to influence function in recipient cells. PMID:23580760
-
Identification and persistence of Pinus pollen DNA on cotton fabrics: A forensic application.
Schield, Cassandra; Campelli, Cassandra; Sycalik, Jennifer; Randle, Christopher; Hughes-Stamm, Sheree; Gangitano, David
2016-01-01
Advances in plant genomics have had an impact on the field of forensic botany. However, the use of pollen DNA profiling in forensic investigations has yet to be applied. Five volunteers wore a jacket with Pinus echinata pollen-containing cotton swatches for a 14-day period. Pollen decay was evaluated at days 0, 3, 6, 9 and 14 by microscopy. Pollen grains were then transferred to slides using a portable forensic vacuum handle. Ten single grains per swatch were isolated for DNA analysis. DNA was extracted using a high throughput extraction method. A nine-locus short tandem repeat (STR) multiplex system, including previously published primers from Pinus taeda, was developed. DNA was amplified by PCR using fluorescent dyes and analyzed by capillary electrophoresis. Pollen counts from cotton swatches in a 14-day period exhibited an exponential decay from 100% to 17%. The success rate of PCR amplification was 81.2%. Complete and partial STR profiles were generated from 250 pollen grains analyzed (44% and 37%, respectively). Due to the limited amount of DNA, drop-in events were observed (1.87%). However, the rate of contamination with pollen from other pine individuals originating from environmental sources was 4.4%. In conclusion, this study has shown that pollen can be a stable source of forensic DNA evidence, as a proof-of-principle, and that may persist on cotton clothing for at least 14 days of wear. This method can be applied in forensic cases where pollen grains larger than 10 μm (e.g., from herbs or trees) may be transferred to clothing (worn by suspect or victim) by primary contact. Copyright © 2015 The Chartered Society of Forensic Sciences. Published by Elsevier Ireland Ltd. All rights reserved.
-
Zhao, H; Teng, X M; Li, Y F
2017-11-25
Objective: To explore the relationship between the embryo with the different morphological types in the third day and its mitochondrial copy number, the membrane potential. Methods: Totally 117 embryos with poor development after normal fertilization and were not suitable transferred in the fresh cycle and 106 frozen embryos that were discarded voluntarily by infertility patients with in vitro fertilization-embryo transfer after successful pregnancy were selected. According to evaluation of international standard in embryos, all cleavage stage embryos were divided into class Ⅰ frozen embryo group ( n= 64), class Ⅱ frozen embryo group ( n= 42) and class Ⅲ fresh embryonic group (not transplanted embryos; n= 117). Real-time PCR and confocal microscopy methods were used to detect mitochondrial DNA (mtDNA) copy number and the mitochondrial membrane potential of a single embryo. The differences between embryo quality and mtDNA copy number and membrane potential of each group were compared. Results: The copy number of mtDNA and the mitochondrial membrane potential in class Ⅲ fresh embryonic group [(1.7±1.0)×10(5) copy/μl, 1.56±0.32] were significantly lower than those in class Ⅰ frozen embryo group [(3.4±1.7)×10(5) copy/μl, 2.66±0.21] and class Ⅱ frozen embryo group [(2.6±1.2)×10(5) copy/μl, 1.80±0.32; all P< 0.05]. The copy number of mtDNA and the mitochondrial membrane potential in classⅠ frozen embryo group were significantly higher than those in classⅡ frozen embryo group (both P< 0.05). Conclusion: The mtDNA copy number and the mitochondrial membrane potential of embryos of the better quality embryo are higher.
-
NASA Astrophysics Data System (ADS)
Rybenkov, Valentin V.
2016-09-01
The ability of living systems to defy thermodynamics without explicitly violating it is a continued source of inspiration to many biophysicists. The story of type-2 DNA topoisomerases is a beautiful example from that book. DNA topoisomerases catalyze a concerted DNA cleavage-religation reaction, which is interjected by a strand passage event. This sequence of events results in a seemingly unhindered transfer of one piece of DNA through another upon their random collision. An obvious consequence of such transfer is a change in the topological state of the colliding DNAs; hence the name of the enzymes, topoisomerases. There are several classes of topoisomerases, which differ in how they capture the cleaved and transported DNA segments (which are often referred to as the gate and transfer segments; or the G- and T-segments, to be short). Type-2 topoisomerases have two cleavage-religation centers. They open a gate in double stranded DNA and transfer another piece of double stranded DNA through it [1]. And in doing so, they manage to collect information about the rest of the DNA and perform strand passage in a directional manner so as to take the molecule away from the thermodynamic equilibrium [2].
-
Jones, R W; Ring, S; Tyfield, L; Hamvas, R; Simmons, H; Pembrey, M; Golding, J
2000-09-01
We describe a unique human DNA resource forming part of the Avon Longitudinal Study of Pregnancy and Childhood (ALSPAC), a longitudinal cohort study involving 14 000 children and their families living in a geographically defined area of England. The DNA bank will underpin the search for associations between genetic polymorphisms and common health outcomes. The opportunities to collect blood samples suitable for DNA extraction are necessarily limited, and the samples themselves have often been treated in different ways and have varied storage histories. With the need to maximise yields, the choice of DNA extraction method is critical to the success of the bank and we have investigated the suitability of various commercial and in-house methods of DNA extraction. Various steps have been taken to minimise errors in sample address and identification, including the use of a pipetting robot for dilution and transfer of samples between 96-well arrays to provide aliquots suitable for PCR. The robot has been programmed to cope with concentrated viscous DNA solutions.
-
Wallen, Rachel; Gokarn, Nirmal; Bercea, Priscila; Grzincic, Elissa; Bandyopadhyay, Krisanu
2015-12-01
Vertically aligned single-walled carbon nanotube (VASWCNT) assemblies are generated on cysteamine and 2-mercaptoethanol (2-ME)-functionalized gold surfaces through amide bond formation between carboxylic groups generated at the end of acid-shortened single-walled carbon nanotubes (SWCNTs) and amine groups present on the gold surfaces. Atomic force microscopy (AFM) imaging confirms the vertical alignment mode of SWCNT attachment through significant changes in surface roughness compared to bare gold surfaces and the lack of any horizontally aligned SWCNTs present. These SWCNT assemblies are further modified with an amine-terminated single-stranded probe-DNA. Subsequent hybridization of the surface-bound probe-DNA in the presence of complementary strands in solution is followed using impedance measurements in the presence of Fe(CN)6 (3-/4-) as the redox probe in solution, which show changes in the interfacial electrochemical properties, specifically the charge-transfer resistance, due to hybridization. In addition, hybridization of the probe-DNA is also compared when it is attached directly to the gold surfaces without any intermediary SWCNTs. Contrary to our expectations, impedance measurements show a decrease in charge-transfer resistance with time due to hybridization with 300 nM complementary DNA in solution with the probe-DNA attached to SWCNTs. In contrast, an increase in charge-transfer resistance is observed with time during hybridization when the probe-DNA is attached directly to the gold surfaces. The decrease in charge-transfer resistance during hybridization in the presence of VASWCNTs indicates an enhancement in the electron transfer process of the redox probe at the VASWCNT-modified electrode. The results suggest that VASWCNTs are acting as mediators of electron transfer, which facilitate the charge transfer of the redox probe at the electrode-solution interface.
-
NASA Astrophysics Data System (ADS)
Wallen, Rachel; Gokarn, Nirmal; Bercea, Priscila; Grzincic, Elissa; Bandyopadhyay, Krisanu
2015-06-01
Vertically aligned single-walled carbon nanotube (VASWCNT) assemblies are generated on cysteamine and 2-mercaptoethanol (2-ME)-functionalized gold surfaces through amide bond formation between carboxylic groups generated at the end of acid-shortened single-walled carbon nanotubes (SWCNTs) and amine groups present on the gold surfaces. Atomic force microscopy (AFM) imaging confirms the vertical alignment mode of SWCNT attachment through significant changes in surface roughness compared to bare gold surfaces and the lack of any horizontally aligned SWCNTs present. These SWCNT assemblies are further modified with an amine-terminated single-stranded probe-DNA. Subsequent hybridization of the surface-bound probe-DNA in the presence of complementary strands in solution is followed using impedance measurements in the presence of Fe(CN)6 3-/4- as the redox probe in solution, which show changes in the interfacial electrochemical properties, specifically the charge-transfer resistance, due to hybridization. In addition, hybridization of the probe-DNA is also compared when it is attached directly to the gold surfaces without any intermediary SWCNTs. Contrary to our expectations, impedance measurements show a decrease in charge-transfer resistance with time due to hybridization with 300 nM complementary DNA in solution with the probe-DNA attached to SWCNTs. In contrast, an increase in charge-transfer resistance is observed with time during hybridization when the probe-DNA is attached directly to the gold surfaces. The decrease in charge-transfer resistance during hybridization in the presence of VASWCNTs indicates an enhancement in the electron transfer process of the redox probe at the VASWCNT-modified electrode. The results suggest that VASWCNTs are acting as mediators of electron transfer, which facilitate the charge transfer of the redox probe at the electrode-solution interface.
-
NASA Astrophysics Data System (ADS)
Pihlasalo, S.; Mariani, L.; Härmä, H.
2016-03-01
Homogeneous simple assays utilizing luminescence quenching and time-resolved luminescence resonance energy transfer (TR-LRET) were developed for the quantification of nucleic acids without sequence information. Nucleic acids prevent the adsorption of a protein to europium nanoparticles which is detected as a luminescence quenching of europium nanoparticles with a soluble quencher or as a decrease of TR-LRET from europium nanoparticles to the acceptor dye. Contrary to the existing methods based on fluorescent dye binding to nucleic acids, equal sensitivities for both single- (ssDNA) and double-stranded DNA (dsDNA) were measured and a detection limit of 60 pg was calculated for the quenching assay. The average coefficient of variation was 5% for the quenching assay and 8% for the TR-LRET assay. The TR-LRET assay was also combined with a nucleic acid dye selective to dsDNA in a single tube assay to measure the total concentration of DNA and the ratio of ssDNA and dsDNA in the mixture. To our knowledge, such a multiplexed assay is not accomplished with commercially available assays.Homogeneous simple assays utilizing luminescence quenching and time-resolved luminescence resonance energy transfer (TR-LRET) were developed for the quantification of nucleic acids without sequence information. Nucleic acids prevent the adsorption of a protein to europium nanoparticles which is detected as a luminescence quenching of europium nanoparticles with a soluble quencher or as a decrease of TR-LRET from europium nanoparticles to the acceptor dye. Contrary to the existing methods based on fluorescent dye binding to nucleic acids, equal sensitivities for both single- (ssDNA) and double-stranded DNA (dsDNA) were measured and a detection limit of 60 pg was calculated for the quenching assay. The average coefficient of variation was 5% for the quenching assay and 8% for the TR-LRET assay. The TR-LRET assay was also combined with a nucleic acid dye selective to dsDNA in a single tube assay to measure the total concentration of DNA and the ratio of ssDNA and dsDNA in the mixture. To our knowledge, such a multiplexed assay is not accomplished with commercially available assays. Electronic supplementary information (ESI) available: The labeling of amino modified polystyrene nanoparticles with Eu3+ chelate and the experimental details and results for the optimization of nucleic acid binding protein and for the ratiometric measurement of DNA and RNA with quenching assay. See DOI: 10.1039/c5nr09252c
-
DNA-imprinted polymer nanoparticles with monodispersity and prescribed DNA-strand patterns
NASA Astrophysics Data System (ADS)
Trinh, Tuan; Liao, Chenyi; Toader, Violeta; Barłóg, Maciej; Bazzi, Hassan S.; Li, Jianing; Sleiman, Hanadi F.
2018-02-01
As colloidal self-assembly increasingly approaches the complexity of natural systems, an ongoing challenge is to generate non-centrosymmetric structures. For example, patchy, Janus or living crystallization particles have significantly advanced the area of polymer assembly. It has remained difficult, however, to devise polymer particles that associate in a directional manner, with controlled valency and recognition motifs. Here, we present a method to transfer DNA patterns from a DNA cage to a polymeric nanoparticle encapsulated inside the cage in three dimensions. The resulting DNA-imprinted particles (DIPs), which are 'moulded' on the inside of the DNA cage, consist of a monodisperse crosslinked polymer core with a predetermined pattern of different DNA strands covalently 'printed' on their exterior, and further assemble with programmability and directionality. The number, orientation and sequence of DNA strands grafted onto the polymeric core can be controlled during the process, and the strands are addressable independently of each other.
-
Polymer multilayer tattooing for enhanced DNA vaccination
NASA Astrophysics Data System (ADS)
Demuth, Peter C.; Min, Younjin; Huang, Bonnie; Kramer, Joshua A.; Miller, Andrew D.; Barouch, Dan H.; Hammond, Paula T.; Irvine, Darrell J.
2013-04-01
DNA vaccines have many potential benefits but have failed to generate robust immune responses in humans. Recently, methods such as in vivo electroporation have demonstrated improved performance, but an optimal strategy for safe, reproducible, and pain-free DNA vaccination remains elusive. Here we report an approach for rapid implantation of vaccine-loaded polymer films carrying DNA, immune-stimulatory RNA, and biodegradable polycations into the immune-cell-rich epidermis, using microneedles coated with releasable polyelectrolyte multilayers. Films transferred into the skin following brief microneedle application promoted local transfection and controlled the persistence of DNA and adjuvants in the skin from days to weeks, with kinetics determined by the film composition. These ‘multilayer tattoo’ DNA vaccines induced immune responses against a model HIV antigen comparable to electroporation in mice, enhanced memory T-cell generation, and elicited 140-fold higher gene expression in non-human primate skin than intradermal DNA injection, indicating the potential of this strategy for enhancing DNA vaccination.
-
Hanhineva, Kati J; Kärenlampi, Sirpa O
2007-01-01
Background Strawberry (Fragaria × ananassa) is an economically important soft fruit crop with polyploid genome which complicates the breeding of new cultivars. For certain traits, genetic engineering offers a potential alternative to traditional breeding. However, many strawberry varieties are quite recalcitrant for Agrobacterium-mediated transformation, and a method allowing easy handling of large amounts of starting material is needed. Also the genotyping of putative transformants is challenging since the isolation of DNA for Southern analysis is difficult due to the high amount of phenolic compounds and polysaccharides that complicate efficient extraction of digestable DNA. There is thus a need to apply a screening method that is sensitive and unambiguous in identifying the different transformation events. Results Hygromycin-resistant strawberries were developed in temporary immersion bioreactors by Agrobacterium-mediated gene transfer. Putative transformants were screened by TAIL-PCR to verify T-DNA integration and to distinguish between the individual transformation events. Several different types of border sequence arrangements were detected. Conclusion This study demonstrates that temporary immersion bioreactor system suits well for the regeneration of transgenic strawberry plants as a labour-efficient technique. Small amount of DNA required by TAIL-PCR is easily recovered even from a small transformant, which allows rapid verification of T-DNA integration and detection of separate gene transfer events. These techniques combined clearly facilitate the generation of transgenic strawberries but should be applicable to other plants as well. PMID:17309794
-
A new computational method for the detection of horizontal gene transfer events.
Tsirigos, Aristotelis; Rigoutsos, Isidore
2005-01-01
In recent years, the increase in the amounts of available genomic data has made it easier to appreciate the extent by which organisms increase their genetic diversity through horizontally transferred genetic material. Such transfers have the potential to give rise to extremely dynamic genomes where a significant proportion of their coding DNA has been contributed by external sources. Because of the impact of these horizontal transfers on the ecological and pathogenic character of the recipient organisms, methods are continuously sought that are able to computationally determine which of the genes of a given genome are products of transfer events. In this paper, we introduce and discuss a novel computational method for identifying horizontal transfers that relies on a gene's nucleotide composition and obviates the need for knowledge of codon boundaries. In addition to being applicable to individual genes, the method can be easily extended to the case of clusters of horizontally transferred genes. With the help of an extensive and carefully designed set of experiments on 123 archaeal and bacterial genomes, we demonstrate that the new method exhibits significant improvement in sensitivity when compared to previously published approaches. In fact, it achieves an average relative improvement across genomes of between 11 and 41% compared to the Codon Adaptation Index method in distinguishing native from foreign genes. Our method's horizontal gene transfer predictions for 123 microbial genomes are available online at http://cbcsrv.watson.ibm.com/HGT/.
-
Bacteriophage-associated gene transfer in pneumococcus: transduction or pseudotransduction?
Porter, R D; Shoemaker, N B; Rampe, G; Guild, W R
1979-01-01
Lysates of pneumococcal phage PG24 transferred genes from one host to another in a process with many of the properties of generalized transduction, in that the host genes were packaged in DNase-resistant particles that closely resembled infectious phage in physical properties, adsorbed to the recipient cells like phage, and were inhibited by antisera to the phage and by trypsin. However, phage processes did not complete the transfer of host DNA as they did phage DNA. Instead, gene transfer required development of competence and entry of the host DNA by the endonuclease-dependent pathway used for transforming and transfecting DNA. This process often occurred on the assay plate hours after adsorption of the particles to the cells, and the transfer was DNase sensitive if challenged at this time. Phenotypic expression was therefore also delayed. The product of entry was like that in transformation, a single strand of DNA that integrates by formation of a hex-sensitive donor-recipient heteroduplex. Whether this gene transfer process is unique to this system or is only the first one described is not clear. The term "pseudotransduction" may be useful in calling attention to its unexpected features. The DNA of PG24 phage has anomalous physical properties reflecting unusual bases. Images PMID:33154
-
Andrade, B S; Góes-Neto, A
2015-10-30
The filamentous fungus Moniliophthora perniciosa is a hemibiotrophic basidiomycete that causes witches' broom disease of cacao (Theobroma cacao L.). Many fungal mitochondrial plasmids are DNA and RNA polymerase-encoding invertrons with terminal inverted repeats and 5'-linked proteins. The aim of this study was to carry out comparative and phylogenetic analyses of DNA and RNA polymerases for all known linear mitochondrial plasmids in fungi. We performed these analyses at both gene and protein levels and assessed differences between fungal and viral polymerases in order to test the lateral gene transfer (LGT) hypothesis. We analyzed all mitochondrial plasmids of the invertron type within the fungal clade, including five from Ascomycota, seven from Basidiomycota, and one from Chytridiomycota. All phylogenetic analyses generated similar tree topologies regardless of the methods and datasets used. It is likely that DNA and RNA polymerase genes were inserted into the mitochondrial genomes of the 13 fungal species examined in our study as a result of different LGT events. These findings are important for a better understanding of the evolutionary relationships between fungal mitochondrial plasmids.
-
Gao, Xue; Niu, Lu; Su, Xingguang
2012-01-01
This manuscript reports a method for the detection of double-stranded DNA, based on Mn:ZnSe d-dots and intercalating agent doxorubicin (DOX). DOX can quench the photoluminescence (PL) of Mn:ZnSe d-dots through photoinduced electron transfer process, after binding with Mn:ZnSe d-dots. The addition of DNA can result in the formation of the Mn:ZnSe d-dots-DOX-DNA ternary complexes, the fluorescence of the Mn:ZnSe d-dots-DOX complexes would be further quenched by the addition of DNA, thus allowing the detection of DNA. The formation mechanism of the Mn:ZnSe d-dots-DOX-DNA ternary complexes was studied in detail in this paper. Under optimal conditions, the quenched fluorescence intensity of Mn:ZnSe d-dots-DOX system are perfectly described by Stern-Volmer equation with the concentration of hsDNA ranging from 0.006 μg mL(-1) to 6.4 μg mL(-1). The detection limit (S/N = 3) for hsDNA is 0.5 ng mL(-1). The proposed method was successfully applied to the detection of DNA in synthetic samples and the results were satisfactory.
-
Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta’ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa
2016-01-01
The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology. PMID:27435636
-
NASA Astrophysics Data System (ADS)
Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta'Ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa
2016-07-01
The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology.
-
Modification of the Genome of Domestic Animals.
Lotti, Samantha N; Polkoff, Kathryn M; Rubessa, Marcello; Wheeler, Matthew B
2017-07-03
In the past few years, new technologies have arisen that enable higher efficiency of gene editing. With the increase ease of using gene editing technologies, it is important to consider the best method for transferring new genetic material to livestock animals. Microinjection is a technique that has proven to be effective in mice but is less efficient in large livestock animals. Over the years, a variety of methods have been used for cloning as well as gene transfer including; nuclear transfer, sperm mediated gene transfer (SMGT), and liposome-mediated DNA transfer. This review looks at the different success rate of these methods and how they have evolved to become more efficient. As well as gene editing technologies, including Zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the most recent clustered regulatory interspaced short palindromic repeats (CRISPRs). Through the advancements in gene-editing technologies, generating transgenic animals is now more accessible and affordable. The goals of producing transgenic animals are to 1) increase our understanding of biology and biomedical science; 2) increase our ability to produce more efficient animals; and 3) produce disease resistant animals. ZFNs, TALENs, and CRISPRs combined with gene transfer methods increase the possibility of achieving these goals.
-
Harder, Timm C.; Hufnagel, Markus; Zahn, Katrin; Beutel, Karin; Schmitt, Heinz-Josef; Ullmann, Uwe; Rautenberg, Peter
2001-01-01
Detection of parvovirus B19 DNA offers diagnostic advantages over serology, particularly in persistent infections of immunocompromised patients. A rapid, novel method of B19 DNA detection and quantification is introduced. This method, a quantitative PCR assay, is based on real-time glass capillary thermocycling (LightCycler [LC]) and fluorescence resonance energy transfer (FRET). The PCR assay allowed quantification over a dynamic range of over 7 logs and could quantify as little as 250 B19 genome equivalents (geq) per ml as calculated for plasmid DNA (i.e., theoretically ≥5 geq per assay). Interrater agreement analysis demonstrated equivalence of LC-FRET PCR and conventional nested PCR in the diagnosis of an active B19 infection (kappa coefficient = 0.83). The benefit of the new method was demonstrated in an immunocompromised child with a relapsing infection, who required an attenuation of the immunosuppressive therapy in addition to repeated doses of immunoglobulin to eliminate the virus. PMID:11724854
-
Exonuclease III-Assisted Upconversion Resonance Energy Transfer in a Wash-Free Suspension DNA Assay.
Chen, Yinghui; Duong, Hien T T; Wen, Shihui; Mi, Chao; Zhou, Yingzhu; Shimoni, Olga; Valenzuela, Stella M; Jin, Dayong
2018-01-02
Sensitivity is the key in optical detection of low-abundant analytes, such as circulating RNA or DNA. The enzyme Exonuclease III (Exo III) is a useful tool in this regard; its ability to recycle target DNA molecules results in markedly improved detection sensitivity. Lower limits of detection may be further achieved if the detection background of autofluorescence can be removed. Here we report an ultrasensitive and specific method to quantify trace amounts of DNA analytes in a wash-free suspension assay. In the presence of target DNA, the Exo III recycles the target DNA by selectively digesting the dye-tagged sequence-matched probe DNA strand only, so that the amount of free dye removed from the probe DNA is proportional to the number of target DNAs. Remaining intact probe DNAs are then bound onto upconversion nanoparticles (energy donor), which allows for upconversion luminescence resonance energy transfer (LRET) that can be used to quantify the difference between the free dye and tagged dye (energy acceptor). This scheme simply avoids both autofluorescence under infrared excitation and many tedious washing steps, as the free dye molecules are physically located away from the nanoparticle surface, and as such they remain "dark" in suspension. Compared to alternative approaches requiring enzyme-assisted amplification on the nanoparticle surface, introduction of probe DNAs onto nanoparticles only after DNA hybridization and signal amplification steps effectively avoids steric hindrance. Via this approach, we have achieved a detection limit of 15 pM in LRET assays of human immunodeficiency viral DNA.
-
Dong, Lan-Feng; Kovarova, Jaromira; Bajzikova, Martina; Bezawork-Geleta, Ayenachew; Svec, David; Endaya, Berwini; Sachaphibulkij, Karishma; Coelho, Ana R; Sebkova, Natasa; Ruzickova, Anna; Tan, An S; Kluckova, Katarina; Judasova, Kristyna; Zamecnikova, Katerina; Rychtarcikova, Zuzana; Gopalan, Vinod; Andera, Ladislav; Sobol, Margarita; Yan, Bing; Pattnaik, Bijay; Bhatraju, Naveen; Truksa, Jaroslav; Stopka, Pavel; Hozak, Pavel; Lam, Alfred K; Sedlacek, Radislav; Oliveira, Paulo J; Kubista, Mikael; Agrawal, Anurag; Dvorakova-Hortova, Katerina; Rohlena, Jakub; Berridge, Michael V; Neuzil, Jiri
2017-01-01
Recently, we showed that generation of tumours in syngeneic mice by cells devoid of mitochondrial (mt) DNA (ρ0 cells) is linked to the acquisition of the host mtDNA. However, the mechanism of mtDNA movement between cells remains unresolved. To determine whether the transfer of mtDNA involves whole mitochondria, we injected B16ρ0 mouse melanoma cells into syngeneic C57BL/6Nsu9-DsRed2 mice that express red fluorescent protein in their mitochondria. We document that mtDNA is acquired by transfer of whole mitochondria from the host animal, leading to normalisation of mitochondrial respiration. Additionally, knockdown of key mitochondrial complex I (NDUFV1) and complex II (SDHC) subunits by shRNA in B16ρ0 cells abolished or significantly retarded their ability to form tumours. Collectively, these results show that intact mitochondria with their mtDNA payload are transferred in the developing tumour, and provide functional evidence for an essential role of oxidative phosphorylation in cancer. DOI: http://dx.doi.org/10.7554/eLife.22187.001 PMID:28195532
-
Li, M; Selvin, P R
1997-01-01
An isothiocyanate form of a lanthanide chelate which is highly luminescent when bound to terbium or europium has been synthesized. The chelate consists of diethylenetriaminepentaacetic acid (DTPA) covalently joined to a chromophore, 7-amino-4-methyl-2(1H)-quinolinone (cs124), and to L-p-aminophenylalanine, in which the aromatic amine was further converted to an isothiocyanate group. Ethylenediamine was also used in place of aminophenylalanine, but the isothiocyanate formed from the aliphatic amine was significantly less reactive. Site-specific attachments to triglycine and to the 5' ends of amine-modified DNA oligomers have been made. In addition, as an alternative method of coupling to macromolecules, DTPA anhydride-cs124 can be used to react specifically with a 5' amine group on base-deprotected synthetic DNA oligomers. Synthesis and purification is relatively straightforward in both cases, and luminescent properties are favorable for several applications, including as nonisotopic labels, as long-lifetime alternatives to fluorophores in imaging and diagnostics and particularly as donors in luminescence resonance energy transfer. Energy transfer measurements are consistent with previously reported measurements using different attachment mechanisms.
-
Helmig, Sarah; Gothelf, Kurt Vesterager
2017-10-23
Signal transfer is central to the controlled exchange of information in biology and advanced technologies. Therefore, the development of reliable, long-range signal transfer systems for artificial nanoscale assemblies is of great scientific interest. We have designed such a system for the signal transfer between two connected DNA nanostructures, using the hybridization chain reaction (HCR). Two sets of metastable DNA hairpins, one of which is immobilized at specific points along tracks on DNA origami structures, are polymerized to form a continuous DNA duplex, which is visible using atomic force microscopy (AFM). Upon addition of a designed initiator, the initiation signal is efficiently transferred more than 200 nm from a specific location on one origami structure to an end point on another origami structure. The system shows no significant loss of signal when crossing from one nanostructure to another and, therefore, has the potential to be applied to larger multi-component DNA assemblies. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
Charge-transfer interactions of Cr species with DNA.
Nowicka, Anna M; Matysiak-Brynda, Edyta; Hepel, Maria
2017-10-01
Interactions of Cr species with nucleic acids in living organisms depend strongly on Cr oxidation state and the environmental conditions. As the effects of these interactions range from benign to pre-mutagenic to carcinogenic, careful assessment of the hazard they pose to human health is necessary. We have investigated methods that would enable quantifying the DNA damage caused by Cr species under varying environmental conditions, including UV, O 2 , and redox potential, using simple instrumental techniques which could be in future combined into a field-deployable instrumentation. We have employed electrochemical quartz crystal nanogravimetry (EQCN), cyclic voltammetry (CV), and electrochemical impedance spectroscopy (EIS) to evaluate the extent of DNA damage expressed in terms of guanine oxidation yield (η) and changes in specific characteristics provided by these techniques. The effects of the interactions of Cr species with DNA were analyzed using a model calf thymus DNA (ctDNA) film on a gold electrode (Au@ctDNA) in different media, including: (i) Cr(VI), (ii) Cr(VI) reduced at -0.2V, (iii) Cr(III)+UV radiation+O 2 , and Cr(III), obtaining the η values: 7.4±1.4, 1.5±0.4, 1.1±0.31%, and 0%, respectively, thus quantifying the hazard posed. The EIS measurements have enabled utilizing the decrease in charge-transfer resistance (R ct ) for ferri/ferrocyanide redox probe at an Au@ctDNA electrode to assess the oxidative ctDNA damage by Cr(VI) species. In this case, circular dichroism indicates an extensive damage to the ctDNA hydrogen bonding. On the other hand, Cr(III) species have not induced any damage to ctDNA, although the EQCN measurements show an electrostatic binding to DNA. Copyright © 2017 Elsevier Inc. All rights reserved.
-
NASA Astrophysics Data System (ADS)
Ploetz, Evelyn; Lerner, Eitan; Husada, Florence; Roelfs, Martin; Chung, Sangyoon; Hohlbein, Johannes; Weiss, Shimon; Cordes, Thorben
2016-09-01
Advanced microscopy methods allow obtaining information on (dynamic) conformational changes in biomolecules via measuring a single molecular distance in the structure. It is, however, extremely challenging to capture the full depth of a three-dimensional biochemical state, binding-related structural changes or conformational cross-talk in multi-protein complexes using one-dimensional assays. In this paper we address this fundamental problem by extending the standard molecular ruler based on Förster resonance energy transfer (FRET) into a two-dimensional assay via its combination with protein-induced fluorescence enhancement (PIFE). We show that donor brightness (via PIFE) and energy transfer efficiency (via FRET) can simultaneously report on e.g., the conformational state of double stranded DNA (dsDNA) following its interaction with unlabelled proteins (BamHI, EcoRV, and T7 DNA polymerase gp5/trx). The PIFE-FRET assay uses established labelling protocols and single molecule fluorescence detection schemes (alternating-laser excitation, ALEX). Besides quantitative studies of PIFE and FRET ruler characteristics, we outline possible applications of ALEX-based PIFE-FRET for single-molecule studies with diffusing and immobilized molecules. Finally, we study transcription initiation and scrunching of E. coli RNA-polymerase with PIFE-FRET and provide direct evidence for the physical presence and vicinity of the polymerase that causes structural changes and scrunching of the transcriptional DNA bubble.
-
Ploetz, Evelyn; Lerner, Eitan; Husada, Florence; Roelfs, Martin; Chung, SangYoon; Hohlbein, Johannes; Weiss, Shimon; Cordes, Thorben
2016-01-01
Advanced microscopy methods allow obtaining information on (dynamic) conformational changes in biomolecules via measuring a single molecular distance in the structure. It is, however, extremely challenging to capture the full depth of a three-dimensional biochemical state, binding-related structural changes or conformational cross-talk in multi-protein complexes using one-dimensional assays. In this paper we address this fundamental problem by extending the standard molecular ruler based on Förster resonance energy transfer (FRET) into a two-dimensional assay via its combination with protein-induced fluorescence enhancement (PIFE). We show that donor brightness (via PIFE) and energy transfer efficiency (via FRET) can simultaneously report on e.g., the conformational state of double stranded DNA (dsDNA) following its interaction with unlabelled proteins (BamHI, EcoRV, and T7 DNA polymerase gp5/trx). The PIFE-FRET assay uses established labelling protocols and single molecule fluorescence detection schemes (alternating-laser excitation, ALEX). Besides quantitative studies of PIFE and FRET ruler characteristics, we outline possible applications of ALEX-based PIFE-FRET for single-molecule studies with diffusing and immobilized molecules. Finally, we study transcription initiation and scrunching of E. coli RNA-polymerase with PIFE-FRET and provide direct evidence for the physical presence and vicinity of the polymerase that causes structural changes and scrunching of the transcriptional DNA bubble. PMID:27641327
-
A statistical approach for inferring the 3D structure of the genome.
Varoquaux, Nelle; Ay, Ferhat; Noble, William Stafford; Vert, Jean-Philippe
2014-06-15
Recent technological advances allow the measurement, in a single Hi-C experiment, of the frequencies of physical contacts among pairs of genomic loci at a genome-wide scale. The next challenge is to infer, from the resulting DNA-DNA contact maps, accurate 3D models of how chromosomes fold and fit into the nucleus. Many existing inference methods rely on multidimensional scaling (MDS), in which the pairwise distances of the inferred model are optimized to resemble pairwise distances derived directly from the contact counts. These approaches, however, often optimize a heuristic objective function and require strong assumptions about the biophysics of DNA to transform interaction frequencies to spatial distance, and thereby may lead to incorrect structure reconstruction. We propose a novel approach to infer a consensus 3D structure of a genome from Hi-C data. The method incorporates a statistical model of the contact counts, assuming that the counts between two loci follow a Poisson distribution whose intensity decreases with the physical distances between the loci. The method can automatically adjust the transfer function relating the spatial distance to the Poisson intensity and infer a genome structure that best explains the observed data. We compare two variants of our Poisson method, with or without optimization of the transfer function, to four different MDS-based algorithms-two metric MDS methods using different stress functions, a non-metric version of MDS and ChromSDE, a recently described, advanced MDS method-on a wide range of simulated datasets. We demonstrate that the Poisson models reconstruct better structures than all MDS-based methods, particularly at low coverage and high resolution, and we highlight the importance of optimizing the transfer function. On publicly available Hi-C data from mouse embryonic stem cells, we show that the Poisson methods lead to more reproducible structures than MDS-based methods when we use data generated using different restriction enzymes, and when we reconstruct structures at different resolutions. A Python implementation of the proposed method is available at http://cbio.ensmp.fr/pastis. © The Author 2014. Published by Oxford University Press.
-
DNA transfer-a never ending story. A study on scenarios involving a second person as carrier.
Helmus, Janine; Bajanowski, Thomas; Poetsch, Micaela
2016-01-01
The transfer of DNA directly from one item to another has been shown in many studies with elaborate discussions on the nature of the DNA donor as well as material and surface of the items or surrounding features. Every DNA transfer scenario one can imagine seems to be possible. This evokes more and more intricate scenarios proposed by lawyers or attorneys searching for an explanation of the DNA of a certain person on a distinct item with impact on a crime. At court, the forensic genetic scientist has to comment on the probability of these scenarios thus calling for extensive studies on such settings. Here, the possibility of an involvement of a second person as a carrier of the donor's DNA in a variety of different scenarios including three pairs of people and two kinds of items (textiles and plastic bags) was investigated. All transfer settings were executed with and without gloves on the carrier's hands. DNA left on the items was isolated and analyzed using the Powerplex® ESX17 kit. In 21 out of 180 samples, all alleles of the donor DNA could be obtained on the second item (12%), on eight samples, the donor's DNA was dominant compared to all other alleles (38% of samples with complete donor profile). Additionally, 51 samples displayed at least more than half of the donor's alleles (28%). The complete DNA profile of the carrier was found in 47 out of 180 samples (42 partial profiles). In summary, it could be shown that a transfer of donor DNA from epithelial cells through a carrier to a second item is possible, even if the carrier does not wear gloves.
-
Zhou, Feng; Noor, M Omair; Krull, Ulrich J
2014-03-04
A bioassay based on DNA hybridization on cellulose paper is a promising format for gene fragment detection that may be suited for in-field and rapid diagnostic applications. We demonstrate for the first time that luminescence resonance energy transfer (LRET) associated with upconverting phosphors (UCPs) can be used to develop a paper-based DNA hybridization assay with high sensitivity, selectivity and fast response. UCPs with strong green emission were synthesized and subsequently functionalized with streptavidin (UCP-strep). UCP-strep particles were immobilized on cellulose paper, and then biotinylated single-stranded oligonucleotide probes were conjugated onto the UCPs via streptavidin-biotin linkage. The UCPs served as donors that were LRET-paired with Cy3-labeled target DNA. Selective DNA hybridization enabled the proximity required for LRET-sensitized emission from Cy3, which was used as the detection signal. Hybridization was complete within 2 min, and the limit of detection of the method was 34 fmol, which is a significant improvement in comparison to an analogous fluorescence resonance energy transfer (FRET) assay based on quantum dots. The assay exhibited excellent resistance to nonspecific adsorption of noncomplementary short/long DNA and protein. The selectivity of the assay was further evaluated by one base pair mismatched (1BPM) DNA detection, where a maximum signal ratio of 3.1:1 was achieved between fully complementary and 1BPM samples. This work represents a preliminary but significant step for the development of paper-based UCP-LRET nucleic acid hybridization assays, which offer potential for lowering the limit of detection of luminescent hybridization assays due to the negligible background signal associated with optical excitation by near-infrared (NIR) light.
-
Electronic Properties of Synthetic Shrimp Pathogens-derived DNA Schottky Diodes.
Rizan, Nastaran; Yew, Chan Yen; Niknam, Maryam Rajabpour; Krishnasamy, Jegenathan; Bhassu, Subha; Hong, Goh Zee; Devadas, Sridevi; Din, Mohamed Shariff Mohd; Tajuddin, Hairul Anuar; Othman, Rofina Yasmin; Phang, Siew Moi; Iwamoto, Mitsumasa; Periasamy, Vengadesh
2018-01-17
The exciting discovery of the semiconducting-like properties of deoxyribonucleic acid (DNA) and its potential applications in molecular genetics and diagnostics in recent times has resulted in a paradigm shift in biophysics research. Recent studies in our laboratory provide a platform towards detecting charge transfer mechanism and understanding the electronic properties of DNA based on the sequence-specific electronic response, which can be applied as an alternative to identify or detect DNA. In this study, we demonstrate a novel method for identification of DNA from different shrimp viruses and bacteria using electronic properties of DNA obtained from both negative and positive bias regions in current-voltage (I-V) profiles. Characteristic electronic properties were calculated and used for quantification and further understanding in the identification process. Aquaculture in shrimp industry is a fast-growing food sector throughout the world. However, shrimp culture in many Asian countries faced a huge economic loss due to disease outbreaks. Scientists have been using specific established methods for detecting shrimp infection, but those methods do have their significant drawbacks due to many inherent factors. As such, we believe that this simple, rapid, sensitive and cost-effective tool can be used for detection and identification of DNA from different shrimp viruses and bacteria.
-
Overballe-Petersen, Søren; Willerslev, Eske
2014-01-01
Horizontal gene transfer in the form of long DNA fragments has changed our view of bacterial evolution. Recently, we discovered that such processes may also occur with the massive amounts of short and damaged DNA in the environment, and even with truly ancient DNA. Although it presently remains unclear how often it takes place in nature, horizontal gene transfer of short and damaged DNA opens up the possibility for genetic exchange across distinct species in both time and space. In this essay, we speculate on the potential evolutionary consequences of this phenomenon. We argue that it may challenge basic assumptions in evolutionary theory; that it may have distant origins in life's history; and that horizontal gene transfer should be viewed as an evolutionary strategy not only preceding but causally underpinning the evolution of sexual reproduction. PMID:25143190
-
Overballe-Petersen, Søren; Willerslev, Eske
2014-10-01
Horizontal gene transfer in the form of long DNA fragments has changed our view of bacterial evolution. Recently, we discovered that such processes may also occur with the massive amounts of short and damaged DNA in the environment, and even with truly ancient DNA. Although it presently remains unclear how often it takes place in nature, horizontal gene transfer of short and damaged DNA opens up the possibility for genetic exchange across distinct species in both time and space. In this essay, we speculate on the potential evolutionary consequences of this phenomenon. We argue that it may challenge basic assumptions in evolutionary theory; that it may have distant origins in life's history; and that horizontal gene transfer should be viewed as an evolutionary strategy not only preceding but causally underpinning the evolution of sexual reproduction. © 2014 The Authors. BioEssays Published by WILEY Periodicals, Inc.
-
DNA origami as biocompatible surface to match single-molecule and ensemble experiments
Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip
2012-01-01
Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083
-
Evidence for horizontal transfer of mitochondrial DNA to the plastid genome in a bamboo genus.
Ma, Peng-Fei; Zhang, Yu-Xiao; Guo, Zhen-Hua; Li, De-Zhu
2015-06-23
In flowering plants, three genomes (nuclear, mitochondrial, and plastid) coexist and intracellular horizontal transfer of DNA is prevalent, especially from the plastid to the mitochondrion genome. However, the plastid genomes are generally conserved in evolution and have long been considered immune to foreign DNA. Recently, the opposite direction of DNA transfer from the mitochondrial to the plastid genome has been reported in two eudicot lineages. Here we sequenced 6 plastid genomes of bamboos, three of which are neotropical woody species and three are herbaceous ones. Several unusual features were found, including the duplication of trnT-GGU and loss of one copy of rps19 due to contraction of inverted repeats (IRs). The most intriguing was the ~2.7 kb insertion in the plastid IR regions in the three herbaceous bamboos. Furthermore, the insertion was documented to be horizontally transferred from the mitochondrial to the plastid genome. Our study provided evidence of the mitochondrial-to-plastid DNA transfer in the monocots, demonstrating again that this rare event does occur in other angiosperm lineages. However, the mechanism underlying the transfer remains obscure, and more studies in other plants may elucidate it in the future.
-
Studying DNA looping by single-molecule FRET.
Le, Tung T; Kim, Harold D
2014-06-28
Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.
-
Studying DNA Looping by Single-Molecule FRET
Le, Tung T.; Kim, Harold D.
2014-01-01
Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA. PMID:24998459
-
Transfer of DNA from Bacteria to Eukaryotes
2016-01-01
ABSTRACT Historically, the members of the Agrobacterium genus have been considered the only bacterial species naturally able to transfer and integrate DNA into the genomes of their eukaryotic hosts. Yet, increasing evidence suggests that this ability to genetically transform eukaryotic host cells might be more widespread in the bacterial world. Indeed, analyses of accumulating genomic data reveal cases of horizontal gene transfer from bacteria to eukaryotes and suggest that it represents a significant force in adaptive evolution of eukaryotic species. Specifically, recent reports indicate that bacteria other than Agrobacterium, such as Bartonella henselae (a zoonotic pathogen), Rhizobium etli (a plant-symbiotic bacterium related to Agrobacterium), or even Escherichia coli, have the ability to genetically transform their host cells under laboratory conditions. This DNA transfer relies on type IV secretion systems (T4SSs), the molecular machines that transport macromolecules during conjugative plasmid transfer and also during transport of proteins and/or DNA to the eukaryotic recipient cells. In this review article, we explore the extent of possible transfer of genetic information from bacteria to eukaryotic cells as well as the evolutionary implications and potential applications of this transfer. PMID:27406565
-
Hypermutation by intersegmental transfer of APOBEC3G cytidine deaminase.
Nowarski, Roni; Britan-Rosich, Elena; Shiloach, Tamar; Kotler, Moshe
2008-10-01
Deamination of cytidine residues in single-stranded DNA (ssDNA) is an important mechanism by which apolipoprotein B mRNA-editing, catalytic polypeptide-like (APOBEC) enzymes restrict endogenous and exogenous viruses. The dynamic process underlying APOBEC-induced hypermutation is not fully understood. Here we show that enzymatically active APOBEC3G can be detected in wild-type Vif(+) HIV-1 virions, albeit at low levels. In vitro studies showed that single enzyme-DNA encounters result in distributive deamination of adjacent cytidines. Nonlinear translocation of APOBEC3G, however, directed scattered deamination of numerous targets along the DNA. Increased ssDNA concentrations abolished enzyme processivity in the case of short, but not long, DNA substrates, emphasizing the key role of rapid intersegmental transfer in targeting the deaminase. Our data support a model by which APOBEC3G intersegmental transfer via monomeric binding to two ssDNA segments results in dispersed hypermutation of viral genomes.
-
Reproducible and efficient murine CNS gene delivery using a microprocessor-controlled injector.
Brooks, A I; Halterman, M W; Chadwick, C A; Davidson, B L; Haak-Frendscho, M; Radel, C; Porter, C; Federoff, H J
1998-04-30
To develop a reproducible gene transfer method for the murine CNS we evaluated delivery of various gene vehicles using mechanical or manual stereotaxic intracranial inoculation. A microprocessor controlled microsyringe pump (The World Precision Instruments/UltraMicroPump) programmable for volume, rate and syringe size and designed to dispense nanoliter and picoliter volumes was compared to a standard manual deliver method. Gene transfer efficiency of two viral vectors, two synthetic cationic lipid molecules, and naked DNA were evaluated in mice injected unilaterally in two brain regions. Animals received 1 microl over 10 min. of either HSVlac (1 x 10(5) b.f.u), AdLac (1 x 10(5) p.f.u), Tfx-10 or Tfx-20 (2.6 microg DNA in 2.0 microl Tfx; 1:1 charge ratio of DNA to liposome), or naked DNA (HSVlac plasmid, 10 microg/microl). After 4 days, animals from each group were perfused and tissue prepared for X-gal histochemical detection of beta-galactosidase expression. Blue cells were observed in the HSV, Adenovirus, and Tfx-20 groups only at the injection site in animals injected using the UMP. Animals injected manually exhibited fewer blue cells and positive cells were not restricted to the injection site. To quantify expression, tissue punches harvested from the injection sites as well as other brain regions were analyzed using a chemiluminescent reporter assay to detect beta-galactosidase (Galacto-Light). These data indicated increased activity in all animals injected with a lacZ containing vector via the UMP as compared to manual delivery: A 41% increase in the expression levels of beta-gal in HSVlac infected animals (p = 0.0029); a 29% increase in Adlac infected animals (p = 0.01); a 56% increase in Tfx-10 transduced animals (p = 0.04); a 24% increase in Tfx-20 transduced animals (p = 0.01); and a 69% increase in naked DNA gene transfer (p = 0.05). Total beta-galactosidase activity was greatest in HSVlac infected mice followed by Adlac > Tfx-20 > Tfx-10 = naked DNA.
-
Altevogt, Dominik; Hrenn, Andrea; Kern, Claudia; Clima, Lilia; Bannwarth, Willi; Merfort, Irmgard
2009-10-07
Herein we report a feasibility study for a new concept to detect DNA binding protein NF-kappaB based on a DNA triple helix formation in combination with a fluorescence resonance energy transfer (FRET). The new principle avoids expensive antibodies and radioactivity and might have implications for assays of other DNA binding proteins.
-
A non-canonical transferred DNA insertion at the BRI1 locus in Arabidopsis thaliana.
Zhao, Zhong; Zhu, Yan; Erhardt, Mathieu; Ruan, Ying; Shen, Wen-Hui
2009-04-01
Agrobacterium-mediated transformation is widely used in transgenic plant engineering and has been proven to be a powerful tool for insertional mutagenesis of the plant genome. The transferred DNA (T-DNA) from Agrobacterium is integrated into the plant genome through illegitimate recombination between the T-DNA and the plant DNA. Contrasting to the canonical insertion, here we report on a locus showing a complex mutation associated with T-DNA insertion at the BRI1 gene in Arabidopsis thaliana. We obtained a mutant line, named salade for its phenotype of dwarf stature and proliferating rosette. Molecular characterization of this mutant revealed that in addition to T-DNA a non-T-DNA-localized transposon from bacteria was inserted in the Arabidopsis genome and that a region of more than 11.5 kb of the Arabidopsis genome was deleted at the insertion site. The deleted region contains the brassinosteroid receptor gene BRI1 and the transcription factor gene WRKY13. Our finding reveals non-canonical T-DNA insertion, implicating horizontal gene transfer and cautioning the use of T-DNA as mutagen in transgenic research.
-
Kolek, Jan; Sedlar, Karel; Provaznik, Ivo; Patakova, Petra
2016-01-01
Butanol is currently one of the most discussed biofuels. Its use provides many benefits in comparison to bio-ethanol, but the price of its fermentative production is still high. Genetic improvements could help solve many problems associated with butanol production during ABE fermentation, such as its toxicity, low concentration achievable in the cultivation medium, the need for a relatively expensive substrate, and many more. Clostridium pasteurianum NRRL B-598 is non-type strain producing butanol, acetone, and a negligible amount of ethanol. Its main benefits are high oxygen tolerance, utilization of a wide range of carbon and nitrogen sources, and the availability of its whole genome sequence. However, there is no established method for the transfer of foreign DNA into this strain; this is the next step necessary for progress in its use for butanol production. We have described functional protocols for conjugation and transformation of the bio-butanol producer C. pasteurianum NRRL B-598 by foreign plasmid DNA. We show that the use of unmethylated plasmid DNA is necessary for efficient transformation or successful conjugation. Genes encoding DNA methylation and those for restriction-modification systems and antibiotic resistance were searched for in the whole genome sequence and their homologies with other clostridial bacteria were determined. Furthermore, activity of described novel type I restriction system was proved experimentally. The described electrotransformation protocol achieved an efficiency 1.2 × 10(2) cfu/μg DNA after step-by-step optimization and an efficiency of 1.6 × 10(2) cfu/μg DNA was achieved by the sonoporation technique using a standard laboratory ultrasound bath. The highest transformation efficiency was achieved using a combination of these approaches; sono/electroporation led to an increase in transformation efficiency, to 5.3 × 10(2) cfu/μg DNA. Both Dam and Dcm methylations are detrimental for transformation of C. pasteurianum NRRL B-598. Methods for conjugation, electroporation, sonoporation, and a combined method for sono/electroporation were established for this strain. The methods described could be used for genetic improvement of this strain, which is suitable for bio-butanol production.
-
Electrotransfer of Plasmid Vector DNA into Muscle
NASA Astrophysics Data System (ADS)
Miyazaki, Satsuki; Miyazaki, Jun-Ichi
Wolff et al. (1990) first reported that plasmid DNA injected into skeletal muscle is taken up by muscle cells and the genes in the plasmid are expressed for more than two months thereafter, although the transfected DNA does not usually undergo chromosomal integration (Wolff et al., 1991, 1992). However, the relatively low expression levels attained by this method have hampered its applications for uses other than as a DNA vaccine (Davis et al., 1995). There are a number of reports analyzing the conditions that affect the efficiency of gene transfer by intramuscular DNA injection and assessing the fine structures of expression plasmid vectors that may affect expression levels (Davis et al., 1993; Liang et al., 1996; Norman et al., 1997). Furthermore, various attempts were done to improve the efficiency of gene transfer by intramus cular DNA injection. Consequently, regenerating muscle was shown to produce 80-fold or more protein than did normal muscle, following injection of an expression plas-mid. Muscle regeneration was induced by treatment with cardiotoxin or bupivacaine (Wells, 1993; Vitadello et al., 1994). We previously demonstrated that by combining a strong promoter and bupivacaine pretreatment intramuscular injection of an IL-5 expression plasmid results in IL-5 production in muscle at a level sufficient to induce marked proliferation of eosinophils in the bone marrow and eosinophil infiltration of various organs (Tokui et al., 1997). It was also reported that a single intramuscular injection of an erythropoietin expression plasmid produced physiologically significant elevations in serum erythropoietin levels and increased hematocrits in adult mice (Tripathy et al., 1996). Hematocrits in these animals remained elevated at >60% for at least 90 days after a single injection. However, improvements to this method have not been sufficient to extend its applications including clinical use.
-
Suboptimal Doses of Raltegravir Cause Aberrant HIV Integrations | Center for Cancer Research
When a cell is infected with HIV, a DNA copy of the HIV genome is inserted into that cell’s chromosomal DNA. This insertion reaction is carried out by the viral enzyme integrase (IN) and involves two distinct steps: removal of two nucleotides from each 3’ end of the viral DNA, followed by the strand transfer reaction, in which the viral DNA ends are inserted into the host chromosomal DNA. Integration is essential for viral replication, making it an important target for antiviral therapy. Raltegravir, and the other approved integrase inhibitor, Elvitegravir, are called integrase strand transfer inhibitors (INSTIs), because they bind to the active site of IN and block the strand transfer reaction.
-
Use of electroporation for high-molecular-weight DNA-mediated gene transfer.
Jastreboff, M M; Ito, E; Bertino, J R; Narayanan, R
1987-08-01
Electroporation was used to introduce high-molecular-weight DNA into murine hematopoietic cells and NIH3T3 cells. CCRF-CEM cells were stably transfected with SV2NEO plasmid and the genomic DNA from G-418-resistant clones (greater than 65 kb) was introduced into mouse bone marrow and NIH3T3 cells by electroporation. NEO sequences and expression were detected in the hematopoietic tissues of lethally irradiated mice, with 24% of individual spleen colonies expressing NEO. The frequency of genomic DNA transfer into NIH3T3 cells was 0.25 X 10(-3). Electroporation thus offers a powerful mode of gene transfer not only of cloned genes but also of high-molecular-weight DNA into cells.
-
Ryu, Kyoung-Seok; Tugarinov, Vitali; Clore, G Marius
2014-10-15
The kinetics of translocation of the homeodomain transcription factor HoxD9 between specific sites of the same or opposite polarities on the same DNA molecule have been studied by (15)Nz-exchange NMR spectroscopy. We show that exchange occurs by two facilitated diffusion mechanisms: a second-order intermolecular exchange reaction between specific sites located on different DNA molecules without the protein dissociating into free solution that predominates at high concentrations of free DNA, and a first-order intramolecular process involving direct transfer between specific sites located on the same DNA molecule. Control experiments using a mixture of two DNA molecules, each possessing only a single specific site, indicate that transfer between specific sites by full dissociation of HoxD9 into solution followed by reassociation is too slow to measure by z-exchange spectroscopy. Intramolecular transfer with comparable rate constants occurs between sites of the same and opposing polarity, indicating that both rotation-coupled sliding and hopping/flipping (analogous to geminate recombination) occur. The half-life for intramolecular transfer (0.5-1 s) is many orders of magnitude larger than the calculated transfer time (1-100 μs) by sliding, leading us to conclude that the intramolecular transfer rates measured by z-exchange spectroscopy represent the rate-limiting step for a one-base-pair shift from the specific site to the immediately adjacent nonspecific site. At zero concentration of added salt, the intramolecular transfer rate constants between sites of opposing polarity are smaller than those between sites of the same polarity, suggesting that hopping/flipping may become rate-limiting at very low salt concentrations.
-
Capture, Unfolding, and Detection of Individual tRNA Molecules Using a Nanopore Device
Smith, Andrew M.; Abu-Shumays, Robin; Akeson, Mark; Bernick, David L.
2015-01-01
Transfer RNAs (tRNA) are the most common RNA molecules in cells and have critical roles as both translators of the genetic code and regulators of protein synthesis. As such, numerous methods have focused on studying tRNA abundance and regulation, with the most widely used methods being RNA-seq and microarrays. Though revolutionary to transcriptomics, these assays are limited by an inability to encode tRNA modifications in the requisite cDNA. These modifications are abundant in tRNA and critical to their function. Here, we describe proof-of-concept experiments where individual tRNA molecules are examined as linear strands using a biological nanopore. This method utilizes an enzymatically ligated synthetic DNA adapter to concentrate tRNA at the lipid bilayer of the nanopore device and efficiently denature individual tRNA molecules, as they are pulled through the α-hemolysin (α-HL) nanopore. Additionally, the DNA adapter provides a loading site for ϕ29 DNA polymerase (ϕ29 DNAP), which acts as a brake on the translocating tRNA. This increases the dwell time of adapted tRNA in the nanopore, allowing us to identify the region of the nanopore signal that is produced by the translocating tRNA itself. Using adapter-modified Escherichia coli tRNAfMet and tRNALys, we show that the nanopore signal during controlled translocation is dependent on the identity of the tRNA. This confirms that adapter-modified tRNA can translocate end-to-end through nanopores and provide the foundation for future work in direct sequencing of individual transfer RNA with a nanopore-based device. PMID:26157798
-
Functional transferred DNA within extracellular vesicles
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cai, Jin; Department of Neurology, Jinling Hospital, Nanjing University School of Medicine, Jiangsu Province; Wu, Gengze
Extracellular vesicles (EVs) are small membrane vesicles including exosomes and shedding vesicles that mediated a cell-to-cell communication. EVs are released from almost all cell types under both physiological and pathological conditions and incorporate nuclear and cytoplasmic molecules for intercellular delivery. Besides protein, mRNA, and microRNA of these molecules, as recent studies show, specific DNA are prominently packaged into EVs. It appears likely that some of exosomes or shedding vesicles, bearing nuclear molecules are released upon bubble-like blebs. Specific interaction of EVs with susceptible recipients performs the uptake of EVs into the target cells, discharging their cargo including nuclear and cytoplasmicmore » macromolecules into the cytosol. These findings expand the nucleic acid content of EVs to include increased levels of specific DNA. Thus, EVs contain a repertoire of genetic information available for horizontal gene transfer and potential use as blood biomarkers for cancer and atherosclerosis. In this review, the focus is on the characteristics, biological functions, and roles in diseases of DNA within EVs. - Highlights: • This review is focused on the DNA within EVs including its characteristics, biological functions, and roles in diseases. • It is clear that DNA within EVs might have important physiological and pathological roles in various diseases. • Knowledge in this area may provides us alternative methods for disease diagnosis or therapy in the future.« less
-
NASA Astrophysics Data System (ADS)
Genç, Eminegül; Kepceoǧlu, Abdullah; Gezgin, Serap Yiǧit; Kars, Meltem Demirel; Kılıç, Hamdi Şükür
2017-02-01
The use of the femtosecond (fs) laser pulses for ablation applications have several advantageous and Laser-Induced Forward Transfer (LIFT) is an ablation-driven transfer process. The use of fs laser pulses for LIFT is gaining a great attraction nowadays. The most of the Direct Writing (DW) methods are laser based techniques and the LIFT technique is the one of them. This spectacular technique allows high resolution without lithographic processes. In this study, we have grown Ti, Pt and Ta thin films on the microscope slides by Pulse Laser Deposition (PLD) technique using Nd:YAG laser in the high vacuum condition. As a result, thin films produced in this work is a good candidate to produce native DNA biosensors based on LIFT technique.
-
Against the traffic: The first evidence for mitochondrial DNA transfer into the plastid genome
USDA-ARS?s Scientific Manuscript database
Transfer of DNA between different compartments of the plant cell, i.e. plastid, mitochondrion and nucleus, is a well-known phenomenon in plant evolution. Six directions of inter-compartmental DNA migration are possible in theory, however only four of them have been previously reported. These include...
-
Intravenous Delivery of pDNA and siRNA into Muscle with Bubble Liposomes and Ultrasound
NASA Astrophysics Data System (ADS)
Negishi, Yoichi; Sekine, Shohko; Endo, Yoko; Nishijima, Nobuaki; Suzuki, Ryo; Maruyama, Kazuo; Aramaki, Yukihiko
2010-03-01
Skeletal muscle is an attractive target tissue for numerous gene therapy strategies. Gene delivery into muscle has been extensively studied. Of the strategies, intravascular delivery of naked pDNA is desirable. Muscle has a high density of capillaries that are in close contact with myofibers. Previously, we developed polyethylene glycol (PEG)-modified liposomes entrapping echo-contrast gas, known as ultrasound (US) imaging gas. We called the liposomes "Bubble liposomes" (BLs). It has been reported that BLs improve the tissue permeability by cavitation on US exposure. Here, we modified the naked pDNA or siRNA transfer method into hind limb muscle through blood vessels using BLs and US. The intravenous delivery of pDNA into muscle can be markedly enhanced when the pDNA is delivered in combination with BLs and US. In addition, the expression of pDNA is high in the US-focused site. Moreover, efficient gene delivery can be achieved by the intravenous delivery of pDNA into muscle with BLs and US. Expression is also down-regulated by delivering siRNA with BLs and US. Thus, this US-mediated BL technique involving veins may be an effective method for gene therapy.
-
Stanczak-Mrozek, Kinga I.; Laing, Ken G.
2017-01-01
Objectives: Horizontal gene transfer of antimicrobial resistance (AMR) genes between clinical isolates via transduction is poorly understood. MRSA are opportunistic pathogens resistant to all classes of antimicrobial agents but currently no strains are fully drug resistant. AMR gene transfer between Staphylococcus aureus isolates is predominantly due to generalized transduction via endogenous bacteriophage, and recent studies have suggested transfer is elevated during host colonization. The aim was to investigate whether exposure to sub-MIC concentrations of antimicrobials triggers bacteriophage induction and/or increased efficiency of AMR gene transfer. Methods: Isolates from MRSA carriers were exposed to nine antimicrobials and supernatants were compared for lytic phage particles and ability to transfer an AMR gene. A new technology, droplet digital PCR, was used to measure the concentration of genes in phage particles. Results: All antibiotics tested induced lytic phage and AMR gene transduction, although the ratio of transducing particles to lytic particles differed substantially for each antibiotic. Mupirocin induced the highest ratio of transducing versus lytic particles. Gentamicin and novobiocin reduced UV-induced AMR transduction. The genes carried in phage particles correlated with AMR transfer or lytic particle activity, suggesting antimicrobials influence which DNA sequences are packaged into phage particles. Conclusions: Sub-inhibitory antibiotics induce AMR gene transfer between clinical MRSA, while combination therapy with an inhibiting antibiotic could potentially alter AMR gene packaging into phage particles, reducing AMR transfer. In a continually evolving environment, pathogens have an advantage if they can transfer DNA while lowering the risk of lytic death. PMID:28369562
-
Szkuta, Bianca; Ballantyne, Kaye N; Kokshoorn, Bas; van Oorschot, Roland A H
2018-03-01
Questions relating to how DNA from an individual got to where it was recovered from and the activities associated with its pickup, retention and deposition are increasingly relevant to criminal investigations and judicial considerations. To address activity level propositions, investigators are typically required to assess the likelihood that DNA was transferred indirectly and not deposited through direct contact with an item or surface. By constructing a series of Bayesian networks, we demonstrate their use in assessing activity level propositions derived from a recent legal case involving the alleged secondary transfer of DNA to a surface following a handshaking event. In the absence of data required to perform the assessment, a set of handshaking simulations were performed to obtain probabilities on the persistence of non-self DNA on the hands following a 40min, 5h or 8h delay between the handshake and contact with the final surface (an axe handle). Variables such as time elapsed, and the activities performed and objects contacted between the handshake and contact with the axe handle, were also considered when assessing the DNA results. DNA from a known contributor was transferred to the right hand of an opposing hand-shaker (as a depositor), and could be subsequently transferred to, and detected on, a surface contacted by the depositor 40min to 5h post-handshake. No non-self DNA from the known contributor was detected in deposits made 8h post-handshake. DNA from the depositor was generally detected as the major or only contributor in the profiles generated. Contributions from the known contributor were minor, decreasing in presence and in the strength of support for inclusion as the time between the handshake and transfer event increased. The construction of a series of Bayesian networks based on the case circumstances provided empirical estimations of the likelihood of direct or indirect deposition. The analyses and conclusions presented demonstrate both the complexity of activity level assessments concerning DNA evidence, and the power of Bayesian networks to visualise and explore the issues of interest for a given case. Copyright © 2017 Elsevier B.V. All rights reserved.
-
2015-01-01
Numerous kinetic, structural, and theoretical studies have established that DNA polymerases adjust their domain structures to enclose nucleotides in their active sites and then rearrange critical active site residues and substrates for catalysis, with the latter conformational change acting to kinetically limit the correct nucleotide incorporation rate. Additionally, structural studies have revealed a large conformational change between the apoprotein and the DNA–protein binary state for Y-family DNA polymerases. In previous studies [Xu, C., Maxwell, B. A., Brown, J. A., Zhang, L., and Suo, Z. (2009) PLoS Biol.7, e1000225], a real-time Förster resonance energy transfer (FRET) method was developed to monitor the global conformational transitions of DNA polymerase IV from Sulfolobus solfataricus (Dpo4), a prototype Y-family enzyme, during nucleotide binding and incorporation by measuring changes in distance between locations on the enzyme and the DNA substrate. To elucidate further details of the conformational transitions of Dpo4 during substrate binding and catalysis, in this study, the real-time FRET technique was used to monitor changes in distance between various pairs of locations in the protein itself. In addition to providing new insight into the conformational changes as revealed in previous studies, the results here show that the previously described conformational change between the apo and DNA-bound states of Dpo4 occurs in a mechanistic step distinct from initial formation or dissociation of the binary complex of Dpo4 and DNA. PMID:24568554
-
A nanophosphor-based method for selective DNA recovery in Synthosomes.
Nallani, Madhavan; Onaca, Ozana; Gera, Nimish; Hildenbrand, Karlheinz; Hoheisel, Werner; Schwaneberg, Ulrich
2006-01-01
A nanocompartment system composed of an ABA triblock copolymer, where A is poly(dimethylsiloxane) and B is poly(2-methyloxazoline), has been developed for selective recovery and detection of DNA. Translocation of TAMRA-labeled complementary primers into the nanocompartment system has been achieved through two deletion mutants (FhuA Delta1-129; FhuA Delta1-160) of the channel protein FhuA. Translocation was monitored by fluorescence resonance energy transfer through hybridization of the TAMRA-labeled primer to the complementary sequence of a nanophosphor-DNA-conjugate, which reduces its half-life (FhuA Delta1-129, 16.0% reduced; FhuA Delta1-160, 39.0% reduced).
-
Study of the effect of simulated space environment on nucleoprotein and DNA thin films
NASA Astrophysics Data System (ADS)
Fekete, A.; Módos, K.; Hegedüs, M.; Rontó, Gy.; Kovács, G.; Bérces, A.; Kargl, G.; Kömle, N. I.; Lammer, H.
2002-11-01
The main goal of PUR experiment (phage and uracil response) is to examine and quantify the effect of specific space conditions on nucleic acid models. To achieve this an improved method was elaborated for the preparation of DNA and bacteriophage thin films. The homogeneity of the films was controlled by UV spectroscopy and microscopy. To provide experimental evidence for the hypothesis that interplanetary transfer of life is possible, phage T7 and isolated T7 DNA thin films have been exposed to selected space conditions: intense UVC radiation (λ = 254 nm) and high vacuum (10-5 mbar). The effects of DNA hydration, conformation and packing on UV radiation damage were examined. Characteristic changes in the absorption spectrum, in the electrophoretic pattern of DNA and the decrease of the amount of PCR products have been detected indicating the photodamage of isolated and intraphage DNA.
-
Simulation experiments of the effect of space environment on bacteriophage and DNA thin films
NASA Astrophysics Data System (ADS)
Fekete, A.; Rontó, Gy.; Hegedüs, M.; Módos, K.; Bérces, A.; Kovács, G.; Lammer, H.; Panitz, C.
2004-01-01
The main goal of PUR experiment (phage and uracil response) is to examine and quantify the effect of specific space conditions on nucleic acid models. To achieve this an improved method was elaborated for the preparation of DNA and bacteriophage thin films. The homogeneity of the films was controlled by UV spectroscopy and microscopy. To provide experimental evidence for the hypothesis that interplanetary transfer of the genetic material is possible, phage T7 and isolated T7 DNA thin films have been exposed to selected space conditions: intense UVC radiation ( λ=254 nm) and high vacuum (10 -4 Pa). The effects of DNA hydration, conformation and packing on UV radiation damage were examined. Characteristic changes in the absorption spectrum, in the electrophoretic pattern of DNA and the decrease of the amount of PCR products have been detected indicating the photodamage of isolated and intraphage DNA.
-
Polymer multilayer tattooing for enhanced DNA vaccination
DeMuth, Peter C.; Min, Younjin; Huang, Bonnie; Kramer, Joshua A.; Miller, Andrew D.; Barouch, Dan H.; Hammond, Paula T.; Irvine, Darrell J.
2014-01-01
DNA vaccines have many potential benefits but have failed to generate robust immune responses in humans. Recently, methods such as in vivo electroporation have demonstrated improved performance, but an optimal strategy for safe, reproducible, and pain-free DNA vaccination remains elusive. Here we report an approach for rapid implantation of vaccine-loaded polymer films carrying DNA, immune-stimulatory RNA, and biodegradable polycations into the immune-cell-rich epidermis, using microneedles coated with releasable polyelectrolyte multilayers. Films transferred into the skin following brief microneedle application promoted local transfection and controlled the persistence of DNA and adjuvants in the skin from days to weeks, with kinetics determined by the film composition. These “multilayer tattoo” DNA vaccines induced immune responses against a model HIV antigen comparable to electroporation in mice, enhanced memory T-cell generation, and elicited 140-fold higher gene expression in non-human primate skin than intradermal DNA injection, indicating the potential of this strategy for enhancing DNA vaccination. PMID:23353628
-
Rapid DNA transformation in Salmonella Typhimurium by the hydrogel exposure method.
Elabed, Hamouda; Hamza, Rim; Bakhrouf, Amina; Gaddour, Kamel
2016-07-01
Even with advances in molecular cloning and DNA transformation, new or alternative methods that permit DNA penetration in Salmonella enterica subspecies enterica serovar Typhimurium are required in order to use this pathogen in biotechnological or medical applications. In this work, an adapted protocol of bacterial transformation with plasmid DNA based on the "Yoshida effect" was applied and optimized on Salmonella enterica serovar Typhimurium LT2 reference strain. The plasmid transference based on the use of sepiolite as acicular materials to promote cell piercing via friction forces produced by spreading on the surface of a hydrogel. The transforming mixture containing sepiolite nanofibers, bacterial cells to be transformed and plasmid DNA were plated directly on selective medium containing 2% agar. In order to improve the procedure, three variables were tested and the transformation of Salmonella cells was accomplished using plasmids pUC19 and pBR322. Using the optimized protocol on Salmonella LT2 strain, the efficiency was about 10(5) transformed cells per 10(9) subjected to transformation with 0.2μg plasmid DNA. In summary, the procedure is fast, offers opportune efficiency and promises to become one of the widely used transformation methods in laboratories. Copyright © 2016 Elsevier B.V. All rights reserved.
-
Li, Junting; Zhao, Qi; Tang, Yanli
2016-06-13
We developed a new method for detecting S1 nuclease and hydroxyl radicals based on the use of water-soluble conjugated poly[9,9-bis(6,6-(N,N,N-trimethylammonium)-fluorene)-2,7-ylenevinylene-co-alt-2,5-dicyano-1,4-phenylene)] (PFVCN) and tungsten disulfide (WS₂) nanosheets. Cationic PFVCN is used as a signal reporter, and single-layer WS₂ is used as a quencher with a negatively charged surface. The ssDNA forms complexes with PFVCN due to much stronger electrostatic interactions between cationic PFVCN and anionic ssDNA, whereas PFVCN emits yellow fluorescence. When ssDNA is hydrolyzed by S1 nuclease or hydroxyl radicals into small fragments, the interactions between the fragmented DNA and PFVCN become weaker, resulting in PFVCN being adsorbed on the surface of WS₂ and the fluorescence being quenched through fluorescence resonance energy transfer. The new method based on PFVCN and WS₂ can sense S1 nuclease with a low detection limit of 5 × 10(-6) U/mL. Additionally, this method is cost-effective by using affordable WS₂ as an energy acceptor without the need for dye-labeled ssDNA. Furthermore, the method provides a new platform for the nuclease assay and reactive oxygen species, and provides promising applications for drug screening.
-
Southern, Edwin
2015-01-01
The history of the development of DNA blotting is described in this chapter. DNA blotting, involving the transfer of electrophoretically separated DNA fragments to a membrane support through capillary action, is also known as Southern blotting. This procedure enables the detection of a specific DNA sequence by hybridization with probes. The term Southern blotting led to a "geographic" naming tradition, with RNA blotting bearing the name Northern blotting and protein transfer to membranes becoming known as Western blotting.
-
Rizzi, Aurora; Raddadi, Noura; Sorlini, Claudia; Nordgrd, Lise; Nielsen, Kaare Magne; Daffonchio, Daniele
2012-01-01
The fate of dietary DNA in the gastrointestinal tract (GIT) of animals has gained renewed interest after the commercial introduction of genetically modified organisms (GMO). Among the concerns regarding GM food, are the possible consequences of horizontal gene transfer (HGT) of recombinant dietary DNA to bacteria or animal cells. The exposure of the GIT to dietary DNA is related to the extent of food processing, food composition, and to the level of intake. Animal feeding studies have demonstrated that a minor amount of fragmented dietary DNA may resist the digestive process. Mammals have been shown to take up dietary DNA from the GIT, but stable integration and expression of internalized DNA has not been demonstrated. Despite the ability of several bacterial species to acquire external DNA by natural transformation, in vivo transfer of dietary DNA to bacteria in the intestine has not been detected in the few experimental studies conducted so far. However, major methodological limitations and knowledge gaps of the mechanistic aspects of HGT calls for methodological improvements and further studies to understand the fate of various types of dietary DNA in the GIT.
-
Dating of the human-ape splitting by a molecular clock of mitochondrial DNA.
Hasegawa, M; Kishino, H; Yano, T
1985-01-01
A new statistical method for estimating divergence dates of species from DNA sequence data by a molecular clock approach is developed. This method takes into account effectively the information contained in a set of DNA sequence data. The molecular clock of mitochondrial DNA (mtDNA) was calibrated by setting the date of divergence between primates and ungulates at the Cretaceous-Tertiary boundary (65 million years ago), when the extinction of dinosaurs occurred. A generalized least-squares method was applied in fitting a model to mtDNA sequence data, and the clock gave dates of 92.3 +/- 11.7, 13.3 +/- 1.5, 10.9 +/- 1.2, 3.7 +/- 0.6, and 2.7 +/- 0.6 million years ago (where the second of each pair of numbers is the standard deviation) for the separation of mouse, gibbon, orangutan, gorilla, and chimpanzee, respectively, from the line leading to humans. Although there is some uncertainty in the clock, this dating may pose a problem for the widely believed hypothesis that the pipedal creature Australopithecus afarensis, which lived some 3.7 million years ago at Laetoli in Tanzania and at Hadar in Ethiopia, was ancestral to man and evolved after the human-ape splitting. Another likelier possibility is that mtDNA was transferred through hybridization between a proto-human and a proto-chimpanzee after the former had developed bipedalism.
-
He, Peng; He, Lin
2009-07-13
We report here an approach to grafting DNA-polymer bioconjugates on a planar solid support using reversible addition-fragmentation chain transfer (RAFT) polymerization. In particular, a trithiocarbonate compound as the RAFT chain transfer agent (CTA) is attached to the distal point of a surface-immobilized oligonucleotide. Initiation of RAFT polymerization leads to controlled growth of polymers atop DNA molecules on the surface. Growth kinetics of poly(monomethoxy-capped oligo(ethylene glycol) methacrylate) atop DNA molecules is investigated by monitoring the change of polymer film thickness as a function of reaction time. The reaction conditions, including the polymerization temperature, the initiator concentration, the CTA surface density, and the selection of monomers, are varied to examine their impacts on the grafting efficiency of DNA-polymer conjugates. Comparing to polymer growth atop small molecules, the experimental results suggest that DNA molecules significantly accelerate polymer growth, which is speculated as a result of the presence of highly charged DNA backbones and purine/pyrimidine moieties surrounding the reaction sites.
-
The distribution of cotransformed transgenes in particle bombardment-mediated transformed wheat
USDA-ARS?s Scientific Manuscript database
Although particle bombardment is the predominant method of foreign DNA direct transfer, whether transgene is integrated randomly into the genome has not been determined. In this study, we identified the distribution of transgene loci in 45 transgenic wheat (Triticum aestivum L.) lines containing c...
-
Indication of Horizontal DNA Gene Transfer by Extracellular Vesicles
Speiseder, Thomas; Badbaran, Anita; Reimer, Rudolph; Indenbirken, Daniela; Grundhoff, Adam; Brunswig-Spickenheier, Bärbel; Alawi, Malik; Lange, Claudia
2016-01-01
The biological relevance of extracellular vesicles (EV) in intercellular communication has been well established. Thus far, proteins and RNA were described as main cargo. Here, we show that EV released from human bone marrow derived mesenchymal stromal cells (BM-hMSC) also carry high-molecular DNA in addition. Extensive EV characterization revealed this DNA mainly associated with the outer EV membrane and to a smaller degree also inside the EV. Our EV purification protocol secured that DNA is not derived from apoptotic or necrotic cells. To analyze the relevance of EV-associated DNA we lentivirally transduced Arabidopsis thaliana-DNA (A.t.-DNA) as indicator into BM-hMSC and generated EV. Using quantitative polymerase chain reaction (qPCR) techniques we detected high copy numbers of A.t.-DNA in EV. In recipient hMSC incubated with tagged EV for two weeks we identified A.t.-DNA transferred to recipient cells. Investigation of recipient cell DNA using quantitative PCR and verification of PCR-products by sequencing suggested stable integration of A.t.-DNA. In conclusion, for the first time our proof-of-principle experiments point to horizontal DNA transfer into recipient cells via EV. Based on our results we assume that eukaryotic cells are able to exchange genetic information in form of DNA extending the known cargo of EV by genomic DNA. This mechanism might be of relevance in cancer but also during cell evolution and development. PMID:27684368
-
Indication of Horizontal DNA Gene Transfer by Extracellular Vesicles.
Fischer, Stefanie; Cornils, Kerstin; Speiseder, Thomas; Badbaran, Anita; Reimer, Rudolph; Indenbirken, Daniela; Grundhoff, Adam; Brunswig-Spickenheier, Bärbel; Alawi, Malik; Lange, Claudia
The biological relevance of extracellular vesicles (EV) in intercellular communication has been well established. Thus far, proteins and RNA were described as main cargo. Here, we show that EV released from human bone marrow derived mesenchymal stromal cells (BM-hMSC) also carry high-molecular DNA in addition. Extensive EV characterization revealed this DNA mainly associated with the outer EV membrane and to a smaller degree also inside the EV. Our EV purification protocol secured that DNA is not derived from apoptotic or necrotic cells. To analyze the relevance of EV-associated DNA we lentivirally transduced Arabidopsis thaliana-DNA (A.t.-DNA) as indicator into BM-hMSC and generated EV. Using quantitative polymerase chain reaction (qPCR) techniques we detected high copy numbers of A.t.-DNA in EV. In recipient hMSC incubated with tagged EV for two weeks we identified A.t.-DNA transferred to recipient cells. Investigation of recipient cell DNA using quantitative PCR and verification of PCR-products by sequencing suggested stable integration of A.t.-DNA. In conclusion, for the first time our proof-of-principle experiments point to horizontal DNA transfer into recipient cells via EV. Based on our results we assume that eukaryotic cells are able to exchange genetic information in form of DNA extending the known cargo of EV by genomic DNA. This mechanism might be of relevance in cancer but also during cell evolution and development.
-
Bacterial sex in dental plaque.
Olsen, Ingar; Tribble, Gena D; Fiehn, Nils-Erik; Wang, Bing-Yan
2013-01-01
Genes are transferred between bacteria in dental plaque by transduction, conjugation, and transformation. Membrane vesicles can also provide a mechanism for horizontal gene transfer. DNA transfer is considered bacterial sex, but the transfer is not parallel to processes that we associate with sex in higher organisms. Several examples of bacterial gene transfer in the oral cavity are given in this review. How frequently this occurs in dental plaque is not clear, but evidence suggests that it affects a number of the major genera present. It has been estimated that new sequences in genomes established through horizontal gene transfer can constitute up to 30% of bacterial genomes. Gene transfer can be both inter- and intrageneric, and it can also affect transient organisms. The transferred DNA can be integrated or recombined in the recipient's chromosome or remain as an extrachromosomal inheritable element. This can make dental plaque a reservoir for antimicrobial resistance genes. The ability to transfer DNA is important for bacteria, making them better adapted to the harsh environment of the human mouth, and promoting their survival, virulence, and pathogenicity.
-
Herzig, Eytan; Voronin, Nickolay; Kucherenko, Nataly; Hizi, Amnon
2015-08-01
The process of reverse transcription (RTN) in retroviruses is essential to the viral life cycle. This key process is catalyzed exclusively by the viral reverse transcriptase (RT) that copies the viral RNA into DNA by its DNA polymerase activity, while concomitantly removing the original RNA template by its RNase H activity. During RTN, the combination between DNA synthesis and RNA hydrolysis leads to strand transfers (or template switches) that are critical for the completion of RTN. The balance between these RT-driven activities was considered to be the sole reason for strand transfers. Nevertheless, we show here that a specific mutation in HIV-1 RT (L92P) that does not affect the DNA polymerase and RNase H activities abolishes strand transfer. There is also a good correlation between this complete loss of the RT's strand transfer to the loss of the DNA clamp activity of the RT, discovered recently by us. This finding indicates a mechanistic linkage between these two functions and that they are both direct and unique functions of the RT (apart from DNA synthesis and RNA degradation). Furthermore, when the RT's L92P mutant was introduced into an infectious HIV-1 clone, it lost viral replication, due to inefficient intracellular strand transfers during RTN, thus supporting the in vitro data. As far as we know, this is the first report on RT mutants that specifically and directly impair RT-associated strand transfers. Therefore, targeting residue Leu92 may be helpful in selectively blocking this RT activity and consequently HIV-1 infectivity and pathogenesis. Reverse transcription in retroviruses is essential for the viral life cycle. This multistep process is catalyzed by viral reverse transcriptase, which copies the viral RNA into DNA by its DNA polymerase activity (while concomitantly removing the RNA template by its RNase H activity). The combination and balance between synthesis and hydrolysis lead to strand transfers that are critical for reverse transcription completion. We show here for the first time that a single mutation in HIV-1 reverse transcriptase (L92P) selectively abolishes strand transfers without affecting the enzyme's DNA polymerase and RNase H functions. When this mutation was introduced into an infectious HIV-1 clone, viral replication was lost due to an impaired intracellular strand transfer, thus supporting the in vitro data. Therefore, finding novel drugs that target HIV-1 reverse transcriptase Leu92 may be beneficial for developing new potent and selective inhibitors of retroviral reverse transcription that will obstruct HIV-1 infectivity. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
-
The use of carboxymethylcellulose gel to increase non-viral gene transfer in mouse airways
Griesenbach, Uta; Meng, Cuixiang; Farley, Raymond; Wasowicz, Marguerite; Munkonge, Felix M; Chan, Mario; Stoneham, Charlotte; Sumner-Jones, Stephanie; Pringle, Ian A.; Gill, Deborah R.; Hyde, Stephen C.; Stevenson, Barbara; Holder, Emma; Ban, Hiroshi; Hasegawa, Mamoru; Cheng, Seng H; Scheule, Ronald K; Sinn, Patrick L; McCray, Paul B; Alton, Eric WFW
2014-01-01
We have assessed whether viscoelastic gels known to inhibit mucociliary clearance can increase lipid-mediated gene transfer. Methylcellulose or carboxymethylcellulose (0.25 to 1.5%) were mixed with complexes of the cationic lipid GL67A and plasmids encoding luciferase and perfused onto the nasal epithelium of mice. Survival after perfusion with 1% CMC or1% MC was 90 and 100%, respectively. In contrast 1.5% CMC was uniformly lethal likely due to the viscous solution blocking the airways. Perfusion with 0.5% CMC containing lipid/DNA complexes reproducibly increased gene expression by approximately 3-fold (n= 16, p<0.05). Given this benefit, likely related to increased duration of contact, we also assessed the effect of prolonging contact time of the liposome/DNA complexes by delivering our standard 80 μg DNA dose over either approximately 22 or 60 min of perfusion. This independently increased gene transfer by 6-fold (n=8, p<0.05) and could be further enhanced by the addition of 0.5% CMC, leading to an overall 25-fold enhancement (n=8, p<0.001) in gene expression. As a result of these interventions CFTR transgene mRNA transgene levels were increased several logs above background. Interestingly, this did not lead to correction of the ion transport defects in the nasal epithelium of cystic fibrosis mice nor for immunohistochemical quantification of CFTR expression. To assess if 0.5% CMC also increased gene transfer in the mouse lung, we used whole body nebulisation chambers. CMC was nebulised for 1 hr immediately before, or simultaneously with GL67A/pCIKLux. The former did not increase gene transfer, whereas co-administration significantly increased gene transfer by 4-fold (p<0.0001, n=18). This study suggests that contact time of non-viral gene transfer agents is a key factor for gene delivery, and suggests two methods which may be translatable for use in man. PMID:20022367
-
Liu, Yuhong; Zhao, Linlin; Zhang, Jin; Zhang, Jinzha; Zhao, Wenbo; Mao, Chun
2016-12-01
The work investigates a new fluorescence resonance energy transfer (FRET) system using NaEuF 4 nanoparticles (NPs) and Au@Ag 2 S NPs as the energy donor-acceptor pair for the first time. The NaEuF 4 /Au@Ag 2 S NPs-based FRET DNA sensor was constructed with NaEuF 4 NPs as the fluorescence (FL) donor and Au@Ag 2 S core-shell NPs as FL acceptor. In order to find the matching energy acceptor, the amount of AgNO 3 and Na 2 S were controlled in the synthesis process to overlap the absorption spectrum of energy acceptor with the emission spectrum of energy donors. The sensitivity of FRET-based DNA sensor can be enhanced and the self-absorption of ligand as well as the background of signals can be decreased because of Eu 3+ which owns large Stokes shifts and narrow emission bands due to f-f electronic transitions of 4f shell. We obtained the efficient FRET system by studying suitable distance between the donor and acceptor. Then the FRET-based DNA sensor was used for the design of specific and sensitive detection of target DNA and the quenching efficiency (ΔFL/F 0 , ΔFL=F-F 0 ) of FL was logarithmically related to the concentration of the target DNA, ranging from 100aM to 100pM. We can realize an ultrasensitive detection of target DNA with a detection limit of 32 aM. This proposed method was feasible to analyse target DNA in real samples with satisfactory results. Copyright © 2016 Elsevier B.V. All rights reserved.
-
[Nuclear transfer of goat somatic cells transgenic for human lactoferrin].
Li, Lan; Shen, Wei; Pan, Qing-Yu; Min, Ling-Jiang; Sun, Yu-Jiang; Fang, Yong-Wei; Deng, Ji-Xian; Pan, Qing-Jie
2006-12-01
Transgenic animal mammary gland bioreactors are being used to produce recombinant proteins with appropriate post-translational modifications, and nuclear transfer of transgenic somatic cells is a more powerful method to produce mammary gland bioreactor. Here we describe efficient gene transfer and nuclear transfer in goat somatic cells. Gene targeting vector pGBC2LF was constructed by cloning human lactoferrin (LF) gene cDNA into exon 2 of the milk goat beta-casein gene, and the endogenous start condon was replaced by that of human LF gene. Goat fetal fibroblasts were transfected with linearized pGBC2LF and 14 cell lines were positive according to PCR and Southern blot. The transgenic cells were used as donor cells of nuclear transfer, and some of reconstructed embryos could develop to blastocyst in vitro.
-
Banasiak, Anna; Cassidy, John; Colleran, John
2018-06-01
To date, DNA cleavage, caused by cleavage agents, has been monitored mainly by gel and capillary electrophoresis. However, these techniques are time-consuming, non-quantitative and require gel stains. In this work, a novel, simple and, importantly, a quantitative method for monitoring the DNA nuclease activity of potential anti-cancer drugs, at a DNA electrochemical sensor, is presented. The DNA sensors were prepared using thiol-modified oligonucleotides that self-assembled to create a DNA monolayer at gold electrode surfaces. The quantification of DNA double-strand breaks is based on calculating the DNA surface coverage, before and after exposure to a DNA cleavage agent. The nuclease properties of a model DNA cleavage agent, copper bis-phenanthroline ([Cu II (phen) 2 ] 2+ ), that can cleave DNA in a Fenton-type reaction, were quantified electrochemically. The DNA surface coverage decreased on average by 21% after subjecting the DNA sensor to a nuclease assay containing [Cu II (phen) 2 ] 2+ , a reductant and an oxidant. This percentage indicates that 6 base pairs were cleaved in the nuclease assay from the immobilised 30 base pair strands. The DNA cleavage can be also induced electrochemically in the absence of a chemical reductant. [Cu II (phen) 2 ] 2+ intercalates between DNA base pairs and, on application of a suitable potential, can be reduced to [Cu I (phen) 2 ] + , with dissolved oxygen acting as the required oxidant. This reduction process is facilitated through DNA strands via long-range electron transfer, resulting in DNA cleavage of 23%. The control measurements for both chemically and electrochemically induced cleavage revealed that DNA strand breaks did not occur under experimental conditions in the absence of [Cu II (phen) 2 ] 2+ . Copyright © 2018 Elsevier B.V. All rights reserved.
-
Wang, Chun-Xia; Xu, Xin; Li, Shu-Qiang
2017-01-01
Extreme environments, such as subterranean habitats, are suspected to be responsible for morphologically inseparable cryptic or sibling species and can bias biodiversity assessment. A DNA barcode is a short, standardized DNA sequence used for taxonomic purposes and has the potential to lessen the challenges presented by a biotic inventory. Here, we investigate the diversity of the genus Leptonetela Kratochvíl, 1978 that is endemic to karst systems in Eurasia using DNA barcoding. We analyzed 624 specimens using one mitochondrial gene fragment (COI). The results show that DNA barcoding is an efficient and rapid species identification method in this genus. DNA barcoding gap and automatic barcode gap discovery (ABGD) analyses indicated the existence of 90 species, a result consistent with previous taxonomic hypotheses, and supported the existence of extreme male pedipalpal tibial spine and median apophysis polymorphism in Leptonetela species, with direct implications for the taxonomy of the group and its diversity. Based on the molecular and morphological evidence, we delimit and diagnose 90 Leptonetela species, including the type species Leptonetela kanellisi(Deeleman-Reinhold, 1971). Forty-six of them are previously undescribed. The female of Leptonetela zhai Wang & Li, 2011 is reported for the first time. Leptonetela tianxinensis (Tong & Li, 2008) comb. nov. is transferred from the genus Leptoneta Simon, 1872;the genus Guineta Lin & Li, 2010 syn. nov. is a junior synonym of Leptonetela; Leptonetela gigachela(Lin & Li, 2010) comb. nov. is transferred from Guineta. The genus Sinoneta Lin & Li, 2010 syn. nov. is a junior synonym of Leptonetela; Leptonetela notabilis(Lin & Li, 2010) comb. nov. and Leptonetela sexdigiti(Lin & Li, 2010) comb. nov. are transferred from Sinoneta; Leptonetela sanchahe Wang & Li nom. nov. is proposed as a replacement name for Sinoneta palmata(Chen et al, 2010) because Leptonetela palmata is preoccupied. PMID:29280363
-
Wang, Chun-Xia; Xu, Xin; Li, Shu-Qiang
2017-11-18
Extreme environments, such as subterranean habitats, are suspected to be responsible for morphologically inseparable cryptic or sibling species and can bias biodiversity assessment. A DNA barcode is a short, standardized DNA sequence used for taxonomic purposes and has the potential to lessen the challenges presented by a biotic inventory. Here, we investigate the diversity of the genus Leptonetela Kratochvíl, 1978 that is endemic to karst systems in Eurasia using DNA barcoding. We analyzed 624 specimens using one mitochondrial gene fragment ( COI ). The results show that DNA barcoding is an efficient and rapid species identification method in this genus. DNA barcoding gap and automatic barcode gap discovery (ABGD) analyses indicated the existence of 90 species, a result consistent with previous taxonomic hypotheses, and supported the existence of extreme male pedipalpal tibial spine and median apophysis polymorphism in Leptonetela species, with direct implications for the taxonomy of the group and its diversity. Based on the molecular and morphological evidence, we delimit and diagnose 90 Leptonetela species, including the type species Leptonetela kanellisi (Deeleman-Reinhold, 1971). Forty-six of them are previously undescribed. The female of Leptonetela zhai Wang & Li, 2011 is reported for the first time. Leptonetela tianxinensis (Tong & Li, 2008) comb. nov. is transferred from the genus Leptoneta Simon, 1872; the genus Guineta Lin & Li, 2010 syn. nov. is a junior synonym of Leptonetela; Leptonetela gigachela (Lin & Li, 2010) comb. nov. is transferred from Guineta . The genus Sinoneta Lin & Li, 2010 syn. nov. is a junior synonym of Leptonetela ; Leptonetela notabilis (Lin & Li, 2010) comb. nov. and Leptonetela sexdigiti (Lin & Li, 2010) comb. nov. are transferred from Sinoneta ; Leptonetela sanchahe Wang & Li nom. nov. is proposed as a replacement name for Sinoneta palmata (Chen et al., 2010) because Leptonetela palmata is preoccupied.
-
NASA Astrophysics Data System (ADS)
Shafirovich, Vladimir; Singh, Carolyn; Geacintov, Nicholas E.
2003-11-01
Oxidative damage of DNA molecules associated with electron-transfer reactions is an important phenomenon in living cells, which can lead to mutations and contribute to carcinogenesis and the aging processes. This article describes the design of several simple experiments to explore DNA damage initiated by photoinduced electron-transfer reactions sensitized by the acridine derivative, proflavine (PF). A supercoiled DNA agarose gel nicking assay is employed as a sensitive probe of DNA strand cleavage. A low-cost experimental and computer-interfaced imaging apparatus is described allowing for the digital recording and analysis of the gel electrophoresis results. The first experiment describes the formation of direct strand breaks in double-stranded DNA induced by photoexcitation of the intercalated PF molecules. The second experiment demonstrates that the addition of the well-known electron acceptor, methylviologen, gives rise to a significant enhancement of the photochemical DNA strand cleavage effect. This occurs by an electron transfer step to methylviologen that renders the inital photoinduced charge separation between photoexcited PF and DNA irreversible. The third experiment demonstrates that the action spectrum of the DNA photocleavage matches the absorption spectrum of DNA-bound, intercalated PF molecules, which differs from that of free PF molecules. This result demonstrates that the photoinduced DNA strand cleavage is initiated by intercalated rather than free PF molecules.
-
Viral Vectors for in Vivo Gene Transfer
NASA Astrophysics Data System (ADS)
Thévenot, E.; Dufour, N.; Déglon, N.
The transfer of DNA into the nucleus of a eukaryotic cell (gene transfer) is a central theme of modern biology. The transfer is said to be somatic when it refers to non-germline organs of a developed individual, and germline when it concerns gametes or the fertilised egg of an animal, with the aim of transmitting the relevant genetic modification to its descendents [1]. The efficient introduction of genetic material into a somatic or germline cell and the control of its expression over time have led to major advances in understanding how genes work in vivo, i.e., in living organisms (functional genomics), but also to the development of innovative therapeutic methods (gene therapy). The efficiency of gene transfer is conditioned by the vehicle used, called the vector. Desirable features for a vector are as follows: Easy to produce high titer stocks of the vector in a reproducible way. Absence of toxicity related to transduction (transfer of genetic material into the target cell, and its expression there) and no immune reaction of the organism against the vector and/or therapeutic protein. Stability in the expression of the relevant gene over time, and the possibility of regulation, e.g., to control expression of the therapeutic protein on the physiological level, or to end expression at the end of treatment. Transduction of quiescent cells should be as efficient as transduction of dividing cells. Vectors currently used fall into two categories: non-viral and viral vectors. In non-viral vectors, the DNA is complexed with polymers, lipids, or cationic detergents (described in Chap. 3). These vectors have a low risk of toxicity and immune reaction. However, they are less efficient in vivo than viral vectors when it comes to the number of cells transduced and long-term transgene expression. (Naked DNA transfer or electroporation is rather inefficient in the organism. This type of gene transfer will not be discussed here, and the interested reader is referred to the review [2].) For this reason, it is mainly viral vectors that are used for gene transfer in animals and humans.
-
Cloning endangered gray wolves (Canis lupus) from somatic cells collected postmortem.
Oh, H J; Kim, M K; Jang, G; Kim, H J; Hong, S G; Park, J E; Park, K; Park, C; Sohn, S H; Kim, D Y; Shin, N S; Lee, B C
2008-09-01
The objective of the present study was to investigate whether nuclear transfer of postmortem wolf somatic cells into enucleated dog oocytes, is a feasible method to produce a cloned wolf. In vivo-matured oocytes (from domestic dogs) were enucleated and fused with somatic cells derived from culture of tissue obtained from a male gray wolf 6h after death. The reconstructed embryos were activated and transferred into the oviducts of naturally synchronous domestic bitches. Overall, 372 reconstructed embryos were transferred to 17 recipient dogs; four recipients (23.5%) were confirmed pregnant (ultrasonographically) 23-25 d after embryo transfer. One recipient spontaneously delivered two dead pups and three recipients delivered, by cesarean section, four cloned wolf pups, weighing 450, 190, 300, and 490g, respectively. The pup that weighed 190g died within 12h after birth. The six cloned wolf pups were genetically identical to the donor wolf, and their mitochondrial DNA originated from the oocyte donors. The three live wolf pups had a normal wolf karyotype (78, XY), and the amount of telomeric DNA, assessed by quantitative fluorescence in situ hybridization, was similar to, or lower than, that of the nuclear donor. In conclusion, the present study demonstrated the successful cloning of an endangered male gray wolf via interspecies transfer of somatic cells, isolated postmortem from a wolf, and transferred into enucleated dog oocytes. Therefore, somatic cell nuclear transfer has potential for preservation of canine species in extreme situations, including sudden death.
-
Nanostructure and Corresponding Quenching Efficiency of Fluorescent DNA Probes.
Guo, Wenjuan; Wei, Yanhong; Dai, Zhao; Chen, Guangping; Chu, Yuanyuan; Zhao, Yifei
2018-02-09
Based on the fluorescence resonance energy transfer (FRET) mechanism, fluorescent DNA probes were prepared with a novel DNA hairpin template method, with SiO₂ coated CdTe (CdTe/SiO₂) core/shell nanoparticles used as the fluorescence energy donors and gold (Au) nanoparticles (AuNPs) as the energy acceptors. The nanostructure and energy donor/acceptor ratio in a probe were controlled with this method. The relationship between the nanostructure of the probes and FRET efficiency (quenching efficiency) were investigated. The results indicated that when the donor/acceptor ratios were 2:1, 1:1, and 1:2; the corresponding FRET efficiencies were about 33.6%, 57.5%, and 74.2%, respectively. The detection results indicated that the fluorescent recovery efficiency of the detecting system was linear when the concentration of the target DNA was about 0.0446-2.230 nmol/L. Moreover, the probes showed good sensitivity and stability in different buffer conditions with a low detection limit of about 0.106 nmol/L.
-
Nanostructure and Corresponding Quenching Efficiency of Fluorescent DNA Probes
Guo, Wenjuan; Wei, Yanhong; Dai, Zhao; Chen, Guangping; Chu, Yuanyuan; Zhao, Yifei
2018-01-01
Based on the fluorescence resonance energy transfer (FRET) mechanism, fluorescent DNA probes were prepared with a novel DNA hairpin template method, with SiO2 coated CdTe (CdTe/SiO2) core/shell nanoparticles used as the fluorescence energy donors and gold (Au) nanoparticles (AuNPs) as the energy acceptors. The nanostructure and energy donor/acceptor ratio in a probe were controlled with this method. The relationship between the nanostructure of the probes and FRET efficiency (quenching efficiency) were investigated. The results indicated that when the donor/acceptor ratios were 2:1, 1:1, and 1:2; the corresponding FRET efficiencies were about 33.6%, 57.5%, and 74.2%, respectively. The detection results indicated that the fluorescent recovery efficiency of the detecting system was linear when the concentration of the target DNA was about 0.0446–2.230 nmol/L. Moreover, the probes showed good sensitivity and stability in different buffer conditions with a low detection limit of about 0.106 nmol/L. PMID:29425163
-
Watson-Crick base pairing controls excited-state decay in natural DNA.
Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang
2014-10-13
Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
[Electroporation of sperm to introduce foreign DNA into the genome of Pinctada maxima (Jameson)].
Hu, W; Yu, D H; Wang, Y P; Wu, K C; Zhu, Z Y
2000-03-01
Gene transfer was investigated in marine molluscs via electroporated sperm. Sperm of P. maxima (J.) was incubated with linear "all-fish" growth hormone gene (pCAgcGH and pCAgcGHc) for 30 min. Then, mature eggs were in-vitro fertilized with the sperm cells treated with electroporation at 10 kV and 2(7) pulses of six cycles. DNA was extracted from spat and analyzed by PCR and southern blot. The results indicated that the foreign DNA had been transferred into the genome of experimental molluscs. The transgenetic ration was 5.6%, 20% and 50% when 2 micrograms/mL, 6 micrograms/mL and 18 micrograms/mL of foreign DNA was used, respectively. It is suggested that the transferred efficiency is correlated with the amount of the foreign DNA.
-
Piétrement, Olivier; Castro-Smirnov, Fidel Antonio; Le Cam, Eric; Aranda, Pilar; Ruiz-Hitzky, Eduardo; Lopez, Bernard S
2017-12-29
Sepiolite is a nanofibrous natural silicate that can be used as a nanocarrier for DNA transfer thanks to its strong interaction with DNA molecules and its ability to be naturally internalized into mammalian cells through both non-endocytic and endocytic pathways. Sepiolite, due to its ability to bind various biomolecules, could be a good candidate for use as a nanocarrier for the simultaneous vectorization of diverse biological molecules. In this paper, we review our recent work, issued from a starting collaboration with Prof. Ruiz-Hitzky, that includes diverse aspects on the characterization and main features of sepiolite/DNA nanohybrids, and we present an outlook for the further development of sepiolite for DNA transfer. © 2017 The Chemical Society of Japan & Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
Blinkowa, A
1976-01-01
The possible role of DNA polimerase III in conjugation was studied in a series of mutants temperature-sensitive for DNA polymerase III synthesis. The temperature-sensitive DNA mutation called dnaE 486 (ts) prohibits vegetative DNA replication at 41-45 degrees. Transfer of episome and chromosome from temperature-sensitive donor, carrying dnaE mutation to wild-type recipient strains, revertants and dnaE recipients was investigated. In the first two cases the number of Lac+ sexductants being even slightly higher at 43 degrees. Conjugational synthesis accompanying transfer involving the combination of dnaE (ts) thymine dependent and thymine independent donor and recipient strains measured by incorporation of 14C thymine was observed at the restrictive temperature. In the case of conjugation with temperaturesensitive recipient strains a drop of Lac+ sexductants and Pro+ recombinants may be as a result of disturbances in the synthesis of complementary strand in recipient, known to be dependent on pol III. However, the episome investigated by centrifugation in neutral CsC1 gradient after its transfer to the recipient with faulty polymerase III was double stranded (replicated) at the restrictive temperature.
-
DNA electrotransfer into the skin using a combination of one high- and one low-voltage pulse.
Pavselj, N; Préat, V
2005-09-02
Electroporation is an effective alternative to viral methods to significantly improve DNA transfection after intradermal and topical delivery. The aim of the study was to check whether a combination of a short high-voltage pulse (HV) to permeabilize the skin cells and a long low-voltage pulse (LV) to transfer DNA by electrophoresis was more efficient to enhance DNA expression than conventional repeated HV or LV pulses alone after intradermal injection of DNA plasmid. GFP and luciferase expressions in the skin were enhanced by HV+LV protocol as compared to HV or LV pulses alone. The expression lasted for up to 10 days. Consistently, HV+LV protocol induced a higher Th2 immune response against ovalbumin than HV or LV pulses. Standard methods were used to assess the effect of electric pulses on skin: the application of a combination of HV and LV pulses on rat skin fold delivered by plate electrodes was well tolerated. These data demonstrate that a combination of one HV (700 to 1000 V/cm; 100 micros) followed by one LV (140 to 200 V/cm; 400 ms) is an efficient electroporation protocol to enhance DNA expression in the skin.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Giri, Anupam; Goswami, Nirmal; Lemmens, Peter
2012-08-15
Graphical abstract: Förster resonance energy transfer (FRET) studies on the interaction of water soluble arginine-capped CdSe/ZnS QDs with ethidium bromide (EB) labeled synthetic dodecamer DNA. Highlights: ► We have solubilized CdSe/ZnS QD in water replacing their TOPO ligand by L-arginine. ► We have studied arginine@QD–DNA interaction using FRET technique. ► Arginine@QDs act as energy donor and ethidium bromide-DNA acts as energy acceptor. ► We have applied a kinetic model to understand the kinetics of energy transfer. ► Circular dichroism studies revealed negligible perturbation in the DNA B-form in the arg@QD-DNA complex. -- Abstract: We have exchanged TOPO (trioctylphosphine oxide) ligandmore » of CdSe/ZnS core/shell quantum dots (QDs) with an amino acid L-arginine (Arg) at the toluene/water interface and eventually rendered the QDs from toluene to aqueous phase. We have studied the interaction of the water soluble Arg-capped QDs (energy donor) with ethidium (EB) labeled synthetic dodecamer DNA (energy acceptor) using picoseconds resolved Förster resonance energy transfer (FRET) technique. Furthermore, we have applied a model developed by M. Tachiya to understand the kinetics of energy transfer and the distribution of acceptor (EB-DNA) molecules around the donor QDs. Circular dichroism (CD) studies revealed a negligible perturbation in the native B-form structure of the DNA upon interaction with Arg-capped QDs. The melting and the rehybridization pathways of the DNA attached to the QDs have been monitored by the CD which reveals hydrogen bonding is the associative mechanism for interaction between Arg-capped QDs and DNA.« less
-
Xuan Lin; Nurul Faridi; Claudio Casola
2016-01-01
Comparative genomics analyses empowered by the wealth of sequenced genomes have revealed numerous instances of horizontal DNA transfers between distantly related species. In  eukaryotes, repetitive DNA sequences known as transposable elements (TEs) are especially prone to  move across species boundaries. Such horizontal transposon transfers, or HTTs, are relatively  ...
-
Koop, G; De Visscher, A; Collar, C A; Bacon, D A C; Maga, E A; Murray, J D; Supré, K; De Vliegher, S; Haesebrouck, F; Rowe, J D; Nielen, M; van Werven, T
2012-12-01
Coagulase-negative staphylococci (CNS) are the most commonly isolated bacteria from goat milk, but they have often been identified with phenotypic methods, which may have resulted in misclassification. The aims of this paper were to assess the amount of misclassification of a phenotypic test for identifying CNS species from goat milk compared with transfer RNA intergenic spacer PCR (tDNA-PCR) followed by capillary electrophoresis, and to apply the tDNA-PCR technique on different capillary electrophoresis equipment. Milk samples were collected from 416 does in 5 Californian dairy goat herds on 3 occasions during lactation. In total, 219 CNS isolates were identified at the species level with tDNA-PCR and subjected to the API 20 Staph identification test kit (API Staph; bioMérieux, Durham, NC). If the same species was isolated multiple times from the same udder gland, only the first isolate was used for further analyses, resulting in 115 unique CNS isolates. According to the tDNA-PCR test, the most prevalent CNS species were Staphylococcus epidermidis, Staphylococcus caprae, and Staphylococcus simulans. Typeability with API staph was low (72%). Although the API Staph test was capable of identifying the majority of Staph. epidermidis and Staph. caprae isolates, sensitivity for identification of Staph. simulans was low. The true positive fraction was high for the 3 most prevalent species. It was concluded that the overall performance of API Staph in differentiating CNS species from goat milk was moderate to low, mainly because of the low typeability, and that genotypic methods such as tDNA-PCR are preferred. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
-
The fluorescence resonance energy transfer (FRET) gate: a time-resolved study.
Xu, Qing-Hua; Wang, Shu; Korystov, Dmitry; Mikhailovsky, Alexander; Bazan, Guillermo C; Moses, Daniel; Heeger, Alan J
2005-01-18
The two-step energy-transfer process in a self-assembled complex comprising a cationic conjugated polymer (CCP) and a dsDNA is investigated by using pump-dump-emission spectroscopy and time-correlated single-photon counting; energy is transferred from the CCP to an ethidium bromide (EB) molecule intercalated into the dsDNA through a fluorescein molecule linked to one terminus of the DNA. Time-dependent anisotropy measurements indicate that the inefficient direct energy transfer from the CCP to the intercalated EB results from the near orthogonality of their transition moments. These measurements also show that the transition moment of the fluorescein spans a range of angular distributions and lies between that of the CCP and EB. Consequently, the fluorescein acts as a fluorescence resonance energy-transfer gate to relay the excitation energy from the CCP to the EB.
-
The fluorescence resonance energy transfer (FRET) gate: A time-resolved study
Xu, Qing-Hua; Wang, Shu; Korystov, Dmitry; Mikhailovsky, Alexander; Bazan, Guillermo C.; Moses, Daniel; Heeger, Alan J.
2005-01-01
The two-step energy-transfer process in a self-assembled complex comprising a cationic conjugated polymer (CCP) and a dsDNA is investigated by using pump-dump-emission spectroscopy and time-correlated single-photon counting; energy is transferred from the CCP to an ethidium bromide (EB) molecule intercalated into the dsDNA through a fluorescein molecule linked to one terminus of the DNA. Time-dependent anisotropy measurements indicate that the inefficient direct energy transfer from the CCP to the intercalated EB results from the near orthogonality of their transition moments. These measurements also show that the transition moment of the fluorescein spans a range of angular distributions and lies between that of the CCP and EB. Consequently, the fluorescein acts as a fluorescence resonance energy-transfer gate to relay the excitation energy from the CCP to the EB. PMID:15642946
-
Jung, Joohye; Kim, Si Joon; Lee, Keun Woo; Yoon, Doo Hyun; Kim, Yeong-Gyu; Kwak, Hee Young; Dugasani, Sreekantha Reddy; Park, Sung Ha; Kim, Hyun Jae
2014-05-15
Low-temperature solution-processed In-Zn-O (IZO) thin-film transistors (TFTs) exhibiting a favorable microenvironment for electron transfer by adsorbed artificial deoxyribonucleic acid (DNA) have extraordinary potential for emerging flexible biosensor applications. Superb sensing ability to differentiate even 0.5 μL of 50 nM DNA target solution was achieved through using IZO TFTs fabricated at 280 °C. Our IZO TFT had a turn-on voltage (V(on)) of -0.8 V, on/off ratio of 6.94 × 10(5), and on-current (I(on)) value of 2.32 × 10(-6)A in pristine condition. A dry-wet method was applied to immobilize two dimensional double crossover tile based DNA nanostructures on the IZO surface, after which we observed a negative shift of the transfer curve accompanied by a significant increase in the Ion and degradation of the Von and on/off ratio. As the concentration of DNA target solution increased, variances in these parameters became increasingly apparent. The sensing mechanism based on the current evolution was attributed to the oxidation of DNA, in which the guanine nucleobase plays a key role. The sensing behavior obtained from flexible biosensors on a polymeric substrate fabricated under the identical conditions was exactly analogous. These results compare favorably with the conventional field-effect transistor based DNA sensors by demonstrating remarkable sensitivity and feasibility of flexible devices that arose from a different sensing mechanism and a low-temperature process, respectively. © 2013 Published by Elsevier B.V.
-
The archaeal Ced system imports DNA
van Wolferen, Marleen; Wagner, Alexander; van der Does, Chris; Albers, Sonja-Verena
2016-01-01
The intercellular transfer of DNA is a phenomenon that occurs in all domains of life and is a major driving force of evolution. Upon UV-light treatment, cells of the crenarchaeal genus Sulfolobus express Ups pili, which initiate cell aggregate formation. Within these aggregates, chromosomal DNA, which is used for the repair of DNA double-strand breaks, is exchanged. Because so far no clear homologs of bacterial DNA transporters have been identified among the genomes of Archaea, the mechanisms of archaeal DNA transport have remained a puzzling and underinvestigated topic. Here we identify saci_0568 and saci_0748, two genes from Sulfolobus acidocaldarius that are highly induced upon UV treatment, encoding a transmembrane protein and a membrane-bound VirB4/HerA homolog, respectively. DNA transfer assays showed that both proteins are essential for DNA transfer between Sulfolobus cells and act downstream of the Ups pili system. Our results moreover revealed that the system is involved in the import of DNA rather than the export. We therefore propose that both Saci_0568 and Saci_0748 are part of a previously unidentified DNA importer. Given the fact that we found this transporter system to be widely spread among the Crenarchaeota, we propose to name it the Crenarchaeal system for exchange of DNA (Ced). In this study we have for the first time to our knowledge described an archaeal DNA transporter. PMID:26884154
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pluta, Radoslaw; Boer, D. Roeland; Lorenzo-Diaz, Fabian
Relaxases are metal-dependent nucleases that break and join DNA for the initiation and completion of conjugative bacterial gene transfer. Conjugation is the main process through which antibiotic resistance spreads among bacteria, with multidrug-resistant staphylococci and streptococci infections posing major threats to human health. The MOB V family of relaxases accounts for approximately 85% of all relaxases found in Staphylococcus aureus isolates. Here, we present six structures of the MOB V relaxase MobM from the promiscuous plasmid pMV158 in complex with several origin of transfer DNA fragments. A combined structural, biochemical, and computational approach reveals that MobM follows a previously uncharacterizedmore » histidine/metal-dependent DNA processing mechanism, which involves the formation of a covalent phosphoramidate histidine-DNA adduct for cell-to-cell transfer. In conclusion, we discuss how the chemical features of the high-energy phosphorus-nitrogen bond shape the dominant position of MOB V histidine relaxases among small promiscuous plasmids and their preference toward Gram-positive bacteria.« less
-
Pluta, Radoslaw; Boer, D. Roeland; Lorenzo-Diaz, Fabian; ...
2017-07-24
Relaxases are metal-dependent nucleases that break and join DNA for the initiation and completion of conjugative bacterial gene transfer. Conjugation is the main process through which antibiotic resistance spreads among bacteria, with multidrug-resistant staphylococci and streptococci infections posing major threats to human health. The MOB V family of relaxases accounts for approximately 85% of all relaxases found in Staphylococcus aureus isolates. Here, we present six structures of the MOB V relaxase MobM from the promiscuous plasmid pMV158 in complex with several origin of transfer DNA fragments. A combined structural, biochemical, and computational approach reveals that MobM follows a previously uncharacterizedmore » histidine/metal-dependent DNA processing mechanism, which involves the formation of a covalent phosphoramidate histidine-DNA adduct for cell-to-cell transfer. In conclusion, we discuss how the chemical features of the high-energy phosphorus-nitrogen bond shape the dominant position of MOB V histidine relaxases among small promiscuous plasmids and their preference toward Gram-positive bacteria.« less
-
NASA Astrophysics Data System (ADS)
Cunningham, Paul D.; Bricker, William P.; Díaz, Sebastián A.; Medintz, Igor L.; Bathe, Mark; Melinger, Joseph S.
2017-08-01
Sequence-selective bis-intercalating dyes exhibit large increases in fluorescence in the presence of specific DNA sequences. This property makes this class of fluorophore of particular importance to biosensing and super-resolution imaging. Here we report ultrafast transient anisotropy measurements of resonance energy transfer (RET) between thiazole orange (TO) molecules in a complex formed between the homodimer TOTO and double-stranded (ds) DNA. Biexponential homo-RET dynamics suggest two subpopulations within the ensemble: 80% intercalated and 20% non-intercalated. Based on the application of the transition density cube method to describe the electronic coupling and Monte Carlo simulations of the TOTO/dsDNA geometry, the dihedral angle between intercalated TO molecules is estimated to be 81° ± 5°, corresponding to a coupling strength of 45 ± 22 cm-1. Dye intercalation with this geometry is found to occur independently of the underlying DNA sequence, despite the known preference of TOTO for the nucleobase sequence CTAG. The non-intercalated subpopulation is inferred to have a mean inter-dye separation distance of 19 Å, corresponding to coupling strengths between 0 and 25 cm-1. This information is important to enable the rational design of energy transfer systems that utilize TOTO as a relay dye. The approach used here is generally applicable to determining the electronic coupling strength and intercalation configuration of other dimeric bis-intercalators.
-
Band edge engineering of TiO2@DNA nanohybrids and implications for capacitive energy storage devices
NASA Astrophysics Data System (ADS)
Imani, Roghayeh; Pazoki, Meysam; Tiwari, Ashutosh; Boschloo, G.; Turner, Anthony P. F.; Kralj-Iglič, V.; Iglič, Aleš
2015-06-01
Novel mesoporous TiO2@DNA nanohybrid electrodes, combining covalently encoded DNA with mesoporous TiO2 microbeads using dopamine as a linker, were prepared and characterised for application in supercapacitors. Detailed information about donor density, charge transfer resistance and chemical capacitance, which have an important role in the performance of an electrochemical device, were studied by electrochemical methods. The results indicated the improvement of electrochemical performance of the TiO2 nanohybrid electrode by DNA surface functionalisation. A supercapacitor was constructed from TiO2@DNA nanohybrids with PBS as the electrolyte. From the supercapacitor experiment, it was found that the addition of DNA played an important role in improving the specific capacitance (Cs) of the TiO2 supercapacitor. The highest Cs value of 8 F g-1 was observed for TiO2@DNA nanohybrids. The nanohybrid electrodes were shown to be stable over long-term cycling, retaining 95% of their initial specific capacitance after 1500 cycles.Novel mesoporous TiO2@DNA nanohybrid electrodes, combining covalently encoded DNA with mesoporous TiO2 microbeads using dopamine as a linker, were prepared and characterised for application in supercapacitors. Detailed information about donor density, charge transfer resistance and chemical capacitance, which have an important role in the performance of an electrochemical device, were studied by electrochemical methods. The results indicated the improvement of electrochemical performance of the TiO2 nanohybrid electrode by DNA surface functionalisation. A supercapacitor was constructed from TiO2@DNA nanohybrids with PBS as the electrolyte. From the supercapacitor experiment, it was found that the addition of DNA played an important role in improving the specific capacitance (Cs) of the TiO2 supercapacitor. The highest Cs value of 8 F g-1 was observed for TiO2@DNA nanohybrids. The nanohybrid electrodes were shown to be stable over long-term cycling, retaining 95% of their initial specific capacitance after 1500 cycles. Electronic supplementary information (ESI) available: The HRTEM analysis of TiO2 microbeads, XPS spectra of modified electrodes (Ti 2p and O 1s peaks), total number of surface states vs applied potential (calculated DOS) of modified electrodes, circuit used for EIS data fitting, specific capacitance of FTO/TiO2/DA/DNA calculated from Galvanostatic charge-discharge test versus cycle number. See DOI: 10.1039/c5nr02533h
-
Recombinational Cloning Using Gateway and In-Fusion Cloning Schemes
Throop, Andrea L.; LaBaer, Joshua
2015-01-01
The comprehensive study of protein structure and function, or proteomics, depends on the obtainability of full-length cDNAs in species-specific expression vectors and subsequent functional analysis of the expressed protein. Recombinational cloning is a universal cloning technique based on site-specific recombination that is independent of the insert DNA sequence of interest, which differentiates this method from the classical restriction enzyme-based cloning methods. Recombinational cloning enables rapid and efficient parallel transfer of DNA inserts into multiple expression systems. This unit summarizes strategies for generating expression-ready clones using the most popular recombinational cloning technologies, including the commercially available Gateway® (Life Technologies) and In-Fusion® (Clontech) cloning technologies. PMID:25827088
-
Berger, C; Berger, B; Parson, W
2012-01-01
In recent years, evidence from domestic dogs has increasingly been analyzed by forensic DNA testing. Especially, canine hairs have proved most suitable and practical due to the high rate of hair transfer occurring between dogs and humans. Starting with the description of a contamination-free sample handling procedure, we give a detailed workflow for sequencing hypervariable segments (HVS) of the mtDNA control region from canine evidence. After the hair material is lysed and the DNA extracted by Phenol/Chloroform, the amplification and sequencing strategy comprises the HVS I and II of the canine control region and is optimized for DNA of medium-to-low quality and quantity. The sequencing procedure is based on the Sanger Big-dye deoxy-terminator method and the separation of the sequencing reaction products is performed on a conventional multicolor fluorescence detection capillary electrophoresis platform. Finally, software-aided base calling and sequence interpretation are addressed exemplarily.
-
Chromosomal integration of adenoviral vector DNA in vivo.
Stephen, Sam Laurel; Montini, Eugenio; Sivanandam, Vijayshankar Ganesh; Al-Dhalimy, Muhseen; Kestler, Hans A; Finegold, Milton; Grompe, Markus; Kochanek, Stefan
2010-10-01
So far there has been no report of any clinical or preclinical evidence for chromosomal vector integration following adenovirus (Ad) vector-mediated gene transfer in vivo. We used liver gene transfer with high-capacity Ad vectors in the FAH(Deltaexon5) mouse model to analyze homologous and heterologous recombination events between vector and chromosomal DNA. Intravenous injection of Ad vectors either expressing a fumarylacetoacetate hydrolase (FAH) cDNA or carrying part of the FAH genomic locus resulted in liver nodules of FAH-expressing hepatocytes, demonstrating chromosomal vector integration. Analysis of junctions between vector and chromosomal DNA following heterologous recombination indicated integration of the vector genome through its termini. Heterologous recombination occurred with a median frequency of 6.72 x 10(-5) per transduced hepatocyte, while homologous recombination occurred more rarely with a median frequency of 3.88 x 10(-7). This study has established quantitative and qualitative data on recombination of adenoviral vector DNA with genomic DNA in vivo, contributing to a risk-benefit assessment of the biosafety of Ad vector-mediated gene transfer.
-
Opportunities for embryo transfer in the age of DNA testing
USDA-ARS?s Scientific Manuscript database
Embryo transfer (ET) has contributed to increasing selection intensity in cattle breeding for many years. Preimplantation DNA testing offers the opportunity to increase selection response further through increasing within-family selection intensity. Further increases in between-family selection inte...
-
NASA Astrophysics Data System (ADS)
Lee, Gwo-Bin; Chen, Shu-Hui; Huang, Guan-Ruey; Lin, Yen-Heng; Sung, Wang-Chou
2000-08-01
Design and fabrication of microfluidic devices on polymethylmethacrylate (PMMA) substrates using novel microfabrication methods are described. The image of microfluidic devices is transferred from quartz master templates possessing inverse image of the devices to plastic plates by using hot embossing method. The micro channels on master templates are formed by the combination of metal etch mask and wet chemical etching. The micromachined quartz templates can be used repeatedly to fabricate cheap and disposable plastic devices. The reproducibility of the hot embossing method is evaluated after using 10 channels on different plastics. The relative standard deviation of the plastic channel profile from ones on quartz templates is less than 1%. In this study, the PMMA chips have been demonstrated as a micro capillary electrophoresis ((mu) -CE) device for DNA separation and detection. The capability of the fabricated chip for electrophoretic injection and separation is characterized via the analysis of DNA fragments (phi) X174. Results indicate that all of the 11 DNA fragments of the size marker could be identified in less than 3 minutes with relative standard deviations less than 0.4% and 8% for migration time and peak area, respectively. Moreover, with the use of near IR dye, fluorescence signals of the higher molecular weight fragments ($GTR 603 bp in length) could be detected at total DNA concentrations as low as 0.1 (mu) g/mL. In addition to DNA fragments (phi) X174, DNA sizing of hepatitis C viral (HCV) amplicon is also achieved using microchip electrophoresis fabricated on PMMA substrate.
-
No genome barriers to promiscuous DNA
NASA Astrophysics Data System (ADS)
Lewin, R.
1984-06-01
Farrelly and Butow (1983) used the term 'promiscuous DNA' in their report of the apparent natural transfer of yeast mitochondrial DNA sequences into the nuclear genome. Ellis (1982) applied the same term in an editorial comment. It is pointed out since that time the subject of DNA's promiscuity has exploded with a series of reports. According to a report by Stern (1984), movement of DNA sequences between chloroplasts and mitochondria is not just a rare event but is a rampant process. It was recently concluded that 'the widespread presence of ctDNA sequences in plant mtDNA is best regarded as a dramatic demonstration of the dynamo nature of interactions between the chloroplast and the mitochondrion, similar to the ongoing process of interorganellar DNA transfer already documented between mitochondrion and nucleus and between chloroplast and nucleus'.
-
Non-radioactive detection of trinucleotide repeat size variability.
Tomé, Stéphanie; Nicole, Annie; Gomes-Pereira, Mario; Gourdon, Genevieve
2014-03-06
Many human diseases are associated with the abnormal expansion of unstable trinucleotide repeat sequences. The mechanisms of trinucleotide repeat size mutation have not been fully dissected, and their understanding must be grounded on the detailed analysis of repeat size distributions in human tissues and animal models. Small-pool PCR (SP-PCR) is a robust, highly sensitive and efficient PCR-based approach to assess the levels of repeat size variation, providing both quantitative and qualitative data. The method relies on the amplification of a very low number of DNA molecules, through sucessive dilution of a stock genomic DNA solution. Radioactive Southern blot hybridization is sensitive enough to detect SP-PCR products derived from single template molecules, separated by agarose gel electrophoresis and transferred onto DNA membranes. We describe a variation of the detection method that uses digoxigenin-labelled locked nucleic acid probes. This protocol keeps the sensitivity of the original method, while eliminating the health risks associated with the manipulation of radiolabelled probes, and the burden associated with their regulation, manipulation and waste disposal.
-
Stein, Eric D; White, Bryan P; Mazor, Raphael D; Miller, Peter E; Pilgrim, Erik M
2013-01-01
Molecular methods, such as DNA barcoding, have the potential to enhance biomonitoring programs worldwide. Altering routinely used sample preservation methods to protect DNA from degradation may pose a potential impediment to application of DNA barcoding and metagenomics for biomonitoring using benthic macroinvertebrates. Using higher volumes or concentrations of ethanol, requirements for shorter holding times, or the need to include additional filtering may increase cost and logistical constraints to existing biomonitoring programs. To address this issue we evaluated the efficacy of various ethanol-based sample preservation methods at maintaining DNA integrity. We evaluated a series of methods that were minimally modified from typical field protocols in order to identify an approach that can be readily incorporated into existing monitoring programs. Benthic macroinvertebrates were collected from a minimally disturbed stream in southern California, USA and subjected to one of six preservation treatments. Ten individuals from five taxa were selected from each treatment and processed to produce DNA barcodes from the mitochondrial gene cytochrome c oxidase I (COI). On average, we obtained successful COI sequences (i.e. either full or partial barcodes) for between 93-99% of all specimens across all six treatments. As long as samples were initially preserved in 95% ethanol, successful sequencing of COI barcodes was not affected by a low dilution ratio of 2∶1, transfer to 70% ethanol, presence of abundant organic matter, or holding times of up to six months. Barcoding success varied by taxa, with Leptohyphidae (Ephemeroptera) producing the lowest barcode success rate, most likely due to poor PCR primer efficiency. Differential barcoding success rates have the potential to introduce spurious results. However, routine preservation methods can largely be used without adverse effects on DNA integrity.
-
Stein, Eric D.; White, Bryan P.; Mazor, Raphael D.; Miller, Peter E.; Pilgrim, Erik M.
2013-01-01
Molecular methods, such as DNA barcoding, have the potential to enhance biomonitoring programs worldwide. Altering routinely used sample preservation methods to protect DNA from degradation may pose a potential impediment to application of DNA barcoding and metagenomics for biomonitoring using benthic macroinvertebrates. Using higher volumes or concentrations of ethanol, requirements for shorter holding times, or the need to include additional filtering may increase cost and logistical constraints to existing biomonitoring programs. To address this issue we evaluated the efficacy of various ethanol-based sample preservation methods at maintaining DNA integrity. We evaluated a series of methods that were minimally modified from typical field protocols in order to identify an approach that can be readily incorporated into existing monitoring programs. Benthic macroinvertebrates were collected from a minimally disturbed stream in southern California, USA and subjected to one of six preservation treatments. Ten individuals from five taxa were selected from each treatment and processed to produce DNA barcodes from the mitochondrial gene cytochrome c oxidase I (COI). On average, we obtained successful COI sequences (i.e. either full or partial barcodes) for between 93–99% of all specimens across all six treatments. As long as samples were initially preserved in 95% ethanol, successful sequencing of COI barcodes was not affected by a low dilution ratio of 2∶1, transfer to 70% ethanol, presence of abundant organic matter, or holding times of up to six months. Barcoding success varied by taxa, with Leptohyphidae (Ephemeroptera) producing the lowest barcode success rate, most likely due to poor PCR primer efficiency. Differential barcoding success rates have the potential to introduce spurious results. However, routine preservation methods can largely be used without adverse effects on DNA integrity. PMID:23308097
-
A septal chromosome segregator protein evolved into a conjugative DNA-translocator protein
Sepulveda, Edgardo; Vogelmann, Jutta
2011-01-01
Streptomycetes, Gram-positive soil bacteria well known for the production of antibiotics feature a unique conjugative DNA transfer system. In contrast to classical conjugation which is characterized by the secretion of a pilot protein covalently linked to a single-stranded DNA molecule, in Streptomyces a double-stranded DNA molecule is translocated during conjugative transfer. This transfer involves a single plasmid encoded protein, TraB. A detailed biochemical and biophysical characterization of TraB, revealed a close relationship to FtsK, mediating chromosome segregation during bacterial cell division. TraB translocates plasmid DNA by recognizing 8-bp direct repeats located in a specific plasmid region clt. Similar sequences accidentally also occur on chromosomes and have been shown to be bound by TraB. We suggest that TraB mobilizes chromosomal genes by the interaction with these chromosomal clt-like sequences not relying on the integration of the conjugative plasmid into the chromosome. PMID:22479692
-
The use of Hemastix and the subsequent lack of DNA recovery using the Promega DNA IQ system.
Poon, Hiron; Elliott, Jim; Modler, Jeff; Frégeau, Chantal
2009-11-01
Following implementation of our automated process incorporating the Promega DNA IQ system as a DNA extraction method, a large number of blood-containing exhibits failed to produce DNA. These exhibits had been tested with the Hemastix reagent strip, commonly used by police investigators and forensic laboratories as a screening test for blood. Some exhibits were even tainted green following transfer of the presumptive test reagents onto the samples. A series of experiments were carried out to examine the effect of the Hemastix chemistries on the DNA IQ system. Our results indicate that one or more chemicals imbedded in the Hemastix reagent strip severely reduce the ability to recover DNA from any suspected stain using the DNA IQ magnetic bead technology. The 3,3',5,5'-tetramethylbenzidine (TMB) used as the reporting dye appears to interact with the magnetic beads to prevent DNA recovery. Hydrogen peroxide does not seem to be involved. The Hemastix chemistries do not interfere in any way with DNA extraction performed using phenol-chloroform. The incompatibility of the Hemastix chemistries on the DNA IQ system forced us to adopt an indirect approach using filter paper to carry out the presumptive test.
-
DNA profiling of trace DNA recovered from bedding.
Petricevic, Susan F; Bright, Jo-Anne; Cockerton, Sarah L
2006-05-25
Trace DNA is often detected on handled items and worn clothing examined in forensic laboratories. In this study, the potential transfer of trace DNA to bedding by normal contact, when an individual sleeps in a bed, is examined. Volunteers slept one night on a new, lower bed sheet in their own bed and one night in a bed foreign to them. Samples from the sheets were collected and analysed by DNA profiling. The results indicate that the DNA profile of an individual can be obtained from bedding after one night of sleeping in a bed. The DNA profile of the owner of the bed could also be detected in the foreign bed experiments. Since mixed DNA profiles can be obtained from trace DNA on bedding, caution should be exercised when drawing conclusions from DNA profiling results obtained from such samples. This transfer may have important repercussions in sexual assault investigations.
-
Pea amyloplast DNA is qualitatively similar to pea chloroplast DNA
NASA Technical Reports Server (NTRS)
Gaynor, J. J.
1984-01-01
Amyloplast DNA (apDNA), when subjected to digestion with restriction endonucleases, yields patterns nearly identical to that of DNA from mature pea chloroplasts (ctDNA). Southern transfers of apDNA and ctDNA, probed with the large subunit (LS) gene of ribulose-1,5-bisphosphate carboxylase (Rubisco), shows hybridization to the expected restriction fragments for both apDNA and ctDNA. However, Northern transfers of total RNA from chloroplasts and amyloplasts, probed again with the LS gene of Rubisco, shows that no detectable LS meggage is found in amyloplasts although LS expression in mature chloroplasts is high. Likewise, two dimensional polyacrylamide gel electrophoresis of etiolated gravisensitive pea tissue shows that both large and small subunits of Rubisco are conspicuously absent; however, in greening tissue these two constitute the major soluble proteins. These findings suggest that although the informational content of these two organelle types is equivalent, gene expression is quite different and is presumably under nuclear control.
-
Yuan, Jipei; Guo, Weiwei; Yang, Xiurong; Wang, Erkang
2009-01-01
A sensing system based on the photoinduced electron transfer of quantum dots (QDs) was designed to measure the interaction of anticancer drug and DNA, taking mitoxantrone (MTX) as a model drug. MTX adsorbed on the surface of QDs can quench the photoluminescence (PL) of QDs through the photoinduced electron-transfer process; and then the addition of DNA will bring the restoration of QDs PL intensity, as DNA can bind with MTX and remove it from QDs. Sensitive detection of MTX with the detection limit of 10 nmol L(-1) and a linear detection range from 10 nmol L(-1) to 4.5 micromol L(-1) was achieved. The dependence of PL intensity on DNA amount was successfully utilized to investigate the interactions between MTX and DNA. Both the binding constants and the sizes of binding site of MTX-DNA interactions were calculated based on the equations deduced for the PL recovery process. The binding constant obtained in our experiment was generally consistent with previous reports. The sensitive and speedy detection of MTX as well as the avoidance of modification or immobilization process made this system suitable and promising in the drug-DNA interaction studies.
-
High density FTA plates serve as efficient long-term sample storage for HLA genotyping.
Lange, V; Arndt, K; Schwarzelt, C; Boehme, I; Giani, A S; Schmidt, A H; Ehninger, G; Wassmuth, R
2014-02-01
Storage of dried blood spots (DBS) on high-density FTA(®) plates could constitute an appealing alternative to frozen storage. However, it remains controversial whether DBS are suitable for high-resolution sequencing of human leukocyte antigen (HLA) alleles. Therefore, we extracted DNA from DBS that had been stored for up to 4 years, using six different methods. We identified those extraction methods that recovered sufficient high-quality DNA for reliable high-resolution HLA sequencing. Further, we confirmed that frozen whole blood samples that had been stored for several years can be transferred to filter paper without compromising HLA genotyping upon extraction. Concluding, DNA derived from high-density FTA(®) plates is suitable for high-resolution HLA sequencing, provided that appropriate extraction protocols are employed. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
-
Biolistic transfection of neuronal cultures using a hand-held gene gun
O'Brien, John A; Lummis, Sarah C R
2009-01-01
Biolistic transfection is a technique in which subcellular-sized particles coated with DNA are accelerated to high velocity to propel them into cells. This method is applicable to tissues, cells and organelles, and can be used for both in vitro and in vivo transformations; with the right equipment, it is simple, rapid and efficient. Here we provide a detailed protocol for biolistic transfection of plasmids into cultured human embryonic kidney (HEK) 293 cells and organotypic brain slices using a hand-held gene gun. There are three major steps: (i) coating microcarriers with DNA, (ii) transferring the microcarriers into a cartridge to make a ‘bullet’, and (iii) firing the DNA-coated microcarriers into cells using a pulse of helium gas. The method can be readily adapted to other cell types and tissues. The protocol can be completed in 1–2 h. PMID:17406333
-
DNA modification and functional delivery into human cells using Escherichia coli DH10B
Narayanan, Kumaran; Warburton, Peter E.
2003-01-01
The availability of almost the complete human genome as cloned BAC libraries represents a valuable resource for functional genomic analysis, which, however, has been somewhat limited by the ability to modify and transfer this DNA into mammalian cells intact. Here we report a novel comprehensive Escherichia coli-based vector system for the modification, propagation and delivery of large human genomic BAC clones into mammalian cells. The GET recombination inducible homologous recombination system was used in the BAC host strain E.coli DH10B to precisely insert an EGFPneo cassette into the vector portion of a ∼200 kb human BAC clone, providing a relatively simple method to directly convert available BAC clones into suitable vectors for mammalian cells. GET recombination was also used for the targeted deletion of the asd gene from the E.coli chromosome, resulting in defective cell wall synthesis and diaminopimelic acid auxotrophy. Transfer of the Yersinia pseudotuberculosis invasin gene into E.coli DH10B asd– rendered it competent to invade HeLa cells and deliver DNA, as judged by transient expression of green fluorescent protein and stable neomycin-resistant colonies. The efficiency of DNA transfer and survival of HeLa cells has been optimized for incubation time and multiplicity of infection of invasive E.coli with HeLa cells. This combination of E.coli-based homologous recombination and invasion technologies using BAC host strain E.coli DH10B will greatly improve the utility of the available BAC libraries from the human and other genomes for gene expression and functional genomic studies. PMID:12711696
-
Ma, Jun; Marignier, Jean-Louis; Pernot, Pascal; Houée-Levin, Chantal; Kumar, Anil; Sevilla, Michael D; Adhikary, Amitava; Mostafavi, Mehran
2018-05-30
In irradiated DNA, by the base-to-base and backbone-to-base hole transfer processes, the hole (i.e., the unpaired spin) localizes on the most electropositive base, guanine. Phosphate radicals formed via ionization events in the DNA-backbone must play an important role in the backbone-to-base hole transfer process. However, earlier studies on irradiated hydrated DNA, on irradiated DNA-models in frozen aqueous solution and in neat dimethyl phosphate showed the formation of carbon-centered radicals and not phosphate radicals. Therefore, to model the backbone-to-base hole transfer process, we report picosecond pulse radiolysis studies of the reactions between H2PO4˙ with the DNA bases - G, A, T, and C in 6 M H3PO4 at 22 °C. The time-resolved observations show that in 6 M H3PO4, H2PO4˙ causes the one-electron oxidation of adenine, guanine and thymine, by forming the cation radicals via a single electron transfer (SET) process; however, the rate constant of the reaction of H2PO4˙ with cytosine is too low (<107 L mol-1 s-1) to be measured. The rates of these reactions are influenced by the protonation states and the reorganization energies of the base radicals and of the phosphate radical in 6 M H3PO4.
-
How-To-Do-It: Recombinant DNA Made Easy: I. "Jumping Genes."
ERIC Educational Resources Information Center
Thomson, Robert G.
1988-01-01
Presents as part I of a two-part series a study involving the intercellular transfer of bacterial DNA that codes for the resistance to antibiotics. Demonstrates to students that such transfers occur. Discusses laboratory procedures, materials and results. (CW)
-
Zhang, Xiaoru; Xu, Yunpeng; Zhao, Yanqing; Song, Weiling
2013-01-15
We report a strategy for the transduction of DNA hybridization into a readily detectable photoelectrochemical signal by means of a conformational change analogous to electrochemical DNA (E-DNA) approach. To demonstrate the effect of distance change for photosensitizer to the surface of electrode on the change of photocurrent, photosensitizer Ru(bpy)(2)(dcbpy)(2+) tagged DNA stem-loop structures were self-assembled onto a nanogold modified ITO electrode. Hybridization induced a large conformational change in DNA structure, which in turn significantly altered the electron-transfer tunneling distance between the electrode and photosensitizer. The resulting change in photocurrent was proportional to the concentration of DNA in the range of 1.0×10(-10)-8.0×10(-9)M. In order to improve the sensitivity of the photoelectrochemical biosensor, an amplified detection method based on isothermal strand displacement polymerization reaction was employed. With multiple rounds of isothermal strand replication, which led to strand displacement and constituted consecutive signal amplification, a detection limit of 9.4×10(-14)M target DNA was achieved. Copyright © 2012 Elsevier B.V. All rights reserved.
-
Lee, Wonyou; Song, Kilyoung; Lee, Inhyung; Shin, Hyungdo; Lee, Byeong Chun; Yeon, Seongchan; Jang, Goo
2015-01-01
Transvaginal ultrasound-guided follicle aspiration is one method of obtaining recipient oocytes for equine somatic cell nuclear transfer (SCNT). This study was conducted: (1) to evaluate the possibility of oocyte aspiration from pre-ovulatory follicles using a short disposable needle system (14-G) by comparing the oocyte recovery rate with that of a long double lumen needle (12-G); (2) to investigate the developmental competence of recovered oocytes after SCNT and embryo transfer. The recovery rates with the short disposable needle vs. the long needle were not significantly different (47.5% and 35.0%, respectively). Twenty-six SCNT embryos were transferred to 13 mares, and one mare delivered a live offspring at Day 342. There was a perfect identity match between the cloned foal and the cell donor after analysis of microsatellite DNA, and the mitochondrial DNA of the cloned foal was identical with that of the oocyte donor. These results demonstrated that the short disposable needle system can be used to recover oocytes to use as cytoplasts for SCNT, in the production of cloned foals and for other applications in equine embryology.
-
Stemp, E D; Barton, J K
2000-08-21
Electron transfer from a protein to oxidatively damaged DNA, specifically from ferrocytochrome c to the guanine radical, was examined using the flash-quench technique. Ru(phen)2dppz2+ (dppz = dipyridophenazine) was employed as the photosensitive intercalator, and ferricytochrome c (Fe3+ cyt c), as the oxidative quencher. Using transient absorption and time-resolved luminescence spectroscopies, we examined the electron-transfer reactions following photoexcitation of the ruthenium complex in the presence of poly(dA-dT) or poly(dG-dC). The luminescence-quenching titrations of excited Ru(phen)2dppz2+ by Fe3+ cyt c are nearly identical for the two DNA polymers. However, the spectral characteristics of the long-lived transient produced by the quenching depend strongly upon the DNA. For poly(dA-dT), the transient has a spectrum consistent with formation of a [Ru(phen)2dppz3+, Fe2+ cyt c] intermediate, indicating that the system regenerates itself via electron transfer from the protein to the Ru(III) metallointercalator for this polymer. For poly(dG-dC), however, the transient has the characteristics expected for an intermediate of Fe2+ cyt c and the neutral guanine radical. The characteristics of the transient formed with the GC polymer are consistent with rapid oxidation of guanine by the Ru(III) complex, followed by slow electron transfer from Fe2+ cyt c to the guanine radical. These experiments show that electron holes on DNA can be repaired by protein and demonstrate how the flash-quench technique can be used generally in studying electron transfer from proteins to guanine radicals in duplex DNA.
-
Arenskötter, Matthias; Baumeister, Dirk; Kalscheuer, Rainer; Steinbüchel, Alexander
2003-01-01
Gene transfer systems for Gordonia polyisoprenivorans strains VH2 and Y2K based on electroporation and conjugation, respectively, were established. Several parameters were optimized, resulting in transformation efficiencies of >4 × 105 CFU/μg of plasmid DNA. In contrast to most previously described electroporation protocols, the highest efficiencies were obtained by applying a heat shock after the intrinsic electroporation. Under these conditions, transfer and autonomous replication of plasmid pNC9503 was also demonstrated to proceed in G. alkanivorans DSM44187, G. nitida DSM44499T, G. rubropertincta DSM43197T, G. rubropertincta DSM46038, and G. terrae DSM43249T. Conjugational plasmid DNA transfer to G. polyisoprenivorans resulted in transfer frequencies of up to 5 × 10−6 of the recipient cells. Recombinant strains capable of polyhydroxyalkanoate synthesis from alkanes were constructed. PMID:12902293
-
Blochlinger, K; Diggelmann, H
1984-12-01
The DNA coding sequence for the hygromycin B phosphotransferase gene was placed under the control of the regulatory sequences of a cloned long terminal repeat of Moloney sarcoma virus. This construction allowed direct selection for hygromycin B resistance after transfection of eucaryotic cell lines not naturally resistant to this antibiotic, thus providing another dominant marker for DNA transfer in eucaryotic cells.
-
Blochlinger, K; Diggelmann, H
1984-01-01
The DNA coding sequence for the hygromycin B phosphotransferase gene was placed under the control of the regulatory sequences of a cloned long terminal repeat of Moloney sarcoma virus. This construction allowed direct selection for hygromycin B resistance after transfection of eucaryotic cell lines not naturally resistant to this antibiotic, thus providing another dominant marker for DNA transfer in eucaryotic cells. Images PMID:6098829
-
Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)
NASA Astrophysics Data System (ADS)
Risqi, A. M.; Yudiarsah, E.
2017-07-01
Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.
-
Quantum dot-based microfluidic biosensor for cancer detection
NASA Astrophysics Data System (ADS)
Ghrera, Aditya Sharma; Pandey, Chandra Mouli; Ali, Md. Azahar; Malhotra, Bansi Dhar
2015-05-01
We report results of the studies relating to fabrication of an impedimetric microfluidic-based nucleic acid sensor for quantification of DNA sequences specific to chronic myelogenous leukemia (CML). The sensor chip is prepared by patterning an indium-tin-oxide (ITO) coated glass substrate via wet chemical etching method followed by sealing with polydimethylsiloxane (PDMS) microchannel for fluid control. The fabricated microfluidic chip comprising of a patterned ITO substrate is modified by depositing cadmium selenide quantum dots (QCdSe) via Langmuir-Blodgett technique. Further, the QCdSe surface has been functionalized with specific DNA probe for CML detection. The probe DNA functionalized QCdSe integrated miniaturized system has been used to monitor target complementary DNA concentration by measuring the interfacial charge transfer resistance via hybridization. The presence of complementary DNA in buffer solution significantly results in decreased electro-conductivity of the interface due to presence of a charge barrier for transport of the redox probe ions. The microfluidic DNA biosensor exhibits improved linearity in the concentration range of 10-15 M to 10-11 M.
-
Simulation experiments of the effect of space environment on bacteriophage and DNA thin films
NASA Technical Reports Server (NTRS)
Fekete, A.; Ronto, Gy; Hegedus, M.; Modos, K.; Berces, A.; Kovacs, G.; Lammer, H.; Panitz, C.
2004-01-01
The main goal of PUR experiment (phage and uracil response) is to examine and quantify the effect of specific space conditions on nucleic acid models. To achieve this an improved method was elaborated for the preparation of DNA and bacteriophage thin films. The homogeneity of the films was controlled by UV spectroscopy and microscopy. To provide experimental evidence for the hypothesis that interplanetary transfer of the genetic material is possible, phage T7 and isolated T7 DNA thin films have been exposed to selected space conditions: intense UVC radiation (lambda=254 nm) and high vacuum (10(-4) Pa). The effects of DNA hydration, conformation and packing on UV radiation damage were examined. Characteristic changes in the absorption spectrum, in the electrophoretic pattern of DNA and the decrease of the amount of PCR products have been detected indicating the photodamage of isolated and intraphage DNA. c2004 COSPAR. Published by Elsevier Ltd. All rights reserved.
-
Ni, W; Le Guiner, C; Gernoux, G; Penaud-Budloo, M; Moullier, P; Snyder, R O
2011-07-01
Legitimate uses of gene transfer technology can benefit from sensitive detection methods to determine vector biodistribution in pre-clinical studies and in human clinical trials, and similar methods can detect illegitimate gene transfer to provide sports-governing bodies with the ability to maintain fairness. Real-time PCR assays were developed to detect a performance-enhancing transgene (erythropoietin, EPO) and backbone sequences in the presence of endogenous cellular sequences. In addition to developing real-time PCR assays, the steps involved in DNA extraction, storage and transport were investigated. By real-time PCR, the vector transgene is distinguishable from the genomic DNA sequence because of the absence of introns, and the vector backbone can be identified by heterologous gene expression control elements. After performance of the assays was optimized, cynomolgus macaques received a single dose by intramuscular (IM) injection of plasmid DNA, a recombinant adeno-associated viral vector serotype 1 (rAAV1) or a rAAV8 vector expressing cynomolgus macaque EPO. Macaques received a high plasmid dose intended to achieve a significant, but not life-threatening, increase in hematocrit. rAAV vectors were used at low doses to achieve a small increase in hematocrit and to determine the limit of sensitivity for detecting rAAV sequences by single-step PCR. DNA extracted from white blood cells (WBCs) was tested to determine whether WBCs can be collaterally transfected by plasmid or transduced by rAAV vectors in this context, and can be used as a surrogate marker for gene doping. We demonstrate that IM injection of a conventional plasmid and rAAV vectors results in the presence of DNA that can be detected at high levels in blood before rapid elimination, and that rAAV genomes can persist for several months in WBCs.
-
A Polymerase With Potential: The Fe-S Cluster in Human DNA Primase.
Holt, Marilyn E; Salay, Lauren E; Chazin, Walter J
2017-01-01
Replication of DNA in eukaryotes is primarily executed by the combined action of processive DNA polymerases δ and ɛ. These enzymes cannot initiate synthesis of new DNA without the presence of a primer on the template ssDNA. The primers on both the leading and lagging strands are generated by DNA polymerase α-primase (pol-prim). DNA primase is a DNA-dependent RNA polymerase that synthesizes the first ~10 nucleotides and then transfers the substrate to polymerase α to complete primer synthesis. The mechanisms governing the coordination and handoff between primase and polymerase α are largely unknown. Isolated DNA primase contains a [4Fe-4S] 2+ cluster that has been shown to serve as a redox switch modulating DNA binding affinity. This discovery suggests a mechanism for modulating the priming activity of primase and handoff to polymerase α. In this chapter, we briefly discuss the current state of knowledge of primase structure and function, including the role of its iron-sulfur cluster. This is followed by providing the methods for expressing, purifying, and biophysically/structurally characterizing primase and its iron-sulfur cluster-containing domain, p58C. © 2017 Elsevier Inc. All rights reserved.
-
Studying of kinetics of rear earth ion (REI) nanoscale complex formation by resonant energy transfer
NASA Astrophysics Data System (ADS)
Ignatova, Tetyana; Pristinski, Denis; Rotkin, Slava V.
2011-03-01
We observed formation of nanoscale complexes between multivalent REIs (Tb and Eu) and negatively charged DNA wrapped SWNTs, ionized in the water solution. Foerster Resonance Energy Transfer (FRET) was found to be an ideal method to confirm the complex formation. Because of its high sensitivity and non-destructive characterization approach FRET can be used to trace the kinetics of the complex formation. Strong dependence of SWNT photoluminescence (PL) on the REI concentration was detected and interpreted as a competition between the REI absorption on the SWNTs and subsequent FRET enhanced PL and the SWNT agglomeration followed by PL quenching. We measured the distance between REI and SWNT which appears to be much shorter than the one from their relative concentration in solution. We speculate that Manning condensation of the REIs on the SWNT/DNA surface happens thereby significantly reducing their spacing and making FRET possible.
-
Characterisation of gene delivery using liposomal bubbles and ultrasound
NASA Astrophysics Data System (ADS)
Koshima, Risa; Suzuki, Ryo; Oda, Yusuke; Hirata, Keiichi; Nomura, Tetsuya; Negishi, Yoichi; Utoguchi, Naoki; Kudo, Nobuki; Maruyama, Kazuo
2011-09-01
The combination of nano/microbubbles and ultrasound is a novel technique for a non-viral gene deliver. We have previously developed novel ultrasound sensitive liposomes (Bubble liposomes) which contain the ultrasound imaging gas perfluoropropane. In this study, Bubble liposomes were compared with cationic lipid (CL)-DNA complexes as potential gene delivery carriers into tumors in vivo. The delivery of genes by bubble liposomes depended on the intensity of the applied ultrasound. The transfection efficiency plateaued at 0.7 W/cm2 ultrasound intensity. Bubble liposomes efficiently transferred genes into cultured cells even when the cells were exposed to ultrasound for only 1 s. In addition, bubble liposomes were able to introduce the luciferase gene more effectively than CL-DNA complexes into mouse ascites tumor cells. We conclude that the combination of Bubble liposomes and ultrasound is a good method for gene transfer in vivo.
-
Kakiuchi, Toshifumi; Ito, Fuyuki; Nagamura, Toshihiko
2008-04-03
The excitation energy transfer from meso-tetrakis(N-methylpyridinium-4-yl)porphyrin (TMPyP) to 3,3'-diethyl-2,2'-thiatricarbocyanine iodide (DTTCI) along the deoxyribonucleic acid (DNA) double strand was investigated by the steady-state absorption and fluorescence measurements and time-resolved fluorescence measurements. The steady-state fluorescence spectra showed that the near-infrared fluorescence of DTTCI was strongly enhanced up to 86 times due to the energy transfer from the excited TMPyP molecule in DNA buffer solution. Furthermore, we elucidated the mechanism of fluorescence quenching and enhancement by the direct observation of energy transfer using the time-resolved measurements. The fluorescence quenching of TMPyP chiefly consists of a static component due to the formation of complex and dynamic components due to the excitation energy transfer. In a heterogeneous one-dimensional system such as a DNA chain, it was proved that the energy transfer process only carries out within the critical distance based on the Förster theory and within a threshold value estimated from the modified Stern-Volmer equation. The present results showed that DNA chain is one of the most powerful tools for nanoassemblies and will give a novel concepts of material design.
-
Voltage dependency of transmission probability of aperiodic DNA molecule
NASA Astrophysics Data System (ADS)
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
-
Liu, Ye; Kannegulla, Akash; Wu, Bo; Cheng, Li-Jing
2018-05-15
Spherical fullerene (C 60 ) can quench the fluorescence of a quantum dot (QD) through energy transfer and charge transfer processes, with the quenching efficiency regulated by the number of proximate C 60 on each QD. With the quenching property and its small size compared with other nanoparticle-based quenchers, it is advantageous to group a QD reporter and multiple C 60 -labeled oligonucleotide probes to construct a molecular beacon (MB) probe for sensitive, robust nucleic acid detection. We demonstrated a rapid, high-sensitivity DNA detection method using the nanosensors composed of QD-C 60 based MBs carried by magnetic nanoparticles (MNPs). The assay was accelerated by first dispersing the nanosensors in analytes for highly efficient DNA capture resulting from short-distance 3-dimensional diffusion of targets to the sensor surface and then concentrating the nanosensors to a substrate by magnetic force to amplify the fluorescence signal for target quantification. The enhanced mass transport enabled a rapid detection (< 10 min) with a small sample volume (1-10 µl). The high signal-to-noise ratio produced by the QD-C 60 pairs and magnetic concentration yielded a detection limit of 100 fM (~106 target DNA copies for a 10 µl analyte). The rapid, sensitive, label-free detection method will benefit the applications in point-of-care molecular diagnostic technologies.
-
Du, Lei; Liu, Rui-Hua; Ying, Li; Zhao, Guang-Rong
2012-01-01
Streptomyces lincolnensis is a producer of lincomycin, which is a lincosamide antibiotic for the treatment of infective diseases caused by Gram-positive bacteria. S. lincolnensis is refractory to introducing plasmid DNA into cells because of resistance of foreign DNAs and poor sporulation. In this study, a simple and efficient method of transferring plasmids into S. lincolnensis through the intergeneric Escherichia coli-mycelia conjugation was established and optimized for the first time. The recipient mycelia of S. lincolnensis were prepared in liquid SM medium containing 10.3% sucrose for three days. The dispersed mycelia were conjugated with competent E. coli donor cells. The exconjugants were regenerated efficiently on solid mannitol soya flour (MS) medium containing 20 mM MgCl2. The average conjugation frequency was observed at 1.1 × 10−4 per input donor cell and validated functionally by transferring two types of vectors containing lincomycin resistance genes lmrA, lmrB and lmrC into S. lincolnensis mycelia. The data of fermentation in shaking flasks showed the lincomycin yield of the exconjugants increased by 52.9% for the multiple copy vector and 38.3% for the integrative one, compared with the parental strain. The efficient and convenient method of intergeneric E. coli-mycelia conjugation in this study provides a promising procedure to introduce plasmid DNA into other refractory streptomycetes. PMID:22606009
-
Perwez, T; Meyer, R
1996-01-01
An essential early step in conjugal mobilization of R1162, nicking of the DNA strand that is subsequently transferred, is carried out in the relaxosome, a complex of two plasmid-encoded proteins and DNA at the origin of transfer (oriT). A third protein, MobB, is also required for efficient mobilization. We show that in the cell this protein increases the proportion of molecules specifically nicked at oriT, resulting in lower yields of covalently closed molecules after alkaline extraction. These nicked molecules largely remain supercoiled, with unwinding presumably constrained by the relaxosome. MobB enhances the sensitivity of the oriT DNA to oxidation by permanganate, indicating that the protein acts by increasing the fraction of complexed molecules. Mutations that significantly reduce the amount of complexed DNA in the cell were isolated. However, plasmids with these mutations were mobilized at nearly the normal frequency, were nicked at a commensurate level, and still required MobB. Our results indicate that the frequency of transfer is determined both by the amount of time each molecule is in the nicked form and by the proportion of complexed molecules in the total population. PMID:8824623
-
Bacterial DNA in water and dialysate: detection and significance for patient outcomes.
Handelman, Garry J; Megdal, Peter A; Handelman, Samuel K
2009-01-01
The fluid used for hemodialysis may contain DNA fragments from bacteria, which could be harmful for patient outcomes. DNA fragments from bacteria, containing the nonmethylated CpG motif, can trigger inflammation through the monocyte and lymphocyte Toll-like receptor 9, and these DNA fragments have been observed in dialysate. The fragments may transfer across the dialyzer into the patient's bloodstream during hemodialysis treatment. During hemodiafiltration, the fragments would be introduced directly into the bloodstream. The DNA fragments may arise from biofilm in the pipes of the water system, from growth of bacteria in the water, or as contaminants in the bicarbonate and salt mixture used for preparation of dialysate. Current filtration methods, such as Diasafe filters, are not able to remove these fragments. It would be prudent to seek to reduce or eliminate these contaminants. However, the cost and effort of decreasing bacterial DNA content may ultimately require substantial facility improvements; we therefore need to fund research studies to determine if modifications to reduce bacterial DNA content are clinically warranted. This research will require methods to accurately determine the species of bacteria that contribute the DNA, since this information will allow the source to be established as biofilm, bicarbonate mixtures, or other problems in the dialysis system such as bacterial growth or leakage during water preparation. In this review, the evidence for bacterial DNA fragments will be examined and suggestions for further studies will be described.
-
Clustered DNA damages induced in isolated DNA and in human cells by low doses of ionizing radiation
NASA Technical Reports Server (NTRS)
Sutherland, B. M.; Bennett, P. V.; Sidorkina, O.; Laval, J.; Lowenstein, D. I. (Principal Investigator)
2000-01-01
Clustered DNA damages-two or more closely spaced damages (strand breaks, abasic sites, or oxidized bases) on opposing strands-are suspects as critical lesions producing lethal and mutagenic effects of ionizing radiation. However, as a result of the lack of methods for measuring damage clusters induced by ionizing radiation in genomic DNA, neither the frequencies of their production by physiological doses of radiation, nor their repairability, nor their biological effects are known. On the basis of methods that we developed for quantitating damages in large DNAs, we have devised and validated a way of measuring ionizing radiation-induced clustered lesions in genomic DNA, including DNA from human cells. DNA is treated with an endonuclease that induces a single-strand cleavage at an oxidized base or abasic site. If there are two closely spaced damages on opposing strands, such cleavage will reduce the size of the DNA on a nondenaturing gel. We show that ionizing radiation does induce clustered DNA damages containing abasic sites, oxidized purines, or oxidized pyrimidines. Further, the frequency of each of these cluster classes is comparable to that of frank double-strand breaks; among all complex damages induced by ionizing radiation, double-strand breaks are only about 20%, with other clustered damage constituting some 80%. We also show that even low doses (0.1-1 Gy) of high linear energy transfer ionizing radiation induce clustered damages in human cells.
-
NASA Astrophysics Data System (ADS)
Niroomand, Sona; Khorasani-Motlagh, Mozhgan; Noroozifar, Meissam; Jahani, Shohreh; Moodi, Asieh
2017-02-01
The binding of the lanthanum(III) complex containing 1,10-phenanthroline (phen), [La(phen)3Cl3·OH2], to DNA is investigated by absorption and emission methods. This complex shows absorption decreasing in a charge transfer band, and fluorescence decrement when it binds to DNA. Electronic absorption spectroscopy (UV-Vis), fluorescence spectra, iodide quenching experiments, salt effect and viscosity measurements, ethidium bromide (EB) competition test, circular dichroism (CD) spectra as well as variable temperature experiments indicate that the La(III) complex binds to fish salmon (FS) DNA, presumably via groove binding mode. The binding constants (Kb) of the La(III) complex with DNA is (2.55 ± 0.02) × 106 M-1. Furthermore, the binding site size, n, the Stern-Volmer constant KSV and thermodynamic parameters; enthalpy change (ΔH0) and entropy change (ΔS0) and Gibb's free energy (ΔG0), are calculated according to relevant fluorescent data and the Van't Hoff equation. The La(III) complex has been screened for its antibacterial activities by the disc diffusion method. Also, in order to supplement the experimental findings, DFT computation and NBO analysis are carried out.
-
Delbianco, Alice; Lanzoni, Chiara; Klein, Elodie; Rubies Autonell, Concepcion; Gilmer, David; Ratti, Claudio
2013-05-01
Agroinoculation is a quick and easy method for the infection of plants with viruses. This method involves the infiltration of tissue with a suspension of Agrobacterium tumefaciens carrying binary plasmids harbouring full-length cDNA copies of viral genome components. When transferred into host cells, transcription of the cDNA produces RNA copies of the viral genome that initiate infection. We produced full-length cDNA corresponding to Beet necrotic yellow vein virus (BNYVV) RNAs and derived replicon vectors expressing viral and fluorescent proteins in pJL89 binary plasmid under the control of the Cauliflower mosaic virus 35S promoter. We infected Nicotiana benthamiana and Beta macrocarpa plants with BNYVV by leaf agroinfiltration of combinations of agrobacteria carrying full-length cDNA clones of BNYVV RNAs. We validated the ability of agroclones to reproduce a complete viral cycle, from replication to cell-to-cell and systemic movement and, finally, plant-to-plant transmission by its plasmodiophorid vector. We also showed successful root agroinfection of B. vulgaris, a new tool for the assay of resistance to rhizomania, the sugar beet disease caused by BNYVV. © 2013 BSPP AND BLACKWELL PUBLISHING LTD.
-
A Proximity-Based Programmable DNA Nanoscale Assembly Line
Gu, Hongzhou; Chao, Jie; Xiao, Shou-Jun; Seeman, Nadrian C.
2010-01-01
Our ability to synthesize nanometer-scale particles with desired shapes and compositions offers the exciting prospect of generating new functional materials and devices by combining the particles in a controlled fashion into larger structures. Self-assembly can achieve this task efficiently, but may be subject to thermodynamic and kinetic limitations: Reactants, intermediates and products may collide with each other throughout the assembly timecourse to produce non-target instead of target species. An alternative approach to nanoscale assembly uses information-containing molecules such as DNA1 to control interactions and thereby minimize unwanted crosstalk between different components. In principle, this method should allow the stepwise and programmed construction of target products by fastening individually selected nanoscale components – much as an automobile is built on an assembly line. Here, we demonstrate that a nanoscale assembly line can indeed be realized by the judicious combination of three known DNA-based modules: a DNA origami2 tile that provides a framework and track for the assembly process, cassettes containing three distinct two-state DNA machines that serve as programmable cargo-donating devices3,4 and are attached4,5 in series to the tile, and a DNA walker that can move on the track from device to device and collect cargo. As the walker traverses the pathway prescribed by the origami tile track, it encounters sequentially the three DNA devices that can be independently switched between an ‘ON’ state allowing its cargo to be transferred to the walker, and an ‘OFF’ state where no transfer occurs. We use three different types of gold nanoparticles as cargo and show that the experimental system does indeed allow the controlled fabrication of the eight different products that can be obtained with three two-state devices. PMID:20463734
-
DNA Replication During Conjugal Transfer of R1162
2002-01-01
transport out of the cell. This idea is stimulated by the similarity between the intermediates of single-stranded phage DNA replication and conjugative...the tra gene clusters ( Miele et al., 1991). The protein is not required for replication of the plasmid, and it seems to be dispensable for transfer...donor, in order to reattach to the transport mechanism prior to the start of a new round of transfer. Rolling circle replication itself might also be
-
An optimized procedure for obtaining DNA from fired and unfired ammunition.
Montpetit, Shawn; O'Donnell, Patrick
2015-07-01
Gun crimes are a significant problem facing law enforcement agencies. Traditional forensic examination of firearms involves comparisons of markings imparted to bullets and cartridge casings during the firing process. DNA testing of casings and cartridges may not be routinely done in crime laboratories due a variety of factors including the typically low amounts of DNA recovered. The San Diego Police Department (SDPD) Crime Laboratory conducted a study to optimize the collection and profiling of DNA from fired and unfired ammunition. The method was optimized to where interpretable DNA results were obtained for 26.1% of the total number of forensic casework evidence samples, and provided some insights into the level of secondary transfer that might be expected from this type of evidence. Briefly detailed are the results from the experimental study and the forensic casework analysis using the optimized process. Mixtures (samples having more DNA types than the loader's known genotype detected or visible at any marker) were obtained in 39.8% of research samples and the likely source of DNA mixtures is discussed. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
-
USDA-ARS?s Scientific Manuscript database
Antibiotic resistant foodborne pathogens pose serious public health concerns and increase the burden of disease treatment. Antibiotic resistance genes can reside on the bacterial chromosome or on other self-replicating DNA molecules such as plasmids. The resistance genes/DNA can be transferred int...
-
Widespread unidirectional transfer of mitochondrial DNA: a case in western Palaearctic water frogs.
Plötner, J; Uzzell, T; Beerli, P; Spolsky, C; Ohst, T; Litvinchuk, S N; Guex, G-D; Reyer, H-U; Hotz, H
2008-05-01
Interspecies transfer of mitochondrial (mt) DNA is a common phenomenon in plants, invertebrates and vertebrates, normally linked with hybridization of closely related species in zones of sympatry or parapatry. In central Europe, in an area north of 48 degrees N latitude and between 8 degrees and 22 degrees E longitude, western Palaearctic water frogs show massive unidirectional introgression of mtDNA: 33.7% of 407 Rana ridibunda possessed mtDNA specific for Rana lessonae. By contrast, no R. lessonae with R. ridibunda mtDNA was observed. That R. ridibunda with introgressed mitochondrial genomes were found exclusively within the range of the hybrid Rana esculenta and that most hybrids had lessonae mtDNA (90.4% of 335 individuals investigated) is evidence that R. esculenta serves as a vehicle for transfer of lessonae mtDNA into R. ridibunda. Such introgression has occurred several times independently. The abundance and wide distribution of individuals with introgressed mitochondrial genomes show that R. lessonae mt genomes work successfully in a R. ridibunda chromosomal background despite their high sequence divergence from R. ridibunda mtDNAs (14.2-15.2% in the ND2/ND3 genes). Greater effectiveness of enzymes encoded by R. lessonae mtDNA may be advantageous to individuals of R. ridibunda and probably R. esculenta in the northern parts of their ranges.
-
Della Valle, G; Fenton, R G; Basilico, C
1981-01-01
To study the mechanism of deoxyribonucleic acid (DNA)-mediated gene transfer, normal rat cells were transfected with total cellular DNA extracted from polyoma virus-transformed cells. This resulted in the appearance of the transformed phenotype in 1 X 10(-6) to 3 X 10(-6) of the transfected cells. Transformation was invariably associated with the acquisition of integrated viral DNA sequences characteristic of the donor DNA. This was caused not by the integration of free DNA molecules, but by the transfer of large DNA fragments (10 to 20 kilobases) containing linked cellular and viral sequences. Although Southern blot analysis showed that integration did not appear to occur in a homologous region of the recipient chromosome, the frequency of transformation was rather high when compared with that of purified polyoma DNA, perhaps due to "position" effects or to the high efficiency of recombination of large DNA fragments. Images PMID:6100965
-
Plasmonic nanostructures through DNA-assisted lithography
Shen, Boxuan; Linko, Veikko; Tapio, Kosti; Pikker, Siim; Lemma, Tibebe; Gopinath, Ashwin; Gothelf, Kurt V.; Kostiainen, Mauri A.; Toppari, J. Jussi
2018-01-01
Programmable self-assembly of nucleic acids enables the fabrication of custom, precise objects with nanoscale dimensions. These structures can be further harnessed as templates to build novel materials such as metallic nanostructures, which are widely used and explored because of their unique optical properties and their potency to serve as components of novel metamaterials. However, approaches to transfer the spatial information of DNA constructions to metal nanostructures remain a challenge. We report a DNA-assisted lithography (DALI) method that combines the structural versatility of DNA origami with conventional lithography techniques to create discrete, well-defined, and entirely metallic nanostructures with designed plasmonic properties. DALI is a parallel, high-throughput fabrication method compatible with transparent substrates, thus providing an additional advantage for optical measurements, and yields structures with a feature size of ~10 nm. We demonstrate its feasibility by producing metal nanostructures with a chiral plasmonic response and bowtie-shaped nanoantennas for surface-enhanced Raman spectroscopy. We envisage that DALI can be generalized to large substrates, which would subsequently enable scale-up production of diverse metallic nanostructures with tailored plasmonic features. PMID:29423446
-
Zheng, Haocheng; Goldner, Lori S; Leuba, Sanford H
2007-03-01
Many technical improvements in fluorescence microscopy over the years have focused on decreasing background and increasing the signal to noise ratio (SNR). The scanning confocal fluorescence microscope (SCFM) represented a major improvement in these efforts. The SCFM acquires signal from a thin layer of a thick sample, rejecting light whose origin is not in the focal plane thereby dramatically decreasing the background signal. A second major innovation was the advent of high quantum-yield, low noise, single-photon counting detectors. The superior background rejection of SCFM combined with low-noise, high-yield detectors makes it possible to detect the fluorescence from single-dye molecules. By labeling a DNA molecule or a DNA/protein complex with a donor/acceptor dye pair, fluorescence resonance energy transfer (FRET) can be used to track conformational changes in the molecule/complex itself, on a single molecule/complex basis. In this methods paper, we describe the core concepts of SCFM in the context of a study that uses FRET to reveal conformational fluctuations in individual Holliday junction DNA molecules and nucleosomal particles. We also discuss data processing methods for SCFM.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Kai; Roberts, Gareth A.; Stephanou, Augoustinos S.
2010-07-23
Research highlights: {yields} Successful fusion of GFP to M.EcoKI DNA methyltransferase. {yields} GFP located at C-terminal of sequence specificity subunit does not later enzyme activity. {yields} FRET confirms structural model of M.EcoKI bound to DNA. -- Abstract: We describe the fusion of enhanced green fluorescent protein to the C-terminus of the HsdS DNA sequence-specificity subunit of the Type I DNA modification methyltransferase M.EcoKI. The fusion expresses well in vivo and assembles with the two HsdM modification subunits. The fusion protein functions as a sequence-specific DNA methyltransferase protecting DNA against digestion by the EcoKI restriction endonuclease. The purified enzyme shows Foerstermore » resonance energy transfer to fluorescently-labelled DNA duplexes containing the target sequence and to fluorescently-labelled ocr protein, a DNA mimic that binds to the M.EcoKI enzyme. Distances determined from the energy transfer experiments corroborate the structural model of M.EcoKI.« less
-
Shamsipur, Mojtaba; Nasirian, Vahid; Barati, Ali; Mansouri, Kamran; Vaisi-Raygani, Asad; Kashanian, Soheila
2017-05-08
In the present study, we developed a sensitive method based on fluorescence resonance energy transfer (FRET) for the determination of the BCR/ABL fusion gene, which is used as a biomarker to confirm the clinical diagnosis of both chronic myelogenous leukemia (CML) and acute lymphocytic leukemia (ALL). For this purpose, CdTe quantum dots (QDs) were conjugated to amino-modified 18-mer oligonucleotide ((N)DNA) to form the QDs-(N)DNA nanosensor. In the presence of methylene blue (MB) as an intercalator, the hybridization of QDs-(N)DNA with the target BCR/ABL fusion gene (complementary DNA), brings the MB (acceptor) at close proximity of the QDs (donor), leading to FRET upon photoexcitation of the QDs. The enhancement in the emission intensity of MB was used to follow up the hybridization, which was linearly proportional to concentration of the target complementary DNA in a range from 1.0 × 10 -9 to 1.25 × 10 -7 M. The detection limit of the proposed method was obtained to be 1.5 × 10 -10 M. Finally, the feasibility and selectivity of the proposed nanosensor was evaluated by the analysis of derived nucleotides from both mismatched sequences and clinical samples of patients with leukemia as real samples. Copyright © 2017 Elsevier B.V. All rights reserved.
-
DeRocco, Vanessa; Anderson, Trevor; Piehler, Jacob; Erie, Dorothy A; Weninger, Keith
2010-11-01
To enable studies of conformational changes within multimolecular complexes, we present a simultaneous, four-color single molecule fluorescence methodology implemented with total internal reflection illumination and camera-based, wide-field detection. We further demonstrate labeling histidine-tagged proteins noncovalently with Tris-nitrilotriacetic acid (Tris-NTA)-conjugated dyes to achieve single molecule detection. We combine these methods to colocalize the mismatch repair protein MutSα on DNA while monitoring MutSα-induced DNA bending using Förster resonance energy transfer (FRET) and to monitor assembly of membrane-tethered SNARE protein complexes.
-
DeRocco, Vanessa C.; Anderson, Trevor; Piehler, Jacob; Erie, Dorothy A.; Weninger, Keith
2010-01-01
To allow studies of conformational changes within multi-molecular complexes, we present a simultaneous, 4-color single molecule fluorescence methodology implemented with total internal reflection illumination and camera based, wide-field detection. We further demonstrate labeling histidine-tagged proteins non-covalently with tris-Nitrilotriacetic acid (tris-NTA) conjugated dyes to achieve single molecule detection. We combine these methods to co-localize the mismatch repair protein MutSα on DNA while monitoring MutSα-induced DNA bending using Förster resonance energy transfer (FRET) and to monitor assembly of membrane-tethered SNARE protein complexes. PMID:21091445
-
Development of a sensor to study the DNA conformation using molecular logic gates
NASA Astrophysics Data System (ADS)
Roy, Arpan Datta; Dey, Dibyendu; Saha, Jaba; Chakraborty, Santanu; Bhattacharjee, D.; Hussain, Syed Arshad
2015-02-01
This communication reports our investigations on the Fluorescence Resonance Energy Transfer (FRET) between two laser dyes Acriflavine and Rhodamine B in absence and presence of DNA at different pH. It has been observed that energy transfer efficiency is largely affected by the presence of DNA as well as the pH of the system. It is well known that with increase in pH, DNA conformation changes from double stranded to single stranded (denaturation) and finally form random coil. Based on our experimental results two different types of molecular logic gates namely, XOR and OR logic have been demonstrated which can be used to have an idea about DNA conformation in solution.
-
Xu, Zhicheng; Bai, Guan; Dong, Chuan
2005-10-15
The interaction of a new intramolecular charge transfer probe, namely 4'-dimethylamino-2,5-dihydroxychalcone (DMADHC), with calf thymus DNA has been studied. Compared to the spectral characteristics of the free form in aqueous solution, the fluorescence of DMADHC enhanced dramatically accompanying a blueshift of the emission maxima in the presence of DNA. The absorption and fluorescence spectra, salt concentration effect, KI quenching, fluorescence polarization, and DNA denaturation experiments were given. These results give evidence that the DMADHC molecule is inserted into the base-stacking domain of the DNA double helix. The intrinsic binding constant and the binding site number were estimated. The analytical characteristics were also given.
-
Ho, Mae-Wan
2014-01-01
A culture of denial over the horizontal spread of genetically modified nucleic acids prevails in the face of direct evidence that it has occurred widely when appropriate methods and molecular probes are used for detection.
-
Low-frequency ultrasound increases non-viral gene transfer to the mouse lung.
Xenariou, Stefania; Liang, Hai-Dong; Griesenbach, Uta; Zhu, Jie; Farley, Raymond; Somerton, Lucinda; Singh, Charanjit; Jeffery, Peter K; Scheule, Ronald K; Cheng, Seng H; Geddes, Duncan M; Blomley, Martin; Alton, Eric W F W
2010-01-01
The aim of the study was to assess if low-frequency ultrasound (US), in the range of 30-35 kHz, increases non-viral gene transfer to the mouse lung. US is greatly attenuated in the lung due to large energy losses at the air/tissue interfaces. The advantages of low-frequency US, compared with high-frequency US are: (i) increased cavitation (responsible for the formation of transient pores in the cell membrane) and (ii) reduced energy losses during lung penetration. Cationic lipid GL67/plasmid DNA (pDNA), polyethylenimine (PEI)/pDNA and naked pDNA were delivered via intranasal instillation and the animals were then exposed to US (sonoporation) at 0.07 or 0.1 MPa for 10 min. Under these conditions, US did not enhance GL67 or PEI-mediated transfection. It did, however, increase naked pDNA gene transfer by approximately 4 folds. Importantly, this was achieved in the absence of microbubbles, which are crucial for the commonly used high-frequency (1 MHz) sonoporation but may not be able to withstand nebulization in a clinically relevant setup. Lung hemorrhage was also assessed and shown to increase with US pressure in a dose-dependent manner. We have thus, established that low-frequency US can enhance lung gene transfer with naked pDNA and this enhancement is more effective than the previously reported 1 MHz US.
-
Yera, H.; Filisetti, D.; Bastien, P.; Ancelle, T.; Thulliez, P.; Delhaes, L.
2009-01-01
Over the past few years, a number of new nucleic acid extraction methods and extraction platforms using chemistry combined with magnetic or silica particles have been developed, in combination with instruments to facilitate the extraction procedure. The objective of the present study was to investigate the suitability of these automated methods for the isolation of Toxoplasma gondii DNA from amniotic fluid (AF). Therefore, three automated procedures were compared to two commercialized manual extraction methods. The MagNA Pure Compact (Roche), BioRobot EZ1 (Qiagen), and easyMAG (bioMérieux) automated procedures were compared to two manual DNA extraction kits, the QIAamp DNA minikit (Qiagen) and the High Pure PCR template preparation kit (Roche). Evaluation was carried out with two specific Toxoplasma PCRs (targeting the 529-bp repeat element), inhibitor search PCRs, and human beta-globin PCRs. The samples each consisted of 4 ml of AF with or without a calibrated Toxoplasma gondii RH strain suspension (0, 1, 2.5, 5, and 25 tachyzoites/ml). All PCR assays were laboratory-developed real-time PCR assays, using either TaqMan or fluorescent resonance energy transfer probes. A total of 1,178 PCRs were performed, including 978 Toxoplasma PCRs. The automated and manual methods were similar in sensitivity for DNA extraction from T. gondii at the highest concentration (25 Toxoplasma gondii cells/ml). However, our results showed that the DNA extraction procedures led to variable efficacy in isolating low concentrations of tachyzoites in AF samples (<5 Toxoplasma gondii cells/ml), a difference that might have repercussions since low parasite concentrations in AF exist and can lead to congenital toxoplasmosis. PMID:19846633
-
Nguyen, Jenny; Ma, Yuhan; Luo, Ting; Bristow, Robert G.; Jaffray, David A.; Lu, Qing-Bin
2011-01-01
Both water and electron-transfer reactions play important roles in chemistry, physics, biology, and the environment. Oxidative DNA damage is a well-known mechanism, whereas the relative role of reductive DNA damage is unknown. The prehydrated electron (), a novel species of electrons in water, is a fascinating species due to its fundamental importance in chemistry, biology, and the environment. is an ideal agent to observe reductive DNA damage. Here, we report both the first in situ femtosecond time-resolved laser spectroscopy measurements of ultrafast-electron-transfer (UET) reactions of with various scavengers (KNO3, isopropanol, and dimethyl sulfoxide) and the first gel electrophoresis measurements of DNA strand breaks induced by and OH• radicals co-produced by two-UV-photon photolysis of water. We strikingly found that the yield of reductive DNA strand breaks induced by each is twice the yield of oxidative DNA strand breaks induced by each OH• radical. Our results not only unravel the long-standing mystery about the relative role of radicals in inducing DNA damage under ionizing radiation, but also challenge the conventional notion that oxidative damage is the main pathway for DNA damage. The results also show the potential of femtomedicine as a new transdisciplinary frontier and the broad significance of UET reactions of in many processes in chemistry, physics, biology, and the environment. PMID:21730183
-
Stewart, Barry J; Wardle, Simon J; Haniford, David B
2002-08-15
The frequency of DNA transposition in transposition systems that employ a strand transfer step may be significantly affected by the occurrence of a disintegration reaction, a reaction that reverses the strand transfer event. We have asked whether disintegration occurs in the Tn10 transposition system. We show that disintegration substrates (substrates constituting one half of the strand transfer product) are assembled into a transpososome that mimics the strand transfer intermediate. This strand transfer transpososome (STT) does appear to support an intermolecular disintegration reaction, but only at a very low level. Strikingly, assembly of the STT is not dependent on IHF, a host protein that is required for de novo assembly of all previously characterized Tn10 transpososomes. We suggest that disintegration substrates are able to form both transposon end and target type contacts with transposase because of their enhanced conformational flexibility. This probably allows the conformation of DNA within the complex that prevents the destructive disintegration reaction, and is responsible for relaxing the DNA sequence requirements for STT formation relative to other Tn10 transpososomes.
-
Stewart, Barry J.; Wardle, Simon J.; Haniford, David B.
2002-01-01
The frequency of DNA transposition in transposition systems that employ a strand transfer step may be significantly affected by the occurrence of a disintegration reaction, a reaction that reverses the strand transfer event. We have asked whether disintegration occurs in the Tn10 transposition system. We show that disintegration substrates (substrates constituting one half of the strand transfer product) are assembled into a transpososome that mimics the strand transfer intermediate. This strand transfer transpososome (STT) does appear to support an intermolecular disintegration reaction, but only at a very low level. Strikingly, assembly of the STT is not dependent on IHF, a host protein that is required for de novo assembly of all previously characterized Tn10 transpososomes. We suggest that disintegration substrates are able to form both transposon end and target type contacts with transposase because of their enhanced conformational flexibility. This probably allows the conformation of DNA within the complex that prevents the destructive disintegration reaction, and is responsible for relaxing the DNA sequence requirements for STT formation relative to other Tn10 transpososomes. PMID:12169640
-
DNA-Based Diet Analysis for Any Predator
Dunshea, Glenn
2009-01-01
Background Prey DNA from diet samples can be used as a dietary marker; yet current methods for prey detection require a priori diet knowledge and/or are designed ad hoc, limiting their scope. I present a general approach to detect diverse prey in the feces or gut contents of predators. Methodology/Principal Findings In the example outlined, I take advantage of the restriction site for the endonuclease Pac I which is present in 16S mtDNA of most Odontoceti mammals, but absent from most other relevant non-mammalian chordates and invertebrates. Thus in DNA extracted from feces of these mammalian predators Pac I will cleave and exclude predator DNA from a small region targeted by novel universal primers, while most prey DNA remain intact allowing prey selective PCR. The method was optimized using scat samples from captive bottlenose dolphins (Tursiops truncatus) fed a diet of 6–10 prey species from three phlya. Up to five prey from two phyla were detected in a single scat and all but one minor prey item (2% of the overall diet) were detected across all samples. The same method was applied to scat samples from free-ranging bottlenose dolphins; up to seven prey taxa were detected in a single scat and 13 prey taxa from eight teleost families were identified in total. Conclusions/Significance Data and further examples are provided to facilitate rapid transfer of this approach to any predator. This methodology should prove useful to zoologists using DNA-based diet techniques in a wide variety of study systems. PMID:19390570
-
Fast kinetic studies of plasmid DNA transfer in intact yeast cells mediated by electropulsation.
Ganeva, V; Galutzov, B; Teissie, J
1995-09-25
Intact yeast cell Electrotransformation process was investigated. It is a two step process. The plasmid must be pre-mixed and present in contact with the cells during the pulse. During the millisecond field pulse, plasmid DNA is associated to the envelope. It therefore crosses the membrane by a process which lasts several seconds as shown by its sensitivity to a post pulse addition of DNase. Electrotransformation is not supported by an electrophoretic transfer due to the external field nor by a free diffusion across the electropermeabilized envelope. DNA is first bound during the field pulse and then is transferred by a still unknown active process due to cell metabolism.
-
Marrero, Joeli; Waldor, Matthew K
2005-06-01
Conjugation enables horizontal transmission of DNA among bacteria, thereby facilitating the rapid spread of genes such as those conferring resistance to antibiotics. Cell-cell contact is required for conjugative DNA transfer but does not ensure its success. The presence of certain plasmids in potential recipient cells inhibits redundant transfer of these plasmids from competent donors despite contact between donor and recipient cells. Here, we used two closely related integrating conjugative elements (ICEs), SXT and R391, to identify genes that inhibit redundant conjugative transfer. Cells containing SXT exclude transfer of a second copy of SXT but not R391 and vice versa. The specific exclusion of SXT and R391 is dependent upon variants of TraG and Eex, ICE-encoded inner membrane proteins in donor and recipient cells, respectively. We identified short sequences within each variant that determine the exquisite specificity of self-recognition; these data suggest that direct interactions between TraG and Eex mediate exclusion.
-
Oral Gene Application Using Chitosan-DNA Nanoparticles Induces Transferable Tolerance
Ensminger, Stephan M.; Spriewald, Bernd M.
2012-01-01
Oral tolerance is a promising approach to induce unresponsiveness to various antigens. The development of tolerogenic vaccines could be exploited in modulating the immune response in autoimmune disease and allograft rejection. In this study, we investigated a nonviral gene transfer strategy for inducing oral tolerance via antigen-encoding chitosan-DNA nanoparticles (NP). Oral application of ovalbumin (OVA)-encoding chitosan-DNA NP (OVA-NP) suppressed the OVA-specific delayed-type hypersensitivity (DTH) response and anti-OVA antibody formation, as well as spleen cell proliferation following OVA stimulation. Cytokine expression patterns following OVA stimulation in vitro showed a shift from a Th1 toward a Th2/Th3 response. The OVA-NP-induced tolerance was transferable from donor to naïve recipient mice via adoptive spleen cell transfer and was mediated by CD4+CD25+ T cells. These findings indicate that nonviral oral gene transfer can induce regulatory T cells for antigen-specific immune modulation. PMID:22933401
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
McLaughlin, K. J.; Nash, R. P.; Redinbo, M. R.
The widespread development of multidrug-resistant bacteria is a major health emergency. Conjugative DNA plasmids, which harbor a wide range of antibiotic resistance genes, also encode the protein factors necessary to orchestrate the propagation of plasmid DNA between bacterial cells through conjugative transfer. Successful conjugative DNA transfer depends on key catalytic components to nick one strand of the duplex DNA plasmid and separate the DNA strands while cell-to-cell transfer occurs. The TraI protein from the conjugative Salmonella plasmid pCU1 fulfills these key catalytic roles, as it contains both single-stranded DNA-nicking relaxase and ATP-dependent helicase domains within a single, 1,078-residue polypeptide. Inmore » this work, we unraveled the helicase determinants of Salmonella pCU1 TraI through DNA binding, ATPase, and DNA strand separation assays. TraI binds DNA substrates with high affinity in a manner influenced by nucleic acid length and the presence of a DNA hairpin structure adjacent to the nick site. TraI selectively hydrolyzes ATP, and mutations in conserved helicase motifs eliminate ATPase activity. Surprisingly, the absence of a relatively short (144-residue) domain at the extreme C terminus of the protein severely diminishes ATP-dependent strand separation. Collectively, these data define the helicase motifs of the conjugative factor TraI from Salmonella pCU1 and reveal a previously uncharacterized C-terminal functional domain that uncouples ATP hydrolysis from strand separation activity.« less
-
Smart DNA Fabrication Using Sound Waves
Kanigowska, Paulina; Shen, Yue; Zheng, Yijing; Rosser, Susan; Cai, Yizhi
2016-01-01
Acoustic droplet ejection (ADE) technology uses focused acoustic energy to transfer nanoliter-scale liquid droplets with high precision and accuracy. This noncontact, tipless, low-volume dispensing technology minimizes the possibility of cross-contamination and potentially reduces the costs of reagents and consumables. To date, acoustic dispensers have mainly been used in screening libraries of compounds. In this paper, we describe the first application of this powerful technology to the rapidly developing field of synthetic biology, for DNA synthesis and assembly at the nanoliter scale using a Labcyte Echo 550 acoustic dispenser. We were able to successfully downscale PCRs and the popular one-pot DNA assembly methods, Golden Gate and Gibson assemblies, from the microliter to the nanoliter scale with high assembly efficiency, which effectively cut the reagent cost by 20- to 100-fold. We envision that acoustic dispensing will become an instrumental technology in synthetic biology, in particular in the era of DNA foundries. PMID:26163567
-
Impact of Lateral Transfers on the Genomes of Lepidoptera
Drezen, Jean-Michel; Josse, Thibaut; Bézier, Annie; Gauthier, Jérémy; Huguet, Elisabeth
2017-01-01
Transfer of DNA sequences between species regardless of their evolutionary distance is very common in bacteria, but evidence that horizontal gene transfer (HGT) also occurs in multicellular organisms has been accumulating in the past few years. The actual extent of this phenomenon is underestimated due to frequent sequence filtering of “alien” DNA before genome assembly. However, recent studies based on genome sequencing have revealed, and experimentally verified, the presence of foreign DNA sequences in the genetic material of several species of Lepidoptera. Large DNA viruses, such as baculoviruses and the symbiotic viruses of parasitic wasps (bracoviruses), have the potential to mediate these transfers in Lepidoptera. In particular, using ultra-deep sequencing, newly integrated transposons have been identified within baculovirus genomes. Bacterial genes have also been acquired by genomes of Lepidoptera, as in other insects and nematodes. In addition, insertions of bracovirus sequences were present in the genomes of certain moth and butterfly lineages, that were likely corresponding to rearrangements of ancient integrations. The viral genes present in these sequences, sometimes of hymenopteran origin, have been co-opted by lepidopteran species to confer some protection against pathogens. PMID:29120392
-
Raeber, Alexandra E; Wong, Bryan M
2015-05-12
We present a detailed analysis of several time-dependent DFT (TD-DFT) methods, including conventional hybrid functionals and two types of nonempirically tuned range-separated functionals, for predicting a diverse set of electronic excitations in DNA nucleobase monomers and dimers. This large and extensive set of excitations comprises a total of 50 different transitions (for each tested DFT functional) that includes several n → π and π → π* valence excitations, long-range charge-transfer excitations, and extended Rydberg transitions (complete with benchmark calculations from high-level EOM-CCSD(T) methods). The presence of localized valence excitations as well as extreme long-range charge-transfer excitations in these systems poses a serious challenge for TD-DFT methods that allows us to assess the importance of both short- and long-range exchange contributions for simultaneously predicting all of these various transitions. In particular, we find that functionals that do not have both short- and full long-range exchange components are unable to predict the different types of nucleobase excitations with the same accuracy. Most importantly, the current study highlights the importance of both short-range exchange and a nonempirically tuned contribution of long-range exchange for accurately predicting the diverse excitations in these challenging nucleobase systems.
-
Highly Sensitive DNA Sensor Based on Upconversion Nanoparticles and Graphene Oxide.
Alonso-Cristobal, P; Vilela, P; El-Sagheer, A; Lopez-Cabarcos, E; Brown, T; Muskens, O L; Rubio-Retama, J; Kanaras, A G
2015-06-17
In this work we demonstrate a DNA biosensor based on fluorescence resonance energy transfer (FRET) between NaYF4:Yb,Er nanoparticles and graphene oxide (GO). Monodisperse NaYF4:Yb,Er nanoparticles with a mean diameter of 29.1 ± 2.2 nm were synthesized and coated with a SiO2 shell of 11 nm, which allowed the attachment of single strands of DNA. When these DNA-functionalized NaYF4:Yb,Er@SiO2 nanoparticles were in the proximity of the GO surface, the π-π stacking interaction between the nucleobases of the DNA and the sp(2) carbons of the GO induced a FRET fluorescence quenching due to the overlap of the fluorescence emission of the NaYF4:Yb,Er@SiO2 and the absorption spectrum of GO. By contrast, in the presence of the complementary DNA strands, the hybridization leads to double-stranded DNA that does not interact with the GO surface, and thus the NaYF4:Yb,Er@SiO2 nanoparticles remain unquenched and fluorescent. The high sensitivity and specificity of this sensor introduces a new method for the detection of DNA with a detection limit of 5 pM.
-
MutY: optimized to find DNA damage site electronically?
NASA Astrophysics Data System (ADS)
Lin, Jong-Chin; Cox, Daniel; Singh, Rajiv
2006-03-01
Iron sulfur clusters are present in the DNA repair protein MutY in a region highly homologous in species as diverse as E. Coli and Homo Sapiens, yet their function remains unknown. In MutY, this mixed valence cluster exists in two oxidation states, [Fe4S4]^2+/3+, with the stability depending upon the presence of DNA. We have studied the electronic structure and stability of these clusters using the local orbital based SIESTA implementation of density functional theory. We find that the iron-sulfur cluster in MutY can undergo 2+ to 3+ oxidation when coupling to DNA through hole transfer, especially when MutY is near an oxoguanine modified base(oxoG). Employing the Marcus theory for electron transfer, we find (i) near optimal Frank-Condon(FC) factor for 2+ transfer to oxoG; (ii) reduced FC factor for transfer to G due to a high oxidation potential; (iii) reduced FC factor with the mutation L154F; (iv) reduced tunning matrix element with the mutation R149W. Both L154F and R149W mutations dramatically reduce or eliminate repair efficiency. Hence, redox modulation of MutY search and binding appears plausible and may have broader implications for DNA-protein interactions.
-
Davis, R; Vapnek, D
1976-01-01
The amounts of plasmid deoxyribonucleic acid (DNA) and the levels of the in vivo transcription of the Escherichia coli plasmids R538-1 (repressed for conjugal transfer) and R538-1drd (derepressed for transfer) were determined by DNA-DNA hybridization and DNA-ribonucleic acid hybridization, respectively. The results demonstrate that the level of plasmid transcription is increased by two-fold in the strain carrying the derepressed plasmid, compared to an isogenic strain carrying the repressed plasmid, whereas the amount of plasmid DNA is approximately the same, suggesting that the transfer genes are under transcriptional control. Levels of plasmid DNA, plasmid DNA transcription, and chloramphenicol acetyltransferase activity were also compared in a mutant strain that carried the R538-1drd plasmid and was resistant to high levels of antibiotics. This strain produces about 13 copies of plasmid DNA per chromosome compared to five copies for the parent strain. The level of transcription of plasmid DNA was found to be twofold higher in the high-level resistant strain, whereas the level of chloramphenition, acetyltransferase activity was increased by 10-fold. In addition the levels of plasmid DNA transcription and chloramphenicol acetyltransferase activity in the high-level resistant strain were found to be further increased by the presence of high levels of chloramphenicol in the growth medium. The amount of plasmid DNA remained constant under these conditions, indicating that high levels of chloramphenicol can stimulate the expression of plasmid genes at the level of transcription in this strain. PMID:767321
-
Exact method for numerically analyzing a model of local denaturation in superhelically stressed DNA
NASA Astrophysics Data System (ADS)
Fye, Richard M.; Benham, Craig J.
1999-03-01
Local denaturation, the separation at specific sites of the two strands comprising the DNA double helix, is one of the most fundamental processes in biology, required to allow the base sequence to be read both in DNA transcription and in replication. In living organisms this process can be mediated by enzymes which regulate the amount of superhelical stress imposed on the DNA. We present a numerically exact technique for analyzing a model of denaturation in superhelically stressed DNA. This approach is capable of predicting the locations and extents of transition in circular superhelical DNA molecules of kilobase lengths and specified base pair sequences. It can also be used for closed loops of DNA which are typically found in vivo to be kilobases long. The analytic method consists of an integration over the DNA twist degrees of freedom followed by the introduction of auxiliary variables to decouple the remaining degrees of freedom, which allows the use of the transfer matrix method. The algorithm implementing our technique requires O(N2) operations and O(N) memory to analyze a DNA domain containing N base pairs. However, to analyze kilobase length DNA molecules it must be implemented in high precision floating point arithmetic. An accelerated algorithm is constructed by imposing an upper bound M on the number of base pairs that can simultaneously denature in a state. This accelerated algorithm requires O(MN) operations, and has an analytically bounded error. Sample calculations show that it achieves high accuracy (greater than 15 decimal digits) with relatively small values of M (M<0.05N) for kilobase length molecules under physiologically relevant conditions. Calculations are performed on the superhelical pBR322 DNA sequence to test the accuracy of the method. With no free parameters in the model, the locations and extents of local denaturation predicted by this analysis are in quantitatively precise agreement with in vitro experimental measurements. Calculations performed on the fructose-1,6-bisphosphatase gene sequence from yeast show that this approach can also accurately treat in vivo denaturation.
-
Lin, Hung-Yu; Liou, Chia-Wei; Chen, Shang-Der; Hsu, Te-Yao; Chuang, Jiin-Haur; Wang, Pei-Wen; Huang, Sheng-Teng; Tiao, Mao-Meng; Chen, Jin-Bor; Lin, Tsu-Kung; Chuang, Yao-Chung
2015-05-01
Adult mesenchymal stem cell (MSC)-conducted mitochondrial transfer has been recently shown to rescue cellular bioenergetics and prevent cell death caused by mitochondrial dysfunction. Wharton's jelly-derived MSCs (WJMSCs) harvested from postpartum umbilical cords are an accessible and abundant source of stem cells. This study aimed to determine the capability of WJMSCs to transfer their own mitochondria and rescue impaired oxidative phosphorylation (OXPHOS) and bioenergetics caused by mitochondrial DNA defects. To do this, WJMSCs were co-cultured with mitochondrial DNA (mtDNA)-depleted ρ(0) cells and the recapture of mitochondrial function was evaluated. WJMSCs were shown to be capable of transferring their own mitochondria into ρ(0) cells and underwent interorganellar mixture within these cells. Permissive culture media (BrdU-containing and pyruvate- and uridine-free) sieved out a survival cell population from the co-cultured WJMSCs (BrdU-sensitive) and ρ(0) cells (pyruvate/uridine-free). The survival cells had mtDNA identical to that of WJMSCs, whereas they expressed cellular markers identical to that of ρ(0) cells. Importantly, these ρ(0)-plus -WJMSC-mtDNA (ρ(+W)) cells recovered the expression of mtDNA-encoded proteins and exhibited functional oxygen consumption and respiratory control, as well as the activity of electron transport chain (ETC) complexes I, II, III and IV. In addition, ETC complex V-inhibitor-sensitive ATP production and metabolic shifting were also recovered. Furthermore, cellular behaviors including attachment-free proliferation, aerobic viability and OXPHOS-reliant cellular motility were also regained after mitochondrial transfer by WJMSCs. The therapeutic effect of WJMSCs-derived mitochondrial transfer was able to stably sustain for at least 45 passages. In conclusion, this study suggests that WJMSCs may serve as a potential therapeutic strategy for diseases linked to mitochondrial dysfunction through the donation of healthy mitochondria to cells with genetic mitochondrial defects. Copyright © 2015 Elsevier B.V. All rights reserved.
-
Excited-state solvation and proton transfer dynamics of DAPI in biomimetics and genomic DNA.
Banerjee, Debapriya; Pal, Samir Kumar
2008-08-14
The fluorescent probe DAPI (4',6-diamidino-2-phenylindole) is an efficient DNA binder. Studies on the DAPI-DNA complexes show that the probe exhibits a wide variety of interactions of different strengths and specificities with DNA. Recently the probe has been used to report the environmental dynamics of a DNA minor groove. However, the use of the probe as a solvation reporter in restricted environments is not straightforward. This is due to the presence of two competing relaxation processes (intramolecular proton transfer and solvation stabilization) in the excited state, which can lead to erroneous interpretation of the observed excited-state dynamics. In this study, the possibility of using DAPI to unambiguously report the environmental dynamics in restricted environments including DNA is explored. The dynamics of the probe is studied in bulk solvents, biomimetics like micelles and reverse micelles, and genomic DNA using steady-state and picosecond-resolved fluorescence spectroscopies.
-
Madsen, Mikael; Christensen, Rasmus S; Krissanaprasit, Abhichart; Bakke, Mette R; Riber, Camilla F; Nielsen, Karina S; Zelikin, Alexander N; Gothelf, Kurt V
2017-08-04
Conjugated polymers have been intensively studied due to their unique optical and electronic properties combined with their physical flexibility and scalable bottom up synthesis. Although the bulk qualities of conjugated polymers have been extensively utilized in research and industry, the ability to handle and manipulate conjugated polymers at the nanoscale lacks significantly behind. Here, the toolbox for controlled manipulation of conjugated polymers was expanded through the synthesis of a polyfluorene-DNA graft-type polymer (poly(F-DNA)). The polymer possesses the characteristics associated with the conjugated polyfluorene backbone, but the protruding single-stranded DNA provides the material with an exceptional addressability. This study demonstrates controlled single-molecule patterning of poly(F-DNA), as well as energy transfer between two different polymer-DNA conjugates. Finally, highly efficient DNA-directed quenching of polyfluorene fluorescence was shown. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
Zhao, Ming; Huang, Run; Peng, Leilei
2012-11-19
Förster resonant energy transfer (FRET) is extensively used to probe macromolecular interactions and conformation changes. The established FRET lifetime analysis method measures the FRET process through its effect on the donor lifetime. In this paper we present a method that directly probes the time-resolved FRET signal with frequency domain Fourier lifetime excitation-emission matrix (FLEEM) measurements. FLEEM separates fluorescent signals by their different phonon energy pathways from excitation to emission. The FRET process generates a unique signal channel that is initiated by donor excitation but ends with acceptor emission. Time-resolved analysis of the FRET EEM channel allows direct measurements on the FRET process, unaffected by free fluorophores that might be present in the sample. Together with time-resolved analysis on non-FRET channels, i.e. donor and acceptor EEM channels, time resolved EEM analysis allows precise quantification of FRET in the presence of free fluorophores. The method is extended to three-color FRET processes, where quantification with traditional methods remains challenging because of the significantly increased complexity in the three-way FRET interactions. We demonstrate the time-resolved EEM analysis method with quantification of three-color FRET in incompletely hybridized triple-labeled DNA oligonucleotides. Quantitative measurements of the three-color FRET process in triple-labeled dsDNA are obtained in the presence of free single-labeled ssDNA and double-labeled dsDNA. The results establish a quantification method for studying multi-color FRET between multiple macromolecules in biochemical equilibrium.
-
Zhao, Ming; Huang, Run; Peng, Leilei
2012-01-01
Förster resonant energy transfer (FRET) is extensively used to probe macromolecular interactions and conformation changes. The established FRET lifetime analysis method measures the FRET process through its effect on the donor lifetime. In this paper we present a method that directly probes the time-resolved FRET signal with frequency domain Fourier lifetime excitation-emission matrix (FLEEM) measurements. FLEEM separates fluorescent signals by their different phonon energy pathways from excitation to emission. The FRET process generates a unique signal channel that is initiated by donor excitation but ends with acceptor emission. Time-resolved analysis of the FRET EEM channel allows direct measurements on the FRET process, unaffected by free fluorophores that might be present in the sample. Together with time-resolved analysis on non-FRET channels, i.e. donor and acceptor EEM channels, time resolved EEM analysis allows precise quantification of FRET in the presence of free fluorophores. The method is extended to three-color FRET processes, where quantification with traditional methods remains challenging because of the significantly increased complexity in the three-way FRET interactions. We demonstrate the time-resolved EEM analysis method with quantification of three-color FRET in incompletely hybridized triple-labeled DNA oligonucleotides. Quantitative measurements of the three-color FRET process in triple-labeled dsDNA are obtained in the presence of free single-labeled ssDNA and double-labeled dsDNA. The results establish a quantification method for studying multi-color FRET between multiple macromolecules in biochemical equilibrium. PMID:23187535
-
NASA Astrophysics Data System (ADS)
Beckstead, Ashley Ann
UV radiation from the sun is strongly absorbed by DNA, and the resulting electronic excited states can lead to the formation of mutagenic photoproducts. Decades of research have brought to light the excited-state dynamics of single RNA and DNA nucleobases, but questions remain about the nature of excited states accessed in DNA strands. In this thesis, I present ultrafast spectroscopic observations of photoinduced electron transfer from the oxidatively damaged bases, 8-oxo-7,8-dihydro-2'-deoxyguanosine, 5-hydroxy-2'-deoxycytidine and 5-hydroxy-2'-deoxyuridine, to adenine in three dinucleotides. The results reveal that charge transfer states are formed on a timescale faster than our instrumental resolution (<0.5 ps), and back electron transfer efficiently returns the excited-state population to the ground state on timescales from tens to hundreds of ps. In addition to recent spectroscopic observations of charge transfer state species in DNA by other groups, our results have augmented understanding of the long-lived transient signals observed in DNA strands. The observation of photoinduced electron transfer in these oxidatively damaged nucleobases also supports a recent proposal regarding the role of oxidative products in pre-RNA catalysis. I discuss these observations in the contexts of fundamental DNA excited-state dynamics and prebiotic chemical evolution. In this thesis, I also present the first ultrafast spectroscopic investigation of violacein, a pigment isolated from Antarctic bacteria. Despite claims for the photoprotective role of this pigment, there has never been a spectroscopic analysis of excited-state deactivation in violacein. Emission spectra, fluorescence quantum yields and excited-state lifetimes of violacein in various solvents were measured for the first time. Both the fluorescence quantum yield and excited-state lifetime of violacein increase in increasingly viscous solvents, suggesting a large-scale motion mediates excited-state deactivation. I compare these results to similar observations of viscosity-dependent excited-state decay rates in other molecules. I also consider the relevance of violacein's excited-state properties to the hypothesized sunscreening role of violacein. Overall, the studies presented in this dissertation illustrate how ultrafast spectroscopic techniques can be used to unravel complex biomolecular excited-state dynamics in solution.
-
Mikkelsen, Jacob Giehm; Lund, Anders H.; Dybkær, Karen; Duch, Mogens; Pedersen, Finn Skou
1998-01-01
We have previously demonstrated recombinational rescue of primer binding site (PBS)-impaired Akv murine leukemia virus-based vectors involving initial priming on endogenous viral sequences and template switching during cDNA synthesis to obtain PBS complementarity in second-strand transfer of reverse transcription (Mikkelsen et al., J. Virol. 70:1439–1447, 1996). By use of the same forced recombination system, we have now found recombinant proviruses of different structures, suggesting that PBS knockout vectors may be rescued through initial priming on endogenous virus RNA, read-through of the mutated PBS during minus-strand synthesis, and subsequent second-strand transfer mediated by the R-U5 complementarity of the plus strand and the extended minus-strand DNA acceptor template. Mechanisms for R-U5-mediated second-strand transfer and its possible role in retrovirus replication and evolution are discussed. PMID:9499117
-
Development of a sensor to study the DNA conformation using molecular logic gates.
Roy, Arpan Datta; Dey, Dibyendu; Saha, Jaba; Chakraborty, Santanu; Bhattacharjee, D; Hussain, Syed Arshad
2015-02-05
This communication reports our investigations on the Fluorescence Resonance Energy Transfer (FRET) between two laser dyes Acriflavine and Rhodamine B in absence and presence of DNA at different pH. It has been observed that energy transfer efficiency is largely affected by the presence of DNA as well as the pH of the system. It is well known that with increase in pH, DNA conformation changes from double stranded to single stranded (denaturation) and finally form random coil. Based on our experimental results two different types of molecular logic gates namely, XOR and OR logic have been demonstrated which can be used to have an idea about DNA conformation in solution. Copyright © 2014 Elsevier B.V. All rights reserved.
-
Bignon, Emmanuelle; Gattuso, Hugo; Morell, Christophe; Dumont, Elise; Monari, Antonio
2015-08-03
The main chromophore of (6-4) photoproducts, namely, 5-methyl-2-pyrimidone (Pyo), is an artificial noncanonical nucleobase. This chromophore has recently been reported as a potential photosensitizer that induces triplet damage in thymine DNA. In this study, we investigate the spectroscopic properties of the Pyo unit embedded in DNA by means of explicit solvent molecular-dynamics simulations coupled to time-dependent DFT and quantum-mechanics/molecular-mechanics techniques. Triplet-state transfer from the Pyo to the thymine unit was monitored in B-DNA by probing the propensity of this photoactive pyrimidine analogue to induce a Dexter-type triplet photosensitization and subsequent DNA damage. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
Method for identifying mutagenic agents which induce large, multilocus deletions in DNA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bradley, W.E.C.; Belouchi, A.; Dewyse, P.
1993-07-13
A method of identifying a mutagenic agent is described which includes a large, multilocus deletions in DNA in mammalian cells comprising: (i) exposing a class III heterozygous CHO cell line to a potential mutagenic agent under investigation, and allowing any mutation of the cell line to proceed, said cell line being characterized in that a restriction fragment length variation exists in on mutation it becomes resistant to 2,6-diaminopurine and in that the DNA sequence adjacent to the two alleles of the APRT gene such that the DNA sequence adjacent to one of the two alleles can be digested with themore » enzyme BclI but the DNA sequence variation adjacent to the other of the two alleles cannot be digested with BclI, (ii) isolating induced mutations of the cell line deficient in APRT function, (iii) isolating DNA from the induced mutants, (iv) digesting the isolated DNA with BclI enzyme to produce digested fragments including a 19 kb fragment and any 2 kb fragment, which fragments hybridize with the labeled probe derived from DNA fragment PDI, (v) separating any digested fragments, (vi) transferring the separated fragments of (v) to a solid support, (vii) hybridizing the supported separated fragments with a labeled probe derived from the clone DNA fragment PD 1, (viii) determining fragments having undergone loss of the 2 kb band identified by the probe, as an identification of parent mutants in which the loss occurred, and (ix) evaluating the mutating ability of the potential mutagenic agent.« less
-
Lee, Wonyou; Song, Kilyoung; Lee, Inhyung; Shin, Hyungdo; Lee, Byeong Chun
2015-01-01
Transvaginal ultrasound-guided follicle aspiration is one method of obtaining recipient oocytes for equine somatic cell nuclear transfer (SCNT). This study was conducted: (1) to evaluate the possibility of oocyte aspiration from pre-ovulatory follicles using a short disposable needle system (14-G) by comparing the oocyte recovery rate with that of a long double lumen needle (12-G); (2) to investigate the developmental competence of recovered oocytes after SCNT and embryo transfer. The recovery rates with the short disposable needle vs. the long needle were not significantly different (47.5% and 35.0%, respectively). Twenty-six SCNT embryos were transferred to 13 mares, and one mare delivered a live offspring at Day 342. There was a perfect identity match between the cloned foal and the cell donor after analysis of microsatellite DNA, and the mitochondrial DNA of the cloned foal was identical with that of the oocyte donor. These results demonstrated that the short disposable needle system can be used to recover oocytes to use as cytoplasts for SCNT, in the production of cloned foals and for other applications in equine embryology PMID:26119166
-
Quantum dot-based microfluidic biosensor for cancer detection
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ghrera, Aditya Sharma; School of Engineering and Technology, ITM University, Gurgaon-122017; Pandey, Chandra Mouli
2015-05-11
We report results of the studies relating to fabrication of an impedimetric microfluidic–based nucleic acid sensor for quantification of DNA sequences specific to chronic myelogenous leukemia (CML). The sensor chip is prepared by patterning an indium–tin–oxide (ITO) coated glass substrate via wet chemical etching method followed by sealing with polydimethylsiloxane (PDMS) microchannel for fluid control. The fabricated microfluidic chip comprising of a patterned ITO substrate is modified by depositing cadmium selenide quantum dots (QCdSe) via Langmuir–Blodgett technique. Further, the QCdSe surface has been functionalized with specific DNA probe for CML detection. The probe DNA functionalized QCdSe integrated miniaturized system hasmore » been used to monitor target complementary DNA concentration by measuring the interfacial charge transfer resistance via hybridization. The presence of complementary DNA in buffer solution significantly results in decreased electro-conductivity of the interface due to presence of a charge barrier for transport of the redox probe ions. The microfluidic DNA biosensor exhibits improved linearity in the concentration range of 10{sup −15} M to 10{sup −11} M.« less
-
Gholami, Somayeh; Kompany-Zareh, Mohsen
2013-07-01
Actinomycin D (Act D), an oncogenic c-Myc promoter binder, interferes with the action of RNA polymerase. There is great demand for high-throughput technology able to monitor the activity of DNA-binding drugs. To this end, binding of 7-aminoactinomycin D (7AAD) to the duplex c-Myc promoter was investigated by use of 2D-photoluminescence emission (2D-PLE), and the resulting data were subjected to analysis by use of convenient and powerful multi-way approaches. Fluorescence measurements were performed by use of the quantum dot (QD)-conjugated c-Myc promoter. Intercalation of 7AAD within duplex base pairs resulted in efficient energy transfer from drug to QD via fluorescence resonance energy transfer (FRET). Multi-way analysis of the three-way data array obtained from titration experiments was performed by use of restricted Tucker3 and hard trilinear decomposition (HTD). These techniques enable analysis of high-dimensional and complex data from nanobiological systems which include several spectrally overlapped structures. It was almost impossible to obtain robust and meaningful information about the FRET process for such high overlap data by use of classical analysis. The soft approach had the important advantage over univariate classical methods of enabling us to investigate the source of variance in the fluorescence signal of the DNA-drug complex. It was established that hard trilinear decomposition analysis of FRET-measured data overcomes the problem of rank deficiency, enabling calculation of concentration profiles and pure spectra for all species, including non-fluorophores. The hard modeling approach was also used for determination of equilibrium constants for the hybridization and intercalation equilibria, using nonlinear fit data analysis. The intercalation constant 3.6 × 10(6) mol(-1) L and hybridization stability 1.0 × 10(8) mol(-1) L obtained were in good agreement with values reported in the literature. The analytical concentration of the QD-labeled DNA was determined by use of nonlinear fitting, without using external standard calibration samples. This study was a successful application of multi-way chemometric methods to investigation of nano-biotechnological systems where several overlapped species coexist in solution.
-
Simplified methods for the construction of RNA and DNA virus infectious clones.
Nagata, Tatsuya; Inoue-Nagata, Alice Kazuko
2015-01-01
Infectious virus clones are one of the most powerful tools in plant pathology, molecular biology, and biotechnology. The construction of infectious clones of RNA and DNA viruses, however, usually requires laborious cloning and subcloning steps. In addition, instability of the RNA virus genome is frequently reported after its introduction into the vector and transference to Escherichia coli. These difficulties hamper the cloning procedures, making it tedious and cumbersome. This chapter describes two protocols for a simple construction of infectious viruses, an RNA virus, the tobamovirus Pepper mild mottle virus, and a DNA virus, a bipartite begomovirus. For this purpose, the strategy of overlap-extension PCR was used for the construction of infectious tobamovirus clone and of rolling circle amplification (RCA) for the construction of a dimeric form of the begomovirus clone.
-
Gebala, Magdalena; La Mantia, Fabio; Schuhmann, Wolfgang
2013-07-22
Surface-confined immobilized redox species often do not show the expected zero peak separation in slow-scan cyclic voltammograms. This phenomenon is frequently associated to experimental drawbacks and hence neglected. However, a nonzero peak separation, which is common to many electrochemical systems with high structural flexibility, can be rationally assigned to a thermodynamic hysteresis. To study this phenomenon, a surface-confined redox species was used. Specifically, a DNA strand which is tagged with ferrocene (Fc) moieties at its 5' end and its complementary capture probe is thiolated at the 3' end was self-assembled in a monolayer at a Au electrode with the Fc moieties being located at the bottom plane of the double-stranded DNA (dsDNA). The DNA-bound Fc undergoes rapid electron transfer with the electrode surface as evaluated by fast scan cyclic voltammetry. The electron transfer is sensitive to the ion transport along the DNA strands, a phenomenon which is modulated upon specific intercalation of proflavine into surface-bound dsDNA. The electron transfer rate of the Fc(0/+) redox process is influenced by the cationic permselectivity of the DNA monolayer. In addition to the kinetic hindrance, a thermodynamic effect correlated with changes in the activity coefficients of the Fc(0/+) moieties near the gold-dsDNA interface is observed and discussed as source of the observed hysteresis causing the non-zero peak separation in the voltammograms. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Palmer, T.D.; Hock, R.A.; Osborne, W.R.A.
1987-02-01
Skin fibroblasts might be considered suitable recipients for therapeutic genes to cure several human genetic diseases; however, these cells are resistant to gene transfer by most methods. The authors studied the ability of retroviral vectors to transfer genes into normal human diploid skin fibroblasts. Retroviruses carrying genes for neomycin or hygromycin B resistance conferred drug resistance to greater than 50% of the human fibroblasts after a single exposure to virus-containing medium. This represents at least a 500-fold increase in efficiency over other methods. Transfer was achieved in the absence of helper virus by using amphotropic retrovirus-packaging cells. A retrovirus vectormore » containing a human adenosine deaminase (ADA) cDNA was constructed and used to infect ADA/sup -/ fibroblasts from a patient with ADA deficiency. The infected cells produced 12-fold more ADA enzyme than fibroblasts from normal individuals and were able to rapidly metabolize exogenous deoxyadenosine and adenosine, metabolites that accumulate in plasma in ADA-deficient patients and are responsible for the severe combined immunodeficiency in these patients. These experiments indicate the potential of retrovirus-mediated gene transfer into human fibroblasts for gene therapy.« less
-
Kim, Tae S; Jung, Mi Y; Cho, Daeho; Cohen, Edward P
2006-10-30
Breast cancer cells, like other types of neoplastic cells, form weakly immunogenic tumor-associated antigens. The antigenic properties of the tumor-associated antigens can be enhanced if they are expressed by highly immunogenic cells. In this study, a cancer vaccine was prepared by transfer of a cDNA expression library from SB5b breast carcinoma into mouse fibroblast cells of C3H/He mouse origin (H-2(k)), that had been previously modified to secrete GM-CSF and to express allogeneic class I-determinants (H-2(b)). The transfected syngeneic/allogeneic fibroblasts secreting GM-CSF were used as a vaccine in C3H/He mice. Robust cell-mediated immunity toward the breast cancer cells was generated in mice immunized with the cDNA-based vaccine. The immunity, mediated predominantly by CD8(+) T lymphocytes, was directed toward the breast cancer cells, but not against either of two other non-cross-reactive neoplasms of C3H/He mice. The immunity was sufficient to prolong the survival of mice with established breast cancer. Among other advantages, preparation of the vaccine by cDNA-transfer into a fibroblast cell line enabled the recipient cells to be modified in advance of DNA-transfer to augment their immunogenic properties. As the transferred DNA is replicated as the transfected cells divide, the vaccine could be prepared from microgram quantities of tumor tissue.
-
Ma, Jiehua; Li, Chao; Tao, Yaqin; Feng, Chang; Li, Genxi
2016-12-15
Nanog is among the most important indicators of cell pluripotency and self-renew, so detection of Nanog is critical for tumor assessment and monitoring of clinical prognosis. In this work, a novel method for Nanog detection is proposed by using electrochemical technique based on target-induced conformational change of an electrode-bound DNA pseudoknot. In the absence of Nanog, the rigid structure of the pseudoknot will minimize the connection between the redox tag and the electrode, thus reducing the obtained faradaic current. Nevertheless, the Nanog binding may liberate the flexible single-stranded element that transforms the DNA pesudokont into DNA hairpin structure due to steric hindrance effect, thus making the electrochemical tag close to the electrode surface. Consequently, electron transfer can be enhanced and very well electrochemical response can be observed. By using the proposed method, Nanog can be determined in a linear range from 2nM to 25nM with a detection limit of 163 pM. Furthermore, the proposed method can be directly used to assay Nanog not only in purified samples but also in complex media (cell extracts), which shows potential applications in Nanog functional studies as well as clinical diagnosis in the future. Copyright © 2016 Elsevier B.V. All rights reserved.
-
Chromatic shifts in the fluorescence emitted by murine thymocytes stained with Hoechst 33342.
Petersen, Timothy W; Ibrahim, Sherrif F; Diercks, Alan H; van den Engh, Ger
2004-08-01
Many methods in flow cytometry rely on staining DNA with a fluorescent dye to gauge DNA content. From the relative intensity of the fluorescence signature, one can then infer position in cell cycle, amount of DNA (i.e., for sperm selection), or, as in the case of flow karyotyping, to distinguish individual chromosomes. This work examines the staining of murine thymocytes with a common DNA dye, Hoechst 33342, to investigate nonlinearities in the florescence intensity as well as chromatic shifts. Murine thymocytes were stained with Hoechst 33342 and measured in a flow cytometer at two fluorescence emission bands. In other measurements, cells were stained at different dye concentrations, and then centrifuged. The supernatant was then used for a second round of staining to test the amount of dye uptake. Finally, to test for resonant energy transfer, we measured fluorescence anisotropy at two different wavelengths. The fluorescence of cells stained with Hoechst 33342 is a nonlinear process that shows an overall decrease in intensity with increased dye uptake, and spectral shift to the red. Along with the spectral shift of the fluorescence to the longer wavelengths, we document decreases in the fluorescence anisotropy that may indicate resonant energy transfer. At low concentrations, Hoechst 33342 binds to the minor groove of DNA and shows an increase in fluorescence and a blue shift upon binding. At higher concentrations, at which the dye molecules can no longer bind without overlapping, the blue fluorescence decreases and the red fluorescence increases until there is approximately one dye molecule per DNA base pair. The ratio of the blue fluorescence to the red fluorescence is an accurate indicator of the cellular dye concentration.
-
Sun, Yueying; Lu, Xiaohui; Su, Fengxia; Wang, Limei; Liu, Chenghui; Duan, Xinrui; Li, Zhengping
2015-12-15
Most of practical methods for detection of single nucleotide polymorphism (SNP) need at least two steps: amplification (usually by PCR) and detection of SNP by using the amplification products. Ligase chain reaction (LCR) can integrate the amplification and allele discrimination in one step. However, the detection of LCR products still remains a great challenge for highly sensitive and quantitative SNP detection. Herein, a simple but robust strategy for real-time fluorescence LCR has been developed for highly sensitive and quantitative SNP detection. A pair of LCR probes are firstly labeled with a fluorophore and a quencher, respectively. When the pair of LCR probes are ligated in LCR, the fluorophore will be brought close to the quencher, and thus, the fluorescence will be specifically quenched by fluorescence resonance energy transfer (FRET). The decrease of fluorescence intensity resulted from FRET can be real-time monitored in the LCR process. With the proposed real-time fluorescence LCR assay, 10 aM DNA targets or 100 pg genomic DNA can be accurately determined and as low as 0.1% mutant DNA can be detected in the presence of a large excess of wild-type DNA, indicating the high sensitivity and specificity. The real-time measuring does not require the detection step after LCR and gives a wide dynamic range for detection of DNA targets (from 10 aM to 1 pM). As LCR has been widely used for detection of SNP, DNA methylation, mRNA and microRNA, the real-time fluorescence LCR assay shows great potential for various genetic analysis. Copyright © 2015 Elsevier B.V. All rights reserved.
-
Hirakawa, Kazutaka; Taguchi, Makoto; Okazaki, Shigetoshi
2015-10-15
Electron donor-connecting cationic porphyrins meso-(1-naphthyl)-tris(N-methyl-p-pyridinio)porphyrin (1-NapTMPyP) and meso-(2-naphthyl)-tris(N-methyl-p-pyridinio)porphyrin (2-NapTMPyP) were designed and synthesized. DFT calculations speculate that the photoexcited states of 1- and 2-NapTMPyPs can be deactivated via intramolecular electron transfer from the naphthyl moiety to the porphyrin moiety. However, the quenching effect through the intramolecular electron transfer is insufficient, possibly due to the orthogonal position of the electron donor and the porphyrin ring and the relatively small driving force: Gibbs energies are 0.11 and 0.07 eV for 1- and 2-NapTMPyPs, respectively. It was speculated that more than 0.3 eV of the driving force is required to realize effective electron transfer in similar electron-donor connecting porphyrin systems. These porphyrins aggregated around the DNA strand, accelerating the deactivation of their excited singlet state and decreasing their photosensitized singlet oxygen-generating activities. In the presence of a sufficiently large concentration of DNA, these porphyrins can bind to a DNA strand stably, leading to an increased fluorescence quantum yield and lifetime. Singlet oxygen generation was also suppressed by the aggregation of porphyrins around DNA. Although the quantum yield of singlet oxygen generation was recovered in the presence of sufficient DNA, the singlet oxygen generated by DNA-binding porphyrins was significantly smaller than that without DNA. These results suggest that DNA-binding drugs limit the generation of photosensitized singlet oxygen by quenching the DNA strand.
-
McLaughlin, Krystle J; Nash, Rebekah P; Redinbo, Mathew R
2014-09-01
The widespread development of multidrug-resistant bacteria is a major health emergency. Conjugative DNA plasmids, which harbor a wide range of antibiotic resistance genes, also encode the protein factors necessary to orchestrate the propagation of plasmid DNA between bacterial cells through conjugative transfer. Successful conjugative DNA transfer depends on key catalytic components to nick one strand of the duplex DNA plasmid and separate the DNA strands while cell-to-cell transfer occurs. The TraI protein from the conjugative Salmonella plasmid pCU1 fulfills these key catalytic roles, as it contains both single-stranded DNA-nicking relaxase and ATP-dependent helicase domains within a single, 1,078-residue polypeptide. In this work, we unraveled the helicase determinants of Salmonella pCU1 TraI through DNA binding, ATPase, and DNA strand separation assays. TraI binds DNA substrates with high affinity in a manner influenced by nucleic acid length and the presence of a DNA hairpin structure adjacent to the nick site. TraI selectively hydrolyzes ATP, and mutations in conserved helicase motifs eliminate ATPase activity. Surprisingly, the absence of a relatively short (144-residue) domain at the extreme C terminus of the protein severely diminishes ATP-dependent strand separation. Collectively, these data define the helicase motifs of the conjugative factor TraI from Salmonella pCU1 and reveal a previously uncharacterized C-terminal functional domain that uncouples ATP hydrolysis from strand separation activity. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
-
Geometry-dependent DNA-TiO2 immobilization mechanism: A spectroscopic approach
NASA Astrophysics Data System (ADS)
Silva-Moraes, M. O.; Garcia-Basabe, Y.; de Souza, R. F. B.; Mota, A. J.; Passos, R. R.; Galante, D.; Fonseca Filho, H. D.; Romaguera-Barcelay, Y.; Rocco, M. L. M.; Brito, W. R.
2018-06-01
DNA nucleotides are used as a molecular recognition system on electrodes modified to be applied in the detection of various diseases, but immobilization mechanisms, as well as, charge transfers are not satisfactorily described in the literature. An electrochemical and spectroscopic study was carried out to characterize the molecular groups involved in the direct immobilization of DNA structures on the surface of nanostructured TiO2 with the aim of evaluating the influence of the geometrical aspects. X-ray photoelectron spectroscopy at O1s and P2p core levels indicate that immobilization of DNA samples occurs through covalent (Psbnd Osbnd Ti) bonds. X-ray absorption spectra at the Ti2p edge reinforce this conclusion. A new species at 138.5 eV was reported from P2p XPS spectra analysis which plays an important role in DNA-TiO2 immobilization. The Psbnd Osbnd Ti/Osbnd Ti ratio showed that quantitatively the DNA immobilization mechanism is dependent on their geometry, becoming more efficient for plasmid ds-DNA structures than for PCR ds-DNA structures. The analysis of photoabsorption spectra at C1s edge revealed that the molecular groups that participate in the C1s → LUMO electronic transitions have different pathways in the charge transfer processes at the DNA-TiO2 interface. Our results may contribute to additional studies of immobilization mechanisms understanding the influence of the geometry of different DNA molecules on nanostructured semiconductor and possible impact to the charge transfer processes with application in biosensors or aptamers.
-
Photonically driven DNA nanomachine with hybrid functions towards cell measurement
NASA Astrophysics Data System (ADS)
Ogura, Yusuke; Nishimura, Takahiro; Yamada, Kenji; Tanida, Jun
2018-02-01
Physical properties of a cell are often valuable information about the status of the cell, and developing technologies to measure such properties is important to enhance the progress in, for example, diagnosis of diseases. In this paper, we present a photonically driven DNA nanomachine with hybrid functions: providing a physical operation to a cell and reporting the cell's response. The DNA nanomachine can be controlled according to optical signals, and therefore the measurement is achieved locally at designated positions and at desired times. Black hole quenchers (BHQs) are introduced to drive the DNA nanomachine using light. When the DNA nanomachine is irradiated with the light at the excitation wavelength of the BHQs, the thermal energy is produced from the BHQs to drive the DNA nanomachine. To demonstrate a basic functionality, we constructed a DNA nanomachine that transformed between a linear conformation and a hairpin-like conformation depending on the presence or absence of a controlling DNA. This conformation change will be able to provide a force to deform cells as a physical operation. The response of the cell is reported as fluorescence resonance energy transfer (FRET) signals. An experimental result demonstrated that the FRET signal changed according to the presence or absence of the controlling DNA. The method is expected to be useful in measuring the stiffness of a cell.
-
An electrochemical sensor based on polyaniline for monitoring hydroquinone and its damage on DNA.
Tang, Wenwei; Zhang, Min; Li, Weihao; Zeng, Xinping
2014-09-01
A dsDNA/PANI/CTS/GCE biosensor was constructed by using the biocompatible chitosan (CTS) and the polyaniline (PANI) with excellent electric catalytic properties and large specific surface areas. The electrochemical behavior of hydroquinone on biosensor and its DNA-damaging mechanisms were investigated. Results showed that the redox peak current was remarkably increased after glassy carbon electrode (GCE) was modified by PANI/CTS. The dsDNA damage by hydroquinone was concentration dependent, and increased along with the increase of hydroquinone oxidation peak current and the reduction of dsDNA guanine oxidation peak current. The linear detection range of hydroquinone with dsDNA/PANI/CTS/GCE was 1.25×10(-6)-3.2×10(-4) M, and the detection limit was 9.65×10(-7) M. It was confirmed by the UV method that applying dsDNA/PANI/CTS/GCE to monitor hydroquinone was accurate and reliable. In addition, it could be deduced that the mode of interaction between the hydroquinone and dsDNA was intercalation. The electrochemical oxidation of hydroquinone on the dsDNA/PANI/CTS/GCE electrode was an adsorption-controlled irreversible and a two-electron two-proton transfer process. Copyright © 2014 Elsevier B.V. All rights reserved.
-
ERIC Educational Resources Information Center
Felsenfeld, Gary
1985-01-01
Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)
-
Cloning of an endangered species (Bos gaurus) using interspecies nuclear transfer.
Lanza, R P; Cibelli, J B; Diaz, F; Moraes, C T; Farin, P W; Farin, C E; Hammer, C J; West, M D; Damiani, P
2000-01-01
Approximately 100 species become extinct a day. Despite increasing interest in using cloning to rescue endangered species, successful interspecies nuclear transfer has not been previously described, and only a few reports of in vitro embryo formation exist. Here we show that interspecies nuclear transfer can be used to clone an endangered species with normal karyotypic and phenotypic development through implantation and the late stages of fetal growth. Somatic cells from a gaur bull (Bos gaurus), a large wild ox on the verge of extinction, (Species Survival Plan < 100 animals) were electrofused with enucleated oocytes from domestic cows. Twelve percent of the reconstructed oocytes developed to the blastocyst stage, and 18% of these embryos developed to the fetal stage when transferred to surrogate mothers. Three of the fetuses were electively removed at days 46 to 54 of gestation, and two continued gestation longer than 180 (ongoing) and 200 days, respectively. Microsatellite marker and cytogenetic analyses confirmed that the nuclear genome of the cloned animals was gaurus in origin. The gaur nuclei were shown to direct normal fetal development, with differentiation into complex tissue and organs, even though the mitochondrial DNA (mtDNA) within all the tissue types evaluated was derived exclusively from the recipient bovine oocytes. These results suggest that somatic cell cloning methods could be used to restore endangered, or even extinct, species and populations.
-
Vesicle Fusion Observed by Content Transfer across a Tethered Lipid Bilayer
Rawle, Robert J.; van Lengerich, Bettina; Chung, Minsub; Bendix, Poul Martin; Boxer, Steven G.
2011-01-01
Synaptic transmission is achieved by exocytosis of small, synaptic vesicles containing neurotransmitters across the plasma membrane. Here, we use a DNA-tethered freestanding bilayer as a target architecture that allows observation of content transfer of individual vesicles across the tethered planar bilayer. Tethering and fusion are mediated by hybridization of complementary DNA-lipid conjugates inserted into the two membranes, and content transfer is monitored by the dequenching of an aqueous content dye. By analyzing the diffusion profile of the aqueous dye after vesicle fusion, we are able to distinguish content transfer across the tethered bilayer patch from vesicle leakage above the patch. PMID:22004762
-
Bunge, Andreas; Kurz, Anke; Windeck, Anne-Kathrin; Korte, Thomas; Flasche, Wolfgang; Liebscher, Jürgen; Herrmann, Andreas; Huster, Daniel
2007-04-10
For the development of surface functionalized bilayers, we have synthesized lipophilic oligonucleotides to combine the molecular recognition mechanism of nucleic acids and the self-assembly characteristics of lipids in planar membranes. A lipophilic oligonucleotide consisting of 21 thymidine units and two lipophilic nucleotides with an alpha-tocopherol moiety as a lipophilic anchor was synthesized using solid-phase methods with a phosphoramadite strategy. The interaction of the water soluble lipophilic oligonucleotide with vesicular lipid membranes and its capability to bind complementary DNA strands was studied using complementary methods such as NMR, EPR, DSC, fluorescence spectroscopy, and fluorescence microscopy. This oligonucleotide inserted stably into preformed membranes from the aqueous phase. Thereby, no significant perturbation of the lipid bilayer and its stability was observed. However, the non-lipidated end of the oligonucleotide is exposed to the aqueous environment, is relatively mobile, and is free to interact with complementary DNA strands. Binding of the complementary single-stranded DNA molecules is fast and accomplished by the formation of Watson-Crick base pairs, which was confirmed by 1H NMR chemical shift analysis and fluorescence resonance energy transfer. The molecular structure of the membrane bound DNA double helix is very similar to the free double-stranded DNA. Further, the membrane bound DNA double strands also undergo regular melting. Finally, in raft-like membrane mixtures, the lipophilic oligonucleotide was shown to preferentially sequester into liquid-disordered membrane domains.
-
Packaging of Dinoroseobacter shibae DNA into Gene Transfer Agent Particles Is Not Random.
Tomasch, Jürgen; Wang, Hui; Hall, April T K; Patzelt, Diana; Preusse, Matthias; Petersen, Jörn; Brinkmann, Henner; Bunk, Boyke; Bhuju, Sabin; Jarek, Michael; Geffers, Robert; Lang, Andrew S; Wagner-Döbler, Irene
2018-01-01
Gene transfer agents (GTAs) are phage-like particles which contain a fragment of genomic DNA of the bacterial or archaeal producer and deliver this to a recipient cell. GTA gene clusters are present in the genomes of almost all marine Rhodobacteraceae (Roseobacters) and might be important contributors to horizontal gene transfer in the world's oceans. For all organisms studied so far, no obvious evidence of sequence specificity or other nonrandom process responsible for packaging genomic DNA into GTAs has been found. Here, we show that knock-out of an autoinducer synthase gene of Dinoroseobacter shibae resulted in overproduction and release of functional GTA particles (DsGTA). Next-generation sequencing of the 4.2-kb DNA fragments isolated from DsGTAs revealed that packaging was not random. DNA from low-GC conjugative plasmids but not from high-GC chromids was excluded from packaging. Seven chromosomal regions were strongly overrepresented in DNA isolated from DsGTA. These packaging peaks lacked identifiable conserved sequence motifs that might represent recognition sites for the GTA terminase complex. Low-GC regions of the chromosome, including the origin and terminus of replication, were underrepresented in DNA isolated from DsGTAs. DNA methylation reduced packaging frequency while the level of gene expression had no influence. Chromosomal regions found to be over- and underrepresented in DsGTA-DNA were regularly spaced. We propose that a "headful" type of packaging is initiated at the sites of coverage peaks and, after linearization of the chromosomal DNA, proceeds in both directions from the initiation site. GC-content, DNA-modifications, and chromatin structure might influence at which sides GTA packaging can be initiated. © The Author(s) 2018. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
-
Packaging of Dinoroseobacter shibae DNA into Gene Transfer Agent Particles Is Not Random
Wang, Hui; Hall, April T K; Patzelt, Diana; Preusse, Matthias; Petersen, Jörn; Brinkmann, Henner; Bunk, Boyke; Bhuju, Sabin; Jarek, Michael; Geffers, Robert; Lang, Andrew S; Wagner-Döbler, Irene
2018-01-01
Abstract Gene transfer agents (GTAs) are phage-like particles which contain a fragment of genomic DNA of the bacterial or archaeal producer and deliver this to a recipient cell. GTA gene clusters are present in the genomes of almost all marine Rhodobacteraceae (Roseobacters) and might be important contributors to horizontal gene transfer in the world’s oceans. For all organisms studied so far, no obvious evidence of sequence specificity or other nonrandom process responsible for packaging genomic DNA into GTAs has been found. Here, we show that knock-out of an autoinducer synthase gene of Dinoroseobacter shibae resulted in overproduction and release of functional GTA particles (DsGTA). Next-generation sequencing of the 4.2-kb DNA fragments isolated from DsGTAs revealed that packaging was not random. DNA from low-GC conjugative plasmids but not from high-GC chromids was excluded from packaging. Seven chromosomal regions were strongly overrepresented in DNA isolated from DsGTA. These packaging peaks lacked identifiable conserved sequence motifs that might represent recognition sites for the GTA terminase complex. Low-GC regions of the chromosome, including the origin and terminus of replication, were underrepresented in DNA isolated from DsGTAs. DNA methylation reduced packaging frequency while the level of gene expression had no influence. Chromosomal regions found to be over- and underrepresented in DsGTA-DNA were regularly spaced. We propose that a “headful” type of packaging is initiated at the sites of coverage peaks and, after linearization of the chromosomal DNA, proceeds in both directions from the initiation site. GC-content, DNA-modifications, and chromatin structure might influence at which sides GTA packaging can be initiated. PMID:29325123
-
Anno, Takayuki; Higashi, Taishi; Motoyama, Keiichi; Hirayama, Fumitoshi; Uekama, Kaneto; Arima, Hidetoshi
2012-04-01
In this study, we evaluated the polyamidoamine starburst dendrimer (dendrimer, generation 2: G2) conjugate with 6-O-α-(4-O-α-D-glucuronyl)-D-glucosyl-β-cyclodextrin (GUG-β-CDE (G2)) as a gene transfer carrier. The in vitro gene transfer activity of GUG-β-CDE (G2, degree of substitution (DS) of cyclodextrin (CyD) 1.8) was remarkably higher than that of dendrimer (G2) conjugate with α-CyD (α-CDE (G2, DS 1.2)) and that with β-CyD(β-CDE (G2, DS 1.3)) in A549 and RAW264.7 cells. The particle size, ζ-potential, DNase I-catalyzed degradation, and cellular association of plasmid DNA (pDNA) complex with GUG-β-CDE (G2, DS 1.8) were almost the same as those of the other CDEs. Fluorescent-labeled GUG-β-CDE (G2, DS 1.8) localized in the nucleus 6 h after transfection of its pDNA complex in A549 cells, suggesting that nuclear localization of pDNA complex with GUG-β-CDE (G2, DS 1.8), at least in part, contributes to its high gene transfer activity. GUG-β-CDE (G2, DS 1.8) provided higher gene transfer activity than α-CDE (G2, DS 1.2) and β-CDE (G2, DS 1.3) in kidney with negligible changes in blood chemistry values 12 h after intravenous injection of pDNA complexes with GUG-β-CDE (G2, DS 1.8) in mice. In conclusion, the present findings suggest that GUG-β-CDE (G2, DS 1.8) has the potential for a novel polymeric pDNA carrier in vitro and in vivo.
-
Agúndez, Leticia; González-Prieto, Coral; Machón, Cristina; Llosa, Matxalen
2012-01-01
Background Bacterial conjugation is a mechanism for horizontal DNA transfer between bacteria which requires cell to cell contact, usually mediated by self-transmissible plasmids. A protein known as relaxase is responsible for the processing of DNA during bacterial conjugation. TrwC, the relaxase of conjugative plasmid R388, is also able to catalyze site-specific integration of the transferred DNA into a copy of its target, the origin of transfer (oriT), present in a recipient plasmid. This reaction confers TrwC a high biotechnological potential as a tool for genomic engineering. Methodology/Principal Findings We have characterized this reaction by conjugal mobilization of a suicide plasmid to a recipient cell with an oriT-containing plasmid, selecting for the cointegrates. Proteins TrwA and IHF enhanced integration frequency. TrwC could also catalyze integration when it is expressed from the recipient cell. Both Y18 and Y26 catalytic tyrosil residues were essential to perform the reaction, while TrwC DNA helicase activity was dispensable. The target DNA could be reduced to 17 bp encompassing TrwC nicking and binding sites. Two human genomic sequences resembling the 17 bp segment were accepted as targets for TrwC-mediated site-specific integration. TrwC could also integrate the incoming DNA molecule into an oriT copy present in the recipient chromosome. Conclusions/Significance The results support a model for TrwC-mediated site-specific integration. This reaction may allow R388 to integrate into the genome of non-permissive hosts upon conjugative transfer. Also, the ability to act on target sequences present in the human genome underscores the biotechnological potential of conjugative relaxase TrwC as a site-specific integrase for genomic modification of human cells. PMID:22292089
-
NASA Technical Reports Server (NTRS)
Kozlov, I. A.; De Bouvere, B.; Van Aerschot, A.; Herdewijn, P.; Orgel, L. E.
1999-01-01
Hexitol nucleic acids (HNAs) are DNA analogues that contain the standard nucleoside bases attached to a phosphorylated 1,5-anhydrohexitol backbone. We find that HNAs support efficient information transfer in nonensymatic template-directed reactions. HNA heterosequences appeared to be superior to the corresponding DNA heterosequences in facilitating synthesis of complementary oligonucleotides from nucleoside-5'-phosphoro-2-methyl imidazolides.
-
Juhas, Mario; Ajioka, James W
2017-11-01
The majority of the good DNA editing techniques have been developed in Escherichia coli; however, Bacillus subtilis is better host for a plethora of synthetic biology and biotechnology applications. Reliable and efficient systems for the transfer of synthetic DNA between E. coli and B. subtilis are therefore of the highest importance. Using synthetic biology approaches, such as streamlined lambda Red recombineering and Gibson Isothermal Assembly, we integrated genetic circuits pT7L123, Repr-ts-1 and pLT7pol encoding the lysis genes of bacteriophages MS2, ΦX174 and lambda, the thermosensitive repressor and the T7 RNA polymerase into the E. coli chromosome. In this system, T7 RNA polymerase regulated by the thermosensitive repressor drives the expression of the phage lysis genes. We showed that T7 RNA polymerase significantly increases efficiency of cell lysis and transfer of the plasmid and bacterial artificial chromosome-encoded DNA from the lysed E. coli into B. subtilis. The T7 RNA polymerase-driven inducible cell lysis system is suitable for the efficient cell lysis and transfer of the DNA engineered in E. coli to other naturally competent hosts, such as B. subtilis. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.
-
Martínez-Cruz, Jesús; Romero, Diego; de Vicente, Antonio; Pérez-García, Alejandro
2017-03-01
The obligate biotrophic fungal pathogen Podosphaera xanthii is the main causal agent of powdery mildew in cucurbit crops all over the world. A major limitation of molecular studies of powdery mildew fungi (Erysiphales) is their genetic intractability. In this work, we describe a robust method based on the promiscuous transformation ability of Agrobacterium tumefaciens for reliable transformation of P. xanthii. The A. tumefaciens-mediated transformation (ATMT) system yielded transformants of P. xanthii with diverse transferred DNA (T-DNA) constructs. Analysis of the resultant transformants showed the random integration of T-DNA into the P. xanthii genome. The integrations were maintained in successive generations in the presence of selection pressure. Transformation was found to be transient, because in the absence of selection agent, the introduced genetic markers were lost due to excision of T-DNA from the genome. The ATMT system represents a potent tool for genetic manipulation of P. xanthii and will likely be useful for studying other biotrophic fungi. We hope that this method will contribute to the development of detailed molecular studies of the intimate interaction established between powdery mildew fungi and their host plants. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
-
Pancoska, Petr; Moravek, Zdenek; Moll, Ute M
2004-01-01
Nucleic acids are molecules of choice for both established and emerging nanoscale technologies. These technologies benefit from large functional densities of 'DNA processing elements' that can be readily manufactured. To achieve the desired functionality, polynucleotide sequences are currently designed by a process that involves tedious and laborious filtering of potential candidates against a series of requirements and parameters. Here, we present a complete novel methodology for the rapid rational design of large sets of DNA sequences. This method allows for the direct implementation of very complex and detailed requirements for the generated sequences, thus avoiding 'brute force' filtering. At the same time, these sequences have narrow distributions of melting temperatures. The molecular part of the design process can be done without computer assistance, using an efficient 'human engineering' approach by drawing a single blueprint graph that represents all generated sequences. Moreover, the method eliminates the necessity for extensive thermodynamic calculations. Melting temperature can be calculated only once (or not at all). In addition, the isostability of the sequences is independent of the selection of a particular set of thermodynamic parameters. Applications are presented for DNA sequence designs for microarrays, universal microarray zip sequences and electron transfer experiments.
-
Gene therapy in dentistry: tool of genetic engineering. Revisited.
Gupta, Khushboo; Singh, Saurabh; Garg, Kavita Nitish
2015-03-01
Advances in biotechnology have brought gene therapy to the forefront of medical research. The concept of transferring genes to tissues for clinical applications has been discussed nearly half a century, but the ability to manipulate genetic material via recombinant DNA technology has brought this goal to reality. The feasibility of gene transfer was first demonstrated using tumour viruses. This led to development of viral and nonviral methods for the genetic modification of somatic cells. Applications of gene therapy to dental and oral problems illustrate the potential impact of this technology on dentistry. Preclinical trial results regarding the same have been very promising. In this review we will discuss methods, vectors involved, clinical implication in dentistry and scientific issues associated with gene therapy. Copyright © 2014 Elsevier Ltd. All rights reserved.
-
Tolmachov, Oleg E
2010-04-01
Minimized derivatives of bacterial plasmids with removed bacterial backbones are promising vectors for the efficient delivery and for the long-term expression of therapeutic genes. The absence of the bacterial plasmid backbone, a known inducer of innate immune response and a known silencer of transgene expression, provides a partial explanation for the high efficiency of gene transfer using minimized DNA vectors. Supercoiled minicircle DNA is a type of minimized DNA vector obtained via intra-plasmid recombination in bacteria. Minicircle vectors seem to get an additional advantage from their physical compactness, which reduces DNA damage due to the mechanical stress during gene delivery. An independent topological means for DNA compression is knotting, with some knotted DNA isoforms offering superior compactness. I propose that, firstly, knotted DNA can be a suitable compact DNA form for the efficient transfection of a range of human cells with therapeutic genes, and, secondly, that knotted minimized DNA vectors without bacterial backbones ("miniknot" vectors) can surpass supercoiled minicircle DNA vectors in the efficiency of therapeutic gene delivery. Crucially, while the introduction of a single nick to a supercoiled DNA molecule leads to the loss of the compact supercoiled status, the introduction of nicks to knotted DNA does not change knotting. Tight miniknot vectors can be readily produced by the direct action of highly concentrated type II DNA topoisomerase on minicircle DNA or, alternatively, by annealing of the 19-base cohesive ends of the minimized vectors confined within the capsids of Escherichia coli bacteriophage P2 or its satellite bacteriophage P4. After reaching the nucleoplasm of the target cell, the knotted DNA is expected to be unknotted through type II topoisomerase activity and thus to become available for transcription, chromosomal integration or episomal maintenance. The hypothesis can be tested by comparing the gene transfer efficiency achieved with the proposed miniknot vectors, the minicircle vectors described previously, knotted plasmid vectors and standard plasmid vectors. Tightly-wound miniknots can be particularly useful in the gene administration procedures involving considerable forces acting on vector DNA: aerosol inhalation, jet-injection, electroporation, particle bombardment and ultrasound DNA transfer. (c) 2009 Elsevier Ltd. All rights reserved.
-
Charge-transfer optical absorption mechanism of DNA:Ag-nanocluster complexes
NASA Astrophysics Data System (ADS)
Longuinhos, R.; Lúcio, A. D.; Chacham, H.; Alexandre, S. S.
2016-05-01
Optical properties of DNA:Ag-nanoclusters complexes have been successfully applied experimentally in Chemistry, Physics, and Biology. Nevertheless, the mechanisms behind their optical activity remain unresolved. In this work, we present a time-dependent density functional study of optical absorption in DNA:Ag4. In all 23 different complexes investigated, we obtain new absorption peaks in the visible region that are not found in either the isolated Ag4 or isolated DNA base pairs. Absorption from red to green are predominantly of charge-transfer character, from the Ag4 to the DNA fragment, while absorption in the blue-violet range are mostly associated to electronic transitions of a mixed character, involving either DNA-Ag4 hybrid orbitals or intracluster orbitals. We also investigate the role of exchange-correlation functionals in the calculated optical spectra. Significant differences are observed between the calculations using the PBE functional (without exact exchange) and the CAM-B3LYP functional (which partly includes exact exchange). Specifically, we observe a tendency of charge-transfer excitations to involve purines bases, and the PBE spectra error is more pronounced in the complexes where the Ag cluster is bound to the purines. Finally, our results also highlight the importance of adding both the complementary base pair and the sugar-phosphate backbone in order to properly characterize the absorption spectrum of DNA:Ag complexes.
-
Charge-transfer optical absorption mechanism of DNA:Ag-nanocluster complexes.
Longuinhos, R; Lúcio, A D; Chacham, H; Alexandre, S S
2016-05-01
Optical properties of DNA:Ag-nanoclusters complexes have been successfully applied experimentally in Chemistry, Physics, and Biology. Nevertheless, the mechanisms behind their optical activity remain unresolved. In this work, we present a time-dependent density functional study of optical absorption in DNA:Ag_{4}. In all 23 different complexes investigated, we obtain new absorption peaks in the visible region that are not found in either the isolated Ag_{4} or isolated DNA base pairs. Absorption from red to green are predominantly of charge-transfer character, from the Ag_{4} to the DNA fragment, while absorption in the blue-violet range are mostly associated to electronic transitions of a mixed character, involving either DNA-Ag_{4} hybrid orbitals or intracluster orbitals. We also investigate the role of exchange-correlation functionals in the calculated optical spectra. Significant differences are observed between the calculations using the PBE functional (without exact exchange) and the CAM-B3LYP functional (which partly includes exact exchange). Specifically, we observe a tendency of charge-transfer excitations to involve purines bases, and the PBE spectra error is more pronounced in the complexes where the Ag cluster is bound to the purines. Finally, our results also highlight the importance of adding both the complementary base pair and the sugar-phosphate backbone in order to properly characterize the absorption spectrum of DNA:Ag complexes.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kaur, G.P.; Athwal, R.S.
1993-01-01
Complementation of DNA excision repair defect in xeroderma pigmentosum cells of group C (XP-C) has been achieved by the transfer of human chromosome 5. Individual human chromosomes tagged with a selectable marker were transferred to XP-C cells by microcell fusion from mouse-human hybrid cell lines each bearing a single different human chromosome. Analysis of the chromosome transfer clones revealed that introduction of chromosome 5 into XP-C cells corrected the DNA repair defect as well as UV-sensitive phenotypes, while chromosomes 2, 6, 7, 9, 13, 15, 17, and 21 failed to complement. The introduced chromosome 5 in complemented UV[sup r] clonesmore » was distinguished from the parental XP-C chromosomes by polymorphism for dinucleotide (CA)[sub n] repeats at two loci, D5S117 and D5S209. In addition, an intact marked chromosome 5 was rescued into mouse cells from a complemented UV[sup r] clone by microcell fusion. Five subclones of a complemented clone that had lost the marked chromosome 5 exhibited UV-sensitive and repair-deficient phenotypes identical to parental XP-C cells. Concordant loss of the transferred chromosome and reappearance of XP-C phenotype further confirmed the presence of a DNA repair gene on human chromosome 5. 38 refs., 7 figs., 1 tab.« less
-
Homologous and heterologous recombination between adenovirus vector DNA and chromosomal DNA.
Stephen, Sam Laurel; Sivanandam, Vijayshankar Ganesh; Kochanek, Stefan
2008-11-01
Adenovirus vector DNA is perceived to remain as episome following gene transfer. We quantitatively and qualitatively analysed recombination between high capacity adenoviral vector (HC-AdV) and chromosomal DNA following gene transfer in vitro. We studied homologous and heterologous recombination with a single HC-AdV carrying (i) a large genomic HPRT fragment with the HPRT CHICAGO mutation causing translational stop upon homologous recombination with the HPRT locus and (ii) a selection marker to allow for clonal selection in the event of heterologous recombination. We analysed the sequences at the junctions between vector and chromosomal DNA. In primary cells and in cell lines, the frequency of homologous recombination ranged from 2 x 10(-5) to 1.6 x 10(-6). Heterologous recombination occurred at rates between 5.5 x 10(-3) and 1.1 x 10(-4). HC-AdV DNA integrated via the termini mostly as intact molecules. Analysis of the junction sequences indicated vector integration in a relatively random manner without an obvious preference for particular chromosomal regions, but with a preference for integration into genes. Integration into protooncogenes or tumor suppressor genes was not observed. Patchy homologies between vector termini and chromosomal DNA were found at the site of integration. Although the majority of integrations had occurred without causing mutations in the chromosomal DNA, cases of nucleotide substitutions and insertions were observed. In several cases, deletions of even relative large chromosomal regions were likely. These results extend previous information on the integration patterns of adenovirus vector DNA and contribute to a risk-benefit assessment of adenovirus-mediated gene transfer.
-
DeYonker, Nathan J; Webster, Charles Edwin
2015-07-14
Tyrosyl-DNA phosphodiesterase I (Tdp1) is a DNA repair enzyme conserved across eukaryotes that catalyzes the hydrolysis of the phosphodiester bond between the tyrosine residue of topoisomerase I and the 3'-phosphate of DNA. Atomic level details of the mechanism of Tdp1 are proposed and analyzed using a fully quantum mechanical, geometrically constrained model. The structural basis for the computational model is the vanadate-inhibited crystal structure of human Tdp1 (hTdp1, Protein Data Bank entry 1RFF ). Density functional theory computations are used to acquire thermodynamic and kinetic data along the catalytic pathway, including the phosphoryl transfer and subsequent hydrolysis. Located transition states and intermediates along the reaction coordinate suggest an associative phosphoryl transfer mechanism with five-coordinate phosphorane intermediates. Similar to both theoretical and experimental results for phospholipase D, the proposed mechanism for hTdp1 also includes the thermodynamically favorable possibility of a four-coordinate phosphohistidine "dead-end" product.
-
Overexpression of Tet3 in donor cells enhances goat somatic cell nuclear transfer efficiency.
Han, Chengquan; Deng, Ruizhi; Mao, Tingchao; Luo, Yan; Wei, Biao; Meng, Peng; Zhao, Lu; Zhang, Qing; Quan, Fusheng; Liu, Jun; Zhang, Yong
2018-05-23
Ten-eleven translocation 3 (TET3) mediates active DNA demethylation of paternal genomes during mouse embryonic development. However, the mechanism of DNA demethylation in goat embryos remains unknown. In addition, aberrant DNA methylation reprogramming prevalently occurs in embryos cloned by somatic cell nuclear transfer (SCNT). In this study, we reported that TET3 is a key factor in DNA demethylation in goat pre-implantation embryos. Knockdown of Tet3 hindered DNA demethylation at the two- to four-cell stage in goat embryos and decreased Nanog expression in blastocysts. Overexpression of Tet3 in somatic cells can initiate DNA demethylation, reduce 5-methylcytosine level, increase 5-hydroxymethylcytosine level and promote the expression of key pluripotency genes. After SCNT, overexpression of Tet3 in donor cells corrected abnormal DNA hypermethylation of cloned embryos and significantly enhanced in vitro and in vivo developmental rate (P < 0.05). We conclude that overexpression of Tet3 in donor cells significantly improves goat SCNT efficiency. © 2018 Federation of European Biochemical Societies.
-
Carbon Nanotube Arrays for Intracellular Delivery and Biological Applications
NASA Astrophysics Data System (ADS)
Golshadi, Masoud
Introducing nucleic acids into mammalian cells is a crucial step to elucidate biochemical pathways, modify gene expression in immortalized cells, primary cells, and stem cells, and intoduces new approaches for clinical diagnostics and therapeutics. Current gene transfer technologies, including lipofection, electroporation, and viral delivery, have enabled break-through advances in basic and translational science to enable derivation and programming of embryonic stem cells, advanced gene editing using CRISPR (Clustered regularly interspaced short palindromic repeats), and development of targeted anti-tumor therapy using chimeric antigen receptors in T-cells (CAR-T). Despite these successes, current transfection technologies are time consuming and limited by the inefficient introduction of test molecules into large populations of target cells, and the cytotoxicity of the techniques. Moreover, many cell types cannot be consistently transfected by lipofection or electroporation (stem cells, T-cells) and viral delivery has limitations to the size of experimental DNA that can be packaged. In this dissertation, a novel coverslip-like platform consisting of an array of aligned hollow carbon nanotubes (CNTs) embedded in a sacrificial template is developed that enhances gene transfer capabilities, including high efficiency, low toxicity, in an expanded range of target cells, with the potential to transfer mixed combinations of protein and nucleic acids. The CNT array devices are fabricated by a scalable template-based manufacturing method using commercially available membranes, eliminating the need for nano-assembly. High efficient transfection has been demonstrated by delivering various cargos (nanoparticles, dye and plasmid DNA) into populations of cells, achieving 85% efficiency of plasmid DNA delivery into immortalized cells. Moreover, the CNT-mediated transfection of stem cells shows 3 times higher efficiency compared to current lipofection methods. Evaluating the cell-CNT interaction elucidates the importance of the geometrical properties of CNT arrays (CNT exposed length and surface morphology) on transfection efficiency. The results indicate that densely-packed and shortly-exposed CNT arrays with planar surface will enhance gene delivery using this new platform. This technology offers a significant increase in efficiency and cell viability, along with the ease of use compared to current standard methods, which demonstrates its potential to accelerate the development of new cell models to study intractable diseases, decoding the signaling pathways, and drug discovery.
-
Sullivan, Thomas D.; Rooney, Peggy J.; Klein, Bruce S.
2002-01-01
The dimorphic fungi Blastomyces dermatitidis and Histoplasma capsulatum cause systemic mycoses in humans and other animals. Forward genetic approaches to generating and screening mutants for biologically important phenotypes have been underutilized for these pathogens. The plant-transforming bacterium Agrobacterium tumefaciens was tested to determine whether it could transform these fungi and if the fate of transforming DNA was suited for use as an insertional mutagen. Yeast cells from both fungi and germinating conidia from B. dermatitidis were transformed via A. tumefaciens by using hygromycin resistance for selection. Transformation frequencies up to 1 per 100 yeast cells were obtained at high effector-to-target ratios of 3,000:1. B. dermatitidis and H. capsulatum ura5 lines were complemented with transfer DNA vectors expressing URA5 at efficiencies 5 to 10 times greater than those obtained using hygromycin selection. Southern blot analyses indicated that in 80% of transformants the transferred DNA was integrated into chromosomal DNA at single, unique sites in the genome. Progeny of B. dermatitidis transformants unexpectedly showed that a single round of colony growth under hygromycin selection or visible selection of transformants by lacZ expression generated homokaryotic progeny from multinucleate yeast. Theoretical analysis of random organelle sorting suggests that the majority of B. dermatitidis cells would be homokaryons after the ca. 20 generations necessary for colony formation. Taken together, the results demonstrate that A. tumefaciens efficiently transfers DNA into B. dermatitidis and H. capsulatum and has the properties necessary for use as an insertional mutagen in these fungi. PMID:12477790
-
Ultrasensitive FRET-based DNA sensor using PNA/DNA hybridization.
Yang, Lan-Hee; Ahn, Dong June; Koo, Eunhae
2016-12-01
In the diagnosis of genetic diseases, rapid and highly sensitive DNA detection is crucial. Therefore, many strategies for detecting target DNA have been developed, including electrical, optical, and mechanical methods. Herein, a highly sensitive FRET based sensor was developed by using PNA (Peptide Nucleic Acid) probe and QD, in which red color QDs are hybridized with capture probes, reporter probes and target DNAs by EDC-NHS coupling. The hybridized probe with target DNA gives off fluorescent signal due to the energy transfer from QD to Cy5 dye in the reporter probe. Compared to the conventional DNA sensor using DNA probes, the DNA sensor using PNA probes shows higher FRET factor and efficiency due to the higher reactivity between PNA and target DNA. In addition, to elicit the effect of the distance between the donor and the acceptor, we have investigated two types of the reporter probes having Cy5 dyes attached at the different positions of the reporter probes. Results show that the shorter the distance between QDs and Cy5s, the stronger the signal intensity. Furthermore, based on the fluorescence microscopy images using microcapillary chips, the FRET signal is enhanced to be up to 276% times stronger than the signal obtained using the cuvette by the fluorescence spectrometer. These results suggest that the PNA probe system conjugated with QDs can be used as ultrasensitive DNA nanosensors. Copyright © 2016. Published by Elsevier B.V.
-
Typeability of DNA in Touch Traces Deposited on Paper and Optical Data Discs.
Sołtyszewski, Ireneusz; Szeremeta, Michał; Skawrońska, Małgorzata; Niemcunowicz-Janica, Anna; Pepiński, Witold
2015-01-01
Nucleated epithelial cells that are transferred by casual touching and handling of objects are the primary source of biological evidence that is found in high-volume crimes. Cellular material associated with touch traces usually contains low levels of DNA template making it challenging to acquire an informative profile. The main purpose of this study was to examine the efficacy of DNA typing in fingerprints deposited on optical data discs and the office paper. Latent fingerprints were made by 60 subjects of both sexes (30 males and 30 females). A highly effective DNA extraction method with QIAamp DNA Mini Kit (Qiagen) and an increased sensitivity PCR by AmpFlSTR® NGM™ Amplification Kit (Applied Biosystems) carried out at standard 30 cycles and at increased 34 cycles were used. The mean value of total DNA recovery was 0.4 ng from CDs/DVDs and 0.3 ng from the office paper. Amplification of Low Template DNA (LT-DNA) resulted in improved analytical success by increasing the number of PCR cycles from standard 30 to 34. On the other hand, the increased PCR cycles resulted in allele drop-ins showing additional peaks, the majority of which were outside the stutter positions. Rigorous procedures and interpretation guidelines are required during LT-DNA for producing reliable and reproducible DNA profiles for forensic purposes.
-
Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction
NASA Astrophysics Data System (ADS)
Zhang, Z.; Birkedal, V.; Gothelf, K. V.
2016-05-01
The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection.
-
A pneumatic device for rapid loading of DNA sequencing gels.
Panussis, D A; Cook, M W; Rifkin, L L; Snider, J E; Strong, J T; McGrane, R M; Wilson, R K; Mardis, E R
1998-05-01
This work describes the design and construction of a device that facilitates the loading of DNA samples onto polyacrylamide gels for detection in the Perkin Elmer/Applied Biosystems (PE/ABI) 373 and 377 DNA sequencing instruments. The device is mounted onto the existing gel cassettes and makes the process of loading high-density gels less cumbersome while the associated time and errors are reduced. The principle of operation includes the simultaneous transfer of the entire batch of samples, in which a spring-loaded air cylinder generates positive pressure and flexible silica capillaries transfer the samples. A retractable capillary array carrier allows the delivery ends of the capillaries to be held up clear of the gel during loader attachment on the gel plates, while enabling their insertion in the gel wells once the device is securely mounted. Gel-loading devices capable of simultaneously transferring 72 samples onto the PE/ABI 373 and 377 are currently being used in our production sequencing groups while a 96-sample transfer prototype undergoes testing.
-
Vesicle fusion observed by content transfer across a tethered lipid bilayer.
Rawle, Robert J; van Lengerich, Bettina; Chung, Minsub; Bendix, Poul Martin; Boxer, Steven G
2011-10-19
Synaptic transmission is achieved by exocytosis of small, synaptic vesicles containing neurotransmitters across the plasma membrane. Here, we use a DNA-tethered freestanding bilayer as a target architecture that allows observation of content transfer of individual vesicles across the tethered planar bilayer. Tethering and fusion are mediated by hybridization of complementary DNA-lipid conjugates inserted into the two membranes, and content transfer is monitored by the dequenching of an aqueous content dye. By analyzing the diffusion profile of the aqueous dye after vesicle fusion, we are able to distinguish content transfer across the tethered bilayer patch from vesicle leakage above the patch. Copyright © 2011 Biophysical Society. Published by Elsevier Inc. All rights reserved.
-
Shannon C.K. Straub; Richard C. Cronn; Christopher Edwards; Mark Fishbein; Aaron Liston
2013-01-01
Horizontal gene transfer (HGT) of DNA from the plastid to the nuclear and mitochondrial genomes of higher plants is a common phenomenon; however, plastid genomes (plastomes) are highly conserved and have generally been regarded as impervious to HGT. We sequenced the 158 kb plastome and the 690 kb mitochondrial genome of common milkweed (Asclepias syriaca [Apocynaceae...
-
Laser capture microdissection: Arcturus(XT) infrared capture and UV cutting methods.
Gallagher, Rosa I; Blakely, Steven R; Liotta, Lance A; Espina, Virginia
2012-01-01
Laser capture microdissection (LCM) is a technique that allows the precise procurement of enriched cell populations from a heterogeneous tissue under direct microscopic visualization. LCM can be used to harvest the cells of interest directly or can be used to isolate specific cells by ablating the unwanted cells, resulting in histologically enriched cell populations. The fundamental components of laser microdissection technology are (a) visualization of the cells of interest via microscopy, (b) transfer of laser energy to a thermolabile polymer with either the formation of a polymer-cell composite (capture method) or transfer of laser energy via an ultraviolet laser to photovolatize a region of tissue (cutting method), and (c) removal of cells of interest from the heterogeneous tissue section. Laser energy supplied by LCM instruments can be infrared (810 nm) or ultraviolet (355 nm). Infrared lasers melt thermolabile polymers for cell capture, whereas ultraviolet lasers ablate cells for either removal of unwanted cells or excision of a defined area of cells. LCM technology is applicable to an array of applications including mass spectrometry, DNA genotyping and loss-of-heterozygosity analysis, RNA transcript profiling, cDNA library generation, proteomics discovery, and signal kinase pathway profiling. This chapter describes the unique features of the Arcturus(XT) laser capture microdissection instrument, which incorporates both infrared capture and ultraviolet cutting technology in one instrument, using a proteomic downstream assay as a model.
-
Raut, Vishal V.; Pandey, Shashibhal M.; Sainis, Jayashree K.
2011-01-01
Background and Scope In eukaryotes, chromatin remodelling complexes are shown to be responsible for nucleosome mobility, leading to increased accessibility of DNA for DNA binding proteins. Although the existence of such complexes in plants has been surmised mainly at the genetic level from bioinformatics studies and analysis of mutants, the biochemical existence of such complexes has remained unexplored. Methods Histone H1-depleted donor chromatin was prepared by micrococcal nuclease digestion of wheat nuclei and fractionation by exclusion chromatography. Nuclear extract was partially purified by cellulose phosphate ion exchange chromatography. Histone octamer trans-transfer activity was analysed using the synthetic nucleosome positioning sequence in the absence and presence of ATP and its analogues. ATPase activity was measured as 32Pi released using liquid scintillation counting. Key Results ATP-dependent histone octamer trans-transfer activity, partially purified from wheat nuclei using cellulose phosphate, showed ATP-dependent octamer displacement in trans from the H1-depleted native donor chromatin of wheat to the labelled synthetic nucleosome positioning sequence. It also showed nucleosome-dependent ATPase activity. Substitution of ATP by ATP analogues, namely ATPγS, AMP-PNP and ADP abolished the octamer trans-transfer, indicating the requirement of ATP hydrolysis for this activity. Conclusions ATP-dependent histone octamer transfer in trans is a recognized activity of chromatin remodelling complexes required for chromatin structure dynamics in non-plant species. Our results suggested that wheat nuclei also possess a typical chromatin remodelling activity, similar to that in other eukaryotes. This is the first report on chromatin remodelling activity in vitro from plants. PMID:21896571
-
Conjugative DNA Transfer Is Enhanced by Plasmid R1 Partitioning Proteins
Gruber, Christian J.; Lang, Silvia; Rajendra, Vinod K. H.; Nuk, Monika; Raffl, Sandra; Schildbach, Joel F.; Zechner, Ellen L.
2016-01-01
Bacterial conjugation is a form of type IV secretion used to transport protein and DNA directly to recipient bacteria. The process is cell contact-dependent, yet the mechanisms enabling extracellular events to trigger plasmid transfer to begin inside the cell remain obscure. In this study of plasmid R1 we investigated the role of plasmid proteins in the initiation of gene transfer. We find that TraI, the central regulator of conjugative DNA processing, interacts physically, and functionally with the plasmid partitioning proteins ParM and ParR. These interactions stimulate TraI catalyzed relaxation of plasmid DNA in vivo and in vitro and increase ParM ATPase activity. ParM also binds the coupling protein TraD and VirB4-like channel ATPase TraC. Together, these protein-protein interactions probably act to co-localize the transfer components intracellularly and promote assembly of the conjugation machinery. Importantly these data also indicate that the continued association of ParM and ParR at the conjugative pore is necessary for plasmid transfer to start efficiently. Moreover, the conjugative pilus and underlying secretion machinery assembled in the absence of Par proteins mediate poor biofilm formation and are completely dysfunctional for pilus specific R17 bacteriophage uptake. Thus, functional integration of Par components at the interface of relaxosome, coupling protein, and channel ATPases appears important for an optimal conformation and effective activation of the transfer machinery. We conclude that low copy plasmid R1 has evolved an active segregation system that optimizes both its vertical and lateral modes of dissemination. PMID:27486582
-
Delivering the Goods for Genome Engineering and Editing.
Skipper, Kristian Alsbjerg; Mikkelsen, Jacob Giehm
2015-08-01
A basic understanding of genome evolution and the life and impact of microorganisms, like viruses and bacteria, has been fundamental in the quest for efficient genetic therapies. The expanding tool box for genetic engineering now contains transposases, recombinases, and nucleases, all created from naturally occurring genome-modifying proteins. Whereas conventional gene therapies have sought to establish sustained expression of therapeutic genes, genomic tools are needed only in a short time window and should be delivered to cells ideally in a balanced "hit-and-run" fashion. Current state-of-the-art delivery strategies are based on intracellular production of protein from transfected plasmid DNA or in vitro-transcribed RNA, or from transduced viral templates. Here, we discuss advantages and challenges of intracellular production strategies and describe emerging approaches based on the direct delivery of protein either by transfer of recombinant protein or by lentiviral protein transduction. With focus on adapting viruses for protein delivery, we describe the concept of "all-in-one" lentiviral particles engineered to codeliver effector proteins and donor sequences for DNA transposition or homologous recombination. With optimized delivery methods-based on transferring DNA, RNA, or protein-it is no longer far-fetched that researchers in the field will indeed deliver the goods for somatic gene therapies.
-
Laser Capture Microdissection for Protein and NanoString RNA analysis
Golubeva, Yelena; Salcedo, Rosalba; Mueller, Claudius; Liotta, Lance A.; Espina, Virginia
2013-01-01
Laser capture microdissection (LCM) allows the precise procurement of enriched cell populations from a heterogeneous tissue, or live cell culture, under direct microscopic visualization. Histologically enriched cell populations can be procured by harvesting cells of interest directly, or isolating specific cells by ablating unwanted cells. The basic components of laser microdissection technology are a) visualization of cells via light microscopy, b) transfer of laser energy to a thermolabile polymer with either the formation of a polymer-cell composite (capture method) or transfer of laser energy via an ultraviolet laser to photovolatize a region of tissue (cutting method), and c) removal of cells of interest from the heterogeneous tissue section. The capture and cutting methods (instruments) for laser microdissection differ in the manner by which cells of interest are removed from the heterogeneous sample. Laser energy in the capture method is infrared (810nm), while in the cutting mode the laser is ultraviolet (355nm). Infrared lasers melt a thermolabile polymer that adheres to the cells of interest, whereas ultraviolet lasers ablate cells for either removal of unwanted cells or excision of a defined area of cells. LCM technology is applicable to an array of applications including mass spectrometry, DNA genotyping and loss-of-heterozygosity analysis, RNA transcript profiling, cDNA library generation, proteomics discovery, and signal kinase pathway profiling. This chapter describes laser capture microdissection using an ArcturusXT instrument for protein LCM sample analysis, and using a mmi CellCut Plus® instrument for RNA analysis via NanoString technology. PMID:23027006
-
Kukowska-Latallo, J F; Bielinska, A U; Johnson, J; Spindler, R; Tomalia, D A; Baker, J R
1996-01-01
Starburst polyamidoamine dendrimers are a new class of synthetic polymers with unique structural and physical characteristics. These polymers were investigated for the ability to bind DNA and enhance DNA transfer and expression in a variety of mammalian cell lines. Twenty different types of polyamidoamine dendrimers were synthesized, and the polymer structure was confirmed using well-defined analytical techniques. The efficiency of plasmid DNA transfection using dendrimers was examined using two reporter gene systems: firefly luciferase and bacterial beta-galactosidase. The transfections were performed using various dendrimers, and levels of expression of the reporter protein were determined. Highly efficient transfection of a broad range of eukaryotic cells and cell lines was achieved with minimal cytotoxicity using the DNA/dendrimer complexes. However, the ability to transfect cells was restricted to certain types of dendrimers and in some situations required the presence of additional compounds, such as DEAE-dextran, that appeared to alter the nature of the complex. A few cell lines demonstrated enhanced transfection with the addition of chloroquine, indicating endosomal localization of the complexes. The capability of a dendrimer to transfect cells appeared to depend on the size, shape, and number of primary amino groups on the surface of the polymer. However, the specific dendrimer most efficient in achieving transfection varied between different types of cells. These studies demonstrate that Starburst dendrimers can transfect a wide variety of cell types in vitro and offer an efficient method for producing permanently transfected cell lines. Images Fig. 1 Fig. 2 Fig. 4 PMID:8643500
-
Kofron, Michelle D; Laurencin, Cato T
2004-06-01
One of the most common non-viral methods for the introduction of foreign deoxyribonucleic acid (DNA) into cultured cells is calcium phosphate co-precipitate transfection. This technique involves the encapsulation of DNA within a calcium phosphate co-precipitate, particulate addition to in vitro cell culture, endocytosis of the co-precipitate, and exogenous DNA expression by the transfected cell. In this study, we fabricated a novel non-viral gene transfer system by adsorbing DNA, encapsulated in calcium phosphate (DNA/Ca-P) co-precipitates, to biodegradable two- and three-dimensional poly(lactide-co-glycolide) matrices (2D-DNA/Ca-P/PLAGA, 3D-DNA/Ca-P/PLAGA). Co-precipitate release studies demonstrated an initial burst release over the first 48 h. By day 7, approximately 96% of the initially adsorbed DNA/Ca-P co-precipitate had been released. This was followed by low levels of co-precipitate release for 42 days. Polymerase chain reaction was used to demonstrate the ability of the released DNA containing co-precipitates to transfect SaOS-2 cells cultured in vitro on the 3D-DNA/Ca-P/PLAGA matrix and maintenance of the structural integrity of the exogenous DNA. In summary, a promising system for the incorporation and controlled delivery of exogenous genes encapsulated within a calcium phosphate co-precipitate from biodegradable polymeric matrices has been developed and may have applicability to the delivery of therapeutic genes and the transfection of other cell types.
-
Problems associated with gene transfer and opportunities for microgravity environments
NASA Astrophysics Data System (ADS)
Tennessen, Daniel J.
1997-01-01
The method of crop improvement by gene transfer is becoming increasingly routine with transgenic foods and ornamental crops now being marketed to consumers. However, biological processes of plants, and the physical barriers of current protocols continue to limit the application of gene transfer in many commercial crops. The goal of this paper is to outline the current limitations of gene transfer and to hypothesize possible opportunities for use of microgravity to overcome such limitations. The limitations detailed in this paper include host-range specificity of Agrobacterium mediated transformation, probability of gene insertion, position effects of the inserted genes, gene copy number, stability of foreign gene expression in host plants, and regeneration of recalcitrant plant species. Microgravity offers an opportunity for gene transfer where cell growth kinetics, DNA synthesis, and genetic recombination rates can be altered. Such biological conditions may enhance the ability for recombination of reporter genes and other genes of interest to agriculture. Proposed studies would be useful for understanding instability of foreign gene expression and may lead to stable transformed plants. Other aspects of gene transfer in microgravity are discussed.
-
Tengku Baharudin, Nadiah; Jaafar, Hasnan; Zainuddin, Zafarina
2012-01-01
Background: The mitochondrial DNA (mtDNA) 10398 polymorphism is hypothesised to alter a mitochondrial subunit of the electron transfer chain and is associated with several neurodegenerative disorders and cancers. Methods: In this study, an mtDNA polymorphism at nucleotide position 10398 was screened in 101 Malay female patients with invasive breast cancer and 90 age-matched healthy female controls using minisequencing analysis. Results: The Malay women with the 10398G variant showed a significantly increased risk of invasive breast cancer (OR = 2.29, 95% CI 1.25–4.20, P = 0.007). Immunohistochemistry analysis was conducted to investigate the effect of this polymorphism on the levels of apoptosis in breast cancer cells. The level of Bax (a pro-apoptotic protein) expression was significantly higher than that of Bcl-2 (an anti-apoptotic protein) in patients carrying the G allele (P = 0.016) but not in those carrying the A allele (P = 0.48). Conclusion: Based on these findings, we propose that the mtDNA 10398 polymorphism may be a potential risk marker for breast cancer susceptibility in the Malay population. PMID:22977373
-
Ye, Yu-Dan; Xia, Li; Xu, Dang-Dang; Xing, Xiao-Jing; Pang, Dai-Wen; Tang, Hong-Wu
2016-11-15
Based on the remarkable difference between the interactions of carbon nanoparticles (CNPs) oxide with single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA), and the fact that fluorescence of DNA-stabilized silver nanoclusters (AgNCs) can be quenched by CNPs oxide, DNA-functionalized AgNCs were applied as label-free fluorescence probes and a novel fluorescence resonance energy transfer (FRET) sensor was successfully constructed for the detection of human immunodeficiency virus (HIV) DNA sequences. CNPs oxide were prepared with the oxidation of candle soot, hence it is simple, time-saving and low-cost. The strategy of dual AgNCs probes was applied to improve the detection sensitivity by using dual- probe capturing the same target DNA in a sandwich mode and as the fluorescence donor, and using CNPs oxide as the acceptor. In the presence of target DNA, a dsDNA hybrid forms, leading to the desorption of the ssDNA-AgNCs probes from CNPs oxide, and the recovering of fluorescence of the AgNCs in a HIV-DNA concentration-dependent manner. The results show that HIV-DNA can be detected in the range of 1-50nM with a detection limit of 0.40nM in aqueous buffer. The method is simple, rapid and sensitive with no need of labeled fluorescent probes, and moreover, the design of fluorescent dual-probe makes full use of the excellent fluorescence property of AgNCs and further improves the detection sensitivity. Copyright © 2016 Elsevier B.V. All rights reserved.
-
Dissolving Hydroxyolite: A DNA Molecule into Its Hydroxyapatite Mold.
Bertran, Oscar; Revilla-López, Guillermo; Casanovas, Jordi; Del Valle, Luis J; Turon, Pau; Puiggalí, Jordi; Alemán, Carlos
2016-05-04
In spite of the clinical importance of hydroxyapatite (HAp), the mechanism that controls its dissolution in acidic environments remains unclear. Knowledge of such a process is highly desirable to provide better understanding of different pathologies, as for example osteoporosis, and of the HAp potential as vehicle for gene delivery to replace damaged DNA. In this work, the mechanism of dissolution in acid conditions of HAp nanoparticles encapsulating double-stranded DNA has been investigated at the atomistic level using computer simulations. For this purpose, four consecutive (multi-step) molecular dynamics simulations, involving different temperatures and proton transfer processes, have been carried out. Results are consistent with a polynuclear decalcification mechanism in which proton transfer processes, from the surface to the internal regions of the particle, play a crucial role. In addition, the DNA remains protected by the mineral mold and transferred proton from both temperature and chemicals. These results, which indicate that biomineralization imparts very effective protection to DNA, also have important implications in other biomedical fields, as for example in the design of artificial bones or in the fight against osteoporosis by promoting the fixation of Ca(2+) ions. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
Srirattana, Kanokwan; St John, Justin C
2018-05-08
We generated cattle embryos using mitochondrial supplementation and somatic cell nuclear transfer (SCNT), named miNT, to determine how additional mitochondrial DNA (mtDNA) modulates the nuclear genome. To eliminate any confounding effects from somatic cell mtDNA in intraspecies SCNT, donor cell mtDNA was depleted prior to embryo production. Additional oocyte mtDNA did not affect embryo development rates but increased mtDNA copy number in blastocyst stage embryos. Moreover, miNT-derived blastocysts had different gene expression profiles when compared with SCNT-derived blastocysts. Additional mtDNA increased expression levels of genes involved in oxidative phosphorylation, cell cycle and DNA repair. Supplementing the embryo culture media with a histone deacetylase inhibitor, Trichostatin A (TSA), had no beneficial effects on the development of miNT-derived embryos, unlike SCNT-derived embryos. When compared with SCNT-derived blastocysts cultured in the presence of TSA, additional mtDNA alone had beneficial effects as the activity of glycolysis may increase and embryonic cell death may decrease. However, these beneficial effects were not found with additional mtDNA and TSA together, suggesting that additional mtDNA alone enhances reprogramming. In conclusion, additional mtDNA increased mtDNA copy number and expression levels of genes involved in energy production and embryo development in blastocyst stage embryos emphasising the importance of nuclear-mitochondrial interactions.
-
Spectroscopic studies of STZ-induced methylated-DNA in both in vivo and in vitro conditions
NASA Astrophysics Data System (ADS)
Bathaie, S. Z.; Sedghgoo, F.; Jafarnejad, A.; Farzami, B.; Khayatian, M.
2008-12-01
Alkylating agents after formation of DNA adduct not only posses their harmful role on living cells but also can transfer this information to the next generation. Different techniques have been introduced to study the alkylated DNA, most of which are specific and designed for investigation of specific target DNA. But the exact differences between spectroscopic and functional properties of alkylated DNA are not seen in the literature. In the present study DNA was methylated using streptozotocin (STZ) by both in vitro and in vivo protocols, then methylated-DNA was investigated by various techniques. Our results show that (1) the binding of ethidium bromide as an intercalating dye decreases to methylated-DNA in comparison with normal DNA, (2) CD spectra of methylated-DNA show changes including a decrease in the positive band at 275 nm and a shift from 258 nm crossover to a longer wavelength, which is caused by reduction of water around it, due to the presence of additional hydrophobic methyl groups, (3) the stability of methylated-DNA against DTAB as a denaturant is decreased and (4) the enzyme-like activity of methylated-DNA in an electron transfer reaction is reduced. In conclusion, additional methyl groups not only protrude water around DNA, but also cause the loss of hydrogen bonding, loosening of conformation, preventing desired interactions and thus normal function of DNA.
-
Kanigowska, Paulina; Shen, Yue; Zheng, Yijing; Rosser, Susan; Cai, Yizhi
2016-02-01
Acoustic droplet ejection (ADE) technology uses focused acoustic energy to transfer nanoliter-scale liquid droplets with high precision and accuracy. This noncontact, tipless, low-volume dispensing technology minimizes the possibility of cross-contamination and potentially reduces the costs of reagents and consumables. To date, acoustic dispensers have mainly been used in screening libraries of compounds. In this paper, we describe the first application of this powerful technology to the rapidly developing field of synthetic biology, for DNA synthesis and assembly at the nanoliter scale using a Labcyte Echo 550 acoustic dispenser. We were able to successfully downscale PCRs and the popular one-pot DNA assembly methods, Golden Gate and Gibson assemblies, from the microliter to the nanoliter scale with high assembly efficiency, which effectively cut the reagent cost by 20- to 100-fold. We envision that acoustic dispensing will become an instrumental technology in synthetic biology, in particular in the era of DNA foundries. © 2015 Society for Laboratory Automation and Screening.
-
Canovas, Sebastian; Ross, Pablo J; Kelsey, Gavin; Coy, Pilar
2017-11-01
DNA methylation can be considered a component of epigenetic memory with a critical role during embryo development, and which undergoes dramatic reprogramming after fertilization. Though it has been a focus of research for many years, the reprogramming mechanism is still not fully understood. Recent results suggest that absence of maintenance at DNA replication is a major factor, and that there is an unexpected role for TET3-mediated oxidation of 5mC to 5hmC in guarding against de novo methylation. Base-resolution and genome-wide profiling methods are enabling more comprehensive assessments of the extent to which ART might impair DNA methylation reprogramming, and which sequence elements are most vulnerable. Indeed, as we also review here, studies showing the effect of culture media, ovarian stimulation or embryo transfer on the methylation pattern of embryos emphasize the need to face ART-associated defects and search for strategies to mitigate adverse effects on the health of ART-derived children. © 2017 WILEY Periodicals, Inc.
-
Xu, Qing-Hua; Gaylord, Brent S; Wang, Shu; Bazan, Guillermo C; Moses, Daniel; Heeger, Alan J
2004-08-10
We have investigated the energy transfer processes in DNA sequence detection by using cationic conjugated polymers and peptide nucleic acid (PNA) probes with ultrafast pump-dump-emission spectroscopy. Pump-dump-emission spectroscopy provides femtosecond temporal resolution and high sensitivity and avoids interference from the solvent response. The energy transfer from donor (the conjugated polymer) to acceptor (a fluorescent molecule attached to a PNA terminus) has been time resolved. The results indicate that both electrostatic and hydrophobic interactions contribute to the formation of cationic conjugated polymers/PNA-C/DNA complexes. The two interactions result in two different binding conformations. This picture is supported by the average donor-acceptor separations as estimated from time-resolved and steady-state measurements. Electrostatic interactions dominate at low concentrations and in mixed solvents.
-
Xu, Qing-Hua; Gaylord, Brent S.; Wang, Shu; Bazan, Guillermo C.; Moses, Daniel; Heeger, Alan J.
2004-01-01
We have investigated the energy transfer processes in DNA sequence detection by using cationic conjugated polymers and peptide nucleic acid (PNA) probes with ultrafast pump-dump-emission spectroscopy. Pump-dump-emission spectroscopy provides femtosecond temporal resolution and high sensitivity and avoids interference from the solvent response. The energy transfer from donor (the conjugated polymer) to acceptor (a fluorescent molecule attached to a PNA terminus) has been time resolved. The results indicate that both electrostatic and hydrophobic interactions contribute to the formation of cationic conjugated polymers/PNA-C/DNA complexes. The two interactions result in two different binding conformations. This picture is supported by the average donor–acceptor separations as estimated from time-resolved and steady-state measurements. Electrostatic interactions dominate at low concentrations and in mixed solvents. PMID:15282375
-
Müller, J-M V; Wissemann, J; Meli, M L; Dasen, G; Lutz, H; Heinzerling, L; Feige, K
2011-11-01
Whole blood pharmacokinetics of intratumourally injected naked plasmid DNA coding for equine Interleukin 12 (IL-12) was assessed as a means of in vivo gene transfer in the treatment of melanoma in grey horses. The expression of induced interferon gamma (IFN-g) was evaluated in order to determine the pharmacodynamic properties of in vivo gene transduction. Seven grey horses bearing melanoma were injected intratumourally with 250 µg naked plasmid DNA coding for IL-12. Peripheral blood and biopsies from the injection site were taken at 13 time points until day 14 post injection (p.i.). Samples were analysed using quantitative real-time PCR. Plasmid DNA was quantified in blood samples and mRNA expression for IFN-g in tissue samples. Plasmid DNA showed fast elimination kinetics with more than 99 % of the plasmid disappearing within 36 hours. IFN-g expression increased quickly after IL-12 plasmid injection, but varied between individual horses. Intratumoural injection of plasmid DNA is a feasible method for inducing transgene expression in vivo. Biological activity of the transgene IL-12 was confirmed by measuring expression of IFN-g.
-
Basu, Anirban; Kumar, Gopinatha Suresh
2016-08-01
Interaction of the food colorant acid red 27 with double stranded DNA was investigated using spectroscopic and calorimetric methods. Absorbance and fluorescence studies suggested an intimate binding interaction between the dye and DNA. The quantum efficiency value testified an effective energy transfer from the DNA base pairs to the dye molecules. Minor groove displacement assay with Hoechst 33258 revealed that the binding occurs in the minor groove of DNA. Circular dichroism studies revealed that acid red 27 induces moderate conformational perturbations in DNA. Results of calorimetric studies suggested that the complexation process was driven largely by positive entropic contribution with a smaller favorable enthalpy contribution. The equilibrium constant of the binding was calculated to be (3.04 ± 0.09) × 10(4) M(-1) at 298.15 K. Negative heat capacity value along with the enthalpy-entropy compensation phenomenon established the involvement of dominant hydrophobic forces in the binding process. Differential scanning calorimetry studies presented evidence for an increased thermal stability of DNA on binding of acid red 27. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
-
Mitochondrial Replacement Techniques, Scientific Tourism, and the Global Politics of Science.
Chan, Sarah; Palacios-González, César; De Jesús Medina Arellano, María
2017-09-01
The United Kingdom is the first and so far only country to pass explicit legislation allowing for the licensed use of the new reproductive technology known as mitochondrial replacement therapy. The techniques used in this technology may prevent the transmission of mitochondrial DNA diseases, but they are controversial because they involve the manipulation of oocytes or embryos and the transfer of genetic material. Some commentators have even suggested that MRT constitutes germline genome modification. All eyes were on the United Kingdom as the most likely location for the first MRT birth, so it was a shock when, on September 27, 2016, an announcement went out that the first baby to result from use of the intervention had already been born. In New York City, United States-based scientist John Zhang used maternal spindle transfer (one of the recognized MRT methods) to generate five embryos for a woman carrying oocytes with deleterious mutations of the mitochondrial DNA. Zhang then shipped the only euploid embryo to Mexico, where it was transferred to the mother's uterus. Zhang's team's travel across international borders to carry out experimental procedures represents a form of scientific tourism that has not been properly ethically explored; it can, however, have seriously detrimental effects for developing countries. © 2017 The Hastings Center.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gonsalves, C.; Xue, B.; Yepes, M.
1994-03-01
A single regeneration procedure using cotyledon examples effectively regenerated five commercially grown muskmelon cultivars. This regeneration scheme was used to facilitate gene transfers using either Agrobacterium tumefaciens or microprojectile bombardment methods. In both cases, the transferred genes were from the T-DNA region of the binary vector plasmid pGA482GG/cp cucumber mosaic virus-white leaf strain (CMV-WL), which contains genes that encode neomycin phosphotransferase II (NPT II), [beta]-glucuronidase (GUS), and the CMV-WL coat protein (CP). Explants treated with pGA482GG/cpCMV-WL regenerated shoots on Murashige and Skoog medium containing 4.4 [mu]m 6-benzylaminopurine (BA), kanamycin (Km) at 150 mg[center dot]liter[sup [minus]1] and carbenicillin (Cb) at 500more » mg[center dot]liter[sup [minus]1]. The authors' comparison of A. tumefaciens- and microprojectile-mediated gene transfer procedures shows that both methods effectively produce nearly the same percentage of transgenic plants. R[sub 0] plants were first tested for GUS or NPT II expression, then the polymerase chain reaction (PCR) and other tests were used to verify the transfer of the NPT II, GUS, and CMV-WL CP genes.« less
-
NASA Astrophysics Data System (ADS)
Gogonea, Valentin; Merz, Kenneth M.
2000-02-01
This paper presents a theoretical model for the investigation of charge transfer between ions and a solvent treated as a dielectric continuum media. The method is a combination of a semiempirical effective Hamiltonian with a modified Poisson-Boltzmann equation which includes charge transfer in the form of a surface charge density positioned at the dielectric interface. The new Poisson-Boltzmann equation together with new boundary conditions results in a new set of equations for the electrostatic potential (or polarization charge densities). Charge transfer adds a new free energy component to the solvation free energy term, which accounts for all interactions between the transferred charge at the dielectric interface, the solute wave function and the solvent polarization charges. Practical calculations on a set of 19 anions and 17 cations demonstrate that charge exchange with a dielectric is present and it is in the range of 0.06-0.4 eu. Furthermore, the pattern of the magnitudes of charge transfer can be related to the acid-base properties of the ions in many cases, but exceptions are also found. Finally, we show that the method leads to an energy decomposition scheme of the total electrostatic energy, which can be used in mechanistic studies on protein and DNA interaction with water.
-
Capturing the radical ion-pair intermediate in DNA guanine oxidation
Jie, Jialong; Liu, Kunhui; Wu, Lidan; Zhao, Hongmei; Song, Di; Su, Hongmei
2017-01-01
Although the radical ion pair has been frequently invoked as a key intermediate in DNA oxidative damage reactions and photoinduced electron transfer processes, the unambiguous detection and characterization of this species remain formidable and unresolved due to its extremely unstable nature and low concentration. We use the strategy that, at cryogenic temperatures, the transient species could be sufficiently stabilized to be detectable spectroscopically. By coupling the two techniques (the cryogenic stabilization and the time-resolved laser flash photolysis spectroscopy) together, we are able to capture the ion-pair transient G+•⋯Cl− in the chlorine radical–initiated DNA guanine (G) oxidation reaction, and provide direct evidence to ascertain the intricate type of addition/charge separation mechanism underlying guanine oxidation. The unique spectral signature of the radical ion-pair G+•⋯Cl− is identified, revealing a markedly intense absorption feature peaking at 570 nm that is distinctive from G+• alone. Moreover, the ion-pair spectrum is found to be highly sensitive to the protonation equilibria within guanine-cytosine base pair (G:C), which splits into two resolved bands at 480 and 610 nm as the acidic proton transfers along the central hydrogen bond from G+• to C. We thus use this exquisite sensitivity to track the intrabase-pair proton transfer dynamics in the double-stranded DNA oligonucleotides, which is of critical importance for the description of the proton-coupled charge transfer mechanisms in DNA. PMID:28630924
-
Mitochondrial DNA transfer to the nucleus generates extensive insertion site variation in maize.
Lough, Ashley N; Roark, Leah M; Kato, Akio; Ream, Thomas S; Lamb, Jonathan C; Birchler, James A; Newton, Kathleen J
2008-01-01
Mitochondrial DNA (mtDNA) insertions into nuclear chromosomes have been documented in a number of eukaryotes. We used fluorescence in situ hybridization (FISH) to examine the variation of mtDNA insertions in maize. Twenty overlapping cosmids, representing the 570-kb maize mitochondrial genome, were individually labeled and hybridized to root tip metaphase chromosomes from the B73 inbred line. A minimum of 15 mtDNA insertion sites on nine chromosomes were detectable using this method. One site near the centromere on chromosome arm 9L was identified by a majority of the cosmids. To examine variation in nuclear mitochondrial DNA sequences (NUMTs), a mixture of labeled cosmids was applied to chromosome spreads of ten diverse inbred lines: A188, A632, B37, B73, BMS, KYS, Mo17, Oh43, W22, and W23. The number of detectable NUMTs varied dramatically among the lines. None of the tested inbred lines other than B73 showed the strong hybridization signal on 9L, suggesting that there is a recent mtDNA insertion at this site in B73. Different sources of B73 and W23 were examined for NUMT variation within inbred lines. Differences were detectable, suggesting either that mtDNA is being incorporated or lost from the maize nuclear genome continuously. The results indicate that mtDNA insertions represent a major source of nuclear chromosomal variation.
-
Zhang, Yan; Wang, Xin-Yan; Zhang, Qianyi; Zhang, Chun-Yang
2017-11-21
DNA methyltransferases (MTases) may specifically recognize the short palindromic sequences and transfer a methyl group from S-adenosyl-l-methionine to target cytosine/adenine. The aberrant DNA methylation is linked to the abnormal DNA MTase activity, and some DNA MTases have become promising targets of anticancer/antimicrobial drugs. However, the reported DNA MTase assays often involve laborious operation, expensive instruments, and radio-labeled substrates. Here, we develop a simple and label-free fluorescent method to sensitively detect DNA adenine methyltransferase (Dam) on the basis of terminal deoxynucleotidyl transferase (TdT)-activated Endonuclease IV (Endo IV)-assisted hyperbranched amplification. We design a hairpin probe with a palindromic sequence in the stem as the substrate and a NH 2 -modified 3' end for the prevention of nonspecific amplification. The substrate may be methylated by Dam and subsequently cleaved by DpnI, producing three single-stranded DNAs, two of which with 3'-OH termini may be amplified by hyperbranched amplification to generate a distinct fluorescence signal. Because high exactitude of TdT enables the amplification only in the presence of free 3'-OH termini and Endo IV only hydrolyzes the intact apurinic/apyrimidinic sites in double-stranded DNAs, zero background signal can be achieved. This method exhibits excellent selectivity and high sensitivity with a limit of detection of 0.003 U/mL for pure Dam and 9.61 × 10 -6 mg/mL for Dam in E. coli cells. Moreover, it can be used to screen the Dam inhibitors, holding great potentials in disease diagnosis and drug development.
-
Shankara Narayanan, Jeyaraman; Bhuvana, Mohanlal; Dharuman, Venkataraman
2014-08-15
Cationic N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylammonium propane (DOTAP) liposome is spherically sandwiched in gold nanoparticle (abbreviated as sDOTAP-AuNP) onto a gold electrode surface. The sDOTAP-AuNP is applied for electrochemical label free DNA sensing and Escherichia coli cell transfection for the first time. Complementary target (named as hybridized), non-complementary target (un-hybridized) and single base mismatch target (named as SMM) hybridized surfaces are discriminated sensitively and selectively in presence of [Fe(CN)6](3-/4-). Double strand specific intercalator methylene blue in combination with [Fe(CN)6](3-) is used to enhance target detection limit down to femtomolar concentration. Cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS), differential pulse voltammetry (DPV) techniques are used for characterizing DNA sensing. High Resolution Transmission Electron Microscopy (HRTEM), Fourier Transform Infrared Spectroscopy (FTIR), Atomic Force Microscopy (AFM) and Dynamic Light Scattering (DLS) techniques are used to confirm the spherical nature of the sDOTAP-AuNP-DNA composite in solution and on the solid surface. DNA on the sDOTAP-ssDNA is transferred by potential stripping method (+0.2V (Ag/AgCl)) into buffer solution containing E. coli cells. The transfection is confirmed by the contrast images for the transfected and non-transfected cell from Confocal Laser Scanning Microscopy (CLSM). The results demonstrate effectiveness of the electrochemical DNA transfection method developed and could be applied for other cells. Copyright © 2014 Elsevier B.V. All rights reserved.
-
Izhar, Lior; Goldsmith, Moshe; Dahan, Ronny; Geacintov, Nicholas; Lloyd, Robert G; Livneh, Zvi
2008-09-12
Daughter strand gaps formed upon interruption of replication at DNA lesions in Escherichia coli can be repaired by either translesion DNA synthesis or homologous recombination (HR) repair. Using a plasmid-based assay system that enables discrimination between strand transfer and template switching (information copying) modes of HR gap repair, we found that approximately 80% of strand gaps were repaired by physical strand transfer from the donor, whereas approximately 20% appear to be repaired by template switching. HR gap repair operated on both small and bulky lesions and largely depended on RecA and RecF but not on the RecBCD nuclease. In addition, we found that HR was mildly reduced in cells lacking the RuvABC and RecG proteins involved in resolution of Holliday junctions. These results, obtained for the first time under conditions that detect the two HR gap repair mechanisms, provide in vivo high-resolution molecular evidence for the predominance of the strand transfer mechanism in HR gap repair. A small but significant portion of HR gap repair appears to occur via a template switching mechanism.
-
Bilbao, Nerea; Destoop, Iris; De Feyter, Steven; González-Rodríguez, David
2016-01-11
We present an approach that makes use of DNA base pairing to produce hydrogen-bonded macrocycles whose supramolecular structure can be transferred from solution to a solid substrate. A hierarchical assembly process ultimately leads to two-dimensional nanostructured porous networks that are able to host size-complementary guests. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
Fonneløp, Ane Elida; Johannessen, Helen; Egeland, Thore; Gill, Peter
2016-07-01
As the profiling systems used in forensic analyses have become more sensitive in recent years, the risk of detecting a contamination in a DNA sample has increased proportionally. This requires more stringent work protocols and awareness to minimize the chance of contamination. Although there is high consciousness on contamination and best practice procedures in forensic labs, the same requirements are not always applied by the police. In this study we have investigated the risk of contamination from police staff. Environmental DNA was monitored by performing wipe tests (sampling of hot spots) at two large police units (scenes of crime departments). Additionally, the DNA profiles of the scenes of crime officers were compared to casework samples that their own unit had investigated in the period of 2009-2015. Furthermore, a pilot study to assess whether DNA from the outside package of an exhibit could be transferred to a DNA sample was carried out. Environmental DNA was detected in various samples from hot spots. Furthermore, 16 incidences of previously undetected police-staff contamination were found in casework that had been submitted between 2009 and 2015. In 6 cases the police officers with a matching DNA profile reported that they had not been involved with the case. We have demonstrated that DNA from the outside package can be transferred to an exhibit during examination. This experience demonstrates that when implementing the new multiplex systems, it is important to ensure that 'best practice' procedures are upgraded, and appropriate training is provided in order to ensure that police are aware of the increased contamination risks. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
-
Engineering the DNA cytosine-5 methyltransferase reaction for sequence-specific labeling of DNA
Lukinavičius, Gražvydas; Lapinaitė, Audronė; Urbanavičiūtė, Giedrė; Gerasimaitė, Rūta; Klimašauskas, Saulius
2012-01-01
DNA methyltransferases catalyse the transfer of a methyl group from the ubiquitous cofactor S-adenosyl-L-methionine (AdoMet) onto specific target sites on DNA and play important roles in organisms from bacteria to humans. AdoMet analogs with extended propargylic side chains have been chemically produced for methyltransferase-directed transfer of activated groups (mTAG) onto DNA, although the efficiency of reactions with synthetic analogs remained low. We performed steric engineering of the cofactor pocket in a model DNA cytosine-5 methyltransferase (C5-MTase), M.HhaI, by systematic replacement of three non-essential positions, located in two conserved sequence motifs and in a variable region, with smaller residues. We found that double and triple replacements lead to a substantial improvement of the transalkylation activity, which manifests itself in a mild increase of cofactor binding affinity and a larger increase of the rate of alkyl transfer. These effects are accompanied with reduction of both the stability of the product DNA–M.HhaI–AdoHcy complex and the rate of methylation, permitting competitive mTAG labeling in the presence of AdoMet. Analogous replacements of two conserved residues in M.HpaII and M2.Eco31I also resulted in improved transalkylation activity attesting a general applicability of the homology-guided engineering to the C5-MTase family and expanding the repertoire of sequence-specific tools for covalent in vitro and ex vivo labeling of DNA. PMID:23042683
-
Li, Haiyin; Chang, Jiafu; Hou, Ting; Ge, Lei; Li, Feng
2016-11-01
Reliable, selective and sensitive approaches for trinitrophenol (TNP) detection are highly desirable with respect to national security and environmental protection. Herein, a simple and novel fluorescent strategy for highly sensitive and specific TNP assay has been successfully developed, which is based on the quenching of the fluorescent poly(thymine)-templated copper nanoclusters (DNA-CuNCs), through the synergetic effects of acid induction and electron transfer. Upon the addition of TNP, donor-acceptor complexes between the electron-deficient nitro-groups in TNP and the electron-donating DNA templates are formed, resulting in the close proximity between TNP and CuNCs. Moreover, the acidity of TNP contributes to the pH decrease of the system. These factors combine to dramatically quench the fluorescence of DNA-CuNCs, providing a "signal-off" strategy for TNP sensing. The as-proposed strategy demonstrates high sensitivity for TNP assay, and a detection limit of 0.03μM is obtained, which is lower than those reported by using organic fluorescent materials. More significantly, this approach shows outstanding selectivity over a number of TNP analogues, such as 2,4,6-trinitrotoluene (TNT), 2,4-dinitrotoluene (DNT), 2,4-dinitrophenol (DNP), 3-nitrophenol (NP), nitrobenzene (NB), phenol (BP), and toluene (BT). Compared with previous studies, this method does not need complex DNA sequence design, fluorescent dye labeling, or sophisticated organic reactions, rendering the strategy with additional advantages of simplicity and cost-effectiveness. In addition, the as-proposed strategy has been adopted for the detection of TNP in natural water samples, indicating its great potential to be applied in the fields of public safety and environmental monitoring. Copyright © 2016 Elsevier B.V. All rights reserved.
-
A Three-Dimensional Model of the Yeast Genome
NASA Astrophysics Data System (ADS)
Noble, William; Duan, Zhi-Jun; Andronescu, Mirela; Schutz, Kevin; McIlwain, Sean; Kim, Yoo Jung; Lee, Choli; Shendure, Jay; Fields, Stanley; Blau, C. Anthony
Layered on top of information conveyed by DNA sequence and chromatin are higher order structures that encompass portions of chromosomes, entire chromosomes, and even whole genomes. Interphase chromosomes are not positioned randomly within the nucleus, but instead adopt preferred conformations. Disparate DNA elements co-localize into functionally defined aggregates or factories for transcription and DNA replication. In budding yeast, Drosophila and many other eukaryotes, chromosomes adopt a Rabl configuration, with arms extending from centromeres adjacent to the spindle pole body to telomeres that abut the nuclear envelope. Nonetheless, the topologies and spatial relationships of chromosomes remain poorly understood. Here we developed a method to globally capture intra- and inter-chromosomal interactions, and applied it to generate a map at kilobase resolution of the haploid genome of Saccharomyces cerevisiae. The map recapitulates known features of genome organization, thereby validating the method, and identifies new features. Extensive regional and higher order folding of individual chromosomes is observed. Chromosome XII exhibits a striking conformation that implicates the nucleolus as a formidable barrier to interaction between DNA sequences at either end. Inter-chromosomal contacts are anchored by centromeres and include interactions among transfer RNA genes, among origins of early DNA replication and among sites where chromosomal breakpoints occur. Finally, we constructed a three-dimensional model of the yeast genome. Our findings provide a glimpse of the interface between the form and function of a eukaryotic genome.
-
Lin, Xuan; Faridi, Nurul; Casola, Claudio
2016-01-01
Comparative genomics analyses empowered by the wealth of sequenced genomes have revealed numerous instances of horizontal DNA transfers between distantly related species. In eukaryotes, repetitive DNA sequences known as transposable elements (TEs) are especially prone to move across species boundaries. Such horizontal transposon transfers, or HTTs, are relatively common within major eukaryotic kingdoms, including animals, plants, and fungi, while rarely occurring across these kingdoms. Here, we describe the first case of HTT from animals to plants, involving TEs known as Penelope-like elements, or PLEs, a group of retrotransposons closely related to eukaryotic telomerases. Using a combination of in situ hybridization on chromosomes, polymerase chain reaction experiments, and computational analyses we show that the predominant PLE lineage, EN(+)PLEs, is highly diversified in loblolly pine and other conifers, but appears to be absent in other gymnosperms. Phylogenetic analyses of both protein and DNA sequences reveal that conifers EN(+)PLEs, or Dryads, form a monophyletic group clustering within a clade of primarily arthropod elements. Additionally, no EN(+)PLEs were detected in 1,928 genome assemblies from 1,029 nonmetazoan and nonconifer genomes from 14 major eukaryotic lineages. These findings indicate that Dryads emerged following an ancient horizontal transfer of EN(+)PLEs from arthropods to a common ancestor of conifers approximately 340 Ma. This represents one of the oldest known interspecific transmissions of TEs, and the most conspicuous case of DNA transfer between animals and plants. PMID:27190138
-
The mechanism and control of DNA transfer by the conjugative relaxase of resistance plasmid pCU1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nash, Rebekah Potts; Habibi, Sohrab; Cheng, Yuan
2010-11-15
Bacteria expand their genetic diversity, spread antibiotic resistance genes, and obtain virulence factors through the highly coordinated process of conjugative plasmid transfer (CPT). A plasmid-encoded relaxase enzyme initiates and terminates CPT by nicking and religating the transferred plasmid in a sequence-specific manner. We solved the 2.3 {angstrom} crystal structure of the relaxase responsible for the spread of the resistance plasmid pCU1 and determined its DNA binding and nicking capabilities. The overall fold of the pCU1 relaxase is similar to that of the F plasmid and plasmid R388 relaxases. However, in the pCU1 structure, the conserved tyrosine residues (Y18,19,26,27) that aremore » required for DNA nicking and religation were displaced up to 14 {angstrom} out of the relaxase active site, revealing a high degree of mobility in this region of the enzyme. In spite of this flexibility, the tyrosines still cleaved the nic site of the plasmid's origin of transfer, and did so in a sequence-specific, metal-dependent manner. Unexpectedly, the pCU1 relaxase lacked the sequence-specific DNA binding previously reported for the homologous F and R388 relaxase enzymes, despite its high sequence and structural similarity with both proteins. In summary, our work outlines novel structural and functional aspects of the relaxase-mediated conjugative transfer of plasmid pCU1.« less
-
Differences in lateral gene transfer in hypersaline versus thermal environments.
Rhodes, Matthew E; Spear, John R; Oren, Aharon; House, Christopher H
2011-07-08
The role of lateral gene transfer (LGT) in the evolution of microorganisms is only beginning to be understood. While most LGT events occur between closely related individuals, inter-phylum and inter-domain LGT events are not uncommon. These distant transfer events offer potentially greater fitness advantages and it is for this reason that these "long distance" LGT events may have significantly impacted the evolution of microbes. One mechanism driving distant LGT events is microbial transformation. Theoretically, transformative events can occur between any two species provided that the DNA of one enters the habitat of the other. Two categories of microorganisms that are well-known for LGT are the thermophiles and halophiles. We identified potential inter-class LGT events into both a thermophilic class of Archaea (Thermoprotei) and a halophilic class of Archaea (Halobacteria). We then categorized these LGT genes as originating in thermophiles and halophiles respectively. While more than 68% of transfer events into Thermoprotei taxa originated in other thermophiles, less than 11% of transfer events into Halobacteria taxa originated in other halophiles. Our results suggest that there is a fundamental difference between LGT in thermophiles and halophiles. We theorize that the difference lies in the different natures of the environments. While DNA degrades rapidly in thermal environments due to temperature-driven denaturization, hypersaline environments are adept at preserving DNA. Furthermore, most hypersaline environments, as topographical minima, are natural collectors of cellular debris. Thus halophiles would in theory be exposed to a greater diversity and quantity of extracellular DNA than thermophiles.
-
NASA Astrophysics Data System (ADS)
Katebi, Samira; Esmaeili, Abolghasem; Ghaedi, Kamran
2016-03-01
Spermatozoa could introduce exogenous oligonucleotides of interest to the oocyte. The most important reason of low efficiency of sperm mediated gene transfer (SMGT) is low uptake of exogenous DNA by spermatozoa. The aim of this study was to evaluate the effects of static magnetic field on exogenous oligonucleotide uptake of spermatozoa using magnetofection method. Magnetic nanoparticles (MNPs) associated with the labeled oligonucleotides were used to increase the efficiency of exogenous oligonucleotide uptake by rooster spermatozoa. We used high-field/high-gradient magnet (NdFeB) to enhance and accelerate exogenous DNA sedimentation at the spermatozoa surface. Flow cytometry analysis was performed to measure viability and percentage of exogenous oligonucleotide uptake by sperm. Flow cytometry analysis showed a significant increase in exogenous oligonucleotide uptake by rooster spermatozoa (P<0.001) when spermatozoa were incubated in exogenous oligonucleotide solution and MNPs. However, by applying static magnetic field during magnetofection method, a significant decrease in exogenous oligonucleotide uptake was observed (P<0.05). Findings of this study showed that MNPs were effective to increase exogenous oligonucleotide uptake by rooster spermatozoa; however unlike others studies, static magnetic field, was not only ineffective to enhance exogenous oligonucleotide uptake by rooster spermatozoa but also led to reduction in efficiency of magnetic nanoparticles in gene transfer.
-
Mitochondrial Retroprocessing Promoted Functional Transfers of rpl5 to the Nucleus in Grasses.
Wu, Zhiqiang; Sloan, Daniel B; Brown, Colin W; Rosenblueth, Mónica; Palmer, Jeffrey D; Ong, Han Chuan
2017-09-01
Functional gene transfers from the mitochondrion to the nucleus are ongoing in angiosperms and have occurred repeatedly for all 15 ribosomal protein genes, but it is not clear why some of these genes are transferred more often than others nor what the balance is between DNA- and RNA-mediated transfers. Although direct insertion of mitochondrial DNA into the nucleus occurs frequently in angiosperms, case studies of functional mitochondrial gene transfer have implicated an RNA-mediated mechanism that eliminates introns and RNA editing sites, which would otherwise impede proper expression of mitochondrial genes in the nucleus. To elucidate the mechanisms that facilitate functional gene transfers and the evolutionary dynamics of the coexisting nuclear and mitochondrial gene copies that are established during these transfers, we have analyzed rpl5 genes from 90 grasses (Poaceae) and related monocots. Multiple lines of evidence indicate that rpl5 has been functionally transferred to the nucleus at least three separate times in the grass family and that at least seven species have intact and transcribed (but not necessarily functional) copies in both the mitochondrion and nucleus. In two grasses, likely functional nuclear copies of rpl5 have been subject to recent gene conversion events via secondarily transferred mitochondrial copies in what we believe are the first described cases of mitochondrial-to-nuclear gene conversion. We show that rpl5 underwent a retroprocessing event within the mitochondrial genome early in the evolution of the grass family, which we argue predisposed the gene towards successful, DNA-mediated functional transfer by generating a "pre-edited" sequence. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
-
Bacterial gene transfer by natural genetic transformation in the environment.
Lorenz, M G; Wackernagel, W
1994-01-01
Natural genetic transformation is the active uptake of free DNA by bacterial cells and the heritable incorporation of its genetic information. Since the famous discovery of transformation in Streptococcus pneumoniae by Griffith in 1928 and the demonstration of DNA as the transforming principle by Avery and coworkers in 1944, cellular processes involved in transformation have been studied extensively by in vitro experimentation with a few transformable species. Only more recently has it been considered that transformation may be a powerful mechanism of horizontal gene transfer in natural bacterial populations. In this review the current understanding of the biology of transformation is summarized to provide the platform on which aspects of bacterial transformation in water, soil, and sediments and the habitat of pathogens are discussed. Direct and indirect evidence for gene transfer routes by transformation within species and between different species will be presented, along with data suggesting that plasmids as well as chromosomal DNA are subject to genetic exchange via transformation. Experiments exploring the prerequisites for transformation in the environment, including the production and persistence of free DNA and factors important for the uptake of DNA by cells, will be compiled, as well as possible natural barriers to transformation. The efficiency of gene transfer by transformation in bacterial habitats is possibly genetically adjusted to submaximal levels. The fact that natural transformation has been detected among bacteria from all trophic and taxonomic groups including archaebacteria suggests that transformability evolved early in phylogeny. Probable functions of DNA uptake other than gene acquisition will be discussed. The body of information presently available suggests that transformation has a great impact on bacterial population dynamics as well as on bacterial evolution and speciation. PMID:7968924
-
Specific gene transfer mediated by galactosylated poly-L-lysine into hepatoma cells.
Han, J; Il Yeom, Y
2000-07-20
Plasmid DNA/galactosylated poly-L-lysine(GalPLL) complex was used to transfer luciferase reporter gene in vitro into human hepatoma cells by a receptor-mediated endocytosis process. DNA was combined with galPLL via charge interaction (DNA:GalPLL:fusogenic peptide, 1:0.4:5, w/w/w) and the resulting complex was characterized by dynamic light scattering, gel retardation assay and zeta potential analyzer to determine the particle size, electrostatic charge interaction, and apparent surface charge. The complex was tested for the efficiency of gene transfer in cultured human hepatoblastoma cell line Hep G2 and fibroblast cells NIH/3T3 in vitro. The mean diameter of the complex (DNA:GalPLL=1:0.4, w/w) was 256+/-34.8 nm, and at this ratio, it was positively charged (zeta potential of this complex was 10.1 mV). Hep G2 cells, which express a galactose specific membrane lectin, were efficiently and selectively transfected with the RSV Luc/GalPLL complex in a sugar-dependent manner. NIH/3T3 cells, which do not express the galactose-specific membrane lectin, showed only a marginal level of gene expression. The transfection efficiency of GalPLL-conjugated DNA complex into Hep G2 cells was greatly enhanced in the presence of fusogenic peptide that can disrupt endosomes, where the GalPLL-DNA complex is entrapped with the fusogenic peptide. With the fusogenic peptide KALA, the luciferase activity in Hep G2 cells was ten-fold higher than that of cells transfected in the absence of the fusogenic peptide. Our gene transfer formulation may find potential application for the gene therapy of liver diseases.
-
High-Efficiency Ligation and Recombination of DNA Fragments by Vertebrate Cells
NASA Astrophysics Data System (ADS)
Miller, Cynthia K.; Temin, Howard M.
1983-05-01
DNA-mediated gene transfer (transfection) is used to introduce specific genes into vertebrate cells. Events soon after transfection were quantitatively analyzed by determining the infectivity of the DNA from an avian retrovirus and of mixtures of subgenomic fragments of this DNA. The limiting step of transfection with two DNA molecules is the uptake by a single cell of both DNA's in a biologically active state. Transfected cells mediate ligation and recombination of physically unlinked DNA's at nearly 100 percent efficiency.
-
42 CFR 73.13 - Restricted experiments.
Code of Federal Regulations, 2011 CFR
2011-10-01
...) Restricted experiments: (1) Experiments utilizing recombinant DNA that involve the deliberate transfer of a... agriculture. (2) Experiments involving the deliberate formation of recombinant DNA containing genes for the...
-
42 CFR 73.13 - Restricted experiments.
Code of Federal Regulations, 2010 CFR
2010-10-01
...) Restricted experiments: (1) Experiments utilizing recombinant DNA that involve the deliberate transfer of a... agriculture. (2) Experiments involving the deliberate formation of recombinant DNA containing genes for the...
-
42 CFR 73.13 - Restricted experiments.
Code of Federal Regulations, 2012 CFR
2012-10-01
...) Restricted experiments: (1) Experiments utilizing recombinant DNA that involve the deliberate transfer of a... agriculture. (2) Experiments involving the deliberate formation of recombinant DNA containing genes for the...
-
DNA-COMPACT: DNA COMpression Based on a Pattern-Aware Contextual Modeling Technique
Li, Pinghao; Wang, Shuang; Kim, Jihoon; Xiong, Hongkai; Ohno-Machado, Lucila; Jiang, Xiaoqian
2013-01-01
Genome data are becoming increasingly important for modern medicine. As the rate of increase in DNA sequencing outstrips the rate of increase in disk storage capacity, the storage and data transferring of large genome data are becoming important concerns for biomedical researchers. We propose a two-pass lossless genome compression algorithm, which highlights the synthesis of complementary contextual models, to improve the compression performance. The proposed framework could handle genome compression with and without reference sequences, and demonstrated performance advantages over best existing algorithms. The method for reference-free compression led to bit rates of 1.720 and 1.838 bits per base for bacteria and yeast, which were approximately 3.7% and 2.6% better than the state-of-the-art algorithms. Regarding performance with reference, we tested on the first Korean personal genome sequence data set, and our proposed method demonstrated a 189-fold compression rate, reducing the raw file size from 2986.8 MB to 15.8 MB at a comparable decompression cost with existing algorithms. DNAcompact is freely available at https://sourceforge.net/projects/dnacompact/for research purpose. PMID:24282536
-
Preparation of Formalin-fixed Paraffin-embedded Tissue Cores for both RNA and DNA Extraction.
Patel, Palak G; Selvarajah, Shamini; Boursalie, Suzanne; How, Nathan E; Ejdelman, Joshua; Guerard, Karl-Philippe; Bartlett, John M; Lapointe, Jacques; Park, Paul C; Okello, John B A; Berman, David M
2016-08-21
Formalin-fixed paraffin embedded tissue (FFPET) represents a valuable, well-annotated substrate for molecular investigations. The utility of FFPET in molecular analysis is complicated both by heterogeneous tissue composition and low yields when extracting nucleic acids. A literature search revealed a paucity of protocols addressing these issues, and none that showed a validated method for simultaneous extraction of RNA and DNA from regions of interest in FFPET. This method addresses both issues. Tissue specificity was achieved by mapping cancer areas of interest on microscope slides and transferring annotations onto FFPET blocks. Tissue cores were harvested from areas of interest using 0.6 mm microarray punches. Nucleic acid extraction was performed using a commercial FFPET extraction system, with modifications to homogenization, deparaffinization, and Proteinase K digestion steps to improve tissue digestion and increase nucleic acid yields. The modified protocol yields sufficient quantity and quality of nucleic acids for use in a number of downstream analyses, including a multi-analyte gene expression platform, as well as reverse transcriptase coupled real time PCR analysis of mRNA expression, and methylation-specific PCR (MSP) analysis of DNA methylation.
-
Xiao, W; Rank, G H
1989-03-15
The yeast SMR1 gene was used as a dominant resistance-selectable marker for industrial yeast transformation and for targeting integration of an economically important gene at the homologous ILV2 locus. A MEL1 gene, which codes for alpha-galactosidase, was inserted into a dispensable upstream region of SMR1 in vitro; different treatments of the plasmid (pWX813) prior to transformation resulted in 3' end, 5' end and replacement integrations that exhibited distinct integrant structures. One-step replacement within a nonessential region of the host genome generated a stable integration of MEL1 devoid of bacterial plasmid DNA. Using this method, we have constructed several alpha-galactosidase positive industrial Saccharomyces strains. Our study provides a general method for stable gene transfer in most industrial Saccharomyces yeasts, including those used in the baking, brewing (ale and lager), distilling, wine and sake industries, with solely nucleotide sequences of interest. The absence of bacterial DNA in the integrant structure facilitates the commercial application of recombinant DNA technology in the food and beverage industry.
-
van Grinsven, Bart; Eersels, Kasper; Peeters, Marloes; Losada-Pérez, Patricia; Vandenryt, Thijs; Cleij, Thomas J; Wagner, Patrick
2014-08-27
In recent years, biosensors have become increasingly important in various scientific domains including medicine, biology, and pharmacology, resulting in an increased demand for fast and effective readout techniques. In this Spotlight on Applications, we report on the recently developed heat-transfer method (HTM) and illustrate the use of the technique by zooming in on four established bio(mimetic) sensor applications: (i) mutation analysis in DNA sequences, (ii) cancer cell identification through surface-imprinted polymers, (iii) detection of neurotransmitters with molecularly imprinted polymers, and (iv) phase-transition analysis in lipid vesicle layers. The methodology is based on changes in heat-transfer resistance at a functionalized solid-liquid interface. To this extent, the device applies a temperature gradient over this interface and monitors the temperature underneath and above the functionalized chip in time. The heat-transfer resistance can be obtained by dividing this temperature gradient by the power needed to achieve a programmed temperature. The low-cost, fast, label-free and user-friendly nature of the technology in combination with a high degree of specificity, selectivity, and sensitivity makes HTM a promising sensor technology.
-
Grebennikova, T. V.; Syroeshkin, A. V.; Shubralova, E. V.; Eliseeva, O. V.; Kostina, L. V.; Kulikova, N. Y.; Latyshev, O. E.; Morozova, M. A.; Yuzhakov, A. G.; Chichaeva, M. A.; Tsygankov, O. S.
2018-01-01
Cosmic dust samples from the surface of the illuminator of the International Space Station (ISS) were collected by a crew member during his spacewalk. The sampler with tampon in a vacuum container was delivered to the Earth. Washouts from the tampon's material and the tampon itself were analyzed for the presence of bacterial DNA by the method of nested PCR with primers specific to DNA of the genus Mycobacteria, DNA of the strains of capsular bacteria Bacillus, and DNA encoding 16S ribosomal RNA. The results of amplification followed by sequencing and phylogenetic analysis indicated the presence of the bacteria of the genus Mycobacteria and the extreme bacterium of the genus Delftia in the samples of cosmic dust. It was shown that the DNA sequence of one of the bacteria of the genus Mycobacteria was genetically similar to that previously observed in superficial micro layer at the Barents and Kara seas' coastal zones. The presence of the wild land and marine bacteria DNA on the ISS suggests their possible transfer from the stratosphere into the ionosphere with the ascending branch of the global electric circuit. Alternatively, the wild land and marine bacteria as well as the ISS bacteria may all have an ultimate space origin. PMID:29849510
-
Grebennikova, T V; Syroeshkin, A V; Shubralova, E V; Eliseeva, O V; Kostina, L V; Kulikova, N Y; Latyshev, O E; Morozova, M A; Yuzhakov, A G; Zlatskiy, I A; Chichaeva, M A; Tsygankov, O S
2018-01-01
Cosmic dust samples from the surface of the illuminator of the International Space Station (ISS) were collected by a crew member during his spacewalk. The sampler with tampon in a vacuum container was delivered to the Earth. Washouts from the tampon's material and the tampon itself were analyzed for the presence of bacterial DNA by the method of nested PCR with primers specific to DNA of the genus Mycobacteria , DNA of the strains of capsular bacteria Bacillus , and DNA encoding 16S ribosomal RNA. The results of amplification followed by sequencing and phylogenetic analysis indicated the presence of the bacteria of the genus Mycobacteria and the extreme bacterium of the genus Delftia in the samples of cosmic dust. It was shown that the DNA sequence of one of the bacteria of the genus Mycobacteria was genetically similar to that previously observed in superficial micro layer at the Barents and Kara seas' coastal zones. The presence of the wild land and marine bacteria DNA on the ISS suggests their possible transfer from the stratosphere into the ionosphere with the ascending branch of the global electric circuit. Alternatively, the wild land and marine bacteria as well as the ISS bacteria may all have an ultimate space origin.
-
Quantum mechanical calculations related to ionization and charge transfer in DNA
NASA Astrophysics Data System (ADS)
Cauët, E.; Valiev, M.; Weare, J. H.; Liévin, J.
2012-07-01
Ionization and charge migration in DNA play crucial roles in mechanisms of DNA damage caused by ionizing radiation, oxidizing agents and photo-irradiation. Therefore, an evaluation of the ionization properties of the DNA bases is central to the full interpretation and understanding of the elementary reactive processes that occur at the molecular level during the initial exposure and afterwards. Ab initio quantum mechanical (QM) methods have been successful in providing highly accurate evaluations of key parameters, such as ionization energies (IE) of DNA bases. Hence, in this study, we performed high-level QM calculations to characterize the molecular energy levels and potential energy surfaces, which shed light on ionization and charge migration between DNA bases. In particular, we examined the IEs of guanine, the most easily oxidized base, isolated and embedded in base clusters, and investigated the mechanism of charge migration over two and three stacked guanines. The IE of guanine in the human telomere sequence has also been evaluated. We report a simple molecular orbital analysis to explain how modifications in the base sequence are expected to change the efficiency of the sequence as a hole trap. Finally, the application of a hybrid approach combining quantum mechanics with molecular mechanics brings an interesting discussion as to how the native aqueous DNA environment affects the IE threshold of nucleobases.
-
Target Capture during Mos1 Transposition*
Pflieger, Aude; Jaillet, Jerôme; Petit, Agnès; Augé-Gouillou, Corinne; Renault, Sylvaine
2014-01-01
DNA transposition contributes to genomic plasticity. Target capture is a key step in the transposition process, because it contributes to the selection of new insertion sites. Nothing or little is known about how eukaryotic mariner DNA transposons trigger this step. In the case of Mos1, biochemistry and crystallography have deciphered several inverted terminal repeat-transposase complexes that are intermediates during transposition. However, the target capture complex is still unknown. Here, we show that the preintegration complex (i.e., the excised transposon) is the only complex able to capture a target DNA. Mos1 transposase does not support target commitment, which has been proposed to explain Mos1 random genomic integrations within host genomes. We demonstrate that the TA dinucleotide used as the target is crucial both to target recognition and in the chemistry of the strand transfer reaction. Bent DNA molecules are better targets for the capture when the target DNA is nicked two nucleotides apart from the TA. They improve strand transfer when the target DNA contains a mismatch near the TA dinucleotide. PMID:24269942
-
Target capture during Mos1 transposition.
Pflieger, Aude; Jaillet, Jerôme; Petit, Agnès; Augé-Gouillou, Corinne; Renault, Sylvaine
2014-01-03
DNA transposition contributes to genomic plasticity. Target capture is a key step in the transposition process, because it contributes to the selection of new insertion sites. Nothing or little is known about how eukaryotic mariner DNA transposons trigger this step. In the case of Mos1, biochemistry and crystallography have deciphered several inverted terminal repeat-transposase complexes that are intermediates during transposition. However, the target capture complex is still unknown. Here, we show that the preintegration complex (i.e., the excised transposon) is the only complex able to capture a target DNA. Mos1 transposase does not support target commitment, which has been proposed to explain Mos1 random genomic integrations within host genomes. We demonstrate that the TA dinucleotide used as the target is crucial both to target recognition and in the chemistry of the strand transfer reaction. Bent DNA molecules are better targets for the capture when the target DNA is nicked two nucleotides apart from the TA. They improve strand transfer when the target DNA contains a mismatch near the TA dinucleotide.
-
Horizontal gene transfer from Agrobacterium to plants.
Matveeva, Tatiana V; Lutova, Ludmila A
2014-01-01
Most genetic engineering of plants uses Agrobacterium mediated transformation to introduce novel gene content. In nature, insertion of T-DNA in the plant genome and its subsequent transfer via sexual reproduction has been shown in several species in the genera Nicotiana and Linaria. In these natural examples of horizontal gene transfer from Agrobacterium to plants, the T-DNA donor is assumed to be a mikimopine strain of A. rhizogenes. A sequence homologous to the T-DNA of the Ri plasmid of Agrobacterium rhizogenes was found in the genome of untransformed Nicotiana glauca about 30 years ago, and was named "cellular T-DNA" (cT-DNA). It represents an imperfect inverted repeat and contains homologs of several T-DNA oncogenes (NgrolB, NgrolC, NgORF13, NgORF14) and an opine synthesis gene (Ngmis). A similar cT-DNA has also been found in other species of the genus Nicotiana. These presumably ancient homologs of T-DNA genes are still expressed, indicating that they may play a role in the evolution of these plants. Recently T-DNA has been detected and characterized in Linaria vulgaris and L. dalmatica. In Linaria vulgaris the cT-DNA is present in two copies and organized as a tandem imperfect direct repeat, containing LvORF2, LvORF3, LvORF8, LvrolA, LvrolB, LvrolC, LvORF13, LvORF14, and the Lvmis genes. All L. vulgaris and L. dalmatica plants screened contained the same T-DNA oncogenes and the mis gene. Evidence suggests that there were several independent T-DNA integration events into the genomes of these plant genera. We speculate that ancient plants transformed by A. rhizogenes might have acquired a selective advantage in competition with the parental species. Thus, the events of T-DNA insertion in the plant genome might have affected their evolution, resulting in the creation of new plant species. In this review we focus on the structure and functions of cT-DNA in Linaria and Nicotiana and discuss their possible evolutionary role.
-
Continuous Influx of Genetic Material from Host to Virus Populations
Gilbert, Clément; Peccoud, Jean; Chateigner, Aurélien; Moumen, Bouziane
2016-01-01
Many genes of large double-stranded DNA viruses have a cellular origin, suggesting that host-to-virus horizontal transfer (HT) of DNA is recurrent. Yet, the frequency of these transfers has never been assessed in viral populations. Here we used ultra-deep DNA sequencing of 21 baculovirus populations extracted from two moth species to show that a large diversity of moth DNA sequences (n = 86) can integrate into viral genomes during the course of a viral infection. The majority of the 86 different moth DNA sequences are transposable elements (TEs, n = 69) belonging to 10 superfamilies of DNA transposons and three superfamilies of retrotransposons. The remaining 17 sequences are moth sequences of unknown nature. In addition to bona fide DNA transposition, we uncover microhomology-mediated recombination as a mechanism explaining integration of moth sequences into viral genomes. Many sequences integrated multiple times at multiple positions along the viral genome. We detected a total of 27,504 insertions of moth sequences in the 21 viral populations and we calculate that on average, 4.8% of viruses harbor at least one moth sequence in these populations. Despite this substantial proportion, no insertion of moth DNA was maintained in any viral population after 10 successive infection cycles. Hence, there is a constant turnover of host DNA inserted into viral genomes each time the virus infects a moth. Finally, we found that at least 21 of the moth TEs integrated into viral genomes underwent repeated horizontal transfers between various insect species, including some lepidopterans susceptible to baculoviruses. Our results identify host DNA influx as a potent source of genetic diversity in viral populations. They also support a role for baculoviruses as vectors of DNA HT between insects, and call for an evaluation of possible gene or TE spread when using viruses as biopesticides or gene delivery vectors. PMID:26829124
-
Continuous Influx of Genetic Material from Host to Virus Populations.
Gilbert, Clément; Peccoud, Jean; Chateigner, Aurélien; Moumen, Bouziane; Cordaux, Richard; Herniou, Elisabeth A
2016-02-01
Many genes of large double-stranded DNA viruses have a cellular origin, suggesting that host-to-virus horizontal transfer (HT) of DNA is recurrent. Yet, the frequency of these transfers has never been assessed in viral populations. Here we used ultra-deep DNA sequencing of 21 baculovirus populations extracted from two moth species to show that a large diversity of moth DNA sequences (n = 86) can integrate into viral genomes during the course of a viral infection. The majority of the 86 different moth DNA sequences are transposable elements (TEs, n = 69) belonging to 10 superfamilies of DNA transposons and three superfamilies of retrotransposons. The remaining 17 sequences are moth sequences of unknown nature. In addition to bona fide DNA transposition, we uncover microhomology-mediated recombination as a mechanism explaining integration of moth sequences into viral genomes. Many sequences integrated multiple times at multiple positions along the viral genome. We detected a total of 27,504 insertions of moth sequences in the 21 viral populations and we calculate that on average, 4.8% of viruses harbor at least one moth sequence in these populations. Despite this substantial proportion, no insertion of moth DNA was maintained in any viral population after 10 successive infection cycles. Hence, there is a constant turnover of host DNA inserted into viral genomes each time the virus infects a moth. Finally, we found that at least 21 of the moth TEs integrated into viral genomes underwent repeated horizontal transfers between various insect species, including some lepidopterans susceptible to baculoviruses. Our results identify host DNA influx as a potent source of genetic diversity in viral populations. They also support a role for baculoviruses as vectors of DNA HT between insects, and call for an evaluation of possible gene or TE spread when using viruses as biopesticides or gene delivery vectors.
-
Brežná, Barbara; Šmíd, Jiří; Costa, Joana; Radvanszky, Jan; Mafra, Isabel; Kuchta, Tomáš
2015-04-01
Ten published DNA-based analytical methods aiming at detecting material of almond (Prunus dulcis) were in silico evaluated for potential cross-reactivity with other stone fruits (Prunus spp.), including peach, apricot, plum, cherry, sour cherry and Sargent cherry. For most assays, the analysis of nucleotide databases suggested none or insufficient discrimination of at least some stone fruits. On the other hand, the assay targeting non-specific lipid transfer protein (Röder et al., 2011, Anal Chim Acta 685:74-83) was sufficiently discriminative, judging from nucleotide alignments. Empirical evaluation was performed for three of the published methods, one modification of a commercial kit (SureFood allergen almond) and one attempted novel method targeting thaumatin-like protein gene. Samples of leaves and kernels were used in the experiments. The empirical results were favourable for the method from Röder et al. (2011) and a modification of SureFood allergen almond kit, both showing cross-reactivity <10(-3) compared to the model almond. Copyright © 2014 Elsevier Ltd. All rights reserved.
-
Dispersion of bamboo type multi-wall carbon nanotubes in calf-thymus double stranded DNA.
Primo, Emiliano N; Cañete-Rosales, Paulina; Bollo, Soledad; Rubianes, María D; Rivas, Gustavo A
2013-08-01
We report for the first time the use of double stranded calf-thymus DNA (dsDNA) to successfully disperse bamboo-like multi-walled carbon nanotubes (bCNT). The dispersion and the modified electrodes were studied by different spectroscopic, microscopic and electrochemical techniques. The drastic treatment for dispersing the bCNT (45min sonication in a 50% (v/v) ethanol:water solution), produces a partial denaturation and a decrease in the length of dsDNA that facilitates the dispersion of CNT and makes possible an efficient electron transfer of guanine residues to the electrode. A critical analysis of the influence of different experimental conditions on the efficiency of the dispersion and on the performance of glassy carbon electrodes (GCE) modified with bCNT-dsDNA dispersion is also reported. The electron transfer of redox probes and guanine residues was more efficient at GCE modified with bCNT dispersed in dsDNA than at GCE modified with hollow CNT (hCNT) dispersed in dsDNA, demonstrating the importance of the presence of bCNT. Copyright © 2013 Elsevier B.V. All rights reserved.
-
Adsorption behavior of plasmid DNA onto perfusion chromatographic matrix.
Limonta, Miladys; Zumalacárregui, Lourdes; Soler, Dayana
2012-05-01
Anion exchange chromatography is the most popular chromatographic method for plasmid separation. POROS RI 50 is a perfusion chromatographic support which is a reversed phase matrix and is an alternative to conventional ones due to its mass transfer properties. The adsorption and elution of the pIDKE2 plasmid onto reversed phase POROS R1 50 was studied. Langmuir isotherm model was adjusted in order to get the maximum adsorption capacity and the dissociation constant for POROS R1 50-plasmid DNA (pDNA) system. Breakthrough curves were obtained for volumetric flows between 0.69-3.33 mL/min, given dynamic capacity up to 2.3 times higher than those reported for ionic exchange matrix used during the purification process of plasmids with similar size to that of pIDKE2. The efficiency was less than 45% for the flow conditions and initial concentration studied, which means that the support will not be operated under saturation circumstances.
-
7 CFR 331.13 - Restricted experiments. 5
Code of Federal Regulations, 2010 CFR
2010-01-01
... Recombinant DNA Molecules.” This document is available on the Internet at http://www.aphis.usda.gov/programs...) Experiments utilizing recombinant DNA that involve the deliberate transfer of a drug resistance trait to...) Experiments involving the deliberate formation of recombinant DNA containing genes for the biosynthesis of...
-
7 CFR 331.13 - Restricted experiments. 5
Code of Federal Regulations, 2011 CFR
2011-01-01
... Recombinant DNA Molecules.” This document is available on the Internet at http://www.aphis.usda.gov/programs...) Experiments utilizing recombinant DNA that involve the deliberate transfer of a drug resistance trait to...) Experiments involving the deliberate formation of recombinant DNA containing genes for the biosynthesis of...
-
7 CFR 331.13 - Restricted experiments. 5
Code of Federal Regulations, 2012 CFR
2012-01-01
... Recombinant DNA Molecules.” This document is available on the Internet at http://www.aphis.usda.gov/programs...) Experiments utilizing recombinant DNA that involve the deliberate transfer of a drug resistance trait to...) Experiments involving the deliberate formation of recombinant DNA containing genes for the biosynthesis of...
-
Massive Gene Transfer and Extensive RNA Editing of a Symbiotic Dinoflagellate Plastid Genome
Mungpakdee, Sutada; Shinzato, Chuya; Takeuchi, Takeshi; Kawashima, Takeshi; Koyanagi, Ryo; Hisata, Kanako; Tanaka, Makiko; Goto, Hiroki; Fujie, Manabu; Lin, Senjie; Satoh, Nori; Shoguchi, Eiichi
2014-01-01
Genome sequencing of Symbiodinium minutum revealed that 95 of 109 plastid-associated genes have been transferred to the nuclear genome and subsequently expanded by gene duplication. Only 14 genes remain in plastids and occur as DNA minicircles. Each minicircle (1.8–3.3 kb) contains one gene and a conserved noncoding region containing putative promoters and RNA-binding sites. Nine types of RNA editing, including a novel G/U type, were discovered in minicircle transcripts but not in genes transferred to the nucleus. In contrast to DNA editing sites in dinoflagellate mitochondria, which tend to be highly conserved across all taxa, editing sites employed in DNA minicircles are highly variable from species to species. Editing is crucial for core photosystem protein function. It restores evolutionarily conserved amino acids and increases peptidyl hydropathy. It also increases protein plasticity necessary to initiate photosystem complex assembly. PMID:24881086
-
Beiter, Thomas; Zimmermann, Martina; Fragasso, Annunziata; Armeanu, Sorin; Lauer, Ulrich M; Bitzer, Michael; Su, Hua; Young, William L; Niess, Andreas M; Simon, Perikles
2008-01-01
So far, the abuse of gene transfer technology in sport, so-called gene doping, is undetectable. However, recent studies in somatic gene therapy indicate that long-term presence of transgenic DNA (tDNA) following various gene transfer protocols can be found in DNA isolated from whole blood using conventional PCR protocols. Application of these protocols for the direct detection of gene doping would require almost complete knowledge about the sequence of the genetic information that has been transferred. Here, we develop and describe the novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure that overcomes this difficulty. Apart from the interesting perspectives that this spiPCR procedure offers in the fight against gene doping, this technology could also be of interest in biodistribution and biosafety studies for gene therapeutic applications.
-
Electron Transfer Mechanisms of DNA Repair by Photolyase
NASA Astrophysics Data System (ADS)
Zhong, Dongping
2015-04-01
Photolyase is a flavin photoenzyme that repairs two DNA base damage products induced by ultraviolet (UV) light: cyclobutane pyrimidine dimers and 6-4 photoproducts. With femtosecond spectroscopy and site-directed mutagenesis, investigators have recently made significant advances in our understanding of UV-damaged DNA repair, and the entire enzymatic dynamics can now be mapped out in real time. For dimer repair, six elementary steps have been characterized, including three electron transfer reactions and two bond-breaking processes, and their reaction times have been determined. A unique electron-tunneling pathway was identified, and the critical residues in modulating the repair function at the active site were determined. The dynamic synergy between the elementary reactions for maintaining high repair efficiency was elucidated, and the biological nature of the flavin active state was uncovered. For 6-4 photoproduct repair, a proton-coupled electron transfer repair mechanism has been revealed. The elucidation of electron transfer mechanisms and two repair photocycles is significant and provides a molecular basis for future practical applications, such as in rational drug design for curing skin cancer.
-
Single-cell forensic short tandem repeat typing within microfluidic droplets.
Geng, Tao; Novak, Richard; Mathies, Richard A
2014-01-07
A short tandem repeat (STR) typing method is developed for forensic identification of individual cells. In our strategy, monodisperse 1.5 nL agarose-in-oil droplets are produced with a high frequency using a microfluidic droplet generator. Statistically dilute single cells, along with primer-functionalized microbeads, are randomly compartmentalized in the droplets. Massively parallel single-cell droplet polymerase chain reaction (PCR) is performed to transfer replicas of desired STR targets from the single-cell genomic DNA onto the coencapsulated microbeads. These DNA-conjugated beads are subsequently harvested and reamplified under statistically dilute conditions for conventional capillary electrophoresis (CE) STR fragment size analysis. The 9-plex STR profiles of single cells from both pure and mixed populations of GM09947 and GM09948 human lymphoid cells show that all alleles are correctly called and allelic drop-in/drop-out is not observed. The cell mixture study exhibits a good linear relationship between the observed and input cell ratios in the range of 1:1 to 10:1. Additionally, the STR profile of GM09947 cells could be deduced even in the presence of a high concentration of cell-free contaminating 9948 genomic DNA. Our method will be valuable for the STR analysis of samples containing mixtures of cells/DNA from multiple contributors and for low-concentration samples.
-
Sleator, Roy D
2011-04-01
The recent rapid expansion in the DNA and protein databases, arising from large-scale genomic and metagenomic sequence projects, has forced significant development in the field of phylogenetics: the study of the evolutionary relatedness of the planet's inhabitants. Advances in phylogenetic analysis have greatly transformed our view of the landscape of evolutionary biology, transcending the view of the tree of life that has shaped evolutionary theory since Darwinian times. Indeed, modern phylogenetic analysis no longer focuses on the restricted Darwinian-Mendelian model of vertical gene transfer, but must also consider the significant degree of lateral gene transfer, which connects and shapes almost all living things. Herein, I review the major tree-building methods, their strengths, weaknesses and future prospects.
-
Study of hepatitis B virus gene mutations with enzymatic colorimetry-based DNA microarray.
Mao, Hailei; Wang, Huimin; Zhang, Donglei; Mao, Hongju; Zhao, Jianlong; Shi, Jian; Cui, Zhichu
2006-01-01
To establish a modified microarray method for detecting HBV gene mutations in the clinic. Site-specific oligonucleotide probes were immobilized to microarray slides and hybridized to biotin-labeled HBV gene fragments amplified from two-step PCR. Hybridized targets were transferred to nitrocellulose membranes, followed by intensity measurement using BCIP/NBT colorimetry. HBV genes from 99 Hepatitis B patients and 40 healthy blood donors were analyzed. Mutation frequencies of HBV pre-core/core and basic core promoter (BCP) regions were found to be significantly higher in the patient group (42%, 40% versus 2.5%, 5%, P < 0.01). Compared with a traditional fluorescence method, the colorimetry method exhibited the same level of sensitivity and reproducibility. An enzymatic colorimetry-based DNA microarray assay was successfully established to monitor HBV mutations. Pre-core/core and BCP mutations of HBV genes could be major causes of HBV infection in HBeAg-negative patients and could also be relevant to chronicity and aggravation of hepatitis B.
-
Electron transfer of plurimodified DNA SAMs.
Rospigliosi, Alessandro; Ehlich, Rudolf; Hoerber, Heinrich; Middelberg, Anton; Moggridge, Geoff
2007-07-17
An STM-based current-voltage (I/V) investigation of deoxyribonucleic acid (DNA) 18 base pair (bp) oligonucleotide monolayers on gold is presented. Three bases of each of the immobilized and complementary strands were modified with either iodine or phenylethylene moieties. The oligonucleotides were immobilized on template stripped gold (tsg) surfaces and characterized by atomic force microscopy (AFM) and scanning tunneling microscopy (STM). AFM imaging showed that monolayers of the expected height were formed. A comparative study of normal, halogenated, and phenyl-modified DNA was made with the STM in tunneling spectroscopy (TS) mode. I/V spectroscopic measurements in the range +/-250 mV on both single- and double-stranded (ds) DNA monolayers (modified and unmodified) showed that for negative substrate bias (U(sub)) electron transfer is more efficient through a phenyl-modified monolayer than through normal or halogenated DNA. This effect was particularly clear below a threshold bias of -100 mV. For positive U(sub), unmodified ds DNA was found to conduct slightly better than the modified strands. This is presumably caused by greater order in the unmodified versus modified DNA monolayers. Modifications on the immobilized (thiolated) strand seem to improve electron transport through the DNA monolayer more than modifications on the complementary (not surface-bound) strand.
-
Wang, Guobao; Zhao, Tingting; Wang, Leyu; Hu, Bianxiang; Darabi, Ali; Lin, Jiansheng; Xing, Malcolm M Q; Qiu, Xiaozhong
2015-11-25
Single-walled carbon nanotubes (SWCNTs) have been used to deliver single-stranded (ssDNA). ssDNA in oligonucleotide can act as an inhibitor of microRNA to regulate cellular functions. However, these ssDNA are difficult to bind carbon nanotubes with low transferring efficiency to cells. To this end, we designed ssDNA with regulatory and functional units to form ssDNA-SWCNT hybrids to study their binding effects and transferring efficiency. The functional unit on ssDNA mimics the inhibitor (MI) of miRNA-382, which plays a crucial role in the progress of many diseases such as renal interstitial fibrosis. After verification of overexpression of miRNA-382 in a coculture system, we designed oligonucleotide sequences (GCG)5-MI, (TAT)5-MI, and N23-MI as regulatory units added to the 5'-terminal end of the functional DNA fragment, respectively. These regulatory units lead to different secondary structures and thus exhibit different affinity ability to SWCNTs, and finally decide their deliver efficacy to cells. Autophagy, apoptosis and necrosis were observed in renal mesangial cells.
-
Energy barriers and rates of tautomeric transitions in DNA bases: ab initio quantum chemical study.
Basu, Soumalee; Majumdar, Rabi; Das, Gourab K; Bhattacharyya, Dhananjay
2005-12-01
Tautomeric transitions of DNA bases are proton transfer reactions, which are important in biology. These reactions are involved in spontaneous point mutations of the genetic material. In the present study, intrinsic reaction coordinates (IRC) analyses through ab initio quantum chemical calculations have been carried out for the individual DNA bases A, T, G, C and also A:T and G:C base pairs to estimate the kinetic and thermodynamic barriers using MP2/6-31G** method for tautomeric transitions. Relatively higher values of kinetic barriers (about 50-60 kcal/mol) have been observed for the single bases, indicating that tautomeric alterations of isolated single bases are quite unlikely. On the other hand, relatively lower values of the kinetic barriers (about 20-25 kcal/mol) for the DNA base pairs A:T and G:C clearly suggest that the tautomeric shifts are much more favorable in DNA base pairs than in isolated single bases. The unusual base pairing A':C, T':G, C':A or G':T in the daughter DNA molecule, resulting from a parent DNA molecule with tautomeric shifts, is found to be stable enough to result in a mutation. The transition rate constants for the single DNA bases in addition to the base pairs are also calculated by computing the free energy differences between the transition states and the reactants.
-
NASA Astrophysics Data System (ADS)
Gnapareddy, Bramaramba; Dugasani, Sreekantha Reddy; Son, Junyoung; Park, Sung Ha
2018-02-01
DNA is considered as a useful building bio-material, and it serves as an efficient template to align functionalized nanomaterials. Riboflavin (RF)-doped synthetic double-crossover DNA (DX-DNA) lattices and natural salmon DNA (SDNA) thin films were constructed using substrate-assisted growth and drop-casting methods, respectively, and their topological, chemical and electro-optical characteristics were evaluated. The critical doping concentrations of RF ([RF]C, approx. 5 mM) at given concentrations of DX-DNA and SDNA were obtained by observing the phase transition (from crystalline to amorphous structures) of DX-DNA and precipitation of SDNA in solution above [RF]C. [RF]C are verified by analysing the atomic force microscopy images for DX-DNA and current, absorbance and photoluminescence (PL) for SDNA. We study the physical characteristics of RF-embedded SDNA thin films, using the Fourier transform infrared spectrum to understand the interaction between the RF and DNA molecules, current to evaluate the conductance, absorption to understand the RF binding to the DNA and PL to analyse the energy transfer between the RF and DNA. The current and UV absorption band of SDNA thin films decrease up to [RF]C followed by an increase above [RF]C. By contrast, the PL intensity illustrates the reverse trend, as compared to the current and UV absorption behaviour as a function of the varying [RF]. Owing to the intense PL characteristic of RF, the DNA lattices and thin films with RF might offer immense potential to develop efficient bio-sensors and useful bio-photonic devices.
-
Gnapareddy, Bramaramba; Son, Junyoung
2018-01-01
DNA is considered as a useful building bio-material, and it serves as an efficient template to align functionalized nanomaterials. Riboflavin (RF)-doped synthetic double-crossover DNA (DX-DNA) lattices and natural salmon DNA (SDNA) thin films were constructed using substrate-assisted growth and drop-casting methods, respectively, and their topological, chemical and electro-optical characteristics were evaluated. The critical doping concentrations of RF ([RF]C, approx. 5 mM) at given concentrations of DX-DNA and SDNA were obtained by observing the phase transition (from crystalline to amorphous structures) of DX-DNA and precipitation of SDNA in solution above [RF]C. [RF]C are verified by analysing the atomic force microscopy images for DX-DNA and current, absorbance and photoluminescence (PL) for SDNA. We study the physical characteristics of RF-embedded SDNA thin films, using the Fourier transform infrared spectrum to understand the interaction between the RF and DNA molecules, current to evaluate the conductance, absorption to understand the RF binding to the DNA and PL to analyse the energy transfer between the RF and DNA. The current and UV absorption band of SDNA thin films decrease up to [RF]C followed by an increase above [RF]C. By contrast, the PL intensity illustrates the reverse trend, as compared to the current and UV absorption behaviour as a function of the varying [RF]. Owing to the intense PL characteristic of RF, the DNA lattices and thin films with RF might offer immense potential to develop efficient bio-sensors and useful bio-photonic devices. PMID:29515837
-
ZAP-70 Restoration in Mice by In Vivo Thymic Electroporation
Kissenpfennig, Adrien; Poulin, Lionel Franz; Leserman, Lee; Marche, Patrice N.; Jouvin-Marche, Evelyne; Berger, François; Nguyen, Catherine
2008-01-01
Viral and non-viral vectors have been developed for gene therapy, but their use is associated with unresolved problems of efficacy and safety. Efficient and safe methods of DNA delivery need to be found for medical application. Here we report a new monopolar system of non-viral electro-gene transfer into the thymus in vivo that consists of the local application of electrical pulses after the introduction of the DNA. We assessed the proof of concept of this approach by correcting ZAP-70 deficient severe combined immunodeficiency (SCID) in mice. The thymic electro-gene transfer of the pCMV-ZAP-70-IRES-EGFP vector in these mice resulted in rapid T cell differentiation in the thymus with mature lymphocytes detected by three weeks in secondary lymphoid organs. Moreover, this system resulted in the generation of long-term functional T lymphocytes. Peripheral reconstituted T cells displayed a diversified T cell receptor (TCR) repertoire, and were responsive to alloantigens in vivo. This process applied to the thymus could represent a simplified and effective alternative for gene therapy of T cell immunodeficiencies. PMID:18446234
-
Abnormalities in human pluripotent cells due to reprogramming mechanisms
Ma, Hong; Morey, Robert; O’Neil, Ryan C.; He, Yupeng; Daughtry, Brittany; Schultz, Matthew D.; Hariharan, Manoj; Nery, Joseph R.; Castanon, Rosa; Sabatini, Karen; Thiagarajan, Rathi D.; Tachibana, Masahito; Kang, Eunju; Tippner-Hedges, Rebecca; Ahmed, Riffat; Gutierrez, Nuria Marti; Van Dyken, Crystal; Polat, Alim; Sugawara, Atsushi; Sparman, Michelle; Gokhale, Sumita; Amato, Paula; Wolf, Don P.; Ecker, Joseph R.; Laurent, Louise C.; Mitalipov, Shoukhrat
2016-01-01
Human pluripotent stem cells hold potential for regenerative medicine, but available cell types have significant limitations. Although embryonic stem cells (ES cells) from in vitro fertilized embryos (IVF ES cells) represent the ‘gold standard’, they are allogeneic to patients. Autologous induced pluripotent stem cells (iPS cells) are prone to epigenetic and transcriptional aberrations. To determine whether such abnormalities are intrinsic to somatic cell reprogramming or secondary to the reprogramming method, genetically matched sets of human IVF ES cells, iPS cells and nuclear transfer ES cells (NT ES cells) derived by somatic cell nuclear transfer (SCNT) were subjected to genome-wide analyses. Both NT ES cells and iPS cells derived from the same somatic cells contained comparable numbers of de novo copy number variations. In contrast, DNA methylation and transcriptome profiles of NT ES cells corresponded closely to those of IVF ES cells, whereas iPS cells differed and retained residual DNA methylation patterns typical of parental somatic cells. Thus, human somatic cells can be faithfully reprogrammed to pluripotency by SCNT and are therefore ideal for cell replacement therapies. PMID:25008523
-
New procedure for recovering extra- and intracellular DNA from marine sediment samples
NASA Astrophysics Data System (ADS)
Alawi, M.; Kallmeyer, J.
2012-12-01
Extracellular DNA (eDNA) is a ubiquitous biological compound in aquatic sediment and soil. Despite major methodological advances, analysis of DNA from sediment is still technically challenging, not just because of the co-elution of inhibitory substances, but also due to co-elution of extracellular DNA, which potentially leads to an overestimate of the actual diversity. Previous studies suggested that eDNA might play an important role in biogeochemical element cycling, horizontal gene transfer and stabilization of biofilm structures. Several protocols based on the precipitation of eDNA e.g. with CTAB and ethanol have already been published. However, using these methods we did not succeed in quantifying very low amounts of eDNA (e.g. <1μg eDNA/g dry wt) in marine sediment even when using DNA carriers like glycogen. Since the recovery of eDNA by precipitation strongly depends on its concentration, these previously published procedures are not adequate for deep biosphere sediment due to the low eDNA content. We have focused on the question whether eDNA could be a source of nitrogen and phosphorus for microbes in the subseafloor biosphere. Therefore we developed a new method for the (semi)-quantitative extraction of eDNA from sediment. The new extraction procedure is based on sequential washing of the sediment to remove simultaneously eDNA and microbial cells without lysing them. After separation of the cells by centrifugation, the eDNA was extracted from the supernatant and purified by adsorption onto a solid phase, followed by removal of the solids and subsequent elution of the pure eDNA. Intracellular DNA (iDNA) was extracted and purified from the cell pellet using a commercial DNA extraction kit. Additional to a very low detection limit and reproducible quantification, this new method allows separation and purification of both extracellular and intracellular DNA to an extent that inhibitors are removed and downstream applications like PCR can be performed. To evaluate the new extraction method two sediments with rather opposing composition were analyzed. Sediment from the South Pacific Gyre, the most oligotrophic oceanic region on earth and organic-rich Baltic Sea sediment (Northern Germany) were processed. Using this new procedure high purity genomic iDNA and eDNA with a molecular size range between 20 bp and 50k bp can be simultaneously recovered even from very oligotrophic sediment with very low cell abundances. The main fraction of recovered eDNA was suitable for downstream applications like PCR and had a molecular size that indicates minimal shearing. Despite about two decades of research many questions about deep subsurface life remain unanswered. The fact that microbes can be found even in deep oligotrophic marine sediment raises the fundamental questions of the types and availability of substrates and their biogeochemical cycling. This is the first study that provides evidence that eDNA is an important potential substrate for microorganisms in the deep biosphere. Also, our results show a link between cell counts and eDNA content, indicating that the eDNA pool in the investigated sediment consist mainly of microbial DNA. Comparative sequence analysis of extracted iDNA and eDNA will provide deeper insights into the origin and turnover of eDNA and the apparent microbial community composition in the deep biosphere.
-
An inter-laboratory comparison study on transfer, persistence and recovery of DNA from cable ties.
Steensma, Kristy; Ansell, Ricky; Clarisse, Lindy; Connolly, Edward; Kloosterman, Ate D; McKenna, Louise G; van Oorschot, Roland A H; Szkuta, Bianca; Kokshoorn, Bas
2017-11-01
To address questions on the activity that led to the deposition of biological traces in a particular case, general information on the probabilities of transfer, persistence and recovery of cellular material in relevant scenarios is necessary. These figures may be derived from experimental data described in forensic literature when conditions relevant to the case were included. The experimental methodology regarding sampling, DNA extraction, DNA typing and profile interpretation that were used to generate these published data may differ from those applied in the case and thus the applicability of the literature data may be questioned. To assess the level of variability that different laboratories obtain when similar exhibits are analysed, we performed an inter-laboratory study between four partner laboratories. Five sets of 20 cable ties bound by different volunteers were distributed to the participating laboratories and sampled and processed according to the in-house protocols. Differences were found for the amount of retrieved DNA, as well as for the reportability and composition of the DNA profiles. These differences also resulted in different probabilities of transfer, persistence and recovery for each laboratory. Nevertheless, when applied to a case example, these differences resulted in similar assignments of weight of evidence given activity-level propositions. Copyright © 2017 Elsevier B.V. All rights reserved.
-
Kimura, Takumi; Kawai, Kiyohiko; Majima, Tetsuro
2004-02-07
The electron transfer quenching of 2-aminopurine by guanine and 7-deazaguanine was investigated in B- and Z-DNA, and an increase in the fluorescence intensity of 2-aminopurine upon B- to Z-DNA transition was demonstrated.
-
Self-assembled nanoscale DNA-porphyrin complex for artificial light harvesting.
Woller, Jakob G; Hannestad, Jonas K; Albinsson, Bo
2013-02-20
Mimicking green plants' and bacteria's extraordinary ability to absorb a vast number of photons and harness their energy is a longstanding goal in artificial photosynthesis. Resonance energy transfer among donor dyes has been shown to play a crucial role on the overall transfer of energy in the natural systems. Here, we present artificial, self-assembled, light-harvesting complexes consisting of DNA scaffolds, intercalated YO-PRO-1 (YO) donor dyes and a porphyrin acceptor anchored to a lipid bilayer, conceptually mimicking the natural light-harvesting systems. A model system consisting of 39-mer duplex DNA in a linear wire configuration with the porphyrin attached in the middle of the wire is primarily investigated. Utilizing intercalated donor fluorophores to sensitize the excitation of the porphyrin acceptor, we obtain an effective absorption coefficient 12 times larger than for direct excitation of the porphyrin. On the basis of steady-state and time-resolved emission measurements and Markov chain simulations, we show that YO-to-YO resonance energy transfer substantially contributes to the overall flow of energy to the porphyrin. This increase is explained through energy migration along the wire allowing the excited state energy to transfer to positions closer to the porphyrin. The versatility of DNA as a structural material is demonstrated through the construction of a more complex, hexagonal, light-harvesting scaffold yielding further increase in the effective absorption coefficient. Our results show that, by using DNA as a scaffold, we are able to arrange chromophores on a nanometer scale and in this way facilitate the assembly of efficient light-harvesting systems.
-
ERIC Educational Resources Information Center
Brinner, Bonnie
1992-01-01
Presents an activity in which models help students visualize both the DNA process and transcription. After constructing DNA, RNA messenger, and RNA transfer molecules; students model cells, protein synthesis, codons, and RNA movement. (MDH)
-
Suppression of BRCA2 by Mutant Mitochondrial DNA in Prostate Cancer
2011-05-01
Briefly, the electron transfer activities of complex I/III (NADH dehydrogenase/cytochrome bc1 complex: catalyzes the electron transfer from NADH to...ferricytochrome c) and complex II/III (succinate dehydrogenase/cytochrome bc1 complex: catalyzes the electron transfer from succinate to ferricytochrome...The electron transfer activity of complex IV (cytochrome c oxidase: catalyzes the final step of the respiratory chain by transferring electrons from
-
Tan, Chuang; Guo, Lijun; Ai, Yuejie; Li, Jiang; Wang, Lijuan; Sancar, Aziz; Luo, Yi; Zhong, Dongping
2014-11-13
Photoantenna is essential to energy transduction in photoinduced biological machinery. A photoenzyme, photolyase, has a light-harvesting pigment of methenyltetrahydrofolate (MTHF) that transfers its excitation energy to the catalytic flavin cofactor FADH¯ to enhance DNA-repair efficiency. Here we report our systematic characterization and direct determination of the ultrafast dynamics of resonance energy transfer from excited MTHF to three flavin redox states in E. coli photolyase by capturing the intermediates formed through the energy transfer and thus excluding the electron-transfer quenching pathway. We observed 170 ps for excitation energy transferring to the fully reduced hydroquinone FADH¯, 20 ps to the fully oxidized FAD, and 18 ps to the neutral semiquinone FADH(•), and the corresponding orientation factors (κ(2)) were determined to be 2.84, 1.53 and 1.26, respectively, perfectly matching with our calculated theoretical values. Thus, under physiological conditions and over the course of evolution, photolyase has adopted the optimized orientation of its photopigment to efficiently convert solar energy for repair of damaged DNA.
-
The prion protein has DNA strand transfer properties similar to retroviral nucleocapsid protein.
Gabus, C; Auxilien, S; Péchoux, C; Dormont, D; Swietnicki, W; Morillas, M; Surewicz, W; Nandi, P; Darlix, J L
2001-04-06
The transmissible spongiform encephalopathies are fatal neurodegenerative diseases that are associated with the accumulation of a protease-resistant form of the cellular prion protein (PrP). Although PrP is highly conserved and widely expressed in vertebrates, its function remains a matter of speculation. Indeed PrP null mice develop normally and are healthy. Recent results show that PrP binds to nucleic acids in vitro and is found associated with retroviral particles. Furthermore, in mice the scrapie infectious process appears to be accelerated by MuLV replication. These observations prompted us to further investigate the interaction between PrP and nucleic acids, and compare it with that of the retroviral nucleocapsid protein (NC). As the major nucleic acid-binding protein of the retroviral particle, NC protein is tightly associated with the genomic RNA in the virion nucleocapsid, where it chaperones proviral DNA synthesis by reverse transcriptase. Our results show that the human prion protein (huPrP) functionally resembles NCp7 of HIV-1. Both proteins form large nucleoprotein complexes upon binding to DNA. They accelerate the hybridization of complementary DNA strands and chaperone viral DNA synthesis during the minus and plus DNA strand transfers necessary to generate the long terminal repeats. The DNA-binding and strand transfer properties of huPrP appear to map to the N-terminal fragment comprising residues 23 to 144, whereas the C-terminal domain is inactive. These findings suggest that PrP could be involved in nucleic acid metabolism in vivo. Copyright 2001 Academic Press.
-
Brightwell, Gale; Boerema, Jackie; Mills, John; Mowat, Eilidh; Pulford, David
2006-05-25
We examined the bacterial community present on an Intralox conveyor belt system in an operating lamb boning room by sequencing the 16S ribosomal DNA (rDNA) of bacteria extracted in the presence or absence of cultivation. RFLP patterns for 16S rDNA clone library and cultures were generated using HaeIII and MspI restriction endonucleases. 16S rDNA amplicons produced 8 distinct RFLP pattern groups. RFLP groups I-IV were represented in the clone library and RFLP groups I and V-VIII were represented amongst the cultured isolates. Partial DNA sequences from each RFLP group revealed that all group I, II and VIII representatives were Pseudomonas spp., group III were Sphingomonas spp., group IV clones were most similar to an uncultured alpha proteobacterium, group V was similar to a Serratia spp., group VI with an Alcaligenes spp., and group VII with Microbacterium spp. Sphingomonads were numerically dominant in the culture-independent clone library and along with the group IV alpha proteobacterium were not represented amongst the cultured isolates. Serratia, Alcaligenes and Microbacterium spp. were only represented with cultured isolates. Pseudomonads were detected by both culture-dependent (84% of isolates) and culture-independent (12.5% of clones) methods and their presence at high frequency does pose the risk of product spoilage if transferred onto meat stored under aerobic conditions. The detection of sphingomonads in large numbers by the culture-independent method demands further analysis because sphingomonads may represent a new source of meat spoilage that has not been previously recognised in the meat processing environment. The 16S rDNA collections generated by both methods were important at representing the diversity of the bacterial population associated with an Intralox conveyor belt system.
-
Isaza, Laura Arango; Opelt, Katja; Wagner, Tobias; Mattes, Elke; Bieber, Evi; Hatley, Elwood O; Roth, Greg; Sanjuán, Juan; Fischer, Hans-Martin; Sandermann, Heinrich; Hartmann, Anton; Ernst, Dieter
2011-01-01
A field study was conducted at the Russell E. Larson Agricultural Research Center to determine the effect of transgenic glyphosate-resistant soybean in combination with herbicide (Roundup) application on its endosymbiont Bradyrhizobium japonicum. DNA of bacteroids from isolated nodules was analysed for the presence of the transgenic 5-enolpyruvylshikimate-3-phosphate synthase (CP4-EPSPS) DNA sequence using polymerase chain reaction (PCR). To further assess the likelihood that the EPSPS gene may be transferred from the Roundup Ready (RR) soybean to B. japonicum, we have examined the natural transformation efficiency of B. japonicum strain 110spc4. Analyses of nodules showed the presence of the transgenic EPSPS DNA sequence. In bacteroids that were isolated from nodules of transgenic soybean plants and then cultivated in the presence of glyphosate this sequence could not be detected. This indicates that no stable horizontal gene transfer (HGT) of the EPSPS gene had occurred under field conditions. Under laboratory conditions, no natural transformation was detected in B. japonicum strain 110spc4 in the presence of various amounts of recombinant plasmid DNA. Our results indicate that no natural competence state exists in B. japonicum 110spc4. Results from field and laboratory studies indicate the lack of functional transfer of the CP4-EPSPS gene from glyphosate-tolerant soybean treated with glyphosate to root-associated B. japonicum.
-
Fisher-Adams, G; Wong, K K; Podsakoff, G; Forman, S J; Chatterjee, S
1996-07-15
Gene transfer vectors based on adeno-associated virus (AAV) appear promising because of their high transduction frequencies regardless of cell cycle status and ability to integrate into chromosomal DNA. We tested AAV-mediated gene transfer into a panel of human bone marrow or umbilical cord-derived CD34+ hematopoietic progenitor cells, using vectors encoding several transgenes under the control of viral and cellular promoters. Gene transfer was evaluated by (1) chromosomal integration of vector sequences and (2) analysis of transgene expression. Southern hybridization and fluorescence in situ hybridization analysis of transduced CD34 genomic DNA showed the presence of integrated vector sequences in chromosomal DNA in a portion of transduced cells and showed that integrated vector sequences were replicated along with cellular DNA during mitosis. Transgene expression in transduced CD34 cells in suspension cultures and in myeloid colonies differentiating in vitro from transduced CD34 cells approximated that predicted by the multiplicity of transduction. This was true in CD34 cells from different donors, regardless of the transgene or selective pressure. Comparisons of CD34 cell transduction either before or after cytokine stimulation showed similar gene transfer frequencies. Our findings suggest that AAV transduction of CD34+ hematopoietic progenitor cells is efficient, can lead to stable integration in a population of transduced cells, and may therefore provide the basis for safe and efficient ex vivo gene therapy of the hematopoietic system.
-
Efficient gene transfer into nondividing cells by adeno-associated virus-based vectors.
Podsakoff, G; Wong, K K; Chatterjee, S
1994-01-01
Gene transfer vectors based on adeno-associated virus (AAV) are emerging as highly promising for use in human gene therapy by virtue of their characteristics of wide host range, high transduction efficiencies, and lack of cytopathogenicity. To better define the biology of AAV-mediated gene transfer, we tested the ability of an AAV vector to efficiently introduce transgenes into nonproliferating cell populations. Cells were induced into a nonproliferative state by treatment with the DNA synthesis inhibitors fluorodeoxyuridine and aphidicolin or by contact inhibition induced by confluence and serum starvation. Cells in logarithmic growth or DNA synthesis arrest were transduced with vCWR:beta gal, an AAV-based vector encoding beta-galactosidase under Rous sarcoma virus long terminal repeat promoter control. Under each condition tested, vCWR:beta Gal expression in nondividing cells was at least equivalent to that in actively proliferating cells, suggesting that mechanisms for virus attachment, nuclear transport, virion uncoating, and perhaps some limited second-strand synthesis of AAV vectors were present in nondividing cells. Southern hybridization analysis of vector sequences from cells transduced while in DNA synthetic arrest and expanded after release of the block confirmed ultimate integration of the vector genome into cellular chromosomal DNA. These findings may provide the basis for the use of AAV-based vectors for gene transfer into quiescent cell populations such as totipotent hematopoietic stem cells. Images PMID:8057446
-
Efficient gene transfer into nondividing cells by adeno-associated virus-based vectors.
Podsakoff, G; Wong, K K; Chatterjee, S
1994-09-01
Gene transfer vectors based on adeno-associated virus (AAV) are emerging as highly promising for use in human gene therapy by virtue of their characteristics of wide host range, high transduction efficiencies, and lack of cytopathogenicity. To better define the biology of AAV-mediated gene transfer, we tested the ability of an AAV vector to efficiently introduce transgenes into nonproliferating cell populations. Cells were induced into a nonproliferative state by treatment with the DNA synthesis inhibitors fluorodeoxyuridine and aphidicolin or by contact inhibition induced by confluence and serum starvation. Cells in logarithmic growth or DNA synthesis arrest were transduced with vCWR:beta gal, an AAV-based vector encoding beta-galactosidase under Rous sarcoma virus long terminal repeat promoter control. Under each condition tested, vCWR:beta Gal expression in nondividing cells was at least equivalent to that in actively proliferating cells, suggesting that mechanisms for virus attachment, nuclear transport, virion uncoating, and perhaps some limited second-strand synthesis of AAV vectors were present in nondividing cells. Southern hybridization analysis of vector sequences from cells transduced while in DNA synthetic arrest and expanded after release of the block confirmed ultimate integration of the vector genome into cellular chromosomal DNA. These findings may provide the basis for the use of AAV-based vectors for gene transfer into quiescent cell populations such as totipotent hematopoietic stem cells.
-
Multifluorophore DNA Origami Beacon as a Biosensing Platform.
Selnihhin, Denis; Sparvath, Steffen Møller; Preus, Søren; Birkedal, Victoria; Andersen, Ebbe Sloth
2018-05-24
Biosensors play increasingly important roles in many fields, from clinical diagnosis to environmental monitoring, and there is a growing need for cheap and simple analytical devices. DNA nanotechnology provides methods for the creation of sophisticated biosensors, however many of the developed DNA-based sensors are limited by cumbersome and time-consuming readouts involving advanced experimental techniques. Here we describe design, construction, and characterization of an optical DNA origami nanobiosensor device exploiting arrays of precisely positioned organic fluorophores. Two arrays of donor and acceptor fluorophores make up a multifluorophore Förster resonance energy-transfer pair that results in a high-output signal for microscopic detection of single devices. Arrangement of fluorophores into arrays increases the signal-to-noise ratio, allowing detection of signal output from singular biosensors using a conventional fluorescence microscopy setup. Single device analysis enables detection of target DNA sequences in concentrations down to 100 pM in <45 min. We expect that the presented nanobiosensor can function as a general platform for incorporating sensor modules for a variety of targets and that the strong signal amplification properties may allow detection in portable microscope systems to be used for biosensor applications in the field.
-
Zheng, Qi; Oldenburg, Delene J; Bendich, Arnold J
2011-05-01
In maize (Zea mays L.), chloroplast development progresses from the basal meristem to the mature leaf tip, and light is required for maturation to photosynthetic competence. During chloroplast greening, it was found that chloroplast DNA (cpDNA) is extensively degraded, falling to undetectable levels in many individual chloroplasts for three maize cultivars, as well as Zea mexicana (the ancestor of cultivated maize) and the perennial species Zea diploperennis. In dark-grown maize seedlings, the proplastid-to-etioplast transition is characterized by plastid enlargement, cpDNA replication, and the retention of high levels of cpDNA. When dark-grown seedlings are transferred to white light, the DNA content per plastid increases slightly during the first 4 h of illumination and then declines rapidly to a minimum at 24 h during the etioplast-to-chloroplast transition. Plastid autofluorescence (from chlorophyll) continues to increase as cpDNA declines, whereas plastid size remains constant. It is concluded that the increase in cpDNA that accompanies plastid enlargement is a consequence of cell and leaf growth, rather than illumination, whereas light stimulates photosynthetic capacity and cpDNA instability. When cpDNA from total tissue was monitored by blot hybridization and real-time quantitative PCR, no decline following transfer from dark to light was observed. The lack of agreement between DNA per plastid and cpDNA per cell may be attributed to nupts (nuclear sequences of plastid origin).
-
One-Dimensional Multichromophor Arrays Based on DNA: From Self-Assembly to Light-Harvesting.
Ensslen, Philipp; Wagenknecht, Hans-Achim
2015-10-20
Light-harvesting complexes collect light energy and deliver it by a cascade of energy and electron transfer processes to the reaction center where charge separation leads to storage as chemical energy. The design of artificial light-harvesting assemblies faces enormous challenges because several antenna chromophores need to be kept in close proximity but self-quenching needs to be avoided. Double stranded DNA as a supramolecular scaffold plays a promising role due to its characteristic structural properties. Automated DNA synthesis allows incorporation of artificial chromophore-modified building blocks, and sequence design allows precise control of the distances and orientations between the chromophores. The helical twist between the chromophores, which is induced by the DNA framework, controls energy and electron transfer and thereby reduces the self-quenching that is typically observed in chromophore aggregates. This Account summarizes covalently multichromophore-modified DNA and describes how such multichromophore arrays were achieved by Watson-Crick-specific and DNA-templated self-assembly. The covalent DNA systems were prepared by incorporation of chromophores as DNA base substitutions (either as C-nucleosides or with acyclic linkers as substitutes for the 2'-deoxyribofuranoside) and as DNA base modifications. Studies with DNA base substitutions revealed that distances but more importantly relative orientations of the chromophores govern the energy transfer efficiencies and thereby the light-harvesting properties. With DNA base substitutions, duplex stabilization was faced and could be overcome, for instance, by zipper-like placement of the chromophores in both strands. For both principal structural approaches, DNA-based light-harvesting antenna could be realized. The major disadvantages, however, for covalent multichromophore DNA conjugates are the poor yields of synthesis and the solubility issues for oligonucleotides with more than 5-10 chromophore modifications in a row. A logical alternative approach is to leave out the phosphodiester bridges between the chromophores and let chromophore-nucleoside conjugates self-assemble specifically along single stranded DNA as template. The self-organization of chromophores along the DNA template based on canonical base pairing would be advantageous because sequence selective base pairing could provide a structural basis for programmed complexity within the chromophore assembly. The self-assembly is governed by two interactions. The chromophore-nucleoside conjugates as guest molecules are recognized via hydrogen bonds to the corresponding counter bases in the single stranded DNA template. Moreover, the π-π interactions between the stacked chromophores stabilize these self-assembled constructs with increasing length. Longer DNA templates are more attractive for self-assembled antenna. The helicity in the stack of porphyrins as guest molecules assembled on the DNA template can be switched by environmental changes, such as pH variations. DNA-templated stacks of ethynyl pyrene and nile red exhibit left-handed chirality, which stands in contrast to similar covalent multichromophore-DNA conjugates with enforced right-handed helicity. With ethynyl nile red, it is possible to occupy every available binding site on the templates. Mixed assemblies of ethynyl pyrene and nile red show energy transfer and thereby provide a proof-of-principle that simple light-harvesting antennae can be obtained in a noncovalent and self-assembled fashion. With respect to the next important step, chemical storage of the absorbed light energy, future research has to focus on the coupling of sophisticated DNA-based light-harvesting antenna to reaction centers.
-
Gene transfer into the kidney: current status and limitations.
Moullier, P; Salvetti, A; Champion-Arnaud, P; Ronco, P M
1997-01-01
Gene therapy is obviously a controversial issue and a wave of suspicion has dampened the initial enthusiasm raised by this new therapeutic approach. It has now become fashionable to downplay the potential for gene therapy in most fields including kidney-related diseases. In our opinion, this is an unfair and unrealistic view of the future. In fact, gene therapy of well-selected kidney diseases will certainly become feasible, but a large data base on vectors and transfer methods both in the normal kidney and in disease models has first to be collected. Any significant progress in the biology of the vectors, in the cellular interactions of the newly introduced DNA, and in the regulation and persistency of the transgene should be rapidly translated to the kidney in relevant experimental models. Herein, we present the use and current limitations of gene transfer to the kidney and the potential therapeutic perspectives.
-
NASA Astrophysics Data System (ADS)
Jinno, M.; Ikeda, Y.; Motomura, H.; Isozaki, Y.; Kido, Y.; Satoh, S.
2017-06-01
We have developed a new micro-discharge plasma (MDP)-based gene transfection method, which transfers genes into cells with high efficiency and low cytotoxicity; however, the mechanism underlying the method is still unknown. Studies revealed that the N-acetylcysteine-mediated inhibition of reactive oxygen species (ROS) activity completely abolished gene transfer. In this study, we used laser-produced plasma to demonstrate that gene transfer does not occur in the absence of electrical factors. Our results show that both electrical and chemical factors are necessary for gene transfer inside cells by microplasma irradiation. This indicates that plasma-mediated gene transfection utilizes the synergy between electrical and chemical factors. The electric field threshold required for transfection was approximately 1 kV m-1 in our MDP system. This indicates that MDP irradiation supplies sufficient concentrations of ROS, and the stimulation intensity of the electric field determines the transfection efficiency in our system. Gene transfer by plasma irradiation depends mainly on endocytosis, which accounts for at least 80% of the transfer, and clathrin-mediated endocytosis is a dominant endocytosis. In plasma-mediated gene transfection, alterations in electrical and chemical factors can independently regulate plasmid DNA adhesion and triggering of endocytosis, respectively. This implies that plasma characteristics can be adjusted according to target cell requirements, and the transfection process can be optimized with minimum damage to cells and maximum efficiency. This may explain how MDP simultaneously achieves high transfection efficiency with minimal cell damage.
-
Tantrawatpan, Chairat; Saijuntha, Weerachai; Manochantr, Sirikul; Kheolamai, Pakpoom; Thanchomnang, Tongjit; Sadaow, Lakkhana; Intapan, Pewpan M; Maleewong, Wanchai
2016-01-01
Because the eggs of Paragonimus, Echinostoma and Fasciola are very similar in size and shape, it is difficult to distinguish and accurately identify species by the morphology of their eggs, which is a standard diagnostic method. In this study, a novel assay combining a real-time fluorescence resonance energy transfer PCR and melting curve analysis using one set of primers and fluorophore-labelled hybridization probes specific for the 28S rDNA region was developed for the molecular detection of Paragonimus heterotremus, Echinostoma malayanum and Fasciola gigantica eggs. This assay could detect and distinguish P. heterotremus, E. malayanum and F. gigantica DNA with the distinct melting temperature (Tm) values of 57.99±0.08, 62.12±0.15 and 74.10±0.18, respectively. The assay can also be used to detect and distinguish DNA from P. bangkokensis, P. harinasutai, P. machorchis, E. revolutum, Hypodereum conoideum and F. hepatica, which have different Tm values. The sensitivity of this assay enabled the detection of one egg of P. heterotremus, E. malayanum or F. gigantica per 100 mg of faeces. In addition, the specificity testing showed no fluorescence signal for other parasites. Due to the sensitivity and specificity of our assay in detecting P. heterotremus, E. malayanum and F. gigantica, our method could be used to accurately diagnose these three medically important parasitic groups and has potential implications for molecular epidemiological investigations of human and/or animal infections. © The Author 2015. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
-
Nakamoto, Hitoshi; Fujita, Kensaku; Ohtaki, Aguru; Watanabe, Satoru; Narumi, Shoichi; Maruyama, Takahiro; Suenaga, Emi; Misono, Tomoko S; Kumar, Penmetcha K R; Goloubinoff, Pierre; Yoshikawa, Hirofumi
2014-02-28
In eukaryotes, heat shock protein 90 (Hsp90) is an essential ATP-dependent molecular chaperone that associates with numerous client proteins. HtpG, a prokaryotic homolog of Hsp90, is essential for thermotolerance in cyanobacteria, and in vitro it suppresses the aggregation of denatured proteins efficiently. Understanding how the non-native client proteins bound to HtpG refold is of central importance to comprehend the essential role of HtpG under stress. Here, we demonstrate by yeast two-hybrid method, immunoprecipitation assays, and surface plasmon resonance techniques that HtpG physically interacts with DnaJ2 and DnaK2. DnaJ2, which belongs to the type II J-protein family, bound DnaK2 or HtpG with submicromolar affinity, and HtpG bound DnaK2 with micromolar affinity. Not only DnaJ2 but also HtpG enhanced the ATP hydrolysis by DnaK2. Although assisted by the DnaK2 chaperone system, HtpG enhanced native refolding of urea-denatured lactate dehydrogenase and heat-denatured glucose-6-phosphate dehydrogenase. HtpG did not substitute for DnaJ2 or GrpE in the DnaK2-assisted refolding of the denatured substrates. The heat-denatured malate dehydrogenase that did not refold by the assistance of the DnaK2 chaperone system alone was trapped by HtpG first and then transferred to DnaK2 where it refolded. Dissociation of substrates from HtpG was either ATP-dependent or -independent depending on the substrate, indicating the presence of two mechanisms of cooperative action between the HtpG and the DnaK2 chaperone system.
-
Ghedira, Rim; De Buck, Sylvie; Van Ex, Frédéric; Angenon, Geert; Depicker, Ann
2013-12-01
T-DNA transfer and integration frequencies during Agrobacterium-mediated root explant cocultivation and floral dip transformations of Arabidopsis thaliana were analyzed with and without selection for transformation-competent cells. Based on the presence or absence of CRE recombinase activity without or with the CRE T-DNA being integrated, transient expression versus stable transformation was differentiated. During root explant cocultivation, continuous light enhanced the number of plant cells competent for interaction with Agrobacterium and thus the number of transient gene expression events. However, in transformation competent plant cells, continuous light did not further enhance cotransfer or cointegration frequencies. Upon selection for root transformants expressing a first T-DNA, 43-69 % of these transformants showed cotransfer of another non-selected T-DNA in two different light regimes. However, integration of the non-selected cotransferred T-DNA occurred only in 19-46 % of these transformants, indicating that T-DNA integration in regenerating root cells limits the transformation frequencies. After floral dip transformation, transient T-DNA expression without integration could not be detected, while stable T-DNA transformation occurred in 0.5-1.3 % of the T1 seedlings. Upon selection for floral dip transformants with a first T-DNA, 8-34 % of the transformants showed cotransfer of the other non-selected T-DNA and in 93-100 % of them, the T-DNA was also integrated. Therefore, a productive interaction between the agrobacteria and the female gametophyte, rather than the T-DNA integration process, restricts the floral dip transformation frequencies.
-
Dimeric fluorescent energy transfer dyes comprising asymmetric cyanine azole-indolenine chromophores
Glazer, Alexander N.; Benson, Scott C.
1998-01-01
Novel fluorescent heterodimeric DNA-staining energy transfer dyes are provided combining asymmetric cyanine azole-indolenine dyes, which provide for strong DNA affinity, large Stokes shifts and emission in the red region of the spectrum. The dyes find particular application in gel electrophoresis and for labels which may be bound to a variety of compositions in a variety of contexts. Kits and individual compounds are provided, where the kits find use for simultaneous detection of a variety of moieties, particularly using a single narrow wavelength irradiation source. The individual compounds are characterized by high donor quenching and high affinity to dsDNA as a result of optimizing the length of the linking group separating the two chromophores.
-
Kamba, Keisuke; Nagata, Takashi; Katahira, Masato
2018-01-31
APOBEC3G (A3G), an anti-human immunodeficiency virus 1 factor, deaminates cytidines. We examined deamination of two cytidines located separately on substrate ssDNA by the C-terminal domain (CTD) of A3G using real-time NMR monitoring. The deamination preference between the two cytidines was lost when either the substrate or non-substrate ssDNA concentration increased. When the non-substrate ssDNA concentration increased, the deamination activity first increased, but then decreased. This indicates that even a single domain, A3G-CTD, undergoes intersegmental transfer for a target search.
-
Standardization of Spore Inactivation Method for PMA-PhyloChip Analysis
NASA Technical Reports Server (NTRS)
Schrader, Michael
2011-01-01
In compliance with the Committee on Space Research (COSPAR) planetary protection policy, National Aeronautics and Space Administration (NASA) monitors the total microbial burden of spacecraft as a means for minimizing the inadvertent transfer of viable contaminant microorganisms to extraterrestrial environments (forward contamination). NASA standard assay-based counts are used both as a proxy for relative surface cleanliness and to estimate overall microbial burden as well as to assess whether forward planetary protection risk criteria are met for a given mission, which vary by the planetary body to be explored and whether or not life detection missions are present. Despite efforts to reduce presence of microorganisms from spacecraft prior to launch, microbes have been isolated from spacecraft and associated surfaces within the extreme conditions of clean room facilities using state of the art molecular technologies. Development of a more sensitive method that will better enumerate all viable microorganisms from spacecraft and associated surfaces could support future life detection missions. Current culture-based (NASA standard spore assay) and nucleic-acid-based polymerase chain reaction (PCR) methods have significant shortcomings in this type of analysis. The overall goal of this project is to evaluate and validate a new molecular method based on the use of a deoxyribonucleic acid (DNA) intercalating agent propidium monoazide (PMA). This is used in combination with DNA microarray (PhyloChip) which has been shown to identify very low levels of organisms on spacecraft associated surfaces. PMA can only penetrate the membrane of dead cells. Once penetrated, it intercalates the DNA and, upon photolysis using visible light it produces stable DNA monoadducts. This allows DNA to be unavailable for further PCR analysis. The specific aim of this study is to standardize the spore inactivation method for PMA-PhyloChip analysis. We have used the bacterial spores Bacillus subtilis 168 (standard laboratory isolate) as a test organism.
-
Adachi, Takumi; Sahara, Takehiko; Okuyama, Hidetoshi; Morita, Naoki
2017-07-01
Here, we describe a new method for genetic transformation of thraustochytrids, well-known producers of polyunsaturated fatty acids (PUFAs) like docosahexaenoic acid, by combining mild glass (zirconia) bead treatment and electroporation. Because the cell wall is a barrier against transfer of exogenous DNA into cells, gentle vortexing of cells with glass beads was performed prior to electroporation for partial cell wall disruption. G418-resistant transformants of thraustochytrid cells (Aurantiochytrium limacinum strain SR21 and thraustochytrid strain 12B) were successfully obtained with good reproducibility. The method reported here is simpler than methods using enzymes to generate spheroplasts and may provide advantages for PUFA production by using genetically modified thraustochytrids.
-
2013-01-01
Background Reducing the production cost of, and increasing revenues from, industrial biofuels will greatly facilitate their proliferation and co-integration with fossil fuels. The cost of feedstock is the largest cost in most fermentation bioprocesses and therefore represents an important target for cost reduction. Meanwhile, the biorefinery concept advocates revenue growth through complete utilization of by-products generated during biofuel production. Taken together, the production of biofuels from low-cost crude glycerol, available in oversupply as a by-product of bioethanol production, in the form of thin stillage, and biodiesel production, embodies a remarkable opportunity to advance affordable biofuel development. However, few bacterial species possess the natural capacity to convert glycerol as a sole source of carbon and energy into value-added bioproducts. Of particular interest is the anaerobe Clostridium pasteurianum, the only microorganism known to convert glycerol alone directly into butanol, which currently holds immense promise as a high-energy biofuel and bulk chemical. Unfortunately, genetic and metabolic engineering of C. pasteurianum has been fundamentally impeded due to lack of an efficient method for deoxyribonucleic acid (DNA) transfer. Results This work reports the development of an electrotransformation protocol permitting high-level DNA transfer to C. pasteurianum ATCC 6013 together with accompanying selection markers and vector components. The CpaAI restriction-modification system was found to be a major barrier to DNA delivery into C. pasteurianum which we overcame by in vivo methylation of the recognition site (5’-CGCG-3’) using the M.FnuDII methyltransferase. With proper selection of the replication origin and antibiotic-resistance marker, we initially electroporated methylated DNA into C. pasteurianum at a low efficiency of 2.4 × 101 transformants μg-1 DNA by utilizing conditions common to other clostridial electroporations. Systematic investigation of various parameters involved in the cell growth, washing and pulse delivery, and outgrowth phases of the electrotransformation procedure significantly elevated the electrotransformation efficiency, up to 7.5 × 104 transformants μg-1 DNA, an increase of approximately three order of magnitude. Key factors affecting the electrotransformation efficiency include cell-wall-weakening using glycine, ethanol-mediated membrane solubilization, field strength of the electric pulse, and sucrose osmoprotection. Conclusions C. pasteurianum ATCC 6013 can be electrotransformed at a high efficiency using appropriately methylated plasmid DNA. The electrotransformation method and tools reported here should promote extensive genetic manipulation and metabolic engineering of this biotechnologically important bacterium. PMID:23570573
-
USDA-ARS?s Scientific Manuscript database
Premise of the study: Prunus L. phylogeny has extensively studied using cpDNA sequences. CpDNA has a slow rate of evolution which is beneficial to determine species relationships at a deeper level. However, a limitation of the chloroplast based phylogenies is its transfer by interspecific hybridizat...
-
Cai, Xue; Nash, Zack; Conley, Shannon M; Fliesler, Steven J; Cooper, Mark J; Naash, Muna I
2009-01-01
Previously we have shown that compacted DNA nanoparticles can drive high levels of transgene expression after subretinal injection in the mouse eye. Here we delivered compacted DNA nanoparticles containing a therapeutic gene to the retinas of a mouse model of retinitis pigmentosa. Nanoparticles containing the wild-type retinal degeneration slow (Rds) gene were injected into the subretinal space of rds(+/-) mice on postnatal day 5. Gene expression was sustained for up to four months at levels up to four times higher than in controls injected with saline or naked DNA. The nanoparticles were taken up into virtually all photoreceptors and mediated significant structural and biochemical rescue of the disease without histological or functional evidence of toxicity. Electroretinogram recordings showed that nanoparticle-mediated gene transfer restored cone function to a near-normal level in contrast to transfer of naked plasmid DNA. Rod function was also improved. These findings demonstrate that compacted DNA nanoparticles represent a viable option for development of gene-based interventions for ocular diseases and obviate major barriers commonly encountered with non-viral based therapies.
-
Das, Susanta; Nam, Kwangho; Major, Dan Thomas
2018-03-13
In recent years, a number of quantum mechanical-molecular mechanical (QM/MM) enzyme studies have investigated the dependence of reaction energetics on the size of the QM region using energy and free energy calculations. In this study, we revisit the question of QM region size dependence in QM/MM simulations within the context of energy and free energy calculations using a proton transfer in a DNA base pair as a test case. In the simulations, the QM region was treated with a dispersion-corrected AM1/d-PhoT Hamiltonian, which was developed to accurately describe phosphoryl and proton transfer reactions, in conjunction with an electrostatic embedding scheme using the particle-mesh Ewald summation method. With this rigorous QM/MM potential, we performed rather extensive QM/MM sampling, and found that the free energy reaction profiles converge rapidly with respect to the QM region size within ca. ±1 kcal/mol. This finding suggests that the strategy of QM/MM simulations with reasonably sized and selected QM regions, which has been employed for over four decades, is a valid approach for modeling complex biomolecular systems. We point to possible causes for the sensitivity of the energy and free energy calculations to the size of the QM region, and potential implications.
-
Liu, Mengmeng; Wu, Jie; Yang, Kaili; Zong, Chen; Lei, Jianping; Ju, Huangxian
2016-07-01
Chemiluminescence resonance energy transfer (CRET) and the proximity ligation assay have been widely used in design of sensors for the bioanalysis. Here, a wash-free and homogeneous strategy was proposed to detect carcino-embryonic antigen (CEA) based on proximity hybridization-regulated CRET. The Cy5 demonstrated strong chemiluminescence (CL) via the oxidation of TCPO in the presence of H2O2 and energy transfer between excited TCPO and Cy5. Graphene oxide (GO) as an excellent quencher was used to produce the "Signal off" mode that little CL emission was observed through CRET between GO and the Cy5-labelled DNA3. Once CEA was introduced, the target-induced proximity hybridization occurred to form a proximate complex, which inhibited the CRET by preventing GO from absorbing Cy5-labelled DNA3. Furthermore, taking advantage of nicking endonuclease Nt.BbvCI for in situ recycling, the signal could be further amplified for highly sensitive CL detection. Our results showed that this strategy enabled a specific response to CEA with a detection range of 5 orders of magnitude, along with a detection limit of 3.2pg mL(-1). Apart from its easy operation, high sensitivity and acceptable accuracy, the proposed method needed only 0.3μL of sample, indicating its great opportunity for commercial application. Copyright © 2016 Elsevier B.V. All rights reserved.
-
Molas, M; Bartrons, R; Perales, J C
2002-08-15
Nonviral gene transfer vectors have been actively studied in the past years in order to obtain structural entities with minimum size and defined shape. The final size of a gene transfer vector, which is compacted into unimolecular complexes, is directly proportional to the mass of the nucleic acid to be compacted. Thus, the purpose of this study was to assess the possibility of producing ssDNA vectors and their biophysical and biological characterization. We have obtained ssDNA/poly-L-lysine complexes that are significantly smaller than their double-stranded counterparts. We have also identified a lesser aggregative behavior of compacted single-stranded vs. double-stranded DNA vectors in the presence of physiological NaCl concentrations. Expression of compacted ssDNA is observed in hepatoma cell lines. Moreover, we have successfully delivered galactosylated ssDNA complexes into cells that express the asialoglycoprotein receptor via receptor-mediated endocytosis. The reduced size and biophysical behavior of ssDNA vectors may provide an advantage for transfection of eukaryotic cells.
-
Internal twisting motion dependent conductance of an aperiodic DNA molecule
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta
The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less
-
Fröbel, Sascha; Levi, Lucilla; Ulamec, Sabine M; Gilch, Peter
2016-05-04
Psoralens are heterocyclic compounds which are, among other uses, used to treat skin deseases in the framework of PUVA therapy. In the dark, they intercalate into DNA and can form photoadducts with thymines upon UV-A excitation, which harms the affected cells. We have recently discovered that after excitation of intercalated psoralens, an efficient photoinduced electron transfer (PET) from DNA occurs. Here, the PET is studied in detail by means of femtosecond transient absorption spectroscopy. Using DNA samples that contain either only GC or AT base pairs, we show that only guanine donates the electrons. Additionally, the substituent effects on PET are studied relying on three different psoralen derivatives. The substitution alters spectroscopic and electrochemical properties of the psoralens, which are determined by cyclic voltammetry and steady state spectroscopy. These experiments allow us to estimate the PET energetics, which are in line with the measured kinetics. Implications for the applications of psoralens are discussed. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
Gold, Marvin; Gefter, Malcolm; Hausmann, Rudolph; Hurwitz, Jerard
1966-01-01
The methylated bases of DNA are formed by the transfer of the methyl group from S-adenosylmethionine to a polynucleotide acceptor. This transfer is catalyzed by highly specific enzymes which recognize a limited number of available sites in the DNA. The mechanism for the recognition is presently unknown. In some instances, there is evidence that other cellular components, such as lipopolysaccharides, can influence the methylation reaction. Certain bacteriophages induce new methylases upon infection of their hosts. Phage T3 is unique in establishing an environment in which methylation of neither the phage nor the host nucleic acid can occur. By superinfecting T3-infected cells with other phages, the latter can be obtained with methyl-deficient DNA. Although a great deal is known about the enzymology of the methylation reaction, and there appears to be a strong correlation between the in vitro and in vivo reactions, studies in which DNA is either supermethylated or totally unmethylated have not yielded any insight as to what the possible function of the methylated bases may be. PMID:5338563
-
Information transfer from DNA to peptide nucleic acids by template-directed syntheses
NASA Technical Reports Server (NTRS)
Schmidt, J. G.; Christensen, L.; Nielsen, P. E.; Orgel, L. E.; Bada, J. L. (Principal Investigator)
1997-01-01
Peptide nucleic acids (PNAs) are analogs of nucleic acids in which the ribose-phosphate backbone is replaced by a backbone held together by amide bonds. PNAs are interesting as models of alternative genetic systems because they form potentially informational base paired helical structures. Oligocytidylates have been shown to act as templates for formation of longer oligomers of G from PNA G2 dimers. In this paper we show that information can be transferred from DNA to PNA. DNA C4T2C4 is an efficient template for synthesis of PNA G4A2G4 using G2 and A2 units as substrates. The corresponding synthesis of PNA G4C2G4 on DNA C4G2C4 is less efficient. Incorporation of PNA T2 into PNA products on DNA C4A2C4 is the least efficient of the three reactions. These results, obtained using PNA dimers as substrates, parallel those obtained using monomeric activated nucleotides.
-
Engineering T7 bacteriophage as a potential DNA vaccine targeting delivery vector.
Xu, Hai; Bao, Xi; Wang, Yiwei; Xu, Yue; Deng, Bihua; Lu, Yu; Hou, Jibo
2018-03-20
DNA delivery with bacteriophage by surface-displayed mammalian cell penetrating peptides has been reported. Although, various phages have been used to facilitate DNA transfer by surface displaying the protein transduction domain of human immunodeficiency virus type 1 Tat protein (Tat peptide), no similar study has been conducted using T7 phage. In this study, we engineeredT7 phage as a DNA targeting delivery vector to facilitate cellular internalization. We constructed recombinant T7 phages that displayed Tat peptide on their surface and carried eukaryotic expression box (EEB) as a part of their genomes (T7-EEB-Tat). We demonstrated that T7 phage harboring foreign gene insertion had packaged into infective progeny phage particles. Moreover, when mammalian cells that were briefly exposed to T7-EEB-Tat, expressed a significant higher level of the marker gene with the control cells infected with the wide type phage without displaying Tat peptides. These data suggested that the potential of T7 phage as an effective delivery vector for DNA vaccine transfer.
-
Reimer, D L; Kong, S; Monck, M; Wyles, J; Tam, P; Wasan, E K; Bally, M B
1999-05-01
The transfer of plasmid expression vectors to cells is essential for transfection after administration of lipid-based DNA formulations (lipoplexes). A murine i.p. B16/BL6 tumor model was used to characterize DNA delivery, liposomal lipid delivery, and gene transfer after regional (i.p.) administration of free plasmid DNA and DNA lipoplexes. DNA lipoplexes were prepared using cationic dioleoyldimethylammonium chloride/dioleoylphosphatidylethanolamine (50:50 mol ratio) liposomes mixed with plasmid DNA (1 microgram DNA/10 nmol lipid). The plasmid used contained the chloramphenicol acetyltransferase gene and chloramphenicol acetyltransferase expression (mU/g tumor) was measured to estimate transfection efficiency. Tumor-associated DNA and liposomal lipid levels were measured to estimate the efficiency of lipid-mediated DNA delivery to tumors. Plasmid DNA delivery was estimated using [3H]-labeled plasmid as a tracer, dot blot analysis, and/or Southern analysis. Liposomal lipid delivery was estimated using [14C]-dioleoylphosphatidylethanolamine as a liposomal lipid marker. Gene expression in the B16/BL6 tumors was highly variable, with values ranging from greater than 2,000 mU/g tumor to less than 100 mU/g tumor. There was a tendency to observe enhanced transfection in small (<250 mg) tumors. Approximately 18% of the injected dose of DNA was associated with these small tumors 2 h after i.p. administration. Southern analysis of extracted tumor DNA indicated that plasmid DNA associated with tumors was intact 24 h after administration. DNA and associated liposomal lipid are efficiently bound to tumors after regional administration; however, it is unclear whether delivery is sufficient to abet internalization and appropriate subcellular localization of the expression vector.
-
Lin, F L; Sternberg, N
1984-05-01
We have constructed a substrate to study homologous recombination between adjacent segments of chromosomal DNA. This substrate, designated lambda tk2 , consists of one completely defective and one partially defective herpes simplex virus thymidine kinase (tk) gene cloned in bacteriophage lambda DNA. The two genes have homologous 984-base-pair sequences and are separated by 3 kilobases of largely vector DNA. When lambda tk2 DNA was transferred into mouse LMtk- cells by the calcium phosphate method, rare TK+ transformants were obtained that contained many (greater than 40) copies of the unrecombined DNA. Tk- revertants, which had lost most of the copies of unrecombined DNA, were isolated from these TK+-transformed lines. Two of these Tk- lines were further studied by analysis of their reversion back to the Tk+ phenotype. They generated ca. 200 Tk+ revertants per 10(8) cells after growth in nonselecting medium for 5 days. All of these Tk+ revertants have an intact tk gene reconstructed by homologous recombination; they also retain various amounts of unrecombined lambda tk2 DNA. Southern blot analysis suggested that at least some of the recombination events involve unequal sister chromatid exchanges. We also tested three agents, mitomycin C, 12-O-tetradecanoyl-phorbol-13-acetate, and mezerein, that are thought to stimulate recombination to determine whether they affect the reversion from Tk- to Tk+. Only mitomycin C increased the number of Tk+ revertants.
-
Zhang, Zhen; Xiang, Xia; Shi, Jianbin; Huang, Fenghong; Xia, Xiaoyang; Zheng, Mingming; Han, Ling; Tang, Hu
2018-10-05
An amplified fluorescence strategy is described for the detection of sinapine (SP) by using a cationic conjugated polymer (PFP) and graphene oxide (GO). It is observed that the fluorescein (FAM)-labeled single-stranded DNA (FAM-DNA) is absorbed on the surface of GO if SP is absent. This causes that fluorescence resonance energy transfer (FRET) from PFP to FAM is inefficient when adding PFP into FAM-DNA/GO complex. If SP is added to FAM-DNA/GO complex, FAM-DNA is desorbed from GO surface due to the competitive binding of SP and FAM-DNA toward GO. In this case, FAM-DNA is close to PFP in the presence of PFP through strong electrostatic interaction, leading to the occurrence of efficient FRET. Based on the above phenomenon, we demonstrate a method to amplify fluorescence signal of traditional GO-based SP assay by introducing PFP. In comparison to the use of single GO, the combination of PFP with GO-based strategy displays high turn-on ratio and enhanced sensitivity with a limit of detection as low as 7.3 ng mL -1 for SP detection. Satisfactory results in practical samples are also obtained by the recovery experiments, demonstrating the potential application of cationic conjugated polymer in plant-derived small molecule. Copyright © 2018 Elsevier B.V. All rights reserved.
-
Long-range electron transfer in a model for DNA
NASA Astrophysics Data System (ADS)
Endres, R. G.; Cox, D. L.
2001-03-01
Long-range electron transfer (ET) between well separated donor (D) and acceptor (A) sites through quantum mechanical tunneling is essential to many biological processes like respiration, photosynthesis and possibly DNA repair and damage. We are investigating the distance dependence of the electronic transition matrix element H_DA and hence of the electron transfer rate in a model for DNA. Fluorescence quenching in DNA at D-A distances of 40 Åand more suggests ET with an unusually high decay length β-1 of order 10 Å (S.O.Kelley and J.K.Barton, in:Metal Ions in Biological Systems), A.Sigel and H.Sigel, Eds., Marcel Dekker, New York, Vol.36, 1999. Assuming strong electron interactions on the D complex and suitable energetics, this could be explained by formation of a many electron Kondo boundstate. We obtain H_DA from the splitting between the two lowest adiabatic electronic eigenenergies, which constitute the potential energy surfaces (PES) of the nuclear motion in lowest order Born-Oppenheimer approximation. The PES are constructed by coupling D and A to local breathing modes and by making a semi-analytical variational ansatz for the adiabatic eigenstates. The results from the PES are compared with results from the Mulliken-Hush algorithm.
-
FRET enhancement close to gold nanoparticles positioned in DNA origami constructs.
Aissaoui, Nesrine; Moth-Poulsen, Kasper; Käll, Mikael; Johansson, Peter; Wilhelmsson, L Marcus; Albinsson, Bo
2017-01-05
Here we investigate the energy transfer rates of a Förster resonance energy transfer (FRET) pair positioned in close proximity to a 5 nm gold nanoparticle (AuNP) on a DNA origami construct. We study the distance dependence of the FRET rate by varying the location of the donor molecule, D, relative to the AuNP while maintaining a fixed location of the acceptor molecule, A. The presence of the AuNP induces an alteration in the spontaneous emission of the donor (including radiative and non-radiative rates) which is strongly dependent on the distance between the donor and AuNP surface. Simultaneously, the energy transfer rates are enhanced at shorter D-A (and D-AuNP) distances. Overall, in addition to the direct influence of the acceptor and AuNP on the donor decay there is also a significant increase in decay rate not explained by the sum of the two interactions. This leads to enhanced energy transfer between donor and acceptor in the presence of a 5 nm AuNP. We also demonstrate that the transfer rate in the three "particle" geometry (D + A + AuNP) depends approximately linearly on the transfer rate in the donor-AuNP system, suggesting the possibility to control FRET process with electric field induced by 5 nm AuNPs close to the donor fluorophore. It is concluded that DNA origami is a very versatile platform for studying interactions between molecules and plasmonic nanoparticles in general and FRET enhancement in particular.
-
Slama-Schwok, A; Zakrzewska, K; Léger, G; Leroux, Y; Takahashi, M; Käs, E; Debey, P
2000-01-01
Using spectroscopic methods, we have studied the structural changes induced in both protein and DNA upon binding of the High-Mobility Group I (HMG-I) protein to a 21-bp sequence derived from mouse satellite DNA. We show that these structural changes depend on the stoichiometry of the protein/DNA complexes formed, as determined by Job plots derived from experiments using pyrene-labeled duplexes. Circular dichroism and melting temperature experiments extended in the far ultraviolet range show that while native HMG-I is mainly random coiled in solution, it adopts a beta-turn conformation upon forming a 1:1 complex in which the protein first binds to one of two dA.dT stretches present in the duplex. HMG-I structure in the 1:1 complex is dependent on the sequence of its DNA target. A 3:1 HMG-I/DNA complex can also form and is characterized by a small increase in the DNA natural bend and/or compaction coupled to a change in the protein conformation, as determined from fluorescence resonance energy transfer (FRET) experiments. In addition, a peptide corresponding to an extended DNA-binding domain of HMG-I induces an ordered condensation of DNA duplexes. Based on the constraints derived from pyrene excimer measurements, we present a model of these nucleated structures. Our results illustrate an extreme case of protein structure induced by DNA conformation that may bear on the evolutionary conservation of the DNA-binding motifs of HMG-I. We discuss the functional relevance of the structural flexibility of HMG-I associated with the nature of its DNA targets and the implications of the binding stoichiometry for several aspects of chromatin structure and gene regulation. PMID:10777751
-
A hybrid approach to simulation of electron transfer in complex molecular systems
Kubař, Tomáš; Elstner, Marcus
2013-01-01
Electron transfer (ET) reactions in biomolecular systems represent an important class of processes at the interface of physics, chemistry and biology. The theoretical description of these reactions constitutes a huge challenge because extensive systems require a quantum-mechanical treatment and a broad range of time scales are involved. Thus, only small model systems may be investigated with the modern density functional theory techniques combined with non-adiabatic dynamics algorithms. On the other hand, model calculations based on Marcus's seminal theory describe the ET involving several assumptions that may not always be met. We review a multi-scale method that combines a non-adiabatic propagation scheme and a linear scaling quantum-chemical method with a molecular mechanics force field in such a way that an unbiased description of the dynamics of excess electron is achieved and the number of degrees of freedom is reduced effectively at the same time. ET reactions taking nanoseconds in systems with hundreds of quantum atoms can be simulated, bridging the gap between non-adiabatic ab initio simulations and model approaches such as the Marcus theory. A major recent application is hole transfer in DNA, which represents an archetypal ET reaction in a polarizable medium. Ongoing work focuses on hole transfer in proteins, peptides and organic semi-conductors. PMID:23883952
-
Dynamics of Charge Transfer in DNA Wires: A Proton-Coupled Approach
NASA Astrophysics Data System (ADS)
Behnia, Sohrab; Fathizadeh, Samira; Ziaei, Javid; Akhshani, Afshin
2017-12-01
The advent of molecular electronics has fueled interest in studying DNA as a nanowire. The well-known Peyrard-Bishop-Dauxois (PBD) model, which was proposed for the purpose of understanding the mechanism of DNA denaturation, has a limited number of degrees of freedom. In addition, considering the Peyrard-Bishop-Holstein (PBH) model as a means of studying the charge transfer effect, in which the dynamical motion is described via the PBD model, may apply limitations on observing all the phenomena. Therefore, we have attempted to add the mutual interaction of a proton and electron in the form of proton-coupled electron transfer (PCET) to the PBH model. PCET has been implicated in a variety of oxidative processes that ultimately lead to mutations. When we have considered the PCET approach to DNA based on a proton-combined PBH model, we were able to extract the electron and proton currents independently. In this case, the reciprocal influence of electron and proton current is considered. This interaction does not affect the general form of the electronic current in DNA, but it changes the threshold of the occurrence of phenomena such as negative differential resistance. It is worth mentioning that perceiving the structural properties of the attractors in phase space via the Rényi dimension and concentrating on the critical regions through a scalogram can present a clear picture of the critical points in such phenomena.
-
The gene transfer agent-like particle of the marine phototrophic bacterium Rhodovulum sulfidophilum.
Nagao, Nobuyoshi; Yamamoto, Junya; Komatsu, Hiroyuki; Suzuki, Hiromichi; Hirose, Yuu; Umekage, So; Ohyama, Takashi; Kikuchi, Yo
2015-12-01
Gene transfer agents (GTAs) are shaped like bacteriophage particles but have many properties that distinguish them from bacteriophages. GTAs play a role in horizontal gene transfer in nature and thus affect the evolution of prokaryotic genomes. In the course of studies on the extracellular production of designed RNAs using the marine bacterium Rhodovulum sulfidophilum , we found that this bacterium produces a GTA-like particle. The particle contains DNA fragments of 4.5 kb, which consist of randomly fragmented genomic DNA from the bacterium. This 4.5-kb DNA production was prevented while quorum sensing was inhibited. Direct observation of the particle by transmission electron microscopy revealed that the particle resembles a tailed phage and has a head diameter of about 40 nm and a tail length of about 60 nm. We also identified the structural genes for the GTA in the genome. Translated amino acid sequences and gene positions are closely related to those of the genes that encode the Rhodobacter capsulatus GTA. This is the first report of a GTA-like particle from the genus Rhodovulum . However, gene transfer activity of this particle has not yet been confirmed. The differences between this particle and other GTAs are discussed.
-
Weber, Stefan
2005-02-25
More than 50 years ago, initial experiments on enzymatic photorepair of ultraviolet (UV)-damaged DNA were reported [Proc. Natl. Acad. Sci. U. S. A. 35 (1949) 73]. Soon after this discovery, it was recognized that one enzyme, photolyase, is able to repair UV-induced DNA lesions by effectively reversing their formation using blue light. The enzymatic process named DNA photoreactivation depends on a non-covalently bound cofactor, flavin adenine dinucleotide (FAD). Flavins are ubiquitous redox-active catalysts in one- and two-electron transfer reactions of numerous biological processes. However, in the case of photolyase, not only the ground-state redox properties of the FAD cofactor are exploited but also, and perhaps more importantly, its excited-state properties. In the catalytically active, fully reduced redox form, the FAD absorbs in the blue and near-UV ranges of visible light. Although there is no direct experimental evidence, it appears generally accepted that starting from the excited singlet state, the chromophore initiates a reductive cleavage of the two major DNA photodamages, cyclobutane pyrimidine dimers and (6-4) photoproducts, by short-distance electron transfer to the DNA lesion. Back electron transfer from the repaired DNA segment is believed to eventually restore the initial redox states of the cofactor and the DNA nucleobases, resulting in an overall reaction with net-zero exchanged electrons. Thus, the entire process represents a true catalytic cycle. Many biochemical and biophysical studies have been carried out to unravel the fundamentals of this unique mode of action. The work has culminated in the elucidation of the three-dimensional structure of the enzyme in 1995 that revealed remarkable details, such as the FAD-cofactor arrangement in an unusual U-shaped configuration. With the crystal structure of the enzyme at hand, research on photolyases did not come to an end but, for good reason, intensified: the geometrical structure of the enzyme alone is not sufficient to fully understand the enzyme's action on UV-damaged DNA. Much effort has therefore been invested to learn more about, for example, the geometry of the enzyme-substrate complex, and the mechanism and pathways of intra-enzyme and enzyme <-->DNA electron transfer. Many of the key results from biochemical and molecular biology characterizations of the enzyme or the enzyme-substrate complex have been summarized in a number of reviews. Complementary to these articles, this review focuses on recent biophysical studies of photoreactivation comprising work performed from the early 1990s until the present.
-
Constrained subsystem density functional theory.
Ramos, Pablo; Pavanello, Michele
2016-08-03
Constrained Subsystem Density Functional Theory (CSDFT) allows to compute diabatic states for charge transfer reactions using the machinery of the constrained DFT method, and at the same time is able to embed such diabatic states in a molecular environment via a subsystem DFT scheme. The CSDFT acronym is chosen to reflect the fact that on top of the subsystem DFT approach, a constraining potential is applied to each subsystem. We show that CSDFT can successfully tackle systems as complex as single stranded DNA complete of its backbone, and generate diabatic states as exotic as a hole localized on a phosphate group as well as on the nucleobases. CSDFT will be useful to investigators needing to evaluate the environmental effect on charge transfer couplings for systems in condensed phase environments.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Han; Sonoda, Koh-Hei, E-mail: sonodak@med.kyushu-u.ac.jp; Hijioka, Kuniaki
2009-04-17
Ocular neovascularization (NV) is the primary cause of blindness in a wide range of ocular diseases. The exact mechanism underlying the pathogenesis of ocular NV is not yet well understood, and so there is no satisfactory therapy for ocular NV. Here, we describe a strategy targeting Flk-1, a self-antigen overexpressed on proliferating endothelial cells in ocular NV, by antiangiogenic immunotherapy-DNA vaccine and adoptive T cell therapy. An oral DNA vaccine encoding Flk-1 carried by attenuated Salmonella typhimurium markedly suppressed development of laser-induced choroidal NV. We further demonstrated that adoptive transfer of vaccine-induced CD8{sup +} T cells reduced pathological preretinal NV,more » with a concomitant facilitation of physiological revascularization after oxygen-induced retinal vessel obliteration. However, physiological retinal vascular development was unaffected in neonatal mice transferred with vaccine-induced CD8{sup +} T cells. These findings suggested that antiangiogenic immunotherapy targeting Flk-1 such as vaccination and adoptive immunotherapy may contribute to future therapies for ocular NV.« less
-
Massive gene transfer and extensive RNA editing of a symbiotic dinoflagellate plastid genome.
Mungpakdee, Sutada; Shinzato, Chuya; Takeuchi, Takeshi; Kawashima, Takeshi; Koyanagi, Ryo; Hisata, Kanako; Tanaka, Makiko; Goto, Hiroki; Fujie, Manabu; Lin, Senjie; Satoh, Nori; Shoguchi, Eiichi
2014-05-31
Genome sequencing of Symbiodinium minutum revealed that 95 of 109 plastid-associated genes have been transferred to the nuclear genome and subsequently expanded by gene duplication. Only 14 genes remain in plastids and occur as DNA minicircles. Each minicircle (1.8-3.3 kb) contains one gene and a conserved noncoding region containing putative promoters and RNA-binding sites. Nine types of RNA editing, including a novel G/U type, were discovered in minicircle transcripts but not in genes transferred to the nucleus. In contrast to DNA editing sites in dinoflagellate mitochondria, which tend to be highly conserved across all taxa, editing sites employed in DNA minicircles are highly variable from species to species. Editing is crucial for core photosystem protein function. It restores evolutionarily conserved amino acids and increases peptidyl hydropathy. It also increases protein plasticity necessary to initiate photosystem complex assembly. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
-
Zhang, Han; Sonoda, Koh-Hei; Hijioka, Kuniaki; Qiao, Hong; Oshima, Yuji; Ishibashi, Tatsuro
2009-04-17
Ocular neovascularization (NV) is the primary cause of blindness in a wide range of ocular diseases. The exact mechanism underlying the pathogenesis of ocular NV is not yet well understood, and so there is no satisfactory therapy for ocular NV. Here, we describe a strategy targeting Flk-1, a self-antigen overexpressed on proliferating endothelial cells in ocular NV, by antiangiogenic immunotherapy-DNA vaccine and adoptive T cell therapy. An oral DNA vaccine encoding Flk-1 carried by attenuated Salmonella typhimurium markedly suppressed development of laser-induced choroidal NV. We further demonstrated that adoptive transfer of vaccine-induced CD8+ T cells reduced pathological preretinal NV, with a concomitant facilitation of physiological revascularization after oxygen-induced retinal vessel obliteration. However, physiological retinal vascular development was unaffected in neonatal mice transferred with vaccine-induced CD8+ T cells. These findings suggested that antiangiogenic immunotherapy targeting Flk-1 such as vaccination and adoptive immunotherapy may contribute to future therapies for ocular NV.
-
Programmed coherent coupling in a synthetic DNA-based excitonic circuit
NASA Astrophysics Data System (ADS)
Boulais, Étienne; Sawaya, Nicolas P. D.; Veneziano, Rémi; Andreoni, Alessio; Banal, James L.; Kondo, Toru; Mandal, Sarthak; Lin, Su; Schlau-Cohen, Gabriela S.; Woodbury, Neal W.; Yan, Hao; Aspuru-Guzik, Alán; Bathe, Mark
2018-02-01
Natural light-harvesting systems spatially organize densely packed chromophore aggregates using rigid protein scaffolds to achieve highly efficient, directed energy transfer. Here, we report a synthetic strategy using rigid DNA scaffolds to similarly program the spatial organization of densely packed, discrete clusters of cyanine dye aggregates with tunable absorption spectra and strongly coupled exciton dynamics present in natural light-harvesting systems. We first characterize the range of dye-aggregate sizes that can be templated spatially by A-tracts of B-form DNA while retaining coherent energy transfer. We then use structure-based modelling and quantum dynamics to guide the rational design of higher-order synthetic circuits consisting of multiple discrete dye aggregates within a DX-tile. These programmed circuits exhibit excitonic transport properties with prominent circular dichroism, superradiance, and fast delocalized exciton transfer, consistent with our quantum dynamics predictions. This bottom-up strategy offers a versatile approach to the rational design of strongly coupled excitonic circuits using spatially organized dye aggregates for use in coherent nanoscale energy transport, artificial light-harvesting, and nanophotonics.
-
Lin, Xuan; Faridi, Nurul; Casola, Claudio
2016-05-02
Comparative genomics analyses empowered by the wealth of sequenced genomes have revealed numerous instances of horizontal DNA transfers between distantly related species. In eukaryotes, repetitive DNA sequences known as transposable elements (TEs) are especially prone to move across species boundaries. Such horizontal transposon transfers, or HTTs, are relatively common within major eukaryotic kingdoms, including animals, plants, and fungi, while rarely occurring across these kingdoms. Here, we describe the first case of HTT from animals to plants, involving TEs known as Penelope-like elements, or PLEs, a group of retrotransposons closely related to eukaryotic telomerases. Using a combination of in situ hybridization on chromosomes, polymerase chain reaction experiments, and computational analyses we show that the predominant PLE lineage, EN(+)PLEs, is highly diversified in loblolly pine and other conifers, but appears to be absent in other gymnosperms. Phylogenetic analyses of both protein and DNA sequences reveal that conifers EN(+)PLEs, or Dryads, form a monophyletic group clustering within a clade of primarily arthropod elements. Additionally, no EN(+)PLEs were detected in 1,928 genome assemblies from 1,029 nonmetazoan and nonconifer genomes from 14 major eukaryotic lineages. These findings indicate that Dryads emerged following an ancient horizontal transfer of EN(+)PLEs from arthropods to a common ancestor of conifers approximately 340 Ma. This represents one of the oldest known interspecific transmissions of TEs, and the most conspicuous case of DNA transfer between animals and plants. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution 2016. This work is written by US Government employees and is in the public domain in the US.
-
Mamaeva, O K; Gabrielian, A G; Arutiunian, G L; Bocharova, T N; Smirnova, E A; Volodin, A A; Shchelkina, A K; Kaliuzhnyĭ, D N
2014-01-01
Earlier, a new class of compounds--amphiphilic derivatives of 1,3-diazaadamantanes, capable of facilitating the strand exchange in the system of short oligonucleotides was revealed. Longer hydrophobic side chains of 1,3-diazaadamantanes promoted stronger acceleration of the reaction. In this study, interaction with DNA of two 1,3-diazaadamantane derivatives containing different side chains was investigated by use of optical methods. Concentration of the investigated 1,3-diazaadamantans micelles formation were determined by the means of monitoring fluorescence intensity enhancement of 1-anilinonaphtalene-8-sulphonate probe; as well as the ranges of concentrations where the compounds/water mixtures existed as true solutions. 1,3-diazaadamantanes affinity to DNA was determined with Fluorescent Intercalator Displacement (FID) approach. Significant increase in hydrodynamic volume of short DNA hairpins in the complexes with 1,3-diazaadamantanes was revealed by estimation of the fluorescence polarization of ethidium bromide probe bound to the hairpins. Intermolecular association of DNA hairpins upon binding with 1,3-diazaadamantans was confirmed by Förster resonance energy transfer in system of an equimolar mixture of fluorescently labeled with Cy-3 and Cy-5 hairpins. In this study, the number of positive charges at 1,3-diazaadamantane derivatives containing side chains of different lengths was demonstrated to affect their affinity to DNA, whereas longer length of the hydrophobic side chains ensured more efficient interaction between the DNA duplexes that may facilitate, in particular, DNA strand exchange.
-
Kassegne, Sam; Wibowo, Denni; Chi, James; Ramesh, Varsha; Narenji, Alaleh; Khosla, Ajit; Mokili, John
2015-06-01
In this study, AC characterisation of DNA molecular wires, effects of frequency, temperature and UV irradiation on their conductivity is presented. λ-DNA molecular wires suspended between high aspect-ratio electrodes exhibit highly frequency-dependent conductivity that approaches metal-like behaviour at high frequencies (∼MHz). Detailed temperature dependence experiments were performed that traced the impedance response of λ-DNA until its denaturation. UV irradiation experiments where conductivity was lost at higher and longer UV exposures helped to establish that it is indeed λ-DNA molecular wires that generate conductivity. The subsequent renaturation of λ-DNA resulted in the recovery of current conduction, providing yet another proof of the conducting DNA molecular wire bridge. The temperature results also revealed hysteretic and bi-modal impedance responses that could make DNA a candidate for nanoelectronics components like thermal transistors and switches. Further, these experiments shed light on the charge transfer mechanism in DNA. At higher temperatures, the expected increase in thermal-induced charge hopping may account for the decrease in impedance supporting the 'charge hopping mechanism' theory. UV light, on the other hand, causes damage to GC base-pairs and phosphate groups reducing the path available both for hopping and short-range tunneling mechanisms, and hence increasing impedance--this again supporting both the 'charge hopping' and 'tunneling' mechanism theories.
-
Energy and Charge Localization in Irradiated DNA
1994-01-01
distances. Numerous experiments support this viewpoint. As an example we note that exciplex formation in DNA is a rapid process /31/ estimated to be the...B-DNA) and tT is the trapping time. Assuming an exciplex formation time of 10`2 sec gives a transfer distance d, of 1.5 nm or approximately 4 to 5
-
Miodek, Anna; Mejri, Nawel; Gomgnimbou, Michel; Sola, Christophe; Korri-Youssoufi, Hafsa
2015-09-15
Two-step electrochemical patterning methods have been employed to elaborate composite nanomaterials formed with multiwalled carbon nanotubes (MWCNTs) coated with polypyrrole (PPy) and redox PAMAM dendrimers. The nanomaterial has been demonstrated as a molecular transducer for electrochemical DNA detection. The nanocomposite MWCNTs-PPy has been formed by wrapping the PPy film on MWCNTs during electrochemical polymerization of pyrrole on the gold electrode. The MWCNTs-PPy layer was modified with PAMAM dendrimers of fourth generation (PAMAM G4) with covalent bonding by electro-oxidation method. Ferrocenyl groups were then attached to the surface as a redox marker. The electrochemical properties of the nanomaterial (MWCNTs-PPy-PAMAM-Fc) were studied using both square wave voltammetry and cyclic voltammetry to demonstrate efficient electron transfer. The nanomaterial shows high performance in the electrochemical detection of DNA hybridization leading to a variation in the electrochemical signal of ferrocene with a detection limit of 0.3 fM. Furthermore, the biosensor demonstrates ability for sensing DNA of rpoB gene of Mycobacterium tuberculosis in real PCR samples. Developed biosensor was suitable for detection of sequences with a single nucleotide polymorphism (SNP) T (TCG/TTG), responsible for resistance of M. tuberculosis to rifampicin drug, and discriminating them from wild-type samples without such mutation. This shows potential of such systems for further application in pathogens diagnostic and therapeutic purpose.
-
USDA-ARS?s Scientific Manuscript database
Horizontal gene transfer is an important component of evolution and adaptation of bacterial species. Xylella fastidiosa has the ability to incorporate exogenous DNA into its genome by homologous recombination at relatively high rates. This genetic recombination is believed to play a role in adaptati...
-
Beyond Agrobacterium-Mediated Transformation: Horizontal Gene Transfer from Bacteria to Eukaryotes.
Lacroix, Benoît; Citovsky, Vitaly
2018-03-03
Besides the massive gene transfer from organelles to the nuclear genomes, which occurred during the early evolution of eukaryote lineages, the importance of horizontal gene transfer (HGT) in eukaryotes remains controversial. Yet, increasing amounts of genomic data reveal many cases of bacterium-to-eukaryote HGT that likely represent a significant force in adaptive evolution of eukaryotic species. However, DNA transfer involved in genetic transformation of plants by Agrobacterium species has traditionally been considered as the unique example of natural DNA transfer and integration into eukaryotic genomes. Recent discoveries indicate that the repertoire of donor bacterial species and of recipient eukaryotic hosts potentially are much wider than previously thought, including donor bacterial species, such as plant symbiotic nitrogen-fixing bacteria (e.g., Rhizobium etli) and animal bacterial pathogens (e.g., Bartonella henselae, Helicobacter pylori), and recipient species from virtually all eukaryotic clades. Here, we review the molecular pathways and potential mechanisms of these trans-kingdom HGT events and discuss their utilization in biotechnology and research.
-
Suboptimal Doses of Raltegravir Cause Aberrant HIV Integrations | Center for Cancer Research
When a cell is infected with HIV, a DNA copy of the HIV genome is inserted into that cell’s chromosomal DNA. This insertion reaction is carried out by the viral enzyme integrase (IN) and involves two distinct steps: removal of two nucleotides from each 3’ end of the viral DNA, followed by the strand transfer reaction, in which the viral DNA ends are inserted into the host
-
van den Berge, M; Ozcanhan, G; Zijlstra, S; Lindenbergh, A; Sijen, T
2016-03-01
Especially when minute evidentiary traces are analysed, background cell material unrelated to the crime may contribute to detectable levels in the genetic analyses. To gain understanding on the composition of human cell material residing on surfaces contributing to background traces, we performed DNA and mRNA profiling on samplings of various items. Samples were selected by considering events contributing to cell material deposits in exemplary activities (e.g. dragging a person by the trouser ankles), and can be grouped as public objects, private samples, transfer-related samples and washing machine experiments. Results show that high DNA yields do not necessarily relate to an increased number of contributors or to the detection of other cell types than skin. Background cellular material may be found on any type of public or private item. When a major contributor can be deduced in DNA profiles from private items, this can be a different person than the owner of the item. Also when a specific activity is performed and the areas of physical contact are analysed, the "perpetrator" does not necessarily represent the major contributor in the STR profile. Washing machine experiments show that transfer and persistence during laundry is limited for DNA and cell type dependent for RNA. Skin conditions such as the presence of sebum or sweat can promote DNA transfer. Results of this study, which encompasses 549 samples, increase our understanding regarding the prevalence of human cell material in background and activity scenarios. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
-
Introgression of the Kinetoplast DNA: An Unusual Evolutionary Journey in Trypanosoma cruzi.
Tomasini, Nicolás
2018-02-01
Phylogenetic relationships between different lineages of Trypanosoma cruzi, the agent of Chagas disease, have been controversial for several years. However, recent phylogenetic and phylogenomic analyses clarified the nuclear relationships among such lineages. However, incongruence between nuclear and kinetoplast DNA phylogenies has emerged as a new challenge. This incongruence implies several events of mitochondrial introgression at evolutionary level. However, the mechanism that gave origin to introgressed lineages is unknown. Here, I will review and discuss how maxicircles of the kinetoplast were horizontally and vertically transferred between different lineages of T. cruzi. Finally, I will discuss what we know - and what we don't - about the kDNA transference and inheritance in the context of sexual reproduction in this parasite.
-
NASA Astrophysics Data System (ADS)
Caracciolo, G.; Pozzi, D.; Caminiti, R.; Congiu Castellano, A.
2003-04-01
We investigated, for the first time, by using Energy Dispersive X-ray Diffraction, the structure of a new ternary cationic liposome formulated with dioleoyl trimethylammonium propane (DOTAP), 1,2-dioleoyl-3-phosphatidylethanolamine (DOPE) and cholesterol (Chol) (DDC) which has been recently found to have a selective high gene transfer ability in ovarian cancer cells. Our structural results provide a further experimental support to the widely accepted statement that there is not a simple and direct correlation between structure and transfection efficiency and that the factors controlling cationic lipid/DNA (CL-DNA) complexes-mediated gene transfer depend not only on the formulations of the cationic liposomes and their thermodynamic phase, but also significantly on the cell properties.
-
The mitochondrial genome in embryo technologies.
Hiendleder, S; Wolf, E
2003-08-01
The mammalian mitochondrial genome encodes for 37 genes which are involved in a broad range of cellular functions. The mitochondrial DNA (mtDNA) molecule is commonly assumed to be inherited through oocyte cytoplasm in a clonal manner, and apparently species-specific mechanisms have evolved to eliminate the contribution of sperm mitochondria after natural fertilization. However, recent evidence for paternal mtDNA inheritance in embryos and offspring questions the general validity of this model, particularly in the context of assisted reproduction and embryo biotechnology. In addition to normal mt DNA haplotype variation, oocytes and spermatozoa show remarkable differences in mtDNA content and may be affected by inherited or acquired mtDNA aberrations. All these parameters have been correlated with gamete quality and reproductive success rates. Nuclear transfer (NT) technology provides experimental models for studying interactions between nuclear and mitochondrial genomes. Recent studies demonstrated (i) a significant effect of mtDNA haplotype or other maternal cytoplasmic factors on the efficiency of NT; (ii) phenotypic differences between transmitochondrial clones pointing to functionally relevant nuclear-cytoplasmic interactions; and (iii) neutral or non-neutral selection of mtDNA haplotypes in heteroplasmic conditions. Mitochondria form a dynamic reticulum, enabling complementation of mitochondrial components and possibly mixing of different mtDNA populations in heteroplasmic individuals. Future directions of research on mtDNA in the context of reproductive biotechnology range from the elimination of adverse effects of artificial heteroplasmy, e.g. created by ooplasm transfer, to engineering of optimized constellations of nuclear and cytoplasmic genes for the production of superior livestock.
-
Molecular-Sized DNA or RNA Sequencing Machine | NCI Technology Transfer Center | TTC
The National Cancer Institute's Gene Regulation and Chromosome Biology Laboratory is seeking statements of capability or interest from parties interested in collaborative research to co-develop a molecular-sized DNA or RNA sequencing machine.
-
Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won
2014-11-01
Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates heterologous expression of large gene clusters for drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.
-
Zhang, John; Zhuang, Guanglun; Zeng, Yong; Grifo, Jamie; Acosta, Carlo; Shu, Yimin; Liu, Hui
2016-10-01
Nuclear transfer of an oocyte into the cytoplasm of another enucleated oocyte has shown that embryogenesis and implantation are influenced by cytoplasmic factors. We report a case of a 30-year-old nulligravida woman who had two failed IVF cycles characterized by all her embryos arresting at the two-cell stage and ultimately had pronuclear transfer using donor oocytes. After her third IVF cycle, eight out of 12 patient oocytes and 12 out of 15 donor oocytes were fertilized. The patient's pronuclei were transferred subzonally into an enucleated donor cytoplasm resulting in seven reconstructed zygotes. Five viable reconstructed embryos were transferred into the patient's uterus resulting in a triplet pregnancy with fetal heartbeats, normal karyotypes and nuclear genetic fingerprinting matching the mother's genetic fingerprinting. Fetal mitochondrial DNA profiles were identical to those from donor cytoplasm with no detection of patient's mitochondrial DNA. This report suggests that a potentially viable pregnancy with normal karyotype can be achieved through pronuclear transfer. Ongoing work to establish the efficacy and safety of pronuclear transfer will result in its use as an aid for human reproduction. Copyright © 2016 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.
-
Campylobacter jejuni biofilms contain extracellular DNA and are sensitive to DNase I treatment
Brown, Helen L.; Hanman, Kate; Reuter, Mark; Betts, Roy P.; van Vliet, Arnoud H. M.
2015-01-01
Biofilms make an important contribution to survival and transmission of bacterial pathogens in the food chain. The human pathogen Campylobacter jejuni is known to form biofilms in vitro in food chain-relevant conditions, but the exact roles and composition of the extracellular matrix are still not clear. Extracellular DNA has been found in many bacterial biofilms and can be a major component of the extracellular matrix. Here we show that extracellular DNA is also an important component of the C. jejuni biofilm when attached to stainless steel surfaces, in aerobic conditions and on conditioned surfaces. Degradation of extracellular DNA by exogenous addition of DNase I led to rapid biofilm removal, without loss of C. jejuni viability. Following treatment of a surface with DNase I, C. jejuni was unable to re-establish a biofilm population within 48 h. Similar results were obtained by digesting extracellular DNA with restriction enzymes, suggesting the need for high molecular weight DNA. Addition of C. jejuni genomic DNA containing an antibiotic resistance marker resulted in transfer of the antibiotic resistance marker to susceptible cells in the biofilm, presumably by natural transformation. Taken together, this suggest that eDNA is not only an important component of C. jejuni biofilms and subsequent food chain survival of C. jejuni, but may also contribute to the spread of antimicrobial resistance in C. jejuni. The degradation of extracellular DNA with enzymes such as DNase I is a rapid method to remove C. jejuni biofilms, and is likely to potentiate the activity of antimicrobial treatments and thus synergistically aid disinfection treatments. PMID:26217328
-
Campylobacter jejuni biofilms contain extracellular DNA and are sensitive to DNase I treatment.
Brown, Helen L; Hanman, Kate; Reuter, Mark; Betts, Roy P; van Vliet, Arnoud H M
2015-01-01
Biofilms make an important contribution to survival and transmission of bacterial pathogens in the food chain. The human pathogen Campylobacter jejuni is known to form biofilms in vitro in food chain-relevant conditions, but the exact roles and composition of the extracellular matrix are still not clear. Extracellular DNA has been found in many bacterial biofilms and can be a major component of the extracellular matrix. Here we show that extracellular DNA is also an important component of the C. jejuni biofilm when attached to stainless steel surfaces, in aerobic conditions and on conditioned surfaces. Degradation of extracellular DNA by exogenous addition of DNase I led to rapid biofilm removal, without loss of C. jejuni viability. Following treatment of a surface with DNase I, C. jejuni was unable to re-establish a biofilm population within 48 h. Similar results were obtained by digesting extracellular DNA with restriction enzymes, suggesting the need for high molecular weight DNA. Addition of C. jejuni genomic DNA containing an antibiotic resistance marker resulted in transfer of the antibiotic resistance marker to susceptible cells in the biofilm, presumably by natural transformation. Taken together, this suggest that eDNA is not only an important component of C. jejuni biofilms and subsequent food chain survival of C. jejuni, but may also contribute to the spread of antimicrobial resistance in C. jejuni. The degradation of extracellular DNA with enzymes such as DNase I is a rapid method to remove C. jejuni biofilms, and is likely to potentiate the activity of antimicrobial treatments and thus synergistically aid disinfection treatments.
-
DNA damage induced by the direct effect of radiation
NASA Astrophysics Data System (ADS)
Yokoya, A.; Shikazono, N.; Fujii, K.; Urushibara, A.; Akamatsu, K.; Watanabe, R.
2008-10-01
We have studied the nature of DNA damage induced by the direct effect of radiation. The yields of single- (SSB) and double-strand breaks (DSB), base lesions and clustered damage were measured using the agarose gel electrophoresis method after exposing to various kinds of radiations to a simple model DNA molecule, fully hydrated closed-circular plasmid DNA (pUC18). The yield of SSB does not show significant dependence on linear energy transfer (LET) values. On the other hand, the yields of base lesions revealed by enzymatic probes, endonuclease III (Nth) and formamidopyrimidine DNA glycosylase (Fpg), which excise base lesions and leave a nick at the damage site, strongly depend on LET values. Soft X-ray photon (150 kVp) irradiation gives a maximum yield of the base lesions detected by the enzymatic probes as SSB and clustered damage, which is composed of one base lesion and proximate other base lesions or SSBs. The clustered damage is visualized as an enzymatically induced DSB. The yields of the enzymatically additional damages strikingly decrease with increasing levels of LET. These results suggest that in higher LET regions, the repair enzymes used as probes are compromised because of the dense damage clustering. The studies using simple plasmid DNA as a irradiation sample, however, have a technical difficulty to detect multiple SSBs in a plasmid DNA. To detect the additional SSBs induced in opposite strand of the first SSB, we have also developed a novel technique of DNA-denaturation assay. This allows us to detect multiply induced SSBs in both strand of DNA, but not induced DSB.
-
Mo, Yongkai; Quanquin, Natalie M; Vecino, William H; Ranganathan, Uma Devi; Tesfa, Lydia; Bourn, William; Derbyshire, Keith M; Letvin, Norman L; Jacobs, William R; Fennelly, Glenn J
2007-10-01
Mycobacteria target and persist within phagocytic monocytes and are strong adjuvants, making them attractive candidate vectors for DNA vaccines. We characterized the ability of mycobacteria to deliver transgenes to mammalian cells and the effects of various bacterial chromosomal mutations on the efficiency of transfer in vivo and in vitro. First, we observed green fluorescent protein expression via microscopy and fluorescence-activated cell sorting analysis after infection of phagocytic and nonphagocytic cell lines by Mycobacterium smegmatis or M. bovis BCG harboring a plasmid encoding the fluorescence gene under the control of a eukaryotic promoter. Next, we compared the efficiencies of gene transfer using M. smegmatis or BCG containing chromosomal insertions or deletions that cause early lysis, hyperconjugation, or an increased plasmid copy number. We observed a significant-albeit only 1.7-fold-increase in the level of plasmid transfer to eukaryotic cells infected with M. smegmatis hyperconjugation mutants. M. smegmatis strains that overexpressed replication proteins (Rep) of pAL5000, a plasmid whose replicon is incorporated in many mycobacterial constructs, generated a 10-fold increase in plasmid copy number and 3.5-fold and 3-fold increases in gene transfer efficiency to HeLa cells and J774 cells, respectively. Although BCG strains overexpressing Rep could not be recovered, BCG harboring a plasmid with a copy-up mutation in oriM resulted in a threefold increase in gene transfer to J774 cells. Moreover, M. smegmatis strains overexpressing Rep enhanced gene transfer in vivo compared with a wild-type control. Immunization of mice with mycobacteria harboring a plasmid (pgp120(h)(E)) encoding human immunodeficiency virus gp120 elicited gp120-specific CD8 T-cell responses among splenocytes and peripheral blood mononuclear cells that were up to twofold (P < 0.05) and threefold (P < 0.001) higher, respectively, in strains supporting higher copy numbers. The magnitude of these responses was approximately one-half of that observed after intramuscular immunization with pgp120(h)(E). M. smegmatis and other nonpathogenic mycobacteria are promising candidate vectors for DNA vaccine delivery.
-
Viršek, Manca Kovač; Lovšin, Marija Nika; Koren, Špela; Kržan, Andrej; Peterlin, Monika
2017-12-15
Microplastics is widespread in the marine environment where it can cause numerous negative effects. It can provide space for the growth of organisms and serves as a vector for the long distance transfer of marine microorganisms. In this study, we examined the sea surface concentrations of microplastics in the North Adriatic and characterized bacterial communities living on the microplastics. DNA from microplastics particles was isolated by three different methods, followed by PCR amplification of 16S rDNA, clone libraries preparation and phylogenetic analysis. 28 bacterial species were identified on the microplastics particles including Aeromonas spp. and hydrocarbon-degrading bacterial species. Based on the 16S rDNA sequences the pathogenic fish bacteria Aeromonas salmonicida was identified for the first time on microplastics. Because A. salmonicida is responsible for illnesses in fish, it is crucial to get answers if and how microplastics pollution is responsible for spreading of diseases. Copyright © 2017 Elsevier Ltd. All rights reserved.
-
Researchers at the National Cancer Institute (NCI) developed a genetic assay for detecting transcription errors in RNA synthesis. This new assay extends the familiar concept of an Ames test which monitors DNA damage and synthesis errors to the previously inaccessible issue of RNA synthesis fidelity. The FDA requires genetic DNA focused tests for all drug approval as it assesses the in vivo mutagenic and carcinogenic potential of a drug. The new assay will open an approach to monitoring the impact of treatments on the accuracy of RNA synthesis. Errors in transcription have been hypothesized to be a component of aging and age-related diseases. The National Cancer Institute (NCI) seeks licensing partners for the genetic assay.
-
Jiang, Wei-jie; Jin, Fan; Zhou, Li-ming
2016-05-01
To investigate the influence of the DNA integrity of optimized sperm on the embryonic development and clinical outcomes of in vitro fertilization and embryo transfer (IVF-ET). This study included 605 cycles of conventional IVF-ET for pure oviductal infertility performed from January 1, 2013 to December 31, 2014. On the day of retrieval, we examined the DNA integrity of the sperm using the sperm chromatin dispersion method. According to the ROC curve and Youden index, we grouped the cycles based on the sperm DNA fragmentation index (DFI) threshold value for predicting implantation failure, early miscarriage, and fertilization failure, followed by analysis of the correlation between DFI and the outcomes of IVF-ET. According to the DFI threshold values obtained, the 605 cycles fell into four groups (DFI value < 5%, 5-10%, 10-15%, and ≥ 15%). Statistically significant differences were observed among the four groups in the rates of fertilization, cleavage, high-quality embryo, implantation, clinical pregnancy, early miscarriage, and live birth (P < 0.05), but not in the rates of multiple pregnancy, premature birth, and low birth weight (P > 0.05). DFI was found to be correlated negatively with the rates of fertilization (r = -0.32, P < 0.01), cleavage (r = -0.19, P < 0.01), high-quality embryo (r = -0.40, P < 0.01), clinical pregnancy (r = -0.20, P < 0.01), and live birth (r = -0.09 P = 0.04), positively with the rate of early miscarriage (r = 0.23, P < 0.01), but not with the rates of multiple pregnancy (r = -0.01, P = 0.83), premature birth (r = 0.04, P = 0.54), and low birth weight (r = 0.03, P = 0.62). The DNA integrity of optimized sperm influences fertilization, embryonic development, early miscarriage, and live birth of IVF-ET, but its correlation with premature birth and low birth weight has to be further studied.
-
A new type of localized fast moving electronic excitations in molecular chains
NASA Astrophysics Data System (ADS)
Korshunova, A. N.; Lakhno, V. D.
2014-06-01
It is shown that in a Holstein molecular chain placed in a strong longitudinal electric field some new types of excitations can arise. These excitations can transfer a charge over large distance (more than 1000 nucleotide pairs) along the chain retaining approximately their shapes. Excitations are formed only when a strong electric field either exists or quickly arises under especially preassigned conditions. These excitations transfer a charge even in the case when Holstein polarons are practically immobile. The results obtained are applied to synthetic homogeneous PolyG/PolyC DNA duplexes. They can also be provide the basis for explanation of famous H.W. Fink and C. Schönenberger experiment on long-range charge transfer in DNA.
-
DeVore, Matthew S; Gull, Stephen F; Johnson, Carey K
2012-04-05
We describe a method for analysis of single-molecule Förster resonance energy transfer (FRET) burst measurements using classic maximum entropy. Classic maximum entropy determines the Bayesian inference for the joint probability describing the total fluorescence photons and the apparent FRET efficiency. The method was tested with simulated data and then with DNA labeled with fluorescent dyes. The most probable joint distribution can be marginalized to obtain both the overall distribution of fluorescence photons and the apparent FRET efficiency distribution. This method proves to be ideal for determining the distance distribution of FRET-labeled biomolecules, and it successfully predicts the shape of the recovered distributions.
-
Forensic Science in Support of Wildlife Conservation Efforts - Genetic Approaches (Global Trends).
Linacre, A
2011-01-01
Wildlife forensic science is a relatively recent development to meet the increasing need of the criminal justice system where there are investigations in alleged transgressions of either international or national legislation. This application of science draws on conservation genetics and forensic geneticists from mainstream forensic science. This review is a broad overview of the history of forensic wildlife science and some of the recent developments in forensic wildlife genetics with the application of DNA developments to nonhuman samples encountered in a forensic science investigation. The review will move from methods to look at the entire genome, when there is no previous knowledge of the species studied, through methods of species identification, using DNA to determine a possible geographic origin, through to assigning samples to a particular individual or a close genetic relative of this individual. The transfer of research methods into the criminal justice system for the investigation of wildlife crimes has been largely successful as is illustrated in the review. The review concludes with comments on the need for standardization and regulation in wildlife forensic science. Copyright © 2011 Central Police University.
-
Jiang, Chao; Yuan, Yuan; Yang, Guang; Jin, Yan; Liu, Libing; Zhao, Yuyang; Huang, Luqi
2016-10-21
Inaccurate labeling of materials used in herbal products may compromise the therapeutic efficacy and may pose a threat to medicinal safety. In this paper, a rapid (within 3 h), sensitive and visual colorimetric method for identifying substitutions in terminal market products was developed using cationic conjugated polymer-based fluorescence resonance energy transfer (CCP-based FRET). Chinese medicinal materials with similar morphology and chemical composition were clearly distinguished by the single-nucleotide polymorphism (SNP) genotyping method. Assays using CCP-based FRET technology showed a high frequency of adulterants in Lu-Rong (52.83%) and Chuan-Bei-Mu (67.8%) decoction pieces, and patented Chinese drugs (71.4%, 5/7) containing Chuan-Bei-Mu ingredients were detected in the terminal herbal market. In comparison with DNA sequencing, this protocol simplifies procedures by eliminating the cumbersome workups and sophisticated instruments, and only a trace amount of DNA is required. The CCP-based method is particularly attractive because it can detect adulterants in admixture samples with high sensitivity. Therefore, the CCP-based detection system shows great potential for routine terminal market checks and drug safety controls.
-
Polycation-based gene therapy: current knowledge and new perspectives.
Tiera, Marcio J; Shi, Qin; Winnik, Françoise M; Fernandes, Julio C
2011-08-01
At present, gene transfection insufficient efficiency is a major drawback of non-viral gene therapy. The 2 main types of delivery systems deployed in gene therapy are based on viral or non-viral gene carriers. Several non-viral modalities can transfer foreign genetic material into the human body. To do so, polycation-based gene delivery methods must achieve sufficient efficiency in the transportation of therapeutic genes across various extracellular and intracellular barriers. These barriers include interactions with blood components, vascular endothelial cells and uptake by the reticuloendothelial system. Furthermore, the degradation of therapeutic DNA by serum nucleases is a potential obstacle for functional delivery to target cells. Cationic polymers constitute one of the most promising approaches to the use of viral vectors for gene therapy. A better understanding of the mechanisms by which DNA can escape from endosomes and traffic to enter the nucleus has triggered new strategies of synthesis and has revitalized research into new polycation-based systems. The objective of this review is to address the state of the art in gene therapy with synthetic and natural polycations and the latest advances to improve gene transfer efficiency in cells.
-
Synthetic oligodeoxynucleotides (ODN) containing unmethylated Cytosine-Guanine (CpG) motifs mimic the immunostimulatory activity of bacterial DNA. CpG ODN directly stimulate B cells and plasmacytoid dendritic cells (pDC), promote the production of T Helper 1 cells (Th1) and pro-inflammatory cytokines, and trigger the maturation/activation of professional antigen presenting cells. The National Cancer Institute, Laboratory of Experimental Immunology, seeks interested parties to co- develop methods for inducing an immune response to tumors.
-
Miyanoshita, Mitsuru; Nakashima, Takashi; Kakuta, Yoshimitsu; Kimura, Makoto
2015-01-01
Fluorescence resonance energy transfer-based assay showed that archaeal ribonuclease P (RNase P) proteins significantly promoted DNA annealing and strand displacement. Moreover, we found that archaeal RNase P proteins could discriminate nucleotide exchanges in DNA chains via their activity accelerating DNA strand displacement, suggesting that they have potential for biotechnological application to genetic diagnosis.
-
ERIC Educational Resources Information Center
Kugel, Jennifer F.
2008-01-01
An undergraduate biochemistry laboratory experiment that will teach the technique of fluorescence resonance energy transfer (FRET) while analyzing protein-induced DNA bending is described. The experiment uses the protein TATA binding protein (TBP), which is a general transcription factor that recognizes and binds specific DNA sequences known as…
-
77 FR 31624 - Office of the Director, National Institutes of Health; Notice of Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2012-05-29
... Committee Act, as amended (5 U.S.C. App.), notice is hereby given of a meeting of the Recombinant DNA... Committee: Recombinant DNA Advisory Committee. Date: June 19, 2012. Time: 9:00 a.m. to 3:30 p.m. Agenda: The NIH Recombinant DNA Advisory Committee (RAC) will discuss selected human gene transfer protocols...
-
77 FR 50516 - Office of the Director, National Institutes of Health; Notice of Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2012-08-21
... Committee Act, as amended (5 U.S.C. App.), notice is hereby given of a meeting of the Recombinant DNA... Committee: Recombinant DNA Advisory Committee. Date: September 12, 2012. Time: 2:00 p.m. to 5:00 p.m. Agenda: The NIH Recombinant DNA Advisory Committee (RAC) will discuss selected human gene transfer protocols...
-
76 FR 7224 - Office of the Director, National Institutes of Health; Notice of Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2011-02-09
... Committee Act, as amended (5 U.S.C. App.), notice is hereby given of a meeting of the Recombinant DNA... Committee: Recombinant DNA Advisory Committee. Date: March 8, 2011. Time: 11 a.m. to 3:30 p.m. Agenda: The NIH Recombinant DNA Advisory Committee (RAC) will review and discuss selected human gene transfer...
-
78 FR 11897 - Office of the Director, National Institutes of Health; Notice of Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-02-20
... Committee Act, as amended (5 U.S.C. App.), notice is hereby given of a meeting of the Recombinant DNA... Committee: Recombinant DNA Advisory Committee. Date: March 12, 2013. Time: 8:30 a.m. to 3:30 p.m. Agenda: The NIH Recombinant DNA Advisory Committee (RAC) will review and discuss selected human gene transfer...
-
75 FR 69686 - Office of the Director, National Institutes of Health; Notice of Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2010-11-15
... Committee Act, as amended (5 U.S.C. App.), notice is hereby given of a meeting of the Recombinant DNA... Committee: Recombinant DNA Advisory Committee. Date: December 7-8, 2010. Time: December 7, 2010, 12 p.m. to 6 p.m. Agenda: The NIH Recombinant DNA Advisory Committee will review selected human gene transfer...
-
DNA complexes with dyes designed for energy transfer as fluorescent markers
Glazer, Alexander M.; Benson, Scott C.
1999-01-01
Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated.
-
DNA complexes with dyes designed for energy transfer as fluorescent markers
Glazer, Alexander M.; Benson, Scott C.
1998-01-01
Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated.
-
DNA complexes with dyes designed for energy transfer as fluorescent markers
Glazer, Alexander N.; Benson, Scott C.
1995-01-01
Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated.
-
DNA complexes with dyes designed for energy transfer as fluorescent markers
Glazer, Alexander N.; Benson, Scott C.
1997-01-01
Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated.
-
Mahelka, Václav; Krak, Karol; Kopecký, David; Fehrer, Judith; Šafář, Jan; Bartoš, Jan; Hobza, Roman; Blavet, Nicolas; Blattner, Frank R
2017-02-14
The movement of nuclear DNA from one vascular plant species to another in the absence of fertilization is thought to be rare. Here, nonnative rRNA gene [ribosomal DNA (rDNA)] copies were identified in a set of 16 diploid barley ( Hordeum ) species; their origin was traceable via their internal transcribed spacer (ITS) sequence to five distinct Panicoideae genera, a lineage that split from the Pooideae about 60 Mya. Phylogenetic, cytogenetic, and genomic analyses implied that the nonnative sequences were acquired between 1 and 5 Mya after a series of multiple events, with the result that some current Hordeum sp. individuals harbor up to five different panicoid rDNA units in addition to the native Hordeum rDNA copies. There was no evidence that any of the nonnative rDNA units were transcribed; some showed indications of having been silenced via pseudogenization. A single copy of a Panicum sp. rDNA unit present in H. bogdanii had been interrupted by a native transposable element and was surrounded by about 70 kbp of mostly noncoding sequence of panicoid origin. The data suggest that horizontal gene transfer between vascular plants is not a rare event, that it is not necessarily restricted to one or a few genes only, and that it can be selectively neutral.
-
Line scanning system for direct digital chemiluminescence imaging of DNA sequencing blots
DOE Office of Scientific and Technical Information (OSTI.GOV)
Karger, A.E.; Weiss, R.; Gesteland, R.F.
A cryogenically cooled charge-coupled device (CCD) camera equipped with an area CCD array is used in a line scanning system for low-light-level imaging of chemiluminescent DNA sequencing blots. Operating the CCD camera in time-delayed integration (TDI) mode results in continuous data acquisition independent of the length of the CCD array. Scanning is possible with a resolution of 1.4 line pairs/mm at the 50% level of the modulation transfer function. High-sensitivity, low-light-level scanning of chemiluminescent direct-transfer electrophoresis (DTE) DNA sequencing blots is shown. The detection of DNA fragments on the blot involves DNA-DNA hybridization with oligonucleotide-alkaline phosphatase conjugate and 1,2-dioxetane-based chemiluminescence.more » The width of the scan allows the recording of up to four sequencing reactions (16 lanes) on one scan. The scan speed of 52 cm/h used for the sequencing blots corresponds to a data acquisition rate of 384 pixels/s. The chemiluminescence detection limit on the scanned images is 3.9 [times] 10[sup [minus]18] mol of plasmid DNA. A conditional median filter is described to remove spikes caused by cosmic ray events from the CCD images. 39 refs., 9 refs.« less
-
Fang, Huimin; Huangfu, Liexiang; Chen, Rujia; Li, Pengcheng; Xu, Shuhui; Zhang, Enying; Cao, Wei; Liu, Li; Yao, Youli; Liang, Guohua; Xu, Chenwu; Zhou, Yong; Yang, Zefeng
2017-08-24
The origin and evolution of land plants was an important event in the history of life and initiated the establishment of modern terrestrial ecosystems. From water to terrestrial environments, plants needed to overcome the enhanced ultraviolet (UV) radiation and many other DNA-damaging agents. Evolving new genes with the function of DNA repair is critical for the origin and radiation of land plants. In bacteria, the DNA-3-methyladenine glycosylase (MAG) recognizes of a variety of base lesions and initiates the process of the base excision repair for damaged DNA. The homologs of MAG gene are present in all major lineages of streptophytes, and both the phylogenic and sequence similarity analyses revealed that green plant MAG gene originated through an ancient horizontal gene transfer (HGT) event from bacteria. Experimental evidence demonstrated that the expression of the maize ZmMAG gene was induced by UV and zeocin, both of which are known as DNA-damaging agents. Further investigation revealed that Streptophyta MAG genes had undergone positive selection during the initial evolutionary period in the ancestor of land plants. Our findings demonstrated that the ancient HGT of MAG to the ancestor of land plants probably played an important role in preadaptation to DNA-damaging agents in terrestrial environments.
-
Small RNAs Derived from the T-DNA of Agrobacterium rhizogenes in Hairy Roots of Phaseolus vulgaris
Peláez, Pablo; Hernández-López, Alejandrina; Estrada-Navarrete, Georgina; Sanchez, Federico
2017-01-01
Agrobacterium rhizogenes is a pathogenic bacteria that causes hairy root disease by transferring bacterial DNA into the plant genome. It is an essential tool for industry and research due to its capacity to produce genetically modified roots and whole organisms. Here, we identified and characterized small RNAs generated from the transfer DNA (T-DNA) of A. rhizogenes in hairy roots of common bean (Phaseolus vulgaris). Distinct abundant A. rhizogenes T-DNA-derived small RNAs (ArT-sRNAs) belonging to several oncogenes were detected in hairy roots using high-throughput sequencing. The most abundant and diverse species of ArT-sRNAs were those of 21- and 22-nucleotides in length. Many T-DNA encoded genes constituted phasiRNA producing loci (PHAS loci). Interestingly, degradome analysis revealed that ArT-sRNAs potentially target genes of P. vulgaris. In addition, we detected low levels of ArT-sRNAs in the A. rhizogenes-induced calli generated at the wound site before hairy root emergence. These results suggest that RNA silencing targets several genes from T-DNA of A. rhizogenes in hairy roots of common bean. Therefore, the role of RNA silencing observed in this study has implications in our understanding and usage of this unique plant-bacteria interaction. PMID:28203245
-
Burke, Sean V; Wysocki, William P; Zuloaga, Fernando O; Craine, Joseph M; Pires, J Chris; Edger, Patrick P; Mayfield-Jones, Dustin; Clark, Lynn G; Kelchner, Scot A; Duvall, Melvin R
2016-06-18
Panicoideae are the second largest subfamily in Poaceae (grass family), with 212 genera and approximately 3316 species. Previous studies have begun to reveal relationships within the subfamily, but largely lack resolution and/or robust support for certain tribal and subtribal groups. This study aims to resolve these relationships, as well as characterize a putative mitochondrial insert in one linage. 35 newly sequenced Panicoideae plastomes were combined in a phylogenomic study with 37 other species: 15 Panicoideae and 22 from outgroups. A robust Panicoideae topology largely congruent with previous studies was obtained, but with some incongruences with previously reported subtribal relationships. A mitochondrial DNA (mtDNA) to plastid DNA (ptDNA) transfer was discovered in the Paspalum lineage. The phylogenomic analysis returned a topology that largely supports previous studies. Five previously recognized subtribes appear on the topology to be non-monophyletic. Additionally, evidence for mtDNA to ptDNA transfer was identified in both Paspalum fimbriatum and P. dilatatum, and suggests a single rare event that took place in a common progenitor. Finally, the framework from this study can guide larger whole plastome sampling to discern the relationships in Cyperochloeae, Steyermarkochloeae, Gynerieae, and other incertae sedis taxa that are weakly supported or unresolved.
-
Model studies on the detectability of genetically modified feeds in milk.
Poms, R E; Hochsteiner, W; Luger, K; Glössl, J; Foissy, H
2003-02-01
Detecting the use of genetically modified feeds in milk has become important, because the voluntary labeling of milk and dairy products as "GMO free" or as "organically grown" prohibits the employment of genetically modified organisms (GMOs). The aim of this work was to investigate whether a DNA transfer from foodstuffs like soya and maize was analytically detectable in cow's milk after digestion and transportation via the bloodstream of dairy cows and, thus, whether milk could report for the employment of transgene feeds. Blood, milk, urine, and feces of dairy cows were examined, and foreign DNA was detected by polymerase chain reaction by specifically amplifying a 226-bp fragment of the maize invertase gene and a 118-bp fragment of the soya lectin gene. An intravenous application of purified plant DNA showed a fast elimination of marker DNA in blood or its reduction below the detection limit. With feeding experiments, it could be demonstrated that a specific DNA transfer from feeds into milk was not detectable. Therefore, foreign DNA in milk cannot serve as an indicator for the employment of transgene feeds unless milk is directly contaminated with feed components or airborne feed particles.
-
Formation of Clustered DNA Damage after High-LET Irradiation: A Review
NASA Technical Reports Server (NTRS)
Hada, Megumi; Georgakilas, Alexandros G.
2008-01-01
Radiation can cause as well as cure cancer. The risk of developing radiation-induced cancer has traditionally been estimated from cancer incidence among survivors of the atomic bombs in Hiroshima and Nagasaki. These data provide the best estimate of human cancer risk over the dose range for low linear energy transfer (LET) radiations, such as X- or gamma-rays. The situation of estimating the real biological effects becomes even more difficult in the case of high LET particles encountered in space or as the result of domestic exposure to particles from radon gas emitters or other radioactive emitters like uranium-238. Complex DNA damage, i.e., the signature of high-LET radiations comprises by closely spaced DNA lesions forming a cluster of DNA damage. The two basic groups of complex DNA damage are double strand breaks (DSBs) and non-DSB oxidative clustered DNA lesions (OCDL). Theoretical analysis and experimental evidence suggest there is increased complexity and severity of complex DNA damage with increasing LET (linear energy transfer) and a high mutagenic or carcinogenic potential. Data available on the formation of clustered DNA damage (DSBs and OCDL) by high-LET radiations are often controversial suggesting a variable response to dose and type of radiation. The chemical nature and cellular repair mechanisms of complex DNA damage have been much less characterized than those of isolated DNA lesions like an oxidized base or a single strand break especially in the case of high-LET radiation. This review will focus on the induction of clustered DNA damage by high-LET radiations presenting the earlier and recent relative data.
-
DNA nanostructures: Through, rather than across
NASA Astrophysics Data System (ADS)
Bruchez, Marcel P.
2018-02-01
Dye molecules are shown to assemble into J-aggregate arrays by sequence-specific organization in the minor groove of DNA duplex sequences. Energy transfer through these structures displays the hallmarks of coherent coupling over distances that exceed those of conventional dipole-coupling processes.
-
Kongklieng, Amornmas; Intapan, Pewpan M; Boonmars, Thidarut; Thanchomnang, Tongjit; Janwan, Penchom; Sanpool, Oranuch; Lulitanond, Viraphong; Taweethavonsawat, Piyanan; Chungpivat, Sudchit; Maleewong, Wanchai
2015-03-01
A real-time fluorescence resonance energy transfer polymerase chain reaction (qFRET PCR) coupled with melting curve analysis was developed for detection of Babesia canis vogeli and Hepatozoon canis infections in canine blood samples in a single tube assay. The target of the assay was a region within the 18S ribosomal RNA gene amplified in either species by a single pair of primers. Following amplification from the DNA of infected dog blood, a fluorescence melting curve analysis was done. The 2 species, B. canis vogeli and H. canis, could be detected and differentiated in infected dog blood samples (n = 37) with high sensitivity (100%). The detection limit for B. canis vogeli was 15 copies of a positive control plasmid, and for H. canis, it was 150 copies of a positive control plasmid. The assay could simultaneously distinguish the DNA of both parasites from the DNA of controls. Blood samples from 5 noninfected dogs were negative, indicating high specificity. Several samples can be run at the same time. The assay can reduce misdiagnosis and the time associated with microscopic examination, and is not prone to the carryover contamination associated with the agarose gel electrophoresis step of conventional PCR. In addition, this qFRET PCR method would be useful to accurately determine the range of endemic areas or to discover those areas where the 2 parasites co-circulate. © 2015 The Author(s).
-
Overcoming the Coupling Dilemma in DNA-Programmable Nanoparticle Assemblies by "Ag+ Soldering".
Wang, Huiqiao; Li, Yulin; Liu, Miao; Gong, Ming; Deng, Zhaoxiang
2015-05-20
Strong coupling between nanoparticles is critical for facilitating charge and energy transfers. Despite the great success of DNA-programmable nanoparticle assemblies, the very weak interparticle coupling represents a key barrier to various applications. Here, an extremely simple, fast, and highly efficient process combining DNA-programming and molecular/ionic bonding is developed to address this challenge, which exhibits a seamless fusion with DNA nanotechnology. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.