Sample records for donor strand complementation

  1. Sak and Sak4 recombinases are required for bacteriophage replication in Staphylococcus aureus

    PubMed Central

    Neamah, Maan M.; Mir-Sanchis, Ignacio; López-Sanz, María; Acosta, Sonia; Baquedano, Ignacio; Haag, Andreas F.

    2017-01-01

    Abstract DNA-single strand annealing proteins (SSAPs) are recombinases frequently encoded in the genome of many bacteriophages. As SSAPs can promote homologous recombination among DNA substrates with an important degree of divergence, these enzymes are involved both in DNA repair and in the generation of phage mosaicisms. Here, analysing Sak and Sak4 as representatives of two different families of SSAPs present in phages infecting the clinically relevant bacterium Staphylococcus aureus, we demonstrate for the first time that these enzymes are absolutely required for phage reproduction. Deletion of the genes encoding these enzymes significantly reduced phage replication and the generation of infectious particles. Complementation studies revealed that these enzymes are required both in the donor (after prophage induction) and in the recipient strain (for infection). Moreover, our results indicated that to perform their function SSAPs require the activity of their cognate single strand binding (Ssb) proteins. Mutational studies demonstrated that the Ssb proteins are also required for phage replication, both in the donor and recipient strain. In summary, our results expand the functions attributed to the Sak and Sak4 proteins, and demonstrate that both SSAPs and Ssb proteins are essential for the life cycle of temperate staphylococcal phages. PMID:28475766

  2. Donor Brain Death Exacerbates Complement-Dependent Ischemia Reperfusion Injury in Transplanted Hearts

    PubMed Central

    Atkinson, Carl; Floerchinger, Bernhard; Qiao, Fei; Casey, Sarah; Williamson, Tucker; Moseley, Ellen; Stoica, Serban; Goddard, Martin; Ge, Xupeng; Tullius, Stefan G.; Tomlinson, Stephen

    2013-01-01

    Background Brain death (BD) can immunologically prime the donor organ and is thought to lead to exacerbated ischemia reperfusion injury (IRI) post-transplantation. Using a newly developed mouse model of BD, we investigated the effect of donor BD on post transplant cardiac IRI. We further investigated the therapeutic effect of a targeted complement inhibitor in recipients of BD donor hearts, and addressed the clinical relevance of these studies by analysis of human heart biopsies from BD and domino (living) donors. Methods and Results Hearts from living or brain dead donor C57BL/6 mice were transplanted into C57BL/6 or BALB/c recipients. Recipient mice were treated with the complement inhibitor CR2-Crry or vehicle control (n=6). Isografts were analyzed 48 hours post-transplant for injury, inflammation and complement deposition, and allografts monitored for graft survival. Human cardiac biopsies were analyzed for complement deposition and inflammatory cell infiltration. In the murine model, donor BD exacerbated IRI and graft rejection as demonstrated by increased myocardial injury, serum cardiac troponin, cellular infiltration, inflammatory chemokine and cytokine levels, complement deposition, and decreased graft survival. CR2-Crry treatment of recipients significantly reduced all measured outcomes in grafts from both BD and living donors compared to controls. Analysis of human samples documented the relevance of our experimental findings and revealed exacerbated complement deposition and inflammation in grafts from BD donors compared to grafts from living donors. Conclusions BD exacerbates post-transplant cardiac IRI in mice and humans, and decreases survival of mouse allografts. Further, targeted complement inhibition in recipient mice ameliorates BD-exacerbated IRI. PMID:23443736

  3. Sak and Sak4 recombinases are required for bacteriophage replication in Staphylococcus aureus.

    PubMed

    Neamah, Maan M; Mir-Sanchis, Ignacio; López-Sanz, María; Acosta, Sonia; Baquedano, Ignacio; Haag, Andreas F; Marina, Alberto; Ayora, Silvia; Penadés, José R

    2017-06-20

    DNA-single strand annealing proteins (SSAPs) are recombinases frequently encoded in the genome of many bacteriophages. As SSAPs can promote homologous recombination among DNA substrates with an important degree of divergence, these enzymes are involved both in DNA repair and in the generation of phage mosaicisms. Here, analysing Sak and Sak4 as representatives of two different families of SSAPs present in phages infecting the clinically relevant bacterium Staphylococcus aureus, we demonstrate for the first time that these enzymes are absolutely required for phage reproduction. Deletion of the genes encoding these enzymes significantly reduced phage replication and the generation of infectious particles. Complementation studies revealed that these enzymes are required both in the donor (after prophage induction) and in the recipient strain (for infection). Moreover, our results indicated that to perform their function SSAPs require the activity of their cognate single strand binding (Ssb) proteins. Mutational studies demonstrated that the Ssb proteins are also required for phage replication, both in the donor and recipient strain. In summary, our results expand the functions attributed to the Sak and Sak4 proteins, and demonstrate that both SSAPs and Ssb proteins are essential for the life cycle of temperate staphylococcal phages. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Discriminating the hemolytic risk of blood type A plasmas using the complement hemolysis using human erythrocytes (CHUHE) assay.

    PubMed

    Cunnion, Kenji M; Hair, Pamela S; Krishna, Neel K; Sass, Megan A; Enos, Clinton W; Whitley, Pamela H; Maes, Lanne Y; Goldberg, Corinne L

    2017-03-01

    The agglutination-based cross-matching method is sensitive for antibody binding to red blood cells but is only partially predictive of complement-mediated hemolysis, which is important in many acute hemolytic transfusion reactions. Here, we describe complement hemolysis using human erythrocytes (CHUHE) assays that directly evaluate complement-mediated hemolysis between individual serum-plasma and red blood cell combinations. The CHUHE assay is used to evaluate correlations between agglutination titers and complement-mediated hemolysis as well as the hemolytic potential of plasma from type A blood donors. Plasma or serum from each type A blood donor was incubated with AB or B red blood cells in the CHUHE assay and measured for free hemoglobin release. CHUHE assays for serum or plasma demonstrate a wide, dynamic range and high sensitivity for complement-mediated hemolysis for individual serum/plasma and red blood cell combinations. CHUHE results suggest that agglutination assays alone are only moderately predictive of complement-mediated hemolysis. CHUHE results also suggest that plasma from particular type A blood donors produce minimal complement-mediated hemolysis, whereas plasma from other type A blood donors produce moderate to high-level complement-mediated hemolysis, depending on the red blood cell donor. The current results indicate that the CHUHE assay can be used to assess complement-mediated hemolysis for plasma or serum from a type A blood donor, providing additional risk discrimination over agglutination titers alone. © 2016 AABB.

  5. Intracellular generation of single-strand template increases the knock-in efficiency by combining CRISPR/Cas9 with AAV.

    PubMed

    Xiao, Qing; Min, Taishan; Ma, Shuangping; Hu, Lingna; Chen, Hongyan; Lu, Daru

    2018-04-18

    Targeted integration of transgenes facilitates functional genomic research and holds prospect for gene therapy. The established microhomology-mediated end-joining (MMEJ)-based strategy leads to the precise gene knock-in with easily constructed donor, yet the limited efficiency remains to be further improved. Here, we show that single-strand DNA (ssDNA) donor contributes to efficient increase of knock-in efficiency and establishes a method to achieve the intracellular linearization of long ssDNA donor. We identified that the CRISPR/Cas9 system is responsible for breaking double-strand DNA (dsDNA) of palindromic structure in inverted terminal repeats (ITRs) region of recombinant adeno-associated virus (AAV), leading to the inhibition of viral second-strand DNA synthesis. Combing Cas9 plasmids targeting genome and ITR with AAV donor delivery, the precise knock-in of gene cassette was achieved, with 13-14% of the donor insertion events being mediated by MMEJ in HEK 293T cells. This study describes a novel method to integrate large single-strand transgene cassettes into the genomes, increasing knock-in efficiency by 13.6-19.5-fold relative to conventional AAV-mediated method. It also provides a comprehensive solution to the challenges of complicated production and difficult delivery with large exogenous fragments.

  6. In trans paired nicking triggers seamless genome editing without double-stranded DNA cutting.

    PubMed

    Chen, Xiaoyu; Janssen, Josephine M; Liu, Jin; Maggio, Ignazio; 't Jong, Anke E J; Mikkers, Harald M M; Gonçalves, Manuel A F V

    2017-09-22

    Precise genome editing involves homologous recombination between donor DNA and chromosomal sequences subjected to double-stranded DNA breaks made by programmable nucleases. Ideally, genome editing should be efficient, specific, and accurate. However, besides constituting potential translocation-initiating lesions, double-stranded DNA breaks (targeted or otherwise) are mostly repaired through unpredictable and mutagenic non-homologous recombination processes. Here, we report that the coordinated formation of paired single-stranded DNA breaks, or nicks, at donor plasmids and chromosomal target sites by RNA-guided nucleases based on CRISPR-Cas9 components, triggers seamless homology-directed gene targeting of large genetic payloads in human cells, including pluripotent stem cells. Importantly, in addition to significantly reducing the mutagenicity of the genome modification procedure, this in trans paired nicking strategy achieves multiplexed, single-step, gene targeting, and yields higher frequencies of accurately edited cells when compared to the standard double-stranded DNA break-dependent approach.CRISPR-Cas9-based gene editing involves double-strand breaks at target sequences, which are often repaired by mutagenic non-homologous end-joining. Here the authors use Cas9 nickases to generate coordinated single-strand breaks in donor and target DNA for precise homology-directed gene editing.

  7. Ligand reprogramming in dinuclear helicate complexes: a consequence of allosteric or electrostatic effects?

    PubMed

    Jeffery, John C; Rice, Craig R; Harding, Lindsay P; Baylies, Christian J; Riis-Johannessen, Thomas

    2007-01-01

    The ditopic ligand 6,6'-bis(4-methylthiazol-2-yl)-3,3'-([18]crown-6)-2,2'-bipyridine (L(1)) contains both a potentially tetradentate pyridyl-thiazole (py-tz) N-donor chain and an additional "external" crown ether binding site which spans the central 2,2'-bipyridine unit. In polar solvents (MeCN, MeNO(2)) this ligand forms complexes with Zn(II), Cd(II), Hg(II) and Cu(I) ions via coordination of the N donors to the metal ion. Reaction with both Hg(II) and Cu(I) ions results in the self-assembly of dinuclear double-stranded helicate complexes. The ligands are partitioned by rotation about the central py--py bond, such that each can coordinate to both metals as a bis-bidentate donor ligand. With Zn(II) ions a single-stranded mononuclear species is formed in which one ligand coordinates the metal ion in a planar tetradentate fashion. Reaction with Cd(II) ions gives rise to an equilibrium between both the dinuclear double-stranded helicate and the mononuclear species. These complexes can further coordinate s-block metal cations via the remote crown ether O-donor domains; a consequence of which are some remarkable changes in the binding modes of the N-donor domains. Reaction of the Hg(II)- or Cd(II)-containing helicate with either Ba(2+) or Sr(2+) ions effectively reprogrammes the ligand to form only the single-stranded heterobinuclear complexes [MM'(L(1))](4+) (M=Hg(II), Cd(II); M'=Ba(2+), Sr(2+)), where the transition and s-block cations reside in the N- and O-donor sites, respectively. In contrast, the same ions have only a minor structural impact on the Zn(II) species, which already exists as a single-stranded mononuclear complex. Similar reactions with the Cd(II) system result in a shift in equilibrium towards the single-stranded species, the extent of which depends on the size and charge of the s-block cation in question. Reaction of the dicopper(I) double-stranded helicate with Ba(2+) shows that the dinuclear structure still remains intact but the pitch length is significantly increased.

  8. Donor Polymorphisms in Genes Related to B-Cell Biology Associated With Antibody-Mediated Rejection After Heart Transplantation.

    PubMed

    Marrón-Liñares, Grecia M; Núñez, Lucía; Crespo-Leiro, María G; Álvarez-López, Eloy; Barge-Caballero, Eduardo; Barge-Caballero, Gonzalo; Couto-Mallón, David; Pradas-Irun, Concepción; Muñiz, Javier; Tan, Carmela; Rodríguez, E Rene; Vázquez-Rodríguez, José Manuel; Hermida-Prieto, Manuel

    2018-04-25

    Heart transplantation (HT) is a well-established lifesaving treatment for endstage cardiac failure. Antibody-mediated rejection (AMR) represents one of the main problems after HT because of its diagnostic complexity and the poor evidence for supporting treatments. Complement cascade and B-cells play a key role in AMR and contribute to graft damage. This study explored the importance of variants in genes related to complement pathway and B-cell biology in HT and AMR in donors and in donor-recipient pairs.Methods and Results:Genetic variants in 112 genes (51 complement and 61 B-cell biology genes) were analyzed on next-generation sequencing in 28 donor-recipient pairs, 14 recipients with and 14 recipients without AMR. Statistical analysis was performed with SNPStats, R, and EPIDAT3.1. We identified one single nucleotide polymorphism (SNP) in donors in genes related to B-cell biology,interleukin-4 receptor subunitα (p.Ile75Val-IL4Rα), which correlated with the development of AMR. Moreover, in the analysis of recipient-donor genotype discrepancies, we identified another SNP, in this case inadenosine deaminase(ADA; p.Val178(p=)), which was related to B-cell biology, associated with the absence of AMR. Donor polymorphisms and recipient-donor discrepancies in genes related to the biology of B-cells, could have an important role in the development of AMR. In contrast, no variants in donor or in donor-recipient pairs in complement pathways seem to have an impact on AMR.

  9. Identification of cis-acting elements on positive-strand subgenomic mRNA required for the synthesis of negative-strand counterpart in bovine coronavirus.

    PubMed

    Yeh, Po-Yuan; Wu, Hung-Yi

    2014-07-30

    It has been demonstrated that, in addition to genomic RNA, sgmRNA is able to serve as a template for the synthesis of the negative-strand [(-)-strand] complement. However, the cis-acting elements on the positive-strand [(+)-strand] sgmRNA required for (-)-strand sgmRNA synthesis have not yet been systematically identified. In this study, we employed real-time quantitative reverse transcription polymerase chain reaction to analyze the cis-acting elements on bovine coronavirus (BCoV) sgmRNA 7 required for the synthesis of its (-)-strand counterpart by deletion mutagenesis. The major findings are as follows. (1) Deletion of the 5'-terminal leader sequence on sgmRNA 7 decreased the synthesis of the (-)-strand sgmRNA complement. (2) Deletions of the 3' untranslated region (UTR) bulged stem-loop showed no effect on (-)-strand sgmRNA synthesis; however, deletion of the 3' UTR pseudoknot decreased the yield of (-)-strand sgmRNA. (3) Nucleotides positioned from -15 to -34 of the sgmRNA 7 3'-terminal region are required for efficient (-)-strand sgmRNA synthesis. (4) Nucleotide species at the 3'-most position (-1) of sgmRNA 7 is correlated to the efficiency of (-)-strand sgmRNA synthesis. These results together suggest, in principle, that the 5'- and 3'-terminal sequences on sgmRNA 7 harbor cis-acting elements are critical for efficient (-)-strand sgmRNA synthesis in BCoV.

  10. Chlamydomonas chloroplasts can use short dispersed repeats and multiple pathways to repair a double-strand break in the genome.

    PubMed

    Odom, Obed W; Baek, Kwang-Hyun; Dani, Radhika N; Herrin, David L

    2008-03-01

    Certain group I introns insert into intronless DNA via an endonuclease that creates a double-strand break (DSB). There are two models for intron homing in phage: synthesis-dependent strand annealing (SDSA) and double-strand break repair (DSBR). The Cr.psbA4 intron homes efficiently from a plasmid into the chloroplast psbA gene in Chlamydomonas, but little is known about the mechanism. Analysis of co-transformants selected using a spectinomycin-resistant 16S gene (16S(spec)) provided evidence for both pathways. We also examined the consequences of the donor DNA having only one-sided or no homology with the psbA gene. When there was no homology with the donor DNA, deletions of up to 5 kb involving direct repeats that flank the psbA gene were obtained. Remarkably, repeats as short as 15 bp were used for this repair, which is consistent with the single-strand annealing (SSA) pathway. When the donor had one-sided homology, the DSB in most co-transformants was repaired using two DNAs, the donor and the 16S(spec) plasmid, which, coincidentally, contained a region that is repeated upstream of psbA. DSB repair using two separate DNAs provides further evidence for the SDSA pathway. These data show that the chloroplast can repair a DSB using short dispersed repeats located proximally, distally, or even on separate molecules relative to the DSB. They also provide a rationale for the extensive repertoire of repeated sequences in this genome.

  11. Protein- protein interaction detection system using fluorescent protein microdomains

    DOEpatents

    Waldo, Geoffrey S.; Cabantous, Stephanie

    2010-02-23

    The invention provides a protein labeling and interaction detection system based on engineered fragments of fluorescent and chromophoric proteins that require fused interacting polypeptides to drive the association of the fragments, and further are soluble and stable, and do not change the solubility of polypeptides to which they are fused. In one embodiment, a test protein X is fused to a sixteen amino acid fragment of GFP (.beta.-strand 10, amino acids 198-214), engineered to not perturb fusion protein solubility. A second test protein Y is fused to a sixteen amino acid fragment of GFP (.beta.-strand 11, amino acids 215-230), engineered to not perturb fusion protein solubility. When X and Y interact, they bring the GFP strands into proximity, and are detected by complementation with a third GFP fragment consisting of GFP amino acids 1-198 (strands 1-9). When GFP strands 10 and 11 are held together by interaction of protein X and Y, they spontaneous association with GFP strands 1-9, resulting in structural complementation, folding, and concomitant GFP fluorescence.

  12. Xeroderma pigmentosum complementation group C cells remove pyrimidine dimers selectively from the transcribed strand of active genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Venema, J.; van Hoffen, A.; Karcagi, V.

    1991-08-01

    The authors have measured the removal of UV-induced pyrimidine dimers from DNA fragments of the adenosine deaminase (ADA) and dihydrofolate reductase (DHFR) genes in primary normal human and xeroderma pigmentosum complementation group C (XP-C) cells. Using strand-specific probes, we show that in normal cells, preferential repair of the 5{prime} part of the ADA gene is due to the rapid and efficient repair of the transcribed strand. Within 8 h after irradiation with UV at 10 J m-2, 70% of the pyrimidine dimers in this strand are removed. The nontranscribed strand is repaired at a much slower rate, with 30% dimersmore » removed after 8 h. Repair of the transcribed strand in XP-C cells occurs at a rate indistinguishable from that in normal cells, but the nontranscribed strand is not repaired significantly in these cells. Similar results were obtained for the DHFR gene. In the 3{prime} part of the ADA gene, however, both normal and XP-C cells perform fast and efficient repair of either strand, which is likely to be caused by the presence of transcription units on both strands. The factor defective in XP-C cells is apparently involved in the processing of DNA damage in inactive parts of the genome, including nontranscribed strands of active genes. These findings have important implications for the understanding of the mechanism of UV-induced excision repair and mutagenesis in mammalian cells.« less

  13. Modular supramolecular approach for co-crystallization of donors and acceptors into ordered networks

    DOEpatents

    Stupp, Samuel I.; Stoddart, J. Fraser; Shveyd, Alex K.; Tayi, Alok S.; Sue, Andrew C. H.; Narayanan, Ashwin

    2016-09-20

    Organic charge-transfer (CT) co-crystals in a mixed stack system are disclosed, wherein a donor molecule (D) and an acceptor molecule (A) occupy alternating positions (DADADA) along the CT axis. A platform is provided which amplifies the molecular recognition of donors and acceptors and produces co-crystals at ambient conditions, wherein the platform comprises (i) a molecular design of the first constituent (.alpha.-complement), (ii) a molecular design of the second compound (.beta.-complement), and (iii) a solvent system that promotes co-crystallization.

  14. Modular supramolecular approach for co-crystallization of donors and acceptors into ordered networks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stupp, Samuel I.; Stoddart, J. Fraser; Shveyd, Alexander K.

    Organic charge-transfer (CT) co-crystals in a mixed stack system are disclosed, wherein a donor molecule (D) and an acceptor molecule (A) occupy alternating positions (DADADA) along the CT axis. A platform is provided which amplifies the molecular recognition of donors and acceptors and produces co-crystals at ambient conditions, wherein the platform comprises (i) a molecular design of the first constituent (.alpha.-complement), (ii) a molecular design of the second compound (.beta.-complement), and (iii) a solvent system that promotes co-crystallization.

  15. Assessment of donor/recipient ratios in permethrin transfer studies with Reticulitermes virginicus Banks

    Treesearch

    T. G. Shelton

    2012-01-01

    Crowding of termites may influence observed recipient mortality in donor-recipient toxicant transfer studies. It was hypothesized that if crowding were important, any termiticide (particularly repellent termiticides, which were not thought to transfer) could be transferred by contact among termites when the donor complement was sufficient. Termiticide transfer donor-...

  16. Trinucleotide's quadruplet symmetries and natural symmetry law of DNA creation ensuing Chargaff's second parity rule.

    PubMed

    Rosandić, Marija; Vlahović, Ines; Glunčić, Matko; Paar, Vladimir

    2016-07-01

    For almost 50 years the conclusive explanation of Chargaff's second parity rule (CSPR), the equality of frequencies of nucleotides A=T and C=G or the equality of direct and reverse complement trinucleotides in the same DNA strand, has not been determined yet. Here, we relate CSPR to the interstrand mirror symmetry in 20 symbolic quadruplets of trinucleotides (direct, reverse complement, complement, and reverse) mapped to double-stranded genome. The symmetries of Q-box corresponding to quadruplets can be obtained as a consequence of Watson-Crick base pairing and CSPR together. Alternatively, assuming Natural symmetry law for DNA creation that each trinucleotide in one strand of DNA must simultaneously appear also in the opposite strand automatically leads to Q-box direct-reverse mirror symmetry which in conjunction with Watson-Crick base pairing generates CSPR. We demonstrate quadruplet's symmetries in chromosomes of wide range of organisms, from Escherichia coli to Neanderthal and human genomes, introducing novel quadruplet-frequency histograms and 3D-diagrams with combined interstrand frequencies. These "landscapes" are mutually similar in all mammals, including extinct Neanderthals, and somewhat different in most of older species. In human chromosomes 1-12, and X, Y the "landscapes" are almost identical and slightly different in the remaining smaller and telocentric chromosomes. Quadruplet frequencies could provide a new robust tool for characterization and classification of genomes and their evolutionary trajectories.

  17. Improvement of DNA adenylation using T4 DNA ligase with a template strand and a strategically mismatched acceptor strand

    PubMed Central

    Patel, Maha P.; Baum, Dana A.; Silverman, Scott K.

    2008-01-01

    DNA with a 5′-adenylpyrophosphoryl cap (5′-adenylated DNA; AppDNA) is an activated form of DNA that is the biochemical intermediate of the reactions catalyzed by DNA ligase, RNA ligase, polynucleotide kinase, and other nucleic acid modifying enzymes. 5′-Adenylated DNA is also useful for in vitro selection experiments. Efficient preparation of 5′-adenylated DNA is therefore desirable for several biochemical applications. Here we have developed a DNA adenylation procedure that uses T4 DNA ligase and is more reliable than a previously reported approach that used the 5′-phosphorylated donor DNA substrate to be adenylated, a DNA template, and ATP but no acceptor strand. Our improved DNA adenylation procedure uses the above components as well as an acceptor strand that has a strategically chosen C-T acceptor-template mismatch directly adjacent to the adenylation site. This mismatch permits adenylation of the donor DNA substrate but largely suppresses subsequent ligation of the donor with the acceptor, as assayed on nine different DNA substrates that collectively have all four DNA nucleotides represented at each of the first two positions. The new DNA adenylation procedure is successful using either laboratory-prepared or commercial T4 DNA ligase and works well on the preparative (2 nmol) scale for all nine of the test DNA substrates. PMID:18022669

  18. Polarity of recombination in transformation of Streptococcus pneumoniae

    PubMed Central

    Pasta, Franck; Sicard, Michel A.

    1999-01-01

    In transformation of Streptococcus pneumoniae DNA enters the cell as single-strand fragments and integrates into the chromosome by homologous recombination. Deletions and insertions of a few hundred base pairs frequently stop the recombination process of a donor strand. In this work we took advantage of such interruptions of recombination to compare the transformation efficiencies of the segments 5′- and 3′-ward from a deletion. The deletion was created in the center of a fragment of the ami locus, and sites around the deletion were labeled by a frameshift generating a restriction site. Heteroduplexes were constructed containing two restriction sites on one strand and two different ones on the complementary strand. ami+ bacteria were transformed with such heteroduplexes. ami− transformants were isolated and individually underwent amplification of the transformed ami region. We have obtained two kinds of amplification products: short when the deletion was integrated, long when recombination stops at the deletion. Each long fragment was tested by the four restriction enzymes to detect which strand and which side of the deletion had recombined. We found that 80% of the cuts were located 5′ to the deletion, showing that, in vivo, the 5′ side is strongly favored by recombination. Further results suggest that exchanges occurring from 5′ to 3′ relative to the donor strand are more efficient than in the opposite direction, thus accounting for the 5′ preference. PMID:10077616

  19. Polarity of recombination in transformation of Streptococcus pneumoniae.

    PubMed

    Pasta, F; Sicard, M A

    1999-03-16

    In transformation of Streptococcus pneumoniae DNA enters the cell as single-strand fragments and integrates into the chromosome by homologous recombination. Deletions and insertions of a few hundred base pairs frequently stop the recombination process of a donor strand. In this work we took advantage of such interruptions of recombination to compare the transformation efficiencies of the segments 5'- and 3'-ward from a deletion. The deletion was created in the center of a fragment of the ami locus, and sites around the deletion were labeled by a frameshift generating a restriction site. Heteroduplexes were constructed containing two restriction sites on one strand and two different ones on the complementary strand. ami+ bacteria were transformed with such heteroduplexes. ami- transformants were isolated and individually underwent amplification of the transformed ami region. We have obtained two kinds of amplification products: short when the deletion was integrated, long when recombination stops at the deletion. Each long fragment was tested by the four restriction enzymes to detect which strand and which side of the deletion had recombined. We found that 80% of the cuts were located 5' to the deletion, showing that, in vivo, the 5' side is strongly favored by recombination. Further results suggest that exchanges occurring from 5' to 3' relative to the donor strand are more efficient than in the opposite direction, thus accounting for the 5' preference.

  20. Solvent-modified ultrafast decay dynamics in conjugated polymer/dye labeled single stranded DNA

    NASA Astrophysics Data System (ADS)

    Kim, Inhong; Kang, Mijeong; Woo, Han Young; Oh, Jin-Woo; Kyhm, Kwangseuk

    2015-07-01

    We have investigated that organic solvent (DMSO, dimethyl sulfoxide) modifies energy transfer efficiency between conjugated polymers (donors) and fluorescein-labeled single stranded DNAs (acceptors). In a mixture of buffer and organic solvent, fluorescence of the acceptors is significantly enhanced compared to that of pure water solution. This result can be attributed to change of the donor-acceptor environment such as decreased hydrophobicity of polymers, screening effect of organic solvent molecules, resulting in an enhanced energy transfer efficiency. Time-resolved fluorescence decay of the donors and the acceptors was modelled by considering the competition between the energy harvesting Foerster resonance energy transfer and the energy-wasting quenching. This enables to quantity that the Foerster distance (R0 = 43.3 Å) and resonance energy transfer efficiency (EFRET = 58.7 %) of pure buffer solution become R0 = 38.6 Å and EFRET = 48.0 % when 80% DMSO/buffer mixture is added.

  1. Age-related macular degeneration and modification of systemic complement factor H production through liver transplantation.

    PubMed

    Khandhadia, Samir; Hakobyan, Svetlana; Heng, Ling Z; Gibson, Jane; Adams, David H; Alexander, Graeme J; Gibson, Jonathan M; Martin, Keith R; Menon, Geeta; Nash, Kathryn; Sivaprasad, Sobha; Ennis, Sarah; Cree, Angela J; Morgan, B Paul; Lotery, Andrew J

    2013-08-01

    To investigate whether modification of liver complement factor H (CFH) production, by alteration of liver CFH Y402H genotype through liver transplantation (LT), influences the development of age-related macular degeneration (AMD). Multicenter, cross-sectional study. We recruited 223 Western European patients ≥ 55 years old who had undergone LT ≥ 5 years previously. We determined AMD status using a standard grading system. Recipient CFH Y402H genotype was obtained from DNA extracted from recipient blood samples. Donor CFH Y402H genotype was inferred from recipient plasma CFH Y402H protein allotype, measured using enzyme-linked immunosorbent assays. This approach was verified by genotyping donor tissue from a subgroup of patients. Systemic complement activity was ascertained by measuring levels of plasma complement proteins using an enzyme-linked immunosorbent assay, including substrates (C3, C4), activation products (C3a, C4a, and terminal complement complex), and regulators (total CFH, C1 inhibitor). We evaluated AMD status and recipient and donor CFH Y402H genotype. In LT patients, AMD was associated with recipient CFH Y402H genotype (P = 0.036; odds ratio [OR], 1.6; 95% confidence interval [CI], 1.0-2.4) but not with donor CFH Y402H genotype (P = 0.626), after controlling for age, sex, smoking status, and body mass index. Recipient plasma CFH Y402H protein allotype predicted donor CFH Y402H genotype with 100% accuracy (n = 49). Plasma complement protein or activation product levels were similar in LT patients with and without AMD. Compared with previously reported prevalence figures (Rotterdam Study), LT patients demonstrated a high prevalence of both AMD (64.6% vs 37.1%; OR, 3.09; P<0.001) and the CFH Y402H sequence variation (41.9% vs 36.2%; OR, 1.27; P = 0.014). Presence of AMD is not associated with modification of hepatic CFH production. In addition, AMD is not associated with systemic complement activity in LT patients. These findings suggest that local intraocular complement activity is of greater importance in AMD pathogenesis. The high AMD prevalence observed in LT patients may be associated with the increased frequency of the CFH Y402H sequence variation. The authors have no proprietary or commercial interest in any materials discussed in this article. Copyright © 2013 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.

  2. Cytotoxic activity against human neuroblastoma and melanoma cells mediated by IgM antibodies derived from peripheral blood of healthy donors.

    PubMed

    Devarapu, Satish Kumar; Mamidi, Srinivas; Plöger, Frank; Dill, Othmar; Blixt, Ola; Kirschfink, Michael; Schwartz-Albiez, Reinhard

    2016-06-15

    A small percentage of healthy donors identified in the Western population carry antibodies in their peripheral blood which convey cytotoxic activity against certain human melanoma and neuroblastoma cell lines. We measured the cytotoxic activity of sera and plasmas from healthy donors on the human neuroblastoma cell line Kelly and various melanoma cell lines. Antibodies of IgM isotype, presumably belonging to the class of naturally occurring antibodies, exerted cytotoxic activity in a complement-dependent fashion. Apart from complement-dependent tumor cell lysis, we observed C3 opsonization in all tumor cell lines upon treatment with cytotoxic plasmas. Cell lines tested primarily expressed membrane complement regulatory proteins (mCRP) CD46, CD55 and CD59 to various extents. Blocking of mCRPs by monoclonal antibodies enhanced cell lysis and opsonization, though some melanoma cells remained resistant to complement attack. Epitopes recognized by cytotoxic antibodies were represented by gangliosides such as GD2 and GD3, as evidenced by cellular sialidase pretreatment and enhanced expression of distinct gangliosides. It remains to be clarified why only a small fraction of healthy persons carry these antitumor cytotoxic antibodies. © 2016 UICC.

  3. Temperature-sensitive Mutants of Sindbis Virus: Biochemical Correlates of Complementation

    PubMed Central

    Burge, Boyce W.; Pfefferkorn, E. R.

    1967-01-01

    Temperature-sensitive mutants of Sindbis virus fail to grow at a temperature that permits growth of the wild type, but when certain pairs of these mutants, mixed together, infect cells at that temperature, viral growth (i.e., complementation) occurs. The yield from this complementation, however, is of the same order of magnitude as the infectivity in the inoculum. Since in animal virus infections the protein components of the virion probably enter the cell with the viral nucleic acid, it was necessary to demonstrate that the observed complementation required synthesis of new viral protein and nucleic acid rather than some sort of rearrangement of the structural components of the inoculum. To demonstrate that complementation does require new biosynthesis, three biochemical events of normal virus growth have been observed during complementation and correlated with the efficiency of viral growth seen in complementation. These events include: (i) entrance of parental viral ribonucleic acid (RNA) into a double-stranded form; (ii) subsequent synthesis of viral RNA; and (iii) synthesis and subsequent incorporation of viral protein(s) into cell membranes where they were detected by hemadsorption. Although the infecting single-stranded RNA genome of the wild type was converted to a ribonuclease-resistant form, the genome of a mutant (ts-11) incapable of RNA synthesis at a nonpermissive temperature was not so converted. However, during complementation with another mutant also defective in viral RNA synthesis, some of the RNA of mutant ts-11 was converted to a ribonuclease-resistant form, and total synthesis of virus-specific RNA was markedly enhanced. The virus-specific alteration of the cell surface, detected by hemadsorption, was also extensively increased during complementation. These observations support the view that complementation between temperature-sensitive mutants and replication of wild-type virus are similar processes. PMID:5630228

  4. Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes

    DTIC Science & Technology

    2007-10-01

    reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07

  5. Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes (Postprint)

    DTIC Science & Technology

    2007-01-01

    reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07

  6. Base pairing among three cis-acting sequences contributes to template switching during hepadnavirus reverse transcription.

    PubMed

    Liu, Ning; Tian, Ru; Loeb, Daniel D

    2003-02-18

    Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis.

  7. An Anti-C1s Monoclonal, TNT003, Inhibits Complement Activation Induced by Antibodies Against HLA.

    PubMed

    Thomas, K A; Valenzuela, N M; Gjertson, D; Mulder, A; Fishbein, M C; Parry, G C; Panicker, S; Reed, E F

    2015-08-01

    Antibody-mediated rejection (AMR) of solid organ transplants (SOT) is characterized by damage triggered by donor-specific antibodies (DSA) binding donor Class I and II HLA (HLA-I and HLA-II) expressed on endothelial cells. While F(ab')2 portions of DSA cause cellular activation and proliferation, Fc regions activate the classical complement cascade, resulting in complement deposition and leukocyte recruitment, both hallmark features of AMR. We characterized the ability of an anti-C1s monoclonal antibody, TNT003, to inhibit HLA antibody (HLA-Ab)-induced complement activation. Complement deposition induced by HLA-Ab was evaluated using novel cell- and bead-based assays. Human aortic endothelial cells (HAEC) were cultured with HLA-Ab and human complement; production of activated complement proteins was measured by flow cytometry. Additionally, C3d deposition was measured on single antigen beads (SAB) mixed with HLA-Ab and human complement. TNT003 inhibited HLA-Ab mediated complement deposition on HAEC in a concentration-dependent manner; C3a, C4a and C5a anaphylatoxin production was also diminished by TNT003. Finally, TNT003 blocked C3d deposition induced by Class I (HLAI-Ab)- and Class II (HLAII-Ab)-specific antibodies on SAB. These data suggest TNT003 may be useful for modulating the effects of DSA, as TNT003 inhibits complement deposition and split product formation generated by HLA-I/II-Ab in vitro. © 2015 The Authors. American Journal of Transplantation Published by Wiley Periodicals, Inc.

  8. An Anti-C1s Monoclonal, TNT003, Inhibits Complement Activation Induced by Antibodies Against HLA

    PubMed Central

    Thomas, K A; Valenzuela, N M; Gjertson, D; Mulder, A; Fishbein, M C; Parry, G C; Panicker, S; Reed, E F

    2015-01-01

    Antibody-mediated rejection (AMR) of solid organ transplants (SOT) is characterized by damage triggered by donor-specific antibodies (DSA) binding donor Class I and II HLA (HLA-I and HLA-II) expressed on endothelial cells. While F(ab′)2 portions of DSA cause cellular activation and proliferation, Fc regions activate the classical complement cascade, resulting in complement deposition and leukocyte recruitment, both hallmark features of AMR. We characterized the ability of an anti-C1s monoclonal antibody, TNT003, to inhibit HLA antibody (HLA-Ab)-induced complement activation. Complement deposition induced by HLA-Ab was evaluated using novel cell- and bead-based assays. Human aortic endothelial cells (HAEC) were cultured with HLA-Ab and human complement; production of activated complement proteins was measured by flow cytometry. Additionally, C3d deposition was measured on single antigen beads (SAB) mixed with HLA-Ab and human complement. TNT003 inhibited HLA-Ab mediated complement deposition on HAEC in a concentration-dependent manner; C3a, C4a and C5a anaphylatoxin production was also diminished by TNT003. Finally, TNT003 blocked C3d deposition induced by Class I (HLAI-Ab)- and Class II (HLAII-Ab)-specific antibodies on SAB. These data suggest TNT003 may be useful for modulating the effects of DSA, as TNT003 inhibits complement deposition and split product formation generated by HLA-I/II-Ab in vitro. PMID:25904443

  9. Implication of a Central Cysteine Residue and the HHCC Domain of Moloney Murine Leukemia Virus Integrase Protein in Functional Multimerization

    PubMed Central

    Donzella, George A.; Leon, Oscar; Roth, Monica J.

    1998-01-01

    Moloney murine leukemia virus (M-MuLV) IN-IN protein interactions important for catalysis of strand transfer and unimolecular and bimolecular disintegration reactions were investigated by using a panel of chemically modified M-MuLV IN proteins. Functional complementation of an HHCC-deleted protein (NΔ105) by an independent HHCC domain (CΔ232) was severely compromised by NEM modification of either subunit. Productive NΔ105 IN-DNA interactions with a disintegration substrate lacking a long terminal repeat 5′-single-stranded tail also required complementation by a functional HHCC domain. Virus encoding the C209A M-MuLV IN mutation exhibited delayed virion production and replication kinetics. PMID:9445080

  10. Analysis of Duck Hepatitis B Virus Reverse Transcription Indicates a Common Mechanism for the Two Template Switches during Plus-Strand DNA Synthesis

    PubMed Central

    Havert, Michael B.; Ji, Lin; Loeb, Daniel D.

    2002-01-01

    The synthesis of the hepadnavirus relaxed circular DNA genome requires two template switches, primer translocation and circularization, during plus-strand DNA synthesis. Repeated sequences serve as donor and acceptor templates for these template switches, with direct repeat 1 (DR1) and DR2 for primer translocation and 5′r and 3′r for circularization. These donor and acceptor sequences are at, or near, the ends of the minus-strand DNA. Analysis of plus-strand DNA synthesis of duck hepatitis B virus (DHBV) has indicated that there are at least three other cis-acting sequences that make contributions during the synthesis of relaxed circular DNA. These sequences, 5E, M, and 3E, are located near the 5′ end, the middle, and the 3′ end of minus-strand DNA, respectively. The mechanism by which these sequences contribute to the synthesis of plus-strand DNA was unclear. Our aim was to better understand the mechanism by which 5E and M act. We localized the DHBV 5E element to a short sequence of approximately 30 nucleotides that is 100 nucleotides 3′ of DR2 on minus-strand DNA. We found that the new 5E mutants were partially defective for primer translocation/utilization at DR2. They were also invariably defective for circularization. In addition, examination of several new DHBV M variants indicated that they too were defective for primer translocation/utilization and circularization. Thus, this analysis indicated that 5E and M play roles in both primer translocation/utilization and circularization. In conjunction with earlier findings that 3E functions in both template switches, our findings indicate that the processes of primer translocation and circularization share a common underlying mechanism. PMID:11861843

  11. Easi-CRISPR for creating knock-in and conditional knockout mouse models using long ssDNA donors.

    PubMed

    Miura, Hiromi; Quadros, Rolen M; Gurumurthy, Channabasavaiah B; Ohtsuka, Masato

    2018-01-01

    CRISPR/Cas9-based genome editing can easily generate knockout mouse models by disrupting the gene sequence, but its efficiency for creating models that require either insertion of exogenous DNA (knock-in) or replacement of genomic segments is very poor. The majority of mouse models used in research involve knock-in (reporters or recombinases) or gene replacement (e.g., conditional knockout alleles containing exons flanked by LoxP sites). A few methods for creating such models have been reported that use double-stranded DNA as donors, but their efficiency is typically 1-10% and therefore not suitable for routine use. We recently demonstrated that long single-stranded DNAs (ssDNAs) serve as very efficient donors, both for insertion and for gene replacement. We call this method efficient additions with ssDNA inserts-CRISPR (Easi-CRISPR) because it is a highly efficient technology (efficiency is typically 30-60% and reaches as high as 100% in some cases). The protocol takes ∼2 months to generate the founder mice.

  12. Marrow donor registry and cord blood bank in Taiwan.

    PubMed

    Lee, Tsung Dao

    2002-08-01

    Unrelated Bone marrow transplant was initiated thirty years ago. Though there are over millions of donors registered with the bone marrow registries worldwide, Asian patients rarely find a match with all these donors. Tzu Chi Marrow Donor Registry was established to meet this need. It has become the largest Asian marrow donor registry in the world. With the introduction of high technology to test the HLA of the donors and recipients, the success rate of bone marrow transplant is greatly improved among Asian countries. 50% of blood disease Asian patients who cannot find a bone marrow matched donor will be complemented by the establishment of cord blood banks in Taiwan.

  13. Fanconi Anemia Complementation Group A (FANCA) Protein Has Intrinsic Affinity for Nucleic Acids with Preference for Single-stranded Forms*

    PubMed Central

    Yuan, Fenghua; Qian, Liangyue; Zhao, Xinliang; Liu, Jesse Y.; Song, Limin; D'Urso, Gennaro; Jain, Chaitanya; Zhang, Yanbin

    2012-01-01

    The Fanconi anemia complementation group A (FANCA) gene is one of 15 disease-causing genes and has been found to be mutated in ∼60% of Fanconi anemia patients. Using purified protein, we report that human FANCA has intrinsic affinity for nucleic acids. FANCA binds to both single-stranded (ssDNA) and double-stranded (dsDNA) DNAs; however, its affinity for ssDNA is significantly higher than for dsDNA in an electrophoretic mobility shift assay. FANCA also binds to RNA with an intriguingly higher affinity than its DNA counterpart. FANCA requires a certain length of nucleic acids for optimal binding. Using DNA and RNA ladders, we determined that the minimum number of nucleotides required for FANCA recognition is ∼30 for both DNA and RNA. By testing the affinity between FANCA and a variety of DNA structures, we found that a 5′-flap or 5′-tail on DNA facilitates its interaction with FANCA. A patient-derived FANCA truncation mutant (Q772X) has diminished affinity for both DNA and RNA. In contrast, the complementing C-terminal fragment of Q772X, C772–1455, retains the differentiated nucleic acid-binding activity (RNA > ssDNA > dsDNA), indicating that the nucleic acid-binding domain of FANCA is located primarily at its C terminus, where most disease-causing mutations are found. PMID:22194614

  14. Fanconi anemia complementation group A (FANCA) protein has intrinsic affinity for nucleic acids with preference for single-stranded forms.

    PubMed

    Yuan, Fenghua; Qian, Liangyue; Zhao, Xinliang; Liu, Jesse Y; Song, Limin; D'Urso, Gennaro; Jain, Chaitanya; Zhang, Yanbin

    2012-02-10

    The Fanconi anemia complementation group A (FANCA) gene is one of 15 disease-causing genes and has been found to be mutated in ∼60% of Fanconi anemia patients. Using purified protein, we report that human FANCA has intrinsic affinity for nucleic acids. FANCA binds to both single-stranded (ssDNA) and double-stranded (dsDNA) DNAs; however, its affinity for ssDNA is significantly higher than for dsDNA in an electrophoretic mobility shift assay. FANCA also binds to RNA with an intriguingly higher affinity than its DNA counterpart. FANCA requires a certain length of nucleic acids for optimal binding. Using DNA and RNA ladders, we determined that the minimum number of nucleotides required for FANCA recognition is ∼30 for both DNA and RNA. By testing the affinity between FANCA and a variety of DNA structures, we found that a 5'-flap or 5'-tail on DNA facilitates its interaction with FANCA. A patient-derived FANCA truncation mutant (Q772X) has diminished affinity for both DNA and RNA. In contrast, the complementing C-terminal fragment of Q772X, C772-1455, retains the differentiated nucleic acid-binding activity (RNA > ssDNA > dsDNA), indicating that the nucleic acid-binding domain of FANCA is located primarily at its C terminus, where most disease-causing mutations are found.

  15. Binding of Free and Immune Complex-Associated Hepatitis C Virus to Erythrocytes Is Mediated by the Complement System.

    PubMed

    Salam, Kazi Abdus; Wang, Richard Y; Grandinetti, Teresa; De Giorgi, Valeria; Alter, Harvey J; Allison, Robert D

    2018-05-09

    Erythrocytes bind circulating immune complexes (IC) and facilitate IC clearance from the circulation. Chronic hepatitis C virus (HCV) infection is associated with IC-related disorders. In this study we investigated the kinetics and mechanism of HCV and HCV-IC binding to and dissociation from erythrocytes. Cell culture-produced HCV was mixed with erythrocytes from healthy blood donors and erythrocyte-associated virus particles were quantified. Purified complement proteins, complement-depleted serum, and complement receptor antibodies were used to investigate complement-mediated HCV-erythrocyte binding. Purified HCV-specific immunoglobulin G from a chronic HCV-infected patient was used to study complement-mediated HCV-IC-erythrocyte binding. Binding of HCV to erythrocytes increased 200 to 1,000 fold after adding complement active human serum in the absence of antibody. Opsonization of free HCV occurred within 10 minutes and peak binding to erythrocytes was observed at 20-30 minutes. Complement protein C1 was required for binding, while C2, C3 and C4 significantly enhanced binding. Complement receptor 1 (CR1, CD35) antibodies blocked the binding of HCV to erythrocytes isolated from chronically infected HCV patients and healthy blood donors. HCV-ICs significantly enhanced complement-mediated binding to erythrocytes compared to unbound HCV. Dissociation of complement-opsonized HCV from erythrocytes depended on the presence of Factor I. HCV released by Factor I bound preferentially to CD19+ B cells compared to other leukocytes. These results demonstrate that complement mediates the binding of free and IC-associated HCV to CR1 on erythrocytes, and provide a mechanistic rationale for investigating the differential phenotypic expression of HCV-IC-related disease. This article is protected by copyright. All rights reserved. © 2018 by the American Association for the Study of Liver Diseases.

  16. Base pairing among three cis-acting sequences contributes to template switching during hepadnavirus reverse transcription

    PubMed Central

    Liu, Ning; Tian, Ru; Loeb, Daniel D.

    2003-01-01

    Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis. PMID:12578983

  17. Pre-transplant donor HLA-specific antibodies: characteristics causing detrimental effects on survival after lung transplantation.

    PubMed

    Smith, John D; Ibrahim, Mohamed W; Newell, Helen; Danskine, Anna J; Soresi, Simona; Burke, Margaret M; Rose, Marlene L; Carby, Martin

    2014-10-01

    The impact of Luminex-detected HLA antibodies on outcomes after lung transplantation is unclear. Herein we have undertaken a retrospective study of pre-transplant sera from 425 lung transplants performed between 1991 and 2003. Pre-transplant sera, originally screened by complement-dependent cytotoxicity (CDC) assays, were retrospectively tested for the presence of HLA-specific antibodies using HLA-coated Luminex beads and C4d deposition on Luminex beads. The results were correlated with graft survival at 1 year. Twenty-seven patients were retrospectively identified as having been transplanted against donor-specific HLA antibodies (DSA) and 36 patients against non-donor-specific HLA antibodies (NDSA). DSA-positive patients had 1-year survival of 51.9% compared with 77.8% for NDSA and 71.8% for antibody-negative patients (p = 0.029). One-year survival of patients with complement-fixing DSA was 12.5% compared with 62.5% for non-complement-fixing DSA, 75.8% for non-complement-fixing NDSA and 71.8% for antibody-negative patients (p < 0.0001). DSA-positive patients with mean fluorescence intensity (MFI) >5,000 had 1-year survival of 33.3% compared with 71.4% for MFI 2,000 to 5000 and 62.5% for MFI <2,000 (p = 0.0046). Multivariable analysis revealed DSA to be an independent predictor of poor patient survival within 1 year (p = 0.0010, hazard ratio [HR] = 3.569) as well as complement-fixing DSA (p < 0.0001, HR = 11.083) and DSA with MFI >5,000 (p = 0.0001, HR = 5.512). Pre-formed DSA, particularly complement-fixing DSA, and high MFI are associated with poor survival within the first year after lung transplantation. Risk stratification according to complement fixation or MFI levels may allow for increased transplantation in sensitized patients. Copyright © 2014 International Society for Heart and Lung Transplantation. Published by Elsevier Inc. All rights reserved.

  18. Identification of anti-Lea by platelet complement fixation.

    PubMed

    Ando, B; Ibayashi, H

    1986-01-01

    Two anti-Lea sera which were able to detect Lea antigen on platelets were identified in a screening for anti-platelet antibodies by means of a platelet complement fixation test. These two antisera hemolyzed erythrocytes without enzyme treatment. The anti-Lea activity could be completely absorbed by red cells, platelets and lymphocytes of Le(a+b-) donors but not by cells from Le(a-b+) or Le(a-b-) donors. The antibody activity against red cells was eliminated by treatment of the antisera with dithiothreitol, thereby suggesting that the activity resided in the IgM class of immunoglobulins. As the anti-Lea was more reactive at 37 degrees C than at room temperature against both red cells and platelets, we suggest that transfusion of platelets of Lea-negative donors should be considered for patients with this type of anti-Lea.

  19. Differential mechanisms of complement-mediated neutralization of the closely related paramyxoviruses simian virus 5 and mumps virus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Johnson, John B.; Capraro, Gerald A.; Parks, Griffith D.

    2008-06-20

    The complement system is an important component of the innate immune response to virus infection. The role of human complement pathways in the in vitro neutralization of three closely related paramyxoviruses, Simian Virus 5 (SV5), Mumps virus (MuV) and Human Parainfluenza virus type 2 (HPIV2) was investigated. Sera from ten donors showed high levels of neutralization against HPIV2 that was largely complement-independent, whereas nine of ten donor sera were found to neutralize SV5 and MuV only in the presence of active complement pathways. SV5 and MuV neutralization proceeded through the alternative pathway of the complement cascade. Electron microscopy studies andmore » biochemical analyses showed that treatment of purified SV5 with human serum resulted in C3 deposition on virions and the formation of massive aggregates, but there was relatively little evidence of virion lysis. Treatment of MuV with human serum also resulted in C3 deposition on virions, however in contrast to SV5, MuV particles were lysed by serum complement and there was relatively little aggregation. Assays using serum depleted of complement factors showed that SV5 and MuV neutralization in vitro was absolutely dependent on complement factor C3, but was not dependent on downstream complement factors C5 or C8. Our results indicate that even though antibodies exist that recognize both SV5 and MuV, they are mostly non-neutralizing and viral inactivation in vitro occurs through the alternative pathway of complement. The implications of our work for development of paramyxovirus vectors and vaccines are discussed.« less

  20. Interaction of non-human primate complement and antibodies with hypermucoviscous Klebsiella pneumoniae.

    PubMed

    Soto, Esteban; Marchi, Sylvia; Beierschmitt, Amy; Kearney, Michael; Francis, Stewart; VanNess, Kimberly; Vandenplas, Michel; Thrall, MaryAnna; Palmour, Roberta

    2016-03-08

    Emergent hypermucoviscosity (HMV) phenotypes of Klebsiella pneumoniae have been associated with increased invasiveness and pathogenicity in primates. In this study, we investigated the interaction of African green monkeys (AGM) (Chlorocebus aethiops sabaeus) complement and antibody with HMV and non-HMV isolates as in vitro models of primate infection. Significantly greater survival of HMV isolates was evident after incubation in normal serum or whole blood (p < 0.05) of AGM donors when compared to non-HMV strains. Greater survival of HMV strains (p < 0.05) was found after incubation in whole blood and serum from seropositive donors when compared to seronegative donor samples. Additionally, significantly greater amounts of K. pneumoniae were phagocytozed by AGM leukocytes when complement was active (p < 0.05), but no difference in uptake was observed when serum from seropositive or seronegative animals was used in challenged cells utilizing flow cytometry. Results demonstrate that interaction of cellular and humoral immune elements play a role in the in vitro killing of K. pneumoniae, particularly HMV isolates. Neither AGM serum, nor washed whole blood effectively killed HMV isolates; however, assays using heparinized whole blood of seronegative donors significantly reduced viability of HMV and non-HMV strains. The lack of bacterial killing observed in seropositive donors treatments could be at least partially associated with low IgG2 present in these animals. A better understanding of the pathogenesis of klebsiellosis in primates and host immune response is necessary to identify surface molecules that can induce both opsonizing and bactericidal antibody facilitating killing of Klebsiella, and the development of vaccines in human and animals.

  1. Improved silencing properties using small internally segmented interfering RNAs

    PubMed Central

    Bramsen, Jesper B.; Laursen, Maria B.; Damgaard, Christian K.; Lena, Suzy W.; Ravindra Babu, B.; Wengel, Jesper; Kjems, Jørgen

    2007-01-01

    RNA interference is mediated by small interfering RNAs (siRNAs) that upon incorporation into the RNA-induced silencing complex (RISC) can target complementary mRNA for degradation. Standard siRNA design usually feature a 19–27 base pair contiguous double-stranded region that is believed to be important for RISC incorporation. Here, we describe a novel siRNA design composed of an intact antisense strand complemented with two shorter 10–12 nt sense strands. This three-stranded construct, termed small internally segmented interfering RNA (sisiRNA), is highly functional demonstrating that an intact sense strand is not a prerequisite for RNA interference. Moreover, when using the sisiRNA design only the antisense strand is functional in activated RISC thereby completely eliminating unintended mRNA targeting by the sense strand. Interestingly, the sisiRNA design supports the function of chemically modified antisense strands, which are non-functional within the context of standard siRNA designs. This suggests that the sisiRNA design has a clear potential of improving the pharmacokinetic properties of siRNA in vivo. PMID:17726057

  2. Latent cytomegalovirus infection in blood donors

    PubMed Central

    Diosi, Peter; Moldovan, Eva; Tomescu, Nicholas

    1969-01-01

    Twenty-one out of 32 apparently healthy blood donors aged 21 to 65 years yielded positive complement fixation tests with a cytomegalovirus antigen, at titres ranging from 1:8 to 1:64. Virus was present in leucocyte cultures of fresh peripheral blood of two seropositive subjects from a total of 35 donors examined. Plasma and 48-hour stored blood specimens failed to disclose virus in culture. Viruria could not be demonstrated, and there was no evidence of recent illness in the study group. These findings suggest that subclinical viraemia is not uncommon in blood donors. PMID:4311727

  3. High speed nucleic acid sequencing

    DOEpatents

    Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

    2011-05-17

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid. Each type of labeled nucleotide comprises an acceptor fluorophore attached to a phosphate portion of the nucleotide such that the fluorophore is removed upon incorporation into a growing strand. Fluorescent signal is emitted via fluorescent resonance energy transfer between the donor fluorophore and the acceptor fluorophore as each nucleotide is incorporated into the growing strand. The sequence is deduced by identifying which base is being incorporated into the growing strand.

  4. The multiple personalities of Watson and Crick strands.

    PubMed

    Cartwright, Reed A; Graur, Dan

    2011-02-08

    In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin.

  5. Does funding from donors displace government spending for health in developing countries?

    PubMed

    Farag, Marwa; Nandakumar, A K; Wallack, Stanley S; Gaumer, Gary; Hodgkin, Dominic

    2009-01-01

    The notable increases in funding from various donors for health over the past several years have made examining the effectiveness of aid all the more important. We examine the extent to which donor funding for health substitutes for--rather than complements--health financing by recipient governments. We find evidence of a strong substitution effect. The proportionate decrease in government spending associated with an increase in donor funding is largest in low-income countries. The results suggest that aid needs to be structured in a way that better aligns donors' and recipient governments' incentives, using innovative approaches such as performance-based aid financing.

  6. The antigenic complex in HIT binds to B cells via complement and complement receptor 2 (CD21)

    PubMed Central

    Khandelwal, Sanjay; Lee, Grace M.; Hester, C. Garren; Poncz, Mortimer; McKenzie, Steven E.; Sachais, Bruce S.; Rauova, Lubica; Kelsoe, Garnett; Cines, Douglas B.; Frank, Michael

    2016-01-01

    Heparin-induced thrombocytopenia is a prothrombotic disorder caused by antibodies to platelet factor 4 (PF4)/heparin complexes. The mechanism that incites such prevalent anti-PF4/heparin antibody production in more than 50% of patients exposed to heparin in some clinical settings is poorly understood. To investigate early events associated with antigen exposure, we first examined the interaction of PF4/heparin complexes with cells circulating in whole blood. In healthy donors, PF4/heparin complexes bind preferentially to B cells (>90% of B cells bind to PF4/heparin in vitro) relative to neutrophils, monocytes, or T cells. Binding of PF4 to B cells is heparin dependent, and PF4/heparin complexes are found on circulating B cells from some, but not all, patients receiving heparin. Given the high proportion of B cells that bind PF4/heparin, we investigated complement as a mechanism for noncognate antigen recognition. Complement is activated by PF4/heparin complexes, co-localizes with antigen on B cells from healthy donors, and is present on antigen-positive B cells in patients receiving heparin. Binding of PF4/heparin complexes to B cells is mediated through the interaction between complement and complement receptor 2 (CR2 [CD21]). To the best of our knowledge, these are the first studies to demonstrate complement activation by PF4/heparin complexes, opsonization of PF4/heparin to B cells via CD21, and the presence of complement activation fragments on circulating B cells in some patients receiving heparin. Given the critical contribution of complement to humoral immunity, our observations provide new mechanistic insights into the immunogenicity of PF4/heparin complexes. PMID:27412887

  7. The multiple personalities of Watson and Crick strands

    PubMed Central

    2011-01-01

    Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin. PMID:21303550

  8. Intravenous Immunoglobulin in the Therapeutic Armamentarium of Systemic Lupus Erythematosus: A Systematic Review and Meta-Analysis

    PubMed Central

    Sakthiswary, Rajalingham; D’Cruz, David

    2014-01-01

    Abstract Prepared from the plasma of thousands of blood donors, therapeutic intravenous immunoglobulin (IVIg) mostly consists of human polyspecific immunoglobulin G (IgG). The use of IVIg in systemic lupus erythematosus (SLE) is still considered experimental without any clear indications. The purpose of this systematic review is, therefore, to evaluate the available evidence to determine the therapeutic role of IVIg in SLE. A comprehensive, computerised search was performed in the MEDLINE (Pubmed), Scopus, EMBASE, and Cochrane controlled trials. The study eligibility criteria were randomized controlled trials, and prospective and retrospective observational studies that examined the efficacy of IVIg in adult patients with SLE who were considered the participants. IVIg therapy was the mode of intervention in these patients. Data abstracted included the study design, study population, changes in the disease activity scores (Systemic Lupus Erythematosus Disease Activity Index, Systemic Lupus Activity Measure, and Lupus Activity Index-Pregnancy), steroid dose, complement levels, autoantibodies, and renal function. Thereafter, data analysis established statistical procedures for meta-analysis. Thirteen studies (including 3 controlled and 10 observational) were eligible for inclusion. There was significant reduction in the SLE disease activity scores with IVIg therapy with a standard mean difference of 0.584 (P = 0.002, 95% confidence interval [CI] 0.221–0.947). In terms of rise in complement levels, the response rate was 30.9% (P = 0.001, 95 CI 22.1–41.3). The effects of IVIg on other clinical outcome measures including anti-double-stranded DNA, antinuclear antibody, average steroid dose, and renal function could not be determined because of the limited numbers of trials. The limitations of this review were lack of well-designed controlled trials with adequate sample size on the use of IVIg in SLE. In conclusion, the use of IVIg is associated with significant reduction in SLE disease activity and improvement in complement levels. PMID:25310743

  9. Intravenous immunoglobulin in the therapeutic armamentarium of systemic lupus erythematosus: a systematic review and meta-analysis.

    PubMed

    Sakthiswary, Rajalingham; D'Cruz, David

    2014-10-01

    Prepared from the plasma of thousands of blood donors, therapeutic intravenous immunoglobulin (IVIg) mostly consists of human polyspecific immunoglobulin G (IgG). The use of IVIg in systemic lupus erythematosus (SLE) is still considered experimental without any clear indications. The purpose of this systematic review is, therefore, to evaluate the available evidence to determine the therapeutic role of IVIg in SLE. A comprehensive, computerised search was performed in the MEDLINE (Pubmed), Scopus, EMBASE, and Cochrane controlled trials. The study eligibility criteria were randomized controlled trials, and prospective and retrospective observational studies that examined the efficacy of IVIg in adult patients with SLE who were considered the participants.IVIg therapy was the mode of intervention in these patients. Data abstracted included the study design, study population, changes in the disease activity scores (Systemic Lupus Erythematosus Disease Activity Index, Systemic Lupus Activity Measure, and Lupus Activity Index-Pregnancy), steroid dose, complement levels, autoantibodies, and renal function. Thereafter, data analysis established statistical procedures for meta-analysis. Thirteen studies (including 3 controlled and 10 observational) were eligible for inclusion. There was significant reduction in the SLE disease activity scores with IVIg therapy with a standard mean difference of 0.584 (P = 0.002, 95% confidence interval [CI] 0.221-0.947). In terms of rise in complement levels, the response rate was 30.9% (P = 0.001, 95 CI 22.1-41.3). The effects of IVIg on other clinical outcome measures including anti-double-stranded DNA, antinuclear antibody, average steroid dose, and renal function could not be determined because of the limited numbers of trials. The limitations of this review were lack of well-designed controlled trials with adequate sample size on the use of IVIg in SLE. In conclusion, the use of IVIg is associated with significant reduction in SLE disease activity and improvement in complement levels.

  10. Validation of a multi-analyte panel with cell-bound complement activation products for systemic lupus erythematosus.

    PubMed

    Dervieux, Thierry; Conklin, John; Ligayon, Jo-Anne; Wolover, Leilani; O'Malley, Tyler; Alexander, Roberta Vezza; Weinstein, Arthur; Ibarra, Claudia A

    2017-07-01

    We describe the analytical validation of an assay panel intended to assist clinicians with the diagnosis of systemic lupus erythematosus (SLE). The multi-analyte panel includes quantitative assessment of complement activation and measurement of autoantibodies. The levels of the complement split product C4d bound to erythrocytes (EC4d) and B-lymphocytes (BC4d) (expressed as mean fluorescence intensity [MFI]) are measured by quantitative flow cytometry, while autoantibodies (inclusive of antinuclear and anti-double stranded DNA antibodies) are determined by immunoassays. Results of the multi-analyte panel are reported as positive or negative based on a 2-tiered index score. Post-phlebotomy stability of EC4d and BC4d in EDTA-anticoagulated blood is determined using specimens collected from patients with SLE and normal donors. Three-level C4 coated positive beads are run daily as controls. Analytical validity is reported using intra-day and inter-day coefficient of variation (CV). EC4d and BC4d are stable for 2days at ambient temperature and for 4days at 4°C post-phlebotomy. Median intra-day and inter-day CV range from 2.9% to 7.8% (n=30) and 7.3% to 12.4% (n=66), respectively. The 2-tiered index score is reproducible over 4 consecutive daysupon storage of blood at 4°C. A total of 2,888 three-level quality control data were collected from 6 flow cytometers with an overall failure rate below 3%. Median EC4d level is 6 net MFI (Interquartile [IQ] range 4-9 net MFI) and median BC4d is 18 net MFI (IQ range 13-27 net MFI) among 86,852 specimens submitted for testing. The incidence of 2-tiered positive test results is 13.4%. We have established the analytical validity of a multi-analyte assay panel for SLE. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Relaxation Process of Photoexcited meso-Naphthylporphyrins while Interacting with DNA and Singlet Oxygen Generation.

    PubMed

    Hirakawa, Kazutaka; Taguchi, Makoto; Okazaki, Shigetoshi

    2015-10-15

    Electron donor-connecting cationic porphyrins meso-(1-naphthyl)-tris(N-methyl-p-pyridinio)porphyrin (1-NapTMPyP) and meso-(2-naphthyl)-tris(N-methyl-p-pyridinio)porphyrin (2-NapTMPyP) were designed and synthesized. DFT calculations speculate that the photoexcited states of 1- and 2-NapTMPyPs can be deactivated via intramolecular electron transfer from the naphthyl moiety to the porphyrin moiety. However, the quenching effect through the intramolecular electron transfer is insufficient, possibly due to the orthogonal position of the electron donor and the porphyrin ring and the relatively small driving force: Gibbs energies are 0.11 and 0.07 eV for 1- and 2-NapTMPyPs, respectively. It was speculated that more than 0.3 eV of the driving force is required to realize effective electron transfer in similar electron-donor connecting porphyrin systems. These porphyrins aggregated around the DNA strand, accelerating the deactivation of their excited singlet state and decreasing their photosensitized singlet oxygen-generating activities. In the presence of a sufficiently large concentration of DNA, these porphyrins can bind to a DNA strand stably, leading to an increased fluorescence quantum yield and lifetime. Singlet oxygen generation was also suppressed by the aggregation of porphyrins around DNA. Although the quantum yield of singlet oxygen generation was recovered in the presence of sufficient DNA, the singlet oxygen generated by DNA-binding porphyrins was significantly smaller than that without DNA. These results suggest that DNA-binding drugs limit the generation of photosensitized singlet oxygen by quenching the DNA strand.

  12. The role of polymerase III in conjugation between E. coli K12 donor and recipient strains carrying dnaE ts mutation.

    PubMed

    Blinkowa, A

    1976-01-01

    The possible role of DNA polimerase III in conjugation was studied in a series of mutants temperature-sensitive for DNA polymerase III synthesis. The temperature-sensitive DNA mutation called dnaE 486 (ts) prohibits vegetative DNA replication at 41-45 degrees. Transfer of episome and chromosome from temperature-sensitive donor, carrying dnaE mutation to wild-type recipient strains, revertants and dnaE recipients was investigated. In the first two cases the number of Lac+ sexductants being even slightly higher at 43 degrees. Conjugational synthesis accompanying transfer involving the combination of dnaE (ts) thymine dependent and thymine independent donor and recipient strains measured by incorporation of 14C thymine was observed at the restrictive temperature. In the case of conjugation with temperaturesensitive recipient strains a drop of Lac+ sexductants and Pro+ recombinants may be as a result of disturbances in the synthesis of complementary strand in recipient, known to be dependent on pol III. However, the episome investigated by centrifugation in neutral CsC1 gradient after its transfer to the recipient with faulty polymerase III was double stranded (replicated) at the restrictive temperature.

  13. Analysis of strand transfer and template switching mechanisms of DNA gap repair by homologous recombination in Escherichia coli: predominance of strand transfer.

    PubMed

    Izhar, Lior; Goldsmith, Moshe; Dahan, Ronny; Geacintov, Nicholas; Lloyd, Robert G; Livneh, Zvi

    2008-09-12

    Daughter strand gaps formed upon interruption of replication at DNA lesions in Escherichia coli can be repaired by either translesion DNA synthesis or homologous recombination (HR) repair. Using a plasmid-based assay system that enables discrimination between strand transfer and template switching (information copying) modes of HR gap repair, we found that approximately 80% of strand gaps were repaired by physical strand transfer from the donor, whereas approximately 20% appear to be repaired by template switching. HR gap repair operated on both small and bulky lesions and largely depended on RecA and RecF but not on the RecBCD nuclease. In addition, we found that HR was mildly reduced in cells lacking the RuvABC and RecG proteins involved in resolution of Holliday junctions. These results, obtained for the first time under conditions that detect the two HR gap repair mechanisms, provide in vivo high-resolution molecular evidence for the predominance of the strand transfer mechanism in HR gap repair. A small but significant portion of HR gap repair appears to occur via a template switching mechanism.

  14. Properties of Native High-Density Lipoproteins Inspire Synthesis of Actively Targeted In Vivo siRNA Delivery Vehicles.

    PubMed

    McMahon, Kaylin M; Plebanek, Michael P; Thaxton, C Shad

    2016-11-15

    Efficient systemic administration of therapeutic short interfering RNA (siRNA) is challenging. High-density lipoproteins (HDL) are natural in vivo RNA delivery vehicles. Specifically, native HDLs: 1) Load single-stranded RNA; 2) Are anionic, which requires charge reconciliation between the RNA and HDL, and 3) Actively target scavenger receptor type B-1 (SR-B1) to deliver RNA. Emphasizing these particular parameters, we employed templated lipoprotein particles (TLP), mimics of spherical HDLs, and self-assembled them with single-stranded complements of, presumably, any highly unmodified siRNA duplex pair after formulation with a cationic lipid. Resulting siRNA templated lipoprotein particles (siRNA-TLP) are anionic and tunable with regard to RNA assembly and function. Data demonstrate that the siRNA-TLPs actively target SR-B1 to potently reduce androgen receptor (AR) and enhancer of zeste homolog 2 (EZH2) proteins in multiple cancer cell lines. Systemic administration of siRNA-TLPs demonstrated no off-target toxicity and significantly reduced the growth of prostate cancer xenografts. Thus, native HDLs inspired the synthesis of a hybrid siRNA delivery vehicle that can modularly load single-stranded RNA complements after charge reconciliation with a cationic lipid, and that function due to active targeting of SR-B1.

  15. 'Cold shock' increases the frequency of homology directed repair gene editing in induced pluripotent stem cells.

    PubMed

    Guo, Q; Mintier, G; Ma-Edmonds, M; Storton, D; Wang, X; Xiao, X; Kienzle, B; Zhao, D; Feder, John N

    2018-02-01

    Using CRISPR/Cas9 delivered as a RNA modality in conjunction with a lipid specifically formulated for large RNA molecules, we demonstrate that homology directed repair (HDR) rates between 20-40% can be achieved in induced pluripotent stem cells (iPSC). Furthermore, low HDR rates (between 1-20%) can be enhanced two- to ten-fold in both iPSCs and HEK293 cells by 'cold shocking' cells at 32 °C for 24-48 hours following transfection. This method can also increases the proportion of loci that have undergone complete sequence conversion across the donor sequence, or 'perfect HDR', as opposed to partial sequence conversion where nucleotides more distal to the CRISPR cut site are less efficiently incorporated ('partial HDR'). We demonstrate that the structure of the single-stranded DNA oligo donor can influence the fidelity of HDR, with oligos symmetric with respect to the CRISPR cleavage site and complementary to the target strand being more efficient at directing 'perfect HDR' compared to asymmetric non-target strand complementary oligos. Our protocol represents an efficient method for making CRISPR-mediated, specific DNA sequence changes within the genome that will facilitate the rapid generation of genetic models of human disease in iPSCs as well as other genome engineered cell lines.

  16. Double Stranded Sperm DNA Breaks, Measured by Comet Assay, Are Associated with Unexplained Recurrent Miscarriage in Couples without a Female Factor

    PubMed Central

    Ribas-Maynou, Jordi; García-Peiró, Agustín; Fernandez-Encinas, Alba; Amengual, Maria José; Prada, Elena; Cortés, Pilar; Navarro, Joaquima; Benet, Jordi

    2012-01-01

    It is known that sperm samples from recurrent pregnancy loss (RPL) couples have an increase in their sperm DNA fragmentation (SDF), but no studies have been performed in order to identify differences between single stranded SDF (ssSDF) and double stranded SDF (dsSDF) in these patients. This could be relevant because the type of DNA damage could have different effects. Semen samples were classified attending their clinical status: 25 fertile donors and 20 RPL patients with at least two unexplained first trimester miscarriages. SDF was analysed using alkaline and neutral Comet assay, SCD test and pulsed-field gel electrophoresis (PFGE), and ROC analysis including data from 105 more infertile patients (n = 150) was performed to establish predictive threshold values. SDF for alkaline and neutral Comet, and the SCD test was analysed in these categories of individuals. Data revealed the presence of two subgroups within fertile donors. The values obtained were 21.10±9.13, 23.35±10.45 and 12.31±4.31, respectively, for fertile donors with low values for both ssSDF and dsSDF; 27.86±12.64, 80.69±12.67 and 12.43±5.22, for fertile donors with low ssSDF and high dsSDF; and 33.61±15.50, 84.64±11.28 and 19.28±6.05, for unexplained RPL patients, also showing a low ssSDF and high dsSDF profile. This latter profile was seen in 85% of unexplained RPL and 33% of fertile donors, suggesting that it may be associated to a male risk factor for undergoing RPL. ROC analysis regarding recurrent miscarriage set the cut-off value at 77.50% of dsDNA SDF. PFGE for low ssSDF and high dsSDF profile samples and positive controls treated with DNase, to induce dsDNA breaks, showed a more intense band of about 48 kb, which fits the toroid model of DNA compaction in sperm, pointing out that some nuclease activity may be affecting their sperm DNA in RPL patients. This work identifies a very specific SDF profile related to the paternal risk of having RPL. PMID:23028579

  17. Reflection in Medical Education

    ERIC Educational Resources Information Center

    Hargreaves, Ken

    2016-01-01

    This paper offers a medical-education perspective that I will hope complement other disciplinary perspectives in examining the value of reflection for learning in tertiary education. The paper outlines some of the theoretical strands of reflective practice facilitated in a unique course subject for professionalism and patient safety, within the…

  18. Computer applications in the search for unrelated stem cell donors.

    PubMed

    Müller, Carlheinz R

    2002-08-01

    The majority of patients which are eligible for a blood stem cell transplantation from an allogeneic donor do not have a suitable related donor so that an efficient unrelated donor search is a prerequisite for this treatment. Currently, there are over 7 million volunteer donors in the files of 50 registries in the world and in most countries the majority of transplants are performed from a foreign donor. Evidently, computer and communication technology must play a crucial role in the complex donor search process on the national and international level. This article describes the structural elements of the donor search process and discusses major systematic and technical issues to be addressed in the development and evolution of the supporting telematic systems. The theoretical considerations are complemented by a concise overview over the current state of the art which is given by describing the scope, relevance, interconnection and technical background of three major national and international computer appliances: The German Marrow Donor Information System (GERMIS) and the European Marrow Donor Information System (EMDIS) are interoperable business-to-business e-commerce systems and Bone Marrow Donors World Wide (BMDW) is the basic international donor information desk on the web.

  19. Complement Inhibitors from Scabies Mites Promote Streptococcal Growth – A Novel Mechanism in Infected Epidermis?

    PubMed Central

    Mika, Angela; Reynolds, Simone L.; Pickering, Darren; McMillan, David; Sriprakash, Kadaba S.; Kemp, David J.; Fischer, Katja

    2012-01-01

    Background Scabies is highly prevalent in socially disadvantaged communities such as indigenous populations and in developing countries. Generalized itching causes discomfort to the patient; however, serious complications can occur as a result of secondary bacterial pyoderma, commonly caused by Streptococcus pyogenes (GAS) or Staphylococcus aureus. In the tropics, skin damage due to scabies mite infestations has been postulated to be an important link in the pathogenesis of disease associated with acute rheumatic fever and heart disease, poststreptococcal glomerulonephritis and systemic sepsis. Treatment of scabies decreases the prevalence of infections by bacteria. This study aims to identify the molecular mechanisms underlying the link between scabies and GAS infections. Methodology/Principal Findings GAS bacteria were pre-incubated with blood containing active complement, phagocytes and antibodies against the bacteria, and subsequently tested for viability by plate counts. Initial experiments were done with serum from an individual previously exposed to GAS with naturally acquired anti-GAS antibodies. The protocol was optimized for large-scale testing of low-opsonic whole blood from non-exposed human donors by supplementing with a standard dose of heat inactivated human sera previously exposed to GAS. This allowed an extension of the dataset to two additional donors and four proteins tested at a range of concentrations. Shown first is the effect of scabies mite complement inhibitors on human complement using ELISA-based complement activation assays. Six purified recombinant mite proteins tested at a concentration of 50 µg/ml blocked all three complement activation pathways. Further we demonstrate in human whole blood assays that each of four scabies mite complement inhibitors tested increased GAS survival rates by 2–15 fold. Conclusions/Significance We propose that local complement inhibition plays an important role in the development of pyoderma in scabies infested skin. This molecular link between scabies and bacterial infections may provide new avenues to develop alternative treatment options against this neglected disease. PMID:22815998

  20. Sequential self-assembly of DNA functionalized droplets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Yin; McMullen, Angus; Pontani, Lea-Laetitia

    Complex structures and devices, both natural and manmade, are often constructed sequentially. From crystallization to embryogenesis, a nucleus or seed is formed and built upon. Sequential assembly allows for initiation, signaling, and logical programming, which are necessary for making enclosed, hierarchical structures. Though biology relies on such schemes, they have not been available in materials science. We demonstrate programmed sequential self-assembly of DNA functionalized emulsions. The droplets are initially inert because the grafted DNA strands are pre-hybridized in pairs. Active strands on initiator droplets then displace one of the paired strands and thus release its complement, which in turn activatesmore » the next droplet in the sequence, akin to living polymerization. This strategy provides time and logic control during the self-assembly process, and offers a new perspective on the synthesis of materials.« less

  1. Sequential self-assembly of DNA functionalized droplets

    DOE PAGES

    Zhang, Yin; McMullen, Angus; Pontani, Lea-Laetitia; ...

    2017-06-16

    Complex structures and devices, both natural and manmade, are often constructed sequentially. From crystallization to embryogenesis, a nucleus or seed is formed and built upon. Sequential assembly allows for initiation, signaling, and logical programming, which are necessary for making enclosed, hierarchical structures. Though biology relies on such schemes, they have not been available in materials science. We demonstrate programmed sequential self-assembly of DNA functionalized emulsions. The droplets are initially inert because the grafted DNA strands are pre-hybridized in pairs. Active strands on initiator droplets then displace one of the paired strands and thus release its complement, which in turn activatesmore » the next droplet in the sequence, akin to living polymerization. This strategy provides time and logic control during the self-assembly process, and offers a new perspective on the synthesis of materials.« less

  2. Structural dynamics of possible late-stage intermediates in folding of quadruplex DNA studied by molecular simulations

    PubMed Central

    Stadlbauer, Petr; Krepl, Miroslav; Cheatham, Thomas E.; Koča, Jaroslav; Šponer, Jiří

    2013-01-01

    Explicit solvent molecular dynamics simulations have been used to complement preceding experimental and computational studies of folding of guanine quadruplexes (G-DNA). We initiate early stages of unfolding of several G-DNAs by simulating them under no-salt conditions and then try to fold them back using standard excess salt simulations. There is a significant difference between G-DNAs with all-anti parallel stranded stems and those with stems containing mixtures of syn and anti guanosines. The most natural rearrangement for all-anti stems is a vertical mutual slippage of the strands. This leads to stems with reduced numbers of tetrads during unfolding and a reduction of strand slippage during refolding. The presence of syn nucleotides prevents mutual strand slippage; therefore, the antiparallel and hybrid quadruplexes initiate unfolding via separation of the individual strands. The simulations confirm the capability of G-DNA molecules to adopt numerous stable locally and globally misfolded structures. The key point for a proper individual folding attempt appears to be correct prior distribution of syn and anti nucleotides in all four G-strands. The results suggest that at the level of individual molecules, G-DNA folding is an extremely multi-pathway process that is slowed by numerous misfolding arrangements stabilized on highly variable timescales. PMID:23700306

  3. The Alpha-Tocopherol Form of Vitamin E Boosts Elastase Activity of Human PMNs and Their Ability to Kill Streptococcus pneumoniae.

    PubMed

    Bou Ghanem, Elsa N; Lee, James N; Joma, Basma H; Meydani, Simin N; Leong, John M; Panda, Alexander

    2017-01-01

    Despite the availability of vaccines, Streptococcus pneumoniae remains a leading cause of life-threatening infections, such as pneumonia, bacteremia and meningitis. Polymorphonuclear leukocytes (PMNs) are a key determinant of disease course, because optimal host defense requires an initial robust pulmonary PMN response to control bacterial numbers followed by modulation of this response later in infection. The elderly, who manifest a general decline in immune function and higher basal levels of inflammation, are at increased risk of developing pneumococcal pneumonia. Using an aged mouse infection model, we previously showed that oral supplementation with the alpha-tocopherol form of vitamin E (α-Toc) decreases pulmonary inflammation, in part by modulating neutrophil migration across lung epithelium into alveolar spaces, and reverses the age-associated decline in resistance to pneumococcal pneumonia. The objective of this study was to test the effect of α-Toc on the ability of neutrophils isolated from young (22-35 years) or elderly (65-69 years) individuals to migrate across epithelial cell monolayers in response to S. pneumoniae and to kill complement-opsonized pneumococci. We found that basal levels of pneumococcal-induced transepithelial migration by PMNs from young or elderly donors were indistinguishable, suggesting that the age-associated exacerbation of pulmonary inflammation is not due to intrinsic properties of PMNs of elderly individuals but rather may reflect the inflammatory milieu of the aged lung. Consistent with its anti-inflammatory activity, α-Toc treatment diminished PMN migration regardless of donor age. Unexpectedly, unlike previous studies showing poor killing of antibody-opsonized bacteria, we found that PMNs of elderly donors were more efficient at killing complement-opsonized bacteria ex vivo than their younger counterparts. We also found that the heightened antimicrobial activity in PMNs from older donors correlated with increased activity of neutrophil elastase, a serine protease that is required to kill pneumococci. Notably, incubation with α-Toc increased PMN elastase activity from young donors and boosted their ability to kill complement-opsonized pneumococci. These findings demonstrate that α-Toc is a potent modulator of PMN responses and is a potential nutritional intervention to combat pneumococcal infection.

  4. The Alpha-Tocopherol Form of Vitamin E Boosts Elastase Activity of Human PMNs and Their Ability to Kill Streptococcus pneumoniae

    PubMed Central

    Bou Ghanem, Elsa N.; Lee, James N.; Joma, Basma H.; Meydani, Simin N.; Leong, John M.; Panda, Alexander

    2017-01-01

    Despite the availability of vaccines, Streptococcus pneumoniae remains a leading cause of life-threatening infections, such as pneumonia, bacteremia and meningitis. Polymorphonuclear leukocytes (PMNs) are a key determinant of disease course, because optimal host defense requires an initial robust pulmonary PMN response to control bacterial numbers followed by modulation of this response later in infection. The elderly, who manifest a general decline in immune function and higher basal levels of inflammation, are at increased risk of developing pneumococcal pneumonia. Using an aged mouse infection model, we previously showed that oral supplementation with the alpha-tocopherol form of vitamin E (α-Toc) decreases pulmonary inflammation, in part by modulating neutrophil migration across lung epithelium into alveolar spaces, and reverses the age-associated decline in resistance to pneumococcal pneumonia. The objective of this study was to test the effect of α-Toc on the ability of neutrophils isolated from young (22–35 years) or elderly (65–69 years) individuals to migrate across epithelial cell monolayers in response to S. pneumoniae and to kill complement-opsonized pneumococci. We found that basal levels of pneumococcal-induced transepithelial migration by PMNs from young or elderly donors were indistinguishable, suggesting that the age-associated exacerbation of pulmonary inflammation is not due to intrinsic properties of PMNs of elderly individuals but rather may reflect the inflammatory milieu of the aged lung. Consistent with its anti-inflammatory activity, α-Toc treatment diminished PMN migration regardless of donor age. Unexpectedly, unlike previous studies showing poor killing of antibody-opsonized bacteria, we found that PMNs of elderly donors were more efficient at killing complement-opsonized bacteria ex vivo than their younger counterparts. We also found that the heightened antimicrobial activity in PMNs from older donors correlated with increased activity of neutrophil elastase, a serine protease that is required to kill pneumococci. Notably, incubation with α-Toc increased PMN elastase activity from young donors and boosted their ability to kill complement-opsonized pneumococci. These findings demonstrate that α-Toc is a potent modulator of PMN responses and is a potential nutritional intervention to combat pneumococcal infection. PMID:28516066

  5. THE GLOMERULAR MESANGIUM

    PubMed Central

    Mauer, S. Michael; Sutherland, David E. R.; Howard, Richard J.; Fish, Alfred J.; Najarian, John S.; Michael, Alfred F.

    1973-01-01

    A mechanism of immune glomerular injury is described based on the fixation of antibody (Ab) to an antigen (Ag) that has localized in the glomerular mesangium. Rabbits were given, intravenously (i.v.), aggregated human IgG (AHIgG) or albumin (AHSA) and 10 h later, when the Ag by immunofluorescent microscopy was present in the mesangium, a kidney was removed and transplanted into a normal rabbit. The recipient then received, i.v., rabbit anti-HIgG or anti-HSA. Within minutes of Ab infusion, glomeruli of the donor kidney had polymorphonuclear (PMN) infiltration that over the next few hours became marked and was associated with glomerular cell swelling. At 24 h a decrease in PMN's and early mesangial proliferation was seen. By 3 days there was marked mesangial hypercellularity and increased mesangial matrix. Within minutes after Ab administration rabbit IgG, C3, and fibrin were seen in the glomerular mesangium. There was a fall in complement titer by 1 min after Ab infusion that was due to complement consumption by the donor kidney. Complement then returned to normal levels by 48 h. Significant glomerular injury did not occur (a) in the recipient's own kidney, (b) from Ag administration and transplantation without recipient Ab administration, or (c) from transplantation and Ab administration without prior Ag administration. These studies demonstrated that Ag localized in the glomerular mesangium can react with circulating Ab and complement resulting in severe glomerular injury. PMID:4570015

  6. Symmetry and diffusivity of the interstitial hydrogen shallow-donor center in In 2O 3

    DOE PAGES

    Weiser, Philip; Qin, Ying; Yin, Weikai; ...

    2016-11-16

    Uniaxial stress experiments performed for the 3306 cm -1 vibrational line assigned to the interstitial-hydrogen, shallow-donor center in In 2O 3 reveal its symmetry and transition- moment direction. The defect alignment that can be produced by a [001] stress applied at 165 K is due to a process that is also a hydrogen- diffusion jump, providing a microscopic determination of the diffusion constant for H in In 2O 3 and its mechanism. Lastly, our experimental results strongly complement theoretical predictions for the structure and diffusion of the interstitial hydrogen donor center in In 2O 3.

  7. Synthesis of triple-stranded complexes using bis(dipyrromethene) ligands.

    PubMed

    Zhang, Zhan; Dolphin, David

    2010-12-20

    The reaction of an α-free, β,β'-linked bis(dipyrromethene) ligand with Fe(3+) or Co(3+) led to noninterconvertible triple-stranded helicates and mesocates. In the present context, a stable α-free ligand 2 has been developed and complexation of ligands 1 and 2 with diamagnetic Co(3+), Ga(3+), and In(3+) has been studied. The triple-stranded M(2)1(3) (M = Ga, In) and M(2)2(3) (M = Co, Ga, In) complexes were characterized using matrix-assisted laser desorption ionization time-of-flight spectrometry, (1)H NMR and UV-vis spectroscopy, and X-ray crystallography. Again, the (1)H NMR analysis showed that both the triple-stranded helicates and mesocates were generated in this metal-directed assembly. Consistent with our previous finding on coordinatively inert Co(3+) complexes, variable-temperature NMR spectroscopy indicated that the triple-stranded helicate and mesocate of labile In(3+) did not interconvert in solution, either. However, the diastereoselectivity of the M(2)2(3) complexes was found to improve with an increase in the reaction temperature. Taken together, this study complements the coordination chemistry of poly(dipyrromethene) ligands and provides further insight into the formation of helicates versus mesocates.

  8. Philanthropic partnerships and the future of cancer research.

    PubMed

    Murciano-Goroff, Yonina R

    2015-02-01

    Complementing government and industry funding, philanthropies have made distinct contributions to altering the trajectory of cancer research, often in ways that reflect both the business training of their donors and their close ties to the lay public.

  9. Large scale validation of an efficient CRISPR/Cas-based multi gene editing protocol in Escherichia coli.

    PubMed

    Zerbini, Francesca; Zanella, Ilaria; Fraccascia, Davide; König, Enrico; Irene, Carmela; Frattini, Luca F; Tomasi, Michele; Fantappiè, Laura; Ganfini, Luisa; Caproni, Elena; Parri, Matteo; Grandi, Alberto; Grandi, Guido

    2017-04-24

    The exploitation of the CRISPR/Cas9 machinery coupled to lambda (λ) recombinase-mediated homologous recombination (recombineering) is becoming the method of choice for genome editing in E. coli. First proposed by Jiang and co-workers, the strategy has been subsequently fine-tuned by several authors who demonstrated, by using few selected loci, that the efficiency of mutagenesis (number of mutant colonies over total number of colonies analyzed) can be extremely high (up to 100%). However, from published data it is difficult to appreciate the robustness of the technology, defined as the number of successfully mutated loci over the total number of targeted loci. This information is particularly relevant in high-throughput genome editing, where repetition of experiments to rescue missing mutants would be impractical. This work describes a "brute force" validation activity, which culminated in the definition of a robust, simple and rapid protocol for single or multiple gene deletions. We first set up our own version of the CRISPR/Cas9 protocol and then we evaluated the mutagenesis efficiency by changing different parameters including sequence of guide RNAs, length and concentration of donor DNAs, and use of single stranded and double stranded donor DNAs. We then validated the optimized conditions targeting 78 "dispensable" genes. This work led to the definition of a protocol, featuring the use of double stranded synthetic donor DNAs, which guarantees mutagenesis efficiencies consistently higher than 10% and a robustness of 100%. The procedure can be applied also for simultaneous gene deletions. This work defines for the first time the robustness of a CRISPR/Cas9-based protocol based on a large sample size. Since the technical solutions here proposed can be applied to other similar procedures, the data could be of general interest for the scientific community working on bacterial genome editing and, in particular, for those involved in synthetic biology projects requiring high throughput procedures.

  10. Toehold-Mediated Displacement of an Adenosine-Binding Aptamer from a DNA Duplex by its Ligand.

    PubMed

    Monserud, Jon H; Macri, Katherine M; Schwartz, Daniel K

    2016-10-24

    DNA is increasingly used to engineer dynamic nanoscale circuits, structures, and motors, many of which rely on DNA strand-displacement reactions. The use of functional DNA sequences (e.g., aptamers, which bind to a wide range of ligands) in these reactions would potentially confer responsiveness on such devices, and integrate DNA computation with highly varied molecular stimuli. By using high-throughput single-molecule FRET methods, we compared the kinetics of a putative aptamer-ligand and aptamer-complement strand-displacement reaction. We found that the ligands actively disrupted the DNA duplex in the presence of a DNA toehold in a similar manner to complementary DNA, with kinetic details specific to the aptamer structure, thus suggesting that the DNA strand-displacement concept can be extended to functional DNA-ligand systems. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Homologous Recombination Repair Protects Against Particulate Chromate-induced Chromosome Instability in Chinese Hamster Cells

    PubMed Central

    Stackpole, Megan M.; Wise, Sandra S.; Duzevik, Eliza Grlickova; Munroe, Ray C.; Thompson, W. Douglas; Thacker, John; Thompson, Larry H.; Hinz, John M.; Wise, John Pierce

    2008-01-01

    Particulate hexavalent chromium [Cr(VI)] compounds are well-established human carcinogens. Cr(VI)-induced tumors are characterized by chromosomal instability (CIN); however, the mechanisms of this effect are unknown. We investigated the hypothesis that homologous recombination (HR) repair of DNA double strand breaks protect cells from Cr(VI)-induced CIN by focusing on the XRCC3 and RAD51C genes, which play an important role in cellular resistance to DNA double strand breaks. We used Chinese hamster cells defective in each HR gene (irs3 for RAD51C and irs1SF for XRCC3) and compared with their wildtype parental and cDNA-complemented controls. We found that the intracellular Cr ion levels varied among the cell lines after particulate chromate treatment. Importantly, accounting for differences in Cr ion levels, we discovered that XRCC3 and RAD51C cells treated with lead chromate had increased cytotoxicity and chromosomal aberrations, relative to wild-type and cDNA-complimented cells. We also observed the emergence of high levels of chromatid exchanges in the two mutant cell lines. For example, 1 ug/cm2 lead chromate induced 20 and 32 exchanges in XRCC3- and RAD51C-deficient cells, respectively, whereas no exchanges were detected in the wildtype and cDNA-complemented cells. These observations suggest that HR protects cells from Cr(VI)-induced CIN, consistent with the ability of particulate Cr(VI) to induce double strand breaks. PMID:17662313

  12. Structure/cleavage-based insights into helical perturbations at bulge sites within T. thermophilus Argonaute silencing complexes

    PubMed Central

    Sheng, Gang; Gogakos, Tasos; Wang, Jiuyu; Zhao, Hongtu; Serganov, Artem; Juranek, Stefan

    2017-01-01

    Abstract We have undertaken a systematic structural study of Thermus thermophilus Argonaute (TtAgo) ternary complexes containing single-base bulges positioned either within the seed segment of the guide or target strands and at the cleavage site. Our studies establish that single-base bulges 7T8, 5A6 and 4A5 on the guide strand are stacked-into the duplex, with conformational changes localized to the bulge site, thereby having minimal impact on the cleavage site. By contrast, single-base bulges 6’U7’ and 6’A7’ on the target strand are looped-out of the duplex, with the resulting conformational transitions shifting the cleavable phosphate by one step. We observe a stable alignment for the looped-out 6’N7’ bulge base, which stacks on the unpaired first base of the guide strand, with the looped-out alignment facilitated by weakened Watson–Crick and reversed non-canonical flanking pairs. These structural studies are complemented by cleavage assays that independently monitor the impact of bulges on TtAgo-mediated cleavage reaction. PMID:28911094

  13. A programming language for composable DNA circuits

    PubMed Central

    Phillips, Andrew; Cardelli, Luca

    2009-01-01

    Recently, a range of information-processing circuits have been implemented in DNA by using strand displacement as their main computational mechanism. Examples include digital logic circuits and catalytic signal amplification circuits that function as efficient molecular detectors. As new paradigms for DNA computation emerge, the development of corresponding languages and tools for these paradigms will help to facilitate the design of DNA circuits and their automatic compilation to nucleotide sequences. We present a programming language for designing and simulating DNA circuits in which strand displacement is the main computational mechanism. The language includes basic elements of sequence domains, toeholds and branch migration, and assumes that strands do not possess any secondary structure. The language is used to model and simulate a variety of circuits, including an entropy-driven catalytic gate, a simple gate motif for synthesizing large-scale circuits and a scheme for implementing an arbitrary system of chemical reactions. The language is a first step towards the design of modelling and simulation tools for DNA strand displacement, which complements the emergence of novel implementation strategies for DNA computing. PMID:19535415

  14. A programming language for composable DNA circuits.

    PubMed

    Phillips, Andrew; Cardelli, Luca

    2009-08-06

    Recently, a range of information-processing circuits have been implemented in DNA by using strand displacement as their main computational mechanism. Examples include digital logic circuits and catalytic signal amplification circuits that function as efficient molecular detectors. As new paradigms for DNA computation emerge, the development of corresponding languages and tools for these paradigms will help to facilitate the design of DNA circuits and their automatic compilation to nucleotide sequences. We present a programming language for designing and simulating DNA circuits in which strand displacement is the main computational mechanism. The language includes basic elements of sequence domains, toeholds and branch migration, and assumes that strands do not possess any secondary structure. The language is used to model and simulate a variety of circuits, including an entropy-driven catalytic gate, a simple gate motif for synthesizing large-scale circuits and a scheme for implementing an arbitrary system of chemical reactions. The language is a first step towards the design of modelling and simulation tools for DNA strand displacement, which complements the emergence of novel implementation strategies for DNA computing.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sobottka, Marcelo, E-mail: sobottka@mtm.ufsc.br; Hart, Andrew G., E-mail: ahart@dim.uchile.cl

    Highlights: {yields} We propose a simple stochastic model to construct primitive DNA sequences. {yields} The model provide an explanation for Chargaff's second parity rule in primitive DNA sequences. {yields} The model is also used to predict a novel type of strand symmetry in primitive DNA sequences. {yields} We extend the results for bacterial DNA sequences and compare distributional properties intrinsic to the model to statistical estimates from 1049 bacterial genomes. {yields} We find out statistical evidences that the novel type of strand symmetry holds for bacterial DNA sequences. -- Abstract: Chargaff's second parity rule for short oligonucleotides states that themore » frequency of any short nucleotide sequence on a strand is approximately equal to the frequency of its reverse complement on the same strand. Recent studies have shown that, with the exception of organellar DNA, this parity rule generally holds for double-stranded DNA genomes and fails to hold for single-stranded genomes. While Chargaff's first parity rule is fully explained by the Watson-Crick pairing in the DNA double helix, a definitive explanation for the second parity rule has not yet been determined. In this work, we propose a model based on a hidden Markov process for approximating the distributional structure of primitive DNA sequences. Then, we use the model to provide another possible theoretical explanation for Chargaff's second parity rule, and to predict novel distributional aspects of bacterial DNA sequences.« less

  16. Studies of Xenopus laevis mitochondrial DNA: D-loop mapping and characterization of DNA-binding proteins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cairns, S.S.

    1987-01-01

    In X. laevis oocytes, mitochondrial DNA accumulates to 10/sup 5/ times the somatic cell complement, and is characterized by a high frequency of a triple-stranded displacement hoop structure at the origin of replication. To map the termini of the single strands, it was necessary to correct the nucleotide sequence of the D-loop region. The revised sequence of 2458 nucleotides contains 54 discrepancies in comparison to a previously published sequence. Radiolabeling of the nascent strands of the D-loop structure either at the 5' end or at the 3' end identifies a major species with a length of 1670 nucleotides. Cleavage ofmore » the 5' labeled strands reveals two families of ends located near several matches to an element, designated CSB-1, that is conserved in this location in several vertebrate genomes. Cleavage of 3' labeled strands produced one fragment. The unique 3' end maps to about 15 nucleotides preceding the tRNA/sup Pro/ gene. A search for proteins which may bind to mtDNA in this region to regulate nucleic acid synthesis has identified three activities in lysates of X. laevis mitochondria. The DNA-binding proteins were assayed by monitoring their ability to retard the migration of labeled double- or single-stranded DNA fragments in polyacrylamide gels. The DNA binding preference was determined by competition with an excess of either ds- or ssDNA.« less

  17. The influence of sequence context and length on the kinetics of DNA duplex formation from complementary hairpins possessing (CNG) repeats.

    PubMed

    Paiva, Anthony M; Sheardy, Richard D

    2005-04-20

    The formation of unusual structures during DNA replication has been invoked for gene expansion in genomes possessing triplet repeat sequences, CNG, where N = A, C, G, or T. In particular, it has been suggested that the daughter strand of the leading strand partially dissociates from the parent strand and forms a hairpin. The equilibrium between the fully duplexed parent:daugter species and the parent:hairpin species is dependent upon their relative stabilities and the rates of reannealing of the daughter strand back to the parent. These stabilities and rates are ultimately influenced by the sequence context of the DNA and its length. Previous work has demonstrated that longer strands are more stable than shorter strands and that the identity of N also influences the thermal stability [Paiva, A. M.; Sheardy, R. D. Biochemistry 2004, 43, 14218-14227]. Here, we show that the rate of duplex formation from complementary hairpins is also sequence context and length dependent. In particular, longer duplexes have higher activation energies than shorter duplexes of the same sequence context. Further, [(CCG):(GGC)] duplexes have lower activation energies than corresponding [(CAG):(GTC)] duplexes of the same length. Hence, hairpins formed from long CNG sequences are more thermodynamically stable and have slower kinetics for reannealing to their complement than shorter analogues. Gene expansion can now be explained in terms of thermodynamics and kinetics.

  18. Increased C3 production in human monocytes after stimulation with Candida albicans is suppressed by granulocyte-macrophage colony-stimulating factor.

    PubMed Central

    Høgåsen, A K; Abrahamsen, T G

    1993-01-01

    Activation of the complement system is an important part of host resistance against fungal infections. When human monocytes, cultured for 2 days or more, were treated in vitro with Candida albicans for 24 h, an enhancement of their biosynthesis of the complement components C3 and factor B was found. However, when C. albicans was administered to freshly isolated monocytes, a consistent stimulation of factor B biosynthesis occurred, while the C3 production was increased in about 50% of the donors. C. albicans also induced the release of granulocyte-macrophage colony-stimulating factor (GM-CSF) from the cultured cells, apparently in larger amounts in the donors in whom no stimulation of C3 production was found. An antibody to GM-CSF administered with the yeast at the initiation of the monocyte culture caused an increase in the C3 production. Furthermore, when monocytes were treated with recombinant human GM-CSF either at the same time as or 4 days prior to the addition of C. albicans, the increase in C3 production was suppressed or neutralized, while factor B biosynthesis was unaffected. Taken together, these results indicate that monocytes respond to C. albicans with an increased production of complement factors. This may be an important mechanism both for opsonization of the fungus and for initiation of an inflammatory reaction. At an inflammatory site, this complement response may be suppressed by locally produced GM-CSF. PMID:8478067

  19. Rabbit somatic cell cloning: effects of donor cell type, histone acetylation status and chimeric embryo complementation.

    PubMed

    Yang, Feikun; Hao, Ru; Kessler, Barbara; Brem, Gottfried; Wolf, Eckhard; Zakhartchenko, Valeri

    2007-01-01

    The epigenetic status of a donor nucleus has an important effect on the developmental potential of embryos produced by somatic cell nuclear transfer (SCNT). In this study, we transferred cultured rabbit cumulus cells (RCC) and fetal fibroblasts (RFF) from genetically marked rabbits (Alicia/Basilea) into metaphase II oocytes and analyzed the levels of histone H3-lysine 9-lysine 14 acetylation (acH3K9/14) in donor cells and cloned embryos. We also assessed the correlation between the histone acetylation status of donor cells and cloned embryos and their developmental potential. To test whether alteration of the histone acetylation status affects development of cloned embryos, we treated donor cells with sodium butyrate (NaBu), a histone deacetylase inhibitor. Further, we tried to improve cloning efficiency by chimeric complementation of cloned embryos with blastomeres from in vivo fertilized or parthenogenetic embryos. The levels of acH3K9/14 were higher in RCCs than in RFFs (P<0.05). Although the type of donor cells did not affect development to blastocyst, after transfer into recipients, RCC cloned embryos induced a higher initial pregnancy rate as compared to RFF cloned embryos (40 vs 20%). However, almost all pregnancies with either type of cloned embryos were lost by the middle of gestation and only one fully developed, live RCC-derived rabbit was obtained. Treatment of RFFs with NaBu significantly increased the level of acH3K9/14 and the proportion of nuclear transfer embryos developing to blastocyst (49 vs 33% with non-treated RFF, P<0.05). The distribution of acH3K9/14 in either group of cloned embryos did not resemble that in in vivo fertilized embryos suggesting that reprogramming of this epigenetic mark is aberrant in cloned rabbit embryos and cannot be corrected by treatment of donor cells with NaBu. Aggregation of embryos cloned from NaBu-treated RFFs with blastomeres from in vivo derived embryos improved development to blastocyst, but no cloned offspring were obtained. Two live cloned rabbits were produced from this donor cell type only after aggregation of cloned embryos with a parthenogenetic blastomere. Our study demonstrates that the levels of histone acetylation in donor cells and cloned embryos correlate with their developmental potential and may be a useful epigenetic mark to predict efficiency of SCNT in rabbits.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Weiser, Philip; Qin, Ying; Yin, Weikai

    Uniaxial stress experiments performed for the 3306 cm -1 vibrational line assigned to the interstitial-hydrogen, shallow-donor center in In 2O 3 reveal its symmetry and transition- moment direction. The defect alignment that can be produced by a [001] stress applied at 165 K is due to a process that is also a hydrogen- diffusion jump, providing a microscopic determination of the diffusion constant for H in In 2O 3 and its mechanism. Lastly, our experimental results strongly complement theoretical predictions for the structure and diffusion of the interstitial hydrogen donor center in In 2O 3.

  1. An indicator gene to demonstrate intracellular transposition of defective retroviruses.

    PubMed Central

    Heidmann, T; Heidmann, O; Nicolas, J F

    1988-01-01

    An indicator gene for detection and quantitation of RNA-mediated transposition was constructed (neoRT). It was inserted into a Moloney murine leukemia provirus (Mo-MLV) deleted for the envelope gene to test for intracellular transposition of defective retroviruses [Mo-MLV(neo)RT]. NeoRT contains the selectable neo gene (which confers resistance to the drug G418), inactivated by a polyadenylylation sequence inserted between the neo promotor and coding sequence. The polyadenylylation sequence is flanked (on the antisense strand of the DNA) by a donor and an acceptor splice site so as to be removed upon passage of the provirus through an RNA intermediate. 3T3 cells transfected with the defective Mo-MLV(neo)RT provirus are sensitive to G418. After trans-complementation with Mo-MLV, viral transcripts confer resistance to G418 upon infection of test cells. In the resistant cells, the polyadenylylation sequence has been removed, as a result in most cases of precise splicing of the intronic domain. Retrotransposition of the defective Mo-MLV(neo)RT provirus was demonstrated by submitting transfected G418-sensitive clones to selection. Between 1 and 10 G418-resistant clones were obtained per 10(7) cells. Several possess additional copies, with evidence for precise removal of the intronic domain. By using target test cells in coculture experiments, extracellular intermediates of retrotransposition could not be detected. Images PMID:2832848

  2. Damage-dependent regulation of MUS81-EME1 by Fanconi anemia complementation group A protein

    PubMed Central

    Benitez, Anaid; Yuan, Fenghua; Nakajima, Satoshi; Wei, Leizhen; Qian, Liangyue; Myers, Richard; Hu, Jennifer J.; Lan, Li; Zhang, Yanbin

    2014-01-01

    MUS81-EME1 is a DNA endonuclease involved in replication-coupled repair of DNA interstrand cross-links (ICLs). A prevalent hypothetical role of MUS81-EME1 in ICL repair is to unhook the damage by incising the leading strand at the 3′ side of an ICL lesion. In this study, we report that purified MUS81-EME1 incises DNA at the 5′ side of a psoralen ICL residing in fork structures. Intriguingly, ICL repair protein, Fanconi anemia complementation group A protein (FANCA), greatly enhances MUS81-EME1-mediated ICL incision. On the contrary, FANCA exhibits a two-phase incision regulation when DNA is undamaged or the damage affects only one DNA strand. Studies using truncated FANCA proteins indicate that both the N- and C-moieties of the protein are required for the incision regulation. Using laser-induced psoralen ICL formation in cells, we find that FANCA interacts with and recruits MUS81 to ICL lesions. This report clarifies the incision specificity of MUS81-EME1 on ICL damage and establishes that FANCA regulates the incision activity of MUS81-EME1 in a damage-dependent manner. PMID:24170812

  3. The Pathway of Oligomeric DNA Melting Investigated by Molecular Dynamics Simulations

    PubMed Central

    Wong, Ka-Yiu; Pettitt, B. Montgomery

    2008-01-01

    Details of the reaction coordinate for DNA melting are fundamental to much of biology and biotechnology. Recently, it has been shown experimentally that there are at least three states involved. To clarify the reaction mechanism of the melting transition of DNA, we perform 100-ns molecular dynamics simulations of a homo-oligomeric, 12-basepair DNA duplex, d(A12)·d(T12), with explicit salt water at 400 K. Analysis of the trajectory reveals the various biochemically important processes that occur on different timescales. Peeling (including fraying from the ends), searching for Watson-Crick complements, and dissociation are recognizable processes. However, we find that basepair searching for Watson-Crick complements along a strand is not mechanistically tied to or directly accessible from the dissociation steps of strand melting. A three-step melting mechanism is proposed where the untwisting of the duplex is determined to be the major component of the reaction coordinate at the barrier. Though the observations are limited to the characteristics of the system being studied, they provide important insight into the mechanism of melting of other more biologically relevant forms of DNA, which will certainly differ in details from those here. PMID:18952784

  4. DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles.

    PubMed

    Delplanque, Aleksandra; Wawrzynczyk, Dominika; Jaworski, Pawel; Matczyszyn, Katarzyna; Pawlik, Krzysztof; Buckle, Malcolm; Nyk, Marcin; Nogues, Claude; Samoc, Marek

    2015-01-01

    Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio) probes in Förster Resonance Energy Transfer (FRET) where trivalent lanthanide ions (La3+) act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm) NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA) by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5) modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+) and the acceptor (Cy5) with sensitivity at a nanometre scale.

  5. Effect of the reflectional symmetry on the coherent hole transport across DNA hairpins

    NASA Astrophysics Data System (ADS)

    Zarea, Mehdi; Berlin, Yuri; Ratner, Mark A.

    2017-03-01

    The coherent hole transfer in three types of DNA hairpins containing strands with adenine (A) and guanine (G) nucleobases has been studied. The investigated hairpins involve An+1GGAn, AnGAGAn, or (AG)2nA strands that connect the hole donor and hole acceptor located on opposite ends of hairpins. The positive charge transfer from the photo-excited donor to the acceptor is shown to be slower for An+1GGAn in comparison with AnGAGAn and (AG)2nA sequences. We have revealed that this is due to the reflectional symmetry of the last two sequences with respect to the axis passing through the middle base. As has been demonstrated, the symmetry of the sequence structure manifests itself in the reflectional symmetry of the energy eigenstates. In addition, it has been shown that (AG)2nA is the only symmetric sequence with a zero energy state in the middle of the LUMO tight-binding energy band. Based on our theoretical findings, we predict that the hairpin with this sequence should have the fastest coherent hole transfer rate among the class of base sequences studied.

  6. Targeted gene knock-in by homology-directed genome editing using Cas9 ribonucleoprotein and AAV donor delivery.

    PubMed

    Gaj, Thomas; Staahl, Brett T; Rodrigues, Gonçalo M C; Limsirichai, Prajit; Ekman, Freja K; Doudna, Jennifer A; Schaffer, David V

    2017-06-20

    Realizing the full potential of genome editing requires the development of efficient and broadly applicable methods for delivering programmable nucleases and donor templates for homology-directed repair (HDR). The RNA-guided Cas9 endonuclease can be introduced into cells as a purified protein in complex with a single guide RNA (sgRNA). Such ribonucleoproteins (RNPs) can facilitate the high-fidelity introduction of single-base substitutions via HDR following co-delivery with a single-stranded DNA oligonucleotide. However, combining RNPs with transgene-containing donor templates for targeted gene addition has proven challenging, which in turn has limited the capabilities of the RNP-mediated genome editing toolbox. Here, we demonstrate that combining RNP delivery with naturally recombinogenic adeno-associated virus (AAV) donor vectors enables site-specific gene insertion by homology-directed genome editing. Compared to conventional plasmid-based expression vectors and donor templates, we show that combining RNP and AAV donor delivery increases the efficiency of gene addition by up to 12-fold, enabling the creation of lineage reporters that can be used to track the conversion of striatal neurons from human fibroblasts in real time. These results thus illustrate the potential for unifying nuclease protein delivery with AAV donor vectors for homology-directed genome editing. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Double-labeled donor probe can enhance the signal of fluorescence resonance energy transfer (FRET) in detection of nucleic acid hybridization

    PubMed Central

    Okamura, Yukio; Kondo, Satoshi; Sase, Ichiro; Suga, Takayuki; Mise, Kazuyuki; Furusawa, Iwao; Kawakami, Shigeki; Watanabe, Yuichiro

    2000-01-01

    A set of fluorescently-labeled DNA probes that hybridize with the target RNA and produce fluorescence resonance energy transfer (FRET) signals can be utilized for the detection of specific RNA. We have developed probe sets to detect and discriminate single-strand RNA molecules of plant viral genome, and sought a method to improve the FRET signals to handle in vivo applications. Consequently, we found that a double-labeled donor probe labeled with Bodipy dye yielded a remarkable increase in fluorescence intensity compared to a single-labeled donor probe used in an ordinary FRET. This double-labeled donor system can be easily applied to improve various FRET probes since the dependence upon sequence and label position in enhancement is not as strict. Furthermore this method could be applied to other nucleic acid substances, such as oligo RNA and phosphorothioate oligonucleotides (S-oligos) to enhance FRET signal. Although the double-labeled donor probes labeled with a variety of fluorophores had unexpected properties (strange UV-visible absorption spectra, decrease of intensity and decay of donor fluorescence) compared with single-labeled ones, they had no relation to FRET enhancement. This signal amplification mechanism cannot be explained simply based on our current results and knowledge of FRET. Yet it is possible to utilize this double-labeled donor system in various applications of FRET as a simple signal-enhancement method. PMID:11121494

  8. A trait stacking system via intra-genomic homologous recombination.

    PubMed

    Kumar, Sandeep; Worden, Andrew; Novak, Stephen; Lee, Ryan; Petolino, Joseph F

    2016-11-01

    A gene targeting method has been developed, which allows the conversion of 'breeding stacks', containing unlinked transgenes into a 'molecular stack' and thereby circumventing the breeding challenges associated with transgene segregation. A gene targeting method has been developed for converting two unlinked trait loci into a single locus transgene stack. The method utilizes intra-genomic homologous recombination (IGHR) between stably integrated target and donor loci which share sequence homology and nuclease cleavage sites whereby the donor contains a promoterless herbicide resistance transgene. Upon crossing with a zinc finger nuclease (ZFN)-expressing plant, double-strand breaks (DSB) are created in both the stably integrated target and donor loci. DSBs flanking the donor locus result in intra-genomic mobilization of a promoterless selectable marker-containing donor sequence, which can be utilized as a template for homology-directed repair of a concomitant DSB at the target locus resulting in a functional selectable marker via nuclease-mediated cassette exchange (NMCE). The method was successfully demonstrated in maize using a glyphosate tolerance gene as a donor whereby up to 3.3 % of the resulting progeny embryos cultured on selection medium regenerated plants with the donor sequence integrated into the target locus. The process could be extended to multiple cycles of trait stacking by virtue of a unique intron sequence homology for NMCE between the target and the donor loci. This is the first report that describes NMCE via IGHR, thereby enabling trait stacking using conventional crossing.

  9. Effects of heat-treatment on plasma rich in growth factors-derived autologous eye drop.

    PubMed

    Anitua, E; Muruzabal, F; De la Fuente, M; Merayo-Lloves, J; Orive, G

    2014-02-01

    We have developed and characterized a new type of plasma rich in growth factors (PRGF) derived eye-drop therapy for patients suffering from autoimmune diseases. To determine the concentration of several growth factors, proteins, immunoglobulins and complement activity of the heat-inactivated eye-drop and to study its biological effects on cell proliferation and migration of different ocular surface cells, blood from healthy donors was collected, centrifuged and PRGF was prepared avoiding the buffy coat. The half volume of the obtained plasma supernatant from each donor was heat-inactivated at 56 °C for 1 h (heat-inactivated PRGF). The concentration of several proteins involved on corneal wound healing, immunoglubolins G, M and E and functional integrity of the complement system assayed by CH50 test were determined. The proliferative and migratory potential of inactivated and non-inactivated PRGF eye drops were assayed on corneal epithelial cells (HCE), keratocytes (HK) and conjunctival fibroblasts (HConF). Heat-inactivated PRGF preserves the content of most of the proteins and morphogens involved in its wound healing effects while reduces drastically the content of IgE and complement activity. Heat-inactivated PRGF eye drops increased proliferation and migration potential of ocular surface cells with regard to PRGF showing significant differences on proliferation and migration rate of HCE and HConF respectively. In summary, heat-inactivation of PRGF eye drops completely reduced complement activity and deceased significantly the presence of IgE, maintaining the biological activity of PRGF on ocular surface cells. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Single-Stranded γPNAs for In Vivo Site-Specific Genome Editing via Watson-Crick Recognition

    PubMed Central

    Bahal, Raman; Quijano, Elias; McNeer, Nicole Ali; Liu, Yanfeng; Bhunia, Dinesh C.; López-Giráldez, Francesco; Fields, Rachel J.; Saltzman, W. Mark; Ly, Danith H.; Glazer, Peter M.

    2014-01-01

    Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction. PMID:25174576

  11. Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition.

    PubMed

    Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M

    2014-01-01

    Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.

  12. Tn552 transposase purification and in vitro activities.

    PubMed Central

    Rowland, S J; Sherratt, D J; Stark, W M; Boocock, M R

    1995-01-01

    The Staphylococcus aureus transposon Tn552 encodes a protein (p480) containing the 'D,D(35)E' motif common to retroviral integrases and the transposases of a number of bacterial elements, including phage Mu, the integron-containing element Tn5090, Tn7 and IS3. p480 and a histidine-tagged derivative were overexpressed in Escherichia coli and purified by methods involving denaturation and renaturation. DNase I footprinting and gel binding assays demonstrated that p480 binds to two adjacent, directly repeated 23 bp motifs at each end of Tn552. Although donor strand cleavage by p480 was not detected, in vitro conditions were defined for strand transfer activity with transposon end fragments having pre-cleaved 3' termini. Strand transfer was Mn(2+)-dependent and appeared to join a single left or right end fragment to target DNA. The importance of the terminal dinucleotide CA-3' was demonstrated by mutation. The in vitro activities of p480 are consistent with its proposed function as the Tn552 transposase. Images PMID:7828593

  13. Method for detecting point mutations in DNA utilizing fluorescence energy transfer

    DOEpatents

    Parkhurst, Lawrence J.; Parkhurst, Kay M.; Middendorf, Lyle

    2001-01-01

    A method for detecting point mutations in DNA using a fluorescently labeled oligomeric probe and Forster resonance energy transfer (FRET) is disclosed. The selected probe is initially labeled at each end with a fluorescence dye, which act together as a donor/acceptor pair for FRET. The fluorescence emission from the dyes changes dramatically from the duplex stage, wherein the probe is hybridized to the complementary strand of DNA, to the single strand stage, when the probe is melted to become detached from the DNA. The change in fluorescence is caused by the dyes coming into closer proximity after melting occurs and the probe becomes detached from the DNA strand. The change in fluorescence emission as a function of temperature is used to calculate the melting temperature of the complex or T.sub.m. In the case where there is a base mismatch between the probe and the DNA strand, indicating a point mutation, the T.sub.m has been found to be significantly lower than the T.sub.m for a perfectly match probelstand duplex. The present invention allows for the detection of the existence and magnitude of T.sub.m, which allows for the quick and accurate detection of a point mutation in the DNA strand and, in some applications, the determination of the approximate location of the mutation within the sequence.

  14. Paying donors and the ethics of blood supply.

    PubMed Central

    Rodriguez del Pozo, P

    1994-01-01

    Countries may be erring in the current trend towards relying entirely on volunteers to fulfil blood and plasma needs. Complementing uncompensated blood with compensated blood is vitally necessary not only effectively to meet the blood and plasma needs of most countries, but it is also ethically sound. PMID:8035437

  15. Risk factors for Trypanosoma cruzi infection among blood donors in central Brazil.

    PubMed

    Martelli, C M; Andrade, A L; Silva, S A; Zicker, F

    1992-01-01

    Characteristics and possible risk factors associated with Trypanosoma cruzi infection among blood donors were assessed within a routine screening programme in blood banks in an endemic area of Chagas disease. 6,172 voluntary blood donors were interviewed and tested for anti-T. cruzi antibodies by Haemagglutination and Complement Fixation tests in six blood banks in Goiânia-Central Brazil from October 1988 to April 1989. An overall prevalence of 2.3% for T. cruzi infection was obtained, being 3.3% for first-time blood donors and 1.9% for regular ones (p < 0.01). Considering this seropositivity among regular blood donors, selection of candidates relying only on the history of previous donation was found to be inadequate. The risk of infection increased inversely with the degrees of education and monthly income. There was a 9.2 risk of infection (95% CI 3.8-22.6) for those who had lived more than 21 years in an endemic area compared to subjects who had never lived in rural settings, after multivariate analysis. These informations may help to review the criteria of selection of donors in order to improve quality of blood products in endemic areas.

  16. Specificity of EIA immunoassay for complement factor Bb testing.

    PubMed

    Pavlov, Igor Y; De Forest, Nikol; Delgado, Julio C

    2011-01-01

    During the alternative complement pathway activation, factor B is cleaved in two fragments, Ba and Bb. Concentration of those fragments is about 2 logs lower than of factor B present in the blood, which makes fragment detection challenging because of potential cross-reactivity. Lack of information on Bb assay cross-reactivity stimulated the authors to investigate this issue. We ran 109 healthy donor EDTA plasmas and 80 sera samples with both factor B immunodiffusion (The Binding Site) and Quidel Bb EIA assays. During the study it was shown that physiological concentrations of gently purified factor B demonstrated approximately 0.15% cross-reactivity in the Quidel Bb EIA assay. We also observed that Bb concentration in serum is higher than in plasma due to complement activation during clot formation which let us use sera as samples representing complement activated state. Our study demonstrated that despite the potential 0.15% cross-reactivity between endogenous factor B and cleaved Bb molecule, measuring plasma concentrations of factor Bb is adequate to evaluate the activation of the alternative complement pathway.

  17. A Smart DNA Tweezer for Detection of Human Telomerase Activity.

    PubMed

    Xu, Xiaowen; Wang, Lei; Li, Kan; Huang, Qihong; Jiang, Wei

    2018-03-06

    Reliable and accurate detection of telomerase activity is crucial to better understand its role in cancer cells and to further explore its function in cancer diagnosis and treatment. Here, we construct a smart DNA tweezer (DT) for detection of telomerase activity. The DT is assembled by three specially designed single-stranded oligonucleotides: a central strand dually labeled with donor/acceptor fluorophores and two arm strands containing overhangs complementary to telomerase reaction products (TRPs). It can get closed through hybridization with TRPs and get reopen through strand displacement reaction by TRPs' complementary sequences. First, under the action of telomerase, telomerase binding substrates (TS) are elongated to generate TRPs ended with telomeric repeats (TTAGGG) n . TRPs hybridize with the two arm overhangs cooperatively and strain DT to closed state, inducing an increased fluorescence resonance energy transfer (FRET) efficiency, which is utilized for telomerase activity detection. Second, upon introduction of a removal strand (RS) complementary to TRPs, the closed DT is relaxed to open state via the toehold-mediated strand displacement, inducing a decreased FRET efficiency, which is utilized for determination of TRP length distribution. The detection limit of telomerase activity is equivalent to 141 cells/μL for HeLa cells, and telomerase-active cellular extracts can be differentiated from telomerase-inactive cellular extracts. Furthermore, TRPs owning 1, 2, 3, 4, and ≥5 telomeric repeats are identified to account for 25.6%, 20.5%, 15.7%, 12.5%, and 25.7%, respectively. The proposed strategy will offer a new approach for reliable, accurate detection of telomerase activity and product length distribution for deeper studying its role and function in cancer.

  18. Cytokine overproduction and crosslinker hypersensitivity are unlinked in Fanconi anemia macrophages.

    PubMed

    Garbati, Michael R; Hays, Laura E; Rathbun, R Keaney; Jillette, Nathaniel; Chin, Kathy; Al-Dhalimy, Muhsen; Agarwal, Anupriya; Newell, Amy E Hanlon; Olson, Susan B; Bagby, Grover C

    2016-03-01

    The Fanconi anemia proteins participate in a canonical pathway that repairs cross-linking agent-induced DNA damage. Cells with inactivated Fanconi anemia genes are universally hypersensitive to such agents. Fanconi anemia-deficient hematopoietic stem cells are also hypersensitive to inflammatory cytokines, and, as importantly, Fanconi anemia macrophages overproduce such cytokines in response to TLR4 and TLR7/8 agonists. We questioned whether TLR-induced DNA damage is the primary cause of aberrantly regulated cytokine production in Fanconi anemia macrophages by quantifying TLR agonist-induced TNF-α production, DNA strand breaks, crosslinker-induced chromosomal breakage, and Fanconi anemia core complex function in Fanconi anemia complementation group C-deficient human and murine macrophages. Although both M1 and M2 polarized Fanconi anemia cells were predictably hypersensitive to mitomycin C, only M1 macrophages overproduced TNF-α in response to TLR-activating signals. DNA damaging agents alone did not induce TNF-α production in the absence of TLR agonists in wild-type or Fanconi anemia macrophages, and mitomycin C did not enhance TLR responses in either normal or Fanconi anemia cells. TLR4 and TLR7/8 activation induced cytokine overproduction in Fanconi anemia macrophages. Also, although TLR4 activation was associated with induced double strand breaks, TLR7/8 activation was not. That DNA strand breaks and chromosome breaks are neither necessary nor sufficient to account for the overproduction of inflammatory cytokines by Fanconi anemia cells suggests that noncanonical anti-inflammatory functions of Fanconi anemia complementation group C contribute to the aberrant macrophage phenotype and suggests that suppression of macrophage/TLR hyperreactivity might prevent cytokine-induced stem cell attrition in Fanconi anemia. © Society for Leukocyte Biology.

  19. CFH Y402H polymorphism and the complement activation product C5a: effects on NF-κB activation and inflammasome gene regulation.

    PubMed

    Cao, Sijia; Wang, Jay Ching Chieh; Gao, Jiangyuan; Wong, Matthew; To, Elliott; White, Valerie A; Cui, Jing Z; Matsubara, Joanne A

    2016-05-01

    The Y402H polymorphism in the complement factor H (CFH) gene is an important risk factor for age-related macular degeneration (AMD). Complement activation products and proinflammatory cytokines are associated with this polymorphism at the systemic level, but less is known of the associations in the outer retina of the genotyped eye. Here we investigate complement activation products and their role in nuclear factor (NF)-κB activation and gene expression of the NLRP3 inflammasome pathway. Postmortem donor eyes were genotyped for the CFH Y402H polymorphism and assessed for complement C3a, C5a, interleukin (IL)-18 and tumour necrosis factor (TNF)-α. ARPE19 cells were stimulated basolaterally with C5a or TNF-α in polarised cultures. NF-κB activation was assessed with a reporter cell line. Gene expression of inflammasome-related (NLRP3, caspase-1, IL-1β and IL-18) and classic inflammatory (IL-6 and IL-8) genes was studied. The distribution of inflammasome products, IL-1β and IL-18, was studied in postmortem donor eyes with AMD pathologies. Eyes with the homozygous at-risk variant demonstrated higher levels of C5a, IL-18 and TNF-α in Bruch's membrane and choroid. C5a promoted NF-κB activation and upregulation of IL-18 in polarised ARPE19. TNF-α promoted NF-κB activation and gene expression of caspase-1, IL-1β, IL-18, IL-6 and IL-8, but downregulated NLRP3. In eyes with geographic atrophy, strong immunoreactivity was observed for inflammasome products IL-1β and IL-18 compared with age-matched controls. The at-risk polymorphism of the CFH Y402H may contribute to AMD disease process through increased complement and NF-κB activation, and the upregulation of IL-18, a product of inflammasome activation. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  20. Role of humoral immune reactions as target for antirejection therapy in recipients of a spousal-donor kidney graft.

    PubMed

    Böhmig, G A; Regele, H; Säemann, M D; Exner, M; Druml, W; Kovarik, J; Hörl, W H; Zlabinger, G J; Watschinger, B

    2000-04-01

    Excellent graft outcome has been reported for spousal-donor kidney transplantation. In husband-to-wife transplantation, however, a tendency toward inferior graft survival has been described for recipients who were previously pregnant. In our series of spousal-kidney transplantations (nine transplantations; three female recipients), actual graft survival is 100% (median observation time, 339 days). Five patients experienced early allograft rejection. In four transplant recipients, rejection was easily reversible by conventional antirejection therapy. In a multiparous recipient, however, mild interstitial allograft rejection associated with early graft dysfunction was resistant to anticellular treatment (antilymphocyte antibody, tacrolimus rescue therapy). The particular finding of polymorphonuclear neutrophils in peritubular capillaries and the finding of diffuse capillary deposits of the complement split product, C4d, in a posttransplantation biopsy specimen suggested a role of antibody-mediated graft injury. Retrospective flow cytometry cross-matching showed the presence of preformed immunoglobulin G (IgG) antibodies to HLA class I antigens that were not detectable by pretransplantation lymphocytotoxic cross-match testing or screening for panel reactive antibodies. After transplantation, however, complement-fixing antibodies, also presumably triggered by reexposure to spousal-donor HLA antigens, could be detected in the patient's serum. These findings suggested antibody-mediated allograft rejection and led to the initiation of immunoadsorption therapy (14 sessions) with staphylococcal protein A. Selective removal of recipient IgG resulted in complete reversal of graft dysfunction. Our findings suggest that in husband-to-wife transplantation, donor-specific antibodies, presumably triggered by previous pregnancies, might occasionally induce sustained allograft dysfunction. Thus, in this particular setting, a detailed immunologic and histopathologic work-up regarding antibody-mediated allograft dysfunction is warranted because immunoadsorption may be a highly effective treatment modality.

  1. Reactive arthritis and serum levels of mannose binding lectin – lack of association

    PubMed Central

    LOCHT, H; CHRISTIANSEN, M; LAURSEN, I

    2003-01-01

    The purpose was to evaluate the possible association of serum mannose binding lectin (s-MBL) levels on type of triggering microbe, duration of diarrhoea, incidence and course of reactive arthritis (ReA) caused by Salmonella, Yersinia and Campylobacter. Sixty patients with ReA of 1–228 months duration, 173 patients with ReA or uncomplicated enterocolitis caused by Campylobacter, 226 sera from patients with elevated antibody levels against Salmonella, Yersinia or Campylobacter, and 114 blood donors were tested for s-MBL using ELISA technique, both direct mannan binding assay and sandwich ELISA. s-MBL was compared with C-reactive protein (CRP) levels and with the ability of activating complement C4. Among the 114 donors 9% had s-MBL <50 µg/l, 16% had from 50–500 µg/l and 75% had >500 µg/l. The distribution of s-MBL levels in the three-patient groups did not differ significantly from the controls. There were no indications that low s-MBL was associated with prolonged duration of arthritis, diarrhoea or individual bacterial infections. The two MBL assays were comparable with respect to serum concentrations, indicating that the actual circulating MBL was also functionally active. s-MBL exhibited acute phase reactant behaviour and correlated to CRP level, but only in patients with s-MBL concentrations exceeding 1000 µg/l. MBL in 10 randomly selected ReA sera were tested for the ability to activate complement C4. The results did not differ from those of donor controls. This study demonstrates that the distributions of s-MBL levels in serum among patients with ReA are not different from donor controls. The course, outcome or triggering bacteria are not associated with a particular level of s-MBL. PMID:12519401

  2. A randomized controlled trial oftransfusion-related acute lung injury: is plasma from multiparous blood donors dangerous?

    PubMed

    Palfi, M; Berg, S; Ernerudh, J; Berlin, G

    2001-03-01

    Transfusion-related acute lung injury (TRALI) and other posttransfusion reactions may be caused by granulocyte and/or HLA antibodies, which are often present in blood from multiparous donors. The purpose of this study was to compare the effects of plasma from multiparous donors with those of plasma from donors with no history of transfusion or pregnancy (control plasma) in a prospective, randomized, double-blind, crossover study. Intensive care patients, judged to need at least 2 units of plasma, were randomly assigned to receive a unit of control plasma and, 4 hours later, a plasma unit from a multiparous donor (> or = 3 live births) or to receive the plasma units in opposite order. The patients were closely monitored, and body temperature, blood pressure, and heart rate were recorded. Blood samples for analysis of blood gases, TNFalpha, IL-1 receptor antagonist, soluble E selectin, and C3d complement factor were collected at least on four occasions (before and after the transfusion of each unit). Transfusion of plasma from multiparous donors was associated with significantly lower oxygen saturation and higher TNFalpha concentrations than transfusion of control plasma. The mean arterial pressure increased significantly after the transfusion of control plasma, whereas plasma from multiparous donors had no effect on it. Five posttransfusion reactions were observed in 100 patients, in four cases after the transfusion of plasma from multiparous donors. Plasma from multiparous blood donors may impair pulmonary function in intensive care unit patients.

  3. A second-generation blood substitute (perfluorodichlorooctane emulsion) does not activate complement during an ex vivo circulation model of bypass.

    PubMed

    Rosoff, J D; Soltow, L O; Vocelka, C R; Schmer, G; Chandler, W L; Cochran, R P; Kunzelman, K S; Spiess, B D

    1998-08-01

    To examine whether a second-generation perfluorocarbon (PFC) blood substitute added to the cardiopulmonary bypass (CPB) prime influences complement production. A prospective, randomized, single-blinded, ex vivo model. A university hospital, laboratory, and clinics. Ten healthy adult consented volunteer blood donors (five men, five women). Ex vivo closed-loop extracorporeal circuit including membrane oxygenator, tubing, and filter primed with crystalloid or crystalloid plus PFC was circulated for 1 hour with the addition of 500 mL of heparinized fresh human whole blood. Laboratory specimens were drawn from the circuit at 10-minute intervals for 1 hour and measured for complement (C3a, Bb fragment) concentrations, blood gases, fibrinogen concentration, platelet count, and hematocrit. In the PFC group, C3a and Bb fragments were equal to or less than those in the group that received crystalloid alone. The second-generation PFC added to the prime of a CPB circuit does not independently increase complement production.

  4. DNA Damage Induced by Alkylating Agents and Repair Pathways

    PubMed Central

    Kondo, Natsuko; Takahashi, Akihisa; Ono, Koji; Ohnishi, Takeo

    2010-01-01

    The cytotoxic effects of alkylating agents are strongly attenuated by cellular DNA repair processes, necessitating a clear understanding of the repair mechanisms. Simple methylating agents form adducts at N- and O-atoms. N-methylations are removed by base excision repair, AlkB homologues, or nucleotide excision repair (NER). O6-methylguanine (MeG), which can eventually become cytotoxic and mutagenic, is repaired by O6-methylguanine-DNA methyltransferase, and O6MeG:T mispairs are recognized by the mismatch repair system (MMR). MMR cannot repair the O6MeG/T mispairs, which eventually lead to double-strand breaks. Bifunctional alkylating agents form interstrand cross-links (ICLs) which are more complex and highly cytotoxic. ICLs are repaired by complex of NER factors (e.g., endnuclease xeroderma pigmentosum complementation group F-excision repair cross-complementing rodent repair deficiency complementation group 1), Fanconi anemia repair, and homologous recombination. A detailed understanding of how cells cope with DNA damage caused by alkylating agents is therefore potentially useful in clinical medicine. PMID:21113301

  5. Msh2 Blocks an Alternative Mechanism for Non-Homologous Tail Removal during Single-Strand Annealing in Saccharomyces cerevisiae

    PubMed Central

    Manthey, Glenn M.; Naik, Nilan; Bailis, Adam M.

    2009-01-01

    Chromosomal translocations are frequently observed in cells exposed to agents that cause DNA double-strand breaks (DSBs), such as ionizing radiation and chemotherapeutic drugs, and are often associated with tumors in mammals. Recently, translocation formation in the budding yeast, Saccharomyces cerevisiae, has been found to occur at high frequencies following the creation of multiple DSBs adjacent to repetitive sequences on non-homologous chromosomes. The genetic control of translocation formation and the chromosome complements of the clones that contain translocations suggest that translocation formation occurs by single-strand annealing (SSA). Among the factors important for translocation formation by SSA is the central mismatch repair (MMR) and homologous recombination (HR) factor, Msh2. Here we describe the effects of several msh2 missense mutations on translocation formation that suggest that Msh2 has separable functions in stabilizing annealed single strands, and removing non-homologous sequences from their ends. Additionally, interactions between the msh2 alleles and a null allele of RAD1, which encodes a subunit of a nuclease critical for the removal of non-homologous tails suggest that Msh2 blocks an alternative mechanism for removing these sequences. These results suggest that Msh2 plays multiple roles in the formation of chromosomal translocations following acute levels of DNA damage. PMID:19834615

  6. Differential effects of donor-specific HLA antibodies in living versus deceased donor transplant.

    PubMed

    Kamburova, E G; Wisse, B W; Joosten, I; Allebes, W A; van der Meer, A; Hilbrands, L B; Baas, M C; Spierings, E; Hack, C E; van Reekum, F E; van Zuilen, A D; Verhaar, M C; Bots, M L; Drop, A C A D; Plaisier, L; Seelen, M A J; Sanders, J S F; Hepkema, B G; Lambeck, A J A; Bungener, L B; Roozendaal, C; Tilanus, M G J; Voorter, C E; Wieten, L; van Duijnhoven, E M; Gelens, M; Christiaans, M H L; van Ittersum, F J; Nurmohamed, S A; Lardy, N M; Swelsen, W; van der Pant, K A; van der Weerd, N C; Ten Berge, I J M; Bemelman, F J; Hoitsma, A; van der Boog, P J M; de Fijter, J W; Betjes, M G H; Heidt, S; Roelen, D L; Claas, F H; Otten, H G

    2018-02-21

    The presence of donor-specific anti-HLA antibodies (DSAs) is associated with increased risk of graft failure after kidney transplant. We hypothesized that DSAs against HLA class I, class II, or both classes indicate a different risk for graft loss between deceased and living donor transplant. In this study, we investigated the impact of pretransplant DSAs, by using single antigen bead assays, on long-term graft survival in 3237 deceased and 1487 living donor kidney transplants with a negative complement-dependent crossmatch. In living donor transplants, we found a limited effect on graft survival of DSAs against class I or II antigens after transplant. Class I and II DSAs combined resulted in decreased 10-year graft survival (84% to 75%). In contrast, after deceased donor transplant, patients with class I or class II DSAs had a 10-year graft survival of 59% and 60%, respectively, both significantly lower than the survival for patients without DSAs (76%). The combination of class I and II DSAs resulted in a 10-year survival of 54% in deceased donor transplants. In conclusion, class I and II DSAs are a clear risk factor for graft loss in deceased donor transplants, while in living donor transplants, class I and II DSAs seem to be associated with an increased risk for graft failure, but this could not be assessed due to their low prevalence. © 2018 The Authors. American Journal of Transplantation published by Wiley Periodicals, Inc. on behalf of The American Society of Transplantation and the American Society of Transplant Surgeons.

  7. Detection of parvovirus B19 DNA in blood: Viruses or DNA remnants?

    PubMed

    Molenaar-de Backer, M W A; Russcher, A; Kroes, A C M; Koppelman, M H G M; Lanfermeijer, M; Zaaijer, H L

    2016-11-01

    Parvovirus B19 (B19V) DNA can be detected in blood over a long period after acute infection. Several reports associate the presence of B19V DNA with disease, irrespective of timing of the initial B19V infection. This study aims to analyze the properties of B19V DNA in blood, differentiating between bare, non-infectious strands of DNA and B19V DNA in viable virions. Ten blood donors with asymptomatic acute B19V infection were followed and sampled up to 22 months after infection. The samples were treated with and without an endonuclease and tested for B19V DNA, to distinguish between DNA in virions and naked DNA. In the acute phase of infection, high levels of B19V DNA were detected, concurrent with B19V IgM antibodies. B19V DNA apparently was encapsidated, as indicated by resistance to endonuclease degradation. Subsequently, B19V DNA remained detectable for more than one year in all donors at low levels (<10 5 IU/mL). Approximately 150days after infection B19V DNA became degradable by an endonuclease, indicating that this concerned naked DNA. In some donors a second endonuclease-resistant peak occurred. Detection of B19V DNA in blood by PCR does not necessarily imply that B19V replication takes place and that infectious B19V virions are present. We propose that remnant B19V DNA strands can be released from tissues without active replication. This finding urges to reconsider an assumed role of B19V infection mainly based on B19V DNA detection in blood, a much debated subject in clinical syndromes such as myocarditis and arthritis. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Off-pathway assembly of fimbria subunits is prevented by chaperone CfaA of CFA/I fimbriae from enterotoxigenic E. coli.

    PubMed

    Bao, Rui; Liu, Yang; Savarino, Stephen J; Xia, Di

    2016-12-01

    The assembly of the class 5 colonization factor antigen I (CFA/I) fimbriae of enterotoxigenic E. coli was proposed to proceed via the alternate chaperone-usher pathway. Here, we show that in the absence of the chaperone CfaA, CfaB, the major pilin subunit of CFA/I fimbriae, is able to spontaneously refold and polymerize into cyclic trimers. CfaA kinetically traps CfaB to form a metastable complex that can be stabilized by mutations. Crystal structure of the stabilized complex reveals distinctive interactions provided by CfaA to trap CfaB in an assembly competent state through donor-strand complementation (DSC) and cleft-mediated anchorage. Mutagenesis indicated that DSC controls the stability of the chaperone-subunit complex and the cleft-mediated anchorage of the subunit C-terminus additionally assist in subunit refolding. Surprisingly, over-stabilization of the chaperone-subunit complex led to delayed fimbria assembly, whereas destabilizing the complex resulted in no fimbriation. Thus, CfaA acts predominantly as a kinetic trap by stabilizing subunit to avoid its off-pathway self-polymerization that results in energetically favorable trimers and could serve as a driving force for CFA/I pilus assembly, representing an energetic landscape unique to class 5 fimbria assembly. Published 2016. This article is a U.S. Government work and is in the public domain in the USA. Molecular Microbiology published by John Wiley & Sons Ltd.

  9. Capillary electrophoresis, a method for the determination of nucleic acid ligands covalently attached to quantum dots representing a donor of Förster resonance energy transfer.

    PubMed

    Datinská, Vladimíra; Klepárník, Karel; Belšánová, Barbora; Minárik, Marek; Foret, František

    2018-05-09

    The synthesis and determination of the structure of a Förster resonance energy transfer probe intended for the detection of specific nucleic acid sequences are described here. The probe is based on the hybridization of oligonucleotide modified quantum dots with a fluorescently labeled nucleic acid sample resulting in changes of the fluorescence emission due to the energy transfer effect. The stoichiometry distribution of oligonucleotides conjugated to quantum dots was determined by capillary electrophoresis separation. The results indicate that one to four molecules of oligonucleotide are conjugated to the surface of a single nanoparticle. This conclusion is confirmed by the course of the dependence of Förster resonance energy transfer efficiency on the concentration of fluorescently labeled complementary single-stranded nucleic acid, showing saturation. While the energy transfer efficiency of the probe hybridized with complementary nucleic acid strands was 30%, negligible efficiency was observed with a non-complementary strands. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  10. DNA Replication During Conjugal Transfer of R1162

    DTIC Science & Technology

    2002-01-01

    transport out of the cell. This idea is stimulated by the similarity between the intermediates of single-stranded phage DNA replication and conjugative...the tra gene clusters ( Miele et al., 1991). The protein is not required for replication of the plasmid, and it seems to be dispensable for transfer...donor, in order to reattach to the transport mechanism prior to the start of a new round of transfer. Rolling circle replication itself might also be

  11. A Photo-triggered and photo-calibrated nitric oxide donor: Rational design, spectral characterizations, and biological applications.

    PubMed

    He, Haihong; Liu, Yuxin; Zhou, Zhongneng; Guo, Chunlei; Wang, Hong-Yin; Wang, Zhuang; Wang, Xueli; Zhang, Ziqian; Wu, Fu-Gen; Wang, Haolu; Chen, Daijie; Yang, Dahai; Liang, Xiaowen; Chen, Jinquan; Zhou, Shengmin; Liang, Xin; Qian, Xuhong; Yang, Youjun

    2018-04-27

    Nitric oxide (NO) donors are valuable tools to probe the profound implications of NO in health and disease. The elusive nature of NO bio-relevance has largely limited the use of spontaneous NO donors and promoted the development of next generation NO donors, whose NO release is not only stimulated by a trigger, but also readily monitored via a judiciously built-in self-calibration mechanism. Light is without a doubt the most sensitive, versatile and biocompatible method of choice for both triggering and monitoring, for applications in complex biological matrices. Herein, we designed and synthesized an N-nitroso rhodamine derivative (NOD560) as a photo-triggered and photo-calibrated NO donor to address this need. NOD560 is essentially non-fluorescent. Upon irradiation by green light (532 nm), it efficiently release NO and a rhodamine dye, the dramatic fluorescence turn-on from which could be harnessed to conveniently monitor the localization, flux, and dose of NO release. The potentials of NOD560 for in vitro biological applications were also exemplified in in vitro biological models, i.e. mesenchymal stem cell (MSC) migration suppression. NOD560 is expected to complement the existing NO donors and find widespread applications in chemical biological studies. Copyright © 2018 Elsevier Inc. All rights reserved.

  12. Effects of Different Buffers on the Construction of Aptamer Sensors

    NASA Astrophysics Data System (ADS)

    Yu, Quan; Dai, Zhao; Wu, Wenjing; Zhu, Haijia; Ji, Luyu

    2017-12-01

    In this paper, the effect of different buffers, PBS and TBE, on the construction of an aptamer sensor (apt sensor) for ATP was investigated. The apt sensor was based on fluorescence energy resonance transfer (FRET), when the energy donor was 5'-carboxyfluorescein (5'-FAM) and the energy receptor was Au nanoparticles (AuNPs), respectively. Both the donor and acceptor were conjugated with complementary and single stranded DNA (ssDNA). The fluorescent changes of the sensors were measured to investigate the influence of different buffers during the whole preparation and detection process. The results indicated that when the AuNPs and ssDNA (Au-DNA1) were conjugated in PBS buffer, the corresponding apt sensors would obtain a better detection ability of ATP than in TBE buffer.

  13. Donor-acceptor-donor thienyl/bithienyl-benzothiadiazole/quinoxaline model oligomers: experimental and theoretical studies.

    PubMed

    Pina, João; de Melo, J Seixas; Breusov, D; Scherf, Ullrich

    2013-09-28

    A comprehensive spectral and photophysical investigation of four donor-acceptor-donor (DAD) oligomers consisting of electron-deficient 2,1,3-benzothiadiazole or quinoxaline moieties linked to electron-rich thienyl or bithienyl units has been undertaken. Additionally, a bis(dithienyl) substituted naphthalene was also investigated. The D-A-D nature of these oligomers resulted in the presence of an intramolecular charge transfer (ICT) state, which was further substantiated by solvatochromism studies (analysis with the Lippert-Mataga formalism). Hereby, significant differences have been obtained for the fluorescence quantum yields of the oligomers in the non-polar solvent methylcyclohexane vs. the polar ethanol. The study was further complemented with the determination of the optimized ground-state molecular geometries for the oligomers together with the prediction of the lowest vertical one-electron excitation energy and the relevant molecular orbital contours using DFT calculations. The electronic transitions show a clear HOMO to LUMO charge-transfer character. In contrast to the thiophene oligomers (the oligothiophenes with n = 1-7), where the intersystem crossing (ISC) yield decreases with n, the studied DAD oligomers were found to show an increase in the ISC efficiency with the number of (donor) thienyl units.

  14. Species-specific Typing of DNA Based on Palindrome Frequency Patterns

    PubMed Central

    Lamprea-Burgunder, Estelle; Ludin, Philipp; Mäser, Pascal

    2011-01-01

    DNA in its natural, double-stranded form may contain palindromes, sequences which read the same from either side because they are identical to their reverse complement on the sister strand. Short palindromes are underrepresented in all kinds of genomes. The frequency distribution of short palindromes exhibits more than twice the inter-species variance of non-palindromic sequences, which renders palindromes optimally suited for the typing of DNA. Here, we show that based on palindrome frequency, DNA sequences can be discriminated to the level of species of origin. By plotting the ratios of actual occurrence to expectancy, we generate palindrome frequency patterns that allow to cluster different sequences of the same genome and to assign plasmids, and in some cases even viruses to their respective host genomes. This finding will be of use in the growing field of metagenomics. PMID:21429991

  15. PNA binding to the non-template DNA strand interferes with transcription, suggesting a blockage mechanism mediated by R-loop formation.

    PubMed

    Belotserkovskii, Boris P; Hanawalt, Philip C

    2015-11-01

    Peptide Nucleic Acids (PNAs) are artificial DNA mimics with superior nucleic acid binding capabilities. T7 RNA polymerase (T7 RNAP) transcription upon encountering PNA bound to the non-template DNA strand was studied in vitro. A characteristic pattern of blockage signals was observed, extending downstream from the PNA binding site, similar to that produced by G-rich homopurine-homopyrimidine (hPu-hPy) sequences and likely caused by R-loop formation. Since blocked transcription complexes in association with stable R-loops may interfere with replication and in some cases trigger apoptosis, targeted R-loop formation might be employed to inactivate selected cells, such as those in tumors, based upon their unique complement of expressed genes. © 2014 The Authors. Molecular Carcinogenesis published by Wiley Periodicals, Inc.

  16. 4-(4-Meth­oxy­phen­yl)-2-methyl­but-3-yn-2-ol

    PubMed Central

    Eissmann, Frank; Kafurke, Uwe; Weber, Edwin

    2010-01-01

    The mol­ecular structure of the title compound, C12H14O2, features a nearly coplanar arrangement including the aromatic ring, the C C—C group and the ether O atom. The maximum deviation from the least-squares plane of these ten atoms is 0.0787 (8) Å for the ether O atom. In the crystal, mol­ecules are connected via O—H⋯O hydrogen bonds (involving the hy­droxy O atom both as hydrogen-bond donor and acceptor) and weaker (ar­yl)C—H⋯π(ar­yl) contacts, leading to the formation of strands running parallel to the b axis. Further stabilization results from weaker (meth­yl)C—H⋯π(acetyl­ene) inter­actions between different strands. PMID:21588063

  17. Crispr-mediated Gene Targeting of Human Induced Pluripotent Stem Cells.

    PubMed

    Byrne, Susan M; Church, George M

    2015-01-01

    CRISPR/Cas9 nuclease systems can create double-stranded DNA breaks at specific sequences to efficiently and precisely disrupt, excise, mutate, insert, or replace genes. However, human embryonic stem or induced pluripotent stem cells (iPSCs) are more difficult to transfect and less resilient to DNA damage than immortalized tumor cell lines. Here, we describe an optimized protocol for genome engineering of human iPSCs using a simple transient transfection of plasmids and/or single-stranded oligonucleotides. With this protocol, we achieve transfection efficiencies greater than 60%, with gene disruption efficiencies from 1-25% and gene insertion/replacement efficiencies from 0.5-10% without any further selection or enrichment steps. We also describe how to design and assess optimal sgRNA target sites and donor targeting vectors; cloning individual iPSC by single cell FACS sorting, and genotyping successfully edited cells.

  18. Prophylactic eculizumab for kidney transplantation in a child with atypical hemolytic uremic syndrome due to complement factor H mutation.

    PubMed

    Ranch, Daniel; Crowther, Barrett; Arar, Mazen; Assanasen, Chatchawin

    2014-09-01

    We present a case of successful deceased-donor kidney transplantation in a three-yr-old child with aHUS due to complement factor H mutation, using only prophylactic eculizumab treatment prior to transplant. She developed disease exacerbation in the immediate post-operative period despite having therapeutic eculizumab concentrations and evidence for complete complement pathway blockade. The patient responded well to additional doses of eculizumab and has maintained excellent graft function and disease control in the first year post-transplantation. The optimal dosing scheme for eculizumab in the perioperative period remains to be determined. More sensitive biomarkers of early disease activity are needed to improve disease monitoring. Finally, the duration of eculizumab therapy in patients with aHUS remains to be determined. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Parallel nucleic acid recognition by the LNA (locked nucleic acid) stereoisomers beta-L-LNA and alpha-D-LNA; studies in the mirror image world.

    PubMed

    Christensen, Nanna K; Bryld, Torsten; Sørensen, Mads D; Arar, Khalil; Wengel, Jesper; Nielsen, Poul

    2004-02-07

    Two LNA (locked nucleic acid) stereoisomers (beta-L-LNA and alpha-D-LNA) are evaluated in the mirror-image world, that is by the study of two mixed sequences of LNA and alpha-L-LNA and their L-DNA and L-RNA complements. Both are found to display high-affinity RNA-recognition by the formation of duplexes with parallel strand orientation.

  20. Visualizing double-stranded RNA distribution and dynamics in living cells by dsRNA binding-dependent fluorescence complementation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cheng, Xiaofei; College of Life and Environmental Sciences, Hangzhou Normal University, Hangzhou, Zhejiang 310036; Deng, Ping

    Double-stranded RNA (dsRNA) is an important type of RNA that plays essential roles in diverse cellular processes in eukaryotic organisms and a hallmark in infections by positive-sense RNA viruses. Currently, no in vivo technology has been developed for visualizing dsRNA in living cells. Here, we report a dsRNA binding-dependent fluorescence complementation (dRBFC) assay that can be used to efficiently monitor dsRNA distribution and dynamics in vivo. The system consists of two dsRNA-binding proteins, which are fused to the N- and C-terminal halves of the yellow fluorescent protein (YFP). Binding of the two fusion proteins to a common dsRNA brings themore » split YFP halves in close proximity, leading to the reconstitution of the fluorescence-competent structure and restoration of fluorescence. Using this technique, we were able to visualize the distribution and trafficking of the replicative RNA intermediates of positive-sense RNA viruses in living cells. - Highlights: • A live-cell imaging system was developed for visualizing dsRNA in vivo. • It uses dsRNA binding proteins fused with two halves of a fluorescent protein. • Binding to a common dsRNA enables the reporter to become fluorescent. • The system can efficiently monitor viral RNA replication in living cells.« less

  1. Properties of polyproline II, a secondary structure element implicated in protein-protein interactions.

    PubMed

    Cubellis, M V; Caillez, F; Blundell, T L; Lovell, S C

    2005-03-01

    The polyproline II (PPII) conformation of protein backbone is an important secondary structure type. It is unusual in that, due to steric constraints, its main-chain hydrogen-bond donors and acceptors cannot easily be satisfied. It is unable to make local hydrogen bonds, in a manner similar to that of alpha-helices, and it cannot easily satisfy the hydrogen-bonding potential of neighboring residues in polyproline conformation in a manner analogous to beta-strands. Here we describe an analysis of polyproline conformations using the HOMSTRAD database of structurally aligned proteins. This allows us not only to determine amino acid propensities from a much larger database than previously but also to investigate conservation of amino acids in polyproline conformations, and the conservation of the conformation itself. Although proline is common in polyproline helices, helices without proline represent 46% of the total. No other amino acid appears to be greatly preferred; glycine and aromatic amino acids have low propensities for PPII. Accordingly, the hydrogen-bonding potential of PPII main-chain is mainly satisfied by water molecules and by other parts of the main-chain. Side-chain to main-chain interactions are mostly nonlocal. Interestingly, the increased number of nonsatisfied H-bond donors and acceptors (as compared with alpha-helices and beta-strands) makes PPII conformers well suited to take part in protein-protein interactions. Copyright 2005 Wiley-Liss, Inc.

  2. Caffeine inhibits gene conversion by displacing Rad51 from ssDNA

    PubMed Central

    Tsabar, Michael; Mason, Jennifer M.; Chan, Yuen-Ling; Bishop, Douglas K.; Haber, James E.

    2015-01-01

    Efficient repair of chromosomal double-strand breaks (DSBs) by homologous recombination relies on the formation of a Rad51 recombinase filament that forms on single-stranded DNA (ssDNA) created at DSB ends. This filament facilitates the search for a homologous donor sequence and promotes strand invasion. Recently caffeine treatment has been shown to prevent gene targeting in mammalian cells by increasing non-productive Rad51 interactions between the DSB and random regions of the genome. Here we show that caffeine treatment prevents gene conversion in yeast, independently of its inhibition of the Mec1ATR/Tel1ATM-dependent DNA damage response or caffeine's inhibition of 5′ to 3′ resection of DSB ends. Caffeine treatment results in a dosage-dependent eviction of Rad51 from ssDNA. Gene conversion is impaired even at low concentrations of caffeine, where there is no discernible dismantling of the Rad51 filament. Loss of the Rad51 filament integrity is independent of Srs2's Rad51 filament dismantling activity or Rad51's ATPase activity and does not depend on non-specific Rad51 binding to undamaged double-stranded DNA. Caffeine treatment had similar effects on irradiated HeLa cells, promoting loss of previously assembled Rad51 foci. We conclude that caffeine treatment can disrupt gene conversion by disrupting Rad51 filaments. PMID:26019181

  3. Gal knockout and beyond.

    PubMed

    Zhong, R

    2007-01-01

    Recently, Galalpha1-3Galbeta1-4GlcNAc (Gal) knockout (k/o) pigs have been developed using genetic cloning technologies. This remarkable achievement has generated great enthusiasm in xenotransplantation studies. This review summarizes the current status of nonhuman primate experiments using Gal k/o pig organs. Briefly, when Gal k/o pig organs are transplanted into primates, hyperacute rejection does not occur. Although graft survival has been prolonged up to a few months in some cases, the overall results were not better than those using Gal-positive pig organs with human complement regulatory protein transgenes. Gal k/o pig kidneys rapidly developed rejection which was associated with increased anti-non-Gal antibodies. Although the precise mechanisms of Gal k/o pig organ rejection are not clear, it could result from incomplete deletion of Gal, up-regulation of new antigen (non-Gal antigen) and/or production of non-Gal antibodies. Future work in xenotransplantation should place emphasis on further modification of donors, such as combining human complement regulatory genes with Gal k/o, deleting non-Gal antigens and adding protective/surviving genes or a gene that inhibits coagulation. Induction of donor-specific T- and B-cell tolerance and promotion of accommodation are also warranted.

  4. Microparticle content of platelet concentrates is predicted by donor microparticles and is altered by production methods and stress.

    PubMed

    Maurer-Spurej, Elisabeth; Larsen, Rune; Labrie, Audrey; Heaton, Andrew; Chipperfield, Kate

    2016-08-01

    In circulation, shedding of microparticles from a variety of viable cells can be triggered by pathological activation of inflammatory processes, by activation of coagulation or complement systems, or by physical stress. Elevated microparticle content (MPC) in donor blood might therefore indicate a clinical condition of the donor which, upon transfusion, might affect the recipient. In blood products, elevated MPC might also represent product stress. Surprisingly, the MPC in blood collected from normal blood donors is highly variable, which raises the question whether donor microparticles are present in-vivo and transfer into the final blood component, and how production methods and post-production processing might affect the MPC. We measured MPC using ThromboLUX in (a) platelet-rich plasma (PRP) of 54 apheresis donors and the corresponding apheresis products, (b) 651 apheresis and 646 pooled platelet concentrates (PCs) with plasma and 414 apheresis PCs in platelet additive solution (PAS), and (c) apheresis PCs before and after transportation, gamma irradiation, and pathogen inactivation (N = 8, 7, and 12 respectively). ThromboLUX-measured MPC in donor PRP and their corresponding apheresis PC samples were highly correlated (r = 0.82, P = .001). The average MPC in pooled PC was slightly lower than that in apheresis PC and substantially lower in apheresis PC stored with PAS rather than plasma. Mirasol Pathogen Reduction treatment significantly increased MPC with age. Thus, MPC measured in donor samples might be a useful predictor of product stability, especially if post-production processes are necessary. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  5. Immunoserological parameters in SLE: high-avidity anti-dsDNA detected by ELISA are the most closely associated with the disease activity.

    PubMed

    Andrejevic, Sladjana; Jeremic, Ivica; Sefik-Bukilica, Mirjana; Nikolic, Milos; Stojimirovic, Biljana; Bonaci-Nikolic, Branka

    2013-11-01

    We assessed the relationship between the serum levels of antibodies against double-stranded DNA (dsDNA), C1q, nucleosomes, histones, C3 and C4 complement components with one another, with organ involvement and overall disease activity in patients with systemic lupus erythematosus (SLE). One hundred seventy-five sera from 99 patients with SLE, 31 sera of patients with other connective tissue diseases, and 20 sera from healthy blood donors were tested. SLE disease activity was assessed by modified SLEDAI-2K (M-SLEDAI-2K), not including complement and anti-dsDNA descriptors. Anti-dsDNA antibodies were measured by indirect immunofluorescence on Crithidia luciliae (CLIFT), standard enzyme-linked immunosorbent assay (ELISA) and ELISA for high-avidity antibodies. The most significant risk factor for renal involvement were anti-C1q antibodies (OR = 3.88, p < 0.05), high-avidity anti-dsDNA antibodies for polyserositis (OR = 7.99, p < 0.01), anti-histone antibodies for joint involvement (OR = 2.75, p < 0.05), and low C3 for cytopenia (OR = 11.96, p < 0.001) and mucocutaneous lesions (OR = 3.32, p < 0.01). Multiple linear regression analysis showed that disease activity in SLE could be predicted by the levels of antibodies against dsDNA determined by standard (p < 0.05) and high-avidity (p < 0.001) ELISA, and inversely associated with concentration of C3 (p < 0.001). Using stepwise method, high-avidity anti-dsDNA antibodies were found to be in the closest association to M-SLEDAI-2K. Moreover, positive test for high-avidity anti-dsDNA antibodies appeared as an independent risk factor for moderately to severely active disease (M-SLEDAI-2K>5) (OR = 5.5, p < 0.01). The presence of high-avidity anti-dsDNA antibodies represented a risk for renal, joint, and most importantly for serosal involvement. Our results suggest that simple and reliable ELISA for high-avidity anti-dsDNA antibodies is the test of good clinical utility for the assessment of global SLE activity.

  6. Anti-complement activities of human breast-milk.

    PubMed

    Ogundele, M O

    1999-08-01

    It has long been observed that the human milk possesses significant anti-inflammatory properties, while simultaneously protecting the infant against many intestinal and respiratory pathogens. There is, however, a paucity of information on the degree and extent of this anti-inflammatory activity. In the present study, the inhibitory effects of different fractions of human milk on serum complement activity were analysed. Colostrum and milk samples from healthy voluntary lactating donors at different postpartum ages were obtained and pooled normal human serum was used as source of complement in a modified CH50 assay. Inherent complement activity in human milk was also investigated by measuring the deposition of an activated C3 fragment on a serum-sensitive bacteria, and by haemolytic assays. Most whole- and defatted-milk samples consistently showed a dose-dependent inhibition of the serum complement activity. This inhibition was greater in mature milk compared to transitional milk samples. It was enhanced by inactivation of milk complement, and diminished by centrifugation of milk samples, which partly removed fat and larger protein components including casein micelles. Inherent complement activity in human milk was also demonstrated by haemolysis of sensitised sheep erythrocytes and deposition of C3 fragments on solid-phase bacteria. These activities were highest in the colostrum and gradually decreased as lactation proceeded. Several natural components abundant in the fluid phase of the human breast-milk have been shown to be inhibitors of complement activation in vitro. Their physiological significance probably reside in their ability to prevent inflammatory-induced tissue damage of the delicate immature gastrointestinal tract of the new-born as well as the mammary gland itself, which may arise from ongoing complement activation.

  7. Effect of two intermediate electron donors, NADPH and FADH(2), on Spirulina Delta (6)-desaturase co-expressed with two different immediate electron donors, cytochrome b (5) and ferredoxin, in Escherichia coli.

    PubMed

    Kurdrid, Pavinee; Subudhi, Sanjukta; Cheevadhanarak, Supapon; Tanticharoen, Morakot; Hongsthong, Apiradee

    2007-12-01

    When the gene desD encoding Spirulina Delta(6)-desaturase was heterologously expressed in E. coli, the enzyme was expressed without the ability to function. However, when this enzyme was co-expressed with an immediate electron donor, i.e. the cytochrome b (5) domain from Mucor rouxii, the results showed the production of GLA (gamma-linolenic acid), the product of the reaction catalyzed by Delta(6)-desaturase. The results revealed that in E. coli cells, where cytochrome b (5) is absent and ferredoxin, a natural electron donor of Delta(6)-desaturase, is present at a very low level, the cytochrome b (5) domain can complement for the function of ferredoxin in the host cells. In the present study, the Spirulina-ferredoxin gene was cloned and co-expressed with the Delta(6)-desaturase in E. coli. In comparison to the co-expression of cytochrome b ( 5 ) with the Delta(6)-desaturase, the co-expression with ferredoxin did not cause any differences in the GLA level. Moreover, the cultures containing the Delta(6)-desaturase co-expressed with cytochrome b (5) and ferredoxin were exogenously supplied with the intermediate electron donors, NADPH (nicotinamide adenine dinucleotide phosphate, reduced form) and FADH(2) (flavin adenine dinucleotide, reduced form), respectively. The GLA level in these host cells increased drastically, by approximately 50%, compared to the cells without the intermediate electron donors. The data indicated that besides the level of immediate electron donors, the level of intermediate electron donors is also critical for GLA production. Therefore, if the pools of the immediate and intermediate electron donors in the cells are manipulated, the GLA production in the heterologous host will be affected.

  8. Donor-bridge-acceptor energetics determine the distance dependence of electron tunneling in DNA

    NASA Astrophysics Data System (ADS)

    Lewis, Frederick D.; Liu, Jianqin; Weigel, Wilfried; Rettig, Wolfgang; Kurnikov, Igor V.; Beratan, David N.

    2002-10-01

    Electron transfer (ET) processes in DNA are of current interest because of their involvement in oxidative strand cleavage reactions and their relevance to the development of molecular electronics. Two mechanisms have been identified for ET in DNA, a single-step tunneling process and a multistep charge-hopping process. The dynamics of tunneling reactions depend on both the distance between the electron donor and acceptor and the nature of the molecular bridge separating the donor and acceptor. In the case of protein and alkane bridges, the distance dependence is not strongly dependent on the properties of the donor and acceptor. In contrast, we show here that the distance decay of DNA ET rates varies markedly with the energetics of the donor and acceptor relative to the bridge. Specifically, we find that an increase in the energy of the bridge states by 0.25 eV (1 eV = 1.602 × 1019 J) relative to the donor and acceptor energies for photochemical oxidation of nucleotides, without changing the reaction free energy, results in an increase in the characteristic exponential distance decay constant for the ET rates from 0.71 to 1.1 Å1. These results show that, in the small tunneling energy gap regime of DNA ET, the distance dependence is not universal; it varies strongly with the tunneling energy gap. These DNA ET reactions fill a "missing link" or transition regime between the large barrier (rapidly decaying) tunneling regime and the (slowly decaying) hopping regime in the general theory of bridge-mediated ET processes.

  9. A Paper-Based Sandwich Format Hybridization Assay for Unlabeled Nucleic Acid Detection Using Upconversion Nanoparticles as Energy Donors in Luminescence Resonance Energy Transfer.

    PubMed

    Zhou, Feng; Noor, M Omair; Krull, Ulrich J

    2015-09-24

    Bioassays based on cellulose paper substrates are gaining increasing popularity for the development of field portable and low-cost diagnostic applications. Herein, we report a paper-based nucleic acid hybridization assay using immobilized upconversion nanoparticles (UCNPs) as donors in luminescence resonance energy transfer (LRET). UCNPs with intense green emission served as donors with Cy3 dye as the acceptor. The avidin functionalized UCNPs were immobilized on cellulose paper and subsequently bioconjugated to biotinylated oligonucleotide probes. Introduction of unlabeled oligonucleotide targets resulted in a formation of probe-target duplexes. A subsequent hybridization of Cy3 labeled reporter with the remaining single stranded portion of target brought the Cy3 dye in close proximity to the UCNPs to trigger a LRET-sensitized emission from the acceptor dye. The hybridization assays provided a limit of detection (LOD) of 146.0 fmol and exhibited selectivity for one base pair mismatch discrimination. The assay was functional even in undiluted serum samples. This work embodies important progress in developing DNA hybridization assays on paper. Detection of unlabeled targets is achieved using UCNPs as LRET donors, with minimization of background signal from paper substrates owing to the implementation of low energy near-infrared (NIR) excitation.

  10. XRCC1 suppresses somatic hypermutation and promotes alternative nonhomologous end joining in Igh genes.

    PubMed

    Saribasak, Huseyin; Maul, Robert W; Cao, Zheng; McClure, Rhonda L; Yang, William; McNeill, Daniel R; Wilson, David M; Gearhart, Patricia J

    2011-10-24

    Activation-induced deaminase (AID) deaminates cytosine to uracil in immunoglobulin genes. Uracils in DNA can be recognized by uracil DNA glycosylase and abasic endonuclease to produce single-strand breaks. The breaks are repaired either faithfully by DNA base excision repair (BER) or mutagenically to produce somatic hypermutation (SHM) and class switch recombination (CSR). To unravel the interplay between repair and mutagenesis, we decreased the level of x-ray cross-complementing 1 (XRCC1), a scaffold protein involved in BER. Mice heterozygous for XRCC1 showed a significant increase in the frequencies of SHM in Igh variable regions in Peyer's patch cells, and of double-strand breaks in the switch regions during CSR. Although the frequency of CSR was normal in Xrcc1(+/-) splenic B cells, the length of microhomology at the switch junctions decreased, suggesting that XRCC1 also participates in alternative nonhomologous end joining. Furthermore, Xrcc1(+/-) B cells had reduced Igh/c-myc translocations during CSR, supporting a role for XRCC1 in microhomology-mediated joining. Our results imply that AID-induced single-strand breaks in Igh variable and switch regions become substrates simultaneously for BER and mutagenesis pathways.

  11. Estimation of strength in different extra Watson-Crick hydrogen bonds in DNA double helices through quantum chemical studies.

    PubMed

    Bandyopadhyay, D; Bhattacharyya, D

    2006-10-15

    It was shown earlier, from database analysis, model building studies, and molecular dynamics simulations that formation of cross-strand bifurcated or Extra Watson-Crick hydrogen (EWC) bonds between successive base pairs may lead to extra rigidity to DNA double helices of certain sequences. The strengths of these hydrogen bonds are debatable, however, as they do not have standard linear geometry criterion. We have therefore carried out detailed ab initio quantum chemical studies using RHF/6-31G(2d,2p) and B3LYP/6-31G(2p,2d) basis sets to determine strengths of several bent hydrogen bonds with different donor and acceptors. Interaction energy calculations, corrected for the basis set superposition errors, suggest that N-H...O type bent EWC hydrogen bonds are possible along same strands or across the strands between successive base pairs, leading to significant stability (ca. 4-9 kcal/mol). The N-H...N and C-H...O type interactions, however, are not so stabilizing. Hence, consideration of EWC N-H...O H-bonds can lead to a better understanding of DNA sequence directed structural features. Copyright (c) 2006 Wiley Periodicals, Inc.

  12. Recipient’s Genetic R702W NOD2 Variant Is Associated with an Increased Risk of Bacterial Infections after Orthotopic Liver Transplantation

    PubMed Central

    van Hoek, Bart; van den Berg, Arie P.; Porte, Robert J.; Blokzijl, Hans; Coenraad, Minneke J.; Hepkema, Bouke G.; Schaapherder, Alexander F.; Ringers, Jan; Weersma, Rinse K.; Verspaget, Hein W.

    2013-01-01

    Introduction Orthotopic liver transplantation (OLT) is accompanied by a significant postoperative infection risk. Immunosuppression to prevent rejection increases the susceptibility to infections, mainly by impairing the adaptive immune system. Genetic polymorphisms in the lectin complement pathway of the donor have recently been identified as important risk determinants of clinically significant bacterial infection (CSI) after OLT. Another genetic factor involved in innate immunity is NOD2, which was reported to be associated with increased risk of spontaneous bacterial peritonitis in cirrhotic patients. Methods We assessed association of three genetic NOD2 variants (R702W, G908R and 3020insC) with increased risk of CSI after OLT. 288 OLT recipient-donor pairs from two tertiary referral centers were genotyped for the three NOD2 variants. The probability of CSI in relation to NOD2 gene variants was determined with cumulative incidence curves and log-rank analysis. Results The R702W NOD2 variant in the recipient was associated with CSI after OLT. Eight out of 15 (53.3%) individuals with a mutated genotype compared to 80/273 (29.3%) with wild type genotype developed CSI (p=0.027, univariate cox regression), illustrated by a higher frequency of CSI after OLT over time (p=0.0003, log rank analysis). Multivariate analysis (including the donor lectin complement pathway profile) showed independence of this R702W NOD2 association from other risk factors (HR 2.0; p=0.04). The other NOD2 variants, G908R and 3020insC, in the recipient were not associated with CSI. There was no association with CSI after OLT for any of the NOD2 variants in the donor. Conclusion The mutated NOD2 R702W genotype in the recipient is independently associated with an increased risk of bacterial infections after liver transplantation, indicating a predisposing role for this genetic factor impairing the recipient’s innate immune system. PMID:23977330

  13. Innate Immune Mechanisms in Transplant Allograft Vasculopathy

    PubMed Central

    Jane-wit, D; Fang, C; Goldstein, DR

    2016-01-01

    Purpose of Review Allograft vasculopathy (AV) is the leading cause of late allograft loss following solid organ transplantation. Ischemia reperfusion injury (IRI) and donor specific antibody (DSA)-induced complement activation confer heightened risk for AV via numerous innate immune mechanisms including MyD88, HMGB1, and complement induced non-canonical NF-kB signaling. Recent Findings The role of MyD88, a signal adaptor downstream of the toll-like receptors (TLR), has been defined in an experimental heart transplant model, which demonstrated that recipient MyD88 enhanced AV. Importantly, triggering receptor on myeloid receptor 1(Trem1), a MyD88 amplifying signal, was present in rejecting human cardiac transplant biopsies and enhanced the development of AV in mice. HMGB1, a nuclear protein that activates TLRs, also enhanced the development of AV. Complement activation elicits assembly of membrane attack complexes (MAC) on endothelial cells which activate non-canonical NF-kB signaling, a novel complement effector pathway that induces pro-inflammatory genes and potentiates endothelial cell mediated alloimmune T cell activation, processes which enhance AV. Summary Innate immune mediators including HMGB1, MyD88, and non-canonical NFκB signaling via complement activation contribute to AV. These pathways represent potential therapeutic targets to reduce AV after solid organ transplantation. PMID:27077602

  14. A matter of respect: a defense of the dead donor rule and of a "whole-brain" criterion for determination of death.

    PubMed

    Khushf, George

    2010-06-01

    Many accounts of the historical development of neurological criteria for determination of death insufficiently distinguish between two strands of interpretation advanced by advocates of a "whole-brain" criterion. One strand focuses on the brain as the organ of integration. Another provides a far more complex and nuanced account, both of death and of a policy on the determination of death. Current criticisms of the whole-brain criterion are effective in refuting the first interpretation, but not the second, which is advanced in the 2008 President's Council report on the determination of death. In this essay, I seek to further develop this second strand of interpretation. I argue that policy on determination of death aligns moral, biological, and ontological death concepts. Morally, death marks the stage when respect is no longer owed. Biologically, death concerns integrated functioning of an organism as a whole. But the biological concepts are underdetermined. The moral concerns lead to selection of strong individuality concepts rather than weak ones. They also push criteria to the "far side" of the dying process. There is a countervailing consideration associated with optimizing the number of available organs, and this pushes to the "near side" of death. Policy is governed by a conviction that it is possible to align these moral and biological death concepts, but this conviction simply lays out an agenda. There is also a prescription-integral to the dead donor rule-that lexically prioritizes the deontic concerns and that seeks to balance the countervailing tendencies by using science-based refinements to make the line between life and death more precise. After showing how these concerns have been effectively aligned in the current policy, I present a modified variant of a "division" scenario and show how an "inverse decapitation problem" leads to a conclusive refutation of the nonbrain account of death.

  15. Nitrosative stress induces DNA strand breaks but not caspase mediated apoptosis in a lung cancer cell line

    PubMed Central

    Bentz, Brandon G; Hammer, Neal D; Radosevich, James A; Haines, G Kenneth

    2004-01-01

    Background Key steps crucial to the process of tumor progression are genomic instability and escape from apoptosis. Nitric oxide and its interrelated reactive intermediates (collectively denoted as NOX) have been implicated in DNA damage and mutational events leading to cancer development, while also being implicated in the inhibition of apoptosis through S-nitrosation of key apoptotic enzymes. The purpose of this study was to explore the interrelationship between NOX-mediated DNA strand breaks (DSBs) and apoptosis in cultured tumor cell lines. Methods Two well-characterized cell lines were exposed to increasing concentrations of exogenous NOX via donor compounds. Production of NOX was quantified by the Greiss reaction and spectrophotometery, and confirmed by nitrotyrosine immunostaining. DSBs were measured by the alkaline single-cell gel electrophoresis assay (the COMET assay), and correlated with cell viability by the MTT assay. Apoptosis was analyzed both by TUNEL staining and Annexin V/propidium iodine FACS. Finally, caspase enzymatic activity was measured using an in-vitro fluorogenic caspase assay. Results Increases in DNA strand breaks in our tumor cells, but not in control fibroblasts, correlated with the concentration as well as rate of release of exogenously administered NOX. This increase in DSBs did not correlate with an increase in cell death or apoptosis in our tumor cell line. Finally, this lack of apoptosis was found to correlate with inhibition of caspase activity upon exposure to thiol- but not NONOate-based NOX donor compounds. Conclusions Genotoxicity appears to be highly interrelated with both the concentration and kinetic delivery of NOX. Moreover, alterations in cell apoptosis can be seen as a consequence of the explicit mechanisms of NOX delivery. These findings lend credence to the hypothesis that NOX may play an important role in tumor progression, and underscores potential pitfalls which should be considered when developing NOX-based chemotherapeutic agents. PMID:15617570

  16. Fmoc-RGDS based fibrils: atomistic details of their hierarchical assembly.

    PubMed

    Zanuy, David; Poater, Jordi; Solà, Miquel; Hamley, Ian W; Alemán, Carlos

    2016-01-14

    We describe the 3D supramolecular structure of Fmoc-RGDS fibrils, where Fmoc and RGDS refer to the hydrophobic N-(fluorenyl-9-methoxycarbonyl) group and the hydrophilic Arg-Gly-Asp-Ser peptide sequence, respectively. For this purpose, we performed atomistic all-atom molecular dynamics simulations of a wide variety of packing modes derived from both parallel and antiparallel β-sheet configurations. The proposed model, which closely resembles the cross-β core structure of amyloids, is stabilized by π-π stacking interactions between hydrophobic Fmoc groups. More specifically, in this organization, the Fmoc-groups of β-strands belonging to the same β-sheet form columns of π-stacked aromatic rings arranged in a parallel fashion. Eight of such columns pack laterally forming a compact and dense hydrophobic core, in which two central columns are surrounded by three adjacent columns on each side. In addition to such Fmoc···Fmoc interactions, the hierarchical assembly of the constituent β-strands involves a rich variety of intra- and inter-strand interactions. Accordingly, hydrogen bonding, salt bridges and π-π stacking interactions coexist in the highly ordered packing network proposed for the Fmoc-RGDS amphiphile. Quantum mechanical calculations, which have been performed to quantify the above referred interactions, confirm the decisive role played by the π-π stacking interactions between the rings of the Fmoc groups, even though both inter-strand and intra-strand hydrogen bonds and salt bridges also play a non-negligible role. Overall, these results provide a solid reference to complement the available experimental data, which are not precise enough to determine the fibril structure, and reconcile previous independent observations.

  17. C1q-Mediated Complement Activation and C3 Opsonization Trigger Recognition of Stealth Poly(2-methyl-2-oxazoline)-Coated Silica Nanoparticles by Human Phagocytes.

    PubMed

    Tavano, Regina; Gabrielli, Luca; Lubian, Elisa; Fedeli, Chiara; Visentin, Silvia; Polverino De Laureto, Patrizia; Arrigoni, Giorgio; Geffner-Smith, Alessandra; Chen, Fangfang; Simberg, Dmitri; Morgese, Giulia; Benetti, Edmondo M; Wu, Linping; Moghimi, Seyed Moein; Mancin, Fabrizio; Papini, Emanuele

    2018-05-23

    Poly(2-methyl-2-oxazoline) (PMOXA) is an alternative promising polymer to poly(ethylene glycol) (PEG) for design and engineering of macrophage-evading nanoparticles (NPs). Although PMOXA-engineered NPs have shown comparable pharmacokinetics and in vivo performance to PEGylated stealth NPs in the murine model, its interaction with elements of the human innate immune system has not been studied. From a translational angle, we studied the interaction of fully characterized PMOXA-coated vinyltriethoxysilane-derived organically modified silica NPs (PMOXA-coated NPs) of approximately 100 nm in diameter with human complement system, blood leukocytes, and macrophages and compared their performance with PEGylated and uncoated NP counterparts. Through detailed immunological and proteomic profiling, we show that PMOXA-coated NPs extensively trigger complement activation in human sera exclusively through the classical pathway. Complement activation is initiated by the sensing molecule C1q, where C1q binds with high affinity ( K d = 11 ± 1 nM) to NP surfaces independent of immunoglobulin binding. C1q-mediated complement activation accelerates PMOXA opsonization with the third complement protein (C3) through the amplification loop of the alternative pathway. This promoted NP recognition by human blood leukocytes and monocyte-derived macrophages. The macrophage capture of PMOXA-coated NPs correlates with sera donor variability in complement activation and opsonization but not with other major corona proteins, including clusterin and a wide range of apolipoproteins. In contrast to these observations, PMOXA-coated NPs poorly activated the murine complement system and were marginally recognized by mouse macrophages. These studies provide important insights into compatibility of engineered NPs with elements of the human innate immune system for translational steps.

  18. M. leprae components induce nerve damage by complement activation: identification of lipoarabinomannan as the dominant complement activator.

    PubMed

    Bahia El Idrissi, Nawal; Das, Pranab K; Fluiter, Kees; Rosa, Patricia S; Vreijling, Jeroen; Troost, Dirk; Morgan, B Paul; Baas, Frank; Ramaglia, Valeria

    2015-05-01

    Peripheral nerve damage is the hallmark of leprosy pathology but its etiology is unclear. We previously identified the membrane attack complex (MAC) of the complement system as a key determinant of post-traumatic nerve damage and demonstrated that its inhibition is neuroprotective. Here, we determined the contribution of the MAC to nerve damage caused by Mycobacterium leprae and its components in mouse. Furthermore, we studied the association between MAC and the key M. leprae component lipoarabinomannan (LAM) in nerve biopsies of leprosy patients. Intraneural injections of M. leprae sonicate induced MAC deposition and pathological changes in the mouse nerve, whereas MAC inhibition preserved myelin and axons. Complement activation occurred mainly via the lectin pathway and the principal activator was LAM. In leprosy nerves, the extent of LAM and MAC immunoreactivity was robust and significantly higher in multibacillary compared to paucibacillary donors (p = 0.01 and p = 0.001, respectively), with a highly significant association between LAM and MAC in the diseased samples (r = 0.9601, p = 0.0001). Further, MAC co-localized with LAM on axons, pointing to a role for this M. leprae antigen in complement activation and nerve damage in leprosy. Our findings demonstrate that MAC contributes to nerve damage in a model of M. leprae-induced nerve injury and its inhibition is neuroprotective. In addition, our data identified LAM as the key pathogen associated molecule that activates complement and causes nerve damage. Taken together our data imply an important role of complement in nerve damage in leprosy and may inform the development of novel therapeutics for patients.

  19. Yersinia infection tools-characterization of structure and function of adhesins.

    PubMed

    Mikula, Kornelia M; Kolodziejczyk, Robert; Goldman, Adrian

    2012-01-01

    Among the seventeen species of the Gram-negative genus Yersinia, three have been shown to be virulent and pathogenic to humans and animals-Y. enterocolitica, Y. pseudotuberculosis, and Y. pestis. In order to be so, they are armoured with various factors that help them adhere to tissues and organelles, cross the cellular barrier and escape the immune system during host invasion. The group of proteins that mediate pathogen-host interactions constitute adhesins. Invasin, Ail, YadA, YadB, YadC, Pla, and pH 6 antigen belong to the most prominent and best-known Yersinia adhesins. They act at different times and stages of infection complementing each other by their ability to bind a variety of host molecules such as collagen, fibronectin, laminin, β1 integrins, and complement regulators. All the proteins are anchored in the bacterial outer membrane (OM), often forming rod-like or fimbrial-like structures that protrude to the extracellular milieu. Structural studies have shown that the anchor region forms a β-barrel composed of 8, 10, or 12 antiparallel β-strands. Depending on the protein, the extracellular part can be composed of several domains belonging to the immunoglobulin fold superfamily, or form a coiled-coil structure with globular head domain at the end, or just constitute several loops connecting individual β-strands in the β-barrel. Those extracellular regions define the activity of each adhesin. This review focuses on the structure and function of these important molecules, and their role in pathogenesis.

  20. Yersinia infection tools—characterization of structure and function of adhesins

    PubMed Central

    Mikula, Kornelia M.; Kolodziejczyk, Robert; Goldman, Adrian

    2013-01-01

    Among the seventeen species of the Gram-negative genus Yersinia, three have been shown to be virulent and pathogenic to humans and animals—Y. enterocolitica, Y. pseudotuberculosis, and Y. pestis. In order to be so, they are armoured with various factors that help them adhere to tissues and organelles, cross the cellular barrier and escape the immune system during host invasion. The group of proteins that mediate pathogen–host interactions constitute adhesins. Invasin, Ail, YadA, YadB, YadC, Pla, and pH 6 antigen belong to the most prominent and best-known Yersinia adhesins. They act at different times and stages of infection complementing each other by their ability to bind a variety of host molecules such as collagen, fibronectin, laminin, β1 integrins, and complement regulators. All the proteins are anchored in the bacterial outer membrane (OM), often forming rod-like or fimbrial-like structures that protrude to the extracellular milieu. Structural studies have shown that the anchor region forms a β-barrel composed of 8, 10, or 12 antiparallel β-strands. Depending on the protein, the extracellular part can be composed of several domains belonging to the immunoglobulin fold superfamily, or form a coiled-coil structure with globular head domain at the end, or just constitute several loops connecting individual β-strands in the β-barrel. Those extracellular regions define the activity of each adhesin. This review focuses on the structure and function of these important molecules, and their role in pathogenesis. PMID:23316485

  1. Human Fanconi Anemia Complementation Group A Protein Stimulates the 5’ Flap Endonuclease Activity of FEN1

    PubMed Central

    Qian, Liangyue; Yuan, Fenghua; Rodriguez-Tello, Paola; Padgaonkar, Suyog; Zhang, Yanbin

    2013-01-01

    In eukaryotic cells, Flap endonuclease 1 (FEN1) is a major structure-specific endonuclease that processes 5’ flapped structures during maturation of lagging strand DNA synthesis, long patch base excision repair, and rescue of stalled replication forks. Here we report that fanconi anemia complementation group A protein (FANCA), a protein that recognizes 5’ flap structures and is involved in DNA repair and maintenance of replication forks, constantly stimulates FEN1-mediated incision of both DNA and RNA flaps. Kinetic analyses indicate that FANCA stimulates FEN1 by increasing the turnover rate of FEN1 and altering its substrate affinity. More importantly, six pathogenic FANCA mutants are significantly less efficient than the wild-type at stimulating FEN1 endonuclease activity, implicating that regulation of FEN1 by FANCA contributes to the maintenance of genomic stability. PMID:24349332

  2. Mechanism of Promoter Melting by the Xeroderma Pigmentosum Complementation Group B Helicase of Transcription Factor IIH Revealed by Protein-DNA Photo-Cross-Linking

    PubMed Central

    Douziech, Maxime; Coin, Frédéric; Chipoulet, Jean-Marc; Arai, Yoko; Ohkuma, Yoshiaki; Egly, Jean-Marc; Coulombe, Benoit

    2000-01-01

    The p89/xeroderma pigmentosum complementation group B (XPB) ATPase-helicase of transcription factor IIH (TFIIH) is essential for promoter melting prior to transcription initiation by RNA polymerase II (RNAPII). By studying the topological organization of the initiation complex using site-specific protein-DNA photo-cross-linking, we have shown that p89/XPB makes promoter contacts both upstream and downstream of the initiation site. The upstream contact, which is in the region where promoter melting occurs (positions −9 to +2), requires tight DNA wrapping around RNAPII. The addition of hydrolyzable ATP tethers the template strand at positions −5 and +1 to RNAPII subunits. A mutation in p89/XPB found in a xeroderma pigmentosum patient impairs the ability of TFIIH to associate correctly with the complex and thereby melt promoter DNA. A model for open complex formation is proposed. PMID:11027286

  3. DNA Hairpins Containing the Cytidine Analog Pyrrolo-dC: Structural, Thermodynamic, and Spectroscopic Studies

    PubMed Central

    Zhang, Xu; Wadkins, Randy M.

    2009-01-01

    Structures formed by single-strand DNA have become increasingly interesting because of their roles in a number of biological processes, particularly transcription and its regulation. Of particular importance is the fact that antitumor drugs such as Actinomycin D can selectively bind DNA hairpins over fully paired, double-strand DNA. A new fluorescent base analog, pyrrolo-deoxycytidine (PdC), can now be routinely incorporated into single-strand DNA. The fluorescence of PdC is particularly useful for studying the formation of single-strand DNA in regions of double-strand DNA. The fluorescence is quenched when PdC is paired with a complementary guanine residue, and thus is greatly enhanced upon formation of single-strand DNA. Hence, any process that results in melting or opening of DNA strands produces an increase in the fluorescence intensity of this base analog. In this study we measured the structural effects of incorporating PdC into DNA hairpins, and the effect of this incorporation on the binding of the hairpins by a fluorescent analog of the drug Actinomycin D. Two hairpin DNAs were used: one with PdC in the stem (basepaired) and one with PdC in the loop (unpaired). The thermal stability, 7-aminoactinomycin D binding, and three-dimensional structures of PdC incorporated into these DNA hairpins were all quite similar as compared to the hairpins containing an unmodified dC residue. Fluorescence lifetime measurements indicate that two lifetimes are present in PdC, and that the increase in fluorescence of the unpaired PdC residue compared to the basepaired PdC is due to an increase in the contribution of the longer lifetime to the average fluorescence lifetime. Our data indicate that PdC can be used effectively to differentiate paired and unpaired bases in DNA hairpin secondary structures, and should be similarly applicable for related structures such as cruciforms and quadruplexes. Further, our data indicate that PdC can act as a fluorescence resonance energy transfer donor for the fluorescent drug 7-aminoactinomycin D. PMID:19254547

  4. DNA hairpins containing the cytidine analog pyrrolo-dC: structural, thermodynamic, and spectroscopic studies.

    PubMed

    Zhang, Xu; Wadkins, Randy M

    2009-03-04

    Structures formed by single-strand DNA have become increasingly interesting because of their roles in a number of biological processes, particularly transcription and its regulation. Of particular importance is the fact that antitumor drugs such as Actinomycin D can selectively bind DNA hairpins over fully paired, double-strand DNA. A new fluorescent base analog, pyrrolo-deoxycytidine (PdC), can now be routinely incorporated into single-strand DNA. The fluorescence of PdC is particularly useful for studying the formation of single-strand DNA in regions of double-strand DNA. The fluorescence is quenched when PdC is paired with a complementary guanine residue, and thus is greatly enhanced upon formation of single-strand DNA. Hence, any process that results in melting or opening of DNA strands produces an increase in the fluorescence intensity of this base analog. In this study we measured the structural effects of incorporating PdC into DNA hairpins, and the effect of this incorporation on the binding of the hairpins by a fluorescent analog of the drug Actinomycin D. Two hairpin DNAs were used: one with PdC in the stem (basepaired) and one with PdC in the loop (unpaired). The thermal stability, 7-aminoactinomycin D binding, and three-dimensional structures of PdC incorporated into these DNA hairpins were all quite similar as compared to the hairpins containing an unmodified dC residue. Fluorescence lifetime measurements indicate that two lifetimes are present in PdC, and that the increase in fluorescence of the unpaired PdC residue compared to the basepaired PdC is due to an increase in the contribution of the longer lifetime to the average fluorescence lifetime. Our data indicate that PdC can be used effectively to differentiate paired and unpaired bases in DNA hairpin secondary structures, and should be similarly applicable for related structures such as cruciforms and quadruplexes. Further, our data indicate that PdC can act as a fluorescence resonance energy transfer donor for the fluorescent drug 7-aminoactinomycin D.

  5. Successful kidney transplantation across a positive complement-dependent cytotoxicity crossmatch by using C1q assay-directed, bortezomib-assisted desensitization

    PubMed Central

    Lee, Juhan; Park, Borae G.; Jeong, Hyang Sook; Park, Youn Hee; Kim, Sinyoung; Kim, Beom Seok; Kim, Hye Jin; Huh, Kyu Ha; Jeong, Hyeon Joo; Kim, Yu Seun

    2017-01-01

    Abstract Rationale: Human leukocyte antigen (HLA) is the major immunologic barrier in kidney transplantation (KT). Various desensitization protocols to overcome the HLA barrier have increased the opportunity for transplantation in sensitized patients. In addition, technological advances in solid-phase assays have permitted more comprehensive assessment of donor-specific antibodies. Although various desensitization therapies and immunologic techniques have been developed, the final transplantation decision is still based on the classic complement-dependent cytotoxicity (CDC) crossmatch (XM) technique. Some patients who fail to achieve negative XM have lost their transplant opportunities, even after receiving sufficient desensitization therapies. Patient concerns: A 57-year-old male with end-stage renal disease secondary to chronic glomerulonephritis was scheduled to have a second transplant from his son, but CDC XM was positive. Diagnoses: Initial CDC XM (Initial T-AHG 1:32) and flow-cytometry XM were positive. Anti-HLA-B59 donor specific antibody was detected by Luminex single antigen assay. Interventions: Herein, we report a successful case of KT across a positive CDC XM (T-AHG 1:8 at the time of transplantation) by using C1q assay-directed, bortezomib-assisted desensitization. After confirming a negative conversion in the C1q donor-specific antibody, we decided to perform KT accepting a positive AHG-CDC XM of 1:8 at the time of transplantation. Outcomes: The posttransplant course was uneventful and a protocol biopsy at 3 months showed no evidence of rejection. The patient had excellent graft function at 12 months posttransplant. Lessons: The results of XM test and solid-phase assay should be interpreted in the context of the individual patient. PMID:28953652

  6. Successful kidney transplantation across a positive complement-dependent cytotoxicity crossmatch by using C1q assay-directed, bortezomib-assisted desensitization: A case report.

    PubMed

    Lee, Juhan; Park, Borae G; Jeong, Hyang Sook; Park, Youn Hee; Kim, Sinyoung; Kim, Beom Seok; Kim, Hye Jin; Huh, Kyu Ha; Jeong, Hyeon Joo; Kim, Yu Seun

    2017-09-01

    Human leukocyte antigen (HLA) is the major immunologic barrier in kidney transplantation (KT). Various desensitization protocols to overcome the HLA barrier have increased the opportunity for transplantation in sensitized patients. In addition, technological advances in solid-phase assays have permitted more comprehensive assessment of donor-specific antibodies. Although various desensitization therapies and immunologic techniques have been developed, the final transplantation decision is still based on the classic complement-dependent cytotoxicity (CDC) crossmatch (XM) technique. Some patients who fail to achieve negative XM have lost their transplant opportunities, even after receiving sufficient desensitization therapies. A 57-year-old male with end-stage renal disease secondary to chronic glomerulonephritis was scheduled to have a second transplant from his son, but CDC XM was positive. Initial CDC XM (Initial T-AHG 1:32) and flow-cytometry XM were positive. Anti-HLA-B59 donor specific antibody was detected by Luminex single antigen assay. Herein, we report a successful case of KT across a positive CDC XM (T-AHG 1:8 at the time of transplantation) by using C1q assay-directed, bortezomib-assisted desensitization. After confirming a negative conversion in the C1q donor-specific antibody, we decided to perform KT accepting a positive AHG-CDC XM of 1:8 at the time of transplantation. The posttransplant course was uneventful and a protocol biopsy at 3 months showed no evidence of rejection. The patient had excellent graft function at 12 months posttransplant. The results of XM test and solid-phase assay should be interpreted in the context of the individual patient.

  7. Antibody mediated rejection associated with complement factor h-related protein 3/1 deficiency successfully treated with eculizumab.

    PubMed

    Noone, D; Al-Matrafi, J; Tinckam, K; Zipfel, P F; Herzenberg, A M; Thorner, P S; Pluthero, F G; Kahr, W H A; Filler, G; Hebert, D; Harvey, E; Licht, C

    2012-09-01

    Antibody mediated rejection (AMR) activates the classical complement pathway and can be detrimental to graft survival. AMR can be accompanied by thrombotic microangiopathy (TMA). Eculizumab, a monoclonal C5 antibody prevents induction of the terminal complement cascade (TCC) and has recently emerged as a therapeutic option for AMR. We present a highly sensitized 13-year-old female with end-stage kidney disease secondary to spina bifida-associated reflux nephropathy, who developed severe steroid-, ATG- and plasmapheresis-resistant AMR with TMA 1 week post second kidney transplant despite previous desensitization therapy with immunoglobulin infusions. Eculizumab rescue therapy resulted in a dramatic improvement in biochemical (C3; creatinine) and hematological (platelets) parameters within 6 days. The patient was proven to be deficient in complement Factor H-related protein 3/1 (CFHR3/1), a plasma protein that regulates the complement cascade at the level of C5 conversion and has been involved in the pathogenesis of atypical hemolytic uremic syndrome caused by CFH autoantibodies (DEAP-HUS). CFHR1 deficiency may have worsened the severe clinical progression of AMR and possibly contributed to the development of donor-specific antibodies. Thus, screening for CFHR3/1 deficiency should be considered in patients with severe AMR associated with TMA. © Copyright 2012 The American Society of Transplantation and the American Society of Transplant Surgeons.

  8. A Bayesian Meta-Analysis on Prevalence of Hepatitis B Virus Infection among Chinese Volunteer Blood Donors

    PubMed Central

    Liu, Guang-ying; Zheng, Yang; Deng, Yan; Gao, Yan-yan; Wang, Lie

    2013-01-01

    Background Although transfusion-transmitted infection of hepatitis B virus (HBV) threatens the blood safety of China, the nationwide circumstance of HBV infection among blood donors is still unclear. Objectives To comprehensively estimate the prevalence of HBsAg positive and HBV occult infection (OBI) among Chinese volunteer blood donors through bayesian meta-analysis. Methods We performed an electronic search in Pub-Med, Web of Knowledge, Medline, Wanfang Data and CNKI, complemented by a hand search of relevant reference lists. Two authors independently extracted data from the eligible studies. Then two bayesian random-effect meta-analyses were performed, followed by bayesian meta-regressions. Results 5957412 and 571227 donors were identified in HBsAg group and OBI group, respectively. The pooled prevalence of HBsAg group and OBI group among donors is 1.085% (95% credible interval [CI] 0.859%∼1.398%) and 0.094% (95% CI 0.0578%∼0.1655%). For HBsAg group, subgroup analysis shows the more developed area has a lower prevalence than the less developed area; meta-regression indicates there is a significant decreasing trend in HBsAg positive prevalence with sampling year (beta = −0.1202, 95% −0.2081∼−0.0312). Conclusion Blood safety against HBV infection in China is suffering serious threats and the government should take effective measures to improve this situation. PMID:24236110

  9. Transplantation of donor hearts after circulatory or brain death in a rat model.

    PubMed

    Li, Shiliang; Loganathan, Sivakkanan; Korkmaz, Sevil; Radovits, Tamás; Hegedűs, Peter; Zhou, Yan; Karck, Matthias; Szabó, Gábor

    2015-05-01

    Heart transplantation represents the only curative treatment for end-stage heart failure. Presently, the donor pool is restricted to brain-dead donors. Based on the lack of suitable donors and the increasing number of patients, we investigated some molecular pathomechanisms of the potential use of hearts after circulatory determination of death (DCDD) in transplantation. Rats were either maintained brain death for 5 h by inflation of a subdurally placed balloon catheter (n = 6) or subjected to cardiac arrest by exsanguinations (n = 6). Additionally, a control group was used (n = 9). Then the hearts were perfused with a cold preservation solution (Custodiol), explanted, stored at 4°C in Custodiol, and heterotopically transplanted. Brain death was associated with decreased left-ventricular contractility (dP/dtmax: 4895 ± 505 versus 8037 ± 565 mm Hg/s; ejection fraction: 27 ± 5 versus 44 ± 5%; Emax: 2.2 ± 0.3 versus 4.2 ± 0.3 mm Hg/μL; preload recruitable stroke work: 59 ± 5 versus 96 ± 6 mm Hg; 5 h after brain death versus before brain death; P < 0.05) and impaired cardiac relaxation (dP/dtmin: -4734 ± 575 versus -9404 ± 550 mm Hg/s and prolonged Tau, P < 0.05) compared with controls. After transplantation, significantly decreased systolic function and prolonged Tau were observed in brain-dead and DCDD groups compared with those in controls. Tumor necrosis factor-alpha, cyclooxygenase-2, nuclear factor-κB, inducible-NOS, and caspase-3 messenger RNA and protein-levels were significantly increased in the brain-dead compared with both control and DCDD groups. Additionally, marked myocardial inflammatory cell infiltration, edema, necrosis, and DNA-strand breaks were observed in the brain-dead group. Our results show that despite the similar functional outcome in DCDD and brain-dead groups, brain-dead hearts showed marked myocardial inflammatory cell infiltration, edema, necrosis, DNA-strand breaks, and increased transcriptional and posttranscriptional expression for markers of apoptosis and inflammatory signaling pathways. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Protein-DNA interactions define the mechanistic aspects of circle formation and insertion reactions in IS2 transposition.

    PubMed

    Lewis, Leslie A; Astatke, Mekbib; Umekubo, Peter T; Alvi, Shaheen; Saby, Robert; Afrose, Jehan; Oliveira, Pedro H; Monteiro, Gabriel A; Prazeres, Duarte Mf

    2012-01-26

    Transposition in IS3, IS30, IS21 and IS256 insertion sequence (IS) families utilizes an unconventional two-step pathway. A figure-of-eight intermediate in Step I, from asymmetric single-strand cleavage and joining reactions, is converted into a double-stranded minicircle whose junction (the abutted left and right ends) is the substrate for symmetrical transesterification attacks on target DNA in Step II, suggesting intrinsically different synaptic complexes (SC) for each step. Transposases of these ISs bind poorly to cognate DNA and comparative biophysical analyses of SC I and SC II have proven elusive. We have prepared a native, soluble, active, GFP-tagged fusion derivative of the IS2 transposase that creates fully formed complexes with single-end and minicircle junction (MCJ) substrates and used these successfully in hydroxyl radical footprinting experiments. In IS2, Step I reactions are physically and chemically asymmetric; the left imperfect, inverted repeat (IRL), the exclusive recipient end, lacks donor function. In SC I, different protection patterns of the cleavage domains (CDs) of the right imperfect inverted repeat (IRR; extensive in cis) and IRL (selective in trans) at the single active cognate IRR catalytic center (CC) are related to their donor and recipient functions. In SC II, extensive binding of the IRL CD in trans and of the abutted IRR CD in cis at this CC represents the first phase of the complex. An MCJ substrate precleaved at the 3' end of IRR revealed a temporary transition state with the IRL CD disengaged from the protein. We propose that in SC II, sequential 3' cleavages at the bound abutted CDs trigger a conformational change, allowing the IRL CD to complex to its cognate CC, producing the second phase. Corroborating data from enhanced residues and curvature propensity plots suggest that CD to CD interactions in SC I and SC II require IRL to assume a bent structure, to facilitate binding in trans. Different transpososomes are assembled in each step of the IS2 transposition pathway. Recipient versus donor end functions of the IRL CD in SC I and SC II and the conformational change in SC II that produces the phase needed for symmetrical IRL and IRR donor attacks on target DNA highlight the differences.

  11. Protein-DNA interactions define the mechanistic aspects of circle formation and insertion reactions in IS2 transposition

    PubMed Central

    2012-01-01

    Background Transposition in IS3, IS30, IS21 and IS256 insertion sequence (IS) families utilizes an unconventional two-step pathway. A figure-of-eight intermediate in Step I, from asymmetric single-strand cleavage and joining reactions, is converted into a double-stranded minicircle whose junction (the abutted left and right ends) is the substrate for symmetrical transesterification attacks on target DNA in Step II, suggesting intrinsically different synaptic complexes (SC) for each step. Transposases of these ISs bind poorly to cognate DNA and comparative biophysical analyses of SC I and SC II have proven elusive. We have prepared a native, soluble, active, GFP-tagged fusion derivative of the IS2 transposase that creates fully formed complexes with single-end and minicircle junction (MCJ) substrates and used these successfully in hydroxyl radical footprinting experiments. Results In IS2, Step I reactions are physically and chemically asymmetric; the left imperfect, inverted repeat (IRL), the exclusive recipient end, lacks donor function. In SC I, different protection patterns of the cleavage domains (CDs) of the right imperfect inverted repeat (IRR; extensive in cis) and IRL (selective in trans) at the single active cognate IRR catalytic center (CC) are related to their donor and recipient functions. In SC II, extensive binding of the IRL CD in trans and of the abutted IRR CD in cis at this CC represents the first phase of the complex. An MCJ substrate precleaved at the 3' end of IRR revealed a temporary transition state with the IRL CD disengaged from the protein. We propose that in SC II, sequential 3' cleavages at the bound abutted CDs trigger a conformational change, allowing the IRL CD to complex to its cognate CC, producing the second phase. Corroborating data from enhanced residues and curvature propensity plots suggest that CD to CD interactions in SC I and SC II require IRL to assume a bent structure, to facilitate binding in trans. Conclusions Different transpososomes are assembled in each step of the IS2 transposition pathway. Recipient versus donor end functions of the IRL CD in SC I and SC II and the conformational change in SC II that produces the phase needed for symmetrical IRL and IRR donor attacks on target DNA highlight the differences. PMID:22277150

  12. Hardware Acceleration Of Multi-Deme Genetic Algorithm for DNA Codeword Searching

    DTIC Science & Technology

    2008-01-01

    C and G are complementary to each other. A Watson - Crick complement of a DNA sequence is another DNA sequence which replaces all the A with T or vise...versa and replaces all the T with A or vise versa, and also switches the 5’ and 3’ ends. A DNA sequence binds most stably with its Watson - Crick ...bind with 5 Watson - Crick pairs. The length of the longest complementary sequence between two flexible DNA strands, A and B, is the same as the

  13. Anti-CD40 antibody-mediated costimulation blockade promotes long-term survival of deep-lamellar porcine corneal grafts in non-human primates.

    PubMed

    Kim, Jaeyoung; Kim, Dong Hyun; Choi, Hyuk Jin; Lee, Hyun Ju; Kang, Hee Jung; Park, Chung-Gyu; Hwang, Eung-Soo; Kim, Mee Kum; Wee, Won Ryang

    2017-05-01

    Corneal xenotransplantation is an effective solution for the shortage of human donor corneas, and the porcine cornea may be a suitable candidate for the donor cornea because of its optical similarity with humans. However, it is necessary to administer additional immunosuppressants to overcome antigenic differences. We aimed to investigate the feasibility of porcine corneas with anti-CD40 antibody-mediated costimulation blockade in a clinically applicable pig-to-non-human primate corneal xenotransplantation model. Five Chinese rhesus macaques underwent deep-lamellar corneal transplantation using clinically acceptable sized (7.5 mm diameter) porcine corneal grafts. The anti-CD40 antibody was intravenously administered on a programmed schedule. Graft survival, central corneal thickness, and intraocular pressure were evaluated. Changes in effector and memory T and B cell subsets and anti-αGal and donor-specific antibodies were investigated in the blood, and the changes in complement levels in the aqueous humor and blood were evaluated. Memory cell profiles in the anti-CD40 antibody-treated group were compared with those from the anti-CD154 antibody-treated group or rejected controls presented in our previous report. The changes in anti-αGal, non-αGal, and donor-specific antibodies after 6 months were compared with baseline values. Anti-CD40 antibody-mediated costimulation blockade resulted in the successful survival of xenocorneal grafts (>389, >382, >236, >201, and >61 days), with 80% reaching 6 months of survival. Injection of anti-CD40 antibody considerably reduced the infiltration of inflammatory cells into the grafts and significantly blocked the complement response in the aqueous humor (P=.0159, Mann-Whitney U test). Systemic expansion of central or effector memory T cells was abrogated in the anti-CD40 antibody-treated primates compared with those in the rejected controls (P<.05, Mann-Whitney U test) or those in the anti-CD154 antibody-treated primates (P>.05, Mann-Whitney U test). The levels of anti-αGal, non-αGal, and donor-specific antibodies at 6 months were not significantly increased compared with baseline levels (P>.05, Wilcoxon signed rank test). An anti-CD40 antibody-mediated blockade appears to be effective immunosuppressive approach for porcine corneal deep-lamellar xenotransplantation in primates. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Novel recA-Independent Horizontal Gene Transfer in Escherichia coli K-12.

    PubMed

    Kingston, Anthony W; Roussel-Rossin, Chloé; Dupont, Claire; Raleigh, Elisabeth A

    2015-01-01

    In bacteria, mechanisms that incorporate DNA into a genome without strand-transfer proteins such as RecA play a major role in generating novelty by horizontal gene transfer. We describe a new illegitimate recombination event in Escherichia coli K-12: RecA-independent homologous replacements, with very large (megabase-length) donor patches replacing recipient DNA. A previously uncharacterized gene (yjiP) increases the frequency of RecA-independent replacement recombination. To show this, we used conjugal DNA transfer, combining a classical conjugation donor, HfrH, with modern genome engineering methods and whole genome sequencing analysis to enable interrogation of genetic dependence of integration mechanisms and characterization of recombination products. As in classical experiments, genomic DNA transfer begins at a unique position in the donor, entering the recipient via conjugation; antibiotic resistance markers are then used to select recombinant progeny. Different configurations of this system were used to compare known mechanisms for stable DNA incorporation, including homologous recombination, F'-plasmid formation, and genome duplication. A genome island of interest known as the immigration control region was specifically replaced in a minority of recombinants, at a frequency of 3 X 10(-12) CFU/recipient per hour.

  15. Analgesia after ACL reconstruction: Hamstring donor-site injection versus intra-articular local anaesthetic injection.

    PubMed

    Sonnery-Cottet, B; Saithna, A; Azeem, A; Choudja, E; Pic, J B; Cabaton, J; Thaunat, M

    2017-04-01

    The purpose of this study was to compare hamstring donor-site injection versus intra-articular injection of a local anaesthetic for analgesia after anterior cruciate ligament (ACL) reconstruction. The two methods provide similar pain relief. 158 consecutive patients undergoing ACL hamstring tendon graft reconstruction (semi-tendinosus/gracilis [STG] or four-stranded semi-tendinosus [ST4]) during two periods in 2015 were included. Peripheral nerve block was not performed. At the end of surgery, 20mL of ropivacaine 7.5mg/mL was injected, intra-articularly during the early period (n=79) and into the hamstring donor site during the second period (n=79). Post-operative pain was evaluated subjectively by the patients using a visual analogue scale (VAS). We recorded patient demographics, concomitant surgical procedures, VAS pain scores, rescue analgesic use, time to discharge, and patient satisfaction. VAS pain score, side effects, and patient satisfaction were also recorded during a phone interview on the day after surgery (D1). Mean VAS pain scores were not significantly different between the two groups immediately after surgery (D0) or on D1 (D0: intra-articular, 2.08 and donor site, 1.88; Mann-Whitney P=0.6). Neither were the groups significantly different for rescue analgesic use, patient satisfaction, or quadriceps activation. The same local anaesthetic provides similar pain relief when injected intra-articularly or into the hamstring donor site after hamstring tendon ACL reconstruction (STG or ST4). III, prospective case-control study. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  16. Role of Saccharomyces cerevisiae Msh2 and Msh3 repair proteins in double-strand break-induced recombination.

    PubMed

    Sugawara, N; Pâques, F; Colaiácovo, M; Haber, J E

    1997-08-19

    When gene conversion is initiated by a double-strand break (DSB), any nonhomologous DNA that may be present at the ends must be removed before new DNA synthesis can be initiated. In Saccharomyces cerevisiae, removal of nonhomologous ends depends not only on the nucleotide excision repair endonuclease Rad1/Rad10 but also on Msh2 and Msh3, two proteins that are required to correct mismatched bp. These proteins have no effect when DSB ends are homologous to the donor, either in the kinetics of recombination or in the proportion of gene conversions associated with crossing-over. A second DSB repair pathway, single-strand annealing also requires Rad1/Rad10 and Msh2/Msh3, but reveals a difference in their roles. When the flanking homologous regions that anneal are 205 bp, the requirement for Msh2/Msh3 is as great as for Rad1/Rad10; but when the annealing partners are 1,170 bp, Msh2/Msh3 have little effect, while Rad1/Rad10 are still required. Mismatch repair proteins Msh6, Pms1, and Mlh1 are not required. We suggest Msh2 and Msh3 recognize not only heteroduplex loops and mismatched bp, but also branched DNA structures with a free 3' tail.

  17. The Perfect Storm: HLA Antibodies, Complement, FcγRs and Endothelium in Transplant Rejection

    PubMed Central

    Thomas, Kimberly A.; Valenzuela, Nicole M.; Reed, Elaine F.

    2015-01-01

    The pathophysiology of antibody-mediated rejection (AMR) in solid organ transplants is multi-faceted and predominantly caused by antibodies directed against polymorphic donor human leukocyte antigens (HLA). Despite the clearly detrimental impact of HLA antibodies (HLA-Ab) on graft function and survival, the prevention, diagnosis and treatment of AMR remain a challenge. Histological manifestations of AMR reflect signatures of HLA-Ab-triggered injury, specifically endothelial changes, recipient leukocytic infiltrate, and complement deposition. We review the interconnected mechanisms of HLA-Ab-mediated injury that might synergize in a “perfect storm” of inflammation. Characterization of antibody features that are critical for effector functions may help identify HLA-Ab more likely to cause rejection. We also highlight recent advancements that may pave the way for new, more effective therapeutics. PMID:25801125

  18. Polyfluorophore Excimers and Exciplexes as FRET Donors in DNA

    PubMed Central

    Teo, Yin Nah; Kool, Eric T.

    2009-01-01

    We describe studies aimed at testing whether oligomeric exciplex- and excimer fluorophores conjugated to DNA have the potential to act as donors for energy transfer by the Förster mechanism. Oligodeoxyfluorosides (ODFs) are composed of stacked, electronically interacting fluorophores replacing the bases on a DNA scaffold. The monomer chromophores in the twenty tetramer-length ODFs studied here include pyrene (Y), benzopyrene (B), perylene (E), dimethylaminostilbene (D), and a nonfluorescent spacer (S); these are conjugated in varied combinations at the 3’ end of a 14mer DNA probe sequence. In the absence of an acceptor chromophore, many of the ODF-DNAs show broad, unstructured long-wavelength emission peaks characteristic of excimer and exciplex excited states, similar to what has been observed for unconjugated ODFs. Although such delocalized excited states have been widely studied, we know of no prior report of their use in FRET. We tested the ability of the twenty ODFs to donate energy to Cy5 and TAMRA dyes conjugated to a complementary strand of DNA, with these acceptors oriented either at the near or far end of the ODF-conjugated probes. Results showed that a number of the ODF fluorophores exhibited relatively efficient energy transfer characteristic of the Förster mechanism, as judged by drops in donor emission quantum yield and fluorescence lifetime, accompanied by increases in intensity of acceptor emission bands. Excimer/exciplex bands in the donors were selectively quenched while shorter-wavelength monomer emission stayed relatively constant, consistent with the notion that the delocalized excited states, rather than individual fluorophores, are the donors. Interestingly, only specific sequences of ODFs were able to act as donors, while others did not, even though their emission wavelengths were similar. The new FRET donors possess large Stokes shifts, which can be beneficial for multiple applications. In addition, all ODFs can be excited at a single wavelength; thus, ODFs may be candidates as “universal FRET donors”, thus allowing multicolor FRET of multiple species to be carried out with one excitation. PMID:19916519

  19. Microinjection of cytoplasm as a test of complementation in Paramecium

    PubMed Central

    1982-01-01

    Mutants in Paramecium tetraurelia, unable to generate action potentials, have been isolated as cells which show no backward swimming in response to ionic stimulation. These "pawn" mutants belong to at least three complementation groups designated pwA, pwB, and pwC. We have found that microinjection of cytoplasm from a wild-type donor into a pawn recipient of any of the three complementation groups restores the ability of the pawn to generate action potentials and hence swim backward. In addition, the cytoplasm from a pawn cannot restore a recipient of the same complementation group, but that from a pawn of a different group can. Electrophysiological analysis had demonstrated that the restoration of backward swimming is not due to a simple addition of ions but represents a profound change in the excitable membrane of the recipient pawn cells. Using known pawn mutants and those which had previously been unclassified, we have been able to establish a perfect concordance of genetic complementation and complementation by cytoplasmic transfer through microinjection. This method has been used to classify pawn mutants that are sterile or hard- to-mate and to examine the ability of cytoplasms from different species of ciliated protozoa to restore the ability to swim backward in the pawn mutants of P. tetraurelia. A cell homogenate has also been fractionated by centrifugation to further purify the active components. These results demonstrate that transfer of cytoplasm between cells by microinjection can be a valid and systematic method to classify mutants. This test is simpler to perform than the genetic complementation test and can be used under favorable conditions in mutants that are sterile and in cells of different species. PMID:7061597

  20. Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets.

    PubMed

    Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard

    2007-10-30

    We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 x 10(8) bound targets per cm(2) sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format.

  1. Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets

    PubMed Central

    Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard

    2007-01-01

    We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 × 108 bound targets per cm2 sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format. PMID:17951434

  2. Apollo contributes to G overhang maintenance and protects leading-end telomeres.

    PubMed

    Wu, Peng; van Overbeek, Megan; Rooney, Sean; de Lange, Titia

    2010-08-27

    Mammalian telomeres contain a single-stranded 3' overhang that is thought to mediate telomere protection. Here we identify the TRF2-interacting factor Apollo as a nuclease that contributes to the generation/maintenance of this overhang. The function of mouse Apollo was determined using Cre-mediated gene deletion, complementation with Apollo mutants, and the TRF2-F120A mutant that cannot bind Apollo. Cells lacking Apollo activated the ATM kinase at their telomeres in S phase and showed leading-end telomere fusions. These telomere dysfunction phenotypes were accompanied by a reduction in the telomeric overhang signal. The telomeric functions of Apollo required its TRF2-interaction and nuclease motifs. Thus, TRF2 recruits the Apollo nuclease to process telomere ends synthesized by leading-strand DNA synthesis, thereby creating a terminal structure that avoids ATM activation and resists end-joining. These data establish that the telomeric overhang is required for the protection of telomeres from the DNA damage response. Copyright (c) 2010 Elsevier Inc. All rights reserved.

  3. Activation of the lectin pathway of complement in experimental human keratitis with Pseudomonas aeruginosa.

    PubMed

    Osthoff, Michael; Brown, Karl D; Kong, David C M; Daniell, Mark; Eisen, Damon P

    2014-01-01

    Pseudomonas aeruginosa (P. aeruginosa) microbial keratitis (MK) is a sight-threatening disease. Previous animal studies have identified an important contribution of the complement system to the clearance of P. aeruginosa infection of the cornea. Mannose-binding lectin (MBL), a pattern recognition receptor of the lectin pathway of complement, has been implicated in the host defense against P. aeruginosa. However, studies addressing the role of the lectin pathway in P. aeruginosa MK are lacking. Hence, we sought to determine the activity of the lectin pathway in human MK caused by P. aeruginosa. Primary human corneal epithelial cells (HCECs) from cadaveric donors were exposed to two different P. aeruginosa strains. Gene expression of interleukin (IL)-6, IL-8, MBL, and other complement proteins was determined by reverse transcription-polymerase chain reaction (RT-PCR) and MBL synthesis by enzyme-linked immunosorbent assay and intracellular flow cytometry. MBL gene expression was not detected in unchallenged HCECs. Exposure of HCECs to P. aeruginosa resulted in rapid induction of the transcriptional expression of MBL, IL-6, and IL-8. In addition, expression of several complement proteins of the classical and lectin pathways, but not the alternative pathway, were upregulated after 5 h of challenge, including MBL-associated serine protease 1. However, MBL protein secretion was not detectable 18 h after challenge with P. aeruginosa. MK due to P. aeruginosa triggers activation of MBL and the lectin pathway of complement. However, the physiologic relevance of this finding is unclear, as corresponding MBL oligomer production was not observed.

  4. Activation of the lectin pathway of complement in experimental human keratitis with Pseudomonas aeruginosa

    PubMed Central

    Osthoff, Michael; Brown, Karl D.; Kong, David C.M.; Daniell, Mark

    2014-01-01

    Purpose Pseudomonas aeruginosa (P. aeruginosa) microbial keratitis (MK) is a sight-threatening disease. Previous animal studies have identified an important contribution of the complement system to the clearance of P. aeruginosa infection of the cornea. Mannose-binding lectin (MBL), a pattern recognition receptor of the lectin pathway of complement, has been implicated in the host defense against P. aeruginosa. However, studies addressing the role of the lectin pathway in P. aeruginosa MK are lacking. Hence, we sought to determine the activity of the lectin pathway in human MK caused by P. aeruginosa. Methods Primary human corneal epithelial cells (HCECs) from cadaveric donors were exposed to two different P. aeruginosa strains. Gene expression of interleukin (IL)-6, IL-8, MBL, and other complement proteins was determined by reverse transcription-polymerase chain reaction (RT–PCR) and MBL synthesis by enzyme-linked immunosorbent assay and intracellular flow cytometry. Results MBL gene expression was not detected in unchallenged HCECs. Exposure of HCECs to P. aeruginosa resulted in rapid induction of the transcriptional expression of MBL, IL-6, and IL-8. In addition, expression of several complement proteins of the classical and lectin pathways, but not the alternative pathway, were upregulated after 5 h of challenge, including MBL-associated serine protease 1. However, MBL protein secretion was not detectable 18 h after challenge with P. aeruginosa. Conclusions MK due to P. aeruginosa triggers activation of MBL and the lectin pathway of complement. However, the physiologic relevance of this finding is unclear, as corresponding MBL oligomer production was not observed. PMID:24426774

  5. Allogeneic major histocompatibility complex-mismatched equine bone marrow-derived mesenchymal stem cells are targeted for death by cytotoxic anti-major histocompatibility complex antibodies.

    PubMed

    Berglund, A K; Schnabel, L V

    2017-07-01

    Allogeneic mesenchymal stem cells (MSCs) are a promising cell source for treating musculoskeletal injuries in horses. Controversy exists, however, over whether major histocompatibility complex (MHC)-mismatched MSCs are recognised by the recipient immune system and targeted for death by a cytotoxic antibody response. To determine if cytotoxic anti-MHC antibodies generated in vivo following MHC-mismatched MSC injections are capable of initiating complement-dependent cytotoxicity of MSCs. Experimental controlled study. Antisera previously collected at Days 0, 7, 14 and 21 post-injection from 4 horses injected with donor MHC-mismatched equine leucocyte antigen (ELA)-A2 haplotype MSCs and one control horse injected with donor MHC-matched ELA-A2 MSCs were utilised in this study. Antisera were incubated with ELA-A2 MSCs before adding complement in microcytotoxicity assays and cell death was analysed via eosin dye exclusion. ELA-A2 peripheral blood leucocytes (PBLs) were used in the assays as a positive control. Antisera from all 4 horses injected with MHC-mismatched MSCs contained antibodies that caused the death of ELA-A2 haplotype MSCs in the microcytotoxicity assays. In 2 of the 4 horses, antibodies were present as early as Day 7 post-injection. MSC death was consistently equivalent to that of ELA-A2 haplotype PBL death at all time points and antisera dilutions. Antisera from the control horse that was injected with MHC-matched MSCs did not contain cytotoxic ELA-A2 antibodies at any of the time points examined. This study examined MSC death in vitro only and utilized antisera from a small number of horses. The cytotoxic antibody response induced in recipient horses following injection with donor MHC-mismatched MSCs is capable of killing donor MSCs in vitro. These results suggest that the use of allogeneic MHC-mismatched MSCs must be cautioned against, not only for potential adverse events, but also for reduced therapeutic efficacy due to targeted MSC death. © 2016 The Authors Equine Veterinary Journal published by John Wiley & Sons Ltd on behalf of EVJ Ltd.

  6. Flavivirus RNA cap methyltransferase: structure, function, and inhibition.

    PubMed

    Liu, Lihui; Dong, Hongping; Chen, Hui; Zhang, Jing; Ling, Hua; Li, Zhong; Shi, Pei-Yong; Li, Hongmin

    2010-08-01

    Many flaviviruses are significant human pathogens. The plus-strand RNA genome of a flavivirus contains a 5' terminal cap 1 structure (m(7)GpppAmG). The flavivirus encodes one methyltransferase (MTase), located at the N-terminal portion of the NS5 RNA-dependent RNA polymerase (RdRp). Here we review recent advances in our understanding of flaviviral capping machinery and the implications for drug development. The NS5 MTase catalyzes both guanine N7 and ribose 2'-OH methylations during viral cap formation. Representative flavivirus MTases, from dengue, yellow fever, and West Nile virus (WNV), sequentially generate GpppA → m(7)GpppA → m(7)GpppAm. Despite the existence of two distinct methylation activities, the crystal structures of flavivirus MTases showed a single binding site for S-adenosyl-L-methionine (SAM), the methyl donor. This finding indicates that the substrate GpppA-RNA must be repositioned to accept the N7 and 2'-O methyl groups from SAM during the sequential reactions. Further studies demonstrated that distinct RNA elements are required for the methylations of guanine N7 on the cap and of ribose 2'-OH on the first transcribed nucleotide. Mutant enzymes with different methylation defects can trans complement one another in vitro, demonstrating that separate molecules of the enzyme can independently catalyze the two cap methylations in vitro. In the context of the infectious virus, defects in both methylations, or a defect in the N7 methylation alone, are lethal to WNV. However, viruses defective solely in 2'-O methylation are attenuated and can protect mice from later wild-type WNV challenge. The results demonstrate that the N7 methylation activity is essential for the WNV life cycle and, thus, methyltransferase represents a novel and promising target for flavivirus therapy.

  7. Maternal Vaccination with a Fimbrial Tip Adhesin and Passive Protection of Neonatal Mice against Lethal Human Enterotoxigenic Escherichia coli Challenge

    PubMed Central

    Luiz, Wilson B.; Rodrigues, Juliana F.; Crabb, Joseph H.

    2015-01-01

    Globally, enterotoxigenic Escherichia coli (ETEC) is a leading cause of childhood and travelers' diarrhea, for which an effective vaccine is needed. Prevalent intestinal colonization factors (CFs) such as CFA/I fimbriae and heat-labile enterotoxin (LT) are important virulence factors and protective antigens. We tested the hypothesis that donor strand-complemented CfaE (dscCfaE), a stabilized form of the CFA/I fimbrial tip adhesin, is a protective antigen, using a lethal neonatal mouse ETEC challenge model and passive dam vaccination. For CFA/I-ETEC strain H10407, which has been extensively studied in volunteers, an inoculum of 2 × 107 bacteria resulted in 50% lethal doses (LD50) in neonatal DBA/2 mice. Vaccination of female DBA/2 mice with CFA/I fimbriae or dscCfaE, each given with a genetically attenuated LT adjuvant (LTK63) by intranasal or orogastric delivery, induced high antigen-specific serum IgG and fecal IgA titers and detectable milk IgA responses. Neonates born to and suckled by dams antenatally vaccinated with each of these four regimens showed 78 to 93% survival after a 20× LD50 challenge with H10407, compared to 100% mortality in pups from dams vaccinated with sham vaccine or LTK63 only. Crossover experiments showed that high pup survival rates after ETEC challenge were associated with suckling but not birthing from vaccinated dams, suggesting that vaccine-specific milk antibodies are protective. In corroboration, preincubation of the ETEC inoculum with antiadhesin and antifimbrial bovine colostral antibodies conferred a dose-dependent increase in pup survival after challenge. These findings indicate that the dscCfaE fimbrial tip adhesin serves as a protective passive vaccine antigen in this small animal model and merits further evaluation. PMID:26371126

  8. Sirolimus in kidney transplant donors and clinical and histologic improvement in recipients: rat model.

    PubMed

    Cicora, F; Lausada, N; Vasquez, D N; Cicora, P; Zalazar, G; Gonzalez, P; Palti, G; Raimondi, C

    2010-01-01

    Ischemia-reperfusion (I/R) injury is one of the risk factors for delayed graft function, acute rejection episodes, and impaired long-term allograft survival after kidney transplantation. This antigen-independent inflammatory process produces tissue damage. Isogeneic transplantation in a rat model is a useful method for study of nonimmunologic risk factors for kidney damage. To study the effect of sirolimus on I/R injury using only 1 dose of the drug in the donor. Eighteen rats were allocated to 3 groups of 6 rats each: sham group, control group, and rapamycin group. Improved renal function and systemic inflammatory response were observed in the rapamycin group compared with the control group (Deltaurea, Deltacreatinine, and DeltaC3, all P < .01). The number of apoptotic nuclei in the renal medulla in the control group was higher than in the rapamycin group (P < .01). Tubular damage was less severe in the rapamycin group compared with the control group (P < .01). Complement 3 and tumor necrosis factor-alpha expression in the kidney samples were significantly decreased when rapamycin was given to the donor rats (P > .01). Bcl-2 protein was upregulated in the rapamycin group compared with the control group (P < .01). Administration of rapamycin in donors attenuates the I/R injury process after kidney transplantation in a rat model.

  9. Xenogeneic chimera-Generated by blastocyst complementation-As a potential unlimited source of recipient-tailored organs.

    PubMed

    Oldani, Graziano; Peloso, Andrea; Lacotte, Stéphanie; Meier, Raphael; Toso, Christian

    2017-07-01

    Blastocyst complementation refers to the injection of cells into a blastocyst. The technology allows for the creation of chimeric animals, which have the potential to be used as an unlimited source of organ donors. Pluripotent stem cells could be generated from a patient in need of a transplantation and injected into a large animal blastocyst (potentially of a pig), leading to the creation of organ(s) allowing immunosuppression-free transplantation. Various chimera combinations have already been generated, but one of the most recent steps leads to the creation of human-pig chimeras, which could be studied at an embryo stage. Although still far from clinical reality, the potential application is almost unlimited. The present review illustrates the historical steps of intra- and interspecific blastocyst complementation in rodents and large animals, specifically looking at its potential for generation of organ grafts. We also speculate on how it could change transplant indications, on its economic impact, and on the linked ethical concerns. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Platelet activation and aggregation by the opportunistic pathogen Cutibacterium (Propionibacterium) acnes

    PubMed Central

    Petersson, Frida; Kilsgård, Ola; Shannon, Oonagh

    2018-01-01

    Cutibacterium (Propionibacterium) acnes, considered a part of the skin microbiota, is one of the most commonly isolated anaerobic bacteria from medical implants in contact with plasma. However, the precise interaction of C. acnes with blood cells and plasma proteins has not been fully elucidated. Herein, we have investigated the molecular interaction of C. acnes with platelets and plasma proteins. We report that the ability of C. acnes to aggregate platelets is dependent on phylotype, with a significantly lower ability amongst type IB isolates, and the interaction of specific donor-dependent plasma proteins (or concentrations thereof) with C. acnes. Pretreatment of C. acnes with plasma reduces the lag time before aggregation demonstrating that pre-deposition of plasma proteins on C. acnes is an important step in platelet aggregation. Using mass spectrometry we identified several plasma proteins deposited on C. acnes, including IgG, fibrinogen and complement factors. Inhibition of IgG, fibrinogen or complement decreased C. acnes-mediated platelet aggregation, demonstrating the importance of these plasma proteins for aggregation. The interaction of C. acnes and platelets was visualized using fluorescence microscopy, verifying the presence of IgG and fibrinogen as components of the aggregates, and co-localization of C. acnes and platelets in the aggregates. Here, we have demonstrated the ability of C. acnes to activate and aggregate platelets in a bacterium and donor-specific fashion, as well as added mechanistic insights into this interaction. PMID:29385206

  11. Banff study of pathologic changes in lung allograft biopsy specimens with donor-specific antibodies.

    PubMed

    Wallace, William Dean; Li, Ning; Andersen, Claus B; Arrossi, A Valeria; Askar, Medhat; Berry, Gerry J; DeNicola, Matthew M; Neil, Desley A; Pavlisko, Elizabeth N; Reed, Elaine F; Remmelink, Myriam; Weigt, S Sam; Weynand, Birgit; Zhang, Jennifer Q; Budev, Marie M; Farver, Carol F

    2016-01-01

    The diagnosis of antibody-mediated rejection (AMR) in the lung transplant is still an area under investigation. We performed a blinded multicenter study to determine if any statistically significant histologic findings in transbronchial biopsy specimens from lung transplant patients correlate with the presence of donor-specific antibodies (DSAs). We asked 9 pathologists with experience in lung transplantation to evaluate 161 lung transplant biopsy specimens for various histologic parameters. The findings were correlated with antibody status positive for DSAs, positive for non-DSAs, and no antibodies (NABs) present. The significance of each histologic variable was reviewed. We found no statistically significant association with acute cellular rejection, airway inflammation, or bronchiolitis obliterans and the presence or absence of antibodies. However, biopsy specimens with DSAs had a statistically significant difference vs NABs in the setting of acute lung injury, with or without diffuse alveolar damage (p = 0.0008), in the presence of capillary neutrophilic inflammation (p = 0.0014), and in samples with endotheliitis (p = 0.0155). In samples with complement 4d staining, there was a trend but no statistically significant difference between specimens associated with DSAs and specimens with NABs. Capillary inflammation, acute lung injury, and endotheliitis significantly correlated with DSAs. The infrequently observed diffuse staining for complement 4d limits the usefulness of this stain. Copyright © 2016 International Society for Heart and Lung Transplantation. Published by Elsevier Inc. All rights reserved.

  12. Platelet activation and aggregation by the opportunistic pathogen Cutibacterium (Propionibacterium) acnes.

    PubMed

    Petersson, Frida; Kilsgård, Ola; Shannon, Oonagh; Lood, Rolf

    2018-01-01

    Cutibacterium (Propionibacterium) acnes, considered a part of the skin microbiota, is one of the most commonly isolated anaerobic bacteria from medical implants in contact with plasma. However, the precise interaction of C. acnes with blood cells and plasma proteins has not been fully elucidated. Herein, we have investigated the molecular interaction of C. acnes with platelets and plasma proteins. We report that the ability of C. acnes to aggregate platelets is dependent on phylotype, with a significantly lower ability amongst type IB isolates, and the interaction of specific donor-dependent plasma proteins (or concentrations thereof) with C. acnes. Pretreatment of C. acnes with plasma reduces the lag time before aggregation demonstrating that pre-deposition of plasma proteins on C. acnes is an important step in platelet aggregation. Using mass spectrometry we identified several plasma proteins deposited on C. acnes, including IgG, fibrinogen and complement factors. Inhibition of IgG, fibrinogen or complement decreased C. acnes-mediated platelet aggregation, demonstrating the importance of these plasma proteins for aggregation. The interaction of C. acnes and platelets was visualized using fluorescence microscopy, verifying the presence of IgG and fibrinogen as components of the aggregates, and co-localization of C. acnes and platelets in the aggregates. Here, we have demonstrated the ability of C. acnes to activate and aggregate platelets in a bacterium and donor-specific fashion, as well as added mechanistic insights into this interaction.

  13. Regulation of age-related macular degeneration-like pathology by complement factor H

    PubMed Central

    Toomey, Christopher B.; Kelly, Una; Saban, Daniel R.; Bowes Rickman, Catherine

    2015-01-01

    Complement factor H (CFH) is a major susceptibility gene for age-related macular degeneration (AMD); however, its impact on AMD pathobiology is unresolved. Here, the role of CFH in the development of AMD pathology in vivo was interrogated by analyzing aged Cfh+/− and Cfh−/− mice fed a high-fat, cholesterol-enriched diet. Strikingly, decreased levels of CFH led to increased sub-retinal pigmented epithelium (sub-RPE) deposit formation, specifically basal laminar deposits, following high-fat diet. Mechanistically, our data show that deposits are due to CFH competition for lipoprotein binding sites in Bruch’s membrane. Interestingly and despite sub-RPE deposit formation occurring in both Cfh+/− and Cfh−/− mice, RPE damage accompanied by loss of vision occurred only in old Cfh+/− mice. We demonstrate that such pathology is a function of excess complement activation in Cfh+/− mice versus complement deficiency in Cfh−/− animals. Due to the CFH-dependent increase in sub-RPE deposit height, we interrogated the potential of CFH as a previously unidentified regulator of Bruch’s membrane lipoprotein binding and show, using human Bruch’s membrane explants, that CFH removes endogenous human lipoproteins in aged donors. Thus, advanced age, high-fat diet, and decreased CFH induce sub-RPE deposit formation leading to complement activation, which contributes to RPE damage and visual function impairment. This new understanding of the complicated interactions of CFH in AMD-like pathology provides an improved foundation for the development of targeted therapies for AMD. PMID:25991857

  14. T cell subsets and immunoglobulin G levels are associated with the infection status of systemic lupus erythematosus patients

    PubMed Central

    Wu, Lifen; Wang, Xinru; Chen, Fenghua; Lv, Xing; Sun, Wenwen; Guo, Ying; Hou, Hou; Ji, Haiyan; Wei, Wei; Gong, Lu

    2017-01-01

    Systemic lupus erythematosus (SLE) is a chronic, autoimmune disorder that affects nearly all organs and tissues. As knowledge about the mechanism of SLE has increased, some immunosuppressive agents have become routinely used in clinical care, and infections have become one of the direct causes of mortality in SLE patients. To identify the risk factors indicative of infection in SLE patients, a case control study of our hospital's medical records between 2011 and 2013 was performed. We reviewed the records of 117 SLE patients with infection and 61 SLE patients without infection. Changes in the levels of T cell subsets, immunoglobulin G (IgG), complement C3, complement C4, globulin, and anti-double-stranded DNA (anti-ds-DNA) were detected. CD4+ and CD4+/CD8+ T cell levels were significantly lower and CD8+ T cell levels were significantly greater in SLE patients with infection than in SLE patients without infection. Additionally, the concentrations of IgG in SLE patients with infection were significantly lower than those in SLE patients without infection. However, complement C3, complement C4, globulin, and anti-ds-DNA levels were not significantly different in SLE patients with and without infection. Therefore, clinical testing for T cell subsets and IgG is potentially useful for identifying the presence of infection in SLE patients and for distinguishing a lupus flare from an acute infection. PMID:29267496

  15. A Polyamide Inhibits Replication of Vesicular Stomatitis Virus by Targeting RNA in the Nucleocapsid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gumpper, Ryan H.; Li, Weike; Castañeda, Carlos H.

    Polyamides have been shown to bind double-stranded DNA by complementing the curvature of the minor groove and forming various hydrogen bonds with DNA. Several polyamide molecules have been found to have potent antiviral activities against papillomavirus, a double-stranded DNA virus. By analogy, we reason that polyamides may also interact with the structured RNA bound in the nucleocapsid of a negative-strand RNA virus. Vesicular stomatitis virus (VSV) was selected as a prototype virus to test this possibility since its genomic RNA encapsidated in the nucleocapsid forms a structure resembling one strand of an A-form RNA duplex. One polyamide molecule, UMSL1011, wasmore » found to inhibit infection of VSV. To confirm that the polyamide targeted the nucleocapsid, a nucleocapsid-like particle (NLP) was incubated with UMSL1011. The encapsidated RNA in the polyamide-treated NLP was protected from thermo-release and digestion by RNase A. UMSL1011 also inhibits viral RNA synthesis in the intracellular activity assay for the viral RNA-dependent RNA polymerase. The crystal structure revealed that UMSL1011 binds the structured RNA in the nucleocapsid. The conclusion of our studies is that the RNA in the nucleocapsid is a viable antiviral target of polyamides. Since the RNA structure in the nucleocapsid is similar in all negative-strand RNA viruses, polyamides may be optimized to target the specific RNA genome of a negative-strand RNA virus, such as respiratory syncytial virus and Ebola virus. IMPORTANCENegative-strand RNA viruses (NSVs) include several life-threatening pathogens, such as rabies virus, respiratory syncytial virus, and Ebola virus. There are no effective antiviral drugs against these viruses. Polyamides offer an exceptional opportunity because they may be optimized to target each NSV. Our studies on vesicular stomatitis virus, an NSV, demonstrated that a polyamide molecule could specifically target the viral RNA in the nucleocapsid and inhibit viral growth. The target specificity of the polyamide molecule was proved by its inhibition of thermo-release and RNA nuclease digestion of the RNA bound in a model nucleocapsid, and a crystal structure of the polyamide inside the nucleocapsid. This encouraging observation provided the proof-of-concept rationale for designing polyamides as antiviral drugs against NSVs.« less

  16. A Polyamide Inhibits Replication of Vesicular Stomatitis Virus by Targeting RNA in the Nucleocapsid.

    PubMed

    Gumpper, Ryan H; Li, Weike; Castañeda, Carlos H; Scuderi, M José; Bashkin, James K; Luo, Ming

    2018-04-15

    Polyamides have been shown to bind double-stranded DNA by complementing the curvature of the minor groove and forming various hydrogen bonds with DNA. Several polyamide molecules have been found to have potent antiviral activities against papillomavirus, a double-stranded DNA virus. By analogy, we reason that polyamides may also interact with the structured RNA bound in the nucleocapsid of a negative-strand RNA virus. Vesicular stomatitis virus (VSV) was selected as a prototype virus to test this possibility since its genomic RNA encapsidated in the nucleocapsid forms a structure resembling one strand of an A-form RNA duplex. One polyamide molecule, UMSL1011, was found to inhibit infection of VSV. To confirm that the polyamide targeted the nucleocapsid, a nucleocapsid-like particle (NLP) was incubated with UMSL1011. The encapsidated RNA in the polyamide-treated NLP was protected from thermo-release and digestion by RNase A. UMSL1011 also inhibits viral RNA synthesis in the intracellular activity assay for the viral RNA-dependent RNA polymerase. The crystal structure revealed that UMSL1011 binds the structured RNA in the nucleocapsid. The conclusion of our studies is that the RNA in the nucleocapsid is a viable antiviral target of polyamides. Since the RNA structure in the nucleocapsid is similar in all negative-strand RNA viruses, polyamides may be optimized to target the specific RNA genome of a negative-strand RNA virus, such as respiratory syncytial virus and Ebola virus. IMPORTANCE Negative-strand RNA viruses (NSVs) include several life-threatening pathogens, such as rabies virus, respiratory syncytial virus, and Ebola virus. There are no effective antiviral drugs against these viruses. Polyamides offer an exceptional opportunity because they may be optimized to target each NSV. Our studies on vesicular stomatitis virus, an NSV, demonstrated that a polyamide molecule could specifically target the viral RNA in the nucleocapsid and inhibit viral growth. The target specificity of the polyamide molecule was proved by its inhibition of thermo-release and RNA nuclease digestion of the RNA bound in a model nucleocapsid, and a crystal structure of the polyamide inside the nucleocapsid. This encouraging observation provided the proof-of-concept rationale for designing polyamides as antiviral drugs against NSVs. Copyright © 2018 American Society for Microbiology.

  17. Long-term changes of bacterial and viral compositions in the intestine of a recovered Clostridium difficile patient after fecal microbiota transplantation.

    PubMed

    Broecker, Felix; Klumpp, Jochen; Schuppler, Markus; Russo, Giancarlo; Biedermann, Luc; Hombach, Michael; Rogler, Gerhard; Moelling, Karin

    2016-01-01

    Fecal microbiota transplantation (FMT) is an effective treatment for recurrent Clostridium difficile infections (RCDIs). However, long-term effects on the patients' gut microbiota and the role of viruses remain to be elucidated. Here, we characterized bacterial and viral microbiota in the feces of a cured RCDI patient at various time points until 4.5 yr post-FMT compared with the stool donor. Feces were subjected to DNA sequencing to characterize bacteria and double-stranded DNA (dsDNA) viruses including phages. The patient's microbial communities varied over time and showed little overall similarity to the donor until 7 mo post-FMT, indicating ongoing gut microbiota adaption in this time period. After 4.5 yr, the patient's bacteria attained donor-like compositions at phylum, class, and order levels with similar bacterial diversity. Differences in the bacterial communities between donor and patient after 4.5 yr were seen at lower taxonomic levels. C. difficile remained undetectable throughout the entire timespan. This demonstrated sustainable donor feces engraftment and verified long-term therapeutic success of FMT on the molecular level. Full engraftment apparently required longer than previously acknowledged, suggesting the implementation of year-long patient follow-up periods into clinical practice. The identified dsDNA viruses were mainly Caudovirales phages. Unexpectedly, sequences related to giant algae-infecting Chlorella viruses were also detected. Our findings indicate that intestinal viruses may be implicated in the establishment of gut microbiota. Therefore, virome analyses should be included in gut microbiota studies to determine the roles of phages and other viruses-such as Chlorella viruses-in human health and disease, particularly during RCDI.

  18. Molecular defects leading to human complement component C6 deficiency in an African-American family

    PubMed Central

    Zhu, Z-B; Totemchokchyakarn, K; Atkinson, T P; Volanakis, J E

    1998-01-01

    Complement component C6 deficiency (C6D) was diagnosed in a 16-year-old African-American male with meningococcal meningitis. The patient's father and two brothers also had C6D, but gave no history of meningitis or other neisserial infection. By using exon-specific polymerase chain reaction (PCR)/single-strand conformation polymorphism as a screening step and nucleotide sequencing of target exons, we determined that the proband was a compound heterozygote for two C6 gene mutations. The first, 1195delC located in exon 7, is a novel mutation, while the second, 1936delG in exon 12, has been described before to cause C6D in an unrelated African-American individual. Both mutations result in premature termination codons and C6 null alleles. Allele-specific PCR indicated that the proband's two brothers also inherited the 1195delC mutation from their heterozygous mother and the 1936delG mutation from their homozygous father. PMID:9472666

  19. DNA Repair: The Search for Homology.

    PubMed

    Haber, James E

    2018-05-01

    The repair of chromosomal double-strand breaks (DSBs) by homologous recombination is essential to maintain genome integrity. The key step in DSB repair is the RecA/Rad51-mediated process to match sequences at the broken end to homologous donor sequences that can be used as a template to repair the lesion. Here, in reviewing research about DSB repair, I consider the many factors that appear to play important roles in the successful search for homology by several homologous recombination mechanisms. See also the video abstract here: https://youtu.be/vm7-X5uIzS8. © 2018 WILEY Periodicals, Inc.

  20. Replication of poliovirus RNA and subgenomic RNA transcripts in transfected cells.

    PubMed Central

    Collis, P S; O'Donnell, B J; Barton, D J; Rogers, J A; Flanegan, J B

    1992-01-01

    Full-length and subgenomic poliovirus RNAs were transcribed in vitro and transfected into HeLa cells to study viral RNA replication in vivo. RNAs with deletion mutations were analyzed for the ability to replicate in either the absence or the presence of helper RNA by using a cotransfection procedure and Northern (RNA) blot analysis. An advantage of this approach was that viral RNA replication and genetic complementation could be characterized without first isolating conditional-lethal mutants. A subgenomic RNA with a large in-frame deletion in the capsid coding region (P1) replicated more efficiently than full-length viral RNA transcripts. In cotransfection experiments, both the full-length and subgenomic RNAs replicated at slightly reduced levels and appeared to interfere with each other's replication. In contrast, a subgenomic RNA with a similarly sized out-of-frame deletion in P1 did not replicate in transfected cells, either alone or in the presence of helper RNA. Similar results were observed with an RNA transcript containing a large in-frame deletion spanning the P1, P2, and P3 coding regions. A mutant RNA with an in-frame deletion in the P1-2A coding sequence was self-replicating but at a significantly reduced level. The replication of this RNA was fully complemented after cotransfection with a helper RNA that provided 2A in trans. A P1-2A-2B in-frame deletion, however, totally blocked RNA replication and was not complemented. Control experiments showed that all of the expected viral proteins were both synthesized and processed when the RNA transcripts were translated in vitro. Thus, our results indicated that 2A was a trans-acting protein and that 2B and perhaps other viral proteins were cis acting during poliovirus RNA replication in vivo. Our data support a model for poliovirus RNA replication which directly links the translation of a molecule of plus-strand RNA with the formation of a replication complex for minus-strand RNA synthesis. Images PMID:1328676

  1. Homologous recombination mediates S-phase-dependent radioresistance in cells deficient in DNA polymerase eta.

    PubMed

    Nicolay, Nils H; Carter, Rebecca; Hatch, Stephanie B; Schultz, Niklas; Prevo, Remko; McKenna, W Gillies; Helleday, Thomas; Sharma, Ricky A

    2012-11-01

    DNA polymerase eta (pol η) is the only DNA polymerase causally linked to carcinogenesis in humans. Inherited deficiency of pol η in the variant form of xeroderma pigmentosum (XPV) predisposes to UV-light-induced skin cancer. Pol η-deficient cells demonstrate increased sensitivity to cisplatin and oxaliplatin chemotherapy. We have found that XP30R0 fibroblasts derived from a patient with XPV are more resistant to cell kill by ionising radiation (IR) than the same cells complemented with wild-type pol η. This phenomenon has been confirmed in Burkitt's lymphoma cells, which either expressed wild-type pol η or harboured a pol η deletion. Pol η deficiency was associated with accumulation of cells in S-phase, which persisted after IR. Cells deficient in pol η demonstrated increased homologous recombination (HR)-directed repair of double strand breaks created by IR. Depletion of the HR protein, X-ray repair cross-complementing protein 3 (XRCC3), abrogated the radioresistance observed in pol η-deficient cells as compared with pol η-complemented cells. These findings suggest that HR mediates S-phase-dependent radioresistance associated with pol η deficiency. We propose that pol η protein levels in tumours may potentially be used to identify patients who require treatment with chemo-radiotherapy rather than radiotherapy alone for adequate tumour control.

  2. Role of Saccharomyces cerevisiae Msh2 and Msh3 repair proteins in double-strand break-induced recombination

    PubMed Central

    Sugawara, Neal; Pâques, Frédéric; Colaiácovo, Mónica; Haber, James E.

    1997-01-01

    When gene conversion is initiated by a double-strand break (DSB), any nonhomologous DNA that may be present at the ends must be removed before new DNA synthesis can be initiated. In Saccharomyces cerevisiae, removal of nonhomologous ends depends not only on the nucleotide excision repair endonuclease Rad1/Rad10 but also on Msh2 and Msh3, two proteins that are required to correct mismatched bp. These proteins have no effect when DSB ends are homologous to the donor, either in the kinetics of recombination or in the proportion of gene conversions associated with crossing-over. A second DSB repair pathway, single-strand annealing also requires Rad1/Rad10 and Msh2/Msh3, but reveals a difference in their roles. When the flanking homologous regions that anneal are 205 bp, the requirement for Msh2/Msh3 is as great as for Rad1/Rad10; but when the annealing partners are 1,170 bp, Msh2/Msh3 have little effect, while Rad1/Rad10 are still required. Mismatch repair proteins Msh6, Pms1, and Mlh1 are not required. We suggest Msh2 and Msh3 recognize not only heteroduplex loops and mismatched bp, but also branched DNA structures with a free 3′ tail. PMID:9256462

  3. Morphological Alterations Within the Peripheral Fixation of the Iris Dilator Muscle in Eyes With Pigmentary Glaucoma

    PubMed Central

    Flügel-Koch, Cassandra M.; Tektas, Ozan Y.; Kaufman, Paul L.; Paulsen, Friedrich P.; Lütjen-Drecoll, Elke

    2014-01-01

    Purpose. To analyze the peripheral fixation of the iris dilator muscle in normal eyes and in eyes with pigmentary glaucoma (PG). Methods. Using 63 control eyes (age 18 months–99 years), the peripheral iris dilator was investigated by light microscopy, immunohistochemistry, and electron microscopy. Development was studied using 18 differently aged fetal eyes stained immunohistochemically against α-smooth muscle (SM) actin. The peripheral iris dilator muscle in PG was analyzed using semithin and ultrathin sections of six glutaraldehyde-fixed eyes from three donors aged 38, 62, and 74 years. Results. In normal eyes, the peripheral end of the iris dilator muscle is arranged in a sphincter-like manner. Arcade-shaped tendinous connections associated with myofibroblasts (iridial strands) anchor the iris dilator within the elastic–fibromuscular ciliary meshwork that also serves as fixation area for the elastic tendons of the inner ciliary muscle portions. The iridial strands are innervated and can adapt their length during accommodation. The PG eyes show incomplete circular bundles and iridial strands that are mainly anchored to the iris stroma and the flexible uveal parts of the trabecular meshwork. Conclusions. The normal anchorage of the peripheral iris dilator and its presumably neuronally regulated length adaptation stabilize the peripheral iris during accommodation. Insufficient fixation in PG could promote posterior bowing of the iris with rubbing against the zonular fibers and pigment liberation from the iris pigmented epithelium. PMID:24938519

  4. Development and Use of a Serum Bactericidal Assay Using Pooled Human Complement To Assess Responses to a Meningococcal Group A Conjugate Vaccine in African Toddlers

    PubMed Central

    Lynn, Freyja; Mocca, Brian; Borrow, Ray; Findlow, Helen; Hassan-King, Musa; Preziosi, Marie-Pierre; Idoko, Olubukola; Sow, Samba; Kulkarni, Prasad; LaForce, F. Marc

    2014-01-01

    A meningococcal group A polysaccharide (PS) conjugate vaccine (PsA-TT) has been developed for African countries affected by epidemic meningitis caused by Neisseria meningitidis. Complement-mediated serum bactericidal antibody (SBA) assays are used to assess protective immune responses to meningococcal vaccination. Human complement (hC′) was used in early studies demonstrating antibody-mediated protection against disease, but it is difficult to obtain and standardize. We developed and evaluated a method for sourcing hC′ and then used the SBA assay with hC′ (hSBA) to measure bactericidal responses to PsA-TT vaccination in 12- to 23-month-old African children. Sera with active complement from 100 unvaccinated blood donors were tested for intrinsic bactericidal activity, SBA titer using rabbit complement (rSBA), and anti-group A PS antibody concentration. Performance criteria and pooling strategies were examined and then verified by comparisons of three independently prepared hC′ lots in two laboratories. hSBA titers of clinical trial sera were then determined using this complement sourcing method. Two different functional antibody tests were necessary for screening hC′. hSBA titers determined using three independent lots of pooled hC′ were within expected assay variation among lots and between laboratories. In African toddlers, PsA-TT elicited higher hSBA titers than meningococcal polysaccharide or Hib vaccines. PsA-TT immunization or PS challenge of PsA-TT-primed subjects resulted in vigorous hSBA memory responses, and titers persisted in boosted groups for over a year. Quantifying SBA using pooled hC′ is feasible and showed that PsA-TT was highly immunogenic in African toddlers. PMID:24671551

  5. Entrepreneurial ventures and whole-body donations: a regional perspective from the United States.

    PubMed

    Anteby, Michel; Hyman, Mikell

    2008-02-01

    Human cadavers are crucial to medical science. While the debate on how to secure sufficient cadavers has focused primarily on donors' behaviors, procuring organizations' roles in increasing donations remain less explored. The United States offers a unique setting in which to examine this question since entrepreneurial ventures supplying cadavers for medical science have recently emerged alongside traditional academic-housed programs, raising both hopes and fears about their impact on whole-body donations. To assess their potential impact, an archival survey of voluntary, in-state whole-body donors to two programs procuring in the same U.S. state was conducted. The programs' specimen recipients were also analyzed. One program is academic-housed and the other is an entrepreneurial venture. Both offered equal levels of financial support to donating parties. Eighty donations and 120 specimen shipping invoices from 2005 were analyzed in each program. Donations to the two programs did not significantly differ in terms of donors' sex, marital status, maximum educational level, and estimated hourly wage. The entrepreneurial venture's donors were, however, significantly younger, more likely to be from a minority group, and more likely to have died from cancer. For-profit organizations, continuing medical training organizations, and medical device companies were more likely recipients of the entrepreneurial venture's specimens. Non-profit and academic organizations were more likely recipients of the academic-housed program's specimens. These findings suggest that although the programs procured from a somewhat similar pool of donors, they also complemented one another. The entrepreneurial program procured donations that the academic-housed program often did not attract. Specimen recipients' distinct demands partly explain these procurement behaviors. Thus, organizational efforts to meet demands seem to shape the supply. Examining organizations alongside donors might provide new answers to secure donations.

  6. [Alanine aminotransferase (ALAT, GPT): a reevaluation of exclusion limits for blood donors].

    PubMed

    Grunenberg, R; Banik, N; Krüger, J

    1995-06-01

    The screening policy of alanine aminotransferase (ALT) testing in blood donors was reassessed. The cutoff value for ALT levels according to German guidelines has always been controversial. In this study the activity and distribution of ALT in a blood donor population were reevaluated and new exclusion levels were defined. 5,706 blood donors were tested for ALT activities with the Reflotron system at 37 degrees C. Donors with ALT levels > 51 IU/l were deferred, a detailed physical examination and additional serologic and biochemical testing were done. ALT values of blood donors were transformed in logarithmic values in order to get a Gaussian distribution. The mean transformed value +/- SD was calculated with 1.24 +/- 0.14 for females and with 1.35 +/- 0.16 for males, corresponding to mean values of ALT activity of 17.6 and 22.5 IU/l, respectively. Exclusion levels of > 33.4 IU/l for female and > 46.7 IU/l for male blood donors (geometric mean +2.0 SD) predict a loss of donations of 2.8 and 2.7%, respectively, cutoff values of > 39.1 or > 56.1 IU/l (geometric mean +2.5 SD) a loss of 1.8 and 1.4%, respectively. The most likely causes of elevated ALT levels in 166 of our donors included daily alcohol use (82), infections with/without antibiotic medication (29), therapy with hepatotoxic drugs (8), strenuous exercises (5), bodybuilding complemented by anabolic steroids (2), acute infections with HCV (1), HBV (1) and CMV (1), alcohol/drug abuse and detection of HCV antibodies (1). ALT screening is still considered a useful indicator of risk donors despite its nonspecificity and limited predictive value. The selection of the appropriate cutoff value has always been disputed. The present exclusion level of > 45 IU/l (25 degrees C), analogous to > 81.8 IU/l (37 degrees C), does not even take into account such a variable as sex. The cutoff value above 4.5 SD of the geometric mean for females and above 3.5 SD for males seems to be of limited medical and practical value.

  7. Role of the disulfide bond in stabilizing and folding of the fimbrial protein DraE from uropathogenic Escherichia coli

    PubMed Central

    Pilipczuk, Justyna; Zalewska-Piątek, Beata; Bruździak, Piotr; Czub, Jacek; Wieczór, Miłosz; Olszewski, Marcin; Wanarska, Marta; Nowicki, Bogdan; Augustin-Nowacka, Danuta; Piątek, Rafał

    2017-01-01

    Dr fimbriae are homopolymeric adhesive organelles of uropathogenic Escherichia coli composed of DraE subunits, responsible for the attachment to host cells. These structures are characterized by enormously high stability resulting from the structural properties of an Ig-like fold of DraE. One feature of DraE and other fimbrial subunits that makes them peculiar among Ig-like domain-containing proteins is a conserved disulfide bond that joins their A and B strands. Here, we investigated how this disulfide bond affects the stability and folding/unfolding pathway of DraE. We found that the disulfide bond stabilizes self-complemented DraE (DraE-sc) by ∼50 kJ mol−1 in an exclusively thermodynamic manner, i.e. by lowering the free energy of the native state and with almost no effect on the free energy of the transition state. This finding was confirmed by experimentally determined folding and unfolding rate constants of DraE-sc and a disulfide bond-lacking DraE-sc variant. Although the folding of both proteins exhibited similar kinetics, the unfolding rate constant changed upon deletion of the disulfide bond by 10 orders of magnitude, from ∼10−17 s−1 to 10−7 s−1. Molecular simulations revealed that unfolding of the disulfide bond-lacking variant is initiated by strands A or G and that disulfide bond-mediated joining of strand A to the core strand B cooperatively stabilizes the whole protein. We also show that the disulfide bond in DraE is recognized by the DraB chaperone, indicating a mechanism that precludes the incorporation of less stable, non-oxidized DraE forms into the fimbriae. PMID:28739804

  8. Bloom DNA Helicase Facilitates Homologous Recombination between Diverged Homologous Sequences*

    PubMed Central

    Kikuchi, Koji; Abdel-Aziz, H. Ismail; Taniguchi, Yoshihito; Yamazoe, Mitsuyoshi; Takeda, Shunichi; Hirota, Kouji

    2009-01-01

    Bloom syndrome caused by inactivation of the Bloom DNA helicase (Blm) is characterized by increases in the level of sister chromatid exchange, homologous recombination (HR) associated with cross-over. It is therefore believed that Blm works as an anti-recombinase. Meanwhile, in Drosophila, DmBlm is required specifically to promote the synthesis-dependent strand anneal (SDSA), a type of HR not associating with cross-over. However, conservation of Blm function in SDSA through higher eukaryotes has been a matter of debate. Here, we demonstrate the function of Blm in SDSA type HR in chicken DT40 B lymphocyte line, where Ig gene conversion diversifies the immunoglobulin V gene through intragenic HR between diverged homologous segments. This reaction is initiated by the activation-induced cytidine deaminase enzyme-mediated uracil formation at the V gene, which in turn converts into abasic site, presumably leading to a single strand gap. Ig gene conversion frequency was drastically reduced in BLM−/− cells. In addition, BLM−/− cells used limited donor segments harboring higher identity compared with other segments in Ig gene conversion event, suggesting that Blm can promote HR between diverged sequences. To further understand the role of Blm in HR between diverged homologous sequences, we measured the frequency of gene targeting induced by an I-SceI-endonuclease-mediated double-strand break. BLM−/− cells showed a severer defect in the gene targeting frequency as the number of heterologous sequences increased at the double-strand break site. Conversely, the overexpression of Blm, even an ATPase-defective mutant, strongly stimulated gene targeting. In summary, Blm promotes HR between diverged sequences through a novel ATPase-independent mechanism. PMID:19661064

  9. Enlightenment of Yeast Mitochondrial Homoplasmy: Diversified Roles of Gene Conversion

    PubMed Central

    Ling, Feng; Mikawa, Tsutomu; Shibata, Takehiko

    2011-01-01

    Mitochondria have their own genomic DNA. Unlike the nuclear genome, each cell contains hundreds to thousands of copies of mitochondrial DNA (mtDNA). The copies of mtDNA tend to have heterogeneous sequences, due to the high frequency of mutagenesis, but are quickly homogenized within a cell (“homoplasmy”) during vegetative cell growth or through a few sexual generations. Heteroplasmy is strongly associated with mitochondrial diseases, diabetes and aging. Recent studies revealed that the yeast cell has the machinery to homogenize mtDNA, using a common DNA processing pathway with gene conversion; i.e., both genetic events are initiated by a double-stranded break, which is processed into 3′ single-stranded tails. One of the tails is base-paired with the complementary sequence of the recipient double-stranded DNA to form a D-loop (homologous pairing), in which repair DNA synthesis is initiated to restore the sequence lost by the breakage. Gene conversion generates sequence diversity, depending on the divergence between the donor and recipient sequences, especially when it occurs among a number of copies of a DNA sequence family with some sequence variations, such as in immunoglobulin diversification in chicken. MtDNA can be regarded as a sequence family, in which the members tend to be diversified by a high frequency of spontaneous mutagenesis. Thus, it would be interesting to determine why and how double-stranded breakage and D-loop formation induce sequence homogenization in mitochondria and sequence diversification in nuclear DNA. We will review the mechanisms and roles of mtDNA homoplasmy, in contrast to nuclear gene conversion, which diversifies gene and genome sequences, to provide clues toward understanding how the common DNA processing pathway results in such divergent outcomes. PMID:24710143

  10. High sensitive detection of double-stranded DNA autoantibodies by a modified Crithidia luciliae immunofluorescence test.

    PubMed

    Conrad, Karsten; Ittenson, Annelore; Reinhold, Dirk; Fischer, Richard; Roggenbuck, Dirk; Büttner, Thomas; Bosselmann, Hans-Peter; Steinbach, Jörg; Schössler, Werner

    2009-09-01

    Anti-double-stranded (ds)DNA antibodies are serological markers of systemic lupus erythematosus (SLE). Of all anti-dsDNA antibody detection methods, the Crithidia luciliae immunofluorescence test (CLIFT) is thought to have the highest specificity for SLE. However, the clinical application is hampered by the low diagnostic sensitivity. A CLIFT with modified assay buffer (mCLIFT) was developed and compared with conventional CLIFT, using sera from 110 patients with SLE, 89 anti-dsDNA ELISA-positive patients with other diseases (non-SLE group A), 157 non-SLE patients with undetectable anti-dsDNA antibodies by ELISA (non-SLE group B), 77 disease controls (non-SLE group C), and 50 healthy blood donors. Out of the 110 anti-dsDNA antibody ELISA-positive SLE patients, 84 (76.4%) demonstrated a positive kinetoplast staining, using the mCLIFT, compared to only 42.3%, using the conventional CLIFT. The diagnostic specificity of mCLIFT was 100% with healthy blood donors and 98.1% with the non-SLE group C (anti-nuclear antibodies negative; no signs or symptoms of an autoimmune disease) included. In the non-SLE groups A and B with various other autoimmune diseases or symptoms of a possible autoimmune disease, positive mCLIFT results were obtained in 33.7% and 3.2%, respectively. In conclusion, by modification of the assay buffer, a significant increase in sensitivity of the CLIFT could be observed while retaining the high specificity for SLE. Further investigation is required to check whether the CLIFT-positive non-SLE patients develop SLE and whether anti-dsDNA antibodies detected by the mCLIFT represent a pathogenetic and diagnostic subgroup of autoantibodies that may improve the early diagnosis of SLE or SLE-overlap syndromes.

  11. A novel high-throughput format assay for HIV-1 integrase strand transfer reaction using magnetic beads.

    PubMed

    He, Hong-qiu; Ma, Xiao-hui; Liu, Bin; Chen, Wei-zu; Wang, Cun-xin; Cheng, Shao-hui

    2008-03-01

    To develop a novel high-throughput format assay to monitor the integrase (IN) strand transfer (ST) reaction in vitro and apply it to a reaction character study and the identification of antiviral drugs. The donor DNA duplex, with a sequence identical to the U5 end of HIV-1 long terminal repeats, is labeled at its 5' end with biotin (BIO). The target DNA duplex is labeled at its 3' end with digoxin (DIG). IN mediates the integration of donor DNA into target DNA and results in a 5' BIO and 3' DIG-labeled duplex DNA product. Streptavidin-coated magnetic beads were used to capture the product, and the amount of DIG was measured as the ST reaction product. The assay was optimized in 96-well microplate format for high-throughput screening purpose. Moreover, the assay was applied in a ST reaction character study, and the efficiency of the assay in the identification of antiviral compounds was tested. The end-point values, measured as absorbance at 405 nm was approximately 1.5 for the IN-mediated ST reaction as compared with no more than 0.05 of background readings. The ST reaction character and the half maximal inhibitory concentration (IC50) values of 2 known IN inhibitors obtained in our assay were similar to previously reported results using other assays. The evaluation parameter Z' factor for this assay ranged from 0.6 to 0.9. The assay presented here has been proven to be rapid, sensitive, and specific for the detection of IN ST activity, the reaction character study, as well as for the identification of antiviral drugs targeting IN.

  12. Role of Double-Strand Break End-Tethering during Gene Conversion in Saccharomyces cerevisiae

    PubMed Central

    Haber, James E.

    2016-01-01

    Correct repair of DNA double-strand breaks (DSBs) is critical for maintaining genome stability. Whereas gene conversion (GC)-mediated repair is mostly error-free, repair by break-induced replication (BIR) is associated with non-reciprocal translocations and loss of heterozygosity. We have previously shown that a Recombination Execution Checkpoint (REC) mediates this competition by preventing the BIR pathway from acting on DSBs that can be repaired by GC. Here, we asked if the REC can also determine whether the ends that are engaged in a GC-compatible configuration belong to the same break, since repair involving ends from different breaks will produce potentially deleterious translocations. We report that the kinetics of repair are markedly delayed when the two DSB ends that participate in GC belong to different DSBs (termed Trans) compared to the case when both DSB ends come from the same break (Cis). However, repair in Trans still occurs by GC rather than BIR, and the overall efficiency of repair is comparable. Hence, the REC is not sensitive to the “origin” of the DSB ends. When the homologous ends for GC are in Trans, the delay in repair appears to reflect their tethering to sequences on the other side of the DSB that themselves recombine with other genomic locations with which they share sequence homology. These data support previous observations that the two ends of a DSB are usually tethered to each other and that this tethering facilitates both ends encountering the same donor sequence. We also found that the presence of homeologous/repetitive sequences in the vicinity of a DSB can distract the DSB end from finding its bona fide homologous donor, and that inhibition of GC by such homeologous sequences is markedly increased upon deleting Sgs1 but not Msh6. PMID:27074148

  13. Evaluation of sperm DNA quality in men presenting with testicular cancer and lymphoma using alkaline and neutral Comet assays.

    PubMed

    Kumar, K; Lewis, S; Vinci, S; Riera-Escamilla, A; Fino, M-G; Tamburrino, L; Muratori, M; Larsen, P; Krausz, C

    2018-01-01

    Despite more cancers in young men over the past two decades, improvements in therapies give a greater chance to live full lives following treatment. Sperm genomic quality is variable following cancer diagnosis, so its assessment is important if sperm cryopreservation is being considered. Here, we evaluated DNA damage using two DNA damage assays: an alkaline and for the first time, a neutral Comet assays in men presenting with testicular cancer (n = 19 for alkaline and 13 for neutral group) and lymphoma (n = 13 for alkaline and 09 for neutral group) compared with fertile donors (n = 20 for alkaline and 14 for neutral group). No significant differences were observed in any semen analysis parameters. In contrast, sperm DNA damage was higher in men with testicular cancer than in donors as assessed by both the alkaline (12.4% vs. 37.4%, p < 0.001) and neutral (7.5% vs. 13.4%; p < 0.05) Comet assays. Similar trends were observed in men with lymphoma. Here, sperm DNA damage was higher using both the alkaline (35.0% vs. 12.4%) and neutral (10.7% against 7.5% (p < 0.05) Comet assays. Moreover, the DNA strand breaks (particularly double-strand breaks) were significantly more prominent in men with cancer having abnormal seminal parameters than normozoospermic ones. This study showed that sperm DNA testing using alkaline and neutral Comet assays is more sensitive than semen analysis in detecting impaired sperm quality in men presenting with cancer. It may provide a useful adjunct when considering storage prior to cancer investigations and assisted reproductive techniques (ART)-based treatment. © 2017 American Society of Andrology and European Academy of Andrology.

  14. [Structural Damage to the Hamstring Graft due to Interaction with Fixation Material and its Effect on Biomechanical Properties of ACL Reconstruction].

    PubMed

    Kautzner, J; Držík, M; Handl, M; Povýšil, C; Kos, P; Trč, T; Havlas, V

    2017-01-01

    PURPOSE OF THE STUDY Hamstring grafts are commonly used for ACL reconstruction. The purpose of our study is to determine the effects of the suspension fixation compared to graft cross-pinning transfixation, and the effect(s) of structural damage during the preparation of the graft on biomechanical properties of the graft. MATERIAL AND METHODS The design of the study is a cadaveric biomechanical laboratory study. 38 fresh-frozen human hamstring specimens from 19 cadaveric donors were used. The grafts were tested for their loading properties. One half of each specimen was suspended over a 3.3mm pin, the other half was cross-pinned by a 3.3mm pin to simulate the graft cross-pinning technique. Single impact testing was performed and the failure force, elongation and acceleration/deceleration of each graft was recorded and the loading force vs. elongation of the graft specimens was calculated. Results for suspended and cross-pinned grafts were analysed using ANOVA method, comparing the grafts from each donor. RESULTS The ultimate strength of a double-strand gracilis graft was 1287 ± 134 N when suspended over a pin, the strength of a cross-pinned graft was 833 ± 111 N. For double-strand semitendinosus grafts the strengths were 1883 ± 198 and 997 ± 234 N, respectively. Thus, the failure load for the cross-pinning method is only 64.7% or 52.9% for the suspension method. DISCUSSION Structural damage to the graft significantly reduces the graft strength. Also, extensive suturing during preparation of the graft reduces its strength. CONCLUSIONS Fixation methods that do not interfere with the graft's structure should be used to reduce the risk of graft failure. Key words: ACL reconstruction, hamstring graft, biomechanical testing.

  15. Field emission analysis of band bending in donor/acceptor heterojunction

    NASA Astrophysics Data System (ADS)

    Xing, Yingjie; Li, Shuai; Wang, Guiwei; Zhao, Tianjiao; Zhang, Gengmin

    2016-06-01

    The donor/acceptor heterojunction plays an important role in organic solar cells. An investigation of band bending in the donor/acceptor heterojunction is helpful in analysis of the charge transport behavior and for the improvement of the device performance. In this work, we report an approach for detection of band bending in a donor/acceptor heterojunction that has been prepared on a small and sharp tungsten tip. In situ field emission measurements are performed after the deposition process, and a linear Fowler-Nordheim plot is obtained from the fresh organic film surface. The thickness-dependent work function is then measured in the layer-by-layer deposited heterojunction. Several different types of heterojunction (zinc phthalocyanine (ZnPc)/C60, copper phthalocyanine (CuPc)/3,4,9,10-perylenetetracarboxylic bisbenzimidazole, and CuPc/C60) are fabricated and analyzed. The different charge transfer directions in the heterojunctions are distinguished by field emission measurements. The calculation method used to determine the band bending is then discussed in detail. A triple layer heterojunction (C60/ZnPc/CuPc) is also analyzed using this method. A small amount of band bending is measured in the outer CuPc layer. This method provides an independent reference method for determination of the band bending in an organic heterojunction that will complement photoemission spectroscopy and current-voltage measurement methods.

  16. The perfect storm: HLA antibodies, complement, FcγRs, and endothelium in transplant rejection.

    PubMed

    Thomas, Kimberly A; Valenzuela, Nicole M; Reed, Elaine F

    2015-05-01

    The pathophysiology of antibody-mediated rejection (AMR) in solid organ transplants is multifaceted and predominantly caused by antibodies directed against polymorphic donor human leukocyte antigens (HLAs). Despite the clearly detrimental impact of HLA antibodies (HLA-Abs) on graft function and survival, the prevention, diagnosis, and treatment of AMR remain a challenge. The histological manifestations of AMR reflect the signatures of HLA-Ab-triggered injury, specifically endothelial changes, recipient leukocytic infiltrate, and complement deposition. We review the interconnected mechanisms of HLA-Ab-mediated injury that might synergize in a 'perfect storm' of inflammation. Characterization of antibody features that are critical for effector functions may help to identify HLA-Abs that are more likely to cause rejection. We also highlight recent advances that may pave the way for new, more effective therapies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Crystal structure of the N-terminal domain of the secretin GspD from ETEC determined with the assistance of a nanobody

    PubMed Central

    Korotkov, Konstantin V.; Pardon, Els

    2009-01-01

    Summary Secretins are among the largest bacterial outer membrane proteins known. Here we report the crystal structure of the periplasmic N-terminal domain of GspD (peri-GspD) from the type 2 secretion system (T2SS) secretin in complex with a “nanobody”, the VHH domain of a “heavy-chain” camelid antibody. Two different crystal forms contained the same compact peri-GspD:nanobody heterotetramer. The nanobody contacts peri-GspD mainly via CDR3 and framework residues. The peri-GspD structure reveals three subdomains with the second and third subdomains exhibiting the KH-fold which also occurs in ring-forming proteins of the type 3 secretion system. The first subdomain of GspD is related to domains in phage tail proteins and outer membrane TonB-dependent receptors. A dodecameric peri-GspD model is proposed in which a solvent-accessible β-strand of the first subdomain interacts with secreted proteins and/or T2SS partner proteins by β-strand complementation. PMID:19217396

  18. Pretransplantation fetal-maternal microchimerism in pediatric liver transplantation from mother

    PubMed Central

    Yi, Nam-Joon; Park, Min-Su; Song, Eun Young; Ahn, Hye Young; Byun, Jeik; Kim, Hyeyoung; Hong, Suk Kyun; Yoon, Kyungchul; Kim, Hyo-Sin; Ahn, Sung-Woo; Lee, Hae Won; Choi, YoungRok; Lee, Kwang-Woong; Suh, Kyung-Suk; Park, Myoung Hee

    2017-01-01

    AIM To investigate the rates of pretransplantation fetal-maternal microchimerism (MC) and its effect on rejection in children receiving maternal liver grafts. METHODS DNA or blood samples before liver transplantation (LT) were available in 45 pediatric patients and their mothers. The presence of pretransplantation MC to non-inherited maternal antigens (NIMAs) (NIMA-MC) in the peripheral blood was tested using nested PCR-single-strand conformation polymorphism analysis for the human leukocyte antigen (HLA)-DRB1 alleles. NIMA-MC was successfully evaluated in 26 of the 45 children. Among these 45 pediatric LT recipients, 23 children (51.1%) received transplants from maternal donors and the other 22 from non-maternal donors. RESULTS Among these 26 children, pretransplantation NIMA-MC was detected in 23.1% (n = 6), 6.1 (range, 0.8-14) years after birth. Among the children with a maternal donor, the rate of biopsy-proven cellular rejection (BPCR) was 0% in patients with NIMA-MC positivity (0/3) and those with HLA-DR identity with the mother (0/4), but it was 50% in those with NIMA-MC negativity (5/10). Patients with NIMA-MC positivity or HLA-DR identity with the mother showed significantly lower BPCR rate compared with NIMA-MC-negative patients (0% vs 50%, P = 0.04). NIMA-MC-positive patients tended to show lower BPCR rate compared with NIMA-MC-negative patients (P = 0.23). CONCLUSION The presence of pretransplantation NIMA-MC or HLA-DR identity with the mother could be associated with BPCR-free survival in pediatric recipients of LT from maternal donors. PMID:29259377

  19. Antimicrobial properties of single-donor-derived, platelet-leukocyte fibrin for fistula occlusion: An in vitro study.

    PubMed

    Wu, Xiuwen; Ren, Jianan; Yuan, Yujie; Luan, Jianfeng; Yao, Genhong; Li, Jieshou

    2013-01-01

    Fibrin glue is a promising alternative for low-output enterocutaneous fistula closure. Bacterial flora colonizing inside the fistula tract, however, may limit the glue application. Single-donor-derived, platelet-rich materials were hypothesized in this study to have antimicrobial activity against Gram-negative microorganisms. Platelet-leukocyte fibrin (PLF), platelet-rich plasma (PRP), and platelet-poor plasma (PPP) were obtained from healthy volunteers. The amounts of platelet, leukocyte, and complement/antibody were determined. In vitro laboratory susceptibility to PLF and plasmas was determined by the Kirby-Bauer disc-diffusion method. Antimicrobial activity of PLF, PRP, and PPP against three Gram-negative ATCC strains was determined in a bacterial kill assay. Levels of complement and antibody did not significantly differ among PLF, PRP, and PPP (p > 0.05), while platelet and leukocyte counts in platelet-rich biomaterials were significantly higher than those in PPP (p < 0.001). The bactericidal effects produced by PLF and PRP were more pronounced than those by PPP in both qualitative and quantitative aspects. No inhibitory zones against three Gram-negative organisms were observed in the Bioseal®. In conclusion, our homemade PLF, as compared with commercial products, had remarkable antimicrobial activity against Gram-negative bacteria relevant to fistula colonization. The presence of platelets and leukocytes may play an important role in bacterial defense. This is the first study to demonstrate the antibacterial properties of single-unit PLF for fistula closure, presenting a new opportunity for glue sealing.

  20. The expression of Fc and complement receptors in young, adult and aged mice.

    PubMed Central

    Vĕtvicka, V; Fornůsek, L; Zídková, J

    1985-01-01

    Age-dependent changes in the expression of Fc receptors (FcR) for different isotypes of immunoglobulins and receptors for C3b, C5b and C3bi fragments of complement on the membranes of peritoneal macrophages were studied with mice of different ages. An age-related increase in expression of Fc receptors for IgM, IgE, IgA, IgG2b and IgG3, and a decrease in the expression of Fc receptors for IgG1 was observed. The expression of FcR on macrophages of donors of different ages corresponded with Fc-receptor mediated phagocytosis. The highest number of C3b-binding macrophages was found in aged mice, in contrast to low numbers of C3bi-binding macrophages at this age. The percentage of C5b-binding macrophages was lowest in adult animals. We also observed effective inhibition of binding of the C3b component of complement by preincubation of macrophages with aggregated IgG and vice versa. These observations suggest that fluctuation in expression of Fc but not C receptors may be important to the generalized changes that occur in macrophage function during development and ageing. PMID:2931351

  1. Genetic studies on a nitrogen-fixing cyanobacterium. [Anabaena; Escherichi coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wolk, C.P.; Cardemil, L.; Elhai, J.

    1987-04-01

    Mutants of Anabaena PCC7120 capable of aerobic growth with NO/sub 3//sup -/ but not N/sub 2/, and capable of microaerobic reduction of C/sub 2/H/sub 2/, were isolated by penicillin enrichment after UV irradiation. Heterocysts of two mutants lack the principal envelope glycolipid, those of EF116 have a non-cohesive envelope polysaccharide, and those of other strains have other defects. A Nm/sup r/ cosmid library of DNA from wild type Anabaena PCC7120 was established in Escherichia coli bearing the Ap helper plasmid pDS4101. A conjugative plasmid was introduced, and the bacteria replicated to lawns of individual mutant strains of Anabaena. After onemore » day of non-selective growth, selection was applied for Nm/sup r/ and nitrogen fixation. Overlapping cosmids complementing EF116 and one complementing another mutant have been mapped. The complementing genes are thought to act early in differentiation. Inclusion, in an E. coli donor of an appropriate methylase gene enhanced, by a factor of 10/sup 2/ to 10/sup 3/, transfer to Anabaena PCC7120 of a plasmid containing numerous sites for the Anabaena restriction endonuclease, AvaII.« less

  2. Autoimmune oophoritis in thymectomized mice: T cell requirement in adoptive cell transfer.

    PubMed Central

    Taguchi, O; Nishizuka, Y

    1980-01-01

    Experimental autoimmune oophoritis characterized by rapid loss of oocytes with infiltration of lymphocytes and circulating anti-oocyte antibodies could be induced in (C57Bl/6Cr x A/JCr)F1 mice after thymectomy (Tx) at a critical age of 3 days (Tx-3) but not 0. or 7 days after birth without any sensitization. The lesion of the ovary was passively transferred into neonatal, but not adult, mice 7 days after intraperitoneal (i.p.) injection of spleen cells (10(7)) obtained from syngeneic donors with oophoritis. In contrast, the lesion was never evoked in the recipient ovaries when spleen cells were prepared from Tx-3 mice ovariectomized at day 0. The spleen cells prepared from Tx-3 donors, depleted of T cells by incubation with anti-Thy 1.2 antiserum plus guinea-pig complement (GPC), showed no transfer capacity. However, the spleen cells prepared from the same donors, depleted of B cells with anti-Ig antiserum plus GPC, still kept the capacity to induce oophoritis. The results indicate the presence of autoreactive T cells against ovarian tissues in Tx-3 mice which are capable of inducing oophoritis. Images Fig. 1 Fig. 2 Fig. 3 PMID:6970639

  3. [Immunologic and transplantation biology studies in patients with terminal renal failure].

    PubMed

    Lanzer, G

    1985-01-01

    Best possible tissue compatibility is a fundamental precondition for a successful organ transplantation. The desirable tissue compatibility is mainly defined by transplantation-antigens of the donor and the recipient and therefore--beside ABO antigens--the characteristics of HLA-system are the focal point of the preoperative immunological diagnosis. Based on the results of comperative examinations it is demonstrated, that HLA-antisera have such a widespread biological variability, that they lead sometimes to a faulty diagnosis which in turn causes the biological importance of the HLA-system to be doubted. The preoperative immunologic diagnosis should include an estimation of the risk factors in the patient. The consideration of the crossmatch between donor and recipient is a decisive factor in organ transplantation. The starting point is the preoperative antibody monitoring which checks the patients serum reactions against a panel of blood donors to see, whether the patient is a "high" or "low"-- responder to allogenetic stimuli. A positive reaction in the crossmatch is brought about by different kinds of antibodies whereby only in the presence of auto-antibody or cold-reactive B-cell antibody a transplantation may take place. The antibody characterisation in preoperative diagnosis is supported by the results of the immunologic antibody monitoring, whereby--because of the results here presented-- it can be confirmed, that through the knowledge of the antibody specifities which have been checked in a positive crossmatch transplantation on highly sensitized patients can take place with a prospect of success. Supplementing the "Eurotransplant" results the HLA-DRw6 antigen is shown not only to be an indication of risk in transplantation, but may also be an aetiopathogenetic factor. In the presentated statistics it can be shown, that in patients suffering from glomerulonephritis or pyelonephritis and requiring dialysis treatment the HLA - DRw6 antigen occur more frequently than in the control group of healthy blood donors. In glomerulonephritis patients there is additionally a significant change in distribution favourable to HLA - DRw10 shown. The determination of genetically caused risk factors is appreciably supported by characterisation of lymphocyte subpopulations and diagnosis of changes in the Complement-system. Changes in T-lymphocyte subpopulations pointing to proceedings of immunostimulation and conditions of the activated Complement-system represent warning signals in organ transplantation.

  4. Molecular cloning of MSSP-2, a c-myc gene single-strand binding protein: characterization of binding specificity and DNA replication activity.

    PubMed Central

    Takai, T; Nishita, Y; Iguchi-Ariga, S M; Ariga, H

    1994-01-01

    We have previously reported the human cDNA encoding MSSP-1, a sequence-specific double- and single-stranded DNA binding protein [Negishi, Nishita, Saëgusa, Kakizaki, Galli, Kihara, Tamai, Miyajima, Iguchi-Ariga and Ariga (1994) Oncogene, 9, 1133-1143]. MSSP-1 binds to a DNA replication origin/transcriptional enhancer of the human c-myc gene and has turned out to be identical with Scr2, a human protein which complements the defect of cdc2 kinase in S.pombe [Kataoka and Nojima (1994) Nucleic Acid Res., 22, 2687-2693]. We have cloned the cDNA for MSSP-2, another member of the MSSP family of proteins. The MSSP-2 cDNA shares highly homologous sequences with MSSP-1 cDNA, except for the insertion of 48 bp coding 16 amino acids near the C-terminus. Like MSSP-1, MSSP-2 has RNP-1 consensus sequences. The results of the experiments using bacterially expressed MSSP-2, and its deletion mutants, as histidine fusion proteins suggested that the binding specificity of MSSP-2 to double- and single-stranded DNA is the same as that of MSSP-1, and that the RNP consensus sequences are required for the DNA binding of the protein. MSSP-2 stimulated the DNA replication of an SV40-derived plasmid containing the binding sequence for MSSP-1 or -2. MSSP-2 is hence suggested to play an important role in regulation of DNA replication. Images PMID:7838710

  5. Study of nucleic acid-gold nanorod interactions and detecting nucleic acid hybridization using gold nanorod solutions in the presence of sodium citrate.

    PubMed

    Kanjanawarut, Roejarek; Su, Xiaodi

    2010-09-01

    In this study, the authors report that sodium citrate can aggregate hexadecyl-trimethyl-ammonium ion(+)-coated gold nanorods (AuNRs), and nucleic acids of different charge and structure properties, i.e., single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), single-stranded peptide nucleic acid (PNA), and PNA-DNA complex, can bind to the AuNRs and therefore retard the sodium citrate-induced aggregation to different extents. The discovery that hybridized dsDNA (and the PNA-DNA complex) has a more pronounced protection effect than ssDNA (and PNA) allows the authors to develop a homogeneous phase AuNRs-based UV-visible (UV-vis) spectral assay for detecting specific sequences of oligonucleotides (20 mer) with a single-base-mismatch selectivity and a limit of detection of 5 nM. This assay involves no tedious bioconjugation and on-particle hybridization. The simple "set and test" format allows for a highly efficient hybridization in a homogeneous phase and a rapid display of the results in less than a minute. By measuring the degree of reduction in AuNR aggregation in the presence of different nucleic acid samples, one can assess how different nucleic acids interact with the AuNRs to complement the knowledge of spherical gold nanoparticles. Besides UV-vis characterization, transmission electron microscopy and zeta potential measurements were conduced to provide visual evidence of the particle aggregation and to support the discussion of the assay principle.

  6. The effects of DNA supercoiling on G-quadruplex formation.

    PubMed

    Sekibo, Doreen A T; Fox, Keith R

    2017-12-01

    Guanine-rich DNAs can fold into four-stranded structures that contain stacks of G-quartets. Bioinformatics studies have revealed that G-rich sequences with the potential to adopt these structures are unevenly distributed throughout genomes, and are especially found in gene promoter regions. With the exception of the single-stranded telomeric DNA, all genomic G-rich sequences will always be present along with their C-rich complements, and quadruplex formation will be in competition with the corresponding Watson-Crick duplex. Quadruplex formation must therefore first require local dissociation (melting) of the duplex strands. Since negative supercoiling is known to facilitate the formation of alternative DNA structures, we have investigated G-quadruplex formation within negatively supercoiled DNA plasmids. Plasmids containing multiple copies of (G3T)n and (G3T4)n repeats, were probed with dimethylsulphate, potassium permanganate and S1 nuclease. While dimethylsulphate footprinting revealed some evidence for G-quadruplex formation in (G3T)n sequences, this was not affected by supercoiling, and permanganate failed to detect exposed thymines in the loop regions. (G3T4)n sequences were not protected from DMS and showed no reaction with permanganate. Similarly, both S1 nuclease and 2D gel electrophoresis of DNA topoisomers did not detect any supercoil-dependent structural transitions. These results suggest that negative supercoiling alone is not sufficient to drive G-quadruplex formation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Restoration of G1 chemo/radioresistance and double-strand-break repair proficiency by wild-type but not endonuclease-deficient Artemis.

    PubMed

    Mohapatra, Susovan; Kawahara, Misako; Khan, Imran S; Yannone, Steven M; Povirk, Lawrence F

    2011-08-01

    Deficiency in Artemis is associated with lack of V(D)J recombination, sensitivity to radiation and radiomimetic drugs, and failure to repair a subset of DNA double-strand breaks (DSBs). Artemis harbors an endonuclease activity that trims both 5'- and 3'-ends of DSBs. To examine whether endonucleolytic trimming of terminally blocked DSBs by Artemis is a biologically relevant function, Artemis-deficient fibroblasts were stably complemented with either wild-type Artemis or an endonuclease-deficient D165N mutant. Wild-type Artemis completely restored resistance to γ-rays, bleomycin and neocarzinostatin, and also restored DSB-repair proficiency in G0/G1 phase as measured by pulsed-field gel electrophoresis and repair focus resolution. In contrast, cells expressing the D165N mutant, even at very high levels, remained as chemo/radiosensitive and repair deficient as the parental cells, as evidenced by persistent γ-H2AX, 53BP1 and Mre11 foci that slowly increased in size and ultimately became juxtaposed with promyelocytic leukemia protein nuclear bodies. In normal fibroblasts, overexpression of wild-type Artemis increased radioresistance, while D165N overexpression conferred partial repair deficiency following high-dose radiation. Restoration of chemo/radioresistance by wild-type, but not D165N Artemis suggests that the lack of endonucleolytic trimming of DNA ends is the principal cause of sensitivity to double-strand cleaving agents in Artemis-deficient cells.

  8. Modification and restriction of T-even bacteriophages. In vitro degradation of deoxyribonucleic acid containing 5-hydroxymethylctosine.

    PubMed

    Fleischman, R A; Cambell, J L; Richardson, C C

    1976-03-25

    Using the single-stranded circular DNA of bacteriophage fd as template, double-stranded circular DNA has been prepared in vitro with either 5-hydroxymethylcytosine ([hmdC]DNA) or cytosine ([dC]DNA) in the product strand. Extracts prepared from Escherichia coli cells restrictive to T-even phage containing nonglucosylated DNA degrade [hmdC]DNA to acid-soluble material in vitro, but do not degrade [dC]dna. In contrast, extracts prepared from E. coli K12 rglA- rglB-, a strain permissive to T-even phage containing nonglucosylated DNA, do not degrade [hmdC]DNA or [dC]DNA. In addition, glucosylation of the [hmdC]DNA renders it resistant to degradation by extracts from restrictive strains. The conversion of [hmdC]DNA to acid-soluble material in vitro consists of an HmCyt-specific endonucleolytic cleavage requiring the presence of the RglB gene product to form a linear molecule, followed by a non-HmCyt-specific hydrolysis of the linear DNA to acid-soluble fragments, catalyzed in part by exonuclease V. The RglB protein present in extracts of E. coli K12 rglA- rglB+ has been purified 200-fold by complementation with extracts from E. coli K12 rglA- rglB-. The purified RglB protein does not contain detectable HmCyt-specific endonuclease or exonuclease activity. In vitro endonucleolytic cleavage of [hmdC]DNA thus requires additional factors present in cell extracts.

  9. Contribution of DNA double-strand break repair gene XRCC3 genotypes to oral cancer susceptibility in Taiwan.

    PubMed

    Tsai, Chia-Wen; Chang, Wen-Shin; Liu, Juhn-Cherng; Tsai, Ming-Hsui; Lin, Cheng-Chieh; Bau, Da-Tian

    2014-06-01

    The DNA repair gene X-ray repair cross complementing protein 3 (XRCC3) is thought to play a major role in double-strand break repair and in maintaining genomic stability. Very possibly, defective double-strand break repair of cells can lead to carcinogenesis. Therefore, a case-control study was performed to reveal the contribution of XRCC3 genotypes to individual oral cancer susceptibility. In this hospital-based research, the association of XRCC3 rs1799794, rs45603942, rs861530, rs3212057, rs1799796, rs861539, rs28903081 genotypes with oral cancer risk in a Taiwanese population was investigated. In total, 788 patients with oral cancer and 956 age- and gender-matched healthy controls were genotyped. The results showed that there was significant differential distribution among oral cancer and controls in the genotypic (p=0.001428) and allelic (p=0.0013) frequencies of XRCC3 rs861539. As for the other polymorphisms, there was no difference between case and control groups. In gene-lifestyle interaction analysis, we have provided the first evidence showing that there is an obvious joint effect of XRCC3 rs861539 genotype with individual areca chewing habits on oral cancer risk. In conclusion, the T allele of XRCC3 rs861539, which has an interaction with areca chewing habit in oral carcinogenesis, may be an early marker for oral cancer in Taiwanese. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  10. Nicotinamide megadosing increases hepatic poly(ADP-ribose) levels in choline-deficient rats.

    PubMed

    ApSimon, M M; Rawling, J M; Kirkland, J B

    1995-07-01

    Previous work in our laboratory has shown that dietary megadoses of nicotinamide, used in the prevention of diabetes, cause increases in hepatic poly(ADP-ribose). Poly(ADP-ribose) is synthesized from NAD+ by a nuclear enzyme, poly(ADP-ribose)polymerase, which is activated by DNA strand breaks. The nicotinamide-induced increase in poly(ADP-ribose) could result from an increase in substrate, NAD+, or the induction of strand breaks in DNA. Strand breaks may result from the depletion of single carbon groups, through the excretion of methylated derivatives of nicotinamide. To differentiate between these mechanisms, a 3 x 3 factorial experiment was conducted in which rats were fed diets containing various supplements of choline bitartrate (0, 2, 20 g/kg diet) and nicotinamide (0, 1, 2 g/kg diet). At the conclusion of treatments, blood NAD+ and liver lipid, NAD+ and poly(ADP-ribose) levels were determined. Choline deficiency caused the characteristic accumulation of fat in the liver at all levels of nicotinamide. In choline deficient rats, nicotinamide supplements further increased liver lipid concentration. Blood and liver NAD+ concentrations were increased by nicotinamide supplementation, irrespective of choline status. In contrast, liver poly(ADP-ribose) levels were increased by nicotinamide supplementation only in choline deficient rats. These results show that nicotinamide-induced increases in poly(ADP-ribose) levels appear to be dependent on decreased methyl donor status and suggest that adequate choline status is important for preventing some deleterious effects of nicotinamide treatment.

  11. Morphological alterations within the peripheral fixation of the iris dilator muscle in eyes with pigmentary glaucoma.

    PubMed

    Flügel-Koch, Cassandra M; Tektas, Ozan Y; Kaufman, Paul L; Paulsen, Friedrich P; Lütjen-Drecoll, Elke

    2014-06-17

    To analyze the peripheral fixation of the iris dilator muscle in normal eyes and in eyes with pigmentary glaucoma (PG). Using 63 control eyes (age 18 months-99 years), the peripheral iris dilator was investigated by light microscopy, immunohistochemistry, and electron microscopy. Development was studied using 18 differently aged fetal eyes stained immunohistochemically against α-smooth muscle (SM) actin. The peripheral iris dilator muscle in PG was analyzed using semithin and ultrathin sections of six glutaraldehyde-fixed eyes from three donors aged 38, 62, and 74 years. In normal eyes, the peripheral end of the iris dilator muscle is arranged in a sphincter-like manner. Arcade-shaped tendinous connections associated with myofibroblasts (iridial strands) anchor the iris dilator within the elastic-fibromuscular ciliary meshwork that also serves as fixation area for the elastic tendons of the inner ciliary muscle portions. The iridial strands are innervated and can adapt their length during accommodation. The PG eyes show incomplete circular bundles and iridial strands that are mainly anchored to the iris stroma and the flexible uveal parts of the trabecular meshwork. The normal anchorage of the peripheral iris dilator and its presumably neuronally regulated length adaptation stabilize the peripheral iris during accommodation. Insufficient fixation in PG could promote posterior bowing of the iris with rubbing against the zonular fibers and pigment liberation from the iris pigmented epithelium. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.

  12. Homologous recombination mediates S-phase-dependent radioresistance in cells deficient in DNA polymerase eta

    PubMed Central

    Sharma, Ricky A.

    2012-01-01

    DNA polymerase eta (pol η) is the only DNA polymerase causally linked to carcinogenesis in humans. Inherited deficiency of pol η in the variant form of xeroderma pigmentosum (XPV) predisposes to UV-light-induced skin cancer. Pol η-deficient cells demonstrate increased sensitivity to cisplatin and oxaliplatin chemotherapy. We have found that XP30R0 fibroblasts derived from a patient with XPV are more resistant to cell kill by ionising radiation (IR) than the same cells complemented with wild-type pol η. This phenomenon has been confirmed in Burkitt’s lymphoma cells, which either expressed wild-type pol η or harboured a pol η deletion. Pol η deficiency was associated with accumulation of cells in S-phase, which persisted after IR. Cells deficient in pol η demonstrated increased homologous recombination (HR)-directed repair of double strand breaks created by IR. Depletion of the HR protein, X-ray repair cross-complementing protein 3 (XRCC3), abrogated the radioresistance observed in pol η-deficient cells as compared with pol η-complemented cells. These findings suggest that HR mediates S-phase-dependent radioresistance associated with pol η deficiency. We propose that pol η protein levels in tumours may potentially be used to identify patients who require treatment with chemo-radiotherapy rather than radiotherapy alone for adequate tumour control. PMID:22822095

  13. Structure-function analysis of rotavirus NSP2 octamer by using a novel complementation system.

    PubMed

    Taraporewala, Zenobia F; Jiang, Xiaofang; Vasquez-Del Carpio, Rodrigo; Jayaram, Hariharan; Prasad, B V Venkataram; Patton, John T

    2006-08-01

    Viral inclusion bodies, or viroplasms, that form in rotavirus-infected cells direct replication and packaging of the segmented double-stranded RNA (dsRNA) genome. NSP2, one of two rotavirus proteins needed for viroplasm assembly, possesses NTPase, RNA-binding, and helix-unwinding activities. NSP2 of the rotavirus group causing endemic infantile diarrhea (group A) was shown to self-assemble into large doughnut-shaped octamers with circumferential grooves and deep clefts containing nucleotide-binding histidine triad (HIT)-like motifs. Here, we demonstrate that NSP2 of group C rotavirus, a group that fails to reassort with group A viruses, retains the unique architecture of the group A octamer but differs in surface charge distribution. By using an NSP2-dependent complementation system, we show that the HIT-dependent NTPase activity of NSP2 is necessary for dsRNA synthesis, but not for viroplasm formation. The complementation system also showed that despite the retention of the octamer structure and the HIT-like fold, group C NSP2 failed to rescue replication and viroplasm formation in NSP2-deficient cells infected with group A rotavirus. The distinct differences in the surface charges on the Bristol and SA11 NSP2 octamers suggest that charge complementarity of the viroplasm-forming proteins guides the specificity of viroplasm formation and, possibly, reassortment restriction between rotavirus groups.

  14. FANCJ Helicase Operates in the Fanconi Anemia DNA Repair Pathway and the Response to Replicational Stress

    PubMed Central

    Wu, Yuliang; Brosh, Robert M.

    2009-01-01

    Fanconi anemia (FA) is an autosomal recessive disorder characterized by multiple congenital anomalies, progressive bone marrow failure, and high cancer risk. Cells from FA patients exhibit spontaneous chromosomal instability and hypersensitivity to DNA interstrand cross-linking (ICL) agents. Although the precise mechanistic details of the FA/BRCA pathway of ICL-repair are not well understood, progress has been made in the identification of the FA proteins that are required for the pathway. Among the 13 FA complementation groups from which all the FA genes have been cloned, only a few of the FA proteins are predicted to have direct roles in DNA metabolism. One of the more recently identified FA proteins, shown to be responsible for complementation of the FA complementation group J, is the BRCA1 Associated C-terminal Helicase (BACH1, designated FANCJ), originally identified as a protein associated with breast cancer. FANCJ has been proposed to function downstream of FANCD2 monoubiquitination, a critical event in the FA pathway. Evidence supports a role for FANCJ in a homologous recombination (HR) pathway of double strand break (DSB) repair. In this review, we will summarize the current knowledge in terms of FANCJ functions through its enzymatic activities and protein interactions. The molecular roles of FANCJ in DNA repair and the response to replicational stress will be discussed. PMID:19519404

  15. The nitric oxide donor JS-K sensitizes U87 glioma cells to repetitive irradiation.

    PubMed

    Heckler, Max; Osterberg, Nadja; Guenzle, Jessica; Thiede-Stan, Nina Kristin; Reichardt, Wilfried; Weidensteiner, Claudia; Saavedra, Joseph E; Weyerbrock, Astrid

    2017-06-01

    As a potent radiosensitizer nitric oxide (NO) may be a putative adjuvant in the treatment of malignant gliomas which are known for their radio- and chemoresistance. The NO donor prodrug JS-K (O2-(2.4-dinitrophenyl) 1-[(4-ethoxycarbonyl) piperazin-1-yl] diazen-1-ium-1,2-diolate) allows cell-type specific intracellular NO release via enzymatic activation by glutathione-S-transferases overexpressed in glioblastoma multiforme. The cytotoxic and radiosensitizing efficacy of JS-K was assessed in U87 glioma cells in vitro focusing on cell proliferation, induction of DNA damage, and cell death. In vivo efficacy of JS-K and repetitive irradiation were investigated in an orthotopic U87 xenograft model in mice. For the first time, we could show that JS-K acts as a potent cytotoxic and radiosensitizing agent in U87 cells in vitro. This dose- and time-dependent effect is due to an enhanced induction of DNA double-strand breaks leading to mitotic catastrophe as the dominant form of cell death. However, this potent cytotoxic and radiosensitizing effect could not be confirmed in an intracranial U87 xenograft model, possibly due to insufficient delivery into the brain. Although NO donor treatment was well tolerated, neither a retardation of tumor growth nor an extended survival could be observed after JS-K and/or radiotherapy.

  16. Inverse Symmetry in Complete Genomes and Whole-Genome Inverse Duplication

    PubMed Central

    Kong, Sing-Guan; Fan, Wen-Lang; Chen, Hong-Da; Hsu, Zi-Ting; Zhou, Nengji; Zheng, Bo; Lee, Hoong-Chien

    2009-01-01

    The cause of symmetry is usually subtle, and its study often leads to a deeper understanding of the bearer of the symmetry. To gain insight into the dynamics driving the growth and evolution of genomes, we conducted a comprehensive study of textual symmetries in 786 complete chromosomes. We focused on symmetry based on our belief that, in spite of their extreme diversity, genomes must share common dynamical principles and mechanisms that drive their growth and evolution, and that the most robust footprints of such dynamics are symmetry related. We found that while complement and reverse symmetries are essentially absent in genomic sequences, inverse–complement plus reverse–symmetry is prevalent in complex patterns in most chromosomes, a vast majority of which have near maximum global inverse symmetry. We also discovered relations that can quantitatively account for the long observed but unexplained phenomenon of -mer skews in genomes. Our results suggest segmental and whole-genome inverse duplications are important mechanisms in genome growth and evolution, probably because they are efficient means by which the genome can exploit its double-stranded structure to enrich its code-inventory. PMID:19898631

  17. Use of eculizumab and plasma exchange in successful combined liver-kidney transplantation in a case of atypical HUS associated with complement factor H mutation.

    PubMed

    Tran, Ha; Chaudhuri, Abanti; Concepcion, Waldo; Grimm, Paul C

    2014-03-01

    Atypical hemolytic uremic syndrome (aHUS) evolves into end-stage renal failure in nearly half of affected patients and is associated with defective regulation of the alternative complement pathway. Patients with a complement factor H (CFH) mutation have a 30-100% risk of graft loss due to aHUS recurrence or graft thrombosis. Since CFH is produced predominantly by the liver, combined liver-kidney transplant is a curative treatment option. One major unexpected risk includes liver failure secondary to uncontrolled complement activation. We report a successful combined liver-kidney transplantation with perioperative plasma exchange and use of the humanized anti-C5 monoclonal antibody eculizumab. An 11-month-old female presented with oliguric renal failure after 3 weeks of flu-like symptoms in the absence of diarrhea. Following the identification of Escherichia coli 0157:H7 in her stool, she was discharged home on peritoneal dialysis with a diagnosis of Shiga toxin-associated HUS. Three months later, she developed severe anemia, thrombocytopenia, and neurological involvement. aHUS was diagnosed and confirmed, and genetic testing revealed a mutation in CFH SCR20. Once donor organs became available, she received preoperative plasma exchange followed by eculizumab infusion with intra-operative fresh frozen plasma prior to combined liver-kidney transplant. At 19 months post-transplant, she continues to have excellent allograft and liver function without signs of disease recurrence. Perioperative use of eculizumab in conjunction with plasma exchange during simultaneous liver-kidney transplant can be used to inhibit terminal complement activity, thereby optimizing successful transplantation by reducing the risk of graft thrombosis.

  18. Loxoprofen sodium induces the production of complement C5a in human serum.

    PubMed

    Kumagai, Tomoaki; Yamaguchi, Nozomi; Hirai, Hiroyuki; Kojima, Shigeyuki; Kodani, Yoshiko; Hashiguchi, Akihiko; Haida, Michiko; Nakamura, Masataka

    2016-04-01

    Basophil activation test (BAT) is an in vitro allergy test that is useful to identify allergens that cause IgE-dependent allergies. The test has been used to detect not only food allergies and allergies caused by environmental factors but also to detect drug hypersensitivity, which has been known to include IgE-independent reactions. In our preliminary studies in which BAT was applied to detect hypersensitivity of loxoprofen, a non-steroidal anti-inflammatory drug (NSAID), conventional BAT with incubation for 30min did not show basophil activation by means of increased CD203c expression. In this study, we extended the incubation time to 24h on the basis of the hypothesis that loxoprofen indirectly activates basophils. Basophils from healthy control donors as well as allergic patients showed up-regulation of CD203c after incubation with loxoprofen for 24h. Activation was induced using loxoprofen-treated serum. Proteomic and pharmacologic analyses revealed that serum incubation with loxoprofen generated an active complement component C5a, which induced CD203c expression via binding to the C5a receptor on basophils. Because C3a production was also detected after incubation for 24h, loxoprofen is likely to stimulate the complement classical pathway. Our findings suggest that the complement activation is involved in drug hypersensitivity and the suppression of this activation may contribute to the elimination of false positive of BAT for drug allergies. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Successful Renal Transplantation Across HLA Barrier: Report from India.

    PubMed

    Aggarwal, G; Tiwari, A K; Dorwal, P; Chauhan, R; Arora, D; Dara, R C; Kher, V

    2017-01-01

    Organ donors are sometimes found "unsuitable" due to the presence of donor-specific anti-HLA antibodies in the recipient. In recent years, improved desensitization protocols have successfully helped to overcome HLA incompatibility hurdle. We present three cases where optimum desensitization was achieved in patients with the donor-specific anti-HLA antibody (DSA) leading to successful renal transplantation. All patient-donor pair underwent HLA typing, complement dependent cytotoxicity crossmatch (CDC-XM), flow cytometry XM (FC-XM), and panel reactive antibody. If any of the three tests was positive, single antigen bead assay was performed to determine the specificity of the anti-HLA antibody (s). Patients with DSA were offered organ-swap or anti-HLA antibody desensitization followed by transplantation. Desensitization protocol consisted of single dose rituximab and cascade plasmapheresis (CP) along with standard triple immunosuppression. The target DSA mean fluorescence index (MFI) was <500, along with negative CDC-XM and FC-XM for both T- and B-cells. Three patients with anti-HLA DSA, who did not find a suitable match in organ swap program, consented to anti-HLA antibody desensitization, followed by transplantation. Mean pre-desensitization antibody MFI was 1740 (1422-2280). Mean number of CP required to achieve the target MFI was 2.3 (2-3). All the three patients are on regular follow-up and have normal renal function test at a mean follow-up of 8 months. This report underlines successful application of desensitization protocol leading to successful HLA-antibody incompatible renal transplants and their continued normal renal functions.

  20. Independent Structural Domains in Paramyxovirus Polymerase Protein*

    PubMed Central

    Dochow, Melanie; Krumm, Stefanie A.; Crowe, James E.; Moore, Martin L.; Plemper, Richard K.

    2012-01-01

    All enzymatic activities required for genomic replication and transcription of nonsegmented negative strand RNA viruses (or Mononegavirales) are believed to be concentrated in the viral polymerase (L) protein. However, our insight into the organization of these different enzymatic activities into a bioactive tertiary structure remains rudimentary. Fragments of Mononegavirales polymerases analyzed to date cannot restore bioactivity through trans-complementation, unlike the related L proteins of segmented NSVs. We investigated the domain organization of phylogenetically diverse Paramyxovirus L proteins derived from measles virus (MeV), Nipah virus (NiV), and respiratory syncytial virus (RSV). Through a comprehensive in silico and experimental analysis of domain intersections, we defined MeV L position 615 as an interdomain candidate in addition to the previously reported residue 1708. Only position 1708 of MeV and the homologous positions in NiV and RSV L also tolerated the insertion of epitope tags. Splitting of MeV L at residue 1708 created fragments that were unable to physically interact and trans-complement, but strikingly, these activities were reconstituted by the addition of dimerization tags to the fragments. Equivalently split fragments of NiV, RSV, and MeV L oligomerized with comparable efficiency in all homo- and heterotypic combinations, but only the homotypic pairs were able to trans-complement. These results demonstrate that synthesis as a single polypeptide is not required for the Mononegavirales polymerases to adopt a proper tertiary conformation. Paramyxovirus polymerases are composed of at least two truly independent folding domains that lack a traditional interface but require molecular compatibility for bioactivity. The functional probing of the L domain architecture through trans-complementation is anticipated to be applicable to all Mononegavirales polymerases. PMID:22215662

  1. Soluble expression, purification and characterization of the full length IS2 Transposase.

    PubMed

    Lewis, Leslie A; Astatke, Mekbib; Umekubo, Peter T; Alvi, Shaheen; Saby, Robert; Afrose, Jehan

    2011-10-27

    The two-step transposition pathway of insertion sequences of the IS3 family, and several other families, involves first the formation of a branched figure-of-eight (F-8) structure by an asymmetric single strand cleavage at one optional donor end and joining to the flanking host DNA near the target end. Its conversion to a double stranded minicircle precedes the second insertional step, where both ends function as donors. In IS2, the left end which lacks donor function in Step I acquires it in Step II. The assembly of two intrinsically different protein-DNA complexes in these F-8 generating elements has been intuitively proposed, but a barrier to testing this hypothesis has been the difficulty of isolating a full length, soluble and active transposase that creates fully formed synaptic complexes in vitro with protein bound to both binding and catalytic domains of the ends. We address here a solution to expressing, purifying and structurally analyzing such a protein. A soluble and active IS2 transposase derivative with GFP fused to its C-terminus functions as efficiently as the native protein in in vivo transposition assays. In vitro electrophoretic mobility shift assay data show that the partially purified protein prepared under native conditions binds very efficiently to cognate DNA, utilizing both N- and C-terminal residues. As a precursor to biophysical analyses of these complexes, a fluorescence-based random mutagenesis protocol was developed that enabled a structure-function analysis of the protein with good resolution at the secondary structure level. The results extend previous structure-function work on IS3 family transposases, identifying the binding domain as a three helix H + HTH bundle and explaining the function of an atypical leucine zipper-like motif in IS2. In addition gain- and loss-of-function mutations in the catalytic active site define its role in regional and global binding and identify functional signatures that are common to the three dimensional catalytic core motif of the retroviral integrase superfamily. Intractably insoluble transposases, such as the IS2 transposase, prepared by solubilization protocols are often refractory to whole protein structure-function studies. The results described here have validated the use of GFP-tagging and fluorescence-based random mutagenesis in overcoming this limitation at the secondary structure level.

  2. Soluble expression, purification and characterization of the full length IS2 Transposase

    PubMed Central

    2011-01-01

    Background The two-step transposition pathway of insertion sequences of the IS3 family, and several other families, involves first the formation of a branched figure-of-eight (F-8) structure by an asymmetric single strand cleavage at one optional donor end and joining to the flanking host DNA near the target end. Its conversion to a double stranded minicircle precedes the second insertional step, where both ends function as donors. In IS2, the left end which lacks donor function in Step I acquires it in Step II. The assembly of two intrinsically different protein-DNA complexes in these F-8 generating elements has been intuitively proposed, but a barrier to testing this hypothesis has been the difficulty of isolating a full length, soluble and active transposase that creates fully formed synaptic complexes in vitro with protein bound to both binding and catalytic domains of the ends. We address here a solution to expressing, purifying and structurally analyzing such a protein. Results A soluble and active IS2 transposase derivative with GFP fused to its C-terminus functions as efficiently as the native protein in in vivo transposition assays. In vitro electrophoretic mobility shift assay data show that the partially purified protein prepared under native conditions binds very efficiently to cognate DNA, utilizing both N- and C-terminal residues. As a precursor to biophysical analyses of these complexes, a fluorescence-based random mutagenesis protocol was developed that enabled a structure-function analysis of the protein with good resolution at the secondary structure level. The results extend previous structure-function work on IS3 family transposases, identifying the binding domain as a three helix H + HTH bundle and explaining the function of an atypical leucine zipper-like motif in IS2. In addition gain- and loss-of-function mutations in the catalytic active site define its role in regional and global binding and identify functional signatures that are common to the three dimensional catalytic core motif of the retroviral integrase superfamily. Conclusions Intractably insoluble transposases, such as the IS2 transposase, prepared by solubilization protocols are often refractory to whole protein structure-function studies. The results described here have validated the use of GFP-tagging and fluorescence-based random mutagenesis in overcoming this limitation at the secondary structure level. PMID:22032517

  3. Non-Homologous End Joining and Homology Directed DNA Repair Frequency of Double-Stranded Breaks Introduced by Genome Editing Reagents.

    PubMed

    Zaboikin, Michail; Zaboikina, Tatiana; Freter, Carl; Srinivasakumar, Narasimhachar

    2017-01-01

    Genome editing using transcription-activator like effector nucleases or RNA guided nucleases allows one to precisely engineer desired changes within a given target sequence. The genome editing reagents introduce double stranded breaks (DSBs) at the target site which can then undergo DNA repair by non-homologous end joining (NHEJ) or homology directed recombination (HDR) when a template DNA molecule is available. NHEJ repair results in indel mutations at the target site. As PCR amplified products from mutant target regions are likely to exhibit different melting profiles than PCR products amplified from wild type target region, we designed a high resolution melting analysis (HRMA) for rapid identification of efficient genome editing reagents. We also designed TaqMan assays using probes situated across the cut site to discriminate wild type from mutant sequences present after genome editing. The experiments revealed that the sensitivity of the assays to detect NHEJ-mediated DNA repair could be enhanced by selection of transfected cells to reduce the contribution of unmodified genomic DNA from untransfected cells to the DNA melting profile. The presence of donor template DNA lacking the target sequence at the time of genome editing further enhanced the sensitivity of the assays for detection of mutant DNA molecules by excluding the wild-type sequences modified by HDR. A second TaqMan probe that bound to an adjacent site, outside of the primary target cut site, was used to directly determine the contribution of HDR to DNA repair in the presence of the donor template sequence. The TaqMan qPCR assay, designed to measure the contribution of NHEJ and HDR in DNA repair, corroborated the results from HRMA. The data indicated that genome editing reagents can produce DSBs at high efficiency in HEK293T cells but a significant proportion of these are likely masked by reversion to wild type as a result of HDR. Supplying a donor plasmid to provide a template for HDR (that eliminates a PCR amplifiable target) revealed these cryptic DSBs and facilitated the determination of the true efficacy of genome editing reagents. The results indicated that in HEK293T cells, approximately 40% of the DSBs introduced by genome editing, were available for participation in HDR.

  4. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  5. Mutations in XRCC4 cause primordial dwarfism without causing immunodeficiency.

    PubMed

    Saito, Shinta; Kurosawa, Aya; Adachi, Noritaka

    2016-08-01

    In successive reports from 2014 to 2015, X-ray repair cross-complementing protein 4 (XRCC4) has been identified as a novel causative gene of primordial dwarfism. XRCC4 is indispensable for non-homologous end joining (NHEJ), the major pathway for repairing DNA double-strand breaks. As NHEJ is essential for V(D)J recombination during lymphocyte development, it is generally believed that abnormalities in XRCC4 cause severe combined immunodeficiency. Contrary to expectations, however, no overt immunodeficiency has been observed in patients with primordial dwarfism harboring XRCC4 mutations. Here, we describe the various XRCC4 mutations that lead to disease and discuss their impact on NHEJ and V(D)J recombination.

  6. An 'instant gene bank' method for gene cloning by mutant complementation.

    PubMed

    Gems, D; Aleksenko, A; Belenky, L; Robertson, S; Ramsden, M; Vinetski, Y; Clutterbuck, A J

    1994-02-01

    We describe a new method of gene cloning by complementation of mutant alleles which obviates the need for construction of a gene library in a plasmid vector in vitro and its amplification in Escherichia coli. The method involves simultaneous transformation of mutant strains of the fungus Aspergillus nidulans with (i) fragmented chromosomal DNA from a donor species and (ii) DNA of a plasmid without a selectable marker gene, but with a fungal origin of DNA replication ('helper plasmid'). Transformant colonies appear as the result of the joining of chromosomal DNA fragments carrying the wild-type copies of the mutant allele with the helper plasmid. Joining may occur either by ligation (if the helper plasmid is in linear form) or recombination (if it is cccDNA). This event occurs with high efficiency in vivo, and generates an autonomously replicating plasmid cointegrate. Transformants containing Penicillium chrysogenum genomic DNA complementing A. nidulans niaD, nirA and argB mutations have been obtained. While some of these cointegrates were evidently rearranged or consisted only of unaltered replicating plasmid, in other cases plasmids could be recovered into E. coli and were subsequently shown to contain the selected gene. The utility of this "instant gene bank" technique is demonstrated here by the molecular cloning of the P. canescens trpC gene.

  7. Effect of Permeation Enhancers on the Buccal Permeability of Nicotine: Ex vivo Transport Studies Complemented by MALDI MS Imaging.

    PubMed

    Marxen, Eva; Jin, Liang; Jacobsen, Jette; Janfelt, Christian; Hyrup, Birgitte; Nicolazzo, Joseph A

    2018-02-21

    The purpose of this study was to assess the effect of several chemical permeation enhancers on the buccal permeability of nicotine and to image the spatial distribution of nicotine in buccal mucosa with and without buccal permeation enhancers. The impact of sodium taurodeoxycholate (STDC), sodium dodecyl sulphate (SDS), dimethyl sulfoxide (DMSO) and Azone® on the permeability of [ 3 H]-nicotine and [ 14 C]-mannitol (a paracellular marker) across porcine buccal mucosa was studied ex vivo in modified Ussing chambers. The distribution of nicotine, mannitol and permeation enhancers was imaged using using matrix-assisted laser desorption ionization mass spectrometry imaging (MALDI MSI). Despite STDC significantly increasing permeability of [ 14 C]-mannitol, no enhancing effect was seen on [ 3 H]-nicotine permeability with any of the permeation enhancers. Rather, SDS and DMSO retarded nicotine permeability, likely due to nicotine being retained in the donor compartment. The permeability results were complemented by the spatial distribution of nicotine and mannitol determined with MALDI MSI. The buccal permeability of nicotine was affected in an enhancer specific manner, suggesting that nicotine primarily diffuses via the transcellular pathway. MALDI MSI was shown to complement ex vivo permeability studies and to be a useful qualitative tool for visualizing drug and penetration enhancer distribution in buccal mucosa.

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xing, Yingjie, E-mail: xingyj@pku.edu.cn; Li, Shuai; Wang, Guiwei

    The donor/acceptor heterojunction plays an important role in organic solar cells. An investigation of band bending in the donor/acceptor heterojunction is helpful in analysis of the charge transport behavior and for the improvement of the device performance. In this work, we report an approach for detection of band bending in a donor/acceptor heterojunction that has been prepared on a small and sharp tungsten tip. In situ field emission measurements are performed after the deposition process, and a linear Fowler-Nordheim plot is obtained from the fresh organic film surface. The thickness-dependent work function is then measured in the layer-by-layer deposited heterojunction.more » Several different types of heterojunction (zinc phthalocyanine (ZnPc)/C60, copper phthalocyanine (CuPc)/3,4,9,10-perylenetetracarboxylic bisbenzimidazole, and CuPc/C60) are fabricated and analyzed. The different charge transfer directions in the heterojunctions are distinguished by field emission measurements. The calculation method used to determine the band bending is then discussed in detail. A triple layer heterojunction (C60/ZnPc/CuPc) is also analyzed using this method. A small amount of band bending is measured in the outer CuPc layer. This method provides an independent reference method for determination of the band bending in an organic heterojunction that will complement photoemission spectroscopy and current-voltage measurement methods.« less

  9. C4d-negative antibody-mediated rejection with high anti-angiotensin II type I receptor antibodies in absence of donor-specific antibodies.

    PubMed

    Fuss, Alexander; Hope, Christopher M; Deayton, Susan; Bennett, Greg Donald; Holdsworth, Rhonda; Carroll, Robert P; Coates, P Toby H

    2015-07-01

    Acute antibody-mediated rejection can occur in absence of circulating donor-specific antibodies. Agonistic antibodies targeting the anti-angiotensin II type 1 receptor (anti-AT1 R) are emerging as important non-human leucocyte antigen (HLA) antibodies. Elevated levels of anti-angiotensin II receptor antibodies were first observed in kidney transplant recipients with malignant hypertension and allograft rejection. They have now been studied in three separate kidney transplant populations and associate to frequency of rejection, severity of rejection and graft failure. We report 11 cases of biopsy-proven, Complement 4 fragment d (C4d)-negative, acute rejection occurring without circulating donor-specific anti-HLA antibodies. In eight cases, anti-angiotensin receptor antibodies were retrospectively examined. The remaining three subjects were identified from our centre's newly instituted routine anti-angiotensin receptor antibody screening. All subjects fulfilled Banff 2013 criteria for antibody-mediated rejection and all responded to anti-rejection therapy, which included plasma exchange and angiotensin receptor blocker therapy. These cases support the routine assessment of anti-AT1 R antibodies in kidney transplant recipients to identify subjects at risk. Further studies will need to determine optimal assessment protocol and the effectiveness of pre-emptive treatment with angiotensin receptor blockers. © 2015 Asian Pacific Society of Nephrology.

  10. A CAF-1–PCNA-Mediated Chromatin Assembly Pathway Triggered by Sensing DNA Damage

    PubMed Central

    Moggs, Jonathan G.; Grandi, Paola; Quivy, Jean-Pierre; Jónsson, Zophonías O.; Hübscher, Ulrich; Becker, Peter B.; Almouzni, Geneviève

    2000-01-01

    Sensing DNA damage is crucial for the maintenance of genomic integrity and cell cycle progression. The participation of chromatin in these events is becoming of increasing interest. We show that the presence of single-strand breaks and gaps, formed either directly or during DNA damage processing, can trigger the propagation of nucleosomal arrays. This nucleosome assembly pathway involves the histone chaperone chromatin assembly factor 1 (CAF-1). The largest subunit (p150) of this factor interacts directly with proliferating cell nuclear antigen (PCNA), and critical regions for this interaction on both proteins have been mapped. To isolate proteins specifically recruited during DNA repair, damaged DNA linked to magnetic beads was used. The binding of both PCNA and CAF-1 to this damaged DNA was dependent on the number of DNA lesions and required ATP. Chromatin assembly linked to the repair of single-strand breaks was disrupted by depletion of PCNA from a cell-free system. This defect was rescued by complementation with recombinant PCNA, arguing for role of PCNA in mediating chromatin assembly linked to DNA repair. We discuss the importance of the PCNA–CAF-1 interaction in the context of DNA damage processing and checkpoint control. PMID:10648606

  11. INTERACTION OF BENZO(A)PYRENE DIOL EPOXIDE WITH SVAO MINICHROMOSOMES

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gamper, Howard B.; Yokota, Hisao A.; Bartholomew, James C.

    SV40 minichromosomes were reacted with (+)7{beta},8{alpha}-dihydroxy-9{alpha},10{alpha}-epoxy- 7,8,9,10-tetrahydrobenzo[a]pyrene (BaP diol epoxide). Low levels of modification (< 5 DNA adducts/minichromosome) did not detectably alter the structure of the minichromosomes but high levels (> 200 DNA adducts/minichromosome) led to extensive fragmentation. Relative to naked SV40 DNA BaP diol epoxide induced alkylation and strand scission of minichromosomal DNA was reduced or enhanced by factors of 1.5 and 2.0, respectively. The reduction in covalent binding was attributed to the presence of histones, which competed with DNA for the hydrocarbon and reduced the probability of BaP diol epoxide intercalation by tightening the helix. The enhancement ofmore » strand scission was probably due to the catalytic effect of histones on the rate of S-elimination at apurinic sites, although an altered adduct profile or the presence of a repair endonuclease were not excluded. Staphylococcal nuclease digestion indicated that BaP dial epoxide randomly alkylated the minichromosomal DNA. This is in contrast to studies with cellular chromatin where internucleosomal DNA was preferentially modified. Differences in the minichromosomal protein complement were responsible for this altered susceptibility.« less

  12. The structure and DNA-binding properties of Mgm101 from a yeast with a linear mitochondrial genome

    PubMed Central

    Pevala, Vladimír; Truban, Dominika; Bauer, Jacob A.; Košťan, Július; Kunová, Nina; Bellová, Jana; Brandstetter, Marlene; Marini, Victoria; Krejčí, Lumír; Tomáška, Ľubomír; Nosek, Jozef; Kutejová, Eva

    2016-01-01

    To study the mechanisms involved in the maintenance of a linear mitochondrial genome we investigated the biochemical properties of the recombination protein Mgm101 from Candida parapsilosis. We show that CpMgm101 complements defects associated with the Saccharomyces cerevisiae mgm101–1ts mutation and that it is present in both the nucleus and mitochondrial nucleoids of C. parapsilosis. Unlike its S. cerevisiae counterpart, CpMgm101 is associated with the entire nucleoid population and is able to bind to a broad range of DNA substrates in a non-sequence specific manner. CpMgm101 is also able to catalyze strand annealing and D-loop formation. CpMgm101 forms a roughly C-shaped trimer in solution according to SAXS. Electron microscopy of a complex of CpMgm101 with a model mitochondrial telomere revealed homogeneous, ring-shaped structures at the telomeric single-stranded overhangs. The DNA-binding properties of CpMgm101, together with its DNA recombination properties, suggest that it can play a number of possible roles in the replication of the mitochondrial genome and the maintenance of its telomeres. PMID:26743001

  13. A Third Approach to Gene Prediction Suggests Thousands of Additional Human Transcribed Regions

    PubMed Central

    Glusman, Gustavo; Qin, Shizhen; El-Gewely, M. Raafat; Siegel, Andrew F; Roach, Jared C; Hood, Leroy; Smit, Arian F. A

    2006-01-01

    The identification and characterization of the complete ensemble of genes is a main goal of deciphering the digital information stored in the human genome. Many algorithms for computational gene prediction have been described, ultimately derived from two basic concepts: (1) modeling gene structure and (2) recognizing sequence similarity. Successful hybrid methods combining these two concepts have also been developed. We present a third orthogonal approach to gene prediction, based on detecting the genomic signatures of transcription, accumulated over evolutionary time. We discuss four algorithms based on this third concept: Greens and CHOWDER, which quantify mutational strand biases caused by transcription-coupled DNA repair, and ROAST and PASTA, which are based on strand-specific selection against polyadenylation signals. We combined these algorithms into an integrated method called FEAST, which we used to predict the location and orientation of thousands of putative transcription units not overlapping known genes. Many of the newly predicted transcriptional units do not appear to code for proteins. The new algorithms are particularly apt at detecting genes with long introns and lacking sequence conservation. They therefore complement existing gene prediction methods and will help identify functional transcripts within many apparent “genomic deserts.” PMID:16543943

  14. Characterizing polymorphic inversions in human genomes by single-cell sequencing

    PubMed Central

    Sanders, Ashley D.; Hills, Mark; Porubský, David; Guryev, Victor; Falconer, Ester; Lansdorp, Peter M.

    2016-01-01

    Identifying genomic features that differ between individuals and cells can help uncover the functional variants that drive phenotypes and disease susceptibilities. For this, single-cell studies are paramount, as it becomes increasingly clear that the contribution of rare but functional cellular subpopulations is important for disease prognosis, management, and progression. Until now, studying these associations has been challenged by our inability to map structural rearrangements accurately and comprehensively. To overcome this, we coupled single-cell sequencing of DNA template strands (Strand-seq) with custom analysis software to rapidly discover, map, and genotype genomic rearrangements at high resolution. This allowed us to explore the distribution and frequency of inversions in a heterogeneous cell population, identify several polymorphic domains in complex regions of the genome, and locate rare alleles in the reference assembly. We then mapped the entire genomic complement of inversions within two unrelated individuals to characterize their distinct inversion profiles and built a nonredundant global reference of structural rearrangements in the human genome. The work described here provides a powerful new framework to study structural variation and genomic heterogeneity in single-cell samples, whether from individuals for population studies or tissue types for biomarker discovery. PMID:27472961

  15. Characterization of Plasmodium vivax Transmission-Blocking Activity in Low to Moderate Malaria Transmission Settings of the Colombian Pacific Coast

    PubMed Central

    Arévalo-Herrera, Myriam; Solarte, Yezid; Rocha, Leonardo; Álvarez, Diego; Beier, John C.; Herrera, Sócrates

    2011-01-01

    Malaria infection induces antibodies capable of suppressing the infectivity of gametocytes and gametes, however, little is known about the duration of the antibody response, the parasite specificity, and the role of complement. We report the analyses of the transmission-blocking (TB) activity of sera collected from 105 Plasmodium vivax-infected and 44 non-infected individuals from a malaria endemic region of Colombia, using a membrane feeding assay in Anopheles albimanus mosquitoes. In infected donors we found that TB activity was antibody dose dependent (35%), lasted for 2–4 months after infection, and in 70% of the cases different P. vivax wild isolates displayed differential susceptibility to blocking antibodies. Additionally, in a number of assays TB was complement-dependent. Twenty-seven percent of non-infected individuals presented TB activity that correlated with antibody titers. Studies here provide preliminary data on factors of great importance for further work on the development of TB vaccines. PMID:21292881

  16. Does condom social marketing improve health outcomes and increase usage and equitable access?

    PubMed

    Knerr, Wendy

    2011-05-01

    Condom social marketing (CSM) has increased condom supplies, broadened commercial markets for condoms and introduced marketing innovations in developing countries. Yet rigorous and reliable evidence of the impact on condom usage and disease prevention is limited, as is evidence of the impact on equity of access to condoms for poor populations, women and people living with HIV. One strand of research on CSM reports mostly on output (e.g. sales and processes) and market growth; but these have been found to be highly unreliable measures of condom usage. Another strand of research reports primarily on changes in sexual behaviour, attitude or condom usage, using survey data. While random sampling is rare, these studies often use representative samples, which provide some measure of validity. There have been attempts to improve the reliability or results to good effect, but challenges remain for researchers, scholars and donors, including the need to supplement output data with measures of behaviour change, use rigorous designs which are built into programmes a priori, report on equity measures, report on potential harms of CSM programmes, and encourage external and systematic reviews. Copyright © 2011 Reproductive Health Matters. Published by Elsevier Ltd. All rights reserved.

  17. Crossovers are associated with mutation and biased gene conversion at recombination hotspots.

    PubMed

    Arbeithuber, Barbara; Betancourt, Andrea J; Ebner, Thomas; Tiemann-Boege, Irene

    2015-02-17

    Meiosis is a potentially important source of germline mutations, as sites of meiotic recombination experience recurrent double-strand breaks (DSBs). However, evidence for a local mutagenic effect of recombination from population sequence data has been equivocal, likely because mutation is only one of several forces shaping sequence variation. By sequencing large numbers of single crossover molecules obtained from human sperm for two recombination hotspots, we find direct evidence that recombination is mutagenic: Crossovers carry more de novo mutations than nonrecombinant DNA molecules analyzed for the same donors and hotspots. The observed mutations were primarily CG to TA transitions, with a higher frequency of transitions at CpG than non-CpGs sites. This enrichment of mutations at CpG sites at hotspots could predominate in methylated regions involving frequent single-stranded DNA processing as part of DSB repair. In addition, our data set provides evidence that GC alleles are preferentially transmitted during crossing over, opposing mutation, and shows that GC-biased gene conversion (gBGC) predominates over mutation in the sequence evolution of hotspots. These findings are consistent with the idea that gBGC could be an adaptation to counteract the mutational load of recombination.

  18. Crossovers are associated with mutation and biased gene conversion at recombination hotspots

    PubMed Central

    Arbeithuber, Barbara; Betancourt, Andrea J.; Ebner, Thomas; Tiemann-Boege, Irene

    2015-01-01

    Meiosis is a potentially important source of germline mutations, as sites of meiotic recombination experience recurrent double-strand breaks (DSBs). However, evidence for a local mutagenic effect of recombination from population sequence data has been equivocal, likely because mutation is only one of several forces shaping sequence variation. By sequencing large numbers of single crossover molecules obtained from human sperm for two recombination hotspots, we find direct evidence that recombination is mutagenic: Crossovers carry more de novo mutations than nonrecombinant DNA molecules analyzed for the same donors and hotspots. The observed mutations were primarily CG to TA transitions, with a higher frequency of transitions at CpG than non-CpGs sites. This enrichment of mutations at CpG sites at hotspots could predominate in methylated regions involving frequent single-stranded DNA processing as part of DSB repair. In addition, our data set provides evidence that GC alleles are preferentially transmitted during crossing over, opposing mutation, and shows that GC-biased gene conversion (gBGC) predominates over mutation in the sequence evolution of hotspots. These findings are consistent with the idea that gBGC could be an adaptation to counteract the mutational load of recombination. PMID:25646453

  19. IGR J19294+1816: a new Be-X-ray binary revealed through infrared spectroscopy

    NASA Astrophysics Data System (ADS)

    Rodes-Roca, J. J.; Bernabeu, G.; Magazzù, A.; Torrejón, J. M.; Solano, E.

    2018-05-01

    The aim of this work is to characterize the counterpart to the INTErnational Gamma-Ray Astrophysics Laboratory high-mass X-ray binary candidate IGR J19294+1816 so as to establish its true nature. We obtained H-band spectra of the selected counterpart acquired with the Near Infrared Camera and Spectrograph instrument mounted on the Telescopio Nazionale Galileo 3.5-m telescope which represents the first infrared spectrum ever taken of this source. We complement the spectral analysis with infrared photometry from UKIDSS, 2MASS, WISE, and NEOWISE data bases. We classify the mass donor as a Be star. Subsequently, we compute its distance by properly taking into account the contamination produced by the circumstellar envelope. The findings indicate that IGR J19294+1816 is a transient source with a B1Ve donor at a distance of d = 11 ± 1 kpc, and luminosities of the order of 1036-37 erg s-1, displaying the typical behaviour of a Be-X-ray binary.

  20. Separation of Single-stranded DNA, Double-stranded DNA and RNA from an Environmental Viral Community Using Hydroxyapatite Chromatography

    PubMed Central

    Fadrosh, Douglas W.; Andrews-Pfannkoch, Cynthia; Williamson, Shannon J.

    2011-01-01

    Viruses, particularly bacteriophages (phages), are the most numerous biological entities on Earth1,2. Viruses modulate host cell abundance and diversity, contribute to the cycling of nutrients, alter host cell phenotype, and influence the evolution of both host cell and viral communities through the lateral transfer of genes 3. Numerous studies have highlighted the staggering genetic diversity of viruses and their functional potential in a variety of natural environments. Metagenomic techniques have been used to study the taxonomic diversity and functional potential of complex viral assemblages whose members contain single-stranded DNA (ssDNA), double-stranded DNA (dsDNA) and RNA genotypes 4-9. Current library construction protocols used to study environmental DNA-containing or RNA-containing viruses require an initial nuclease treatment in order to remove nontargeted templates 10. However, a comprehensive understanding of the collective gene complement of the virus community and virus diversity requires knowledge of all members regardless of genome composition. Fractionation of purified nucleic acid subtypes provides an effective mechanism by which to study viral assemblages without sacrificing a subset of the community’s genetic signature. Hydroxyapatite, a crystalline form of calcium phosphate, has been employed in the separation of nucleic acids, as well as proteins and microbes, since the 1960s11. By exploiting the charge interaction between the positively-charged Ca2+ ions of the hydroxyapatite and the negatively charged phosphate backbone of the nucleic acid subtypes, it is possible to preferentially elute each nucleic acid subtype independent of the others. We recently employed this strategy to independently fractionate the genomes of ssDNA, dsDNA and RNA-containing viruses in preparation of DNA sequencing 12. Here, we present a method for the fractionation and recovery of ssDNA, dsDNA and RNA viral nucleic acids from mixed viral assemblages using hydroxyapatite chromotography. PMID:21989424

  1. New paradigms in the repair of oxidative damage in human genome: mechanisms ensuring repair of mutagenic base lesions during replication and involvement of accessory proteins.

    PubMed

    Dutta, Arijit; Yang, Chunying; Sengupta, Shiladitya; Mitra, Sankar; Hegde, Muralidhar L

    2015-05-01

    Oxidized bases in the mammalian genome, which are invariably mutagenic due to their mispairing property, are continuously induced by endogenous reactive oxygen species and more abundantly after oxidative stress. Unlike bulky base adducts induced by UV and other environmental mutagens in the genome that block replicative DNA polymerases, oxidatively damaged bases such as 5-hydroxyuracil, produced by oxidative deamination of cytosine in the template strand, do not block replicative polymerases and thus need to be repaired prior to replication to prevent mutation. Following up our earlier studies, which showed that the Nei endonuclease VIII like 1 (NEIL1) DNA glycosylase, one of the five base excision repair (BER)-initiating enzymes in mammalian cells, has enhanced expression during the S-phase and higher affinity for replication fork-mimicking single-stranded (ss) DNA substrates, we recently provided direct experimental evidence for NEIL1's role in replicating template strand repair. The key requirement for this event, which we named as the 'cow-catcher' mechanism of pre-replicative BER, is NEIL1's non-productive binding (substrate binding without product formation) to the lesion base in ss DNA template to stall DNA synthesis, causing fork regression. Repair of the lesion in reannealed duplex is then carried out by NEIL1 in association with the DNA replication proteins. NEIL1 (and other BER-initiating enzymes) also interact with several accessory and non-canonical proteins including the heterogeneous nuclear ribonucleoprotein U and Y-box-binding protein 1 as well as high mobility group box 1 protein, whose precise roles in BER are still obscure. In this review, we have discussed the recent advances in our understanding of oxidative genome damage repair pathways with particular focus on the pre-replicative template strand repair and the role of scaffold factors like X-ray repairs cross-complementing protein 1 and poly (ADP-ribose) polymerase 1 and other accessory proteins guiding distinct BER sub-pathways.

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Helfenbein, Kevin G.; Brown, Wesley M.; Boore, Jeffrey L.

    We have sequenced the complete mitochondrial DNA (mtDNA) of the articulate brachiopod Terebratalia transversa. The circular genome is 14,291 bp in size, relatively small compared to other published metazoan mtDNAs. The 37 genes commonly found in animal mtDNA are present; the size decrease is due to the truncation of several tRNA, rRNA, and protein genes, to some nucleotide overlaps, and to a paucity of non-coding nucleotides. Although the gene arrangement differs radically from those reported for other metazoans, some gene junctions are shared with two other articulate brachiopods, Laqueus rubellus and Terebratulina retusa. All genes in the T. transversa mtDNA,more » unlike those in most metazoan mtDNAs reported, are encoded by the same strand. The A+T content (59.1 percent) is low for a metazoan mtDNA, and there is a high propensity for homopolymer runs and a strong base-compositional strand bias. The coding strand is quite G+T-rich, a skew that is shared by the confamilial (laqueid) specie s L. rubellus, but opposite to that found in T. retusa, a cancellothyridid. These compositional skews are strongly reflected in the codon usage patterns and the amino acid compositions of the mitochondrial proteins, with markedly different usage observed between T. retusa and the two laqueids. This observation, plus the similarity of the laqueid non-coding regions to the reverse complement of the non-coding region of the cancellothyridid, suggest that an inversion that resulted in a reversal in the direction of first-strand replication has occurred in one of the two lineages. In addition to the presence of one non-coding region in T. transversa that is comparable to those in the other brachiopod mtDNAs, there are two others with the potential to form secondary structures; one or both of these may be involved in the process of transcript cleavage.« less

  3. Lack of KIs virus DNA in plasma and cerebrospinal fluid in Italy.

    PubMed

    Macera, Lisa; Focosi, Daniele; Manzin, Aldo; Ceccherini Nelli, Luca; Pistello, Mauro; Maggi, Fabrizio

    2015-10-01

    Dear Sirs, Satoh et al. recently screened 516 Japanese blood donors with PCR using primers constructed from the consensus domain of the helicase of positive-stranded RNA viruses. They reported a novel enveloped virus with a circular double-stranded DNA genome (tentatively named KIs virus, KIs-V) (Satoh et al., 2011) occurring in 36 out of the 100 hepatitis E (HEV) antibody-positive donors with elevated alanine aminotransferase (ALT) levels (>60 IU/L). More recently, Biagini et al. failed to find KIs-V in plasma from 576 French blood donors with unknown HEV serostatus and unknown ALT values (Biagini et al., 2012). Based on an HEV seroprevalence of 3-52% in France, the authors suggested an uncommon frequency of KIs-V infection in healthy persons in France. To date, no information has been available on the prevalence of KIs-V DNA in Italy. In the present paper, we analyzed KIs-V in 242 plasma samples of blood donors, transplant recipients, and patients with chronic viral infections, and in 52 cerebrospinal fluid (CSF) samples of patients with different neurological disorders. Informed consent was obtained from all patients and the study was performed in accordance with the ethical standards laid down in the 1964 Declaration of Helsinki and its amendments. Viral DNA extraction was carried out on 200 μl of plasma or 200 μl of CSF by using QIAamp DNA blood kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. Extracted nucleic acids were amplified for KIs-V DNA with the nested PCR protocol developed by Satoh et al. (2011) and used for screening Japanese blood donors. The first and second PCR rounds were designed on 458 and 304 nt-length fragments, respectively. To validate the amplification process, positive controls obtained from plasma dilutions of a synthetic template corresponding to the target sequence were run in each PCR. PCR sensitivity was less than 5 copies of target sequence. Fourteen liver and 16 kidney and/or pancreas transplant recipients were tested before transplantation and at the time after transplantation when viremia levels of TTV were highest, TTV having been validated by our group and others as a marker of functional immune deficiency (Focosi et al., 2014). None of the samples tested positive for KIs-V. At the same time, we also tested 79 healthy blood donors. Since determination of ALT is a mandatory part of on blood donation according to Italian law we could establish that only 2 donors had ALT values >60 IU/L but in any case <80 IU/L: all of them tested negative for KIs-V. No information on HEV status was available and HEV seroprevalence studies are limited in Italy (Arends et al., 2014). However regional studies show prevalences ranging from 2.9% to 8.8% (Masia et al., 2009). We also tested 50 HIV-positive patients, 41 HCV-positive patients, and 42 HBV-positive patients. None of the samples tested positive for KIs-V. Finally, cerebrospinal fluid from 52 patients with different neurological disorders was also tested. All these samples were negative for KIs-V DNA. Thus, although we cannot rule out the possibility that KIs-V circulates in Italy at a very low level and genetically different from the virus found in Japanese population, the results seem to demonstrate a very low prevalence of this novel virus in the Italian population. While the implication of KIs-V in human health remains under debate, extensive regional surveys will help to elucidate the geographical spread of KIs-V and to understand the natural history of the infection in human beings.

  4. Maternal vaccination with a fimbrial tip adhesin and passive protection of neonatal mice against lethal human enterotoxigenic Escherichia coli challenge.

    PubMed

    Luiz, Wilson B; Rodrigues, Juliana F; Crabb, Joseph H; Savarino, Stephen J; Ferreira, Luis C S

    2015-12-01

    Globally, enterotoxigenic Escherichia coli (ETEC) is a leading cause of childhood and travelers' diarrhea, for which an effective vaccine is needed. Prevalent intestinal colonization factors (CFs) such as CFA/I fimbriae and heat-labile enterotoxin (LT) are important virulence factors and protective antigens. We tested the hypothesis that donor strand-complemented CfaE (dscCfaE), a stabilized form of the CFA/I fimbrial tip adhesin, is a protective antigen, using a lethal neonatal mouse ETEC challenge model and passive dam vaccination. For CFA/I-ETEC strain H10407, which has been extensively studied in volunteers, an inoculum of 2 × 10(7) bacteria resulted in 50% lethal doses (LD50) in neonatal DBA/2 mice. Vaccination of female DBA/2 mice with CFA/I fimbriae or dscCfaE, each given with a genetically attenuated LT adjuvant (LTK63) by intranasal or orogastric delivery, induced high antigen-specific serum IgG and fecal IgA titers and detectable milk IgA responses. Neonates born to and suckled by dams antenatally vaccinated with each of these four regimens showed 78 to 93% survival after a 20× LD50 challenge with H10407, compared to 100% mortality in pups from dams vaccinated with sham vaccine or LTK63 only. Crossover experiments showed that high pup survival rates after ETEC challenge were associated with suckling but not birthing from vaccinated dams, suggesting that vaccine-specific milk antibodies are protective. In corroboration, preincubation of the ETEC inoculum with antiadhesin and antifimbrial bovine colostral antibodies conferred a dose-dependent increase in pup survival after challenge. These findings indicate that the dscCfaE fimbrial tip adhesin serves as a protective passive vaccine antigen in this small animal model and merits further evaluation. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  5. Autologous peripheral blood haematopoietic stem cell transplantation for systemic lupus erythematosus: the observation of long-term outcomes in a Chinese centre.

    PubMed

    Cao, Can; Wang, Menglei; Sun, Jing; Peng, Xuebiao; Liu, Qifa; Huang, Liang; Chai, Yanyan; Lai, Kuan; Chen, Pingjiao; Liu, Qingxiu; Li, Qian; Peng, Yusheng; Xiong, Hao; Zhang, Jing; Chen, Minghua; Zeng, Kang

    2017-01-01

    We aimed to evaluate the safety and long-term efficacy of autologous peripheral blood haematopoietic stem cell transplantation (APHSCT). We did not want to evaluate the efficacy of antibodies but rather the clinical response by investigating progression-free survival and serologic response by assessing autoantibody titres and complement levels. Overall, 22 patients with SLE (17 females; median age, 23 years) undergoing APHSCT were included. The 3-year progression-free survival (PFS) was 77.27% at our centre. We found that all the patients survived over three years. The 5-year PFS and overall survival (OS) rate was 67.90% and 95.20%. The titres of antinuclear antibody (ANA), anti-double-stranded deoxyribonucleic acid antibody (anti-dsDNA), anti-Sm antibody, and 24-h urinary protein significantly decreased, while complements 3 (C3) and C4 normalised at 100 days after transplantation (p<0.05). Kidney re-biopsy revealed a decrease in immune complex deposits in patients with remission. The incidence of CMV reactivation was 59.09% after transplantation in 3 years. Pregnancy and childbirth were reported in three female patients after transplantation. The risk of post-transplantation complications persisted for many years. Immunoablation followed by APHSCT has the potential to induce long-term clinical and serologic remissions despite withdrawal of immunosuppressive maintenance therapy. While relapses may occur, in our small cohort of patients we found no predictive markers for relapse development by analysing antibody and complement levels and urinary proteinuria.

  6. Phylogenetic and Complementation Analysis of a Single-Stranded DNA Binding Protein Family from Lactococcal Phages Indicates a Non-Bacterial Origin

    PubMed Central

    Mariadassou, Mahendra; Bardowski, Jacek K.; Bidnenko, Elena

    2011-01-01

    Background The single-stranded-nucleic acid binding (SSB) protein superfamily includes proteins encoded by different organisms from Bacteria and their phages to Eukaryotes. SSB proteins share common structural characteristics and have been suggested to descend from an ancestor polypeptide. However, as other proteins involved in DNA replication, bacterial SSB proteins are clearly different from those found in Archaea and Eukaryotes. It was proposed that the corresponding genes in the phage genomes were transferred from the bacterial hosts. Recently new SSB proteins encoded by the virulent lactococcal bacteriophages (Orf14bIL67-like proteins) have been identified and characterized structurally and biochemically. Methodology/Principal Findings This study focused on the determination of phylogenetic relationships between Orf14bIL67-like proteins and other SSBs. We have performed a large scale phylogenetic analysis and pairwise sequence comparisons of SSB proteins from different phyla. The results show that, in remarkable contrast to other phage SSBs, the Orf14bIL67–like proteins form a distinct, self-contained and well supported phylogenetic group connected to the archaeal SSBs. Functional studies demonstrated that, despite the structural and amino acid sequence differences from bacterial SSBs, Orf14bIL67 protein complements the conditional lethal ssb-1 mutation of Escherichia coli. Conclusions/Significance Here we identified for the first time a group of phages encoded SSBs which are clearly distinct from their bacterial counterparts. All methods supported the recognition of these phage proteins as a new family within the SSB superfamily. Our findings suggest that unlike other phages, the virulent lactococcal phages carry ssb genes that were not acquired from their hosts, but transferred from an archaeal genome. This represents a unique example of a horizontal gene transfer between Archaea and bacterial phages. PMID:22073223

  7. Analysis of DNA binding by human factor xeroderma pigmentosum complementation group A (XPA) provides insight into its interactions with nucleotide excision repair substrates.

    PubMed

    Sugitani, Norie; Voehler, Markus W; Roh, Michelle S; Topolska-Woś, Agnieszka M; Chazin, Walter J

    2017-10-13

    Xeroderma pigmentosum (XP) complementation group A (XPA) is an essential scaffolding protein in the multiprotein nucleotide excision repair (NER) machinery. The interaction of XPA with DNA is a core function of this protein; a number of mutations in the DNA-binding domain (DBD) are associated with XP disease. Although structures of the central globular domain of human XPA and data on binding of DNA substrates have been reported, the structural basis for XPA's DNA-binding activity remains unknown. X-ray crystal structures of the central globular domain of yeast XPA (Rad14) with lesion-containing DNA duplexes have provided valuable insights, but the DNA substrates used for this study do not correspond to the substrates of XPA as it functions within the NER machinery. To better understand the DNA-binding activity of human XPA in NER, we used NMR to investigate the interaction of its DBD with a range of DNA substrates. We found that XPA binds different single-stranded/double-stranded junction DNA substrates with a common surface. Comparisons of our NMR-based mapping of binding residues with the previously reported Rad14-DNA crystal structures revealed similarities and differences in substrate binding between XPA and Rad14. This includes direct evidence for DNA contacts to the residues extending C-terminally from the globular core, which are lacking in the Rad14 construct. Moreover, mutation of the XPA residue corresponding to Phe-262 in Rad14, previously reported as being critical for DNA binding, had only a moderate effect on the DNA-binding activity of XPA. The DNA-binding properties of several disease-associated mutations in the DBD were investigated. These results suggest that for XPA mutants exhibiting altered DNA-binding properties, a correlation exists between the extent of reduction in DNA-binding affinity and the severity of symptoms in XP patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Skipping of exon 27 in C3 gene compromises TED domain and results in complete human C3 deficiency.

    PubMed

    da Silva, Karina Ribeiro; Fraga, Tatiana Rodrigues; Lucatelli, Juliana Faggion; Grumach, Anete Sevciovic; Isaac, Lourdes

    2016-05-01

    Primary deficiency of complement C3 is rare and usually associated with increased susceptibility to bacterial infections. In this work, we investigated the molecular basis of complete C3 deficiency in a Brazilian 9-year old female patient with a family history of consanguinity. Hemolytic assays revealed complete lack of complement-mediated hemolytic activity in the patient's serum. While levels of the complement regulatory proteins Factor I, Factor H and Factor B were normal in the patient's and family members' sera, complement C3 levels were undetectable in the patient's serum and were reduced by at least 50% in the sera of the patient's parents and brother. Additionally, no C3 could be observed in the patient's plasma and cell culture supernatants by Western blot. We also observed that patient's skin fibroblasts stimulated with Escherichia coli LPS were unable to secrete C3, which might be accumulated within the cells before being intracellularly degraded. Sequencing analysis of the patient's C3 cDNA revealed a genetic mutation responsible for the complete skipping of exon 27, resulting in the loss of 99 nucleotides (3450-3549) located in the TED domain. Sequencing of the intronic region between the exons 26 and 27 of the C3 gene (nucleotides 6690313-6690961) showed a nucleotide exchange (T→C) at position 6690626 located in a splicing donor site, resulting in the complete skipping of exon 27 in the C3 mRNA. Copyright © 2016. Published by Elsevier GmbH.

  9. DNA double-strand break response factors influence end-joining features of IgH class switch and general translocation junctions.

    PubMed

    Panchakshari, Rohit A; Zhang, Xuefei; Kumar, Vipul; Du, Zhou; Wei, Pei-Chi; Kao, Jennifer; Dong, Junchao; Alt, Frederick W

    2018-01-23

    Ig heavy chain (IgH) class switch recombination (CSR) in B lymphocytes switches IgH constant regions to change antibody functions. CSR is initiated by DNA double-strand breaks (DSBs) within a donor IgH switch (S) region and a downstream acceptor S region. CSR is completed by fusing donor and acceptor S region DSB ends by classical nonhomologous end-joining (C-NHEJ) and, in its absence, by alternative end-joining that is more biased to use longer junctional microhomologies (MHs). Deficiency for DSB response (DSBR) factors, including ataxia telangiectasia-mutated (ATM) and 53BP1, variably impair CSR end-joining, with 53BP1 deficiency having the greatest impact. However, studies of potential impact of DSBR factor deficiencies on MH-mediated CSR end-joining have been technically limited. We now use a robust DSB joining assay to elucidate impacts of deficiencies for DSBR factors on CSR and chromosomal translocation junctions in primary mouse B cells and CH12F3 B-lymphoma cells. Compared with wild-type, CSR and c-myc to S region translocation junctions in the absence of 53BP1, and, to a lesser extent, other DSBR factors, have increased MH utilization; indeed, 53BP1-deficient MH profiles resemble those associated with C-NHEJ deficiency. However, translocation junctions between c-myc DSB and general DSBs genome-wide are not MH-biased in ATM-deficient versus wild-type CH12F3 cells and are less biased in 53BP1- and C-NHEJ-deficient cells than CSR junctions or c-myc to S region translocation junctions. We discuss potential roles of DSBR factors in suppressing increased MH-mediated DSB end-joining and features of S regions that may render their DSBs prone to MH-biased end-joining in the absence of DSBR factors.

  10. Effect of solvent additives and P3HT on PDTSTTz/PCBM-based bulk heterojunction solar cells

    NASA Astrophysics Data System (ADS)

    Ergete, Assegid; Sabir, Fedlu K.; Li, Yongfang; Yohannes, Teketel

    2015-01-01

    In this investigation, photovoltaic (PV) parameters improvements in poly[2,6-(4,4‧-bis(2-ethylhexyl)dithieno[3,2-b:2‧,3‧-d]silole)-alt-5,5‧-(3,6-bis[4-(2-ethylhexyl)thienyl-2-yl]-s-tetrazine] and fullerene derivative [6,6]-phenyl-C61-butyric acid methyl ester (PDTSTTz:PCBM) blend were made through solvent additives and secondary donor addition. Short carbon chain solvent additives such as iodomethane (IMe), iodoethane (IEt), iodobutane (IBu), and diiodomethane (DIMe) were used. The results have shown that the short circuit current density (Jsc), as well as power conversion efficiency (PCE) of PDTSTTz:PCBM blend cell increased with the increase in length of carbon chains of the additives. IBu, with relatively the longest carbon chain, has better performance-improving impact than IMe (with the shortest carbon chain). The same trend was observed for fill factor. The other PV parameter, open circuit voltages (Voc), did not show significant change following these solvent additives. The effect of a secondary (additional) donor on the PDTSTTz/PCBM system was investigated by adding different proportions of poly(3-hexylthiophene-2,5-diyl) (P3HT). Because P3HT (secondary donor) and PDTSTTz (hosting donor) complement each other in light absorption, the PDTSTTz/PCBM system containing an optimum proportion of P3HT could provide a wider range of light absorption, and as a result it exhibited a higher short circuit current (11.08 mA/cm2) and then a PCE of 2.42%.

  11. [Serological screening for Trypanosoma cruzi among blood donors in central Brazil].

    PubMed

    de Andrade, A L; Martelli, C M; Luquetti, A O; de Oliveira, O S; Almeida e Silva, S; Zicker, F

    1992-07-01

    The present study compares the results of serological screening for Trypanosoma cruzi infection done at blood banks with results obtained in Chagas' disease studies undertaken by the Reference Laboratory of the Federal University of Goiás (UFG) and evaluates the use of the enzyme-linked immunosorbent assay (ELISA) for this purpose. The study was conducted with data from six of the eight blood banks in the city of Goiânia in central Brazil, an urban area in which this infection is highly endemic. The population studied consisted of 1,513 volunteers who had donated blood for the first time between October 1988 and April 1989. The sample represented 50% of all first-time blood donors during the period. Of these donors, 94% were residents of urban areas, and of these, approximately 26% had migrated from the countryside. Nearly 90% of the blood donations in the city are received at these banks, which normally use the indirect hemagglutination and complement-fixation tests. The samples selected for the study of T. cruzi antibody in first-time blood donors were assayed at the Reference Laboratory of the Federal University of Goiás using the indirect hemagglutination (IH), indirect immunofluorescence (IF), and enzyme-linked immunosorbent assay (ELISA) tests, independently of the serological classification performed by the blood banks. Comparison of the results provided by the latter with the positivity pattern established in the study (IH and IF yielded simultaneous positive results in the Reference Laboratory) revealed a relative sensitivity of 77%, with extremes ranging between 50% and 100%, depending on the blood bank studied.(ABSTRACT TRUNCATED AT 250 WORDS)

  12. Somatic, hematologic phenotype, long-term outcome, and effect of hematopoietic stem cell transplantation. An analysis of 97 Fanconi anemia patients from the Italian national database on behalf of the Marrow Failure Study Group of the AIEOP (Italian Association of Pediatric Hematology-Oncology).

    PubMed

    Svahn, Johanna; Bagnasco, Francesca; Cappelli, Enrico; Onofrillo, Daniela; Caruso, Silvia; Corsolini, Fabio; De Rocco, Daniela; Savoia, Anna; Longoni, Daniela; Pillon, Marta; Marra, Nicoletta; Ramenghi, Ugo; Farruggia, Piero; Locasciulli, Anna; Addari, Carmen; Cerri, Carla; Mastrodicasa, Elena; Casazza, Gabriella; Verzegnassi, Federico; Riccardi, Francesca; Haupt, Riccardo; Barone, Angelica; Cesaro, Simone; Cugno, Chiara; Dufour, Carlo

    2016-07-01

    We analyzed 97 Fanconi anemia patients from a clinic/biological database for genotype, somatic, and hematologic phenotype, adverse hematological events, solid tumors, and treatment. Seventy-two patients belonged to complementation group A. Eighty percent of patients presented with mild/moderate somatic phenotype and most with cytopenia. No correlation was seen between somatic/hematologic phenotype and number of missense mutations of FANCA alleles. Over follow-up, 33% of patients improved or maintained mild/moderate cytopenia or normal blood count, whereas remaining worsened cytopenia. Eleven patients developed a hematological adverse event (MDS, AML, pathological cytogenetics) and three developed solid tumors. 10 years cumulative risk of death of the whole cohort was 25.6% with median follow-up 5.8 years. In patients eligible to hematopoietic stem cell transplantation because of moderate cytopenia, mortality was significantly higher in subjects transplanted from matched unrelated donor over nontransplanted subjects, whereas there was no significant difference between matched sibling donor transplants and nontransplanted patients. In patients eligible to transplant because of severe cytopenia and clonal disease, mortality risk was not significantly different in transplanted from matched unrelated versus matched sibling donor versus nontransplanted subjects. The decision to transplant should rely on various elements including, type of donor, HLA matching, patient comorbidities, impairment, and clonal evolution of hematopoiesis. Am. J. Hematol. 91:666-671, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  13. The Gift Relationship Revisited.

    PubMed

    Shearmur, Jeremy Frank

    2015-12-01

    If unremunerated blood donors are willing to participate, and if the use of them is economical from the perspective of those collecting blood, I can see no objection to their use. But there seems to me no good reason, moral or practical, why they should be used. The system of paid plasmapheresis as it currently operates in the United States and in Canada would seem perfectly adequate, and while there may always be ways in which the safety and efficiency of supply could be increased, there seems no reason whatever to think that there would be an improvement if the current system changed so as to rely entirely on unpaid donors. Further, given the adequacy of paid plasmapheresis, I could see no problem if the collection of whole blood were to take place on a similar, fully-commercial, basis. Such a view is controversial. To argue for it, this paper offers just one strand in a complex argument: a critique of Richard Titmuss's Gift Relationship, which holds an iconic position in the critical literature on the paid provision of blood. As I conclude: all told, there seems no good basis for rejecting supply of whole blood for money--let alone the supply of blood plasma.

  14. Enterococcus faecalis Sex Pheromone cCF10 Enhances Conjugative Plasmid Transfer In Vivo.

    PubMed

    Hirt, Helmut; Greenwood-Quaintance, Kerryl E; Karau, Melissa J; Till, Lisa M; Kashyap, Purna C; Patel, Robin; Dunny, Gary M

    2018-02-13

    Cell-cell communication mediated by peptide pheromones (cCF10 [CF]) is essential for high-frequency plasmid transfer in vitro in Enterococcus faecalis To examine the role of pheromone signaling in vivo , we established either a CF-producing (CF+) recipient or a recipient producing a biologically inactive variant of CF (CF- recipient) in a germfree mouse model 3 days before donor inoculation and determined transfer frequencies of the pheromone-inducible plasmid pCF10. Plasmid transfer was detected in the upper and middle sections of the intestinal tract 5 h after donor inoculation and was highly efficient in the absence of antibiotic selection. The transconjugant/donor ratio reached a maximum level approaching 1 on day 4 in the upper intestinal tract. Plasmid transfer was significantly lower with the CF- recipient. While rescue of the CF- mating defect by coculture with CF+ recipients is easily accomplished in vitro , no extracellular complementation occurred in vivo This suggests that most pheromone signaling in the gut occurs between recipient and donor cells in very close proximity. Plasmid-bearing cells (donors plus transconjugants) steadily increased in the population from 0.1% after donor inoculation to about 10% at the conclusion of the experiments. This suggests a selective advantage of pCF10 carriage distinct from antibiotic resistance or bacteriocin production. Our results demonstrate that pheromone signaling is required for efficient pCF10 transfer in vivo In the absence of CF+ recipients, a low level of transfer to CF- recipients occurred in the gut. This may result from low-level host-mediated induction of the donors in the gastrointestinal (GI) tract, similar to that previously observed in serum. IMPORTANCE Horizontal gene transfer is a major factor in the biology of Enterococcus faecalis , an important nosocomial pathogen. Previous studies showing efficient conjugative plasmid transfer in the gastrointestinal (GI) tracts of experimental animals did not examine how the enterococcal sex pheromone response impacts the efficiency of transfer. Our study demonstrates for the first time pheromone-enhanced, high-frequency plasmid transfer of E. faecalis plasmid pCF10 in a mouse model in the absence of antibiotic or bacteriocin selection. Pheromone production by recipients dramatically increased plasmid transfer in germfree mice colonized initially with recipients, followed by donors. The presence of a coresident community of common gut microbes did not significantly reduce in vivo plasmid transfer between enterococcal donors and recipients. In mice colonized with enterococcal recipients, we detected plasmid transfer in the intestinal tract within 5 h of addition of donors, before transconjugants could be cultured from feces. Surprisingly, pCF10 carriage provided a competitive fitness advantage unrelated to antibiotic resistance or bacteriocin production. Copyright © 2018 Hirt et al.

  15. Fluorescence energy transfer as a probe for nucleic acid structures and sequences.

    PubMed Central

    Mergny, J L; Boutorine, A S; Garestier, T; Belloc, F; Rougée, M; Bulychev, N V; Koshkin, A A; Bourson, J; Lebedev, A V; Valeur, B

    1994-01-01

    The primary or secondary structure of single-stranded nucleic acids has been investigated with fluorescent oligonucleotides, i.e., oligonucleotides covalently linked to a fluorescent dye. Five different chromophores were used: 2-methoxy-6-chloro-9-amino-acridine, coumarin 500, fluorescein, rhodamine and ethidium. The chemical synthesis of derivatized oligonucleotides is described. Hybridization of two fluorescent oligonucleotides to adjacent nucleic acid sequences led to fluorescence excitation energy transfer between the donor and the acceptor dyes. This phenomenon was used to probe primary and secondary structures of DNA fragments and the orientation of oligodeoxynucleotides synthesized with the alpha-anomers of nucleoside units. Fluorescence energy transfer can be used to reveal the formation of hairpin structures and the translocation of genes between two chromosomes. PMID:8152922

  16. Chromosomal abnormalities in human sperm

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martin, R.H.

    1985-01-01

    The ability to analyze human sperm chromosome complements after penetration of zona pellucida-free hamster eggs provides the first opportunity to study the frequency and type of chromosomal abnormalities in human gametes. Two large-scale studies have provided information on normal men. We have studied 1,426 sperm complements from 45 normal men and found an abnormality rate of 8.9%. Brandriff et al. (5) found 8.1% abnormal complements in 909 sperm from 4 men. The distribution of numerical and structural abnormalities was markedly dissimilar in the 2 studies. The frequency of aneuploidy was 5% in our sample and only 1.6% in Brandriff's, perhapsmore » reflecting individual variability among donors. The frequency of 24,YY sperm was low: 0/1,426 and 1/909. This suggests that the estimates of nondisjunction based on fluorescent Y body data (1% to 5%) are not accurate. We have also studied men at increased risk of sperm chromosomal abnormalities. The frequency of chromosomally unbalanced sperm in 6 men heterozygous for structural abnormalities varied dramatically: 77% for t11;22, 32% for t6;14, 19% for t5;18, 13% for t14;21, and 0% for inv 3 and 7. We have also studied 13 cancer patients before and after radiotherapy and demonstrated a significant dose-dependent increase of sperm chromosome abnormalities (numerical and structural) 36 months after radiation treatment.« less

  17. Molluskan Hemocyanins Activate the Classical Pathway of the Human Complement System through Natural Antibodies

    PubMed Central

    Pizarro-Bauerle, Javier; Maldonado, Ismael; Sosoniuk-Roche, Eduardo; Vallejos, Gerardo; López, Mercedes N.; Salazar-Onfray, Flavio; Aguilar-Guzmán, Lorena; Valck, Carolina; Ferreira, Arturo; Becker, María Inés

    2017-01-01

    Molluskan hemocyanins are enormous oxygen-carrier glycoproteins that show remarkable immunostimulatory properties when inoculated in mammals, such as the generation of high levels of antibodies, a strong cellular reaction, and generation of non-specific antitumor immune responses in some types of cancer, particularly for superficial bladder cancer. These proteins have the ability to bias the immune response toward a Th1 phenotype. However, despite all their current uses with beneficial clinical outcomes, a clear mechanism explaining these properties is not available. Taking into account reports of natural antibodies against the hemocyanin of the gastropod Megathura crenulata [keyhole limpet hemocyanin (KLH)] in humans as well as other vertebrate species, we report here for the first time, the presence, in sera from unimmunized healthy donors, of antibodies recognizing, in addition to KLH, two other hemocyanins from gastropods with documented immunomodulatory capacities: Fisurella latimarginata hemocyanin (FLH) and Concholepas concholepas hemocyanin (CCH). Through an ELISA screening, we found IgM and IgG antibodies reactive with these hemocyanins. When the capacity of these antibodies to bind deglycosylated hemocyanins was studied, no decreased interaction was detected. Moreover, in the case of FLH, deglycosylation increased antibody binding. We evaluated through an in vitro complement deposition assay whether these antibodies activated the classical pathway of the human complement system. The results showed that all three hemocyanins and their deglycosylated counterparts elicited this activation, mediated by C1 binding to immunoglobulins. Thus, this work contributes to the understanding on how the complement system could participate in the immunostimulatory properties of hemocyanins, through natural, complement-activating antibodies reacting with these proteins. Although a role for carbohydrates cannot be completely ruled out, in our experimental setting, glycosylation status had a limited effect. Finally, our data open possibilities for further studies leading to the design of improved hemocyanin-based research tools for diagnosis and immunotherapy. PMID:28286504

  18. Molluskan Hemocyanins Activate the Classical Pathway of the Human Complement System through Natural Antibodies.

    PubMed

    Pizarro-Bauerle, Javier; Maldonado, Ismael; Sosoniuk-Roche, Eduardo; Vallejos, Gerardo; López, Mercedes N; Salazar-Onfray, Flavio; Aguilar-Guzmán, Lorena; Valck, Carolina; Ferreira, Arturo; Becker, María Inés

    2017-01-01

    Molluskan hemocyanins are enormous oxygen-carrier glycoproteins that show remarkable immunostimulatory properties when inoculated in mammals, such as the generation of high levels of antibodies, a strong cellular reaction, and generation of non-specific antitumor immune responses in some types of cancer, particularly for superficial bladder cancer. These proteins have the ability to bias the immune response toward a T h 1 phenotype. However, despite all their current uses with beneficial clinical outcomes, a clear mechanism explaining these properties is not available. Taking into account reports of natural antibodies against the hemocyanin of the gastropod Megathura crenulata [keyhole limpet hemocyanin (KLH)] in humans as well as other vertebrate species, we report here for the first time, the presence, in sera from unimmunized healthy donors, of antibodies recognizing, in addition to KLH, two other hemocyanins from gastropods with documented immunomodulatory capacities: Fisurella latimarginata hemocyanin (FLH) and Concholepas concholepas hemocyanin (CCH). Through an ELISA screening, we found IgM and IgG antibodies reactive with these hemocyanins. When the capacity of these antibodies to bind deglycosylated hemocyanins was studied, no decreased interaction was detected. Moreover, in the case of FLH, deglycosylation increased antibody binding. We evaluated through an in vitro complement deposition assay whether these antibodies activated the classical pathway of the human complement system. The results showed that all three hemocyanins and their deglycosylated counterparts elicited this activation, mediated by C1 binding to immunoglobulins. Thus, this work contributes to the understanding on how the complement system could participate in the immunostimulatory properties of hemocyanins, through natural, complement-activating antibodies reacting with these proteins. Although a role for carbohydrates cannot be completely ruled out, in our experimental setting, glycosylation status had a limited effect. Finally, our data open possibilities for further studies leading to the design of improved hemocyanin-based research tools for diagnosis and immunotherapy.

  19. Mycoviruses as Triggers and Targets of RNA Silencing in White Mold Fungus Sclerotinia sclerotiorum.

    PubMed

    Mochama, Pauline; Jadhav, Prajakta; Neupane, Achal; Lee Marzano, Shin-Yi

    2018-04-22

    This study aimed to demonstrate the existence of antiviral RNA silencing mechanisms in Sclerotinia sclerotiorum by infecting wild-type and RNA-silencing-deficient strains of the fungus with an RNA virus and a DNA virus. Key silencing-related genes were disrupted to dissect the RNA silencing pathway. Specifically, dicer genes ( dcl-1, dcl-2 , and both dcl-1 / dcl-2 ) were displaced by selective marker(s). Disruption mutants were then compared for changes in phenotype, virulence, and susceptibility to virus infections. Wild-type and mutant strains were transfected with a single-stranded RNA virus, SsHV2-L, and copies of a single-stranded DNA mycovirus, SsHADV-1, as a synthetic virus constructed in this study. Disruption of dcl-1 or dcl-2 resulted in no changes in phenotype compared to wild-type S. sclerotiorum ; however, the double dicer mutant strain exhibited significantly slower growth. Furthermore, the Δdcl-1/dcl-2 double mutant, which was slow growing without virus infection, exhibited much more severe debilitation following virus infections including phenotypic changes such as slower growth, reduced pigmentation, and delayed sclerotial formation. These phenotypic changes were absent in the single mutants, Δdcl-1 and Δdcl-2 . Complementation of a single dicer in the double disruption mutant reversed viral susceptibility to the wild-type state. Virus-derived small RNAs were accumulated from virus-infected wild-type strains with strand bias towards the negative sense. The findings of these studies indicate that S. sclerotiorum has robust RNA silencing mechanisms that process both DNA and RNA mycoviruses and that, when both dicers are silenced, invasive nucleic acids can greatly debilitate the virulence of this fungus.

  20. Intramolecular interactions in aminoacyl nucleotides: Implications regarding the origin of genetic coding and protein synthesis

    NASA Technical Reports Server (NTRS)

    Lacey, J. C., Jr.; Mullins, D. W., Jr.; Watkins, C. L.; Hall, L. M.

    1986-01-01

    Cellular organisms store information as sequences of nucleotides in double stranded DNA. This information is useless unless it can be converted into the active molecular species, protein. This is done in contemporary creatures first by transcription of one strand to give a complementary strand of mRNA. The sequence of nucleotides is then translated into a specific sequence of amino acids in a protein. Translation is made possible by a genetic coding system in which a sequence of three nucleotides codes for a specific amino acid. The origin and evolution of any chemical system can be understood through elucidation of the properties of the chemical entities which make up the system. There is an underlying logic to the coding system revealed by a correlation of the hydrophobicities of amino acids and their anticodonic nucleotides (i.e., the complement of the codon). Its importance lies in the fact that every amino acid going into protein synthesis must first be activated. This is universally accomplished with ATP. Past studies have concentrated on the chemistry of the adenylates, but more recently we have found, through the use of NMR, that we can observe intramolecular interactions even at low concentrations, between amino acid side chains and nucleotide base rings in these adenylates. The use of this type of compound thus affords a novel way of elucidating the manner in which amino acids and nucleotides interact with each other. In aqueous solution, when a hydrophobic amino acid is attached to the most hydrophobic nucleotide, AMP, a hydrophobic interaction takes place between the amino acid side chain and the adenine ring. The studies to be reported concern these hydrophobic interactions.

  1. The food-borne pathogen Campylobacter jejuni depends on the AddAB DNA repair system to defend against bile in the intestinal environment.

    PubMed

    Gourley, Christopher R; Negretti, Nicholas M; Konkel, Michael E

    2017-10-31

    Accurate repair of DNA damage is crucial to ensure genome stability and cell survival of all organisms. Bile functions as a defensive barrier against intestinal colonization by pathogenic microbes. Campylobacter jejuni, a leading bacterial cause of foodborne illness, possess strategies to mitigate the toxic components of bile. We recently found that growth of C. jejuni in medium with deoxycholate, a component of bile, caused DNA damage consistent with the exposure to reactive oxygen species. We hypothesized that C. jejuni must repair DNA damage caused by reactive oxygen species to restore chromosomal integrity. Our efforts focused on determining the importance of the putative AddAB DNA repair proteins. A C. jejuni addAB mutant demonstrated enhanced sensitivity to deoxycholate and was impaired in DNA double strand break repair. Complementation of the addAB mutant restored resistance to deoxycholate, as well as function of the DNA double strand break repair system. The importance of these findings translated to the natural host, where the AddAB system was found to be required for efficient C. jejuni colonization of the chicken intestine. This research provides new insight into the molecular mechanism utilized by C. jejuni, and possibly other intestinal pathogens, to survive in the presence of bile.

  2. The structure and DNA-binding properties of Mgm101 from a yeast with a linear mitochondrial genome.

    PubMed

    Pevala, Vladimír; Truban, Dominika; Bauer, Jacob A; Košťan, Július; Kunová, Nina; Bellová, Jana; Brandstetter, Marlene; Marini, Victoria; Krejčí, Lumír; Tomáška, Ľubomír; Nosek, Jozef; Kutejová, Eva

    2016-03-18

    To study the mechanisms involved in the maintenance of a linear mitochondrial genome we investigated the biochemical properties of the recombination protein Mgm101 from Candida parapsilosis. We show that CpMgm101 complements defects associated with the Saccharomyces cerevisiae mgm101-1(ts) mutation and that it is present in both the nucleus and mitochondrial nucleoids of C. parapsilosis. Unlike its S. cerevisiae counterpart, CpMgm101 is associated with the entire nucleoid population and is able to bind to a broad range of DNA substrates in a non-sequence specific manner. CpMgm101 is also able to catalyze strand annealing and D-loop formation. CpMgm101 forms a roughly C-shaped trimer in solution according to SAXS. Electron microscopy of a complex of CpMgm101 with a model mitochondrial telomere revealed homogeneous, ring-shaped structures at the telomeric single-stranded overhangs. The DNA-binding properties of CpMgm101, together with its DNA recombination properties, suggest that it can play a number of possible roles in the replication of the mitochondrial genome and the maintenance of its telomeres. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Mechanisms of Surface-Mediated DNA Hybridization

    PubMed Central

    2015-01-01

    Single-molecule total internal reflection fluorescence microscopy was employed in conjunction with resonance energy transfer (RET) to observe the dynamic behavior of donor-labeled ssDNA at the interface between aqueous solution and a solid surface decorated with complementary acceptor-labeled ssDNA. At least 100 000 molecular trajectories were determined for both complementary strands and negative control ssDNA. RET was used to identify trajectory segments corresponding to the hybridized state. The vast majority of molecules from solution adsorbed nonspecifically to the surface, where a brief two-dimensional search was performed with a 7% chance of hybridization. Successful hybridization events occurred with a characteristic search time of ∼0.1 s, and unsuccessful searches resulted in desorption from the surface, ultimately repeating the adsorption and search process. Hybridization was reversible, and two distinct modes of melting (i.e., dehybridization) were observed, corresponding to long-lived (∼15 s) and short-lived (∼1.4 s) hybridized time intervals. A strand that melted back onto the surface could rehybridize after a brief search or desorb from the interface. These mechanistic observations provide guidance for technologies that involve DNA interactions in the near-surface region, suggesting a need to design surfaces that both enhance the complex multidimensional search process and stabilize the hybridized state. PMID:24708278

  4. Upconversion luminescence resonance energy transfer-based aptasensor for the sensitive detection of oxytetracycline.

    PubMed

    Zhang, Hui; Fang, Congcong; Wu, Shijia; Duan, Nuo; Wang, Zhouping

    2015-11-15

    In this work, a biosensor based on luminescence resonance energy transfer (LRET) from NaYF4:Yb,Tm upconversion nanoparticles (UCNPs) to SYBR Green I has been developed. The aptamers are covalently linked to UCNPs and hybridized with their complementary strands. The subsequent addition of SYBR Green allows SYBR Green I to insert into the formed double-stranded DNA (dsDNA) duplex and brings the energy donor and acceptor into close proximity, leading to the fluorescence of UCNPs transferred to SYBR Green I. When excited at 980 nm, the UCNPs emit luminescence at 477 nm, and this energy is transferred to SYBR Green I, which emits luminescence at 530 nm. In the presence of oxytetracycline (OTC), the aptamers prefer to bind to its corresponding analyte and dehybridize with the complementary DNA. This dehybridization leads to the liberation of SYBR Green I, which distances SYBR Green I from the UCNPs and recovers the UCNPs' luminescence. Under optimal conditions, a linear calibration is obtained between the ratio of I530 to I477 nm (I530/I477) and the OTC concentration, which ranges from 0.1 to 10 ng/ml with a limit of detection (LOD) of 0.054 ng/ml. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. The impact of homologous recombination repair deficiency on depleted uranium clastogenicity in Chinese hamster ovary cells: XRCC3 protects cells from chromosome aberrations, but increases chromosome fragmentation.

    PubMed

    Holmes, Amie L; Joyce, Kellie; Xie, Hong; Falank, Carolyne; Hinz, John M; Wise, John Pierce

    2014-04-01

    Depleted uranium (DU) is extensively used in both industry and military applications. The potential for civilian and military personnel exposure to DU is rising, but there are limited data on the potential health hazards of DU exposure. Previous laboratory research indicates DU is a potential carcinogen, but epidemiological studies remain inconclusive. DU is genotoxic, inducing DNA double strand breaks, chromosome damage and mutations, but the mechanisms of genotoxicity or repair pathways involved in protecting cells against DU-induced damage remain unknown. The purpose of this study was to investigate the effects of homologous recombination repair deficiency on DU-induced genotoxicity using RAD51D and XRCC3-deficient Chinese hamster ovary (CHO) cell lines. Cells deficient in XRCC3 (irs1SF) exhibited similar cytotoxicity after DU exposure compared to wild-type (AA8) and XRCC3-complemented (1SFwt8) cells, but DU induced more break-type and fusion-type lesions in XRCC3-deficient cells compared to wild-type and XRCC3-complemented cells. Surprisingly, loss of RAD51D did not affect DU-induced cytotoxicity or genotoxicity. DU induced selective X-chromosome fragmentation irrespective of RAD51D status, but loss of XRCC3 nearly eliminated fragmentation observed after DU exposure in wild-type and XRCC3-complemented cells. Thus, XRCC3, but not RAD51D, protects cells from DU-induced breaks and fusions and also plays a role in DU-induced chromosome fragmentation. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Peptide Nucleic Acid Knockdown and Intra-host Cell Complementation of Ehrlichia Type IV Secretion System Effector.

    PubMed

    Sharma, Pratibha; Teymournejad, Omid; Rikihisa, Yasuko

    2017-01-01

    Survival of Ehrlichia chaffeensis depends on obligatory intracellular infection. One of the barriers to E. chaffeensis research progress has been the inability, using conventional techniques, to generate knock-out mutants for genes essential for intracellular infection. This study examined the use of Peptide Nucleic Acids (PNAs) technology to interrupt type IV secretion system (T4SS) effector protein expression in E. chaffeensis followed by intracellular complementation of the effector to determine its requirement for infection. Successful E. chaffeensis infection depends on the E. chaffeensis -specific T4SS protein effector, ehrlichial translocated factor-1 (Etf-1), which induces Rab5-regulated autophagy to provide host cytosolic nutrients required for E. chaffeensis proliferation. Etf-1 is also imported by host cell mitochondria where it inhibits host cell apoptosis to prolong its infection. We designed a PNA specific to Etf-1 and showed that the PNA bound to the target region of single-stranded Etf-1 RNA using a competitive binding assay. Electroporation of E. chaffeensis with this PNA significantly reduced Etf-1 mRNA and protein, and the bacteria's ability to induce host cell autophagy and infect host cells. Etf-1 PNA-mediated inhibition of ehrlichial Etf-1 expression and E. chaffeensis infection could be intracellularly trans-complemented by ectopic expression of Etf-1-GFP in host cells. These data affirmed the critical role of bacterial T4SS effector in host cell autophagy and E. chaffeensis infection, and demonstrated the use of PNA to analyze the gene functions of obligate intracellular bacteria.

  7. Peptide Nucleic Acid Knockdown and Intra-host Cell Complementation of Ehrlichia Type IV Secretion System Effector

    PubMed Central

    Sharma, Pratibha; Teymournejad, Omid; Rikihisa, Yasuko

    2017-01-01

    Survival of Ehrlichia chaffeensis depends on obligatory intracellular infection. One of the barriers to E. chaffeensis research progress has been the inability, using conventional techniques, to generate knock-out mutants for genes essential for intracellular infection. This study examined the use of Peptide Nucleic Acids (PNAs) technology to interrupt type IV secretion system (T4SS) effector protein expression in E. chaffeensis followed by intracellular complementation of the effector to determine its requirement for infection. Successful E. chaffeensis infection depends on the E. chaffeensis-specific T4SS protein effector, ehrlichial translocated factor-1 (Etf-1), which induces Rab5-regulated autophagy to provide host cytosolic nutrients required for E. chaffeensis proliferation. Etf-1 is also imported by host cell mitochondria where it inhibits host cell apoptosis to prolong its infection. We designed a PNA specific to Etf-1 and showed that the PNA bound to the target region of single-stranded Etf-1 RNA using a competitive binding assay. Electroporation of E. chaffeensis with this PNA significantly reduced Etf-1 mRNA and protein, and the bacteria's ability to induce host cell autophagy and infect host cells. Etf-1 PNA-mediated inhibition of ehrlichial Etf-1 expression and E. chaffeensis infection could be intracellularly trans-complemented by ectopic expression of Etf-1-GFP in host cells. These data affirmed the critical role of bacterial T4SS effector in host cell autophagy and E. chaffeensis infection, and demonstrated the use of PNA to analyze the gene functions of obligate intracellular bacteria. PMID:28638803

  8. Desensitization Protocol in Recipients of Deceased Kidney Donor With Donor-Specific Antibody-Low Titers.

    PubMed

    Kanter Berga, J; Sancho Calabuig, A; Gavela Martinez, E; Puig Alcaraz, N; Avila Bernabeu, A; Crespo Albiach, J; Molina Vila, P; Beltrán Catalan, S; Pallardó Mateu, L

    2016-11-01

    Kidney transplantation is the better option for end-stage renal disease (ESRD), but for patients with human leukocyte antigen (HLA) sensitization, the wait times are significantly longer than for patients without antibodies. Many desensitization protocols have been described involving strong immunosuppression, the use of apheresis, and B-cell-modulating therapies. We have designed a desensitization protocol from day 0 for deceased donor kidney transplantation. Our aim was to present our initial experience with five kidney transplant patients. All patients had a negative complement-dependent cytotoxicity cross-match. The desensitization protocol included five to seven doses of thymoglobulin (1.25 mg/kg) and three sessions of plasmapheresis (PP) within the first week after transplantation, with intravenous immunoglobulin (500 mg/kg) after each PP session and one dose of rituximab on day 8. The presence of donor-specific antibodies (DSA) was analyzed by use of Luminex technology; levels between 1000 and 3000 mean fluorescence intensity were considered for desensitization. The median age was 44 years and median renal replacement therapy time was 9 years. All recipients presented 1 to 3 DSA specificities. There were no severe side effects related to PP, infusion of intravenous immunoglobulin, or rituximab. The median follow-up period was 19.3 months. Median serum creatinine level at last follow-up was 1.7 mg/dL. A kidney biopsy was performed in all patients. Graft and patient survival was 100%. Until now, few data are available concerning whether HLA-incompatible kidney transplantation after desensitization would benefit patients with ERSD. The desensitization strategy using the combination of PP, low doses of intravenous immunoglobulin, and rituximab at our center resulted in a satisfactory clinical outcome. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Porcine Knock-in Fibroblasts Expressing hDAF on α-1,3-Galactosyltransferase (GGTA1) Gene Locus.

    PubMed

    Kim, Ji Woo; Kim, Hye-Min; Lee, Sang Mi; Kang, Man-Jong

    2012-10-01

    The Galactose-α1,3-galactose (α1,3Gal) epitope is responsible for hyperacute rejection in pig-to-human xenotransplantation. Human decay-accelerating factor (hDAF) is a cell surface regulatory protein that serves as a complement inhibitor to protect self cells from complement attack. The generation of α1,3-galactosyltransferase (GGTA1) knock-out pigs expressing DAF is a necessary step for their use as organ donors for humans. In this study, we established GGTA1 knock-out cell lines expressing DAF from pig ear fibroblasts for somatic cell nuclear transfer. hDAF expression was detected in hDAF knock-in heterozygous cells, but not in normal pig cells. Expression of the GGTA1 gene was lower in the knock-in heterozygous cell line compared to the normal pig cell. Knock-in heterozygous cells afforded more effective protection against cytotoxicity with human serum than with GGTA1 knock-out heterozygous and control cells. These cell lines may be used in the production of GGTA1 knock-out and DAF expression pigs for xenotransplantation.

  10. Erythrocyte-bound C4d in combination with complement and autoantibody status for the monitoring of SLE.

    PubMed

    Merrill, Joan T; Petri, Michelle A; Buyon, Jill; Ramsey-Goldman, Rosalind; Kalunian, Kenneth; Putterman, Chaim; Conklin, John; Furie, Richard A; Dervieux, Thierry

    2018-01-01

    We examined the usefulness of erythrocyte-bound C4d (EC4d) to monitor disease activity in SLE. Data and blood samples were collected from three different studies, each of which included longitudinal evaluations using the Physicians Global Assessment (PGA) of disease activity and the Safety of Estrogens in Lupus Erythematosus National Assessment (SELENA) SLE Disease Activity Index (SLEDAI), which was assessed without anti-double-stranded DNA (dsDNA) and low complement C3/C4 (clinical SELENA-SLEDAI). EC4d levels were determined using flow cytometry; other laboratory measures included antibodies to dsDNA, C3 and C4 proteins. Relationships between clinical SELENA-SLEDAI, PGA and the laboratory measures were analysed using linear mixed effect models. The three studies combined enrolled 124 patients with SLE (mean age 42 years, 97% women, 31% Caucasians and 34% African-Americans) followed for an average of 5 consecutive visits (range 2-13 visits). EC4d levels and low C3/C4 status were significantly associated the clinical SELENA-SLEDAI or PGA in each of the three study groups (p<0.05). Multivariate analysis revealed that EC4d levels (estimate=0.94±0.28) and low complement C3/C4 (estimate=1.24±0.43) were both independently and significantly associated with the clinical SELENA-SLEDAI (p<0.01) and PGA. EC4d levels were also associated with the clinical SELENA-SLEDAI (estimate: 1.20±0.29) and PGA (estimate=0.19±0.04) among patients with chronically low or normal C3/C4 (p<0.01). Anti-dsDNA titres were generally associated with disease activity. These data support the association of EC4d with disease activity regardless of complement C3/C4 status and its usefulness in monitoring SLE disease. Additional studies will be required to support these validation data.

  11. Development of a time-resolved fluorometric method for observing hybridization in living cells using fluorescence resonance energy transfer.

    PubMed Central

    Tsuji, A; Sato, Y; Hirano, M; Suga, T; Koshimoto, H; Taguchi, T; Ohsuka, S

    2001-01-01

    We previously showed that a specific kind of mRNA (c-fos) was detected in a living cell under a microscope by introducing two fluorescently labeled oligodeoxynucleotides, each labeled with donor or acceptor, into the cytoplasm, making them hybridize to adjacent locations on c-fos mRNA, and taking images of fluorescence resonance energy transfer (FRET) (A. Tsuji, H. Koshimoto, Y. Sato, M. Hirano. Y. Sei-Iida, S. Kondo, and K. Ishibashi, 2000, Biophys. J. 78:3260-3274). On the formed hybrid, the distance between donor and acceptor becomes close and FRET occurs. To observe small numbers of mRNA in living cells using this method, it is required that FRET fluorescence of hybrid must be distinguished from fluorescence of excess amounts of non-hybridizing probes and from cell autofluorescence. To meet these requirements, we developed a time-resolved method using acceptor fluorescence decays. When a combination of a donor having longer fluorescence lifetime and an acceptor having shorter lifetime is used, the measured fluorescence decays of acceptors under FRET becomes slower than the acceptor fluorescence decay with direct excitation. A combination of Bodipy493/503 and Cy5 was selected as donor and acceptor. When the formed hybrid had a configuration where the target RNA has no single-strand part between the two fluorophores, the acceptor fluorescence of hybrid had a sufficiently longer delay to detect fluorescence of hybrid in the presence of excess amounts of non-hybridizing probes. Spatial separation of 10-12 bases between two fluorophores on the hybrid is also required. The decay is also much slower than cell autofluorescence, and smaller numbers of hybrid were detected with less interference of cell autofluorescence in the cytoplasm of living cells under a time-resolved fluorescence microscope with a time-gated function equipped camera. The present method will be useful when observing induced expressions of mRNA in living cells. PMID:11423432

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Unterberger, Claudia; Hanson, Steven; Department of Infection, Immunity and Inflammation, University of Leicester, University Road, Leicester LE1 9HN

    Little is known about determinants regulating expression of Mannan-binding lectin associated serine protease-2 (MASP-2), the effector component of the lectin pathway of complement activation. Comparative bioinformatic analysis of the MASP2 promoter regions in human, mouse, and rat, revealed conservation of two putative Stat binding sites, termed StatA and StatB. Site directed mutagenesis specific for these sites was performed. Transcription activity was decreased 5-fold when StatB site was mutated in the wildtype reporter gene construct. Gel retardation and competition assays demonstrated that proteins contained in the nuclear extract prepared from HepG2 specifically bound double-stranded StatB oligonucleotides. Supershift analysis revealed Stat3 tomore » be the major specific binding protein. We conclude that Stat3 binding is important for MASP2 promoter activity.« less

  13. A Review of Therapeutic Aptamer Conjugates with Emphasis on New Approaches

    PubMed Central

    Bruno, John G.

    2013-01-01

    The potential to emulate or enhance antibodies with nucleic acid aptamers while lowering costs has prompted development of new aptamer-protein, siRNA, drug, and nanoparticle conjugates. Specific focal points of this review discuss DNA aptamers covalently bound at their 3' ends to various proteins for enhanced stability and greater pharmacokinetic lifetimes in vivo. The proteins can include Fc tails of IgG for opsonization, and the first component of complement (C1q) to trigger complement-mediated lysis of antibiotic-resistant Gram negative bacteria, cancer cells and possibly some parasites during vulnerable stages. In addition, the 3' protein adduct may be a biotoxin, enzyme, or may simply be human serum albumin (HSA) or a drug known to bind HSA, thereby retarding kidney and other organ clearance and inhibiting serum exonucleases. In this review, the author summarizes existing therapeutic aptamer conjugate categories and describes his patented concept for PCR-based amplification of double-stranded aptamers followed by covalent attachment of proteins or other agents to the chemically vulnerable overhanging 3' adenine added by Taq polymerase. PCR amplification of aptamers could dramatically lower the current $2,000/gram cost of parallel chemical oligonucleotide synthesis, thereby enabling mass production of aptamer-3'-protein or drug conjugates to better compete against expensive humanized monoclonal antibodies. PMID:24276022

  14. The DNLZ/HEP zinc-binding subdomain is critical for regulation of the mitochondrial chaperone HSPA9

    PubMed Central

    Vu, Michael T; Zhai, Peng; Lee, Juhye; Guerra, Cecilia; Liu, Shirley; Gustin, Michael C; Silberg, Jonathan J

    2012-01-01

    Human mitochondrial DNLZ/HEP regulates the catalytic activity and solubility of the mitochondrial hsp70 chaperone HSPA9. Here, we investigate the role that the DNLZ zinc-binding and C-terminal subdomains play in regulating HSPA9. We show that truncations lacking portions of the zinc-binding subdomain (ZBS) do not affect the solubility of HSPA9 or its ATPase domain, whereas those containing the ZBS and at least 10 residues following this subdomain enhance chaperone solubility. Binding measurements further show that DNLZ requires its ZBS to form a stable complex with the HSPA9 ATPase domain, and ATP hydrolysis measurements reveal that the ZBS is critical for full stimulation of HSPA9 catalytic activity. We also examined if DNLZ is active in vivo. We found that DNLZ partially complements the growth of Δzim17Saccharomyces cerevisiae, and we discovered that a Zim17 truncation lacking a majority of the C-terminal subdomain strongly complements growth like full-length Zim17. These findings provide direct evidence that human DNLZ is a functional ortholog of Zim17. In addition, they implicate the pair of antiparallel β-strands that coordinate zinc in Zim17/DNLZ-type proteins as critical for binding and regulating hsp70 chaperones. PMID:22162012

  15. The DNLZ/HEP zinc-binding subdomain is critical for regulation of the mitochondrial chaperone HSPA9.

    PubMed

    Vu, Michael T; Zhai, Peng; Lee, Juhye; Guerra, Cecilia; Liu, Shirley; Gustin, Michael C; Silberg, Jonathan J

    2012-02-01

    Human mitochondrial DNLZ/HEP regulates the catalytic activity and solubility of the mitochondrial hsp70 chaperone HSPA9. Here, we investigate the role that the DNLZ zinc-binding and C-terminal subdomains play in regulating HSPA9. We show that truncations lacking portions of the zinc-binding subdomain (ZBS) do not affect the solubility of HSPA9 or its ATPase domain, whereas those containing the ZBS and at least 10 residues following this subdomain enhance chaperone solubility. Binding measurements further show that DNLZ requires its ZBS to form a stable complex with the HSPA9 ATPase domain, and ATP hydrolysis measurements reveal that the ZBS is critical for full stimulation of HSPA9 catalytic activity. We also examined if DNLZ is active in vivo. We found that DNLZ partially complements the growth of Δzim17 Saccharomyces cerevisiae, and we discovered that a Zim17 truncation lacking a majority of the C-terminal subdomain strongly complements growth like full-length Zim17. These findings provide direct evidence that human DNLZ is a functional ortholog of Zim17. In addition, they implicate the pair of antiparallel β-strands that coordinate zinc in Zim17/DNLZ-type proteins as critical for binding and regulating hsp70 chaperones. Copyright © 2011 The Protein Society.

  16. KIAA1530 Protein Is Recruited by Cockayne Syndrome Complementation Group Protein A (CSA) to Participate in Transcription-coupled Repair (TCR)

    PubMed Central

    Fei, Jia; Chen, Junjie

    2012-01-01

    Transcription-coupled repair (TCR) is the major pathway involved in the removal of UV-induced photolesions from the transcribed strand of active genes. Two Cockayne syndrome (CS) complementation group proteins, CSA and CSB, are important for TCR repair. The molecular mechanisms by which CS proteins regulate TCR remain elusive. Here, we report the characterization of KIAA1530, an evolutionarily conserved protein that participates in this pathway through its interaction with CSA and the TFIIH complex. We found that UV irradiation led to the recruitment of KIAA1530 onto chromatin in a CSA-dependent manner. Cells lacking KIAA1530 were highly sensitive to UV irradiation and displayed deficiency in TCR. In addition, KIAA1530 depletion abrogated stability of the CSB protein following UV irradiation. More excitingly, we found that a unique CSA mutant (W361C), which was previously identified in a patient with UVsS syndrome, showed defective KIAA1530 binding and resulted in a failure of recruiting KIAA1530 and stabilizing CSB after UV treatment. Together, our data not only reveal that KIAA1530 is an important player in TCR but also lead to a better understanding of the molecular mechanism underlying UVsS syndrome. PMID:22902626

  17. Bovine oocytes with the potential to reprogram somatic cell nuclei have a unique 23-kDa protein, phosphorylated transcriptionally controlled tumor protein (TCTP).

    PubMed

    Tani, Tetsuya; Shimada, Hiroaki; Kato, Yoko; Tsunoda, Yukio

    2007-01-01

    Despite the long-held assumption that reprogramming factors are present in mammalian oocytes at the second metaphase stage, the molecular nature of these factors is not known. Here, we demonstrated that oocytes with the potential to reprogram somatic cell nuclei have a unique 23-kDa protein, phosphorylated transcriptionally controlled tumor protein (TCTP). Injection of TCTP double-stranded RNA into germinal vesicle oocytes decreased the potential of nuclear-transferred (NT) oocytes, but not in vitro fertilized oocytes, to develop into blastocysts. Phosphorylated TCTP is considered to facilitate the first step of somatic cell reprogramming. After transfer of blastocysts that developed from NT oocytes fused with cumulus cells in which phosphorylated TCTP peptide was previously incorporated, the recipient pregnancy rate (47%) increased and the abortion rate (13%) decreased. Moreover, all seven cloned calves survived for at least 1 month after parturition, and had no morphologic abnormalities. The present study demonstrated that pretreatment of donor cells with phosphorylated TCTP peptide has a beneficial effect on the potential of bovine somatic cell nuclei to develop into normal cloned calves. Before widespread application of TCTP for bovine cloning, however, a large-scale embryo transfer study using different donor cell lines of various origins is necessary.

  18. 48-spot single-molecule FRET setup with periodic acceptor excitation

    NASA Astrophysics Data System (ADS)

    Ingargiola, Antonino; Segal, Maya; Gulinatti, Angelo; Rech, Ivan; Labanca, Ivan; Maccagnani, Piera; Ghioni, Massimo; Weiss, Shimon; Michalet, Xavier

    2018-03-01

    Single-molecule Förster resonance energy transfer (smFRET) allows measuring distances between donor and acceptor fluorophores on the 3-10 nm range. Solution-based smFRET allows measurement of binding-unbinding events or conformational changes of dye-labeled biomolecules without ensemble averaging and free from surface perturbations. When employing dual (or multi) laser excitation, smFRET allows resolving the number of fluorescent labels on each molecule, greatly enhancing the ability to study heterogeneous samples. A major drawback to solution-based smFRET is the low throughput, which renders repetitive measurements expensive and hinders the ability to study kinetic phenomena in real-time. Here we demonstrate a high-throughput smFRET system that multiplexes acquisition by using 48 excitation spots and two 48-pixel single-photon avalanche diode array detectors. The system employs two excitation lasers allowing separation of species with one or two active fluorophores. The performance of the system is demonstrated on a set of doubly labeled double-stranded DNA oligonucleotides with different distances between donor and acceptor dyes along the DNA duplex. We show that the acquisition time for accurate subpopulation identification is reduced from several minutes to seconds, opening the way to high-throughput screening applications and real-time kinetics studies of enzymatic reactions such as DNA transcription by bacterial RNA polymerase.

  19. Reprogramming MHC specificity by CRISPR-Cas9-assisted cassette exchange

    PubMed Central

    Kelton, William; Waindok, Ann Cathrin; Pesch, Theresa; Pogson, Mark; Ford, Kyle; Parola, Cristina; Reddy, Sai T.

    2017-01-01

    The development of programmable nucleases has enabled the application of new genome engineering strategies for cellular immunotherapy. While targeted nucleases have mostly been used to knock-out or knock-in genes in immune cells, the scarless exchange of entire immunogenomic alleles would be of great interest. In particular, reprogramming the polymorphic MHC locus could enable the creation of matched donors for allogeneic cellular transplantation. Here we show a proof-of-concept for reprogramming MHC-specificity by performing CRISPR-Cas9-assisted cassette exchange. Using murine antigen presenting cell lines (RAW264.7 macrophages), we demonstrate that the generation of Cas9-induced double-stranded breaks flanking the native MHC-I H2-Kd locus led to exchange of an orthogonal H2-Kb allele. MHC surface expression allowed for easy selection of reprogrammed cells by flow cytometry, thus obviating the need for additional selection markers. MHC-reprogrammed cells were fully functional as they could present H2-Kd-restricted peptide and activate cognate T cells. Finally, we investigated the role of various donor template formats on exchange efficiency, discovering that templates that underwent in situ linearization resulted in the highest MHC-reprogramming efficiency. These findings highlight a potential new approach for the correcting of MHC mismatches in cellular transplantation. PMID:28374766

  20. [Markerless DNA deletion based on Red recombination and in vivo I-Sec I endonuclease cleavage in Escherichia coli chromosome].

    PubMed

    Zhu, Meiqin; Yu, Jian; Zhou, Changlin; Fang, Hongqing

    2016-01-01

    Red-based recombineering has been widely used in Escherichia coli genome modification through electroporating PCR fragments into electrocompetent cells to replace target sequences. Some mutations in the PCR fragments may be brought into the homologous regions near the target. To solve this problem in markeless gene deletion we developed a novel method characterized with two-step recombination and a donor plasmid. First, generated by PCR a linear DNA cassette which comprises a I-Sec I site-containing marker gene and homologous arms was electroporated into cells for marker-substitution deletion of the target sequence. Second, after a donor plasmid carrying the I-Sec I site-containing fusion homologous arm was chemically transformed into the marker-containing cells, the fusion arms and the marker was simultaneously cleaved by I-Sec I endonuclease and the marker-free deletion was stimulated by double-strand break-mediated intermolecular recombination. Eleven nonessential regions in E. coli DH1 genome were sequentially deleted by our method, resulting in a 10.59% reduced genome size. These precise deletions were also verified by PCR sequencing and genome resequencing. Though no change in the growth rate on the minimal medium, we found the genome-reduced strains have some alteration in the acid resistance and for the synthesis of lycopene.

  1. A microplate assay to measure classical and alternative complement activity.

    PubMed

    Puissant-Lubrano, Bénédicte; Fortenfant, Françoise; Winterton, Peter; Blancher, Antoine

    2017-05-01

    We developed and validated a kinetic microplate hemolytic assay (HA) to quantify classical and alternative complement activity in a single dilution of human plasma or serum. The assay is based on monitoring hemolysis of sensitized sheep (or uncoated rabbit) red blood cells by means of a 96-well microplate reader. The activity of the calibrator was evaluated by reference to 200 healthy adults. The conversion of 50% hemolysis time into a percentage of activity was obtained using a calibration curve plotted daily. The linearity of the assay as well as interference (by hemolysis, bilrubinemia and lipemia) was assessed for classical pathway (CP). The within-day and the between-day precision was satisfactory regarding the performance of commercially available liposome immunoassay (LIA) and ELISA. Patients with hereditary or acquired complement deficiencies were detected (activity was measured <30%). We also provided a reference range obtained from 200 blood donors. The agreement of CP evaluated on samples from 48 patients was 94% with LIA and 87.5% with ELISA. The sensitivity of our assay was better than that of LIA, and the cost was lower than either LIA or ELISA. In addition, this assay was less time consuming than previously reported HAs. This assay allows the simultaneous measurement of 36 samples in duplicate per run of a 96-well plate. The use of a daily calibration curve allows standardization of the method and leads to good reproducibility. The same technique was also adapted for the quantification of alternative pathway (AP) activity.

  2. Attenuation of S. aureus-induced bacteremia by human mini-antibodies targeting the complement inhibitory protein Efb

    PubMed Central

    Georgoutsou-Spyridonos, Maria; Ricklin, Daniel; Pratsinis, Haris; Perivolioti, Eustathia; Pirmettis, Ioannis; Garcia, Brandon L.; Geisbrecht, Brian V.; Foukas, Periklis G.; Lambris, John D.; Mastellos, Dimitrios C.; Sfyroera, Georgia

    2015-01-01

    Staphylococcus aureus (S. aureus) can cause a broad range of potentially fatal inflammatory complications (e.g. sepsis, endocarditis). Its emerging antibiotic resistance and formidable immune evasion arsenal have emphasized the need for more effective antimicrobial approaches. Complement is an innate immune sensor that rapidly responds to bacterial infection eliciting C3-mediated opsonophagocytic and immunomodulatory responses. Extracellular Fibrinogen-binding Protein (Efb) is a key immune evasion protein of S. aureus that intercepts complement at the level of C3. To date, Efb has not been explored as a target for monoclonal antibody (mAb)-based antimicrobial therapeutics. Herein we have isolated donor-derived anti-Efb IgGs that attenuate S. aureus survival through enhanced neutrophil killing. A phage library screen yielded mAbs (miniAbs) that selectively inhibit the interaction of Efb with C3 partly by disrupting contacts essential for complex formation. Surface Plasmon Resonance-based kinetic analysis enabled the selection of miniAbs with favorable Efb-binding profiles as therapeutic leads. MiniAb-mediated blockade of Efb attenuated S aureus survival in a whole blood model of bacteremia. This neutralizing effect was associated with enhanced neutrophil-mediated killing of S. aureus, increased C5a release and modulation of IL-6 secretion. Finally, these miniAbs afforded protection from S. aureus-induced bacteremia in a murine renal abscess model, attenuating bacterial inflammation in kidneys. Overall, these findings are anticipated to pave the way towards novel antibody-based therapeutics for S. aureus-related diseases. PMID:26342032

  3. Blood group genotyping for Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, K/k, Kp(a)/Kp(b), Js(a)/Js(b), Co(a)/Co(b), and Lu(a)/Lu(b) with microarray beads.

    PubMed

    Karpasitou, Katerina; Drago, Francesca; Crespiatico, Loretta; Paccapelo, Cinzia; Truglio, Francesca; Frison, Sara; Scalamogna, Mario; Poli, Francesca

    2008-03-01

    Traditionally, blood group typing has been performed with serologic techniques, the classical method being the hemagglutination test. Serotyping, however, may present important limitations such as scarce availability of rare antisera, typing of recently transfused patients, and those with a positive direct antiglobulin test. Consequently, serologic tests are being complemented with molecular methods. The aim of this study was to develop a low-cost, high-throughput method for large-scale genotyping of red blood cells (RBCs). Single-nucleotide polymorphisms associated with some clinically important blood group antigens, as well as with certain rare blood antigens, were evaluated: Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, K/k, Kp(a)/Kp(b), Js(a)/Js(b), Co(a)/Co(b), and Lu(a)/Lu(b). Polymerase chain reaction (PCR)-amplified targets were detected by direct hybridization to microspheres coupled to allele-specific oligonucleotides. Cutoff values for each genotype were established with phenotyped and/or genotyped samples. The method was validated with a blind panel of 92 blood donor samples. The results were fully concordant with those provided by hemagglutination assays and/or sequence-specific primer (SSP)-PCR. The method was subsequently evaluated with approximately 800 blood donor and patient samples. This study presents a flexible, quick, and economical method for complete genotyping of large donor cohorts for RBC alleles.

  4. Meta-analysis of cytomegalovirus seroprevalence in volunteer blood donors and healthy subjects in Iran from 1992 to 2013

    PubMed Central

    Shaiegan, Mojgan; Rasouli, Mahbobeh; Zadsar, Maryam; Zolfaghari, Sima

    2015-01-01

    Objective(s): Human cytomegalovirus (CMV), a double-strand DNA herpesvirus, can be transmitted via blood transfusion which is especially important for immunocompromised recipients and can cause a fatal infection. CMV seroprevalence in Iran was studied on blood donors, healthy subjects, and some patients. Highly variable rates were detected. The purpose of this study was to review CMV seroprevalence in blood donors and apparently healthy individuals, in Iran. Materials and Methods: One hundred and fifty-eight electronic and paper-based resources and databases including published articles in internal and external journals, seminars, dissertations, and theses available in the database and different websites were used to be systematically reviewed as a meta-analysis. Less related articles to the issue, papers of specific high risk population, and articles with not enough information, were excluded. Eventually 22 articles that satisfied our selection criteria were systematically reviewed and analyzed. To explore heterogeneity between studies the I square (I2) index was used. Data were analyzed using the statistical software package (STATA) 11. Results: The heterogeneity between selected studies was 97% with an I2 statistic. In this study a random effects model was used for meta-analysis. The prevalence of CMV IgG and CMV IgM antibodies in the country were estimated to be 92% (95% CI: 90-94) and 2.6% (95% CI: 1.7-3.6), respectively. Conclusion: Given high rate of CMV seropositivity in Iran, it seems that CMVAbs screening would not be a reasonable and affordable approach to prevent CMV infection via transfusion especially for immune compromised recipients, so alternative strategies should be considered. PMID:26351551

  5. Template Dimerization Promotes an Acceptor Invasion-Induced Transfer Mechanism during Human Immunodeficiency Virus Type 1 Minus-Strand Synthesis

    PubMed Central

    Balakrishnan, Mini; Roques, Bernard P.; Fay, Philip J.; Bambara, Robert A.

    2003-01-01

    The biochemical mechanism of template switching by human immunodeficiency virus type 1 (HIV-1) reverse transcriptase and the role of template dimerization were examined. Homologous donor-acceptor template pairs derived from the HIV-1 untranslated leader region and containing the wild-type and mutant dimerization initiation sequences (DIS) were used to examine the efficiency and distribution of transfers. Inhibiting donor-acceptor interaction was sufficient to reduce transfers in DIS-containing template pairs, indicating that template dimerization, and not the mere presence of the DIS, promotes efficient transfers. Additionally, we show evidence that the overall transfer process spans an extended region of the template and proceeds through a two-step mechanism. Transfer is initiated through an RNase H-facilitated acceptor invasion step, while synthesis continues on the donor template. The invasion then propagates towards the primer terminus by branch migration. Transfer is completed with the translocation of the primer terminus at a site distant from the invasion point. In our system, most invasions initiated before synthesis reached the DIS. However, transfer of the primer terminus predominantly occurred after synthesis through the DIS. The two steps were separated by 60 to 80 nucleotides. Sequence markers revealed the position of primer terminus switch, whereas DNA oligomers designed to block acceptor-cDNA interactions defined sites of invasion. Within the region of homology, certain positions on the template were inherently more favorable for invasion than others. In templates with DIS, the proximity of the acceptor facilitates invasion, thereby enhancing transfer efficiency. Nucleocapsid protein enhanced the overall efficiency of transfers but did not alter the mechanism. PMID:12663778

  6. Nonrenal and renal activity of systemic lupus erythematosus: a comparison of two anti-C1q and five anti-dsDNA assays and complement C3 and C4.

    PubMed

    Julkunen, Heikki; Ekblom-Kullberg, Susanne; Miettinen, Aaro

    2012-08-01

    Associations of different assays for antibodies to C1q (anti-C1q) and to dsDNA (anti-dsDNA) and of complements C3 and C4 with disease activity in patients with systemic lupus erythematosus (SLE) were studied. The clinical manifestations of 223 SLE patients were recorded, and the disease activity was assessed by the SLEDAI score. Anti-C1q were determined by two enzyme-linked immunosorbent assays (ELISA) and anti-dsDNA by a radioimmunoassay (RIA), a Crithidia immunofluorescence (IF) assay and three ELISA assays using human telomere DNA, plasmid DNA circles, or calf thymus DNA as antigens, respectively. Complement C3 and C4 were determined by nephelometry. Control sera were obtained from 98 blood donors. In patients with SLE, the prevalence of anti-C1q was 17-18% and that of anti-dsDNA was 36-69%. Anti-C1q, anti-dsDNA, and complement C3 and C4 correlated well with the overall activity of SLE (r = 0.323-0.351, 0.353-0.566, and -0.372-0.444, respectively; P < 0.001). Sensitivity, specificity, positive predictive value, and negative predictive value for active lupus nephritis among SLE patients were 40-44, 92, 29, and 91-92% for anti-C1q and 48-68, 29-66, 11-16, and 86-91% for anti-dsDNA, respectively. Patients with active nephritis had higher levels of anti-C1q and lower levels of C3 and C4 than patients with inactive nephritis (P = 0.003-0.018). The corresponding associations of anti-dsDNA were somewhat weaker (P = 0.023-0.198). Hematological parameters reflecting disease activity correlated clearly better with anti-dsDNA and complement C3 and C4 than with anti-C1q. Anti-C1q is inferior to anti-dsDNA as a diagnostic test in SLE and in the evaluation of overall clinical activity of the disease. Anti-C1q together with complement C3 and C4 may offer useful additional information to monitor lupus nephritis activity. There are no practical differences between different assays for anti-C1q and anti-dsDNA.

  7. Successful COG8 and PDF overlap is mediated by alterations in splicing and polyadenylation signals.

    PubMed

    Pereira-Castro, Isabel; Quental, Rita; da Costa, Luís T; Amorim, António; Azevedo, Luisa

    2012-02-01

    Although gene-free areas compose the great majority of eukaryotic genomes, a significant fraction of genes overlaps, i.e., unique nucleotide sequences are part of more than one transcription unit. In this work, the evolutionary history and origin of a same-strand gene overlap is dissected through the analysis of COG8 (component of oligomeric Golgi complex 8) and PDF (peptide deformylase). Comparative genomic surveys reveal that the relative locations of these two genes have been changing over the last 445 million years from distinct chromosomal locations in fish to overlapping in rodents and primates, indicating that the overlap between these genes precedes their divergence. The overlap between the two genes was initiated by the gain of a novel splice donor site between the COG8 stop codon and PDF initiation codon. Splicing is accomplished by the use of the PDF acceptor, leading COG8 to share the 3'end with PDF. In primates, loss of the ancestral polyadenylation signal for COG8 makes the overlap between COG8 and PDF mandatory, while in mouse and rat concurrent overlapping and non-overlapping Cog8 transcripts exist. Altogether, we demonstrate that the origin, evolution and preservation of the COG8/PDF same-strand overlap follow similar mechanistic steps as those documented for antisense overlaps where gain and/or loss of splice sites and polyadenylation signals seems to drive the process.

  8. In vivo genome editing as a potential treatment strategy for inherited retinal dystrophies.

    PubMed

    Yanik, Mert; Müller, Brigitte; Song, Fei; Gall, Jacqueline; Wagner, Franziska; Wende, Wolfgang; Lorenz, Birgit; Stieger, Knut

    2017-01-01

    In vivo genome editing represents an emerging field in the treatment of monogenic disorders, as it may constitute a solution to the current hurdles in classic gene addition therapy, which are the low levels and limited duration of transgene expression. Following the introduction of a double strand break (DSB) at the mutational site by highly specific endonucleases, such as TALENs (transcription activator like effector nucleases) or RNA based nucleases (clustered regulatory interspaced short palindromic repeats - CRISPR-Cas), the cell's own DNA repair machinery restores integrity to the DNA strand and corrects the mutant sequence, thus allowing the cell to produce protein levels as needed. The DNA repair happens either through the error prone non-homologous end-joining (NHEJ) pathway or with high fidelity through homology directed repair (HDR) in the presence of a DNA donor template. A third pathway called microhomology mediated endjoining (MMEJ) has been recently discovered. In this review, the authors focus on the different DNA repair mechanisms, the current state of the art tools for genome editing and the particularities of the retina and photoreceptors with regard to in vivo therapeutic approaches. Finally, current attempts in the field of retinal in vivo genome editing are discussed and future directions of research identified. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  9. Repair of DNA double-strand breaks by templated nucleotide sequence insertions derived from distant regions of the genome.

    PubMed

    Onozawa, Masahiro; Zhang, Zhenhua; Kim, Yoo Jung; Goldberg, Liat; Varga, Tamas; Bergsagel, P Leif; Kuehl, W Michael; Aplan, Peter D

    2014-05-27

    We used the I-SceI endonuclease to produce DNA double-strand breaks (DSBs) and observed that a fraction of these DSBs were repaired by insertion of sequences, which we termed "templated sequence insertions" (TSIs), derived from distant regions of the genome. These TSIs were derived from genic, retrotransposon, or telomere sequences and were not deleted from the donor site in the genome, leading to the hypothesis that they were derived from reverse-transcribed RNA. Cotransfection of RNA and an I-SceI expression vector demonstrated insertion of RNA-derived sequences at the DNA-DSB site, and TSIs were suppressed by reverse-transcriptase inhibitors. Both observations support the hypothesis that TSIs were derived from RNA templates. In addition, similar insertions were detected at sites of DNA DSBs induced by transcription activator-like effector nuclease proteins. Whole-genome sequencing of myeloma cell lines revealed additional TSIs, demonstrating that repair of DNA DSBs via insertion was not restricted to experimentally produced DNA DSBs. Analysis of publicly available databases revealed that many of these TSIs are polymorphic in the human genome. Taken together, these results indicate that insertional events should be considered as alternatives to gross chromosomal rearrangements in the interpretation of whole-genome sequence data and that this mutagenic form of DNA repair may play a role in genetic disease, exon shuffling, and mammalian evolution.

  10. Accelerated reforms in healthcare financing: the need to scale up private sector participation in Nigeria.

    PubMed

    Ejughemre, Ufuoma John

    2014-01-01

    The health sector, a foremost service sector in Nigeria, faces a number of challenges; primarily, the persistent under-funding of the health sector by the Nigerian government as evidence reveals low allocations to the health sector and poor health system performance which are reflected in key health indices of the country.Notwithstanding, there is evidence that the private sector could be a key player in delivering health services and impacting health outcomes, including those related to healthcare financing. This underscores the need to optimize the role of private sector in complementing the government's commitment to financing healthcare delivery and strengthening the health system in Nigeria. There are also concerns about uneven quality and affordability of private-driven health systems, which necessitates reforms aimed at regulation. Accordingly, the argument is that the benefits of leveraging the private sector in complementing the national government in healthcare financing outweigh the challenges, particularly in light of lean public resources and finite donor supports. This article, therefore, highlights the potential for the Nigerian government to scale up healthcare financing by leveraging private resources, innovations and expertise, while working to achieve the universal health coverage.

  11. Recent Advances in Allograft Vasculopathy

    PubMed Central

    Merola, Jonathan; Jane-Wit, Daniel D.; Pober, Jordan S.

    2017-01-01

    Purpose of review Despite considerable advances in controlling acute rejection, the longevity of cardiac and renal allografts remains significantly limited by chronic rejection in the form of allograft vasculopathy (AV). This review discusses recently reported mechanistic insights of AV pathogenesis as well recent clinical evaluations of new therapeutic approaches. Recent findings Although adaptive immunity is the major driver of AV, natural killer cells mediate vasculopathic changes in a transplanted mouse heart following treatment with donor-specific antibody (DSA). However, NK cells may also dampen chronic inflammatory responses by killing donor-derived tissue-resident CD4 T cells that provide help to host B cells, the source of DSA. DSA may directly contribute to vascular inflammation by inducing intracellular signaling cascades that upregulate leukocyte adhesion molecules, facilitating recruitment of neutrophils and monocytes. DSA-mediated complement activation additionally enhances endothelial alloimmunogenicity through activation of non-canonical NF-κB signaling. New clinical studies evaluating mTOR and proteasome inhibitors to target these pathways have been reported. Summary AV is a pathology resultant from several innate and adaptive alloimmune responses. Mechanistic insights from preclinical studies have identified agents that are currently being investigated in clinical trials. PMID:27898462

  12. Engineered Viruses as Genome Editing Devices.

    PubMed

    Chen, Xiaoyu; Gonçalves, Manuel A F V

    2016-03-01

    Genome editing based on sequence-specific designer nucleases, also known as programmable nucleases, seeks to modify in a targeted and precise manner the genetic information content of living cells. Delivering into cells designer nucleases alone or together with donor DNA templates, which serve as surrogate homologous recombination (HR) substrates, can result in gene knockouts or gene knock-ins, respectively. As engineered replication-defective viruses, viral vectors are having an increasingly important role as delivery vehicles for donor DNA templates and designer nucleases, namely, zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and clustered, regularly interspaced, short palindromic repeats (CRISPR)-associated Cas9 (CRISPR-Cas9) nucleases, also known as RNA-guided nucleases (RGNs). We review this dual role played by engineered viral particles on genome editing while focusing on their main scaffolds, consisting of lentiviruses, adeno-associated viruses, and adenoviruses. In addition, the coverage of the growing body of research on the repurposing of viral vectors as delivery systems for genome editing tools is complemented with information regarding their main characteristics, pros, and cons. Finally, this information is framed by a concise description of the chief principles, tools, and applications of the genome editing field as a whole.

  13. Engineered Viruses as Genome Editing Devices

    PubMed Central

    Chen, Xiaoyu; Gonçalves, Manuel A F V

    2016-01-01

    Genome editing based on sequence-specific designer nucleases, also known as programmable nucleases, seeks to modify in a targeted and precise manner the genetic information content of living cells. Delivering into cells designer nucleases alone or together with donor DNA templates, which serve as surrogate homologous recombination (HR) substrates, can result in gene knockouts or gene knock-ins, respectively. As engineered replication-defective viruses, viral vectors are having an increasingly important role as delivery vehicles for donor DNA templates and designer nucleases, namely, zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and clustered, regularly interspaced, short palindromic repeats (CRISPR)-associated Cas9 (CRISPR−Cas9) nucleases, also known as RNA-guided nucleases (RGNs). We review this dual role played by engineered viral particles on genome editing while focusing on their main scaffolds, consisting of lentiviruses, adeno-associated viruses, and adenoviruses. In addition, the coverage of the growing body of research on the repurposing of viral vectors as delivery systems for genome editing tools is complemented with information regarding their main characteristics, pros, and cons. Finally, this information is framed by a concise description of the chief principles, tools, and applications of the genome editing field as a whole. PMID:26336974

  14. Protein subcellular localization assays using split fluorescent proteins

    DOEpatents

    Waldo, Geoffrey S [Santa Fe, NM; Cabantous, Stephanie [Los Alamos, NM

    2009-09-08

    The invention provides protein subcellular localization assays using split fluorescent protein systems. The assays are conducted in living cells, do not require fixation and washing steps inherent in existing immunostaining and related techniques, and permit rapid, non-invasive, direct visualization of protein localization in living cells. The split fluorescent protein systems used in the practice of the invention generally comprise two or more self-complementing fragments of a fluorescent protein, such as GFP, wherein one or more of the fragments correspond to one or more beta-strand microdomains and are used to "tag" proteins of interest, and a complementary "assay" fragment of the fluorescent protein. Either or both of the fragments may be functionalized with a subcellular targeting sequence enabling it to be expressed in or directed to a particular subcellular compartment (i.e., the nucleus).

  15. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  16. Multiple lupus-associated ITGAM variants alter Mac-1 functions on neutrophils.

    PubMed

    Zhou, Yebin; Wu, Jianming; Kucik, Dennis F; White, Nathan B; Redden, David T; Szalai, Alexander J; Bullard, Daniel C; Edberg, Jeffrey C

    2013-11-01

    Multiple studies have demonstrated that single-nucleotide polymorphisms (SNPs) in the ITGAM locus (including the nonsynonymous SNPs rs1143679, rs1143678, and rs1143683) are associated with systemic lupus erythematosus (SLE). ITGAM encodes the protein CD11b, a subunit of the β2 integrin Mac-1. The purpose of this study was to determine the effects of ITGAM genetic variation on the biologic functions of neutrophil Mac-1. Neutrophils from ITGAM-genotyped and -sequenced healthy donors were isolated for functional studies. The phagocytic capacity of neutrophil ITGAM variants was probed with complement-coated erythrocytes, serum-treated zymosan, heat-treated zymosan, and IgG-coated erythrocytes. The adhesion capacity of ITGAM variants, in adhering to either purified intercellular adhesion molecule 1 or tumor necrosis factor α-stimulated endothelial cells, was assessed in a flow chamber. Expression levels of total CD11b and activation of CD11b were assessed by flow cytometry. Mac-1-mediated neutrophil phagocytosis, determined in cultures with 2 different complement-coated particles, was significantly reduced in individuals with nonsynonymous variant alleles of ITGAM. This reduction in phagocytosis was related to variation at either rs1143679 (in the β-propeller region) or rs1143678/rs1143683 (highly linked SNPs in the cytoplasmic/calf-1 regions). Phagocytosis mediated by Fcγ receptors was also significantly reduced in donors with variant ITGAM alleles. Similarly, firm adhesion of neutrophils was significantly reduced in individuals with variant ITGAM alleles. These functional alterations were not attributable to differences in total receptor expression or activation. The nonsynonymous ITGAM variants rs1143679 and rs1143678/rs113683 contribute to altered Mac-1 function on neutrophils. These results underscore the need to consider multiple nonsynonymous SNPs when assessing the functional consequences of ITGAM variation on immune cell processes and the risk of SLE. Copyright © 2013 by the American College of Rheumatology.

  17. Ionic tethering contributes to the conformational stability and function of complement C3b.

    PubMed

    López-Perrote, Andrés; Harrison, Reed E S; Subías, Marta; Alcorlo, Martín; Rodríguez de Córdoba, Santiago; Morikis, Dimitrios; Llorca, Oscar

    2017-05-01

    C3b, the central component of the alternative pathway (AP) of the complement system, coexists as a mixture of conformations in solution. These conformational changes can affect interactions with other proteins and complement regulators. Here we combine a computational model for electrostatic interactions within C3b with molecular imaging to study the conformation of C3b. The computational analysis shows that the TED domain in C3b is tethered ionically to the macroglobulin (MG) ring. Monovalent counterion concentration affects the magnitude of electrostatic forces anchoring the TED domain to the rest of the C3b molecule in a thermodynamic model. This is confirmed by observing NaCl concentration dependent conformational changes using single molecule electron microscopy (EM). We show that the displacement of the TED domain is compatible with C3b binding to Factor B (FB), suggesting that the regulation of the C3bBb convertase could be affected by conditions that promote movement in the TED domain. Our molecular model also predicts mutations that could alter the positioning of the TED domain, including the common R102G polymorphism, a risk variant for developing age-related macular degeneration. The common C3b isoform, C3bS, and the risk isoform, C3bF, show distinct energetic barriers to displacement in the TED that are related to a network of electrostatic interactions at the interface of the TED and MG-ring domains of C3b. These computational predictions agree with experimental evidence that shows differences in conformation observed in C3b isoforms purified from homozygous donors. Altogether, we reveal an ionic, reversible attachment of the TED domain to the MG ring that may influence complement regulation in some mutations and polymorphisms of C3b. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Human neutrophil peptides and complement factor Bb in pathogenesis of acquired thrombotic thrombocytopenic purpura.

    PubMed

    Cao, Wenjing; Pham, Huy P; Williams, Lance A; McDaniel, Jenny; Siniard, Rance C; Lorenz, Robin G; Marques, Marisa B; Zheng, X Long

    2016-11-01

    Acquired thrombotic thrombocytopenic purpura is primarily caused by the deficiency of plasma ADAMTS13 activity resulting from autoantibodies against ADAMTS13. However, ADAMTS13 deficiency alone is often not sufficient to cause acute thrombotic thrombocytopenic purpura. Infections or systemic inflammation may precede acute bursts of the disease, but the underlying mechanisms are not fully understood. Herein, 52 patients with acquired autoimmune thrombotic thrombocytopenic purpura and 30 blood donor controls were recruited for the study. The plasma levels of human neutrophil peptides 1-3 and complement activation fragments (i.e. Bb, iC3b, C4d, and sC5b-9) were determined by enzyme-linked immunosorbent assays. Univariate analyses were performed to determine the correlation between each biomarker and clinical outcomes. We found that the plasma levels of human neutrophil peptides 1-3 and Bb in patients with acute thrombotic thrombocytopenic purpura were significantly higher than those in the control (P<0.0001). The plasma levels of HNP1-3 correlated with the levels of plasma complement fragment Bb (rho=0.48, P=0.0004) and serum lactate dehydrogenase (rho=0.28, P=0.04); in addition, the plasma levels of Bb correlated with iC3b (rho=0.55, P<0.0001), sC5b-9 (rho=0.63, P<0.0001), serum creatinine (rho=0.42, p=0.0011), and lactate dehydrogenase (rho=0.40, P=0.0034), respectively. Moreover, the plasma levels of iC3b and sC5b-9 were correlated (rho=0.72, P<0.0001), despite no statistically significant difference of the two markers between thrombotic thrombocytopenic purpura patients and the control. We conclude that innate immunity, i.e. neutrophil and complement activation via the alternative pathway, may play a role in the pathogenesis of acute autoimmune thrombotic thrombocytopenic purpura, and a therapy targeted at these pathways may be considered in a subset of these patients. Copyright© Ferrata Storti Foundation.

  19. TaqMan 5′-Nuclease Human Immunodeficiency Virus Type 1 PCR Assay with Phage-Packaged Competitive Internal Control for High-Throughput Blood Donor Screening

    PubMed Central

    Drosten, C.; Seifried, E.; Roth, W. K.

    2001-01-01

    Screening of blood donors for human immunodeficiency virus type 1 (HIV-1) infection by PCR permits the earlier diagnosis of HIV-1 infection compared with that by serologic assays. We have established a high-throughput reverse transcription (RT)-PCR assay based on 5′-nuclease PCR. By in-tube detection of HIV-1 RNA with a fluorogenic probe, the 5′-nuclease PCR technology (TaqMan PCR) eliminates the risk of carryover contamination, a major problem in PCR testing. We outline the development and evaluation of the PCR assay from a technical point of view. A one-step RT-PCR that targets the gag genes of all known HIV-1 group M isolates was developed. An internal control RNA detectable with a heterologous 5′-nuclease probe was derived from the viral target cDNA and was packaged into MS2 coliphages (Armored RNA). Because the RNA was protected against digestion with RNase, it could be spiked into patient plasma to control the complete sample preparation and amplification process. The assay detected 831 HIV-1 type B genome equivalents per ml of native plasma (95% confidence interval [CI], 759 to 936 HIV-1 B genome equivalents per ml) with a ≥95% probability of a positive result, as determined by probit regression analysis. A detection limit of 1,195 genome equivalents per ml of (individual) donor plasma (95% CI, 1,014 to 1,470 genome equivalents per ml of plasma pooled from individuals) was achieved when 96 samples were pooled and enriched by centrifugation. Up to 4,000 plasma samples per PCR run were tested in a 3-month trial period. Although data from the present pilot feasibility study will have to be complemented by a large clinical validation study, the assay is a promising approach to the high-throughput screening of blood donors and is the first noncommercial test for high-throughput screening for HIV-1. PMID:11724836

  20. Attitudes to deceased organ donation and registration as a donor among minority ethnic groups in North America and the U.K.: a synthesis of quantitative and qualitative research.

    PubMed

    Morgan, Myfanwy; Kenten, Charlotte; Deedat, Sarah

    2013-01-01

    A systematic review and synthesis of quantitative and qualitative research were undertaken to examine attitudes to deceased donation and registration as an organ donor among ethnic minorities in the U.K. and North America. A systematic search and assessments of relevance and quality were conducted. Parallel syntheses were then undertaken of 14 quantitative and 12 qualitative papers followed by their integration. The synthesis was organised around five barriers that emerged as key issues: (1) knowledge regarding deceased donation and registration as a donor; (2) discussion of donation/registration with family members; (3) faith and cultural beliefs; (4) bodily concerns including disfigurement and intactness; and (5) trust in doctors and the health care system. In all countries, knowledge of organ donation and registration remained low despite public campaigns, with African-Americans and Black African and Black Caribbean populations in the U.K. often regarding organ donation as a 'white' issue. Each of the four attitudinal barriers was also more prevalent among ethnic minorities compared with the majority population. However, the significance of trust and uncertainties regarding religion/faith differed between groups, reflecting salient aspects of ethnic identity and experiences. Differences were also identified within ethnic groups associated with age and generation, although respect for the views of elders often influenced younger peoples' willingness to donate. There is a need for a more nuanced understanding of ethnicity and of variations in attitudes associated with country of origin, age/generation, socio-economic status and area of residence, to inform public campaigns and promote sensitive discussions with bereaved ethnic minority families. The traditional focus on knowledge and attitudes also requires to be complemented by a greater emphasis on organisational and service-related barriers and changes required to enhance ethnic minorities' access to registration as a donor and consent to deceased donation.

  1. Identification of a New Human Adenovirus Protein Encoded by a Novel Late l-Strand Transcription Unit▿

    PubMed Central

    Tollefson, Ann E.; Ying, Baoling; Doronin, Konstantin; Sidor, Peter D.; Wold, William S. M.

    2007-01-01

    A short open reading frame named the “U exon,” located on the adenovirus (Ad) l-strand (for leftward transcription) between the early E3 region and the fiber gene, is conserved in mastadenoviruses. We have observed that Ad5 mutants with large deletions in E3 that infringe on the U exon display a mild growth defect, as well as an aberrant Ad E2 DNA-binding protein (DBP) intranuclear localization pattern and an apparent failure to organize replication centers during late infection. Mutants in which the U exon DNA is reconstructed have a reversed phenotype. Chow et al. (L. T. Chow et al., J. Mol. Biol. 134:265-303, 1979) described mRNAs initiating in the region of the U exon and spliced to downstream sequences in the late DBP mRNA leader and the DBP-coding region. We have cloned this mRNA (as cDNA) from Ad5 late mRNA; the predicted protein is 217 amino acids, initiating in the U exon and continuing in frame in the DBP leader and in the DBP-coding region but in a different reading frame from DBP. Polyclonal and monoclonal antibodies generated against the predicted U exon protein (UXP) showed that UXP is ∼24K in size by immunoblot and is a late protein. At 18 to 24 h postinfection, UXP is strongly associated with nucleoli and is found throughout the nucleus; later, UXP is associated with the periphery of replication centers, suggesting a function relevant to Ad DNA replication or RNA transcription. UXP is expressed by all four species C Ads. When expressed in transient transfections, UXP complements the aberrant DBP localization pattern of UXP-negative Ad5 mutants. Our data indicate that UXP is a previously unrecognized protein derived from a novel late l-strand transcription unit. PMID:17881437

  2. Development of an opsonophagocytic killing assay for group a streptococcus.

    PubMed

    Jones, Scott; Moreland, Nicole J; Zancolli, Marta; Raynes, Jeremy; Loh, Jacelyn M S; Smeesters, Pierre R; Sriskandan, Shiranee; Carapetis, Jonathan R; Fraser, John D; Goldblatt, David

    2018-05-15

    Group A Streptococcus (GAS) or Streptococcus pyogenes is responsible for an estimated 500,000 deaths worldwide each year. Protection against GAS infection is thought to be mediated by phagocytosis, enhanced by bacteria-specific antibody. There are no licenced GAS vaccines, despite many promising candidates in preclinical and early stage clinical development, the most advanced of which are based on the GAS M-protein. Vaccine progress has been hindered, in part, by the lack of a standardised functional assay suitable for vaccine evaluation. Current assays, developed over 50 years ago, rely on non-immune human whole blood as a source of neutrophils and complement. Variations in complement and neutrophil activity between donors result in variable data that is difficult to interpret. We have developed an opsonophagocytic killing assay (OPKA) for GAS that utilises dimethylformamide (DMF)-differentiated human promyelocytic leukemia cells (HL-60) as a source of neutrophils and baby rabbit complement, thus removing the major sources of variation in current assays. We have standardised the OPKA for several clinically relevant GAS strain types (emm1, emm6 and emm12) and have shown antibody-specific killing for each emm-type using M-protein specific rabbit antisera. Specificity was demonstrated by pre-incubation of the antisera with homologous M-protein antigens that blocked antibody-specific killing. Additional qualifications of the GAS OPKA, including the assessment of the accuracy, precision, linearity and the lower limit of quantification, were also performed. This GAS OPKA assay has the potential to provide a robust and reproducible platform to accelerate GAS vaccine development. Copyright © 2018 Elsevier Ltd. All rights reserved.

  3. Attenuation of Staphylococcus aureus-Induced Bacteremia by Human Mini-Antibodies Targeting the Complement Inhibitory Protein Efb.

    PubMed

    Georgoutsou-Spyridonos, Maria; Ricklin, Daniel; Pratsinis, Haris; Perivolioti, Eustathia; Pirmettis, Ioannis; Garcia, Brandon L; Geisbrecht, Brian V; Foukas, Periklis G; Lambris, John D; Mastellos, Dimitrios C; Sfyroera, Georgia

    2015-10-15

    Staphylococcus aureus can cause a broad range of potentially fatal inflammatory complications (e.g., sepsis and endocarditis). Its emerging antibiotic resistance and formidable immune evasion arsenal have emphasized the need for more effective antimicrobial approaches. Complement is an innate immune sensor that rapidly responds to bacterial infection eliciting C3-mediated opsonophagocytic and immunomodulatory responses. Extracellular fibrinogen-binding protein (Efb) is a key immune evasion protein of S. aureus that intercepts complement at the level of C3. To date, Efb has not been explored as a target for mAb-based antimicrobial therapeutics. In this study, we have isolated donor-derived anti-Efb IgGs that attenuate S. aureus survival through enhanced neutrophil killing. A phage library screen yielded mini-Abs that selectively inhibit the interaction of Efb with C3 partly by disrupting contacts essential for complex formation. Surface plasmon resonance-based kinetic analysis enabled the selection of mini-Abs with favorable Efb-binding profiles as therapeutic leads. Mini-Ab-mediated blockade of Efb attenuated S. aureus survival in a whole blood model of bacteremia. This neutralizing effect was associated with enhanced neutrophil-mediated killing of S. aureus, increased C5a release, and modulation of IL-6 secretion. Finally, these mini-Abs afforded protection from S. aureus-induced bacteremia in a murine renal abscess model, attenuating bacterial inflammation in kidneys. Overall, these findings are anticipated to pave the way toward novel Ab-based therapeutics for S. aureus-related diseases. Copyright © 2015 by The American Association of Immunologists, Inc.

  4. Discovery of a new family of relaxases in Firmicutes bacteria.

    PubMed

    Ramachandran, Gayetri; Miguel-Arribas, Andrés; Abia, David; Singh, Praveen K; Crespo, Isidro; Gago-Córdoba, César; Hao, Jian An; Luque-Ortega, Juan Roman; Alfonso, Carlos; Wu, Ling J; Boer, D Roeland; Meijer, Wilfried J J

    2017-02-01

    Antibiotic resistance is a serious global problem. Antibiotic resistance genes (ARG), which are widespread in environmental bacteria, can be transferred to pathogenic bacteria via horizontal gene transfer (HGT). Gut microbiomes are especially apt for the emergence and dissemination of ARG. Conjugation is the HGT route that is predominantly responsible for the spread of ARG. Little is known about conjugative elements of Gram-positive bacteria, including those of the phylum Firmicutes, which are abundantly present in gut microbiomes. A critical step in the conjugation process is the relaxase-mediated site- and strand-specific nick in the oriT region of the conjugative element. This generates a single-stranded DNA molecule that is transferred from the donor to the recipient cell via a connecting channel. Here we identified and characterized the relaxosome components oriT and the relaxase of the conjugative plasmid pLS20 of the Firmicute Bacillus subtilis. We show that the relaxase gene, named relLS20, is essential for conjugation, that it can function in trans and provide evidence that Tyr26 constitutes the active site residue. In vivo and in vitro analyses revealed that the oriT is located far upstream of the relaxase gene and that the nick site within oriT is located on the template strand of the conjugation genes. Surprisingly, the RelLS20 shows very limited similarity to known relaxases. However, more than 800 genes to which no function had been attributed so far are predicted to encode proteins showing significant similarity to RelLS20. Interestingly, these putative relaxases are encoded almost exclusively in Firmicutes bacteria. Thus, RelLS20 constitutes the prototype of a new family of relaxases. The identification of this novel relaxase family will have an important impact in different aspects of future research in the field of HGT in Gram-positive bacteria in general, and specifically in the phylum of Firmicutes, and in gut microbiome research.

  5. Intrinsically Labeled Fluorescent Oligonucleotide Probes on Quantum Dots for Transduction of Nucleic Acid Hybridization.

    PubMed

    Shahmuradyan, Anna; Krull, Ulrich J

    2016-03-15

    Quantum dots (QDs) have been widely used in chemical and biosensing due to their unique photoelectrical properties and are well suited as donors in fluorescence resonance energy transfer (FRET). Selective hybridization interactions of oligonucleotides on QDs have been determined by FRET. Typically, the QD-FRET constructs have made use of labeled targets or have implemented labeled sandwich format assays to introduce dyes in proximity to the QDs for the FRET process. The intention of this new work is to explore a method to incorporate the acceptor dye into the probe molecule. Thiazole orange (TO) derivatives are fluorescent intercalating dyes that have been used for detection of double-stranded nucleic acids. One such dye system has been reported in which single-stranded oligonucleotide probes were doubly labeled with adjacent thiazole orange derivatives. In the absence of the fully complementary (FC) oligonucleotide target, the dyes form an H-aggregate, which results in quenching of fluorescence emission due to excitonic interactions between the dyes. The hybridization of the FC target to the probe provides for dissociation of the aggregate as the dyes intercalate into the double stranded duplex, resulting in increased fluorescence. This work reports investigation of the dependence of the ratiometric signal on the type of linkage used to conjugate the dyes to the probe, the location of the dye along the length of the probe, and the distance between adjacent dye molecules. The limit of detection for 34mer and 90mer targets was found to be identical and was 10 nM (2 pmol), similar to analogous QD-FRET using labeled oligonucleotide target. The detection system could discriminate a one base pair mismatch (1BPM) target and was functional without substantial compromise of the signal in 75% serum. The 1BPM was found to reduce background signal, indicating that the structure of the mismatch affected the environment of the intercalating dyes.

  6. Discovery of a new family of relaxases in Firmicutes bacteria

    PubMed Central

    Singh, Praveen K.; Hao, Jian An; Luque-Ortega, Juan Roman; Wu, Ling J.; Boer, D. Roeland

    2017-01-01

    Antibiotic resistance is a serious global problem. Antibiotic resistance genes (ARG), which are widespread in environmental bacteria, can be transferred to pathogenic bacteria via horizontal gene transfer (HGT). Gut microbiomes are especially apt for the emergence and dissemination of ARG. Conjugation is the HGT route that is predominantly responsible for the spread of ARG. Little is known about conjugative elements of Gram-positive bacteria, including those of the phylum Firmicutes, which are abundantly present in gut microbiomes. A critical step in the conjugation process is the relaxase-mediated site- and strand-specific nick in the oriT region of the conjugative element. This generates a single-stranded DNA molecule that is transferred from the donor to the recipient cell via a connecting channel. Here we identified and characterized the relaxosome components oriT and the relaxase of the conjugative plasmid pLS20 of the Firmicute Bacillus subtilis. We show that the relaxase gene, named relLS20, is essential for conjugation, that it can function in trans and provide evidence that Tyr26 constitutes the active site residue. In vivo and in vitro analyses revealed that the oriT is located far upstream of the relaxase gene and that the nick site within oriT is located on the template strand of the conjugation genes. Surprisingly, the RelLS20 shows very limited similarity to known relaxases. However, more than 800 genes to which no function had been attributed so far are predicted to encode proteins showing significant similarity to RelLS20. Interestingly, these putative relaxases are encoded almost exclusively in Firmicutes bacteria. Thus, RelLS20 constitutes the prototype of a new family of relaxases. The identification of this novel relaxase family will have an important impact in different aspects of future research in the field of HGT in Gram-positive bacteria in general, and specifically in the phylum of Firmicutes, and in gut microbiome research. PMID:28207825

  7. Immunostimulation by cytomegalovirus (CMV): helper T cell-dependent activation of immunoglobulin production in vitro by lymphocytes from CMV-immune donors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yachie, A.; Tosato, G.; Straus, S.E.

    1985-08-01

    Cytomegalovirus (CMV) is the cause of a number of different diseases ranging from self-limited benign infections in healthy adults to life threatening illnesses among immunocompromised hosts and newborns. Suppression of cell-mediated immunity is often found in cases of acute CMV infection, and in addition, the virus may also be a potent stimulant of lymphoid cells in vivo. The authors studied cellular proliferation and immunoglobulin (Ig) production induced by CMV to determine its effect on human lymphocytes in vitro. The CMV that was added to cultures of lymphocytes from CMV-seronegative donors failed to induce either significant cellular proliferation or Ig production.more » By contrast, CMV-stimulated cultures from CMV-seropositive donors induced both prominent cellular proliferation and Ig production. B cell differentiation into Ig-secreting cells required the presence of T cells, and this T cell help was sensitive to irradiation with 2000 rad and to treatment with cyclosporin A. When T cells were depleted of OKT4+ cells with monoclonal antibody and complement, the co-cultured B cells failed to produce Ig, whereas the depletion of OKT8+ cells had no effect on the Ig-secreting cell response. Inactivation of CMV before culture did not result in a reduction of either cellular proliferation or Ig production. Thus, infection of target cells is not required for in vitro lymphocyte activation by CMV. These results demonstrate that CMV is a potent activator of B cells inducing Ig production in vitro, and that this process requires the presence of virus-specific memory T cells.« less

  8. Innate inflammatory gene expression profiling in potential brain-dead donors: detailed investigation of the effect of common corticosteroid therapy.

    PubMed

    Gholamnezhadjafari, Reza; Tajik, Nader; Falak, Reza; Aflatoonian, Reza; Dehghan, Sanaz; Rezaei, Abbas

    2017-07-01

    Our study aimed to assess the influence of common methylprednisolone therapy on innate inflammatory factors in potential brain-dead organ donors (BDDs). The study groups consisted of 50 potential BDDs who received 15 mg/kg/d methylprednisolone and 25 live organ donors (LDs) as control group. Innate immunity gene expression profiling was performed by RT-PCR array. Soluble serum cytokines and chemokines, complement components, heat shock protein 70 (HSP70) and high mobility group box-1 (HMGB1) were measured by ELISA. Surface expression of TLR2 and TLR4 were determined using flow cytometry. Gene expression profiling revealed up-regulation of TLRs 1, 2, 4, 5, 6, 7 and 8, MYD88, NF-κB, NF-κB1A, IRAK1, STAT3, JAK2, TNF-α, IL-1β, CD86 and CD14 in the BDD group. Remarkably, the serum levels of C-reactive protein and HSP70 were considerably higher in the BDD group. In addition, serum amounts of IL-1β, IL-6, TNF-α, HMGB1, HSP70, C3a and C5a, but not IL-8, sCD86 or monocyte chemoattractant protein-1, were significantly increased in the BDD group. Significant differences were observed in flow cytometry analysis of TLR2 and TLR4 between the two groups. In summary, common methylprednisolone therapy in BDDs did not adequately reduce systemic inflammation, which could be due to inadequate doses or inefficient impact on other inflammatory-inducing pathways, for example oxidative stress or production of damage-associated molecules.

  9. Gene editing advance re-ignites debate on the merits and risks of animal to human transplantation.

    PubMed

    Fung, R K F; Kerridge, I H

    2016-09-01

    In Australia, and internationally, the shortage of organ and tissue donors significantly limits the number of patients with critical organ or tissue failure who are able to receive a transplant each year. The rationale for xenotransplantation - the transplantation of living cells, tissues or organs from one species to another - is to meet this shortfall in human donor material. While early clinical trials showed promise, particularly in patients with type I diabetes whose insulin dependence could be temporarily reversed by the transplantation of porcine islet cells, these benefits have been balanced with scientific, clinical and ethical concerns revolving around the risks of immune rejection and the potential transmission of porcine endogenous retroviruses or other infectious agents from porcine grafts to human recipients. However, the advent of CRISPR/Cas9, a revolutionary gene editing technology, has reignited interest in the field with the possibility of genetically engineering porcine organs and tissues that are less immunogenic and have virtually no risk of transmission of porcine endogenous retroviruses. At the same time, CRISPR/Cas9 may also open up a myriad of possibilities for tissue engineering and stem cell research, which may complement xenotransplantation research by providing an additional source of donor cells, tissues and organs for transplantation into patients. The recent international symposium on gene editing, organised by the US National Academy of Sciences, highlights both the enormous therapeutic potential of CRISPR/Cas9 and the raft of ethical and regulatory challenges that may follow its utilisation in transplantation and in medicine more generally. © 2016 Royal Australasian College of Physicians.

  10. Silicon as a model ion trap: Time domain measurements of donor Rydberg states

    PubMed Central

    Vinh, N. Q.; Greenland, P. T.; Litvinenko, K.; Redlich, B.; van der Meer, A. F. G.; Lynch, S. A.; Warner, M.; Stoneham, A. M.; Aeppli, G.; Paul, D. J.; Pidgeon, C. R.; Murdin, B. N.

    2008-01-01

    One of the great successes of quantum physics is the description of the long-lived Rydberg states of atoms and ions. The Bohr model is equally applicable to donor impurity atoms in semiconductor physics, where the conduction band corresponds to the vacuum, and the loosely bound electron orbiting a singly charged core has a hydrogen-like spectrum according to the usual Bohr–Sommerfeld formula, shifted to the far-infrared because of the small effective mass and high dielectric constant. Manipulation of Rydberg states in free atoms and ions by single and multiphoton processes has been tremendously productive since the development of pulsed visible laser spectroscopy. The analogous manipulations have not been conducted for donor impurities in silicon. Here, we use the FELIX pulsed free electron laser to perform time-domain measurements of the Rydberg state dynamics in phosphorus- and arsenic-doped silicon and we have obtained lifetimes consistent with frequency domain linewidths for isotopically purified silicon. This implies that the dominant decoherence mechanism for excited Rydberg states is lifetime broadening, just as for atoms in ion traps. The experiments are important because they represent a step toward coherent control and manipulation of atomic-like quantum levels in the most common semiconductor and complement magnetic resonance experiments in the literature, which show extraordinarily long spin lattice relaxation times—key to many well known schemes for quantum computing qubits—for the same impurities. Our results, taken together with the magnetic resonance data and progress in precise placement of single impurities, suggest that doped silicon, the basis for modern microelectronics, is also a model ion trap.

  11. Bioactive grape proanthocyanidins enhance immune reactivity in UV-irradiated skin through functional activation of dendritic cells in mice

    PubMed Central

    Vaid, Mudit; Singh, Tripti; Prasad, Ram; Elmets, Craig A.; Xu, Hui; Katiyar, Santosh K.

    2013-01-01

    Ultraviolet (UV) radiation-induced immunosuppression has been implicated in skin carcinogenesis. Grape seed proanthocyanidins (GSPs) have anti-skin carcinogenic effects in mice and GSPs-fed mice exhibit a reduction in UV-induced suppression of allergic contact hypersensitivity (CHS), a prototypic T cell-mediated response. Here, we report that dietary GSPs did not inhibit UVB-induced suppression of CHS in xeroderma pigmentosum complementation group A (XPA)-deficient mice, which lack nucleotide excision repair mechanisms. GSPs enhanced repair of UVB-induced DNA damage (cyclobutane pyrimidine dimers) in wild-type, but not XPA-deficient, dendritic cells (DCs). Co-culture of CD4+ T cells with DCs from UVB-irradiated wild-type mice resulted in suppression of T-cell proliferation and secretion of Th-1 type cytokines that was ameliorated when the DCs were obtained from GSPs-fed mice; whereas, DCs obtained from GSPs-fed XPA-KO mice failed to restore T-cell proliferation. In adoptive transfer experiments, donor DCs were positively selected from the draining lymph nodes of UVB-exposed donor mice that were sensitized to 2,4, dinitrofluorobenzene were transferred into naïve recipient mice and the CHS response assessed. Naïve recipients that received DCs from UVB-exposed wild-type donors that had been fed GSPs exhibited a full CHS response, whereas no significant CHS was observed in mice that received DCs from XPA-KO mice fed GSPs. These results suggest that GSPs prevent UVB-induced immunosuppression through DNA repair-dependent functional activation of dendritic cells in mice. PMID:23321928

  12. Biophysics of Artificially Expanded Genetic Information Systems. Thermodynamics of DNA Duplexes Containing Matches and Mismatches Involving 2-Amino-3-nitropyridin-6-one (Z) and Imidazo[1,2-a]-1,3,5-triazin-4(8H)one (P).

    PubMed

    Wang, Xiaoyu; Hoshika, Shuichi; Peterson, Raymond J; Kim, Myong-Jung; Benner, Steven A; Kahn, Jason D

    2017-05-19

    Synthetic nucleobases presenting non-Watson-Crick arrangements of hydrogen bond donor and acceptor groups can form additional nucleotide pairs that stabilize duplex DNA independent of the standard A:T and G:C pairs. The pair between 2-amino-3-nitropyridin-6-one 2'-deoxyriboside (presenting a {donor-donor-acceptor} hydrogen bonding pattern on the Watson-Crick face of the small component, trivially designated Z) and imidazo[1,2-a]-1,3,5-triazin-4(8H)one 2'-deoxyriboside (presenting an {acceptor-acceptor-donor} hydrogen bonding pattern on the large component, trivially designated P) is one of these extra pairs for which a substantial amount of molecular biology has been developed. Here, we report the results of UV absorbance melting measurements and determine the energetics of binding of DNA strands containing Z and P to give short duplexes containing Z:P pairs as well as various mismatches comprising Z and P. All measurements were done at 1 M NaCl in buffer (10 mM Na cacodylate, 0.5 mM EDTA, pH 7.0). Thermodynamic parameters (ΔH°, ΔS°, and ΔG° 37 ) for oligonucleotide hybridization were extracted. Consistent with the Watson-Crick model that considers both geometric and hydrogen bonding complementarity, the Z:P pair was found to contribute more to duplex stability than any mismatches involving either nonstandard nucleotide. Further, the Z:P pair is more stable than a C:G pair. The Z:G pair was found to be the most stable mismatch, forming either a deprotonated mismatched pair or a wobble base pair analogous to the stable T:G mismatch. The C:P pair is less stable, perhaps analogous to the wobble pair observed for C:O 6 -methyl-G, in which the pyrimidine is displaced into the minor groove. The Z:A and T:P mismatches are much less stable. Parameters for predicting the thermodynamics of oligonucleotides containing Z and P bases are provided. This represents the first case where this has been done for a synthetic genetic system.

  13. Heart transplant coronary artery disease: Multimodality approach in percutaneous intervention.

    PubMed

    Leite, Luís; Matos, Vítor; Gonçalves, Lino; Silva Marques, João; Jorge, Elisabete; Calisto, João; Antunes, Manuel; Pego, Mariano

    2016-06-01

    Coronary artery disease is the most important cause of late morbidity and mortality after heart transplantation. It is usually an immunologic phenomenon termed cardiac allograft vasculopathy, but can also be the result of donor-transmitted atherosclerosis. Routine surveillance by coronary angiography should be complemented by intracoronary imaging, in order to determine the nature of the coronary lesions, and also by assessment of their functional significance to guide the decision whether to perform percutaneous coronary intervention. We report a case of coronary angiography at five-year follow-up after transplantation, using optical coherence tomography and fractional flow reserve to assess and optimize treatment of coronary disease in this challenging population. Copyright © 2016 Sociedade Portuguesa de Cardiologia. Published by Elsevier España. All rights reserved.

  14. Paramyxovirus activation and inhibition of innate immune responses.

    PubMed

    Parks, Griffith D; Alexander-Miller, Martha A

    2013-12-13

    Paramyxoviruses represent a remarkably diverse family of enveloped nonsegmented negative-strand RNA viruses, some of which are the most ubiquitous disease-causing viruses of humans and animals. This review focuses on paramyxovirus activation of innate immune pathways, the mechanisms by which these RNA viruses counteract these pathways, and the innate response to paramyxovirus infection of dendritic cells (DC). Paramyxoviruses are potent activators of extracellular complement pathways, a first line of defense that viruses must face during natural infections. We discuss mechanisms by which these viruses activate and combat complement to delay neutralization. Once cells are infected, virus replication drives type I interferon (IFN) synthesis that has the potential to induce a large number of antiviral genes. Here we describe four approaches by which paramyxoviruses limit IFN induction: by limiting synthesis of IFN-inducing aberrant viral RNAs, through targeted inhibition of RNA sensors, by providing viral decoy substrates for cellular kinase complexes, and through direct blocking of the IFN promoter. In addition, paramyxoviruses have evolved diverse mechanisms to disrupt IFN signaling pathways. We describe three general mechanisms, including targeted proteolysis of signaling factors, sequestering cellular factors, and upregulation of cellular inhibitors. DC are exceptional cells with the capacity to generate adaptive immunity through the coupling of innate immune signals and T cell activation. We discuss the importance of innate responses in DC following paramyxovirus infection and their consequences for the ability to mount and maintain antiviral T cells. © 2013.

  15. Paramyxovirus Activation and Inhibition of Innate Immune Responses

    PubMed Central

    Parks, Griffith D.; Alexander-Miller, Martha A.

    2014-01-01

    Paramyxoviruses represent a remarkably diverse family of enveloped nonsegmented negative-strand RNA viruses, some of which are the most ubiquitous disease-causing viruses of humans and animals. This review focuses on paramyxovirus activation of innate immune pathways, the mechanisms by which these RNA viruses counteract these pathways, and the innate response to paramyxovirus infection of dendritic cells (DC). Paramyxoviruses are potent activators of extracellular complement pathways, a first line of defense that viruses must face during natural infections. We discuss mechanisms by which these viruses activate and combat complement to delay neutralization. Once cells are infected, virus replication drives type I interferon (IFN) synthesis that has the potential to induce a large number of antiviral genes. Here we describe four approaches by which paramyxoviruses limit IFN induction: by limiting synthesis of IFN-inducing aberrant viral RNAs, through targeted inhibition of RNA sensors, by providing viral decoy substrates for cellular kinase complexes, and through direct blocking of the IFN promoter. In addition, paramyxoviruses have evolved diverse mechanisms to disrupt IFN signaling pathways. We describe three general mechanisms, including targeted proteolysis of signaling factors, sequestering cellular factors, and upregulation of cellular inhibitors. DC are exceptional cells with the capacity to generate adaptive immunity through the coupling of innate immune signals and T cell activation. We discuss the importance of innate responses in DC following paramyxovirus infection and their consequences for the ability to mount and maintain antiviral T cells. PMID:24056173

  16. Worldwide Distribution of Four SNPs in X‐Ray and Repair and Cross‐Complementing Group 1 (XRCC1)

    PubMed Central

    Takeshita, Haruo; Yasuda, Toshihiro; Kimura‐Kataoka, Kaori

    2014-01-01

    Abstract Purpose X‐ray repair cross‐complementing group 1 (XRCC1) repairs single‐strand breaks in DNA. Several reports have shown the association of single nucleotide polymorphisms (SNPs) (Arg194Trp, Pro206Pro, Arg280His, Arg399Gln) in XRCC1 to diseases. Limited population data are available regarding SNPs in XRCC1, especially in African populations. In this study, genotype distributions of four SNPs in worldwide populations were examined and compared with those reported previously. Materials and Methods Four SNPs (Arg194Trp, Pro206Pro, Arg280His, Arg399Gln) in XRCC1 from genomic DNA samples of 10 populations were evaluated by using polymerase chain reaction followed by restriction fragment length polymorphism analysis. Results The frequency of the minor allele corresponding to the Trp allele of XRCC1Arg194Trp was higher in Asian populations than in African and Caucasian populations. As for XRCC1Pro206Pro, Africans showed higher minor allele frequencies than did Asian populations, except for Tamils and Sinhalese. XRCC1 Arg280His frequencies were similar among Africans and Caucasians but differed among Asian populations. Similarly, lower mutant XRCC1 Arg399Gln frequencies were observed in Africans. Conclusions This study is the first to show the existence of a certain genetic heterogeneity in the worldwide distribution of four SNPs in XRCC1. PMID:25387884

  17. Quantitative and Dynamic Imaging of ATM Kinase Activity by Bioluminescence Imaging.

    PubMed

    Nyati, Shyam; Young, Grant; Ross, Brian Dale; Rehemtulla, Alnawaz

    2017-01-01

    Ataxia telangiectasia mutated (ATM) is a serine/threonine kinase critical to the cellular DNA damage response, including DNA double strand breaks (DSBs). ATM activation results in the initiation of a complex cascade of events facilitating DNA damage repair, cell cycle checkpoint control, and survival. Traditionally, protein kinases have been analyzed in vitro using biochemical methods (kinase assays using purified proteins or immunological assays) requiring a large number of cells and cell lysis. Genetically encoded biosensors based on optical molecular imaging such as fluorescence or bioluminescence have been developed to enable interrogation of kinase activities in live cells with a high signal to background. We have genetically engineered a hybrid protein whose bioluminescent activity is dependent on the ATM-mediated phosphorylation of a substrate. The engineered protein consists of the split luciferase-based protein complementation pair with a CHK2 (a substrate for ATM kinase activity) target sequence and a phospho-serine/threonine-binding domain, FHA2, derived from yeast Rad53. Phosphorylation of the serine residue within the target sequence by ATM would lead to its interaction with the phospho-serine-binding domain, thereby preventing complementation of the split luciferase pair and loss of reporter activity. Bioluminescence imaging of reporter-expressing cells in cultured plates or as mouse xenografts provides a quantitative surrogate for ATM kinase activity and therefore the cellular DNA damage response in a noninvasive, dynamic fashion.

  18. Quantitative and Dynamic Imaging of ATM Kinase Activity.

    PubMed

    Nyati, Shyam; Young, Grant; Ross, Brian Dale; Rehemtulla, Alnawaz

    2017-01-01

    Ataxia telangiectasia mutated (ATM) is a serine/threonine kinase critical to the cellular DNA-damage response, including DNA double-strand breaks (DSBs). ATM activation results in the initiation of a complex cascade of events facilitating DNA damage repair, cell cycle checkpoint control, and survival. Traditionally, protein kinases have been analyzed in vitro using biochemical methods (kinase assays using purified proteins or immunological assays) requiring a large number of cells and cell lysis. Genetically encoded biosensors based on optical molecular imaging such as fluorescence or bioluminescence have been developed to enable interrogation of kinase activities in live cells with a high signal to background. We have genetically engineered a hybrid protein whose bioluminescent activity is dependent on the ATM-mediated phosphorylation of a substrate. The engineered protein consists of the split luciferase-based protein complementation pair with a CHK2 (a substrate for ATM kinase activity) target sequence and a phospho-serine/threonine-binding domain, FHA2, derived from yeast Rad53. Phosphorylation of the serine residue within the target sequence by ATM would lead to its interaction with the phospho-serine-binding domain, thereby preventing complementation of the split luciferase pair and loss of reporter activity. Bioluminescence imaging of reporter expressing cells in cultured plates or as mouse xenografts provides a quantitative surrogate for ATM kinase activity and therefore the cellular DNA damage response in a noninvasive, dynamic fashion.

  19. Functional conservation of the yeast and Arabidopsis RAD54-like genes.

    PubMed

    Klutstein, Michael; Shaked, Hezi; Sherman, Amir; Avivi-Ragolsky, Naomi; Shema, Efrat; Zenvirth, Drora; Levy, Avraham A; Simchen, Giora

    2008-04-01

    The Saccharomyces cerevisiae RAD54 gene has critical roles in DNA double-strand break repair, homologous recombination, and gene targeting. Previous results show that the yeast gene enhances gene targeting when expressed in Arabidopsis thaliana. In this work we address the trans-species compatibility of Rad54 functions. We show that overexpression of yeast RAD54 in Arabidopsis enhances DNA damage resistance severalfold. Thus, the yeast gene is active in the Arabidopsis homologous-recombination repair system. Moreover, we have identified an A. thaliana ortholog of yeast RAD54, named AtRAD54. This gene, with close sequence similarity to RAD54, complements methylmethane sulfonate (MMS) sensitivity but not UV sensitivity or gene targeting defects of rad54Delta mutant yeast cells. Overexpression of AtRAD54 in Arabidopsis leads to enhanced resistance to DNA damage. This gene's assignment as a RAD54 ortholog is further supported by the interaction of AtRad54 with AtRad51 and the interactions between alien proteins (i.e., yeast Rad54 with AtRAD51 and yeast Rad51 with AtRad54) in a yeast two-hybrid experiment. These interactions hint at the molecular nature of this interkingdom complementation, although the stronger effect of the yeast Rad54 in plants than AtRad54 in yeast might be explained by an ability of the Rad54 protein to act alone, independently of its interaction with Rad51.

  20. Fast and Efficient Drosophila melanogaster Gene Knock-Ins Using MiMIC Transposons

    PubMed Central

    Vilain, Sven; Vanhauwaert, Roeland; Maes, Ine; Schoovaerts, Nils; Zhou, Lujia; Soukup, Sandra; da Cunha, Raquel; Lauwers, Elsa; Fiers, Mark; Verstreken, Patrik

    2014-01-01

    Modern molecular genetics studies necessitate the manipulation of genes in their endogenous locus, but most of the current methodologies require an inefficient donor-dependent homologous recombination step to locally modify the genome. Here we describe a methodology to efficiently generate Drosophila knock-in alleles by capitalizing on the availability of numerous genomic MiMIC transposon insertions carrying recombinogenic attP sites. Our methodology entails the efficient PhiC31-mediated integration of a recombination cassette flanked by unique I-SceI and/or I-CreI restriction enzyme sites into an attP-site. These restriction enzyme sites allow for double-strand break−mediated removal of unwanted flanking transposon sequences, while leaving the desired genomic modifications or recombination cassettes. As a proof-of-principle, we mutated LRRK, tau, and sky by using different MiMIC elements. We replaced 6 kb of genomic DNA encompassing the tau locus and 35 kb encompassing the sky locus with a recombination cassette that permits easy integration of DNA at these loci and we also generated a functional LRRKHA knock in allele. Given that ~92% of the Drosophila genes are located within the vicinity (<35 kb) of a MiMIC element, our methodology enables the efficient manipulation of nearly every locus in the fruit fly genome without the need for inefficient donor-dependent homologous recombination events. PMID:25298537

  1. Fast and efficient Drosophila melanogaster gene knock-ins using MiMIC transposons.

    PubMed

    Vilain, Sven; Vanhauwaert, Roeland; Maes, Ine; Schoovaerts, Nils; Zhou, Lujia; Soukup, Sandra; da Cunha, Raquel; Lauwers, Elsa; Fiers, Mark; Verstreken, Patrik

    2014-10-08

    Modern molecular genetics studies necessitate the manipulation of genes in their endogenous locus, but most of the current methodologies require an inefficient donor-dependent homologous recombination step to locally modify the genome. Here we describe a methodology to efficiently generate Drosophila knock-in alleles by capitalizing on the availability of numerous genomic MiMIC transposon insertions carrying recombinogenic attP sites. Our methodology entails the efficient PhiC31-mediated integration of a recombination cassette flanked by unique I-SceI and/or I-CreI restriction enzyme sites into an attP-site. These restriction enzyme sites allow for double-strand break-mediated removal of unwanted flanking transposon sequences, while leaving the desired genomic modifications or recombination cassettes. As a proof-of-principle, we mutated LRRK, tau, and sky by using different MiMIC elements. We replaced 6 kb of genomic DNA encompassing the tau locus and 35 kb encompassing the sky locus with a recombination cassette that permits easy integration of DNA at these loci and we also generated a functional LRRK(HA) knock in allele. Given that ~92% of the Drosophila genes are located within the vicinity (<35 kb) of a MiMIC element, our methodology enables the efficient manipulation of nearly every locus in the fruit fly genome without the need for inefficient donor-dependent homologous recombination events. Copyright © 2014 Vilain et al.

  2. Culture time of vitrified/warmed zygotes before microinjection affects the production efficiency of CRISPR-Cas9-mediated knock-in mice.

    PubMed

    Nakagawa, Yoshiko; Sakuma, Tetsushi; Nishimichi, Norihisa; Yokosaki, Yasuyuki; Takeo, Toru; Nakagata, Naomi; Yamamoto, Takashi

    2017-05-15

    Robust reproductive engineering techniques are required for the efficient and rapid production of genetically modified mice. We have reported the efficient production of genome-edited mice using reproductive engineering techniques, such as ultra-superovulation, in vitro fertilization (IVF) and vitrification/warming of zygotes. We usually use vitrified/warmed fertilized oocytes created by IVF for microinjection because of work efficiency and flexible scheduling. Here, we investigated whether the culture time of zygotes before microinjection influences the efficiency of producing knock-in mice. Knock-in mice were generated using clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) system and single-stranded oligodeoxynucleotide (ssODN) or PITCh (Precise Integration into Target Chromosome) system, a method of integrating a donor vector assisted by microhomology-mediated end-joining. The cryopreserved fertilized oocytes were warmed, cultured for several hours and microinjected at different timings. Microinjection was performed with Cas9 protein, guide RNA(s), and an ssODN or PITCh donor plasmid for the ssODN knock-in and the PITCh knock-in, respectively. Different production efficiencies of knock-in mice were observed by changing the timing of microinjection. Our study provides useful information for the CRISPR-Cas9-based generation of knock-in mice. © 2017. Published by The Company of Biologists Ltd.

  3. Half-peroneus-longus-tendon graft augmentation for unqualified hamstring tendon graft of anterior cruciate ligament reconstruction.

    PubMed

    Liu, Chung-Ting; Lu, Yung-Chang; Huang, Chang-Hung

    2015-09-01

    In some situations, harvested hamstring tendon grafts are not qualified for anterior cruciate ligament (ACL) reconstruction. This study aimed to present a reinforcing method with additional half peroneus longus tendon (half-PLT) graft augmentation. Eight cases underwent ACL reconstruction with unqualified hamstring tendon grafts (diameter <7 mm) and were salvaged by additional half-PLT graft augmentation. The pivot shift test and KT-1000 tests were performed 3 years after surgery. Functional evaluation of subjective International Knee Documentation Committee (IKDC) and Lysholm scores was also done. In addition, Foot and Ankle Disability Index (FADI) scores were used to evaluate the function of the ankle donor site. The diameter of unqualified four-strand hamstring tendon grafts was 6.2 mm on average (range, 6.0-6.5 mm). The average diameter of hamstring grafts with half-PLT augmentation was 9.6 mm (range, 9.5-10.0 mm). The pivot shift test was negative in all patients. No significant differences between normal and abnormal knees were found by KT-1000. The average IKDC score was 86.0 (range, 83 to 89), and the average Lysholm score was 84.4 (range, 80-90). The average FADI score for the donor sites of half-PLT was 135.8 (range, 134-136). Additional half-PLT can successfully and safely reinforce unqualified hamstring tendon grafts for ACL reconstruction.

  4. Cytochrome P450 isozyme protein verified in the skin of southern hemisphere humpback whales (Megaptera novaeangliae): implications for biochemical biomarker assessment.

    PubMed

    Waugh, Courtney A; Huston, Wilhelmina M; Noad, Michael J; Bengtson Nash, Susan

    2011-04-01

    Large mysticete whales represent a unique challenge for chemical risk assessment. Few epidemiological investigations are possible due to the low incidence of adult stranding events. Similarly their often extreme life-history adaptations of prolonged migration and fasting challenge exposure assumptions. Molecular biomarkers offer the potential to complement information yielded through tissue chemical analysis, as well as providing evidence of a molecular response to chemical exposure. In this study we confirm the presence of cytochrome P450 reductase (CPR) and cytochrome P450 isoenzyme 1A1 (CYP1A1) in epidermal tissue of southern hemisphere humpback whales (Megaptera novaeangliae). The detection of CYP1A1 in the integument of the humpback whale affords the opportunity for further quantitative non-destructive investigations of enzyme activity as a function of chemical stress. Copyright © 2011 Elsevier Ltd. All rights reserved.

  5. Collagenolytic Matrix Metalloproteinase Structure-Function Relationships: Insights From Molecular Dynamics Studies.

    PubMed

    Karabencheva-Christova, Tatyana G; Christov, Christo Z; Fields, Gregg B

    2017-01-01

    Several members of the zinc-dependent matrix metalloproteinase (MMP) family catalyze collagen degradation. Experimental data reveal a collaboration between different MMP domains in order to achieve efficient collagenolysis. Molecular dynamics (MD) simulations have been utilized to provide atomistic details of the collagenolytic process. The triple-helical structure of collagen exhibits local regions of flexibility, with modulation of interchain salt bridges and water bridges contributing to accessibility of individual chains by the enzyme. In turn, the hemopexin-like (HPX) domain of the MMP initially binds the triple helix and facilitates the presentation of individual strands to active site in the catalytic (CAT) domain. Extensive positive and negative correlated motions are observed between the CAT and HPX domains when collagen is bound. Ultimately, the MD simulation studies have complemented structural (NMR spectroscopy, X-ray crystallography) and kinetic analyses to provide a more detailed mechanistic view of MMP-catalyzed collagenolysis. © 2017 Elsevier Inc. All rights reserved.

  6. Nuclease-mediated double-strand break (DSB) enhancement of small fragment homologous recombination (SFHR) gene modification in human-induced pluripotent stem cells (hiPSCs).

    PubMed

    Sargent, R Geoffrey; Suzuki, Shingo; Gruenert, Dieter C

    2014-01-01

    Recent developments in methods to specifically modify genomic DNA using sequence-specific endonucleases and donor DNA have opened the door to a new therapeutic paradigm for cell and gene therapy of inherited diseases. Sequence-specific endonucleases, in particular transcription activator-like (TAL) effector nucleases (TALENs), have been coupled with polynucleotide small/short DNA fragments (SDFs) to correct the most common mutation in the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene, a 3-base-pair deletion at codon 508 (delF508), in induced pluripotent stem (iPS) cells. The studies presented here describe the generation of candidate TALENs and their co-transfection with wild-type (wt) CFTR-SDFs into CF-iPS cells homozygous for the delF508 mutation. Using an allele-specific PCR (AS-PCR)-based cyclic enrichment protocol, clonal populations of corrected CF-iPS cells were isolated and expanded.

  7. Interaction of the host protein NbDnaJ with Potato virus X minus-strand stem-loop 1 RNA and capsid protein affects viral replication and movement.

    PubMed

    Cho, Sang-Yun; Cho, Won Kyong; Sohn, Seong-Han; Kim, Kook-Hyung

    2012-01-06

    Plant viruses must interact with host cellular components to replicate and move from cell to cell. In the case of Potato virus X (PVX), it carries stem-loop 1 (SL1) RNA essential for viral replication and movement. Using two-dimensional electrophoresis northwestern blot analysis, we previously identified several host proteins that bind to SL1 RNA. Of those, we further characterized a DnaJ-like protein from Nicotiana benthamiana named NbDnaJ. An electrophoretic mobility shift assay confirmed that NbDnaJ binds only to SL1 minus-strand RNA, and bimolecular fluorescence complementation (BiFC) indicated that NbDnaJ interacts with PVX capsid protein (CP). Using a series of deletion mutants, the C-terminal region of NbDnaJ was found to be essential for the interaction with PVX CP. The expression of NbDnaJ significantly changed upon infection with different plant viruses such as PVX, Tobacco mosaic virus, and Cucumber mosaic virus, but varied depending on the viral species. In transient experiments, both PVX replication and movement were inhibited in plants that over-expressed NbDnaJ but accelerated in plants in which NbDnaJ was silenced. In summary, we suggest that the newly identified NbDnaJ plays a role in PVX replication and movement by interacting with SL1(-) RNA and PVX CP. Copyright © 2011 Elsevier Inc. All rights reserved.

  8. mre11S—a yeast mutation that blocks double-strand-break processing and permits nonhomologous synapsis in meiosis

    PubMed Central

    Nairz, Knud; Klein, Franz

    1997-01-01

    During meiotic prophase the repair of self-inflicted DNA double-strand break (DSB) damage leads to meiotic recombination in yeast. We employed a genetic screen to specifically characterize cellular functions that become essential after this DSB formation. As a result a new allele of MRE11, termed mre11S (for Separation of functions) was isolated that allows initiation but not processing and repair of meiotic DSBs similar to the well-characterized rad50S allele. In contrast, the mre11-1 allele blocks initiation of meiotic DSBs as reported previously by others. The mre11S allele, which is mutated in the 5′ part of the gene, can partially complement mre11 alleles disrupted close to the 3′ end that cannot initiate DSBs when homozygous. This suggests homodimerization of the Mre11 protein and the presence of separate domains for DSB initiation and 5′ resection. The fact that two genes, RAD50 and MRE11, required for DSB processing are also essential for DSB initiation dictates a model in which a bifunctional initiation/repair complex is required to initiate meiotic recombination. A subset of mre11S nuclei was shown to perform extensive but partially nonhomologous synapsis. We propose that the unprocessed DSBs present in mre11S allow for synapsis, but that homologous synapsis is only ensured at a later stage of recombination. PMID:9303542

  9. The Genotoxin Colibactin Is a Determinant of Virulence in Escherichia coli K1 Experimental Neonatal Systemic Infection.

    PubMed

    McCarthy, Alex J; Martin, Patricia; Cloup, Emilie; Stabler, Richard A; Oswald, Eric; Taylor, Peter W

    2015-09-01

    Escherichia coli strains expressing the K1 capsule are a major cause of sepsis and meningitis in human neonates. The development of these diseases is dependent on the expression of a range of virulence factors, many of which remain uncharacterized. Here, we show that all but 1 of 34 E. coli K1 neonatal isolates carried clbA and clbP, genes contained within the pks pathogenicity island and required for the synthesis of colibactin, a polyketide-peptide genotoxin that causes genomic instability in eukaryotic cells by induction of double-strand breaks in DNA. Inactivation of clbA and clbP in E. coli A192PP, a virulent strain of serotype O18:K1 that colonizes the gastrointestinal tract and translocates to the blood compartment with very high frequency in experimental infection of the neonatal rat, significantly reduced the capacity of A192PP to colonize the gut, engender double-strand breaks in DNA, and cause invasive, lethal disease. Mutation of clbA, which encodes a pleiotropic enzyme also involved in siderophore synthesis, impacted virulence to a greater extent than mutation of clbP, encoding an enzyme specific to colibactin synthesis. Restoration of colibactin gene function by complementation reestablished the fully virulent phenotype. We conclude that colibactin contributes to the capacity of E. coli K1 to colonize the neonatal gastrointestinal tract and to cause invasive disease in the susceptible neonate. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  10. The Genotoxin Colibactin Is a Determinant of Virulence in Escherichia coli K1 Experimental Neonatal Systemic Infection

    PubMed Central

    McCarthy, Alex J.; Martin, Patricia; Cloup, Emilie; Stabler, Richard A.

    2015-01-01

    Escherichia coli strains expressing the K1 capsule are a major cause of sepsis and meningitis in human neonates. The development of these diseases is dependent on the expression of a range of virulence factors, many of which remain uncharacterized. Here, we show that all but 1 of 34 E. coli K1 neonatal isolates carried clbA and clbP, genes contained within the pks pathogenicity island and required for the synthesis of colibactin, a polyketide-peptide genotoxin that causes genomic instability in eukaryotic cells by induction of double-strand breaks in DNA. Inactivation of clbA and clbP in E. coli A192PP, a virulent strain of serotype O18:K1 that colonizes the gastrointestinal tract and translocates to the blood compartment with very high frequency in experimental infection of the neonatal rat, significantly reduced the capacity of A192PP to colonize the gut, engender double-strand breaks in DNA, and cause invasive, lethal disease. Mutation of clbA, which encodes a pleiotropic enzyme also involved in siderophore synthesis, impacted virulence to a greater extent than mutation of clbP, encoding an enzyme specific to colibactin synthesis. Restoration of colibactin gene function by complementation reestablished the fully virulent phenotype. We conclude that colibactin contributes to the capacity of E. coli K1 to colonize the neonatal gastrointestinal tract and to cause invasive disease in the susceptible neonate. PMID:26150540

  11. Clinical evaluation of cobas core anti-dsDNA EIA quant.

    PubMed

    González, Concepción; Guevara, Paloma; García-Berrocal, Belén; Alejandro Navajo, José; Manuel González-Buitrago, José

    2004-01-01

    The measurement of antibodies to double-stranded DNA (anti-dsDNA) is a useful tool for the diagnosis and monitoring of patients with connective tissue diseases, particularly systemic lupus erythematosus (SLE). The aim of the present study was to compare a new enzyme-linked immunosorbent assay (ELISA) for the measurement of anti-dsDNA antibodies, which uses purified double-stranded plasmid DNA as the antigen (anti-dsDNA EIA Quant; Roche Diagnostics, Mannheim, Germany), with an established ELISA. The clinical usefulness of this new ELISA was also assessed. We measured anti-dsDNA antibodies in 398 serum samples that were divided into four groups: 1). routine samples sent to our laboratory for an antinuclear antibody (ANA) test (n=229), 2). samples from blood donors (n=74), 3). samples from patients with SLE (n=48), and 4) samples from patients with other autoimmune diseases (n=47). The methods used were the Cobas Core Anti-dsDNA EIA Quant (Roche Diagnostics, Mannheim, Germany) and the Anti-dsDNA test (Gull Diagnostics, Bois d'Arcy, France). We obtained a kappa index and Spearman correlation coefficient in the comparative study, and sensitivity, specificity, predictive values, and likelihood ratios in the clinical study. The results obtained show a good agreement between the two methods in both the qualitative results (kappa=0.91) and the quantitative data (r=0.854). The best accuracy, predictive values, likelihood ratios, and correlation with active disease were obtained with the Roche anti-dsDNA assay. Copyright 2004 Wiley-Liss, Inc.

  12. Structures of bacterial polynucleotide kinase in a Michaelis complex with GTP•Mg2+ and 5'-OH oligonucleotide and a product complex with GDP•Mg2+ and 5'-PO4 oligonucleotide reveal a mechanism of general acid-base catalysis and the determinants of phosphoacceptor recognition.

    PubMed

    Das, Ushati; Wang, Li Kai; Smith, Paul; Jacewicz, Agata; Shuman, Stewart

    2014-01-01

    Clostridium thermocellum polynucleotide kinase (CthPnk), the 5' end-healing module of a bacterial RNA repair system, catalyzes reversible phosphoryl transfer from an NTP donor to a 5'-OH polynucleotide acceptor. Here we report the crystal structures of CthPnk-D38N in a Michaelis complex with GTP•Mg(2+) and a 5'-OH oligonucleotide and a product complex with GDP•Mg(2+) and a 5'-PO4 oligonucleotide. The O5' nucleophile is situated 3.0 Å from the GTP γ phosphorus in the Michaelis complex, where it is coordinated by Asn38 and is apical to the bridging β phosphate oxygen of the GDP leaving group. In the product complex, the transferred phosphate has undergone stereochemical inversion and Asn38 coordinates the 5'-bridging phosphate oxygen of the oligonucleotide. The D38N enzyme is poised for catalysis, but cannot execute because it lacks Asp38-hereby implicated as the essential general base catalyst that abstracts a proton from the 5'-OH during the kinase reaction. Asp38 serves as a general acid catalyst during the 'reverse kinase' reaction by donating a proton to the O5' leaving group of the 5'-PO4 strand. The acceptor strand binding mode of CthPnk is distinct from that of bacteriophage T4 Pnk.

  13. JS-K, an arylating nitric oxide (NO) donor, has synergistic anti-leukemic activity with cytarabine (ARA-C).

    PubMed

    Shami, Paul J; Maciag, Anna E; Eddington, Jordan K; Udupi, Vidya; Kosak, Ken M; Saavedra, Joseph E; Keefer, Larry K

    2009-11-01

    We have designed prodrugs that release nitric oxide (NO) on metabolism by glutathione S-transferases (GST). This design exploits the upregulation of GST in acute myeloid leukemia (AML) cells. O(2)-(2,4-dinitrophenyl) 1-[(4-ethoxycarbonyl)piperazin-1-yl]diazen-1-ium-1,2-diolate (JS-K, a member of this class) has potent anti-leukemic activity. HL-60 myeloid leukemia cells were used for in vitro studies of the combination of JS-K with daunorubicin (DAUNO), cytarabine (ARA-C) or etoposide (ETOP) using the median effect method to determine synergistic, antagonistic, or additive effects. Combinations of JS-K added simultaneously, 2h before or 2h after the other compounds were used. JS-K and DAUNO were antagonistic in all three drug sequences. JS-K and ETOP were also antagonistic but to a lesser degree. JS-K and ARA-C showed strong synergy. The combination index at the 50% fraction affected was 0.37+/-0.23, 0.24+/-0.27, and 0.15+/-0.11 for simultaneous, JS-K first and ARA-C first additions, respectively. JS-K by itself induced DNA strand breaks at relatively high concentrations. However, at submicromolar concentrations, it significantly augmented ARA-C-induced DNA strand breaks. NMR spectroscopy revealed no evidence of chemical interaction between JS-K and the other chemotherapeutic agents. We conclude that ARA-C and JS-K have synergistic anti-leukemic activity and warrant further exploration in combination.

  14. Novel single-stranded DNA binding protein-assisted fluorescence aptamer switch based on FRET for homogeneous detection of antibiotics.

    PubMed

    Wang, Ye; Gan, Ning; Zhou, You; Li, Tianhua; Cao, Yuting; Chen, Yinji

    2017-01-15

    Herein, a smart single-stranded DNA binding protein (SSB)-assisted fluorescence aptamer switch based on fluorescence resonance energy transfer (FRET) was designed. The FRET switch was synthesized by connecting SSB labeled quantum dots (QDs@SSB) as donor with aptamer (apt) labeled gold nanoparticles (AuNPs@apt) as acceptor, and it was employed for detecting chloramphenicol (CAP) in a homogenous solution. In the assay, the interaction between core-shell QDs@SSB and AuNPs@apt leads to a dramatic quenching (turning off). After adding CAP in the detection system, AuNPs@apt can bind the target specifically then separate QDs@SSB with AuNPs@apt-target, resulting in restoring the fluorescence intensity of QDs (turning on). Consequently, the fluorescence intensity recovers and the recovery extent can be used for detection of CAP in homogenous phase via optical responses. Under optimal conditions, the fluorescence intensity increased linearly with increasing concentrations of CAP from 0.005 to 100ngmL -1 . The limit of this fluorescence aptamer switch was around 3pgmL -1 for CAP detection. When the analyte is changed, the assay can be applied to detect other targets only by changing relative aptamer in AuNPs@apt probe. Furthermore, it has potential to be served as a simple, sensitive and portable platform for antibiotic contaminants detection in biological and environmental samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. A case report of embryo donation: ethical and clinical implications for psychologists.

    PubMed

    Rizk, Marianne; Pawlak, Stacey

    2016-10-01

    Third-party reproduction is a growing field, and an increasing body of literature considers the ethics of embryo donation. Due to the psychosocial complexities that generally accompany the donation and/or use of donor embryos, psychologists can play a pivotal role in these specialised fertility cases. While laws in the USA are in place to regulate the medical procedures involved in embryo donation, only unenforceable guidelines exist for psychologists specialising in fertility cases. The presentation of this case study aims to: (1) clarify the ethical concerns that fertility psychologists should consider in similar situations by assessing whether American Society of Reproductive Medicine (ASRM) and the American Psychological Association (APA) guidelines compete or complement one another within this case of embryo donation and (2) consider the interests, obligations and rights of all parties involved. Several principles, standards and guidelines that must be considered are described. Overall, the APA Ethics Code and the ASRM Guidelines appear to complement one another for most aspects of this case. Fertility psychologists should consider the clinical implications of the interests, rights and duties of all involved parties, including themselves. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  16. The role of hemocytes in A. gambiae antiplasmodial immunity

    PubMed Central

    Ramirez, Jose Luis; Garver, Lindsey S.; Brayner, Fábio André; Alves, Luiz Carlos; Rodrigues, Janneth; Molina-Cruz, Alvaro; Barillas-Mury, Carolina

    2013-01-01

    Hemocytes synthesize key components of the mosquito complement-like system, but their role in the activation of antiplasmodial responses has not been established. The effect of activating Toll signaling in hemocytes on Plasmodium survival was investigated by transferring hemocytes or cell-free hemolymph from donor mosquitoes in which the suppressor cactus was silenced. These transfers greatly enhanced antiplasmodial immunity, indicating that hemocytes are active players in the activation of the complement-like system, through an effector(s) regulated by the Toll pathway. A comparative analysis of hemocyte populations between susceptible (S) G3 and the refractory (R) L3-5 A. gambiae mosquito strains did not reveal significant differences under basal conditions or in response to Plasmodium berghei infection. The response of S mosquitoes to different Plasmodium species revealed similar kinetics following infection with P. berghei, P. yoelii or P. falciparum, but the strength of the priming response was stronger in less compatible mosquito-parasite pairs. The Toll, Imd, STAT or JNK signaling cascades were not essential for the production of hemocyte differentiation factor (HDF) in response to P. berghei infection, but disruption of Toll, STAT or JNK abolished hemocyte differentiation in response to HDF. We conclude that hemocytes are key mediators of A. gambiae antiplasmodial responses. PMID:23886925

  17. [Generation of functional organs from pluripotent stem cells].

    PubMed

    Miyamoto, Tatsuyuki; Nakauchi, Hiromitsu

    2015-10-01

    Hematopoietic stem cells (HSCs) have played a major role in stem cell biology, providing many conceptual ideas and models. Among them is the concept of the "niche", a special bone-marrow microenvironment that by exchanging cues regulates stem-cell fate. The HSC niche also plays an important role in HSC transplantation. Successful engraftment of donor HSCs depends on myeloablative pretreatment to empty the niche. The concept of the stem-cell niche has now been extended to the generation of organs. We postulated that an empty "organ niche" exists in a developing animal when development of an organ is genetically disabled. This organ niche should be developmentally compensated by blastocyst complementation using wild-type primary stem cells (PSCs). We proved the principle of organogenesis from xenogeneic PSCs in an embryo unable to form a specific organ, demonstrating the generation of functionally normal rat pancreas by injecting rat PSCs into pancreatogenesis-disabled mouse embryos. This principle has held in pigs. When pancreatogenesis-disabled pig embryos underwent complementation with blastomeres from wild-type pig embryos to produce chimeric pigs, the chimeras had normal pancreata and survived to adulthood. Demonstration of the generation of a functional organ from PSCs in pigs is a very important step toward generation of human cells, tissues, and organs from individual patients' own PSCs in large animals.

  18. The Saccharomyces cerevisiae DPM1 gene encoding dolichol-phosphate-mannose synthase is able to complement a glycosylation-defective mammalian cell line.

    PubMed Central

    Beck, P J; Orlean, P; Albright, C; Robbins, P W; Gething, M J; Sambrook, J F

    1990-01-01

    The Saccharomyces cerevisiae DPM1 gene product, dolichol-phosphate-mannose (Dol-P-Man) synthase, is involved in the coupled processes of synthesis and membrane translocation of Dol-P-Man. Dol-P-Man is the lipid-linked sugar donor of the last four mannose residues that are added to the core oligosaccharide transferred to protein during N-linked glycosylation in the endoplasmic reticulum. We present evidence that the S. cerevisiae gene DPM1, when stably transfected into a mutant Chinese hamster ovary cell line, B4-2-1, is able to correct the glycosylation defect of the cells. Evidence for complementation includes (i) fluorescence-activated cell sorter analysis of differential lectin binding to cell surface glycoproteins, (ii) restoration of Dol-P-Man synthase enzymatic activity in crude cell lysates, (iii) isolation and high-performance liquid chromatography fractionation of the lipid-linked oligosaccharides synthesized in the transfected and control cell lines, and (iv) the restoration of endoglycosidase H sensitivity to the oligosaccharides transferred to a specific glycoprotein synthesized in the DPM1 CHO transfectants. Indirect immunofluorescence with a primary antibody directed against the DPM1 protein shows a reticular staining pattern of protein localization in transfected hamster and monkey cell lines. Images PMID:2201896

  19. Iron binding activity is essential for the function of IscA in iron-sulphur cluster biogenesis

    PubMed Central

    Landry, Aaron P.; Cheng, Zishuo; Ding, Huangen

    2013-01-01

    Iron-sulphur cluster biogenesis requires coordinated delivery of iron and sulphur to scaffold proteins, followed by transfer of the assembled clusters from scaffold proteins to target proteins. This complex process is accomplished by a group of dedicated iron-sulphur cluster assembly proteins that are conserved from bacteria to humans. While sulphur in iron-sulphur clusters is provided by L-cysteine via cysteine desulfurase, the iron donor(s) for iron-sulphur cluster assembly remains largely elusive. Here we report that among the primary iron-sulphur cluster assembly proteins, IscA has a unique and strong binding activity for mononuclear iron in vitro and in vivo. Furthermore, the ferric iron centre tightly bound in IscA can be readily extruded by L-cysteine, followed by reduction to ferrous iron for iron-sulphur cluster biogenesis. Substitution of the highly conserved residue tyrosine 40 with phenylalanine (Y40F) in IscA results in a mutant protein that has a diminished iron binding affinity but retains the iron-sulphur cluster binding activity. Genetic complementation studies show that the IscA Y40F mutant is inactive in vivo, suggesting that the iron binding activity is essential for the function of IscA in iron-sulphur cluster biogenesis. PMID:23258274

  20. Iron binding activity is essential for the function of IscA in iron-sulphur cluster biogenesis.

    PubMed

    Landry, Aaron P; Cheng, Zishuo; Ding, Huangen

    2013-03-07

    Iron-sulphur cluster biogenesis requires coordinated delivery of iron and sulphur to scaffold proteins, followed by transfer of the assembled clusters from scaffold proteins to target proteins. This complex process is accomplished by a group of dedicated iron-sulphur cluster assembly proteins that are conserved from bacteria to humans. While sulphur in iron-sulphur clusters is provided by L-cysteine via cysteine desulfurase, the iron donor(s) for iron-sulphur cluster assembly remains largely elusive. Here we report that among the primary iron-sulphur cluster assembly proteins, IscA has a unique and strong binding activity for mononuclear iron in vitro and in vivo. Furthermore, the ferric iron centre tightly bound in IscA can be readily extruded by l-cysteine, followed by reduction to ferrous iron for iron-sulphur cluster biogenesis. Substitution of the highly conserved residue tyrosine 40 with phenylalanine (Y40F) in IscA results in a mutant protein that has a diminished iron binding affinity but retains the iron-sulphur cluster binding activity. Genetic complementation studies show that the IscA Y40F mutant is inactive in vivo, suggesting that the iron binding activity is essential for the function of IscA in iron-sulphur cluster biogenesis.

  1. Induction and disappearance of G2 chromatid breaks in lymphocytes after low doses of low-LET gamma-rays and high-LET fast neutrons.

    PubMed

    Vral, A; Thierens, H; Baeyens, A; De Ridder, L

    2002-04-01

    To determine by means of the G2 assay the number of chromatid breaks induced by low-LET gamma-rays and high-LET neutrons, and to compare the kinetics of chromatid break rejoining for radiations of different quality. The G2 assay was performed on blood samples of four healthy donors who were irradiated with low-LET gamma-rays and high-LET neutrons. In a first set of experiments a dose-response curve for the formation of chromatid breaks was carried out for gamma-rays and neutrons with doses ranging between 0.1 and 0.5 Gy. In a second set of experiments, the kinetics of chromatid break formation and disappearance were investigated after a dose of 0.5 Gy using post-irradiation times ranging between 0.5 and 3.5 h. For the highest dose of 0.5 Gy, the number of isochromatid breaks was also scored. No significant differences in the number of chromatid breaks were observed between low-LET gamma-rays and high-LET neutrons for the four donors at any of the doses given. The dose-response curves for the formation of chromatid breaks are linear for both radiation qualities and RBEs = 1 were obtained. Scoring of isochromatid breaks at the highest dose of 0.5 Gy revealed that high-LET neutrons were, however, more effective at inducing isochromatid breaks (RBE = 6.2). The rejoining experiments further showed that the kinetics of disappearance of chromatid breaks following irradiation with low-LET gamma-rays or high-LET neutrons were not significantly different. Half-times of 0.92 h for gamma-rays and 0.84 h for neutrons were obtained. Applying the G2 assay, the results demonstrate that at low doses of irradiation, the induction as well as the disappearance of chromatid breaks is independent of the LET of the radiation qualities used (0.24 keV x microm(-1) 60Co gamma-rays and 20 keV x microm(-1) fast neutrons). As these radiation qualities produce the same initial number of double-strand breaks, the results support the signal model that proposes that chromatid breaks are the result of an exchange process which is triggered by a single double-strand break.

  2. Complement-binding anti-HLA antibodies are independent predictors of response to treatment in kidney recipients with antibody-mediated rejection.

    PubMed

    Viglietti, Denis; Bouatou, Yassine; Kheav, Vissal David; Aubert, Olivier; Suberbielle-Boissel, Caroline; Glotz, Denis; Legendre, Christophe; Taupin, Jean-Luc; Zeevi, Adriana; Loupy, Alexandre; Lefaucheur, Carmen

    2018-05-22

    A major hurdle to improving clinical care in the field of kidney transplantation is the lack of biomarkers of the response to antibody-mediated rejection (ABMR) treatment. To discover these we investigated the value of complement-binding donor-specific anti-HLA antibodies (DSAs) for evaluating the response to treatment. The study encompassed a prospective cohort of 139 kidney recipients with ABMR receiving the standard of care treatment, including plasma exchange, intravenous immunoglobulin and rituximab. Patients were systematically assessed at the time of diagnosis and three months after treatment initiation for clinical and allograft histological characteristics and anti-HLA DSAs, including their C1q-binding ability. After adjusting for clinical and histological parameters, post-treatment C1q-binding anti-HLA DSA was an independent and significant determinant of allograft loss (adjusted hazard ratio 2.57 (95% confidence interval 1.29-5.12). In 101 patients without post-treatment C1q-binding anti-HLA DSA there was a significantly improved glomerular filtration rate with significantly reduced glomerulitis, peritubular capillaritis, interstitial inflammation, tubulitis, C4d deposition, and endarteritis compared with 38 patients with posttreatment C1q-binding anti-HLA DSA. A conditional inference tree model identified five prognostic groups at the time of post-treatment evaluation based on glomerular filtration rate, presence of cg lesion and C1q-binding anti-HLA DSA (cross-validated accuracy: 0.77). Thus, circulating complement-binding anti-HLA DSAs are strong and independent predictors of allograft outcome after standard of care treatment in kidney recipients with ABMR. Copyright © 2018 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.

  3. Trends of T. cruzi infection based on data from blood bank screening.

    PubMed

    Zicker, F; Martelli, C M; de Andrade, A L; Almeida e Silva, S

    1990-01-01

    Between October 1988 and April 1989 a cross-sectional survey was carried out in six out of eight blood banks of Goiánia, Central Brazil. Subjects attending for first-time blood donation in the mornings of the study period (n = 1358) were interviewed and screened for T. cruzi infection as a part of a major study among blood donors. Tests to anti-T. cruzi antibodies were performed, simultaneously, by indirect hemagglutination test (IHA) and complement fixation test (CFT). A subject was considered seropositive when any one of the two tests showed a positive result. Information on age, sex, place of birth, migration and socio-economic level was recorded. Results from this survey were compared with seroprevalence rates obtained in previous studies in an attempt to analyse trend of T. cruzi infection in an endemic urban area. The overall seroprevalence of T. cruzi infection among first-time donors was found to be 3.5% (95% confidence interval 2.5%-4.5%). The seroprevalence rate increased with age up to 45 years and then decreased. Migrants from rural areas had higher seroprevalence rates than subjects from urban counties (1.8%-16.2% vs. 0%-3.6%). A four fold decrease in prevalence rates was observed when these rates were compared with those of fifteen years ago. Two possible hypotheses to explain this difference were suggested: 1. a cohort effect related with the decrease of transmission in rural areas and/or 2. a differential proportion of people of rural origin among blood donors between the two periods. The potential usefulness of blood banks as a source of epidemiological information to monitor trends of T. cruzi infection in an urban adult population was stressed.

  4. Serologic screening for Trypanosoma cruzi among blood donors in central Brazil.

    PubMed

    de Andrade, A L; Martelli, C M; Luquetti, A O; de Oliveira, O S; Almeida e Silva, S; Zicker, F

    1992-01-01

    The study reported here compares results obtained by blood banks screening sera for chagasic (Trypanosoma cruzi) infection with results obtained by the Chagas' Disease Reference Laboratory of the Federal University of Goiás in Goiânia, Brazil. It also evaluates results obtained using the ELISA technique to screen the study sera. The survey used data from six of eight blood banks serving the city of Goiânia, an urban region of Central Brazil where Chagas' disease is highly endemic. The survey population consisted of 1,513 voluntary first-time blood donors whose donations occurred between October 1988 and April 1989. This group included 50% of all the first-time blood donors in that period. The six participating blood banks, which accounted for about 90% of all blood donations in Goiânia during the study period, routinely used indirect hemagglutination (IHA) and complement fixation (CF) tests to screen sera for antibodies to T. cruzi. Comparison of the results provided by the blood banks with the reference laboratory's results indicated a relative sensitivity of 77%, which ranged from 50% to 100% depending on the blood bank studied. The comparison, which found 12 false negative results, indicated that transfusions of infected blood might have occurred despite the serologic screening performed by the blood banks. Relative to the standard of positivity established for the study, the enzyme-linked immunosorbent assay (ELISA) technique was found to have a sensitivity of 96.3%. Considering as positive only those sera yielding positive IHA and indirect immunofluorescence (IIF) test results, the ELISA technique yielded 2 false negative and 41 false positive responses.(ABSTRACT TRUNCATED AT 250 WORDS)

  5. Highly efficient generation of GGTA1 biallelic knockout inbred mini-pigs with TALENs.

    PubMed

    Xin, Jige; Yang, Huaqiang; Fan, Nana; Zhao, Bentian; Ouyang, Zhen; Liu, Zhaoming; Zhao, Yu; Li, Xiaoping; Song, Jun; Yang, Yi; Zou, Qingjian; Yan, Quanmei; Zeng, Yangzhi; Lai, Liangxue

    2013-01-01

    Inbred mini-pigs are ideal organ donors for future human xenotransplantations because of their clear genetic background, high homozygosity, and high inbreeding endurance. In this study, we chose fibroblast cells from a highly inbred pig line called Banna mini-pig inbred line (BMI) as donor nuclei for nuclear transfer, combining with transcription activator-like effector nucleases (TALENs) and successfully generated α-1,3-galactosyltransferase (GGTA1) gene biallelic knockout (KO) pigs. To validate the efficiency of TALEN vectors, in vitro-transcribed TALEN mRNAs were microinjected into one-cell stage parthenogenetically activated porcine embryos. The efficiency of indel mutations at the GGTA1-targeting loci was as high as 73.1% (19/26) among the parthenogenetic blastocysts. TALENs were co-transfected into porcine fetal fibroblasts of BMI with a plasmid containing neomycin gene. The targeting efficiency reached 89.5% (187/209) among the survived cell clones after a 10 d selection. More remarkably 27.8% (58/209) of colonies were biallelic KO. Five fibroblast cell lines with biallelic KO were chosen as nuclear donors for somatic cell nuclear transfer (SCNT). Three miniature piglets with biallelic mutations of the GGTA1 gene were achieved. Gal epitopes on the surface of cells from all the three biallelic KO piglets were completely absent. The fibroblasts from the GGTA1 null piglets were more resistant to lysis by pooled complement-preserved normal human serum than those from wild-type pigs. These results indicate that a combination of TALENs technology with SCNT can generate biallelic KO pigs directly with high efficiency. The GGTA1 null piglets with inbred features created in this study can provide a new organ source for xenotransplantation research.

  6. Assignment of C1q-binding HLA antibodies as unacceptable HLA antigens avoids positive CDC-crossmatches prior to transplantation of deceased donor organs.

    PubMed

    Juhl, David; Marget, Matthias; Hallensleben, Michael; Görg, Siegfried; Ziemann, Malte

    2017-03-01

    Soon, a virtual crossmatch shall replace the complement-dependent cytotoxicity (CDC) allocation crossmatch in the Eurotransplant region. To prevent positive CDC-crossmatches in the recipient centre, careful definition of unacceptable antigens is necessary. For highly sensitized patients, this is difficult by CDC alone. Assignment of all antibodies detected by sensitive assays, however, could prevent organ allocation. To assess the usefulness of the Luminex C1q-assay to prevent positive CDC-crossmatches, all CDC-crossmatches performed prior to deceased kidney transplantation in a 16-month-period were reviewed. Sera causing positive crossmatches were investigated by the C1q-assay. 31 out of 1432 crossmatches (2.2%) were positive. Sera involved in 26 positive crossmatches were available. C1q-binding donor-specific antibodies were detected in 19 sera (73.1%). The other sera were from recipients without any HLA antibodies detectable by CDC or common solid phase assays. Three patients had known Non-HLA antibodies causing positive CDC-results. Four crossmatches were only weak positive. Therefore, avoidance of donors with HLA antigens against whom C1q-binding antibodies were detected would have prevented all positive crossmatches due to HLA antibodies. Provided that all HLA specificities against which antibodies are detected by the Luminex C1q-assay are considered as unacceptable antigens, CDC-crossmatches prior to transplantation might safely be omitted in many patients. They should be maintained in highly immunized patients, however, for whom assignment of all C1q-positive antibodies as unacceptable antigens could lead to a significant delay or even prevention of transplantation. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Bioactive grape proanthocyanidins enhance immune reactivity in UV-irradiated skin through functional activation of dendritic cells in mice.

    PubMed

    Vaid, Mudit; Singh, Tripti; Prasad, Ram; Elmets, Craig A; Xu, Hui; Katiyar, Santosh K

    2013-03-01

    Ultraviolet (UV) radiation-induced immunosuppression has been implicated in skin carcinogenesis. Grape seed proanthocyanidins (GSPs) have anti-skin carcinogenic effects in mice and GSPs-fed mice exhibit a reduction in UV-induced suppression of allergic contact hypersensitivity (CHS), a prototypic T-cell-mediated response. Here, we report that dietary GSPs did not inhibit UVB-induced suppression of CHS in xeroderma pigmentosum complementation group A (XPA)-deficient mice, which lack nucleotide excision repair mechanisms. GSPs enhanced repair of UVB-induced DNA damage (cyclobutane pyrimidine dimers) in wild-type, but not XPA-deficient, dendritic cells (DC). Co-culture of CD4(+) T cells with DCs from UVB-irradiated wild-type mice resulted in suppression of T-cell proliferation and secretion of T-helper (TH) 1-type cytokines that was ameliorated when the DCs were obtained from GSP-fed mice, whereas DCs obtained from GSP-fed XPA-KO mice failed to restore T-cell proliferation. In adoptive transfer experiments, donor DCs were positively selected from the draining lymph nodes of UVB-exposed donor mice that were sensitized to 2,4,-dinitrofluorobenzene were transferred into naïve recipient mice and the CHS response assessed. Naïve recipients that received DCs from UVB-exposed wild-type donors that had been fed GSPs exhibited a full CHS response, whereas no significant CHS was observed in mice that received DCs from XPA-KO mice fed GSPs. These results suggest that GSPs prevent UVB-induced immunosuppression through DNA repair-dependent functional activation of dendritic cells in mice. Cancer Prev Res; 6(3); 242-52. ©2013 AACR. ©2013 AACR.

  8. Effect of fragrance use on discrimination of individual body odor.

    PubMed

    Allen, Caroline; Havlíček, Jan; Roberts, S Craig

    2015-01-01

    Previous research suggests that artificial fragrances may be chosen to complement or enhance an individual's body odor, rather than simply masking it, and that this may create an odor blend with an emergent quality that is perceptually distinguishable from body odor or fragrance alone. From this, it can be predicted that a new emergent odor might be more easily identified than an individual's body odor in isolation. We used a triangle test paradigm to assess whether fragrance affects people's ability to distinguish between individual odors. Six male and six female donors provided axillary odor samples in three conditions (without fragrance, wearing their own fragrance, and wearing an assigned fragrance). In total, 296 female and 131 male participants selected the odd one from three odor samples (two from one donor, one from another; both of the same sex). We found that participants could discriminate between the odors at above chance levels in all three odor conditions. Olfactory identification ability (measured using Sniffin' Sticks) positively predicted discrimination performance, and sex differences in performance were also observed, with female raters being correct more often than men. Success rates were also higher for odors of male donors. Additionally, while performance was above chance in all conditions, individual odor discrimination varied across the three conditions. Discrimination rate was significantly higher in the "no fragrance" condition than either of the fragranced conditions. Importantly, however, discrimination rate was also significantly higher in the "own fragrance" condition than the "assigned fragrance" condition, suggesting that naturally occurring variance in body odor is more preserved when blended with fragrances that people choose for themselves, compared with other fragrances. Our data are consistent with the idea that fragrance choices are influenced by fragrance interactions with an individual's own body odor.

  9. Effect of fragrance use on discrimination of individual body odor

    PubMed Central

    Allen, Caroline; Havlíček, Jan; Roberts, S. Craig

    2015-01-01

    Previous research suggests that artificial fragrances may be chosen to complement or enhance an individual’s body odor, rather than simply masking it, and that this may create an odor blend with an emergent quality that is perceptually distinguishable from body odor or fragrance alone. From this, it can be predicted that a new emergent odor might be more easily identified than an individual’s body odor in isolation. We used a triangle test paradigm to assess whether fragrance affects people’s ability to distinguish between individual odors. Six male and six female donors provided axillary odor samples in three conditions (without fragrance, wearing their own fragrance, and wearing an assigned fragrance). In total, 296 female and 131 male participants selected the odd one from three odor samples (two from one donor, one from another; both of the same sex). We found that participants could discriminate between the odors at above chance levels in all three odor conditions. Olfactory identification ability (measured using Sniffin’ Sticks) positively predicted discrimination performance, and sex differences in performance were also observed, with female raters being correct more often than men. Success rates were also higher for odors of male donors. Additionally, while performance was above chance in all conditions, individual odor discrimination varied across the three conditions. Discrimination rate was significantly higher in the “no fragrance” condition than either of the fragranced conditions. Importantly, however, discrimination rate was also significantly higher in the “own fragrance” condition than the “assigned fragrance” condition, suggesting that naturally occurring variance in body odor is more preserved when blended with fragrances that people choose for themselves, compared with other fragrances. Our data are consistent with the idea that fragrance choices are influenced by fragrance interactions with an individual’s own body odor. PMID:26300812

  10. Thorough analysis of unorthodox ABO deletions called by the 1000 Genomes project.

    PubMed

    Möller, M; Hellberg, Å; Olsson, M L

    2018-02-01

    ABO remains the clinically most important blood group system, but despite earlier extensive research, significant findings are still being made. The vast majority of catalogued ABO null alleles are based on the c.261delG polymorphism. Apart from c.802G>A, other mechanisms for O alleles are rare. While analysing the data set from the 1000 Genomes (1000G) project, we encountered two previously uncharacterized deletions, which needed further exploration. The Erythrogene database, complemented with bioinformatics software, was used to analyse ABO in 2504 individuals from 1000G. DNA samples from selected 1000G donors and African blood donors were examined by allele-specific PCR and Sanger sequencing to characterize predicted deletions. A 5821-bp deletion encompassing exons 5-7 was called in twenty 1000G individuals, predominantly Africans. This allele was confirmed and its exact deletion point defined by bioinformatic analyses and in vitro experiments. A PCR assay was developed, and screening of African samples revealed three donors heterozygous for this deletion, which was thereby phenotypically established as an O allele. Analysis of upstream genetic markers indicated an ancestral origin from ABO*O.01.02. We estimate this deletion as the 3rd most common mechanism behind O alleles. A 24-bp deletion was called in nine individuals and showed greater diversity regarding ethnic distribution and allelic background. It could neither be confirmed by in silico nor in vitro experiments. A previously uncharacterized ABO deletion among Africans was comprehensively mapped and a genotyping strategy devised. The false prediction of another deletion emphasizes the need for cautious interpretation of NGS data and calls for strict validation routines. © 2017 International Society of Blood Transfusion.

  11. Marine mammal strandings in the New Caledonia region, Southwest Pacific.

    PubMed

    Borsa, Philippe

    2006-04-01

    Four hundred twenty three marine mammals, in 72 stranding events, were recorded between 1877 and 2005 in New Caledonia, the Loyalty Islands, and Vanuatu in the southwest Pacific. Sixteen species were represented in this count, including: minke whale, Balaenoptera acutorostrata (1 single stranding), sei whale, B. borealis (1 single stranding), blue whale, B. musculus (1 single stranding), humpback whale, Megaptera novaeangliae (2 single strandings), giant sperm whale, Physeter macrocephalus (18 single strandings, 2 pair strandings), pygmy sperm whale, Kogia breviceps (5 single strandings), dwarf sperm whale, K. sima (2 single strandings, 1 triple stranding), Blainville's beaked whale, Mesoplodon densirostris (2 single strandings), short-finned pilot whale, Globicephala macrorhynchus (4 strandings, 56 individuals), melon-headed whale, Peponocephala electra (1 single stranding and 2 mass strandings totalling 231 individuals), common dolphin, Delphinus delphis (1 single stranding), spinner dolphin, Stenella longirostris (1 pair stranding and 2 mass strandings of groups of approximately 30 individuals each), Indian Ocean bottlenose dolphin, Tursiops aduncus (2 single strandings), dugong, Dugong dugon (14 single strandings), and New Zealand fur seal, Arctocephalus forsteri (3 single strandings). A stranded rorqual identified as an Antarctic minke whale (B. bonaerensis), with coloration patterns that did not match known descriptions, was also reported. Sei whale was recorded for the first time in the tropical Southwest Pacific region and Antarctic minke whale, melon-headed whale, and Indian Ocean bottlenose dolphin were recorded for the first time in New Caledonia. Strandings of sperm whales were most frequent in the spring, but also occurred in autumn months, suggesting a seasonal pattern of occurrence possibly related to seasonal migration. One stranded humpback whale bore the scars of a killer whale's attack and one dugong was injured by a shark. Scars left by propellers were noted on several stranded animals including one Antarctic minke whale, one pygmy sperm whale, one dwarf sperm whale, and four dugongs. Collisions with vessels were suspected to be a frequent cause of death for dugong.

  12. Preferential association of a functional variant in complement receptor 2 with antibodies to double-stranded DNA

    PubMed Central

    Zhao, Jian; Giles, Brendan M; Taylor, Rhonda L; Yette, Gabriel A; Lough, Kara M; Ng, Han Leng; Abraham, Lawrence J; Wu, Hui; Kelly, Jennifer A; Glenn, Stuart B; Adler, Adam J; Williams, Adrienne H; Comeau, Mary E; Ziegler, Julie T; Marion, Miranda; Alarcón-Riquelme, Marta E; Alarcón, Graciela S; Anaya, Juan-Manuel; Bae, Sang-Cheol; Kim, Dam; Lee, Hye-Soon; Criswell, Lindsey A; Freedman, Barry I; Gilkeson, Gary S; Guthridge, Joel M; Jacob, Chaim O; James, Judith A; Kamen, Diane L; Merrill, Joan T; Sivils, Kathy Moser; Niewold, Timothy B; Petri, Michelle A; Ramsey-Goldman, Rosalind; Reveille, John D; Scofield, R Hal; Stevens, Anne M; Vilá, Luis M; Vyse, Timothy J; Kaufman, Kenneth M; Harley, John B; Langefeld, Carl D; Gaffney, Patrick M; Brown, Elizabeth E; Edberg, Jeffrey C; Kimberly, Robert P; Ulgiati, Daniela; Tsao, Betty P; Boackle, Susan A

    2016-01-01

    Objectives Systemic lupus erythematosus (SLE; OMIM 152700) is characterised by the production of antibodies to nuclear antigens. We previously identified variants in complement receptor 2 (CR2/CD21) that were associated with decreased risk of SLE. This study aimed to identify the causal variant for this association. Methods Genotyped and imputed genetic variants spanning CR2 were assessed for association with SLE in 15 750 case-control subjects from four ancestral groups. Allele-specific functional effects of associated variants were determined using quantitative real-time PCR, quantitative flow cytometry, electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP)-PCR. Results The strongest association signal was detected at rs1876453 in intron 1 of CR2 (pmeta=4.2×10−4, OR 0.85), specifically when subjects were stratified based on the presence of dsDNA autoantibodies (case-control pmeta=7.6×10−7, OR 0.71; case-only pmeta=1.9×10−4, OR 0.75). Although allele-specific effects on B cell CR2 mRNA or protein levels were not identified, levels of complement receptor 1 (CR1/CD35) mRNA and protein were significantly higher on B cells of subjects harbouring the minor allele (p=0.0248 and p=0.0006, respectively). The minor allele altered the formation of several DNA protein complexes by EMSA, including one containing CCCTC-binding factor (CTCF), an effect that was confirmed by ChIP-PCR. Conclusions These data suggest that rs1876453 in CR2 has long-range effects on gene regulation that decrease susceptibility to lupus. Since the minor allele at rs1876453 is preferentially associated with reduced risk of the highly specific dsDNA autoantibodies that are present in preclinical, active and severe lupus, understanding its mechanisms will have important therapeutic implications. PMID:25180293

  13. Identification of Plasmodium falciparum DNA Repair Protein Mre11 with an Evolutionarily Conserved Nuclease Function

    PubMed Central

    Badugu, Sugith Babu; Nabi, Shaik Abdul; Vaidyam, Pratap; Laskar, Shyamasree; Bhattacharyya, Sunanda; Bhattacharyya, Mrinal Kanti

    2015-01-01

    The eukaryotic Meiotic Recombination protein 11 (Mre11) plays pivotal roles in the DNA damage response (DDR). Specifically, Mre11 senses and signals DNA double strand breaks (DSB) and facilitates their repair through effector proteins belonging to either homologous recombination (HR) or non-homologous end joining (NHEJ) repair mechanisms. In the human malaria parasite Plasmodium falciparum, HR and alternative-NHEJ have been identified; however, little is known about the upstream factors involved in the DDR of this organism. In this report, we identify a putative ortholog of Mre11 in P. falciparum (PfalMre11) that shares 22% sequence similarity to human Mre11. Homology modeling reveals striking structural resemblance of the predicted PfalMre11 nuclease domain to the nuclease domain of Saccharomyces cerevisiae Mre11 (ScMre11). Complementation analyses reveal functional conservation of PfalMre11 nuclease activity as demonstrated by the ability of the PfalMre11 nuclease domain, in conjunction with the C-terminal domain of ScMre11, to functionally complement an mre11 deficient yeast strain. Functional complementation was virtually abrogated by an amino acid substitution in the PfalMre11 nuclease domain (D398N). PfalMre11 is abundant in the mitotically active trophozoite and schizont stages of P. falciparum and is up-regulated in response to DNA damage, suggesting a role in the DDR. PfalMre11 exhibits physical interaction with PfalRad50. In addition, yeast 2-hybrid studies show that PfalMre11 interacts with ScRad50 and ScXrs2, two important components of the well characterized Mre11-Rad50-Xrs2 complex which is involved in DDR signaling and repair in S. cerevisiae, further supporting a role for PfalMre11 in the DDR. Taken together, these findings provide evidence that PfalMre11 is an evolutionarily conserved component of the DDR in Plasmodium. PMID:25938776

  14. Fungal origin by horizontal transfer of a plant mitochondrial group I intron in the chimeric CoxI gene of Peperomia.

    PubMed

    Vaughn, J C; Mason, M T; Sper-Whitis, G L; Kuhlman, P; Palmer, J D

    1995-11-01

    We present phylogenetic evidence that a group I intron in an angiosperm mitochondrial gene arose recently by horizontal transfer from a fungal donor species. A 1,716-bp fragment of the mitochondrial coxI gene from the angiosperm Peperomia polybotrya was amplified via the polymerase chain reaction and sequenced. Comparison to other coxI genes revealed a 966-bp group I intron, which, based on homology with the related yeast coxI intron aI4, potentially encodes a 279-amino-acid site-specific DNA endonuclease. This intron, which is believed to function as a ribozyme during its own splicing, is not present in any of 19 coxI genes examined from other diverse vascular plant species. Phylogenetic analysis of intron origin was carried out using three different tree-generating algorithms, and on a variety of nucleotide and amino acid data sets from the intron and its flanking exon sequences. These analyses show that the Peperomia coxI gene intron and exon sequences are of fundamentally different evolutionary origin. The Peperomia intron is more closely related to several fungal mitochondrial introns, two of which are located at identical positions in coxI, than to identically located coxI introns from the land plant Marchantia and the green alga Prototheca. Conversely, the exon sequence of this gene is, as expected, most closely related to other angiosperm coxI genes. These results, together with evidence suggestive of co-conversion of exonic markers immediately flanking the intron insertion site, lead us to conclude that the Peperomia coxI intron probably arose by horizontal transfer from a fungal donor, using the double-strand-break repair pathway. The donor species may have been one of the symbiotic mycorrhizal fungi that live in close obligate association with most plants.

  15. A homogeneous nucleic acid hybridization assay based on strand displacement.

    PubMed Central

    Vary, C P

    1987-01-01

    A homogeneous nucleic acid hybridization assay which is conducted in solution and requires no separation steps is described. The assay is based on the concept of strand displacement. In the strand displacement assay, an RNA "signal strand" is hybridized within a larger DNA strand termed the "probe strand", which is, in turn, complementary to the target nucleic acid of interest. Hybridization of the target nucleic acid with the probe strand ultimately results in displacement of the RNA signal strand. Strand displacement, therefore, causes conversion of the RNA from double to single-stranded form. The single-strand specificity of polynucleotide phosphorylase (EC 2.7.7.8) allows discrimination between double-helical and single-stranded forms of the RNA signal strand. As displacement proceeds, free RNA signal strands are preferentially phosphorolyzed to component nucleoside diphosphates, including adenosine diphosphate. The latter nucleotide is converted to ATP by pyruvate kinase(EC 2.7.1.40). Luciferase catalyzed bioluminescence is employed to measure the ATP generated as a result of strand displacement. Images PMID:3309890

  16. Cancer-Associated Mutants of RNA Helicase DDX3X Are Defective in RNA-Stimulated ATP Hydrolysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Epling, Leslie B.; Grace, Christy R.; Lowe, Brandon R.

    The DEAD-box RNA helicase DDX3X is frequently mutated in pediatric medulloblastoma. We dissect how these mutants affect DDX3X function with structural, biochemical, and genetic experiments. We identify an N-terminal extension (“ATP-binding loop”, ABL) that is critical for the stimulation of ATP hydrolysis by RNA. We present crystal structures suggesting that the ABL interacts dynamically with ATP and confirming that the interaction occurs in solution by NMR chemical shift perturbation and isothermal titration calorimetry. DEAD-box helicases require interaction between two conserved RecA-like helicase domains, D1 and D2 for function. We use NMR chemical shift perturbation to show that DDX3X interacts specificallymore » with double-stranded RNA through its D1 domain, with contact mediated by residues G302 and G325. Mutants of these residues, G302V and G325E, are associated with pediatric medulloblastoma. These mutants are defective in RNA-stimulated ATP hydrolysis. We show that DDX3X complements the growth defect in a ded1 temperature-sensitive strain of Schizosaccharomyces pombe, but the cancer-associated mutants G302V and G325E do not complement and exhibit protein expression defects. In conclusion, taken together, our results suggest that impaired translation of important mRNA targets by mutant DDX3X represents a key step in the development of medulloblastoma.« less

  17. Cancer-Associated Mutants of RNA Helicase DDX3X Are Defective in RNA-Stimulated ATP Hydrolysis

    DOE PAGES

    Epling, Leslie B.; Grace, Christy R.; Lowe, Brandon R.; ...

    2015-02-25

    The DEAD-box RNA helicase DDX3X is frequently mutated in pediatric medulloblastoma. We dissect how these mutants affect DDX3X function with structural, biochemical, and genetic experiments. We identify an N-terminal extension (“ATP-binding loop”, ABL) that is critical for the stimulation of ATP hydrolysis by RNA. We present crystal structures suggesting that the ABL interacts dynamically with ATP and confirming that the interaction occurs in solution by NMR chemical shift perturbation and isothermal titration calorimetry. DEAD-box helicases require interaction between two conserved RecA-like helicase domains, D1 and D2 for function. We use NMR chemical shift perturbation to show that DDX3X interacts specificallymore » with double-stranded RNA through its D1 domain, with contact mediated by residues G302 and G325. Mutants of these residues, G302V and G325E, are associated with pediatric medulloblastoma. These mutants are defective in RNA-stimulated ATP hydrolysis. We show that DDX3X complements the growth defect in a ded1 temperature-sensitive strain of Schizosaccharomyces pombe, but the cancer-associated mutants G302V and G325E do not complement and exhibit protein expression defects. In conclusion, taken together, our results suggest that impaired translation of important mRNA targets by mutant DDX3X represents a key step in the development of medulloblastoma.« less

  18. Is dengue a threat to the blood supply?

    PubMed Central

    Teo, D; Ng, L C; Lam, S

    2009-01-01

    Dengue is the most common arthropod-borne infection worldwide, affecting at least 50 million people every year and endemic in more than 100 countries. The dengue virus is a single-stranded RNA virus with four major serotypes. Infection with one serotype confers homotypic immunity but not heterologous immunity, and secondary infection with another serotype may lead to more severe disease. The major route of transmission occurs through the Aedes aegypti mosquito vector, but dengue has also been transmitted through blood transfusion and organ transplantation. Infection results in a spectrum of clinical illness ranging from asymptomatic infection, undifferentiated fever, dengue fever, dengue haemorrhagic fever (DHF) to dengue shock syndrome (DSS). Dengue is spreading rapidly to new areas and with increasing frequency of major outbreaks. A trend has also been observed towards increasing age among infected patients. This will impact blood supply availability as more blood donors are deferred because of dengue infection or exposure to infection. The risk of transmission through transfusion of blood from asymptomatic viraemic donors will also increase. Although screening tests for dengue and effective pathogen reduction processes are now available for the blood supply, the value of implementing these costly measures needs to be carefully considered. Demand for platelets and fresh frozen plasma will rise with increasing number of DHF/DSS. Evidence-based guidelines for the clinical use of these blood components in the management of patients with DHF/DSS have not been well established, and inappropriate use will contribute to the challenges faced by blood services. PMID:19392949

  19. A series of Cadmium(II) complexes with 2-substituted terephthalate building block and N-Donor co-ligands: Structural diversity and fluorescence properties

    NASA Astrophysics Data System (ADS)

    Ren, Yixia; Zhou, Shanhong; Wang, Zhixiang; Zhang, Meili; Wang, Jijiang; Cao, Jia

    2017-11-01

    Four new Cd(II) complexes have been prepared based on 1,2,4-trimellitic acid (H3tma) and monosodium 2-sulfoterephthalate (2-NaH2stp), formulated as [Cd2(Htma)2 (dpp)2(H2O)] (1), [Cd3 (tma)2 (2,4-bipy)4(H2O)2] (2), [Cd (2-Hstp) (2,2'-bipy)2]·2H2O (3) and [Cd (2-Hstp) (2,4-bipy) (H2O)2] (4) (dpp = dipyrido [3,2-a:2‧,3'-c] phenazine, 2,4-bipy = 2,4-bipyridine, 2,2'-bipy = 2,2'- bipyridine) by hydrothermal method. X-ray diffraction structural analyses show all these complexes crystallized in triclinic crystal system of Pī space group, but their structures are diverse. Complex 1 exhibits an infinite one-dimensional chain featuring the left- and right-handed stranded chains interweaved each other. For 2, the two-dimensional network is constructed by one-dimensional ladder-like chain linked by Cd2 ions. In complex 3, the cadmium ion is surrounded with one 2-Hstp2- anion and two 2,2'-bipy molecules. Complex 4 is also a discrete structure based on a metallic dimer unit. In all these complexes, the N-donor co-ligands take the important roles in the assembly of three-dimensional supramolecular structures. The fluorescence properties of complexes 1-4 could be assigned to the π - π* transition of organic ligands.

  20. Formation of template-switching artifacts by linear amplification.

    PubMed

    Chakravarti, Dhrubajyoti; Mailander, Paula C

    2008-07-01

    Linear amplification is a method of synthesizing single-stranded DNA from either a single-stranded DNA or one strand of a double-stranded DNA. In this protocol, molecules of a single primer DNA are extended by multiple rounds of DNA synthesis at high temperature using thermostable DNA polymerases. Although linear amplification generates the intended full-length single-stranded product, it is more efficient over single-stranded templates than double-stranded templates. We analyzed linear amplification over single- or double-stranded mouse H-ras DNA (exon 1-2 region). The single-stranded H-ras template yielded only the intended product. However, when the double-stranded template was used, additional artifact products were observed. Increasing the concentration of the double-stranded template produced relatively higher amounts of these artifact products. One of the artifact DNA bands could be mapped and analyzed by sequencing. It contained three template-switching products. These DNAs were formed by incomplete DNA strand extension over the template strand, followed by switching to the complementary strand at a specific Ade nucleotide within a putative hairpin sequence, from which DNA synthesis continued over the complementary strand.

  1. Enhanced Insight into the Autoimmune Component of Glaucoma: IgG Autoantibody Accumulation and Pro-Inflammatory Conditions in Human Glaucomatous Retina

    PubMed Central

    Gramlich, Oliver W.; Beck, Sabine; von Thun und Hohenstein-Blaul, Nadine; Boehm, Nils; Ziegler, Anika; Vetter, Jan M.; Pfeiffer, Norbert; Grus, Franz H.

    2013-01-01

    Background There is accumulating evidence that autoimmune components, such as autoantibodies and autoantibody depositions, play a role in the pathogenesis of neurodegenerative diseases like Alzheimeŕs disease or Multiple Sclerosis. Due to alterations of autoantibody patterns in sera and aqueous humor, an autoimmune component is also assumed in the pathogenesis of glaucoma, a common reason for irreversible blindness worldwide. So far there has been no convincing evidence that autoantibodies are accumulated in the retina of glaucoma patients and that the local immune homeostasis might be affected. Methods and Results Six human glaucomatous donor eyes and nine samples from donors with no recorded ocular disease were included. Antibody microarrays were used to examine the patterns of pro-inflammatory proteins and complement proteins. Analysis of TNF-α and interleukin levels revealed a slight up-regulation exclusively in the glaucomatous group, while complement protein levels were not altered. IgG autoantibody accumulations and/or cellular components were determined by immunohistology (n = 4 per group). A significantly reduced number of retinal ganglion cells was found in the glaucomatous group (healthy: 104±7 nuclei/mm, glaucoma: 67±9 nuclei/mm; p = 0.0007). Cell loss was accompanied by strong retinal IgG autoantibody accumulations, which were at least twice as high as in healthy subjects (healthy: 5.0±0.5 IgG deposits/100 cells, glaucoma: 9.4±1.9 IgG deposits/100 cells; p = 0.004). CD27+ cells and CD27+/IgG+ plasma cells were observed in all glaucomatous subjects, but not in controls. Conclusion This work provides serious evidence for the occurrence of IgG antibody deposition and plasma cells in human glaucomatous retina. Moreover, the results suggest that these IgG deposits occurred in a pro-inflammatory environment which seems to be maintained locally by immune-competent cells like microglia. Thereby, glaucoma features an immunological involvement comparable to other neurodegenerative diseases, but also shows a multifactorial pathomechanism, which diverges and might be linked to the specific nature of both eye and retina. PMID:23451242

  2. The PROCARE consortium: toward an improved allocation strategy for kidney allografts.

    PubMed

    Otten, H G; Joosten, I; Allebes, W A; van der Meer, A; Hilbrands, L B; Baas, M; Spierings, E; Hack, C E; van Reekum, F; van Zuilen, A D; Verhaar, M C; Bots, M L; Seelen, M A J; Sanders, J S F; Hepkema, B G; Lambeck, A J; Bungener, L B; Roozendaal, C; Tilanus, M G J; Vanderlocht, J; Voorter, C E; Wieten, L; van Duijnhoven, E; Gelens, M; Christiaans, M; van Ittersum, F; Nurmohamed, A; Lardy, N M; Swelsen, W T; van Donselaar-van der Pant, K A M I; van der Weerd, N C; Ten Berge, I J M; Bemelman, F J; Hoitsma, A J; de Fijter, J W; Betjes, M G H; Roelen, D L; Claas, F H J

    2014-10-01

    Kidney transplantation is the best treatment option for patients with end-stage renal failure. At present, approximately 800 Dutch patients are registered on the active waiting list of Eurotransplant. The waiting time in the Netherlands for a kidney from a deceased donor is on average between 3 and 4 years. During this period, patients are fully dependent on dialysis, which replaces only partly the renal function, whereas the quality of life is limited. Mortality among patients on the waiting list is high. In order to increase the number of kidney donors, several initiatives have been undertaken by the Dutch Kidney Foundation including national calls for donor registration and providing information on organ donation and kidney transplantation. The aim of the national PROCARE consortium is to develop improved matching algorithms that will lead to a prolonged survival of transplanted donor kidneys and a reduced HLA immunization. The latter will positively affect the waiting time for a retransplantation. The present algorithm for allocation is among others based on matching for HLA antigens, which were originally defined by antibodies using serological typing techniques. However, several studies suggest that this algorithm needs adaptation and that other immune parameters which are currently not included may assist in improving graft survival rates. We will employ a multicenter-based evaluation on 5429 patients transplanted between 1995 and 2005 in the Netherlands. The association between key clinical endpoints and selected laboratory defined parameters will be examined, including Luminex-defined HLA antibody specificities, T and B cell epitopes recognized on the mismatched HLA antigens, non-HLA antibodies, and also polymorphisms in complement and Fc receptors functionally associated with effector functions of anti-graft antibodies. From these data, key parameters determining the success of kidney transplantation will be identified which will lead to the identification of additional parameters to be included in future matching algorithms aiming to extend survival of transplanted kidneys and to diminish HLA immunization. Computer simulation studies will reveal the number of patients having a direct benefit from improved matching, the effect on shortening of the waiting list, and the decrease in waiting time. Copyright © 2014. Published by Elsevier B.V.

  3. The Double-Stranded DNA Virosphere as a Modular Hierarchical Network of Gene Sharing

    PubMed Central

    Iranzo, Jaime

    2016-01-01

    ABSTRACT Virus genomes are prone to extensive gene loss, gain, and exchange and share no universal genes. Therefore, in a broad-scale study of virus evolution, gene and genome network analyses can complement traditional phylogenetics. We performed an exhaustive comparative analysis of the genomes of double-stranded DNA (dsDNA) viruses by using the bipartite network approach and found a robust hierarchical modularity in the dsDNA virosphere. Bipartite networks consist of two classes of nodes, with nodes in one class, in this case genomes, being connected via nodes of the second class, in this case genes. Such a network can be partitioned into modules that combine nodes from both classes. The bipartite network of dsDNA viruses includes 19 modules that form 5 major and 3 minor supermodules. Of these modules, 11 include tailed bacteriophages, reflecting the diversity of this largest group of viruses. The module analysis quantitatively validates and refines previously proposed nontrivial evolutionary relationships. An expansive supermodule combines the large and giant viruses of the putative order “Megavirales” with diverse moderate-sized viruses and related mobile elements. All viruses in this supermodule share a distinct morphogenetic tool kit with a double jelly roll major capsid protein. Herpesviruses and tailed bacteriophages comprise another supermodule, held together by a distinct set of morphogenetic proteins centered on the HK97-like major capsid protein. Together, these two supermodules cover the great majority of currently known dsDNA viruses. We formally identify a set of 14 viral hallmark genes that comprise the hubs of the network and account for most of the intermodule connections. PMID:27486193

  4. The role of charge and multiple faces of the CD8 alpha/alpha homodimer in binding to major histocompatibility complex class I molecules: support for a bivalent model.

    PubMed

    Giblin, P A; Leahy, D J; Mennone, J; Kavathas, P B

    1994-03-01

    The CD8 dimer interacts with the alpha 3 domain of major histocompatibility complex class I molecules through two immunoglobulin variable-like domains. In this study a crystal structure-informed mutational analysis has been performed to identify amino acids in the CD8 alpha/alpha homodimer that are likely to be involved in binding to class I. Several key residues are situated on the top face of the dimer within loops analogous to the complementarity-determining regions (CDRs) of immunoglobulin. In addition, other important amino acids are located in the A and B beta-strands on the sides of the dimer. The potential involvement of amino acids on both the top and the side faces of the molecule is consistent with a bivalent model for the interaction between a single CD8 alpha/alpha homodimer and two class I molecules and may have important implications for signal transduction in class I-expressing cells. This study also demonstrates a role for the positive surface potential of CD8 in class I binding and complements previous work demonstrating the importance of a negatively charged loop on the alpha 3 domain of class I for CD8 alpha/alpha-class I interaction. We propose a model whereby residues located on the CDR-like loops of the CD8 homodimer interact with the alpha 3 domain of MHC class I while amino acids on the side of the molecule containing the A and B beta-strands contact the alpha 2 domain of class I.

  5. RecA-Dependent DNA Repair Results in Increased Heteroplasmy of the Arabidopsis Mitochondrial Genome1[C][W

    PubMed Central

    Miller-Messmer, Marie; Kühn, Kristina; Bichara, Marc; Le Ret, Monique; Imbault, Patrice; Gualberto, José M.

    2012-01-01

    Plant mitochondria have very active DNA recombination activities that are responsible for its plastic structures and that should be involved in the repair of double-strand breaks in the mitochondrial genome. Little is still known on plant mitochondrial DNA repair, but repair by recombination is believed to be a major determinant in the rapid evolution of plant mitochondrial genomes. In flowering plants, mitochondria possess at least two eubacteria-type RecA proteins that should be core components of the mitochondrial repair mechanisms. We have performed functional analyses of the two Arabidopsis (Arabidopsis thaliana) mitochondrial RecAs (RECA2 and RECA3) to assess their potential roles in recombination-dependent repair. Heterologous expression in Escherichia coli revealed that RECA2 and RECA3 have overlapping as well as specific activities that allow them to partially complement bacterial repair pathways. RECA2 and RECA3 have similar patterns of expression, and mutants of either display the same molecular phenotypes of increased recombination between intermediate-size repeats, thus suggesting that they act in the same recombination pathways. However, RECA2 is essential past the seedling stage and should have additional important functions. Treatment of plants with several DNA-damaging drugs further showed that RECA3 is required for different recombination-dependent repair pathways that significantly contribute to plant fitness under stress. Replication repair of double-strand breaks results in the accumulation of crossovers that increase the heteroplasmic state of the mitochondrial DNA. It was shown that these are transmitted to the plant progeny, enhancing the potential for mitochondrial genome evolution. PMID:22415515

  6. DNA-stabilized silver nanoclusters and carbon nanoparticles oxide: A sensitive platform for label-free fluorescence turn-on detection of HIV-DNA sequences.

    PubMed

    Ye, Yu-Dan; Xia, Li; Xu, Dang-Dang; Xing, Xiao-Jing; Pang, Dai-Wen; Tang, Hong-Wu

    2016-11-15

    Based on the remarkable difference between the interactions of carbon nanoparticles (CNPs) oxide with single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA), and the fact that fluorescence of DNA-stabilized silver nanoclusters (AgNCs) can be quenched by CNPs oxide, DNA-functionalized AgNCs were applied as label-free fluorescence probes and a novel fluorescence resonance energy transfer (FRET) sensor was successfully constructed for the detection of human immunodeficiency virus (HIV) DNA sequences. CNPs oxide were prepared with the oxidation of candle soot, hence it is simple, time-saving and low-cost. The strategy of dual AgNCs probes was applied to improve the detection sensitivity by using dual- probe capturing the same target DNA in a sandwich mode and as the fluorescence donor, and using CNPs oxide as the acceptor. In the presence of target DNA, a dsDNA hybrid forms, leading to the desorption of the ssDNA-AgNCs probes from CNPs oxide, and the recovering of fluorescence of the AgNCs in a HIV-DNA concentration-dependent manner. The results show that HIV-DNA can be detected in the range of 1-50nM with a detection limit of 0.40nM in aqueous buffer. The method is simple, rapid and sensitive with no need of labeled fluorescent probes, and moreover, the design of fluorescent dual-probe makes full use of the excellent fluorescence property of AgNCs and further improves the detection sensitivity. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Role for cis-acting RNA sequences in the temperature-dependent expression of the multiadhesive lig proteins in Leptospira interrogans.

    PubMed

    Matsunaga, James; Schlax, Paula J; Haake, David A

    2013-11-01

    The spirochete Leptospira interrogans causes a systemic infection that provokes a febrile illness. The putative lipoproteins LigA and LigB promote adhesion of Leptospira to host proteins, interfere with coagulation, and capture complement regulators. In this study, we demonstrate that the expression level of the LigA and LigB proteins was substantially higher when L. interrogans proliferated at 37°C instead of the standard culture temperature of 30°C. The RNA comprising the 175-nucleotide 5' untranslated region (UTR) and first six lig codons, whose sequence is identical in ligA and ligB, is predicted to fold into two distinct stem-loop structures separated by a single-stranded region. The ribosome-binding site is partially sequestered in double-stranded RNA within the second structure. Toeprint analysis revealed that in vitro formation of a 30S-tRNA(fMet)-mRNA ternary complex was inhibited unless a 5' deletion mutation disrupted the second stem-loop structure. To determine whether the lig sequence could mediate temperature-regulated gene expression in vivo, the 5' UTR and the first six codons were inserted between the Escherichia coli l-arabinose promoter and bgaB (β-galactosidase from Bacillus stearothermophilus) to create a translational fusion. The lig fragment successfully conferred thermoregulation upon the β-galactosidase reporter in E. coli. The second stem-loop structure was sufficient to confer thermoregulation on the reporter, while sequences further upstream in the 5' UTR slightly diminished expression at each temperature tested. Finally, the expression level of β-galactosidase was significantly higher when point mutations predicted to disrupt base pairs in the second structure were introduced into the stem. Compensatory mutations that maintained base pairing of the stem without restoring the wild-type sequence reinstated the inhibitory effect of the 5' UTR on expression. These results indicate that ligA and ligB expression is limited by double-stranded RNA that occludes the ribosome-binding site. At elevated temperatures, the ribosome-binding site is exposed to promote translation initiation.

  8. Mass and molecular composition of vesicular stomatitis virus: a scanning transmission electron microscopy analysis.

    PubMed

    Thomas, D; Newcomb, W W; Brown, J C; Wall, J S; Hainfeld, J F; Trus, B L; Steven, A C

    1985-05-01

    Dark-field scanning transmission electron microscopy was used to perform mass analyses of purified vesicular stomatitis virions, pronase-treated virions, and nucleocapsids, leading to a complete self-consistent account of the molecular composition of vesicular stomatitis virus. The masses obtained were 265.6 +/- 13.3 megadaltons (MDa) for the native virion, 197.5 +/- 8.4 MDa for the pronase-treated virion, and 69.4 +/- 4.9 MDa for the nucleocapsid. The reduction in mass effected by pronase treatment, which corresponds to excision of the external domains (spikes) of G protein, leads to an average of 1,205 molecules of G protein per virion. The nucleocapsid mass, after compensation for the RNA (3.7 MDa) and residual amounts of other proteins, yielded a complement of 1,258 copies of N protein. Calibration of the amounts of M, NS, and L proteins relative to N protein by biochemical quantitation yielded values of 1,826, 466, and 50 molecules, respectively, per virion. Assuming that the remaining virion mass is contributed by lipids in the viral envelope, we obtained a value of 56.1 MDa for its lipid content. In addition, four different electron microscopy procedures were applied to determine the nucleocapsid length, which we conclude to be 3.5 to 3.7 micron. The nucleocapsid comprises a strand of repeating units which have a center-to-center spacing of 3.3 nm as measured along the middle of the strand. We show that these repeating units represent monomers of N protein, each of which is associated with 9 +/- 1 bases of single-stranded RNA. From scanning transmission electron microscopy images of negatively stained nucleocapsids, we inferred that N protein has a wedge-shaped, bilobed structure with dimensions of approximately 9.0 nm (length), approximately 5.0 nm (depth), and approximately 3.3 nm (width, at the midpoint of its long axis). In the coiled configuration of the in situ nucleocapsid, the long axis of N protein is directed radially, and its depth corresponds to the pitch of the nucleocapsid helix.

  9. Mass and molecular composition of vesicular stomatitis virus: a scanning transmission electron microscopy analysis.

    PubMed Central

    Thomas, D; Newcomb, W W; Brown, J C; Wall, J S; Hainfeld, J F; Trus, B L; Steven, A C

    1985-01-01

    Dark-field scanning transmission electron microscopy was used to perform mass analyses of purified vesicular stomatitis virions, pronase-treated virions, and nucleocapsids, leading to a complete self-consistent account of the molecular composition of vesicular stomatitis virus. The masses obtained were 265.6 +/- 13.3 megadaltons (MDa) for the native virion, 197.5 +/- 8.4 MDa for the pronase-treated virion, and 69.4 +/- 4.9 MDa for the nucleocapsid. The reduction in mass effected by pronase treatment, which corresponds to excision of the external domains (spikes) of G protein, leads to an average of 1,205 molecules of G protein per virion. The nucleocapsid mass, after compensation for the RNA (3.7 MDa) and residual amounts of other proteins, yielded a complement of 1,258 copies of N protein. Calibration of the amounts of M, NS, and L proteins relative to N protein by biochemical quantitation yielded values of 1,826, 466, and 50 molecules, respectively, per virion. Assuming that the remaining virion mass is contributed by lipids in the viral envelope, we obtained a value of 56.1 MDa for its lipid content. In addition, four different electron microscopy procedures were applied to determine the nucleocapsid length, which we conclude to be 3.5 to 3.7 micron. The nucleocapsid comprises a strand of repeating units which have a center-to-center spacing of 3.3 nm as measured along the middle of the strand. We show that these repeating units represent monomers of N protein, each of which is associated with 9 +/- 1 bases of single-stranded RNA. From scanning transmission electron microscopy images of negatively stained nucleocapsids, we inferred that N protein has a wedge-shaped, bilobed structure with dimensions of approximately 9.0 nm (length), approximately 5.0 nm (depth), and approximately 3.3 nm (width, at the midpoint of its long axis). In the coiled configuration of the in situ nucleocapsid, the long axis of N protein is directed radially, and its depth corresponds to the pitch of the nucleocapsid helix. Images PMID:2985822

  10. RecFOR Is Not Required for Pneumococcal Transformation but Together with XerS for Resolution of Chromosome Dimers Frequently Formed in the Process

    PubMed Central

    Johnston, Calum; Mortier-Barrière, Isabelle; Granadel, Chantal; Polard, Patrice; Martin, Bernard; Claverys, Jean-Pierre

    2015-01-01

    Homologous recombination (HR) is required for both genome maintenance and generation of diversity in eukaryotes and prokaryotes. This process initiates from single-stranded (ss) DNA and is driven by a universal recombinase, which promotes strand exchange between homologous sequences. The bacterial recombinase, RecA, is loaded onto ssDNA by recombinase loaders, RecBCD and RecFOR for genome maintenance. DprA was recently proposed as a third loader dedicated to genetic transformation. Here we assessed the role of RecFOR in transformation of the human pathogen Streptococcus pneumoniae. We firstly established that RecFOR proteins are not required for plasmid transformation, strongly suggesting that DprA ensures annealing of plasmid single-strands internalized in the process. We then observed no reduction in chromosomal transformation using a PCR fragment as donor, contrasting with the 10,000-fold drop in dprA - cells and demonstrating that RecFOR play no role in transformation. However, a ∼1.45-fold drop in transformation was observed with total chromosomal DNA in recFOR mutants. To account for this limited deficit, we hypothesized that transformation with chromosomal DNA stimulated unexpectedly high frequency (>30% of cells) formation of chromosome dimers as an intermediate in the generation of tandem duplications, and that RecFOR were crucial for dimer resolution. We validated this hypothesis, showing that the site-specific recombinase XerS was also crucial for dimer resolution. An even higher frequency of dimer formation (>80% of cells) was promoted by interspecies transformation with Streptococcus mitis chromosomal DNA, which contains numerous inversions compared to pneumococcal chromosome, each potentially promoting dimerization. In the absence of RecFOR and XerS, dimers persist, as confirmed by DAPI staining, and can limit the efficiency of transformation, since resulting in loss of transformant chromosome. These findings strengthen the view that different HR machineries exist for genome maintenance and transformation in pneumococci. These observations presumably apply to most naturally transformable species. PMID:25569614

  11. Autologous hematopoietic stem cell transplantation in lymphoma patients is associated with a decrease in the double strand break repair capacity of peripheral blood lymphocytes.

    PubMed

    Lacoste, Sandrine; Bhatia, Smita; Chen, Yanjun; Bhatia, Ravi; O'Connor, Timothy R

    2017-01-01

    Patients who undergo autologous hematopoietic stem cell transplantation (aHCT) for treatment of a relapsed or refractory lymphoma are at risk of developing therapy related- myelodysplasia/acute myeloid leukemia (t-MDS/AML). Part of the risk likely resides in inherent interindividual differences in their DNA repair capacity (DRC), which is thought to influence the effect chemotherapeutic treatments have on the patient's stem cells prior to aHCT. Measuring DRC involves identifying small differences in repair proficiency among individuals. Initially, we investigated the cell model in healthy individuals (primary lymphocytes and/or lymphoblastoid cell lines) that would be appropriate to measure genetically determined DRC using host-cell reactivation assays. We present evidence that interindividual differences in DRC double-strand break repair (by non-homologous end-joining [NHEJ] or single-strand annealing [SSA]) are better preserved in non-induced primary lymphocytes. In contrast, lymphocytes induced to proliferate are required to assay base excision (BER) or nucleotide excision repair (NER). We established that both NHEJ and SSA DRCs in lymphocytes of healthy individuals were inversely correlated with the age of the donor, indicating that DSB repair in lymphocytes is likely not a constant feature but rather something that decreases with age (~0.37% NHEJ DRC/year). To investigate the predictive value of pre-aHCT DRC on outcome in patients, we then applied the optimized assays to the analysis of primary lymphocytes from lymphoma patients and found that individuals who later developed t-MDS/AML (cases) were indistinguishable in their DRC from controls who never developed t-MDS/AML. However, when DRC was investigated shortly after aHCT in the same individuals (21.6 months later on average), aHCT patients (both cases and controls) showed a significant decrease in DSB repair measurements. The average decrease of 6.9% in NHEJ DRC observed among aHCT patients was much higher than the 0.65% predicted for such a short time frame, based on ageing results for healthy individuals.

  12. Differential sensitivity of porcine endogenous retrovirus to APOBEC3-mediated inhibition.

    PubMed

    Park, Sung-Han; Kim, Jin Ha; Jung, Yong-Tae

    2015-08-01

    Pigs are considered to be suitable xenotransplantation organ donors. However, the risk of pathogen transmission from pigs to humans is a major concern in the transplantation of porcine tissues. The porcine endogenous retroviruses (PERVs) PERV-A, PERV-A/C, and PERV-B can infect human cells, but PERV-C is an ecotropic virus infecting only pig cells. Thus, several strategies have been proposed to reduce PERV transmission in xenograft recipients. Human APOBEC3G (huA3G) is a single-strand DNA cytosine deaminase, which inactivates the coding capacity of the virus by deamination of cDNA cytosines to uracils. This reaction occurs within the (-) DNA strand during reverse transcription, resulting in a G-to-A mutation in the (+) strand. While recent data have shown that PERV-B is severely inhibited by huA3G and porcine A3Z2-Z3 (poA3F) in a pseudotype assay, little is known about PERV-C. Here, we compare the antiretroviral activities of huA3G, huA3F and poA3Z2-Z3 against PERV-C. Our data show that APOBEC3 was packaged into PERV-C particles and inhibited PERV-C replication in a dose-dependent manner. PERV-C infectivity was strongly inhibited by poA3Z2-Z3, but it did not markedly reduce PERV-B infectivity. This suggests that PERV-C Gag interacts efficiently with poA3Z2-Z3. In addition, we constructed stably huA3G- and poA3Z2-Z3-expressing 293-PERV-PK-CIRCE cells (human 293 cells infected with PK15-derived PERVs) to examine whether PERV is resistant to poA3Z2-Z3 in a virus-spreading assay. The stably expressed huA3G and poA3Z2-Z3 were more packaging-competent than transiently expressed APOBEC3 proteins. These results suggest that poA3Z2-Z3 can inhibit PERV replication in a pseudotype assay as well as in a virus-spreading assay.

  13. The sensitivity, specificity and efficiency values of some serological tests used in the diagnosis of paracoccidioidomycosis.

    PubMed

    Del Negro, G M; Garcia, N M; Rodrigues, E G; Cano, M I; de Aguiar, M S; Lírio, V de S; Lacaz, C da S

    1991-01-01

    This work reports on the results of double immunodiffusion (ID), counterimmunoelectrophoresis (CIE), complement fixation (CF) and indirect immunofluorescence (IIF) techniques in the serodiagnosis of paracoccidioidomycosis. The study was undertaken on four groups of individuals: 46 patients with untreated paracoccidioidomycosis, 22 patients with other deep mycoses, 30 with other infectious diseases (tuberculosis and cutaneous leishmaniasis) and 47 blood donors as negative controls. Data were obtained using Paracoccidioides brasiliensis antigens, i.e., a yeast culture filtrate for ID, CIE and CF, and a yeast cell suspension for IIF. The sensitivity, specificity and efficiency values were measured according to GALEN & GAMBINO. The gel precipitation tests (ID and CIE) showed the greatest sensitivity (91.3 and 95.6%, respectively), maximum specificity (100%) and the highest efficiency values when compared to the CF and IIF tests.

  14. Vibrio Phage KVP40 Encodes a Functional NAD+ Salvage Pathway.

    PubMed

    Lee, Jae Yun; Li, Zhiqun; Miller, Eric S

    2017-05-01

    The genome of T4-type Vibrio bacteriophage KVP40 has five genes predicted to encode proteins of pyridine nucleotide metabolism, of which two, nadV and natV , would suffice for an NAD + salvage pathway. NadV is an apparent nicotinamide phosphoribosyltransferase (NAmPRTase), and NatV is an apparent bifunctional nicotinamide mononucleotide adenylyltransferase (NMNATase) and nicotinamide-adenine dinucleotide pyrophosphatase (Nudix hydrolase). Genes encoding the predicted salvage pathway were cloned and expressed in Escherichia coli , the proteins were purified, and their enzymatic properties were examined. KVP40 NadV NAmPRTase is active in vitro , and a clone complements a Salmonella mutant defective in both the bacterial de novo and salvage pathways. Similar to other NAmPRTases, the KVP40 enzyme displayed ATPase activity indicative of energy coupling in the reaction mechanism. The NatV NMNATase activity was measured in a coupled reaction system demonstrating NAD + biosynthesis from nicotinamide, phosphoribosyl pyrophosphate, and ATP. The NatV Nudix hydrolase domain was also shown to be active, with preferred substrates of ADP-ribose, NAD + , and NADH. Expression analysis using reverse transcription-quantitative PCR (qRT-PCR) and enzyme assays of infected Vibrio parahaemolyticus cells demonstrated nadV and natV transcription during the early and delayed-early periods of infection when other KVP40 genes of nucleotide precursor metabolism are expressed. The distribution and phylogeny of NadV and NatV proteins among several large double-stranded DNA (dsDNA) myophages, and also those from some very large siphophages, suggest broad relevance of pyridine nucleotide scavenging in virus-infected cells. NAD + biosynthesis presents another important metabolic resource control point by large, rapidly replicating dsDNA bacteriophages. IMPORTANCE T4-type bacteriophages enhance DNA precursor synthesis through reductive reactions that use NADH/NADPH as the electron donor and NAD + for ADP-ribosylation of proteins involved in transcribing and translating the phage genome. We show here that phage KVP40 encodes a functional pyridine nucleotide scavenging pathway that is expressed during the metabolic period of the infection cycle. The pathway is conserved in other large, dsDNA phages in which the two genes, nadV and natV , share an evolutionary history in their respective phage-host group. Copyright © 2017 American Society for Microbiology.

  15. MHC class I–specific antibody binding to nonhematopoietic cells drives complement activation to induce transfusion-related acute lung injury in mice

    PubMed Central

    Strait, Richard T.; Hicks, Wyenona; Barasa, Nathaniel; Mahler, Ashley; Khodoun, Marat; Köhl, Jörg; Stringer, Keith; Witte, David; Van Rooijen, Nico; Susskind, Brian M.

    2011-01-01

    Transfusion-related acute lung injury (TRALI), a form of noncardiogenic pulmonary edema that develops during or within 6 h after a blood transfusion, is the most frequent cause of transfusion-associated death in the United States. Because development of TRALI is associated with donor antibodies (Abs) reactive with recipient major histocompatibility complex (MHC), a mouse model has been studied in which TRALI-like disease is caused by injecting mice with anti–MHC class I monoclonal Ab (mAb). Previous publications with this model have concluded that disease is caused by FcR-dependent activation of neutrophils and platelets, with production of reactive oxygen species that damage pulmonary vascular endothelium. In this study, we confirm the role of reactive oxygen species in the pathogenesis of this mouse model of TRALI and show ultrastructural evidence of pulmonary vascular injury within 5 min of anti–MHC class I mAb injection. However, we demonstrate that disease induction in this model involves macrophages rather than neutrophils or platelets, activation of complement and production of C5a rather than activation of FcγRI, FcγRIII, or FcγRIV, and binding of anti–MHC class I mAb to non-BM–derived cells such as pulmonary vascular endothelium. These observations have important implications for the prevention and treatment of TRALI. PMID:22025304

  16. Nonflowering Plants Possess a Unique Folate-Dependent Phenylalanine Hydroxylase That Is Localized in Chloroplasts[W

    PubMed Central

    Pribat, Anne; Noiriel, Alexandre; Morse, Alison M.; Davis, John M.; Fouquet, Romain; Loizeau, Karen; Ravanel, Stéphane; Frank, Wolfgang; Haas, Richard; Reski, Ralf; Bedair, Mohamed; Sumner, Lloyd W.; Hanson, Andrew D.

    2010-01-01

    Tetrahydropterin-dependent aromatic amino acid hydroxylases (AAHs) are known from animals and microbes but not plants. A survey of genomes and ESTs revealed AAH-like sequences in gymnosperms, mosses, and algae. Analysis of full-length AAH cDNAs from Pinus taeda, Physcomitrella patens, and Chlamydomonas reinhardtii indicated that the encoded proteins form a distinct clade within the AAH family. These proteins were shown to have Phe hydroxylase activity by functional complementation of an Escherichia coli Tyr auxotroph and by enzyme assays. The P. taeda and P. patens AAHs were specific for Phe, required iron, showed Michaelian kinetics, and were active as monomers. Uniquely, they preferred 10-formyltetrahydrofolate to any physiological tetrahydropterin as cofactor and, consistent with preferring a folate cofactor, retained activity in complementation tests with tetrahydropterin-depleted E. coli host strains. Targeting assays in Arabidopsis thaliana mesophyll protoplasts using green fluorescent protein fusions, and import assays with purified Pisum sativum chloroplasts, indicated chloroplastic localization. Targeting assays further indicated that pterin-4a-carbinolamine dehydratase, which regenerates the AAH cofactor, is also chloroplastic. Ablating the single AAH gene in P. patens caused accumulation of Phe and caffeic acid esters. These data show that nonflowering plants have functional plastidial AAHs, establish an unprecedented electron donor role for a folate, and uncover a novel link between folate and aromatic metabolism. PMID:20959559

  17. Desensitization strategies in adult heart transplantation-Will persistence pay off?

    PubMed

    Chih, Sharon; Patel, Jignesh

    2016-08-01

    Strategies are needed to enable successful heart transplantation in highly sensitized patients. Immunologic challenges from sensitization to human leukocyte antigen (HLA) reduce access to compatible donors, extend waiting times to transplant, and increase the risks of antibody-mediated rejection and cardiac allograft vasculopathy after transplant. The prime goal of desensitization is to increase access to transplantation through expansion of the donor organ pool. Existing therapies are directed at key components of the humoral immune response with newer biologically based regimens able to target plasma cells as the source of antibody production, as well as complement activation that has a central role in antibody-mediated injury. Despite the emergence of early promising results for these agents, a significant knowledge gap remains with the current data for desensitization, extrapolated mostly from non-heart solid-organ transplants and small observational studies. Notably, no approach has demonstrated significant and sustainable reductions in HLA antibody pre-transplant, and the ideal desensitization strategy remains elusive. In addition, clinical tools to evaluate the humoral response and efficacy of therapy are limited, focusing almost exclusively on HLA antibody detection. Importantly, desensitization is associated with significant costs and potential risks, and overall long-term outcomes and cost-effectiveness have not been sufficiently evaluated. Investigation is ongoing into the development of a clinically effective desensitization strategy in heart transplantation. Copyright © 2016 International Society for Heart and Lung Transplantation. Published by Elsevier Inc. All rights reserved.

  18. Protein a Immunoadsorption May Hamper the Decision to Transplant Due to Interference With CDC Crossmatch Results.

    PubMed

    Koefoed-Nielsen, Pernille; Bistrup, Claus; Christiansen, Mette

    2017-06-01

    Transplanting immunized patients requires immunological monitoring in the pretransplant phase to follow reduction of donor specific HLA antibodies (DSA) after Staphylococcus aureus protein A (SPA) immunoadsorption (IA) or therapeutic plasma exchange followed by IVIG and Rituximab administration. Pretreatment aims to significantly reduce DSA strength. The Tissue Typing Lab at Aarhus University Hospital performs immunological monitoring of approximately 150 kidney transplantation patients per year from two transplant centers. From 2012 to 2013, we experienced seven patients desensitized using SPA IA, initially presenting negative cytotoxic complement dependent (CDC) T-cell crossmatches but positive B and T cell flowcytometric crossmatch, who despite significant DSA reduction developed weakly positive CDC T-cell crossmatch shortly prior to transplantation. We hypothesised that leached SPA during IA could be the cause, as the complication was not observed in patients who received plasma exchanges. We found that the positive CDC was not donor specific and SPA column material incubated with control serum reproduced a positive CDC T-cell crossmatch. Finally, we detected leached SPA in one of the patient samples using a highly sensitive time-resolved fluorescent assay. In conclusion, the results emphasize the importance of carefully considering CDC crossmatch results subsequent to IA, before a planned transplantation is either postponed or cancelled. J. Clin. Apheresis 32:163-169, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  19. Viral infections in transplant recipients.

    PubMed

    Razonable, R R; Eid, A J

    2009-12-01

    Solid organ and hematopoietic stem cell transplant recipients are uniquely predisposed to develop clinical illness, often with increased severity, due to a variety of common and opportunistic viruses. Patients may acquire viral infections from the donor (donor-derived infections), from reactivation of endogenous latent virus, or from the community. Herpes viruses, most notably cytomegalovirus and Epstein Barr virus, are the most common among opportunistic viral pathogens that cause infection after solid organ and hematopoietic stem cell transplantation. The polyoma BK virus causes opportunistic clinical syndromes predominantly in kidney and allogeneic hematopoietic stem cell transplant recipients. The agents of viral hepatitis B and C present unique challenges particularly among liver transplant recipients. Respiratory viral illnesses due to influenza, respiratory syncytial virus, and parainfluenza virus may affect all types of transplant recipients, although severe clinical disease is observed more commonly among lung and allogeneic hematopoietic stem cell transplant recipients. Less common viral infections affecting transplant recipients include those caused by adenoviruses, parvovirus B19, and West Nile virus. Treatment for viruses with proven effective antiviral drug therapies should be complemented by reduction in the degree of immunosuppression. For others with no proven antiviral drugs for therapy, reduction in the degree of immunosuppression remains as the sole effective strategy for management. Prevention of viral infections is therefore of utmost importance, and this may be accomplished through vaccination, antiviral strategies, and aggressive infection control measures.

  20. Sequence-Specific DNA Photosplitting of Crosslinked DNAs Containing the 3-Cyanovinylcarbazole Nucleoside by Using DNA Strand Displacement.

    PubMed

    Nakamura, Shigetaka; Kawabata, Hayato; Fujimoto, Kenzo

    2016-08-17

    An oligodeoxynucleotide (ODN) containing the ultrafast reversible 3-cyanovinylcarbazole ((CNV) K) photo-crosslinker was photo-crosslinked to a complementary strand upon exposure to 366 nm irradiation and photosplit by use of 312 nm irradiation. In this paper we report that the photoreaction of (CNV) K on irradiation at 366 nm involves a photostationary state and that its reaction can be controlled by temperature. Guided by this new insight, we proposed and have now demonstrated previously unknown photosplitting of (CNV) K aided by DNA strand displacement as an alternative to heating. The photo-crosslinked double-stranded DNA (dsDNA) underwent >80 % photosplitting aided by DNA strand displacement on irradiation at 366 nm without heating. In this photosplitting based on DNA strand displacement, the relative thermal stability of the invader strand with respect to the template strands plays an important role, and an invader strand/template strand system that is more stable than the passenger strand/template strand system induces photosplitting without heating. This new strand-displacement-aided photosplitting occurred in a sequence-specific manner through irradiation at 366 nm in the presence of an invader strand. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Possible strand of the North Anatolian fault in the Thrace basin, Turkey - An interpretation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Perincek, D.

    1991-02-01

    This study focuses on the presence of a major strike-slip fault system in the Thrace basin. This new discovery is important for the geology of the Thrace basin and also brings a new perspective to petroleum exploration. The wrench fault system is named the Thrace strike-slip fault system (Perincek, 1988). Similarities with the North Anatolian fault zone prompted an investigation of the relationship between these two fault system.s The study area covers most of the Thrace region of Turkey. The purposes of this paper are (1) to outline the geometry of the Thrace fault system, (2) to demonstrate its tectonicmore » relation with other major structures of the region, (3) to define the age of its inception, and (4) to discuss possible magnitudes of the lateral displacement. The interpretation is based mainly on seismic data consisting of 180 seismic reflection profiles that have a total cumulative length of 2,800 km. Seismic data are complemented with subsurface control from 54 wells.« less

  2. Asymmetric structure of five and six membered DNA hairpin loops

    NASA Technical Reports Server (NTRS)

    Baumann, U.; Chang, S.

    1995-01-01

    The tertiary structure of nucleic acid hairpins was elucidated by means of the accessibility of the single-strand-specific nuclease from mung bean. This molecular probe has proven especially useful in determining details of the structural arrangement of the nucleotides within a loop. In this study 3'-labeling is introduced to complement previously used 5'-labeling in order to assess and to exclude possible artifacts of the method. Both labeling procedures result in mutually consistent cleavage patterns. Therefore, methodological artifacts can be excluded and the potential of the nuclease as structural probe is increased. DNA hairpins with five and six membered loops reveal an asymmetric loop structure with a sharp bend of the phosphate-ribose backbone between the second and third nucleotide on the 3'-side of a loop. These hairpin structures differ from smaller loops with 3 or 4 members, which reveal this type of bend between the first and second 3' nucleotide, and resemble with respect to the asymmetry anticodon loops of tRNA.

  3. Template switching between PNA and RNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    Bohler, C.; Nielsen, P. E.; Orgel, L. E.; Miller, S. L. (Principal Investigator)

    1995-01-01

    The origin of the RNA world is not easily understood, as effective prebiotic syntheses of the components of RNA, the beta-ribofuranoside-5'-phosphates, are hard to envisage. Recognition of this difficulty has led to the proposal that other genetic systems, the components of which are more easily formed, may have preceded RNA. This raises the question of how transitions between one genetic system and another could occur. Peptide nucleic acid (PNA) resembles RNA in its ability to form double-helical complexes stabilized by Watson-Crick hydrogen bonding between adenine and thymine and between cytosine and guanine, but has a backbone that is held together by amide rather than by phosphodiester bonds. Oligonucleotides bases on RNA are known to act as templates that catalyse the non-enzymatic synthesis of their complements from activated mononucleotides, we now show that RNA oligonucleotides facilitate the synthesis of complementary PNA strands and vice versa. This suggests that a transition between different genetic systems can occur without loss of information.

  4. Baseline studies of health status in north Atlantic Baleen whale populations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lambertsen, R.H.

    1988-09-01

    This study investigated the health status of fin and sei whale populations of the central North Atlantic to establish a baseline for comparison with stranded whales in more heavily contaminated coastal zones. Systematic necropsy examinations were conducted on 150 fin whales and 42 sei whales caught by commercial whalers off the west coast of Iceland. Gas chromatographic measurements showed detectable tissue levels of organochlorine pesticides, but these levels were low, ranging from 0.2 ppb (gamma-BHC) to 1540 ppb (p,p{prime} DDE). Relevant to the comparative evaluation of contaminant effects was the finding that both the fin and sei whale, despite verymore » similar life histories, suffered from a distinct complement of natural disease problems. From the high incidence and contaminative route of transmission of the major parasitic diseases found, it is predicted that population-level health effects, including increments in mortality rate potentially caused by environmental contamination, will increase with population density.« less

  5. Identification of a movement protein of Mirafiori lettuce big-vein ophiovirus.

    PubMed

    Hiraguri, Akihiro; Ueki, Shoko; Kondo, Hideki; Nomiyama, Koji; Shimizu, Takumi; Ichiki-Uehara, Tamaki; Omura, Toshihiro; Sasaki, Nobumitsu; Nyunoya, Hiroshi; Sasaya, Takahide

    2013-05-01

    Mirafiori lettuce big-vein virus (MiLBVV) is a member of the genus Ophiovirus, which is a segmented negative-stranded RNA virus. In microprojectile bombardment experiments to identify a movement protein (MP) gene of ophioviruses that can trans-complement intercellular movement of an MP-deficient heterologous virus, a plasmid containing an infectious clone of a tomato mosaic virus (ToMV) derivative expressing the GFP was co-bombarded with plasmids containing one of three genes from MiLBVV RNAs 1, 2 and 4 onto Nicotiana benthamiana. Intercellular movement of the movement-defective ToMV was restored by co-expression of the 55 kDa protein gene, but not with the two other genes. Transient expression in epidermal cells of N. benthamiana and onion showed that the 55 kDa protein with GFP was localized on the plasmodesmata. The 55 kDa protein encoded in the MiLBVV RNA2 can function as an MP of the virus. This report is the first to describe an ophiovirus MP.

  6. Mechanical design of proteins studied by single-molecule force spectroscopy and protein engineering.

    PubMed

    Carrion-Vazquez, M; Oberhauser, A F; Fisher, T E; Marszalek, P E; Li, H; Fernandez, J M

    2000-01-01

    Mechanical unfolding and refolding may regulate the molecular elasticity of modular proteins with mechanical functions. The development of the atomic force microscopy (AFM) has recently enabled the dynamic measurement of these processes at the single-molecule level. Protein engineering techniques allow the construction of homomeric polyproteins for the precise analysis of the mechanical unfolding of single domains. alpha-Helical domains are mechanically compliant, whereas beta-sandwich domains, particularly those that resist unfolding with backbone hydrogen bonds between strands perpendicular to the applied force, are more stable and appear frequently in proteins subject to mechanical forces. The mechanical stability of a domain seems to be determined by its hydrogen bonding pattern and is correlated with its kinetic stability rather than its thermodynamic stability. Force spectroscopy using AFM promises to elucidate the dynamic mechanical properties of a wide variety of proteins at the single molecule level and provide an important complement to other structural and dynamic techniques (e.g., X-ray crystallography, NMR spectroscopy, patch-clamp).

  7. Diasporic dreaming: return reproductive tourism to the Middle East.

    PubMed

    Inhorn, Marcia C

    2011-11-01

    This article attempts to capture the dynamics of return reproductive tourism to the Middle East, based on ethnographic research undertaken at four different Middle Eastern locales (Egypt, Lebanon, United Arab Emirates and Arab America). Across the Middle Eastern diaspora, which is now vast, due to the disruptions of war and political violence, infertile couples often dream of making a test-tube baby 'back home' for a variety of cultural, moral and psychological reasons. These reasons – including medical expatriotism, the language of medicine, co-religion and moral trustworthiness, donor phenotype, the comforts of home and discrimination – are rarely highlighted in the scholarly literature on cross-border reproductive care. Thus, further empirical investigation is needed in order to assess additional reasons for reproductive travel beyond Euro-America. Of particular concern are the needs of 'stranded' refugee populations, who are constrained from seeking assisted reproduction technology 'back home', but who may face economic constraints and cultural discrimination in host communities. Copyright © 2011 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

  8. Development length of 0.6-inch prestressing strand in standard I-shaped pretensioned concrete beams

    NASA Astrophysics Data System (ADS)

    Barnes, Robert Wesley

    The use of 0.6 in prestressing strand at a center-to-center spacing of 2 in allows for the optimal implementation of High Strength Concrete (HSC) in precast, prestressed concrete bridge superstructures. For this strand configuration, partial debonding of strands is a desirable alternative to the more traditional method of draping strands to alleviate extreme concrete stresses after prestress release. Recent experimental evidence suggests that existing code provisions addressing the anchorage of pretensioned strands do not adequately describe the behavior of these strands. In addition, the anchorage behavior of partially debonded strands is not fully understood. These uncertainties have combined to hinder the full exploitation of HSC in pretensioned concrete construction. A research study was conducted to determine the anchorage behavior of 0.6 in strands at 2 in spacing in full-size bridge members. The experimental program consisted of assessing transfer and development lengths in plant-cast AASHTO Type I I-beams. The influence of concrete compressive strengths ranging from 5700 to 14,700 psi was examined. In order to consider the full range of strand surface conditions found in practice, the prestressing strand featured either a bright mill finish or a rusted surface condition. The anchorage behavior of partially debonded strands was investigated by using a variety of strand debonding configurations---including debonded strand percentages as high as 75 percent. A limited investigation of the effect of horizontal web reinforcement on anchorage behavior was performed. Pull-out tests were performed in an attempt to correlate results with the bond quality of the strands used in the study. The correlation between strand draw-in and the anchorage behavior of prestressing strands was also examined. A review of the evolution and shortcomings of existing code provisions for the anchorage of prestressing strands is presented. Results of the experimental program are reported, along with recommended design procedures based on these results and those from other studies. The use of 0.6 in strand at 2 in spacing is concluded to be safe, and partial debonding of prestressing strands is shown to be an effective means of reducing stresses in the end regions of pretensioned girders.

  9. Estimation of Prestress Force Distribution in Multi-Strand System of Prestressed Concrete Structures Using Field Data Measured by Electromagnetic Sensor

    PubMed Central

    Cho, Keunhee; Cho, Jeong-Rae; Kim, Sung Tae; Park, Sung Yong; Kim, Young-Jin; Park, Young-Hwan

    2016-01-01

    The recently developed smart strand can be used to measure the prestress force in the prestressed concrete (PSC) structure from the construction stage to the in-service stage. The higher cost of the smart strand compared to the conventional strand renders it unaffordable to replace all the strands by smart strands, and results in the application of only a limited number of smart strands in the PSC structure. However, the prestress forces developed in the strands of the multi-strand system frequently adopted in PSC structures differ from each other, which means that the prestress force in the multi-strand system cannot be obtained by simple proportional scaling using the measurement of the smart strand. Therefore, this study examines the prestress force distribution in the multi-strand system to find the correlation between the prestress force measured by the smart strand and the prestress force distribution in the multi-strand system. To that goal, the prestress force distribution was measured using electromagnetic sensors for various factors of the multi-strand system adopted on site in the fabrication of actual PSC girders. The results verified the possibility to assume normal distribution for the prestress force distribution per anchor head, and a method computing the mean and standard deviation defining the normal distribution is proposed. This paper presents a meaningful finding by proposing an estimation method of the prestress force based upon field-measured data of the prestress force distribution in the multi-strand system of actual PSC structures. PMID:27548172

  10. DNA forms of the geminivirus African cassava mosaic virus consistent with a rolling circle mechanism of replication.

    PubMed Central

    Saunders, K; Lucy, A; Stanley, J

    1991-01-01

    We have analysed DNA from African cassava mosaic virus (ACMV)-infected Nicotiana benthamiana by two-dimensional agarose gel electrophoresis and detected ACMV-specific DNAs by blot-hybridisation. ACMV DNA forms including the previously characterised single-stranded, open-circular, linear and supercoiled DNAs along with five previously uncharacterised heterogeneous DNAs (H1-H5) were resolved. The heterogeneous DNAs were characterised by their chromatographic properties on BND-cellulose and their ability to hybridise to strand-specific and double-stranded probes. The data suggest a rolling circle mechanism of DNA replication, based on the sizes and strand specificity of the heterogeneous single-stranded DNA forms and their electrophoretic properties in relation to genome length single-stranded DNAs. Second-strand synthesis on a single-stranded virus-sense template is evident from the position of heterogeneous subgenomic complementary-sense DNA (H3) associated with genome-length virus-sense template (VT) DNA. The position of heterogeneous virus-sense DNA (H5), ranging in size from one to two genome lengths, is consistent with its association with genome-length complementary-sense template (CT) DNA, reflecting virus-sense strand displacement during replication from a double-stranded intermediate. The absence of subgenomic complementary-sense DNA associated with the displaced virus-sense strand suggests that replication proceeds via an obligate single-stranded intermediate. The other species of heterogeneous DNAs comprised concatemeric single-stranded virus-sense DNA (H4), and double-stranded or partially single-stranded DNA (H1 and H2). Images PMID:2041773

  11. Emerging science, emerging ethical issues: who should fund innate alloimmunity-suppressing drugs?

    PubMed

    Land, W G; Gutmann, Th; Daar, A S

    2008-01-01

    An emerging body of evidence suggests that the innate immune system plays a critical role in allograft rejection. Any injury to the donor organ, e.g. the reperfusion injury, induces an inflammatory milieu in the allograft which appears to be the initial event for activation of the innate immune system. Injury-induced intragraft damage- associated molecular patterns (DAMPs) are recognized by donor-derived and recipient-derived, TLR4/2-bearing immature dendritic cells (iDCs). After recognition, these cells mature and initiate allorecognition/alloactivation in the lymphoid system of the recipient. Indeed, the key "innate" event, leading to activation of the adaptive alloimmune response, is the injury-induced, TLR4-triggered, and NFkappaB-mediated maturation of DCs ("innate alloimmunity"). Time-restricted treatment of innate immune events would include 1) treatment of the donor during organ removal, 2) in-situ/ex-vivo treatment of the donor organs alone, and 3) treatment of the recipient during allograft reperfusion and immediately postoperatively. Treatment modalities would include 1) minimization of the oxidative allograft injury with the use of antioxidants; 2) prevention of the TLR4-triggered maturation of DCs with the use of TLR4-antagonists; 3) inhibition of complement activation with the use of complement inhibiting agents. According to data from clinical and experimental studies it can be assumed that successful suppression of innate alloimmune events results in either subsequent significant reduction in, or even complete avoidance of the currently applied adaptive alloimmunity-suppressing drugs. However, in view of the time-restricted period of treatment, and the fear to potentially destroy its own business with currently applied alloimmunity-suppressing drugs, the pharmaceutical industry is still, but quite legitimately, reluctant to invest in the high cost of clinical development of those drugs for transplant patients because there are no marketing interests. On the other hand, clinical development of innate alloimmunity-suppressing drugs is urgently warranted. But: Who should fund? In this article, three options are explored which may contribute to a solution of the problem: 1) provision of incentives to companies for drug development; 2) conduction of clinical trials in developing countries; and 3) creation of a public-private professional partnership in analogy to the "European Rare Diseases Therapeutic Initiative" (ERDITI). We suggest and recommend the creation of such a partnership which may be called: "The European Initiative for the Suppression of Innate Alloimmunity" ("EISIA"). In analogy to ERDITI, the main goals of this organization should be:--to provide a streamlined facilitated process of collaboration between Academic Teams/Transplant Centres, Study Groups, and Pharma Companies to develop innate alloimmunity-suppressing drugs;--to give Academic Teams/Transplant Centres facilitated access to a large variety of compounds, developed by companies for other indications, which can be evaluated pre-clinically and, if warranted, clinically;--to guarantee the continuity all the way from research to development and commercialisation of the drug. If preclinical studies uncover the potential of a compound for suppressing innate alloimmune events, the Pharma Partner who has rights to this compound will either develop himself the drug for organ transplantation indication or allow its development by the academic team or a third party if he has no intentions of developing himself.

  12. 75 FR 37382 - Notice of Antidumping Duty Order: Prestressed Concrete Steel Wire Strand from the People's...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-29

    ... strand (``PC strand'') from the People's Republic of China (``PRC''). On June 22, 2010, the ITC notified... investigation of PC strand from the PRC. See Prestressed Concrete Steel Wire Strand From the People's Republic... Determination''). Scope of the Order The scope of this investigation consists of PC strand, produced from wire...

  13. Autonomous parvovirus LuIII encapsidates equal amounts of plus and minus DNA strands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bates, R.C.; Snyder, C.E.; Banerjee, P.T.

    1984-02-01

    Autonomous parvoviruses are thought to uniquely encapsidate single-stranded DNA of minus polarity. In contrast, the defective adeno-associated viruses separately encapsidate equal amounts of plus and minus DNA strands. The uniqueness of minus strand encapsidation is reexamined for the autonomous parvoviruses. Although it was found that Kilham rat virus and H-1 virus encapsidate varying but small amounts of complementary-strand DNA, it was unexpected to find that LuIII virus encapsidated equal amounts of plus and minus DNA. The extracted LuIII DNA possessed properties of double-stranded replicative-form DNA, including insensitivity to S1 endonuclease, cleavage by restriction enzymes, and conversion to unit-length, single-stranded DNAmore » when electrophoresed under denaturing conditions. However, the inability of this DNA to form single-stranded DNA circles when denatured and then renatured in the presence of formamide and the lack of double-stranded DNA circle formation after treatment with exonuclease III and reannealing shows a lack of sequence homology of the 3' and 5' termini of LuIII DNA, in contrast to adeno-associated virus DNA. Digestion of LuIII double-stranded DNA with EcoRI and HincII and separation of plus and minus DNA strands on composite agarose-acrylamide gels identified a heterogeneity present only in the plus DNA strand. These results suggest that strand specificity of viral DNA encapsidation is not a useful property for differentiation between the autonomous and defective parvoviruses. Furthermore, encapsidation by LuIII of equal amounts of complementary DNA strands in contrast to encapsidation of minus strands by H-1 virus, when propagated in the same host cell type, suggests that selection of strands for encapsidation is a virus-coded rather than host-controlled event.« less

  14. Fish stranding in freshwater systems: sources, consequences, and mitigation.

    PubMed

    Nagrodski, Alexander; Raby, Graham D; Hasler, Caleb T; Taylor, Mark K; Cooke, Steven J

    2012-07-30

    Fish can become stranded when water levels decrease, often rapidly, as a result of anthropogenic (e.g., canal drawdown, hydropeaking, vessel wakes) and natural (e.g., floods, drought, winter ice dynamics) events. We summarize existing research on stranding of fish in freshwater, discuss the sources, consequences, and mitigation options for stranding, and report current knowledge gaps. Our literature review revealed that ∼65.5% of relevant peer-reviewed articles were found to focus on stranding associated with hydropower operations and irrigation projects. In fact, anthropogenic sources of fish stranding represented 81.8% of available literature compared to only 19.9% attributed to natural fish stranding events. While fish mortality as a result of stranding is well documented, our analysis revealed that little is known about the sublethal and long-term consequences of stranding on growth and population dynamics. Furthermore, the contribution of stranding to annual mortality rates is poorly understood as are the potential ecosystem-scale impacts. Mitigation strategies available to deal with stranding include fish salvage, ramping rate limitations, and physical habitat works (e.g., to contour substrate to minimize stranding). However, a greater knowledge of the factors that cause fish stranding would promote the development and refinement of mitigation strategies that are economically and ecologically sustainable. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. Triple Helix Formation in a Topologically Controlled DNA Nanosystem.

    PubMed

    Yamagata, Yutaro; Emura, Tomoko; Hidaka, Kumi; Sugiyama, Hiroshi; Endo, Masayuki

    2016-04-11

    In the present study, we demonstrate single-molecule imaging of triple helix formation in DNA nanostructures. The binding of the single-molecule third strand to double-stranded DNA in a DNA origami frame was examined using two different types of triplet base pairs. The target DNA strand and the third strand were incorporated into the DNA frame, and the binding of the third strand was controlled by the formation of Watson-Crick base pairing. Triple helix formation was monitored by observing the structural changes in the incorporated DNA strands. It was also examined using a photocaged third strand wherein the binding of the third strand was directly observed using high-speed atomic force microscopy during photoirradiation. We found that the binding of the third strand could be controlled by regulating duplex formation and the uncaging of the photocaged strands in the designed nanospace. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. A second gene for type I signal peptidase in Bradyrhizobium japonicum, sipF, is located near genes involved in RNA processing and cell division.

    PubMed

    Bairl, A; Müller, P

    1998-11-01

    The TnphoA-induced Bradyrhizobium japonicum mutant 184 shows slow growth and aberrant colonization of soybean nodules. Using a DNA fragment adjacent to the transposon insertion site as a probe, a 3.4-kb BglII fragment of B. japonicum 110spc4 DNA was identified and cloned. Sequence analysis indicated that two truncated ORFs and three complete ORFs were encoded on this fragment. A database search revealed homologies to several other prokaryotic proteins: PdxJ (an enzyme involved in vitamin B6 biosynthesis), AcpS (acyl carrier protein synthase), Lep or Sip (prokaryotic type I signal peptidase), RNase III (an endoribonuclease which processes double-stranded rRNA precursors and mRNA) and Era (a GTP-binding protein required for cell division). The mutation in strain 184 was found to lie within the signal peptidase gene, which was designated sipF. Therefore, sipF is located in a region that encodes gene products involved in posttranscriptional and posttranslational processing processes. By complementation of the lep(ts) E. coli mutant strain IT41 it was demonstrated that sipF indeed encodes a functional signal peptidase, and genetic complementation of B. japonicum mutant 184 by a 2.8-kb SalI fragment indicated that sipF is expressed from a promoter located directly upstream of sipF. Using a non-polar kanamycin resistance cassette, a specific sipF mutant was constructed which exhibited defects in symbiosis similar to those of the original mutant 184.

  17. A compact, in vivo screen of all 6-mers reveals drivers of tissue-specific expression and guides synthetic regulatory element design.

    PubMed

    Smith, Robin P; Riesenfeld, Samantha J; Holloway, Alisha K; Li, Qiang; Murphy, Karl K; Feliciano, Natalie M; Orecchia, Lorenzo; Oksenberg, Nir; Pollard, Katherine S; Ahituv, Nadav

    2013-07-18

    Large-scale annotation efforts have improved our ability to coarsely predict regulatory elements throughout vertebrate genomes. However, it is unclear how complex spatiotemporal patterns of gene expression driven by these elements emerge from the activity of short, transcription factor binding sequences. We describe a comprehensive promoter extension assay in which the regulatory potential of all 6 base-pair (bp) sequences was tested in the context of a minimal promoter. To enable this large-scale screen, we developed algorithms that use a reverse-complement aware decomposition of the de Bruijn graph to design a library of DNA oligomers incorporating every 6-bp sequence exactly once. Our library multiplexes all 4,096 unique 6-mers into 184 double-stranded 15-bp oligomers, which is sufficiently compact for in vivo testing. We injected each multiplexed construct into zebrafish embryos and scored GFP expression in 15 tissues at two developmental time points. Twenty-seven constructs produced consistent expression patterns, with the majority doing so in only one tissue. Functional sequences are enriched near biologically relevant genes, match motifs for developmental transcription factors, and are required for enhancer activity. By concatenating tissue-specific functional sequences, we generated completely synthetic enhancers for the notochord, epidermis, spinal cord, forebrain and otic lateral line, and show that short regulatory sequences do not always function modularly. This work introduces a unique in vivo catalog of short, functional regulatory sequences and demonstrates several important principles of regulatory element organization. Furthermore, we provide resources for designing compact, reverse-complement aware k-mer libraries.

  18. Strand-Specific Analysis of DNA Synthesis and Proteins Association with DNA Replication Forks in Budding Yeast.

    PubMed

    Yu, Chuanhe; Gan, Haiyun; Zhang, Zhiguo

    2018-01-01

    DNA replication initiates at DNA replication origins after unwinding of double-strand DNA(dsDNA) by replicative helicase to generate single-stranded DNA (ssDNA) templates for the continuous synthesis of leading-strand and the discontinuous synthesis of lagging-strand. Therefore, methods capable of detecting strand-specific information will likely yield insight into the association of proteins at leading and lagging strand of DNA replication forks and the regulation of leading and lagging strand synthesis during DNA replication. The enrichment and Sequencing of Protein-Associated Nascent DNA (eSPAN), which measure the relative amounts of proteins at nascent leading and lagging strands of DNA replication forks, is a step-wise procedure involving the chromatin immunoprecipitation (ChIP) of a protein of interest followed by the enrichment of protein-associated nascent DNA through BrdU immunoprecipitation. The isolated ssDNA is then subjected to strand-specific sequencing. This method can detect whether a protein is enriched at leading or lagging strand of DNA replication forks. In addition to eSPAN, two other strand-specific methods, (ChIP-ssSeq), which detects potential protein-ssDNA binding and BrdU-IP-ssSeq, which can measure synthesis of both leading and lagging strand, were developed along the way. These methods can provide strand-specific and complementary information about the association of the target protein with DNA replication forks as well as synthesis of leading and lagging strands genome wide. Below, we describe the detailed eSPAN, ChIP-ssSeq, and BrdU-IP-ssSeq protocols.

  19. Easi-CRISPR: a robust method for one-step generation of mice carrying conditional and insertion alleles using long ssDNA donors and CRISPR ribonucleoproteins.

    PubMed

    Quadros, Rolen M; Miura, Hiromi; Harms, Donald W; Akatsuka, Hisako; Sato, Takehito; Aida, Tomomi; Redder, Ronald; Richardson, Guy P; Inagaki, Yutaka; Sakai, Daisuke; Buckley, Shannon M; Seshacharyulu, Parthasarathy; Batra, Surinder K; Behlke, Mark A; Zeiner, Sarah A; Jacobi, Ashley M; Izu, Yayoi; Thoreson, Wallace B; Urness, Lisa D; Mansour, Suzanne L; Ohtsuka, Masato; Gurumurthy, Channabasavaiah B

    2017-05-17

    Conditional knockout mice and transgenic mice expressing recombinases, reporters, and inducible transcriptional activators are key for many genetic studies and comprise over 90% of mouse models created. Conditional knockout mice are generated using labor-intensive methods of homologous recombination in embryonic stem cells and are available for only ~25% of all mouse genes. Transgenic mice generated by random genomic insertion approaches pose problems of unreliable expression, and thus there is a need for targeted-insertion models. Although CRISPR-based strategies were reported to create conditional and targeted-insertion alleles via one-step delivery of targeting components directly to zygotes, these strategies are quite inefficient. Here we describe Easi-CRISPR (Efficient additions with ssDNA inserts-CRISPR), a targeting strategy in which long single-stranded DNA donors are injected with pre-assembled crRNA + tracrRNA + Cas9 ribonucleoprotein (ctRNP) complexes into mouse zygotes. We show for over a dozen loci that Easi-CRISPR generates correctly targeted conditional and insertion alleles in 8.5-100% of the resulting live offspring. Easi-CRISPR solves the major problem of animal genome engineering, namely the inefficiency of targeted DNA cassette insertion. The approach is robust, succeeding for all tested loci. It is versatile, generating both conditional and targeted insertion alleles. Finally, it is highly efficient, as treating an average of only 50 zygotes is sufficient to produce a correctly targeted allele in up to 100% of live offspring. Thus, Easi-CRISPR offers a comprehensive means of building large-scale Cre-LoxP animal resources.

  20. Biofilm formation on stainless steel and gold wires for bonded retainers in vitro and in vivo and their susceptibility to oral antimicrobials.

    PubMed

    Jongsma, Marije A; Pelser, Floris D H; van der Mei, Henny C; Atema-Smit, Jelly; van de Belt-Gritter, Betsy; Busscher, Henk J; Ren, Yijin

    2013-05-01

    Bonded retainers are used in orthodontics to maintain treatment result. Retention wires are prone to biofilm formation and cause gingival recession, bleeding on probing and increased pocket depths near bonded retainers. In this study, we compare in vitro and in vivo biofilm formation on different wires used for bonded retainers and the susceptibility of in vitro biofilms to oral antimicrobials. Orthodontic wires were exposed to saliva, and in vitro biofilm formation was evaluated using plate counting and live/dead staining, together with effects of exposure to toothpaste slurry alone or followed by antimicrobial mouthrinse application. Wires were also placed intra-orally for 72 h in human volunteers and undisturbed biofilm formation was compared by plate counting and live/dead staining, as well as by denaturing gradient gel electrophoresis for compositional differences in biofilms. Single-strand wires attracted only slightly less biofilm in vitro than multi-strand wires. Biofilms on stainless steel single-strand wires however, were much more susceptible to antimicrobials from toothpaste slurries and mouthrinses than on single-strand gold wires and biofilms on multi-strand wires. Also, in vivo significantly less biofilm was found on single-strand than on multi-strand wires. Microbial composition of biofilms was more dependent on the volunteer involved than on wire type. Biofilms on single-strand stainless steel wires attract less biofilm in vitro and are more susceptible to antimicrobials than on multi-strand wires. Also in vivo, single-strand wires attract less biofilm than multi-strand ones. Use of single-strand wires is preferred over multi-strand wires, not because they attract less biofilm, but because biofilms on single-strand wires are not protected against antimicrobials as in crevices and niches as on multi-strand wires.

  1. Strand displacement by DNA polymerase III occurs through a tau-psi-chi link to single-stranded DNA-binding protein coating the lagging strand template.

    PubMed

    Yuan, Quan; McHenry, Charles S

    2009-11-13

    In addition to the well characterized processive replication reaction catalyzed by the DNA polymerase III holoenzyme on single-stranded DNA templates, the enzyme possesses an intrinsic strand displacement activity on flapped templates. The strand displacement activity is distinguished from the single-stranded DNA-templated reaction by a high dependence upon single-stranded DNA binding protein and an inability of gamma-complex to support the reaction in the absence of tau. However, if gamma-complex is present to load beta(2), a truncated tau protein containing only domains III-V will suffice. This truncated protein is sufficient to bind both the alpha subunit of DNA polymerase (Pol) III and chipsi. This is reminiscent of the minimal requirements for Pol III to replicate short single-stranded DNA-binding protein (SSB)-coated templates where tau is only required to serve as a scaffold to hold Pol III and chi in the same complex (Glover, B., and McHenry, C. (1998) J. Biol. Chem. 273, 23476-23484). We propose a model in which strand displacement by DNA polymerase III holoenzyme depends upon a Pol III-tau-psi-chi-SSB binding network, where SSB is bound to the displaced strand, stabilizing the Pol III-template interaction. The same interaction network is probably important for stabilizing the leading strand polymerase interactions with authentic replication forks. The specificity constant (k(cat)/K(m)) for the strand displacement reaction is approximately 300-fold less favorable than reactions on single-stranded templates and proceeds with a slower rate (150 nucleotides/s) and only moderate processivity (approximately 300 nucleotides). PriA, the initiator of replication restart on collapsed or misassembled replication forks, blocks the strand displacement reaction, even if added to an ongoing reaction.

  2. Estimating costs of programme services and products using information provided in standard financial statements.

    PubMed

    Ellwein, L B; Thulasiraj, R D; Boulter, A R; Dhittal, S P

    1998-01-01

    The financial viability of programme services and product offerings requires that revenue exceeds expenses. Revenue includes payments for services and products as well as donor cash and in-kind contributions. Expenses reflect consumption of purchased or contributed time and materials and utilization (depreciation) of physical plant facilities and equipment. Standard financial reports contain this revenue and expense information, complemented when necessary by valuation and accounting of in-kind contributions. Since financial statements are prepared using consistent and accepted accounting practices, year-to-year and organization-to-organization comparisons can be made. The use of such financial information is illustrated in this article by determining the unit cost of cataract surgery in two hospitals in Nepal. The proportion of unit cost attributed to personnel, medical supplies, administrative materials, and depreciation varied significantly by institution. These variations are accounted for by examining differences in operational structure and capacity utilization.

  3. Estimating costs of programme services and products using information provided in standard financial statements.

    PubMed Central

    Ellwein, L. B.; Thulasiraj, R. D.; Boulter, A. R.; Dhittal, S. P.

    1998-01-01

    The financial viability of programme services and product offerings requires that revenue exceeds expenses. Revenue includes payments for services and products as well as donor cash and in-kind contributions. Expenses reflect consumption of purchased or contributed time and materials and utilization (depreciation) of physical plant facilities and equipment. Standard financial reports contain this revenue and expense information, complemented when necessary by valuation and accounting of in-kind contributions. Since financial statements are prepared using consistent and accepted accounting practices, year-to-year and organization-to-organization comparisons can be made. The use of such financial information is illustrated in this article by determining the unit cost of cataract surgery in two hospitals in Nepal. The proportion of unit cost attributed to personnel, medical supplies, administrative materials, and depreciation varied significantly by institution. These variations are accounted for by examining differences in operational structure and capacity utilization. PMID:9868836

  4. [Prevalence of antibodies against Coxiella burnetii in a healthy population in Lanzarote (Canary Islands)].

    PubMed

    Pascual Velasco, F; Otero Ferrio, I; Borobio Enciso, M V

    1991-05-01

    The Canary Islands area now appears to be a Q-fever endemic zone, especially the west side (La Palma island). The situation in the eastern islands in unknown. In order to evaluate the seric prevalence of Coxiella burnetii, 100 serum samples that were taken from the adult population of Lanzarote and, following strict criteria, were analysed using a complement fixation test; blood donors and patients who had suffered a recent infection were excluded. The study was carried out during November/1986. Three serum samples were positive, one had titers of 1/8 and the other two showed 1/64. This prevalence rate of residual Coxiella burnetii antibodies in Lanzarote (3%)--despite being low compared to other areas in Spain--together with te recent cases described, confirms the suspicion that the Canary Islands area is indeed a new endemic Q-fever zone.

  5. Heteroatom-free arene-cobalt and arene-iron catalysts for hydrogenations.

    PubMed

    Gärtner, Dominik; Welther, Alice; Rad, Babak Rezaei; Wolf, Robert; Jacobi von Wangelin, Axel

    2014-04-01

    75 years after the discovery of hydroformylation, cobalt catalysts are now undergoing a renaissance in hydrogenation reactions. We have evaluated arene metalates in which the low-valent metal species is--conceptually different from heteroatom-based ligands--stabilized by π coordination to hydrocarbons. Potassium bis(anthracene)cobaltate 1 and -ferrate 2 can be viewed as synthetic precursors of quasi-"naked" anionic metal species; their aggregation is effectively impeded by (labile) coordination to the various π acceptors present in the hydrogenation reactions of unsaturated molecules (alkenes, arenes, carbonyl compounds). Kinetic studies, NMR spectroscopy, and poisoning studies of alkene hydrogenations support the formation of a homogeneous catalyst derived from 1 which is stabilized by the coordination of alkenes. This catalyst concept complements the use of complexes with heteroatom donor ligands for reductive processes. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Higher 5-hydroxymethylcytosine identifies immortal DNA strand chromosomes in asymmetrically self-renewing distributed stem cells.

    PubMed

    Huh, Yang Hoon; Cohen, Justin; Sherley, James L

    2013-10-15

    Immortal strands are the targeted chromosomal DNA strands of nonrandom sister chromatid segregation, a mitotic chromosome segregation pattern unique to asymmetrically self-renewing distributed stem cells (DSCs). By nonrandom segregation, immortal DNA strands become the oldest DNA strands in asymmetrically self-renewing DSCs. Nonrandom segregation of immortal DNA strands may limit DSC mutagenesis, preserve DSC fate, and contribute to DSC aging. The mechanisms responsible for specification and maintenance of immortal DNA strands are unknown. To discover clues to these mechanisms, we investigated the 5-methylcytosine and 5-hydroxymethylcytosine (5hmC) content on chromosomes in mouse hair follicle DSCs during nonrandom segregation. Although 5-methylcytosine content did not differ significantly, the relative content of 5hmC was significantly higher in chromosomes containing immortal DNA strands than in opposed mitotic chromosomes containing younger mortal DNA strands. The difference in relative 5hmC content was caused by the loss of 5hmC from mortal chromosomes. These findings implicate higher 5hmC as a specific molecular determinant of immortal DNA strand chromosomes. Because 5hmC is an intermediate during DNA demethylation, we propose a ten-eleven translocase enzyme mechanism for both the specification and maintenance of nonrandomly segregated immortal DNA strands. The proposed mechanism reveals a means by which DSCs "know" the generational age of immortal DNA strands. The mechanism is supported by molecular expression data and accounts for the selection of newly replicated DNA strands when nonrandom segregation is initiated. These mechanistic insights also provide a possible basis for another characteristic property of immortal DNA strands, their guanine ribonucleotide dependency.

  7. Titanium Dioxide Nanoparticle-Based Interdigitated Electrodes: A Novel Current to Voltage DNA Biosensor Recognizes E. coli O157:H7.

    PubMed

    Nadzirah, Sh; Azizah, N; Hashim, Uda; Gopinath, Subash C B; Kashif, Mohd

    2015-01-01

    Nanoparticle-mediated bio-sensing promoted the development of novel sensors in the front of medical diagnosis. In the present study, we have generated and examined the potential of titanium dioxide (TiO2) crystalline nanoparticles with aluminium interdigitated electrode biosensor to specifically detect single-stranded E.coli O157:H7 DNA. The performance of this novel DNA biosensor was measured the electrical current response using a picoammeter. The sensor surface was chemically functionalized with (3-aminopropyl) triethoxysilane (APTES) to provide contact between the organic and inorganic surfaces of a single-stranded DNA probe and TiO2 nanoparticles while maintaining the sensing system's physical characteristics. The complement of the target DNA of E. coli O157:H7 to the carboxylate-probe DNA could be translated into electrical signals and confirmed by the increased conductivity in the current-to-voltage curves. The specificity experiments indicate that the biosensor can discriminate between the complementary sequences from the base-mismatched and the non-complementary sequences. After duplex formation, the complementary target sequence can be quantified over a wide range with a detection limit of 1.0 x 10(-13)M. With target DNA from the lysed E. coli O157:H7, we could attain similar sensitivity. Stability of DNA immobilized surface was calculated with the relative standard deviation (4.6%), displayed the retaining with 99% of its original response current until 6 months. This high-performance interdigitated DNA biosensor with high sensitivity, stability and non-fouling on a novel sensing platform is suitable for a wide range of biomolecular interactive analyses.

  8. Titanium Dioxide Nanoparticle-Based Interdigitated Electrodes: A Novel Current to Voltage DNA Biosensor Recognizes E. coli O157:H7

    PubMed Central

    Nadzirah, Sh.; Azizah, N.; Hashim, Uda; Gopinath, Subash C. B.; Kashif, Mohd

    2015-01-01

    Nanoparticle-mediated bio-sensing promoted the development of novel sensors in the front of medical diagnosis. In the present study, we have generated and examined the potential of titanium dioxide (TiO2) crystalline nanoparticles with aluminium interdigitated electrode biosensor to specifically detect single-stranded E.coli O157:H7 DNA. The performance of this novel DNA biosensor was measured the electrical current response using a picoammeter. The sensor surface was chemically functionalized with (3-aminopropyl) triethoxysilane (APTES) to provide contact between the organic and inorganic surfaces of a single-stranded DNA probe and TiO2 nanoparticles while maintaining the sensing system’s physical characteristics. The complement of the target DNA of E. coli O157:H7 to the carboxylate-probe DNA could be translated into electrical signals and confirmed by the increased conductivity in the current-to-voltage curves. The specificity experiments indicate that the biosensor can discriminate between the complementary sequences from the base-mismatched and the non-complementary sequences. After duplex formation, the complementary target sequence can be quantified over a wide range with a detection limit of 1.0 x 10-13M. With target DNA from the lysed E. coli O157:H7, we could attain similar sensitivity. Stability of DNA immobilized surface was calculated with the relative standard deviation (4.6%), displayed the retaining with 99% of its original response current until 6 months. This high-performance interdigitated DNA biosensor with high sensitivity, stability and non-fouling on a novel sensing platform is suitable for a wide range of biomolecular interactive analyses. PMID:26445455

  9. Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment.

    PubMed

    Paul, David; Hoppe, Simone; Saher, Gesine; Krijnse-Locker, Jacomine; Bartenschlager, Ralf

    2013-10-01

    Like all other positive-strand RNA viruses, hepatitis C virus (HCV) induces rearrangements of intracellular membranes that are thought to serve as a scaffold for the assembly of the viral replicase machinery. The most prominent membranous structures present in HCV-infected cells are double-membrane vesicles (DMVs). However, their composition and role in the HCV replication cycle are poorly understood. To gain further insights into the biochemcial properties of HCV-induced membrane alterations, we generated a functional replicon containing a hemagglutinin (HA) affinity tag in nonstructural protein 4B (NS4B), the supposed scaffold protein of the viral replication complex. By using HA-specific affinity purification we isolated NS4B-containing membranes from stable replicon cells. Complementing biochemical and electron microscopy analyses of purified membranes revealed predominantly DMVs, which contained viral proteins NS3 and NS5A as well as enzymatically active viral replicase capable of de novo synthesis of HCV RNA. In addition to viral factors, co-opted cellular proteins, such as vesicle-associated membrane protein-associated protein A (VAP-A) and VAP-B, that are crucial for viral RNA replication, as well as cholesterol, a major structural lipid of detergent-resistant membranes, are highly enriched in DMVs. Here we describe the first isolation and biochemical characterization of HCV-induced DMVs. The results obtained underline their central role in the HCV replication cycle and suggest that DMVs are sites of viral RNA replication. The experimental approach described here is a powerful tool to more precisely define the molecular composition of membranous replication factories induced by other positive-strand RNA viruses, such as picorna-, arteri- and coronaviruses.

  10. Morphological and Biochemical Characterization of the Membranous Hepatitis C Virus Replication Compartment

    PubMed Central

    Hoppe, Simone; Saher, Gesine; Krijnse-Locker, Jacomine

    2013-01-01

    Like all other positive-strand RNA viruses, hepatitis C virus (HCV) induces rearrangements of intracellular membranes that are thought to serve as a scaffold for the assembly of the viral replicase machinery. The most prominent membranous structures present in HCV-infected cells are double-membrane vesicles (DMVs). However, their composition and role in the HCV replication cycle are poorly understood. To gain further insights into the biochemcial properties of HCV-induced membrane alterations, we generated a functional replicon containing a hemagglutinin (HA) affinity tag in nonstructural protein 4B (NS4B), the supposed scaffold protein of the viral replication complex. By using HA-specific affinity purification we isolated NS4B-containing membranes from stable replicon cells. Complementing biochemical and electron microscopy analyses of purified membranes revealed predominantly DMVs, which contained viral proteins NS3 and NS5A as well as enzymatically active viral replicase capable of de novo synthesis of HCV RNA. In addition to viral factors, co-opted cellular proteins, such as vesicle-associated membrane protein-associated protein A (VAP-A) and VAP-B, that are crucial for viral RNA replication, as well as cholesterol, a major structural lipid of detergent-resistant membranes, are highly enriched in DMVs. Here we describe the first isolation and biochemical characterization of HCV-induced DMVs. The results obtained underline their central role in the HCV replication cycle and suggest that DMVs are sites of viral RNA replication. The experimental approach described here is a powerful tool to more precisely define the molecular composition of membranous replication factories induced by other positive-strand RNA viruses, such as picorna-, arteri- and coronaviruses. PMID:23885072

  11. The Borrelia afzelii outer membrane protein BAPKO_0422 binds human factor-H and is predicted to form a membrane-spanning β-barrel

    PubMed Central

    Dyer, Adam; Brown, Gemma; Stejskal, Lenka; Laity, Peter R.; Bingham, Richard J.

    2015-01-01

    The deep evolutionary history of the Spirochetes places their branch point early in the evolution of the diderms, before the divergence of the present day Proteobacteria. As a spirochete, the morphology of the Borrelia cell envelope shares characteristics of both Gram-positive and Gram-negative bacteria. A thin layer of peptidoglycan, tightly associated with the cytoplasmic membrane, is surrounded by a more labile outer membrane (OM). This OM is rich in lipoproteins but with few known integral membrane proteins. The outer membrane protein A (OmpA) domain is an eight-stranded membrane-spanning β-barrel, highly conserved among the Proteobacteria but so far unknown in the Spirochetes. In the present work, we describe the identification of four novel OmpA-like β-barrels from Borrelia afzelii, the most common cause of erythema migrans (EM) rash in Europe. Structural characterization of one these proteins (BAPKO_0422) by SAXS and CD indicate a compact globular structure rich in β-strand consistent with a monomeric β-barrel. Ab initio molecular envelopes calculated from the scattering profile are consistent with homology models and demonstrate that BAPKO_0422 adopts a peanut shape with dimensions 25×45 Å (1 Å=0.1 nm). Deviations from the standard C-terminal signature sequence are apparent; in particular the C-terminal phenylalanine residue commonly found in Proteobacterial OM proteins is replaced by isoleucine/leucine or asparagine. BAPKO_0422 is demonstrated to bind human factor H (fH) and therefore may contribute to immune evasion by inhibition of the complement response. Encoded by chromosomal genes, these proteins are highly conserved between Borrelia subspecies and may be of diagnostic or therapeutic value. PMID:26181365

  12. A Novel 5-Enolpyruvylshikimate-3-Phosphate Synthase from Rahnella aquatilis with Significantly Reduced Glyphosate Sensitivity

    PubMed Central

    Xiong, Ai-Sheng; Zhao, Wei; Fu, Xiao-Yan; Han, Hong-Juan; Chen, Chen; Jin, Xiao-Fen; Yao, Quan-Hong

    2012-01-01

    The 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS; EC 2.5.1.19) is a key enzyme in the shikimate pathway for the production of aromatic amino acids and chorismate-derived secondary metabolites in plants, fungi, and microorganisms. It is also the target of the broad-spectrum herbicide glyphosate. Natural glyphosate resistance is generally thought to occur within microorganisms in a strong selective pressure condition. Rahnella aquatilis strain GR20, an antagonist against pathogenic agrobacterial strains of grape crown gall, was isolated from the rhizosphere of grape in glyphosate-contaminated vineyards. A novel gene encoding EPSPS was identified from the isolated bacterium by complementation of an Escherichia coli auxotrophic aroA mutant. The EPSPS, named AroAR.aquatilis, was expressed and purified from E. coli, and key kinetic values were determined. The full-length enzyme exhibited higher tolerance to glyphosate than the E. coli EPSPS (AroAE.coli), while retaining high affinity for the substrate phosphoenolpyruvate. Transgenic plants of AroAR.aquatilis were also observed to be more resistant to glyphosate at a concentration of 5 mM than that of AroAE.coli. To probe the sites contributing to increased tolerance to glyphosate, mutant R.aquatilis EPSPS enzymes were produced with the c-strand of subdomain 3 and the f-strand of subdomain 5 (Thr38Lys, Arg40Val, Arg222Gln, Ser224Val, Ile225Val, and Gln226Lys) substituted by the corresponding region of the E. coli EPSPS. The mutant enzyme exhibited greater sensitivity to glyphosate than the wild type R.aquatilis EPSPS with little change of affinity for its first substrate, shikimate-3-phosphate (S3P) and phosphoenolpyruvate (PEP). The effect of the residues on subdomain 5 on glyphosate resistance was more obvious. PMID:22870190

  13. A structural model for apolipoprotein C-II amyloid fibrils: experimental characterization and molecular dynamics simulations.

    PubMed

    Teoh, Chai Lean; Pham, Chi L L; Todorova, Nevena; Hung, Andrew; Lincoln, Craig N; Lees, Emma; Lam, Yuen Han; Binger, Katrina J; Thomson, Neil H; Radford, Sheena E; Smith, Trevor A; Müller, Shirley A; Engel, Andreas; Griffin, Michael D W; Yarovsky, Irene; Gooley, Paul R; Howlett, Geoffrey J

    2011-02-04

    The self-assembly of specific proteins to form insoluble amyloid fibrils is a characteristic feature of a number of age-related and debilitating diseases. Lipid-free human apolipoprotein C-II (apoC-II) forms characteristic amyloid fibrils and is one of several apolipoproteins that accumulate in amyloid deposits located within atherosclerotic plaques. X-ray diffraction analysis of aligned apoC-II fibrils indicated a simple cross-β-structure composed of two parallel β-sheets. Examination of apoC-II fibrils using transmission electron microscopy, scanning transmission electron microscopy, and atomic force microscopy indicated that the fibrils are flat ribbons composed of one apoC-II molecule per 4.7-Å rise of the cross-β-structure. Cross-linking results using single-cysteine substitution mutants are consistent with a parallel in-register structural model for apoC-II fibrils. Fluorescence resonance energy transfer analysis of apoC-II fibrils labeled with specific fluorophores provided distance constraints for selected donor-acceptor pairs located within the fibrils. These findings were used to develop a simple 'letter-G-like' β-strand-loop-β-strand model for apoC-II fibrils. Fully solvated all-atom molecular dynamics (MD) simulations showed that the model contained a stable cross-β-core with a flexible connecting loop devoid of persistent secondary structure. The time course of the MD simulations revealed that charge clusters in the fibril rearrange to minimize the effects of same-charge interactions inherent in parallel in-register models. Our structural model for apoC-II fibrils suggests that apoC-II monomers fold and self-assemble to form a stable cross-β-scaffold containing relatively unstructured connecting loops. Copyright © 2010 Elsevier Ltd. All rights reserved.

  14. Is height the best predictor for adequacy of semitendinosus-alone anterior cruciate ligament reconstruction? A study of hamstring graft dimensions and anthropometric measurements.

    PubMed

    Sundararajan, S R; Rajagopalakrishnan, Ramakanth; Rajasekaran, S

    2016-05-01

    To predict adequacy of semitendinosus (ST) graft dimension for ACLR from anthropometric measures. Single tendon harvest for autograft hamstring ACLR could be beneficial to limit donor site morbidity; however, concerns for reconstruction failure based upon inadequate graft size may limit this surgical technique. To predict adequacy, prospectively, 108 patients who underwent ACLR by hamstring graft (STG graft) were enrolled for the study. Mean age was 33.028 years ± 9.539 SD (14-59) with 88 males and 20 females. Anthropometric measurements (height, weight, BMI, thigh and total limb length) and intraoperative data (graft dimensions and bone tunnel measurements) were collected for analysis. Semitendinosus graft can be used as 3-strand (ST3) or 4-strand (ST4) graft. Adequacy criteria for ST3 and ST4 graft dimensions were determined from data analysis. SPSS (v.17) Pearson's correlation coefficient and ROC curves were used for statistical analyses. A total of 74 out of 108 patients (68.52 %) had adequate graft dimensions for ST3 reconstruction. Height equal or greater than 158 cm was predictive of adequate graft for ST3 reconstruction. Only 23 patients (21.3 %) had adequate graft dimensions for ST4 reconstruction. Height equal or greater than 170 cm was predictive of adequate graft for ST4 reconstruction. Height variable had the highest ROC curve area of 0.840 and 0.910 for both ST3 graft and ST4 graft, respectively. Hence, height was used as best predictor to determine adequacy of the graft. Height can be predictive of adequate graft for single tendon ACL reconstruction.

  15. Alterations in leucocyte subsets and histomorphology in normal-appearing perilesional skin and early and chronic hidradenitis suppurativa lesions.

    PubMed

    van der Zee, H H; de Ruiter, L; Boer, J; van den Broecke, D G; den Hollander, J C; Laman, J D; Prens, E P

    2012-01-01

    Current insight into the histopathological course of events during disease progression in hidradenitis suppurativa (HS) is fragmentary. To identify histological alterations and leucocyte subsets in normal-appearing perilesional skin, and early and chronic HS lesions. In this observational study we examined eight perilesional skin samples, and six early and 10 chronic prototypic HS lesions, as well as skin samples from four healthy donors using in situ immunostaining. Perilesional skin showed mild psoriasiform hyperplasia and follicular plugging as well as a low-grade influx of tryptase-positive mast cells, CD3+ T cells, CD138+ plasma cells and factor XIIIa+ dendritic cells. In early HS lesions, neutrophilic abscess formation and influx of mainly macrophages, monocytes and dendritic cells predominated. In chronic disease, the infiltrate expanded with markedly increased frequencies of CD20+ and CD79a+ B cells and CD138+ plasma cells. As in early lesions, free keratin fibres were detected in the dermis and within giant cells. Single detached keratinocytes and strands of follicular epithelium were observed in the dermis, the latter frequently expressing Ki67, indicative of active proliferation. Psoriasiform hyperplasia, follicular plugging and low-grade leucocytic infiltration are already present in normal-appearing perilesional skin. Keratin fibres in the dermis are associated with clinical disease. Early lesions are characterized by neutrophilic abscess formation and influx of mainly histiocytes, and chronic lesions mainly by expansion of B cells and plasma cells in 'pseudo' follicles. Proliferating strands of follicular epithelium may initiate fistula formation. Mast cells are increased in all stages of HS including perilesional skin. © 2011 The Authors. BJD © 2011 British Association of Dermatologists.

  16. Zn(II) coordination polymers with flexible V-shaped dicarboxylate ligand: Syntheses, helical structures and properties

    NASA Astrophysics Data System (ADS)

    Li, Lin; Liu, Chong-Bo; Yang, Gao-Shan; Xiong, Zhi-Qiang; Liu, Hong; Wen, Hui-Liang

    2015-11-01

    Hydrothermal reactions of 2,2‧-[hexafluoroisopropylidenebis(p-phenyleneoxy)]diacetic acid (H2L) and zinc ions in the presence of N-donor ancillary ligands afford four novel coordination polymers, namely, [Zn2(μ2-OH)(μ4-O)0.5(L)]·0.5H2O (1), [Zn(L)(2,2‧-bipy)(H2O)] (2), [Zn3(L)3(phen)2]·H2O (3) and [Zn2(L)2(4,4‧-bipy)] (4) (2,2‧-bipy=2,2‧-bipyridine; 4,4‧-bipy=4,4‧-bipyridine; phen=1,10-phenanthroline). Their structures have been determined by single-crystal X-ray diffraction analyses, elemental analyses, IR spectra, powder X-ray diffraction (PXRD), and thermogravimetric (TG) analyses. Complex 1 shows a 3-D clover framework consisting of [Zn4(μ4-O)(μ2-OH)2]4+ clusters, and exhibits a novel (3,8)-connected topological net with the Schläfli symbol of {3·4·5}2{34·44·52·66·710·82}, and contains double-stranded and two kinds of meso-helices. 2 displays a helical chain structure, which is further extended via hydrogen bonds into a 3-D supramolecular structure with meso-helix chains. 3 displays a 2-D {44·62} parallelogram structure, which is further extended via hydrogen bonds into a 3-D supramolecular structure with single-stranded helical chains. 4 shows a 2-D {44·62} square structure with left- and right-handed helical chains. Moreover, the luminescent properties of 1-4 have been investigated.

  17. Architecture of polyglutamine-containing fibrils from time-resolved fluorescence decay.

    PubMed

    Röthlein, Christoph; Miettinen, Markus S; Borwankar, Tejas; Bürger, Jörg; Mielke, Thorsten; Kumke, Michael U; Ignatova, Zoya

    2014-09-26

    The disease risk and age of onset of Huntington disease (HD) and nine other repeat disorders strongly depend on the expansion of CAG repeats encoding consecutive polyglutamines (polyQ) in the corresponding disease protein. PolyQ length-dependent misfolding and aggregation are the hallmarks of CAG pathologies. Despite intense effort, the overall structure of these aggregates remains poorly understood. Here, we used sensitive time-dependent fluorescent decay measurements to assess the architecture of mature fibrils of huntingtin (Htt) exon 1 implicated in HD pathology. Varying the position of the fluorescent labels in the Htt monomer with expanded 51Q (Htt51Q) and using structural models of putative fibril structures, we generated distance distributions between donors and acceptors covering all possible distances between the monomers or monomer dimensions within the polyQ amyloid fibril. Using Monte Carlo simulations, we systematically scanned all possible monomer conformations that fit the experimentally measured decay times. Monomers with four-stranded 51Q stretches organized into five-layered β-sheets with alternating N termini of the monomers perpendicular to the fibril axis gave the best fit to our data. Alternatively, the core structure of the polyQ fibrils might also be a zipper layer with antiparallel four-stranded stretches as this structure showed the next best fit. All other remaining arrangements are clearly excluded by the data. Furthermore, the assessed dimensions of the polyQ stretch of each monomer provide structural evidence for the observed polyQ length threshold in HD pathology. Our approach can be used to validate the effect of pharmacological substances that inhibit or alter amyloid growth and structure. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. GC-Biased Gene Conversion in Yeast Is Specifically Associated with Crossovers: Molecular Mechanisms and Evolutionary Significance

    PubMed Central

    Lesecque, Yann; Mouchiroud, Dominique; Duret, Laurent

    2013-01-01

    GC-biased gene conversion (gBGC) is a process associated with recombination that favors the transmission of GC alleles over AT alleles during meiosis. gBGC plays a major role in genome evolution in many eukaryotes. However, the molecular mechanisms of gBGC are still unknown. Different steps of the recombination process could potentially cause gBGC: the formation of double-strand breaks (DSBs), the invasion of the homologous or sister chromatid, and the repair of mismatches in heteroduplexes. To investigate these models, we analyzed a genome-wide data set of crossovers (COs) and noncrossovers (NCOs) in Saccharomyces cerevisiae. We demonstrate that the overtransmission of GC alleles is specific to COs and that it occurs among conversion tracts in which all alleles are converted from the same donor haplotype. Thus, gBGC results from a process that leads to long-patch repair. We show that gBGC is associated with longer tracts and that it is driven by the nature (GC or AT) of the alleles located at the extremities of the tract. These observations invalidate the hypotheses that gBGC is due to the base excision repair machinery or to a bias in DSB formation and suggest that in S. cerevisiae, gBGC is caused by the mismatch repair (MMR) system. We propose that the presence of nicks on both DNA strands during CO resolution could be the cause of the bias in MMR activity. Our observations are consistent with the hypothesis that gBGC is a nonadaptive consequence of a selective pressure to limit the mutation rate in mitotic cells. PMID:23505044

  19. Loss of CD11b Exacerbates Murine Complement-Mediated Tubulointerstitial Nephritis

    PubMed Central

    Wang, Ying; Chang, Anthony; Haas, Mark; Quigg, Richard John

    2014-01-01

    Acute complement activation occurs in the tubulointerstitium (TI) of kidneys transplanted from Crry−/−C3−/− mice into complement-sufficient wildtype mice, followed by marked inflammatory cell infiltration, tubular damage and interstitial fibrosis. We postulated iC3b-CD11b interactions were critical in this TI nephritis model. We transplanted Crry−/−C3−/− mouse kidneys into CD11b−/− and wildtype C57BL/6 mice. Surprisingly, there was greater inflammation in Crry−/−C3−/− kidneys in CD11b−/− recipients compared to those in wildtype hosts. Kidneys in CD11b−/− recipients had large numbers of CD11b−Ly6ChiCCR2hiF4/80+ cells consistent with inflammatory (M1) macrophages recruited from circulating monocytes of the host CD11b−/− animal. There was also an expanded population of CD11b+CD11c+Ly6C−F4/80hi cells. Since these cells were CD11b+, they must have originated from the transplanted kidney; their surface protein expression and appearance within the kidney were consistent with the intrinsic renal mononuclear cellular population. These cells were markedly expanded relative to all relevant controls, including the contralateral donor kidney and Crry−/−C3−/− mouse kidneys in CD11b+/+ wildtype recipients. Direct evidence for their in situ proliferation was the presence of nuclear Ki67 and PCNA in CD11b+F4/80+ cells. Thus, in this experimental model in which there is unrestricted C3 activation, CD11b+ monocytes limit their own infiltration into the kidney and prevent proliferation of endogenous mononuclear cells. This suggests a role for outside-in iC3b-CD11b signals in limiting intrinsic organ inflammation. PMID:24632830

  20. Humanisation of a claudin-1-specific monoclonal antibody for clinical prevention and cure of HCV infection without escape.

    PubMed

    Colpitts, Che C; Tawar, Rajiv G; Mailly, Laurent; Thumann, Christine; Heydmann, Laura; Durand, Sarah C; Xiao, Fei; Robinet, Eric; Pessaux, Patrick; Zeisel, Mirjam B; Baumert, Thomas F

    2018-04-01

    HCV infection is a leading cause of chronic liver disease and a major indication for liver transplantation. Although direct-acting antivirals (DAAs) have much improved the treatment of chronic HCV infection, alternative strategies are needed for patients with treatment failure. As an essential HCV entry factor, the tight junction protein claudin-1 (CLDN1) is a promising antiviral target. However, genotype-dependent escape via CLDN6 and CLDN9 has been described in some cell lines as a possible limitation facing CLDN1-targeted therapies. Here, we evaluated the clinical potential of therapeutic strategies targeting CLDN1. We generated a humanised anti-CLDN1 monoclonal antibody (mAb) (H3L3) suitable for clinical development and characterised its anti-HCV activity using cell culture models, a large panel of primary human hepatocytes (PHH) from 12 different donors, and human liver chimeric mice. H3L3 pan-genotypically inhibited HCV pseudoparticle entry into PHH, irrespective of donor. Escape was likely precluded by low surface expression of CLDN6 and CLDN9 on PHH. Co-treatment of a panel of PHH with a CLDN6-specific mAb did not enhance the antiviral effect of H3L3, confirming that CLDN6 does not function as an entry factor in PHH from multiple donors. H3L3 also inhibited DAA-resistant strains of HCV and synergised with current DAAs. Finally, H3L3 cured persistent HCV infection in human-liver chimeric uPA-SCID mice in monotherapy. Overall, these findings underscore the clinical potential of CLDN1-targeted therapies and describe the functional characterisation of a humanised anti-CLDN1 antibody suitable for further clinical development to complement existing therapeutic strategies for HCV. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  1. Culture, characteristics and chromosome complement of Siberian tiger fibroblasts for nuclear transfer.

    PubMed

    Song, Jimei; Hua, Song; Song, Kai; Zhang, Yong

    2007-01-01

    Tiger (Panthera tigris Linnaeus, 1758) is a characteristic species of Asia, which is in severe danger. Siberian tiger (Panthera tigris altaica) is the largest one of the five existent tiger subspecies. It is extremely endangered. One new way for tiger protection and rescue is to study interspecies cloning. But there is few research data about Siberian tiger. In this study, we cultured Siberian tiger fibroblasts in vitro, analyzed their biological characteristics, chromosomes, and cell cycles, to provide not only nuclear donors with good morphology, normal biological characteristics, and chromosome quantity for tiger interspecies cloning, but also reliable data for further studying Siberian tiger. The results indicated that Siberian tiger ear fibroblasts can be successfully obtained by tissue culture either with or without overnight cold digestion, the cultured cells were typical fibroblasts with normal morphology, growth curve, and chromosome quantity; G0/G1 percentage increased and S percentage decreased with the confluence of cells. G0/G1 and S stage rate was significantly different between 40-50% and 80-90%, 95-100% confluence; there is no distinct difference between 80-90% and 95-100% confluence. The cells at the same density (80-90% confluence) were treated with or without 0.5% serum starving, GO/G1 rate of the former was higher than the latter, but the difference was not significant. GO/G1 proportion of 95-100% confluence was slightly higher than serum starving (80-90% confluence), but no significant difference. Therefore, the Siberian tiger fibroblasts we cultured in vitro can be used as donor cells, and the donor cells do not need to be treated with normal serum starvation during nuclear transfer; if we will just consider the rate of the G0/G1 stage cells, serum starvation can be replaced by confluence inhibition when cultured cells were more than 80-90% confluence.

  2. Procedure for normalization of cDNA libraries

    DOEpatents

    Bonaldo, Maria DeFatima; Soares, Marcelo Bento

    1997-01-01

    This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

  3. Vacuum powder injector and method of impregnating fiber with powder

    NASA Astrophysics Data System (ADS)

    Working, Dennis C.

    1993-05-01

    A method and apparatus uniformly impregnate stranded material with dry powder such as low solubility, high melt flow polymer powder to produce, for example, composite prepregs. The stranded material is expanded in an impregnation chamber by an influx of air so that the powder, which may enter through the same inlet as the air, penetrates to the center of the stranded material. The stranded material then is contracted for holding the powder therein. The stranded material and powder may be pulled through the impregnation chamber in the same direction by vacuum. Larger particles of powder which do not fully penetrate the stranded material may be combed into the stranded material and powder which does not impregnate the stranded material may be collected and reused.

  4. Vacuum powder injector and method of impregnating fiber with powder

    NASA Technical Reports Server (NTRS)

    Working, Dennis C. (Inventor)

    1993-01-01

    A method and apparatus uniformly impregnate stranded material with dry powder such as low solubility, high melt flow polymer powder to produce, for example, composite prepregs. The stranded material is expanded in an impregnation chamber by an influx of air so that the powder, which may enter through the same inlet as the air, penetrates to the center of the stranded material. The stranded material then is contracted for holding the powder therein. The stranded material and powder may be pulled through the impregnation chamber in the same direction by vacuum. Larger particles of powder which do not fully penetrate the stranded material may be combed into the stranded material and powder which does not impregnate the stranded material may be collected and reused.

  5. 3' Homologous Free Ends are Required for Stable Joint Molecule Formation by the RecA and Single-Stranded Binding Proteins of Escherichia coli

    NASA Astrophysics Data System (ADS)

    Konforti, Boyana B.; Davis, Ronald W.

    1987-02-01

    The RecA protein of Escherichia coli is important for genetic recombination in vivo and can promote synapsis and strand exchange in vitro. The DNA pairing and strand exchange reactions have been well characterized in reactions with circular single strands and linear duplexes, but little is known about these two processes using substrates more characteristic of those likely to exist in the cell. Single-stranded linear DNAs were prepared by separating strands of duplex molecules or by cleaving single-stranded circles at a unique restriction site created by annealing a short defined oligonucleotide to the circle. Analysis by gel electrophoresis and electron microscopy revealed that, in the presence of RecA and single-stranded binding proteins, a free 3' homologous end is essential for stable joint molecule formation between linear single-stranded and circular duplex DNA.

  6. Determining orientation and direction of DNA sequences

    DOEpatents

    Goodwin, Edwin H.; Meyne, Julianne

    2000-01-01

    Determining orientation and direction of DNA sequences. A method by which fluorescence in situ hybridization can be made strand specific is described. Cell cultures are grown in a medium containing a halogenated nucleotide. The analog is partially incorporated in one DNA strand of each chromatid. This substitution takes place in opposite strands of the two sister chromatids. After staining with the fluorescent DNA-binding dye Hoechst 33258, cells are exposed to long-wavelength ultraviolet light which results in numerous strand nicks. These nicks enable the substituted strand to be denatured and solubilized by heat, treatment with high or low pH aqueous solutions, or by immersing the strands in 2.times.SSC (0.3M NaCl+0.03M sodium citrate), to name three procedures. It is unnecessary to enzymatically digest the strands using Exo III or another exonuclease in order to excise and solubilize nucleotides starting at the sites of the nicks. The denaturing/solubilizing process removes most of the substituted strand while leaving the prereplication strand largely intact. Hybridization of a single-stranded probe of a tandem repeat arranged in a head-to-tail orientation will result in hybridization only to the chromatid with the complementary strand present.

  7. Single-cell template strand sequencing by Strand-seq enables the characterization of individual homologs.

    PubMed

    Sanders, Ashley D; Falconer, Ester; Hills, Mark; Spierings, Diana C J; Lansdorp, Peter M

    2017-06-01

    The ability to distinguish between genome sequences of homologous chromosomes in single cells is important for studies of copy-neutral genomic rearrangements (such as inversions and translocations), building chromosome-length haplotypes, refining genome assemblies, mapping sister chromatid exchange events and exploring cellular heterogeneity. Strand-seq is a single-cell sequencing technology that resolves the individual homologs within a cell by restricting sequence analysis to the DNA template strands used during DNA replication. This protocol, which takes up to 4 d to complete, relies on the directionality of DNA, in which each single strand of a DNA molecule is distinguished based on its 5'-3' orientation. Culturing cells in a thymidine analog for one round of cell division labels nascent DNA strands, allowing for their selective removal during genomic library construction. To preserve directionality of template strands, genomic preamplification is bypassed and labeled nascent strands are nicked and not amplified during library preparation. Each single-cell library is multiplexed for pooling and sequencing, and the resulting sequence data are aligned, mapping to either the minus or plus strand of the reference genome, to assign template strand states for each chromosome in the cell. The major adaptations to conventional single-cell sequencing protocols include harvesting of daughter cells after a single round of BrdU incorporation, bypassing of whole-genome amplification, and removal of the BrdU + strand during Strand-seq library preparation. By sequencing just template strands, the structure and identity of each homolog are preserved.

  8. CTC1-mediated C-strand fill-in is an essential step in telomere length maintenance

    PubMed Central

    Feng, Xuyang; Hsu, Shih-Jui; Kasbek, Christopher; Chaiken, Mary

    2017-01-01

    Abstract To prevent progressive telomere shortening as a result of conventional DNA replication, new telomeric DNA must be added onto the chromosome end. The de novo DNA synthesis involves elongation of the G-rich strand of the telomere by telomerase. In human cells, the CST complex (CTC1-STN1-TEN1) also functions in telomere replication. CST first aids in duplication of the telomeric dsDNA. Then after telomerase has extended the G-rich strand, CST facilitates fill-in synthesis of the complementary C-strand. Here, we analyze telomere structure after disruption of human CTC1 and demonstrate that functional CST is essential for telomere length maintenance due to its role in mediating C-strand fill-in. Removal of CTC1 results in elongation of the 3΄ overhang on the G-rich strand. This leads to accumulation of RPA and telomeric DNA damage signaling. G-overhang length increases with time after CTC1 disruption and at early times net G-strand growth is apparent, indicating telomerase-mediated G-strand extension. In contrast, C-strand length decreases continuously, indicating a deficiency in C-strand fill-in synthesis. The lack of C-strand maintenance leads to gradual shortening of the telomeric dsDNA, similar to that observed in cells lacking telomerase. Thus, telomerase-mediated G-strand extension and CST-mediated C-strand fill-in are equally important for telomere length maintenance. PMID:28334750

  9. Arabidopsis double-stranded RNA binding protein DRB3 participates in methylation-mediated defense against geminiviruses.

    PubMed

    Raja, Priya; Jackel, Jamie N; Li, Sizhun; Heard, Isaac M; Bisaro, David M

    2014-03-01

    Arabidopsis encodes five double-stranded RNA binding (DRB) proteins. DRB1 and DRB2 are involved in microRNA (miRNA) biogenesis, while DRB4 functions in cytoplasmic posttranscriptional small interfering RNA (siRNA) pathways. DRB3 and DRB5 are not involved in double-stranded RNA (dsRNA) processing but assist in silencing transcripts targeted by DRB2-associated miRNAs. The goal of this study was to determine which, if any, of the DRB proteins might also participate in a nuclear siRNA pathway that leads to geminivirus genome methylation. Here, we demonstrate that DRB3 functions with Dicer-like 3 (DCL3) and Argonaute 4 (AGO4) in methylation-mediated antiviral defense. Plants employ repressive viral genome methylation as an epigenetic defense against geminiviruses, using an RNA-directed DNA methylation (RdDM) pathway similar to that used to suppress endogenous invasive DNAs such as transposons. Chromatin methylation inhibits virus replication and transcription, and methylation-deficient host plants are hypersusceptible to geminivirus infection. Using a panel of drb mutants, we found that drb3 plants uniquely exhibit a similar hypersensitivity and that viral genome methylation is substantially reduced in drb3 compared to wild-type plants. In addition, like dcl3 and ago4 mutants, drb3 plants fail to recover from infection and cannot accomplish the viral genome hypermethylation that is invariably observed in asymptomatic, recovered tissues. Small RNA analysis, bimolecular fluorescence complementation, and coimmunoprecipitation experiments show that DRB3 acts downstream of siRNA biogenesis and suggest that it associates with DCL3 and AGO4 in distinct subnuclear compartments. These studies reveal that in addition to its previously established role in the miRNA pathway, DRB3 also functions in antiviral RdDM. Plants use RNA-directed DNA methylation (RdDM) as an epigenetic defense against geminiviruses. RNA silencing pathways in Arabidopsis include five double-stranded RNA binding proteins (DRBs) related to Drosophila R2D2 and mammalian TRBP and PACT. While DRB proteins have defined roles in miRNA and cytoplasmic siRNA pathways, a role in nuclear RdDM was elusive. Here, we used the geminivirus system to show that DRB3 is involved in methylation-mediated antiviral defense. Beginning with a panel of Arabidopsis drb mutants, we demonstrated that drb3 plants uniquely show enhanced susceptibility to geminiviruses. Further, like dcl3 and ago4 mutants, drb3 plants fail to hypermethylate the viral genome, a requirement for host recovery. We also show that DRB3 physically interacts with the RdDM pathway components DCL3 and AGO4 in the nucleus. This work highlights the utility of geminiviruses as models for de novo RdDM and places DRB3 protein in this fundamental epigenetic pathway.

  10. Re-evaluation of low-resolution crystal structures via interactive molecular-dynamics flexible fitting (iMDFF): a case study in complement C4.

    PubMed

    Croll, Tristan Ian; Andersen, Gregers Rom

    2016-09-01

    While the rapid proliferation of high-resolution structures in the Protein Data Bank provides a rich set of templates for starting models, it remains the case that a great many structures both past and present are built at least in part by hand-threading through low-resolution and/or weak electron density. With current model-building tools this task can be challenging, and the de facto standard for acceptable error rates (in the form of atomic clashes and unfavourable backbone and side-chain conformations) in structures based on data with dmax not exceeding 3.5 Å reflects this. When combined with other factors such as model bias, these residual errors can conspire to make more serious errors in the protein fold difficult or impossible to detect. The three recently published 3.6-4.2 Å resolution structures of complement C4 (PDB entries 4fxg, 4fxk and 4xam) rank in the top quartile of structures of comparable resolution both in terms of Rfree and MolProbity score, yet, as shown here, contain register errors in six β-strands. By applying a molecular-dynamics force field that explicitly models interatomic forces and hence excludes most physically impossible conformations, the recently developed interactive molecular-dynamics flexible fitting (iMDFF) approach significantly reduces the complexity of the conformational space to be searched during manual rebuilding. This substantially improves the rate of detection and correction of register errors, and allows user-guided model building in maps with a resolution lower than 3.5 Å to converge to solutions with a stereochemical quality comparable to atomic resolution structures. Here, iMDFF has been used to individually correct and re-refine these three structures to MolProbity scores of <1.7, and strategies for working with such challenging data sets are suggested. Notably, the improved model allowed the resolution for complement C4b to be extended from 4.2 to 3.5 Å as demonstrated by paired refinement.

  11. Higher 5-hydroxymethylcytosine identifies immortal DNA strand chromosomes in asymmetrically self-renewing distributed stem cells

    PubMed Central

    Huh, Yang Hoon; Cohen, Justin; Sherley, James L.

    2013-01-01

    Immortal strands are the targeted chromosomal DNA strands of nonrandom sister chromatid segregation, a mitotic chromosome segregation pattern unique to asymmetrically self-renewing distributed stem cells (DSCs). By nonrandom segregation, immortal DNA strands become the oldest DNA strands in asymmetrically self-renewing DSCs. Nonrandom segregation of immortal DNA strands may limit DSC mutagenesis, preserve DSC fate, and contribute to DSC aging. The mechanisms responsible for specification and maintenance of immortal DNA strands are unknown. To discover clues to these mechanisms, we investigated the 5-methylcytosine and 5-hydroxymethylcytosine (5hmC) content on chromosomes in mouse hair follicle DSCs during nonrandom segregation. Although 5-methylcytosine content did not differ significantly, the relative content of 5hmC was significantly higher in chromosomes containing immortal DNA strands than in opposed mitotic chromosomes containing younger mortal DNA strands. The difference in relative 5hmC content was caused by the loss of 5hmC from mortal chromosomes. These findings implicate higher 5hmC as a specific molecular determinant of immortal DNA strand chromosomes. Because 5hmC is an intermediate during DNA demethylation, we propose a ten-eleven translocase enzyme mechanism for both the specification and maintenance of nonrandomly segregated immortal DNA strands. The proposed mechanism reveals a means by which DSCs “know” the generational age of immortal DNA strands. The mechanism is supported by molecular expression data and accounts for the selection of newly replicated DNA strands when nonrandom segregation is initiated. These mechanistic insights also provide a possible basis for another characteristic property of immortal DNA strands, their guanine ribonucleotide dependency. PMID:24082118

  12. Five-Strand versus Four-Strand Hamstring Tendon Graft Technique for Anterior Cruciate Ligament Reconstruction: A Biomechanical Comparison.

    PubMed

    Vaillant, Eric R; Parks, Brent G; Camire, Lyn M; Hinton, Richard Y

    2017-11-01

    The aim of this article is to compare diameter and stiffness, displacement, and strain in a five-strand versus four-strand hamstring graft for anterior cruciate ligament reconstruction. Eight matched pairs of lower extremities underwent four-strand or five-strand hamstring graft reconstruction. Diameter was significantly higher in the five-strand versus the four-strand construct ( p  = 0.002). No significant difference was found between the groups in construct displacement or stiffness. Significantly higher strain was observed in the inner limb versus the outer limb in the four-strand construct ( p  = 0.001) and in the inner limb versus the fifth limb in the 5-strand construct ( p  = 0.004). A fifth limb added to a four-strand hamstring graft significantly increased graft diameter but did not significantly change stiffness or displacement, suggesting that attachment of additional graft material via suture did not provide for full incorporation of the added limb into the graft at time zero. The inner limb in both constructs absorbed significantly greater load than did other limbs. The use of suture to attach additional material to a four-strand hamstring graft may not contribute to improved biomechanical qualities of the graft at time zero. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

  13. Management of children undergoing cardiac transplantation with high Panel Reactive Antibodies.

    PubMed

    Asante-Korang, Alfred; Jacobs, Jeffrey P; Ringewald, Jeremy; Carapellucci, Jennifer; Rosenberg, Kristin; McKenna, Daniel; McCormack, Jorge; Wilmot, Ivan; Gjeldum, Abigail; Lopez-Cepero, Mayra; Sleasman, John

    2011-12-01

    Highly sensitised children in need of cardiac transplantation have overall poor outcomes because of increased risk for dysfunction of the cardiac allograft, acute cellular and antibody-mediated rejection, and vasculopathy of the cardiac allograft. Cardiopulmonary bypass and the frequent use of blood products in the operating room and cardiac intensive care unit, as well as the frequent use of homografts, have predisposed potential recipients of transplants to allosensitisation. The expansion in the use of ventricular assist devices and extracorporeal membrane oxygenation has also contributed to increasing rates of allosensitisation in candidates for cardiac transplantation. Antibodies to Human Leukocyte Antigen can be detected before transplantation using several different techniques, the most common being the "complement-dependent lymphocytotoxicity assays". "Solid-phase assays", particularly the "Luminex® single antigen bead method", offer improved specificity and more detailed information regarding specificities of antibodies, leading to improved matching of donors with recipients. Allosensitisation prolongs the time on the waiting list for potential recipients of transplantation and increases the risk of complications and death after transplantation. Aggressive reduction of antibodies to Human Leukocyte Antigen in these high-risk patients is therefore of vital importance for long-term survival of the patient and cardiac allograft. Strategies to decrease Panel Reactive Antibody or percent reactive antibody before transplantation include plasmapheresis, intravenous administration of immunoglobulin, and specific treatment to reduce B-cells, particularly Rituximab. These strategies have resulted in varying degrees of success. Antibody-mediated rejection and cardiac allograft vasculopathy are two of the most important complications of transplantation in patients with high Panel Reactive Antibody. The treatment of antibody-mediated rejection in recipients of cardiac transplants is largely empirical and includes the use of high-dose corticosteroids, plasmapheresis, intravenous administration of immunoglobulins, anti-thymocyte globulin, and Rituximab. Cardiac allograft vasculopathy is believed to be secondary to chronic complement-mediated endothelial injury and chronic vascular rejection. The use of proliferation signal inhibitors, such as sirolimus and everolimus, has been shown to delay the progression of cardiac allograft vasculopathy. In some non-sensitised recipients of cardiac transplants, the de novo formation of antibodies to Human Leukocyte Antigen after transplantation may increase the likelihood of adverse clinical outcomes. The use of serial testing for donor-specific antibodies after cardiac transplantation may be advisable in patients with frequent episodes of rejection and patients with history of sensitisation. Allosensitisation before transplantation can negatively influence outcomes after transplantation. A high incidence of antibody-mediated rejection and graft vasculopathy can result in graft failure and decreased survival. Current strategies to decrease allosensitisation have helped to expand the pool of donors, improve times on the waiting list, and decrease mortality. Centres of transplantation offering desensitisation are currently using plasmapheresis to remove circulating antibodies; intravenous immunoglobulin to inactivate antibodies; cyclophosphamide to suppress B-cell proliferation; and Rituximab to deplete B-lymphocytes. Similar approaches are also used to treat antibody-mediated rejection after transplantation with promising results.

  14. A Novel Computational Method to Reduce Leaky Reaction in DNA Strand Displacement.

    PubMed

    Li, Xin; Wang, Xun; Song, Tao; Lu, Wei; Chen, Zhihua; Shi, Xiaolong

    2015-01-01

    DNA strand displacement technique is widely used in DNA programming, DNA biosensors, and gene analysis. In DNA strand displacement, leaky reactions can cause DNA signals decay and detecting DNA signals fails. The mostly used method to avoid leakage is cleaning up after upstream leaky reactions, and it remains a challenge to develop reliable DNA strand displacement technique with low leakage. In this work, we address the challenge by experimentally evaluating the basic factors, including reaction time, ratio of reactants, and ion concentration to the leakage in DNA strand displacement. Specifically, fluorescent probes and a hairpin structure reporting DNA strand are designed to detect the output of DNA strand displacement, and thus can evaluate the leakage of DNA strand displacement reactions with different reaction time, ratios of reactants, and ion concentrations. From the obtained data, mathematical models for evaluating leakage are achieved by curve derivation. As a result, it is obtained that long time incubation, high concentration of fuel strand, and inappropriate amount of ion concentration can weaken leaky reactions. This contributes to a method to set proper reaction conditions to reduce leakage in DNA strand displacement.

  15. 5′CAG and 5′CTG Repeats Create Differential Impediment to the Progression of a Minimal Reconstituted T4 Replisome Depending on the Concentration of dNTPs

    PubMed Central

    Delagoutte, Emmanuelle; Baldacci, Giuseppe

    2011-01-01

    Instability of repetitive sequences originates from strand misalignment during repair or replicative DNA synthesis. To investigate the activity of reconstituted T4 replisomes across trinucleotide repeats (TNRs) during leading strand DNA synthesis, we developed a method to build replication miniforks containing a TNR unit of defined sequence and length. Each minifork consists of three strands, primer, leading strand template, and lagging strand template with a 5′ single-stranded (ss) tail. Each strand is prepared independently, and the minifork is assembled by hybridization of the three strands. Using these miniforks and a minimal reconstituted T4 replisome, we show that during leading strand DNA synthesis, the dNTP concentration dictates which strand of the structure-forming 5′CAG/5′CTG repeat creates the strongest impediment to the minimal replication complex. We discuss this result in the light of the known fluctuation of dNTP concentration during the cell cycle and cell growth and the known concentration balance among individual dNTPs. PMID:22096622

  16. Developing Single-Molecule TPM Experiments for Direct Observation of Successful RecA-Mediated Strand Exchange Reaction

    PubMed Central

    Fan, Hsiu-Fang; Cox, Michael M.; Li, Hung-Wen

    2011-01-01

    RecA recombinases play a central role in homologous recombination. Once assembled on single-stranded (ss) DNA, RecA nucleoprotein filaments mediate the pairing of homologous DNA sequences and strand exchange processes. We have designed two experiments based on tethered particle motion (TPM) to investigate the fates of the invading and the outgoing strands during E. coli RecA-mediated pairing and strand exchange at the single-molecule level in the absence of force. TPM experiments measure the tethered bead Brownian motion indicative of the DNA tether length change resulting from RecA binding and dissociation. Experiments with beads labeled on either the invading strand or the outgoing strand showed that DNA pairing and strand exchange occurs successfully in the presence of either ATP or its non-hydrolyzable analog, ATPγS. The strand exchange rates and efficiencies are similar under both ATP and ATPγS conditions. In addition, the Brownian motion time-courses suggest that the strand exchange process progresses uni-directionally in the 5′-to-3′ fashion, using a synapse segment with a wide and continuous size distribution. PMID:21765895

  17. Extended Fluorescent Resonant Energy Transfer in DNA Constructs

    NASA Astrophysics Data System (ADS)

    Oh, Taeseok

    This study investigates the use of surfactants and metal cations for the enhancement of long range fluorescent resonant energy transfer (FRET) and the antenna effect in DNA structures with multiple fluorescent dyes. Double-stranded (ds) DNA structures were formed by hybridization of 21mer DNA oligonucleotides with different arrangements of three fluorescent TAMRA donor dyes with two different complementary 21mer oligonucleotides with one fluorescent TexasRed acceptor dye. In such DNA structures, hydrophobic interactions between the fluorescent dyes in close proximity produces dimerization which along with other quenching mechanisms leads to significant reduction of fluorescent emission properties. Addition of the surfactants Triton X-100, cetyltrimethyl ammonium bromide (CTAB) and sodium dodecyl sulfate (SDS) along with sodium cations (Na+) and divalent magnesium cations (Mg 2+) were tested for their ability to reduce quenching of the fluorescent dyes and improve overall fluorescent emission, the long range FRET and the antenna effect properties. When the neutral (uncharged) surfactant Triton X-100 was added to the FRET ds-DNA hybrid structures with three TAMRA donors and one TexasRed acceptor, dye dimerization and emission quenching remained unaffected. However, for the positively charged CTAB surfactant at concentrations of 100 uM or higher, the neutralization of the negatively charged ds-DNA backbone by the cationic surfactant micelles was found to reduce TAMRA dye dimerization and emission quenching and improve TexasRed quantum yield, resulting in much higher FRET efficiencies and an enhanced antenna effect. This improvement is likely due to the CTAB molecules covering or sheathing the fluorescent donor and acceptor dyes which breaks up the dimerized dye complexes and prevents further quenching from interactions with water molecules and guanine bases in the DNA structure. While the negatively charged SDS surfactant alone was not able to reduce dimerization and emission quenching due to repulsive forces between DNA and SDS micelles, the addition of cations such as sodium ions (Na+) and divalent magnesium ions (Mg2+) did lead to a significant reduction in the dimerization and emission quenching resulting in much higher FRET efficiency and an enhanced antenna effect. It appears that when the repulsive electrostatic forces are screened by the cations (Mg2+ in particular), the SDS micelles can approach the FRET ds-DNA structures thereby sheathing or insulating the TAMRA and TexasRed dyes. Overall, the study provides a viable strategy for using combinations of surfactants and cations to reduce adverse fluorescent dye and other quenching mechanisms and improve the overall long distance FRET efficiency and the antenna effect in DNA structures with multi-donor and single acceptor fluorescent dye groups.

  18. Synthesis and photophysical properties of new catenated electron donor-acceptor materials with magnesium and free base porphyrins as donors and C60 as the acceptor

    NASA Astrophysics Data System (ADS)

    Kirner, Sabrina V.; Guldi, Dirk M.; Megiatto, Jackson D., Jr.; Schuster, David I.

    2014-12-01

    A new series of nanoscale electron donor-acceptor systems with [2]catenane architectures has been synthesized, incorporating magnesium porphyrin (MgP) or free base porphyrin (H2P) as electron donor and C60 as electron acceptor, surrounding a central tetrahedral Cu(i)-1,10-phenanthroline (phen) complex. Model catenated compounds incorporating only one or none of these photoactive moieties were also prepared. The synthesis involved the use of Sauvage's metal template protocol in combination with the 1,3-dipolar cycloaddition of azides and alkynes (``click chemistry''), as in other recent reports from our laboratories. Ground state electron interactions between the individual constituents was probed using electrochemistry and UV-vis absorption spectroscopy, while events occurring following photoexcitation in tetrahydrofuran (under both aerobic and anaerobic conditions) at various wavelengths were followed by means of time-resolved transient absorption and emission spectroscopies on the femtosecond and nanosecond time scales, respectively, complemented by measurements of quantum yields for generation of singlet oxygen. From similar studies with model catenates containing one or neither of the chromophores, the events following photoexcitation could be elucidated. The results were compared with those previously reported for analogous catenates based on zinc porphyrin (ZnP). It was determined that a series of energy transfer (EnT) and electron transfer (ET) processes take place in the present catenates, ultimately generating long-distance charge separated (CS) states involving oxidized porphyrin and reduced C60 moieties, with lifetimes ranging from 400 to 1060 nanoseconds. Shorter lived short-distance CS states possessing oxidized copper complexes and reduced C60, with lifetimes ranging from 15 to 60 ns, were formed en route to the long-distance CS states. The dynamics of the ET processes were analyzed in terms of their thermodynamic driving forces. It was clear that intramolecular back ET was occurring in the inverted region of the Marcus parabola correlating rates and driving forces for electron transfer processes. In addition, evidence for triplet excited states as a product of either incomplete ET or back ET was found. The differences in behavior of the three catenates upon photoexcitation are analyzed in terms of the energy levels of the various intermediate states and the driving forces for EnT and ET processes.

  19. Systems-level analysis of age-related macular degeneration reveals global biomarkers and phenotype-specific functional networks

    PubMed Central

    2012-01-01

    Background Age-related macular degeneration (AMD) is a leading cause of blindness that affects the central region of the retinal pigmented epithelium (RPE), choroid, and neural retina. Initially characterized by an accumulation of sub-RPE deposits, AMD leads to progressive retinal degeneration, and in advanced cases, irreversible vision loss. Although genetic analysis, animal models, and cell culture systems have yielded important insights into AMD, the molecular pathways underlying AMD's onset and progression remain poorly delineated. We sought to better understand the molecular underpinnings of this devastating disease by performing the first comparative transcriptome analysis of AMD and normal human donor eyes. Methods RPE-choroid and retina tissue samples were obtained from a common cohort of 31 normal, 26 AMD, and 11 potential pre-AMD human donor eyes. Transcriptome profiles were generated for macular and extramacular regions, and statistical and bioinformatic methods were employed to identify disease-associated gene signatures and functionally enriched protein association networks. Selected genes of high significance were validated using an independent donor cohort. Results We identified over 50 annotated genes enriched in cell-mediated immune responses that are globally over-expressed in RPE-choroid AMD phenotypes. Using a machine learning model and a second donor cohort, we show that the top 20 global genes are predictive of AMD clinical diagnosis. We also discovered functionally enriched gene sets in the RPE-choroid that delineate the advanced AMD phenotypes, neovascular AMD and geographic atrophy. Moreover, we identified a graded increase of transcript levels in the retina related to wound response, complement cascade, and neurogenesis that strongly correlates with decreased levels of phototransduction transcripts and increased AMD severity. Based on our findings, we assembled protein-protein interactomes that highlight functional networks likely to be involved in AMD pathogenesis. Conclusions We discovered new global biomarkers and gene expression signatures of AMD. These results are consistent with a model whereby cell-based inflammatory responses represent a central feature of AMD etiology, and depending on genetics, environment, or stochastic factors, may give rise to the advanced AMD phenotypes characterized by angiogenesis and/or cell death. Genes regulating these immunological activities, along with numerous other genes identified here, represent promising new targets for AMD-directed therapeutics and diagnostics. Please see related commentary: http://www.biomedcentral.com/1741-7015/10/21/abstract PMID:22364233

  20. Cause-specific temporal and spatial trends in green sea turtle strandings in the Hawaiian Archipelago (1982-2003)

    USGS Publications Warehouse

    Chaloupka, Milani; Work, Thierry M.; Balazs, George H.; Murakawa, Shawn K. K.; Morris, Robert

    2008-01-01

    We investigated cause-specific temporal and spatial trends in sea turtle strandings in the Hawaiian Archipelago. Five species of sea turtle were recorded in 3,861 strandings over a 22-year period (1982–2003). Green turtles comprised 97% of these strandings with size and gender composition reflecting the demographic structure of the resident green turtle population and relative green turtle abundance in Hawaiian waters. The cause of strandings was determined by necropsy based on a complete gross external and internal examination. Totally 75% of the 3,732 green turtle strandings were from Oahu where strandings occur year-round. The most common known cause of the green turtle strandings was the tumour-forming disease, fibropapillomatosis (28%) followed by hook-and-line fishing gear-induced trauma (7%), gillnet fishing gear-induced trauma (5%), boat strike (2.5%), and shark attack (2.7%). Miscellaneous causes comprised 5.4% of strandings whereas 49% of green turtle strandings could not be attributed to any known cause. Green turtle strandings attributable to boat strike were more likely from Kauai and Oahu while fibropapilloma strandings were more likely from Oahu and Maui. Hook-and-line gear strandings were more likely from Oahu due to higher per capita inshore fishing effort. The specific mortality rate (conditional probability) for fibropapillomatosis was 88%, 69% for gillnet gear and 52% for hook-and-line gear. The probability of a dead green turtle stranding increased from 1982 but levelled off by the mid-1990s. The declining mortality risk was because the prevalence and severity of fibropapillomatosis has decreased recently and so has the mortality risk attributable to gillnet gear. Despite exposure to disease and inshore fishing gears, the Hawaiian green turtle stock continues to recover following protection since the late 1970s. Nevertheless, measures to reduce incidental capture of sea turtles in coastal Hawaiian fisheries would be prudent, especially since strandings attributable to hook-and-line fishing gear have increased steadily since 1982.

  1. Can a double stranded DNA be unzipped by pulling a single strand?: phases of adsorbed DNA.

    PubMed

    Kapri, Rajeev

    2009-04-14

    We study the unzipping of a double stranded DNA (dsDNA) by applying an external force on a single strand while leaving the other strand free. We find that the dsDNA can be unzipped to two single strands if the external force exceeds a critical value. We obtain the phase diagram, which is found to be different from the phase diagram of unzipping by pulling both the strands in opposite directions. In the presence of an attractive surface near DNA, the phase diagram gets modified drastically and shows richer surprises including a critical end point and a triple point.

  2. Procedure for normalization of cDNA libraries

    DOEpatents

    Bonaldo, M.D.; Soares, M.B.

    1997-12-30

    This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library. 1 fig.

  3. The Stranding Anomaly as Population Indicator: The Case of Harbour Porpoise Phocoena phocoena in North-Western Europe

    PubMed Central

    Peltier, Helene; Baagøe, Hans J.; Camphuysen, Kees C. J.; Czeck, Richard; Dabin, Willy; Daniel, Pierre; Deaville, Rob; Haelters, Jan; Jauniaux, Thierry; Jensen, Lasse F.; Jepson, Paul D.; Keijl, Guido O.; Siebert, Ursula; Van Canneyt, Olivier; Ridoux, Vincent

    2013-01-01

    Ecological indicators for monitoring strategies are expected to combine three major characteristics: ecological significance, statistical credibility, and cost-effectiveness. Strategies based on stranding networks rank highly in cost-effectiveness, but their ecological significance and statistical credibility are disputed. Our present goal is to improve the value of stranding data as population indicator as part of monitoring strategies by constructing the spatial and temporal null hypothesis for strandings. The null hypothesis is defined as: small cetacean distribution and mortality are uniform in space and constant in time. We used a drift model to map stranding probabilities and predict stranding patterns of cetacean carcasses under H0 across the North Sea, the Channel and the Bay of Biscay, for the period 1990–2009. As the most common cetacean occurring in this area, we chose the harbour porpoise Phocoena phocoena for our modelling. The difference between these strandings expected under H0 and observed strandings is defined as the stranding anomaly. It constituted the stranding data series corrected for drift conditions. Seasonal decomposition of stranding anomaly suggested that drift conditions did not explain observed seasonal variations of porpoise strandings. Long-term stranding anomalies increased first in the southern North Sea, the Channel and Bay of Biscay coasts, and finally the eastern North Sea. The hypothesis of changes in porpoise distribution was consistent with local visual surveys, mostly SCANS surveys (1994 and 2005). This new indicator could be applied to cetacean populations across the world and more widely to marine megafauna. PMID:23614031

  4. Database documentation of marine mammal stranding and mortality: current status review and future prospects.

    PubMed

    Chan, Derek K P; Tsui, Henry C L; Kot, Brian C W

    2017-11-21

    Databases are systematic tools to archive and manage information related to marine mammal stranding and mortality events. Stranding response networks, governmental authorities and non-governmental organizations have established regional or national stranding networks and have developed unique standard stranding response and necropsy protocols to document and track stranded marine mammal demographics, signalment and health data. The objectives of this study were to (1) describe and review the current status of marine mammal stranding and mortality databases worldwide, including the year established, types of database and their goals; and (2) summarize the geographic range included in the database, the number of cases recorded, accessibility, filter and display methods. Peer-reviewed literature was searched, focussing on published databases of live and dead marine mammal strandings and mortality and information released from stranding response organizations (i.e. online updates, journal articles and annual stranding reports). Databases that were not published in the primary literature or recognized by government agencies were excluded. Based on these criteria, 10 marine mammal stranding and mortality databases were identified, and strandings and necropsy data found in these databases were evaluated. We discuss the results, limitations and future prospects of database development. Future prospects include the development and application of virtopsy, a new necropsy investigation tool. A centralized web-accessed database of all available postmortem multimedia from stranded marine mammals may eventually support marine conservation and policy decisions, which will allow the use of marine animals as sentinels of ecosystem health, working towards a 'One Ocean-One Health' ideal.

  5. Method and apparatus for testing a forward-moving strand

    DOEpatents

    Ducommun, Joel; Vulliens, Philippe

    1980-01-01

    In a method for testing a continuously forward-moving strand a light beam which passes along a plane that extends approximately perpendicularly to the longitudinal axis of the strand is introduced into the strand. The brightness value is measured on a place of the strand exterior which is distal from the light incidence place by means of at least one photoelectronic element disposed directly on the strand exterior and the measured result is evaluated in a gating circuit which is electrically connected to the photoelectronic element.

  6. Triplex in-situ hybridization

    DOEpatents

    Fresco, Jacques R.; Johnson, Marion D.

    2002-01-01

    Disclosed are methods for detecting in situ the presence of a target sequence in a substantially double-stranded nucleic acid segment, which comprises: a) contacting in situ under conditions suitable for hybridization a substantially double-stranded nucleic acid segment with a detectable third strand, said third strand being capable of hybridizing to at least a portion of the target sequence to form a triple-stranded structure, if said target sequence is present; and b) detecting whether hybridization between the third strand and the target sequence has occured.

  7. Deletions at short direct repeats and base substitutions are characteristic mutations for bleomycin-induced double- and single-strand breaks, respectively, in a human shuttle vector system

    NASA Technical Reports Server (NTRS)

    Dar, M. E.; Jorgensen, T. J.

    1995-01-01

    Using the radiomimetic drug, bleomycin, we have determined the mutagenic potential of DNA strand breaks in the shuttle vector pZ189 in human fibroblasts. The bleomycin treatment conditions used produce strand breaks with 3'-phosphoglycolate termini as > 95% of the detectable dose-dependent lesions. Breaks with this end group represent 50% of the strand break damage produced by ionizing radiation. We report that such strand breaks are mutagenic lesions. The type of mutation produced is largely determined by the type of strand break on the plasmid (i.e. single versus double). Mutagenesis studies with purified DNA forms showed that nicked plasmids (i.e. those containing single-strand breaks) predominantly produce base substitutions, the majority of which are multiples, which presumably originate from error-prone polymerase activity at strand break sites. In contrast, repair of linear plasmids (i.e. those containing double-strand breaks) mainly results in deletions at short direct repeat sequences, indicating the involvement of illegitimate recombination. The data characterize the nature of mutations produced by single- and double-strand breaks in human cells, and suggests that deletions at direct repeats may be a 'signature' mutation for the processing of DNA double-strand breaks.

  8. A strand graph semantics for DNA-based computation

    PubMed Central

    Petersen, Rasmus L.; Lakin, Matthew R.; Phillips, Andrew

    2015-01-01

    DNA nanotechnology is a promising approach for engineering computation at the nanoscale, with potential applications in biofabrication and intelligent nanomedicine. DNA strand displacement is a general strategy for implementing a broad range of nanoscale computations, including any computation that can be expressed as a chemical reaction network. Modelling and analysis of DNA strand displacement systems is an important part of the design process, prior to experimental realisation. As experimental techniques improve, it is important for modelling languages to keep pace with the complexity of structures that can be realised experimentally. In this paper we present a process calculus for modelling DNA strand displacement computations involving rich secondary structures, including DNA branches and loops. We prove that our calculus is also sufficiently expressive to model previous work on non-branching structures, and propose a mapping from our calculus to a canonical strand graph representation, in which vertices represent DNA strands, ordered sites represent domains, and edges between sites represent bonds between domains. We define interactions between strands by means of strand graph rewriting, and prove the correspondence between the process calculus and strand graph behaviours. Finally, we propose a mapping from strand graphs to an efficient implementation, which we use to perform modelling and simulation of DNA strand displacement systems with rich secondary structure. PMID:27293306

  9. Streptavidin-coated magnetic beads for DNA strand separation implicate a multitude of problems during cell-SELEX.

    PubMed

    Paul, Angela; Avci-Adali, Meltem; Ziemer, Gerhard; Wendel, Hans P

    2009-09-01

    Using whole living cells as a target for SELEX (systematic evolution of ligands by exponential enrichment) experiments represents a promising method to generate cell receptor-specific aptamers. These aptamers have a huge potential in diagnostics, therapeutics, imaging, regenerative medicine, and target validation. During the SELEX for selecting DNA aptamers, one important step is the separation of 2 DNA strands to yield one of the 2 strands as single-stranded DNA aptamer. This is being done routinely by biotin labeling of the complementary DNA strand to the desired aptamer and then separating the DNA strand by using streptavidin-coated magnetic beads. After immobilization of the double-stranded DNA on these magnetic beads and alkaline denaturation, the non-biotinylated strand is being eluted and the biotinylated strand is retarded. Using Western blot analysis, we demonstrated the detachment of covalent-bonded streptavidin from the bead surface after alkaline treatment. The eluates were also contaminated with undesired biotinylated strands. Furthermore, a streptavidin-induced aggregation of target cells was demonstrated by flow cytometry and microscopic methods. Cell-specific enrichment of aptamers was not possible due to clustering and patching effects triggered by streptavidin. Therefore, the use of streptavidin-coated magnetic beads for DNA strand separation should be examined thoroughly, especially for cell-SELEX applications.

  10. Polymorphisms in the lectin pathway of complement activation influence the incidence of acute rejection and graft outcome after kidney transplantation.

    PubMed

    Golshayan, Déla; Wójtowicz, Agnieszka; Bibert, Stéphanie; Pyndiah, Nitisha; Manuel, Oriol; Binet, Isabelle; Buhler, Leo H; Huynh-Do, Uyen; Mueller, Thomas; Steiger, Jürg; Pascual, Manuel; Meylan, Pascal; Bochud, Pierre-Yves

    2016-04-01

    There are conflicting data on the role of the lectin pathway of complement activation and its recognition molecules in acute rejection and outcome after transplantation. To help resolve this we analyzed polymorphisms and serum levels of lectin pathway components in 710 consecutive kidney transplant recipients enrolled in the nationwide Swiss Transplant Cohort Study, together with all biopsy-proven rejection episodes and 1-year graft and patient survival. Functional mannose-binding lectin (MBL) levels were determined in serum samples, and previously described MBL2, ficolin 2, and MBL-associated serine protease 2 polymorphisms were genotyped. Low MBL serum levels and deficient MBL2 diplotypes were associated with a higher incidence of acute cellular rejection during the first year, in particular in recipients of deceased-donor kidneys. This association remained significant (hazard ratio 1.75, 95% confidence interval 1.18-2.60) in a Cox regression model after adjustment for relevant covariates. In contrast, there was no significant association with rates of antibody-mediated rejection, patient death, early graft dysfunction or loss. Thus, results in a prospective multicenter contemporary cohort suggest that MBL2 polymorphisms result in low MBL serum levels and are associated with acute cellular rejection after kidney transplantation. Since MBL deficiency is a relatively frequent trait in the normal population, our findings may lead to individual risk stratification and customized immunosuppression. Copyright © 2016 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.

  11. Functional identification of pathogenic autoantibody responses in patients with multiple sclerosis

    PubMed Central

    Elliott, Christina; Lindner, Maren; Arthur, Ariel; Brennan, Kathryn; Jarius, Sven; Hussey, John; Chan, Andrew; Stroet, Anke; Olsson, Tomas; Willison, Hugh; Barnett, Susan C.; Meinl, Edgar

    2012-01-01

    Pathological and clinical studies implicate antibody-dependent mechanisms in the immunopathogenesis of multiple sclerosis. We tested this hypothesis directly by investigating the ability of patient-derived immunoglobulins to mediate demyelination and axonal injury in vitro. Using a myelinating culture system, we developed a sensitive and reproducible bioassay to detect and quantify these effects and applied this to investigate the pathogenic potential of immunoglobulin G preparations obtained from patients with multiple sclerosis (n = 37), other neurological diseases (n = 10) and healthy control donors (n = 13). This identified complement-dependent demyelinating immunoglobulin G responses in approximately 30% of patients with multiple sclerosis, which in two cases was accompanied by significant complement-dependent antibody mediated axonal loss. No pathogenic immunoglobulin G responses were detected in patients with other neurological disease or healthy controls, indicating that the presence of these demyelinating/axopathic autoantibodies is specific for a subset of patients with multiple sclerosis. Immunofluorescence microscopy revealed immunoglobulin G preparations with demyelinating activity contained antibodies that specifically decorated the surface of myelinating oligodendrocytes and their contiguous myelin sheaths. No other binding was observed indicating that the response is restricted to autoantigens expressed by terminally differentiated myelinating oligodendrocytes. In conclusion, our study identifies axopathic and/or demyelinating autoantibody responses in a subset of patients with multiple sclerosis. This observation underlines the mechanistic heterogeneity of multiple sclerosis and provides a rational explanation why some patients benefit from antibody depleting treatments. PMID:22561643

  12. Sulfurtransferase and thioredoxin specifically interact as demonstrated by bimolecular fluorescence complementation analysis and biochemical tests.

    PubMed

    Henne, Melina; König, Nicolas; Triulzi, Tiziana; Baroni, Sara; Forlani, Fabio; Scheibe, Renate; Papenbrock, Jutta

    2015-01-01

    Sulfurtransferases (Strs) and thioredoxins (Trxs) are members of large protein families. Trxs are disulfide reductases and play an important role in redox-related cellular processes. They interact with a broad range of proteins. Strs catalyze the transfer of a sulfur atom from a suitable sulfur donor to nucleophilic sulfur acceptors in vitro, but the physiological roles of these enzymes are not well defined. Several studies in different organisms demonstrate protein-protein interactions of Strs with members of the Trx family. We are interested in investigating the specificity of the interaction between Str and Trx isoforms. In order to use the bimolecular fluorescence complementation (BiFC), several Str and Trx sequences from Arabidopsis thaliana were cloned into the pUC-SPYNE and pUC-SPYCE split-YFP vectors, respectively. Each couple of plasmids containing the sequences for the putative interaction partners were transformed into Arabidopsis protoplasts and screened using a confocal laser scanning microscope. Compartment- and partner-specific interactions could be observed in transformed protoplasts. Replacement of cysteine residues in the redox-active site of Trxs abolished the interaction signal. Therefore, the redox site is not only involved in the redox reaction but also responsible for the interaction with partner proteins. Biochemical assays support a specific interaction among Strs and certain Trxs. Based on the results obtained, the interaction of Strs and Trxs indicates a role of Strs in the maintenance of the cellular redox homeostasis.

  13. Tensile and dimensional properties of wood strands made from plantation southern pine lumber

    Treesearch

    Qinglin Wu; Zhiyong Cai; Jong N. Lee

    2005-01-01

    Working stresses and performance of strand composite lumber largely depend upon the properties of each individual strand. Southern pine strands from plantation lumber grown in southern Louisiana were investigated in this study in order to understand strand behaviors. The effects of hot-pressing and resin application on tensile modulus, strength, and dimensional...

  14. Bone marrow transplantation across major histocompatibility barriers. V. Protection of mice from lethal graft-vs. -host disease by pretreatment of donor cells with monoclonal anti-Thy-1. 2 coupled to the toxin ricin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vallera, D.A.; Youle, R.J.; Neville, D.M. Jr.

    1982-03-01

    A new method has been devised to eliminate T cells from murine bone marrow grafts across major histocompatibility barriers and thus prevent graft-vs.-host disease (GVHD). The method utilizes a monoclonal antibody directed at the Thy-1.2 antigen but is complement independent. To make anti-Thy-1.2 toxic, the antibody is covalently linked to the toxin ricin. Ricin ordinarily binds, enters, and kills cells through receptors containing galactose. The hybrid protein, anti-Thy-1.2-ricin, can enter and kill cells via the Thy-1.2 receptor. In the presence of lactose the usual entry route for ricin is largely blocked and the hybrid is shown to be a highlymore » selective reagent that is T cell specific in its inhibition of mitogen-stimulated splenocytes. We have used a model of severe and fatal GVHD where BALB/c splenocytes and bone marrow cells are given to irradiated C57BL/6 recipients. Over 90% of these mice die by day 70, exhibiting signs of GVHD. When donor cells are pretreated with 0.5 microgram/ml of anti-Thy-1.2-ricin plus 200 mM lactose before injection, 10 of 11 animals survive through day 70 without signs of GVHD. These studies demonstrate that ricin linked to monoclonal antibodies may have utility related to the prevention of GVHD in human bone marrow transplantation.« less

  15. Production of human CD59-transgenic pigs by embryonic germ cell nuclear transfer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ahn, Kwang Sung; Won, Ji Young; Park, Jin-Ki

    Research highlights: {yields} Human CD59 (hCD59) gene was introduced into porcine embryonic germ (EG) cells. {yields} hCD59-transgenic EG cells were resistant to hyperacute rejection in cytolytic assay. {yields} hCD59-transgenic pigs were produced by EG cell nuclear transfer. -- Abstract: This study was performed to produce transgenic pigs expressing the human complement regulatory protein CD59 (hCD59) using the nuclear transfer (NT) of embryonic germ (EG) cells, which are undifferentiated stem cells derived from primordial germ cells. Because EG cells can be cultured indefinitely in an undifferentiated state, they may provide an inexhaustible source of nuclear donor cells for NT to producemore » transgenic pigs. A total of 1980 NT embryos derived from hCD59-transgenic EG cells were transferred to ten recipients, resulting in the birth of fifteen piglets from three pregnancies. Among these offspring, ten were alive without overt health problems. Based on PCR analysis, all fifteen piglets were confirmed as hCD59 transgenic. The expression of the hCD59 transgene in the ten living piglets was verified by RT-PCR. Western analysis showed the expression of the hCD59 protein in four of the ten RT-PCR-positive piglets. These results demonstrate that hCD59-transgenic pigs could effectively be produced by EG cell NT and that such transgenic pigs may be used as organ donors in pig-to-human xenotransplantation.« less

  16. Kidney transplantation after desensitization in sensitized patients: a Korean National Audit.

    PubMed

    Huh, Kyu Ha; Kim, Beom Seok; Yang, Jaeseok; Ahn, Jeongmyung; Kim, Myung-Gyu; Park, Jae Berm; Kim, Jong Man; Chung, Byung-Ha; Kim, Joong Kyung; Kong, Jin Min

    2012-10-01

    The number of end-stage renal disease (ESRD) patients with preformed antibodies waiting for a kidney transplant has been increasing lately. We conducted a nationwide study on the outcomes of kidney transplantation after desensitization in Korea. Six transplant centers have run desensitization programs. The patients who underwent living donor kidney transplantation after desensitization from 2002 to 2010 were retrospectively analyzed. A total of 86 cases were enrolled. Thirty-five of these were cases of re-transplantation (40.7 %). Indications of desensitization were positive complement-dependent cytotoxicity (CDC) cross-match responses (CDC(+), 36.0 %), positive flow-cytometric cross-match responses (FCX(+), 54.7 %), and positive donor-specific antibodies (DSA(+), 8.1 %). The desensitization protocols used pre-transplant plasmapheresis (95.3 %), intravenous immunoglobulin (62.8 %), and rituximab (67.4 %). Acute rejection occurred in 18 patients (20.9 %), graft failure occurred in 4 patients, and the 3-year graft survival rate was 93.8 %. The presence of DSA increased the acute rejection rate (P = 0.015) and decreased the 1-year post-transplant estimated glomerular filtration rate (P = 0.006). Although rejection-free survival rates did not differ significantly between the CDC(+) and FCX(+) groups, the 1-year estimated glomerular filtration rate was lower in the CDC(+) group (P = 0.010). Infectious and significant bleeding complications occurred in 15.5 % and 4.7 % of cases, respectively. Kidney transplantation after desensitization had good graft outcomes and tolerable complications in Korea, and therefore, this therapy can be recommended for sensitized ESRD patients.

  17. A device for high-throughput monitoring of degradation in soft tissue samples.

    PubMed

    Tzeranis, D S; Panagiotopoulos, I; Gkouma, S; Kanakaris, G; Georgiou, N; Vaindirlis, N; Vasileiou, G; Neidlin, M; Gkousioudi, A; Spitas, V; Macheras, G A; Alexopoulos, L G

    2018-06-06

    This work describes the design and validation of a novel device, the High-Throughput Degradation Monitoring Device (HDD), for monitoring the degradation of 24 soft tissue samples over incubation periods of several days inside a cell culture incubator. The device quantifies sample degradation by monitoring its deformation induced by a static gravity load. Initial instrument design and experimental protocol development focused on quantifying cartilage degeneration. Characterization of measurement errors, caused mainly by thermal transients and by translating the instrument sensor, demonstrated that HDD can quantify sample degradation with <6 μm precision and <10 μm temperature-induced errors. HDD capabilities were evaluated in a pilot study that monitored the degradation of fresh ex vivo human cartilage samples by collagenase solutions over three days. HDD could robustly resolve the effects of collagenase concentration as small as 0.5 mg/ml. Careful sample preparation resulted in measurements that did not suffer from donor-to-donor variation (coefficient of variance <70%). Due to its unique combination of sample throughput, measurement precision, temporal sampling and experimental versality, HDD provides a novel biomechanics-based experimental platform for quantifying the effects of proteins (cytokines, growth factors, enzymes, antibodies) or small molecules on the degradation of soft tissues or tissue engineering constructs. Thereby, HDD can complement established tools and in vitro models in important applications including drug screening and biomaterial development. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. Efficacy of induction therapy with ATG and intravenous immunoglobulins in patients with low-level donor-specific HLA-antibodies.

    PubMed

    Bächler, K; Amico, P; Hönger, G; Bielmann, D; Hopfer, H; Mihatsch, M J; Steiger, J; Schaub, S

    2010-05-01

    Low-level donor-specific HLA-antibodies (HLA-DSA) (i.e. detectable by single-antigen flow beads, but negative by complement-dependent cytotoxicity crossmatch) represent a risk factor for early allograft rejection. The short-term efficacy of an induction regimen consisting of polyclonal anti-T-lymphocyte globulin (ATG) and intravenous immunoglobulins (IvIg) in patients with low-level HLA-DSA is unknown. In this study, we compared 67 patients with low-level HLA-DSA not having received ATG/IvIg induction (historic control) with 37 patients, who received ATG/IvIg induction. The two groups were equal regarding retransplants, HLA-matches, number and class of HLA-DSA. The overall incidence of clinical/subclinical antibody-mediated rejection (AMR) was lower in the ATG/IvIg than in the historic control group (38% vs. 55%; p = 0.03). This was driven by a significantly lower rate of clinical AMR (11% vs. 46%; p = 0.0002). Clinical T-cell-mediated rejection (TCR) was significantly lower in the ATG/IvIg than in the historic control group (0% vs. 50%; p < 0.0001). Within the first year, allograft loss due to AMR occurred in 7.5% in the historic control and in 0% in the ATG/IvIg group. We conclude that in patients with low-level HLA-DSA, ATG/IvIg induction significantly reduces TCR and the severity of AMR, but the high rate of subclinical AMR suggests an insufficient control of the humoral immune response.

  19. RNA signal amplifier circuit with integrated fluorescence output.

    PubMed

    Akter, Farhima; Yokobayashi, Yohei

    2015-05-15

    We designed an in vitro signal amplification circuit that takes a short RNA input that catalytically activates the Spinach RNA aptamer to produce a fluorescent output. The circuit consists of three RNA strands: an internally blocked Spinach aptamer, a fuel strand, and an input strand (catalyst), as well as the Spinach aptamer ligand 3,5-difluoro-4-hydroxylbenzylidene imidazolinone (DFHBI). The input strand initially displaces the internal inhibitory strand to activate the fluorescent aptamer while exposing a toehold to which the fuel strand can bind to further displace and recycle the input strand. Under a favorable condition, one input strand was able to activate up to five molecules of the internally blocked Spinach aptamer in 185 min at 30 °C. The simple RNA circuit reported here serves as a model for catalytic activation of arbitrary RNA effectors by chemical triggers.

  20. Separation of 1-23-kb complementary DNA strands by urea-agarose gel electrophoresis.

    PubMed

    Hegedüs, Eva; Kókai, Endre; Kotlyar, Alexander; Dombrádi, Viktor; Szabó, Gábor

    2009-09-01

    Double-stranded (ds), as well as denatured, single-stranded (ss) DNA samples can be analyzed on urea-agarose gels. Here we report that after denaturation by heat in the presence of 8 M urea, the two strands of the same ds DNA fragment of approximately 1-20-kb size migrate differently in 1 M urea containing agarose gels. The two strands are readily distinguished on Southern blots by ss-specific probes. The different migration of the two strands could be attributed to their different, base composition-dependent conformation impinging on the electrophoretic mobility of the ss molecules. This phenomenon can be exploited for the efficient preparation of strand-specific probes and for the separation of the complementary DNA strands for subsequent analysis, offering a new tool for various cell biological research areas.

  1. 75 FR 38977 - Pre-Stressed Concrete Steel Wire Strand from the People's Republic of China: Notice of Amended...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-07

    ... Wire Strand from the People's Republic of China: Notice of Amended Final Affirmative Countervailing... issuing a countervailing duty order on pre-stressed concrete steel wire strand (PC strand) from the People... determination of material injury to a U.S. industry. See Pre-Stressed Concrete Steel Wire Strand from the People...

  2. Language Variation and Change in the Australian Curriculum English: Integrating Sub-Strands through a Pedagogy of Metalogue

    ERIC Educational Resources Information Center

    Willis, Linda-Dianne; Exley, Beryl

    2016-01-01

    The Language Strand of the Australian Curriculum: English (Australian Curriculum, Assessment & Reporting Authority (ACARA), 2016b) includes the sub-strand of "Language Variation and Change". This sub-strand is a marked space for discovery and discussion of the history and politics of language use. As such, this sub-strand points to…

  3. A Novel Computational Method to Reduce Leaky Reaction in DNA Strand Displacement

    PubMed Central

    Li, Xin; Wang, Xun; Song, Tao; Lu, Wei; Chen, Zhihua; Shi, Xiaolong

    2015-01-01

    DNA strand displacement technique is widely used in DNA programming, DNA biosensors, and gene analysis. In DNA strand displacement, leaky reactions can cause DNA signals decay and detecting DNA signals fails. The mostly used method to avoid leakage is cleaning up after upstream leaky reactions, and it remains a challenge to develop reliable DNA strand displacement technique with low leakage. In this work, we address the challenge by experimentally evaluating the basic factors, including reaction time, ratio of reactants, and ion concentration to the leakage in DNA strand displacement. Specifically, fluorescent probes and a hairpin structure reporting DNA strand are designed to detect the output of DNA strand displacement, and thus can evaluate the leakage of DNA strand displacement reactions with different reaction time, ratios of reactants, and ion concentrations. From the obtained data, mathematical models for evaluating leakage are achieved by curve derivation. As a result, it is obtained that long time incubation, high concentration of fuel strand, and inappropriate amount of ion concentration can weaken leaky reactions. This contributes to a method to set proper reaction conditions to reduce leakage in DNA strand displacement. PMID:26491602

  4. Metallographic autopsies of full-scale ITER prototype cable-in-conduit conductors after full testing in SULTAN: 1. The mechanical role of copper strands in a CICC

    DOE PAGES

    Sanabria, Carlos; Lee, Peter J.; Starch, William; ...

    2015-06-22

    Cables made with Nb 3Sn-based superconductor strands will provide the 13 T maximum peak magnetic field of the ITER Central Solenoid (CS) coils and they must survive up to 60,000 electromagnetic cycles. Accordingly, prototype designs of CS cable-in-conduit-conductors (CICC) were electromagnetically tested over multiple magnetic field cycles and warm-up-cool-down scenarios in the SULTAN facility at CRPP. We report here a post mortem metallographic analysis of two CS CICC prototypes which exhibited some rate of irreversible performance degradation during cycling. The standard ITER CS CICC cable design uses a combination of superconducting and Cu strands, and because the Lorentz force onmore » the strand is proportional to the transport current in the strand, removing the copper strands (while increasing the Cu:SC ratio of the superconducting strands) was proposed as one way of reducing the strand load. In this study we compare the two alternative CICCs, with and without Cu strands, keeping in mind that the degradation after SULTAN test was lower for the CICC without Cu strands. The post mortem metallographic evaluation revealed that the overall strand transverse movement was 20% lower in the CICC without Cu strands and that the tensile filament fractures found were less, both indications of an overall reduction in high tensile strain regions. Furthermore, it was interesting to see that the Cu strands in the mixed cable design (with higher degradation) helped reduce the contact stresses on the high pressure side of the CICC, but in either case, the strain reduction mechanisms were not enough to suppress cyclic degradation. Advantages and disadvantages of each conductor design are discussed here aimed to understand the sources of the degradation.« less

  5. Mechanical behaviors of multi-filament twist superconducting strand under tensile and cyclic loading

    NASA Astrophysics Data System (ADS)

    Wang, Xu; Li, Yingxu; Gao, Yuanwen

    2016-01-01

    The superconducting strand, serving as the basic unit cell of the cable-in-conduit-conductors (CICCs), is a typical multi-filament twist composite which is always subjected to a cyclic loading under the operating condition. Meanwhile, the superconducting material Nb3Sn in the strand is sensitive to strain frequently relating to the performance degradation of the superconductivity. Therefore, a comprehensive study on the mechanical behavior of the strand helps understanding the superconducting performance of the strained Nb3Sn strands. To address this issue, taking the LMI (internal tin) strand as an example, a three-dimensional structural finite element model, named as the Multi-filament twist model, of the strand with the real configuration of the LMI strand is built to study the influences of the plasticity of the component materials, the twist of the filament bundle, the initial thermal residual stress and the breakage and its evolution of the filaments on the mechanical behaviors of the strand. The effective properties of superconducting filament bundle with random filament breakage and its evolution versus strain are obtained based on the damage theory of fiber-reinforced composite materials proposed by Curtin and Zhou. From the calculation results of this model, we find that the occurrence of the hysteresis loop in the cyclic loading curve is determined by the reverse yielding of the elastic-plastic materials in the strand. Both the initial thermal residual stress in the strand and the pitch length of the filaments have significant impacts on the axial and hysteretic behaviors of the strand. The damage of the filaments also affects the axial mechanical behavior of the strand remarkably at large axial strain. The critical current of the strand is calculated by the scaling law with the results of the Multi-filament twist model. The predicted results of the Multi-filament twist model show an acceptable agreement with the experiment.

  6. Molecular investigation of evaporation of biodroplets containing single-strand DNA on graphene surface.

    PubMed

    Akbari, Fahimeh; Foroutan, Masumeh

    2018-02-14

    In this study, the water droplet behaviour of four different types of single-strand DNA with homogeneous base sequence on a graphene substrate during evaporation of the droplet was investigated using molecular dynamics (MD) simulation. The simulation results indicated that the evaporation depended on the DNA sequence. The observed changes can be divided into four parts: (i) vaporization mode, (ii) evaporation flux, (iii) mechanism of single-strand placement on the surface, and (iv) consideration of remaining single strands after evaporation. Our simulation observations indicated different evaporation modes for thymine biodroplets as compared to those for other biodroplets. The evaporation of the thymine biodroplets occurred with an increase in the contact angle, while that of the other biodroplets occur in a constant contact angle mode. Moreover, thymine biodroplets generate the lowest contact line compared to other single strands, and it is always placed far away from the centre of the droplets during evaporation. Investigating variations in the evaporation flux shows that thymine has the highest evaporation flux and guanine has the lowest. Moreover, during initial evaporation, the flux of evaporation increases at the triple point of the biodroplets containing thymine single strands, while it decreases in the other biodroplets. The following observation was obtained from the study of the placement of single strands on the substrate: guanine and thymine interacted slower than other single strands during evaporation with graphene, adenine single strand had a higher folding during evaporation, and guanine single strand showed the lowest end-to-end distance. The investigation of single-strand DNA after evaporation shows that adenine produces the most stable structure at the end of evaporation. In addition, cytosine is the most stretched single-strand DNA due to its lack of internal π-π stacking and hydrogen bonding. Therefore, cytosine single strand is more accessible for use in microarrays to detect target single strands.

  7. Correlated Template-Switching Events during Minus-Strand DNA Synthesis: a Mechanism for High Negative Interference during Retroviral Recombination

    PubMed Central

    Anderson, Jeffrey A.; Teufel, Ronald J.; Yin, Philip D.; Hu, Wei-Shau

    1998-01-01

    Two models for the mechanism of retroviral recombination have been proposed: forced copy choice (minus-strand recombination) and strand displacement-assimilation (plus-strand recombination). Each minus-strand recombination event results in one template switch, whereas each plus-strand recombination event results in two template switches. Recombinant proviruses with one and more than one template switches were previously observed. Recombinants with one template switch were generated by minus-strand recombination, while recombinants containing more than one template switch may have been generated by plus-strand recombination or by correlated minus-strand recombination. We recently observed that retroviral recombination exhibits high negative interference whereby the frequency of recombinants containing multiple template-switching events is higher than expected. To delineate the mechanism that generates recombinants with more than one template switch, we devised a system that permits only minus-strand recombination. Two highly homologous vectors, WH204 and WH221, containing eight different restriction site markers were used. The primer binding site (PBS) of WH221 was deleted; although reverse transcription cannot initiate from WH221 RNA, it can serve as a template for DNA synthesis in heterozygotic virions. After one round of retroviral replication, the structures of the recombinant proviruses were examined. Recombinants containing two, three, four, and five template switches were observed at 1.4-, 10-, 65-, and 50-fold-higher frequencies, respectively, than expected. This indicates that minus-strand recombination events are correlated and can generate proviruses with multiple template switches efficiently. The frequencies of recombinants containing multiple template switches were similar to those observed in the previous system, which allowed both minus- and plus-strand recombination. Thus, the previously reported high negative interference during retroviral recombination can be caused by correlated template switches during minus-strand DNA synthesis. In addition, all examined recombinants contained an intact PBS, indicating that most of the plus-strand DNA transfer occurs after completion of the strong-stop DNA. PMID:9445017

  8. Replication of tobacco mosaic virus RNA.

    PubMed Central

    Buck, K W

    1999-01-01

    The replication of tobacco mosaic virus (TMV) RNA involves synthesis of a negative-strand RNA using the genomic positive-strand RNA as a template, followed by the synthesis of positive-strand RNA on the negative-strand RNA templates. Intermediates of replication isolated from infected cells include completely double-stranded RNA (replicative form) and partly double-stranded and partly single-stranded RNA (replicative intermediate), but it is not known whether these structures are double-stranded or largely single-stranded in vivo. The synthesis of negative strands ceases before that of positive strands, and positive and negative strands may be synthesized by two different polymerases. The genomic-length negative strand also serves as a template for the synthesis of subgenomic mRNAs for the virus movement and coat proteins. Both the virus-encoded 126-kDa protein, which has amino-acid sequence motifs typical of methyltransferases and helicases, and the 183-kDa protein, which has additional motifs characteristic of RNA-dependent RNA polymerases, are required for efficient TMV RNA replication. Purified TMV RNA polymerase also contains a host protein serologically related to the RNA-binding subunit of the yeast translational initiation factor, eIF3. Study of Arabidopsis mutants defective in RNA replication indicates that at least two host proteins are needed for TMV RNA replication. The tomato resistance gene Tm-1 may also encode a mutant form of a host protein component of the TMV replicase. TMV replicase complexes are located on the endoplasmic reticulum in close association with the cytoskeleton in cytoplasmic bodies called viroplasms, which mature to produce 'X bodies'. Viroplasms are sites of both RNA replication and protein synthesis, and may provide compartments in which the various stages of the virus mutiplication cycle (protein synthesis, RNA replication, virus movement, encapsidation) are localized and coordinated. Membranes may also be important for the configuration of the replicase with respect to initiation of RNA synthesis, and synthesis and release of progeny single-stranded RNA. PMID:10212941

  9. Sulfolobus chromatin proteins modulate strand displacement by DNA polymerase B1

    PubMed Central

    Sun, Fei; Huang, Li

    2013-01-01

    Strand displacement by a DNA polymerase serves a key role in Okazaki fragment maturation, which involves displacement of the RNA primer of the preexisting Okazaki fragment into a flap structure, and subsequent flap removal and fragment ligation. We investigated the role of Sulfolobus chromatin proteins Sso7d and Cren7 in strand displacement by DNA polymerase B1 (PolB1) from the hyperthermophilic archaeon Sulfolobus solfataricus. PolB1 showed a robust strand displacement activity and was capable of synthesizing thousands of nucleotides on a DNA-primed 72-nt single-stranded circular DNA template. This activity was inhibited by both Sso7d and Cren7, which limited the flap length to 3–4 nt at saturating concentrations. However, neither protein inhibited RNA displacement on an RNA-primed single-stranded DNA minicircle by PolB1. Strand displacement remained sensitive to modulation by the chromatin proteins when PolB1 was in association with proliferating cell nuclear antigen. Inhibition of DNA instead of RNA strand displacement by the chromatin proteins is consistent with the finding that double-stranded DNA was more efficiently bound and stabilized than an RNA:DNA duplex by these proteins. Our results suggest that Sulfolobus chromatin proteins modulate strand displacement by PolB1, permitting efficient removal of the RNA primer while inhibiting excessive displacement of the newly synthesized DNA strand during Okazaki fragment maturation. PMID:23821667

  10. Method for producing labeled single-stranded nucleic acid probes

    DOEpatents

    Dunn, John J.; Quesada, Mark A.; Randesi, Matthew

    1999-10-19

    Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector, the cloning vector having an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe.

  11. Using DNA origami nanostructures to determine absolute cross sections for UV photon-induced DNA strand breakage.

    PubMed

    Vogel, Stefanie; Rackwitz, Jenny; Schürman, Robin; Prinz, Julia; Milosavljević, Aleksandar R; Réfrégiers, Matthieu; Giuliani, Alexandre; Bald, Ilko

    2015-11-19

    We have characterized ultraviolet (UV) photon-induced DNA strand break processes by determination of absolute cross sections for photoabsorption and for sequence-specific DNA single strand breakage induced by photons in an energy range from 6.50 to 8.94 eV. These represent the lowest-energy photons able to induce DNA strand breaks. Oligonucleotide targets are immobilized on a UV transparent substrate in controlled quantities through attachment to DNA origami templates. Photon-induced dissociation of single DNA strands is visualized and quantified using atomic force microscopy. The obtained quantum yields for strand breakage vary between 0.06 and 0.5, indicating highly efficient DNA strand breakage by UV photons, which is clearly dependent on the photon energy. Above the ionization threshold strand breakage becomes clearly the dominant form of DNA radiation damage, which is then also dependent on the nucleotide sequence.

  12. Mechanism of asymmetric polymerase assembly at the eukaryotic replication fork

    PubMed Central

    Georgescu, Roxana E; Langston, Lance; Yao, Nina Y; Yurieva, Olga; Zhang, Dan; Finkelstein, Jeff; Agarwal, Tani; O’Donnell, Mike E

    2015-01-01

    Eukaryotes use distinct polymerases for leading- and lagging-strand replication, but how they target their respective strands is uncertain. We reconstituted Saccharomyces cerevisiae replication forks and found that CMG helicase selects polymerase (Pol) ε to the exclusion of Pol δ on the leading strand. Even if Pol δ assembles on the leading strand, Pol ε rapidly replaces it. Pol δ–PCNA is distributive with CMG, in contrast to its high stability on primed ssDNA. Hence CMG will not stabilize Pol δ, instead leaving the leading strand accessible for Pol ε and stabilizing Pol ε. Comparison of Pol ε and Pol δ on a lagging-strand model DNA reveals the opposite. Pol δ dominates over excess Pol ε on PCNA-primed ssDNA. Thus, PCNA strongly favors Pol δ over Pol ε on the lagging strand, but CMG over-rides and flips this balance in favor of Pol ε on the leading strand. PMID:24997598

  13. Crude oil as a stranding cause among loggerhead sea turtles (Caretta caretta) in the Canary Islands, Spain (1998-2011).

    PubMed

    Camacho, María; Calabuig, Pascual; Luzardo, Octavio P; Boada, Luis D; Zumbado, Manuel; Orós, Jorge

    2013-07-01

    We report the number of strandings caused by crude oil among loggerhead turtles (Caretta caretta) in the Canary Islands between 1998 and 2011 and analyze the impact of the designation of the Canary Islands as a Particularly Sensitive Sea Area (PSSA) in 2005. Among 1,679 stranded loggerhead turtles, 52 turtles stranded due to crude oil (3.1%). The survival rate of the turtles stranded by crude oil was 88%. All turtles that died because of crude oil stranding had signs of ingestion of crude oil and lesions, included esophageal impaction, necrotizing gastroenteritis, necrotizing hepatitis, and tubulonephrosis. The number of strandings caused by crude oil after 2005 was significantly lower than it was before 2006. We show that the designation of the Canary Islands as a PSSA in 2005 by the International Maritime Organization was associated with a reduction of sea turtle strandings caused by crude oil.

  14. Development of strand burner for solid propellant burning rate studies

    NASA Astrophysics Data System (ADS)

    Aziz, A.; Mamat, R.; Ali, W. K. Wan

    2013-12-01

    It is well-known that a strand burner is an apparatus that provides burning rate measurements of a solid propellant at an elevated pressure in order to obtain the burning characteristics of a propellant. This paper describes the facilities developed by author that was used in his studies. The burning rate characteristics of solid propellant have be evaluated over five different chamber pressures ranging from 1 atm to 31 atm using a strand burner. The strand burner has a mounting stand that allows the propellant strand to be mounted vertically. The strand was ignited electrically using hot wire, and the burning time was recorded by electronic timer. Wire technique was used to measure the burning rate. Preliminary results from these techniques are presented. This study shows that the strand burner can be used on propellant strands to obtain accurate low pressure burning rate data.

  15. Extended Minus-Strand DNA as Template for R-U5-Mediated Second-Strand Transfer in Recombinational Rescue of Primer Binding Site-Modified Retroviral Vectors

    PubMed Central

    Mikkelsen, Jacob Giehm; Lund, Anders H.; Dybkær, Karen; Duch, Mogens; Pedersen, Finn Skou

    1998-01-01

    We have previously demonstrated recombinational rescue of primer binding site (PBS)-impaired Akv murine leukemia virus-based vectors involving initial priming on endogenous viral sequences and template switching during cDNA synthesis to obtain PBS complementarity in second-strand transfer of reverse transcription (Mikkelsen et al., J. Virol. 70:1439–1447, 1996). By use of the same forced recombination system, we have now found recombinant proviruses of different structures, suggesting that PBS knockout vectors may be rescued through initial priming on endogenous virus RNA, read-through of the mutated PBS during minus-strand synthesis, and subsequent second-strand transfer mediated by the R-U5 complementarity of the plus strand and the extended minus-strand DNA acceptor template. Mechanisms for R-U5-mediated second-strand transfer and its possible role in retrovirus replication and evolution are discussed. PMID:9499117

  16. Dynamics of Leading-strand Lesion Skipping by the Replisome

    PubMed Central

    Yeeles, Joseph T.P.; Marians, Kenneth J.

    2013-01-01

    SUMMARY The E. coli replisome stalls transiently when it encounters a lesion in the leading-strand template, skipping over the damage by reinitiating replication at a new primer synthesized downstream by the primase. We report here that template unwinding and lagging-strand synthesis continue downstream of the lesion at a reduced rate after replisome stalling, that one replisome is capable of skipping multiple lesions, and that the rate limiting steps of replication restart involve the synthesis and activation of the new primer downstream. We also find little support for the concept that polymerase uncoupling, where extensive lagging-strand synthesis proceeds downstream in the absence of leading-strand synthesis, involves physical separation of the leading-strand polymerase from the replisome. Instead, our data indicate that extensive uncoupled replication likely results from a failure of the leading-strand polymerase still associated with the DNA helicase and the lagging-strand polymerase that are proceeding downstream to reinitiate synthesis. PMID:24268579

  17. Tensile and thickness swelling properties of strands from Southern hardwoods and Southern pine : effect of hot-pressing and resin application

    Treesearch

    Zhiyong Cai; Qinglin Wu; Guangping Han; Jong N. Lee

    2007-01-01

    Tensile and the moisture-induced thickness swelling properties of wood strands are among the most fundamental parameters in modeling and predicting engineering constants of strand-based composites such as oriented strandboard (OSB). The effects of hot-pressing and resin-curing on individual strand properties were investigated in this study. Strands from four Louisiana-...

  18. Statistical analysis of the Nb3Sn strand production for the ITER toroidal field coils

    NASA Astrophysics Data System (ADS)

    Vostner, A.; Jewell, M.; Pong, I.; Sullivan, N.; Devred, A.; Bessette, D.; Bevillard, G.; Mitchell, N.; Romano, G.; Zhou, C.

    2017-04-01

    The ITER toroidal field (TF) strand procurement initiated the largest Nb3Sn superconducting strand production hitherto. The industrial-scale production started in Japan in 2008 and finished in summer 2015. Six ITER partners (so-called Domestic Agencies, or DAs) are in charge of the procurement and involved eight different strand suppliers all over the world, of which four are using the bronze route (BR) process and four the internal-tin (IT) process. In total more than 500 tons have been produced including excess material covering losses during the conductor manufacturing process, in particular the cabling. The procurement is based on a functional specification where the main strand requirements like critical current, hysteresis losses, Cu ratio and residual resistance ratio are specified but not the strand production process or layout. This paper presents the analysis on the data acquired during the quality control (QC) process that was carried out to ensure the same conductor performance requirements are met by the different strand suppliers regardless of strand design. The strand QC is based on 100% billet testing and on applying statistical process control (SPC) limits. Throughout the production, samples adjacent to the strand pieces tested by the suppliers are cross-checked (‘verified’) by their respective DAs reference labs. The level of verification was lowered from 100% at the beginning of the procurement progressively to approximately 25% during the final phase of production. Based on the complete dataset of the TF strand production, an analysis of the SPC limits of the critical strand parameters is made and the related process capability indices are calculated. In view of the large-scale production and costs, key manufacturing parameters such as billet yield, number of breakages and piece-length distribution are also discussed. The results are compared among all the strand suppliers, focusing on the difference between BR and IT processes. Following the completion of the largest Nb3Sn strand production, our experience gained from monitoring the execution of the QC activities and from auditing the results from the measurements is summarised for future superconducting strand material procurement activities.

  19. Estimation of Prestress Force Distribution in the Multi-Strand System of Prestressed Concrete Structures

    PubMed Central

    Cho, Keunhee; Park, Sung Yong; Cho, Jeong-Rae; Kim, Sung Tae; Park, Young-Hwan

    2015-01-01

    Prestressed concrete (PSC) is one of the most reliable, durable and widely used construction materials, which overcomes the weakness of concrete in tension by the introduction of a prestress force. Smart strands enabling measurement of the prestress force have recently been developed to maintain PSC structures throughout their lifetime. However, the smart strand cannot give a representative indication of the whole prestress force when used in multi-strand systems since each strand sustains a different prestress force. In this paper, the actual distribution of the prestress force in a multi-strand system is examined using elastomagnetic (EM) sensors to develop a method for tracking representative indicators of the prestress force using smart strands. PMID:26083230

  20. [Results of flexor tendon sutures of the fingers with 2-strand (40 tendons) and 4-strand (64 tendons) core sutures].

    PubMed

    Winkel, R; Kalbhenn, O; Hoffmann, R

    2012-06-01

    This retrospective examination compares the results of finger flexor tendon sutures with 2 strands and 4 strands. It was checked, whether and how 2 more strands influenced the rupture rate, the movement of the finger and the contentment of the patients. From 1996 to 2000 for the core suture of the flexor tendon of fingers we used 2 strands. 35 patients with 40 tendon sutures of 73 patients were examined. From 2001 to 2005 we used for the core suture 2 loop threads. 53 patients with 64 tendon sutures from a total of 111 patients were examined. At least 12 months had passed between operation and the examination. The rupture rate and the range of movement of each finger joint and the total mobility of the affected fingers were evaluated. Each case was compared to the uninjured opposite hand. The functional result was judged according to the score of Buck-Gramcko. The patient's contentment was recorded by the DASH (disability of arm, shoulder and hand) score. Effects of gender, age, accompanying injuries, zone of the injury and their influence on the results were analysed. The Buck-Gramcko score showed in the 2-strand group a distribution from summarised 70% "excellent" and "good" and 30% "fair" and "poor". In the 4-strand-group the relation was 93.7% "excellent" and "good", 6.3% "fair", one "poor". In the 2-strand group 2/40 (5%) of the tendon sutures ruptured, in the 4-strand group 1/64 (1.6%) ruptured. The average DASH value in the 2-strands-group was 16.6/100, in the 4-strands-group 18.1/100 when 0 is the best possible result and 100 the worst. The patient judgement in the 2-strand group was summarised to 70% for "excellent" and "good" and 30% "fair" and "poor". In the 4-strand group the patient's judgment was summarised in 75% "excellent" and "good" and in 25% "fair". The results of flexor tendon sutures with 4-strand core sutures have been superior to the results with 2-strand core suture according to range of motion of the fingers (P <0.005). © Georg Thieme Verlag KG Stuttgart · New York.

  1. A novel single fluorophore-labeled double-stranded oligonucleotide probe for fluorescence-enhanced nucleic acid detection based on the inherent quenching ability of deoxyguanosine bases and competitive strand-displacement reaction.

    PubMed

    Zhang, Yingwei; Tian, Jingqi; Li, Hailong; Wang, Lei; Sun, Xuping

    2012-01-01

    We develop a novel single fluorophore-labeled double-stranded oligonucleotide (OND) probe for rapid, nanostructure-free, fluorescence-enhanced nucleic acid detection for the first time. We further demonstrate such probe is able to well discriminate single-base mutation in nucleic acid. The design takes advantage of an inherent quenching ability of guanine bases. The short strand of the probe is designed with an end-labeled fluorophore that is placed adjacent to two guanines as the quencher located on the long opposite strand, resulting in great quenching of dye fluorescence. In the presence of a target complementary to the long strand of the probe, a competitive strand-displacement reaction occurs and the long strand forms a more stable duplex with the target, resulting in the two strands of the probe being separated from each other. As a consequence of this displacement, the fluorophore and the quencher are no longer in close proximity and dye fluorescence increases, signaling the presence of target.

  2. Fanconi anemia links reactive oxygen species to insulin resistance and obesity.

    PubMed

    Li, Jie; Sipple, Jared; Maynard, Suzette; Mehta, Parinda A; Rose, Susan R; Davies, Stella M; Pang, Qishen

    2012-10-15

    Insulin resistance is a hallmark of obesity and type 2 diabetes. Reactive oxygen species (ROS) have been proposed to play a causal role in insulin resistance. However, evidence linking ROS to insulin resistance in disease settings has been scant. Since both oxidative stress and diabetes have been observed in patients with the Fanconi anemia (FA), we sought to investigate the link between ROS and insulin resistance in this unique disease model. Mice deficient for the Fanconi anemia complementation group A (Fanca) or Fanconi anemia complementation group C (Fancc) gene seem to be diabetes-prone, as manifested by significant hyperglycemia and hyperinsulinemia, and rapid weight gain when fed with a high-fat diet. These phenotypic features of insulin resistance are characterized by two critical events in insulin signaling: a reduction in tyrosine phosphorylation of the insulin receptor (IR) and an increase in inhibitory serine phosphorylation of the IR substrate-1 in the liver, muscle, and fat tissues from the insulin-challenged FA mice. High levels of ROS, spontaneously accumulated or generated by tumor necrosis factor alpha in these insulin-sensitive tissues of FA mice, were shown to underlie the FA insulin resistance. Treatment of FA mice with the natural anti-oxidant Quercetin restores IR signaling and ameliorates the diabetes- and obesity-prone phenotypes. Finally, pairwise screen identifies protein-tyrosine phosphatase (PTP)-α and stress kinase double-stranded RNA-dependent protein kinase (PKR) that mediate the ROS effect on FA insulin resistance. These findings establish a pathogenic and mechanistic link between ROS and insulin resistance in a unique human disease setting. ROS accumulation contributes to the insulin resistance in FA deficiency by targeting both PTP-α and PKR.

  3. Spontaneous mutation reveals influence of exopolysaccharide on Lactobacillus johnsonii surface characteristics.

    PubMed

    Horn, Nikki; Wegmann, Udo; Dertli, Enes; Mulholland, Francis; Collins, Samuel R A; Waldron, Keith W; Bongaerts, Roy J; Mayer, Melinda J; Narbad, Arjan

    2013-01-01

    As a competitive exclusion agent, Lactobacillus johnsonii FI9785 has been shown to prevent the colonization of selected pathogenic bacteria from the chicken gastrointestinal tract. During growth of the bacterium a rare but consistent emergence of an altered phenotype was noted, generating smooth colonies in contrast to the wild type rough form. A smooth colony variant was isolated and two-dimensional gel analysis of both strains revealed a protein spot with different migration properties in the two phenotypes. The spot in both gels was identified as a putative tyrosine kinase (EpsC), associated with a predicted exopolysaccharide gene cluster. Sequencing of the epsC gene from the smooth mutant revealed a single substitution (G to A) in the coding strand, resulting in the amino acid change D88N in the corresponding gene product. A native plasmid of L. johnsonii was engineered to produce a novel vector for constitutive expression and this was used to demonstrate that expression of the wild type epsC gene in the smooth mutant produced a reversion to the rough colony phenotype. Both the mutant and epsC complemented strains had increased levels of exopolysaccharides compared to the wild type strain, indicating that the rough phenotype is not solely associated with the quantity of exopolysaccharide. Another gene in the cluster, epsE, that encoded a putative undecaprenyl-phosphate galactosephosphotransferase, was deleted in order to investigate its role in exopolysaccharide biosynthesis. The ΔepsE strain exhibited a large increase in cell aggregation and a reduction in exopolysaccharide content, while plasmid complementation of epsE restored the wild type phenotype. Flow cytometry showed that the wild type and derivative strains exhibited clear differences in their adhesive ability to HT29 monolayers in tissue culture, demonstrating an impact of EPS on surface properties and bacteria-host interactions.

  4. Involvement of the putative Ca²⁺-permeable mechanosensitive channels, NtMCA1 and NtMCA2, in Ca²⁺ uptake, Ca²⁺-dependent cell proliferation and mechanical stress-induced gene expression in tobacco (Nicotiana tabacum) BY-2 cells.

    PubMed

    Kurusu, Takamitsu; Yamanaka, Takuya; Nakano, Masataka; Takiguchi, Akiko; Ogasawara, Yoko; Hayashi, Teruyuki; Iida, Kazuko; Hanamata, Shigeru; Shinozaki, Kazuo; Iida, Hidetoshi; Kuchitsu, Kazuyuki

    2012-07-01

    To gain insight into the cellular functions of the mid1-complementing activity (MCA) family proteins, encoding putative Ca²⁺-permeable mechanosensitive channels, we isolated two MCA homologs of tobacco (Nicotiana tabacum) BY-2 cells, named NtMCA1 and NtMCA2. NtMCA1 and NtMCA2 partially complemented the lethality and Ca²⁺ uptake defects of yeast mutants lacking mechanosensitive Ca²⁺ channel components. Furthermore, in yeast cells overexpressing NtMCA1 and NtMCA2, the hypo-osmotic shock-induced Ca²⁺ influx was enhanced. Overexpression of NtMCA1 or NtMCA2 in BY-2 cells enhanced Ca²⁺ uptake, and significantly alleviated growth inhibition under Ca²⁺ limitation. NtMCA1-overexpressing BY-2 cells showed higher sensitivity to hypo-osmotic shock than control cells, and induced the expression of the touch-inducible gene, NtERF4. We found that both NtMCA1-GFP and NtMCA2-GFP were localized at the plasma membrane and its interface with the cell wall, Hechtian strands, and at the cell plate and perinuclear vesicles of dividing cells. NtMCA2 transcript levels fluctuated during the cell cycle and were highest at the G1 phase. These results suggest that NtMCA1 and NtMCA2 play roles in Ca²⁺-dependent cell proliferation and mechanical stress-induced gene expression in BY-2 cells, by regulating the Ca²⁺ influx through the plasma membrane.

  5. Fanconi Anemia Links Reactive Oxygen Species to Insulin Resistance and Obesity

    PubMed Central

    Li, Jie; Sipple, Jared; Maynard, Suzette; Mehta, Parinda A.; Rose, Susan R.; Davies, Stella M.

    2012-01-01

    Abstract Aims: Insulin resistance is a hallmark of obesity and type 2 diabetes. Reactive oxygen species (ROS) have been proposed to play a causal role in insulin resistance. However, evidence linking ROS to insulin resistance in disease settings has been scant. Since both oxidative stress and diabetes have been observed in patients with the Fanconi anemia (FA), we sought to investigate the link between ROS and insulin resistance in this unique disease model. Results: Mice deficient for the Fanconi anemia complementation group A (Fanca) or Fanconi anemia complementation group C (Fancc) gene seem to be diabetes-prone, as manifested by significant hyperglycemia and hyperinsulinemia, and rapid weight gain when fed with a high-fat diet. These phenotypic features of insulin resistance are characterized by two critical events in insulin signaling: a reduction in tyrosine phosphorylation of the insulin receptor (IR) and an increase in inhibitory serine phosphorylation of the IR substrate-1 in the liver, muscle, and fat tissues from the insulin-challenged FA mice. High levels of ROS, spontaneously accumulated or generated by tumor necrosis factor alpha in these insulin-sensitive tissues of FA mice, were shown to underlie the FA insulin resistance. Treatment of FA mice with the natural anti-oxidant Quercetin restores IR signaling and ameliorates the diabetes- and obesity-prone phenotypes. Finally, pairwise screen identifies protein-tyrosine phosphatase (PTP)-α and stress kinase double-stranded RNA-dependent protein kinase (PKR) that mediate the ROS effect on FA insulin resistance. Innovation: These findings establish a pathogenic and mechanistic link between ROS and insulin resistance in a unique human disease setting. Conclusion: ROS accumulation contributes to the insulin resistance in FA deficiency by targeting both PTP-α and PKR. Antioxid. Redox Signal. 00, 000–000. PMID:22482891

  6. Differences in the diagnosis and management of systemic lupus erythematosus by primary care and specialist providers in the American Indian/Alaska Native population.

    PubMed

    McDougall, J A; Helmick, C G; Lim, S S; Johnston, J M; Gaddy, J R; Gordon, C; Ferucci, E D

    2018-06-01

    Objectives The objective of this study is to investigate differences in the diagnosis and management of systemic lupus erythematosus (SLE) by primary care and specialist physicians in a population-based registry. Methods This study includes individuals from the 2009 Indian Health Service lupus registry population with a diagnosis of SLE documented by either a primary care provider or specialist. SLE classification criteria, laboratory testing, and medication use at any time during the course of disease were determined by medical record abstraction. Results Of the 320 individuals with a diagnosis of SLE, 249 had the diagnosis documented by a specialist, with 71 documented by primary care. Individuals with a specialist diagnosis of SLE were more likely to have medical record documentation of meeting criteria for SLE by all criteria sets (American College of Rheumatology, 79% vs 22%; Boston Weighted, 82% vs 32%; and Systemic Lupus International Collaborating Clinics, 83% vs 35%; p < 0.001 for all comparisons). In addition, specialist diagnosis was associated with documentation of ever having been tested for anti-double-stranded DNA antibody and complement 3 and complement 4 ( p < 0.001). Documentation of ever receiving hydroxychloroquine was also more common with specialist diagnosis (86% vs 64%, p < 0.001). Conclusions Within the population studied, specialist diagnosis of SLE was associated with a higher likelihood of having SLE classification criteria documented, being tested for biomarkers of disease, and ever receiving treatment with hydroxychloroquine. These data support efforts both to increase specialist access for patients with suspected SLE and to provide lupus education to primary care providers.

  7. Xrcc2 deficiency sensitizes cells to apoptosis by MNNG and the alkylating anticancer drugs temozolomide, fotemustine and mafosfamide.

    PubMed

    Tsaryk, Roman; Fabian, Kerstin; Thacker, John; Kaina, Bernd

    2006-08-08

    DNA double-strand breaks (DSBs) are potent killing lesions, and inefficient repair of DSBs does not only lead to cell death but also to genomic instability and tumorigenesis. DSBs are repaired by non-homologous end-joining and homologous recombination (HR). A key player in HR is Xrcc2, a Rad51-like protein. Cells deficient in Xrcc2 are hypersensitive to X-rays and mitomycin C and display increased chromosomal aberration frequencies. In order to elucidate the role of Xrcc2 in resistance to anticancer drugs, we compared Xrcc2 knockout (Xrcc2-/-) mouse embryonic fibroblasts with the corresponding isogenic wild-type and Xrcc2 complemented knockout cells. We show that Xrcc2-/- cells are hypersensitive to the killing effect of the simple methylating agent N-methyl-N'-nitro-N-nitrosoguanidine (MNNG). They undergo apoptosis after MNNG treatment while necrosis is only marginally enhanced. Complementation of Xrcc2 deficient cells by Xrcc2 cDNA transfection conferred resistance to the cytotoxic and apoptosis-inducing effect of MNNG. The hypersensitivity of Xrcc2-/- cells to MNNG prompted us to investigate their killing and apoptotic response to various methylating, chloroethylating and crosslinking drugs used in anticancer therapy. Xrcc2 deficient cells were found to be hypersensitive to temozolomide, fotemustine and mafosfamide. They were also hypersensitive to cisplatin but not to taxol. The data reveal that Xrcc2 plays a role in the protection against a wide range of anticancer drugs and, therefore, suggest Xrcc2 to be a determinant of anticancer drug resistance. They also indicate that HR is involved in the processing of DNA damage induced by simple alkylating agents.

  8. T Cell Receptor Vβ Staining Identifies the Malignant Clone in Adult T cell Leukemia and Reveals Killing of Leukemia Cells by Autologous CD8+ T cells

    PubMed Central

    Witkover, Aviva; Tanaka, Yuetsu; Fields, Paul; Bangham, Charles R. M.

    2016-01-01

    There is growing evidence that CD8+ cytotoxic T lymphocyte (CTL) responses can contribute to long-term remission of many malignancies. The etiological agent of adult T-cell leukemia/lymphoma (ATL), human T lymphotropic virus type-1 (HTLV-1), contains highly immunogenic CTL epitopes, but ATL patients typically have low frequencies of cytokine-producing HTLV-1-specific CD8+ cells in the circulation. It remains unclear whether patients with ATL possess CTLs that can kill the malignant HTLV-1 infected clone. Here we used flow cytometric staining of TCRVβ and cell adhesion molecule-1 (CADM1) to identify monoclonal populations of HTLV-1-infected T cells in the peripheral blood of patients with ATL. Thus, we quantified the rate of CD8+-mediated killing of the putative malignant clone in ex vivo blood samples. We observed that CD8+ cells from ATL patients were unable to lyse autologous ATL clones when tested directly ex vivo. However, short in vitro culture restored the ability of CD8+ cells to kill ex vivo ATL clones in some donors. The capacity of CD8+ cells to lyse HTLV-1 infected cells which expressed the viral sense strand gene products was significantly enhanced after in vitro culture, and donors with an ATL clone that expressed the HTLV-1 Tax gene were most likely to make a detectable lytic CD8+ response to the ATL cells. We conclude that some patients with ATL possess functional tumour-specific CTLs which could be exploited to contribute to control of the disease. PMID:27893842

  9. Luminescence resonance energy transfer-based nucleic acid hybridization assay on cellulose paper with upconverting phosphor as donors.

    PubMed

    Zhou, Feng; Noor, M Omair; Krull, Ulrich J

    2014-03-04

    A bioassay based on DNA hybridization on cellulose paper is a promising format for gene fragment detection that may be suited for in-field and rapid diagnostic applications. We demonstrate for the first time that luminescence resonance energy transfer (LRET) associated with upconverting phosphors (UCPs) can be used to develop a paper-based DNA hybridization assay with high sensitivity, selectivity and fast response. UCPs with strong green emission were synthesized and subsequently functionalized with streptavidin (UCP-strep). UCP-strep particles were immobilized on cellulose paper, and then biotinylated single-stranded oligonucleotide probes were conjugated onto the UCPs via streptavidin-biotin linkage. The UCPs served as donors that were LRET-paired with Cy3-labeled target DNA. Selective DNA hybridization enabled the proximity required for LRET-sensitized emission from Cy3, which was used as the detection signal. Hybridization was complete within 2 min, and the limit of detection of the method was 34 fmol, which is a significant improvement in comparison to an analogous fluorescence resonance energy transfer (FRET) assay based on quantum dots. The assay exhibited excellent resistance to nonspecific adsorption of noncomplementary short/long DNA and protein. The selectivity of the assay was further evaluated by one base pair mismatched (1BPM) DNA detection, where a maximum signal ratio of 3.1:1 was achieved between fully complementary and 1BPM samples. This work represents a preliminary but significant step for the development of paper-based UCP-LRET nucleic acid hybridization assays, which offer potential for lowering the limit of detection of luminescent hybridization assays due to the negligible background signal associated with optical excitation by near-infrared (NIR) light.

  10. Interfacial transduction of nucleic acid hybridization using immobilized quantum dots as donors in fluorescence resonance energy transfer.

    PubMed

    Algar, W Russ; Krull, Ulrich J

    2009-01-06

    Fluorescence resonance energy transfer (FRET) using immobilized quantum dots (QDs) as energy donors was explored as a transduction method for the detection of nucleic acid hybridization at an interface. This research was motivated by the success of the QD-FRET-based transduction of nucleic acid hybridization in solution-phase assays. This new work represents a fundamental step toward the assembly of a biosensor, where immobilization of the selective chemistry on a surface is desired. After immobilizing QD-probe oligonucleotide conjugates on optical fibers, a demonstration of the retention of selectivity was achieved by the introduction of acceptor (Cy3)-labeled single-stranded target oligonucleotides. Hybridization generated the proximity required for FRET, and the resulting fluorescence spectra provided an analytical signal proportional to the amount of target. This research provides an important framework for the future development of nucleic acid biosensors based on QDs and FRET. The most important findings of this work are that (1) a QD-FRET solid-phase hybridization assay is viable and (2) a passivating layer of denatured bovine serum albumin alleviates nonspecific adsorption, ultimately resulting in (3) the potential for a reusable assay format and mismatch discrimination. In this, the first incarnation of a solid-phase QD-FRET hybridization assay, the limit of detection was found to be 5 nM, and the dynamic range was almost 2 orders of magnitude. Selective discrimination of the target was shown using a three-base-pairs mismatch from a fully complementary sequence. Despite a gradual loss of signal, reuse of the optical fibers over multiple cycles of hybridization and dehybridization was possible. Directions for further improvement of the analytical performance by optimizing the design of the QD-probe oligonucleotide interface are identified.

  11. Rad59-Facilitated Acquisition of Y′ Elements by Short Telomeres Delays the Onset of Senescence

    PubMed Central

    Churikov, Dmitri; Charifi, Ferose; Simon, Marie-Noëlle; Géli, Vincent

    2014-01-01

    Telomerase-negative yeasts survive via one of the two Rad52-dependent recombination pathways, which have distinct genetic requirements. Although the telomere pattern of type I and type II survivors is well characterized, the mechanistic details of short telomere rearrangement into highly evolved pattern observed in survivors are still missing. Here, we analyze immediate events taking place at the abruptly shortened VII-L and native telomeres. We show that short telomeres engage in pairing with internal Rap1-bound TG1–3-like tracts present between subtelomeric X and Y′ elements, which is followed by BIR-mediated non-reciprocal translocation of Y′ element and terminal TG1–3 repeats from the donor end onto the shortened telomere. We found that choice of the Y′ donor was not random, since both engineered telomere VII-L and native VI-R acquired Y′ elements from partially overlapping sets of specific chromosome ends. Although short telomere repair was associated with transient delay in cell divisions, Y′ translocation on native telomeres did not require Mec1-dependent checkpoint. Furthermore, the homeologous pairing between the terminal TG1–3 repeats at VII-L and internal repeats on other chromosome ends was largely independent of Rad51, but instead it was facilitated by Rad59 that stimulates Rad52 strand annealing activity. Therefore, Y′ translocation events taking place during presenescence are genetically separable from Rad51-dependent Y′ amplification process that occurs later during type I survivor formation. We show that Rad59-facilitated Y′ translocations on X-only telomeres delay the onset of senescence while preparing ground for type I survivor formation. PMID:25375789

  12. TALEN-Mediated Homologous Recombination Produces Site-Directed DNA Base Change and Herbicide-Resistant Rice.

    PubMed

    Li, Ting; Liu, Bo; Chen, Chih Ying; Yang, Bing

    2016-05-20

    Over the last decades, much endeavor has been made to advance genome editing technology due to its promising role in both basic and synthetic biology. The breakthrough has been made in recent years with the advent of sequence-specific endonucleases, especially zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and clustered regularly interspaced short palindromic repeats (CRISPRs) guided nucleases (e.g., Cas9). In higher eukaryotic organisms, site-directed mutagenesis usually can be achieved through non-homologous end-joining (NHEJ) repair to the DNA double-strand breaks (DSBs) caused by the exogenously applied nucleases. However, site-specific gene replacement or genuine genome editing through homologous recombination (HR) repair to DSBs remains a challenge. As a proof of concept gene replacement through TALEN-based HR in rice (Oryza sativa), we successfully produced double point mutations in rice acetolactate synthase gene (OsALS) and generated herbicide resistant rice lines by using TALENs and donor DNA carrying the desired mutations. After ballistic delivery into rice calli of TALEN construct and donor DNA, nine HR events with different genotypes of OsALS were obtained in T0 generation at the efficiency of 1.4%-6.3% from three experiments. The HR-mediated gene edits were heritable to the progeny of T1 generation. The edited T1 plants were as morphologically normal as the control plants while displayed strong herbicide resistance. The results demonstrate the feasibility of TALEN-mediated genome editing in rice and provide useful information for further genome editing by other nuclease-based genome editing platforms. Copyright © 2016 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

  13. Development of a 10 m quasi-isotropic strand assembled from 2G wires

    NASA Astrophysics Data System (ADS)

    Kan, Changtao; Wang, Yinshun; Hou, Yanbing; Li, Yan; Zhang, Han; Fu, Yu; Jiang, Zhe

    2018-03-01

    Quasi-isotropic strands made of second generation (2G) high temperature superconducting (HTS) wires are attractive to applications of high-field magnets at low temperatures and power transmission cables at liquid nitrogen temperature in virtue of their high current carrying capability and well mechanical property. In this contribution, a 10 m length quasi-isotropic strand is manufactured and successfully tested in liquid nitrogen to verify the feasibility of an industrial scale production of the strand by the existing cabling technologies. The strand with copper sheath consists of 72 symmetrically assembled 2G wires. The uniformity of critical properties of long quasi-isotropic strands, including critical current and n-value, is very important for their using. Critical currents as well as n-values of the strand are measured every 1 m respectively and compared with the simulation results. Critical current and n-value of the strand are calculated basing on the self-consistent model solved by the finite element method (FEM). Effects of self-field on the critical current and n-value distributions in wires of the strand are analyzed in detail. The simulation results show good agreement with the experimental data and the 10 m quasi-isotropic strand has good critical properties uniformity.

  14. Offshore Earthquakes Do Not Influence Marine Mammal Stranding Risk on the Washington and Oregon Coasts.

    PubMed

    Grant, Rachel A; Savirina, Anna; Hoppitt, Will

    2018-01-26

    The causes of marine mammals stranding on coastal beaches are not well understood, but may relate to topography, currents, wind, water temperature, disease, toxic algal blooms, and anthropogenic activity. Offshore earthquakes are a source of intense sound and disturbance and could be a contributing factor to stranding probability. We tested the hypothesis that the probability of marine mammal stranding events on the coasts of Washington and Oregon, USA is increased by the occurrence of offshore earthquakes in the nearby Cascadia subduction zone. The analysis carried out here indicated that earthquakes are at most, a very minor predictor of either single, or large (six or more animals) stranding events, at least for the study period and location. We also tested whether earthquakes inhibit stranding and again, there was no link. Although we did not find a substantial association of earthquakes with strandings in this study, it is likely that there are many factors influencing stranding of marine mammals and a single cause is unlikely to be responsible. Analysis of a subset of data for which detailed descriptions were available showed that most live stranded animals were pups, calves, or juveniles, and in the case of dead stranded mammals, the commonest cause of death was trauma, disease, and emaciation.

  15. Optical Properties of Laminarin Using Terahertz Time-Domain Spectroscopy (abstract)

    NASA Astrophysics Data System (ADS)

    Shin, Hee Jun; Maeng, Inhee; Oh, Seung Jae; Kim, Sung In; Kim, Ha Won; Son, Joo-Hiuk

    2009-04-01

    Terahertz spectroscopy is important in the study of biomolecular structure because the vibration and rotation energy of large molecules such as DNA, proteins, and polysaccharides are laid in terahertz regions. Terahertz time-domain spectroscopy (THz-TDS), using terahertz pulses generated and detected by femto-second pulses laser, has been used in the study of biomolecular dynamics, as well as carrier dynamics of semiconductors. Laminarin is a polysaccharide of glucose in brown algae. It is made up of β(1-3)-glucan and β(1-6)-glucan. β-glucan is an anticancer material that activates the immune reaction of human cells and inhibits proliferation of cancer cells. β-glucan with a single-strand structure has been reported to activate the immune reaction to a greater extent than β-glucan with a triple-strand helix structure. We used THz-TDS to characterize the difference between single-strand and triple-strand β-glucan. We obtained single-strand β-glucan by chemical treatment of triple-strand β-glucan. We measured the frequency dependent optical constants of Laminarin using THz-TDS. Power absorption of the triple-strand helix is larger than the single-strand helix in terahertz regions. The refractive index of the triple-strand helix is also larger than that of the single-strand helix.

  16. The Impact of Turtle Excluder Devices and Fisheries Closures on Loggerhead and Kemp's Ridley Strandings in the Western Gulf of Mexico

    USGS Publications Warehouse

    Lewison, R.L.; Crowder, L.B.; Shaver, D.J.

    2003-01-01

    The Sea Turtle Stranding and Salvage Network has been monitoring turtle strandings for more than 20 years in the United States. High numbers of strandings in the early to mid-1980s prompted regulations to require turtle excluder devices (TEDs) on shrimping vessels (trawlers). Following year-round TED implementation in 1991, however, stranding levels in the Gulf of Mexico increased. We evaluated the efficacy of TEDs and other management actions (e.g., fisheries closures) on loggerhead (Caretta caretta) and Kemp's ridley (Lepidochelys kempii) turtle populations by analyzing a long-term, stranding data set from the western Gulf of Mexico. Our analyses suggest that both sea turtle population growth and shrimping activity have contributed to the observed increase in strandings. Compliance with regulations requiring turtle excluder devices was a significant factor in accounting for annual stranding variability: low compliance was correlated with high levels of strandings. Our projections suggest that improved compliance with TED regulations will reduce strandings to levels that, in conjunction with other protective measures, should promote population recoveries for loggerhead and Kemp's ridley turtles. Local, seasonal fisheries closures, concurrent with TED enforcement, could reduce strandings to even lower levels. A seasonal closure adjacent to a recently established Kemp's ridley nesting beach may also reduce mortality of nesting adults and thus promote long-term population persistence by fostering the establishment of a robust secondary nesting site.

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Emanuela Barzi et al.

    Fermilab is developing 11 T superconducting dipole magnets for future accelerators based on Nb{sub 3}Sn conductor. Within the High Field Magnet Project, the first prototypes feature 1 meter long two-layer shell-type coils and common coils. For the former, keystoned Rutherford-type cable made of 28 Nb{sub 3}Sn strands 1 mm in diameter are used, whereas for the latter a 60-strand flat cable was chosen. Multifilamentary Nb{sub 3}Sn strands produced with various technologies by industry were used for the development and testing of the prototype cable. An experimental cabling machine with up to 28-strand capacity that has been recently purchased, installed andmore » commissioned at Fermilab, has allowed further advances in strand and cable studies. Cables of 27 and 28 strands of various structures (single strands or assemblies of sub-strands), with aspect ratios from 7 to 17, packing factors from 85 to 95%, with and without a stainless steel core were made out of Copper, NbTi, and Modified Jelly Roll (OST), Powder-in-Tube (SMI) and Internal Tin (Mitsubishi) Nb{sub 3}Sn strands. optimal parameters were determined with respect to mechanical and electrical properties, including critical current degradation, interstrand resistance, etc. Round strands of the same billets used in the cables were deformed by rolling them down to various thicknesses. Their critical current Ic was then measured and compared with that of the strands extracted from cables having different packing factors. This paper summarizes the results of such R and D efforts at Fermilab.« less

  18. Analyses of pea necrotic yellow dwarf virus-encoded proteins.

    PubMed

    Krenz, Björn; Schießl, Ingrid; Greiner, Eva; Krapp, Susanna

    2017-06-01

    Pea necrotic yellow dwarf virus (PNYDV) is a multipartite, circular, single-stranded DNA plant virus. PNYDV encodes eight proteins and the function of three of which remains unknown-U1, U2, and U4. PNYDV proteins cellular localization was analyzed by GFP tagging and bimolecular fluorescence complementation (BiFC) studies. The interactions of all eight PNYDV proteins were tested pairwise in planta (36 combinations in total). Seven interactions were identified and two (M-Rep with CP and MP with U4) were characterized further. MP and U4 complexes appeared as vesicle-like spots and were localized at the nuclear envelope and cell periphery. These vesicle-like spots were associated with the endoplasmatic reticulum. In addition, a nuclear localization signal (NLS) was mapped for U1, and a mutated U1 with NLS disrupted localized at plasmodesmata and therefore might also have a role in movement. Taken together, this study provides evidence for previously undescribed nanovirus protein-protein interactions and their cellular localization with novel findings not only for those proteins with unknown function, but also for characterized proteins such as the CP.

  19. Measles Virus Fusion Protein: Structure, Function and Inhibition

    PubMed Central

    Plattet, Philippe; Alves, Lisa; Herren, Michael; Aguilar, Hector C.

    2016-01-01

    Measles virus (MeV), a highly contagious member of the Paramyxoviridae family, causes measles in humans. The Paramyxoviridae family of negative single-stranded enveloped viruses includes several important human and animal pathogens, with MeV causing approximately 120,000 deaths annually. MeV and canine distemper virus (CDV)-mediated diseases can be prevented by vaccination. However, sub-optimal vaccine delivery continues to foster MeV outbreaks. Post-exposure prophylaxis with antivirals has been proposed as a novel strategy to complement vaccination programs by filling herd immunity gaps. Recent research has shown that membrane fusion induced by the morbillivirus glycoproteins is the first critical step for viral entry and infection, and determines cell pathology and disease outcome. Our molecular understanding of morbillivirus-associated membrane fusion has greatly progressed towards the feasibility to control this process by treating the fusion glycoprotein with inhibitory molecules. Current approaches to develop anti-membrane fusion drugs and our knowledge on drug resistance mechanisms strongly suggest that combined therapies will be a prerequisite. Thus, discovery of additional anti-fusion and/or anti-attachment protein small-molecule compounds may eventually translate into realistic therapeutic options. PMID:27110811

  20. Functional Information Stored in the Conserved Structural RNA Domains of Flavivirus Genomes

    PubMed Central

    Fernández-Sanlés, Alba; Ríos-Marco, Pablo; Romero-López, Cristina; Berzal-Herranz, Alfredo

    2017-01-01

    The genus Flavivirus comprises a large number of small, positive-sense single-stranded, RNA viruses able to replicate in the cytoplasm of certain arthropod and/or vertebrate host cells. The genus, which has some 70 member species, includes a number of emerging and re-emerging pathogens responsible for outbreaks of human disease around the world, such as the West Nile, dengue, Zika, yellow fever, Japanese encephalitis, St. Louis encephalitis, and tick-borne encephalitis viruses. Like other RNA viruses, flaviviruses have a compact RNA genome that efficiently stores all the information required for the completion of the infectious cycle. The efficiency of this storage system is attributable to supracoding elements, i.e., discrete, structural units with essential functions. This information storage system overlaps and complements the protein coding sequence and is highly conserved across the genus. It therefore offers interesting potential targets for novel therapeutic strategies. This review summarizes our knowledge of the features of flavivirus genome functional RNA domains. It also provides a brief overview of the main achievements reported in the design of antiviral nucleic acid-based drugs targeting functional genomic RNA elements. PMID:28421048

Top