Comparing alchemical and physical pathway methods for computing the absolute binding free energy of charged ligands.

PubMed

Deng, Nanjie; Cui, Di; Zhang, Bin W; Xia, Junchao; Cruz, Jeffrey; Levy, Ronald

2018-06-13

Accurately predicting absolute binding free energies of protein-ligand complexes is important as a fundamental problem in both computational biophysics and pharmaceutical discovery. Calculating binding free energies for charged ligands is generally considered to be challenging because of the strong electrostatic interactions between the ligand and its environment in aqueous solution. In this work, we compare the performance of the potential of mean force (PMF) method and the double decoupling method (DDM) for computing absolute binding free energies for charged ligands. We first clarify an unresolved issue concerning the explicit use of the binding site volume to define the complexed state in DDM together with the use of harmonic restraints. We also provide an alternative derivation for the formula for absolute binding free energy using the PMF approach. We use these formulas to compute the binding free energy of charged ligands at an allosteric site of HIV-1 integrase, which has emerged in recent years as a promising target for developing antiviral therapy. As compared with the experimental results, the absolute binding free energies obtained by using the PMF approach show unsigned errors of 1.5-3.4 kcal mol-1, which are somewhat better than the results from DDM (unsigned errors of 1.6-4.3 kcal mol-1) using the same amount of CPU time. According to the DDM decomposition of the binding free energy, the ligand binding appears to be dominated by nonpolar interactions despite the presence of very large and favorable intermolecular ligand-receptor electrostatic interactions, which are almost completely cancelled out by the equally large free energy cost of desolvation of the charged moiety of the ligands in solution. We discuss the relative strengths of computing absolute binding free energies using the alchemical and physical pathway methods.

Changes in the zero-point energy of the protons as the source of the binding energy of water to A-phase DNA.

PubMed

Reiter, G F; Senesi, R; Mayers, J

2010-10-01

The measured changes in the zero-point kinetic energy of the protons are entirely responsible for the binding energy of water molecules to A phase DNA at the concentration of 6  water molecules/base pair. The changes in kinetic energy can be expected to be a significant contribution to the energy balance in intracellular biological processes and the properties of nano-confined water. The shape of the momentum distribution in the dehydrated A phase is consistent with coherent delocalization of some of the protons in a double well potential, with a separation of the wells of 0.2 Å.

A comparison of the coupled cluster and internally contracted averaged coupled-pair functional levels of theory for the calculation of the MCH2(+) binding energies for M = Sc to Cu

NASA Technical Reports Server (NTRS)

Bauschlicher, Charles W., Jr.; Partridge, Harry; Scuseria, Gustavo E.

1992-01-01

The correlation contribution to the M-C binding energy for the MCH2(+) systems can exceed 100 kcal/mol. At the self-consistent field (SCF) level, these systems can be more than 50 kcal/mol above the fragment energies. In spite of the poor zeroth-order reference, the coupled cluster single and double excitation method with a perturbational estimate of triple excitations, CCSD(T), method is shown to provide an accurate description of these systems. The maximum difference between the CCSD(T) and internally contracted averaged coupled-pair functional binding energies is 1.5 kcal/mol for CrCH2(+), with the remaining systems agreeing to within 1.0 kcal/mol.

Theoretical Study of Fe(CO)n-

NASA Technical Reports Server (NTRS)

Ricca, Alessandra; Baushlicher, Charles W., Jr.

1995-01-01

The structures and CO binding energies are computed for Fe(CO)n- using a hybrid density functional theory (DFT) approach. The structures and ground states can be explained in terms of maximizing the Fe to CO 2pi* donation and minimizing Fe-CO 5 sigma repulsion. The trends in the CO binding energies for Fe(CO)n- and the differences between the trends for Fe(CO)n- and Fe(CO)n are also explained. For Fe(CO)n-, the second, third, and fourth CO bonding energies are in good agreement with experiment, while the first is too small. The first CO binding is also too small using the coupled cluster singles and doubles approach including a perturbation estimate of the connected triple excitations.

Insights into the binding specificity of wild type and mutated wheat germ agglutinin towards Neu5Acα(2-3)Gal: a study by in silico mutations and molecular dynamics simulations.

PubMed

Parasuraman, Ponnusamy; Murugan, Veeramani; Selvin, Jeyasigamani F A; Gromiha, M Michael; Fukui, Kazuhiko; Veluraja, Kasinadar

2014-08-01

Wheat germ agglutinin (WGA) is a plant lectin, which specifically recognizes the sugars NeuNAc and GlcNAc. Mutated WGA with enhanced binding specificity can be used as biomarkers for cancer. In silico mutations are performed at the active site of WGA to enhance the binding specificity towards sialylglycans, and molecular dynamics simulations of 20 ns are carried out for wild type and mutated WGAs (WGA1, WGA2, and WGA3) in complex with sialylgalactose to examine the change in binding specificity. MD simulations reveal the change in binding specificity of wild type and mutated WGAs towards sialylgalactose and bound conformational flexibility of sialylgalactose. The mutated polar amino acid residues Asn114 (S114N), Lys118 (G118K), and Arg118 (G118R) make direct and water mediated hydrogen bonds and hydrophobic interactions with sialylgalactose. An analysis of possible hydrogen bonds, hydrophobic interactions, total pair wise interaction energy between active site residues and sialylgalactose and MM-PBSA free energy calculation reveals the plausible binding modes and the role of water in stabilizing different binding modes. An interesting observation is that the binding specificity of mutated WGAs (cyborg lectin) towards sialylgalactose is found to be higher in double point mutation (WGA3). One of the substituted residues Arg118 plays a crucial role in sugar binding. Based on the interactions and energy calculations, it is concluded that the order of binding specificity of WGAs towards sialylgalactose is WGA3 > WGA1 > WGA2 > WGA. On comparing with the wild type, double point mutated WGA (WGA3) exhibits increased specificity towards sialylgalactose, and thus, it can be effectively used in targeted drug delivery and as biological cell marker in cancer therapeutics. Copyright © 2014 John Wiley & Sons, Ltd.

Double binding energy differences: Mean-field or pairing effect?

NASA Astrophysics Data System (ADS)

Qi, Chong

2012-10-01

In this Letter we present a systematic analysis on the average interaction between the last protons and neutrons in atomic nuclei, which can be extracted from the double differences of nuclear binding energies. The empirical average proton-neutron interaction Vpn thus derived from experimental data can be described in a very simple form as the interplay of the nuclear mean field and the pairing interaction. It is found that the smooth behavior as well as the local fluctuations of the Vpn in even-even nuclei with N ≠ Z are dominated by the contribution from the proton-neutron monopole interactions. A strong additional contribution from the isoscalar monopole interaction and isovector proton-neutron pairing interaction is seen in the Vpn for even-even N = Z nuclei and for the adjacent odd-A nuclei with one neutron or proton being subtracted.

Accurate determination of the binding energy of the formic acid dimer: The importance of geometry relaxation

NASA Astrophysics Data System (ADS)

Kalescky, Robert; Kraka, Elfi; Cremer, Dieter

2014-02-01

The formic acid dimer in its C2h-symmetrical cyclic form is stabilized by two equivalent H-bonds. The currently accepted interaction energy is 18.75 kcal/mol whereas the experimental binding energy D0 value is only 14.22 ±0.12 kcal/mol [F. Kollipost, R. W. Larsen, A. V. Domanskaya, M. Nörenberg, and M. A. Suhm, J. Chem. Phys. 136, 151101 (2012)]. Calculation of the binding energies De and D0 at the CCSD(T) (Coupled Cluster with Single and Double excitations and perturbative Triple excitations)/CBS (Complete Basis Set) level of theory, utilizing CCSD(T)/CBS geometries and the frequencies of the dimer and monomer, reveals that there is a 3.2 kcal/mol difference between interaction energy and binding energy De, which results from (i) not relaxing the geometry of the monomers upon dissociation of the dimer and (ii) approximating CCSD(T) correlation effects with MP2. The most accurate CCSD(T)/CBS values obtained in this work are De = 15.55 and D0 = 14.32 kcal/mol where the latter binding energy differs from the experimental value by 0.1 kcal/mol. The necessity of employing augmented VQZ and VPZ calculations and relaxing monomer geometries of H-bonded complexes upon dissociation to obtain reliable binding energies is emphasized.

Energy and structure of bonds in the interaction of organic anions with layered double hydroxide nanosheets: A molecular dynamics study

NASA Astrophysics Data System (ADS)

Tsukanov, A. A.; Psakhie, S. G.

2016-01-01

The application of hybrid and hierarchical nanomaterials based on layered hydroxides and oxyhydroxides of metals is a swiftly progressing field in biomedicine. Layered double hydroxides (LDH) possess a large specific surface area, significant surface electric charge and biocompatibility. Their physical and structural properties enable them to adsorb various kinds of anionic species and to transport them into cells. However, possible side effects resulting from the interaction of LDH with anions of the intercellular and intracellular medium need to be considered, since such interaction can potentially disrupt ion transport, signaling processes, apoptosis, nutrition and proliferation of living cells. In the present paper molecular dynamics is used to determine the energies of interaction of organic anions (aspartic acid, glutamic acid and bicarbonate) with a fragment of layered double hydroxide Mg/Al-LDH. The average number of hydrogen bonds between the anions and the hydroxide surface and characteristic binding configurations are determined. Possible effects of LDH on the cell resulting from binding of protein fragments and replacement of native intracellular anions with delivered anions are considered.

A comparative study on the binding of single and double chain surfactant-cobalt(III) complexes with bovine serum albumin

NASA Astrophysics Data System (ADS)

Vignesh, G.; Sugumar, K.; Arunachalam, S.; Vignesh, S.; Arthur James, R.

2013-09-01

The comparative binding effect of single and double aliphatic chain containing surfactant-cobalt(III) complexes cis-[Co(bpy)2(DA)2](ClO4)3ṡ2H2O (1), cis-[Co(bpy)2(DA)Cl](ClO4)2ṡ2H2O (2), cis-[Co(phen)2(CA)2](ClO4)3ṡ2H2O (3), and cis-[Co(phen)2(CA)Cl](ClO4)2ṡ2H2O (4) with bovine serum albumin (BSA) under physiological condition was analyzed by steady state, time resolved fluorescence, synchronous, three-dimensional fluorescence, UV-Visible absorption and circular dichroism spectroscopic techniques. The results show that these complexes cause the fluorescence quenching of BSA through a static mechanism. The binding constants (Kb) and the number of binding sites were calculated and binding constant values are found in the range of 104-105 M-1. The results indicate that compared to single chain complex, double chain surfactant-cobalt(III) complex interacts strongly with BSA. Also the sign of thermodynamic parameters (ΔG°, ΔH°, and ΔS°) indicate that all the complexes interact with BSA through hydrophobic force. The binding distance (r) between complexes and BSA was calculated using Förster non-radiation energy transfer theory and found to be less than 7 nm. The results of synchronous, three dimensional fluorescence and circular dichroism spectroscopic methods indicate that the double chain surfactant-cobalt(III) complexes changed the conformation of the protein considerably than the respective single chain surfactant-cobalt(III) complexes. Antimicrobial studies of the complexes showed good activities against pathogenic microorganisms.

Interactions of Ku70/80 with Double-Strand DNA: Energetic, Dynamics, and Functional Implications

NASA Technical Reports Server (NTRS)

Hu, Shaowen; Cucinotta, Francis A.

2010-01-01

Space radiation is a proficient inducer of DNA damage leading to mutation, aberrant cell signaling, and cancer formation. Ku is among the first responding proteins in nucleus to recognize and bind the DNA double strand breaks (DSBs) whenever they are introduced. Once loaded Ku works as a scaffold to recruit other repair factors of non-homologous end joining and facilitates the following repair processes. The crystallographic study of the Ku70/80 heterodimer indicate the core structure of this protein shows virtually no conformational change after binding with DNA. To investigate the dynamical features as well as the energetic characteristics of Ku-DNA binding, we conduct multi-nanosecond molecular dynamics simulations of a modeled Ku70/80 structure and several complexes with two 24-bp DNA duplexes. Free energy calculations show significant energy differences between the complexes with Ku bound at DSBs and those with Ku associated at an internal site of a chromosome. The results also reveal detailed interactions between different nucleotides and the amino acids along the DNA-binding cradle of Ku, indicating subtle binding preference of Ku at specific DNA sequences. The covariance matrix analyses along the trajectories demonstrate the protein is stimulated to undergo correlated motions of different domains once bound to DNA ends. Additionally, principle component analyses identify these low frequency collective motions suitable for binding with and translocation along duplex DNA. It is proposed that the modification of dynamical properties of Ku upon binding with DSBs may provide a signal for the further recruitment of other repair factors such as DNA-PKcs, XLF, and XRCC4.

Structures of Aln (n= 27, 28, 29, and 30) clusters with double-tetrahedron structures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, W.; Lu, W. C.; Sun, J.

2008-01-31

Global search for lowest-energy structures of neutral aluminum clusters Al{sub n} (n = 27, 28, 29 and 30) was performed using a genetic algorithm (GA) coupled with a tight-binding (TB) method. Structural candidates obtained from our GA search were further optimized with first-principles calculations. It is found that the medium-sized aluminum clusters Al{sub 27} to Al{sub 30} favor double-tetrahedron structures.

Probing the origin of structural stability of single and double stapled p53 peptide analogs bound to MDM2.

PubMed

Guo, Zuojun; Streu, Kristina; Krilov, Goran; Mohanty, Udayan

2014-06-01

The stabilization of secondary structure is believed to play an important role in the peptide-protein binding interaction. In this study, the α-helical conformation and structural stability of single and double stapled all-hydrocarbon cross-linked p53 peptides when bound and unbound to MDM2 are investigated. We determined the effects of the peptide sequence, the stereochemistry of the cross-linker, the conformation of the double bond in the alkene bridge, and the length of the bridge, to the relative stability of the α-helix structure. The binding affinity calculations by WaterMap provided over one hundred hydration sites in the MDM2 binding pocket where water density is greater than twice that of the bulk, and the relative value of free energy released by displacing these hydration sites. In agreement with the experimental data, potentials of mean force obtained by weighted histogram analysis methods indicated the order of peptides from lowest to highest binding affinity. Our study provides a comprehensive rationalization of the relationship between peptide stapling strategy, the secondary structural stability, and the binding affinity of p53/MDM2 complex. We hope our efforts can help to further the development of a new generation p53/MDM2 inhibitors that can reactivate the function of p53 as tumor suppressor gene. © 2014 John Wiley & Sons A/S.

Advances in free-energy-based simulations of protein folding and ligand binding.

PubMed

Perez, Alberto; Morrone, Joseph A; Simmerling, Carlos; Dill, Ken A

2016-02-01

Free-energy-based simulations are increasingly providing the narratives about the structures, dynamics and biological mechanisms that constitute the fabric of protein science. Here, we review two recent successes. It is becoming practical: first, to fold small proteins with free-energy methods without knowing substructures and second, to compute ligand-protein binding affinities, not just their binding poses. Over the past 40 years, the timescales that can be simulated by atomistic MD are doubling every 1.3 years--which is faster than Moore's law. Thus, these advances are not simply due to the availability of faster computers. Force fields, solvation models and simulation methodology have kept pace with computing advancements, and are now quite good. At the tip of the spear recently are GPU-based computing, improved fast-solvation methods, continued advances in force fields, and conformational sampling methods that harness external information. Copyright © 2015 Elsevier Ltd. All rights reserved.

Complexes of dipolar excitons in layered quasi-two-dimensional nanostructures

NASA Astrophysics Data System (ADS)

Bondarev, Igor V.; Vladimirova, Maria R.

2018-04-01

We discuss neutral and charged complexes (biexcitons and trions) formed by indirect excitons in layered quasi-two-dimensional semiconductor heterostructures. Indirect excitons—long-lived neutral Coulomb-bound pairs of electrons and holes of different layers—have been known for semiconductor coupled quantum wells and have recently been reported for van der Waals heterostructures such as double bilayer graphene and transition-metal dichalcogenides. Using the configuration space approach, we derive the analytical expressions for the trion and biexciton binding energies as a function of interlayer distance. The method captures essential kinematics of complex formation to reveal significant binding energies, up to a few tens of meV for typical interlayer distances ˜3 -5 Å , with the trion binding energy always being greater than that of the biexciton. Our results can contribute to the understanding of more complex many-body phenomena such as exciton Bose-Einstein condensation and Wigner-like electron-hole crystallization in layered semiconductor heterostructures.

Effect of subband mixing on the energy levels of a hydrogenic impurity in a GaAs/Ga1-xAlxAs double quantum well in a magnetic field

NASA Astrophysics Data System (ADS)

Nguyen, N.; Ranganathan, R.; McCombe, B. D.; Rustgi, M. L.

1992-05-01

In view of the recent evidence found in favor of subband mixing in coupling of confined impurity states in doped double-quantum-well structures, a variational approach employing Gaussian trial wave functions has been used to calculate the binding energies of the ground, (1s, m=0) and first excited, (2p-, m=-1) states of a hydrogenic donor associated with the mixture of subbands of a double-GaAs quantum well coupled by a layer of Ga1-xA1xAs in the presence of a magnetic field. Two different well sizes and three different locations of the impurity, (A) at the outer edge, (B) at the center, and (C) at the inner edge of the well, are considered, and the barrier width is allowed to vary. It is found that for the structures considered here the results from the calculations using the mixture of only first (symmetric) and second (asymmetric) subbands are significantly different from those using only the lowest (symmetric) subband, especially for the intermediate barrier widths, and depend strongly on the location of the impurity in the well. These results demonstrate that subband mixing should be included in double-quantum-well structure calculations. The effect of varying the magnetic field on the binding energies is also studied. A comparison with the measurements of Ranganathan et al. [Phys. Rev. B 44, 1423 (1991)] demonstrates that the agreement is not improved when mixing of subbands higher than the lowest two is included in the calculation.

Distinguishing Binders from False Positives by Free Energy Calculations: Fragment Screening Against the Flap Site of HIV Protease

PubMed Central

2015-01-01

Molecular docking is a powerful tool used in drug discovery and structural biology for predicting the structures of ligand–receptor complexes. However, the accuracy of docking calculations can be limited by factors such as the neglect of protein reorganization in the scoring function; as a result, ligand screening can produce a high rate of false positive hits. Although absolute binding free energy methods still have difficulty in accurately rank-ordering binders, we believe that they can be fruitfully employed to distinguish binders from nonbinders and reduce the false positive rate. Here we study a set of ligands that dock favorably to a newly discovered, potentially allosteric site on the flap of HIV-1 protease. Fragment binding to this site stabilizes a closed form of protease, which could be exploited for the design of allosteric inhibitors. Twenty-three top-ranked protein–ligand complexes from AutoDock were subject to the free energy screening using two methods, the recently developed binding energy analysis method (BEDAM) and the standard double decoupling method (DDM). Free energy calculations correctly identified most of the false positives (≥83%) and recovered all the confirmed binders. The results show a gap averaging ≥3.7 kcal/mol, separating the binders and the false positives. We present a formula that decomposes the binding free energy into contributions from the receptor conformational macrostates, which provides insights into the roles of different binding modes. Our binding free energy component analysis further suggests that improving the treatment for the desolvation penalty associated with the unfulfilled polar groups could reduce the rate of false positive hits in docking. The current study demonstrates that the combination of docking with free energy methods can be very useful for more accurate ligand screening against valuable drug targets. PMID:25189630

Microsolvation of Fluoromethane.

PubMed

Rosenberg, Robert E

2016-09-29

Fluorinated organic compounds are ubiquitous in the pharmaceutical and agricultural industries. To better discern the mode of action of these compounds, it is critical to understand the potential for and strength of hydrogen bonds involving fluorine. It is known that CH3F forms a hydrogen bond with H2O in the gas phase but does not dissolve in bulk water. This paper examines CH3F surrounded by one to six water molecules. For systems of similar topologies, CH3F formed hydrogen bonds of nearly the same strength as water. Although CH3F can bind to a second water cluster with only a modest loss in binding energy, it must bind to these clusters as a double hydrogen bond acceptor. This means that CH3F cannot form a low-energy cyclic 2D hydrogen bonding network with water molecules, which limits its solubility in bulk water. However, CH3F should be able to bind to the periphery of small hydrogen bonding networks. These conclusions were not appreciably altered by SMD calculations. A more complete consideration of solvation, especially entropic effects, was not undertaken. Data for geometries, population changes, and vibrational frequency shifts were also analyzed and compared to binding energies.

Excitons in coupled type-II double quantum wells under electric and magnetic fields: InAs/AlSb/GaSb

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lyo, S. K., E-mail: sklyo@uci.edu; Pan, W.

2015-11-21

We calculate the wave functions and the energy levels of an exciton in double quantum wells under electric (F) and magnetic (B) fields along the growth axis. The result is employed to study the energy levels, the binding energy, and the boundary on the F–B plane of the phase between the indirect exciton ground state and the semiconductor ground state for several typical structures of the type-II quasi-two-dimensional quantum wells such as InAs/AlSb/GaSb. The inter-well inter-band radiative transition rates are calculated for exciton creation and recombination. We find that the rates are modulated over several orders of magnitude by themore » electric and magnetic fields.« less

Characterization of the functional role of Asp141, Asp194, and Asp464 residues in the Mn2+-L-malate binding of pigeon liver malic enzyme.

PubMed

Chou, W Y; Chang, H P; Huang, C H; Kuo, C C; Tong, L; Chang, G G

2000-02-01

Pigeon liver malic enzyme was inactivated and cleaved at Asp141, Asp194, and Asp464 by the Cu2+-ascorbate system in acidic environment. Site-specific mutagenesis was performed at these putative metal-binding sites. Three point mutants, D141N, D194N, and D464N; three double mutants, D(141,194)N, D(194,464)N, and D(141,464)N; and a triple mutant, D(141,194,464)N; as well as the wild-type malic enzyme (WT) were successfully cloned and expressed in Escherichia coli cells. All recombinant enzymes, except the triple mutant, were purified to apparent homogeneity by successive Q-Sepharose and adenosine-2',5'-bisphosphate-agarose columns. The mutants showed similar apparent Km,NADP values to that of the WT. The Km,Mal value was increased in the D141N and D194N mutants. The Km,Mn value, on the other hand, was increased only in the D141N mutant by 14-fold, corresponding to approximately 1.6 kcal/mol for the Asp141-Mn2+ binding energy. Substrate inhibition by L-malate was only observed in WT, D464N, and D(141,464)N. Initial velocity experiments were performed to derive the various kinetic parameters. The possible interactions between Asp141, Asp194, and Asp464 were analyzed by the double-mutation cycles and triple-mutation box. There are synergistic weakening interactions between Asp141 and Asp194 in the metal binding that impel the D(141,194)N double mutant to an overall specificity constant [k(cat)/(Kd,Mn Km,Mal Km,NADP)] at least four orders of magnitude smaller than the WT value. This difference corresponds to an increase of 6.38 kcal/mol energy barrier for the catalytic efficiency. Mutation at Asp464, on the other hand, has partial additivity on the mutations at Asp141 and Asp194. The overall specificity constants for the double mutants D(194,464)N and D(141,464)N or the triple mutant D(141,194,464)N were decreased by only 10- to 100-fold compared to the WT. These results strongly suggest the involvement of Asp141 in the Mn2+-L-malate binding for the pigeon liver malic enzyme. The Asp194 and Asp464, which may be oxidized by nonspecific binding of Cu2+, are involved in the Mn2+-L-malate binding or catalysis indirectly by modulating the binding affinity of Asp141 with the Mn2+.

Character of intermolecular interaction in pyridine-argon complex: Ab initio potential energy surface, internal dynamics, and interrelations between SAPT energy components.

PubMed

Makarewicz, Jan; Shirkov, Leonid

2016-05-28

The pyridine-Ar (PAr) van der Waals (vdW) complex is studied using a high level ab initio method. Its structure, binding energy, and intermolecular vibrational states are determined from the analytical potential energy surface constructed from interaction energy (IE) values computed at the coupled cluster level of theory with single, double, and perturbatively included triple excitations with the augmented correlation consistent polarized valence double-ζ (aug-cc-pVDZ) basis set complemented by midbond functions. The structure of the complex at its global minimum with Ar at a distance of 3.509 Å from the pyridine plane and shifted by 0.218 Å from the center of mass towards nitrogen agrees well with the corresponding equilibrium structure derived previously from the rotational spectrum of PAr. The PAr binding energy De of 392 cm(-1) is close to that of 387 cm(-1) calculated earlier at the same ab initio level for the prototypical benzene-Ar (BAr) complex. However, under an extension of the basis set, De for PAr becomes slightly lower than De for BAr. The ab initio vdW vibrational energy levels allow us to estimate the reliability of the methods for the determination of the vdW fundamentals from the rotational spectra. To disclose the character of the intermolecular interaction in PAr, the symmetry-adapted perturbation theory (SAPT) is employed for the analysis of different physical contributions to IE. It is found that SAPT components of IE can be approximately expressed in the binding region by only two of them: the exchange repulsion and dispersion energy. The total induction effect is negligible. The interrelations between various SAPT components found for PAr are fulfilled for a few other complexes involving aromatic molecules and Ar or Ne, which indicates that they are valid for all rare gas (Rg) atoms and aromatics.

Coupled-cluster and explicitly correlated perturbation-theory calculations of the uracil anion.

PubMed

Bachorz, Rafał A; Klopper, Wim; Gutowski, Maciej

2007-02-28

A valence-type anion of the canonical tautomer of uracil has been characterized using explicitly correlated second-order Moller-Plesset perturbation theory (RI-MP2-R12) in conjunction with conventional coupled-cluster theory with single, double, and perturbative triple excitations. At this level of electron-correlation treatment and after inclusion of a zero-point vibrational energy correction, determined in the harmonic approximation at the RI-MP2 level of theory, the valence anion is adiabatically stable with respect to the neutral molecule by 40 meV. The anion is characterized by a vertical detachment energy of 0.60 eV. To obtain accurate estimates of the vertical and adiabatic electron binding energies, a scheme was applied in which electronic energy contributions from various levels of theory were added, each of them extrapolated to the corresponding basis-set limit. The MP2 basis-set limits were also evaluated using an explicitly correlated approach, and the results of these calculations are in agreement with the extrapolated values. A remarkable feature of the valence anionic state is that the adiabatic electron binding energy is positive but smaller than the adiabatic electron binding energy of the dipole-bound state.

Theoretical structures and binding energies of RNA-RNA/cyanine dyes and spectroscopic properties of cyanine dyes

NASA Astrophysics Data System (ADS)

Salaeh, Salsabila; Chong, Wei Lim; Dokmaisrijan, Supaporn; Payaka, Apirak; Yana, Janchai; Nimmanpipug, Piyarat; Lee, Vannajan Sanghiran; Dumri, Kanchana; Anh, Dau Hung

2014-10-01

Cyanine dyes have been widely used as a fluorescence probe for biomolecules and protein labeling. The mostly used cyanine dyes for nucleic acids labeling are DiSC2(3), DiSC2(5), and DiSC2(7). The possible structures and binding energies of RNA-RNA/Cyanine dyes were predicted theoretically using AutoDock Vina. The results showed that cyanine dyes and bases of RNA-RNA have the van der Waals and pi-pi interactions. The maximum absorption wavelength in the visible region obtained from the TD-DFT calculations of all cyanine dyes in the absence of the RNA-RNA double strand showed the bathochromic shift.

Superfluidity of dipolar excitons in a transition metal dichalcogenide double layer

NASA Astrophysics Data System (ADS)

Berman, Oleg L.; Kezerashvili, Roman Ya.

2017-09-01

We study formation and superfluidity of dipolar excitons in double layer heterostructures formed by two transition metal dichalcogenide (TMDC) atomically thin layers. Considering screening effects for an electron-hole interaction via the harmonic oscillator approximation for the Keldysh potential, the analytical expressions for the exciton energy spectrum and the mean field critical temperature Tc for the superfluidity are obtained. It is shown that binding energies of A excitons are larger than for B excitons. The mean field critical temperature for a two-component dilute exciton system in a TMDC double layer is analyzed and shown that the latter is an increasing function of the factor Q , determined by the effective masses of A and B excitons and their reduced mass. Comparison of the calculations for Tc performed by employing the Coulomb and Keldysh interactions demonstrates the importance of screening effects in TMDC.

Evaluation of B3LYP, X3LYP, and M06-Class Density Functionals for Predicting the Binding Energies of Neutral, Protonated, and Deprotonated Water Clusters.

PubMed

Bryantsev, Vyacheslav S; Diallo, Mamadou S; van Duin, Adri C T; Goddard, William A

2009-04-14

In this paper we assess the accuracy of the B3LYP, X3LYP, and newly developed M06-L, M06-2X, and M06 functionals to predict the binding energies of neutral and charged water clusters including (H2O)n, n = 2-8, 20), H3O(+)(H2O)n, n = 1-6, and OH(-)(H2O)n, n = 1-6. We also compare the predicted energies of two ion hydration and neutralization reactions on the basis of the calculated binding energies. In all cases, we use as benchmarks calculated binding energies of water clusters extrapolated to the complete basis set limit of the second-order Møller-Plesset perturbation theory with the effects of higher order correlation estimated at the coupled-cluster theory with single, double, and perturbative triple excitations in the aug-cc-pVDZ basis set. We rank the accuracy of the functionals on the basis of the mean unsigned error (MUE) between calculated benchmark and density functional theory energies. The corresponding MUE (kcal/mol) for each functional is listed in parentheses. We find that M06-L (0.73) and M06 (0.84) give the most accurate binding energies using very extended basis sets such as aug-cc-pV5Z. For more affordable basis sets, the best methods for predicting the binding energies of water clusters are M06-L/aug-cc-pVTZ (1.24), B3LYP/6-311++G(2d,2p) (1.29), and M06/aug-cc-PVTZ (1.33). M06-L/aug-cc-pVTZ also gives more accurate energies for the neutralization reactions (1.38), whereas B3LYP/6-311++G(2d,2p) gives more accurate energies for the ion hydration reactions (1.69).

In silico molecular docking analysis of the human Argonaute 2 PAZ domain reveals insights into RNA interference.

PubMed

Kandeel, Mahmoud; Kitade, Yukio

2013-07-01

RNA interference (RNAi) is a critical cellular pathway activated by double stranded RNA and regulates the gene expression of target mRNA. During RNAi, the 3' end of siRNA binds with the PAZ domain, followed by release and rebinding in a cyclic manner, which deemed essential for proper gene silencing. Recently, we provided the forces underlying the recognition of small interfering RNA by PAZ in a computational study based on the structure of Drosophila Argonaute 2 (Ago2) PAZ domain. We have now reanalyzed these data within the view of the new available structures from human Argonauts. While the parameters of weak binding are correlated with higher (RNAi) in the Drosophila model, a different profile is predicted with the human Ago2 PAZ domain. On the basis of the human Ago2 PAZ models, the indicators of stronger binding as the total binding energy and the free energy were associated with better RNAi efficacy. This discrepancy might be attributable to differences in the binding site topology and the difference in the conformation of the bound nucleotides.

Gold catalyzed double condensation reaction: Synthesis, antimicrobial and cytotoxicity of spirooxindole derivatives.

PubMed

Parthasarathy, K; Praveen, Chandrasekar; Jeyaveeran, J C; Prince, A A M

2016-09-01

Microwave assisted synthesis of spirooxindoles via tandem double condensation between isatins and 4-hydroxycoumarin under gold catalysis is reported. The reaction is practical to perform, since the products can be isolated by simple filtration without requiring tedious column chromatography. The scope of this chemistry is exemplified by preparing structurally diverse spirooxindoles (22 examples) in excellent yields. Antimicrobial evaluation of the synthesized compounds revealed that three compounds (3a, 3f and 3s) exhibited significant MIC values in comparison to the standard drugs. Molecular docking studies of these compounds with AmpC-β-lactamase receptor revealed that 3a exhibited minimum binding energy (-117.819kcal/mol) indicating its strong affinity towards amino acid residues via strong hydrogen bond interaction. All compounds were also evaluated for their in vitro cytotoxicity against COLO320 cancer cells. Biological assay and molecular docking studies demonstrated that 3g is the most active compound in terms of its low IC50 value (50.0μM) and least free energy of binding (-8.99kcal/mol) towards CHK1 receptor, respectively. Copyright © 2016 Elsevier Ltd. All rights reserved.

Visualizing repetitive diffusion activity of double-strand RNA binding proteins by single molecule fluorescence assays.

PubMed

Koh, Hye Ran; Wang, Xinlei; Myong, Sua

2016-08-01

TRBP, one of double strand RNA binding proteins (dsRBPs), is an essential cofactor of Dicer in the RNA interference pathway. Previously we reported that TRBP exhibits repetitive diffusion activity on double strand (ds)RNA in an ATP independent manner. In the TRBP-Dicer complex, the diffusion mobility of TRBP facilitates Dicer-mediated RNA cleavage. Such repetitive diffusion of dsRBPs on a nucleic acid at the nanometer scale can be appropriately captured by several single molecule detection techniques. Here, we provide a step-by-step guide to four different single molecule fluorescence assays by which the diffusion activity of dsRBPs on dsRNA can be detected. One color assay, termed protein induced fluorescence enhancement enables detection of unlabeled protein binding and diffusion on a singly labeled RNA. Two-color Fluorescence Resonance Energy Transfer (FRET) in which labeled dsRBPs is applied to labeled RNA, allows for probing the motion of protein along the RNA axis. Three color FRET reports on the diffusion movement of dsRBPs from one to the other end of RNA. The single molecule pull down assay provides an opportunity to collect dsRBPs from mammalian cells and examine the protein-RNA interaction at single molecule platform. Copyright © 2016 Elsevier Inc. All rights reserved.

Circular dichroism spectroscopic investigation of double-decker phthalocyanine with G-Quadruplex as promising telomerase inhibitor

NASA Astrophysics Data System (ADS)

Baǧda, Efkan; Baǧda, Esra; Yabaş, Ebru

2017-01-01

In the present study, interaction of a double-decker phthalocyanine with two G-quadruplex DNA, Tel 21 and cMYC, was investigated. To the best of our knowledge, this is the first study about G-quadruplex-double decker phthalocyanine interaction. The spectrophotometric titration method was used for binding constant calculations. From the binding constants, it can be said that double-decker phthalocyanine more likely to bind Tel 21 rather than cMYC. The conformational changes upon binding were monitored via circular dichroism spectroscopy. The ethidium bromide replacement assay was investigated spectrofluorometrically.

Stability of hydrogenated graphene: a first-principles study

DOE PAGES

Yi, Ding; Yang, Liu; Xie, Shijie; ...

2015-02-10

In order to explain the disagreement between present theoretical and experimental investigations on the stability of hydrogenated graphene, we have systematically studied hydrogenated graphene with different configurations from the consideration of single-side and double-side adsorption using first-principles calculations. Both binding energy and formation energy are calculated to characterize the stability of the system. It is found that single-side hydrogenated graphene is always unstable. However, for double-side hydrogenation, some configurations are stable due to the increased carbon–carbon sp 3 hybridization compared to single-side hydrogenation. Furthermore, it is found that the system is energetically favorable when an equal number of hydrogen atomsmore » are adsorbed on each side of the graphene.« less

The Dawn of Lead-Free Perovskite Solar Cell: Highly Stable Double Perovskite Cs2AgBiBr6 Film.

PubMed

Wu, Cuncun; Zhang, Qiaohui; Liu, Yang; Luo, Wei; Guo, Xuan; Huang, Ziru; Ting, Hungkit; Sun, Weihai; Zhong, Xinrui; Wei, Shiyuan; Wang, Shufeng; Chen, Zhijian; Xiao, Lixin

2018-03-01

Recently, lead-free double perovskites have emerged as a promising environmentally friendly photovoltaic material for their intrinsic thermodynamic stability, appropriate bandgaps, small carrier effective masses, and low exciton binding energies. However, currently no solar cell based on these double perovskites has been reported, due to the challenge in film processing. Herein, a first lead-free double perovskite planar heterojunction solar cell with a high quality Cs 2 AgBiBr 6 film, fabricated by low-pressure assisted solution processing under ambient conditions, is reported. The device presents a best power conversion efficiency of 1.44%. The preliminary efficiency and the high stability under ambient condition without encapsulation, together with the high film quality with simple processing, demonstrate promise for lead-free perovskite solar cells.

Impact of resistance mutations on inhibitor binding to HIV-1 integrase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Qi; Buolamwini, John K.; Smith, Jeremy C.

2013-11-08

Here, HIV-1 integrase (IN) is essential for HIV-1 replication, catalyzing two key reaction steps termed 3' processing and strand transfer. Therefore, IN has become an important target for antiviral drug discovery. However, mutants have emerged, such as E92Q/N155H and G140S/Q148H, which confer resistance to raltegravir (RAL), the first IN strand transfer inhibitor (INSTI) approved by the FDA, and to the recently approved elvitegravir (EVG). To gain insights into the molecular mechanisms of ligand binding and drug resistance, we performed molecular dynamics (MD) simulations of homology models of the HIV-1 IN and four relevant mutants complexed with viral DNA and RAL.more » The results show that the structure and dynamics of the 140s loop, comprising residues 140 to 149, are strongly influenced by the IN mutations. In the simulation of the G140S/Q148H double mutant, we observe spontaneous dissociation of RAL from the active site, followed by an intrahelical swing-back of the 3' -OH group of nucleotide A17, consistent with the experimental observation that the G140S/Q148H mutant exhibits the highest resistance to RAL compared to other IN mutants. An important hydrogen bond between residues 145 and 148 is present in the wild-type IN but not in the G140S/Q148H mutant, accounting for the structural and dynamical differences of the 140s' loop and ultimately impairing RAL binding in the double mutant. End-point free energy calculations that broadly capture the experimentally known RAL binding profiles elucidate the contributions of the 140s' loop to RAL binding free energies and suggest possible approaches to overcoming drug resistance.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Makarewicz, Jan, E-mail: jama@amu.edu.pl; Shirkov, Leonid

The pyridine-Ar (PAr) van der Waals (vdW) complex is studied using a high level ab initio method. Its structure, binding energy, and intermolecular vibrational states are determined from the analytical potential energy surface constructed from interaction energy (IE) values computed at the coupled cluster level of theory with single, double, and perturbatively included triple excitations with the augmented correlation consistent polarized valence double-ζ (aug-cc-pVDZ) basis set complemented by midbond functions. The structure of the complex at its global minimum with Ar at a distance of 3.509 Å from the pyridine plane and shifted by 0.218 Å from the center ofmore » mass towards nitrogen agrees well with the corresponding equilibrium structure derived previously from the rotational spectrum of PAr. The PAr binding energy D{sub e} of 392 cm{sup −1} is close to that of 387 cm{sup −1} calculated earlier at the same ab initio level for the prototypical benzene-Ar (BAr) complex. However, under an extension of the basis set, D{sub e} for PAr becomes slightly lower than D{sub e} for BAr. The ab initio vdW vibrational energy levels allow us to estimate the reliability of the methods for the determination of the vdW fundamentals from the rotational spectra. To disclose the character of the intermolecular interaction in PAr, the symmetry-adapted perturbation theory (SAPT) is employed for the analysis of different physical contributions to IE. It is found that SAPT components of IE can be approximately expressed in the binding region by only two of them: the exchange repulsion and dispersion energy. The total induction effect is negligible. The interrelations between various SAPT components found for PAr are fulfilled for a few other complexes involving aromatic molecules and Ar or Ne, which indicates that they are valid for all rare gas (Rg) atoms and aromatics.« less

Noncovalent Interactions of DNA Bases with Naphthalene and Graphene.

PubMed

Cho, Yeonchoo; Min, Seung Kyu; Yun, Jeonghun; Kim, Woo Youn; Tkatchenko, Alexandre; Kim, Kwang S

2013-04-09

The complexes of a DNA base bound to graphitic systems are studied. Considering naphthalene as the simplest graphitic system, DNA base-naphthalene complexes are scrutinized at high levels of ab initio theory including coupled cluster theory with singles, doubles, and perturbative triples excitations [CCSD(T)] at the complete basis set (CBS) limit. The stacked configurations are the most stable, where the CCSD(T)/CBS binding energies of guanine, adenine, thymine, and cytosine are 9.31, 8.48, 8.53, 7.30 kcal/mol, respectively. The energy components are investigated using symmetry-adapted perturbation theory based on density functional theory including the dispersion energy. We compared the CCSD(T)/CBS results with several density functional methods applicable to periodic systems. Considering accuracy and availability, the optB86b nonlocal functional and the Tkatchenko-Scheffler functional are used to study the binding energies of nucleobases on graphene. The predicted values are 18-24 kcal/mol, though many-body effects on screening and energy need to be further considered.

Structures of p -shell double-Λ hypernuclei studied with microscopic cluster models

NASA Astrophysics Data System (ADS)

Kanada-En'yo, Yoshiko

2018-03-01

0 s -orbit Λ states in p -shell double-Λ hypernuclei (Z Λ Λ A ), Li Λ Λ 8 , Li Λ Λ 9 , Be Λ Λ 10 ,11 ,12 , B Λ Λ 12 ,13 , and C Λ Λ 14 are investigated. Microscopic cluster models are applied to core nuclear part and a potential model is adopted for Λ particles. The Λ -core potential is a folding potential obtained with effective G -matrix Λ -N interactions, which reasonably reproduce energy spectra of Z Λ A -1 . System dependence of the Λ -Λ binding energies is understood by the core polarization energy from nuclear size reduction. Reductions of nuclear sizes and E 2 transition strengths by Λ particles are also discussed.

Chelating effect in short polymers for the design of bidentate binders of increased affinity and selectivity

PubMed Central

Fortuna, Sara; Fogolari, Federico; Scoles, Giacinto

2015-01-01

The design of new strong and selective binders is a key step towards the development of new sensing devices and effective drugs. Both affinity and selectivity can be increased through chelation and here we theoretically explore the possibility of coupling two binders through a flexible linker. We prove the enhanced ability of double binders of keeping their target with a simple model where a polymer composed by hard spheres interacts with a spherical macromolecule, such as a protein, through two sticky spots. By Monte Carlo simulations and thermodynamic integration we show the chelating effect to hold for coupling polymers whose radius of gyration is comparable to size of the chelated particle. We show the binding free energy of flexible double binders to be higher than that of two single binders and to be maximized when the binding sites are at distances comparable to the mean free polymer end-to-end distance. The affinity of two coupled binders is therefore predicted to increase non linearly and in turn, by targeting two non-equivalent binding sites, this will lead to higher selectivity. PMID:26496975

High-resolution photoluminescence spectroscopy of Sn-doped ZnO single crystals

DOE PAGES

Kumar, E. Senthil; Mohammadbeigi, F.; Boatner, Lynn A.; ...

2016-01-01

Here, Group IV donors in ZnO are poorly understood, despite evidence that they are effective n-dopants. We present high-resolution photoluminescence spectroscopy studies of unintentionally doped and Sn doped ZnO single crystals grown by the chemical vapor transport method. Doped samples showed greatly increased emission from the I10 bound exciton transition which was recently proven to be related to the incorporation of Sn impurities based on radio-isotope studies. PL linewidths are exceptionally sharp for these samples, enabling clear identification of several donor species. Temperature dependent PL measurements of the I10 line emission energy and intensity dependence reveal a behavior similar tomore » other shallow donors in ZnO. Ionized donor bound exciton and two electron satellite transitions of the I10 transition are unambiguously identified and yield a donor binding energy of 71 meV. In contrast to recent reports of Ge-related donors in ZnO, the spectroscopic binding energy for the Sn-related donor bound exciton follows a linear relationship with donor binding energy (Haynes rule), confirming the shallow nature of this defect center, which we attribute to a SnZn double donor compensated by an unknown single acceptor.« less

On Mass Polarization Effect in Three-Body Nuclear Systems

NASA Astrophysics Data System (ADS)

Filikhin, I.; Kezerashvili, R. Ya.; Suslov, V. M.; Vlahovic, B.

2018-05-01

The mass polarization effect is considered for different three-body nuclear AAB systems having a strongly bound AB and unbound AA subsystems. We employ the Faddeev equations for calculations and the Schrödinger equation for analysis of the contribution of the mass polarization term of the kinetic-energy operator. For a three-boson system the mass polarization effect is determined by the difference of the doubled binding energy of the AB subsystem 2E2 and the three-body binding energy E3(V_{AA}=0) when the interaction between the identical particles is omitted. In this case: | E3(V_{AA}=0)| >2| E2| . In the case of a system complicated by isospins(spins), such as the kaonic clusters K-K-p and ppK-, a similar evaluation is impossible. For these systems it is found that | E3(V_{AA}=0)| <2| E2| . A model with an AB potential averaged over spin(isospin) variables transforms the latter case to the first one. The mass polarization effect calculated within this model is essential for the kaonic clusters. In addition we have obtained the relation |E_3|≤|2E_2| for the binding energy of the kaonic clusters.

The Dawn of Lead‐Free Perovskite Solar Cell: Highly Stable Double Perovskite Cs2AgBiBr6 Film

PubMed Central

Wu, Cuncun; Zhang, Qiaohui; Liu, Yang; Luo, Wei; Guo, Xuan; Huang, Ziru; Ting, Hungkit; Sun, Weihai; Zhong, Xinrui; Wei, Shiyuan

2017-01-01

Abstract Recently, lead‐free double perovskites have emerged as a promising environmentally friendly photovoltaic material for their intrinsic thermodynamic stability, appropriate bandgaps, small carrier effective masses, and low exciton binding energies. However, currently no solar cell based on these double perovskites has been reported, due to the challenge in film processing. Herein, a first lead‐free double perovskite planar heterojunction solar cell with a high quality Cs2AgBiBr6 film, fabricated by low‐pressure assisted solution processing under ambient conditions, is reported. The device presents a best power conversion efficiency of 1.44%. The preliminary efficiency and the high stability under ambient condition without encapsulation, together with the high film quality with simple processing, demonstrate promise for lead‐free perovskite solar cells. PMID:29593974

Differential Cationization of Fatty Acids with Monovalent Cations Studied by ESI-MS/MS and Computational Approach.

PubMed

Sudarshana Reddy, B; Pavankumar, P; Sridhar, L; Saha, Soumen; Narahari Sastry, G; Prabhakar, S

2018-04-24

The intercellular and intracellular transport of charged species (Na + /K + ) entail interaction of the ions with neutral organic molecules and formation of adduct ions. The rate of transport of the ions across the cell membrane(s) may depend on the stability of the adduct ions, which in turn rely on structural aspects of the organic molecules that interact with the ions. Positive ion ESI mass spectra were recorded for the solutions containing fatty acids (FAs) and monovalent cations (X=Li + , Na + , K + , Rb + and Cs + ). Product ion spectra of the [FA+X] + ions were recorded at different collision energies. Theoretical studies were exploited under both gas phase and solvent phase to investigate the structural effects of the fatty acids during cationization. Stability of [FA+X] + adduct ions were further estimated by means of AIM topological analyses and interaction energy (IE) values. Positive ion ESI-MS analyses of the solution of FAs and X + ions showed preferential binding of the K + ions to FAs. The K + ion binding increased with the increase in number of double bonds of FAs, while decreased with increase in the number of carbons of FAs. Dissociation curves of [FA+X] + ions indicated the relative stability order of the [FA+X] + ions and it was in line with the observed trends in ESI-MS. The solvent phase computational studies divulged the mode of binding and the binding efficiencies of different FAs with monovalent cations. Among the studied monovalent cations, the cationization of FAs follow the order K + >Na + >Li + >Rb + >Cs + . The docosahexaenoic acid showed high efficiency in binding with K + ion. The K + ion binding efficiency of FAs depends on the number of double bonds in unsaturated FAs and the carbon chain length in saturated FAs. The cationization trends of FAs obtained from the ESI-MS, ESI-MS/MS analyses were in good agreement with solvent phase computational studies. This article is protected by copyright. All rights reserved.

Surface Charge-Transfer Doping of Graphene Nanoflakes Containing Double-Vacancy (5-8-5) and Stone-Wales (55-77) Defects through Molecular Adsorption.

PubMed

Shakourian-Fard, Mehdi; Jamshidi, Zahra; Kamath, Ganesh

2016-10-18

The adsorption of six electron donor-acceptor (D/A) organic molecules on various sizes of graphene nanoflakes (GNFs) containing two common defects, double-vacancy (5-8-5) and Stone-Wales (55-77), are investigated by means of ab initio DFT [M06-2X(-D3)/cc-pVDZ]. Different D/A molecules adsorb on a defect graphene (DG) surface with binding energies (ΔE b ) of about -12 to -28 kcal mol -1 . The ΔE b values for adsorption of molecules on the Stone-Wales GNF surface are higher than those on the double vacancy GNF surface. Moreover, binding energies increase by about 10 % with an increase in surface size. The nature of cooperative weak interactions is analyzed based on quantum theory of atoms in molecules, noncovalent interactions plot, and natural bond order analyses, and the dominant interaction is compared for different molecules. Electron density population analysis is used to explain the n- and p-type character of defect graphene nanoflakes (DGNFs) and also the change in electronic properties and reactivity parameters of DGNFs upon adsorption of different molecules and with increasing DGNF size. Results indicate that the HOMO-LUMO energy gap (E g ) of DGNFs decreases upon adsorption of molecules. However, by increasing the size of DGNFs, the E g and chemical hardness of all complexes decrease and the electrophilicity index increases. Furthermore, the values of the chemical potential of acceptor-DGNF complexes decrease with increasing size, whereas those of donor-DGNF complexes increase. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Electromagnetic and optical characteristics of Nb5+-doped double-crossover and salmon DNA thin films

NASA Astrophysics Data System (ADS)

Babu Mitta, Sekhar; Reddy Dugasani, Sreekantha; Jung, Soon-Gil; Vellampatti, Srivithya; Park, Tuson; Park, Sung Ha

2017-10-01

We report the fabrication and physical characteristics of niobium ion (Nb5+)-doped double-crossover DNA (DX-DNA) and salmon DNA (SDNA) thin films. Different concentrations of Nb5+ ([Nb5+]) are coordinated into the DNA molecules, and the thin films are fabricated via substrate-assisted growth (DX-DNA) and drop-casting (SDNA) on oxygen plasma treated substrates. We conducted atomic force microscopy to estimate the optimum concentration of Nb5+ ([Nb5+]O = 0.08 mM) in Nb5+-doped DX-DNA thin films, up to which the DX-DNA lattices maintain their structures without deformation. X-ray photoelectron spectroscopy (XPS) was performed to probe the chemical nature of the intercalated Nb5+ in the SDNA thin films. The change in peak intensities and the shift in binding energy were witnessed in XPS spectra to explicate the binding and charge transfer mechanisms between Nb5+ and SDNA molecules. UV-visible, Raman, and photoluminescence (PL) spectra were measured to determine the optical properties and thus investigate the binding modes, Nb5+ coordination sites in Nb5+-doped SDNA thin films, and energy transfer mechanisms, respectively. As [Nb5+] increases, the absorbance peak intensities monotonically increase until ˜[Nb5+]O and then decrease. However, from the Raman measurements, the peak intensities gradually decrease with an increase in [Nb5+] to reveal the binding mechanism and binding sites of metal ions in the SDNA molecules. From the PL, we observe the emission intensities to reduce them at up to ˜[Nb5+]O and then increase after that, expecting the energy transfer between the Nb5+ and SDNA molecules. The current-voltage measurement shows a significant increase in the current observed as [Nb5+] increases in the SDNA thin films when compared to that of pristine SDNA thin films. Finally, we investigate the temperature dependent magnetization in which the Nb5+-doped SDNA thin films reveal weak ferromagnetism due to the existence of tiny magnetic dipoles in the Nb5+-doped SDNA complex.

Enzyme architecture: deconstruction of the enzyme-activating phosphodianion interactions of orotidine 5'-monophosphate decarboxylase.

PubMed

Goldman, Lawrence M; Amyes, Tina L; Goryanova, Bogdana; Gerlt, John A; Richard, John P

2014-07-16

The mechanism for activation of orotidine 5'-monophosphate decarboxylase (OMPDC) by interactions of side chains from Gln215 and Try217 at a gripper loop and R235, adjacent to this loop, with the phosphodianion of OMP was probed by determining the kinetic parameters k(cat) and K(m) for all combinations of single, double, and triple Q215A, Y217F, and R235A mutations. The 12 kcal/mol intrinsic binding energy of the phosphodianion is shown to be equal to the sum of the binding energies of the side chains of R235 (6 kcal/mol), Q215 (2 kcal/mol), Y217 (2 kcal/mol), and hydrogen bonds to the G234 and R235 backbone amides (2 kcal/mol). Analysis of a triple mutant cube shows small (ca. 1 kcal/mol) interactions between phosphodianion gripper side chains, which are consistent with steric crowding of the side chains around the phosphodianion at wild-type OMPDC. These mutations result in the same change in the activation barrier to the OMPDC-catalyzed reactions of the whole substrate OMP and the substrate pieces (1-β-D-erythrofuranosyl)orotic acid (EO) and phosphite dianion. This shows that the transition states for these reactions are stabilized by similar interactions with the protein catalyst. The 12 kcal/mol intrinsic phosphodianion binding energy of OMP is divided between the 8 kcal/mol of binding energy, which is utilized to drive a thermodynamically unfavorable conformational change of the free enzyme, resulting in an increase in (k(cat))(obs) for OMPDC-catalyzed decarboxylation of OMP, and the 4 kcal/mol of binding energy, which is utilized to stabilize the Michaelis complex, resulting in a decrease in (K(m))(obs).

Trends in Adsorption Energies of the Oxygenated Species on Single Platinum Atom Embedded in Carbon Nanotubes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Siahrostami, Samira; Li, Guo-Ling; Nørskov, Jens K.

Herein we study the effect of strain on the catalytic activity of different Pt-doped single wall metallic carbon nanotubes (SWCNT) towards the oxygen reduction reaction (ORR). We consider the possibility of the Pt-doped at single vacancy inside the SWCNT to investigate the effect of confinement on the reaction mechanism. Density functional theory calculations indicate that for the SWCNTs with tube diameters below 7 Å, the strain energy varies significantly influencing the adsorption energies of the key intermediates of the ORR reaction. For the SWCNTs with tube diameters above 7 Å, on the other hand, both the calculated strain and themore » adsorption energies are almost constant. We furthermore find that the adsorption energies are strongly affected by confinement effects as shown for Pt-doped systems that are located inside the SWCNT. We show that the Pt-doped at single vacancy of the SWCNT strongly binds the oxygenated species under ORR potentials and therefore the active species is covered by oxo- or hydroxo group. Because the presence of Pt atoms doped at the single and double vacancies of the SWCNT is equivalently probable we also studied the Pt-doped at double vacancy. We find that the most active motif is the Pt-doped at double vacancy of SWCNT with 0.24V overpotenital.« less

Trends in Adsorption Energies of the Oxygenated Species on Single Platinum Atom Embedded in Carbon Nanotubes

DOE PAGES

Siahrostami, Samira; Li, Guo-Ling; Nørskov, Jens K.; ...

2017-09-30

Herein we study the effect of strain on the catalytic activity of different Pt-doped single wall metallic carbon nanotubes (SWCNT) towards the oxygen reduction reaction (ORR). We consider the possibility of the Pt-doped at single vacancy inside the SWCNT to investigate the effect of confinement on the reaction mechanism. Density functional theory calculations indicate that for the SWCNTs with tube diameters below 7 Å, the strain energy varies significantly influencing the adsorption energies of the key intermediates of the ORR reaction. For the SWCNTs with tube diameters above 7 Å, on the other hand, both the calculated strain and themore » adsorption energies are almost constant. We furthermore find that the adsorption energies are strongly affected by confinement effects as shown for Pt-doped systems that are located inside the SWCNT. We show that the Pt-doped at single vacancy of the SWCNT strongly binds the oxygenated species under ORR potentials and therefore the active species is covered by oxo- or hydroxo group. Because the presence of Pt atoms doped at the single and double vacancies of the SWCNT is equivalently probable we also studied the Pt-doped at double vacancy. We find that the most active motif is the Pt-doped at double vacancy of SWCNT with 0.24V overpotenital.« less

Doping of germanium and silicon crystals with non-hydrogenic acceptors for far infrared lasers

DOEpatents

Haller, Eugene E.; Brundermann, Erik

2000-01-01

A method for doping semiconductors used for far infrared lasers with non-hydrogenic acceptors having binding energies larger than the energy of the laser photons. Doping of germanium or silicon crystals with beryllium, zinc or copper. A far infrared laser comprising germanium crystals doped with double or triple acceptor dopants permitting the doped laser to be tuned continuously from 1 to 4 terahertz and to operate in continuous mode. A method for operating semiconductor hole population inversion lasers with a closed cycle refrigerator.

Conformational changes in fragments D and double-D from human fibrin(ogen) upon binding the peptide ligand Gly-His-Arg-Pro-amide.

PubMed

Everse, S J; Spraggon, G; Veerapandian, L; Doolittle, R F

1999-03-09

The structure of fragment double-D from human fibrin has been solved in the presence and absence of the peptide ligands that simulate the two knobs exposed by the removal of fibrinopeptides A and B, respectively. All told, six crystal structures have been determined, three of which are reported here for the first time: namely, fragments D and double-D with the peptide GHRPam alone and double-D in the absence of any peptide ligand. Comparison of the structures has revealed a series of conformational changes that are brought about by the various knob-hole interactions. Of greatest interest is a moveable "flap" of two negatively charged amino acids (Glubeta397 and Aspbeta398) whose side chains are pinned back to the coiled coil with a calcium atom bridge until GHRPam occupies the beta-chain pocket. Additionally, in the absence of the peptide ligand GPRPam, GHRPam binds to the gamma-chain pocket, a new calcium-binding site being formed concomitantly.

Electrochemical and spectroscopic studies of the interaction of proflavine with DNA.

PubMed

Aslanoglu, Mehmet

2006-03-01

The interaction of proflavine with herring sperm DNA has been investigated by cyclic voltammetry and UV-Vis spectroscopy as well as viscosity measurements. Shifts in the peak potentials in cyclic voltammetry, spectral changes in UV absorption titration, an increase in viscosity of DNA and the results of the effect of ionic strength on the binding constant strongly support the intercalation of proflavine into the DNA double helix. The binding constant for the interaction between proflavine and DNA was K = 2.32 (+/- 0.41) x 10(4) M(-1) and the binding site size was 2.07 (+/- 0.1) base pairs, estimated in voltammetric measurements. The value of the binding site size was determined to be closer to that expected for a planar intercalating agent. The standard Gibbs free-energy change is ca. -24.90 kJ/mol at 25 degrees C, indicating the spontaneity of the binding interaction. The binding constant determined by UV absorption measurements was K = 2.20 (+/- 0.48) x 10(4) M(-1), which is very close to the value determined by cyclic voltammetry assuming that the binding equilibrium is static.

Two- and three-body interatomic dispersion energy contributions to binding in molecules and solids

NASA Astrophysics Data System (ADS)

Anatole von Lilienfeld, O.; Tkatchenko, Alexandre

2010-06-01

We present numerical estimates of the leading two- and three-body dispersion energy terms in van der Waals interactions for a broad variety of molecules and solids. The calculations are based on London and Axilrod-Teller-Muto expressions where the required interatomic dispersion energy coefficients, C6 and C9, are computed "on the fly" from the electron density. Inter- and intramolecular energy contributions are obtained using the Tang-Toennies (TT) damping function for short interatomic distances. The TT range parameters are equally extracted on the fly from the electron density using their linear relationship to van der Waals radii. This relationship is empiricially determined for all the combinations of He-Xe rare gas dimers, as well as for the He and Ar trimers. The investigated systems include the S22 database of noncovalent interactions, Ar, benzene and ice crystals, bilayer graphene, C60 dimer, a peptide (Ala10), an intercalated drug-DNA model [ellipticine-d(CG)2], 42 DNA base pairs, a protein (DHFR, 2616 atoms), double stranded DNA (1905 atoms), and 12 molecular crystal polymorphs from crystal structure prediction blind test studies. The two- and three-body interatomic dispersion energies are found to contribute significantly to binding and cohesive energies, for bilayer graphene the latter reaches 50% of experimentally derived binding energy. These results suggest that interatomic three-body dispersion potentials should be accounted for in atomistic simulations when modeling bulky molecules or condensed phase systems.

Two and three-body interatomic dispersion energy contributions to binding in molecules and solids.

DOE Office of Scientific and Technical Information (OSTI.GOV)

von Lilienfeld-Toal, Otto Anatole; Tkatchenko, Alexandre

We present numerical estimates of the leading two- and three-body dispersion energy terms in van der Waals interactions for a broad variety of molecules and solids. The calculations are based on London and Axilrod-Teller-Muto expressions where the required interatomic dispersion energy coefficients, C{sub 6} and C{sub 9}, are computed 'on the fly' from the electron density. Inter- and intramolecular energy contributions are obtained using the Tang-Toennies (TT) damping function for short interatomic distances. The TT range parameters are equally extracted on the fly from the electron density using their linear relationship to van der Waals radii. This relationship is empiriciallymore » determined for all the combinations of He-Xe rare gas dimers, as well as for the He and Ar trimers. The investigated systems include the S22 database of noncovalent interactions, Ar, benzene and ice crystals, bilayer graphene, C{sub 60} dimer, a peptide (Ala{sub 10}), an intercalated drug-DNA model [ellipticine-d(CG){sub 2}], 42 DNA base pairs, a protein (DHFR, 2616 atoms), double stranded DNA (1905 atoms), and 12 molecular crystal polymorphs from crystal structure prediction blind test studies. The two- and three-body interatomic dispersion energies are found to contribute significantly to binding and cohesive energies, for bilayer graphene the latter reaches 50% of experimentally derived binding energy. These results suggest that interatomic three-body dispersion potentials should be accounted for in atomistic simulations when modeling bulky molecules or condensed phase systems.« less

The tight binding model study of the role of anisotropic AFM spin ordering in the charge ordered CMR manganites

NASA Astrophysics Data System (ADS)

Kar, J. K.; Panda, Saswati; Rout, G. C.

2017-05-01

We propose here a tight binding model study of the interplay between charge and spin orderings in the CMR manganites taking anisotropic effect due to electron hoppings and spin exchanges. The Hamiltonian consists of the kinetic energies of eg and t2g electrons of manganese ion. It further includes double exchange and Heisenberg interactions. The charge density wave interaction (CDW) describes an extra mechanism for the insulating character of the system. The CDW gap and spin parameters are calculated using Zubarev's Green's function technique and computed self-consistently. The results are reported in this communication.

Lipophilic oligonucleotides spontaneously insert into lipid membranes, bind complementary DNA strands, and sequester into lipid-disordered domains.

PubMed

Bunge, Andreas; Kurz, Anke; Windeck, Anne-Kathrin; Korte, Thomas; Flasche, Wolfgang; Liebscher, Jürgen; Herrmann, Andreas; Huster, Daniel

2007-04-10

For the development of surface functionalized bilayers, we have synthesized lipophilic oligonucleotides to combine the molecular recognition mechanism of nucleic acids and the self-assembly characteristics of lipids in planar membranes. A lipophilic oligonucleotide consisting of 21 thymidine units and two lipophilic nucleotides with an alpha-tocopherol moiety as a lipophilic anchor was synthesized using solid-phase methods with a phosphoramadite strategy. The interaction of the water soluble lipophilic oligonucleotide with vesicular lipid membranes and its capability to bind complementary DNA strands was studied using complementary methods such as NMR, EPR, DSC, fluorescence spectroscopy, and fluorescence microscopy. This oligonucleotide inserted stably into preformed membranes from the aqueous phase. Thereby, no significant perturbation of the lipid bilayer and its stability was observed. However, the non-lipidated end of the oligonucleotide is exposed to the aqueous environment, is relatively mobile, and is free to interact with complementary DNA strands. Binding of the complementary single-stranded DNA molecules is fast and accomplished by the formation of Watson-Crick base pairs, which was confirmed by 1H NMR chemical shift analysis and fluorescence resonance energy transfer. The molecular structure of the membrane bound DNA double helix is very similar to the free double-stranded DNA. Further, the membrane bound DNA double strands also undergo regular melting. Finally, in raft-like membrane mixtures, the lipophilic oligonucleotide was shown to preferentially sequester into liquid-disordered membrane domains.

Insight into the binding modes of Lassa nucleoprotein complexed with ssRNA by molecular dynamic simulations and free energy calculations.

PubMed

Zhang, Ying; Chen, Hang; Han, Ju-Guang

2015-01-01

Lassa virus (LASV), an arenavirus known to be responsible for a severe hemorrhagic fever, causes thousands of deaths annually and there is no effective vaccine for it so far. The nucleoprotein (NP) of LASV plays an essential role in the replication and transcription of the viral genome. Recent research shows that viral RNA binds in a deep crevice located within the N-terminal domain of NP and suggests a gating mechanism in which NP transforms from a "closed" position to an "open" position to bind RNA. To characterize the molecular mechanisms of how RNA binds to N-terminal domain of NP, two molecular dynamic (MD) simulations of RNA-binding structure and RNA-free structure have been performed. The simulation results show that an important helix α6 interacts with RNA in the "open" conformation, while helix α6 rotates toward the binding crevice and reduces the space of RNA-binding pocket in the "closed" conformation; it appears that helix α6 would clash with RNA while NP is in a "closed" state. In addition, to characterize the role of residues involved in the binding of RNA, the MD simulations of the double-mutant (W164A/F176A) and the single-mutant (G243P) RNA-binding NP complexes have been performed. Our MD simulations and molecular mechanics-generalized born surface area (MM-GBSA) energy calculations exhibit that the three mutant residues increase the binding affinity. Furthermore, we infer that the defect of the replication and transcription of viral genome is possibly due to the change of structural integrity rather than the reduction of RNA-binding affinity.

Bose-Einstein condensation and superfluidity of dipolar excitons in a phosphorene double layer

NASA Astrophysics Data System (ADS)

Berman, Oleg L.; Gumbs, Godfrey; Kezerashvili, Roman Ya.

2017-07-01

We study the formation of dipolar excitons and their superfluidity in a phosphorene double layer. The analytical expressions for the single dipolar exciton energy spectrum and wave function are obtained. It is predicted that a weakly interacting gas of dipolar excitons in a double layer of black phosphorus exhibits superfluidity due to the dipole-dipole repulsion between the dipolar excitons. In calculations are employed the Keldysh and Coulomb potentials for the interaction between the charge carriers to analyze the influence of the screening effects on the studied phenomena. It is shown that the critical velocity of superfluidity, the spectrum of collective excitations, concentrations of the superfluid and normal component, and mean-field critical temperature for superfluidity are anisotropic and demonstrate the dependence on the direction of motion of dipolar excitons. The critical temperature for superfluidity increases if the exciton concentration and the interlayer separation increase. It is shown that the dipolar exciton binding energy and mean-field critical temperature for superfluidity are sensitive to the electron and hole effective masses. The proposed experiment to observe a directional superfluidity of excitons is addressed.

A converged calculation of the energy barrier to internal rotation in the ethylene-sulfur dioxide dimer

NASA Astrophysics Data System (ADS)

Resende, Stella M.; De Almeida, Wagner B.; van Duijneveldt-van de Rijdt, Jeanne G. C. M.; van Duijneveldt, Frans B.

2001-08-01

Geometrical parameters for the equilibrium (MIN) and lowest saddle-point (TS) geometries of the C2H4⋯SO2 dimer, and the corresponding binding energies, were calculated using the Hartree-Fock and correlated levels of ab initio theory, in basis sets ranging from the D95(d,p) double-zeta basis set to the aug-cc-pVQZ correlation consistent basis set. An assessment of the effect of the basis set superposition error (BSSE) on these results was made. The dissociation energy from the lowest vibrational state was estimated to be 705±100 cm-1 at the basis set limit, which is well within the range expected from experiment. The barrier to internal rotation was found to be 53±5 cm-1, slightly higher than the (revised) experimental result of 43 cm-1, probably due to zero-point vibrational effects. Our results clearly show that, in direct contrast with recent ideas, the BSSE correction affects differentially the MIN and TS binding energies and so has to be included in the calculation of small energy barriers such as that in the C2H4⋯SO2 dimer. Previous reports of positive MP2 frozen-core binding energies for this complex in basis D95(d,p) are confirmed. The anomalies are shown to be an artifact arising from an incorrect removal of virtual orbitals by the default frozen-core option in the GAUSSIAN program.

Comparison between TRF2 and TRF1 of their telomeric DNA-bound structures and DNA-binding activities

PubMed Central

Hanaoka, Shingo; Nagadoi, Aritaka; Nishimura, Yoshifumi

2005-01-01

Mammalian telomeres consist of long tandem arrays of double-stranded telomeric TTAGGG repeats packaged by the telomeric DNA-binding proteins TRF1 and TRF2. Both contain a similar C-terminal Myb domain that mediates sequence-specific binding to telomeric DNA. In a DNA complex of TRF1, only the single Myb-like domain consisting of three helices can bind specifically to double-stranded telomeric DNA. TRF2 also binds to double-stranded telomeric DNA. Although the DNA binding mode of TRF2 is likely identical to that of TRF1, TRF2 plays an important role in the t-loop formation that protects the ends of telomeres. Here, to clarify the details of the double-stranded telomeric DNA-binding modes of TRF1 and TRF2, we determined the solution structure of the DNA-binding domain of human TRF2 bound to telomeric DNA; it consists of three helices, and like TRF1, the third helix recognizes TAGGG sequence in the major groove of DNA with the N-terminal arm locating in the minor groove. However, small but significant differences are observed; in contrast to the minor groove recognition of TRF1, in which an arginine residue recognizes the TT sequence, a lysine residue of TRF2 interacts with the TT part. We examined the telomeric DNA-binding activities of both DNA-binding domains of TRF1 and TRF2 and found that TRF1 binds more strongly than TRF2. Based on the structural differences of both domains, we created several mutants of the DNA-binding domain of TRF2 with stronger binding activities compared to the wild-type TRF2. PMID:15608118

An ab initio study of Fe(CO)n, n = 1,5, and Cr(CO)6

NASA Technical Reports Server (NTRS)

Barnes, Leslie A.; Rosi, Marzio; Bauschlicher, Charles W., Jr.

1991-01-01

Ab initio calculations have been performed for Cr(CO)6 and Fe(CO)n, n = 1,5. Basis sets of better than double zeta quality are used, and correlation is included using the modified coupler-pair functional method. The computed geometries and force constants are in reasonable agreement with experiment. The sequential bond dissociation energies of CO from Fe(CO)5 are estimated to be: 39, 31, 25, 22, and greater than 5 kcal/mol. It is noted that the first bond dissociation energy is relative to the singlet ground state of Fe(CO)5 and the lowest singlet state of Fe(CO)4, whereas the second is relative to the ground triplet states of Fe(CO)4 and Fe(CO)3. In addition, the binding energy for Fe-CO would be modified to 18 kcal/mol if dissociation occurred to the Fe(5F) excited state asymptote. The CO binding energies for Fe and Cr are found to be in poorer agreement with experiment than those found in a previous study on Ni(CO)4. The origins of this difference are discussed.

Interaction of monovalent cations with acetonitrile

NASA Astrophysics Data System (ADS)

Černušák, Ivan; Aranyosiová, Monika; Vollárová, Ol'ga; Velič, Dušan; Kirdajová, Ol'ga; Benko, Ján

Solvation of monovalent cations (Me+) of alkali metals=Na+, K+, Rb+, and Cs+, coinage metals=Cu+, Ag+, Au+, and p-block elements Ga+, In+, and Tl+ with acetonitrile was studied by means of ab initio calculations and time-of-flight secondary ion mass spectrometry (TOF-SIMS). The intermolecular interactions in the complexes Me+···CH3CN were investigated using the coupled clusters theory including single, double, and noniterative triple substitutions (CCSD(T)) in conjunction with the Pol and Pol-dk basis sets. The binding energies of these donor-acceptor complexes were estimated; taking into account the basis set superposition error, zero-point vibrations, correlation contribution, and scalar relativistic corrections. The theoretical ΔG0298 K values based on CCSD(T)/Pol and/or CCSD(T)/Pol-dk binding energies correlated well with experimental transfer Gibbs energies (from water to acetonitrile) for the series of cations. In the case of Au monocation, relativistic correction turned out to be extremely important. Composition of the complex of Ag+ and Na+ with acetonitrile was determined by using SIMS supporting both theoretical and experimental transfer Gibbs energies.

Prediction of Water Binding to Protein Hydration Sites with a Discrete, Semiexplicit Solvent Model.

PubMed

Setny, Piotr

2015-12-08

Buried water molecules are ubiquitous in protein structures and are found at the interface of most protein-ligand complexes. Determining their distribution and thermodynamic effect is a challenging yet important task, of great of practical value for the modeling of biomolecular structures and their interactions. In this study, we present a novel method aimed at the prediction of buried water molecules in protein structures and estimation of their binding free energies. It is based on a semiexplicit, discrete solvation model, which we previously introduced in the context of small molecule hydration. The method is applicable to all macromolecular structures described by a standard all-atom force field, and predicts complete solvent distribution within a single run with modest computational cost. We demonstrate that it indicates positions of buried hydration sites, including those filled by more than one water molecule, and accurately differentiates them from sterically accessible to water but void regions. The obtained estimates of water binding free energies are in fair agreement with reference results determined with the double decoupling method.

Melting of DNA double strand after binding to geroprotective tetrapeptide.

PubMed

Khavinson, V Kh; Solovyov, A Yu; Shataeva, L K

2008-11-01

Experimental relationship between the hyperchromic effect of DNA [poly(dA-dT):poly(dA-dT)] interacting with Ala-Glu-Asp-Gly peptide is presented by a saturation isotherm. The free DNA double strand is melting (the strands separate) at 69.5 degrees C and at higher energy expenditures (enthalpy increase by 976.4 kJ/mol b.p.) in comparison with melting of the DNA-peptide complex (28 degrees C and 444.6 kJ/mol b.p.). The detected regularities of melting of duplex DNA and the thermodynamic parameters of this process indicate the natural mechanism of interaction between DNA and regulatory peptides underlying functioning of the living matter.

Nucleus Z=126 with magic neutron number N=184 may be related to the measured Maruhn-Greiner maximum at A/2=155 from compound nuclei at low energy nuclear reactions

NASA Astrophysics Data System (ADS)

Prelas, M. A.; Hora, H.; Miley, G. H.

2014-07-01

Evaluation of nuclear binding energies from theory close to available measurements of a very high number of superheavy elements (SHE) based on α-decay energies Qα, arrived at a closing shell with a significant neutron number 184. Within the option of several discussed magic numbers for protons of around 120, Bagge's numbers 126 and 184 fit well and are supported by the element generation measurements by low energy nuclear reactions (LENR) discovered in deuterium loaded host metals. These measurements were showing a Maruhn-Greiner maximum from fission of compound nuclei in an excited state with double magic numbers for mutual confirmation.

Asymmetric Assembly of Merkel Cell Polyomavirus Large T-Antigen Origin Binding Domains at the Viral Origin

DOE Office of Scientific and Technical Information (OSTI.GOV)

C Harrison; G Meinke; H Kwun

2011-12-31

The double-stranded DNA polyomavirus Merkel cell polyomavirus (MCV) causes Merkel cell carcinoma, an aggressive but rare human skin cancer that most often affects immunosuppressed and elderly persons. As in other polyomaviruses, the large T-antigen of MCV recognizes the viral origin of replication by binding repeating G(A/G)GGC pentamers. The spacing, number, orientation, and necessity of repeats for viral replication differ, however, from other family members such as SV40 and murine polyomavirus. We report here the 2.9 {angstrom} crystal structure of the MCV large T-antigen origin binding domain (OBD) in complex with a DNA fragment from the MCV origin of replication. Consistentmore » with replication data showing that three of the G(A/G)GGC-like binding sites near the center of the origin are required for replication, the crystal structure contains three copies of the OBD. This stoichiometry was verified using isothermal titration calorimetry. The affinity for G(A/G)GGC-containing double-stranded DNA was found to be {approx} 740 nM, approximately 8-fold weaker than the equivalent domain in SV40 for the analogous region of the SV40 origin. The difference in affinity is partially attributable to DNA-binding residue Lys331 (Arg154 in SV40). In contrast to SV40, a small protein-protein interface is observed between MCV OBDs when bound to the central region of the origin. This protein-protein interface is reminiscent of that seen in bovine papilloma virus E1 protein. Mutational analysis indicates, however, that this interface contributes little to DNA binding energy.« less

TIRR regulates 53BP1 by masking its histone methyl-lysine binding function.

PubMed

Drané, Pascal; Brault, Marie-Eve; Cui, Gaofeng; Meghani, Khyati; Chaubey, Shweta; Detappe, Alexandre; Parnandi, Nishita; He, Yizhou; Zheng, Xiao-Feng; Botuyan, Maria Victoria; Kalousi, Alkmini; Yewdell, William T; Münch, Christian; Harper, J Wade; Chaudhuri, Jayanta; Soutoglou, Evi; Mer, Georges; Chowdhury, Dipanjan

2017-03-09

P53-binding protein 1 (53BP1) is a multi-functional double-strand break repair protein that is essential for class switch recombination in B lymphocytes and for sensitizing BRCA1-deficient tumours to poly-ADP-ribose polymerase-1 (PARP) inhibitors. Central to all 53BP1 activities is its recruitment to double-strand breaks via the interaction of the tandem Tudor domain with dimethylated lysine 20 of histone H4 (H4K20me2). Here we identify an uncharacterized protein, Tudor interacting repair regulator (TIRR), that directly binds the tandem Tudor domain and masks its H4K20me2 binding motif. Upon DNA damage, the protein kinase ataxia-telangiectasia mutated (ATM) phosphorylates 53BP1 and recruits RAP1-interacting factor 1 (RIF1) to dissociate the 53BP1-TIRR complex. However, overexpression of TIRR impedes 53BP1 function by blocking its localization to double-strand breaks. Depletion of TIRR destabilizes 53BP1 in the nuclear-soluble fraction and alters the double-strand break-induced protein complex centring 53BP1. These findings identify TIRR as a new factor that influences double-strand break repair using a unique mechanism of masking the histone methyl-lysine binding function of 53BP1.

Theory of nanotube faraday cage

NASA Astrophysics Data System (ADS)

Roxana Margine, Elena; Nisoli, Cristiano; Kolmogorov, Aleksey; Crespi, Vincent H.

2003-03-01

Charge transfer between dopants and double-wall carbon nanotubes is examined theoretically. We model the system as a triple cylindrical capacitor with the dopants forming a shell around the outer wall of the nanotube. The total energy of the system contains three terms: the band structure energies of the inner and outer tube, calculated in a tight-binding model with rigid bands, and the electrostatic energy of the tri-layer distribution. Even for metallic inner and outer tube walls, wherein the diameter dependence of the bandgap does not favor the outer wall, nearly all of the dopant charge resides on the outer layer, a nanometer-scale Faraday cage. The calculated charge distribution is in agreement with recent experimental measurements.

Ground-State Properties of Mg Isotopes in and Beyond the Island of Inversion through Reaction Cross Sections

NASA Astrophysics Data System (ADS)

Watanabe, Shin; Minomo, Kosho; Shimada, Mitsuhiro; Tagami, Shingo; Kimura, Masaaki; Takechi, Maya; Fukuda, Mitsunori; Nishimura, Daiki; Suzuki, Takeshi; Matsumoto, Takuma; Shimizu, Yoshifumi R.; Yahiro, Masanobu

We analyze recently measured total reaction cross sections (σR) for 24-38Mg incident on 12C targets at 240 MeV/nucleon by using the microscopic framework based on the double folding model and antisymmetrized molecular dynamics (AMD). The framework reproduces not only the measured σR but also other existing measured ground-state properties of Mg Isotopes (spin parity, total binding energy, one-neutron separation energy, and 2+ and 4+ excitation energies) quite well. AMD predicts large deformation from 31Mg19 to a drip-line nucleus 40Mg28, indicating that both the N = 20 and 28 magicities disappear.

Investigations on the Interactions of 5-Fluorouracil with Herring Sperm DNA: Steady State/Time Resolved and Molecular Modeling Studies

NASA Astrophysics Data System (ADS)

Chinnathambi, Shanmugavel; Karthikeyan, Subramani; Velmurugan, Devadasan; Hanagata, Nobutaka; Aruna, Prakasarao; Ganesan, Singaravelu

2015-04-01

In the present study, the interaction of 5-Fluorouracil with herring sperm DNA is reported using spectroscopic and molecular modeling techniques. This binding study of 5-FU with hs-DNA is of paramount importance in understanding chemico-biological interactions for drug design, pharmacy and biochemistry without altering the original structure. The challenge of the study was to find the exact binding mode of the drug 5-Fluorouracil with hs-DNA. From the absorption studies, a hyperchromic effect was observed for the herring sperm DNA in the presence of 5-Fluorouracil and a binding constant of 6.153 × 103 M-1 for 5-Fluorouracil reveals the existence of weak interaction between the 5-Fluorouracil and herring sperm DNA. Ethidium bromide loaded herring sperm DNA showed a quenching in the fluorescence intensity after the addition of 5-Fluorouracil. The binding constants for 5-Fluorouracil stranded DNA and competitive bindings of 5-FU interacting with DNA-EB systems were examined by fluorescence spectra. The Stern-Volmer plots and fluorescence lifetime results confirm the static quenching nature of the drug-DNA complex. The binding constant Kb was 2.5 × 104 L mol-1 and the number of binding sites are 1.17. The 5-FU on DNA system was calculated using double logarithmic plot. From the Forster nonradiative energy transfer study it has been found that the distance of 5-FU from DNA was 4.24 nm. In addition to the spectroscopic results, the molecular modeling studies also revealed the major groove binding as well as the partial intercalation mode of binding between the 5-Fluorouracil and herring sperm DNA. The binding energy and major groove binding as -6.04 kcal mol-1 and -6.31 kcal mol-1 were calculated from the modeling studies. All the testimonies manifested that binding modes between 5-Fluorouracil and DNA were evidenced to be groove binding and in partial intercalative mode.

Surface shapes and surrounding environment analysis of single- and double-stranded DNA-binding proteins in protein-DNA interface.

PubMed

Wang, Wei; Liu, Juan; Sun, Lin

2016-07-01

Protein-DNA bindings are critical to many biological processes. However, the structural mechanisms underlying these interactions are not fully understood. Here, we analyzed the residues shape (peak, flat, or valley) and the surrounding environment of double-stranded DNA-binding proteins (DSBs) and single-stranded DNA-binding proteins (SSBs) in protein-DNA interfaces. In the results, we found that the interface shapes, hydrogen bonds, and the surrounding environment present significant differences between the two kinds of proteins. Built on the investigation results, we constructed a random forest (RF) classifier to distinguish DSBs and SSBs with satisfying performance. In conclusion, we present a novel methodology to characterize protein interfaces, which will deepen our understanding of the specificity of proteins binding to ssDNA (single-stranded DNA) or dsDNA (double-stranded DNA). Proteins 2016; 84:979-989. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Interaction between IGFBP7 and insulin: a theoretical and experimental study

NASA Astrophysics Data System (ADS)

Ruan, Wenjing; Kang, Zhengzhong; Li, Youzhao; Sun, Tianyang; Wang, Lipei; Liang, Lijun; Lai, Maode; Wu, Tao

2016-04-01

Insulin-like growth factor binding protein 7 (IGFBP7) can bind to insulin with high affinity which inhibits the early steps of insulin action. Lack of recognition mechanism impairs our understanding of insulin regulation before it binds to insulin receptor. Here we combine computational simulations with experimental methods to investigate the interaction between IGFBP7 and insulin. Molecular dynamics simulations indicated that His200 and Arg198 in IGFBP7 were key residues. Verified by experimental data, the interaction remained strong in single mutation systems R198E and H200F but became weak in double mutation system R198E-H200F relative to that in wild-type IGFBP7. The results and methods in present study could be adopted in future research of discovery of drugs by disrupting protein-protein interactions in insulin signaling. Nevertheless, the accuracy, reproducibility, and costs of free-energy calculation are still problems that need to be addressed before computational methods can become standard binding prediction tools in discovery pipelines.

The Self-Association of Graphane Is Driven by London Dispersion and Enhanced Orbital Interactions.

PubMed

Wang, Changwei; Mo, Yirong; Wagner, J Philipp; Schreiner, Peter R; Jemmis, Eluvathingal D; Danovich, David; Shaik, Sason

2015-04-14

We investigated the nature of the cohesive energy between graphane sheets via multiple CH···HC interactions, using density functional theory (DFT) including dispersion correction (Grimme's D3 approach) computations of [n]graphane σ dimers (n = 6-73). For comparison, we also evaluated the binding between graphene sheets that display prototypical π/π interactions. The results were analyzed using the block-localized wave function (BLW) method, which is a variant of ab initio valence bond (VB) theory. BLW interprets the intermolecular interactions in terms of frozen interaction energy (ΔE(F)) composed of electrostatic and Pauli repulsion interactions, polarization (ΔE(pol)), charge-transfer interaction (ΔE(CT)), and dispersion effects (ΔE(disp)). The BLW analysis reveals that the cohesive energy between graphane sheets is dominated by two stabilizing effects, namely intermolecular London dispersion and two-way charge transfer energy due to the σ(CH) → σ*(HC) interactions. The shift of the electron density around the nonpolar covalent C-H bonds involved in the intermolecular interaction decreases the C-H bond lengths uniformly by 0.001 Å. The ΔE(CT) term, which accounts for ∼15% of the total binding energy, results in the accumulation of electron density in the interface area between two layers. This accumulated electron density thus acts as an electronic "glue" for the graphane layers and constitutes an important driving force in the self-association and stability of graphane under ambient conditions. Similarly, the "double faced adhesive tape" style of charge transfer interactions was also observed among graphene sheets in which it accounts for ∼18% of the total binding energy. The binding energy between graphane sheets is additive and can be expressed as a sum of CH···HC interactions, or as a function of the number of C-H bonds.

Mapping the Free Energy Landscape of PKA Inhibition and Activation: A Double-Conformational Selection Model for the Tandem cAMP-Binding Domains of PKA RIα

PubMed Central

Akimoto, Madoka; McNicholl, Eric Tyler; Ramkissoon, Avinash; Moleschi, Kody; Taylor, Susan S.; Melacini, Giuseppe

2015-01-01

Protein Kinase A (PKA) is the major receptor for the cyclic adenosine monophosphate (cAMP) secondary messenger in eukaryotes. cAMP binds to two tandem cAMP-binding domains (CBD-A and -B) within the regulatory subunit of PKA (R), unleashing the activity of the catalytic subunit (C). While CBD-A in RIα is required for PKA inhibition and activation, CBD-B functions as a “gatekeeper” domain that modulates the control exerted by CBD-A. Preliminary evidence suggests that CBD-B dynamics are critical for its gatekeeper function. To test this hypothesis, here we investigate by Nuclear Magnetic Resonance (NMR) the two-domain construct RIα (91–379) in its apo, cAMP2, and C-bound forms. Our comparative NMR analyses lead to a double conformational selection model in which each apo CBD dynamically samples both active and inactive states independently of the adjacent CBD within a nearly degenerate free energy landscape. Such degeneracy is critical to explain the sensitivity of CBD-B to weak interactions with C and its high affinity for cAMP. Binding of cAMP eliminates this degeneracy, as it selectively stabilizes the active conformation within each CBD and inter-CBD contacts, which require both cAMP and W260. The latter is contributed by CBD-B and mediates capping of the cAMP bound to CBD-A. The inter-CBD interface is dispensable for intra-CBD conformational selection, but is indispensable for full activation of PKA as it occludes C-subunit recognition sites within CBD-A. In addition, the two structurally homologous cAMP-bound CBDs exhibit marked differences in their residual dynamics profiles, supporting the notion that conservation of structure does not necessarily imply conservation of dynamics. PMID:26618408

Computing the binding affinity of a ligand buried deep inside a protein with the hybrid steered molecular dynamics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Villarreal, Oscar D.; Yu, Lili; Department of Laboratory Medicine, Yancheng Vocational Institute of Health Sciences, Yancheng, Jiangsu 224006

Computing the ligand-protein binding affinity (or the Gibbs free energy) with chemical accuracy has long been a challenge for which many methods/approaches have been developed and refined with various successful applications. False positives and, even more harmful, false negatives have been and still are a common occurrence in practical applications. Inevitable in all approaches are the errors in the force field parameters we obtain from quantum mechanical computation and/or empirical fittings for the intra- and inter-molecular interactions. These errors propagate to the final results of the computed binding affinities even if we were able to perfectly implement the statistical mechanicsmore » of all the processes relevant to a given problem. And they are actually amplified to various degrees even in the mature, sophisticated computational approaches. In particular, the free energy perturbation (alchemical) approaches amplify the errors in the force field parameters because they rely on extracting the small differences between similarly large numbers. In this paper, we develop a hybrid steered molecular dynamics (hSMD) approach to the difficult binding problems of a ligand buried deep inside a protein. Sampling the transition along a physical (not alchemical) dissociation path of opening up the binding cavity- -pulling out the ligand- -closing back the cavity, we can avoid the problem of error amplifications by not relying on small differences between similar numbers. We tested this new form of hSMD on retinol inside cellular retinol-binding protein 1 and three cases of a ligand (a benzylacetate, a 2-nitrothiophene, and a benzene) inside a T4 lysozyme L99A/M102Q(H) double mutant. In all cases, we obtained binding free energies in close agreement with the experimentally measured values. This indicates that the force field parameters we employed are accurate and that hSMD (a brute force, unsophisticated approach) is free from the problem of error amplification suffered by many sophisticated approaches in the literature.« less

Interaction energies for the purine inhibitor roscovitine with cyclin-dependent kinase 2: correlated ab initio quantum-chemical, DFT and empirical calculations.

PubMed

Dobes, Petr; Otyepka, Michal; Strnad, Miroslav; Hobza, Pavel

2006-05-24

The interaction between roscovitine and cyclin-dependent kinase 2 (cdk2) was investigated by performing correlated ab initio quantum-chemical calculations. The whole protein was fragmented into smaller systems consisting of one or a few amino acids, and the interaction energies of these fragments with roscovitine were determined by using the MP2 method with the extended aug-cc-pVDZ basis set. For selected complexes, the complete basis set limit MP2 interaction energies, as well as the coupled-cluster corrections with inclusion of single, double and noninteractive triples contributions [CCSD(T)], were also evaluated. The energies of interaction between roscovitine and small fragments and between roscovitine and substantial sections of protein (722 atoms) were also computed by using density-functional tight-binding methods covering dispersion energy (DFTB-D) and the Cornell empirical potential. Total stabilisation energy originates predominantly from dispersion energy and methods that do not account for the dispersion energy cannot, therefore, be recommended for the study of protein-inhibitor interactions. The Cornell empirical potential describes reasonably well the interaction between roscovitine and protein; therefore, this method can be applied in future thermodynamic calculations. A limited number of amino acid residues contribute significantly to the binding of roscovitine and cdk2, whereas a rather large number of amino acids make a negligible contribution.

Testing the Double Bind Hypothesis: Faculty Recommendations of Minority Women Fellowship Applicants.

ERIC Educational Resources Information Center

Brown, Shirley Vining

1995-01-01

Examines faculty and scientist recommendations of applicants to the National Science Foundation's (NSF) Graduate Fellowship Program, 1976-91. Data from the Cumulative Index on National Science Foundation Fellowships Applicants and Awardees are used. Data analysis supports the double bind hypothesis that minority women are doubly disadvantaged…

Paradox and Double Binds in Adventure-Based Education.

ERIC Educational Resources Information Center

Bacon, Stephen Barcia

Paradox and therapeutic double bind techniques are used to overcome resistance in students with a history of success avoidance. Predictions of failure, restraining comments, and the use of paradox in the midst of an activity are defended theoretically by presenting historical roots and a rationale of effectiveness. A skill-building approach…

Spectroscopic and microcalorimetric studies on the molecular binding of food colorant acid red 27 with deoxyribonucleic acid.

PubMed

Basu, Anirban; Kumar, Gopinatha Suresh

2016-08-01

Interaction of the food colorant acid red 27 with double stranded DNA was investigated using spectroscopic and calorimetric methods. Absorbance and fluorescence studies suggested an intimate binding interaction between the dye and DNA. The quantum efficiency value testified an effective energy transfer from the DNA base pairs to the dye molecules. Minor groove displacement assay with Hoechst 33258 revealed that the binding occurs in the minor groove of DNA. Circular dichroism studies revealed that acid red 27 induces moderate conformational perturbations in DNA. Results of calorimetric studies suggested that the complexation process was driven largely by positive entropic contribution with a smaller favorable enthalpy contribution. The equilibrium constant of the binding was calculated to be (3.04 ± 0.09) × 10(4)  M(-1) at 298.15 K. Negative heat capacity value along with the enthalpy-entropy compensation phenomenon established the involvement of dominant hydrophobic forces in the binding process. Differential scanning calorimetry studies presented evidence for an increased thermal stability of DNA on binding of acid red 27. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Solution structure of CEH-37 homeodomain of the nematode Caenorhabditis elegans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moon, Sunjin; Lee, Yong Woo; Kim, Woo Taek

Highlights: •We have determined solution structures of CEH-37 homedomain. •CEH-37 HD has a compact α-helical structure with HTH DNA binding motif. •Solution structure of CEH-37 HD shares its molecular topology with that of the homeodomain proteins. •Residues in the N-terminal region and HTH motif are important in binding to Caenorhabditis elegans telomeric DNA. •CEH-37 could play an important role in telomere function via DNA binding. -- Abstract: The nematode Caenorhabditis elegans protein CEH-37 belongs to the paired OTD/OTX family of homeobox-containing homeodomain proteins. CEH-37 shares sequence similarity with homeodomain proteins, although it specifically binds to double-stranded C. elegans telomeric DNA,more » which is unusual to homeodomain proteins. Here, we report the solution structure of CEH-37 homeodomain and molecular interaction with double-stranded C. elegans telomeric DNA using nuclear magnetic resonance (NMR) spectroscopy. NMR structure shows that CEH-37 homeodomain is composed of a flexible N-terminal region and three α-helices with a helix-turn-helix (HTH) DNA binding motif. Data from size-exclusion chromatography and fluorescence spectroscopy reveal that CEH-37 homeodomain interacts strongly with double-stranded C. elegans telomeric DNA. NMR titration experiments identified residues responsible for specific binding to nematode double-stranded telomeric DNA. These results suggest that C. elegans homeodomain protein, CEH-37 could play an important role in telomere function via DNA binding.« less

Amino acids 16-275 of minute virus of mice NS1 include a domain that specifically binds (ACCA)2-3-containing DNA.

PubMed

Mouw, M; Pintel, D J

1998-11-10

GST-NS1 purified from Escherichia coli and insect cells binds double-strand DNA in an (ACCA)2-3-dependent fashion under similar ionic conditions, independent of the presence of anti-NS1 antisera or exogenously supplied ATP and interacts with single-strand DNA and RNA in a sequence-independent manner. An amino-terminal domain (amino acids 1-275) of NS1 [GST-NS1(1-275)], representing 41% of the full-length NS1 molecule, includes a domain that binds double-strand DNA in a sequence-specific manner at levels comparable to full-length GST-NS1, as well as single-strand DNA and RNA in a sequence-independent manner. The deletion of 15 additional amino-terminal amino acids yielded a molecule [GST-NS1(1-275)] that maintained (ACCA)2-3-specific double-strand DNA binding; however, this molecule was more sensitive to increasing ionic conditions than full-length GST-NS1 and GST-NS1(1-275) and could not be demonstrated to bind single-strand nucleic acids. A quantitative filter binding assay showed that E. coli- and baculovirus-expressed GST-NS1 and E. coli GST-NS1(1-275) specifically bound double-strand DNA with similar equilibrium kinetics [as measured by their apparent equilibrium DNA binding constants (KD)], whereas GST-NS1(16-275) bound 4- to 8-fold less well. Copyright 1998 Academic Press.

Resonant and nondissipative tunneling in independently contacted graphene structures

NASA Astrophysics Data System (ADS)

Vasko, F. T.

2013-02-01

The tunneling processes between independently contacted graphene sheets separated by thin insulator are restricted by the momentum and energy conservation laws. Because of this, both dissipative tunneling transitions, with momentum transfer due to disorder scattering, and nondissipative regime of tunneling, which appears due to intersection of electron and hole branches of energy spectrum, must be taken into account. The tunneling current density is calculated for the graphene-boron nitride-graphene layers, which is described by the tight-binding approach, and for the predominant momentum scattering by static disorder. Dependencies of current on concentrations in top and bottom graphene layers, which are governed by the voltages applied through independent contacts and gates, are considered for the back- and double-gated structures. The current-voltage characteristics of the back-gated structure are in agreement with the recent experiment [ScienceSCIEAS0036-807510.1126/science.1218461 335, 947 (2012)]. For the double-gated structures, the resonant dissipative tunneling causes a 10-fold enhancement of response which is important for transistor applications.

On the validity of the basis set superposition error and complete basis set limit extrapolations for the binding energy of the formic acid dimer

NASA Astrophysics Data System (ADS)

Miliordos, Evangelos; Xantheas, Sotiris S.

2015-03-01

We report the variation of the binding energy of the Formic Acid Dimer with the size of the basis set at the Coupled Cluster with iterative Singles, Doubles and perturbatively connected Triple replacements [CCSD(T)] level of theory, estimate the Complete Basis Set (CBS) limit, and examine the validity of the Basis Set Superposition Error (BSSE)-correction for this quantity that was previously challenged by Kalescky, Kraka, and Cremer (KKC) [J. Chem. Phys. 140, 084315 (2014)]. Our results indicate that the BSSE correction, including terms that account for the substantial geometry change of the monomers due to the formation of two strong hydrogen bonds in the dimer, is indeed valid for obtaining accurate estimates for the binding energy of this system as it exhibits the expected decrease with increasing basis set size. We attribute the discrepancy between our current results and those of KKC to their use of a valence basis set in conjunction with the correlation of all electrons (i.e., including the 1s of C and O). We further show that the use of a core-valence set in conjunction with all electron correlation converges faster to the CBS limit as the BSSE correction is less than half than the valence electron/valence basis set case. The uncorrected and BSSE-corrected binding energies were found to produce the same (within 0.1 kcal/mol) CBS limits. We obtain CCSD(T)/CBS best estimates for De = - 16.1 ± 0.1 kcal/mol and for D0 = - 14.3 ± 0.1 kcal/mol, the later in excellent agreement with the experimental value of -14.22 ± 0.12 kcal/mol.

The structure and energetics of Cr(CO)6 and Cr(CO)5

NASA Technical Reports Server (NTRS)

Barnes, Leslie A.; Liu, Bowen; Lindh, Roland

1992-01-01

The geometric structure of Cr(CO)6 is optimized at the modified coupled pair functional (MCPF), single and double excitation coupled-cluster (CCSD) and CCSD(T) levels of theory (including a perturbational estimate for connected triple excitations), and the force constants for the totally symmetric representation are determined. The geometry of Cr(CO)5 is partially optimized at the MCPF, CCSD, and CCSD(T) levels of theory. Comparison with experimental data shows that the CCSD(T) method gives the best results for the structures and force constants, and that remaining errors are probably due to deficiencies in the one-particle basis sets used for CO. The total binding energies of Cr(CO)6 and Cr(CO)5 are also determined at the MCPF, CCSD, and CCSD(T) levels of theory. The CCSD(T) method gives a much larger total binding energy than either the MCPF or CCSD methods. An analysis of the basis set superposition error (BSSE) at the MCPF level of treatment points out limitations in the one-particle basis used. Calculations using larger basis sets reduce the BSSE, but the total binding energy of Cr(CO)6 is still significantly smaller than the experimental value, although the first CO bond dissociation energy of Cr(CO)6 is well described. An investigation of 3s3p correlation reveals only a small effect. In the largest basis set, the total CO binding energy of Cr(CO)6 is estimated to be 140 kcal/mol at the CCSD(T) level of theory, or about 86 percent of the experimental value. The remaining discrepancy between the experimental and theoretical value is probably due to limitations in the one-particle basis, rather than limitations in the correlation treatment. In particular an additional d function and an f function on each C and O are needed to obtain quantitative results. This is underscored by the fact that even using a very large primitive set (1042 primitive functions contracted to 300 basis functions), the superposition error for the total binding energy of Cr(CO)6 is 22 kcal/mol at the MCPF level of treatment.

An Ab Initio Study of CuCO

NASA Technical Reports Server (NTRS)

Bauschlicher, Charles W., Jr.

1994-01-01

Modified coupled-pair functional (MCPF) calculations and coupled cluster singles and doubles calculations, which include a perturbational estimate of the connected triples [CCSD(T)], yield a bent structure for CuCO, thus, supporting the prediction of a nonlinear structure based on density functional (DF) calculations. Our best estimate for the binding energy is 4.9 +/- 1.4 kcal/mol; this is in better agreement with experiment (6.0 +/- 1.2 kcal/mol) than the DF approach which yields a value (19.6 kcal/mol) significantly larger than experiment.

The Double Bind: The next Generation

ERIC Educational Resources Information Center

Malcom, Lindsey E.; Malcom, Shirley M.

2011-01-01

In this foreword, Shirley Malcom and Lindsey Malcom speak to the history and current status of women of color in science, technology, engineering, and mathematics (STEM) fields. As the author of the seminal report "The Double Bind: The Price of Being a Minority Woman in Science", Shirley Malcom is uniquely poised to give us an insightful…

Lithium-decorated oxidized graphyne for hydrogen storage by first principles study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yan, Zeyu; Wang, Lang; Cheng, Julong

2014-11-07

The geometric stability and hydrogen storage capacity of Li decorated oxidized γ-graphyne are studied based on the first-principles calculations. It is found that oxygen atoms trend to bond with acetylenic carbons and form C=O double bonds on both sides of graphyne. The binding energy of single Li atom on oxidized graphyne is 3.29 eV, owning to the strong interaction between Li atom and O atom. Meanwhile, the dispersion of Li is stable even under a relatively high density. One attached Li atom can at least adsorb six hydrogen molecules around. Benefitting from the porous structure of graphyne and the high attachedmore » Li density, a maximum hydrogen storage density 12.03 wt. % is achieved with four Li atoms in graphyne cell. The corresponding average binding energy is 0.24 eV/H{sub 2}, which is suitable for reversible storage. These results indicate that Li decorated graphyne can serve as a promising hydrogen storage material.« less

Silicon carbide at nanoscale: Finite single-walled to "infinite" multi-walled tubes

NASA Astrophysics Data System (ADS)

Adhikari, Kapil

A systematic ab initio study of silicon carbide (SiC) nanostructures, especially finite single-walled, infinite double- and multi-walled nanotubes and nanocones is presented. Electronic and structural properties of all these nanostructures have been calculated using hybrid density functionals (B3LYP and PBE0) as implemented in the GAUSSIAN 03/09 suite of software. The unusual dependence of band gap of silicon carbide nanotubes (SiCNT) has been explained as a direct consequence of curvature effect on the ionicity of the bonds. The study of fullerene hemisphere capped, finite SiC nanotubes indicates that the carbon-capped SiC nanotubes are energetically more preferred than silicon-capped finite or hydrogen terminated infinite nanotubes. Capping a nanotube by fullerene hemisphere reduces its band gap. SiC nanocones have also been investigated as possible cap structures of nanotubes. Electronic properties of the nanocones are found to be strongly dependent upon their tip and edge structures, with possible interesting applications in surface science. Three types of double-walled SiCNTs (n, n)@(m, m) (3 ≤ n ≤ 6 ; 7 ≤ m ≤ 12) have been studied using the finite cluster approximation. The stabilities of these nanotubes are of the same order as those of the single-walled SiC nanotubes and it should be experimentally possible to synthesize both single-walled and double-walled SiC nanotubes. The binding energy per atom or the cohesive energy of the double-walled nanotubes depends not only on the number of atoms but also on the coupling of the constituent single-walled nanotubes and their types. A study of binding energies, Mulliken charges, density of states and HOMO-LUMO gaps has been performed for all nanotubes from (n, n)@(n+3,n+3) to (n, n)@(n+6, n+6) (n=3-6). Evolution of band gaps of the SiCNTs with increase in the number of walls has also been investigated. The nature of interaction between transition metal atoms and silicon carbide nanotubes with different curvature has also been investigated. The curvature of the nanotubes affects the nature of the interaction between the nanotubes and the transition teal atoms. Our study of functionalized SiCNTs by 3d transition metal atoms indicates that these nanostructures can have possible applications in spintronics and nano-magnetic storage.

Understanding of assembly phenomena by aromatic-aromatic interactions: benzene dimer and the substituted systems.

PubMed

Lee, Eun Cheol; Kim, Dongwook; Jurecka, Petr; Tarakeshwar, P; Hobza, Pavel; Kim, Kwang S

2007-05-10

Interactions involving aromatic rings are important in molecular/biomolecular assembly and engineering. As a consequence, there have been a number of investigations on dimers involving benzene or other substituted pi systems. In this Feature Article, we examine the relevance of the magnitudes of their attractive and repulsive interaction energy components in governing the geometries of several pi-pi systems. The geometries and the associated binding energies were evaluated at the complete basis set (CBS) limit of coupled cluster theory with singles, doubles, and perturbative triples excitations [CCSD(T)] using a least biased scheme for the given data set. The results for the benzene dimer indicate that the floppy T-shaped structure (center-to-center distance: 4.96 A, with an axial benzene off-centered above the facial benzene) is isoenergetic in zero-point-energy (ZPE) corrected binding energy (D0) to the displaced-stacked structure (vertical interplanar distance: 3.54 A). However, the T-shaped structure is likely to be slightly more stable (D0 approximately equal to 2.4-2.5 kcal/mol) if quadruple excitations are included in the coupled cluster calculations. The presence of substituents on the aromatic ring, irrespective of their electron withdrawing or donating nature, leads to an increase in the binding energy, and the displaced-stacked conformations are more stabilized than the T-shaped conformers. This explains the wide prevalence of displaced stacked structures in organic crystals. Despite that the dispersion energy is dominating, the substituent as well as the conformational effects are correlated to the electrostatic interaction. This electrostatic origin implies that the substituent effect would be reduced in polar solution, but important in apolar media, in particular, for assembling processes.

Consequences of Energetic Frustration on the Ligand-Coupled Folding/Dimerization Dynamics of Allosteric Protein S100A12.

PubMed

Ren, Weitong; Li, Wenfei; Wang, Jun; Zhang, Jian; Wang, Wei

2017-10-26

Allosteric proteins are featured by energetic degeneracy of two (or more) functionally relevant conformations, therefore their energy landscapes are often locally frustrated. How such frustration affects the protein folding/binding dynamics is not well understood. Here, by using molecular simulations we study the consequences of local frustration in the dimerization dynamics of allosteric proteins based on a homodimer protein S100A12. Despite of the structural symmetry of the two EF-hand motifs in the three-dimensional structures, the S100A12 homodimer shows allosteric behaviors and local frustration only in half of its structural elements, i.e., the C-terminal EF-hand. We showed that such spatially asymmetric location of frustration leads to asymmetric dimerization pathways, in which the dimerization is dominantly initiated by the interchain binding of the minimally frustrated N-terminal EF-hands, achieving optimal balance between the requirements of rapid conformational switching and interchain assembling to the energy landscapes. We also showed that the local frustration, as represented by the double-basin topography of the energy landscape, gives rise to multiple cross-linked dimerization pathways, in which the dimerization is coupled with the allosteric motions of the C-terminal EF-hands. Binding of metal ions tends to reshape the energy landscape and modulate the dimerization pathways. In addition, by employing the frustratometer method, we showed that the highly frustrated residue-pairs in the C-terminal EF-hand are partially unfolded during the conformational transitions of the native homodimer, leading to lowing of free energy barrier. Our results revealed tight interplay between the local frustration of the energy landscape and the dimerization dynamics for allosteric proteins.

Vital Roles of the Second DNA-binding Site of Rad52 Protein in Yeast Homologous Recombination*

PubMed Central

Arai, Naoto; Kagawa, Wataru; Saito, Kengo; Shingu, Yoshinori; Mikawa, Tsutomu; Kurumizaka, Hitoshi; Shibata, Takehiko

2011-01-01

RecA/Rad51 proteins are essential in homologous DNA recombination and catalyze the ATP-dependent formation of D-loops from a single-stranded DNA and an internal homologous sequence in a double-stranded DNA. RecA and Rad51 require a “recombination mediator” to overcome the interference imposed by the prior binding of single-stranded binding protein/replication protein A to the single-stranded DNA. Rad52 is the prototype of recombination mediators, and the human Rad52 protein has two distinct DNA-binding sites: the first site binds to single-stranded DNA, and the second site binds to either double- or single-stranded DNA. We previously showed that yeast Rad52 extensively stimulates Rad51-catalyzed D-loop formation even in the absence of replication protein A, by forming a 2:1 stoichiometric complex with Rad51. However, the precise roles of Rad52 and Rad51 within the complex are unknown. In the present study, we constructed yeast Rad52 mutants in which the amino acid residues corresponding to the second DNA-binding site of the human Rad52 protein were replaced with either alanine or aspartic acid. We found that the second DNA-binding site is important for the yeast Rad52 function in vivo. Rad51-Rad52 complexes consisting of these Rad52 mutants were defective in promoting the formation of D-loops, and the ability of the complex to associate with double-stranded DNA was specifically impaired. Our studies suggest that Rad52 within the complex associates with double-stranded DNA to assist Rad51-mediated homologous pairing. PMID:21454474

Antibody-mediated fluorescence enhancement based on shifting the intramolecular dimer<-->monomer equilibrium of fluorescent dyes.

PubMed

Wei, A P; Blumenthal, D K; Herron, J N

1994-05-01

A novel concept is described for directly coupling fluorescence emission to protein-ligand binding. It is based on shifting the intramolecular monomer<-->dimer equilibrium of two fluorescent dyes linked by a short spacer. A 13-residue peptide, recognized by a monoclonal antibody against human chorionic gonadotrophin (hCG), was labeled with fluorescein (F) and tetramethylrhodamine (T) at its N- and C-terminus, respectively. Spectral evidence suggests that when the conjugate is free in solution, F and T exist as an intramolecular dimer. Fluorescence quenching of fluorescein and rhodamine is approximately 98% and approximately 90%, respectively, due to dimerization. When the double-labeled peptide is bound to anti-hCG, however, the rhodamine fluorescence increases by up to 7.8-fold, depending upon the excitation wavelength. This is attributed to the dissociation of intramolecular dimers brought about by conformational changes of the conjugate upon binding. Fluorescein fluorescence, on the other hand, was still quenched because of excited-state energy transfer and residual ground-state interactions. Antibody binding also resulted in a approximately 3.4-fold increase in fluorescence anisotropy of the peptide. These changes in intensity and anisotropy allow direct measurement of antigen-antibody binding with a fluorescence plate reader or a polarization analyzer, without the need for separation steps and labeling antibodies. Because recent advances in peptide technology have allowed rapid and economical identification of antigen-mimicking peptides, the double-labeled peptide approach offers many opportunities for developing new diagnostic assays and screening new therapeutic drugs. It also has many potential applications to techniques involving recombinant antibodies, biosensors, cell sorting, and DNA probes.

Loop L1 governs the DNA-binding specificity and order for RecA-catalyzed reactions in homologous recombination and DNA repair

PubMed Central

Shinohara, Takeshi; Ikawa, Shukuko; Iwasaki, Wakana; Hiraki, Toshiki; Hikima, Takaaki; Mikawa, Tsutomu; Arai, Naoto; Kamiya, Nobuo; Shibata, Takehiko

2015-01-01

In all organisms, RecA-family recombinases catalyze homologous joint formation in homologous genetic recombination, which is essential for genome stability and diversification. In homologous joint formation, ATP-bound RecA/Rad51-recombinases first bind single-stranded DNA at its primary site and then interact with double-stranded DNA at another site. The underlying reason and the regulatory mechanism for this conserved binding order remain unknown. A comparison of the loop L1 structures in a DNA-free RecA crystal that we originally determined and in the reported DNA-bound active RecA crystals suggested that the aspartate at position 161 in loop L1 in DNA-free RecA prevented double-stranded, but not single-stranded, DNA-binding to the primary site. This was confirmed by the effects of the Ala-replacement of Asp-161 (D161A), analyzed directly by gel-mobility shift assays and indirectly by DNA-dependent ATPase activity and SOS repressor cleavage. When RecA/Rad51-recombinases interact with double-stranded DNA before single-stranded DNA, homologous joint-formation is suppressed, likely by forming a dead-end product. We found that the D161A-replacement reduced this suppression, probably by allowing double-stranded DNA to bind preferentially and reversibly to the primary site. Thus, Asp-161 in the flexible loop L1 of wild-type RecA determines the preference for single-stranded DNA-binding to the primary site and regulates the DNA-binding order in RecA-catalyzed recombinase reactions. PMID:25561575

Voices of Aspiring Teachers of Color: Unraveling the Double Bind in Teacher Education

ERIC Educational Resources Information Center

Gist, Conra D.

2017-01-01

This article centers and investigates the voices of teacher candidates of color to examine how double binds influence their teaching and learning experiences in teacher education programs. Interview and focus group data from teacher candidates of color at two teacher education programs are analyzed to unpack the types of personal and systemic ties…

Unraveling the Double Bind: Women of Color in STEM

ERIC Educational Resources Information Center

Harvard Educational Review, 2011

2011-01-01

In 1976, the challenges faced by women of color who pursue careers in science, technology, engineering, and mathematics (STEM) fields were first brought to national attention by Shirley M. Malcom, Paula Hall, and Janet Brown in a report titled "The Double Bind: The Price of Being a Minority Woman in Science." In commemoration of the 35th…

Major versus minor groove DNA binding of a bisarginylporphyrin hybrid molecule: A molecular mechanics investigation

NASA Astrophysics Data System (ADS)

Gresh, Nohad; Perrée-fauvet, Martine

1999-03-01

On the basis of theoretical computations, we have recently synthesised [Perrée-Fauvet, M. and Gresh, N., Tetrahedron Lett., 36 (1995) 4227] a bisarginyl conjugate of a tricationic porphyrin (BAP), designed to target, in the major groove of DNA, the d(GGC GCC)2 sequence which is part of the primary binding site of the HIV-1 retrovirus site [Wain-Hobson, S. et al., Cell, 40 (1985) 9]. In the theoretical model, the chromophore intercalates at the central d(CpG)2 step and each of the arginyl arms targets O6/N7belonging to guanine bases flanking the intercalation site. Recent IR and UV-visible spectroscopic studies have confirmed the essential features of these theoretical predictions [Mohammadi, S. et al., Biochemistry, 37 (1998) 6165]. In the present study, we compare the energies of competing intercalation modes of BAP to several double-stranded oligonucleotides, according to whether one, two or three N- methylpyridinium rings project into the major groove. Correspondingly, three minor groove binding modes were considered, the arginyl arms now targeting N3, O2 sites belonging to the purine or pyrimidine bases flanking the intercalation site. This investigation has shown that: (i) in both the major and minor grooves, the best-bound complexes have the three N-methylpyridinium rings in the groove opposite to that of the phenyl group bearing the arginyl arms; (ii) major groove binding is preferred over minor groove binding by a significant energy (29 kcal/mol); and (iii) the best-bound sequence in the major groove is d(GGC GCC)2 with two successive guanines upstream from the intercalation. On the other hand, due to the flexibility of the arginyl arms, other GC-rich sequences have close binding energies, two of them being less stable than it by less than 8 kcal/mol. These results serve as the basis for the design of derivatives of BAP with enhanced sequence selectivities in the major groove.

MONTE CARLO POPULATION SYNTHESIS OF POST-COMMON-ENVELOPE WHITE DWARF BINARIES AND TYPE Ia SUPERNOVA RATE

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ablimit, Iminhaji; Maeda, Keiichi; Li, Xiang-Dong

Binary population synthesis (BPS) studies provide a comprehensive way to understand the evolution of binaries and their end products. Close white dwarf (WD) binaries have crucial characteristics for examining the influence of unresolved physical parameters on binary evolution. In this paper, we perform Monte Carlo BPS simulations, investigating the population of WD/main-sequence (WD/MS) binaries and double WD binaries using a publicly available binary star evolution code under 37 different assumptions for key physical processes and binary initial conditions. We considered different combinations of the binding energy parameter ( λ {sub g}: considering gravitational energy only; λ {sub b}: considering bothmore » gravitational energy and internal energy; and λ {sub e}: considering gravitational energy, internal energy, and entropy of the envelope, with values derived from the MESA code), CE efficiency, critical mass ratio, initial primary mass function, and metallicity. We find that a larger number of post-CE WD/MS binaries in tight orbits are formed when the binding energy parameters are set by λ {sub e} than in those cases where other prescriptions are adopted. We also determine the effects of the other input parameters on the orbital periods and mass distributions of post-CE WD/MS binaries. As they contain at least one CO WD, double WD systems that evolved from WD/MS binaries may explode as type Ia supernovae (SNe Ia) via merging. In this work, we also investigate the frequency of two WD mergers and compare it to the SNe Ia rate. The calculated Galactic SNe Ia rate with λ = λ {sub e} is comparable to the observed SNe Ia rate, ∼8.2 × 10{sup 5} yr{sup 1} – ∼4 × 10{sup 3} yr{sup 1} depending on the other BPS parameters, if a DD system does not require a mass ratio higher than ∼0.8 to become an SNe Ia. On the other hand, a violent merger scenario, which requires the combined mass of two CO WDs ≥ 1.6 M {sub ⊙} and a mass ratio >0.8, results in a much lower SNe Ia rate than is observed.« less

No way out? The double-bind in seeking global prosperity along with mitigated climate change

NASA Astrophysics Data System (ADS)

Garrett, T. J.

2011-04-01

In a prior study (Garrett, 2011), I introduced a simple thermodynamics-based economic growth model. By treating civilization as a whole, it was found that the global economy's current rate of energy consumption can be tied through a constant to its current accumulation of wealth. The value of the constant is λ = 9.7 ± 0.3 milliwatts per 1990 US dollar. Here, this model is coupled to a linear formulation for the evolution of atmospheric CO2 concentrations. Despite the model's extreme simplicity, multi-decadal hindcasts of trajectories in gross world product (GWP) and CO2 agree closely with recent observations. Extending the model to the future, the model implies that the well-known IPCC SRES scenarios substantially underestimate how much CO2 levels will rise for a given level of future economic prosperity. Instead, what is shown is that, like a long-term natural disaster, future greenhouse warming should be expected to retard the real growth of wealth through inflationary pressures. Because wealth is tied to rates of energy consumption through the constant λ, it follows that dangerous climate change should be a negative feedback on CO2 emission rates, and therefore the ultimate extent of greenhouse warming. Nonetheless, if atmospheric CO2 concentrations are to remain below a "dangerous" level of 450 ppmv (Hansen et al., 2007), there will have to be some combination of an unrealistically rapid rate of energy decarbonization and a near immediate collapse of civilization wealth. Effectively, civilization is in a double-bind. If civilization does not collapse quickly this century, then CO2 levels will likely end up exceeding 1000 ppmv; but, if CO2 levels rise by this much, then the danger is that civilization will gradually tend towards collapse.

cgDNAweb: a web interface to the cgDNA sequence-dependent coarse-grain model of double-stranded DNA.

PubMed

De Bruin, Lennart; Maddocks, John H

2018-06-14

The sequence-dependent statistical mechanical properties of fragments of double-stranded DNA is believed to be pertinent to its biological function at length scales from a few base pairs (or bp) to a few hundreds of bp, e.g. indirect read-out protein binding sites, nucleosome positioning sequences, phased A-tracts, etc. In turn, the equilibrium statistical mechanics behaviour of DNA depends upon its ground state configuration, or minimum free energy shape, as well as on its fluctuations as governed by its stiffness (in an appropriate sense). We here present cgDNAweb, which provides browser-based interactive visualization of the sequence-dependent ground states of double-stranded DNA molecules, as predicted by the underlying cgDNA coarse-grain rigid-base model of fragments with arbitrary sequence. The cgDNAweb interface is specifically designed to facilitate comparison between ground state shapes of different sequences. The server is freely available at cgDNAweb.epfl.ch with no login requirement.

Five-Body Cluster Structure of the Double-{Lambda} Hypernucleus {sub {Lambda}{Lambda}}{sup 11}Be

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hiyama, E.; Kamimura, M.; Yamamoto, Y.

2010-05-28

Energy levels of the double {Lambda} hypernucleus, {sub {Lambda}{Lambda}}{sup 11}Be are calculated within the framework of a {alpha}{alpha}n{Lambda}{Lambda} five-body model. Interactions between constituent particles are determined so as to reproduce reasonably the observed low-energy properties of the {alpha}{alpha}, {alpha}{alpha}n nuclei and the existing data for {Lambda}-binding energies of the {alpha}{Lambda}, {alpha}{alpha}{Lambda}, {alpha}n{Lambda}, and {alpha}{alpha}n{Lambda} systems. An effective {Lambda}{Lambda} interaction is constructed so as to reproduce, within the {alpha}{Lambda}{Lambda} three-body model, the B{sub {Lambda}{Lambda}}of {sub {Lambda}{Lambda}}{sup 6}He, which was extracted from the emulsion experiment, the NAGARA event. With no adjustable parameters for the {alpha}{alpha}n{Lambda}{Lambda} system, B{sub {Lambda}{Lambda}}of the ground and boundmore » excited states of {sub {Lambda}{Lambda}}{sup 11}Be are calculated with the Gaussian expansion method. The Hida event, recently observed at KEK-E373 experiment, is interpreted as an observation of the ground state of the {sub {Lambda}{Lambda}}{sup 11}Be.« less

Structure, stability, thermodynamic properties, and IR spectra of the protonated water decamer H+(H2O)10.

PubMed

Karthikeyan, S; Kim, Kwang S

2009-08-13

Protonated water clusters H+(H2O)n favor two-dimensional (2D) structures for n < or = 7 at low temperatures. At 0 K, the 2D and three-dimensional (3D) structures for n = 8 are almost isoenergetic, and the 3D structures for n > 9 tend to be more stable. However, for n = 9, the netlike structures are likely to be more stable above 150 K. In this regard, we investigate the case of n = 10 to find which structure is more stable between the 3D structure and the netlike structure around 150 and 250 K. We use density functional theory, Møller-Plesset second-order perturbation theory, and coupled cluster theory with single, double, and perturbative triple excitations (CCSD(T)). At the complete basis set limit for the CCSD(T) level of theory, three isomers of 3D cage structure are much more stable in zero point energy corrected binding energy and in free binding energies at 150 K than the lowest energy netlike structures, while the netlike structure would be more stable around approximately 250 K. The predicted vibrational spectra are in good agreement with the experiment. One of the three isomers explains the experimental IR observation of an acceptor (A) type peak of a dangling hydrogen atom.

Low-temperature binding of NO adsorbed on MIL-100(Al)-A case study for the application of high resolution pulsed EPR methods and DFT calculations.

PubMed

Mendt, Matthias; Barth, Benjamin; Hartmann, Martin; Pöppl, Andreas

2017-12-14

The low-temperature binding of nitric oxide (NO) in the metal-organic framework MIL-100(Al) has been investigated by pulsed electron nuclear double resonance and hyperfine sublevel correlation spectroscopy. Three NO adsorption species have been identified. Among them, one species has been verified experimentally to bind directly to an 27 Al atom and all its relevant 14 N and 27 Al hyperfine interaction parameters have been determined spectroscopically. Those parameters fit well to the calculated ones of a theoretical cluster model, which was derived by density functional theory (DFT) in the present work and describes the low temperature binding of NO to the regular coordinatively unsaturated Al 3+ site of the MIL-100(Al) structure. As a result, the Lewis acidity of that site has been characterized using the NO molecule as an electron paramagnetic resonance active probe. The DFT derived wave function analysis revealed a bent end-on coordination of the NO molecule adsorbed at that site which is almost purely ionic and has a weak binding energy. The calculated flat potential energy surface of this species indicates the ability of the NO molecule to freely rotate at intermediate temperatures while it is still binding to the Al 3+ site. For the other two NO adsorption species, no structural models could be derived, but one of them is indicated to be adsorbed at the organic part of the metal-organic framework. Hyperfine interactions with protons, weakly coupled to the observed NO adsorption species, have also been measured by pulsed electron paramagnetic resonance and found to be consistent with their attribution to protons of the MIL-100(Al) benzenetricarboxylate ligand molecules.

Aza-Bambusurils En Route to Anion Transporters.

PubMed

Singh, Mandeep; Solel, Ephrath; Keinan, Ehud; Reany, Ofer

2016-06-20

Previous calculations of anion binding with various bambusuril analogs predicted that the replacement of oxygen by nitrogen atoms to produce semiaza-bambus[6]urils would award these new cavitands with multiple anion binding properties. This study validates the hypothesis by efficient synthesis, crystallography, thermogravimetric analysis and calorimetry. These unique host molecules are easily accessible from the corresponding semithio-bambusurils in a one-pot reaction, which converts a single anion receptor into a potential anion channel. Solid-state structures exhibit simultaneous accommodation of three anions, linearly positioned within the cavity along the main symmetry axis. The ability to hold anions at a short distance of about 4 Å is reminiscent of natural chloride channels in E. coli, which exhibit similar distances between their adjacent anion binding sites. The calculated transition-state energy for double-anion movement through the channel suggests that although these host-guest complexes are thermodynamically stable they enjoy high kinetic flexibility to render them efficient anion channels. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Energy and fuels from electrochemical interfaces

NASA Astrophysics Data System (ADS)

Stamenkovic, Vojislav R.; Strmcnik, Dusan; Lopes, Pietro P.; Markovic, Nenad M.

2017-01-01

Advances in electrocatalysis at solid-liquid interfaces are vital for driving the technological innovations that are needed to deliver reliable, affordable and environmentally friendly energy. Here, we highlight the key achievements in the development of new materials for efficient hydrogen and oxygen production in electrolysers and, in reverse, their use in fuel cells. A key issue addressed here is the degree to which the fundamental understanding of the synergy between covalent and non-covalent interactions can form the basis for any predictive ability in tailor-making real-world catalysts. Common descriptors such as the substrate-hydroxide binding energy and the interactions in the double layer between hydroxide-oxides and H---OH are found to control individual parts of the hydrogen and oxygen electrochemistry that govern the efficiency of water-based energy conversion and storage systems. Links between aqueous- and organic-based environments are also established, encouraging the 'fuel cell' and 'battery' communities to move forward together.

The Fanconi anemia associated protein FAAP24 uses two substrate specific binding surfaces for DNA recognition

PubMed Central

Wienk, Hans; Slootweg, Jack C.; Speerstra, Sietske; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

2013-01-01

To maintain the integrity of the genome, multiple DNA repair systems exist to repair damaged DNA. Recognition of altered DNA, including bulky adducts, pyrimidine dimers and interstrand crosslinks (ICL), partially depends on proteins containing helix-hairpin-helix (HhH) domains. To understand how ICL is specifically recognized by the Fanconi anemia proteins FANCM and FAAP24, we determined the structure of the HhH domain of FAAP24. Although it resembles other HhH domains, the FAAP24 domain contains a canonical hairpin motif followed by distorted motif. The HhH domain can bind various DNA substrates; using nuclear magnetic resonance titration experiments, we demonstrate that the canonical HhH motif is required for double-stranded DNA (dsDNA) binding, whereas the unstructured N-terminus can interact with single-stranded DNA. Both DNA binding surfaces are used for binding to ICL-like single/double-strand junction-containing DNA substrates. A structural model for FAAP24 bound to dsDNA has been made based on homology with the translesion polymerase iota. Site-directed mutagenesis, sequence conservation and charge distribution support the dsDNA-binding model. Analogous to other HhH domain-containing proteins, we suggest that multiple FAAP24 regions together contribute to binding to single/double-strand junction, which could contribute to specificity in ICL DNA recognition. PMID:23661679

Computational Study on Full-length Human Ku70 with Double Stranded DNA: Dynamics, Interactions and Functional Implications

NASA Technical Reports Server (NTRS)

Hu, Shaowen; Cucinotta, Francis A.

2009-01-01

The Ku70/80 heterodimer is the first repair protein in the initial binding of double-strand break (DSB) ends following DNA damage, and is a component of nonhomologous end joining repair, the primary pathway for DSB repair in mammalian cells. In this study we constructed a full-length human Ku70 structure based on its crystal structure, and performed 20 ns conventional molecular dynamic (CMD) simulations on this protein and several other complexes with short DNA duplexes of different sequences. The trajectories of these simulations indicated that, without the topological support of Ku80, the residues in the bridge and C-terminal arm of Ku70 are more flexible than other experimentally identified domains. We studied the two missing loops in the crystal structure and predicted that they are also very flexible. Simulations revealed that they make an important contribution to the Ku70 interaction with DNA. Dislocation of the previously studied SAP domain was observed in several systems, implying its role in DNA binding. Targeted molecular dynamic (TMD) simulation was also performed for one system with a far-away 14bp DNA duplex. The TMD trajectory and energetic analysis disclosed detailed interactions of the DNA-binding residues during the DNA dislocation, and revealed a possible conformational transition for a DSB end when encountering Ku70 in solution. Compared to experimentally based analysis, this study identified more detailed interactions between DNA and Ku70. Free energy analysis indicated Ku70 alone is able to bind DNA with relatively high affinity, with consistent contributions from various domains of Ku70 in different systems. The functional implications of these domains in the processes of Ku heterodimerization and DNA damage recognition and repair can be characterized in detail based upon this analysis.

Computational studies of metal-metal and metal-ligand interactions

NASA Technical Reports Server (NTRS)

Barnes, Leslie A.

1992-01-01

The geometric structure of Cr(CO)6 is optimized at the modified coupled-pair functional (MCPF), single and double excitation coupled-cluster (CCSD) and CCSD(T) levels of theory (including a perturbational estimate for connected triple excitations), and the force constants for the totally symmetric representation are determined. The geometry of Cr(CO)5 is partially optimized at the MCPF, CCSD and CCSD(T) levels of theory. Comparison with experimental data shows that the CCSD(T) method gives the best results for the structures and force constants, and that remaining errors are probably due to deficiencies in the one-particle basis sets used for CO. A detailed comparison of the properties of free CO is therefore given, at both the MCPF and CCSD/CCSD(T) levels of treatment, using a variety of basis sets. With very large one-particle basis sets, the SSCD(T) method gives excellent results for the bond distance, dipole moment and harmonic frequency of free CO. The total binding energies of Cr(CO)6 and Cr(CO)5 are also determined at the MCPF, CCSD and CCSD(T) levels of theory. The CCSD(T) method gives a much larger total binding energy than either the MCPF or CCSD methods. An analysis of the basis set superposition error (BSSE) at the MCPF level of treatment points out limitations in the one-particle basis used here and in a previous study. Calculations using larger basis sets reduced the BSSE, but the total binding energy of Cr(CO)6 is still significantly smaller than the experimental value, although the first CO bond dissociation energy of Cr(CO)6 is well described. An investigation of 3s3p correlation reveals only a small effect. The remaining discrepancy between the experimental and theoretical total binding energy of Cr(CO)6 is probably due to limitations in the one-particle basis, rather than limitations in the correlation treatment. In particular an additional d function and an f function on each C and O are needed to obtain quantitative results. This is underscored by the fact that even using a very large primitive se (1042 primitive functions contracted to 300 basis functions), the superposition error for the total binding energy of Cr(CO)6 is 22 kcal/mol at the MCPF level of treatment.

Direct Spectroscopic Detection of ATP Turnover Reveals Mechanistic Divergence of ABC Exporters.

PubMed

Collauto, Alberto; Mishra, Smriti; Litvinov, Aleksei; Mchaourab, Hassane S; Goldfarb, Daniella

2017-08-01

We have applied high-field (W-band) pulse electron-nuclear double resonance (ENDOR) and electron-electron double resonance (ELDOR)-detected nuclear magnetic resonance (EDNMR) to characterize the coordination sphere of the Mn 2+ co-factor in the nucleotide binding sites (NBSs) of ABC transporters. MsbA and BmrCD are two efflux transporters hypothesized to represent divergent catalytic mechanisms. Our results reveal distinct coordination of Mn 2+ to ATP and transporter residues in the consensus and degenerate NBSs of BmrCD. In contrast, the coordination of Mn 2+ at the two NBSs of MsbA is similar, which provides a mechanistic rationale for its higher rate constant of ATP hydrolysis relative to BmrCD. Direct detection of vanadate ion, trapped in a high-energy post-hydrolysis intermediate, further supports the notion of asymmetric hydrolysis by the two NBSs of BmrCD. The integrated spectroscopic approach presented here, which link energy input to conformational dynamics, can be applied to a variety of systems powered by ATP turnover. Copyright © 2017 Elsevier Ltd. All rights reserved.

Stability and Sugar Recognition Ability of Ricin-Like Carbohydrate Binding Domains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yao, Jianzhuang; Nellas, Ricky B; Glover, Mary M

2011-01-01

Lectins are a class of proteins known for their novel binding to saccharides. Understanding this sugar recognition process can be crucial in creating structure-based designs of proteins with various biological roles. We focus on the sugar binding of a particular lectin, ricin, which has two -trefoil carbohydrate-binding domains (CRDs) found in several plant protein toxins. The binding ability of possible sites of ricin-like CRD has been puzzling. The apo and various (multiple) ligand-bound forms of the sugar-binding domains of ricin were studied by molecular dynamics simulations. By evaluating structural stability, hydrogen bond dynamics, flexibility, and binding energy, we obtained amore » detailed picture of the sugar recognition of the ricin-like CRD. Unlike what was previously believed, we found that the binding abilities of the two known sites are not independent of each other. The binding ability of one site is positively affected by the other site. While the mean positions of different binding scenarios are not altered significantly, the flexibility of the binding pockets visibly decreases upon multiple ligand binding. This change in flexibility seems to be the origin of the binding cooperativity. All the hydrogen bonds that are strong in the monoligand state are also strong in the double-ligand complex, although the stability is much higher in the latter form due to cooperativity. These strong hydrogen bonds in a monoligand state are deemed to be the essential hydrogen bonds. Furthermore, by examining the structural correlation matrix, the two domains are structurally one entity. Galactose hydroxyl groups, OH4 and OH3, are the most critical parts in both site 1 and site 2 recognition.« less

Determinants of binding affinity and specificity for the interaction of TEM-1 and SME-1 beta-lactamase with beta-lactamase inhibitory protein.

PubMed

Zhang, Zhen; Palzkill, Timothy

2003-11-14

The hydrolysis of beta-lactam antibiotics by class A beta-lactamases is a common cause of bacterial resistance to these agents. The beta-lactamase inhibitory protein (BLIP) is able to bind and inhibit several class A beta-lactamases, including TEM-1 beta-lactamase and SME-1 beta-lactamase. Although the TEM-1 and SME-1 enzymes share 33% amino acid sequence identity and a similar fold, they differ substantially in surface electrostatic properties and the conformation of a loop-helix region that BLIP binds. Alanine-scanning mutagenesis was performed to identify the residues on BLIP that contribute to its binding affinity for each of these enzymes. The results indicate that the sequence requirements for binding are similar for both enzymes with most of the binding free energy provided by two patches of aromatic residues on the surface of BLIP. Polar residues such as several serines in the interface do not make significant contributions to affinity for either enzyme. In addition, the specificity of binding is significantly altered by mutation of two charged residues, Glu73 and Lys74, that are buried in the structure of the TEM-1.BLIP complex as well as by residues located on two loops that insert into the active site pocket. Based on the results, a E73A/Y50A double mutant was constructed that exhibited a 220,000-fold change in binding specificity for the TEM-1 versus SME-1 enzymes.

Knowledge-Based Elastic Potentials for Docking Drugs or Proteins with Nucleic Acids

PubMed Central

Ge, Wei; Schneider, Bohdan; Olson, Wilma K.

2005-01-01

Elastic ellipsoidal functions defined by the observed hydration patterns around the DNA bases provide a new basis for measuring the recognition of ligands in the grooves of double-helical structures. Here a set of knowledge-based potentials suitable for quantitative description of such behavior is extracted from the observed positions of water molecules and amino acid atoms that form hydrogen bonds with the nitrogenous bases in high resolution crystal structures. Energies based on the displacement of hydrogen-bonding sites on drugs in DNA-crystal complexes relative to the preferred locations of water binding around the heterocyclic bases are low, pointing to the reliability of the potentials and the apparent displacement of water molecules by drug atoms in these structures. The validity of the energy functions has been further examined in a series of sequence substitution studies based on the structures of DNA bound to polyamides that have been designed to recognize the minor-groove edges of Watson-Crick basepairs. The higher energies of binding to incorrect sequences superimposed (without conformational adjustment or displacement of polyamide ligands) on observed high resolution structures confirm the hypothesis that the drug subunits associate with specific DNA bases. The knowledge-based functions also account satisfactorily for the measured free energies of DNA-polyamide association in solution and the observed sites of polyamide binding on nucleosomal DNA. The computations are generally consistent with mechanisms by which minor-groove binding ligands are thought to recognize DNA basepairs. The calculations suggest that the asymmetric distributions of hydrogen-bond-forming atoms on the minor-groove edge of the basepairs may underlie ligand discrimination of G·C from C·G pairs, in addition to the commonly believed role of steric hindrance. The analysis of polyamide-bound nucleosomal structures reveals other discrepancies in the expected chemical design, including unexpected contacts to DNA and modified basepair targets of some ligands. The ellipsoidal potentials thus appear promising as a mathematical tool for the study of drug- and protein-DNA interactions and for gaining new insights into DNA-binding mechanisms. PMID:15501936

Binding to the minor groove of the double-strand, tau protein prevents DNA from damage by peroxidation.

PubMed

Wei, Yan; Qu, Mei-Hua; Wang, Xing-Sheng; Chen, Lan; Wang, Dong-Liang; Liu, Ying; Hua, Qian; He, Rong-Qiao

2008-07-02

Tau, an important microtubule associated protein, has been found to bind to DNA, and to be localized in the nuclei of both neurons and some non-neuronal cells. Here, using electrophoretic mobility shifting assay (EMSA) in the presence of DNA with different chain-lengths, we observed that tau protein favored binding to a 13 bp or a longer polynucleotide. The results from atomic force microscopy also showed that tau protein preferred a 13 bp polynucleotide to a 12 bp or shorter polynucleotide. In a competitive assay, a minor groove binder distamycin A was able to replace the bound tau from the DNA double helix, indicating that tau protein binds to the minor groove. Tau protein was able to protect the double-strand from digestion in the presence of DNase I that was bound to the minor groove. On the other hand, a major groove binder methyl green as a negative competitor exhibited little effect on the retardation of tau-DNA complex in EMSA. This further indicates the DNA minor groove as the binding site for tau protein. EMSA with truncated tau proteins showed that both the proline-rich domain (PRD) and the microtubule-binding domain (MTBD) contributed to the interaction with DNA; that is to say, both PRD and MTBD bound to the minor groove of DNA and bent the double-strand, as observed by electron microscopy. To investigate whether tau protein is able to prevent DNA from the impairment by hydroxyl free radical, the chemiluminescence emitted by the phen-Cu/H(2)O(2)/ascorbate was measured. The emission intensity of the luminescence was markedly decreased when tau protein was present, suggesting a significant protection of DNA from the damage in the presence of hydroxyl free radical.

Cryptic MCAT enhancer regulation in fibroblasts and smooth muscle cells. Suppression of TEF-1 mediated activation by the single-stranded DNA-binding proteins, Pur alpha, Pur beta, and MSY1.

PubMed

Carlini, Leslie E; Getz, Michael J; Strauch, Arthur R; Kelm, Robert J

2002-03-08

An asymmetric polypurine-polypyrimidine cis-element located in the 5' region of the mouse vascular smooth muscle alpha-actin gene serves as a binding site for multiple proteins with specific affinity for either single- or double-stranded DNA. Here, we test the hypothesis that single-stranded DNA-binding proteins are responsible for preventing a cryptic MCAT enhancer centered within this element from cooperating with a nearby serum response factor-interacting CArG motif to trans-activate the minimal promoter in fibroblasts and smooth muscle cells. DNA binding studies revealed that the core MCAT sequence mediates binding of transcription enhancer factor-1 to the double-stranded polypurine-polypyrimidine element while flanking nucleotides account for interaction of Pur alpha and Pur beta with the purine-rich strand and MSY1 with the complementary pyrimidine-rich strand. Mutations that selectively impaired high affinity single-stranded DNA binding by fibroblast or smooth muscle cell-derived Pur alpha, Pur beta, and MSY1 in vitro, released the cryptic MCAT enhancer from repression in transfected cells. Additional experiments indicated that Pur alpha, Pur beta, and MSY1 also interact specifically, albeit weakly, with double-stranded DNA and with transcription enhancer factor-1. These results are consistent with two plausible models of cryptic MCAT enhancer regulation by Pur alpha, Pur beta, and MSY1 involving either competitive single-stranded DNA binding or masking of MCAT-bound transcription enhancer factor-1.

Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert

Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This alsomore » represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.« less

Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase

DOE PAGES

Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert; ...

2015-06-02

Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This alsomore » represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.« less

The effect of histamine on changes in mental energy and fatigue after a single bout of exercise.

PubMed

Loy, Bryan D; O'Connor, Patrick J

2016-01-01

The purpose of this research was to determine if histamine, acting on brain H1 receptors, influences changes in feelings of energy and fatigue or cognitive test performance after acute exercise. Women (n=20) with low vigor and high fatigue were administered the H1 antagonist drug doxepin hydrocholoride (6 mg) in tomato juice and tomato juice alone (placebo) in a randomized, double-blinded, cross-over experiment before performing 30 min of light intensity cycling exercise and completing energy, fatigue, sleepiness, and motivation scales, and cognitive tasks. After exercise, mental fatigue increased for the doxepin condition (p=0.014) but not placebo (p=0.700), while mental energy decreased for both PLA and DOX (p<0.001) and cognitive task performance was unaffected. It is inferred that histamine binding to H1 receptors in the brain has a role in exercise-induced reductions in mental fatigue, but not increases in energy. Copyright © 2015 Elsevier Inc. All rights reserved.

Double Super-Exchange in Silicon Quantum Dots Connected by Short-Bridged Networks

NASA Astrophysics Data System (ADS)

Li, Huashan; Wu, Zhigang; Lusk, Mark

2013-03-01

Silicon quantum dots (QDs) with diameters in the range of 1-2 nm are attractive for photovoltaic applications. They absorb photons more readily, transport excitons with greater efficiency, and show greater promise in multiple-exciton generation and hot carrier collection paradigms. However, their high excitonic binding energy makes it difficult to dissociate excitons into separate charge carriers. One possible remedy is to create dot assemblies in which a second material creates a Type-II heterojunction with the dot so that exciton dissociation occurs locally. This talk will focus on such a Type-II heterojunction paradigm in which QDs are connected via covalently bonded, short-bridge molecules. For such interpenetrating networks of dots and molecules, our first principles computational investigation shows that it is possible to rapidly and efficiently separate electrons to QDs and holes to bridge units. The bridge network serves as an efficient mediator of electron superexchange between QDs while the dots themselves play the complimentary role of efficient hole superexchange mediators. Dissociation, photoluminescence and carrier transport rates will be presented for bridge networks of silicon QDs that exhibit such double superexchange. This material is based upon work supported by the Renewable Energy Materials Research Science and Engineering Center (REMRSEC) under Grant No. DMR-0820518 and Golden Energy Computing Organization (GECO).

Direct detection of ligand binding to Sepharose-immobilised protein using saturation transfer double difference (STDD) NMR spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haselhorst, Thomas; Muenster-Kuehnel, Anja K.; Oschlies, Melanie

2007-08-10

We report an easy and direct application of 'Saturation Transfer Double Difference' (STDD) NMR spectroscopy to identify ligands that bind to a Sepharose-immobilised target protein. The model protein, cytidine 5'-monophosphate sialic acid (CMP-Sia) synthetase, was expressed as a Strep-Tag II fusion protein and immobilised on Strep-Tactin Sepharose. STD NMR experiments of the protein-enriched Sepharose matrix in the presence of a binding ligand (cytidine 5'-triphosphate, CTP) and a non-binding ligand ({alpha}/{beta}-glucose) clearly show that CTP binds to the immobilised enzyme, whereas glucose has no affinity. This approach has three major advantages: (a) only low quantities of protein are required, (b) nomore » specialised NMR technology or the application of additional data analysis by non-routine methods is required, and (c) easy multiple use of the immobilised protein is available.« less

Common-envelope ejection in massive binary stars. Implications for the progenitors of GW150914 and GW151226

NASA Astrophysics Data System (ADS)

Kruckow, M. U.; Tauris, T. M.; Langer, N.; Szécsi, D.; Marchant, P.; Podsiadlowski, Ph.

2016-11-01

Context. The recently detected gravitational wave signals (GW150914 and GW151226) of the merger event of a pair of relatively massive stellar-mass black holes (BHs) calls for an investigation of the formation of such progenitor systems in general. Aims: We analyse the common-envelope (CE) stage of the traditional formation channel in binaries where the first-formed compact object undergoes an in-spiral inside the envelope of its evolved companion star and ejects the envelope in this process. Methods: We calculated envelope binding energies of donor stars with initial masses between 4 and 115M⊙ for metallicities of Z = ZMilky Way ≃ Z⊙/ 2 and Z = Z⊙/ 50, and derived minimum masses of in-spiralling objects needed to eject these envelopes. Results: In addition to producing double white dwarf and double neutron star binaries, CE evolution may also produce massive BH-BH systems with individual BH component masses of up to 50 - 60M⊙, in particular for donor stars evolved to giants beyond the Hertzsprung gap. However, the physics of envelope ejection of massive stars remains uncertain. We discuss the applicability of the energy-budget formalism, the location of the bifurcation point, the recombination energy, and the accretion energy during in-spiral as possible energy sources, and also comment on the effect of inflated helium cores. Conclusions: Massive stars in a wide range of metallicities and with initial masses of up to at least 115M⊙ may shed their envelopes and survive CE evolution, depending on their initial orbital parameters, similarly to the situation for intermediate- and low-mass stars with degenerate cores. In addition to being dependent on stellar radius, the envelope binding energies and λ-values also depend on the applied convective core-overshooting parameter, whereas these structure parameters are basically independent of metallicity for stars with initial masses below 60M⊙. Metal-rich stars ≳60M⊙ become luminous blue variables and do not evolve to reach the red giant stage. We conclude that based on stellar structure calculations, and in the view of the usual simple energy budget analysis, events like GW150914 and GW151226 might be produced by the CE channel. Calculations of post-CE orbital separations, however, and thus the estimated LIGO detection rates, remain highly uncertain.

New way to produce dense double-antikaonic dibaryon system, 𝐾̄𝐾̄NN, through Λ(1405)-doorway sticking in p + p collisions

PubMed Central

YAMAZAKI, Toshimitsu; AKAISHI, Yoshinori; HASSANVAND, Maryam

2011-01-01

A recent successful observation of a dense and deeply bound 𝐾̄ nuclear system, K−pp, in the p + p → K+ + K−pp reaction in a DISTO experiment indicates that the double-𝐾̄ dibaryon, K−K−pp, which was predicted to be a dense nuclear system, can also be formed in p + p collisions. We find theoretically that the K−-K− repulsion plays no significant role in reducing the density and binding energy of K−K−pp and that, when two Λ(1405) resonances are produced simultaneously in a short-range p + p collision, they act as doorways to copious formation of K−K−pp, if and only if K−K−pp is a dense object, as predicted. PMID:21670568

In vitro DNA binding studies of lenalidomide using spectroscopic in combination with molecular docking techniques

NASA Astrophysics Data System (ADS)

Xu, Liang; Hu, Yan-Xi; Li, Yan-Cheng; Zhang, Li; Ai, Hai-Xin; Liu, Yu-Feng; Liu, Hong-Sheng

2018-02-01

In the present work, the binding interaction between lenalidomide (LEN) and calf thymus DNA (ct-DNA) was systematically studied by using fluorescence, ultraviolet-visible (UV-vis) absorption, circular dichroism (CD) spectroscopies under imitated physiological conditions (pH = 7.4) coupled with molecular docking. It was found that LEN was bound to ct-DNA with high binding affinity (Ka = 2.308 × 105 M-1 at 283 K) through groove binding as evidenced by a slight decrease in the absorption intensity in combination with CD spectra. Thermodynamic parameters (ΔG < 0, ΔH > 0 and ΔS < 0) of the LEN-DNA system obtained at three different temperatures suggested that the binding process was spontaneous and was primarily driven by hydrogen bonds and hydrophobic interaction. Furthermore, competitive binding experiments with ethidium bromide and 4‧, 6-dia-midino-2-phenylindoleas probes showed that LEN could preferentially bind in the minor groove of double-stranded DNA. The average lifetime of LEN was calculated to be 7.645 ns. The φ of LEN was measured as 0.09 and non-radiation energy transfer between LEN and DNA had occurred. The results of the molecular docking were consistent with the experimental results. This study explored the potential applicability of the spectroscopic properties of LEN and also investigated its interactions with relevant biological targets. In addition, it will provide some theoretical references for the deep research of simultaneous administration of LEN with other drugs.

A ruthenium dimer complex with a flexible linker slowly threads between DNA bases in two distinct steps.

PubMed

Bahira, Meriem; McCauley, Micah J; Almaqwashi, Ali A; Lincoln, Per; Westerlund, Fredrik; Rouzina, Ioulia; Williams, Mark C

2015-10-15

Several multi-component DNA intercalating small molecules have been designed around ruthenium-based intercalating monomers to optimize DNA binding properties for therapeutic use. Here we probe the DNA binding ligand [μ-C4(cpdppz)2(phen)4Ru2](4+), which consists of two Ru(phen)2dppz(2+) moieties joined by a flexible linker. To quantify ligand binding, double-stranded DNA is stretched with optical tweezers and exposed to ligand under constant applied force. In contrast to other bis-intercalators, we find that ligand association is described by a two-step process, which consists of fast bimolecular intercalation of the first dppz moiety followed by ∼10-fold slower intercalation of the second dppz moiety. The second step is rate-limited by the requirement for a DNA-ligand conformational change that allows the flexible linker to pass through the DNA duplex. Based on our measured force-dependent binding rates and ligand-induced DNA elongation measurements, we are able to map out the energy landscape and structural dynamics for both ligand binding steps. In addition, we find that at zero force the overall binding process involves fast association (∼10 s), slow dissociation (∼300 s), and very high affinity (Kd ∼10 nM). The methodology developed in this work will be useful for studying the mechanism of DNA binding by other multi-step intercalating ligands and proteins. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Observing single protein binding by optical transmission through a double nanohole aperture in a metal film

PubMed Central

Al Balushi, Ahmed A.; Zehtabi-Oskuie, Ana; Gordon, Reuven

2013-01-01

We experimentally demonstrate protein binding at the single particle level. A double nanohole (DNH) optical trap was used to hold onto a 20 nm biotin-coated polystyrene (PS) particle which subsequently is bound to streptavidin. Biotin-streptavidin binding has been detected by an increase in the optical transmission through the DNH. Similar optical transmission behavior was not observed when streptavidin binding sites where blocked by mixing streptavidin with excess biotin. Furthermore, interaction of non-functionalized PS particles with streptavidin did not induce a change in the optical transmission through the DNH. These results are promising as the DNH trap can make an excellent single molecule resolution sensor which would enable studying biomolecular interactions and dynamics at a single particle/molecule level. PMID:24049672

Determination of the DNA-binding characteristics of ethidium bromide, proflavine, and cisplatin by flow injection analysis: usefulness in studies on antitumor drugs.

PubMed

Alonso, A; Almendral, M J; Curto, Y; Criado, J J; Rodríguez, E; Manzano, J L

2006-08-15

Flow injection analysis was used to study the reactions occurring between DNA and certain compounds that bind to its double helix, deforming this and even breaking it, such that some of them (e.g., cisplatin) are endowed with antitumoral activity. Use of this technique in the merging zones and stopped-flow modes afforded data on the binding parameters and the kinetic characteristics of the process. The first compound studied was ethidium bromide (EtdBr), used as a fluorescent marker because its fluorescence is enhanced when it binds to DNA. The DNA-EtdBr binding parameters, the apparent intrinsic binding constant (0.31+/-0.02 microM(-1)), and the maximum number of binding sites per nucleotide (0.327+/-0.009) were determined. The modification introduced in these parameters by the presence of proflavine (Prf), a classic competitive inhibitor of the binding of EtdBr to the DNA double helix, was also studied, determining the value of the intrinsic binding constant of Prf (K(Prf) = 0.119+/-9x10(-3) microM(-1)). Finally, we determined the binding parameters between DNA and EtdBr in the presence of the antitumor agent cisplatin, a noncompetitive inhibitor of such binding. This provided information about the binding mechanism as well as the duration and activity of the binding of the compound in its pharmacological use.

Modelling of DNA-protein recognition

NASA Technical Reports Server (NTRS)

Rein, R.; Garduno, R.; Colombano, S.; Nir, S.; Haydock, K.; Macelroy, R. D.

1980-01-01

Computer model-building procedures using stereochemical principles together with theoretical energy calculations appear to be, at this stage, the most promising route toward the elucidation of DNA-protein binding schemes and recognition principles. A review of models and bonding principles is conducted and approaches to modeling are considered, taking into account possible di-hydrogen-bonding schemes between a peptide and a base (or a base pair) of a double-stranded nucleic acid in the major groove, aspects of computer graphic modeling, and a search for isogeometric helices. The energetics of recognition complexes is discussed and several models for peptide DNA recognition are presented.

ProbeZT: Simulation of transport coefficients of molecular electronic junctions under environmental effects using Büttiker's probes

NASA Astrophysics Data System (ADS)

Korol, Roman; Kilgour, Michael; Segal, Dvira

2018-03-01

We present our in-house quantum transport package, ProbeZT. This program provides linear response coefficients: electrical and electronic thermal conductances, as well as the thermopower of molecular junctions in which electrons interact with the surrounding thermal environment. Calculations are performed based on the Büttiker probe method, which introduces decoherence, energy exchange and dissipation effects phenomenologically using virtual electrode terminals called probes. The program can realize different types of probes, each introducing various environmental effects, including elastic and inelastic scattering of electrons. The molecular system is described by an arbitrary tight-binding Hamiltonian, allowing the study of different geometries beyond simple one-dimensional wires. Applications of the program to study the thermoelectric performance of molecular junctions are illustrated. The program also has a built-in functionality to simulate electron transport in double-stranded DNA molecules based on a tight-binding (ladder) description of the junction.

Large-scale oscillation of structure-related DNA sequence features in human chromosome 21

NASA Astrophysics Data System (ADS)

Li, Wentian; Miramontes, Pedro

2006-08-01

Human chromosome 21 is the only chromosome in the human genome that exhibits oscillation of the (G+C) content of a cycle length of hundreds kilobases (kb) ( 500kb near the right telomere). We aim at establishing the existence of a similar periodicity in structure-related sequence features in order to relate this (G+C)% oscillation to other biological phenomena. The following quantities are shown to oscillate with the same 500kb periodicity in human chromosome 21: binding energy calculated by two sets of dinucleotide-based thermodynamic parameters, AA/TT and AAA/TTT bi- and tri-nucleotide density, 5'-TA-3' dinucleotide density, and signal for 10- or 11-base periodicity of AA/TT or AAA/TTT. These intrinsic quantities are related to structural features of the double helix of DNA molecules, such as base-pair binding, untwisting or unwinding, stiffness, and a putative tendency for nucleosome formation.

Multiple binding modes for palmitate to barley lipid transfer protein facilitated by the presence of proline 12.

PubMed

Smith, Lorna J; Gunsteren, Wilfred F Van; Allison, Jane R

2013-01-01

Molecular dynamics simulations have been used to characterise the binding of the fatty acid ligand palmitate in the barley lipid transfer protein 1 (LTP) internal cavity. Two different palmitate binding modes (1 and 2), with similar protein-ligand interaction energies, have been identified using a variety of simulation strategies. These strategies include applying experimental protein-ligand atom-atom distance restraints during the simulation, or protonating the palmitate ligand, or using the vacuum GROMOS 54B7 force-field parameter set for the ligand during the initial stages of the simulations. In both the binding modes identified the palmitate carboxylate head group hydrogen bonds with main chain amide groups in helix A, residues 4 to 19, of the protein. In binding mode 1 the hydrogen bonds are to Lys 11, Cys 13, and Leu 14 and in binding mode 2 to Thr 15, Tyr 16, Val 17, Ser 24 and also to the OH of Thr 15. In both cases palmitate binding exploits irregularity of the intrahelical hydrogen-bonding pattern in helix A of barley LTP due to the presence of Pro 12. Simulations of two variants of barley LTP, namely the single mutant Pro12Val and the double mutant Pro12Val Pro70Val, show that Pro 12 is required for persistent palmitate binding in the LTP cavity. Overall, the work identifies key MD simulation approaches for characterizing the details of protein-ligand interactions in complexes where NMR data provide insufficient restraints. Copyright © 2012 The Protein Society.

Interactive Roles of DNA Helicases and Translocases with the Single-Stranded DNA Binding Protein RPA in Nucleic Acid Metabolism.

PubMed

Awate, Sanket; Brosh, Robert M

2017-06-08

Helicases and translocases use the energy of nucleoside triphosphate binding and hydrolysis to unwind/resolve structured nucleic acids or move along a single-stranded or double-stranded polynucleotide chain, respectively. These molecular motors facilitate a variety of transactions including replication, DNA repair, recombination, and transcription. A key partner of eukaryotic DNA helicases/translocases is the single-stranded DNA binding protein Replication Protein A (RPA). Biochemical, genetic, and cell biological assays have demonstrated that RPA interacts with these human molecular motors physically and functionally, and their association is enriched in cells undergoing replication stress. The roles of DNA helicases/translocases are orchestrated with RPA in pathways of nucleic acid metabolism. RPA stimulates helicase-catalyzed DNA unwinding, enlists translocases to sites of action, and modulates their activities in DNA repair, fork remodeling, checkpoint activation, and telomere maintenance. The dynamic interplay between DNA helicases/translocases and RPA is just beginning to be understood at the molecular and cellular levels, and there is still much to be learned, which may inform potential therapeutic strategies.

Interactive Roles of DNA Helicases and Translocases with the Single-Stranded DNA Binding Protein RPA in Nucleic Acid Metabolism

PubMed Central

Awate, Sanket; Brosh, Robert M.

2017-01-01

Helicases and translocases use the energy of nucleoside triphosphate binding and hydrolysis to unwind/resolve structured nucleic acids or move along a single-stranded or double-stranded polynucleotide chain, respectively. These molecular motors facilitate a variety of transactions including replication, DNA repair, recombination, and transcription. A key partner of eukaryotic DNA helicases/translocases is the single-stranded DNA binding protein Replication Protein A (RPA). Biochemical, genetic, and cell biological assays have demonstrated that RPA interacts with these human molecular motors physically and functionally, and their association is enriched in cells undergoing replication stress. The roles of DNA helicases/translocases are orchestrated with RPA in pathways of nucleic acid metabolism. RPA stimulates helicase-catalyzed DNA unwinding, enlists translocases to sites of action, and modulates their activities in DNA repair, fork remodeling, checkpoint activation, and telomere maintenance. The dynamic interplay between DNA helicases/translocases and RPA is just beginning to be understood at the molecular and cellular levels, and there is still much to be learned, which may inform potential therapeutic strategies. PMID:28594346

Thermodynamic effects of proline introduction on protein stability.

PubMed

Prajapati, Ravindra Singh; Das, Mili; Sreeramulu, Sridhar; Sirajuddin, Minhajuddin; Srinivasan, Sankaranarayanan; Krishnamurthy, Vaishnavi; Ranjani, Ranganathan; Ramakrishnan, C; Varadarajan, Raghavan

2007-02-01

The amino acid Pro is more rigid than other naturally occurring amino acids and, in proteins, lacks an amide hydrogen. To understand the structural and thermodynamic effects of Pro substitutions, it was introduced at 13 different positions in four different proteins, leucine-isoleucine-valine binding protein, maltose binding protein, ribose binding protein, and thioredoxin. Three of the maltose binding protein mutants were characterized by X-ray crystallography to confirm that no structural changes had occurred upon mutation. In the remaining cases, fluorescence and CD spectroscopy were used to show the absence of structural change. Stabilities of wild type and mutant proteins were characterized by chemical denaturation at neutral pH and by differential scanning calorimetry as a function of pH. The mutants did not show enhanced stability with respect to chemical denaturation at room temperature. However, 6 of the 13 single mutants showed a small but significant increase in the free energy of thermal unfolding in the range of 0.3-2.4 kcal/mol, 2 mutants showed no change, and 5 were destabilized. In five of the six cases, the stabilization was because of reduced entropy of unfolding. However, the magnitude of the reduction in entropy of unfolding was typically several fold larger than the theoretical estimate of -4 cal K(-1) mol(-1) derived from the relative areas in the Ramachandran map accessible to Pro and Ala residues, respectively. Two double mutants were constructed. In both cases, the effects of the single mutations on the free energy of thermal unfolding were nonadditive. Copyright 2006 Wiley-Liss, Inc.

Structures, energetics, vibrational spectra of NH4+ (H2O)(n=4,6) clusters: Ab initio calculations and first principles molecular dynamics simulations.

PubMed

Karthikeyan, S; Singh, Jiten N; Park, Mina; Kumar, Rajesh; Kim, Kwang S

2008-06-28

Important structural isomers of NH(4) (+)(H(2)O)(n=4,6) have been studied by using density functional theory, Moller-Plesset second order perturbation theory, and coupled-cluster theory with single, double, and perturbative triple excitations [CCSD(T)]. The zero-point energy (ZPE) correction to the complete basis set limit of the CCSD(T) binding energies and free energies is necessary to identify the low energy structures for NH(4) (+)(H(2)O)(n=4,6) because otherwise wrong structures could be assigned for the most probable structures. For NH(4) (+)(H(2)O)(6), the cage-type structure, which is more stable than the previously reported open structure before the ZPE correction, turns out to be less stable after the ZPE correction. In first principles Car-Parrinello molecular dynamics simulations around 100 K, the combined power spectrum of three lowest energy isomers of NH(4) (+)(H(2)O)(4) and two lowest energy isomers of NH(4) (+)(H(2)O)(6) explains each experimental IR spectrum.

Structures, energetics, vibrational spectra of NH4+(H2O)n=4,6 clusters: Ab initio calculations and first principles molecular dynamics simulations

NASA Astrophysics Data System (ADS)

Karthikeyan, S.; Singh, Jiten N.; Park, Mina; Kumar, Rajesh; Kim, Kwang S.

2008-06-01

Important structural isomers of NH4+(H2O)n=4,6 have been studied by using density functional theory, Møller-Plesset second order perturbation theory, and coupled-cluster theory with single, double, and perturbative triple excitations [CCSD(T)]. The zero-point energy (ZPE) correction to the complete basis set limit of the CCSD(T) binding energies and free energies is necessary to identify the low energy structures for NH4+(H2O)n=4,6 because otherwise wrong structures could be assigned for the most probable structures. For NH4+(H2O)6, the cage-type structure, which is more stable than the previously reported open structure before the ZPE correction, turns out to be less stable after the ZPE correction. In first principles Car-Parrinello molecular dynamics simulations around 100 K, the combined power spectrum of three lowest energy isomers of NH4+(H2O)4 and two lowest energy isomers of NH4+(H2O)6 explains each experimental IR spectrum.

Why double-stranded RNA resists condensation

PubMed Central

Tolokh, Igor S.; Pabit, Suzette A.; Katz, Andrea M.; Chen, Yujie; Drozdetski, Aleksander; Baker, Nathan; Pollack, Lois; Onufriev, Alexey V.

2014-01-01

The addition of small amounts of multivalent cations to solutions containing double-stranded DNA leads to inter-DNA attraction and eventual condensation. Surprisingly, the condensation is suppressed in double-stranded RNA, which carries the same negative charge as DNA, but assumes a different double helical form. Here, we combine experiment and atomistic simulations to propose a mechanism that explains the variations in condensation of short (25 base-pairs) nucleic acid (NA) duplexes, from B-like form of homopolymeric DNA, to mixed sequence DNA, to DNA:RNA hybrid, to A-like RNA. Circular dichroism measurements suggest that duplex helical geometry is not the fundamental property that ultimately determines the observed differences in condensation. Instead, these differences are governed by the spatial variation of cobalt hexammine (CoHex) binding to NA. There are two major NA-CoHex binding modes—internal and external—distinguished by the proximity of bound CoHex to the helical axis. We find a significant difference, up to 5-fold, in the fraction of ions bound to the external surfaces of the different NA constructs studied. NA condensation propensity is determined by the fraction of CoHex ions in the external binding mode. PMID:25123663

Energy and fuels from electrochemical interfaces

DOE PAGES

Stamenkovic, Vojislav R.; Strmcnik, Dusan; Lopes, Pietro P.; ...

2016-12-20

Advances in electrocatalysis at solid–liquid interfaces are vital for driving the technological innovations that are needed to deliver reliable, affordable and environmentally friendly energy. Here, in this paper, we highlight the key achievements in the development of new materials for efficient hydrogen and oxygen production in electrolysers and, in reverse, their use in fuel cells. A key issue addressed here is the degree to which the fundamental understanding of the synergy between covalent and non-covalent interactions can form the basis for any predictive ability in tailor-making real-world catalysts. Common descriptors such as the substrate–hydroxide binding energy and the interactions inmore » the double layer between hydroxide-oxides and H---OH are found to control individual parts of the hydrogen and oxygen electrochemistry that govern the efficiency of water-based energy conversion and storage systems. Lastly, links between aqueous- and organic-based environments are also established, encouraging the 'fuel cell' and 'battery' communities to move forward together.« less

Binding affinity and adhesion force of organophosphate hydrolase enzyme with soil particles related to the isoelectric point of the enzyme.

PubMed

Islam, Shah Md Asraful; Yeasmin, Shabina; Islam, Md Saiful; Islam, Md Shariful

2017-07-01

The binding affinity of organophosphate hydrolase enzyme (OphB) with soil particles in relation to the isoelectric point (pI) was studied. Immobilization of OphB with soil particles was observed by confocal microscopy, Fourier transform infrared spectroscopy (FT-IR), and Atomic force microscopy (AFM). The calculated pI of OphB enzyme was increased from 8.69 to 8.89, 9.04 and 9.16 by the single, double and triple mutant of OphB enzyme, respectively through the replacement of negatively charged aspartate with positively charged histidine. Practically, the binding affinity was increased to 5.30%, 11.50%, and 16.80% for single, double and triple mutants, respectively. In contrast, enzyme activity of OphB did not change by the mutation of the enzyme. On the other hand, adhesion forces were gradually increased for wild type OphB enzyme (90 pN) to 96, 100 and 104 pN for single, double and triple mutants of OphB enzyme, respectively. There was an increasing trend of binding affinity and adhesion force by the increase of isoelectric point (pI) of OphB enzyme. Copyright © 2017 Elsevier Inc. All rights reserved.

Mechanism of the formation of the RecA-ssDNA nucleoprotein filament structure: a coarse-grained approach.

PubMed

Mukherjee, Goutam; Pal, Arumay; Levy, Yaakov

2017-11-21

In prokaryotes, the RecA protein catalyzes the repair and strand exchange of double-stranded DNA. RecA binds to single-stranded DNA (ssDNA) and forms a presynaptic complex in which the protein polymerizes around the ssDNA to form a right-handed helical nucleoprotein filament structure. In the present work, the mechanism for the formation of the RecA-ssDNA filament structure is modeled using coarse-grained molecular dynamics simulations. Information from the X-ray structure was used to model the protein itself but not its interactions; the interactions between the protein and the ssDNA were modeled solely by electrostatic, aromatic, and repulsive energies. For the present study, the monomeric, dimeric, and trimeric units of RecA and 4, 8, and 11 NT-long ssDNA, respectively, were studied. Our results indicate that monomeric RecA is not sufficient for nucleoprotein filament formation; rather, dimeric RecA is the elementary binding unit, with higher multimeric units of RecA facilitating filament formation. Our results reveal that loop region flexibility at the primary binding site of RecA is essential for it to bind the incoming ssDNA, that the aromatic residues present in the loop region play an important role in ssDNA binding, and that ATP may play a role in guiding the ssDNA by changing the electrostatic potential of the RecA protein.

Spectroscopic Study of the Binding of Netropsin and Hoechst 33258 to Nucleic Acids

NASA Astrophysics Data System (ADS)

Vardevanyan, P. O.; Parsadanyan, M. A.; Antonyan, A. P.; Sahakyan, V. G.

2018-05-01

The interaction of groove binding compounds — peptide antibiotic (polyamide) netropsin and fluorescent dye (bisbenzimidazole) Hoechst 33258 — with the double-stranded DNA and synthetic double-stranded polynucleotide poly(rA)-poly(rU) has been studied by spectrophotometry. Absorption spectra of these ligand complexes with nucleic acids have been obtained. Spectral changes at the complexation of individual ligands with the mentioned nucleic acids reveal the similarity of binding of each of these ligands with both DNA and RNA. Based on the spectroscopic measurements, the binding parameters of netropsin and Hoechst 33258 binding to DNA and poly(rA)-poly(rU) - K and n, as well as the thermodynamic parameters ΔS, ΔG, and ΔH have been determined. It was found that the binding of Hoechst 33258 to both nucleic acids is accompanied by a positive change in enthalpy, while in the case of netropsin the change in enthalpy is negative. Moreover, the contribution of entropy to the formation of the complexes is more pronounced in the case of Hoechst 33258.

Spectroscopic studies on the binding interaction of phenothiazinium dyes, azure A and azure B to double stranded RNA polynucleotides

NASA Astrophysics Data System (ADS)

Khan, Asma Yasmeen; Suresh Kumar, Gopinatha

2016-01-01

This manuscript presents spectroscopic characterization of the interaction of two phenothiazinium dyes, azure A and azure B with double stranded (ds) ribonucleic acids, poly(A).poly(U), poly(C).poly(G) and poly(I).poly(C). Absorbance and fluorescence studies revealed that these dyes bind to the RNAs with binding affinities of the order 106 M-1 to poly(A).poly(U), and 105 M-1 to poly(C).poly(G) and poly(I).poly(C), respectively. Fluorescence quenching and viscosity data gave conclusive evidence for the intercalation of the dyes to these RNA duplexes. Circular dichroism results suggested that the conformation of the RNAs was perturbed on interaction and the dyes acquired strong induced optical activity on binding. Azure B bound to all the three RNAs stronger than azure A and the binding affinity varied as poly(A).poly(U) > poly(C).poly(G) > poly(I).poly(C) for both dyes.

RecA binding to a single double-stranded DNA molecule: A possible role of DNA conformational fluctuations

PubMed Central

Leger, J. F.; Robert, J.; Bourdieu, L.; Chatenay, D.; Marko, J. F.

1998-01-01

Most genetic regulatory mechanisms involve protein–DNA interactions. In these processes, the classical Watson–Crick DNA structure sometimes is distorted severely, which in turn enables the precise recognition of the specific sites by the protein. Despite its key importance, very little is known about such deformation processes. To address this general question, we have studied a model system, namely, RecA binding to double-stranded DNA. Results from micromanipulation experiments indicate that RecA binds strongly to stretched DNA; based on this observation, we propose that spontaneous thermal stretching fluctuations may play a role in the binding of RecA to DNA. This has fundamental implications for the protein–DNA binding mechanism, which must therefore rely in part on a combination of flexibility and thermal fluctuations of the DNA structure. We also show that this mechanism is sequence sensitive. Theoretical simulations support this interpretation of our experimental results, and it is argued that this is of broad relevance to DNA–protein interactions. PMID:9770480

T-lymphoid, megakaryocyte, and granulocyte development are sensitive to decreases in CBFβ dosage.

PubMed Central

Talebian, Laleh; Li, Zhe; Guo, Yalin; Gaudet, Justin; Speck, Maren E.; Sugiyama, Daisuke; Kaur, Prabhjot; Pear, Warren S.; Maillard, Ivan; Speck, Nancy A.

2007-01-01

The family of core-binding factors includes the DNA-binding subunits Runx1-3 and their common non–DNA-binding partner CBFβ. We examined the collective role of core-binding factors in hematopoiesis with a hypomorphic Cbfb allelic series. Reducing CBFβ levels by 3- or 6-fold caused abnormalities in bone development, megakaryocytes, granulocytes, and T cells. T-cell development was very sensitive to an incremental reduction of CBFβ levels: mature thymocytes were decreased in number upon a 3-fold reduction in CBFβ levels, and were virtually absent when CBFβ levels were 6-fold lower. Partially penetrant consecutive differentiation blocks were found among early T-lineage progenitors within the CD4−CD8− double-negative 1 and downstream double-negative 2 thymocyte subsets. Our data define a critical CBFβ threshold for normal T-cell development, and situate an essential role for core-binding factors during the earliest stages of T-cell development. PMID:16940420

Determination of the Stoichiometry between α- and γ1 Subunits of the BK Channel Using LRET.

PubMed

Carrasquel-Ursulaez, Willy; Alvarez, Osvaldo; Bezanilla, Francisco; Latorre, Ramon

2018-06-05

Two families of accessory proteins, β and γ, modulate BK channel gating and pharmacology. Notably, in the absence of internal Ca 2+ , the γ1 subunit promotes a large shift of the BK conductance-voltage curve to more negative potentials. However, very little is known about how α- and γ1 subunits interact. In particular, the association stoichiometry between both subunits is unknown. Here, we propose a method to answer this question using lanthanide resonance energy transfer. The method assumes that the kinetics of lanthanide resonance energy transfer-sensitized emission of the donor double-labeled α/γ1 complex is the linear combination of the kinetics of the sensitized emission in single-labeled complexes. We used a lanthanide binding tag engineered either into the α- or the γ1 subunits to bind Tb +3 as the donor. The acceptor (BODIPY) was attached to the BK pore-blocker iberiotoxin. We determined that γ1 associates with the α-subunit with a maximal 1:1 stoichiometry. This method could be applied to determine the stoichiometry of association between proteins within heteromultimeric complexes. Copyright © 2018 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Why double-stranded RNA resists condensation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tolokh, Igor S.; Pabit, Suzette; Katz, Andrea M.

2014-09-15

The addition of small amounts of multivalent cations to solutions containing double-stranded DNA leads to attraction between the negatively charged helices and eventually to condensation. Surprisingly, this effect is suppressed in double-stranded RNA, which carries the same charge as the DNA, but assumes a different double helical form. However, additional characterization of short (25 base-pairs) nucleic acid (NA) duplex structures by circular dichroism shows that measured differences in condensation are not solely determined by duplex helical geometry. Here we combine experiment, theory, and atomistic simulations to propose a mechanism that connects the observed variations in condensation of short NA duplexesmore » with the spatial variation of cobalt hexammine (CoHex) binding at the NA duplex surface. The atomistic picture that emerged showed that CoHex distributions around the NA reveals two major NA-CoHex binding modes -- internal and external -- distinguished by the proximity of bound CoHex to the helical axis. Decreasing trends in experimentally observed condensation propensity of the four studied NA duplexes (from B-like form of homopolymeric DNA, to mixed sequence DNA, to DNA:RNA hybrid, to A-like RNA) are explained by the progressive decrease of a single quantity: the fraction of CoHex ions in the external binding mode. Thus, while NA condensation depends on a complex interplay between various structural and sequence features, our coupled experimental and theoretical results suggest a new model in which a single parameter connects the NA condensation propensity with geometry and sequence dependence of CoHex binding.« less

Acute effect of ephedrine on 24-h energy balance

NASA Technical Reports Server (NTRS)

Shannon, J. R.; Gottesdiener, K.; Jordan, J.; Chen, K.; Flattery, S.; Larson, P. J.; Candelore, M. R.; Gertz, B.; Robertson, D.; Sun, M.

1999-01-01

Ephedrine is used to help achieve weight control. Data on its true efficacy and mechanisms in altering energy balance in human subjects are limited. We aimed to determine the acute effect of ephedrine on 24-h energy expenditure, mechanical work and urinary catecholamines in a double-blind, randomized, placebo-controlled, two-period crossover study. Ten healthy volunteers were given ephedrine (50 mg) or placebo thrice daily during each of two 24-h periods (ephedrine and placebo) in a whole-room indirect calorimeter, which accurately measures minute-by-minute energy expenditure and mechanical work. Measurements were taken of 24-h energy expenditure, mechanical work, urinary catecholamines and binding of (+/-)ephedrine in vitro to human beta1-, beta2- and beta3-adrenoreceptors. Twenty-four-hour energy expenditure was 3.6% greater (8965+/-1301 versus 8648+/-1347 kJ, P<0.05) with ephedrine than with placebo, but mechanical work was not different between the ephedrine and placebo periods. Noradrenaline excretion was lower with ephedrine (0.032+/-0.011 microg/mg creatinine) compared with placebo (0.044+/-0.012 microg/mg creatinine) (P<0.05). (+/-)Ephedrine is a relatively weak partial agonist of human beta1- and beta2-adrenoreceptors, and had no detectable activity at human beta3-adrenoreceptors. Ephedrine (50 mg thrice daily) modestly increases energy expenditure in normal human subjects. A lack of binding of ephedrine to beta3-adrenoreceptors and the observed decrease in urinary noradrenaline during ephedrine treatment suggest that the thermogenic effect of ephedrine results from direct beta1-/beta2-adrenoreceptor agonism. An indirect beta3-adrenergic effect through the release of noradrenaline seems unlikely as urinary noradrenaline decreased significantly with ephedrine.

The brain-specific double-stranded RNA-binding protein Staufen2: nucleolar accumulation and isoform-specific exportin-5-dependent export.

PubMed

Macchi, Paolo; Brownawell, Amy M; Grunewald, Barbara; DesGroseillers, Luc; Macara, Ian G; Kiebler, Michael A

2004-07-23

The mammalian double-stranded RNA-binding proteins Staufen (Stau1 and Stau2) are involved in RNA localization in polarized neurons. In contrast to the more ubiquitously expressed Stau1, Stau2 is mainly expressed in the nervous system. In Drosophila, the third double-stranded RNA-binding domain (RBD3) of Staufen is essential for RNA interaction. When conserved amino acids within the RBD3 of Stau2 were mutated to render Stau2 defective for RNA binding, the mutant Stau2 proteins accumulate predominantly in the nucleolus. This is in contrast to wild type Stau2 that mostly localizes in the cytosol. The nuclear import is dependent on a nuclear localization signal in close proximity to the RBD3. The nuclear export of Stau2 is not dependent on CRM1 but rather on Exportin-5. We show that Exportin-5 interacts with the RBD3 of wild type Stau2 in an RNA-dependent manner in vitro but not with mutant Stau2. When Exportin-5 is down-regulated by RNA interference, only the largest isoform of Stau2 (Stau2(62)) preferentially accumulates in the nucleolus. It is tempting to speculate that Stau2(62) binds RNA in the nucleus and assembles into ribonucleoparticles, which are then exported via the Exportin-5 pathway to their final destination.

Binding of Phenazinium Dye Safranin T to Polyriboadenylic Acid: Spectroscopic and Thermodynamic Study

PubMed Central

Roy, Snigdha; Das, Suman

2014-01-01

Here, we report results from experiments designed to explore the association of the phenazinium dye safranin T (ST, 3,7-diamino-2,8-dimethyl-5-phenylphenazinium chloride) with single and double stranded form of polyriboadenylic acid (hereafter poly-A) using several spectroscopic techniques. We demonstrate that the dye binds to single stranded polyriboadenylic acid (hereafter ss poly-A) with high affinity while it does not interact at all with the double stranded (ds) form of the polynucleotide. Fluorescence and absorption spectral studies reveal the molecular aspects of binding of ST to single stranded form of the polynucleotide. This observation is also supported by the circular dichroism study. Thermodynamic data obtained from temperature dependence of binding constant reveals that association is driven by negative enthalpy change and opposed by negative entropy change. Ferrocyanide quenching studies have shown intercalative binding of ST to ss poly-A. Experiments on viscosity measurements confirm the binding mode of the dye to be intercalative. The effect of [Na+] ion concentration on the binding process suggests the role of electrostatic forces in the complexation. Present studies reveal the utility of the dye in probing nucleic acid structure. PMID:24498422

Binding of phenazinium dye safranin T to polyriboadenylic acid: spectroscopic and thermodynamic study.

PubMed

Pradhan, Ankur Bikash; Haque, Lucy; Roy, Snigdha; Das, Suman

2014-01-01

Here, we report results from experiments designed to explore the association of the phenazinium dye safranin T (ST, 3,7-diamino-2,8-dimethyl-5-phenylphenazinium chloride) with single and double stranded form of polyriboadenylic acid (hereafter poly-A) using several spectroscopic techniques. We demonstrate that the dye binds to single stranded polyriboadenylic acid (hereafter ss poly-A) with high affinity while it does not interact at all with the double stranded (ds) form of the polynucleotide. Fluorescence and absorption spectral studies reveal the molecular aspects of binding of ST to single stranded form of the polynucleotide. This observation is also supported by the circular dichroism study. Thermodynamic data obtained from temperature dependence of binding constant reveals that association is driven by negative enthalpy change and opposed by negative entropy change. Ferrocyanide quenching studies have shown intercalative binding of ST to ss poly-A. Experiments on viscosity measurements confirm the binding mode of the dye to be intercalative. The effect of [Na⁺] ion concentration on the binding process suggests the role of electrostatic forces in the complexation. Present studies reveal the utility of the dye in probing nucleic acid structure.

A high level Ab initio study of the anionic hydrogen-bonded complexes FH-CN-, FH-NC-, H2O-CN- and H2O-NC-

NASA Technical Reports Server (NTRS)

Lee, Timothy J.

1989-01-01

HF, H2O, CN- and their hydrogen-bonded complexes were studied using state-of-the-art ab initio quantum mechanical methods. A large Gaussian one particle basis set consisting of triple zeta plus double polarization plus diffuse s and p functions (TZ2P + diffuse) was used. The theoretical methods employed include self consistent field, second order Moller-Plesset perturbation theory, singles and doubles configuration interaction theory and the singles and doubles coupled cluster approach. The FH-CN- and FH-NC- and H2O-CN-, H2O-NC- pairs of complexes are found to be essentially isoenergetic. The first pair of complexes are predicted to be bound by approx. 24 kcal/mole and the latter pair bound by approximately 15 kcal/mole. The ab initio binding energies are in good agreement with the experimental values. The two being shorter than the analogous C-N hydrogen bond. The infrared (IR) spectra of the two pairs of complexes are also very similar, though a severe perturbation of the potential energy surface by proton exchange means that the accurate prediction of the band center of the most intense IR mode requires a high level of electronic structure theory as well as a complete treatment of anharmonic effects. The bonding of anionic hydrogen-bonded complexes is discussed and contrasted with that of neutral hydrogen-bonded complexes.

Enlightening the ultrahigh electrical conductivities of doped double-wall carbon nanotube fibers by Raman spectroscopy and first-principles calculations.

PubMed

Tristant, Damien; Zubair, Ahmed; Puech, Pascal; Neumayer, Frédéric; Moyano, Sébastien; Headrick, Robert J; Tsentalovich, Dmitri E; Young, Colin C; Gerber, Iann C; Pasquali, Matteo; Kono, Junichiro; Leotin, Jean

2016-12-01

Highly aligned, packed, and doped carbon nanotube (CNT) fibers with electrical conductivities approaching that of copper have recently become available. These fibers are promising for high-power electrical applications that require light-weight, high current-carrying capacity cables. However, a microscopic understanding of how doping affects the electrical conductance of such CNT fibers in a quantitative manner has been lacking. Here, we performed Raman spectroscopy measurements combined with first-principles calculations to determine the position of the average Fermi energy and to obtain the temperature of chlorosulfonic-acid-doped double-wall CNT fibers under high current. Due to the unique way in which double-wall CNT Raman spectra depend on doping, it is possible to use Raman data to determine the doping level quantitatively. The correspondence between the Fermi level shift and the carbon charge transfer is derived from a tight-binding model and validated by several calculations. For the doped fiber, we were able to associate an average Fermi energy shift of ∼-0.7 eV with a conductance increase by a factor of ∼5. Furthermore, since current induces heating, local temperature determination is possible. Through the Stokes-to-anti-Stokes intensity ratio of the G-band peaks, we estimated a temperature rise at the fiber surface of ∼135 K at a current density of 2.27 × 10 8 A m -2 identical to that from the G-band shift, suggesting that thermalization between CNTs is well achieved.

Multiple conformational states of DnaA protein regulate its interaction with DnaA boxes in the initiation of DNA replication.

PubMed

Patel, Meera J; Bhatia, Lavesh; Yilmaz, Gulden; Biswas-Fiss, Esther E; Biswas, Subhasis B

2017-09-01

DnaA protein is the initiator of genomic DNA replication in prokaryotes. It binds to specific DNA sequences in the origin of DNA replication and unwinds small AT-rich sequences downstream for the assembly of the replisome. The mechanism of activation of DnaA that enables it to bind and organize the origin DNA and leads to replication initiation remains unclear. In this study, we have developed double-labeled fluorescent DnaA probes to analyze conformational states of DnaA protein upon binding DNA, nucleotide, and Soj sporulation protein using Fluorescence Resonance Energy Transfer (FRET). Our studies demonstrate that DnaA protein undergoes large conformational changes upon binding to substrates and there are multiple distinct conformational states that enable it to initiate DNA replication. DnaA protein adopted a relaxed conformation by expanding ~15Å upon binding ATP and DNA to form the ATP·DnaA·DNA complex. Hydrolysis of bound ATP to ADP led to a contraction of DnaA within the complex. The relaxed conformation of DnaA is likely required for the formation of the multi-protein ATP·DnaA·DNA complex. In the initiation of sporulation, Soj binding to DnaA prevented relaxation of its conformation. Soj·ADP appeared to block the activation of DnaA, suggesting a mechanism for Soj·ADP in switching initiation of DNA replication to sporulation. Our studies demonstrate that multiple conformational states of DnaA protein regulate its binding to DNA in the initiation of DNA replication. Copyright © 2017 Elsevier B.V. All rights reserved.

Strong binding and shrinkage of single and double nuclear systems (K−pp, K−ppn, K−K−p and K−K−pp) predicted by Faddeev-Yakubovsky calculations

PubMed Central

MAEDA, Shuji; AKAISHI, Yoshinori; YAMAZAKI, Toshimitsu

2013-01-01

Non-relativistic Faddeev and Faddeev-Yakubovsky calculations were made for K−pp, K−ppn, K−K−p and K−K−pp kaonic nuclear clusters, where the quasi bound states were treated as bound states by employing real separable potential models for the K−-K− and the K−-nucleon interactions as well as for the nucleon-nucleon interaction. The binding energies and spatial shrinkages of these states, obtained for various values of the interaction, were found to increase rapidly with the interaction strength. Their behaviors are shown in a reference diagram, where possible changes by varying the interaction in the dense nuclear medium are given. Using the Λ(1405) ansatz with a PDG mass of 1405 MeV/c2 for K−p, the following ground-state binding energies together with the wave functions were obtained: 51.5 MeV (K−pp), 69 MeV (K−ppn), 30.4 MeV (K−K−p) and 93 MeV (K−K−pp), which are in good agreement with previous results of variational calculation based on the Akaishi-Yamazaki coupled-channel potential. The K−K−pp state has a significantly increased density where the two nucleons are located very close to each other, in spite of the inner NN repulsion. Relativistic corrections on the calculated non-relativistic results indicate substantial lowering of the bound-state masses, especially of K−K−pp, toward the kaon condensation regime. The fact that the recently observed binding energy of K−pp is much larger (by a factor of 2) than the originally predicted one may infer an enhancement of the interaction in dense nuclei by about 25% possibly due to chiral symmetry restoration. In this respect some qualitative accounts are given based on “clearing QCD vacuum” model of Brown, Kubodera and Rho. PMID:24213206

New instrumentation for precise (n,γ) measurements at ILL Grenoble

NASA Astrophysics Data System (ADS)

Urban, W.; Jentschel, M.; Märkisch, B.; Materna, Th; Bernards, Ch; Drescher, C.; Fransen, Ch; Jolie, J.; Köster, U.; Mutti, P.; Rzaca-Urban, T.; Simpson, G. S.

2013-03-01

An array of eight Ge detectors for coincidence measurements of γ rays from neutron-capture reactions has been constructed at the PF1B cold-neutron facility of the Institut Laue-Langevin. The detectors arranged in one plane every 45° can be used for angular correlation measurements. The neutron collimation line of the setup provides a neutron beam of 12 mm in diameter and the capture flux of about 108/(s × cm2) at the target position, with a negligible neutron halo. With the setup up to 109 γγ and up to 108 triple-γ coincidence events have been collected in a day measurement. Precise energy and efficiency calibrations up to 10 MeV are easily performed with 27Al(n,γ)28Al and 35Cl(n,γ)36Cl reactions. Test measurements have shown that neutron binding energies can be determined with an accuracy down to a few eV and angular correlation coefficients measured with a precision down to a percent level. The triggerless data collected with a digital electronics and acquisition allows to determine half-lives of excited levels in the nano- to microsecond range. The high resolving power of double- and triple-γ time coincidences allows significant improvements of excitation schemes reported in previous (n,γ) works and complements high-resolution γ-energy measurements at the double-crystal Bragg spectrometer GAMS of ILL.

On the Role of low-energy electrons in the radiosensitization of DNA by gold nanoparticles

PubMed Central

Xiao, Fangxing; Zheng, Yi; Cloutier, Pierre; He, Yunhui; Hunting, Darel; Sanche, Léon

2013-01-01

Four different gold nanoparticle (GNP) preparations, including nude GNP and GNP coated either with thiolated undecane (S-C11H23), or with dithiolated diethylenetriaminepentaacetic (DTDTPA) or gadolinium (Gd) DTDTPA chelating agents were synthesized. The average diameters, for each type of nanoparticle are 5 nm, 10 and 13 nm, respectively. Dry films of plasmid DNA pGEM-3Zf(-), DNA with bound GNP and DNA with coated GNP were bombarded with 60 keV electrons. The yields of single and double strand breaks were measured as a function of exposure by electrophoresis. The binding of only one GNP without coating to DNA containing 3197 base pairs increases single and double strand breaks by a factor of 2.3 while for GNP coated with S-C11H23 this factor is reduced to 1.6. GNP coated with the DTDTPA and DTDTPA:Gd in same ratio with DNA, produce essentially no increment in damage. These results could be explained by the attenuation by the coatings of the intensity of low energy photoelectrons emitted from GNP. Thus, coatings of GNP may considerably attenuate short-range low energy electrons emitted from gold, leading to a considerable decrease of radiosensitization. According to our results, the highest radiosensitization should be obtained with GNP having the shortest possible ligand, directed to the DNA of cancer cells. PMID:22024607

A double tyrosine motif in the cardiac sodium channel domain III-IV linker couples calcium-dependent calmodulin binding to inactivation gating.

PubMed

Sarhan, Maen F; Van Petegem, Filip; Ahern, Christopher A

2009-11-27

Voltage-gated sodium channels maintain the electrical cadence and stability of neurons and muscle cells by selectively controlling the transmembrane passage of their namesake ion. The degree to which these channels contribute to cellular excitability can be managed therapeutically or fine-tuned by endogenous ligands. Intracellular calcium, for instance, modulates sodium channel inactivation, the process by which sodium conductance is negatively regulated. We explored the molecular basis for this effect by investigating the interaction between the ubiquitous calcium binding protein calmodulin (CaM) and the putative sodium channel inactivation gate composed of the cytosolic linker between homologous channel domains III and IV (DIII-IV). Experiments using isothermal titration calorimetry show that CaM binds to a novel double tyrosine motif in the center of the DIII-IV linker in a calcium-dependent manner, N-terminal to a region previously reported to be a CaM binding site. An alanine scan of aromatic residues in recombinant DIII-DIV linker peptides shows that whereas multiple side chains contribute to CaM binding, two tyrosines (Tyr(1494) and Tyr(1495)) play a crucial role in binding the CaM C-lobe. The functional relevance of these observations was then ascertained through electrophysiological measurement of sodium channel inactivation gating in the presence and absence of calcium. Experiments on patch-clamped transfected tsA201 cells show that only the Y1494A mutation of the five sites tested renders sodium channel steady-state inactivation insensitive to cytosolic calcium. The results demonstrate that calcium-dependent calmodulin binding to the sodium channel inactivation gate double tyrosine motif is required for calcium regulation of the cardiac sodium channel.

ATP binding and hydrolysis by Saccharomyces cerevisiae Msh2-Msh3 are differentially modulated by mismatch and double-strand break repair DNA substrates.

PubMed

Kumar, Charanya; Eichmiller, Robin; Wang, Bangchen; Williams, Gregory M; Bianco, Piero R; Surtees, Jennifer A

2014-06-01

In Saccharomyces cerevisiae, Msh2-Msh3-mediated mismatch repair (MMR) recognizes and targets insertion/deletion loops for repair. Msh2-Msh3 is also required for 3' non-homologous tail removal (3'NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, we recently demonstrated that the two pathways have distinct requirements with respect to Msh2-Msh3 activities. We identified a set of aromatic residues in the nucleotide binding pocket (FLY motif) of Msh3 that, when mutated, disrupted MMR, but left 3'NHTR largely intact. One of these mutations, msh3Y942A, was predicted to disrupt the nucleotide sandwich and allow altered positioning of ATP within the pocket. To develop a mechanistic understanding of the differential requirements for ATP binding and/or hydrolysis in the two pathways, we characterized Msh2-Msh3 and Msh2-msh3Y942A ATP binding and hydrolysis activities in the presence of MMR and 3'NHTR DNA substrates. We observed distinct, substrate-dependent ATP hydrolysis and nucleotide turnover by Msh2-Msh3, indicating that the MMR and 3'NHTR DNA substrates differentially modify the ATP binding/hydrolysis activities of Msh2-Msh3. Msh2-msh3Y942A retained the ability to bind DNA and ATP but exhibited altered ATP hydrolysis and nucleotide turnover. We propose that both ATP and structure-specific repair substrates cooperate to direct Msh2-Msh3-mediated repair and suggest an explanation for the msh3Y942A separation-of-function phenotype. Copyright © 2014 Elsevier B.V. All rights reserved.

ATP binding and hydrolysis by Saccharomyces cerevisiae Msh2-Msh3 are differentially modulated by Mismatch and Double-strand Break Repair DNA substrates

PubMed Central

Kumar, Charanya; Eichmiller, Robin; Wang, Bangchen; Williams, Gregory M.; Bianco, Piero R.; Surtees, Jennifer A.

2014-01-01

In Saccharomyces cerevisiae, Msh2-Msh3-mediated mismatch repair (MMR) recognizes and targets insertion/deletion loops for repair. Msh2-Msh3 is also required for 3′ non-homologous tail removal (3′NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, we recently demonstrated that the two pathways have distinct requirements with respect to Msh2-Msh3 activities. We identified a set of aromatic residues in the nucleotide binding pocket (FLY motif) of Msh3 that, when mutated, disrupted MMR, but left 3′ NHTR largely intact. One of these mutations, msh3Y942A, was predicted to disrupt the nucleotide sandwich and allow altered positioning of ATP within the pocket. To develop a mechanistic understanding of the differential requirements for ATP binding and/or hydrolysis in the two pathways, we characterized Msh2-Msh3 and Msh2-msh3Y942A ATP binding and hydrolysis activities in the presence of MMR and 3′ NHTR DNA substrates. We observed distinct, substrate-dependent ATP hydrolysis and nucleotide turnover by Msh2-Msh3, indicating that the MMR and 3′ NHTR DNA substrates differentially modify the ATP binding/hydrolysis activities of Msh2-Msh3. Msh2-msh3Y942A retained the ability to bind DNA and ATP but exhibited altered ATP hydrolysis and nucleotide turnover. We propose that both ATP and structure-specific repair substrates cooperate to direct Msh2-Msh3-mediated repair and suggest an explanation for the msh3Y942A separation-of-function phenotype. PMID:24746922

Microwave emulations and tight-binding calculations of transport in polyacetylene

NASA Astrophysics Data System (ADS)

Stegmann, Thomas; Franco-Villafañe, John A.; Ortiz, Yenni P.; Kuhl, Ulrich; Mortessagne, Fabrice; Seligman, Thomas H.

2017-01-01

A novel approach to investigate the electron transport of cis- and trans-polyacetylene chains in the single-electron approximation is presented by using microwave emulation measurements and tight-binding calculations. In the emulation we take into account the different electronic couplings due to the double bonds leading to coupled dimer chains. The relative coupling constants are adjusted by DFT calculations. For sufficiently long chains a transport band gap is observed if the double bonds are present, whereas for identical couplings no band gap opens. The band gap can be observed also in relatively short chains, if additional edge atoms are absent, which cause strong resonance peaks within the band gap. The experimental results are in agreement with our tight-binding calculations using the nonequilibrium Green's function method. The tight-binding calculations show that it is crucial to include third nearest neighbor couplings to obtain the gap in the cis-polyacetylene.

BLM and RMI1 alleviate RPA inhibition of TopoIIIα decatenase activity.

PubMed

Yang, Jay; Bachrati, Csanad Z; Hickson, Ian D; Brown, Grant W

2012-01-01

RPA is a single-stranded DNA binding protein that physically associates with the BLM complex. RPA stimulates BLM helicase activity as well as the double Holliday junction dissolution activity of the BLM-topoisomerase IIIα complex. We investigated the effect of RPA on the ssDNA decatenase activity of topoisomerase IIIα. We found that RPA and other ssDNA binding proteins inhibit decatenation by topoisomerase IIIα. Complex formation between BLM, TopoIIIα, and RMI1 ablates inhibition of decatenation by ssDNA binding proteins. Together, these data indicate that inhibition by RPA does not involve species-specific interactions between RPA and BLM-TopoIIIα-RMI1, which contrasts with RPA modulation of double Holliday junction dissolution. We propose that topoisomerase IIIα and RPA compete to bind to single-stranded regions of catenanes. Interactions with BLM and RMI1 enhance toposiomerase IIIα activity, promoting decatenation in the presence of RPA.

Characterization of the interdependency between residues that bind the substrate in a beta-glycosidase.

PubMed

Tomassi, M H; Rozenfeld, J H K; Gonçalves, L M; Marana, S R

2010-01-01

The manner by which effects of simultaneous mutations combine to change enzymatic activity is not easily predictable because these effects are not always additive in a linear manner. Hence, the characterization of the effects of simultaneous mutations of amino acid residues that bind the substrate can make a significant contribution to the understanding of the substrate specificity of enzymes. In the beta-glycosidase from Spodoptera frugiperda (Sfbetagly), both residues Q39 and E451 interact with the substrate and this is essential for defining substrate specificity. Double mutants of Sfbetagly (A451E39, S451E39 and S451N39) were prepared by site-directed mutagenesis, expressed in bacteria and purified using affinity chromatography. These enzymes were characterized using p-nitrophenyl beta-galactoside and p-nitrophenyl beta-fucoside as substrates. The k cat/Km ratio for single and double mutants of Sfbetagly containing site-directed mutations at positions Q39 and E451 was used to demonstrate that the effect on the free energy of ESdouble dagger (enzyme-transition state complex) of the double mutations (Gdouble daggerxy) is not the sum of the effects resulting from the single mutations (Gdouble daggerx and Gdouble daggery). This difference in Gdouble dagger indicates that the effects of the single mutations partially overlap. Hence, this common effect counts only once in Gdouble daggerxy. Crystallographic data on beta-glycosidases reveal the presence of a bidentate hydrogen bond involving residues Q39 and E451 and the same hydroxyl group of the substrate. Therefore, both thermodynamic and crystallographic data suggest that residues Q39 and E451 exert a mutual influence on their respective interactions with the substrate.

DNA denaturation bubbles: free-energy landscape and nucleation/closure rates.

PubMed

Sicard, François; Destainville, Nicolas; Manghi, Manoel

2015-01-21

The issue of the nucleation and slow closure mechanisms of non-superhelical stress-induced denaturation bubbles in DNA is tackled using coarse-grained MetaDynamics and Brownian simulations. A minimal mesoscopic model is used where the double helix is made of two interacting bead-spring rotating strands with a prescribed torsional modulus in the duplex state. We demonstrate that timescales for the nucleation (respectively, closure) of an approximately 10 base-pair bubble, in agreement with experiments, are associated with the crossing of a free-energy barrier of 22 kBT (respectively, 13 kBT) at room temperature T. MetaDynamics allows us to reconstruct accurately the free-energy landscape, to show that the free-energy barriers come from the difference in torsional energy between the bubble and duplex states, and thus to highlight the limiting step, a collective twisting, that controls the nucleation/closure mechanism, and to access opening time scales on the millisecond range. Contrary to small breathing bubbles, those more than 4 base-pair bubbles are of biological relevance, for example, when a pre-existing state of denaturation is required by specific DNA-binding proteins.

Backbone and sidechain methyl Ile (δ1), Leu and Val chemical shift assignments of RDE-4 (1-243), an RNA interference initiation protein in C. elegans.

PubMed

Chiliveri, Sai Chaitanya; Kumar, Sonu; Marelli, Udaya Kiran; Deshmukh, Mandar V

2012-10-01

The RNAi pathway of several organisms requires presence of double stranded RNA binding proteins for functioning of Dicer in gene regulation. In C. elegans, a double stranded RNA binding protein, RDE-4 (385 aa, 44 kDa) recognizes long exogenous dsRNA and initiates the RNAi pathway. We have achieved complete backbone and stereospecific methyl sidechain Ile (δ1), Leu and Val chemical shifts of first 243 amino acids of RDE-4, namely RDE-4ΔC.

Inter-layer potential for hexagonal boron nitride

NASA Astrophysics Data System (ADS)

Leven, Itai; Azuri, Ido; Kronik, Leeor; Hod, Oded

2014-03-01

A new interlayer force-field for layered hexagonal boron nitride (h-BN) based structures is presented. The force-field contains three terms representing the interlayer attraction due to dispersive interactions, repulsion due to anisotropic overlaps of electron clouds, and monopolar electrostatic interactions. With appropriate parameterization, the potential is able to simultaneously capture well the binding and lateral sliding energies of planar h-BN based dimer systems as well as the interlayer telescoping and rotation of double walled boron-nitride nanotubes of different crystallographic orientations. The new potential thus allows for the accurate and efficient modeling and simulation of large-scale h-BN based layered structures.

Binding specificity of the juvenile hormone carrier protein from the hemolymph of the tobacco hornworm Manduca sexta Johannson (Lepidoptera: Sphingidae).

PubMed

Peterson, R C; Reich, M F; Dunn, P E; Law, J H; Katzenellnbogen, J A

1977-05-17

A series of analogues of insect juvenile hormone (four geometric isomers of methyl epoxyfarnesenate, several para-substituted epoxygeranyl phenyl ethers, and epoxyfarnesol and its acetate and haloacetate derivatives) was prepared to investigate the binding specificity of the hemolymph juvenile hormone binding protein from the tobacco hornworm Manduct sexta. The relative binding affinities were determined by a competition assay against radiolabeled methyl (E,E)-3,11-dimethyl-7-ethyl-cis-10,11-epoxytrideca-2,6-dienoate (JH I). The ratio of dissociation constants was estimated by plotting competitor data according to a linear transformation of the dissociation equations describing competition of two ligands for a binding protein. The importance of the geometry of the sesquiterpene hydrocarbon chain is indicated by the fact that the binding affinity is decreased as Z (cis) double bonds are substituted for E (trans) double bonds in the methyl epoxyfarnesenate series; the unepoxidized analogues do not bind. A carboxylic ester function is important although its orientation can be reversed, as indicated by the good binding of epoxyfarnesyl acetate. In the monoterpene series, methyl epoxygeranoate shows no affinity for the binding protein, but substitution of a phenyl or p-carbomethoxyphenyl ether for the ester function imparts a low, but significant affinity. These data taken together with earlier results indicate that the binding site for juvenile hormone in the hemolymph binding protein is characterized by a sterically defined hydrophobic region with polar sites that recognize the epoxide and the ester functions.

Layered Halide Double Perovskites Cs3+nM(II)nSb2X9+3n (M = Sn, Ge) for Photovoltaic Applications.

PubMed

Tang, Gang; Xiao, Zewen; Hosono, Hideo; Kamiya, Toshio; Fang, Daining; Hong, Jiawang

2018-01-04

Over the past few years, the development of lead-free and stable perovskite absorbers with excellent performance has attracted extensive attention. Much effort has been devoted to screening and synthesizing this type of solar cell absorbers. Here, we present a general design strategy for designing the layered halide double perovskites Cs 3+n M(II) n Sb 2 X 9+3n (M = Sn, Ge) with desired photovoltaic-relevant properties by inserting [MX 6 ] octahedral layers, based on the principles of increased electronic dimensionality. Compared to Cs 3 Sb 2 I 9 , more suitable band gaps, smaller carrier effective masses, larger dielectric constants, lower exciton binding energies, and higher optical absorption can be achieved by inserting variable [SnI 6 ] or [GeI 6 ] octahedral layers into the [Sb 2 I 9 ] bilayers. Moreover, our results show that adjusting the thickness of inserted octahedral layers is an effective approach to tune the band gaps and carrier effective masses in a large range. Our work provides useful guidance for designing the promising layered antimony halide double perovskite absorbers for photovoltaic applications.

Structure and energetics of Cr(CO)6 and Cr(CO)5

NASA Technical Reports Server (NTRS)

Barnes, Leslie A.; Liu, Bowen; Lindh, Roland

1993-01-01

The geometric structures and energetics of Cr(CO)6 and Cr(CO)5 are determined at the modified coupled-pair functional, single and double excitation coupled-cluster (CCSD), and CCSD(T) levels of theory. For Cr(CO)6, the structure and force constants for the totally symmetric representation are in good agreement with experimental data once basis set constants are taken into account. In the largest basis set at the CCSD(T) level of theory, the total binding energy of CR(CO)6 is estimated at around 140 kcal/mol, or about 86 percent of the experimental value. In contrast, the first bond energy of Cr(CO)6 is very well described at the CCSD(T) level of theory, with the best estimated value of 38 kcal/mol being within the experimental uncertainty.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Protocols Utilizing Constant pH Molecular Dynamics to Compute pH-Dependent Binding Free Energies

PubMed Central

2015-01-01

In protein–ligand binding, the electrostatic environments of the two binding partners may vary significantly in bound and unbound states, which may lead to protonation changes upon binding. In cases where ligand binding results in a net uptake or release of protons, the free energy of binding is pH-dependent. Nevertheless, conventional free energy calculations and molecular docking protocols typically do not rigorously account for changes in protonation that may occur upon ligand binding. To address these shortcomings, we present a simple methodology based on Wyman’s binding polynomial formalism to account for the pH dependence of binding free energies and demonstrate its use on cucurbit[7]uril (CB[7]) host–guest systems. Using constant pH molecular dynamics and a reference binding free energy that is taken either from experiment or from thermodynamic integration computations, the pH-dependent binding free energy is determined. This computational protocol accurately captures the large pKa shifts observed experimentally upon CB[7]:guest association and reproduces experimental binding free energies at different levels of pH. We show that incorrect assignment of fixed protonation states in free energy computations can give errors of >2 kcal/mol in these host–guest systems. Use of the methods presented here avoids such errors, thus suggesting their utility in computing proton-linked binding free energies for protein–ligand complexes. PMID:25134690

Development of novel decoy oligonucleotides: advantages of circular dumb-bell decoy.

PubMed

Tomita, Naruya; Tomita, Tetsuya; Yuyama, Kazuhiko; Tougan, Takahiro; Tajima, Tsuyoshi; Ogihara, Toshio; Morishita, Ryuichi

2003-04-01

The inhibition of specific transcription regulatory proteins is a novel approach to regulate gene expression. The transcriptional activities of DNA binding proteins can be inhibited by the use of double-stranded oligonucleotides (ODNs) that compete for binding to their specific target sequences in promoters and enhancers. Transfection of this cis-element double-stranded ODN, referred to as decoy ODN, has been reported to be a powerful tool that provides a new class of anti-gene strategies to gene therapy and permits examination of specific gene regulation. We have demonstrated the usefulness of this decoy ODN strategy in animal models of restenosis, myocardial infarction, glomerulonephritis and rheumatoid arthritis. However, one of the major limitations of decoy ODN technology is the rapid degradation of phosphodiester ODNs by intracellular nucleases. To date, several different types of double-stranded decoy ODNs have been developed to overcome this issue. Circular dumb-bell (CD) double-stranded decoy ODNs that were developed to resolve this issue have attracted a high level of interest. In this review, the applications of decoy ODN strategy and the advantages of modified CD double-stranded decoy ODNs will be discussed.

Effect of the Flexible Regions of the Oncoprotein Mouse Double Minute X on Inhibitor Binding Affinity.

PubMed

Qin, Lingyun; Liu, Huili; Chen, Rong; Zhou, Jingjing; Cheng, Xiyao; Chen, Yao; Huang, Yongqi; Su, Zhengding

2017-11-07

The oncoprotein MdmX (mouse double minute X) is highly homologous to Mdm2 (mouse double minute 2) in terms of their amino acid sequences and three-dimensional conformations, but Mdm2 inhibitors exhibit very weak affinity for MdmX, providing an excellent model for exploring how protein conformation distinguishes and alters inhibitor binding. The intrinsic conformation flexibility of proteins plays pivotal roles in determining and predicting the binding properties and the design of inhibitors. Although the molecular dynamics simulation approach enables us to understand protein-ligand interactions, the mechanism underlying how a flexible binding pocket adapts an inhibitor has been less explored experimentally. In this work, we have investigated how the intrinsic flexible regions of the N-terminal domain of MdmX (N-MdmX) affect the affinity of the Mdm2 inhibitor nutlin-3a using protein engineering. Guided by heteronuclear nuclear Overhauser effect measurements, we identified the flexible regions that affect inhibitor binding affinity around the ligand-binding pocket on N-MdmX. A disulfide engineering mutant, N-MdmX C25-C110/C76-C88 , which incorporated two staples to rigidify the ligand-binding pocket, allowed an affinity for nutlin-3a higher than that of wild-type N-MdmX (K d ∼ 0.48 vs K d ∼ 20.3 μM). Therefore, this mutant provides not only an effective protein model for screening and designing of MdmX inhibitors but also a valuable clue for enhancing the intermolecular interactions of the pharmacophores of a ligand with pronounced flexible regions. In addition, our results revealed an allosteric ligand-binding mechanism of N-MdmX in which the ligand initially interacts with a compact core, followed by augmenting intermolecular interactions with intrinsic flexible regions. This strategy should also be applicable to many other protein targets to accelerate drug discovery.

Stability of Hydrocarbons of the Polyhedrane Family: Convergence of ab Initio Calculations and Corresponding Assessment of DFT Main Approximations.

PubMed

Sancho-García, J C

2011-09-13

Highly accurate coupled-cluster (CC) calculations with large basis sets have been performed to study the binding energy of the (CH)12, (CH)16, (CH)20, and (CH)24 polyhedral hydrocarbons in two, cage-like and planar, forms. We also considered the effect of other minor contributions: core-correlation, relativistic corrections, and extrapolations to the limit of the full CC expansion. Thus, chemically accurate values could be obtained for these complicated systems. These nearly exact results are used to evaluate next the performance of main approximations (i.e., pure, hybrid, and double-hybrid methods) within density functional theory (DFT) in a systematic fashion. Some commonly used functionals, including the B3LYP model, are affected by large errors, and only those having reduced self-interaction error (SIE), which includes the last family of conjectured expressions (double hybrids), are able to achieve reasonable low deviations of 1-2 kcal/mol especially when an estimate for dispersion interactions is also added.

Left-handed Z-DNA: structure and function

NASA Technical Reports Server (NTRS)

Herbert, A.; Rich, A.

1999-01-01

Z-DNA is a high energy conformer of B-DNA that forms in vivo during transcription as a result of torsional strain generated by a moving polymerase. An understanding of the biological role of Z-DNA has advanced with the discovery that the RNA editing enzyme double-stranded RNA adenosine deaminase type I (ADAR1) has motifs specific for the Z-DNA conformation. Editing by ADAR1 requires a double-stranded RNA substrate. In the cases known, the substrate is formed by folding an intron back onto the exon that is targeted for modification. The use of introns to direct processing of exons requires that editing occurs before splicing. Recognition of Z-DNA by ADAR1 may allow editing of nascent transcripts to be initiated immediately after transcription, ensuring that editing and splicing are performed in the correct sequence. Structural characterization of the Z-DNA binding domain indicates that it belongs to the winged helix-turn-helix class of proteins and is similar to the globular domain of histone-H5.

RNA Modulates the Interaction between Influenza A Virus NS1 and Human PABP1.

PubMed

Arias-Mireles, Bryan H; de Rozieres, Cyrus M; Ly, Kevin; Joseph, Simpson

2018-05-25

Nonstructural protein 1 (NS1) is a multifunctional protein involved in preventing host-interferon response in influenza A virus (IAV). Previous studies have indicated that NS1 also stimulates the translation of viral mRNA by binding to conserved sequences in the viral 5'-UTR. Additionally, NS1 binds to poly(A) binding protein 1 (PABP1) and eukaryotic initiation factor 4G (eIF4G). The interaction of NS1 with the viral 5'-UTR, PABP1, and eIF4G has been suggested to specifically enhance the translation of viral mRNAs. In contrast, we report that NS1 does not directly bind to sequences in the viral 5'-UTR, indicating that NS1 is not responsible for providing the specificity to stimulate viral mRNA translation. We also monitored the interaction of NS1 with PABP1 using a new, quantitative FRET assay. Our data show that NS1 binds to PABP1 with high affinity; however, the binding of double-stranded RNA (dsRNA) to NS1 weakens the binding of NS1 to PABP1. Correspondingly, the binding of PABP1 to NS1 weakens the binding of NS1 to double-stranded RNA (dsRNA). In contrast, the affinity of PABP1 for binding to poly(A) RNA is not significantly changed by NS1. We propose that the modulation of NS1·PABP1 interaction by dsRNA may be important for the viral cycle.

Conformational Transitions and Convergence of Absolute Binding Free Energy Calculations

PubMed Central

Lapelosa, Mauro; Gallicchio, Emilio; Levy, Ronald M.

2011-01-01

The Binding Energy Distribution Analysis Method (BEDAM) is employed to compute the standard binding free energies of a series of ligands to a FK506 binding protein (FKBP12) with implicit solvation. Binding free energy estimates are in reasonably good agreement with experimental affinities. The conformations of the complexes identified by the simulations are in good agreement with crystallographic data, which was not used to restrain ligand orientations. The BEDAM method is based on λ -hopping Hamiltonian parallel Replica Exchange (HREM) molecular dynamics conformational sampling, the OPLS-AA/AGBNP2 effective potential, and multi-state free energy estimators (MBAR). Achieving converged and accurate results depends on all of these elements of the calculation. Convergence of the binding free energy is tied to the level of convergence of binding energy distributions at critical intermediate states where bound and unbound states are at equilibrium, and where the rate of binding/unbinding conformational transitions is maximal. This finding mirrors similar observations in the context of order/disorder transitions as for example in protein folding. Insights concerning the physical mechanism of ligand binding and unbinding are obtained. Convergence for the largest FK506 ligand is achieved only after imposing strict conformational restraints, which however require accurate prior structural knowledge of the structure of the complex. The analytical AGBNP2 model is found to underestimate the magnitude of the hydrophobic driving force towards binding in these systems characterized by loosely packed protein-ligand binding interfaces. Rescoring of the binding energies using a numerical surface area model corrects this deficiency. This study illustrates the complex interplay between energy models, exploration of conformational space, and free energy estimators needed to obtain robust estimates from binding free energy calculations. PMID:22368530

Constraints on the symmetry energy from neutron star observations

NASA Astrophysics Data System (ADS)

Newton, W. G.; Gearheart, M.; Wen, De-Hua; Li, Bao-An

2013-03-01

The modeling of many neutron star observables incorporates the microphysics of both the stellar crust and core, which is tied intimately to the properties of the nuclear matter equation of state (EoS). We explore the predictions of such models over the range of experimentally constrained nuclear matter parameters, focusing on the slope of the symmetry energy at nuclear saturation density L. We use a consistent model of the composition and EoS of neutron star crust and core matter to model the binding energy of pulsar B of the double pulsar system J0737-3039, the frequencies of torsional oscillations of the neutron star crust and the instability region for r-modes in the neutron star core damped by electron-electron viscosity at the crust-core interface. By confronting these models with observations, we illustrate the potential of astrophysical observables to offer constraints on poorly known nuclear matter parameters complementary to terrestrial experiments, and demonstrate that our models consistently predict L < 70 MeV.

Defect states of complexes involving a vacancy on the boron site in boronitrene

NASA Astrophysics Data System (ADS)

Ngwenya, T. B.; Ukpong, A. M.; Chetty, N.

2011-12-01

First principles calculations have been performed to investigate the ground state properties of freestanding monolayer hexagonal boronitrene (h-BN). We have considered monolayers that contain native point defects and their complexes, which form when the point defects bind with the boron vacancy on the nearest-neighbor position. The changes in the electronic structure are analyzed to show the extent of localization of the defect-induced midgap states. The variations in formation energies suggest that defective h-BN monolayers that contain carbon substitutional impurities are the most stable structures, irrespective of the changes in growth conditions. The high energies of formation of the boron vacancy complexes suggest that they are less stable, and their creation by ion bombardment would require high-energy ions compared to point defects. Using the relative positions of the derived midgap levels for the double vacancy complex, it is shown that the quasi-donor-acceptor pair interpretation of optical transitions is consistent with stimulated transitions between electron and hole states in boronitrene.

How to deal with multiple binding poses in alchemical relative protein-ligand binding free energy calculations.

PubMed

Kaus, Joseph W; Harder, Edward; Lin, Teng; Abel, Robert; McCammon, J Andrew; Wang, Lingle

2015-06-09

Recent advances in improved force fields and sampling methods have made it possible for the accurate calculation of protein–ligand binding free energies. Alchemical free energy perturbation (FEP) using an explicit solvent model is one of the most rigorous methods to calculate relative binding free energies. However, for cases where there are high energy barriers separating the relevant conformations that are important for ligand binding, the calculated free energy may depend on the initial conformation used in the simulation due to the lack of complete sampling of all the important regions in phase space. This is particularly true for ligands with multiple possible binding modes separated by high energy barriers, making it difficult to sample all relevant binding modes even with modern enhanced sampling methods. In this paper, we apply a previously developed method that provides a corrected binding free energy for ligands with multiple binding modes by combining the free energy results from multiple alchemical FEP calculations starting from all enumerated poses, and the results are compared with Glide docking and MM-GBSA calculations. From these calculations, the dominant ligand binding mode can also be predicted. We apply this method to a series of ligands that bind to c-Jun N-terminal kinase-1 (JNK1) and obtain improved free energy results. The dominant ligand binding modes predicted by this method agree with the available crystallography, while both Glide docking and MM-GBSA calculations incorrectly predict the binding modes for some ligands. The method also helps separate the force field error from the ligand sampling error, such that deviations in the predicted binding free energy from the experimental values likely indicate possible inaccuracies in the force field. An error in the force field for a subset of the ligands studied was identified using this method, and improved free energy results were obtained by correcting the partial charges assigned to the ligands. This improved the root-mean-square error (RMSE) for the predicted binding free energy from 1.9 kcal/mol with the original partial charges to 1.3 kcal/mol with the corrected partial charges.

How To Deal with Multiple Binding Poses in Alchemical Relative Protein–Ligand Binding Free Energy Calculations

PubMed Central

2016-01-01

Recent advances in improved force fields and sampling methods have made it possible for the accurate calculation of protein–ligand binding free energies. Alchemical free energy perturbation (FEP) using an explicit solvent model is one of the most rigorous methods to calculate relative binding free energies. However, for cases where there are high energy barriers separating the relevant conformations that are important for ligand binding, the calculated free energy may depend on the initial conformation used in the simulation due to the lack of complete sampling of all the important regions in phase space. This is particularly true for ligands with multiple possible binding modes separated by high energy barriers, making it difficult to sample all relevant binding modes even with modern enhanced sampling methods. In this paper, we apply a previously developed method that provides a corrected binding free energy for ligands with multiple binding modes by combining the free energy results from multiple alchemical FEP calculations starting from all enumerated poses, and the results are compared with Glide docking and MM-GBSA calculations. From these calculations, the dominant ligand binding mode can also be predicted. We apply this method to a series of ligands that bind to c-Jun N-terminal kinase-1 (JNK1) and obtain improved free energy results. The dominant ligand binding modes predicted by this method agree with the available crystallography, while both Glide docking and MM-GBSA calculations incorrectly predict the binding modes for some ligands. The method also helps separate the force field error from the ligand sampling error, such that deviations in the predicted binding free energy from the experimental values likely indicate possible inaccuracies in the force field. An error in the force field for a subset of the ligands studied was identified using this method, and improved free energy results were obtained by correcting the partial charges assigned to the ligands. This improved the root-mean-square error (RMSE) for the predicted binding free energy from 1.9 kcal/mol with the original partial charges to 1.3 kcal/mol with the corrected partial charges. PMID:26085821

Active site-directed double mutants of dihydrofolate reductase.

PubMed

Ercikan-Abali, E A; Mineishi, S; Tong, Y; Nakahara, S; Waltham, M C; Banerjee, D; Chen, W; Sadelain, M; Bertino, J R

1996-09-15

Variants of dihydrofolate reductase (DHFR), which confer resistance to antifolates, are used as dominant selectable markers in vitro and in vivo and may be useful in the context of gene therapy. To identify improved mutant human DHFRs with increased catalytic efficiency and decreased binding to methotrexate, we constructed by site-directed mutagenesis four variants with substitutions at both Leu22 and Phe31 (i.e., Phe22-Ser31, Tyr22-Ser31, Phe22-Gly31, and Tyr22-Gly31). Antifolate resistance has been observed previously when individual changes are made at these active-site residues. Substrate and antifolate binding properties of these "double" mutants revealed that each have greatly diminished affinity for antifolates (> 10,000-fold) yet only slightly reduced substrate affinity. Comparison of in vitro measured properties with those of single-residue variants indicates that double mutants are indeed significantly superior. This was verified for one of the double mutants that provided high-level methotrexate resistance following retrovirus-mediated gene transfer in NIH3T3 cells.

The RNA-binding region of human TRBP interacts with microRNA precursors through two independent domains

PubMed Central

Benoit, Matthieu P. M. H.; Imbert, Lionel; Palencia, Andrés; Pérard, Julien; Ebel, Christine; Boisbouvier, Jérôme; Plevin, Michael J.

2013-01-01

MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression through RNA interference. Human miRNAs are generated through a series of enzymatic processing steps. The precursor miRNA (pre-miRNA) is recognized and cleaved by a complex containing Dicer and several non-catalytic accessory proteins. HIV TAR element binding protein (TRBP) is a constituent of the Dicer complex, which augments complex stability and potentially functions in substrate recognition and product transfer to the RNA-induced silencing complex. Here we have analysed the interaction between the RNA-binding region of TRBP and an oncogenic human miRNA, miR-155, at different stages in the biogenesis pathway. We show that the region of TRBP that binds immature miRNAs comprises two independent double-stranded RNA-binding domains connected by a 60-residue flexible linker. No evidence of contact between the two double-stranded RNA-binding domains was observed either in the apo- or RNA-bound state. We establish that the RNA-binding region of TRBP interacts with both pre-miR-155 and the miR-155/miR-155* duplex through the same binding surfaces and with similar affinities, and that two protein molecules can simultaneously interact with each immature miRNA. These data suggest that TRBP could play a role before and after processing of pre-miRNAs by Dicer. PMID:23435228

Characterization of calmodulin binding domains in TRPV2 and TRPV5 C-tails.

PubMed

Holakovska, Blanka; Grycova, Lenka; Bily, Jan; Teisinger, Jan

2011-02-01

The transient receptor potential channels TRPV2 and TRPV5 belong to the vanilloid TRP subfamily. TRPV2 is highly similar to TRPV1 and shares many common properties with it. TRPV5 (and also its homolog TRPV6) is a rather distinct member of the TRPV subfamily. It is distant for being strictly Ca(2+)-selective and features quite different properties from the rest of the TRPV subfamily. It is known that TRP channels are regulated by calmodulin in a calcium-dependent manner. In our study we identified a calmodulin binding site on the C-termini of TRPV2 (654-683) and TRPV5 (587-616) corresponding to the consensus CaM binding motif 1-5-10. The R679 and K681 single mutants of TRPV2 caused a 50% decrease in binding affinity and a double mutation of K661/K664 of the same peptide lowered the binding affinity by up to 75%. A double mutation of R606/K607 and triple mutation of R594/R606/R610 in TRPV5 C-terminal peptide resulted in the total loss of binding affinity to calmodulin. These results demonstrate that the TRPV2 C-tail and TRPV5 C-tail contain calmodulin binding sites and that the basic residues are strongly involved in TRP channel binding to calmodulin.

Identification of the SRC pyrimidine-binding protein (SPy) as hnRNP K: implications in the regulation of SRC1A transcription

PubMed Central

Ritchie, Shawn A.; Pasha, Mohammed K.; Batten, Danielle J. P.; Sharma, Rajendra K.; Olson, Douglas J. H.; Ross, Andrew R. S.; Bonham, Keith

2003-01-01

The human SRC gene encodes pp60c–src, a non-receptor tyrosine kinase involved in numerous signaling pathways. Activation or overexpression of c-Src has also been linked to a number of important human cancers. Transcription of the SRC gene is complex and regulated by two closely linked but highly dissimilar promoters, each associated with its own distinct non-coding exon. In many tissues SRC expression is regulated by the housekeeping-like SRC1A promoter. In addition to other regulatory elements, three substantial polypurine:polypyrimidine (TC) tracts within this promoter are required for full transcriptional activity. Previously, we described an unusual factor called SRC pyrimidine-binding protein (SPy) that could bind to two of these TC tracts in their double-stranded form, but was also capable of interacting with higher affinity to all three pyrimidine tracts in their single-stranded form. Mutations in the TC tracts, which abolished the ability of SPy to interact with its double-stranded DNA target, significantly reduced SRC1A promoter activity, especially in concert with mutations in critical Sp1 binding sites. Here we expand upon our characterization of this interesting factor and describe the purification of SPy from human SW620 colon cancer cells using a DNA affinity-based approach. Subsequent in-gel tryptic digestion of purified SPy followed by MALDI-TOF mass spectrometric analysis identified SPy as heterogeneous nuclear ribonucleoprotein K (hnRNP K), a known nucleic-acid binding protein implicated in various aspects of gene expression including transcription. These data provide new insights into the double- and single-stranded DNA-binding specificity, as well as functional properties of hnRNP K, and suggest that hnRNP K is a critical component of SRC1A transcriptional processes. PMID:12595559

Distinct requirements within the Msh3 nucleotide binding pocket for mismatch and double-strand break repair.

PubMed

Kumar, Charanya; Williams, Gregory M; Havens, Brett; Dinicola, Michelle K; Surtees, Jennifer A

2013-06-12

In Saccharomyces cerevisiae, repair of insertion/deletion loops is carried out by Msh2-Msh3-mediated mismatch repair (MMR). Msh2-Msh3 is also required for 3' non-homologous tail removal (3' NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, the kinetics of the two processes appear different; MMR is likely rapid in order to coordinate with the replication fork, whereas 3' NHTR has been shown to be a slower process. To understand the molecular requirements in both repair pathways, we performed an in vivo analysis of well-conserved residues in Msh3 that are hypothesized to be required for MMR and/or 3' NHTR. These residues are predicted to be involved in either communication between the DNA-binding and ATPase domains within the complex or nucleotide binding and/or exchange within Msh2-Msh3. We identified a set of aromatic residues within the FLY motif of the predicted Msh3 nucleotide binding pocket that are essential for Msh2-Msh3-mediated MMR but are largely dispensable for 3' NHTR. In contrast, mutations in other regions gave similar phenotypes in both assays. Based on these results, we suggest that the two pathways have distinct requirements with respect to the position of the bound ATP within Msh3. We propose that the differences are related, at least in part, to the kinetics of each pathway. Proper binding and positioning of ATP is required to induce rapid conformational changes at the replication fork, but is less important when more time is available for repair, as in 3' NHTR. Copyright © 2013 Elsevier Ltd. All rights reserved.

Distinct requirements within the Msh3 nucleotide binding pocket for mismatch and double-strand break repair

PubMed Central

Kumar, Charanya; Williams, Gregory M.; Havens, Brett; Dinicola, Michelle; Surtees, Jennifer A.

2013-01-01

In Saccharomyces cerevisiae, repair of insertion/deletion loops is carried out by Msh2-Msh3-mediated mismatch repair (MMR). Msh2-Msh3 is also required for 3’ non-homologous tail removal (3’NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, the kinetics of the two processes appear different; MMR is likely rapid in order to coordinate with the replication fork, whereas 3’ NHTR has been shown to be a slower process. To understand the molecular requirements in both repair pathways, we performed an in vivo analysis of well conserved residues in Msh3 that are hypothesized to be required for MMR and/or 3’NHTR. These residues are predicted to be involved in either communication between the DNA-binding and ATPase domains within the complex or nucleotide binding and/or exchange within Msh2-Msh3. We identified a set of aromatic residues within the FLY motif of the predicted Msh3 nucleotide binding pocket that are essential for Msh2-Msh3-mediated MMR but are largely dispensable for 3’NHTR. In contrast, mutations in other regions gave similar phenotypes in both assays. Based on these results, we suggest the two pathways have distinct requirements with respect to the position of the bound ATP within Msh3. We propose that the differences are related, at least in part, to the kinetics of each pathway. Proper binding and positioning of ATP is required to induce rapid conformational changes at the replication fork, but is less important when more time is available for repair, as in 3’ NHTR. PMID:23458407

Ammonia-water cation and ammonia dimer cation.

PubMed

Kim, Hahn; Lee, Han Myoung

2009-06-25

We have investigated the structure, interaction energy, electronic properties, and IR spectra of the ammonia-water cation (NH(3)H(2)O)(+) using density functional theory (DFT) and high-level ab initio theory. The ammonia-water cation has three minimum-energy structures of (a) H(2)NH(+)...OH(2), (b) H(3)N(+)...OH(2), and (c) H(3)NH(+)...OH. The lowest-energy structure is (a), followed by (c) and (b). The ammonia dimer cation has two minimum-energy structures [the lowest H(3)NH(+)...NH(2) structure and the second lowest (H(3)N...NH(3))(+) structure]. The minimum transition barrier for the interconversion between (a), (b), and (c) is approximately 6 kcal/mol. Most DFT calculations with various functionals, except a few cases, overstabilize the N...O and N...N binding, predicting different structures from Moller-Plesset second-order perturbation (MP2) theory and the most reliable complete basis set (CBS) limit of coupled cluster theory with single, double, and perturbative triple excitations [CCSD(T)]. Thus, the validity test of the DFT functionals for these ionized molecular systems would be of importance.

Crimean-Congo hemorrhagic fever virus nucleocapsid protein has dual RNA binding modes.

PubMed

Jeeva, Subbiah; Pador, Sean; Voss, Brittany; Ganaie, Safder Saieed; Mir, Mohammad Ayoub

2017-01-01

Crimean Congo hemorrhagic fever, a zoonotic viral disease, has high mortality rate in humans. There is currently no vaccine for Crimean Congo hemorrhagic fever virus (CCHFV) and chemical interventions are limited. The three negative sense genomic RNA segments of CCHFV are specifically encapsidated by the nucleocapsid protein into three ribonucleocapsids, which serve as templates for the viral RNA dependent RNA polymerase. Here we demonstrate that CCHFV nucleocapsid protein has two distinct binding modes for double and single strand RNA. In the double strand RNA binding mode, the nucleocapsid protein preferentially binds to the vRNA panhandle formed by the base pairing of complementary nucleotides at the 5' and 3' termini of viral genome. The CCHFV nucleocapsid protein does not have RNA helix unwinding activity and hence does not melt the duplex vRNA panhandle after binding. In the single strand RNA binding mode, the nucleocapsid protein does not discriminate between viral and non-viral RNA molecules. Binding of both vRNA panhandle and single strand RNA induce a conformational change in the nucleocapsid protein. Nucleocapsid protein remains in a unique conformational state due to simultaneously binding of structurally distinct vRNA panhandle and single strand RNA substrates. Although the role of dual RNA binding modes in the virus replication cycle is unknown, their involvement in the packaging of viral genome and regulation of CCHFV replication in conjunction with RdRp and host derived RNA regulators is highly likely.

Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy

NASA Astrophysics Data System (ADS)

Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.

2016-03-01

We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e

Mechanism of the calcium-regulation of muscle contraction--in pursuit of its structural basis.

PubMed

Wakabayashi, Takeyuki

2015-01-01

The author reviewed the research that led to establish the structural basis for the mechanism of the calcium-regulation of the contraction of striated muscles. The target of calcium ions is troponin on the thin filaments, of which the main component is the double-stranded helix of actin. A model of thin filament was generated by adding tropomyosin and troponin. During the process to provide the structural evidence for the model, the troponin arm was found to protrude from the calcium-depleted troponin and binds to the carboxyl-terminal region of actin. As a result, the carboxyl-terminal region of tropomyosin shifts and covers the myosin-binding sites of actin to block the binding of myosin. At higher calcium concentrations, the troponin arm changes its partner from actin to the main body of calcium-loaded troponin. Then, tropomyosin shifts back to the position near the grooves of actin double helix, and the myosin-binding sites of actin becomes available to myosin resulting in force generation through actin-myosin interactions.

MDA5 cooperatively forms dimers and ATP-sensitive filaments upon binding double-stranded RNA

PubMed Central

Berke, Ian C; Modis, Yorgo

2012-01-01

Melanoma differentiation-associated gene-5 (MDA5) detects viral double-stranded RNA in the cytoplasm. RNA binding induces MDA5 to activate the signalling adaptor MAVS through interactions between the caspase recruitment domains (CARDs) of the two proteins. The molecular mechanism of MDA5 signalling is not well understood. Here, we show that MDA5 cooperatively binds short RNA ligands as a dimer with a 16–18-basepair footprint. A crystal structure of the MDA5 helicase-insert domain demonstrates an evolutionary relationship with the archaeal Hef helicases. In X-ray solution structures, the CARDs in unliganded MDA5 are flexible, and RNA binds on one side of an asymmetric MDA5 dimer, bridging the two subunits. On longer RNA, full-length and CARD-deleted MDA5 constructs assemble into ATP-sensitive filaments. We propose a signalling model in which the CARDs on MDA5–RNA filaments nucleate the assembly of MAVS filaments with the same polymeric geometry. PMID:22314235

Crystallization of the avian reovirus double-stranded RNA-binding and core protein σA

PubMed Central

Hermo-Parrado, X. Lois; Guardado-Calvo, Pablo; Llamas-Saiz, Antonio L.; Fox, Gavin C.; Vazquez-Iglesias, Lorena; Martínez-Costas, José; Benavente, Javier; van Raaij, Mark J.

2007-01-01

The avian reovirus protein σA plays a dual role: it is a structural protein forming part of the transcriptionally active core, but it has also been implicated in the resistance of the virus to interferon by strongly binding double-stranded RNA and thus inhibiting the double-stranded RNA-dependent protein kinase. The σA protein has been crystallized from solutions containing ammonium sulfate at pH values around 6. Crystals belonging to space group P1, with unit-cell parameters a = 103.2, b = 129.9, c = 144.0 Å, α = 93.8, β = 105.1, γ = 98.2° were grown and a complete data set has been collected to 2.3 Å resolution. The self-rotation function suggests that σA may form symmetric arrangements in the crystals. PMID:17565188

Spin Transport in Electric-Barrier-Modulated Ferromagnetic/Normal/Ferromagnetic Monolayer Zigzag MoS2 Nanoribbon Junction

NASA Astrophysics Data System (ADS)

Xia, Y.-Y.; Yuan, R.-Y.; Yang, Q.-J.; Sun, Q.; Zheng, J.; Guo, Y.

In this paper, with the three-band tight-binding model and non-equilibrium Green’s function technique, we investigate spin transport in electric-barrier-modulated Ferromagnetic/Normal/Ferromagnetic (F/N/F) monolayer (ML) zigzag MoS2 nanoribbon junction. The results demonstrate that once the double electric barriers structure emerges, the oscillations of spin conductances become violent, especially for spin-down conductance, the numbers of resonant peaks increase obviously, thus we can obtain 100% spin polarization in the low energy region. It is also found that with the intensity of the exchange field enhancement, the resonant peaks of spin-up and spin-down conductances move in the opposite direction in a certain energy region. As a consequence, the spin-down conductance can be filtered out completely. The findings here indicate that the present structure may be considered as a good candidate for spin filter.

Substitutional and interstitial oxygen in wurtzite GaN

NASA Astrophysics Data System (ADS)

Wright, A. F.

2005-11-01

Density-functional theory was used to compute energy-minimum configurations and formation energies of substitutional and interstitial oxygen (O) in wurtzite GaN. The results indicate that O substituted at a N site (ON) acts as a single donor with the ionized state (ON+1) being the most stable O state in p-type GaN. In n-type GaN, interstitial O (OI) is predicted to be a double acceptor and O substituted at a Ga site (OGa) is predicted to be a triple acceptor. The formation energies of these two species are comparable to that of ON in n-type GaN and, as such, they should form and compensate the ON donors. The extent of compensation was estimated for both Ga-rich and N-rich conditions with a total O concentration of 1017cm-3. Ga-rich conditions yielded negligible compensation and an ON concentration in excess of 9.9×1016cm-3. N-rich conditions yielded a 25% lower ON concentration, due to the increased stability of OI and OGa relative to ON, and moderate compensation. These findings are consistent with experimental results indicating that O acts as a donor in GaN(O). Complexes of ON with the Mg acceptor and OI with the Si donor were examined. Binding energies for charge-conserving reactions were ⩾0.5eV, indicating that these complexes can exist in equilibrium at room temperature. Complexes of ON with the Ga vacancy in n-type GaN were also examined and their binding energies were 1.2 and 1.4eV, indicating that appreciable concentrations can exist in equilibrium even at elevated temperatures.

DNA sensing by a Eu-binding peptide containing a proflavine unit.

PubMed

Ancel, Laetitia; Gateau, Christelle; Lebrun, Colette; Delangle, Pascale

2013-01-18

Synthesis of a lanthanide-binding peptide (LBP) for the detection of double-stranded DNA is presented. A proflavine moiety was introduced into a high affinity LBP involving two unnatural chelating amino acids in the Ln ion coordination. The Eu(3+)-LBP complex is demonstrated to bind to ct-DNA and to sensitize Eu luminescence. The DNA binding process is effectively detected via the Eu-centered luminescence thanks to the intimate coupling between the LBP scaffold and DNA intercalating unit.

Biopolymers: Protein and Nucleic Acids

DTIC Science & Technology

1987-09-15

characterized a 45 kDa "ZSB, de!•ignted S’SB1, most extensively. SSB1 was isolated on the basis of preferential binding to sin ie-stranded versus double...stranded DNA and was subsequently shown also to bind to RNA (9). Although SSB1 seems to bind without sequen-e specificity, it is interesting to note...that it copurifies through several a inity steps with the yeast poly (A) binding protein (11, Sach3 and Jong, unpublished observations). SSB1 stimulates

Doubling the Size of the Glucocorticoid Receptor Ligand Binding Pocket by Deacylcortivazol

DOE Office of Scientific and Technical Information (OSTI.GOV)

Suino-Powell, Kelly; Xu, Yong; Zhang, Chenghai

A common feature of nuclear receptor ligand binding domains (LBD) is a helical sandwich fold that nests a ligand binding pocket within the bottom half of the domain. Here we report that the ligand pocket of glucocorticoid receptor (GR) can be continuously extended into the top half of the LBD by binding to deacylcortivazol (DAC), an extremely potent glucocorticoid. It has been puzzling for decades why DAC, which contains a phenylpyrazole replacement at the conserved 3-ketone of steroid hormones that are normally required for activation of their cognate receptors, is a potent GR activator. The crystal structure of the GRmore » LBD bound to DAC and the fourth LXXLL motif of steroid receptor coactivator 1 reveals that the GR ligand binding pocket is expanded to a size of 1,070 {angstrom}{sup 3}, effectively doubling the size of the GR dexamethasone-binding pocket of 540 {angstrom}{sup 3} and yet leaving the structure of the coactivator binding site intact. DAC occupies only {approx}50% of the space of the pocket but makes intricate interactions with the receptor around the phenylpyrazole group that accounts for the high-affinity binding of DAC. The dramatic expansion of the DAC-binding pocket thus highlights the conformational adaptability of GR to ligand binding. The new structure also allows docking of various nonsteroidal ligands that cannot be fitted into the previous structures, thus providing a new rational template for drug discovery of steroidal and nonsteroidal glucocorticoids that can be specifically designed to reach the unoccupied space of the expanded pocket.« less

Interaction of small molecules with double-stranded RNA: spectroscopic, viscometric, and calorimetric study of hoechst and proflavine binding to PolyCG structures.

PubMed

Sinha, Rangana; Hossain, Maidul; Kumar, Gopinatha Suresh

2009-04-01

Design and synthesis of new small molecules binding to double-stranded RNA necessitate complete understanding of the molecular aspects of the binding of many existing molecules. Toward this goal, in this work we evaluated the biophysical aspects of the interaction of a DNA intercalator (proflavine) and a minor groove binder (hoechst 33258) with two polymorphic forms of polyCG, namely, the right-handed Watson-Crick base paired A-form and the left-handed Hoogsteen base paired H(L)-form, by absorption, fluorescence, and viscometry experiments. The energetics of the interaction of these molecules with the RNA structures has also been elucidated by isothermal titration calorimetry (ITC). Results suggest that proflavine strongly intercalates in both forms of polyCG, whereas hoechst shows mainly groove-binding modes. The binding of both drugs to both forms of RNA resulted in significant conformational change to the RNA structure with the bound molecules being placed in the chiral RNA helix. ITC profiles for both proflavine and hoechst show two binding sites. Binding of proflavine to both forms of RNA is endothermic and entropy driven in the first site and exothermic and enthalpy driven in the second site, whereas hoechst binding to both forms of RNA is exothermic and enthalpy driven in the first site and endothermic and entropy driven in the second site. This study suggests that the binding affinity characteristics and energetics of interaction of these DNA binding molecules with the RNA conformations are significantly different and may serve as data for future development of effective structure-selective RNA-based drugs.

Structure of an XPF endonuclease with and without DNA suggests a model for substrate recognition

PubMed Central

Newman, Matthew; Murray-Rust, Judith; Lally, John; Rudolf, Jana; Fadden, Andrew; Knowles, Philip P; White, Malcolm F; McDonald, Neil Q

2005-01-01

The XPF/Mus81 structure-specific endonucleases cleave double-stranded DNA (dsDNA) within asymmetric branched DNA substrates and play an essential role in nucleotide excision repair, recombination and genome integrity. We report the structure of an archaeal XPF homodimer alone and bound to dsDNA. Superposition of these structures reveals a large domain movement upon binding DNA, indicating how the (HhH)2 domain and the nuclease domain are coupled to allow the recognition of double-stranded/single-stranded DNA junctions. We identify two nonequivalent DNA-binding sites and propose a model in which XPF distorts the 3′ flap substrate in order to engage both binding sites and promote strand cleavage. The model rationalises published biochemical data and implies a novel role for the ERCC1 subunit of eukaryotic XPF complexes. PMID:15719018

Cyclic perylene diimide: Selective ligand for tetraplex DNA binding over double stranded DNA.

PubMed

Vasimalla, Suresh; Sato, Shinobu; Takenaka, Fuminori; Kurose, Yui; Takenaka, Shigeori

2017-12-15

Synthesized cyclic perylene diimide, cPDI, showed the binding constant of 6.3 × 10 6  M -1 with binding number of n = 2 with TA-core as a tetraplex DNA in 50 mM Tris-HCl buffer (pH = 7.4) containing 100 mM KCl using Schatchard analysis and showed a higher preference for tetraplex DNA than for double stranded DNA with over 10 3 times. CD spectra showed that TA-core induced its antiparallel conformation upon addition of cPDI in the absence or presence of K + or Na + ions. The cPDI inhibits the telomerase activity with IC 50 of 0.3 µM using TRAP assay which is potential anti-cancer drug with low side effect. Copyright © 2017 Elsevier Ltd. All rights reserved.

Versatile derivatives of carbohydrate-binding modules for imaging of complex carbohydrates approaching the molecular level of resolution.

PubMed

Ding, Shi-You; Xu, Qi; Ali, Mursheda K; Baker, John O; Bayer, Edward A; Barak, Yoav; Lamed, Raphael; Sugiyama, Junji; Rumbles, Garry; Himmel, Michael E

2006-10-01

The innate binding specificity of different carbohydrate-binding modules (CBMs) offers a versatile approach for mapping the chemistry and structure of surfaces that contain complex carbohydrates. We have employed the distinct recognition properties of a double His-tagged recombinant CBM tagged with semiconductor quantum dots for direct imaging of crystalline cellulose at the molecular level of resolution, using transmission and scanning transmission electron microscopy. In addition, three different types of CBMs from families 3, 6, and 20 that exhibit different carbohydrate specificities were each fused with either green fluorescent protein (GFP) or red fluorescent protein (RFP) and employed for double-labeling fluorescence microscopy studies of primary cell walls and various mixtures of complex carbohydrate target molecules. CBM probes can be used for characterizing both native complex carbohydrates and engineered biomaterials.

Hepatitis Delta Antigen Requires a Flexible Quasi-Double-Stranded RNA Structure To Bind and Condense Hepatitis Delta Virus RNA in a Ribonucleoprotein Complex

PubMed Central

Griffin, Brittany L.; Chasovskikh, Sergey; Dritschilo, Anatoly

2014-01-01

ABSTRACT The circular genome and antigenome RNAs of hepatitis delta virus (HDV) form characteristic unbranched, quasi-double-stranded RNA secondary structures in which short double-stranded helical segments are interspersed with internal loops and bulges. The ribonucleoprotein complexes (RNPs) formed by these RNAs with the virus-encoded protein hepatitis delta antigen (HDAg) perform essential roles in the viral life cycle, including viral replication and virion formation. Little is understood about the formation and structure of these complexes and how they function in these key processes. Here, the specific RNA features required for HDAg binding and the topology of the complexes formed were investigated. Selective 2′OH acylation analyzed by primer extension (SHAPE) applied to free and HDAg-bound HDV RNAs indicated that the characteristic secondary structure of the RNA is preserved when bound to HDAg. Notably, the analysis indicated that predicted unpaired positions in the RNA remained dynamic in the RNP. Analysis of the in vitro binding activity of RNAs in which internal loops and bulges were mutated and of synthetically designed RNAs demonstrated that the distinctive secondary structure, not the primary RNA sequence, is the major determinant of HDAg RNA binding specificity. Atomic force microscopy analysis of RNPs formed in vitro revealed complexes in which the HDV RNA is substantially condensed by bending or wrapping. Our results support a model in which the internal loops and bulges in HDV RNA contribute flexibility to the quasi-double-stranded structure that allows RNA bending and condensing by HDAg. IMPORTANCE RNA-protein complexes (RNPs) formed by the hepatitis delta virus RNAs and protein, HDAg, perform critical roles in virus replication. Neither the structures of these RNPs nor the RNA features required to form them have been characterized. HDV RNA is unusual in that it forms an unbranched quasi-double-stranded structure in which short base-paired segments are interspersed with internal loops and bulges. We analyzed the role of the HDV RNA sequence and secondary structure in the formation of a minimal RNP and visualized the structure of this RNP using atomic force microscopy. Our results indicate that HDAg does not recognize the primary sequence of the RNA; rather, the principle contribution of unpaired bases in HDV RNA to HDAg binding is to allow flexibility in the unbranched quasi-double-stranded RNA structure. Visualization of RNPs by atomic force microscopy indicated that the RNA is significantly bent or condensed in the complex. PMID:24741096

Distortions induced in double-stranded oligonucleotides by the binding of cis- or trans-diammine-dichloroplatinum(II) to the d(GTG) sequence.

PubMed Central

Anin, M F; Leng, M

1990-01-01

Conformational changes induced in double-stranded oligonucleotides by the binding of trans- or cis-diamminedichloro platinum(II) to the d(GTG) sequence have been characterized by means of melting temperatures, electrophoretic migrations in non-denaturing polyacrylamide gels, reactivities with the artificial nuclease Phenanthroline-copper and with chemical probes. The cis-platinum adduct behaves more as a centre of directed bend than as a hinge joint, the induced bend angle being of the order of 25-30 degrees. The double helix is locally denatured over 2 base pairs (corresponding to the platinated 5'G residue and the central T residue) and is distorted over 4-5 base pairs. The trans-platinum adduct behaves also more as a centre of directed bend than as a hinge joint, the induced bend angle being of the order of 60 degrees. The double helix is locally denatured over 4 base pairs (corresponding to the immediately 5'T residue adjacent to the adduct and to the three base residues of the adduct). Both the cis- and trans-platinum adducts decrease the thermal stability of the double helix. Images PMID:2388824

Simultaneous effects of temperature and pressure on the donor binding energy in a V-groove quantum wire

NASA Astrophysics Data System (ADS)

Khordad, R.

2010-03-01

The influence of temperature and pressure, simultaneously, on the binding energy of a hydrogenic donor impurity in a ridge GaAs/Ga 1- xAl xAs quantum wire is studied using a variational procedure within the effective mass approximation. The subband energy and the binding energy of the donor impurity in its ground state as a function of the wire bend width and impurity location at different temperatures and pressures are calculated. The results show that, when the temperature increases, the donor binding energy decreases for a constant applied pressure for all wire bend widths. Also, the binding energy increases by increasing the pressure for a constant temperature for all wire bend widths. In addition, when the temperature and pressure are applied simultaneously the binding energy decreases as the quantum wire bend width increases. On the whole, it is deduced that the temperature and pressure have important effects on the donor binding energy in a V-groove quantum wire.

Modeling the interactions of the nucleotide excision repair UvrA(2) dimer with DNA.

PubMed

Gantchev, Tsvetan G; Hunting, Darel J

2010-12-28

The UvrA protein initiates the DNA damage recognition process by the bacterial nucleotide excision repair (NER) system. Recently, crystallographic structures of holo-UvrA(2) dimers from two different microorganisms have been released (Protein Data Bank entries 2r6f , 2vf7 , and 2vf8 ). However, the details of the DNA binding by UvrA(2) and other peculiarities involved in the damage recognition process remain unknown. We have undertaken a molecular modeling approach to appraise the possible modes of DNA-UvrA(2) interaction using molecular docking and short-scale guided molecular dynamics [continuum field, constrained, and/or unrestricted simulated annealing (SA)], taking into account the three-dimensional location of a series of mutation-identified UvrA residues implicated in DNA binding. The molecular docking was based on the assumptions that the UvrA(2) dimer is preformed prior to DNA binding and that no major protein conformational rearrangements, except moderate domain reorientations, are required for binding of undamaged DNA. As a first approximation, DNA was treated as a rigid ligand. From the electrostatic relief of the ventral surface of UvrA(2), we initially identified three, noncollinear DNA binding paths. Each of the three resulting nucleoprotein complexes (C1, C2, and C3) was analyzed separately, including calculation of binding energies, the number and type of interaction residues (including mutated ones), and the predominant mode of translational and rotational motion of specific protein domains after SA to ensure improved DNA binding. The UvrA(2) dimer can accommodate DNA in all three orientations, albeit with different binding strengths. One of the UvrA(2)-DNA complexes (C1) fulfilled most of the requirements (high interaction energy, proximity of DNA to mutated residues, etc.) expected for a natural, high-affinity DNA binding site. This nucleoprotein presents a structural organization that is designed to clamp and bend double-stranded DNA. We examined the binding site in more detail by docking DNAs of significantly different (AT- vs CG-enriched) sequences and by submitting the complexes to DNA-unrestricted SA. It was found that in a manner independent of the DNA sequence and applied MD protocols, UvrA(2) favors binding of a bent and unwound undamaged DNA, with a kink positioned in the proximity of the Zn3 hairpins, anticollinearly aligned at the bottom of the ventral protein surface. It is further hypothesized that the Zn3 modules play an essential role in the damage recognition process and that the apparent existence of a family of DNA binding sites might be biologically relevant. Our data should prove to be useful in rational (structure-based) mutation studies.

Which model based on fluorescence quenching is suitable to study the interaction between trans-resveratrol and BSA?

NASA Astrophysics Data System (ADS)

Wei, Xin Lin; Xiao, Jian Bo; Wang, Yuanfeng; Bai, Yalong

2010-01-01

There are several models by means of quenching fluorescence of BSA to determine the binding parameters. The binding parameters obtained from different models are quite different from each other. Which model is suitable to study the interaction between trans-resveratrol and BSA? Herein, twelve models based fluorescence quenching of BSA were compared. The number of binding sites increasing with increased binding constant for similar compounds binding to BSA maybe one approach to resolve this question. For example, here eleven flavonoids were tested to illustrate that the double logarithm regression curve is suitable to study binding polyphenols to BSA.

Probing the ATP-induced conformational flexibility of the PcrA helicase protein using molecular dynamics simulation.

PubMed

Mhashal, Anil R; Choudhury, Chandan Kumar; Roy, Sudip

2016-03-01

Helicases are enzymes that unwind double-stranded DNA (dsDNA) into its single-stranded components. It is important to understand the binding and unbinding of ATP from the active sites of helicases, as this knowledge can be used to elucidate the functionality of helicases during the unwinding of dsDNA. In this work, we investigated the unbinding of ATP and its effect on the active-site residues of the helicase PcrA using molecular dynamic simulations. To mimic the unbinding process of ATP from the active site of the helicase, we simulated the application of an external force that pulls ATP from the active site and computed the free-energy change during this process. We estimated an energy cost of ~85 kJ/mol for the transformation of the helicase from the ATP-bound state (1QHH) to the ATP-free state (1PJR). Unbinding led to conformational changes in the residues of the protein at the active site. Some of the residues at the ATP-binding site were significantly reoriented when the ATP was pulled. We observed a clear competition between reorientation of the residues and energy stabilization by hydrogen bonds between the ATP and active-site residues. We also checked the flexibility of the PcrA protein using a principal component analysis of domain motion. We found that the ATP-free state of the helicase is more flexible than the ATP-bound state.

Molecular dynamics simulations studies and free energy analysis on inhibitors of MDM2-p53 interaction.

PubMed

Niu, Rui-Juan; Zheng, Qing-Chuan; Zhang, Ji-Long; Zhang, Hong-Xing

2013-11-01

The oncoprotein MDM2 (murine double minute 2) negatively regulates the activity and stability of tumor suppressor p53. Inactivation of the MDM2-p53 interaction by potent inhibitors offers new possibilities for anticancer therapy. Molecular dynamics (MD) simulations were performed on three inhibitors-MDM2 complexes to investigate the stability and structural transitions. Simulations show that the backbone of MDM2 maintains stable during the whole time. However, slightly structural changes of inhibitors and MDM2 are observed. Furthermore, the molecular mechanics generalized Born surface area (MM-GBSA) approach was introduced to analyze the interactions between inhibitors and MDM2. The results show that binding of inhibitor pDIQ to MDM2 is significantly stronger than that of pMI and pDI to MDM2. The side chains of residues have more contribution than backbone of residues in energy decomposition. The structure-affinity analyses show that L54, I61, M62, Y67, Q72, H73 and V93 produce important interaction energy with inhibitors. The residue W/Y22' is also very important to the interaction between the inhibitors and MDM2. The three-dimensional structures at different times indicate that the mobility of Y100 influences on the binding of inhibitors to MDM2, and its change has important role in conformations of inhibitors and MDM2. Copyright © 2013 Elsevier Inc. All rights reserved.

The ATPase domain of the large terminase protein, gp17, from bacteriophage T4 binds DNA: implications to the DNA packaging mechanism.

PubMed

Alam, Tanfis I; Rao, Venigalla B

2008-03-07

Translocation of double-stranded DNA into a preformed capsid by tailed bacteriophages is driven by powerful motors assembled at the special portal vertex. The motor is thought to drive processive cycles of DNA binding, movement, and release to package the viral genome. In phage T4, there is evidence that the large terminase protein, gene product 17 (gp17), assembles into a multisubunit motor and translocates DNA by an inchworm mechanism. gp17 consists of two domains; an N-terminal ATPase domain (amino acids 1-360) that powers translocation of DNA, and a C-terminal nuclease domain (amino acids 361-610) that cuts concatemeric DNA to generate a headful-size viral genome. While the functional motifs of ATPase and nuclease have been well defined and the ATPase atomic structure has been solved, the DNA binding motif(s) responsible for viral DNA recognition, cutting, and translocation are unknown. Here we report the first evidence for the presence of a double-stranded DNA binding activity in the gp17 ATPase domain. Binding to DNA is sensitive to Mg(2+) and salt, but not the type of DNA used. DNA fragments as short as 20 bp can bind to the ATPase but preferential binding was observed to DNA greater than 1 kb. A high molecular weight ATPase-DNA complex was isolated by gel filtration, suggesting oligomerization of ATPase following DNA interaction. DNA binding was not observed with the full-length gp17, or the C-terminal nuclease domain. The small terminase protein, gp16, inhibited DNA binding, which was further accentuated by ATP. The presence of a DNA binding site in the ATPase domain and its binding properties implicate a role in the DNA packaging mechanism.

Advertising Phuket's nightlife on the Internet: a case study of double binds and hegemonic masculinity in sex tourism.

PubMed

Hobbs, Jeffrey Dale; Pattalung, Piengpen Na; Chandler, Robert C

2011-01-01

One significant human rights violation in Southeast Asia is the exploitation of women through sex tourism. Such sexual exploitation occurs in Thailand because institutions are complacent and society accepts the practice. This case study, guided by the concepts of double binds and hegemonic masculinity, sought to understand if Thai culture is symbolically constructed in ways to portray Thailand as a desirable "sex tourist" destination. Websites portray Phuket as a patriarchal world where men can live their fantasies of being perfect hegemonic males because Thai bar girls are young nymphomaniacs that have no need to be talked to or understood.

Binding mode and thermodynamic studies on the interaction of the anticancer drug dacarbazine and dacarbazine-Cu(II) complex with single and double stranded DNA.

PubMed

Temerk, Yassien; Ibrahim, Hossieny

2014-07-01

The binding mode and thermodynamic characteristics of the anticancer drug dacarbazine (Dac) with double and single stranded DNA were investigated in the absence and presence of Cu(II) using cyclic voltammetry, square wave voltammetry and fluorescence spectroscopy. The interaction of Dac and Dac-Cu(II) complex with dsDNA indicated their intercalation into the base stacking domain of dsDNA double helix and the strength of interaction is independent on the ionic strength. The interaction of Dac with dsDNA in the presence of Cu(II) leads to a much stronger intercalation. The interaction mode of Dac molecules with ssDNA is electrostatic attraction via negative phosphate on the exterior of the ssDNA with Dac. The binding constants, stoichiometric coefficients and thermodynamic parameters of Dac and Dac-Cu(II) complex with dsDNA and ssDNA were evaluated. Comparison of the mode interaction of Dac with dsDNA and ssDNA was discussed. The decrease of peak current of Dac was proportional to DNA concentration, which was applied for determination of dsDNA and ssDNA concentration. Copyright © 2014 Elsevier B.V. All rights reserved.

Free energy profiles of cocaine esterase-cocaine binding process by molecular dynamics and potential of mean force simulations.

PubMed

Zhang, Yuxin; Huang, Xiaoqin; Han, Keli; Zheng, Fang; Zhan, Chang-Guo

2016-11-25

The combined molecular dynamics (MD) and potential of mean force (PMF) simulations have been performed to determine the free energy profile of the CocE)-(+)-cocaine binding process in comparison with that of the corresponding CocE-(-)-cocaine binding process. According to the MD simulations, the equilibrium CocE-(+)-cocaine binding mode is similar to the CocE-(-)-cocaine binding mode. However, based on the simulated free energy profiles, a significant free energy barrier (∼5 kcal/mol) exists in the CocE-(+)-cocaine binding process whereas no obvious free energy barrier exists in the CocE-(-)-cocaine binding process, although the free energy barrier of ∼5 kcal/mol is not high enough to really slow down the CocE-(+)-cocaine binding process. In addition, the obtained free energy profiles also demonstrate that (+)-cocaine and (-)-cocaine have very close binding free energies with CocE, with a negligible difference (∼0.2 kcal/mol), which is qualitatively consistent with the nearly same experimental K M values of the CocE enzyme for (+)-cocaine and (-)-cocaine. The consistency between the computational results and available experimental data suggests that the mechanistic insights obtained from this study are reasonable. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Two zinc-binding domains in the transporter AdcA from Streptococcus pyogenes facilitate high-affinity binding and fast transport of zinc.

PubMed

Cao, Kun; Li, Nan; Wang, Hongcui; Cao, Xin; He, Jiaojiao; Zhang, Bing; He, Qing-Yu; Zhang, Gong; Sun, Xuesong

2018-04-20

Zinc is an essential metal in bacteria. One important bacterial zinc transporter is AdcA, and most bacteria possess AdcA homologs that are single-domain small proteins due to better efficiency of protein biogenesis. However, a double-domain AdcA with two zinc-binding sites is significantly overrepresented in Streptococcus species, many of which are major human pathogens. Using molecular simulation and experimental validations of AdcA from Streptococcus pyogenes , we found here that the two AdcA domains sequentially stabilize the structure upon zinc binding, indicating an organization required for both increased zinc affinity and transfer speed. This structural organization appears to endow Streptococcus species with distinct advantages in zinc-depleted environments, which would not be achieved by each single AdcA domain alone. This enhanced zinc transport mechanism sheds light on the significance of the evolution of the AdcA domain fusion, provides new insights into double-domain transporter proteins with two binding sites for the same ion, and indicates a potential target of antimicrobial drugs against pathogenic Streptococcus species. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

The Strength of Hydrogen Bonds between Fluoro-Organics and Alcohols, a Theoretical Study.

PubMed

Rosenberg, Robert E

2018-05-10

Fluorinated organic compounds are ubiquitous in the pharmaceutical and agricultural industries. To better discern the mode of action of these compounds, it is critical to understand the strengths of hydrogen bonds involving fluorine. There are only a few published examples of the strengths of these bonds. This study provides a high level ab initio study of inter- and intramolecular hydrogen bonds between RF and R'OH, where R and R' are aryl, vinyl, alkyl, and cycloalkyl. Intermolecular binding energies average near 5 kcal/mol, while intramolecular binding energies average about 3 kcal/mol. Inclusion of zero-point energies and applying a counterpoise correction lessen the difference. In both series, modest increases in binding energies are seen with increased acidity of R'OH and increased electron donation of R in RF. In the intramolecular compounds, binding energy increases with the rigidity of the F-(C) n -OH ring. Inclusion of free energy corrections at 298 K results in exoergic binding energies for the intramolecular compounds and endoergic binding energies for the intermolecular compounds. Parameters such as bond lengths, vibrational frequencies, and atomic populations are consistent with formation of a hydrogen bond and with slightly stronger binding in the intermolecular cases over the intramolecular cases. However, these parameters correlated poorly with binding energies.

The improved electrochemical performance of cross-linked 3D graphene nanoribbon monolith electrodes

NASA Astrophysics Data System (ADS)

Vineesh, Thazhe Veettil; Alwarappan, Subbiah; Narayanan, Tharangattu N.

2015-04-01

Technical advancement in the field of ultra-small sensors and devices demands the development of novel micro- or nano-based architectures. Here we report the design and assembly of cross-linked three dimensional graphene nanoribbons (3D GNRs) using solution based covalent binding of individual 2D GNRs and demonstrate its electrochemical application as a 3D electrode. The enhanced performance of 3D GNRs over individual 2D GNRs is established using standard redox probes - [Ru(NH3)6]3+/2+, [Fe(CN)6]3-/4- and important bio-analytes - dopamine and ascorbic acid. 3D GNRs are found to have high double layer capacitance (2482 μF cm-2) and faster electron transfer kinetics; their exceptional electrocatalytic activity towards the oxygen reduction reaction is indicative of their potential over a wide range of electrochemical applications. Moreover, this study opens a new platform for the design of novel point-of-care devices and electrodes for energy devices.Technical advancement in the field of ultra-small sensors and devices demands the development of novel micro- or nano-based architectures. Here we report the design and assembly of cross-linked three dimensional graphene nanoribbons (3D GNRs) using solution based covalent binding of individual 2D GNRs and demonstrate its electrochemical application as a 3D electrode. The enhanced performance of 3D GNRs over individual 2D GNRs is established using standard redox probes - [Ru(NH3)6]3+/2+, [Fe(CN)6]3-/4- and important bio-analytes - dopamine and ascorbic acid. 3D GNRs are found to have high double layer capacitance (2482 μF cm-2) and faster electron transfer kinetics; their exceptional electrocatalytic activity towards the oxygen reduction reaction is indicative of their potential over a wide range of electrochemical applications. Moreover, this study opens a new platform for the design of novel point-of-care devices and electrodes for energy devices. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr07315k

The adsorption-desorption transition of double-stranded DNA interacting with an oppositely charged dendrimer induced by multivalent anions.

PubMed

Jiang, Yangwei; Zhang, Dong; Zhang, Yaoyang; Deng, Zhenyu; Zhang, Linxi

2014-05-28

The adsorption-desorption transition of DNA in DNA-dendrimer solutions is observed when high-valence anions, such as hexavalent anions, are added to the DNA-dendrimer solutions. In the DNA-dendrimer solutions with low-valence anions, dendrimers bind tightly with the V-shaped double-stranded DNA. When high-valence anions, such as pentavalent or hexavalent anions, are added to the DNA-dendrimer solutions, the double-stranded DNA chains can be stretched straightly and the dendrimers are released from the double-stranded DNA chains. In fact, adding high-valence anions to the solutions can change the charge spatial distribution in the DNA-dendrimer solutions, and weaken the electrostatic interactions between the positively charged dendrimers and the oppositely charged DNA chains. Adsorption-desorption transition of DNA is induced by the overcharging of dendrimers. This investigation is capable of helping us understand how to control effectively the release of DNA in gene/drug delivery because an effective gene delivery for dendrimers includes non-covalent DNA-dendrimer binding and the effective release of DNA in gene therapy.

Double-stranded telomeric DNA binding proteins: Diversity matters.

PubMed

Červenák, Filip; Juríková, Katarína; Sepšiová, Regina; Neboháčová, Martina; Nosek, Jozef; Tomáška, L'ubomír

2017-01-01

Telomeric sequences constitute only a small fraction of the whole genome yet they are crucial for ensuring genomic stability. This function is in large part mediated by protein complexes recruited to telomeric sequences by specific telomere-binding proteins (TBPs). Although the principal tasks of nuclear telomeres are the same in all eukaryotes, TBPs in various taxa exhibit a surprising diversity indicating their distinct evolutionary origin. This diversity is especially pronounced in ascomycetous yeasts where they must have co-evolved with rapidly diversifying sequences of telomeric repeats. In this article we (i) provide a historical overview of the discoveries leading to the current list of TBPs binding to double-stranded (ds) regions of telomeres, (ii) describe examples of dsTBPs highlighting their diversity in even closely related species, and (iii) speculate about possible evolutionary trajectories leading to a long list of various dsTBPs fulfilling the same general role(s) in their own unique ways.

Influence of polarization and self-polarization charges on impurity binding energy in spherical quantum dot with parabolic confinement

NASA Astrophysics Data System (ADS)

Sarkar, Supratik; Sarkar, Samrat; Bose, Chayanika

2018-07-01

We present a general formulation of the ground state binding energy of a shallow hydrogenic impurity in spherical quantum dot with parabolic confinement, considering the effects of polarization and self energy. The variational approach within the effective mass approximation is employed here. The binding energy of an on-center impurity is computed for a GaAs/AlxGa1-xAs quantum dot as a function of the dot size with the dot barrier as parameter. The influence of polarization and self energy are also treated separately. Results indicate that the binding energy increases due to the presence of polarization charge, while decreases due to the self energy of the carrier. An overall enhancement in impurity binding energy, especially for small dots is noted.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miliordos, Evangelos; Aprà, Edoardo; Xantheas, Sotiris S.

We establish a new estimate for the binding energy between two benzene molecules in the parallel-displaced (PD) conformation by systematically converging (i) the intra- and intermolecular geometry at the minimum, (ii) the expansion of the orbital basis set, and (iii) the level of electron correlation. The calculations were performed at the second-order Møller–Plesset perturbation (MP2) and the coupled cluster including singles, doubles, and a perturbative estimate of triples replacement [CCSD(T)] levels of electronic structure theory. At both levels of theory, by including results corrected for basis set superposition error (BSSE), we have estimated the complete basis set (CBS) limit bymore » employing the family of Dunning’s correlation-consistent polarized valence basis sets. The largest MP2 calculation was performed with the cc-pV6Z basis set (2772 basis functions), whereas the largest CCSD(T) calculation was with the cc-pV5Z basis set (1752 basis functions). The cluster geometries were optimized with basis sets up to quadruple-ζ quality, observing that both its intra- and intermolecular parts have practically converged with the triple-ζ quality sets. The use of converged geometries was found to play an important role for obtaining accurate estimates for the CBS limits. Our results demonstrate that the binding energies with the families of the plain (cc-pVnZ) and augmented (aug-cc-pVnZ) sets converge [within <0.01 kcal/mol for MP2 and <0.15 kcal/mol for CCSD(T)] to the same CBS limit. In addition, the average of the uncorrected and BSSE-corrected binding energies was found to converge to the same CBS limit much faster than either of the two constituents (uncorrected or BSSE-corrected binding energies). Due to the fact that the family of augmented basis sets (especially for the larger sets) causes serious linear dependency problems, the plain basis sets (for which no linear dependencies were found) are deemed as a more efficient and straightforward path for obtaining an accurate CBS limit. We considered extrapolations of the uncorrected (ΔE) and BSSE-corrected (ΔE cp) binding energies, their average value (ΔE ave), as well as the average of the latter over the plain and augmented sets (Δ~E ave) with the cardinal number of the basis set n. Our best estimate of the CCSD(T)/CBS limit for the π–π binding energy in the PD benzene dimer is D e = -2.65 ± 0.02 kcal/mol. The best CCSD(T)/cc-pV5Z calculated value is -2.62 kcal/mol, just 0.03 kcal/mol away from the CBS limit. For comparison, the MP2/CBS limit estimate is -5.00 ± 0.01 kcal/mol, demonstrating a 90% overbinding with respect to CCSD(T). Finally, the spin-component-scaled (SCS) MP2 variant was found to closely reproduce the CCSD(T) results for each basis set, while scaled opposite spin (SOS) MP2 yielded results that are too low when compared to CCSD(T).« less

Chemical probes of the conformation of DNA modified by cis-diamminedichloroplatinum(II)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marrot, L.; Leng, M.

The purpose of this work was to analyze at the nucleotide level the distortions induced by the binding of cis-diamminedichloroplatinum(II) (cis-DDP) to DNA by means of chemical probes. In order to test the chemical probes, experiments were first carried out on two platinated oligonucleotides. It has been verified by circular dichroism and gel electrophoresis that the binding of cis-DDP to an AG or to a GTG site within a double-stranded oligonucleotide distorts the double helix. The reactivity of the oligonucleotide platinated at the GTG site with chloroacetaldehyde, diethyl pyrocarbonate, and osmium tetraoxide, respectively, suggests a local denaturation of the doublemore » helix. The 5'G residue and the T residue within the adduct are no longer paired, while the 3'G residue is paired. The double helix is more distorted (but not denatured) at the 5' side of the adduct than at the 3' side. The reactivities of the chemical probes with six platinated DNA restriction fragments show that even at a relatively high level of platination only a few base pairs are unpaired but the double helix is largely distorted. No local denaturation has been detected at the GG sites separated from the nearest GG or AG sites by at least three base pairs. The AG sites separated from the nearest AG or GG sites by at least three base pairs do not denature the double helix locally when they are in the sequences puAG/pyTC. It is suggested that the distortion within these sequences is induced by adducts located further away along the DNA fragments, these sequences not being the major sites for the binding of cis-DDP.« less

Quorum sensing inhibitory potential and in silico molecular docking of flavonoids and novel terpenoids from Senegalia nigrescens.

PubMed

Bodede, Olusola; Shaik, Shakira; Chenia, Hafizah; Singh, Parvesh; Moodley, Roshila

2018-04-24

Senegalia nigrescens is used in traditional medicine for the treatment of dysentery and convulsions. This study was aimed at identifying bioactive compounds from S. nigrescens and carrying out in vitro and in silico anti-quorum sensing studies on the compounds. Extracts of S. nigrescens were chromatographed repeatedly. The isolated compounds were characterised using NMR spectroscopy and mass spectrometry. The anti-quorum sensing potential of S. nigrescens crude extracts and selected phytochemicals was quantified using Chromobacterium violaceum quorum sensing-controlled violacein inhibition assays. Qualitative modulation of quorum sensing activity and signal synthesis was investigated using agar diffusion double ring assays and C. violaceum. Molecular docking was conducted to explore the binding conformations of ent-kaurene diterpenes and flavonoids into the binding sites of quorum sensing regulator proteins, CviR and CviR'. Phytochemical investigation of S. nigrescens resulted in the isolation of a new ent-kaurene diterpenoid (ent-kaur-15-en-18,20-diol) alongside ent-kaur-15-en-18-ol, being isolated for the first time from a plant species. Other compounds isolated included 30-hydroxylup-20(29)-en-3β-ol, 3β-hydroxy-20(29)-en-lupan-30-al, lupeol, stigmasterol, a long chain alcohol (tetracosan-1-ol) and three flavonoids (melanoxetin, quercetin and quercetin-3-O-methyl ether). Structures of isolated compounds were elucidated using different spectroscopic techniques including 1D and 2D NMR. Inhibition of violacein production was concentration-dependent, with 56.52% inhibition being obtained with 200 µg of quercetin-3-O-methyl ether, while 53.38% inhibition was obtained with 600 µg of quercetin. Agar diffusion double ring assays indicated CviI synthase/CviR receptor modulation by S. nigrescens phytochemicals, suggesting that quorum signal synthesis was down-regulated and/or targeting binding of signal to the receptor. The computed binding energy data suggested that the flavonoids had a stronger tendency to inhibit both CviR and CviR' with varying binding affinities. S. nigrescens crude extracts together with the novel ent-kaurenoids and flavonoids demonstrated potential anti-quorum sensing activity. S. nigrescens may thus represent a source of anti-quorum sensing therapeutic candidates for the control of existing and emerging infectious diseases. Copyright © 2018 Elsevier B.V. All rights reserved.

Universal binding energy relations in metallic adhesion

NASA Technical Reports Server (NTRS)

Ferrante, J.; Smith, J. R.; Rose, J. H.

1981-01-01

Scaling relations which map metallic adhesive binding energy onto a single universal binding energy curve are discussed in relation to adhesion, friction, and wear in metals. The scaling involved normalizing the energy to the maximum binding energy and normalizing distances by a suitable combination of Thomas-Fermi screening lengths. The universal curve was found to be accurately represented by E*(A*)= -(1+beta A) exp (-Beta A*) where E* is the normalized binding energy, A* is the normalized separation, and beta is the normalized decay constant. The calculated cohesive energies of potassium, barium, copper, molybdenum, and samarium were also found to scale by similar relations, suggesting that the universal relation may be more general than for the simple free electron metals.

Amino acid polymorphisms in the fibronectin-binding repeats of fibronectin-binding protein A affect bond strength and fibronectin conformation

PubMed Central

Casillas-Ituarte, Nadia N.; Cruz, Carlos H. B.; Lins, Roberto D.; DiBartola, Alex C.; Howard, Jessica; Liang, Xiaowen; Höök, Magnus; Viana, Isabelle F. T.; Sierra-Hernández, M. Roxana; Lower, Steven K.

2017-01-01

The Staphylococcus aureus cell surface contains cell wall-anchored proteins such as fibronectin-binding protein A (FnBPA) that bind to host ligands (e.g. fibronectin; Fn) present in the extracellular matrix of tissue or coatings on cardiac implants. Recent clinical studies have found a correlation between cardiovascular infections caused by S. aureus and nonsynonymous SNPs in FnBPA. Atomic force microscopy (AFM), surface plasmon resonance (SPR), and molecular simulations were used to investigate interactions between Fn and each of eight 20-mer peptide variants containing amino acids Ala, Asn, Gln, His, Ile, and Lys at positions equivalent to 782 and/or 786 in Fn-binding repeat-9 of FnBPA. Experimentally measured bond lifetimes (1/koff) and dissociation constants (Kd = koff/kon), determined by mechanically dissociating the Fn·peptide complex at loading rates relevant to the cardiovascular system, varied from the lowest-affinity H782A/K786A peptide (0.011 s, 747 μm) to the highest-affinity H782Q/K786N peptide (0.192 s, 15.7 μm). These atomic force microscopy results tracked remarkably well to metadynamics simulations in which peptide detachment was defined solely by the free-energy landscape. Simulations and SPR experiments suggested that an Fn conformational change may enhance the stability of the binding complex for peptides with K786I or H782Q/K786I (Kdapp = 0.2–0.5 μm, as determined by SPR) compared with the lowest-affinity double-alanine peptide (Kdapp = 3.8 μm). Together, these findings demonstrate that amino acid substitutions in Fn-binding repeat-9 can significantly affect bond strength and influence the conformation of Fn upon binding. They provide a mechanistic explanation for the observation of nonsynonymous SNPs in fnbA among clinical isolates of S. aureus that cause endovascular infections. PMID:28400484

Tetrel Bonding as a Vehicle for Strong and Selective Anion Binding.

PubMed

Scheiner, Steve

2018-05-11

Tetrel atoms T (T = Si, Ge, Sn, and Pb) can engage in very strong noncovalent interactions with nucleophiles, which are commonly referred to as tetrel bonds. The ability of such bonds to bind various anions is assessed with a goal of designing an optimal receptor. The Sn atom seems to form the strongest bonds within the tetrel family. It is most effective in the context of a -SnF₃ group and a further enhancement is observed when a positive charge is placed on the receptor. Connection of the -SnF₃ group to either an imidazolium or triazolium provides a strong halide receptor, which can be improved if its point of attachment is changed from the C to an N atom of either ring. Aromaticity of the ring offers no advantage nor is a cyclic system superior to a simple alkyl amine of any chain length. Placing a pair of -SnF₃ groups on a single molecule to form a bipodal dicationic receptor with two tetrel bonds enhances the binding, but falls short of a simple doubling. These two tetrel groups can be placed on opposite ends of an alkyl diamine chain of any length although SnF₃⁺NH₂(CH₂) n NH₂SnF₃⁺ with n between 2 and 4 seems to offer the strongest halide binding. Of the various anions tested, OH − binds most strongly: OH − > F − > Cl − > Br − > I − . The binding energy of the larger NO₃ − and HCO₃ − anions is more dependent upon the charge of the receptor. This pattern translates into very strong selectivity of binding one anion over another. The tetrel-bonding receptors bind far more strongly to each anion than an equivalent number of K⁺ counterions, which leads to equilibrium ratios in favor of the former of many orders of magnitude.

Amino acid polymorphisms in the fibronectin-binding repeats of fibronectin-binding protein A affect bond strength and fibronectin conformation.

PubMed

Casillas-Ituarte, Nadia N; Cruz, Carlos H B; Lins, Roberto D; DiBartola, Alex C; Howard, Jessica; Liang, Xiaowen; Höök, Magnus; Viana, Isabelle F T; Sierra-Hernández, M Roxana; Lower, Steven K

2017-05-26

The Staphylococcus aureus cell surface contains cell wall-anchored proteins such as fibronectin-binding protein A (FnBPA) that bind to host ligands ( e.g. fibronectin; Fn) present in the extracellular matrix of tissue or coatings on cardiac implants. Recent clinical studies have found a correlation between cardiovascular infections caused by S. aureus and nonsynonymous SNPs in FnBPA. Atomic force microscopy (AFM), surface plasmon resonance (SPR), and molecular simulations were used to investigate interactions between Fn and each of eight 20-mer peptide variants containing amino acids Ala, Asn, Gln, His, Ile, and Lys at positions equivalent to 782 and/or 786 in Fn-binding repeat-9 of FnBPA. Experimentally measured bond lifetimes (1/ k off ) and dissociation constants ( K d = k off / k on ), determined by mechanically dissociating the Fn·peptide complex at loading rates relevant to the cardiovascular system, varied from the lowest-affinity H782A/K786A peptide (0.011 s, 747 μm) to the highest-affinity H782Q/K786N peptide (0.192 s, 15.7 μm). These atomic force microscopy results tracked remarkably well to metadynamics simulations in which peptide detachment was defined solely by the free-energy landscape. Simulations and SPR experiments suggested that an Fn conformational change may enhance the stability of the binding complex for peptides with K786I or H782Q/K786I ( K d app = 0.2-0.5 μm, as determined by SPR) compared with the lowest-affinity double-alanine peptide ( K d app = 3.8 μm). Together, these findings demonstrate that amino acid substitutions in Fn-binding repeat-9 can significantly affect bond strength and influence the conformation of Fn upon binding. They provide a mechanistic explanation for the observation of nonsynonymous SNPs in fnbA among clinical isolates of S. aureus that cause endovascular infections. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

N- vs. C-Domain Selectivity of Catalytic Inactivation of Human Angiotensin Converting Enzyme by Lisinopril-Coupled Transition Metal Chelates

PubMed Central

Hocharoen, Lalintip; Joyner, Jeff C.; Cowan, J. A.

2014-01-01

The N- and C-terminal domains of human somatic Angiotensin I Converting Enzyme (sACE-1) demonstrate distinct physiological functions, with resulting interest in the development of domain-selective inhibitors for specific therapeutic applications. Herein, the activity of lisinopril-coupled transition metal chelates were tested for both reversible binding and irreversible catalytic inactivation of sACE-1. C/N domain binding selectivity ratios ranged from 1 to 350, while rates of irreversible catalytic inactivation of the N- and C-domains were found to be significantly greater for the N-domain, suggesting a more optimal orientation of the M-chelate-lisinopril complexes within the active site of the N-domain of sACE-1. Finally, the combined effect of binding selectivity and inactivation selectivity was assessed for each catalyst (double-filter selectivity factors), and several catalysts were found to cause domain-selective catalytic inactivation. The results of this study demonstrate the ability to optimize the target selectivity of catalytic metallopeptides through both binding and orientation factors (double-filter effect). PMID:24228790

N- versus C-domain selectivity of catalytic inactivation of human angiotensin converting enzyme by lisinopril-coupled transition metal chelates.

PubMed

Hocharoen, Lalintip; Joyner, Jeff C; Cowan, J A

2013-12-27

The N- and C-terminal domains of human somatic angiotensin I converting enzyme (sACE-1) demonstrate distinct physiological functions, with resulting interest in the development of domain-selective inhibitors for specific therapeutic applications. Herein, the activity of lisinopril-coupled transition metal chelates was tested for both reversible binding and irreversible catalytic inactivation of each domain of sACE-1. C/N domain binding selectivity ratios ranged from 1 to 350, while rates of irreversible catalytic inactivation of the N- and C-domains were found to be significantly greater for the N-domain, suggesting a more optimal orientation of M-chelate-lisinopril complexes within the active site of the N-domain of sACE-1. Finally, the combined effect of binding selectivity and inactivation selectivity was assessed for each catalyst (double-filter selectivity factors), and several catalysts were found to cause domain-selective catalytic inactivation. The results of this study demonstrate the ability to optimize the target selectivity of catalytic metallopeptides through both binding and catalytic factors (double-filter effect).

Tetrameric Ctp1 coordinates DNA binding and DNA bridging in DNA double-strand-break repair

DOE PAGES

Andres, Sara N.; Appel, C. Denise; Westmoreland, James W.; ...

2015-01-12

Ctp1 (also known as CtIP or Sae2) collaborates with Mre11-Rad50-Nbs1 to initiate repair of DNA double-strand breaks (DSBs), but its functions remain enigmatic. In this paper, we report that tetrameric Schizosaccharomyces pombe Ctp1 contains multivalent DNA-binding and DNA-bridging activities. Through structural and biophysical analyses of the Ctp1 tetramer, we define the salient features of Ctp1 architecture: an N-terminal interlocking tetrameric helical dimer-of-dimers (THDD) domain and a central intrinsically disordered region (IDR) linked to C-terminal 'RHR' DNA-interaction motifs. The THDD, IDR and RHR are required for Ctp1 DNA-bridging activity in vitro, and both the THDD and RHR are required for efficientmore » DSB repair in S. pombe. Finally, our results establish non-nucleolytic roles of Ctp1 in binding and coordination of DSB-repair intermediates and suggest that ablation of human CtIP DNA binding by truncating mutations underlie the CtIP-linked Seckel and Jawad syndromes.« less

Biochemical analyses indicate that binding and cleavage specificities define the ordered processing of human Okazaki fragments by Dna2 and FEN1.

PubMed

Gloor, Jason W; Balakrishnan, Lata; Campbell, Judith L; Bambara, Robert A

2012-08-01

In eukaryotic Okazaki fragment processing, the RNA primer is displaced into a single-stranded flap prior to removal. Evidence suggests that some flaps become long before they are cleaved, and that this cleavage involves the sequential action of two nucleases. Strand displacement characteristics of the polymerase show that a short gap precedes the flap during synthesis. Using biochemical techniques, binding and cleavage assays presented here indicate that when the flap is ∼ 30 nt long the nuclease Dna2 can bind with high affinity to the flap and downstream double strand and begin cleavage. When the polymerase idles or dissociates the Dna2 can reorient for additional contacts with the upstream primer region, allowing the nuclease to remain stably bound as the flap is further shortened. The DNA can then equilibrate to a double flap that can bind Dna2 and flap endonuclease (FEN1) simultaneously. When Dna2 shortens the flap even more, FEN1 can displace the Dna2 and cleave at the flap base to make a nick for ligation.

Mechanism of the calcium-regulation of muscle contraction — In pursuit of its structural basis —

PubMed Central

WAKABAYASHI, Takeyuki

2015-01-01

The author reviewed the research that led to establish the structural basis for the mechanism of the calcium-regulation of the contraction of striated muscles. The target of calcium ions is troponin on the thin filaments, of which the main component is the double-stranded helix of actin. A model of thin filament was generated by adding tropomyosin and troponin. During the process to provide the structural evidence for the model, the troponin arm was found to protrude from the calcium-depleted troponin and binds to the carboxyl-terminal region of actin. As a result, the carboxyl-terminal region of tropomyosin shifts and covers the myosin-binding sites of actin to block the binding of myosin. At higher calcium concentrations, the troponin arm changes its partner from actin to the main body of calcium-loaded troponin. Then, tropomyosin shifts back to the position near the grooves of actin double helix, and the myosin-binding sites of actin becomes available to myosin resulting in force generation through actin-myosin interactions. PMID:26194856

Mutations Abrogating VP35 Interaction with Double-Stranded RNA Render Ebola Virus Avirulent in Guinea Pigs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prins, Kathleen C.; Delpeut, Sebastien; Leung, Daisy W.

2010-10-11

Ebola virus (EBOV) protein VP35 is a double-stranded RNA (dsRNA) binding inhibitor of host interferon (IFN)-{alpha}/{beta} responses that also functions as a viral polymerase cofactor. Recent structural studies identified key features, including a central basic patch, required for VP35 dsRNA binding activity. To address the functional significance of these VP35 structural features for EBOV replication and pathogenesis, two point mutations, K319A/R322A, that abrogate VP35 dsRNA binding activity and severely impair its suppression of IFN-{alpha}/{beta} production were identified. Solution nuclear magnetic resonance (NMR) spectroscopy and X-ray crystallography reveal minimal structural perturbations in the K319A/R322A VP35 double mutant and suggest that lossmore » of basic charge leads to altered function. Recombinant EBOVs encoding the mutant VP35 exhibit, relative to wild-type VP35 viruses, minimal growth attenuation in IFN-defective Vero cells but severe impairment in IFN-competent cells. In guinea pigs, the VP35 mutant virus revealed a complete loss of virulence. Strikingly, the VP35 mutant virus effectively immunized animals against subsequent wild-type EBOV challenge. These in vivo studies, using recombinant EBOV viruses, combined with the accompanying biochemical and structural analyses directly correlate VP35 dsRNA binding and IFN inhibition functions with viral pathogenesis. Moreover, these studies provide a framework for the development of antivirals targeting this critical EBOV virulence factor.« less

Binding free energy calculations between bovine β-lactoglobulin and four fatty acids using the MMGBSA method.

PubMed

Bello, Martiniano

2014-10-01

The bovine dairy protein β-lactoglobulin (βlg) is a promiscuous protein that has the ability to bind several hydrophobic ligands. In this study, based on known experimental data, the dynamic interaction mechanism between bovine βlg and four fatty acids was investigated by a protocol combining molecular dynamics (MD) simulations and molecular mechanics generalized Born surface area (MMGBSA) binding free energy calculations. Energetic analyses revealed binding free energy trends that corroborated known experimental findings; larger ligand size corresponded to greater binding affinity. Finally, binding free energy decomposition provided detailed information about the key residues stabilizing the complex. © 2014 Wiley Periodicals, Inc.

A Prediction Method of Binding Free Energy of Protein and Ligand

NASA Astrophysics Data System (ADS)

Yang, Kun; Wang, Xicheng

2010-05-01

Predicting the binding free energy is an important problem in bimolecular simulation. Such prediction would be great benefit in understanding protein functions, and may be useful for computational prediction of ligand binding strengths, e.g., in discovering pharmaceutical drugs. Free energy perturbation (FEP)/thermodynamics integration (TI) is a classical method to explicitly predict free energy. However, this method need plenty of time to collect datum, and that attempts to deal with some simple systems and small changes of molecular structures. Another one for estimating ligand binding affinities is linear interaction energy (LIE) method. This method employs averages of interaction potential energy terms from molecular dynamics simulations or other thermal conformational sampling techniques. Incorporation of systematic deviations from electrostatic linear response, derived from free energy perturbation studies, into the absolute binding free energy expression significantly enhances the accuracy of the approach. However, it also is time-consuming work. In this paper, a new prediction method based on steered molecular dynamics (SMD) with direction optimization is developed to compute binding free energy. Jarzynski's equality is used to derive the PMF or free-energy. The results for two numerical examples are presented, showing that the method has good accuracy and efficiency. The novel method can also simulate whole binding proceeding and give some important structural information about development of new drugs.

Laser Energy Monitor for Double-Pulsed 2-Micrometer IPDA Lidar Application

NASA Technical Reports Server (NTRS)

Refaat, Tamer F.; Petros, Mulugeta; Remus, Ruben; Yu, Jirong; Singh, Upendra N.

2014-01-01

Integrated path differential absorption (IPDA) lidar is a remote sensing technique for monitoring different atmospheric species. The technique relies on wavelength differentiation between strong and weak absorbing features normalized to the transmitted energy. 2-micron double-pulsed IPDA lidar is best suited for atmospheric carbon dioxide measurements. In such case, the transmitter produces two successive laser pulses separated by short interval (200 microseconds), with low repetition rate (10Hz). Conventional laser energy monitors, based on thermal detectors, are suitable for low repetition rate single pulse lasers. Due to the short pulse interval in double-pulsed lasers, thermal energy monitors underestimate the total transmitted energy. This leads to measurement biases and errors in double-pulsed IPDA technique. The design and calibration of a 2-micron double-pulse laser energy monitor is presented. The design is based on a high-speed, extended range InGaAs pin quantum detectors suitable for separating the two pulse events. Pulse integration is applied for converting the detected pulse power into energy. Results are compared to a photo-electro-magnetic (PEM) detector for impulse response verification. Calibration included comparing the three detection technologies in single-pulsed mode, then comparing the pin and PEM detectors in double-pulsed mode. Energy monitor linearity will be addressed.

Quantum chemistry of the minimal CdSe clusters

NASA Astrophysics Data System (ADS)

Yang, Ping; Tretiak, Sergei; Masunov, Artëm E.; Ivanov, Sergei

2008-08-01

Colloidal quantum dots are semiconductor nanocrystals (NCs) which have stimulated a great deal of research and have attracted technical interest in recent years due to their chemical stability and the tunability of photophysical properties. While internal structure of large quantum dots is similar to bulk, their surface structure and passivating role of capping ligands (surfactants) are not fully understood to date. We apply ab initio wavefunction methods, density functional theory, and semiempirical approaches to study the passivation effects of substituted phosphine and amine ligands on the minimal cluster Cd2Se2, which is also used to benchmark different computational methods versus high level ab initio techniques. Full geometry optimization of Cd2Se2 at different theory levels and ligand coverage is used to understand the affinities of various ligands and the impact of ligands on cluster structure. Most possible bonding patterns between ligands and surface Cd/Se atoms are considered, including a ligand coordinated to Se atoms. The degree of passivation of Cd and Se atoms (one or two ligands attached to one atom) is also studied. The results suggest that B3LYP/LANL2DZ level of theory is appropriate for the system modeling, whereas frequently used semiempirical methods (such as AM1 and PM3) produce unphysical results. The use of hydrogen atom for modeling of the cluster passivating ligands is found to yield unphysical results as well. Hence, the surface termination of II-VI semiconductor NCs with hydrogen atoms often used in computational models should probably be avoided. Basis set superposition error, zero-point energy, and thermal corrections, as well as solvent effects simulated with polarized continuum model are found to produce minor variations on the ligand binding energies. The effects of Cd-Se complex structure on both the electronic band gap (highest occupied molecular orbital-lowest unoccupied molecular orbital energy difference) and ligand binding energies are systematically examined. The role played by positive charges on ligand binding is also explored. The calculated binding energies for various ligands L are found to decrease in the order OPMe3>OPH3>NH2Me>=NH3>=NMe3>PMe3>PH3 for neutral clusters and OPMe3>OPH3>PMe3>=NMe3>=NH2Me>=NH3>PH3 and OPMe3>OPH3>NH2Me>=NMe3>=PMe3>=NH3>PH3 for single and double ligations of positively charged Cd2Se22+ cluster, respectively.

Zinc finger protein binding to DNA: an energy perspective using molecular dynamics simulation and free energy calculations on mutants of both zinc finger domains and their specific DNA bases.

PubMed

Hamed, Mazen Y; Arya, Gaurav

2016-05-01

Energy calculations based on MM-GBSA were employed to study various zinc finger protein (ZF) motifs binding to DNA. Mutants of both the DNA bound to their specific amino acids were studied. Calculated energies gave evidence for a relationship between binding energy and affinity of ZF motifs to their sites on DNA. ΔG values were -15.82(12), -3.66(12), and -12.14(11.6) kcal/mol for finger one, finger two, and finger three, respectively. The mutations in the DNA bases reduced the value of the negative energies of binding (maximum value for ΔΔG = 42Kcal/mol for F1 when GCG mutated to GGG, and ΔΔG = 22 kcal/mol for F2, the loss in total energy of binding originated in the loss in electrostatic energies upon mutation (r = .98). The mutations in key amino acids in the ZF motif in positions-1, 2, 3, and 6 showed reduced binding energies to DNA with correlation coefficients between total free energy and electrostatic was .99 and with Van der Waal was .93. Results agree with experimentally found selectivity which showed that Arginine in position-1 is specific to G, while Aspartic acid (D) in position 2 plays a complicated role in binding. There is a correlation between the MD calculated free energies of binding and those obtained experimentally for prepared ZF motifs bound to triplet bases in other reports (), our results may help in the design of ZF motifs based on the established recognition codes based on energies and contributing energies to the total energy.

A study of planar anchor groups for graphene-based single-molecule electronics.

PubMed

Bailey, Steven; Visontai, David; Lambert, Colin J; Bryce, Martin R; Frampton, Harry; Chappell, David

2014-02-07

To identify families of stable planar anchor groups for use in single molecule electronics, we report detailed results for the binding energies of two families of anthracene and pyrene derivatives adsorbed onto graphene. We find that all the selected derivatives functionalized with either electron donating or electron accepting substituents bind more strongly to graphene than the parent non-functionalized anthracene or pyrene. The binding energy is sensitive to the detailed atomic alignment of substituent groups over the graphene substrate leading to larger than expected binding energies for -OH and -CN derivatives. Furthermore, the ordering of the binding energies within the anthracene and pyrene series does not simply follow the electron affinities of the substituents. Energy barriers to rotation or displacement on the graphene surface are much lower than binding energies for adsorption and therefore at room temperature, although the molecules are bound to the graphene, they are almost free to move along the graphene surface. Binding energies can be increased by incorporating electrically inert side chains and are sensitive to the conformation of such chains.

A study of planar anchor groups for graphene-based single-molecule electronics

NASA Astrophysics Data System (ADS)

Bailey, Steven; Visontai, David; Lambert, Colin J.; Bryce, Martin R.; Frampton, Harry; Chappell, David

2014-02-01

To identify families of stable planar anchor groups for use in single molecule electronics, we report detailed results for the binding energies of two families of anthracene and pyrene derivatives adsorbed onto graphene. We find that all the selected derivatives functionalized with either electron donating or electron accepting substituents bind more strongly to graphene than the parent non-functionalized anthracene or pyrene. The binding energy is sensitive to the detailed atomic alignment of substituent groups over the graphene substrate leading to larger than expected binding energies for -OH and -CN derivatives. Furthermore, the ordering of the binding energies within the anthracene and pyrene series does not simply follow the electron affinities of the substituents. Energy barriers to rotation or displacement on the graphene surface are much lower than binding energies for adsorption and therefore at room temperature, although the molecules are bound to the graphene, they are almost free to move along the graphene surface. Binding energies can be increased by incorporating electrically inert side chains and are sensitive to the conformation of such chains.

Isolation of thylakoid membrane complexes from rice by a new double-strips BN/SDS-PAGE and bioinformatics prediction of stromal ridge subunits interaction.

PubMed

Shao, Jinzhen; Zhang, Yubo; Yu, Jianlan; Guo, Lin; Ding, Yi

2011-01-01

Thylakoid membrane complexes of rice (Oryza sativa L.) play crucial roles in growth and crop production. Understanding of protein interactions within the complex would provide new insights into photosynthesis. Here, a new "Double-Strips BN/SDS-PAGE" method was employed to separate thylakoid membrane complexes in order to increase the protein abundance on 2D-gels and to facilitate the identification of hydrophobic transmembrane proteins. A total of 58 protein spots could be observed and subunit constitution of these complexes exhibited on 2D-gels. The generality of this new approach was confirmed using thylakoid membrane from spinach (Spinacia oleracea) and pumpkin (Cucurita spp). Furthermore, the proteins separated from rice thylakoid membrane were identified by the mass spectrometry (MS). The stromal ridge proteins PsaD and PsaE were identified both in the holo- and core- PSI complexes of rice. Using molecular dynamics simulation to explore the recognition mechanism of these subunits, we showed that salt bridge interactions between residues R19 of PsaC and E168 of PasD as well as R75 of PsaC and E91 of PsaD played important roles in the stability of the complex. This stromal ridge subunits interaction was also supported by the subsequent analysis of the binding free energy, the intramolecular distances and the intramolecular energy.

Molecular cloning of MSSP-2, a c-myc gene single-strand binding protein: characterization of binding specificity and DNA replication activity.

PubMed Central

Takai, T; Nishita, Y; Iguchi-Ariga, S M; Ariga, H

1994-01-01

We have previously reported the human cDNA encoding MSSP-1, a sequence-specific double- and single-stranded DNA binding protein [Negishi, Nishita, Saëgusa, Kakizaki, Galli, Kihara, Tamai, Miyajima, Iguchi-Ariga and Ariga (1994) Oncogene, 9, 1133-1143]. MSSP-1 binds to a DNA replication origin/transcriptional enhancer of the human c-myc gene and has turned out to be identical with Scr2, a human protein which complements the defect of cdc2 kinase in S.pombe [Kataoka and Nojima (1994) Nucleic Acid Res., 22, 2687-2693]. We have cloned the cDNA for MSSP-2, another member of the MSSP family of proteins. The MSSP-2 cDNA shares highly homologous sequences with MSSP-1 cDNA, except for the insertion of 48 bp coding 16 amino acids near the C-terminus. Like MSSP-1, MSSP-2 has RNP-1 consensus sequences. The results of the experiments using bacterially expressed MSSP-2, and its deletion mutants, as histidine fusion proteins suggested that the binding specificity of MSSP-2 to double- and single-stranded DNA is the same as that of MSSP-1, and that the RNP consensus sequences are required for the DNA binding of the protein. MSSP-2 stimulated the DNA replication of an SV40-derived plasmid containing the binding sequence for MSSP-1 or -2. MSSP-2 is hence suggested to play an important role in regulation of DNA replication. Images PMID:7838710

Tautomerism of monochalcogenosilanoic acids CH3Si(＝O)XH (X D S, Se, Te) in the gas phase and in the polar and aprotic solution: An ab initio computational investigation

NASA Astrophysics Data System (ADS)

Li, Qiang-Gen; Deng, Chao; Ren, Yi; Wong, Ning-Bew; Chu, San-Yan; Wang, Xin

Computational investigations by an ab initio molecular orbital method (HF and MP2) with the 6-311+G(d,p) and 6-311++G(2df, 2pd) basis sets on the tautomerism of three monochalcogenosilanoic acids CH3Si(＝O)XH (X D S, Se, and Te) in the gas phase and a polar and aprotic solution tetrahydrofuran (THF) was undertaken. Calculated results show that the silanol forms CH3Si(＝X)OH are much more stable than the silanone forms CH3Si(＝O)XH in the gas-phase, which is different from the monochalcogenocarboxylic acids, where the keto forms CH3C(＝O)XH are dominant. This situation may be attributed to the fact that the Si＝O and O＝H single bonds in the silanol forms are stronger than the Si＝X and X＝H single bonds in the silanone forms, respectively, even though the Si＝X (X D S, Se, and Te) double bonds are much weaker than the Si＝O double bondE These results indicate that the stability of the monochalcogenosilanoic acid tautomers is not determined by the double bond energies, contrary to the earlier explanation based on the incorrect assumption that the Si＝S double bond is stronger than the S＝O double bond for the tautomeric equilibrium of RSi(＝O)SH (R＝H, F, Cl, CH3, OH, NH2) to shift towards the thione forms [RSi(＝S)OH]. The binding with CH3OCH3 enhances the preference of the silanol form in the tautomeric equilibrium, and meanwhile significantly lowers the tautomeric barriers by more than 34 kJ/mol in THF solution.0

End-specific strategies of attachment of long double stranded DNA onto gold-coated nanofiber arrays

NASA Astrophysics Data System (ADS)

Peckys, Diana B.; de Jonge, Niels; Simpson, Michael L.; McKnight, Timothy E.

2008-10-01

We report the effective and site-specific binding of long double stranded (ds)DNA to high aspect ratio carbon nanofiber arrays. The carbon nanofibers were first coated with a thin gold layer to provide anchorage for two controllable binding methods. One method was based on the direct binding of thiol end-labeled dsDNA. The second and enhanced method used amine end-labeled dsDNA bound with crosslinkers to a carboxyl-terminated self-assembled monolayer. The bound dsDNA was first visualized with a fluorescent, dsDNA-intercalating dye. The specific binding onto the carbon nanofiber was verified by a high resolution detection method using scanning electron microscopy in combination with the binding of neutravidin-coated fluorescent microspheres to the immobilized and biotinylated dsDNA. Functional activity of thiol end-labeled dsDNA on gold-coated nanofiber arrays was verified with a transcriptional assay, whereby Chinese hamster lung cells (V79) were impaled upon the DNA-modified nanofibers and scored for transgene expression of the tethered template. Thiol end-labeled dsDNA demonstrated significantly higher expression levels than nanofibers prepared with control dsDNA that lacked a gold-binding end-label. Employing these site-specific and robust techniques of immobilization of dsDNA onto nanodevices can be of advantage for the study of DNA/protein interactions and for gene delivery applications.

Optimization of the Alkyl Linker of TO Base Surrogate in Triplex-Forming PNA for Enhanced Binding to Double-Stranded RNA.

PubMed

Sato, Takaya; Sato, Yusuke; Nishizawa, Seiichi

2017-03-23

A series of triplex-forming peptide nucleic acid (TFP) probes carrying a thiazole orange (TO) base surrogate through an alkyl linker was synthesized, and the interactions between these so-called tFIT probes and purine-rich sequences within double-stranded RNA (dsRNA) were examined. We found that the TO base surrogate linker significantly affected both the binding affinity and the fluorescence response upon triplex formation with the target dsRNA. Among the probes examined, the TO base surrogate connected through the propyl linker in the tFIT probes increased the binding affinity by a factor of ten while maintaining its function as the fluorescent universal base. Isothermal titration calorimetry experiments revealed that the increased binding affinity resulted from the gain in the binding enthalpy, which could be explained by the enhanced π-stacking interaction between the TO base surrogate and the dsRNA part of the triplex. We expect that these results will provide a molecular basis for designing strong binding tFIT probes for fluorescence sensing of various kinds of purine-rich dsRNAs sequences including those carrying a pyrimidine-purine inversion. The obtained data also offers a new insight into further development of the universal bases incorporated in TFP. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Supramolecular approach to enantioselective DNA recognition using enantiomerically resolved cationic 4-amino-1,8-naphthalimide-based Tröger's bases.

PubMed

Banerjee, Swagata; Bright, Sandra A; Smith, Jayden A; Burgeat, Jeremy; Martinez-Calvo, Miguel; Williams, D Clive; Kelly, John M; Gunnlaugsson, Thorfinnur

2014-10-03

The synthesis and photophysical studies of two cationic Tröger's base (TB)-derived bis-naphthalimides 1 and 2 and the TB derivative 6, characterized by X-ray crystallography, are presented. The enantiomers of 1 and 2 are separated by cation-exchange chromatography on Sephadex C25 using sodium (-)-dibenzoyl-l-tartarate as the chiral mobile phase. The binding of enantiomers with salmon testes (st)-DNA and synthetic polynucleotides are studied by a variety of spectroscopic methods including UV/vis absorbance, circular dichroism, linear dichroism, and ethidium bromide displacement assays, which demonstrated binding of these compounds to the DNA grooves with very high affinity (K ∼ 10(6) M(-1)) and preferential binding of (-)-enantiomer. In all cases, binding to DNA resulted in a significant stabilization of the double-helical structure of DNA against thermal denaturation. Compound (±)-2 and its enantiomers possessed significantly higher binding affinity for double-stranded DNA compared to 1, possibly due to the presence of the methyl group, which allows favorable hydrophobic and van der Waals interactions with DNA. The TB derivatives exhibited marked preference for AT rich sequences, where the binding affinities follow the order (-)-enantiomer > (±) > (+)-enantiomer. The compounds exhibited significant photocleavage of plasmid DNA upon visible light irradiation and are rapidly internalized into malignant cell lines.

Visualizing double-stranded RNA distribution and dynamics in living cells by dsRNA binding-dependent fluorescence complementation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheng, Xiaofei; College of Life and Environmental Sciences, Hangzhou Normal University, Hangzhou, Zhejiang 310036; Deng, Ping

Double-stranded RNA (dsRNA) is an important type of RNA that plays essential roles in diverse cellular processes in eukaryotic organisms and a hallmark in infections by positive-sense RNA viruses. Currently, no in vivo technology has been developed for visualizing dsRNA in living cells. Here, we report a dsRNA binding-dependent fluorescence complementation (dRBFC) assay that can be used to efficiently monitor dsRNA distribution and dynamics in vivo. The system consists of two dsRNA-binding proteins, which are fused to the N- and C-terminal halves of the yellow fluorescent protein (YFP). Binding of the two fusion proteins to a common dsRNA brings themore » split YFP halves in close proximity, leading to the reconstitution of the fluorescence-competent structure and restoration of fluorescence. Using this technique, we were able to visualize the distribution and trafficking of the replicative RNA intermediates of positive-sense RNA viruses in living cells. - Highlights: • A live-cell imaging system was developed for visualizing dsRNA in vivo. • It uses dsRNA binding proteins fused with two halves of a fluorescent protein. • Binding to a common dsRNA enables the reporter to become fluorescent. • The system can efficiently monitor viral RNA replication in living cells.« less

Dust coagulation. [in interstellar medium observed in stellar envelopes and planetary disks

NASA Technical Reports Server (NTRS)

Chokshi, Arati; Tielens, A. G. G. M.; Hollenbach, D.

1993-01-01

The microphysics of coagulation between two, colliding, smooth, spherical grains in the elastic limit is investigated, and the criteria for sticking as a function of particle sizes, collision velocities, elastic properties, and binding energy are calculated. Critical relative velocities for coagulation were evaluated as a function of grain sizes for solicate, icy, and carbonaceous grains. It is concluded that efficient coagulation requires coverage of grain cores by an icy grain mantle. In this case, coagulation leads to only a doubling of the mass of a large grain within a dense core lifetime. It is concluded that coagulation can have a dramatic effect on the visible and, particularly, the UV portion of the extinction curve in dense clouds and on their IR spectrum.

Cyclometalated gold(III) trioxadiborrin complexes: studies of the bonding and excited states.

PubMed

Ayoub, Nicholas A; Browne, Amberle R; Anderson, Bryce L; Gray, Thomas G

2016-03-07

Trioxadiborrins are chelating ligands that assemble in dehydration reactions of boronic acids. They are structurally related to β-diketonate ligands, but have a 2-charge. Little is known of the bonding properties of trioxadiborrin ligands. Presented here are density-functional theory (DFT) studies of cyclometalated gold(III) trioxadiborrins. Substituent effects are evaluated, and comparison is made to the cyclometalating 2-(4-tolyl)pyridine (tpy) ligand on gold. The tpy ligand binds more strongly than any trioxadiborrin ligand considered here, and the two ligands bind competitively to gold. The 1,3-diphenyl trioxadiborrin ligand of 1 has a larger absolute binding enthalpy to gold than its β-diketonate analogue. Conjugation between boron and aryl substituents delocalizes charge and attenuates the trioxadiborrin's binding capacity. Steric effects that disrupt conjugation between boron and aryl substituents cause the trioxadiborrin to chelate more tightly. Fragment bond orders are divided into in-plane and out-of-plane contributions for square planar 1. In-plane bonding accounts for 88% of bond order between (tpy)Au2+ and the trioxadiborrin ligand. Cyclometalated gold(III) trioxadiborrin complexes were previously shown to be phosphorescent. Spin-unrestricted triplet-state geometry optimizations find that the ten largest excited-state distortions all occur on the tpy ligand. A plot of spin density in triplet 1 shows spin to reside predominantly on tpy. The 77 K luminescence spectrum of 1 is reported here. Time-dependent DFT and configuration interaction singles calculations (corrected for doubles excitations) overestimate the emission energy by ∼ 0.12 eV.

Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

PubMed Central

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-01-01

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

Theoretical studies of the electronic spectrum of tellurium monosulfide.

PubMed

Chattopadhyaya, Surya; Nath, Abhijit; Das, Kalyan Kumar

2013-08-01

Ab initio based multireference singles and doubles configuration interaction (MRDCI) study including spin-orbit coupling is carried out to explore the electronic structure and spectroscopic properties of tellurium monosulfide (TeS) molecule by employing relativistic effective core potentials (RECP) and suitable Gaussian basis sets of the constituent atoms. Potential energy curves correlating with the lowest and second dissociation limit are constructed and spectroscopic constants (T(e), r(e), and ω(e)) of several low-lying bound Λ-S electronic states up to 3.68 eV of energy are computed. The binding energies and electric dipole moments (μ(e)) of the ground and the low-lying excited Λ-S states are also computed. The effects of the spin-orbit coupling on the electronic spectrum of the species are studied in details and compared with the available data. The transition probabilities of some dipole-allowed and spin-forbidden transitions are computed and radiative lifetimes of some excited states at lowest vibrational level are estimated from the transition probability data. Copyright © 2013 Elsevier B.V. All rights reserved.

Recognition of RNA by amide modified backbone nucleic acids: molecular dynamics simulations of DNA-RNA hybrids in aqueous solution.

PubMed

Nina, Mafalda; Fonné-Pfister, Raymonde; Beaudegnies, Renaud; Chekatt, Habiba; Jung, Pierre M J; Murphy-Kessabi, Fiona; De Mesmaeker, Alain; Wendeborn, Sebastian

2005-04-27

Thermodynamic and structural properties of a chemically modified DNA-RNA hybrid in which a phosphodiester linkage is replaced by a neutral amide-3 linkage (3'-CH(2)-CONH-5') were investigated using UV melting experiments, molecular dynamics simulations in explicit water, and continuum solvent models. van't Hoff analysis of the experimental UV melting curves suggests that the significant increase of the thermodynamic stability of a 15-mer DNA-RNA with seven alternated amide-3 modifications (+11 degrees C) is mainly due to an increased binding enthalpy. To further evaluate the origin in the observed affinities differences, the electrostatic contribution to the binding free energy was calculated by solving the Poisson-Boltzmann equation numerically. The nonelectrostatic contribution was estimated as the product of a hydrophobic surface tension coefficient and the surface area that is buried upon double strand formation. Structures were taken from 10 ns molecular dynamics simulations computed in a consistent fashion using explicit solvent, counterions, and the particle-mesh Ewald procedure. The present preliminary thermodynamic study suggests that the favorable binding free energy of the amide-3 DNA single strand to the complementary RNA is equally driven by electrostatic and nonpolar contributions to the binding compared to their natural analogues. In addition, molecular dynamics simulations in explicit water were performed on an amide-3 DNA single strand and the corresponding natural DNA. Results from the conformations cluster analysis of the simulated amide-3 DNA single strand ensembles suggest that the 25% of the population sampled within 10 ns has a pre-organized conformation where the sugar C3' endo pucker is favored at the 3'-flanking nucleotides. These structural and thermodynamic features contribute to the understanding of the observed increased affinities of the amide-3 DNA-RNA hybrids at the microscopic level.

Sensitivity of the nuclear deformability and fission barriers to the equation of state

NASA Astrophysics Data System (ADS)

Seif, W. M.; Anwer, Hisham

2018-07-01

The model-dependent analysis of the fission data impacts the extracted fission-related quantities, which are not directly observables, such as the super- and hyperdeformed isomeric states and their energies. We investigated the model dependence of the deformability of a nucleus and its fission barriers on the nuclear equation of state. Within the microscopic-macroscopic model based on a large number of Skyrme nucleon-nucleon interactions, the total energy surfaces and the double-humped fission barrier of 230Th are calculated in a multidimensional deformation space. In addition to the ground-state (GS) and the superdeformed (SD) minima, all the investigated forces yielded a hyperdeformed (HD) minimum. The contour map of the shell-plus-pairing energy clearly displayed the three minima. We found that the GS binding energy and the deformation energy of the different deformation modes along the fission path increase with the incompressibility coefficient K0, while the fission barrier heights and the excitation energies of the SD and HD modes decrease with it. Conversely, the surface-energy coefficient asurf, the symmetry-energy, and its density-slope parameter decrease the GS energy and the deformation energies, but increase the fission barrier heights and the excitation energies. The obtained deformation parameters of the different deformation modes exhibit almost independence on K0, and on the symmetry-energy and its density-slope. The principle deformation parameters of the SD and HD isomeric states tend to decrease with asurf.

Simulation of Reversible Protein–Protein Binding and Calculation of Binding Free Energies Using Perturbed Distance Restraints

PubMed Central

2017-01-01

Virtually all biological processes depend on the interaction between proteins at some point. The correct prediction of biomolecular binding free-energies has many interesting applications in both basic and applied pharmaceutical research. While recent advances in the field of molecular dynamics (MD) simulations have proven the feasibility of the calculation of protein–protein binding free energies, the large conformational freedom of proteins and complex free energy landscapes of binding processes make such calculations a difficult task. Moreover, convergence and reversibility of resulting free-energy values remain poorly described. In this work, an easy-to-use, yet robust approach for the calculation of standard-state protein–protein binding free energies using perturbed distance restraints is described. In the binding process the conformations of the proteins were restrained, as suggested earlier. Two approaches to avoid end-state problems upon release of the conformational restraints were compared. The method was evaluated by practical application to a small model complex of ubiquitin and the very flexible ubiquitin-binding domain of human DNA polymerase ι (UBM2). All computed free energy differences were closely monitored for convergence, and the calculated binding free energies had a mean unsigned deviation of only 1.4 or 2.5 kJ·mol–1 from experimental values. Statistical error estimates were in the order of thermal noise. We conclude that the presented method has promising potential for broad applicability to quantitatively describe protein–protein and various other kinds of complex formation. PMID:28898077

Correlating hydrogen oxidation and evolution activity on platinum at different pH with measured hydrogen binding energy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sheng, WC; Zhuang, ZB; Gao, MR

2015-01-08

The hydrogen oxidation/evolution reactions are two of the most fundamental reactions in distributed renewable electrochemical energy conversion and storage systems. The identification of the reaction descriptor is therefore of critical importance for the rational catalyst design and development. Here we report the correlation between hydrogen oxidation/evolution activity and experimentally measured hydrogen binding energy for polycrystalline platinum examined in several buffer solutions in a wide range of electrolyte pH from 0 to 13. The hydrogen oxidation/evolution activity obtained using the rotating disk electrode method is found to decrease with the pH, while the hydrogen binding energy, obtained from cyclic voltammograms, linearlymore » increases with the pH. Correlating the hydrogen oxidation/evolution activity to the hydrogen binding energy renders a monotonic decreasing hydrogen oxidation/evolution activity with the hydrogen binding energy, strongly supporting the hypothesis that hydrogen binding energy is the sole reaction descriptor for the hydrogen oxidation/evolution activity on monometallic platinum.« less

Anisotropic energy flow and allosteric ligand binding in albumin

NASA Astrophysics Data System (ADS)

Li, Guifeng; Magana, Donny; Dyer, R. Brian

2014-01-01

Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

Anisotropic energy flow and allosteric ligand binding in albumin.

PubMed

Li, Guifeng; Magana, Donny; Dyer, R Brian

2014-01-01

Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

Anisotropic energy flow and allosteric ligand binding in albumin

PubMed Central

Li, Guifeng; Magana, Donny; Dyer, R. Brian

2014-01-01

Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures. PMID:24445265

Binding Energy and Enzymatic Catalysis.

ERIC Educational Resources Information Center

Hansen, David E.; Raines, Ronald T.

1990-01-01

Discussed is the fundamental role that the favorable free energy of binding of the rate-determining transition state plays in catalysis. The principle that all of the catalytic factors discussed are realized by the use of this binding energy is reviewed. (CW)

Identification of antipsychotic drug fluspirilene as a potential p53-MDM2 inhibitor: a combined computational and experimental study

NASA Astrophysics Data System (ADS)

Patil, Sachin P.; Pacitti, Michael F.; Gilroy, Kevin S.; Ruggiero, John C.; Griffin, Jonathan D.; Butera, Joseph J.; Notarfrancesco, Joseph M.; Tran, Shawn; Stoddart, John W.

2015-02-01

The inhibition of tumor suppressor p53 protein due to its direct interaction with oncogenic murine double minute 2 (MDM2) protein, plays a central role in almost 50 % of all human tumor cells. Therefore, pharmacological inhibition of the p53-binding pocket on MDM2, leading to p53 activation, presents an important therapeutic target against these cancers expressing wild-type p53. In this context, the present study utilized an integrated virtual and experimental screening approach to screen a database of approved drugs for potential p53-MDM2 interaction inhibitors. Specifically, using an ensemble rigid-receptor docking approach with four MDM2 protein crystal structures, six drug molecules were identified as possible p53-MDM2 inhibitors. These drug molecules were then subjected to further molecular modeling investigation through flexible-receptor docking followed by Prime/MM-GBSA binding energy analysis. These studies identified fluspirilene, an approved antipsychotic drug, as a top hit with MDM2 binding mode and energy similar to that of a native MDM2 crystal ligand. The molecular dynamics simulations suggested stable binding of fluspirilene to the p53-binding pocket on MDM2 protein. The experimental testing of fluspirilene showed significant growth inhibition of human colon tumor cells in a p53-dependent manner. Fluspirilene also inhibited growth of several other human tumor cell lines in the NCI60 cell line panel. Taken together, these computational and experimental data suggest a potentially novel role of fluspirilene in inhibiting the p53-MDM2 interaction. It is noteworthy here that fluspirilene has a long history of safe human use, thus presenting immediate clinical potential as a cancer therapeutic. Furthermore, fluspirilene could also serve as a structurally-novel lead molecule for the development of more potent, small-molecule p53-MDM2 inhibitors against several types of cancer. Importantly, the combined computational and experimental screening protocol presented in this study may also prove useful for screening other commercially-available compound databases for identification of novel, small molecule p53-MDM2 inhibitors.

Determination of the absolute binding free energies of HIV-1 protease inhibitors using non-equilibrium molecular dynamics simulations

NASA Astrophysics Data System (ADS)

Ngo, Son Tung; Nguyen, Minh Tung; Nguyen, Minh Tho

2017-05-01

The absolute binding free energy of an inhibitor to HIV-1 Protease (PR) was determined throughout evaluation of the non-bonded interaction energy difference between the two bound and unbound states of the inhibitor and surrounding molecules by the fast pulling of ligand (FPL) process using non-equilibrium molecular dynamics (NEMD) simulations. The calculated free energy difference terms help clarifying the nature of the binding. Theoretical binding affinities are in good correlation with experimental data, with R = 0.89. The paradigm used is able to rank two inhibitors having the maximum difference of ∼1.5 kcal/mol in absolute binding free energies.

Simultaneous effects of pressure and temperature on donor binding energy in Pöschl-Teller quantum well

NASA Astrophysics Data System (ADS)

Hakimyfard, Alireza; Barseghyan, M. G.; Duque, C. A.; Kirakosyan, A. A.

2009-12-01

In the frame of the variational method and the effective-mass approximation, the effects of hydrostatic pressure and temperature on the binding energy for donor impurities in the Pöschl-Teller quantum well are studied. The binding energy dependencies on the width of the quantum well, the hydrostatic pressure, the impurity position, the temperature, and the parameters of the confining potential are reported. The results show that the binding energy increases (decreases) with the increasing of the hydrostatic pressure (temperature). It is also found that, associated with the symmetry breaking in the Pöschl-Teller quantum well, and depending on the impurity position, the binding energy can increase or decrease.

Implicit ligand theory for relative binding free energies

NASA Astrophysics Data System (ADS)

Nguyen, Trung Hai; Minh, David D. L.

2018-03-01

Implicit ligand theory enables noncovalent binding free energies to be calculated based on an exponential average of the binding potential of mean force (BPMF)—the binding free energy between a flexible ligand and rigid receptor—over a precomputed ensemble of receptor configurations. In the original formalism, receptor configurations were drawn from or reweighted to the apo ensemble. Here we show that BPMFs averaged over a holo ensemble yield binding free energies relative to the reference ligand that specifies the ensemble. When using receptor snapshots from an alchemical simulation with a single ligand, the new statistical estimator outperforms the original.

Multispectroscopic and Theoretical Exploration of the Comparative Binding Aspects of Bioflavonoid Fisetin with Triple- and Double-Helical Forms of RNA.

PubMed

Bhuiya, Sutanwi; Haque, Lucy; Goswami, Rapti; Das, Suman

2017-12-14

The interactions of RNA triplex (U.A*U) and duplex (A.U) with naturally occurring flavonoid fisetin (FTN) have been examined at pH 7.0 using various spectroscopic, viscometric, and theoretical studies. Experimental observations showed that the ligand binds with both double- and triple-helical forms of RNA, although the binding affinity is greater for the triplex structure (5.94 × 10 6 M -1 ) compared to that for the duplex counterpart (1.0 × 10 5 M -1 ). Thermal melting experiments revealed that the Hoogsteen base-paired third strand of triplex was stabilized to a greater extent (∼14 °C) compared with the Watson-Crick base-paired second strand (∼4 °C) in the presence of FTN. From fluorimetric study, we observed that U.A*U and A.U primarily bind to the photoproduced tautomer of FTN in the excited state. Steady-state and time-resolved anisotropy measurements illustrate considerable modulations of the spectroscopic properties of the tautomeric FTN within the RNA environment. Viscometric, fluorescence quenching, and thermal melting studies all together support the mode of binding to be intercalation. Theoretical study explains the experimental absorption and emission (dual fluorescence) behavior of FTN along with the excited-state intramolecular proton transfer process.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Parkes, Marie V.; Sava Gallis, Dorina F.; Greathouse, Jeffery A.

Computational screening of metal-organic framework (MOF) materials for selective oxygen adsorption from air could lead to new sorbents for the oxyfuel combustion process feedstock streams. A comprehensive study on the effect of MOF metal chemistry on gas binding energies in two common but structurally disparate metal-organic frameworks has been undertaken. Dispersion-corrected density functional theory methods were used to calculate the oxygen and nitrogen binding energies with each of fourteen metals, respectively, substituted into two MOF series, M 2(dobdc) and M 3(btc) 2. The accuracy of DFT methods was validated by comparing trends in binding energy with experimental gas sorption measurements.more » A periodic trend in oxygen binding energies was found, with greater oxygen binding energies for early transition-metal-substituted MOFs compared to late transition metal MOFs; this was independent of MOF structural type. The larger binding energies were associated with oxygen binding in a side-on configuration to the metal, with concomitant lengthening of the O-O bond. In contrast, nitrogen binding energies were similar across the transition metal series, regardless of both MOF structural type and metal identity. Altogether, these findings suggest that early transition metal MOFs are best suited to separating oxygen from nitrogen, and that the MOF structural type is less important than the metal identity.« less

Spectroscopic and electrochemical studies of the interaction between oleuropein, the major bio-phenol in olives, and salmon sperm DNA

NASA Astrophysics Data System (ADS)

Mohamadi, Maryam; Afzali, Daryoush; Esmaeili-Mahani, Saeed; Mostafavi, Ali; Torkzadeh-Mahani, Masoud

2015-09-01

Interaction of oleuropein, the major bio-phenol in olive leaf and fruit, with salmon sperm double-stranded DNA was investigated by employing electronic absorption titrations, fluorescence quenching spectroscopy, competitive fluorescence spectroscopy, thermal denaturation and voltammetric studies. Titration of oleuropein with the DNA caused a hypochromism accompanied with a red shift indicating an intercalative mode of interaction. Binding constant of 1.4 × 104 M-1 was obtained for this interaction. From the curves of fluorescence titration of oleuropein with the DNA, binding constant and binding sites were calculated to be 8.61 × 103 M-1 and 1.05, respectively. Competitive studies with ethidium bromide (a well-known DNA intercalator) showed that the bio-phenol could take the place of ethidium bromide in the DNA intercalation sites. The interaction of oleuropein with DNA was also studied electrochemically. In the presence of the DNA, the anodic and cathodic peak currents of oleuropein decreased accompanied with increases in peak-to-peak potential separation and formal potential, indicating the intercalation of oleuropein into the DNA double helix. Moreover, melting temperature of the DNA was found to increase in the presence of oleuropein, indicating the stabilization of the DNA double helix due to an intercalative interaction.

Stabilized sulfur binding using activated fillers

DOEpatents

Kalb, Paul D.; Vagin, Vyacheslav P.; Vagin, Sergey P.

2015-07-21

A method of making a stable, sulfur binding composite comprising impregnating a solid aggregate with an organic modifier comprising unsaturated hydrocarbons with at least one double or triple covalent bond between adjacent carbon atoms to create a modifier-impregnated aggregate; heating and drying the modifier-impregnated aggregate to activate the surface of the modifier-impregnated aggregate for reaction with sulfur.

An investigation on the effect of impurity position on the binding energy of quantum box under electric field with pressure and temperature

NASA Astrophysics Data System (ADS)

Yilmaz, S.; Kirak, M.

2018-05-01

In the present study, we have studied theoretically the influences of donor impurity position on the binding energy of a GaAs cubic quantum box structure. The binding energy is calculated as functions of the position of impurity, electric field, temperature and hydrostatic pressure. The variational method is employed to obtain the energy eigenvalues of the structure in the framework of the effective mass approximation. It has been found that the impurity positions with electric field, pressure and temperature have an important effect on the binding energy of structure considered. The results can be used to manufacture semiconductor device application by manipulating the binding energy with the impurity positions, electric field, pressure and temperature.

Fluorescence resonance energy-transfer affects the determination of the affinity between ligand and proteins obtained by fluorescence quenching method

NASA Astrophysics Data System (ADS)

Xiao, Jianbo; Wei, Xinlin; Wang, Yuanfeng; Liu, Chunxi

2009-11-01

The interaction between esculin and serum albumins was investigated to illustrate that the fluorescence resonance energy-transfer (FRET) affects the determination of the binding constants obtained by fluorescence quenching method. The binding constants ( Ka) obtained by the double-logarithm curve for esculin-BSA and esculin-HSA were 1.02 × 10 7 and 2.07 × 10 4 L/mol, respectively. These results from synchronous fluorescence showed that the Tyr and Trp residues of HSA were affected more deeply than those in BSA. The excitation profile of esculin showed that in the presence of BSA and HSA, the S 0 → S 1 transition of esculin ( λexmax≈340 nm) appears, which is similar to the λemmax of BSA and HSA. The critical distance ( R0) between BSA and esculin is higher than that of HSA, which showed that the affinity of esculin and HSA should be higher than that of BSA. After centrifugation, the concentrations of esculin bound to albumins were determined by means of the fluorescence of esculin. It was found that much more esculin was bound to HSA than to BSA. However, the bound models for BSA and HSA are almost the same. The concentration of esculin bound to serum albumin at first decreased with the addition of esculin and then increased. From above results, it can be concluded that the affinity of esculin and HSA should be higher than that of esculin and BSA. This example showed that in the presence of FRET, the binding constants between ligands and proteins based on fluorescence quenching might be deviated.

Fluorescence resonance energy-transfer affects the determination of the affinity between ligand and proteins obtained by fluorescence quenching method.

PubMed

Xiao, Jianbo; Wei, Xinlin; Wang, Yuanfeng; Liu, Chunxi

2009-11-01

The interaction between esculin and serum albumins was investigated to illustrate that the fluorescence resonance energy-transfer (FRET) affects the determination of the binding constants obtained by fluorescence quenching method. The binding constants (K(a)) obtained by the double-logarithm curve for esculin-BSA and esculin-HSA were 1.02x10(7) and 2.07x10(4)L/mol, respectively. These results from synchronous fluorescence showed that the Tyr and Trp residues of HSA were affected more deeply than those in BSA. The excitation profile of esculin showed that in the presence of BSA and HSA, the S(0)-->S(1) transition of esculin (lambda(ex)(max) approximately 340nm) appears, which is similar to the lambda(em)(max) of BSA and HSA. The critical distance (R(0)) between BSA and esculin is higher than that of HSA, which showed that the affinity of esculin and HSA should be higher than that of BSA. After centrifugation, the concentrations of esculin bound to albumins were determined by means of the fluorescence of esculin. It was found that much more esculin was bound to HSA than to BSA. However, the bound models for BSA and HSA are almost the same. The concentration of esculin bound to serum albumin at first decreased with the addition of esculin and then increased. From above results, it can be concluded that the affinity of esculin and HSA should be higher than that of esculin and BSA. This example showed that in the presence of FRET, the binding constants between ligands and proteins based on fluorescence quenching might be deviated.

Adapting photosynthesis to the near-infrared: non-covalent binding of phycocyanobilin provides an extreme spectral red-shift to phycobilisome core-membrane linker from Synechococcus sp. PCC7335.

PubMed

Miao, Dan; Ding, Wen-Long; Zhao, Bao-Qing; Lu, Lu; Xu, Qian-Zhao; Scheer, Hugo; Zhao, Kai-Hong

2016-06-01

Phycobiliproteins that bind bilins are organized as light-harvesting complexes, phycobilisomes, in cyanobacteria and red algae. The harvested light energy is funneled to reaction centers via two energy traps, allophycocyanin B and the core-membrane linker, ApcE1 (conventional ApcE). The covalently bound phycocyanobilin (PCB) of ApcE1 absorbs near 660 nm and fluoresces near 675 nm. In cyanobacteria capable of near infrared photoacclimation, such as Synechococcus sp. PCC7335, there exist even further spectrally red shifted components absorbing >700 nm and fluorescing >710 nm. We expressed the chromophore domain of the extra core-membrane linker from Synechococcus sp. PCC7335, ApcE2, in E. coli together with enzymes generating the chromophore, PCB. The resulting chromoproteins, PCB-ApcE2(1-273) and the more truncated PCB-ApcE2(24-245), absorb at 700 nm and fluoresce at 714 nm. The red shift of ~40 nm compared with canonical ApcE1 results from non-covalent binding of the chromophore by which its full conjugation length including the Δ3,3(1) double bond is preserved. The extreme spectral red-shift could not be ascribed to exciton coupling: dimeric PCB-ApcE2(1-273) and monomeric-ApcE2(24-245) absorbed and fluoresced similarly. Chromophorylation of ApcE2 with phycoerythrobilin- or phytochromobilin resulted in similar red shifts (absorption at 615 and 711 nm, fluorescence at 628 or 726 nm, respectively), compared to the covalently bound chromophores. The self-assembled non-covalent chromophorylation demonstrates a novel access to red and near-infrared emitting fluorophores. Brightly fluorescent biomarking was exemplified in E. coli by single-plasmid transformation. Copyright © 2016 Elsevier B.V. All rights reserved.

Direct Comparison of Amino Acid and Salt Interactions with Double-Stranded and Single-Stranded DNA from Explicit-Solvent Molecular Dynamics Simulations.

PubMed

Andrews, Casey T; Campbell, Brady A; Elcock, Adrian H

2017-04-11

Given the ubiquitous nature of protein-DNA interactions, it is important to understand the interaction thermodynamics of individual amino acid side chains for DNA. One way to assess these preferences is to perform molecular dynamics (MD) simulations. Here we report MD simulations of 20 amino acid side chain analogs interacting simultaneously with both a 70-base-pair double-stranded DNA and with a 70-nucleotide single-stranded DNA. The relative preferences of the amino acid side chains for dsDNA and ssDNA match well with values deduced from crystallographic analyses of protein-DNA complexes. The estimated apparent free energies of interaction for ssDNA, on the other hand, correlate well with previous simulation values reported for interactions with isolated nucleobases, and with experimental values reported for interactions with guanosine. Comparisons of the interactions with dsDNA and ssDNA indicate that, with the exception of the positively charged side chains, all types of amino acid side chain interact more favorably with ssDNA, with intercalation of aromatic and aliphatic side chains being especially notable. Analysis of the data on a base-by-base basis indicates that positively charged side chains, as well as sodium ions, preferentially bind to cytosine in ssDNA, and that negatively charged side chains, and chloride ions, preferentially bind to guanine in ssDNA. These latter observations provide a novel explanation for the lower salt dependence of DNA duplex stability in GC-rich sequences relative to AT-rich sequences.

Targeted mutations and MD simulations of a methanol-stable lipase YLIP9 from Yarrowia lipolytica MSR80 to develop a biodiesel enzyme.

PubMed

Syal, Poonam; Verma, Ved Vrat; Gupta, Rani

2017-11-01

Biodiesel, an environment friendly alternative for fuels, contains methyl esters of long-chain fatty acids. Our group has reported a methanol-stable YLIP9 from Yarrowia lipolytica MSR80 that shows poor catalysis of long-chain fatty acids. To shift its substrate specificity, residues within lid and binding pocket were identified for sequential mutations using YLIP2 as the template. Of the two point mutations (Glu116Leu and Ser119Val) introduced in the lid, the former mutation (YLIP9L1) increased the catalytic rate by ∼2-fold without any change in substrate specificity. In this mutant, six binding pocket residues (Bp2-Bp7) were further mutated to obtain six double mutants. YLIP9L1Bp3 showed significant shift in substrate specificity towards long-chain pNPesters with 11-fold increase in catalytic efficiency than YLIP9. Double mutations also led to increased thermostability and lowered activation energy of YLIP9L1Bp3 thereby shifting its optimum temperature from 60°C to 50°C. In silico molecular dynamics simulations revealed improved lid flexibility and increased catalytic triad volume in YLIP9L1Bp3. The enzyme YLIP9L1Bp3 was methanol-stable having selectivity for long-chain fatty acids with improved catalytic efficiency. Its application as a biodiesel enzyme was validated by transesterification of palm oil in presence of methanol, where it showed 8-fold increase in conversion of oil to methyl esters. Copyright © 2017 Elsevier B.V. All rights reserved.

Using Tryptophan Mutants To Probe the Structural and Functional Status of BsSCO, a Copper Binding, Cytochrome c Oxidase Assembly Protein from Bacillus subtilis.

PubMed

Hussain, Shina; Andrews, Diann; Hill, Bruce C

2017-12-05

The synthesis of cytochrome c oxidase protein from Bacillus subtilis (i.e., BsSCO) binds copper with picomolar affinity, which increases the protein's melting temperature (i.e., T M ) by 20 °C. Here two native tryptophans (i.e., W36 and W101) are identified as major contributors to BsSCO's structural form, and their contributions to the stability, intrinsic fluorescence, and copper binding properties of BsSCO are explored. Single mutations of tryptophan to phenylalanine decrease the T M by 10 °C and the folding free energy by 3-4 kcal/mol. A more severe change to alanine (i.e., W36A BsSCO) decreases the T M by 20 °C and the stability by 9 kcal/mol. However, these mutants bind copper with high affinity and assemble cytochrome c oxidase in vivo. Replacing phenylalanine at a position near (∼5 Å) the copper binding site with tryptophan (i.e., F42W) increases the T M of apo-BsSCO by 3 °C but diminishes the effect of copper binding. When both native tryptophans are changed to alanine, apo-BsSCO is unfolded in vitro and is not functional in cytochrome c oxidase assembly in vivo. A double-mutant of BsSCO in which W36A is combined with F42W exhibits a form of metastability. Apo-W36A/F42W BsSCO melts at 37 °C, which upon binding of copper shifts to 65 °C. B. subtilis expressing W36A/F42W BsSCO and grown at 37 °C does not assemble cytochrome c oxidase. However, when these cells are cooled to 25 °C, cytochrome c oxidase activity is recovered. Our results illustrate the subtle relationship between the structural stability and functional properties of BsSCO in the assembly of cytochrome c oxidase.

Computational Modeling Approach in Probing the Effects of Cytosine Methylation on the Transcription Factor Binding to DNA.

PubMed

Tenayuca, John; Cousins, Kimberley; Yang, Shumei; Zhang, Lubo

2017-01-01

Cytosine methylation at CpG dinucleotides is a chief mechanism in epigenetic modification of gene expression patterns. Previous studies demonstrated that increased CpG methylation of Sp1 sites at -268 and -346 of protein kinase C ε promoter repressed the gene expression. The present study investigated the impact of CpG methylation on the Sp1 binding via molecular modeling and electrophoretic mobility shift assay. Each of the Sp1 sites contain two CpGs. Methylation of either CpG lowered the binding affinity of Sp1, whereas methylation of both CpGs produced a greater decrease in the binding affinity. Computation of van der Waals (VDW) energy of Sp1 in complex with the Sp1 sites demonstrated increased VDW values from one to two sites of CpG methylation. Molecular modeling indicated that single CpG methylation caused underwinding of the DNA fragment, with the phosphate groups at C1, C4 and C5 reoriented from their original positions. Methylation of both CpGs pinched the minor groove and increased the helical twist concomitant with a shallow, hydrophobic major groove. Additionally, double methylation eliminated hydrogen bonds on recognition helix residues located at positions -1 and 1, which were essential for interaction with O6/N7 of G-bases. Bonding from linker residues Arg565, Lys595 and Lys596 were also reduced. Methylation of single or both CpGs significantly affected hydrogen bonding from all three Sp1 DNA binding domains, demonstrating that the consequences of cytosine modification extend beyond the neighboring nucleotides. The results indicate that cytosine methylation causes subtle structural alterations in Sp1 binding sites consequently resulting in inhibition of side chain interactions critical for specific base recognition and reduction of the binding affinity of Sp1. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Pairwise additivity of energy components in protein-ligand binding: The HIV II protease-Indinavir case

NASA Astrophysics Data System (ADS)

Ucisik, Melek N.; Dashti, Danial S.; Faver, John C.; Merz, Kenneth M.

2011-08-01

An energy expansion (binding energy decomposition into n-body interaction terms for n ≥ 2) to express the receptor-ligand binding energy for the fragmented HIV II protease-Indinavir system is described to address the role of cooperativity in ligand binding. The outcome of this energy expansion is compared to the total receptor-ligand binding energy at the Hartree-Fock, density functional theory, and semiempirical levels of theory. We find that the sum of the pairwise interaction energies approximates the total binding energy to ˜82% for HF and to >95% for both the M06-L density functional and PM6-DH2 semiempirical method. The contribution of the three-body interactions amounts to 18.7%, 3.8%, and 1.4% for HF, M06-L, and PM6-DH2, respectively. We find that the expansion can be safely truncated after n = 3. That is, the contribution of the interactions involving more than three parties to the total binding energy of Indinavir to the HIV II protease receptor is negligible. Overall, we find that the two-body terms represent a good approximation to the total binding energy of the system, which points to pairwise additivity in the present case. This basic principle of pairwise additivity is utilized in fragment-based drug design approaches and our results support its continued use. The present results can also aid in the validation of non-bonded terms contained within common force fields and in the correction of systematic errors in physics-based score functions.

Electronic and optical properties of exciton, trions and biexciton in II-VI parabolic quantum dot

NASA Astrophysics Data System (ADS)

Sujanah, P.; John Peter, A.; Woo Lee, Chang

2015-08-01

Binding energies of exciton, trions and biexciton and their interband optical transition energies are studied in a CdTe/ZnTe quantum dot nanostructure taking into consideration the geometrical confinement effect. The radial spread of the wavefunctions, binding energies, optical transition energies, oscillator strength, radiative life time and the absorption coefficients of exciton, positively and negatively charged excitons and biexciton are carried out. It is found that the ratio of the radiative life time of exciton with the trions and biexciton enhances with the reduction of geometrical confinement. The results show that (i) the binding energies of exciton, positive and negative trions and the biexciton have strong influence on the reduction of geometrical confinement effect, (ii) the binding energy is found to decrease from the binding energies of exciton to positive trion through biexciton and negative trion binding energies, (iii) the oscillator strength of trions is found to be lesser than exciton and the biexciton and (iv) the electronic and optical properties of exciton, trions and the biexciton are considerably dependent on the spatial confinement, incident photon energy and the radiative life time. The obtained results are in good agreement with the other existing literature.

Calculation of Host-Guest Binding Affinities Using a Quantum-Mechanical Energy Model.

PubMed

Muddana, Hari S; Gilson, Michael K

2012-06-12

The prediction of protein-ligand binding affinities is of central interest in computer-aided drug discovery, but it is still difficult to achieve a high degree of accuracy. Recent studies suggesting that available force fields may be a key source of error motivate the present study, which reports the first mining minima (M2) binding affinity calculations based on a quantum mechanical energy model, rather than an empirical force field. We apply a semi-empirical quantum-mechanical energy function, PM6-DH+, coupled with the COSMO solvation model, to 29 host-guest systems with a wide range of measured binding affinities. After correction for a systematic error, which appears to derive from the treatment of polar solvation, the computed absolute binding affinities agree well with experimental measurements, with a mean error 1.6 kcal/mol and a correlation coefficient of 0.91. These calculations also delineate the contributions of various energy components, including solute energy, configurational entropy, and solvation free energy, to the binding free energies of these host-guest complexes. Comparison with our previous calculations, which used empirical force fields, point to significant differences in both the energetic and entropic components of the binding free energy. The present study demonstrates successful combination of a quantum mechanical Hamiltonian with the M2 affinity method.

DNA as a Binary Code: How the Physical Structure of Nucleotide Bases Carries Information

ERIC Educational Resources Information Center

McCallister, Gary

2005-01-01

The DNA triplet code also functions as a binary code. Because double-ring compounds cannot bind to double-ring compounds in the DNA code, the sequence of bases classified simply as purines or pyrimidines can encode for smaller groups of possible amino acids. This is an intuitive approach to teaching the DNA code. (Contains 6 figures.)

IDN2 Interacts with RPA and Facilitates DNA Double-Strand Break Repair by Homologous Recombination in Arabidopsis.

PubMed

Liu, Mingming; Ba, Zhaoqing; Costa-Nunes, Pedro; Wei, Wei; Li, Lanxia; Kong, Fansi; Li, Yan; Chai, Jijie; Pontes, Olga; Qi, Yijun

2017-03-01

Repair of DNA double-strand breaks (DSBs) is critical for the maintenance of genome integrity. We previously showed that DSB-induced small RNAs (diRNAs) facilitate homologous recombination-mediated DSB repair in Arabidopsis thaliana Here, we show that INVOLVED IN DE NOVO2 (IDN2), a double-stranded RNA binding protein involved in small RNA-directed DNA methylation, is required for DSB repair in Arabidopsis. We find that IDN2 interacts with the heterotrimeric replication protein A (RPA) complex. Depletion of IDN2 or the diRNA binding ARGONAUTE2 leads to increased accumulation of RPA at DSB sites and mislocalization of the recombination factor RAD51. These findings support a model in which IDN2 interacts with RPA and facilitates the release of RPA from single-stranded DNA tails and subsequent recruitment of RAD51 at DSB sites to promote DSB repair. © 2017 American Society of Plant Biologists. All rights reserved.

Double layers and circuits in astrophysics

NASA Technical Reports Server (NTRS)

Alfven, Hannes

1986-01-01

As the rate of energy release in a double layer with voltage delta V is P approx I delta V, a double layer must be treated as a part of a circuit which delivers the current I. As neither double layer nor circuit can be derived from magnetofluid models of a plasma, such models are useless for treating energy transfer by means of double layers. They must be replaced by particle models and circuit theory. A simple circuit is suggested which is applied to the energizing of auroral particles, to solar flares, and to intergalactic double radio sources. Application to the heliospheric current systems leads to the prediction of two double layers on the Sun's axis which may give radiations detectable from Earth. Double layers in space should be classified as a new type of celestial object (one example is the double radio sources). It is tentatively suggested in X-ray and Gamma-ray bursts may be due to exploding double layers (although annihilation is an alternative energy source). A study of how a number of the most used textbooks in astrophysics treat important concepts like double layers, critical velocity, pinch effects and circuits is made.

Large scale affinity calculations of cyclodextrin host-guest complexes: Understanding the role of reorganization in the molecular recognition process

PubMed Central

Wickstrom, Lauren; He, Peng; Gallicchio, Emilio; Levy, Ronald M.

2013-01-01

Host-guest inclusion complexes are useful models for understanding the structural and energetic aspects of molecular recognition. Due to their small size relative to much larger protein-ligand complexes, converged results can be obtained rapidly for these systems thus offering the opportunity to more reliably study fundamental aspects of the thermodynamics of binding. In this work, we have performed a large scale binding affinity survey of 57 β-cyclodextrin (CD) host guest systems using the binding energy distribution analysis method (BEDAM) with implicit solvation (OPLS-AA/AGBNP2). Converged estimates of the standard binding free energies are obtained for these systems by employing techniques such as parallel Hamitionian replica exchange molecular dynamics, conformational reservoirs and multistate free energy estimators. Good agreement with experimental measurements is obtained in terms of both numerical accuracy and affinity rankings. Overall, average effective binding energies reproduce affinity rank ordering better than the calculated binding affinities, even though calculated binding free energies, which account for effects such as conformational strain and entropy loss upon binding, provide lower root mean square errors when compared to measurements. Interestingly, we find that binding free energies are superior rank order predictors for a large subset containing the most flexible guests. The results indicate that, while challenging, accurate modeling of reorganization effects can lead to ligand design models of superior predictive power for rank ordering relative to models based only on ligand-receptor interaction energies. PMID:25147485

Convergence of Domain Architecture, Structure, and Ligand Affinity in Animal and Plant RNA-Binding Proteins.

PubMed

Dias, Raquel; Manny, Austin; Kolaczkowski, Oralia; Kolaczkowski, Bryan

2017-06-01

Reconstruction of ancestral protein sequences using phylogenetic methods is a powerful technique for directly examining the evolution of molecular function. Although ancestral sequence reconstruction (ASR) is itself very efficient, downstream functional, and structural studies necessary to characterize when and how changes in molecular function occurred are often costly and time-consuming, currently limiting ASR studies to examining a relatively small number of discrete functional shifts. As a result, we have very little direct information about how molecular function evolves across large protein families. Here we develop an approach combining ASR with structure and function prediction to efficiently examine the evolution of ligand affinity across a large family of double-stranded RNA binding proteins (DRBs) spanning animals and plants. We find that the characteristic domain architecture of DRBs-consisting of 2-3 tandem double-stranded RNA binding motifs (dsrms)-arose independently in early animal and plant lineages. The affinity with which individual dsrms bind double-stranded RNA appears to have increased and decreased often across both animal and plant phylogenies, primarily through convergent structural mechanisms involving RNA-contact residues within the β1-β2 loop and a small region of α2. These studies provide some of the first direct information about how protein function evolves across large gene families and suggest that changes in molecular function may occur often and unassociated with major phylogenetic events, such as gene or domain duplications. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Binding of the B D D ¯ and B D D systems

NASA Astrophysics Data System (ADS)

Dias, J. M.; Debastiani, V. R.; Roca, L.; Sakai, S.; Oset, E.

2017-11-01

We study theoretically the B D D ¯ and B D D systems to see if they allow for possible bound or resonant states. The three-body interaction is evaluated implementing the fixed center approximation to the Faddeev equations which considers the interaction of a D or D ¯ particle with the components of a B D cluster, previously proved to form a bound state. We find an I (JP)=1 /2 (0-) bound state for the B D D ¯ system at an energy around 8925-8985 MeV within uncertainties, which would correspond to a bottom hidden-charm meson. In contrast, for the B D D system, which would be bottom double-charm and hence manifestly exotic, we have found hints of a bound state in the energy region 8935-8985 MeV, but the results are not stable under the uncertainties of the model, and we cannot assure, nor rule out, the possibility of a B D D three-body state.

An ultrasensitive label-free biosensor for assaying of sequence-specific DNA-binding protein based on amplifying fluorescent conjugated polymer.

PubMed

Liu, Xingfen; Ouyang, Lan; Cai, Xiaohui; Huang, Yanqin; Feng, Xiaomiao; Fan, Quli; Huang, Wei

2013-03-15

Sensitive, reliable, and simple detection of sequence-specific DNA-binding proteins (DBP) is of paramount importance in the area of proteomics, genomics, and biomedicine. We describe herein a novel fluorescent-amplified strategy for ultrasensitive, visual, quantitative, and "turn-on" detection of DBP. A Förster resonance energy transfer (FRET) assay utilizing a cationic conjugated polymer (CCP) and an intercalating dye was designed to detect a key transcription factor, nuclear factor-kappa B (NF-κB), the model target. A series of label-free DNA probes bearing one or two protein-binding sites (PBS) were used to identify the target protein specifically. The binding DBP protects the probe from digestion by exonuclease III, resulting in high efficient FRET due to the high affinity between the intercalating dye and duplex DNA, as well as strong electrostatic interactions between the CCP and DNA probe. By using label-free hairpin DNA or double-stranded DNA containing two PBS as probe, we could detect as low as 1 pg/μL of NF-κB in HeLa nuclear extracts, which is 10000-fold more sensitive than the previously reported methods. The approach also allows naked-eye detection by observing fluorescent color of solutions with the assistance of a hand-held UV lamp. Additionally, a less than 10% relative standard deviation was obtained, which offers a new platform for superior precision, low-cost, and simple detection of DBP. The features of our optical biosensor shows promising potential for early diagnosis of many diseases and high-throughput screening of new drugs targeted to DNA-binding proteins. Copyright © 2012 Elsevier B.V. All rights reserved.

Structure-based optimization of salt-bridge network across the complex interface of PTPN4 PDZ domain with its peptide ligands in neuroglioma.

PubMed

Xiao, Xian; He, Qiang-Hua; Yu, Li-Yan; Wang, Song-Qing; Li, Yang; Yang, Hua; Zhang, Ai-Hua; Ma, Xiao-Hong; Peng, Yu-Jie; Chen, Bing

2017-02-01

The PTP non-receptor type 4 (PTPN4) is an important regulator protein in learning, spatial memory and cerebellar synaptic plasticity; targeting the PDZ domain of PTPN4 has become as attractive therapeutic strategy for human neuroglioma. Here, we systematically examined the complex crystal structures of PTPN4 PDZ domain with its known peptide ligands; a number of charged amino acid residues were identified in these ligands and in the peptide-binding pocket of PDZ domain, which can constitute a complicated salt-bridge network across the complex interface. Molecular dynamics (MD) simulations, binding free energy calculations and continuum model analysis revealed that the electrostatic effect plays a predominant role in domain-peptide binding, while other noncovalent interactions such as hydrogen bonds and hydrophobic forces are also responsible for the binding. The computational findings were then used to guide structure-based optimization of the interfacial salt-bridge network. Consequently, five peptides were rationally designed using the high-affinity binder Cyto8-RETEV (RETEV -COOH ) as template, including four single-point mutants (i.e. Cyto8-mtxe 0 : RETEE -COOH , Cyto8-mtxd -1 : RETDV -COOH , Cyto8-mtxd -3 : RDTEV -COOH and Cyto8-mtxk -4 : KETEV -COOH ) and one double-point mutant (i.e. Cyto8-mtxd -1 k -4 : KETDV -COOH ). Binding assays confirmed that three (Cyto8-mtxd -1 , Cyto8-mtxk -4 and Cyto8-mtxd -1 k -4 ) out of the five designed peptides exhibit moderately or considerably increased affinity as compared to the native peptide Cyto8-RETEV. Copyright © 2016 Elsevier Ltd. All rights reserved.

Free energy decomposition of protein-protein interactions.

PubMed

Noskov, S Y; Lim, C

2001-08-01

A free energy decomposition scheme has been developed and tested on antibody-antigen and protease-inhibitor binding for which accurate experimental structures were available for both free and bound proteins. Using the x-ray coordinates of the free and bound proteins, the absolute binding free energy was computed assuming additivity of three well-defined, physical processes: desolvation of the x-ray structures, isomerization of the x-ray conformation to a nearby local minimum in the gas-phase, and subsequent noncovalent complex formation in the gas phase. This free energy scheme, together with the Generalized Born model for computing the electrostatic solvation free energy, yielded binding free energies in remarkable agreement with experimental data. Two assumptions commonly used in theoretical treatments; viz., the rigid-binding approximation (which assumes no conformational change upon complexation) and the neglect of vdW interactions, were found to yield large errors in the binding free energy. Protein-protein vdW and electrostatic interactions between complementary surfaces over a relatively large area (1400--1700 A(2)) were found to drive antibody-antigen and protease-inhibitor binding.

DNA Double-Strand Breaks Coupled with PARP1 and HNRNPA2B1 Binding Sites Flank Coordinately Expressed Domains in Human Chromosomes

PubMed Central

Fedoseeva, Daria M.; Sosin, Dmitri V.; Grachev, Sergei A.; Serebraykova, Marina V.; Romanenko, Svetlana A.; Vorobieva, Nadezhda V.; Kravatsky, Yuri V.

2013-01-01

Genome instability plays a key role in multiple biological processes and diseases, including cancer. Genome-wide mapping of DNA double-strand breaks (DSBs) is important for understanding both chromosomal architecture and specific chromosomal regions at DSBs. We developed a method for precise genome-wide mapping of blunt-ended DSBs in human chromosomes, and observed non-random fragmentation and DSB hot spots. These hot spots are scattered along chromosomes and delimit protected 50–250 kb DNA domains. We found that about 30% of the domains (denoted forum domains) possess coordinately expressed genes and that PARP1 and HNRNPA2B1 specifically bind DNA sequences at the forum domain termini. Thus, our data suggest a novel type of gene regulation: a coordinated transcription or silencing of gene clusters delimited by DSB hot spots as well as PARP1 and HNRNPa2B1 binding sites. PMID:23593027

Origin Licensing Requires ATP Binding and Hydrolysis by the MCM Replicative Helicase

PubMed Central

Coster, Gideon; Frigola, Jordi; Beuron, Fabienne; Morris, Edward P.; Diffley, John F.X.

2014-01-01

Summary Loading of the six related Minichromosome Maintenance (MCM) proteins as head-to-head double hexamers during DNA replication origin licensing is crucial for ensuring once-per-cell-cycle DNA replication in eukaryotic cells. Assembly of these prereplicative complexes (pre-RCs) requires the Origin Recognition Complex (ORC), Cdc6, and Cdt1. ORC, Cdc6, and MCM are members of the AAA+ family of ATPases, and pre-RC assembly requires ATP hydrolysis. Here we show that ORC and Cdc6 mutants defective in ATP hydrolysis are competent for origin licensing. However, ATP hydrolysis by Cdc6 is required to release nonproductive licensing intermediates. We show that ATP binding stabilizes the wild-type MCM hexamer. Moreover, by analyzing MCM containing mutant subunits, we show that ATP binding and hydrolysis by MCM are required for Cdt1 release and double hexamer formation. This work alters our view of how ATP is used by licensing factors to assemble pre-RCs. PMID:25087873

Effect of metal in M 3(btc) 2 and M 2(dobdc) MOFs for O 2/N 2 separations: A combined density functional theory and experimental study

DOE PAGES

Parkes, Marie V.; Sava Gallis, Dorina F.; Greathouse, Jeffery A.; ...

2015-03-02

Computational screening of metal-organic framework (MOF) materials for selective oxygen adsorption from air could lead to new sorbents for the oxyfuel combustion process feedstock streams. A comprehensive study on the effect of MOF metal chemistry on gas binding energies in two common but structurally disparate metal-organic frameworks has been undertaken. Dispersion-corrected density functional theory methods were used to calculate the oxygen and nitrogen binding energies with each of fourteen metals, respectively, substituted into two MOF series, M 2(dobdc) and M 3(btc) 2. The accuracy of DFT methods was validated by comparing trends in binding energy with experimental gas sorption measurements.more » A periodic trend in oxygen binding energies was found, with greater oxygen binding energies for early transition-metal-substituted MOFs compared to late transition metal MOFs; this was independent of MOF structural type. The larger binding energies were associated with oxygen binding in a side-on configuration to the metal, with concomitant lengthening of the O-O bond. In contrast, nitrogen binding energies were similar across the transition metal series, regardless of both MOF structural type and metal identity. Altogether, these findings suggest that early transition metal MOFs are best suited to separating oxygen from nitrogen, and that the MOF structural type is less important than the metal identity.« less

Binding free energies for nicotine analogs inhibiting cytochrome P450 2A6 by a combined use of molecular dynamics simulations and QM/MM-PBSA calculations.

PubMed

Lu, Haiting; Huang, Xiaoqin; AbdulHameed, Mohamed Diwan M; Zhan, Chang-Guo

2014-04-01

Molecular dynamics (MD) simulations and hybrid quantum mechanical/molecular mechanical (QM/MM) calculations have been performed to explore the dynamic behaviors of cytochrome P450 2A6 (CYP2A6) binding with nicotine analogs (that are typical inhibitors) and to calculate their binding free energies in combination with Poisson-Boltzmann surface area (PBSA) calculations. The combined MD simulations and QM/MM-PBSA calculations reveal that the most important structural parameters affecting the CYP2A6-inhibitor binding affinity are two crucial internuclear distances, that is, the distance between the heme iron atom of CYP2A6 and the coordinating atom of the inhibitor, and the hydrogen-bonding distance between the N297 side chain of CYP2A6 and the pyridine nitrogen of the inhibitor. The combined MD simulations and QM/MM-PBSA calculations have led to dynamic CYP2A6-inhibitor binding structures that are consistent with the observed dynamic behaviors and structural features of CYP2A6-inhibitor binding, and led to the binding free energies that are in good agreement with the experimentally-derived binding free energies. The agreement between the calculated binding free energies and the experimentally-derived binding free energies suggests that the combined MD and QM/MM-PBSA approach may be used as a valuable tool to accurately predict the CYP2A6-inhibitor binding affinities in future computational design of new, potent and selective CYP2A6 inhibitors. Copyright © 2014 Elsevier Ltd. All rights reserved.

Structure of Arabidopsis HYPONASTIC LEAVES1 and Its Molecular Implications for miRNA Processing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, S.; Chen, H; Yang, J

2010-01-01

The Arabidopsis HYPONASTIC LEAVES1 (HYL1) is a double-stranded RNA-binding protein that forms a complex with DICER-LIKE1 (DCL1) and SERRATE to facilitate processing of primary miRNAs into microRNAs (miRNAs). However, the structural mechanisms of miRNA maturation by this complex are poorly understood. Here, we present the crystal structures of double-stranded RNA binding domains (dsRBD1 and dsRBD2) of HYL1 and HYL1 dsRBD1 (HR1)/dsRNA complex as well as human TRBP2 dsRBD2 (TR2)/dsRNA complex for comparison analysis. Structural and functional study demonstrates that both HR1 and TR2 are canonical dsRBDs for dsRNA binding, whereas HR2 of HYL1 is a non-canonical dsRBD harboring a putativemore » dimerization interface. Domain swapping within the context of HYL1 demonstrates that TR2 can supplant the function of HR1 in vitro and in vivo. Further biochemical analyses suggest that HYL1 probably binds to the miRNA/miRNA* region of precursors as a dimer mediated by HR2.« less

The TubR-centromere complex adopts a double-ring segrosome structure in Type III partition systems.

PubMed

Martín-García, Bárbara; Martín-González, Alejandro; Carrasco, Carolina; Hernández-Arriaga, Ana M; Ruíz-Quero, Rubén; Díaz-Orejas, Ramón; Aicart-Ramos, Clara; Moreno-Herrero, Fernando; Oliva, María A

2018-05-14

In prokaryotes, the centromere is a specialized segment of DNA that promotes the assembly of the segrosome upon binding of the Centromere Binding Protein (CBP). The segrosome structure exposes a specific surface for the interaction of the CBP with the motor protein that mediates DNA movement during cell division. Additionally, the CBP usually controls the transcriptional regulation of the segregation system as a cell cycle checkpoint. Correct segrosome functioning is therefore indispensable for accurate DNA segregation. Here, we combine biochemical reconstruction and structural and biophysical analysis to bring light to the architecture of the segrosome complex in Type III partition systems. We present the particular features of the centromere site, tubC, of the model system encoded in Clostridium botulinum prophage c-st. We find that the split centromere site contains two different iterons involved in the binding and spreading of the CBP, TubR. The resulting nucleoprotein complex consists of a novel double-ring structure that covers part of the predicted promoter. Single molecule data provides a mechanism for the formation of the segrosome structure based on DNA bending and unwinding upon TubR binding.

The basic tilted helix bundle domain of the prolyl isomerase FKBP25 is a novel double-stranded RNA binding module

PubMed Central

Dilworth, David; Bonnafous, Pierre; Edoo, Amiirah Bibi; Bourbigot, Sarah; Pesek-Jardim, Francy; Gudavicius, Geoff; Serpa, Jason J.; Petrotchenko, Evgeniy V.; Borchers, Christoph H.

2017-01-01

Abstract Prolyl isomerases are defined by a catalytic domain that facilitates the cis–trans interconversion of proline residues. In most cases, additional domains in these enzymes add important biological function, including recruitment to a set of protein substrates. Here, we report that the N-terminal basic tilted helix bundle (BTHB) domain of the human prolyl isomerase FKBP25 confers specific binding to double-stranded RNA (dsRNA). This binding is selective over DNA as well as single-stranded oligonucleotides. We find that FKBP25 RNA-association is required for its nucleolar localization and for the vast majority of its protein interactions, including those with 60S pre-ribosome and early ribosome biogenesis factors. An independent mobility of the BTHB and FKBP catalytic domains supports a model by which the N-terminus of FKBP25 is anchored to regions of dsRNA, whereas the FKBP domain is free to interact with neighboring proteins. Apart from the identification of the BTHB as a new dsRNA-binding module, this domain adds to the growing list of auxiliary functions used by prolyl isomerases to define their primary cellular targets. PMID:29036638

Immunoelectron microscopic double labeling of alkaline phosphatase and penicillinase with colloidal gold in frozen thin sections of Bacillus licheniformis 749/C.

PubMed Central

Guan, T; Ghosh, A; Ghosh, B K

1985-01-01

The subcellular distribution of alkaline phosphatase and penicillinase was determined by double labeling frozen thin sections of Bacillus licheniformis 749/C with colloidal gold-immunoglobulin G (IgG). Antipenicillinase and anti-alkaline phosphatase antibodies were used to prepare complexes with 5- and 15-nm colloidal gold particles, respectively. The character of the labeling of membrane-bound alkaline phosphatase and penicillinase was different: the immunolabels for alkaline phosphatase (15-nm particles) were bound to a few sites at the inner surface of the plasma membrane, and the gold particles formed clusters of various sizes at the binding sites; the immunolabels for penicillinase (5-nm particles), on the other hand, were bound to the plasma membrane in a dispersed and random fashion. In the cytoplasm, immunolabels for both proteins were distributed randomly, and the character of their binding was similar. The labeling was specific: pretreating the frozen thin sections with different concentrations of anti-alkaline phosphatase or penicillinase blocked the binding of the immunolabel prepared with the same antibody. Binding could be fully blocked by pretreatment with 800 micrograms of either antibody per ml. Images PMID:3876329

An energy-optimal solution for transportation control of cranes with double pendulum dynamics: Design and experiments

NASA Astrophysics Data System (ADS)

Sun, Ning; Wu, Yiming; Chen, He; Fang, Yongchun

2018-03-01

Underactuated cranes play an important role in modern industry. Specifically, in most situations of practical applications, crane systems exhibit significant double pendulum characteristics, which makes the control problem quite challenging. Moreover, most existing planners/controllers obtained with standard methods/techniques for double pendulum cranes cannot minimize the energy consumption when fulfilling the transportation tasks. Therefore, from a practical perspective, this paper proposes an energy-optimal solution for transportation control of double pendulum cranes. By applying the presented approach, the transportation objective, including fast trolley positioning and swing elimination, is achieved with minimized energy consumption, and the residual oscillations are suppressed effectively with all the state constrains being satisfied during the entire transportation process. As far as we know, this is the first energy-optimal solution for transportation control of underactuated double pendulum cranes with various state and control constraints. Hardware experimental results are included to verify the effectiveness of the proposed approach, whose superior performance is reflected by being experimentally compared with some comparative controllers.

Reexamine structures and relative stability of medium-sized silicon clusters: Low-lying endohedral fullerene-like clusters Si 30-Si 38

NASA Astrophysics Data System (ADS)

Yoo, Soohaeng; Shao, Nan; Zeng, X. C.

2009-10-01

We report improved results of lowest-lying silicon clusters Si 30-Si 38. A large population of low-energy clusters are collected from previous searches by several research groups and the binding energies of these clusters are computed using density-functional theory (DFT) methods. Best candidates (isomers with high binding energies) are identified from the screening calculations. Additional constrained search is then performed for the best candidates using the basin-hopping method combined with DFT geometry optimization. The obtained low-lying clusters are classified according to binding energies computed using either the Perdew-Burke-Ernzerhof (PBE) functional or the Becke exchange and Lee-Yang-Parr correlation (BLYP) functional. We propose to rank low-lying clusters according to the mean PBE/BLYP binding energies in view that the PBE functional tends to give greater binding energies for more compact clusters whereas the BLYP functional tends to give greater binding energies for less compact clusters or clusters composed of small-sized magic-number clusters. Except for Si 30, the new search confirms again that medium-size silicon clusters Si 31-Si 38 constructed with proper fullerene cage motifs are most promising to be the lowest-energy structures.

Maintenance Energy Requirements of Double-Muscled Belgian Blue Beef Cows

PubMed Central

Fiems, Leo O.; De Boever, Johan L.; Vanacker, José M.; De Campeneere, Sam

2015-01-01

Simple Summary Double-muscled Belgian Blue animals are extremely lean, characterized by a deviant muscle fiber type with more fast-glycolytic fibers, compared to non-double-muscled animals. This fiber type may result in lower maintenance energy requirements. On the other hand, lean meat animals mostly have a higher rate of protein turnover, which requires more energy for maintenance. Therefore, maintenance requirements of Belgian Blue cows were investigated based on a zero body weight gain. This technique showed that maintenance energy requirements of double-muscled Belgian Blue beef cows were close to the mean requirements of cows of other beef genotypes. Abstract Sixty non-pregnant, non-lactating double-muscled Belgian Blue (DMBB) cows were used to estimate the energy required to maintain body weight (BW). They were fed one of three energy levels for 112 or 140 days, corresponding to approximately 100%, 80% or 70% of their total energy requirements. The relationship between daily energy intake and BW and daily BW change was developed using regression analysis. Maintenance energy requirements were estimated from the regression equation by setting BW gain to zero. Metabolizable and net energy for maintenance amounted to 0.569 ± 0.001 and 0.332 ± 0.001 MJ per kg BW0.75/d, respectively. Maintenance energy requirements were not dependent on energy level (p > 0.10). Parity affected maintenance energy requirements (p < 0.001), although the small numerical differences between parities may hardly be nutritionally relevant. Maintenance energy requirements of DMBB beef cows were close to the mean energy requirements of other beef genotypes reported in the literature. PMID:26479139

Alternative separation of exchange and correlation energies in multi-configuration range-separated density-functional theory.

PubMed

Stoyanova, Alexandrina; Teale, Andrew M; Toulouse, Julien; Helgaker, Trygve; Fromager, Emmanuel

2013-10-07

The alternative separation of exchange and correlation energies proposed by Toulouse et al. [Theor. Chem. Acc. 114, 305 (2005)] is explored in the context of multi-configuration range-separated density-functional theory. The new decomposition of the short-range exchange-correlation energy relies on the auxiliary long-range interacting wavefunction rather than the Kohn-Sham (KS) determinant. The advantage, relative to the traditional KS decomposition, is that the wavefunction part of the energy is now computed with the regular (fully interacting) Hamiltonian. One potential drawback is that, because of double counting, the wavefunction used to compute the energy cannot be obtained by minimizing the energy expression with respect to the wavefunction parameters. The problem is overcome by using short-range optimized effective potentials (OEPs). The resulting combination of OEP techniques with wavefunction theory has been investigated in this work, at the Hartree-Fock (HF) and multi-configuration self-consistent-field (MCSCF) levels. In the HF case, an analytical expression for the energy gradient has been derived and implemented. Calculations have been performed within the short-range local density approximation on H2, N2, Li2, and H2O. Significant improvements in binding energies are obtained with the new decomposition of the short-range energy. The importance of optimizing the short-range OEP at the MCSCF level when static correlation becomes significant has also been demonstrated for H2, using a finite-difference gradient. The implementation of the analytical gradient for MCSCF wavefunctions is currently in progress.

Free Energy-Based Virtual Screening and Optimization of RNase H Inhibitors of HIV-1 Reverse Transcriptase.

PubMed

Zhang, Baofeng; D'Erasmo, Michael P; Murelli, Ryan P; Gallicchio, Emilio

2016-09-30

We report the results of a binding free energy-based virtual screening campaign of a library of 77 α-hydroxytropolone derivatives against the challenging RNase H active site of the reverse transcriptase (RT) enzyme of human immunodeficiency virus-1. Multiple protonation states, rotamer states, and binding modalities of each compound were individually evaluated. The work involved more than 300 individual absolute alchemical binding free energy parallel molecular dynamics calculations and over 1 million CPU hours on national computing clusters and a local campus computational grid. The thermodynamic and structural measures obtained in this work rationalize a series of characteristics of this system useful for guiding future synthetic and biochemical efforts. The free energy model identified key ligand-dependent entropic and conformational reorganization processes difficult to capture using standard docking and scoring approaches. Binding free energy-based optimization of the lead compounds emerging from the virtual screen has yielded four compounds with very favorable binding properties, which will be the subject of further experimental investigations. This work is one of the few reported applications of advanced-binding free energy models to large-scale virtual screening and optimization projects. It further demonstrates that, with suitable algorithms and automation, advanced-binding free energy models can have a useful role in early-stage drug-discovery programs.

Quantum mechanics/molecular mechanics modeling of photoelectron spectra: the carbon 1s core-electron binding energies of ethanol-water solutions.

PubMed

Löytynoja, T; Niskanen, J; Jänkälä, K; Vahtras, O; Rinkevicius, Z; Ågren, H

2014-11-20

Using ethanol-water solutions as illustration, we demonstrate the capability of the hybrid quantum mechanics/molecular mechanics (QM/MM) paradigm to simulate core photoelectron spectroscopy: the binding energies and the chemical shifts. An integrated approach with QM/MM binding energy calculations coupled to preceding molecular dynamics sampling is adopted to generate binding energies averaged over the solute-solvent configurations available at a particular temperature and pressure and thus allowing for a statistical assessment with confidence levels for the final binding energies. The results are analyzed in terms of the contributions in the molecular mechanics model-electrostatic, polarization, and van der Waals-with atom or bond granulation of the corresponding MM charge and polarizability force-fields. The role of extramolecular charge transfer screening of the core-hole and explicit hydrogen bonding is studied by extending the QM core to cover the first solvation shell. The results are compared to those obtained from pure electrostatic and polarizable continuum models. Particularly, the dependence of the carbon 1s binding energies with respect to the ethanol concentration is studied. Our results indicate that QM/MM can be used as an all-encompassing model to study photoelectron binding energies and chemical shifts in solvent environments.

DNA purification by triplex-affinity capture and affinity capture electrophoresis

DOEpatents

Cantor, Charles R.; Ito, Takashi; Smith, Cassandra L.

1996-01-01

The invention provides a method for purifying or isolating double stranded DNA intact using triple helix formation. The method includes the steps of complexing an oligonucleotide and double stranded DNA to generate a triple helix and immobilization of the triple helix on a solid phase by means of a molecular recognition system such as avidin/biotin. The purified DNA is then recovered intact by treating the solid phase with a reagent that breaks the bonds between the oligonucleotide and the intact double stranded DNA while not affecting the Watson-Crick base pairs of the double helix. The present invention also provides a method for purifying or isolating double stranded DNA intact by complexing the double stranded DNA with a specific binding partner and recovering the complex during electrophoresis by immobilizing it on a solid phase trap imbedded in an electrophoretic gel.

Parallel electric fields in extragalactic jets - Double layers and anomalous resistivity in symbiotic relationships

NASA Technical Reports Server (NTRS)

Borovsky, J. E.

1986-01-01

After examining the properties of Coulomb-collision resistivity, anomalous (collective) resistivity, and double layers, a hybrid anomalous-resistivity/double-layer model is introduced. In this model, beam-driven waves on both sides of a double layer provide electrostatic plasma-wave turbulence that greatly reduces the mobility of charged particles. These regions then act to hold open a density cavity within which the double layer resides. In the double layer, electrical energy is dissipated with 100 percent efficiency into high-energy particles, creating conditions optimal for the collective emission of polarized radio waves.

Binding free energy analysis of protein-protein docking model structures by evERdock.

PubMed

Takemura, Kazuhiro; Matubayasi, Nobuyuki; Kitao, Akio

2018-03-14

To aid the evaluation of protein-protein complex model structures generated by protein docking prediction (decoys), we previously developed a method to calculate the binding free energies for complexes. The method combines a short (2 ns) all-atom molecular dynamics simulation with explicit solvent and solution theory in the energy representation (ER). We showed that this method successfully selected structures similar to the native complex structure (near-native decoys) as the lowest binding free energy structures. In our current work, we applied this method (evERdock) to 100 or 300 model structures of four protein-protein complexes. The crystal structures and the near-native decoys showed the lowest binding free energy of all the examined structures, indicating that evERdock can successfully evaluate decoys. Several decoys that show low interface root-mean-square distance but relatively high binding free energy were also identified. Analysis of the fraction of native contacts, hydrogen bonds, and salt bridges at the protein-protein interface indicated that these decoys were insufficiently optimized at the interface. After optimizing the interactions around the interface by including interfacial water molecules, the binding free energies of these decoys were improved. We also investigated the effect of solute entropy on binding free energy and found that consideration of the entropy term does not necessarily improve the evaluations of decoys using the normal model analysis for entropy calculation.

Binding free energy analysis of protein-protein docking model structures by evERdock

NASA Astrophysics Data System (ADS)

Takemura, Kazuhiro; Matubayasi, Nobuyuki; Kitao, Akio

2018-03-01

To aid the evaluation of protein-protein complex model structures generated by protein docking prediction (decoys), we previously developed a method to calculate the binding free energies for complexes. The method combines a short (2 ns) all-atom molecular dynamics simulation with explicit solvent and solution theory in the energy representation (ER). We showed that this method successfully selected structures similar to the native complex structure (near-native decoys) as the lowest binding free energy structures. In our current work, we applied this method (evERdock) to 100 or 300 model structures of four protein-protein complexes. The crystal structures and the near-native decoys showed the lowest binding free energy of all the examined structures, indicating that evERdock can successfully evaluate decoys. Several decoys that show low interface root-mean-square distance but relatively high binding free energy were also identified. Analysis of the fraction of native contacts, hydrogen bonds, and salt bridges at the protein-protein interface indicated that these decoys were insufficiently optimized at the interface. After optimizing the interactions around the interface by including interfacial water molecules, the binding free energies of these decoys were improved. We also investigated the effect of solute entropy on binding free energy and found that consideration of the entropy term does not necessarily improve the evaluations of decoys using the normal model analysis for entropy calculation.

A Comprehensive Docking and MM/GBSA Rescoring Study of Ligand Recognition upon Binding Antithrombin

DOE PAGES

Zhang, Xiaohua; Perez-Sanchez, Horacio; C. Lightstone, Felice

2017-04-06

A high-throughput virtual screening pipeline has been extended from single energetically minimized structure Molecular Mechanics/Generalized Born Surface Area (MM/GBSA) rescoring to ensemble-average MM/GBSA rescoring. The correlation coefficient (R2) of calculated and experimental binding free energies for a series of antithrombin ligands has been improved from 0.36 to 0.69 when switching from the single-structure MM/GBSA rescoring to ensemble-average one. The electrostatic interactions in both solute and solvent are identified to play an important role in determining the binding free energy after the decomposition of the calculated binding free energy. Furthermore, the increasing negative charge of the compounds provides a more favorablemore » electrostatic energy change but creates a higher penalty for the solvation free energy. Such a penalty is compensated by the electrostatic energy change, which results in a better binding affinity. A highly hydrophobic ligand is determined by the docking program to be a non-specific binder. Finally, these results have demonstrated that it is very important to keep a few top poses for rescoring, if the binding is non-specific or the binding mode is not well determined by the docking calculation.« less

A Comprehensive Docking and MM/GBSA Rescoring Study of Ligand Recognition upon Binding Antithrombin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Xiaohua; Perez-Sanchez, Horacio; C. Lightstone, Felice

A high-throughput virtual screening pipeline has been extended from single energetically minimized structure Molecular Mechanics/Generalized Born Surface Area (MM/GBSA) rescoring to ensemble-average MM/GBSA rescoring. The correlation coefficient (R2) of calculated and experimental binding free energies for a series of antithrombin ligands has been improved from 0.36 to 0.69 when switching from the single-structure MM/GBSA rescoring to ensemble-average one. The electrostatic interactions in both solute and solvent are identified to play an important role in determining the binding free energy after the decomposition of the calculated binding free energy. Furthermore, the increasing negative charge of the compounds provides a more favorablemore » electrostatic energy change but creates a higher penalty for the solvation free energy. Such a penalty is compensated by the electrostatic energy change, which results in a better binding affinity. A highly hydrophobic ligand is determined by the docking program to be a non-specific binder. Finally, these results have demonstrated that it is very important to keep a few top poses for rescoring, if the binding is non-specific or the binding mode is not well determined by the docking calculation.« less

Cisplatin Radiosensitization of DNA Irradiated with 2-20 eV Electrons: Role of Transient Anions.

PubMed

Bao, Qianhong; Chen, Yunfeng; Zheng, Yi; Sanche, Léon

2014-06-20

Platinum chemotherapeutic agents, such as cisplatin ( cis -diamminedichloroplatinum(II)), can act as radiosensitizers when bound covalently to nuclear DNA in cancer cells. This radiosensitization is largely due to an increase in DNA damage induced by low-energy secondary electrons, produced in large quantities by high-energy radiation. We report the yields of single- and double-strand breaks (SSB and DSB) and interduplex cross-links (CL) induced by electrons of 1.6-19.6 eV (i.e., the yield functions) incident on 5 monolayer (ML) films of cisplatin-DNA complexes. These yield functions are compared with those previously recorded with 5 ML films of unmodified plasmid DNA. Binding of five cisplatin molecules to plasmid DNA (3197 base pairs) enhances SSB, DSB, and CL by factors varying, from 1.2 to 2.8, 1.4 to 3.5, and 1.2 to 2.7, respectively, depending on electron energy. All yield functions exhibit structures around 5 and 10 eV that can be attributed to enhancement of bond scission, via the initial formation of core-excited resonances associated with π → π * transitions of the bases. This increase in damage is interpreted as arising from a modification of the parameters of the corresponding transient anions already present in nonmodified DNA, particularly those influencing molecular dissociation. Two additional resonances, specific to cisplatin-modified DNA, are formed at 13.6 and 17.6 eV in the yield function of SSB. Furthermore, cisplatin binding causes the induction of DSB by electrons of 1.6-3.6 eV, i.e., in an energy region where a DSB cannot be produced by a single electron in pure DNA. Breaking two bonds with a subexcitation-energy electron is tentatively explained by a charge delocalization mechanism, where a single electron occupies simultaneously two σ * bonds linking the Pt atom to guanine bases on opposite strands.

Cisplatin Radiosensitization of DNA Irradiated with 2–20 eV Electrons: Role of Transient Anions

PubMed Central

Bao, Qianhong; Chen, Yunfeng; Zheng, Yi; Sanche, Léon

2015-01-01

Platinum chemotherapeutic agents, such as cisplatin (cis-diamminedichloroplatinum(II)), can act as radiosensitizers when bound covalently to nuclear DNA in cancer cells. This radiosensitization is largely due to an increase in DNA damage induced by low-energy secondary electrons, produced in large quantities by high-energy radiation. We report the yields of single- and double-strand breaks (SSB and DSB) and interduplex cross-links (CL) induced by electrons of 1.6–19.6 eV (i.e., the yield functions) incident on 5 monolayer (ML) films of cisplatin–DNA complexes. These yield functions are compared with those previously recorded with 5 ML films of unmodified plasmid DNA. Binding of five cisplatin molecules to plasmid DNA (3197 base pairs) enhances SSB, DSB, and CL by factors varying, from 1.2 to 2.8, 1.4 to 3.5, and 1.2 to 2.7, respectively, depending on electron energy. All yield functions exhibit structures around 5 and 10 eV that can be attributed to enhancement of bond scission, via the initial formation of core-excited resonances associated with π → π* transitions of the bases. This increase in damage is interpreted as arising from a modification of the parameters of the corresponding transient anions already present in nonmodified DNA, particularly those influencing molecular dissociation. Two additional resonances, specific to cisplatin-modified DNA, are formed at 13.6 and 17.6 eV in the yield function of SSB. Furthermore, cisplatin binding causes the induction of DSB by electrons of 1.6–3.6 eV, i.e., in an energy region where a DSB cannot be produced by a single electron in pure DNA. Breaking two bonds with a subexcitation-energy electron is tentatively explained by a charge delocalization mechanism, where a single electron occupies simultaneously two σ* bonds linking the Pt atom to guanine bases on opposite strands. PMID:26793285

On binding energy of trions in bulk materials

NASA Astrophysics Data System (ADS)

Filikhin, Igor; Kezerashvili, Roman Ya.; Vlahovic, Branislav

2018-03-01

We study the negatively T- and positively T+ charged trions in bulk materials in the effective mass approximation within the framework of a potential model. The binding energies of trions in various semiconductors are calculated by employing Faddeev equation in configuration space. Results of calculations of the binding energies for T- are consistent with previous computational studies and are in reasonable agreement with experimental measurements, while the T+ is unbound for all considered cases. The mechanism of formation of the binding energy of trions is analyzed by comparing contributions of a mass-polarization term related to kinetic energy operators and a term related to the Coulomb repulsion of identical particles.

Absolute binding free energies between T4 lysozyme and 141 small molecules: calculations based on multiple rigid receptor configurations

PubMed Central

Xie, Bing; Nguyen, Trung Hai; Minh, David D. L.

2017-01-01

We demonstrate the feasibility of estimating protein-ligand binding free energies using multiple rigid receptor configurations. Based on T4 lysozyme snapshots extracted from six alchemical binding free energy calculations with a flexible receptor, binding free energies were estimated for a total of 141 ligands. For 24 ligands, the calculations reproduced flexible-receptor estimates with a correlation coefficient of 0.90 and a root mean square error of 1.59 kcal/mol. The accuracy of calculations based on Poisson-Boltzmann/Surface Area implicit solvent was comparable to previously reported free energy calculations. PMID:28430432

Exploring the free-energy landscape of carbohydrate-protein complexes: development and validation of scoring functions considering the binding-site topology

NASA Astrophysics Data System (ADS)

Eid, Sameh; Saleh, Noureldin; Zalewski, Adam; Vedani, Angelo

2014-12-01

Carbohydrates play a key role in a variety of physiological and pathological processes and, hence, represent a rich source for the development of novel therapeutic agents. Being able to predict binding mode and binding affinity is an essential, yet lacking, aspect of the structure-based design of carbohydrate-based ligands. We assembled a diverse data set comprising 273 carbohydrate-protein crystal structures with known binding affinity and evaluated the prediction accuracy of a large collection of well-established scoring and free-energy functions, as well as combinations thereof. Unfortunately, the tested functions were not capable of reproducing binding affinities in the studied complexes. To simplify the complex free-energy surface of carbohydrate-protein systems, we classified the studied proteins according to the topology and solvent exposure of the carbohydrate-binding site into five distinct categories. A free-energy model based on the proposed classification scheme reproduced binding affinities in the carbohydrate data set with an r 2 of 0.71 and root-mean-squared-error of 1.25 kcal/mol ( N = 236). The improvement in model performance underlines the significance of the differences in the local micro-environments of carbohydrate-binding sites and demonstrates the usefulness of calibrating free-energy functions individually according to binding-site topology and solvent exposure.

Deinococcus radiodurans RecA nucleoprotein filaments characterized at the single-molecule level with optical tweezers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pobegalov, Georgii, E-mail: george.pobegalov@nanobio.spbstu.ru; Cherevatenko, Galina; Alekseev, Aleksandr

2015-10-23

Deinococcus radiodurans can survive extreme doses of ionizing radiation due to the very efficient DNA repair mechanisms that are able to cope even with hundreds of double-strand breaks. RecA, the critical protein of homologous recombination in bacteria, is one of the key components of the DNA-repair system. Repair of double-strand breaks requires RecA binding to DNA and assembly of the RecA nucleoprotein helical filaments. The Escherichia coli RecA protein (EcRecA) and its interactions with DNA have been extensively studied using various approaches including single-molecule techniques, while the D. radiodurans RecA (DrRecA) remains much less characterized. However, DrRecA shows some remarkable differencesmore » from E. coli homolog. Here we combine microfluidics and single-molecule DNA manipulation with optical tweezers to follow the binding of DrRecA to long double-stranded DNA molecules and probe the mechanical properties of DrRecA nucleoprotein filaments at physiological pH. Our data provide a direct comparison of DrRecA and EcRecA binding to double-stranded DNA under identical conditions. We report a significantly faster filaments assembly as well as lower values of persistence length and contour length for DrRecA nucleoprotein filaments compared to EcRecA. Our results support the existing model of DrRecA forming more frequent and less continuous filaments relative to those of EcRecA. - Highlights: • We investigate Deinococcus radiodurans RecA interactions with long double-stranded DNA at the single-molecule level. • At physiological pH D. radiodurans RecA forms nucleoprotein filaments significantly faster relative to Escherichia coli RecA. • D. radiodurans RecA-dsDNA nucleoprotein filaments are more flexible and slightly shorter compared to those of E. coli RecA.« less

Unveiling the Atomic-Level Determinants of Acylase-Ligand Complexes: An Experimental and Computational Study.

PubMed

Mollica, Luca; Conti, Gianluca; Pollegioni, Loredano; Cavalli, Andrea; Rosini, Elena

2015-10-26

The industrial production of higher-generation semisynthetic cephalosporins starts from 7-aminocephalosporanic acid (7-ACA), which is obtained by deacylation of the naturally occurring antibiotic cephalosporin C (CephC). The enzymatic process in which CephC is directly converted into 7-ACA by a cephalosporin C acylase has attracted industrial interest because of the prospects of simplifying the process and reducing costs. We recently enhanced the catalytic efficiency on CephC of a glutaryl acylase from Pseudomonas N176 (named VAC) by a protein engineering approach and solved the crystal structures of wild-type VAC and the H57βS-H70βS VAC double variant. In the present work, experimental measurements on several CephC derivatives and six VAC variants were carried out, and the binding of ligands into the VAC active site was investigated at an atomistic level by means of molecular docking and molecular dynamics simulations and analyzed on the basis of the molecular geometry of encounter complex formation and protein-ligand potential of mean force profiles. The observed significant correlation between the experimental data and estimated binding energies highlights the predictive power of our computational method to identify the ligand binding mode. The present experimental-computational study is well-suited both to provide deep insight into the reaction mechanism of cephalosporin C acylase and to improve the efficiency of the corresponding industrial process.

Screening for lead compounds and herbal extracts with potential anti-influenza viral activity.

PubMed

Klaywong, Konrapob; Khutrakul, Gachagorn; Choowongkomon, Kiattawee; Lekcharoensuk, Chalermpol; Petcharat, Nantawan; Leckcharoensuk, Porntippa; Ramasoota, Pongrama

2014-01-01

Nonstructural protein 1 (NS1) of the highly pathogenic avian influenza virus (H5N1) contains a conserved RNA binding domain (RBD) that inhibits antiviral functions of host-innate immune response. Dimerization of NS1 forms a central groove and binds to double stranded (ds) RNA. This region might serve as a potential drug target. In this study, three dimensional structure model of NS1 RBD protein was constructed and virtual screening was performed to identify lead compounds that bound within and around the central groove. The virtual screening showed that 5 compounds bound within the central groove with binding energy ranging between -16.05 and -17.36 Kcal/mol. Two commercially available compounds, estradiol and veratridine, were selected for using in an in vitro screening assay. The results showed that neither of the compounds could inhibit the association between dsRNA and NS1 RBD protein. In addition, 34 herbal extracts were examined for their inhibitory effects. Five of them were able to inhibit association between NS1 RBD and dsRNA in electrophoresis mobility shift assay. Four herbs, Terminalia belirica, Salacia chinensis, Zingiber montanum and Peltophorum pterocarpum, could reduce > 50% of infectivity of H5N1 in a cell-based assay, and it is worth further studying their potential use as source of antiviral drugs.

Methodological study of computational approaches to address the problem of strong correlations

NASA Astrophysics Data System (ADS)

Lee, Juho

The main focus of this thesis is the detailed investigation of computational methods to tackle strongly correlated materials in which a rich variety of exotic phenomena are found. A many-body problem with sizable electronic correlations can no longer be explained by independent-particle approximations such as density functional theory (DFT) or tight-binding approaches. The influence of an electron to the others is too strong for each electron to be treated as an independent quasiparticle and consequently those standard band-structure methods fail even at a qualitative level. One of the most powerful approaches for strong correlations is the dynamical mean-field theory (DMFT), which has enlightened the understanding of the Mott transition based on the Hubbard model. For realistic applications, the dynamical mean-field theory is combined with various independent-particles approaches. The most widely used one is the DMFT combined with the DFT in the local density approximation (LDA), so-called LDA+DMFT. In this approach, the electrons in the weakly correlated orbitals are calculated by LDA while others in the strongly correlated orbitals are treated by DMFT. Recently, the method combining DMFT with Hedin's GW approximation was also developed, in which the momentum-dependent self-energy is also added. In this thesis, we discuss the application of those methodologies based on DMFT. First, we apply the dynamical mean-field theory to solve the 3-dimensional Hubbard model in Chap. 3. In this application, we model the interface between the thermodynamically coexisting metal and Mott insulator. We show how to model the required slab geometry and extract the electronic spectra. We construct an effective Landau free energy and compute the variation of its parameters across the phase diagram. Finally, using a linear mixture of the density and double-occupancy, we identify a natural Ising order parameter which unifies the treatment of the bandwidth and filling controlled Mott transitions. Secondly, we study the double-counting problem, a subtle issue that arises in LDA+DMFT. We propose a highly precise double-counting functional, in which the intersection of LDA and DMFT is calculated exactly, and implement a parameter-free version of the LDA+DMFT that is tested on one of the simplest strongly correlated systems, the H2 molecule. We show that the exact double-counting treatment along with a good DMFT projector leads to very accurate and total energy and excitation spectrum of H2 molecule. Finally, we implement various versions of GW+DMFT, in its fully self-consistent way, one shot GW approximation, and quasiparticle self-consistent scheme, and studied how well these combined methods perform on H2 molecule as compared to more established methods such as LDA+DMFT. We found that most flavors of GW+DMFT break down in strongly correlated regime due to causality violation. Among GW+DMFT methods, only the self-consistent quasiparticle GW+DMFT with static double-counting, and a new method with causal double-counting, correctly recover the atomic limit at large H-atom separation. While some flavors of GW+DMFT improve the single-electron spectra of LDA+DMFT, the total energy is best predicted by LDA+DMFT, for which the exact double-counting is known, and is static.

Microwave-Induced Inactivation of DNA-Based Hybrid Catalyst in Asymmetric Catalysis

PubMed Central

Zhao, Hua; Shen, Kai

2015-01-01

DNA-based hybrid catalysts have gained strong interests in asymmetric reactions. However, to maintain the high enantioselectivity, these reactions are usually conducted at relatively low temperatures (e.g. < 5 °C) for 2–3 days. Aiming to improve the reaction’s turnover rate, we evaluated microwave irradiation with simultaneous cooling as potential energy source since this method has been widely used to accelerate various chemical and enzymatic reactions. However, our data indicated that microwave irradiation induced an inactivation of DNA-based hybrid catalyst even at low temperatures (such as 5 °C). Circular dichroism (CD) spectra and gel electrophoresis of DNA suggest that microwave exposure degrades DNA molecules and disrupts DNA double-stranded structures, causing changes of DNA–metal ligand binding properties and thus poor DNA catalytic performance. PMID:26712696

Allosteric Ligand Binding and Anisotropic Energy Flow in Albumin

NASA Astrophysics Data System (ADS)

Dyer, Brian

2014-03-01

Protein allostery usually involves propagation of local structural changes through the protein to a remote site. Coupling of structural changes at remote sites is thought to occur through anisotropic energy transport, but the nature of this process is poorly understood. We have studied the relationship between allosteric interactions of remote ligand binding sites of the protein and energy flow through the structure of bovine serum albumin (BSA). We applied ultrafast infrared spectroscopy to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic flow through the protein structure following input of thermal energy into the flexible ligand binding sites. We also observe anisotropic heat flow through the structure, without local heating of the rigid helix bundles that connect these sites. We will discuss the implications of this efficient energy transport mechanism with regard to the allosteric propagation of binding energy through the connecting helix structures.

Funnel metadynamics as accurate binding free-energy method

PubMed Central

Limongelli, Vittorio; Bonomi, Massimiliano; Parrinello, Michele

2013-01-01

A detailed description of the events ruling ligand/protein interaction and an accurate estimation of the drug affinity to its target is of great help in speeding drug discovery strategies. We have developed a metadynamics-based approach, named funnel metadynamics, that allows the ligand to enhance the sampling of the target binding sites and its solvated states. This method leads to an efficient characterization of the binding free-energy surface and an accurate calculation of the absolute protein–ligand binding free energy. We illustrate our protocol in two systems, benzamidine/trypsin and SC-558/cyclooxygenase 2. In both cases, the X-ray conformation has been found as the lowest free-energy pose, and the computed protein–ligand binding free energy in good agreement with experiments. Furthermore, funnel metadynamics unveils important information about the binding process, such as the presence of alternative binding modes and the role of waters. The results achieved at an affordable computational cost make funnel metadynamics a valuable method for drug discovery and for dealing with a variety of problems in chemistry, physics, and material science. PMID:23553839

Enzyme activation through the utilization of intrinsic dianion binding energy.

PubMed

Amyes, T L; Malabanan, M M; Zhai, X; Reyes, A C; Richard, J P

2017-03-01

We consider 'the proposition that the intrinsic binding energy that results from the noncovalent interaction of a specific substrate with the active site of the enzyme is considerably larger than is generally believed. An important part of this binding energy may be utilized to provide the driving force for catalysis, so that the observed binding energy represents only what is left over after this utilization' [Jencks,W.P. (1975) Adv. Enzymol. Relat. Areas. Mol. Biol. , , 219-410]. The large ~12 kcal/mol intrinsic substrate phosphodianion binding energy for reactions catalyzed by triosephosphate isomerase (TIM), orotidine 5'-monophosphate decarboxylase and glycerol-3-phosphate dehydrogenase is divided into 4-6 kcal/mol binding energy that is expressed on the formation of the Michaelis complex in anchoring substrates to the respective enzyme, and 6-8 kcal/mol binding energy that is specifically expressed at the transition state in activating the respective enzymes for catalysis. A structure-based mechanism is described where the dianion binding energy drives a conformational change that activates these enzymes for catalysis. Phosphite dianion plays the active role of holding TIM in a high-energy closed active form, but acts as passive spectator in showing no effect on transition-state structure. The result of studies on mutant enzymes is presented, which support the proposal that the dianion-driven enzyme conformational change plays a role in enhancing the basicity of side chain of E167, the catalytic base, by clamping the base between a pair of hydrophobic side chains. The insight these results provide into the architecture of enzyme active sites and the development of strategies for the de novo design of protein catalysts is discussed. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

dsRNA-protein interactions studied by molecular dynamics techniques. Unravelling dsRNA recognition by DCL1.

PubMed

Drusin, Salvador I; Suarez, Irina P; Gauto, Diego F; Rasia, Rodolfo M; Moreno, Diego M

2016-04-15

Double stranded RNA (dsRNA) participates in several biological processes, where RNA molecules acquire secondary structure inside the cell through base complementarity. The double stranded RNA binding domain (dsRBD) is one of the main protein folds that is able to recognize and bind to dsRNA regions. The N-terminal dsRBD of DCL1 in Arabidopsis thaliana (DCL1-1), in contrast to other studied dsRBDs, lacks a stable structure, behaving as an intrinsically disordered protein. DCL1-1 does however recognize dsRNA by acquiring a canonical fold in the presence of its substrate. Here we present a detailed modeling and molecular dynamics study of dsRNA recognition by DCL1-1. We found that DCL1-1 forms stable complexes with different RNAs and we characterized the residues involved in binding. Although the domain shows a binding loop substantially shorter than other homologs, it can still interact with the dsRNA and results in bending of the dsRNA A-type helix. Furthermore, we found that R8, a non-conserved residue located in the first dsRNA binding region, recognizes preferentially mismatched base pairs. We discuss our findings in the context of the function of DCL1-1 within the microRNA processing complex. Copyright © 2016 Elsevier Inc. All rights reserved.

The Double Face of Mucin-Type O-Glycans in Lectin-Mediated Infection and Immunity.

PubMed

Morozov, Vasily; Borkowski, Julia; Hanisch, Franz-Georg

2018-05-11

Epithelial human blood group antigens (HBGAs) on O-glycans play roles in pathogen binding and the initiation of infection, while similar structures on secretory mucins exert protective functions. These double-faced features of O-glycans in infection and innate immunity are reviewed based on two instructive examples of bacterial and viral pathogens. Helicobacter pylori represents a class 1 carcinogen in the human stomach. By expressing blood group antigen-binding adhesin ( BabA ) and LabA adhesins that bind to Lewis-b and LacdiNAc, respectively, H. pylori colocalizes with the mucin MUC5AC in gastric surface epithelia, but not with MUC6, which is cosecreted with trefoil factor family 2 ( TFF2 ) by deep gastric glands. Both components of the glandular secretome are concertedly up-regulated upon infection. While MUC6 expresses GlcNAc-capped glycans as natural antibiotics for H. pylori growth control, TFF2 may function as a probiotic lectin. In viral infection human noroviruses of the GII genogroup interact with HBGAs via their major capsid protein, VP1. HBGAs on human milk oligosaccharides (HMOs) may exert protective functions by binding to the P2 domain pocket on the capsid. We discuss structural details of the P2 carbohydrate-binding pocket in interaction with blood group H/Lewis-b HMOs and fucoidan-derived oligofucoses as effective interactors for the most prevalent norovirus strains, GII.4 and GII.17.

Pyrene-nucleobase conjugates: synthesis, oligonucleotide binding and confocal bioimaging studies.

PubMed

Jabłoński, Artur; Fritz, Yannic; Wagenknecht, Hans-Achim; Czerwieniec, Rafał; Bernaś, Tytus; Trzybiński, Damian; Woźniak, Krzysztof; Kowalski, Konrad

2017-01-01

Fluorescent pyrene-linker-nucleobase (nucleobase = thymine, adenine) conjugates with carbonyl and hydroxy functionalities in the linker were synthesized and characterized. X-ray single-crystal structure analysis performed for the pyrene-C(O)CH 2 CH 2 -thymine ( 2 ) conjugate reveals dimers of molecules 2 stabilized by hydrogen bonds between the thymine moieties. The photochemical characterization showed structure-dependent fluorescence properties of the investigated compounds. The conjugates bearing a carbonyl function represent weak emitters as compared to compounds with a hydroxy function in the linker. The self-assembly properties of pyrene nucleobases were investigated in respect to their binding to single and double strand oligonucleotides in water and in buffer solution. In respect to the complementary oligothymidine T 10 template in water, compounds 3 and 5 both show a self-assembling behavior according to canonical base-base pairing. However, in buffer solution, derivative 5 was much more effective than 3 in binding to the T 10 template. Furthermore the adenine derivative 5 binds to the double-stranded (dA) 10 -T 10 template with a self-assembly ratio of 112%. Such a high value of a self-assembly ratio can be rationalized by a triple-helix-like binding, intercalation, or a mixture of both. Remarkably, compound 5 also shows dual staining pattern in living HeLa cells. Confocal microscopy confirmed that 5 predominantly stains mitochondria but it also accumulates in the nucleoli of the cells.

Role of Ligand Reorganization and Conformational Restraints on the Binding Free Energies of DAPY Non-Nucleoside Inhibitors to HIV Reverse Transcriptase

PubMed Central

Gallicchio, Emilio

2012-01-01

The results of computer simulations of the binding of etravirine (TMC125) and rilpivirine (TMC278) to HIV reverse transcriptase are reported. It is confirmed that consistent binding free energy estimates are obtained with or without the application of torsional restraints when the free energies of imposing the restraints are taken into account. The restraints have a smaller influence on the thermodynamics and apparent kinetics of binding of TMC125 compared to the more flexible TMC278 inhibitor. The concept of the reorganization free energy of binding is useful to understand and categorize these effects. Contrary to expectations, the use of conformational restraints did not consistently enhance convergence of binding free energy estimates due to suppression of binding/unbinding pathways and due to the influence of rotational degrees of freedom not directly controlled by the restraints. Physical insights concerning the thermodynamic driving forces for binding and the role of “jiggling” and “wiggling” motion of the ligands are discussed. Based on these insights we conclude that an ideal inhibitor, if chemically realizable, would possess the electrostatic charge distribution of TMC125, so as to form strong interactions with the receptor, and the larger and more flexible substituents of TMC278, so as to minimize reorganization free energy penalties and the effects of resistance mutations, suitably modified, as in TMC125, so as to disfavor the formation of non-binding competent extended conformations when free in solution. PMID:22708073

Integrating water exclusion theory into βcontacts to predict binding free energy changes and binding hot spots

PubMed Central

2014-01-01

Background Binding free energy and binding hot spots at protein-protein interfaces are two important research areas for understanding protein interactions. Computational methods have been developed previously for accurate prediction of binding free energy change upon mutation for interfacial residues. However, a large number of interrupted and unimportant atomic contacts are used in the training phase which caused accuracy loss. Results This work proposes a new method, βACV ASA , to predict the change of binding free energy after alanine mutations. βACV ASA integrates accessible surface area (ASA) and our newly defined β contacts together into an atomic contact vector (ACV). A β contact between two atoms is a direct contact without being interrupted by any other atom between them. A β contact’s potential contribution to protein binding is also supposed to be inversely proportional to its ASA to follow the water exclusion hypothesis of binding hot spots. Tested on a dataset of 396 alanine mutations, our method is found to be superior in classification performance to many other methods, including Robetta, FoldX, HotPOINT, an ACV method of β contacts without ASA integration, and ACV ASA methods (similar to βACV ASA but based on distance-cutoff contacts). Based on our data analysis and results, we can draw conclusions that: (i) our method is powerful in the prediction of binding free energy change after alanine mutation; (ii) β contacts are better than distance-cutoff contacts for modeling the well-organized protein-binding interfaces; (iii) β contacts usually are only a small fraction number of the distance-based contacts; and (iv) water exclusion is a necessary condition for a residue to become a binding hot spot. Conclusions βACV ASA is designed using the advantages of both β contacts and water exclusion. It is an excellent tool to predict binding free energy changes and binding hot spots after alanine mutation. PMID:24568581

NMR Reveals Double Occupancy of Quinone-type Ligands in the Catalytic Quinone Binding Site of the Na+-translocating NADH:Quinone Oxidoreductase from Vibrio cholerae*

PubMed Central

Nedielkov, Ruslan; Steffen, Wojtek; Steuber, Julia; Möller, Heiko M.

2013-01-01

The sodium ion-translocating NADH:quinone oxidoreductase (Na+-NQR) from the pathogen Vibrio cholerae exploits the free energy liberated during oxidation of NADH with ubiquinone to pump sodium ions across the cytoplasmic membrane. The Na+-NQR consists of four membrane-bound subunits NqrBCDE and the peripheral NqrF and NqrA subunits. NqrA binds ubiquinone-8 as well as quinones with shorter prenyl chains (ubiquinone-1 and ubiquinone-2). Here we show that the quinone derivative 2,5-dibromo-3-methyl-6-isopropyl-p-benzoquinone (DBMIB), a known inhibitor of the bc1 and b6f complexes found in mitochondria and chloroplasts, also inhibits quinone reduction by the Na+-NQR in a mixed inhibition mode. Tryptophan fluorescence quenching and saturation transfer difference NMR experiments in the presence of Na+-NQR inhibitor (DBMIB or 2-n-heptyl-4-hydroxyquinoline N-oxide) indicate that two quinone analog ligands are bound simultaneously by the NqrA subunit with very similar interaction constants as observed with the holoenzyme complex. We conclude that the catalytic site of quinone reduction is located on NqrA. The two ligands bind to an extended binding pocket in direct vicinity to each other as demonstrated by interligand Overhauser effects between ubiquinone-1 and DBMIB or 2-n-heptyl-4-hydroxyquinoline N-oxide, respectively. We propose that a similar spatially close arrangement of the native quinone substrates is also operational in vivo, enhancing the catalytic efficiency during the final electron transfer steps in the Na+-NQR. PMID:24003222

Ca2+-binding Motif of βγ-Crystallins*

PubMed Central

Srivastava, Shanti Swaroop; Mishra, Amita; Krishnan, Bal; Sharma, Yogendra

2014-01-01

βγ-Crystallin-type double clamp (N/D)(N/D)XX(S/T)S motif is an established but sparsely investigated motif for Ca2+ binding. A βγ-crystallin domain is formed of two Greek key motifs, accommodating two Ca2+-binding sites. βγ-Crystallins make a separate class of Ca2+-binding proteins (CaBP), apparently a major group of CaBP in bacteria. Paralleling the diversity in βγ-crystallin domains, these motifs also show great diversity, both in structure and in function. Although the expression of some of them has been associated with stress, virulence, and adhesion, the functional implications of Ca2+ binding to βγ-crystallins in mediating biological processes are yet to be elucidated. PMID:24567326

Large scale free energy calculations for blind predictions of protein-ligand binding: the D3R Grand Challenge 2015.

PubMed

Deng, Nanjie; Flynn, William F; Xia, Junchao; Vijayan, R S K; Zhang, Baofeng; He, Peng; Mentes, Ahmet; Gallicchio, Emilio; Levy, Ronald M

2016-09-01

We describe binding free energy calculations in the D3R Grand Challenge 2015 for blind prediction of the binding affinities of 180 ligands to Hsp90. The present D3R challenge was built around experimental datasets involving Heat shock protein (Hsp) 90, an ATP-dependent molecular chaperone which is an important anticancer drug target. The Hsp90 ATP binding site is known to be a challenging target for accurate calculations of ligand binding affinities because of the ligand-dependent conformational changes in the binding site, the presence of ordered waters and the broad chemical diversity of ligands that can bind at this site. Our primary focus here is to distinguish binders from nonbinders. Large scale absolute binding free energy calculations that cover over 3000 protein-ligand complexes were performed using the BEDAM method starting from docked structures generated by Glide docking. Although the ligand dataset in this study resembles an intermediate to late stage lead optimization project while the BEDAM method is mainly developed for early stage virtual screening of hit molecules, the BEDAM binding free energy scoring has resulted in a moderate enrichment of ligand screening against this challenging drug target. Results show that, using a statistical mechanics based free energy method like BEDAM starting from docked poses offers better enrichment than classical docking scoring functions and rescoring methods like Prime MM-GBSA for the Hsp90 data set in this blind challenge. Importantly, among the three methods tested here, only the mean value of the BEDAM binding free energy scores is able to separate the large group of binders from the small group of nonbinders with a gap of 2.4 kcal/mol. None of the three methods that we have tested provided accurate ranking of the affinities of the 147 active compounds. We discuss the possible sources of errors in the binding free energy calculations. The study suggests that BEDAM can be used strategically to discriminate binders from nonbinders in virtual screening and to more accurately predict the ligand binding modes prior to the more computationally expensive FEP calculations of binding affinity.

Large scale free energy calculations for blind predictions of protein-ligand binding: the D3R Grand Challenge 2015

NASA Astrophysics Data System (ADS)

Deng, Nanjie; Flynn, William F.; Xia, Junchao; Vijayan, R. S. K.; Zhang, Baofeng; He, Peng; Mentes, Ahmet; Gallicchio, Emilio; Levy, Ronald M.

2016-09-01

We describe binding free energy calculations in the D3R Grand Challenge 2015 for blind prediction of the binding affinities of 180 ligands to Hsp90. The present D3R challenge was built around experimental datasets involving Heat shock protein (Hsp) 90, an ATP-dependent molecular chaperone which is an important anticancer drug target. The Hsp90 ATP binding site is known to be a challenging target for accurate calculations of ligand binding affinities because of the ligand-dependent conformational changes in the binding site, the presence of ordered waters and the broad chemical diversity of ligands that can bind at this site. Our primary focus here is to distinguish binders from nonbinders. Large scale absolute binding free energy calculations that cover over 3000 protein-ligand complexes were performed using the BEDAM method starting from docked structures generated by Glide docking. Although the ligand dataset in this study resembles an intermediate to late stage lead optimization project while the BEDAM method is mainly developed for early stage virtual screening of hit molecules, the BEDAM binding free energy scoring has resulted in a moderate enrichment of ligand screening against this challenging drug target. Results show that, using a statistical mechanics based free energy method like BEDAM starting from docked poses offers better enrichment than classical docking scoring functions and rescoring methods like Prime MM-GBSA for the Hsp90 data set in this blind challenge. Importantly, among the three methods tested here, only the mean value of the BEDAM binding free energy scores is able to separate the large group of binders from the small group of nonbinders with a gap of 2.4 kcal/mol. None of the three methods that we have tested provided accurate ranking of the affinities of the 147 active compounds. We discuss the possible sources of errors in the binding free energy calculations. The study suggests that BEDAM can be used strategically to discriminate binders from nonbinders in virtual screening and to more accurately predict the ligand binding modes prior to the more computationally expensive FEP calculations of binding affinity.

Effects of the Hydroxyl Group on Phenyl Based Ligand/ERRγ Protein Binding

PubMed Central

2015-01-01

Bisphenol-A (4,4′-dihydroxy-2,2-diphenylpropane, BPA, or BPA-A) and its derivatives, when exposed to humans, may affect functions of multiple organs by specific binding to the human estrogen-related receptor γ (ERRγ). We carried out atomistic molecular dynamics (MD) simulations of three ligand compounds including BPA-A, 4-α-cumylphenol (BPA-C), and 2,2-diphenylpropane (BPA-D) binding to the ligand binding domain (LBD) of a human ERRγ to study the structures and energies associated with the binding. We used the implicit Molecular Mechanics/Poisson–Boltzmann Surface Area (MM/PBSA) method to estimate the free energies of binding for the phenyl based compound/ERRγ systems. The addition of hydroxyl groups to the aromatic ring had only a minor effect on binding structures and a significant effect on ligand/protein binding energy in an aqueous solution. Free binding energies of BPA-D to the ERRγ were found to be considerably less than those of BPA-A and BPA-C to the ERRγ. These results are well correlated with those from experiments where no binding affinities were determined in the BPA-D/ERRγ complex. No conformational change was observed for the helix 12 (H-12) of ERRγ upon binding of these compounds preserving an active transcriptional conformation state. PMID:25098505

Genetics Home Reference: Warsaw breakage syndrome

MedlinePlus

... helicase. Helicases are enzymes that attach (bind) to DNA and temporarily unwind the two spiral strands (double helix) of the DNA molecule. This unwinding is necessary for copying ( replicating ) ...

Fragmentation cross sections and binding energies of neutron-rich nuclei

NASA Astrophysics Data System (ADS)

Tsang, M. B.; Lynch, W. G.; Friedman, W. A.; Mocko, M.; Sun, Z. Y.; Aoi, N.; Cook, J. M.; Delaunay, F.; Famiano, M. A.; Hui, H.; Imai, N.; Iwasaki, H.; Motobayashi, T.; Niikura, M.; Onishi, T.; Rogers, A. M.; Sakurai, H.; Suzuki, H.; Takeshita, E.; Takeuchi, S.; Wallace, M. S.

2007-10-01

An exponential dependence of the fragmentation cross section on the average binding energy is observed and reproduced with a statistical model. The observed functional dependence is robust and allows the extraction of binding energies from measured cross sections. From the systematics of Cu isotope cross sections, the binding energies of Cu76,77,78,79 have been extracted. They are 636.94±0.4,647.1±0.4,651.6±0.4, and 657.8±0.5 MeV, respectively. Specifically, the uncertainty of the binding energy of Cu75 is reduced from 980 keV, as listed in the 2003 mass table of Audi, Wapstra, and Thibault to 400 keV. The predicted cross sections of two near drip-line nuclei, Na39 and Mg40 from the fragmentation of Ca48 are discussed.

Information analysis of sequences that bind the replication initiator RepA | Center for Cancer Research

Cancer.gov

The tall letters represent the highly conserved bases in DNA binding sites of several prokaryotic repressors and activators. Conservation is strongest where major grooves of the double helical DNA (represented by crests of a cosine wave) face the protein. This shows that conservation analysis alone can be used to predict the face of DNA that contacts the proteins.

Capacitance of the Double Layer Formed at the Metal/Ionic-Conductor Interface: How Large Can It Be?

NASA Astrophysics Data System (ADS)

Skinner, Brian; Loth, M. S.; Shklovskii, B. I.

2010-03-01

The capacitance of the double layer formed at a metal/ionic-conductor interface can be remarkably large, so that the apparent width of the double layer is as small as 0.3 Å. Mean-field theories fail to explain such large capacitance. We propose an alternate theory of the ionic double layer which allows for the binding of discrete ions to their image charges in the metal. We show that at small voltages the capacitance of the double layer is limited only by the weak dipole-dipole repulsion between bound ions, and is therefore very large. At large voltages the depletion of bound ions from one of the capacitor electrodes triggers a collapse of the capacitance to the mean-field value.

Inhibition of human cytochrome P450 2E1 and 2A6 by aldehydes: structure and activity relationships.

PubMed

Kandagatla, Suneel K; Mack, Todd; Simpson, Sean; Sollenberger, Jill; Helton, Eric; Raner, Gregory M

2014-08-05

The purpose of this study was to probe active site structure and dynamics of human cytochrome P4502E1 and P4502A6 using a series of related short chain fatty aldehydes. Binding efficiency of the aldehydes was monitored via their ability to inhibit the binding and activation of the probe substrates p-nitrophenol (2E1) and coumarin (2A6). Oxidation of the aldehydes was observed in reactions with individually expressed 2E1, but not 2A6, suggesting alternate binding modes. For saturated aldehydes the optimum chain length for inhibition of 2E1 was 9 carbons (KI=7.8 ± 0.3 μM), whereas for 2A6 heptanal was most potent (KI=15.8 ± 1.1 μM). A double bond in the 2-position of the aldehyde significantly decreased the observed KI relative to the corresponding saturated compound in most cases. A clear difference in the effect of the double bond was observed between the two isoforms. With 2E1, the double bond appeared to remove steric constraints on aldehyde binding with KI values for the 5-12 carbon compounds ranging between 2.6 ± 0.1 μM and 12.8 ± 0.5 μM, whereas steric effects remained the dominant factor in the binding of the unsaturated aldehydes to 2A6 (observed KI values between 7.0 ± 0.5 μM and >1000 μM). The aldehyde function was essential for effective inhibition, as the corresponding carboxylic acids had very little effect on enzyme activity over the same range of concentrations, and branching at the 3-position of the aldehydes increased the corresponding KI value in all cases examined. The results suggest that a conjugated π-system may be a key structural determinant in the binding of these compounds to both enzymes, and may also be an important feature for the expansion of the active site volume in 2E1. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Inhibition of human Cytochrome P450 2E1 and 2A6 by aldehydes: Structure and activity relationships

PubMed Central

Kandagatla, Suneel K.; Mack, Todd; Simpson, Sean; Sollenberger, Jill; Helton, Eric; Raner, Gregory M.

2014-01-01

The purpose of this study was to probe active site structure and dynamics of human cytochrome P4502E1 and P4502A6 using a series of related short chain fatty aldehydes. Binding efficiency of the aldehydes was monitored via their ability to inhibit the binding and activation of the probe substrates p-nitrophenol (2E1) and coumarin (2A6). Oxidation of the aldehydes was observed in reactions with individually expressed 2E1, but not 2A6, suggesting alternate binding modes. For saturated aldehydes the optimum chain length for inhibition of 2E1 was 9 carbons (KI=7.8 ±0.3 μM), whereas for 2A6 heptanal was most potent (KI=15.8 ±1.1 μM). A double bond in the 2-position of the aldehyde significantly decreased the observed KI relative to the corresponding saturated compound in most cases. A clear difference in the effect of the double bond was observed between the two isoforms. With 2E1, the double bond appeared to remove steric constraints on aldehyde binding with KI values for the 5–12 carbon compounds ranging between 2.6 ± 0.1 μM and 12.8± 0.5 μM, whereas steric effects remained the dominant factor in the binding of the unsaturated aldehydes to 2A6 (observed KI values between 7.0± 0.5 μM and >1000 μM). The aldehyde function was essential for effective inhibition, as the corresponding carboxylic acids had very little effect on enzyme activity over the same range of concentrations, and branching at the 3-position of the aldehydes increased the corresponding KI value in all cases examined. The results suggest that a conjugated π-system may be a key structural determinant in the binding of these compounds to both enzymes, and may also be an important feature for the expansion of the active site volume in 2E1. PMID:24924949

Interactions of solute (3p, 4p, 5p and 6p) with solute, vacancy and divacancy in bcc Fe

NASA Astrophysics Data System (ADS)

You, Yu-Wei; Kong, Xiang-Shan; Wu, Xue-Bang; Liu, Wei; Liu, C. S.; Fang, Q. F.; Chen, J. L.; Luo, G.-N.; Wang, Zhiguang

2014-12-01

Solute-vacancy binding energy is a key quantity in understanding solute diffusion kinetics and phase segregation, and may help choice of alloy compositions for future material design. However, the binding energy of solute with vacancy is notoriously difficult to measure and largely unknown in bcc Fe. With first-principles method, we systemically calculate the binding energies of solute (3p, 4p, 5p and 6p alloying solutes are included) with vacancy, divacancy and solute in bcc Fe. The binding energy of Si with vacancy in the present work is in good consistent with experimental value available. All the solutes considered are able to form stable solute-vacancy, solute-divacancy complexes, and the binding strength of solute-divacancy is about two times larger than that of solute-vacancy. Most solutes could not form stable solute-solute complexes except S, Se, In and Tl. The factors controlling the binding energies are analyzed at last.

Environmental impact assessment of double- and relay-cropping with winter camelina in the northern Great Plains, USA

USDA-ARS?s Scientific Manuscript database

Recent findings indicate that double- or relay-cropping winter camelina (Camelina sativa L. Crantz.) with feed or food crops can increase yield per area, improve energy balance, and provide several ecosystem services. Double-cropping can help balance food and energy production. The objective of this...

Exciton binding energy in GaAsBiN spherical quantum dot heterostructures

NASA Astrophysics Data System (ADS)

Das, Subhasis; Dhar, S.

2017-03-01

The ground state exciton binding energies (EBE) of heavy hole excitons in GaAs1-x-yBixNy - GaAs spherical quantum dots (QD) are calculated using a variational approach under 1s hydrogenic wavefunctions within the framework of effective mass approximation. Both the nitrogen and the bismuth content in the material are found to affect the binding energy, in particular for larger nitrogen content and lower dot radii. Calculations also show that the ground state exciton binding energies of heavy holes increase more at smaller dot sizes as compared to that for the light hole excitons.

Energetics of Glutamate Binding to an Ionotropic Glutamate Receptor.

PubMed

Yu, Alvin; Lau, Albert Y

2017-11-22

Ionotropic glutamate receptors (iGluRs) are ligand-gated ion channels that are responsible for the majority of excitatory transmission at the synaptic cleft. Mechanically speaking, agonist binding to the ligand binding domain (LBD) activates the receptor by triggering a conformational change that is transmitted to the transmembrane region, opening the ion channel pore. We use fully atomistic molecular dynamics simulations to investigate the binding process in the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor, an iGluR subtype. The string method with swarms of trajectories was applied to calculate the possible pathways glutamate traverses during ligand binding. Residues peripheral to the binding cleft are found to metastably bind the ligand prior to ligand entry into the binding pocket. Umbrella sampling simulations were performed to compute the free energy barriers along the binding pathways. The calculated free energy profiles demonstrate that metastable interactions contribute substantially to the energetics of ligand binding and form local minima in the overall free energy landscape. Protein-ligand interactions at sites outside of the orthosteric agonist-binding site may serve to lower the transition barriers of the binding process.

On the contribution of vibrational anharmonicity to the binding energies of water clusters.

PubMed

Diri, Kadir; Myshakin, Evgeniy M; Jordan, Kenneth D

2005-05-05

The second-order vibrational perturbation theory method has been used together with the B3LYP and MP2 electronic structure methods to investigate the effects of anharmonicity on the vibrational zero-point energy (ZPE) contributions to the binding energies of (H2O)n, n = 2-6, clusters. For the low-lying isomers of (H2O)6, the anharmonicity correction to the binding energy is calculated to range from -248 to -355 cm(-1). It is also demonstrated that although high-order electron correlation effects are important for the individual vibrational frequencies, they are relatively unimportant for the net ZPE contributions to the binding energies of water clusters.

The positive binding energy envelopes of low-mass helium stars

NASA Astrophysics Data System (ADS)

Hall, Philip D.; Jeffery, C. Simon

2018-04-01

It has been hypothesized that stellar envelopes with positive binding energy may be ejected if the release of recombination energy can be triggered and the calculation of binding energy includes this contribution. The implications of this hypothesis for the evolution of normal hydrogen-rich stars have been investigated, but the implications for helium stars - which may represent mass-transfer or merger remnants in binary star systems - have not. Making a set of model helium stars, we find that those with masses between 0.9 and 2.4 M⊙ evolve to configurations with positive binding energy envelopes. We discuss consequences of the ejection hypothesis for such stars, and possible observational tests of these predictions.

The volume- and surface-binding energies of ice systems containing CO, CO2, and H2O

NASA Technical Reports Server (NTRS)

Sandford, Scott A.; Allamandola, Louis J.

1990-01-01

Laboratory-measured, temperature-dependent sticking efficiencies are presently used to derive the surface-binding energies of CO and CO2 on H2O-rich ices, with a view to determining the condensation and vaporization properties of these systems as well as to the measured energies' implications for both cometary behavior and the evolution of interstellar ices. The molecular volume and the surface binding energies are not found to be necessarily related on the basis of simple nearest-neighbor scaling in surface and bulk sites; this may be due to the physical constraints associated with matrix structure-associated physical constraints, which sometimes dominate the volume-binding energies.

Application of Electric Double-layer Capacitors for Energy Storage on Electric Railway

NASA Astrophysics Data System (ADS)

Hase, Shin-Ichi; Konishi, Takeshi; Okui, Akinobu; Nakamichi, Yoshinobu; Nara, Hidetaka; Uemura, Tadashi

The methods to stabilize power sources, which are the measures against voltage drop, power loading fluctuation, regeneration power lapse and so on, have been important issues in DC feeding circuits. Therefore, an energy storage medium that uses power efficiently and reduces above-mentioned problems is much concerned about. In recent years, development of energy storage medium is remarkable for drive-power supplies of electric vehicles. A number of applications of energy storage, for instance, battery and flywheel, have been investigated so far. A large-scale electric double-layer capacitor which is rapidly charged and discharged and offers long life, maintenance-free, low pollution and high efficiency, has been developed in wide range. We have compared the ability to charge batteries and electric double-layer capacitors. Therefore, we carried out fundamental studies about electric double-layer capacitors and its control. And we produced a prototype of energy storage for the DC electric railway system that consists of electric double-layer capacitors, diode bridge rectifiers, chopper system and PWM converters. From the charge and discharge tests of the prototype, useful information was obtained. This paper describes its characteristics and experimental results of energy storage system.

Proton conduction within the reaction centers of Rhodobacter capsulatus: the electrostatic role of the protein.

PubMed

Maróti, P; Hanson, D K; Baciou, L; Schiffer, M; Sebban, P

1994-06-07

Light-induced charge separation in the photosynthetic reaction center results in delivery of two electrons and two protons to the terminal quinone acceptor QB. In this paper, we have used flash-induced absorbance spectroscopy to study three strains that share identical amino acid sequences in the QB binding site, all of which lack the protonatable amino acids Glu-L212 and Asp-L213. These strains are the photosynthetically incompetent site-specific mutant Glu-L212/Asp-L213-->Ala-L212/Ala-L213 and two different photocompetent derivatives that carry both alanine substitutions and an intergenic suppressor mutation located far from QB (class 3 strain, Ala-Ala + Arg-M231-->Leu; class 4 strain, Ala-Ala + Asn-M43-->Asp). At pH 8 in the double mutant, we observe a concomitant decrease of nearly 4 orders of magnitude in the rate constants of second electron and proton transfer to QB compared to the wild type. Surprisingly, these rates are increased to about the same extent in both types of suppressor strains but remain > 2 orders of magnitude smaller than those of the wild type. In the double mutant, at pH 8, the loss of Asp-L213 and Glu-L212 leads to a substantial stabilization (> or = 60 meV) of the semiquinone energy level. Both types of compensatory mutations partially restore, to nearly the same level, the original free energy difference for electron transfer from primary quinone QA to QB. The pH dependence of the electron and proton transfer processes in the double-mutant and the suppressor strains suggests that when reaction centers of the double mutant are shifted to lower pH (1.5-2 units), they function like those of the suppressor strains at physiological pH. Our data suggest that the main effect of the compensatory mutations is to partially restore the negative electrostatic environment of QB and to increase an apparent "functional" pK of the system for efficient proton transfer to the active site. This emphasizes the role of the protein in tuning the electrostatic environment of its cofactors and highlights the possible long-range electrostatic effects.

Wing 1 of protein HOP2 is as important as helix 3 in DNA binding by MD simulation.

PubMed

Moktan, Hem; Zhou, Donghua H

2018-05-01

The repair of programmed DNA double-strand breaks through recombination is required for proper association and disjunction of the meiotic homologous chromosomes. Meiosis-specific protein HOP2 plays essential roles in recombination by promoting recombinase activities. The N-terminal domain of HOP2 interacts with DNA through helix 3 (H3) and wing 1 (W1). Mutations in wing 1 (Y65A/K67A/Q68A) slightly weakened the binding but mutations in helices 2 and 3 (Q30A/K44A/K49A) nearly abolished the binding. To better understand such differential effects at atomic level, molecular dynamics simulations were employed. Despite losing some hydrogen bonds, the W1-mutant DNA complex was rescued by stronger hydrophobic interactions. For the wild type and W1-mutant, the protein was found to slide along the DNA grooves as the DNA rolls along its double-helix axis. This motion could be functionally important to facilitate the precise positioning of the single-stranded DNA with the homologous double-stranded DNA. The sliding motion was reduced in the W1-mutant. The H-mutant nearly lost all intermolecular interactions. Moreover, an additional mutation in wing 1 (Y65A/K67A/Q68A/K69A) also caused complete complex dissociation. Therefore, both wing 1 and helix 3 make important contribution to the DNA binding, which could be important to the strand invasion function of HOP2 homodimer and HOP2-MND1 heterodimer. Similar to cocking a medieval crossbow with the archer's foot placed in the stirrup, wing 1 may push the minor groove to cause distortion while helix 3 grabs the major groove.

SAAMBE: Webserver to Predict the Charge of Binding Free Energy Caused by Amino Acids Mutations.

PubMed

Petukh, Marharyta; Dai, Luogeng; Alexov, Emil

2016-04-12

Predicting the effect of amino acid substitutions on protein-protein affinity (typically evaluated via the change of protein binding free energy) is important for both understanding the disease-causing mechanism of missense mutations and guiding protein engineering. In addition, researchers are also interested in understanding which energy components are mostly affected by the mutation and how the mutation affects the overall structure of the corresponding protein. Here we report a webserver, the Single Amino Acid Mutation based change in Binding free Energy (SAAMBE) webserver, which addresses the demand for tools for predicting the change of protein binding free energy. SAAMBE is an easy to use webserver, which only requires that a coordinate file be inputted and the user is provided with various, but easy to navigate, options. The user specifies the mutation position, wild type residue and type of mutation to be made. The server predicts the binding free energy change, the changes of the corresponding energy components and provides the energy minimized 3D structure of the wild type and mutant proteins for download. The SAAMBE protocol performance was tested by benchmarking the predictions against over 1300 experimentally determined changes of binding free energy and a Pearson correlation coefficient of 0.62 was obtained. How the predictions can be used for discriminating disease-causing from harmless mutations is discussed. The webserver can be accessed via http://compbio.clemson.edu/saambe_webserver/.

Prediction of Ras-effector interactions using position energy matrices.

PubMed

Kiel, Christina; Serrano, Luis

2007-09-01

One of the more challenging problems in biology is to determine the cellular protein interaction network. Progress has been made to predict protein-protein interactions based on structural information, assuming that structural similar proteins interact in a similar way. In a previous publication, we have determined a genome-wide Ras-effector interaction network based on homology models, with a high accuracy of predicting binding and non-binding domains. However, for a prediction on a genome-wide scale, homology modelling is a time-consuming process. Therefore, we here successfully developed a faster method using position energy matrices, where based on different Ras-effector X-ray template structures, all amino acids in the effector binding domain are sequentially mutated to all other amino acid residues and the effect on binding energy is calculated. Those pre-calculated matrices can then be used to score for binding any Ras or effector sequences. Based on position energy matrices, the sequences of putative Ras-binding domains can be scanned quickly to calculate an energy sum value. By calibrating energy sum values using quantitative experimental binding data, thresholds can be defined and thus non-binding domains can be excluded quickly. Sequences which have energy sum values above this threshold are considered to be potential binding domains, and could be further analysed using homology modelling. This prediction method could be applied to other protein families sharing conserved interaction types, in order to determine in a fast way large scale cellular protein interaction networks. Thus, it could have an important impact on future in silico structural genomics approaches, in particular with regard to increasing structural proteomics efforts, aiming to determine all possible domain folds and interaction types. All matrices are deposited in the ADAN database (http://adan-embl.ibmc.umh.es/). Supplementary data are available at Bioinformatics online.

Single-Photon, Double Photodetachment of Nickel Phthalocyanine Tetrasulfonic Acid 4- Anions.

PubMed

Daly, Steven; Girod, Marion; Vojkovic, Marin; Giuliani, Alexandre; Antoine, Rodolphe; Nahon, Laurent; O'Hair, Richard A J; Dugourd, Philippe

2016-07-07

Single-photon, two-electron photodetachment from nickel phthalocyanine tetrasulfonic acid tetra anions, [NiPc](4-), was examined in the gas-phase using a linear ion trap coupled to the DESIRS VUV beamline of the SOLEIL Synchrotron. This system was chosen since it has a low detachment energy, known charge localization, and well-defined geometrical and electronic structures. A threshold for two-electron loss is observed at 10.2 eV, around 1 eV lower than previously observed double detachment thresholds on multiple charged protein anions. The photodetachment energy of [NiPc](4-) has been previously determined to be 3.5 eV and the photodetachment energy of [NiPc](3-•) is determined in this work to be 4.3 eV. The observed single photon double electron detachment threshold is hence 5.9 eV higher than the energy required for sequential single electron loss. Possible mechanisms are for double photodetachment are discussed. These observations pave the way toward new, exciting experiments for probing double photodetachment at relatively low energies, including correlation measurements on emitted photoelectrons.

Free Energy Simulations of Ligand Binding to the Aspartate Transporter GltPh

PubMed Central

Heinzelmann, Germano; Baştuğ, Turgut; Kuyucak, Serdar

2011-01-01

Glutamate/Aspartate transporters cotransport three Na+ and one H+ ions with the substrate and countertransport one K+ ion. The binding sites for the substrate and two Na+ ions have been observed in the crystal structure of the archeal homolog GltPh, while the binding site for the third Na+ ion has been proposed from computational studies and confirmed by experiments. Here we perform detailed free energy simulations of GltPh, giving a comprehensive characterization of the substrate and ion binding sites, and calculating their binding free energies in various configurations. Our results show unequivocally that the substrate binds after the binding of two Na+ ions. They also shed light into Asp/Glu selectivity of GltPh, which is not observed in eukaryotic glutamate transporters. PMID:22098736

Systematics of α-decay fine structure in odd-mass nuclei based on a finite-range nucleon-nucleon interaction

NASA Astrophysics Data System (ADS)

Adel, A.; Alharbi, T.

2018-07-01

A systematic study on α-decay fine structure is presented for odd-mass nuclei in the range 83 ≤ Z ≤ 92. The α-decay partial half-lives and branching ratios to the ground and excited states of daughter nuclei are calculated in the framework of the Wentzel-Kramers-Brillouin (WKB) approximation with the implementation of the Bohr-Sommerfeld quantization condition. The microscopic α-daughter potential is obtained using the double-folding model with a realistic M3Y-Paris nucleon-nucleon (NN) interaction. The exchange potential, which accounts for the knock-on exchange of nucleons between the interacting nuclei, is calculated using the finite-range exchange NN interaction which is essentially a much better approximation as compared to the zero-range pseudo-potential adopted in the usual double-folding calculations. Our calculations of α-decay fine structure have been improved by considering the preformation factor extracted from the recently proposed cluster formation model on basis of the binding energy difference. The computed partial half-lives and branching ratios are compared with the recent experimental data and they are in good agreement.

Structural, energetic, and electronic trends in low-dimensional late-transition-metal systems

NASA Astrophysics Data System (ADS)

Hu, C. H.; Chizallet, C.; Toulhoat, H.; Raybaud, P.

2009-05-01

Using first-principles calculations, we present a comprehensive investigation of the structural trends of low dimensionality late 4d (from Tc to Ag) and 5d (from Re to Au) transition-metal systems including 13-atom clusters. Energetically favorable clusters not being reported previously are discovered by molecular-dynamics simulation based on the simulated annealing method. They allow a better agreement between experiments and theory for their magnetic properties. The structural periodic trend exhibits a nonmonotonic variation of the ratio of square to triangular facets for the two rows, with a maximum for Rh13 and Ir13 . By a comparative analysis of the relevant energetic and electronic properties performed on other metallic systems with reduced dimensionalities such as four-atom planar clusters, one-dimensional (1D) scales, double scales, 1D cylinders, monatomic films, two and seven layer slabs, we highlight that this periodic trend can be generalized. Hence, it appears that 1D-metallic nanocylinders or 1D-double nanoscales (with similar binding energies as TM13 ) also favor square facets for Rh and Ir. We finally propose an interpretation based on the evolution of the width of the valence band and of the Coulombic repulsions of the bonding basins.

DNA purification by triplex-affinity capture and affinity capture electrophoresis

DOEpatents

Cantor, C.R.; Ito, Takashi; Smith, C.L.

1996-01-09

The invention provides a method for purifying or isolating double stranded DNA intact using triple helix formation. The method includes the steps of complexing an oligonucleotide and double stranded DNA to generate a triple helix and immobilization of the triple helix on a solid phase by means of a molecular recognition system such as avidin/biotin. The purified DNA is then recovered intact by treating the solid phase with a reagent that breaks the bonds between the oligonucleotide and the intact double stranded DNA while not affecting the Watson-Crick base pairs of the double helix. The present invention also provides a method for purifying or isolating double stranded DNA intact by complexing the double stranded DNA with a specific binding partner and recovering the complex during electrophoresis by immobilizing it on a solid phase trap imbedded in an electrophoretic gel. 6 figs.

Influences of Mutations on the Electrostatic Binding Free Energies of Chloride Ions in Escherichia Coli ClC

PubMed Central

Yu, Tao; Wang, Xiao-Qing; Sang, Jian-Ping; Pan, Chun-Xu; Zou, Xian-Wu; Chen, Tsung-Yu; Zou, Xiaoqin

2012-01-01

Mutations in ClC channel proteins may cause serious functional changes and even diseases. The function of ClC proteins mainly manifests as Cl− transport, which is related to the binding free energies of chloride ions. Therefore, the influence of a mutation on ClC function can be studied by investigating the mutational effect on the binding free energies of chloride ions. The present study provides quantitative and systematic investigations on the influences of residue mutations on the electrostatic binding free energies in Escherichia coli ClC (EcClC) proteins, using all-atom molecular dynamics simulations. It was found that the change of the electrostatic binding free energy decreases linearly with the increase of the residue-chloride ion distance for a mutation. This work reveals how changes in the charge of a mutated residue and in the distance between the mutated residue and the binding site govern the variations in the electrostatic binding free energies, and therefore influence the transport of chloride ions and conduction in EcClC. This work would facilitate our understanding of the mutational effects on transport of chloride ions and functions of ClC proteins, and provide a guideline to estimate which residue mutations will have great influences on ClC functions. PMID:22612693

Free energy landscape for the binding process of Huperzine A to acetylcholinesterase

PubMed Central

Bai, Fang; Xu, Yechun; Chen, Jing; Liu, Qiufeng; Gu, Junfeng; Wang, Xicheng; Ma, Jianpeng; Li, Honglin; Onuchic, José N.; Jiang, Hualiang

2013-01-01

Drug-target residence time (t = 1/koff, where koff is the dissociation rate constant) has become an important index in discovering better- or best-in-class drugs. However, little effort has been dedicated to developing computational methods that can accurately predict this kinetic parameter or related parameters, koff and activation free energy of dissociation (). In this paper, energy landscape theory that has been developed to understand protein folding and function is extended to develop a generally applicable computational framework that is able to construct a complete ligand-target binding free energy landscape. This enables both the binding affinity and the binding kinetics to be accurately estimated. We applied this method to simulate the binding event of the anti-Alzheimer’s disease drug (−)−Huperzine A to its target acetylcholinesterase (AChE). The computational results are in excellent agreement with our concurrent experimental measurements. All of the predicted values of binding free energy and activation free energies of association and dissociation deviate from the experimental data only by less than 1 kcal/mol. The method also provides atomic resolution information for the (−)−Huperzine A binding pathway, which may be useful in designing more potent AChE inhibitors. We expect this methodology to be widely applicable to drug discovery and development. PMID:23440190

Free energy landscape for the binding process of Huperzine A to acetylcholinesterase.

PubMed

Bai, Fang; Xu, Yechun; Chen, Jing; Liu, Qiufeng; Gu, Junfeng; Wang, Xicheng; Ma, Jianpeng; Li, Honglin; Onuchic, José N; Jiang, Hualiang

2013-03-12

Drug-target residence time (t = 1/k(off), where k(off) is the dissociation rate constant) has become an important index in discovering better- or best-in-class drugs. However, little effort has been dedicated to developing computational methods that can accurately predict this kinetic parameter or related parameters, k(off) and activation free energy of dissociation (ΔG(off)≠). In this paper, energy landscape theory that has been developed to understand protein folding and function is extended to develop a generally applicable computational framework that is able to construct a complete ligand-target binding free energy landscape. This enables both the binding affinity and the binding kinetics to be accurately estimated. We applied this method to simulate the binding event of the anti-Alzheimer's disease drug (-)-Huperzine A to its target acetylcholinesterase (AChE). The computational results are in excellent agreement with our concurrent experimental measurements. All of the predicted values of binding free energy and activation free energies of association and dissociation deviate from the experimental data only by less than 1 kcal/mol. The method also provides atomic resolution information for the (-)-Huperzine A binding pathway, which may be useful in designing more potent AChE inhibitors. We expect this methodology to be widely applicable to drug discovery and development.

A structure-based design of new C2- and C13-substituted taxanes: tubulin binding affinities and extended quantitative structure-activity relationships using comparative binding energy (COMBINE) analysis.

PubMed

Coderch, Claire; Tang, Yong; Klett, Javier; Zhang, Shu-En; Ma, Yun-Tao; Shaorong, Wang; Matesanz, Ruth; Pera, Benet; Canales, Angeles; Jiménez-Barbero, Jesús; Morreale, Antonio; Díaz, J Fernando; Fang, Wei-Shuo; Gago, Federico

2013-05-14

Ten novel taxanes bearing modifications at the C2 and C13 positions of the baccatin core have been synthesized and their binding affinities for mammalian tubulin have been experimentally measured. The design strategy was guided by (i) calculation of interaction energy maps with carbon, nitrogen and oxygen probes within the taxane-binding site of β-tubulin, and (ii) the prospective use of a structure-based QSAR (COMBINE) model derived from an earlier series comprising 47 congeneric taxanes. The tubulin-binding affinity displayed by one of the new compounds (CTX63) proved to be higher than that of docetaxel, and an updated COMBINE model provided a good correlation between the experimental binding free energies and a set of weighted residue-based ligand-receptor interaction energies for 54 out of the 57 compounds studied. The remaining three outliers from the original training series have in common a large unfavourable entropic contribution to the binding free energy that we attribute to taxane preorganization in aqueous solution in a conformation different from that compatible with tubulin binding. Support for this proposal was obtained from solution NMR experiments and molecular dynamics simulations in explicit water. Our results shed additional light on the determinants of tubulin-binding affinity for this important class of antitumour agents and pave the way for further rational structural modifications.

Prediction of the binding sites of huperzine A in acetylcholinesterase by docking studies

NASA Astrophysics Data System (ADS)

Pang, Yuan-Ping; Kozikowski, Alan P.

1994-12-01

We have performed docking studies with the SYSDOC program on acetylcholinesterase (AChE) to predict the binding sites in AChE of huperzine A (HA), which is a potent and selective, reversible inhibitor of AChE. The unique aspects of our docking studies include the following: (i) Molecular flexibility of the guest and the host is taken into account, which permits both to change their conformations upon binding. (ii) The binding energy is evaluated by a sum of energies of steric, electrostatic and hydrogen bonding interactions. In the energy calculation no grid approximation is used, and all hydrogen atoms of the system are treated explicitly. (iii) The energy of cation-π interactions between the guest and the host, which is important in the binding of AChE, is included in the calculated binding energy. (iv) Docking is performed in all regions of the host's binding cavity. Based on our docking studies and the pharmacological results reported for HA and its analogs, we predict that HA binds to the bottom of the binding cavity of AChE (the gorge) with its ammonium group interacting with Trp84, Phe330, Glu199 and Asp72 (catalytic site). At the the opening of the gorge with its ammonium group partially interacting with Trp279 (peripheral site). At the catalytic site, three partially overlapping subsites of HA were identified which might provide a dynamic view of binding of HA to the catalytic site.

Role of Desolvation in Thermodynamics and Kinetics of Ligand Binding to a Kinase

PubMed Central

2015-01-01

Computer simulations are used to determine the free energy landscape for the binding of the anticancer drug Dasatinib to its src kinase receptor and show that before settling into a free energy basin the ligand must surmount a free energy barrier. An analysis based on using both the ligand-pocket separation and the pocket-water occupancy as reaction coordinates shows that the free energy barrier is a result of the free energy cost for almost complete desolvation of the binding pocket. The simulations further show that the barrier is not a result of the reorganization free energy of the binding pocket. Although a continuum solvent model gives the location of free energy minima, it is not able to reproduce the intermediate free energy barrier. Finally, it is shown that a kinetic model for the on rate constant in which the ligand diffuses up to a doorway state and then surmounts the desolvation free energy barrier is consistent with published microsecond time-scale simulations of the ligand binding kinetics for this system [Shaw, D. E. et al. J. Am. Chem. Soc.2011, 133, 9181−918321545110]. PMID:25516727

A brave new world of RNA-binding proteins.

PubMed

Hentze, Matthias W; Castello, Alfredo; Schwarzl, Thomas; Preiss, Thomas

2018-05-01

RNA-binding proteins (RBPs) are typically thought of as proteins that bind RNA through one or multiple globular RNA-binding domains (RBDs) and change the fate or function of the bound RNAs. Several hundred such RBPs have been discovered and investigated over the years. Recent proteome-wide studies have more than doubled the number of proteins implicated in RNA binding and uncovered hundreds of additional RBPs lacking conventional RBDs. In this Review, we discuss these new RBPs and the emerging understanding of their unexpected modes of RNA binding, which can be mediated by intrinsically disordered regions, protein-protein interaction interfaces and enzymatic cores, among others. We also discuss the RNA targets and molecular and cellular functions of the new RBPs, as well as the possibility that some RBPs may be regulated by RNA rather than regulate RNA.

Effect of Escherichia coli DNA binding protein on the transcription of single-stranded phage M13 DNA by Escherichia coli RNA polymerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Niyogi, S.K.; Ratrie, H. III; Datta, A.K.

E. coli DNA binding protein strongly inhibits the transcription of single-stranded rather than double-stranded phage M13 DNA by E. coli RNA polymerase. This inhibition cannot be significantly overcome by increasing the concentration of RNA polymerase. Nor does the order of addition of binding protein affect its inhibitory property: inhibition is evident whether binding protein is added before or after the formation of the RNA polymerase--DNA complex. Inhibition is also observed if binding protein is added at various times after initiation of RNA synthesis. Maximal inhibition occurs at a binding protein-to-DNA ratio (w/w) of about 8:1. This corresponds to one bindingmore » protein molecule covering about 30 nucleotides, in good agreement with values obtained by physical measurements.« less

Experimental and computational studies on the effects of valganciclovir as an antiviral drug on calf thymus DNA.

PubMed

Shahabadi, Nahid; Pourfoulad, Mehdi; Moghadam, Neda Hosseinpour

2017-01-02

DNA-binding properties of an antiviral drug, valganciclovir (valcyte) was studied by using emission, absorption, circular dichroism, viscosity, differential pulse voltammetry, fluorescence techniques, and computational studies. The drug bound to calf thymus DNA (ct-DNA) in a groove-binding mode. The calculated binding constant of UV-vis, K a , is comparable to groove-binding drugs. Competitive fluorimetric studies with Hoechst 33258 showed that valcyte could displace the DNA-bound Hoechst 33258. The drug could not displace intercalated methylene blue from DNA double helix. Furthermore, the induced detectable changes in the CD spectrum of ct-DNA as well as changes in its viscosity confirm the groove-binding mode. In addition, an integrated molecular docking was employed to further investigate the binding interactions between valcyte and calf thymus DNA.

Quantitative and discriminative analysis of nucleic acid samples using luminometric nonspecific nanoparticle methods

NASA Astrophysics Data System (ADS)

Pihlasalo, S.; Mariani, L.; Härmä, H.

2016-03-01

Homogeneous simple assays utilizing luminescence quenching and time-resolved luminescence resonance energy transfer (TR-LRET) were developed for the quantification of nucleic acids without sequence information. Nucleic acids prevent the adsorption of a protein to europium nanoparticles which is detected as a luminescence quenching of europium nanoparticles with a soluble quencher or as a decrease of TR-LRET from europium nanoparticles to the acceptor dye. Contrary to the existing methods based on fluorescent dye binding to nucleic acids, equal sensitivities for both single- (ssDNA) and double-stranded DNA (dsDNA) were measured and a detection limit of 60 pg was calculated for the quenching assay. The average coefficient of variation was 5% for the quenching assay and 8% for the TR-LRET assay. The TR-LRET assay was also combined with a nucleic acid dye selective to dsDNA in a single tube assay to measure the total concentration of DNA and the ratio of ssDNA and dsDNA in the mixture. To our knowledge, such a multiplexed assay is not accomplished with commercially available assays.Homogeneous simple assays utilizing luminescence quenching and time-resolved luminescence resonance energy transfer (TR-LRET) were developed for the quantification of nucleic acids without sequence information. Nucleic acids prevent the adsorption of a protein to europium nanoparticles which is detected as a luminescence quenching of europium nanoparticles with a soluble quencher or as a decrease of TR-LRET from europium nanoparticles to the acceptor dye. Contrary to the existing methods based on fluorescent dye binding to nucleic acids, equal sensitivities for both single- (ssDNA) and double-stranded DNA (dsDNA) were measured and a detection limit of 60 pg was calculated for the quenching assay. The average coefficient of variation was 5% for the quenching assay and 8% for the TR-LRET assay. The TR-LRET assay was also combined with a nucleic acid dye selective to dsDNA in a single tube assay to measure the total concentration of DNA and the ratio of ssDNA and dsDNA in the mixture. To our knowledge, such a multiplexed assay is not accomplished with commercially available assays. Electronic supplementary information (ESI) available: The labeling of amino modified polystyrene nanoparticles with Eu3+ chelate and the experimental details and results for the optimization of nucleic acid binding protein and for the ratiometric measurement of DNA and RNA with quenching assay. See DOI: 10.1039/c5nr09252c

Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

PubMed Central

Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

2017-01-01

AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

Initiating Molecular Growth in the Interstellar Medium via Dimeric Complexes of Observed Ions and Molecules

NASA Technical Reports Server (NTRS)

Bera, Partha P.; Head-Gordon, Martin; Lee, Timothy J.

2011-01-01

A feasible initiation step for particle growth in the interstellar medium (ISM) is simulated by means of ab quantum chemistry methods. The systems studied are dimer ions formed by pairing nitrogen containing small molecules known to exist in the ISM with ions of unsaturated hydrocarbons or vice versa. Complexation energies, structures of ensuing complexes and electronic excitation spectra of the encounter complexes are estimated using various quantum chemistry methods. Moller-Plesset perturbation theory (MP2, Z-averaged perturbation theory (ZAP2), coupled cluster singles and doubles with perturbative triples corrections (CCSD(T)), and density functional theory (DFT) methods (B3LYP) were employed along with the correlation consistent cc-pVTZ and aug-cc-pVTZ basis sets. Two types of complexes are predicted. One type of complex has electrostatic binding with moderate (7-20 kcal per mol) binding energies, that are nonetheless significantly stronger than typical van der Waals interactions between molecules of this size. The other type of complex develops strong covalent bonds between the fragments. Cyclic isomers of the nitrogen containing complexes are produced very easily by ion-molecule reactions. Some of these complexes show intense ultraviolet visible spectra for electronic transitions with large oscillator strengths at the B3LYP, omegaB97, and equations of motion coupled cluster (EOM-CCSD) levels. The open shell nitrogen containing carbonaceous complexes especially exhibit a large oscillator strength electronic transition in the visible region of the electromagnetic spectrum.

Fragmentation cross sections and binding energies of neutron-rich nuclei

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsang, M. B.; Lynch, W. G.; Mocko, M.

An exponential dependence of the fragmentation cross section on the average binding energy is observed and reproduced with a statistical model. The observed functional dependence is robust and allows the extraction of binding energies from measured cross sections. From the systematics of Cu isotope cross sections, the binding energies of {sup 76,77,78,79}Cu have been extracted. They are 636.94{+-}0.4,647.1{+-}0.4,651.6{+-}0.4, and 657.8{+-}0.5 MeV, respectively. Specifically, the uncertainty of the binding energy of {sup 75}Cu is reduced from 980 keV, as listed in the 2003 mass table of Audi, Wapstra, and Thibault to 400 keV. The predicted cross sections of two near drip-linemore » nuclei, {sup 39}Na and {sup 40}Mg from the fragmentation of {sup 48}Ca are discussed.« less

Comparison of the quadratic configuration interaction and coupled cluster approaches to electron correlation including the effect of triple excitations

NASA Technical Reports Server (NTRS)

Taylor, Peter R.; Lee, Timothy J.; Rendell, Alistair P.

1990-01-01

The recently proposed quadratic configuration interaction (QCI) method is compared with the more rigorous coupled cluster (CC) approach for a variety of chemical systems. Some of these systems are well represented by a single-determinant reference function and others are not. The finite order singles and doubles correlation energy, the perturbational triples correlation energy, and a recently devised diagnostic for estimating the importance of multireference effects are considered. The spectroscopic constants of CuH, the equilibrium structure of cis-(NO)2 and the binding energies of Be3, Be4, Mg3, and Mg4 were calculated using both approaches. The diagnostic for estimating multireference character clearly demonstrates that the QCI method becomes less satisfactory than the CC approach as non-dynamical correlation becomes more important, in agreement with a perturbational analysis of the two methods and the numerical estimates of the triple excitation energies they yield. The results for CuH show that the differences between the two methods become more apparent as the chemical systems under investigation becomes more multireference in nature and the QCI results consequently become less reliable. Nonetheless, when the system of interest is dominated by a single reference determinant both QCI and CC give very similar results.

Upconversion luminescence resonance energy transfer-based aptasensor for the sensitive detection of oxytetracycline.

PubMed

Zhang, Hui; Fang, Congcong; Wu, Shijia; Duan, Nuo; Wang, Zhouping

2015-11-15

In this work, a biosensor based on luminescence resonance energy transfer (LRET) from NaYF4:Yb,Tm upconversion nanoparticles (UCNPs) to SYBR Green I has been developed. The aptamers are covalently linked to UCNPs and hybridized with their complementary strands. The subsequent addition of SYBR Green allows SYBR Green I to insert into the formed double-stranded DNA (dsDNA) duplex and brings the energy donor and acceptor into close proximity, leading to the fluorescence of UCNPs transferred to SYBR Green I. When excited at 980 nm, the UCNPs emit luminescence at 477 nm, and this energy is transferred to SYBR Green I, which emits luminescence at 530 nm. In the presence of oxytetracycline (OTC), the aptamers prefer to bind to its corresponding analyte and dehybridize with the complementary DNA. This dehybridization leads to the liberation of SYBR Green I, which distances SYBR Green I from the UCNPs and recovers the UCNPs' luminescence. Under optimal conditions, a linear calibration is obtained between the ratio of I530 to I477 nm (I530/I477) and the OTC concentration, which ranges from 0.1 to 10 ng/ml with a limit of detection (LOD) of 0.054 ng/ml. Copyright © 2015 Elsevier Inc. All rights reserved.

Using the fast fourier transform in binding free energy calculations.

PubMed

Nguyen, Trung Hai; Zhou, Huan-Xiang; Minh, David D L

2018-04-30

According to implicit ligand theory, the standard binding free energy is an exponential average of the binding potential of mean force (BPMF), an exponential average of the interaction energy between the unbound ligand ensemble and a rigid receptor. Here, we use the fast Fourier transform (FFT) to efficiently evaluate BPMFs by calculating interaction energies when rigid ligand configurations from the unbound ensemble are discretely translated across rigid receptor conformations. Results for standard binding free energies between T4 lysozyme and 141 small organic molecules are in good agreement with previous alchemical calculations based on (1) a flexible complex ( R≈0.9 for 24 systems) and (2) flexible ligand with multiple rigid receptor configurations ( R≈0.8 for 141 systems). While the FFT is routinely used for molecular docking, to our knowledge this is the first time that the algorithm has been used for rigorous binding free energy calculations. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

PubMed

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-09-18

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

An ATF4-ATG5 signaling in hypothalamic POMC neurons regulates obesity.

PubMed

Xiao, Yuzhong; Deng, Yalan; Yuan, Feixiang; Xia, Tingting; Liu, Hao; Li, Zhigang; Chen, Shanghai; Liu, Zhixue; Ying, Hao; Liu, Yi; Zhai, Qiwei; Guo, Feifan

2017-06-03

ATF4 (activating transcription factor 4) is an important transcription factor that has many biological functions, while its role in hypothalamic POMC (pro-opiomelanocortin-α) neurons in the regulation of energy homeostasis has not been explored. We recently discovered that mice with an Atf4 deletion specific to POMC neurons (PAKO mice) are lean and have higher energy expenditure. Furthermore, these mice are resistant to high-fat diet (HFD)-induced obesity and obesity-related metabolic disorders. Mechanistically, we found the expression of ATG5 (autophagy-related 5) is upregulated in POMC neurons of PAKO mice, and ATF4 regulates ATG5 expression by binding directly to its promoter. Mice with Atf4 and Atg5 double knockout in POMC neurons have reduced energy expenditure and gain more fat mass compared with PAKO mice under a HFD. Finally, the effect of Atf4 knockout in POMC neurons is possibly mediated by enhanced ATG5-dependent macroautophagy/autophagy and α-melanocyte-stimulating hormone (α-MSH) production in the hypothalamus. Together, this work not only identifies a beneficial role for ATF4 in hypothalamic POMC neurons in the regulation of obesity, but also provides a new potential therapeutic target for obesity and obesity-related metabolic diseases.

The (FHCl)- molecular anion - Structural aspects, global surface, and vibrational eigenspectrum

NASA Technical Reports Server (NTRS)

Klepeis, Neil E.; East, Allan L. L.; Csaszar, Attila G.; Allen, Wesley D.; Lee, Timothy J.; Schwenke, David W.

1993-01-01

State of the art ab initio electronic structure methods have been used to investigate the (FHCl)- molecular anion. It is proposed that the geometric structure and binding energies of the complex are r(e)(H-F) = 0.963 +/- 0.003 A, R(e)(H-Cl) = 1.925 +/- 0.015 A, and D0(HF + Cl(-)) = 21.8 +/- 0.4 kcal/mol. A Morokuma decomposition of the ion-molecular bonding give the following electrostatic, polarization, exchange repulsion, dispersion, and charge-transfer plus higher-order mixing components of the vibrationless complexation energy: -27.3, -5.2, +18.3, -4.5, and -5.0 kcal/mol, respectively. A couples cluster single and doubles global surface is constructed from 208 and 228 energy points for linear and bent configurations, respectively, these being fit to rms errors of only 3.9 and 9.3/cm, respectively, below 8000/cm. Converged J = 0 and J = 1 variational eigenstates of the (FHCl)- surface to near the HF + Cl(-) dissociation threshold are determined. The fundamental vibrational frequencies are found to be nu1 = 247/cm, nu2 = 876/cm, and nu3 = 2884/cm. The complete vibrational eigenspectrum is analyzed.

Structure, energetics and vibrational spectra of dimers, trimers, and tetramers of HX (X = Cl, Br, I)

NASA Astrophysics Data System (ADS)

Latajka, Zdzislaw; Scheiner, Steve

1997-03-01

The title complexes are studied by correlated ab initio methods using a pseudopotential double-ζ basis set, augmented by diffuse sp and two sets of polarization functions. The binding energies of the complexes decrease in the order HCl > HBr > HI. In the mixed HX…HX' dimers, the nature of the proton-donor molecule is more important than is the proton-acceptor with respect to the strength of the interaction. Only one minimum is found on the potential energy surface of the trimers and tetramers, which corresponds to the C nh cyclic structure. Enlargement of the complex leads to progressively greater individual H-bond energy and HX bond stretch, coupled with reduced intermolecular separation and smaller nonlinearity of each H-bond. Electron correlation makes a larger contribution as the atomic number of X increases. The highest degree of cooperativity is noted for oligomers of HCl and HBr, as compared to HI. The nonadditivity is dominated by terms present at the SCF level. The vibrational frequencies exhibit trends that generally parallel the energetics and geometry patterns, particularly the red shifts of the HX stretches and the intermolecular modes.

Hydrogen-vacancy-dislocation interactions in α-Fe

NASA Astrophysics Data System (ADS)

Tehranchi, A.; Zhang, X.; Lu, G.; Curtin, W. A.

2017-02-01

Atomistic simulations of the interactions between dislocations, hydrogen atoms, and vacancies are studied to assess the viability of a recently proposed mechanism for the formation of nanoscale voids in Fe-based steels in the presence of hydrogen. Quantum-mechanics/molecular-mechanics method calculations confirm molecular statics simulations based on embedded atom method (EAM) potential showing that individual vacancies on the compressive side of an edge dislocation can be transported with the dislocation as it glides. Molecular dynamics simulations based on EAM potential then show, however, that vacancy clusters in the glide plane of an approaching dislocation are annihilated or reduced in size by the creation of a double-jog/climb process that is driven by the huge reduction in energy accompanying vacancy annihilation. The effectiveness of annihilation/reduction processes is not reduced by the presence of hydrogen in the vacancy clusters because typical V-H cluster binding energies are much lower than the vacancy formation energy, except at very high hydrogen content in the cluster. Analysis of a range of configurations indicates that hydrogen plays no special role in stabilizing nanovoids against jog formation processes that shrink voids. Experimental observations of nanovoids on the fracture surfaces of steels must be due to as-yet undetermined processes.

dsRNA binding properties of RDE-4 and TRBP reflect their distinct roles in RNAi.

PubMed

Parker, Greg S; Maity, Tuhin Subhra; Bass, Brenda L

2008-12-26

Double-stranded RNA (dsRNA)-binding proteins facilitate Dicer functions in RNA interference. Caenorhabditis elegans RDE-4 facilitates cleavage of long dsRNA to small interfering RNA (siRNA), while human trans-activation response RNA-binding protein (TRBP) functions downstream to pass siRNA to the RNA-induced silencing complex. We show that these distinct in vivo roles are reflected in in vitro binding properties. RDE-4 preferentially binds long dsRNA, while TRBP binds siRNA with an affinity that is independent of dsRNA length. These properties are mechanistically based on the fact that RDE-4 binds cooperatively, via contributions from multiple domains, while TRBP binds noncooperatively. Our studies offer a paradigm for how dsRNA-binding proteins, which are not sequence specific, discern dsRNA length. Additionally, analyses of the ability of RDE-4 deletion constructs and RDE-4/TRBP chimeras to reconstitute Dicer activity suggest RDE-4 promotes activity using its dsRNA-binding motif 2 to bind dsRNA, its linker region to interact with Dicer, and its C-terminus for Dicer activation.

Drug delivery monitoring by photoacoustic tomography with an ICG encapsulated double emulsion

NASA Astrophysics Data System (ADS)

Wang, Xueding; Rajian, Justin R.; Fabiilli, Mario L.; Fowlkes, J. Brian; Carson, Paul L.

2012-02-01

We successfully encapsulated ICG in an ultrasound-triggerable perfluorocarbon double emulsion that prevents ICG from binding with plasma proteins. Photoacoustic spectral measurements on point target as well as 2-D photoacoustic images of blood vessels revealed that the photoacoustic spectrum changes significantly in blood when the ICG-loaded emulsion undergoes acoustic droplet vaporization (ADV), which is the conversion of liquid droplets into gas bubbles using ultrasound. Other than providing a new photoacoustic contrast agent, the ICG encapsulated double emulsion, when imaged with photoacoustic tomography, could facilitate spatial and quantitative monitoring of ultrasound initiated drug delivery.

No way out? The double-bind in seeking global prosperity alongside mitigated climate change

NASA Astrophysics Data System (ADS)

Garrett, T. J.

2012-01-01

In a prior study (Garrett, 2011), I introduced a simple economic growth model designed to be consistent with general thermodynamic laws. Unlike traditional economic models, civilization is viewed only as a well-mixed global whole with no distinction made between individual nations, economic sectors, labor, or capital investments. At the model core is a hypothesis that the global economy's current rate of primary energy consumption is tied through a constant to a very general representation of its historically accumulated wealth. Observations support this hypothesis, and indicate that the constant's value is λ = 9.7 ± 0.3 milliwatts per 1990 US dollar. It is this link that allows for treatment of seemingly complex economic systems as simple physical systems. Here, this growth model is coupled to a linear formulation for the evolution of globally well-mixed atmospheric CO2 concentrations. While very simple, the coupled model provides faithful multi-decadal hindcasts of trajectories in gross world product (GWP) and CO2. Extending the model to the future, the model suggests that the well-known IPCC SRES scenarios substantially underestimate how much CO2 levels will rise for a given level of future economic prosperity. For one, global CO2 emission rates cannot be decoupled from wealth through efficiency gains. For another, like a long-term natural disaster, future greenhouse warming can be expected to act as an inflationary drag on the real growth of global wealth. For atmospheric CO2 concentrations to remain below a "dangerous" level of 450 ppmv (Hansen et al., 2007), model forecasts suggest that there will have to be some combination of an unrealistically rapid rate of energy decarbonization and nearly immediate reductions in global civilization wealth. Effectively, it appears that civilization may be in a double-bind. If civilization does not collapse quickly this century, then CO2 levels will likely end up exceeding 1000 ppmv; but, if CO2 levels rise by this much, then the risk is that civilization will gradually tend towards collapse.

Homology modeling and docking studies of a Δ9-fatty acid desaturase from a Cold-tolerant Pseudomonas sp. AMS8

PubMed Central

Garba, Lawal; Mohamad Yussoff, Mohamad Ariff; Abd Halim, Khairul Bariyyah; Ishak, Siti Nor Hasmah; Mohamad Ali, Mohd Shukuri; Oslan, Siti Nurbaya

2018-01-01

Membrane-bound fatty acid desaturases perform oxygenated desaturation reactions to insert double bonds within fatty acyl chains in regioselective and stereoselective manners. The Δ9-fatty acid desaturase strictly creates the first double bond between C9 and 10 positions of most saturated substrates. As the three-dimensional structures of the bacterial membrane fatty acid desaturases are not available, relevant information about the enzymes are derived from their amino acid sequences, site-directed mutagenesis and domain swapping in similar membrane-bound desaturases. The cold-tolerant Pseudomonas sp. AMS8 was found to produce high amount of monounsaturated fatty acids at low temperature. Subsequently, an active Δ9-fatty acid desaturase was isolated and functionally expressed in Escherichia coli. In this paper we report homology modeling and docking studies of a Δ9-fatty acid desaturase from a Cold-tolerant Pseudomonas sp. AMS8 for the first time to the best of our knowledge. Three dimensional structure of the enzyme was built using MODELLER version 9.18 using a suitable template. The protein model contained the three conserved-histidine residues typical for all membrane-bound desaturase catalytic activity. The structure was subjected to energy minimization and checked for correctness using Ramachandran plots and ERRAT, which showed a good quality model of 91.6 and 65.0%, respectively. The protein model was used to preform MD simulation and docking of palmitic acid using CHARMM36 force field in GROMACS Version 5 and Autodock tool Version 4.2, respectively. The docking simulation with the lowest binding energy, −6.8 kcal/mol had a number of residues in close contact with the docked palmitic acid namely, Ile26, Tyr95, Val179, Gly180, Pro64, Glu203, His34, His206, His71, Arg182, Thr85, Lys98 and His177. Interestingly, among the binding residues are His34, His71 and His206 from the first, second, and third conserved histidine motif, respectively, which constitute the active site of the enzyme. The results obtained are in compliance with the in vivo activity of the Δ9-fatty acid desaturase on the membrane phospholipids. PMID:29576935

IFI16 Preferentially Binds to DNA with Quadruplex Structure and Enhances DNA Quadruplex Formation.

PubMed

Hároníková, Lucia; Coufal, Jan; Kejnovská, Iva; Jagelská, Eva B; Fojta, Miroslav; Dvořáková, Petra; Muller, Petr; Vojtesek, Borivoj; Brázda, Václav

2016-01-01

Interferon-inducible protein 16 (IFI16) is a member of the HIN-200 protein family, containing two HIN domains and one PYRIN domain. IFI16 acts as a sensor of viral and bacterial DNA and is important for innate immune responses. IFI16 binds DNA and binding has been described to be DNA length-dependent, but a preference for supercoiled DNA has also been demonstrated. Here we report a specific preference of IFI16 for binding to quadruplex DNA compared to other DNA structures. IFI16 binds to quadruplex DNA with significantly higher affinity than to the same sequence in double stranded DNA. By circular dichroism (CD) spectroscopy we also demonstrated the ability of IFI16 to stabilize quadruplex structures with quadruplex-forming oligonucleotides derived from human telomere (HTEL) sequences and the MYC promotor. A novel H/D exchange mass spectrometry approach was developed to assess protein interactions with quadruplex DNA. Quadruplex DNA changed the IFI16 deuteration profile in parts of the PYRIN domain (aa 0-80) and in structurally identical parts of both HIN domains (aa 271-302 and aa 586-617) compared to single stranded or double stranded DNAs, supporting the preferential affinity of IFI16 for structured DNA. Our results reveal the importance of quadruplex DNA structure in IFI16 binding and improve our understanding of how IFI16 senses DNA. IFI16 selectivity for quadruplex structure provides a mechanistic framework for IFI16 in immunity and cellular processes including DNA damage responses and cell proliferation.

Universal binding energy relations in metallic adhesion

NASA Technical Reports Server (NTRS)

Ferrante, J.; Smith, J. R.; Rose, J. J.

1984-01-01

Rose, Smith, and Ferrante have discovered scaling relations which map the adhesive binding energy calculated by Ferrante and Smith onto a single universal binding energy curve. These binding energies are calculated for all combinations of Al(111), Zn(0001), Mg(0001), and Na(110) in contact. The scaling involves normalizing the energy by the maximum binding energy and normalizing distances by a suitable combination of Thomas-Fermi screening lengths. Rose et al. have also found that the calculated cohesive energies of K, Ba, Cu, Mo, and Sm scale by similar simple relations, suggesting the universal relation may be more general than for the simple free electron metals for which it was derived. In addition, the scaling length was defined more generally in order to relate it to measurable physical properties. Further this universality can be extended to chemisorption. A simple and yet quite accurate prediction of a zero temperature equation of state (volume as a function of pressure for metals and alloys) is presented. Thermal expansion coefficients and melting temperatures are predicted by simple, analytic expressions, and results compare favorably with experiment for a broad range of metals.

Exciton size and binding energy limitations in one-dimensional organic materials.

PubMed

Kraner, S; Scholz, R; Plasser, F; Koerner, C; Leo, K

2015-12-28

In current organic photovoltaic devices, the loss in energy caused by the charge transfer step necessary for exciton dissociation leads to a low open circuit voltage, being one of the main reasons for rather low power conversion efficiencies. A possible approach to avoid these losses is to tune the exciton binding energy to a value of the order of thermal energy, which would lead to free charges upon absorption of a photon, and therefore increase the power conversion efficiency towards the Shockley-Queisser limit. We determine the size of the excitons for different organic molecules and polymers by time dependent density functional theory calculations. For optically relevant transitions, the exciton size saturates around 0.7 nm for one-dimensional molecules with a size longer than about 4 nm. For the ladder-type polymer poly(benzimidazobenzophenanthroline), we obtain an exciton binding energy of about 0.3 eV, serving as a lower limit of the exciton binding energy for the organic materials investigated. Furthermore, we show that charge transfer transitions increase the exciton size and thus identify possible routes towards a further decrease of the exciton binding energy.

Sequence-specific DNA binding Pyrrole-imidazole polyamides and their applications.

PubMed

Kawamoto, Yusuke; Bando, Toshikazu; Sugiyama, Hiroshi

2018-05-01

Pyrrole-imidazole polyamides (Py-Im polyamides) are cell-permeable compounds that bind to the minor groove of double-stranded DNA in a sequence-specific manner without causing denaturation of the DNA. These compounds can be used to control gene expression and to stain specific sequences in cells. Here, we review the history, structural variations, and functional investigations of Py-Im polyamides. Copyright © 2018 Elsevier Ltd. All rights reserved.

Dyes designed for high sensitivity detection of double-stranded DNA

DOEpatents

Glazer, Alexander N.; Benson, Scott C.

2000-01-01

Novel fluorescent dyes are provided, characterized by having a fluorophore joined to a cationic chain. The dyes are found to provide for high enhancement upon binding to nucleic acid and have strong binding affinities to the nucleic acid, as compared to the fluorophore without the polycationic chain. The dyes find use in detection of dsDNA in gel electrophoresis and solution at substantially higher sensitivities using substantially less dye.

Dyes designed for high sensitivity detection of double-stranded DNA

DOEpatents

Glazer, Alexander N.; Benson, Scott C.

1998-01-01

Novel fluorescent dyes are provided, characterized by having a fluorophore joined to a cationic chain. The dyes are found to provide for high enhancement upon binding to nucleic acid and have strong binding affinities to the nucleic acid, as compared to the fluorophore without the polycationic chain. The dyes find use in detection of dsDNA in gel electrophoresis and solution at substantially higher sensitivities using substantially less dye.

Donor impurity binding energies of coaxial GaAs / Alx Ga1 - x As cylindrical quantum wires in a parallel applied magnetic field

NASA Astrophysics Data System (ADS)

Tshipa, M.; Winkoun, D. P.; Nijegorodov, N.; Masale, M.

2018-04-01

Theoretical investigations are carried out of binding energies of a donor charge assumed to be located exactly at the center of symmetry of two concentric cylindrical quantum wires. The intrinsic confinement potential in the region of the inner cylinder is modeled in any one of the three profiles: simple parabolic, shifted parabolic or the polynomial potential. The potential inside the shell is taken to be a potential step or potential barrier of a finite height. Additional confinement of the charge carriers is due to the vector potential of the axial applied magnetic field. It is found that the binding energies attain maxima in their variations with the radius of the inner cylinder irrespective of the particular intrinsic confinement of the inner cylinder. As the radius of the inner cylinder is increased further, the binding energies corresponding to either the parabolic or the polynomial potentials attain minima at some critical core-radius. Finally, as anticipated, the binding energies increase with the increase of the parallel applied magnetic field. This behaviour of the binding energies is irrespective of the particular electric potential of the nanostructure or its specific dimensions.

BFEE: A User-Friendly Graphical Interface Facilitating Absolute Binding Free-Energy Calculations.

PubMed

Fu, Haohao; Gumbart, James C; Chen, Haochuan; Shao, Xueguang; Cai, Wensheng; Chipot, Christophe

2018-03-26

Quantifying protein-ligand binding has attracted the attention of both theorists and experimentalists for decades. Many methods for estimating binding free energies in silico have been reported in recent years. Proper use of the proposed strategies requires, however, adequate knowledge of the protein-ligand complex, the mathematical background for deriving the underlying theory, and time for setting up the simulations, bookkeeping, and postprocessing. Here, to minimize human intervention, we propose a toolkit aimed at facilitating the accurate estimation of standard binding free energies using a geometrical route, coined the binding free-energy estimator (BFEE), and introduced it as a plug-in of the popular visualization program VMD. Benefitting from recent developments in new collective variables, BFEE can be used to generate the simulation input files, based solely on the structure of the complex. Once the simulations are completed, BFEE can also be utilized to perform the post-treatment of the free-energy calculations, allowing the absolute binding free energy to be estimated directly from the one-dimensional potentials of mean force in simulation outputs. The minimal amount of human intervention required during the whole process combined with the ergonomic graphical interface makes BFEE a very effective and practical tool for the end-user.

First-principles study of the binding energy between nanostructures and its scaling with system size

NASA Astrophysics Data System (ADS)

Tao, Jianmin; Jiao, Yang; Mo, Yuxiang; Yang, Zeng-Hui; Zhu, Jian-Xin; Hyldgaard, Per; Perdew, John P.

2018-04-01

The equilibrium van der Waals binding energy is an important factor in the design of materials and devices. However, it presents great computational challenges for materials built up from nanostructures. Here we investigate the binding-energy scaling behavior from first-principles calculations. We show that the equilibrium binding energy per atom between identical nanostructures can scale up or down with nanostructure size, but can be parametrized for large N with an analytical formula (in meV/atom), Eb/N =a +b /N +c /N2+d /N3 , where N is the number of atoms in a nanostructure and a , b , c , and d are fitting parameters, depending on the properties of a nanostructure. The formula is consistent with a finite large-size limit of binding energy per atom. We find that there are two competing factors in the determination of the binding energy: Nonadditivities of van der Waals coefficients and center-to-center distance between nanostructures. To decode the detail, the nonadditivity of the static multipole polarizability is investigated from an accurate spherical-shell model. We find that the higher-order multipole polarizability displays ultrastrong intrinsic nonadditivity, no matter if the dipole polarizability is additive or not.

MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

DOE PAGES

Paugh, Steven W.; Coss, David R.; Bao, Ju; ...

2016-02-04

MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

Structures of a bi-functional Kunitz-type STI family inhibitor of serine and aspartic proteases: Could the aspartic protease inhibition have evolved from a canonical serine protease-binding loop?

PubMed

Guerra, Yasel; Valiente, Pedro A; Pons, Tirso; Berry, Colin; Rudiño-Piñera, Enrique

2016-08-01

Bi-functional inhibitors from the Kunitz-type soybean trypsin inhibitor (STI) family are glycosylated proteins able to inhibit serine and aspartic proteases. Here we report six crystal structures of the wild-type and a non-glycosylated mutant of the bifunctional inhibitor E3Ad obtained at different pH values and space groups. The crystal structures show that E3Ad adopts the typical β-trefoil fold of the STI family exhibiting some conformational changes due to pH variations and crystal packing. Despite the high sequence identity with a recently reported potato cathepsin D inhibitor (PDI), three-dimensional structures obtained in this work show a significant conformational change in the protease-binding loop proposed for aspartic protease inhibition. The E3Ad binding loop for serine protease inhibition is also proposed, based on structural similarity with a novel non-canonical conformation described for the double-headed inhibitor API-A from the Kunitz-type STI family. In addition, structural and sequence analyses suggest that bifunctional inhibitors of serine and aspartic proteases from the Kunitz-type STI family are more similar to double-headed inhibitor API-A than other inhibitors with a canonical protease-binding loop. Copyright © 2016. Published by Elsevier Inc.

MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paugh, Steven W.; Coss, David R.; Bao, Ju

MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

The Walker A motif mutation recA4159 abolishes the SOS response and recombination in a recA730 mutant of Escherichia coli.

PubMed

Šimatović, Ana; Mitrikeski, Petar T; Vlašić, Ignacija; Sopta, Mary; Brčić-Kostić, Krunoslav

2016-01-01

In bacteria, the RecA protein forms recombinogenic filaments required for the SOS response and DNA recombination. In order to form a recombinogenic filament, wild type RecA needs to bind ATP and to interact with mediator proteins. The RecA730 protein is a mutant version of RecA with superior catalytic abilities, allowing filament formation without the help of mediator proteins. The mechanism of RecA730 filament formation is not well understood, and the question remains as to whether the RecA730 protein requires ATP binding in order to become competent for filament formation. We examined two mutants, recA730,4159 (presumed to be defective for ATP binding) and recA730,2201 (defective for ATP hydrolysis), and show that they have different properties with respect to SOS induction, conjugational recombination and double-strand break repair. We show that ATP binding is essential for all RecA730 functions, while ATP hydrolysis is required only for double-strand break repair. Our results emphasize the similarity of the SOS response and conjugational recombination, neither of which requires ATP hydrolysis by RecA730. Copyright © 2016 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Toward an Experimental Quantum Chemistry: Exploring a New Energy Partitioning.

PubMed

Rahm, Martin; Hoffmann, Roald

2015-08-19

Following the work of L. C. Allen, this work begins by relating the central chemical concept of electronegativity with the average binding energy of electrons in a system. The average electron binding energy, χ̅, is in principle accessible from experiment, through photoelectron and X-ray spectroscopy. It can also be estimated theoretically. χ̅ has a rigorous and understandable connection to the total energy. That connection defines a new kind of energy decomposition scheme. The changing total energy in a reaction has three primary contributions to it: the average electron binding energy, the nuclear-nuclear repulsion, and multielectron interactions. This partitioning allows one to gain insight into the predominant factors behind a particular energetic preference. We can conclude whether an energy change in a transformation is favored or resisted by collective changes to the binding energy of electrons, the movement of nuclei, or multielectron interactions. For example, in the classical formation of H2 from atoms, orbital interactions dominate nearly canceling nuclear-nuclear repulsion and two-electron interactions. While in electron attachment to an H atom, the multielectron interactions drive the reaction. Looking at the balance of average electron binding energy, multielectron, and nuclear-nuclear contributions one can judge when more traditional electronegativity arguments can be justifiably invoked in the rationalization of a particular chemical event.

NMR structure of the DNA decamer duplex containing double T*G mismatches of cis-syn cyclobutane pyrimidine dimer: implications for DNA damage recognition by the XPC-hHR23B complex.

PubMed

Lee, Joon-Hwa; Park, Chin-Ju; Shin, Jae-Sun; Ikegami, Takahisa; Akutsu, Hideo; Choi, Byong-Seok

2004-01-01

The cis-syn cyclobutane pyrimidine dimer (CPD) is a cytotoxic, mutagenic and carcinogenic DNA photoproduct and is repaired by the nucleotide excision repair (NER) pathway in mammalian cells. The XPC-hHR23B complex as the initiator of global genomic NER binds to sites of certain kinds of DNA damage. Although CPDs are rarely recognized by the XPC-hHR23B complex, the presence of mismatched bases opposite a CPD significantly increased the binding affinity of the XPC-hHR23B complex to the CPD. In order to decipher the properties of the DNA structures that determine the binding affinity for XPC-hHR23B to DNA, we carried out structural analyses of the various types of CPDs by NMR spectroscopy. The DNA duplex which contains a single 3' T*G wobble pair in a CPD (CPD/GA duplex) induces little conformational distortion. However, severe distortion of the helical conformation occurs when a CPD contains double T*G wobble pairs (CPD/GG duplex) even though the T residues of the CPD form stable hydrogen bonds with the opposite G residues. The helical bending angle of the CPD/GG duplex was larger than those of the CPD/GA duplex and properly matched CPD/AA duplex. The fluctuation of the backbone conformation and significant changes in the widths of the major and minor grooves at the double T*G wobble paired site were also observed in the CPD/GG duplex. These structural features were also found in a duplex that contains the (6-4) adduct, which is efficiently recognized by the XPC-hHR23B complex. Thus, we suggest that the unique structural features of the DNA double helix (that is, helical bending, flexible backbone conformation, and significant changes of the major and/or minor grooves) might be important factors in determining the binding affinity of the XPC-hHR23B complex to DNA.

Atomic Mass and Nuclear Binding Energy for I-131 (Iodine)

NASA Astrophysics Data System (ADS)

Sukhoruchkin, S. I.; Soroko, Z. N.

This document is part of the Supplement containing the complete sets of data of Subvolume A `Nuclei with Z = 1 - 54' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms'. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope I-131 (Iodine, atomic number Z = 53, mass number A = 131).

Atomic Mass and Nuclear Binding Energy for F-22 (Fluorine)

NASA Astrophysics Data System (ADS)

Sukhoruchkin, S. I.; Soroko, Z. N.

This document is part of the Supplement containing the complete sets of data of Subvolume A `Nuclei with Z = 1 - 54' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms'. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope F-22 (Fluorine, atomic number Z = 9, mass number A = 22).

Predicting relative binding affinities of non-peptide HIV protease inhibitors with free energy perturbation calculations

NASA Astrophysics Data System (ADS)

McCarrick, Margaret A.; Kollman, Peter A.

1999-03-01

The relative binding free energies in HIV protease of haloperidol thioketal (THK) and three of its derivatives were examined with free energy calculations. THK is a weak inhibitor (IC50 = 15 μM) for which two cocrystal structures with HIV type 1 proteases have been solved [Rutenber, E. et al., J. Biol. Chem., 268 (1993) 15343]. A THK derivative with a phenyl group on C2 of the piperidine ring was expected to be a poor inhibitor based on experiments with haloperidol ketal and its 2- phenyl derivative (Caldera, P., personal communication). Our calculations predict that a 5-phenyl THK derivative, suggested based on examination of the crystal structure, will bind significantly better than THK. Although there are large error bars as estimated from hysteresis, the calculations predict that the 5-phenyl substituent is clearly favored over the 2-phenyl derivative as well as the parent compound. The unfavorable free energies of solvation of both phenyl THK derivatives relative to the parent compound contributed to their predicted binding free energies. In a third simulation, the change in binding free energy for 5-benzyl THK relative to THK was calculated. Although this derivative has a lower free energy in the protein, its decreased free energy of solvation increases the predicted ΔΔG(bind) to the same range as that of the 2-phenyl derivative.

DNA conformational change induced by the bacteriophage phi 29 connector.

PubMed Central

Valpuesta, J M; Serrano, M; Donate, L E; Herranz, L; Carrascosa, J L

1992-01-01

Translocation of viral DNA inwards and outwards of the capsid of double-stranded DNA bacteriophages occurs through the connector, a key viral structure that is known to interact with DNA. It is shown here that phage phi 29 connector binds both linear and circular double-stranded DNA. However, DNA-mediated protection of phi 29 connectors against Staphylococcus aureus endoprotease V8 digestion suggests that binding to linear DNA is more stable than to circular DNA. Endoprotease V8-protection assays also suggest that the length of the linear DNA required to produce a stable phi 29 connector-DNA interaction is, at least, twice longer than the phi 29 connector channel. This result is confirmed by experiments of phi 29 connector-protection of DNA against DNase I digestion. Furthermore, DNA circularization assays indicate that phi 29 connectors restrain negative supercoiling when bound to linear DNA. This DNA conformational change is not observed upon binding to circular DNA and it could reflect the existence of some left-handed DNA coiling or DNA untwisting inside of the phi 29 connector channel. Images PMID:1454519

ATP-independent diffusion of double-stranded RNA binding proteins

PubMed Central

Koh, Hye Ran; Kidwell, Mary Anne; Ragunathan, Kaushik; Doudna, Jennifer A.; Myong, Sua

2013-01-01

The proteins harboring double-stranded RNA binding domains (dsRBDs) play diverse functional roles such as RNA localization, splicing, editing, export, and translation, yet mechanistic basis and functional significance of dsRBDs remain unclear. To unravel this enigma, we investigated transactivation response RNA binding protein (TRBP) consisting of three dsRBDs, which functions in HIV replication, protein kinase R(PKR)–mediated immune response, and RNA silencing. Here we report an ATP-independent diffusion activity of TRBP exclusively on dsRNA in a length-dependent manner. The first two dsRBDs of TRBP are essential for diffusion, whereas the third dsRBD is dispensable. Two homologs of TRBP, PKR activator and R3D1-L, displayed the same diffusion, implying a universality of the diffusion activity among this protein family. Furthermore, a Dicer–TRBP complex on dsRNA exhibited dynamic diffusion, which was correlated with Dicer’s catalytic activity. These results implicate the dsRNA-specific diffusion activity of TRBP that contributes to enhancing siRNA and miRNA processing by Dicer. PMID:23251028

Virtual screening of integrase inhibitors by large scale binding free energy calculations: the SAMPL4 challenge

PubMed Central

Gallicchio, Emilio; Deng, Nanjie; He, Peng; Wickstrom, Lauren; Perryman, Alexander L.; Santiago, Daniel N.; Forli, Stefano; Olson, Arthur J.; Levy, Ronald M.

2014-01-01

As part of the SAMPL4 blind challenge, filtered AutoDock Vina ligand docking predictions and large scale binding energy distribution analysis method binding free energy calculations have been applied to the virtual screening of a focused library of candidate binders to the LEDGF site of the HIV integrase protein. The computational protocol leveraged docking and high level atomistic models to improve enrichment. The enrichment factor of our blind predictions ranked best among all of the computational submissions, and second best overall. This work represents to our knowledge the first example of the application of an all-atom physics-based binding free energy model to large scale virtual screening. A total of 285 parallel Hamiltonian replica exchange molecular dynamics absolute protein-ligand binding free energy simulations were conducted starting from docked poses. The setup of the simulations was fully automated, calculations were distributed on multiple computing resources and were completed in a 6-weeks period. The accuracy of the docked poses and the inclusion of intramolecular strain and entropic losses in the binding free energy estimates were the major factors behind the success of the method. Lack of sufficient time and computing resources to investigate additional protonation states of the ligands was a major cause of mispredictions. The experiment demonstrated the applicability of binding free energy modeling to improve hit rates in challenging virtual screening of focused ligand libraries during lead optimization. PMID:24504704

Hydrogen Generation by Koh-Ethanol Plasma Electrolysis Using Double Compartement Reactor

NASA Astrophysics Data System (ADS)

Saksono, Nelson; Sasiang, Johannes; Dewi Rosalina, Chandra; Budikania, Trisutanti

2018-03-01

This study has successfully investigated the generation of hydrogen using double compartment reactor with plasma electrolysis process. Double compartment reactor is designed to achieve high discharged voltage, high concentration, and also reduce the energy consumption. The experimental results showed the use of double compartment reactor increased the productivity ratio 90 times higher compared to Faraday electrolysis process. The highest hydrogen production obtained is 26.50 mmol/min while the energy consumption can reach up 1.71 kJ/mmol H2 at 0.01 M KOH solution. It was shown that KOH concentration, addition of ethanol, cathode depth, and temperature have important effects on hydrogen production, energy consumption, and process efficiency.

Development of a linear-type double reflectron for focused imaging of photofragment ions from mass-selected complex ions

NASA Astrophysics Data System (ADS)

Okutsu, Kenichi; Nakashima, Yuji; Yamazaki, Kenichiro; Fujimoto, Keita; Nakano, Motoyoshi; Ohshimo, Keijiro; Misaizu, Fuminori

2017-05-01

An ion imaging apparatus with a double linear reflectron mass spectrometer has been developed, in order to measure velocity and angular distributions of mass-analyzed fragment ions produced by photodissociation of mass-selected gas phase complex ions. The 1st and the 2nd linear reflectrons were placed facing each other and controlled by high-voltage pulses in order to perform the mass-separation of precursor ions in the 1st reflectron and to observe the focused image of the photofragment ions in the 2nd reflectron. For this purpose, metal meshes were attached on all electrodes in the 1st reflectron, whereas the mesh was attached only on the last electrode in the 2nd reflectron. The performance of this apparatus was evaluated using imaging measurement of Ca+ photofragment ions from photodissociation reaction of Ca+Ar complex ions at 355 nm photoexcitation. The focused ion images were obtained experimentally with the double linear reflectron at the voltages of the reflection electrodes close to the predictions by ion trajectory simulations. The velocity and angular distributions of the produced Ca+ ([Ar] 4p1, 2P3/2) ion were analyzed from the observed images. The binding energy D0 of Ca+Ar in the ground state deduced in the present measurement was consistent with those determined theoretically and by spectroscopic measurements. The anisotropy parameter β of the transition was evaluated for the first time by this instrument.

The Universal Statistical Distributions of the Affinity, Equilibrium Constants, Kinetics and Specificity in Biomolecular Recognition

PubMed Central

Zheng, Xiliang; Wang, Jin

2015-01-01

We uncovered the universal statistical laws for the biomolecular recognition/binding process. We quantified the statistical energy landscapes for binding, from which we can characterize the distributions of the binding free energy (affinity), the equilibrium constants, the kinetics and the specificity by exploring the different ligands binding with a particular receptor. The results of the analytical studies are confirmed by the microscopic flexible docking simulations. The distribution of binding affinity is Gaussian around the mean and becomes exponential near the tail. The equilibrium constants of the binding follow a log-normal distribution around the mean and a power law distribution in the tail. The intrinsic specificity for biomolecular recognition measures the degree of discrimination of native versus non-native binding and the optimization of which becomes the maximization of the ratio of the free energy gap between the native state and the average of non-native states versus the roughness measured by the variance of the free energy landscape around its mean. The intrinsic specificity obeys a Gaussian distribution near the mean and an exponential distribution near the tail. Furthermore, the kinetics of binding follows a log-normal distribution near the mean and a power law distribution at the tail. Our study provides new insights into the statistical nature of thermodynamics, kinetics and function from different ligands binding with a specific receptor or equivalently specific ligand binding with different receptors. The elucidation of distributions of the kinetics and free energy has guiding roles in studying biomolecular recognition and function through small-molecule evolution and chemical genetics. PMID:25885453

Interlimb relation during the double support phase of gait: an electromyographic, mechanical and energy-based analysis.

PubMed

Sousa, Andreia S P; Silva, Augusta; Tavares, João Manuel R S

2013-03-01

The purpose of this study is to analyse the interlimb relation and the influence of mechanical energy on metabolic energy expenditure during gait. In total, 22 subjects were monitored as to electromyographic activity, ground reaction forces and VO2 consumption (metabolic power) during gait. The results demonstrate a moderate negative correlation between the activity of tibialis anterior, biceps femoris and vastus medialis of the trailing limb during the transition between mid-stance and double support and that of the leading limb during double support for the same muscles, and between these and gastrocnemius medialis and soleus of the trailing limb during double support. Trailing limb soleus during the transition between mid-stance and double support was positively correlated to leading limb tibialis anterior, vastus medialis and biceps femoris during double support. Also, the trailing limb centre of mass mechanical work was strongly influenced by the leading limbs, although only the mechanical power related to forward progression of both limbs was correlated to metabolic power. These findings demonstrate a consistent interlimb relation in terms of electromyographic activity and centre of mass mechanical work, being the relations occurred in the plane of forward progression the more important to gait energy expenditure.

Accurate Binding Free Energy Predictions in Fragment Optimization.

PubMed

Steinbrecher, Thomas B; Dahlgren, Markus; Cappel, Daniel; Lin, Teng; Wang, Lingle; Krilov, Goran; Abel, Robert; Friesner, Richard; Sherman, Woody

2015-11-23

Predicting protein-ligand binding free energies is a central aim of computational structure-based drug design (SBDD)--improved accuracy in binding free energy predictions could significantly reduce costs and accelerate project timelines in lead discovery and optimization. The recent development and validation of advanced free energy calculation methods represents a major step toward this goal. Accurately predicting the relative binding free energy changes of modifications to ligands is especially valuable in the field of fragment-based drug design, since fragment screens tend to deliver initial hits of low binding affinity that require multiple rounds of synthesis to gain the requisite potency for a project. In this study, we show that a free energy perturbation protocol, FEP+, which was previously validated on drug-like lead compounds, is suitable for the calculation of relative binding strengths of fragment-sized compounds as well. We study several pharmaceutically relevant targets with a total of more than 90 fragments and find that the FEP+ methodology, which uses explicit solvent molecular dynamics and physics-based scoring with no parameters adjusted, can accurately predict relative fragment binding affinities. The calculations afford R(2)-values on average greater than 0.5 compared to experimental data and RMS errors of ca. 1.1 kcal/mol overall, demonstrating significant improvements over the docking and MM-GBSA methods tested in this work and indicating that FEP+ has the requisite predictive power to impact fragment-based affinity optimization projects.

Atomic Simulation of Complex DNA DSBs and the Interactions with the Ku70/80 Heterodimer

NASA Technical Reports Server (NTRS)

Hu, Shaowen; Cucinotta, Francis A.

2011-01-01

DNA double strand breaks (DSBs) induced by ionizing radiation (IR) usually contain modified bases such as 8-oxo-7,8-dihydroguanine (8-oxoG) and thymine glycol, apurinic/apyrimidinic (AP) sites, 2-deoxyribonolactone, or single-strand breaks (SSBs). The presence of such lesions in close proximity to the DSB terminus makes the DNA nicks more difficult to repair and rejoin than endogenously induced simple DSBs, and as such a major determinant of the biological effects of high linear energy transfer (LET) radiation as encountered in space travel. In this study we conducted molecular dynamics simulations on a series of DNA duplexes with various complex lesions of 8-oxoG and AP sites, in an effort to investigate the effects of such lesions to the structural integrity and stability of DNA after insulted by IR. We also simulated the interaction of such complex DSBs with the Ku70/80 heterodimer, the first protein in mammalian cells to embark the non-homologous end joining (NHEJ) DNA repair pathway. The results indicate, compared to DNA with simple DSBs, the complex lesions can enhance the hydrogen bonds opening rate at the DNA terminus, and increase the mobility of the whole duplex, thus they present more deleterious effects to the genome integrity if not captured and repaired promptly in cells. Simulations also demonstrate the binding of Ku drastically reduces structural disruption and flexibility caused by the complex lesions, and the interactions of Ku with complex DSBs have a different potential energy landscape from the bound structure with simple DSB. In all complex DSBs systems, the binding of DSB terminus with Ku70 is softened while the binding of the middle duplex with Ku80 is tightened. This energy shift may help the Ku protein to secure at the DSB terminus for a longer time, so that other end processing factors or repair pathways can proceed at the lesions before NHEJ repair process starts. These atomic simulations may provide valuable new insight into the selective action of repair proteins on damaged DNA.

Calculated differential and double differential cross section of DT neutron induced reactions on natural chromium (Cr)

NASA Astrophysics Data System (ADS)

Rajput, Mayank; Vala, Sudhirsinh; Srinivasan, R.; Abhangi, M.; Subhash, P. V.; Pandey, B.; Rao, C. V. S.; Bora, D.

2018-01-01

Chromium is an important alloying element of stainless steel (SS) and SS is the main constituent of structural material proposed for fusion reactors. Energy and double differential cross section data will be required to estimate nuclear responses in the materials used in fusion reactors. There are no experimental data of energy and double differential cross section, available for neutron induced reactions on natural chromium at 14 MeV neutron energy. In this study, energy and double differential cross section data of (n,p) and (n,α) reactions for all the stable isotopes of chromium have been estimated, using appropriate nuclear models in TALYS code. The cross section data of stable isotopes are later converted into the energy and double differential cross section data of natural Cr using the isotopic abundance. The contribution from compound, pre-equilibrium and direct nuclear reaction to total reaction have also been calculated for 52,50Cr(n,p) and 52Cr(n,α). The calculation of energy differential cross section shows that most of emitted protons and alpha particles are of 3 and 8 MeV respectively. The calculated data is compared with the data from EXFOR data library and is found to be in good agreement.

Exploring the Origin of Differential Binding Affinities of Human Tubulin Isotypes αβII, αβIII and αβIV for DAMA-Colchicine Using Homology Modelling, Molecular Docking and Molecular Dynamics Simulations

PubMed Central

Panda, Dulal; Kunwar, Ambarish

2016-01-01

Tubulin isotypes are found to play an important role in regulating microtubule dynamics. The isotype composition is also thought to contribute in the development of drug resistance as tubulin isotypes show differential binding affinities for various anti-cancer agents. Tubulin isotypes αβII, αβIII and αβIV show differential binding affinity for colchicine. However, the origin of differential binding affinity is not well understood at the molecular level. Here, we investigate the origin of differential binding affinity of a colchicine analogue N-deacetyl-N-(2-mercaptoacetyl)-colchicine (DAMA-colchicine) for human αβII, αβIII and αβIV isotypes, employing sequence analysis, homology modeling, molecular docking, molecular dynamics simulation and MM-GBSA binding free energy calculations. The sequence analysis study shows that the residue compositions are different in the colchicine binding pocket of αβII and αβIII, whereas no such difference is present in αβIV tubulin isotypes. Further, the molecular docking and molecular dynamics simulations results show that residue differences present at the colchicine binding pocket weaken the bonding interactions and the correct binding of DAMA-colchicine at the interface of αβII and αβIII tubulin isotypes. Post molecular dynamics simulation analysis suggests that these residue variations affect the structure and dynamics of αβII and αβIII tubulin isotypes, which in turn affect the binding of DAMA-colchicine. Further, the binding free-energy calculation shows that αβIV tubulin isotype has the highest binding free-energy and αβIII has the lowest binding free-energy for DAMA-colchicine. The order of binding free-energy for DAMA-colchicine is αβIV ≃ αβII >> αβIII. Thus, our computational approaches provide an insight into the effect of residue variations on differential binding of αβII, αβIII and αβIV tubulin isotypes with DAMA-colchicine and may help to design new analogues with higher binding affinities for tubulin isotypes. PMID:27227832

Pyrene–nucleobase conjugates: synthesis, oligonucleotide binding and confocal bioimaging studies

PubMed Central

Jabłoński, Artur; Fritz, Yannic; Wagenknecht, Hans-Achim; Czerwieniec, Rafał; Bernaś, Tytus; Trzybiński, Damian; Woźniak, Krzysztof

2017-01-01

Fluorescent pyrene–linker–nucleobase (nucleobase = thymine, adenine) conjugates with carbonyl and hydroxy functionalities in the linker were synthesized and characterized. X-ray single-crystal structure analysis performed for the pyrene–C(O)CH2CH2–thymine (2) conjugate reveals dimers of molecules 2 stabilized by hydrogen bonds between the thymine moieties. The photochemical characterization showed structure-dependent fluorescence properties of the investigated compounds. The conjugates bearing a carbonyl function represent weak emitters as compared to compounds with a hydroxy function in the linker. The self-assembly properties of pyrene nucleobases were investigated in respect to their binding to single and double strand oligonucleotides in water and in buffer solution. In respect to the complementary oligothymidine T10 template in water, compounds 3 and 5 both show a self-assembling behavior according to canonical base–base pairing. However, in buffer solution, derivative 5 was much more effective than 3 in binding to the T10 template. Furthermore the adenine derivative 5 binds to the double-stranded (dA)10–T10 template with a self-assembly ratio of 112%. Such a high value of a self-assembly ratio can be rationalized by a triple-helix-like binding, intercalation, or a mixture of both. Remarkably, compound 5 also shows dual staining pattern in living HeLa cells. Confocal microscopy confirmed that 5 predominantly stains mitochondria but it also accumulates in the nucleoli of the cells. PMID:29259662

HEXIM1 is a promiscuous double-stranded RNA-binding protein and interacts with RNAs in addition to 7SK in cultured cells

PubMed Central

Li, Qintong; Cooper, Jeffrey J.; Altwerger, Gary H.; Feldkamp, Michael D.; Shea, Madeline A.; Price, David H.

2007-01-01

P-TEFb regulates eukaryotic gene expression at the level of transcription elongation, and is itself controlled by the reversible association of 7SK RNA and an RNA-binding protein HEXIM1 or HEXIM2. In an effort to determine the minimal region of 7SK needed to interact with HEXIM1 in vitro, we found that an oligo comprised of nucleotides 10–48 sufficed. A bid to further narrow down the minimal region of 7SK led to a surprising finding that HEXIM1 binds to double-stranded RNA in a sequence-independent manner. Both dsRNA and 7SK (10–48), but not dsDNA, competed efficiently with full-length 7SK for HEXIM1 binding in vitro. Upon binding dsRNA, a large conformational change was observed in HEXIM1 that allowed the recruitment and inhibition of P-TEFb. Both subcellular fractionation and immunofluorescence demonstrated that, while most HEXIM1 is found in the nucleus, a significant fraction is found in the cytoplasm. Immunoprecipitation experiments demonstrated that both nuclear and cytoplasmic HEXIM1 is associated with RNA. Interestingly, the one microRNA examined (mir-16) was found in HEXIM1 immunoprecipitates, while the small nuclear RNAs, U6 and U2, were not. Our study illuminates novel properties of HEXIM1 both in vitro and in vivo, and suggests that HEXIM1 may be involved in other nuclear and cytoplasmic processes besides controlling P-TEFb. PMID:17395637

Exciton Binding Energy of Monolayer WS2

PubMed Central

Zhu, Bairen; Chen, Xi; Cui, Xiaodong

2015-01-01

The optical properties of monolayer transition metal dichalcogenides (TMDC) feature prominent excitonic natures. Here we report an experimental approach to measuring the exciton binding energy of monolayer WS2 with linear differential transmission spectroscopy and two-photon photoluminescence excitation spectroscopy (TP-PLE). TP-PLE measurements show the exciton binding energy of 0.71 ± 0.01 eV around K valley in the Brillouin zone. PMID:25783023

A computational analysis of the binding model of MDM2 with inhibitors

NASA Astrophysics Data System (ADS)

Hu, Guodong; Wang, Dunyou; Liu, Xinguo; Zhang, Qinggang

2010-08-01

It is a new and promising strategy for anticancer drug design to block the MDM2-p53 interaction using a non-peptide small-molecule inhibitor. We carry out molecular dynamics simulations to study the binding of a set of six non-peptide small-molecule inhibitors with the MDM2. The relative binding free energies calculated using molecular mechanics Poisson-Boltzmann surface area method produce a good correlation with experimentally determined results. The study shows that the van der Waals energies are the largest component of the binding free energy for each complex, which indicates that the affinities of these inhibitors for MDM2 are dominated by shape complementarity. The A-ligands and the B-ligands are the same except for the conformation of 2,2-dimethylbutane group. The quantum mechanics and the binding free energies calculation also show the B-ligands are the more possible conformation of ligands. Detailed binding free energies between inhibitors and individual protein residues are calculated to provide insights into the inhibitor-protein binding model through interpretation of the structural and energetic results from the simulations. The study shows that G1, G2 and G3 group mimic the Phe19, Trp23 and Leu26 residues in p53 and their interactions with MDM2, but the binding model of G4 group differs from the original design strategy to mimic Leu22 residue in p53.

Intramolecular competition between n-pair and π-pair hydrogen bonding: Microwave spectrum and internal dynamics of the pyridine–acetylene hydrogen-bonded complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mackenzie, Rebecca B.; Dewberry, Christopher T.; Leopold, Kenneth R., E-mail: A.C.Legon@bristol.ac.uk, E-mail: david.tew@bristol.ac.uk, E-mail: kleopold@umn.edu

2015-09-14

a-type rotational spectra of the hydrogen-bonded complex formed from pyridine and acetylene are reported. Rotational and {sup 14}N hyperfine constants indicate that the complex is planar with an acetylenic hydrogen directed toward the nitrogen. However, unlike the complexes of pyridine with HCl and HBr, the acetylene moiety in HCCH—NC{sub 5}H{sub 5} does not lie along the symmetry axis of the nitrogen lone pair, but rather, forms an average angle of 46° with the C{sub 2} axis of the pyridine. The a-type spectra of HCCH—NC{sub 5}H{sub 5} and DCCD—NC{sub 5}H{sub 5} are doubled, suggesting the existence of a low lying pairmore » of tunneling states. This doubling persists in the spectra of HCCD—NC{sub 5}H{sub 5}, DCCH—NC{sub 5}H{sub 5}, indicating that the underlying motion does not involve interchange of the two hydrogens of the acetylene. Single {sup 13}C substitution in either the ortho- or meta-position of the pyridine eliminates the doubling and gives rise to separate sets of spectra that are well predicted by a bent geometry with the {sup 13}C on either the same side (“inner”) or the opposite side (“outer”) as the acetylene. High level ab initio calculations are presented which indicate a binding energy of 1.2 kcal/mol and a potential energy barrier of 44 cm{sup −1} in the C{sub 2v} configuration. Taken together, these results reveal a complex with a bent hydrogen bond and large amplitude rocking of the acetylene moiety. It is likely that the bent equilibrium structure arises from a competition between a weak hydrogen bond to the nitrogen (an n-pair hydrogen bond) and a secondary interaction between the ortho-hydrogens of the pyridine and the π electron density of the acetylene.« less

Resolving the problem of trapped water in binding cavities: prediction of host-guest binding free energies in the SAMPL5 challenge by funnel metadynamics

NASA Astrophysics Data System (ADS)

Bhakat, Soumendranath; Söderhjelm, Pär

2017-01-01

The funnel metadynamics method enables rigorous calculation of the potential of mean force along an arbitrary binding path and thereby evaluation of the absolute binding free energy. A problem of such physical paths is that the mechanism characterizing the binding process is not always obvious. In particular, it might involve reorganization of the solvent in the binding site, which is not easily captured with a few geometrically defined collective variables that can be used for biasing. In this paper, we propose and test a simple method to resolve this trapped-water problem by dividing the process into an artificial host-desolvation step and an actual binding step. We show that, under certain circumstances, the contribution from the desolvation step can be calculated without introducing further statistical errors. We apply the method to the problem of predicting host-guest binding free energies in the SAMPL5 blind challenge, using two octa-acid hosts and six guest molecules. For one of the hosts, well-converged results are obtained and the prediction of relative binding free energies is the best among all the SAMPL5 submissions. For the other host, which has a narrower binding pocket, the statistical uncertainties are slightly higher; longer simulations would therefore be needed to obtain conclusive results.

An ancient protein-DNA interaction underlying metazoan sex determination.

PubMed

Murphy, Mark W; Lee, John K; Rojo, Sandra; Gearhart, Micah D; Kurahashi, Kayo; Banerjee, Surajit; Loeuille, Guy-André; Bashamboo, Anu; McElreavey, Kenneth; Zarkower, David; Aihara, Hideki; Bardwell, Vivian J

2015-06-01

DMRT transcription factors are deeply conserved regulators of metazoan sexual development. They share the DM DNA-binding domain, a unique intertwined double zinc-binding module followed by a C-terminal recognition helix, which binds a pseudopalindromic target DNA. Here we show that DMRT proteins use a unique binding interaction, inserting two adjacent antiparallel recognition helices into a widened DNA major groove to make base-specific contacts. Versatility in how specific base contacts are made allows human DMRT1 to use multiple DNA binding modes (tetramer, trimer and dimer). Chromatin immunoprecipitation with exonuclease treatment (ChIP-exo) indicates that multiple DNA binding modes also are used in vivo. We show that mutations affecting residues crucial for DNA recognition are associated with an intersex phenotype in flies and with male-to-female sex reversal in humans. Our results illuminate an ancient molecular interaction underlying much of metazoan sexual development.

An ancient protein-DNA interaction underlying metazoan sex determination

DOE PAGES

Murphy, Mark W.; Lee, John K.; Rojo, Sandra; ...

2015-05-25

DMRT transcription factors are deeply conserved regulators of metazoan sexual development. They share the DM DNA-binding domain, a unique intertwined double zinc-binding module followed by a C-terminal recognition helix, which binds a pseudopalindromic target DNA. In this paper, we show that DMRT proteins use a unique binding interaction, inserting two adjacent antiparallel recognition helices into a widened DNA major groove to make base-specific contacts. Versatility in how specific base contacts are made allows human DMRT1 to use multiple DNA binding modes (tetramer, trimer and dimer). Chromatin immunoprecipitation with exonuclease treatment (ChIP-exo) indicates that multiple DNA binding modes also are usedmore » in vivo. We show that mutations affecting residues crucial for DNA recognition are associated with an intersex phenotype in flies and with male-to-female sex reversal in humans. Finally, our results illuminate an ancient molecular interaction underlying much of metazoan sexual development.« less

An ancient protein-DNA interaction underlying metazoan sex determination

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murphy, Mark W.; Lee, John K.; Rojo, Sandra

DMRT transcription factors are deeply conserved regulators of metazoan sexual development. They share the DM DNA-binding domain, a unique intertwined double zinc-binding module followed by a C-terminal recognition helix, which binds a pseudopalindromic target DNA. In this paper, we show that DMRT proteins use a unique binding interaction, inserting two adjacent antiparallel recognition helices into a widened DNA major groove to make base-specific contacts. Versatility in how specific base contacts are made allows human DMRT1 to use multiple DNA binding modes (tetramer, trimer and dimer). Chromatin immunoprecipitation with exonuclease treatment (ChIP-exo) indicates that multiple DNA binding modes also are usedmore » in vivo. We show that mutations affecting residues crucial for DNA recognition are associated with an intersex phenotype in flies and with male-to-female sex reversal in humans. Finally, our results illuminate an ancient molecular interaction underlying much of metazoan sexual development.« less

Synthesis and structure elucidation of a copper(II) Schiff-base complex: in vitro DNA binding, pBR322 plasmid cleavage and HSA binding studies.

PubMed

Tabassum, Sartaj; Ahmad, Musheer; Afzal, Mohd; Zaki, Mehvash; Bharadwaj, Parimal K

2014-11-01

New copper(II) complex with Schiff base ligand 4-[(2-Hydroxy-3-methoxy-benzylidene)-amino]-benzoic acid (H₂L) was synthesized and characterized by spectroscopic and analytical and single crystal X-ray diffraction studies which revealed that the complex 1 exist in a distorted octahedral environment. In vitro CT-DNA binding studies were performed by employing different biophysical technique which indicated that the 1 strongly binds to DNA in comparison to ligand via electrostatic binding mode. Complex 1 cleaves pBR322 DNA via hydrolytic pathway and recognizes minor groove of DNA double helix. The HSA binding results showed that ligand and complex 1 has ability to quench the fluorescence emission intensity of Trp 214 residue available in the subdomain IIA of HSA. Copyright © 2014 Elsevier B.V. All rights reserved.

Photodissociation dynamics of Mo(CO) sub 6 at 266 and 355 nm: CO photofragment kinetic-energy and internal-state distributions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buntin, S.A.; Cavanagh, R.R.; Richter, L.J.

1991-06-15

The internal-state and kinetic-energy distributions of the CO photofragments from the 266 and 355 nm photolysis of Mo(CO){sub 6} have been measured under collision-free conditions using vacuum-ultraviolet laser-induced fluorescence. The rotational-state distributions for CO({ital v}{double prime}=0) and ({ital v}{double prime}=1) are well represented by Boltzmann distributions with effective rotational temperatures'' of {ital T}{sub {ital r}}({ital v}{double prime}=0)=950{plus minus}70 K and {ital T}{sub {ital r}}({ital v}{double prime}=1)=935{plus minus}85 K for 266 nm and {ital T}{sub {ital r}}({ital v}{double prime}=0)=750{plus minus}70 K and {ital T}{sub {ital r}}({ital v}{double prime}=1)=1150{plus minus}250 K for 355 nm photolysis. The CO({ital v}{double prime}=1/{ital v}{double prime}=0) vibrational-statemore » ratios for 266 and 355 nm photolysis are 0.19{plus minus}0.03 and 0.09{plus minus}0.02, respectively. The Doppler-broadened CO photofragment line shapes indicate that the translational energy distributions are isotropic and Maxwellian. There is no photolysis-laser wavelength or internal-state dependence to the extracted translational temperatures.'' The observed energy partitioning and kinetic-energy distributions are inconsistent with an impulsive ejection of a single CO ligand. CO photofragment line shapes for 266 nm photolysis are not consistent with a mechanism involving the repulsive ejection of the first CO ligand, followed by the statistical decomposition of the Mo(CO){sub 5} fragment. While phase-space theories do not predict quantitatively the energy disposal, the photodissociation mechanism appears to be dominated by statistical considerations. The results also suggest that the photodissociation of Mo(CO){sub 6} at 266 and 355 nm involves a common initial state'' and that similar exit channel effects are operative.« less

Energy Fluctuations Shape Free Energy of Nonspecific Biomolecular Interactions

NASA Astrophysics Data System (ADS)

Elkin, Michael; Andre, Ingemar; Lukatsky, David B.

2012-01-01

Understanding design principles of biomolecular recognition is a key question of molecular biology. Yet the enormous complexity and diversity of biological molecules hamper the efforts to gain a predictive ability for the free energy of protein-protein, protein-DNA, and protein-RNA binding. Here, using a variant of the Derrida model, we predict that for a large class of biomolecular interactions, it is possible to accurately estimate the relative free energy of binding based on the fluctuation properties of their energy spectra, even if a finite number of the energy levels is known. We show that the free energy of the system possessing a wider binding energy spectrum is almost surely lower compared with the system possessing a narrower energy spectrum. Our predictions imply that low-affinity binding scores, usually wasted in protein-protein and protein-DNA docking algorithms, can be efficiently utilized to compute the free energy. Using the results of Rosetta docking simulations of protein-protein interactions from Andre et al. (Proc. Natl. Acad. Sci. USA 105:16148, 2008), we demonstrate the power of our predictions.

Recognition Mechanism of siRNA by Viral p19 Suppressor of RNA Silencing: A Molecular Dynamics Study

PubMed Central

Xia, Zhen; Zhu, Zhihong; Zhu, Jun; Zhou, Ruhong

2009-01-01

The p19 protein (p19) encoded from Tombusvirus is involved in various activities such as pathogenicity and virus transport. Recent studies have found that p19 is a plant suppressor of RNA silencing, which binds to short interfering RNAs (siRNAs) with high affinity. We use molecular dynamics (MD) simulations of the wild-type and mutant p19 protein (W39 and W42G) binding with a 21-nt siRNA duplex to study the p19-siRNA recognition mechanism and mutation effects. Our simulations with standard MD and steered molecular dynamics have shown that the double mutant structure is indeed much less stable than the wild-type, consistent with the recent experimental findings. Comprehensive structural analysis also shows that the W39/42G mutations first induce the loss of stacking interactions between p19 and siRNA, Trp42-Cyt1 (Cyt1 from the 5′ to 3′ strand) and Trp39-Gua′19 (Gua19 from the 3′ to 5′ strand), and then breaks the hydrophobic core formed by W39-W42 with nucleotide basepairs in the wild-type. The steered molecular dynamics simulations also show that the mutant p19 complex is “decompounded” very fast under a constant separation force, whereas the wild-type remains largely intact under the same steering force. Moreover, we have used the free energy perturbation to predict a binding affinity loss of 6.98 ± 0.95 kcal/mol for the single mutation W39G, and 12.8 ± 1.0 kcal/mol loss for the double mutation W39/42G, with the van der Waals interactions dominating the contribution (∼90%). These results indicate that the W39/42G mutations essentially destroy the important p19-siRNA recognition by breaking the strong stacking interaction between Cyt1 and Gua′19 with end-capping tryptophans. These large scale simulations might provide new insights to the interactions and co-evolution relationship between RNA virus proteins and their hosts. PMID:19254536

DNA Hairpins Containing the Cytidine Analog Pyrrolo-dC: Structural, Thermodynamic, and Spectroscopic Studies

PubMed Central

Zhang, Xu; Wadkins, Randy M.

2009-01-01

Structures formed by single-strand DNA have become increasingly interesting because of their roles in a number of biological processes, particularly transcription and its regulation. Of particular importance is the fact that antitumor drugs such as Actinomycin D can selectively bind DNA hairpins over fully paired, double-strand DNA. A new fluorescent base analog, pyrrolo-deoxycytidine (PdC), can now be routinely incorporated into single-strand DNA. The fluorescence of PdC is particularly useful for studying the formation of single-strand DNA in regions of double-strand DNA. The fluorescence is quenched when PdC is paired with a complementary guanine residue, and thus is greatly enhanced upon formation of single-strand DNA. Hence, any process that results in melting or opening of DNA strands produces an increase in the fluorescence intensity of this base analog. In this study we measured the structural effects of incorporating PdC into DNA hairpins, and the effect of this incorporation on the binding of the hairpins by a fluorescent analog of the drug Actinomycin D. Two hairpin DNAs were used: one with PdC in the stem (basepaired) and one with PdC in the loop (unpaired). The thermal stability, 7-aminoactinomycin D binding, and three-dimensional structures of PdC incorporated into these DNA hairpins were all quite similar as compared to the hairpins containing an unmodified dC residue. Fluorescence lifetime measurements indicate that two lifetimes are present in PdC, and that the increase in fluorescence of the unpaired PdC residue compared to the basepaired PdC is due to an increase in the contribution of the longer lifetime to the average fluorescence lifetime. Our data indicate that PdC can be used effectively to differentiate paired and unpaired bases in DNA hairpin secondary structures, and should be similarly applicable for related structures such as cruciforms and quadruplexes. Further, our data indicate that PdC can act as a fluorescence resonance energy transfer donor for the fluorescent drug 7-aminoactinomycin D. PMID:19254547

DNA hairpins containing the cytidine analog pyrrolo-dC: structural, thermodynamic, and spectroscopic studies.

PubMed

Zhang, Xu; Wadkins, Randy M

2009-03-04

Structures formed by single-strand DNA have become increasingly interesting because of their roles in a number of biological processes, particularly transcription and its regulation. Of particular importance is the fact that antitumor drugs such as Actinomycin D can selectively bind DNA hairpins over fully paired, double-strand DNA. A new fluorescent base analog, pyrrolo-deoxycytidine (PdC), can now be routinely incorporated into single-strand DNA. The fluorescence of PdC is particularly useful for studying the formation of single-strand DNA in regions of double-strand DNA. The fluorescence is quenched when PdC is paired with a complementary guanine residue, and thus is greatly enhanced upon formation of single-strand DNA. Hence, any process that results in melting or opening of DNA strands produces an increase in the fluorescence intensity of this base analog. In this study we measured the structural effects of incorporating PdC into DNA hairpins, and the effect of this incorporation on the binding of the hairpins by a fluorescent analog of the drug Actinomycin D. Two hairpin DNAs were used: one with PdC in the stem (basepaired) and one with PdC in the loop (unpaired). The thermal stability, 7-aminoactinomycin D binding, and three-dimensional structures of PdC incorporated into these DNA hairpins were all quite similar as compared to the hairpins containing an unmodified dC residue. Fluorescence lifetime measurements indicate that two lifetimes are present in PdC, and that the increase in fluorescence of the unpaired PdC residue compared to the basepaired PdC is due to an increase in the contribution of the longer lifetime to the average fluorescence lifetime. Our data indicate that PdC can be used effectively to differentiate paired and unpaired bases in DNA hairpin secondary structures, and should be similarly applicable for related structures such as cruciforms and quadruplexes. Further, our data indicate that PdC can act as a fluorescence resonance energy transfer donor for the fluorescent drug 7-aminoactinomycin D.

Adsorption and Dissociation of Water on the (0001) Surface of DHCP Americium

NASA Astrophysics Data System (ADS)

Dholabhai, Pratik; Ray, Asok

2009-03-01

Ab initio total energy calculations within the framework of density functional theory have been performed for water molecule adsorption on the (0001) surface of double hexagonal closed packed americium. Subsequent partial dissociation (OH+H) and complete dissociation (H+O+H) of the water molecule have been examined. The completely dissociated configuration exhibits the strongest binding with the surface followed by partially dissociated species, with all molecular H2O configurations showing weak physisorption. The change in work functions and net magnetic moments before and after adsorption will be presented for all the cases studied. The adsorbate-substrate interactions will be elaborated using the difference charge density distributions and the local density of states. The effects of adsorption on Am 5f electron localization-delocalization in the vicinity of the Fermi level will be discussed.

Independent-Trajectory Thermodynamic Integration: a practical guide to protein-drug binding free energy calculations using distributed computing.

PubMed

Lawrenz, Morgan; Baron, Riccardo; Wang, Yi; McCammon, J Andrew

2012-01-01

The Independent-Trajectory Thermodynamic Integration (IT-TI) approach for free energy calculation with distributed computing is described. IT-TI utilizes diverse conformational sampling obtained from multiple, independent simulations to obtain more reliable free energy estimates compared to single TI predictions. The latter may significantly under- or over-estimate the binding free energy due to finite sampling. We exemplify the advantages of the IT-TI approach using two distinct cases of protein-ligand binding. In both cases, IT-TI yields distributions of absolute binding free energy estimates that are remarkably centered on the target experimental values. Alternative protocols for the practical and general application of IT-TI calculations are investigated. We highlight a protocol that maximizes predictive power and computational efficiency.

Binding free energy prediction in strongly hydrophobic biomolecular systems.

PubMed

Charlier, Landry; Nespoulous, Claude; Fiorucci, Sébastien; Antonczak, Serge; Golebiowski, Jérome

2007-11-21

We present a comparison of various computational approaches aiming at predicting the binding free energy in ligand-protein systems where the ligand is located within a highly hydrophobic cavity. The relative binding free energy between similar ligands is obtained by means of the thermodynamic integration (TI) method and compared to experimental data obtained through isothermal titration calorimetry measurements. The absolute free energy of binding prediction was obtained on a similar system (a pyrazine derivative bound to a lipocalin) by TI, potential of mean force (PMF) and also by means of the MMPBSA protocols. Although the TI protocol performs poorly either with an explicit or an implicit solvation scheme, the PMF calculation using an implicit solvation scheme leads to encouraging results, with a prediction of the binding affinity being 2 kcal mol(-1) lower than the experimental value. The use of an implicit solvation scheme appears to be well suited for the study of such hydrophobic systems, due to the lack of water molecules within the binding site.

Electric and magnetic field modulated energy dispersion, conductivity and optical response in double quantum wire with spin-orbit interactions

NASA Astrophysics Data System (ADS)

Karaaslan, Y.; Gisi, B.; Sakiroglu, S.; Kasapoglu, E.; Sari, H.; Sokmen, I.

2018-02-01

We study the influence of electric field on the electronic energy band structure, zero-temperature ballistic conductivity and optical properties of double quantum wire. System described by double-well anharmonic confinement potential is exposed to a perpendicular magnetic field and Rashba and Dresselhaus spin-orbit interactions. Numerical results show up that the combined effects of internal and external agents cause the formation of crossing, anticrossing, camel-back/anomaly structures and the lateral, downward/upward shifts in the energy dispersion. The anomalies in the energy subbands give rise to the oscillation patterns in the ballistic conductance, and the energy shifts bring about the shift in the peak positions of optical absorption coefficients and refractive index changes.

Dyes designed for high sensitivity detection of double-stranded DNA

DOEpatents

Glazer, A.N.; Benson, S.C.

1998-07-21

Novel fluorescent dyes are provided, characterized by having a fluorophore joined to a cationic chain. The dyes are found to provide for high enhancement upon binding to nucleic acid and have strong binding affinities to the nucleic acid, as compared to the fluorophore without the polycationic chain. The dyes find use in detection of dsDNA in gel electrophoresis and solution at substantially higher sensitivities using substantially less dye. 10 figs.

Using docking and alchemical free energy approach to determine the binding mechanism of eEF2K inhibitors and prioritizing the compound synthesis.

PubMed

Wang, Qiantao; Edupuganti, Ramakrishna; Tavares, Clint D J; Dalby, Kevin N; Ren, Pengyu

2015-01-01

A-484954 is a known eEF2K inhibitor with submicromolar IC50 potency. However, the binding mechanism and the crystal structure of the kinase remains unknown. Here, we employ a homology eEF2K model, docking and alchemical free energy simulations to probe the binding mechanism of eEF2K, and in turn, guide the optimization of potential lead compounds. The inhibitor was docked into the ATP-binding site of a homology model first. Three different binding poses, hypothesis 1, 2, and 3, were obtained and subsequently applied to molecular dynamics (MD) based alchemical free energy simulations. The calculated relative binding free energy of the analogs of A-484954 using the binding pose of hypothesis 1 show a good correlation with the experimental IC50 values, yielding an r (2) coefficient of 0.96 after removing an outlier (compound 5). Calculations using another two poses show little correlation with experimental data, (r (2) of less than 0.5 with or without removing any outliers). Based on hypothesis 1, the calculated relative free energy suggests that bigger cyclic groups, at R1 e.g., cyclobutyl and cyclopentyl promote more favorable binding than smaller groups, such as cyclopropyl and hydrogen. Moreover, this study also demonstrates the ability of the alchemical free energy approach in combination with docking and homology modeling to prioritize compound synthesis. This can be an effective means of facilitating structure-based drug design when crystal structures are not available.

The feasibility of an efficient drug design method with high-performance computers.

PubMed

Yamashita, Takefumi; Ueda, Akihiko; Mitsui, Takashi; Tomonaga, Atsushi; Matsumoto, Shunji; Kodama, Tatsuhiko; Fujitani, Hideaki

2015-01-01

In this study, we propose a supercomputer-assisted drug design approach involving all-atom molecular dynamics (MD)-based binding free energy prediction after the traditional design/selection step. Because this prediction is more accurate than the empirical binding affinity scoring of the traditional approach, the compounds selected by the MD-based prediction should be better drug candidates. In this study, we discuss the applicability of the new approach using two examples. Although the MD-based binding free energy prediction has a huge computational cost, it is feasible with the latest 10 petaflop-scale computer. The supercomputer-assisted drug design approach also involves two important feedback procedures: The first feedback is generated from the MD-based binding free energy prediction step to the drug design step. While the experimental feedback usually provides binding affinities of tens of compounds at one time, the supercomputer allows us to simultaneously obtain the binding free energies of hundreds of compounds. Because the number of calculated binding free energies is sufficiently large, the compounds can be classified into different categories whose properties will aid in the design of the next generation of drug candidates. The second feedback, which occurs from the experiments to the MD simulations, is important to validate the simulation parameters. To demonstrate this, we compare the binding free energies calculated with various force fields to the experimental ones. The results indicate that the prediction will not be very successful, if we use an inaccurate force field. By improving/validating such simulation parameters, the next prediction can be made more accurate.

Binding energy of the donor impurities in GaAs-Ga 1- x Al x As quantum well wires with Morse potential in the presence of electric and magnetic fields

NASA Astrophysics Data System (ADS)

Aciksoz, Esra; Bayrak, Orhan; Soylu, Asim

2016-10-01

The behavior of a donor in the GaAs-Ga1-x Al x As quantum well wire represented by the Morse potential is examined within the framework of the effective-mass approximation. The donor binding energies are numerically calculated for with and without the electric and magnetic fields in order to show their influence on the binding energies. Moreover, how the donor binding energies change for the constant potential parameters (D e, r e, and a) as well as with the different values of the electric and magnetic field strengths is determined. It is found that the donor binding energy is highly dependent on the external electric and magnetic fields as well as parameters of the Morse potential. Project supported by the Turkish Science Research Council (TÜBİTAK) and the Financial Supports from Akdeniz and Nigde Universities.

Capacitance of carbon-based electrical double-layer capacitors.

PubMed

Ji, Hengxing; Zhao, Xin; Qiao, Zhenhua; Jung, Jeil; Zhu, Yanwu; Lu, Yalin; Zhang, Li Li; MacDonald, Allan H; Ruoff, Rodney S

2014-01-01

Experimental electrical double-layer capacitances of porous carbon electrodes fall below ideal values, thus limiting the practical energy densities of carbon-based electrical double-layer capacitors. Here we investigate the origin of this behaviour by measuring the electrical double-layer capacitance in one to five-layer graphene. We find that the capacitances are suppressed near neutrality, and are anomalously enhanced for thicknesses below a few layers. We attribute the first effect to quantum capacitance effects near the point of zero charge, and the second to correlations between electrons in the graphene sheet and ions in the electrolyte. The large capacitance values imply gravimetric energy storage densities in the single-layer graphene limit that are comparable to those of batteries. We anticipate that these results shed light on developing new theoretical models in understanding the electrical double-layer capacitance of carbon electrodes, and on opening up new strategies for improving the energy density of carbon-based capacitors.

Exciton size and binding energy limitations in one-dimensional organic materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kraner, S., E-mail: stefan.kraner@iapp.de; Koerner, C.; Leo, K.

2015-12-28

In current organic photovoltaic devices, the loss in energy caused by the charge transfer step necessary for exciton dissociation leads to a low open circuit voltage, being one of the main reasons for rather low power conversion efficiencies. A possible approach to avoid these losses is to tune the exciton binding energy to a value of the order of thermal energy, which would lead to free charges upon absorption of a photon, and therefore increase the power conversion efficiency towards the Shockley-Queisser limit. We determine the size of the excitons for different organic molecules and polymers by time dependent densitymore » functional theory calculations. For optically relevant transitions, the exciton size saturates around 0.7 nm for one-dimensional molecules with a size longer than about 4 nm. For the ladder-type polymer poly(benzimidazobenzophenanthroline), we obtain an exciton binding energy of about 0.3 eV, serving as a lower limit of the exciton binding energy for the organic materials investigated. Furthermore, we show that charge transfer transitions increase the exciton size and thus identify possible routes towards a further decrease of the exciton binding energy.« less

Computational design of enzyme-ligand binding using a combined energy function and deterministic sequence optimization algorithm.

PubMed

Tian, Ye; Huang, Xiaoqiang; Zhu, Yushan

2015-08-01

Enzyme amino-acid sequences at ligand-binding interfaces are evolutionarily optimized for reactions, and the natural conformation of an enzyme-ligand complex must have a low free energy relative to alternative conformations in native-like or non-native sequences. Based on this assumption, a combined energy function was developed for enzyme design and then evaluated by recapitulating native enzyme sequences at ligand-binding interfaces for 10 enzyme-ligand complexes. In this energy function, the electrostatic interaction between polar or charged atoms at buried interfaces is described by an explicitly orientation-dependent hydrogen-bonding potential and a pairwise-decomposable generalized Born model based on the general side chain in the protein design framework. The energy function is augmented with a pairwise surface-area based hydrophobic contribution for nonpolar atom burial. Using this function, on average, 78% of the amino acids at ligand-binding sites were predicted correctly in the minimum-energy sequences, whereas 84% were predicted correctly in the most-similar sequences, which were selected from the top 20 sequences for each enzyme-ligand complex. Hydrogen bonds at the enzyme-ligand binding interfaces in the 10 complexes were usually recovered with the correct geometries. The binding energies calculated using the combined energy function helped to discriminate the active sequences from a pool of alternative sequences that were generated by repeatedly solving a series of mixed-integer linear programming problems for sequence selection with increasing integer cuts.

Computational scheme for pH-dependent binding free energy calculation with explicit solvent.

PubMed

Lee, Juyong; Miller, Benjamin T; Brooks, Bernard R

2016-01-01

We present a computational scheme to compute the pH-dependence of binding free energy with explicit solvent. Despite the importance of pH, the effect of pH has been generally neglected in binding free energy calculations because of a lack of accurate methods to model it. To address this limitation, we use a constant-pH methodology to obtain a true ensemble of multiple protonation states of a titratable system at a given pH and analyze the ensemble using the Bennett acceptance ratio (BAR) method. The constant pH method is based on the combination of enveloping distribution sampling (EDS) with the Hamiltonian replica exchange method (HREM), which yields an accurate semi-grand canonical ensemble of a titratable system. By considering the free energy change of constraining multiple protonation states to a single state or releasing a single protonation state to multiple states, the pH dependent binding free energy profile can be obtained. We perform benchmark simulations of a host-guest system: cucurbit[7]uril (CB[7]) and benzimidazole (BZ). BZ experiences a large pKa shift upon complex formation. The pH-dependent binding free energy profiles of the benchmark system are obtained with three different long-range interaction calculation schemes: a cutoff, the particle mesh Ewald (PME), and the isotropic periodic sum (IPS) method. Our scheme captures the pH-dependent behavior of binding free energy successfully. Absolute binding free energy values obtained with the PME and IPS methods are consistent, while cutoff method results are off by 2 kcal mol(-1) . We also discuss the characteristics of three long-range interaction calculation methods for constant-pH simulations. © 2015 The Protein Society.

Electronic Structure Calculations of Hydrogen Storage in Lithium-Decorated Metal-Graphyne Framework.

PubMed

Kumar, Sandeep; Dhilip Kumar, Thogluva Janardhanan

2017-08-30

Porous metal-graphyne framework (MGF) made up of graphyne linker decorated with lithium has been investigated for hydrogen storage. Applying density functional theory spin-polarized generalized gradient approximation with the Perdew-Burke-Ernzerhof functional containing Grimme's diffusion parameter with double numeric polarization basis set, the structural stability, and physicochemical properties have been analyzed. Each linker binds two Li atoms over the surface of the graphyne linker forming MGF-Li 8 by Dewar coordination. On saturation with hydrogen, each Li atom physisorbs three H 2 molecules resulting in MGF-Li 8 -H 24 . H 2 and Li interact by charge polarization mechanism leading to elongation in average H-H bond length indicating physisorption. Sorption energy decreases gradually from ≈0.4 to 0.20 eV on H 2 loading. Molecular dynamics simulations and computed sorption energy range indicate the high reversibility of H 2 in the MGF-Li 8 framework with the hydrogen storage capacity of 6.4 wt %. The calculated thermodynamic practical hydrogen storage at room temperature makes the Li-decorated MGF system a promising hydrogen storage material.

Surface-enhanced redox chemistry of polysulphides on a metallic and polar host for lithium-sulphur batteries.

PubMed

Pang, Quan; Kundu, Dipan; Cuisinier, Marine; Nazar, L F

2014-08-26

The lithium-sulphur battery relies on the reversible conversion between sulphur and Li2S and is highly appealing for energy storage owing to its low cost and high energy density. Porous carbons are typically used as sulfur hosts, but they do not adsorb the hydrophilic polysulphide intermediates or adhere well to Li2S, resulting in pronounced capacity fading. Here we report a different strategy based on an inherently polar, high surface area metallic oxide cathode host and show that it mitigates polysulphide dissolution by forming an excellent interface with Li2S. Complementary physical and electrochemical probes demonstrate strong polysulphide/Li2S binding with this 'sulphiphilic' host and provide experimental evidence for surface-mediated redox chemistry. In a lithium-sulphur cell, Ti4O7/S cathodes provide a discharge capacity of 1,070 mAh g(-1) at intermediate rates and a doubling in capacity retention with respect to a typical conductive carbon electrode, at practical sulphur mass fractions up to 70 wt%. Stable cycling performance is demonstrated at high rates over 500 cycles.

Theoretical investigation of the He4Br2 conformers.

PubMed

Valdés, Álvaro; Prosmiti, Rita; Villarreal, Pablo; Delgado-Barrio, Gerardo

2012-07-05

Full dimensional quantum dynamics calculations of the three lowest isomers of the He(4)Br(2) van der Waals molecule in its ground electronic state are reported. The calculations are performed using the multiconfiguration time-dependent Hartree (MCTDH) method and a realistic potential form that includes the sum of three body ab initio coupled-cluster single double triple [CCSD(T)] He-Br(2) interactions plus the He-He and Br-Br interactions. This potential exhibits several multiple minima, with the three lowest ones lying very close in energy, just within 2 cm(-1). Such small differences are also found in the calculated binding energies of the three most stable conformers, indicating the floppiness of the system and, thus, the need of accurate potential forms and quantum full dynamics methods to treat this kind of complexes. The 12 dimensional results reported in this work present benchmark data and, thus, can serve to evaluate approximate methods aiming to describe higher order rare gas-dihalogen (N > 4) complexes. A comparison with previous studies using different potential forms and approaches to the energetics for the He(4)Br(2) cluster is also presented.

The RNA-Binding Site of Poliovirus 3C Protein Doubles as a Phosphoinositide-Binding Domain.

PubMed

Shengjuler, Djoshkun; Chan, Yan Mei; Sun, Simou; Moustafa, Ibrahim M; Li, Zhen-Lu; Gohara, David W; Buck, Matthias; Cremer, Paul S; Boehr, David D; Cameron, Craig E

2017-12-05

Some viruses use phosphatidylinositol phosphate (PIP) to mark membranes used for genome replication or virion assembly. PIP-binding motifs of cellular proteins do not exist in viral proteins. Molecular-docking simulations revealed a putative site of PIP binding to poliovirus (PV) 3C protein that was validated using nuclear magnetic resonance spectroscopy. The PIP-binding site was located on a highly dynamic α helix, which also functions in RNA binding. Broad PIP-binding activity was observed in solution using a fluorescence polarization assay or in the context of a lipid bilayer using an on-chip, fluorescence assay. All-atom molecular dynamics simulations of the 3C protein-membrane interface revealed PIP clustering and perhaps PIP-dependent conformations. PIP clustering was mediated by interaction with residues that interact with the RNA phosphodiester backbone. We conclude that 3C binding to membranes will be determined by PIP abundance. We suggest that the duality of function observed for 3C may extend to RNA-binding proteins of other viruses. Copyright © 2017 Elsevier Ltd. All rights reserved.

A generic HTS assay for kinase screening: Validation for the isolation of an engineered malate kinase

PubMed Central

Irague, Romain; Topham, Christopher M.; Martineau, Nelly; Baylac, Audrey; Auriol, Clément; Walther, Thomas; François, Jean-Marie; Remaud-Siméon, Magali

2018-01-01

An end-point ADP/NAD+ acid/alkali assay procedure, directly applicable to library screening of any type of ATP-utilising/ADP producing enzyme activity, was implemented. Typically, ADP production is coupled to NAD+ co-enzyme formation by the conventional addition of pyruvate kinase and lactate dehydrogenase. Transformation of enzymatically generated NAD+ into a photometrically active alkali derivative product is then achieved through the successive application of acidic/alkali treatment steps. The assay was successfully miniaturized to search for malate kinase activity in a structurally-guided library of LysC aspartate kinase variants comprising 6,700 clones. The screening procedure enabled the isolation of nine positive variants showing novel kinase activity on (L)-malate, the best mutant, LysC V115A:E119S:E434V exhibited strong substrate selectivity for (L)-malate compared to (L)-aspartate with a (kcat/Km)malate/(kcat/Km)aspartate ratio of 86. Double mutants V115A:E119S, V115A:E119C and E119S:E434V were constructed to further probe the origins of stabilising substrate binding energy gains for (L)-malate due to mutation. The introduction of less sterically hindering side-chains in engineered enzymes carrying E119S and V115A mutations increases the effective volume available for substrate binding in the catalytic pocket. Improved binding of the (L)-malate substrate may be assisted by less hindered movement of the Phe184 aromatic side-chain. Additional favourable long-range electostatic effects on binding arising from the E434V surface mutation are conditionally dependent upon the presence of the V115A mutation close to Phe184 in the active-site. PMID:29462203

A dipole-bound dianion

NASA Astrophysics Data System (ADS)

Skurski, Piotr; Simons, Jack

2000-04-01

The possibility of binding two electrons by the dipole potential of a molecule was examined earlier by us using model potentials. That study suggested that large dipole moments μ=qR and large charge separation distances R (or equivalently large charges q) would be required to achieve binding two electrons. For example, even with a charge q=1.5 a.u. which might be achieved using di- or tri-valent cations, a dipole moment exceeding 15.922 D is needed. The presence of inner-shell electrons even further increases the value of μ that is required because the dipole-bound electrons' orbital must be orthogonal to and excluded from such inner shells. In the present work, we discuss our efforts to find a real molecule that can actually bind two electrons to a single dipole site. Numerical results are presented for the mono- and dianions of a double 5-member carbon ring system substituted with a Ca atom and three superhalogen -PF5 groups. The dianion of this molecule is found to be geometrically stable and to have a vertical electron detachment energy of ca. 0.8 eV. Its two excess electrons occupy the same fully symmetric a1 molecular orbital localized at the electropositive Ca end of the neutral system as is routinely observed in dipole-bound monoanions. Although our final candidate is chemically unusual, it is hoped that our predictions about it will encourage others to search for more synthetically tractable alternatives.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Witte, Jonathon; Molecular Foundry, Lawrence Berkeley National Laboratory, Berkeley, California 94720; Neaton, Jeffrey B., E-mail: jbneaton@lbl.gov

Adsorption of gas molecules in metal-organic frameworks is governed by many factors, the most dominant of which are the interaction of the gas with open metal sites, and the interaction of the gas with the ligands. Herein, we examine the latter class of interaction in the context of CO{sub 2} binding to benzene. We begin by clarifying the geometry of the CO{sub 2}–benzene complex. We then generate a benchmark binding curve using a coupled-cluster approach with single, double, and perturbative triple excitations [CCSD(T)] at the complete basis set (CBS) limit. Against this ΔCCSD(T)/CBS standard, we evaluate a plethora of electronicmore » structure approximations: Hartree-Fock, second-order Møller-Plesset perturbation theory (MP2) with the resolution-of-the-identity approximation, attenuated MP2, and a number of density functionals with and without different empirical and nonempirical van der Waals corrections. We find that finite-basis MP2 significantly overbinds the complex. On the other hand, even the simplest empirical correction to standard density functionals is sufficient to bring the binding energies to well within 1 kJ/mol of the benchmark, corresponding to an error of less than 10%; PBE-D in particular performs well. Methods that explicitly include nonlocal correlation kernels, such as VV10, vdW-DF2, and ωB97X-V, perform with similar accuracy for this system, as do ωB97X and M06-L.« less

Role of the S4-S5 linker in CNG channel activation.

PubMed

Kusch, Jana; Zimmer, Thomas; Holschuh, Jascha; Biskup, Christoph; Schulz, Eckhard; Nache, Vasilica; Benndorf, Klaus

2010-10-20

Cyclic nucleotide-gated (CNG) channels mediate sensory signal transduction in retinal and olfactory cells. The channels are activated by the binding of cyclic nucleotides to a cyclic nucleotide-binding domain (CNBD) in the C-terminus that is located at the intracellular side. The molecular events translating the ligand binding to the pore opening are still unknown. We investigated the role of the S4-S5 linker in the activation process by quantifying its interaction with other intracellular regions. To this end, we constructed chimeric channels in which the N-terminus, the S4-S5 linker, the C-linker, and the CNBD of the retinal CNGA1 subunit were systematically replaced by the respective regions of the olfactory CNGA2 subunit. Macroscopic concentration-response relations were analyzed, yielding the apparent affinity to cGMP and the Hill coefficient. The degree of functional coupling of intracellular regions in the activation gating was determined by thermodynamic double-mutant cycle analysis. We observed that all four intracellular regions, including the relatively short S4-S5 linker, are involved in controlling the apparent affinity of the channel to cGMP and, moreover, in determining the degree of cooperativity between the subunits, as derived from the Hill coefficient. The interaction energies reveal an interaction of the S4-S5 linker with both the N-terminus and the C-linker, but no interaction with the CNBD. Copyright © 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Investigation of naphthofuran moiety as potential dual inhibitor against BACE-1 and GSK-3β: molecular dynamics simulations, binding energy, and network analysis to identify first-in-class dual inhibitors against Alzheimer's disease.

PubMed

Kumar, Akhil; Srivastava, Gaurava; Srivastava, Swati; Verma, Seema; Negi, Arvind S; Sharma, Ashok

2017-08-01

BACE-1 and GSK-3β are potential therapeutic drug targets for Alzheimer's disease. Recently, both the targets received attention for designing dual inhibitors for Alzheimer's disease. Until now, only two-scaffold triazinone and curcumin have been reported as BACE-1 and GSK-3β dual inhibitors. Docking, molecular dynamics, clustering, binding energy, and network analysis of triazinone derivatives with BACE-1 and GSK-3β was performed to get molecular insight into the first reported dual inhibitor. Further, we designed and evaluated a naphthofuran series for its ability to inhibit BACE-1 and GSK-3β with the computational approaches. Docking study of naphthofuran series showed a good binding affinity towards both the targets. Molecular dynamics, binding energy, and network analysis were performed to compare their binding with the targets and amino acids responsible for binding. Naphthofuran series derivatives showed good interaction within the active site residues of both of the targets. Hydrogen bond occupancy and binding energy suggested strong binding with the targets. Dual-inhibitor binding was mostly governed by the hydrophobic interactions for both of the targets. Per residue energy decomposition and network analysis identified the key residues involved in the binding and inhibiting BACE-1 and GSK-3β. The results indicated that naphthofuran series derivative 11 may be a promising first-in-class dual inhibitor against BACE-1 and GSK-3β. This naphthofuran series may be further explored to design better dual inhibitors. Graphical abstract Naphthofuran derivative as a dual inhibitor for BACE-1 and GSK-3β.

Identification of new 2,5-diketopiperazine derivatives as simultaneous effective inhibitors of αβ-tubulin and BCRP proteins: Molecular docking, Structure-Activity Relationships and virtual consensus docking studies

NASA Astrophysics Data System (ADS)

Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh

2017-06-01

In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.

Surfactant-cobalt(III) complexes: The impact of hydrophobicity on interaction with HSA and DNA - insights from experimental and theoretical approach.

PubMed

Veeralakshmi, Selvakumar; Sabapathi, Gopal; Nehru, Selvan; Venuvanalingam, Ponnambalam; Arunachalam, Sankaralingam

2017-05-01

To develop surfactant-based metallodrugs, it is very important to know about their hydrophobicity, micelle forming capacity, their interaction with biomacromolecules such as proteins and nucleic acids, and biological activities. Here, diethylenetriamine (dien) and tetradecylamine ligand (TA) based surfactant-cobalt(III) complexes with single chain domain, [Co(dien)(TA)Cl 2 ]ClO 4 (1) and double chain domain [Co(dien)(TA) 2 Cl](ClO 4 ) 2 (2) were chosen to study the effect of hydrophobicity on the interaction with human serum albumin and calf thymus DNA. The obtained results showed that (i) single chain surfactant-cobalt(III) complex (1) interact with HSA and DNA via electrostatic interaction and groove binding, respectively; (ii) double chain surfactant-cobalt(III) complex (2) interact with HSA and DNA via hydrophobic interaction and partial intercalation, respectively, due to the play of hydrophobicity by single and double chain domains. Further it is noted that, double chain surfactant-cobalt(III) complex interact strongly with HSA and DNA, compared single chain surfactant-cobalt(III) complex due to their more hydrophobicity nature. DFT and molecular docking studies offer insights into the mechanism and mode of binding towards the molecular target CT-DNA and HSA. Hence, the present findings will create new avenue towards the use of hydrophobic metallodrugs for various therapeutic applications. Copyright © 2017 Elsevier B.V. All rights reserved.

Porcine deltacoronavirus accessory protein NS6 antagonizes IFN-β production by interfering with the binding of RIG-I/MDA5 to double-stranded RNA.

PubMed

Fang, Puxian; Fang, Liurong; Ren, Jie; Hong, Yingying; Liu, Xiaorong; Zhao, Yunyang; Wang, Dang; Peng, Guiqing; Xiao, Shaobo

2018-05-16

Porcine deltacoronavirus (PDCoV) has recently emerged as an enteric pathogen that can cause serious vomiting and diarrhea in suckling piglets. The first outbreak of PDCoV occurred in the United States in 2014 and was followed by reports of PDCoV in South Korea, China, Thailand, Lao people's Democratic Republic, and Vietnam, leading to economic losses for pig farms and posing considerable threat to the swine industry worldwide. Our previous studies have shown that PDCoV encodes three accessory proteins, NS6, NS7, and NS7a, but the functions of these proteins in viral replication, pathogenesis, and immune regulation remain unclear. Here, we found that ectopic expression of accessory protein NS6 significantly inhibits Sendai virus-induced interferon-β (IFN-β) production, as well as the activation of transcription factors IRF3 and NF-κB. Interestingly, NS6 does not impede the IFN-β promoter activation mediated via key molecules in the RIG-I-like receptor (RLR) signaling pathway, specifically RIG-I, MDA5, and their downstream molecules MAVS, TBK1, IKKϵ, and IRF3. Further analyses revealed that NS6 is not a RNA-binding protein; however, it interacts with RIG-I/MDA5. This interaction attenuates the binding of double-stranded RNA by RIG-I/MDA5, resulting in the reduction of RLR-mediated IFN-β production. Taken together, our results demonstrate that ectopic expression of NS6 antagonizes IFN-β production by interfering with the binding of RIG-I/MDA5 to double-stranded RNA, revealing a new strategy employed by PDCoV accessory proteins to counteract the host innate antiviral immune response. IMPORTANCE Coronavirus accessory proteins are species-specific, and they perform multiple functions in viral pathogenicity and immunity, such as acting as interferon (IFN) antagonists and cell death inducers. Our previous studies have shown that porcine deltacoronavirus (PDCoV) encodes three accessory proteins. Here, we demonstrated for the first time that PDCoV accessory protein NS6 antagonizes IFN-β production by interacting with RIG-I and MDA5 to impede their association with double-stranded RNA. This is an efficient strategy of antagonizing type I IFN production by disrupting the binding of host pattern recognition receptors (PRRs) and pathogen-associated molecular patterns (PAMPs). These findings deepen our understanding of the function of accessory protein NS6 and may direct us toward novel therapeutic targets and lead to the development of more effective vaccines against PDCoV infection. Copyright © 2018 American Society for Microbiology.

In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

PubMed Central

Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

2017-01-01

In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

Specificity and Affinity Quantification of Flexible Recognition from Underlying Energy Landscape Topography

PubMed Central

Chu, Xiakun; Wang, Jin

2014-01-01

Flexibility in biomolecular recognition is essential and critical for many cellular activities. Flexible recognition often leads to moderate affinity but high specificity, in contradiction with the conventional wisdom that high affinity and high specificity are coupled. Furthermore, quantitative understanding of the role of flexibility in biomolecular recognition is still challenging. Here, we meet the challenge by quantifying the intrinsic biomolecular recognition energy landscapes with and without flexibility through the underlying density of states. We quantified the thermodynamic intrinsic specificity by the topography of the intrinsic binding energy landscape and the kinetic specificity by association rate. We found that the thermodynamic and kinetic specificity are strongly correlated. Furthermore, we found that flexibility decreases binding affinity on one hand, but increases binding specificity on the other hand, and the decreasing or increasing proportion of affinity and specificity are strongly correlated with the degree of flexibility. This shows more (less) flexibility leads to weaker (stronger) coupling between affinity and specificity. Our work provides a theoretical foundation and quantitative explanation of the previous qualitative studies on the relationship among flexibility, affinity and specificity. In addition, we found that the folding energy landscapes are more funneled with binding, indicating that binding helps folding during the recognition. Finally, we demonstrated that the whole binding-folding energy landscapes can be integrated by the rigid binding and isolated folding energy landscapes under weak flexibility. Our results provide a novel way to quantify the affinity and specificity in flexible biomolecular recognition. PMID:25144525

Specificity and affinity quantification of flexible recognition from underlying energy landscape topography.

PubMed

Chu, Xiakun; Wang, Jin

2014-08-01

Flexibility in biomolecular recognition is essential and critical for many cellular activities. Flexible recognition often leads to moderate affinity but high specificity, in contradiction with the conventional wisdom that high affinity and high specificity are coupled. Furthermore, quantitative understanding of the role of flexibility in biomolecular recognition is still challenging. Here, we meet the challenge by quantifying the intrinsic biomolecular recognition energy landscapes with and without flexibility through the underlying density of states. We quantified the thermodynamic intrinsic specificity by the topography of the intrinsic binding energy landscape and the kinetic specificity by association rate. We found that the thermodynamic and kinetic specificity are strongly correlated. Furthermore, we found that flexibility decreases binding affinity on one hand, but increases binding specificity on the other hand, and the decreasing or increasing proportion of affinity and specificity are strongly correlated with the degree of flexibility. This shows more (less) flexibility leads to weaker (stronger) coupling between affinity and specificity. Our work provides a theoretical foundation and quantitative explanation of the previous qualitative studies on the relationship among flexibility, affinity and specificity. In addition, we found that the folding energy landscapes are more funneled with binding, indicating that binding helps folding during the recognition. Finally, we demonstrated that the whole binding-folding energy landscapes can be integrated by the rigid binding and isolated folding energy landscapes under weak flexibility. Our results provide a novel way to quantify the affinity and specificity in flexible biomolecular recognition.

Free energy simulations and MM-PBSA analyses on the affinity and specificity of steroid binding to antiestradiol antibody.

PubMed

Laitinen, Tuomo; Kankare, Jussi A; Peräkylä, Mikael

2004-04-01

Antiestradiol antibody 57-2 binds 17beta-estradiol (E2) with moderately high affinity (K(a) = 5 x 10(8) M(-1)). The structurally related natural estrogens estrone and estriol as well synthetic 17-deoxy-estradiol and 17alpha-estradiol are bound to the antibody with 3.7-4.9 kcal mol(-1) lower binding free energies than E2. Free energy perturbation (FEP) simulations and the molecular mechanics-Poisson-Boltzmann surface area (MM-PBSA) method were applied to investigate the factors responsible for the relatively low cross-reactivity of the antibody with these four steroids, differing from E2 by the substituents of the steroid D-ring. In addition, computational alanine scanning of the binding site residues was carried out with the MM-PBSA method. Both the FEP and MM-PBSA methods reproduced the experimental relative affinities of the five steroids in good agreement with experiment. On the basis of FEP simulations, the number of hydrogen bonds formed between the antibody and steroids, which varied from 0 to 3 in the steroids studied, determined directly the magnitude of the steroid-antibody interaction free energies. One hydrogen bond was calculated to contribute about 3 kcal mol(-1) to the interaction energy. Because the relative binding free energies of estrone (two antibody-steroid hydrogen bonds), estriol (three hydrogen bonds), 17-deoxy-estradiol (no hydrogen bonds), and 17alpha-estradiol (two hydrogen bonds) are close to each other and clearly lower than that of E2 (three hydrogen bonds), the water-steroid interactions lost upon binding to the antibody make an important contribution to the binding free energies. The MM-PBSA calculations showed that the binding of steroids to the antiestradiol antibody is driven by van der Waals interactions, whereas specificity is solely due to electrostatic interactions. In addition, binding of steroids to the antiestradiol antibody 57-2 was compared to the binding to the antiprogesterone antibody DB3 and antitestosterone antibody 3-C4F5, studied earlier with the MM-PBSA method. Copyright 2004 Wiley-Liss, Inc.

Hydrogenic impurity bound polaron in an anisotropic quantum dot

NASA Astrophysics Data System (ADS)

Chen, Shi-Hua

2018-01-01

The effect of the electron-phonon interaction on an electron bound to a hydrogenic impurity in a three-dimensional (3D) anisotropic quantum dot (QD) is studied theoretically. We use the Landau-Pekar variational approach to calculate the binding energy of ground state (GS) and first-excited state (ES) with considering electron-phonon interaction. The expressions of the GS and ES energies under investigation depict a rich variety of dependent relationship with the variational parameters in three different limiting cases. Numerical calculations were performed for ZnSe QDs with different confinement lengths in the xy-plane and the z-direction, respectively. It is illustrated that binding energies of impurity polarons corresponding to each level are larger in small QDs. Furthermore, the contribution to binding energy from phonon is about 15% of the total binding energy.

Atomic Mass and Nuclear Binding Energy for U-287 (Uranium)

NASA Astrophysics Data System (ADS)

Sukhoruchkin, S. I.; Soroko, Z. N.

This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope U-287 (Uranium, atomic number Z = 92, mass number A = 287).

Atomic Mass and Nuclear Binding Energy for Ac-212 (Actinium)

NASA Astrophysics Data System (ADS)

Sukhoruchkin, S. I.; Soroko, Z. N.

This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Ac-212 (Actinium, atomic number Z = 89, mass number A = 212).

Scanning the potential energy surface for synthesis of dendrimer-wrapped gold clusters: design rules for true single-molecule nanostructures.

PubMed

Thompson, Damien; Hermes, Jens P; Quinn, Aidan J; Mayor, Marcel

2012-04-24

The formation of true single-molecule complexes between organic ligands and nanoparticles is challenging and requires careful design of molecules with size, shape, and chemical properties tailored for the specific nanoparticle. Here we use computer simulations to describe the atomic-scale structure, dynamics, and energetics of ligand-mediated synthesis and interlinking of 1 nm gold clusters. The models help explain recent experimental results and provide insight into how multidentate thioether dendrimers can be employed for synthesis of true single-ligand-nanoparticle complexes and also nanoparticle-molecule-nanoparticle "dumbbell" nanostructures. Electronic structure calculations reveal the individually weak thioether-gold bonds (325 ± 36 meV), which act collectively through the multivalent (multisite) anchoring to stabilize the ligand-nanoparticle complex (∼7 eV total binding energy) and offset the conformational and solvation penalties involved in this "wrapping" process. Molecular dynamics simulations show that the dendrimer is sufficiently flexible to tolerate the strained conformations and desolvation penalties involved in fully wrapping the particle, quantifying the subtle balance between covalent anchoring and noncovalent wrapping in the assembly of ligand-nanoparticle complexes. The computed preference for binding of a single dendrimer to the cluster reveals the prohibitively high dendrimer desolvation barrier (1.5 ± 0.5 eV) to form the alternative double-dendrimer structure. Finally, the models show formation of an additional electron transfer channel between nitrogen and gold for ligands with a central pyridine unit, which gives a stiff binding orientation and explains the recently measured larger interparticle distances for particles synthesized and interlinked using linear ligands with a central pyridine rather than a benzene moiety. The findings stress the importance of organic-inorganic interactions, the control of which is central to the rational engineering and eventual large-scale production of functional building blocks for nano(bio)electronics.

Hydrogen storage capacity on Ti-decorated porous graphene: First-principles investigation

NASA Astrophysics Data System (ADS)

Yuan, Lihua; Kang, Long; Chen, Yuhong; Wang, Daobin; Gong, Jijun; Wang, Chunni; Zhang, Meiling; Wu, Xiaojuan

2018-03-01

Hydrogen storage capacity on Titanium (Ti) decorated porous graphene (PG) has been investigated using density functional theory simulations with generalized gradient approximation method. The possible adsorption sites of Ti atom on PG and electronic properties of Ti-PG system are also discussed.The results show a Ti atom prefers to strongly adsorb on the center site above the C hexagon with the binding energy of 3.65 eV, and the polarization and the hybridization mechanisms both contribute to the Ti atom adsorption on PG. To avoid a tendency of clustering among Ti atoms, the single side of the PG unit cell should only contain one Ti atom. For the single side of PG, four H2 molecules can be adsorbed around Ti atom, and the adsorption mechanism of H2 molecules come from not only the polarization mechanism between Ti and H atoms but also the orbital hybridization among Ti atom, H2 molecules and C atoms. For the case of double sides of PG, eight H2 molecules can be adsorbed on Ti-decorated PG unit cell with the average adsorption energy of -0.457 eV, and the gravimetric hydrogen storage capacity is 6.11 wt.%. Furthermore, ab inito molecular-dynaics simulation result shows that six H2 molecules can be adsorbed on double sides of unit cell of Ti-PG system and the configuration of Ti-PG is very stable at 300 K and without external pressure, which indicates Ti-decorated PG could be considered as a potential hydrogen storage medium at ambient conditions.

Manipulation of double-stranded DNA melting by force

NASA Astrophysics Data System (ADS)

Singh, Amit Raj; Granek, Rony

2017-09-01

By integrating elasticity—as described by the Gaussian network model—with bond binding energies that distinguish between different base-pair identities and stacking configurations, we study the force induced melting of a double-stranded DNA (dsDNA). Our approach is a generalization of our previous study of thermal dsDNA denaturation [J. Chem. Phys. 145, 144101 (2016), 10.1063/1.4964285] to that induced by force at finite temperatures. It allows us to obtain semimicroscopic information about the opening of the chain, such as whether the dsDNA opens from one of the ends or from the interior, forming an internal bubble. We study different types of force manipulation: (i) "end unzipping," with force acting at a single end base pair perpendicular to the helix, (ii) "midunzipping," with force acting at a middle base pair perpendicular to the helix, and (iii) "end shearing," where the force acts at opposite ends along the helix. By monitoring the free-energy landscape and probability distribution of intermediate denaturation states, we show that different dominant intermediate states are stabilized depending on the type of force manipulation used. In particular, the bubble state of the sequence L60B36, which we have previously found to be a stable state during thermal denaturation, is absent for end unzipping and end shearing, whereas very similar bubbles are stabilized by midunzipping, or when the force location is near the middle of the chain. Ours results offer a simple tool for stabilizing bubbles and loops using force manipulations at different temperatures, and may implicate on the mechanism in which DNA enzymes or motors open regions of the chain.

Soft-photon emission effects and radiative corrections for electromagnetic processes at very high energies

NASA Technical Reports Server (NTRS)

Gould, R. J.

1979-01-01

Higher-order electromagnetic processes involving particles at ultrahigh energies are discussed, with particular attention given to Compton scattering with the emission of an additional photon (double Compton scattering). Double Compton scattering may have significance in the interaction of a high-energy electron with the cosmic blackbody photon gas. At high energies the cross section for double Compton scattering is large, though this effect is largely canceled by the effects of radiative corrections to ordinary Compton scattering. A similar cancellation takes place for radiative pair production and the associated radiative corrections to the radiationless process. This cancellation is related to the well-known cancellation of the infrared divergence in electrodynamics.

Self-Calibration and Laser Energy Monitor Validations for a Double-Pulsed 2-Micron CO2 Integrated Path Differential Absorption Lidar Application

NASA Technical Reports Server (NTRS)

Refaat, Tamer F.; Singh, Upendra N.; Petros, Mulugeta; Remus, Ruben; Yu, Jirong

2015-01-01

Double-pulsed 2-micron integrated path differential absorption (IPDA) lidar is well suited for atmospheric CO2 remote sensing. The IPDA lidar technique relies on wavelength differentiation between strong and weak absorbing features of the gas normalized to the transmitted energy. In the double-pulse case, each shot of the transmitter produces two successive laser pulses separated by a short interval. Calibration of the transmitted pulse energies is required for accurate CO2 measurement. Design and calibration of a 2-micron double-pulse laser energy monitor is presented. The design is based on an InGaAs pin quantum detector. A high-speed photo-electromagnetic quantum detector was used for laser-pulse profile verification. Both quantum detectors were calibrated using a reference pyroelectric thermal detector. Calibration included comparing the three detection technologies in the single-pulsed mode, then comparing the quantum detectors in the double-pulsed mode. In addition, a self-calibration feature of the 2-micron IPDA lidar is presented. This feature allows one to monitor the transmitted laser energy, through residual scattering, with a single detection channel. This reduces the CO2 measurement uncertainty. IPDA lidar ground validation for CO2 measurement is presented for both calibrated energy monitor and self-calibration options. The calibrated energy monitor resulted in a lower CO2 measurement bias, while self-calibration resulted in a better CO2 temporal profiling when compared to the in situ sensor.

Interaction Entropy: A New Paradigm for Highly Efficient and Reliable Computation of Protein-Ligand Binding Free Energy.

PubMed

Duan, Lili; Liu, Xiao; Zhang, John Z H

2016-05-04

Efficient and reliable calculation of protein-ligand binding free energy is a grand challenge in computational biology and is of critical importance in drug design and many other molecular recognition problems. The main challenge lies in the calculation of entropic contribution to protein-ligand binding or interaction systems. In this report, we present a new interaction entropy method which is theoretically rigorous, computationally efficient, and numerically reliable for calculating entropic contribution to free energy in protein-ligand binding and other interaction processes. Drastically different from the widely employed but extremely expensive normal mode method for calculating entropy change in protein-ligand binding, the new method calculates the entropic component (interaction entropy or -TΔS) of the binding free energy directly from molecular dynamics simulation without any extra computational cost. Extensive study of over a dozen randomly selected protein-ligand binding systems demonstrated that this interaction entropy method is both computationally efficient and numerically reliable and is vastly superior to the standard normal mode approach. This interaction entropy paradigm introduces a novel and intuitive conceptual understanding of the entropic effect in protein-ligand binding and other general interaction systems as well as a practical method for highly efficient calculation of this effect.

On the atomic-number similarity of the binding energies of electrons in filled shells of elements of the periodic table

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karpov, V. Ya.; Shpatakovskaya, G. V., E-mail: shpagalya@yandex.ru

An expression for the binding energies of electrons in the ground state of an atom is derived on the basis of the Bohr–Sommerfeld quantization rule within the Thomas–Fermi model. The validity of this relation for all elements from neon to uranium is tested within a more perfect quantum-mechanical model with and without the inclusion of relativistic effects, as well as with experimental binding energies. As a result, the ordering of electronic levels in filled atomic shells is established, manifested in an approximate atomic-number similarity. It is proposed to use this scaling property to analytically estimate the binding energies of electronsmore » in an arbitrary atom.« less

Ligand deconstruction: Why some fragment binding positions are conserved and others are not.

PubMed

Kozakov, Dima; Hall, David R; Jehle, Stefan; Jehle, Sefan; Luo, Lingqi; Ochiana, Stefan O; Jones, Elizabeth V; Pollastri, Michael; Allen, Karen N; Whitty, Adrian; Vajda, Sandor

2015-05-19

Fragment-based drug discovery (FBDD) relies on the premise that the fragment binding mode will be conserved on subsequent expansion to a larger ligand. However, no general condition has been established to explain when fragment binding modes will be conserved. We show that a remarkably simple condition can be developed in terms of how fragments coincide with binding energy hot spots--regions of the protein where interactions with a ligand contribute substantial binding free energy--the locations of which can easily be determined computationally. Because a substantial fraction of the free energy of ligand binding comes from interacting with the residues in the energetically most important hot spot, a ligand moiety that sufficiently overlaps with this region will retain its location even when other parts of the ligand are removed. This hypothesis is supported by eight case studies. The condition helps identify whether a protein is suitable for FBDD, predicts the size of fragments required for screening, and determines whether a fragment hit can be extended into a higher affinity ligand. Our results show that ligand binding sites can usefully be thought of in terms of an anchor site, which is the top-ranked hot spot and dominates the free energy of binding, surrounded by a number of weaker satellite sites that confer improved affinity and selectivity for a particular ligand and that it is the intrinsic binding potential of the protein surface that determines whether it can serve as a robust binding site for a suitably optimized ligand.

Computational Calorimetry: High-Precision Calculation of Host–Guest Binding Thermodynamics

PubMed Central

2015-01-01

We present a strategy for carrying out high-precision calculations of binding free energy and binding enthalpy values from molecular dynamics simulations with explicit solvent. The approach is used to calculate the thermodynamic profiles for binding of nine small molecule guests to either the cucurbit[7]uril (CB7) or β-cyclodextrin (βCD) host. For these systems, calculations using commodity hardware can yield binding free energy and binding enthalpy values with a precision of ∼0.5 kcal/mol (95% CI) in a matter of days. Crucially, the self-consistency of the approach is established by calculating the binding enthalpy directly, via end point potential energy calculations, and indirectly, via the temperature dependence of the binding free energy, i.e., by the van’t Hoff equation. Excellent agreement between the direct and van’t Hoff methods is demonstrated for both host–guest systems and an ion-pair model system for which particularly well-converged results are attainable. Additionally, we find that hydrogen mass repartitioning allows marked acceleration of the calculations with no discernible cost in precision or accuracy. Finally, we provide guidance for accurately assessing numerical uncertainty of the results in settings where complex correlations in the time series can pose challenges to statistical analysis. The routine nature and high precision of these binding calculations opens the possibility of including measured binding thermodynamics as target data in force field optimization so that simulations may be used to reliably interpret experimental data and guide molecular design. PMID:26523125

The electronic and optical properties of quantum nano-structures

NASA Astrophysics Data System (ADS)

Ham, Heon

In semiconducting quantum nano-structures, the excitonic effects play an important role when we fabricate opto-electronic devices, such as lasers, diodes, detectors, etc. To gain a better understanding of the excitonic effects in quantum nano-structures, we investigated the exciton binding energy, oscillator strength, and linewidth in quantum nano-structures using both the infinite and finite well models. We investigated also the hydrogenic impurity binding energy and the photoionization cross section of the hydrogenic impurity in a spherical quantum dot. In our work, the variational approach is used in all calculations, because the Hamiltonian of the system is not separable, due to the different symmetries of the Coulomb and confining potentials. In the infinite well model of the semiconducting quantum nanostructures, the binding energy of the exciton increases with decreasing width of the potential barriers due to the increase in the effective strength of the Coulomb interaction between the electron and hole. In the finite well model, the exciton binding energy reaches a peak value, and the binding energy decreases with further decrease in the width of the potential barriers. The exciton linewidth in the infinite well model increases with decreasing wire radius, because the scattering rate of the exciton increases with decreasing wire radius. In the finite well model, the exciton linewidth in a cylindrical quantum wire reaches a peak value and the exciton linewidth decreases with further decrease in the wire radius, because the exciton is not well confined at very smaller wire radii. The binding energy of the hydrogenic impurity in a spherical quantum dot has also calculated using both the infinite and the finite well models. The binding energy of the hydrogenic impurity was calculated for on center and off center impurities in the spherical quantum dots. With decreasing radii of the dots, the binding energy of the hydrogenic impurity increases in the infinite well model. The binding energy of the hydrogenic impurity in the finite well model reaches a peak value and decreases with further decrease in the dot radii for both on center and off center impurities. We have calculated the photoionization cross section as a function of the radius and the frequency using both the infinite and finite well models. The photoionizaton cross section has a peak value at a frequency where the photon energy equals the difference between the final and initial state energies of the impurity. The behavior of the cross section with dot radius depends upon the location of the impurity and the polarization of the electromagnetic field.

Assessing the performance of the MM/PBSA and MM/GBSA methods. 1. The accuracy of binding free energy calculations based on molecular dynamics simulations.

PubMed

Hou, Tingjun; Wang, Junmei; Li, Youyong; Wang, Wei

2011-01-24

The Molecular Mechanics/Poisson-Boltzmann Surface Area (MM/PBSA) and the Molecular Mechanics/Generalized Born Surface Area (MM/GBSA) methods calculate binding free energies for macromolecules by combining molecular mechanics calculations and continuum solvation models. To systematically evaluate the performance of these methods, we report here an extensive study of 59 ligands interacting with six different proteins. First, we explored the effects of the length of the molecular dynamics (MD) simulation, ranging from 400 to 4800 ps, and the solute dielectric constant (1, 2, or 4) on the binding free energies predicted by MM/PBSA. The following three important conclusions could be observed: (1) MD simulation length has an obvious impact on the predictions, and longer MD simulation is not always necessary to achieve better predictions. (2) The predictions are quite sensitive to the solute dielectric constant, and this parameter should be carefully determined according to the characteristics of the protein/ligand binding interface. (3) Conformational entropy often show large fluctuations in MD trajectories, and a large number of snapshots are necessary to achieve stable predictions. Next, we evaluated the accuracy of the binding free energies calculated by three Generalized Born (GB) models. We found that the GB model developed by Onufriev and Case was the most successful model in ranking the binding affinities of the studied inhibitors. Finally, we evaluated the performance of MM/GBSA and MM/PBSA in predicting binding free energies. Our results showed that MM/PBSA performed better in calculating absolute, but not necessarily relative, binding free energies than MM/GBSA. Considering its computational efficiency, MM/GBSA can serve as a powerful tool in drug design, where correct ranking of inhibitors is often emphasized.

Modified Acyl-ACP desaturase

DOEpatents

Cahoon, Edgar B.; Shanklin, John; Lindqvist, Ylva; Schneider, Gunter

1999-03-30

Disclosed is a method for modifying the chain length and double bond positional specificities of a soluble plant fatty acid desaturase. More specifically, the method involves modifying amino acid contact residues in the substrate binding channel of the soluble fatty acid desaturase which contact the fatty acid. Specifically disclosed is the modification of an acyl-ACP desaturase. Amino acid contact residues which lie within the substrate binding channel are identified, and subsequently replaced with different residues to effect the modification of activity.

Modified acyl-ACP desaturase

DOEpatents

Cahoon, Edgar B.; Shanklin, John; Lindgvist, Ylva; Schneider, Gunter

1998-01-06

Disclosed is a methods for modifying the chain length and double bond positional specificities of a soluble plant fatty acid desaturase. More specifically, the method involves modifying amino acid contact residues in the substrate binding channel of the soluble fatty acid desaturase which contact the fatty acid. Specifically disclosed is the modification of an acyl-ACP desaturase. Amino acid contact residues which lie within the substrate binding channel are identified, and subsequently replaced with different residues to effect the modification of activity.

Dyes designed for high sensitivity detection of double-stranded DNA

DOEpatents

Glazer, Alexander N.; Benson, Scott C.

1994-01-01

Novel fluorescent dyes are provided, characterized by having a fluorophore joined to a polycationic chain of at least two positive charges. The dyes are found to provide for high enhancement upon binding to nucleic acid and have strong binding affinities to the nucleic acid, as compared to the fluorophore without the polycationic chain. The dyes find use in detection of dsDNA in gel electrophoresis and solution at substantially higher sensitivities using substantially less dye.

Probing electrostatic interactions and ligand binding in aspartyl-tRNA synthetase through site-directed mutagenesis and computer simulations.

PubMed

Thompson, Damien; Lazennec, Christine; Plateau, Pierre; Simonson, Thomas

2008-05-15

Faithful genetic code translation requires that each aminoacyl-tRNA synthetase recognise its cognate amino acid ligand specifically. Aspartyl-tRNA synthetase (AspRS) distinguishes between its negatively-charged Asp substrate and two competitors, neutral Asn and di-negative succinate, using a complex network of electrostatic interactions. Here, we used molecular dynamics simulations and site-directed mutagenesis experiments to probe these interactions further. We attempt to decrease the Asp/Asn binding free energy difference via single, double and triple mutations that reduce the net positive charge in the active site of Escherichia coli AspRS. Earlier, Glutamine 199 was changed to a negatively-charged glutamate, giving a computed reduction in Asp affinity in good agreement with experiment. Here, Lysine 198 was changed to a neutral leucine; then, Lys198 and Gln199 were mutated simultaneously. Both mutants are predicted to have reduced Asp binding and improved Asn binding, but the changes are insufficient to overcome the initial, high specificity of the native enzyme, which retains a preference for Asp. Probing the aminoacyl-adenylation reaction through pyrophosphate exchange experiments, we found no detectable activity for the mutant enzymes, indicating weaker Asp binding and/or poorer transition state stabilization. The simulations show that the mutations' effect is partly offset by proton uptake by a nearby histidine. Therefore, we performed additional simulations where the nearby Histidines 448 and 449 were mutated to neutral or negative residues: (Lys198Leu, His448Gln, His449Gln), and (Lys198Leu, His448Glu, His449Gln). This led to unexpected conformational changes and loss of active site preorganization, suggesting that the AspRS active site has a limited structural tolerance for electrostatic modifications. The data give insights into the complex electrostatic network in the AspRS active site and illustrate the difficulty in engineering charged-to-neutral changes of the preferred ligand. 2007 Wiley-Liss, Inc.

MicroRNAs Form Triplexes with Double Stranded DNA at Sequence-Specific Binding Sites; a Eukaryotic Mechanism via which microRNAs Could Directly Alter Gene Expression

PubMed Central

Grace, Christy R.; Ferreira, Antonio M.; Waddell, M. Brett; Ridout, Granger; Naeve, Deanna; Leuze, Michael; LoCascio, Philip F.; Panetta, John C.; Wilkinson, Mark R.; Pui, Ching-Hon; Naeve, Clayton W.; Uberbacher, Edward C.; Bonten, Erik J.; Evans, William E.

2016-01-01

MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA) and typically down-regulating their stability or translation. Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence (i.e., NMR, FRET, SPR) that purine or pyrimidine-rich microRNAs of appropriate length and sequence form triple-helical structures with purine-rich sequences of duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show that several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 × 10−16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. This work has thus revealed a new mechanism by which microRNAs could interact with gene promoter regions to modify gene transcription. PMID:26844769

Evidence for double-strand break mediated mitochondrial DNA replication in Saccharomyces cerevisiae

PubMed Central

Prasai, Kanchanjunga; Robinson, Lucy C.; Scott, Rona S.; Tatchell, Kelly

2017-01-01

Abstract The mechanism of mitochondrial DNA (mtDNA) replication in Saccharomyces cerevisiae is controversial. Evidence exists for double-strand break (DSB) mediated recombination-dependent replication at mitochondrial replication origin ori5 in hypersuppressive ρ− cells. However, it is not clear if this replication mode operates in ρ+ cells. To understand this, we targeted bacterial Ku (bKu), a DSB binding protein, to the mitochondria of ρ+ cells with the hypothesis that bKu would bind persistently to mtDNA DSBs, thereby preventing mtDNA replication or repair. Here, we show that mitochondrial-targeted bKu binds to ori5 and that inducible expression of bKu triggers petite formation preferentially in daughter cells. bKu expression also induces mtDNA depletion that eventually results in the formation of ρ0 cells. This data supports the idea that yeast mtDNA replication is initiated by a DSB and bKu inhibits mtDNA replication by binding to a DSB at ori5, preventing mtDNA segregation to daughter cells. Interestingly, we find that mitochondrial-targeted bKu does not decrease mtDNA content in human MCF7 cells. This finding is in agreement with the fact that human mtDNA replication, typically, is not initiated by a DSB. Therefore, this study provides evidence that DSB-mediated replication is the predominant form of mtDNA replication in ρ+ yeast cells. PMID:28549155

SSB-1 of the yeast Saccharomyces cerevisiae is a nucleolar-specific, silver-binding protein that is associated with the snR10 and snR11 small nuclear RNAs

PubMed Central

1990-01-01

SSB-1, the yeast single-strand RNA-binding protein, is demonstrated to be a yeast nucleolar-specific, silver-binding protein. In double-label immunofluorescence microscopy experiments antibodies to two other nucleolar proteins, RNA Pol I 190-kD and fibrillarin, were used to reveal the site of rRNA transcription; i.e., the fibrillar region of the nucleolus. SSB-1 colocalized with fibrillarin in a double-label immunofluorescence mapping experiment to the yeast nucleolus. SSB-1 is located, though, over a wider region of the nucleolus than the transcription site marker. Immunoprecipitations of yeast cell extracts with the SSB-1 antibody reveal that in 150 mM NaCl SSB-1 is bound to two small nuclear RNAs (snRNAs). These yeast snRNAs are snR10 and snR11, with snR10 being predominant. Since snR10 has been implicated in pre-rRNA processing, the association of SSB-1 and snR10 into a nucleolar snRNP particle indicates SSB-1 involvement in rRNA processing as well. Also, another yeast protein, SSB-36-kD, isolated by single- strand DNA chromatography, is shown to bind silver under the conditions used for nucleolar-specific staining. It is, most likely, another yeast nucleolar protein. PMID:2121740

Nonbonded interactions in membrane active cyclic biopolymers. IV - Cation dependence

NASA Technical Reports Server (NTRS)

Radhakrishnan, R.; Srinivasan, S.; Prasad, C. V.; Brinda, S. R.; Macelroy, R. D.; Sundaram, K.

1980-01-01

Interactions of valinomycin and form of its analogs in several conformations with the central ions Li(+), Na(+), K(+), Rb(+) and Cs(+) are investigated as part of a study of the specific preference of valinomycin for potassium and the mechanisms of carrier-mediated ion transport across membranes. Ion binding energies and conformational potential energies are calculated taking into account polarization energy formulas and repulsive energy between the central ion and the ligand atoms for conformations representing various stages in ion capture and release for each of the two ring chiralities of valinomycin and its analogs. Results allow the prediction of the chirality and conformation most likely to be observed for a given analog, and may be used to synthesize analogs with a desired rigidity or flexibility. The binding energies with the alkali metal cations are found to decrease with increasing ion size, and to be smaller than the corresponding ion hydration energies. It is pointed out that the observed potassium preference may be explainable in terms of differences between binding and hydration energies. Binding energies are also noted to depend on ligand conformation.

Tunneling effect on double potential barriers GaAs and PbS

NASA Astrophysics Data System (ADS)

Prastowo, S. H. B.; Supriadi, B.; Ridlo, Z. R.; Prihandono, T.

2018-04-01

A simple model of transport phenomenon tunnelling effect through double barrier structure was developed. In this research we concentrate on the variation of electron energy which entering double potential barriers to transmission coefficient. The barriers using semiconductor materials GaAs (Galium Arsenide) with band-gap energy 1.424 eV, distance of lattice 0.565 nm, and PbS (Lead Sulphide) with band gap energy 0.41 eV distance of lattice is 18 nm. The Analysisof tunnelling effect on double potentials GaAs and PbS using Schrodinger’s equation, continuity, and matrix propagation to get transmission coefficient. The maximum energy of electron that we use is 1.0 eV, and observable from 0.0025 eV- 1.0 eV. The shows the highest transmission coefficient is0.9982 from electron energy 0.5123eV means electron can pass the barriers with probability 99.82%. Semiconductor from materials GaAs and PbS is one of selected material to design semiconductor device because of transmission coefficient directly proportional to bias the voltage of semiconductor device. Application of the theoretical analysis of resonant tunnelling effect on double barriers was used to design and develop new structure and combination of materials for semiconductor device (diode, transistor, and integrated circuit).

Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay

PubMed Central

Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.

2011-01-01

The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207

Narratives of the double bind: Intersectionality in life stories of women of color in physics, astrophysics and astronomy

NASA Astrophysics Data System (ADS)

Ko, Lily T.; Kachchaf, Rachel R.; Ong, Maria; Hodari, Apriel K.

2013-01-01

This paper presents themes on the life stories of women of color in physics, astrophysics and astronomy. Drawing from our NSF-sponsored project, Beyond the Double Bind: Women of Color in STEM, we share findings from 10 interviews and 41 extant texts (about 23 women in varied life stages). Employing intersectionality theory and narrative analysis, our study contributes a critical analysis of how the intersection of gender and race affects performance, identity, persistence and overall career and education experiences in the physical sciences. Our findings both support existing literature on women of color in STEM, as well as bring to light two major, emergent issues: the importance of activism, and school/work-life balance. This research will add to the knowledge base about strategies for retaining women of color--widely considered an untapped source of domestic talent that could fill the country's scientific workforce needs.

Triple helical DNA in a duplex context and base pair opening

PubMed Central

Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

2014-01-01

It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

Daring the Foolish to Take Darwin Tests: The Ethical Double Bind of Betting On Natural Hazards

NASA Astrophysics Data System (ADS)

Halpern, J. B.

2017-12-01

While couched in the framework of concentrating minds betting on natural hazards carries an ethical cost. When children dare each other to do risky things parents know that when such dares are taken harm frequently occurs. Giving those who claim that there is no hazard financial reasons to avoid ameliorative actions or to double down in support of their public stance requires a moral calculation. Challenging the conclusions of those who accept such bets while denying danger will lead them to attempt to save face by increasing risk to themselves or others. Thus such wagers, whether person to person or on betting markets, require balancing between alerting the opposing party and others to the risks of not taking action, the associated scientific consensus and the possible harmful outcomes of the bets themselves. This talk will describe strategies for minimizing potential harm while maximizing the instructive component of climate bets. Best practices include having the bet rest on a technical issue that can be authoritatively resolved in a short time. Unfortunately the nature of natural hazard risks makes it difficult to meet all of these criteria, but those making such bets should be aware of the ethical double bind

Find structural aspects of anthozoan desmocyte development (phylum Cnidaria).

PubMed

Tidball, J G

1982-01-01

The fine structural changes associated with the differentiation of skeletogenic cells into cells specialized in binding soft tissues onto skeletal structures are described in the gorgonian coral, Leptogorgia virgulata (Lam.). These binding cells are called desmocytes. The sequence of events in desmocyte development includes: growth of the plasma membrane, invagination of the mesoglea-end of the cell, expansion of the axis-end of the cell, loss of organelles involved in skeletogenesis, proliferation of double vesicles and transformation of double vesicles into cytoskeletal rods. Double vesicles appear either cup-shaped or as a vesicle within a vesicle in sectioned material. These observations of desmocyte development are compared to previous light microscopical observations desmocyte development in diverse forms of anthozoans. Similarities in desmocyte development throughout the class include invagination of the differentiating cell, formation of a pectinate mesogleal margin and formation of an array of cytoskeletal rods at the axis-end of the cell. Comparison with available information on the development and fine structure of desmocytes in the cnidarian classes Scyphozoa and Hydrozoa shows these similarities do not extend across class boundaries and, therefore, common ancestry between the three classes of cnidarian desmocytes seems remote if, indeed, such an ancestral cell existed at all.

Conductance of graphene-based double-barrier nanostructures.

PubMed

Setare, M R; Jahani, D

2010-12-22

The effect of a mass gap on the conductance of graphene double-barrier heterojunctions is studied. By obtaining the 2D expression for the electronic transport of the low energy excitations of pure graphene through double-barrier systems, it is found that the conductivity of these structures does not depend on the type of charge carriers in the zones of the electric field. However, a finite induced gap in the graphene spectrum makes conductivity dependent on the energy band index. We also discuss a few controversies concerning double-barrier systems stemming from an improper choice of the scattering angle. Then it is observed that, for some special values of the incident energy and potential's height, graphene junctions behave like left-handed materials, resulting in a maximum value for the conductivity.

Binding of group 15 and group 16 oxides by a concave host containing an isophthalamide unit.

PubMed

Eckelmann, Jens; Saggiomo, Vittorio; Fischmann, Svenja; Lüning, Ulrich

2012-01-01

A bi-macrocycle with an incorporated isophthalamide substructure was synthesized by double amide formation between an isophthaloyl dichloride and two equivalents of a bis(alkenyloxy)aniline, followed by ring-closing metathesis and hydrogenation. In contrast to many related isophthalamides, the concave host exhibits a better binding for oxides, such as DMSO or pyridine-N-oxide, than for halide anions. A general method for a quick estimation of the strength of binding derived from only a few data points is presented and gives an estimated K(ass) of pyridine-N-oxide of ca. 40 M(-1), NMR titration confirms 25 M(-1).

An immunoassay for the study of DNA-binding activities of herpes simplex virus protein ICP8.

PubMed

Lee, C K; Knipe, D M

1985-06-01

An immunoassay was used to examine the interaction between a herpes simplex virus protein, ICP8, and various types of DNA. The advantage of this assay is that the protein is not subjected to harsh purification procedures. We characterized the binding of ICP8 to both single-stranded (ss) and double-stranded (ds) DNA. ICP8 bound ss DNA fivefold more efficiently than ds DNA, and both binding activities were most efficient in 150 mM NaCl. Two lines of evidence indicate that the binding activities were not identical: (i) ds DNA failed to complete with ss DNA binding even with a large excess of ds DNA; (ii) Scatchard plots of DNA binding with various amounts of DNA were fundamentally different for ss DNA and ds DNA. However, the two activities were related in that ss DNA efficiently competed with the binding of ds DNA. We conclude that the ds DNA-binding activity of ICP8 is probably distinct from the ss DNA-binding activity. No evidence for sequence-specific ds DNA binding was obtained for either the entire herpes simplex virus genome or cloned viral sequences.

Glycine Hinges with Opposing Actions at the Acetylcholine Receptor-Channel Transmitter Binding SiteS⃞

PubMed Central

Purohit, Prasad

2011-01-01

The extent to which agonists activate synaptic receptor-channels depends on both the intrinsic tendency of the unliganded receptor to open and the amount of agonist binding energy realized in the channel-opening process. We examined mutations of the nicotinic acetylcholine receptor transmitter binding site (α subunit loop B) with regard to both of these parameters. αGly147 is an “activation” hinge where backbone flexibility maintains high values for intrinsic gating, the affinity of the resting conformation for agonists and net ligand binding energy. αGly153 is a “deactivation” hinge that maintains low values for these parameters. αTrp149 (between these two glycines) serves mainly to provide ligand binding energy for gating. We propose that a concerted motion of the two glycine hinges (plus other structural elements at the binding site) positions αTrp149 so that it provides physiologically optimal binding and gating function at the nerve-muscle synapse. PMID:21115636

Atomic and molecular adsorption on Au(111)

DOE PAGES

Santiago-Rodriguez, Yohaselly; Herron, Jeffrey A.; Curet-Arana, Maria C.; ...

2014-05-02

Periodic self-consistent density functional theory (DFT-GGA) calculations were used to study the adsorption of several atomic species, molecular species and molecular fragments on the Au(111) surface with a coverage of 1/4 monolayer (ML). Binding geometries, binding energies, and diffusion barriers were calculated for 27 species. Furthermore, we calculated the surface deformation energy associated with the binding events. The binding strength for all the analyzed species can be ordered as follows: NH 3 < NO < CO < CH 3 < HCO < NH 2 < COOH < OH < HCOO < CNH 2 < H < N < NH

Specific ganglioside binding to receptor sites on T lymphocytes that couple to ganglioside-induced decrease of CD4 expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morrison, W.J.; Offner, H.; Vandenbark, A.A.

1989-01-01

The binding of different gangliosides to rat T-helper lymphocytes was characterized under conditions that decrease CD4 expression on different mammalian T-helper lymphoctyes. Saturation binding by monosialylated ({sub 3}H)-GM{sub 1} to rat T-lymphocytes was time- and temperature-dependent, had a dissociation constant (K{sub D}) of 2.2 {plus minus} 1.4 {mu}M and a binding capacity near 2 fmoles/cell. Competitive inhibition of ({sup 3}H)- GM{sub 1} binding demonstrated a structural-activity related to the number of unconstrained sialic acid moieties on GM{sub 1}-congeneric gangliosides. A comparison between the results of these binding studies and gangliosides-induced decrease of CD4 expression demonstrated that every aspect of ({supmore » 3}H)-GM{sub 1} binding concurs with ganglioside modulation of CD4 expression. It is concluded that the specific decrease of CD4 expression induced by pretreatment with gangliosides involves the initial process of gangliosides binding to specific sites on CD4{sup {double dagger}} T-helper lymphocytes.« less

Predicting Binding Free Energy Change Caused by Point Mutations with Knowledge-Modified MM/PBSA Method.

PubMed

Petukh, Marharyta; Li, Minghui; Alexov, Emil

2015-07-01

A new methodology termed Single Amino Acid Mutation based change in Binding free Energy (SAAMBE) was developed to predict the changes of the binding free energy caused by mutations. The method utilizes 3D structures of the corresponding protein-protein complexes and takes advantage of both approaches: sequence- and structure-based methods. The method has two components: a MM/PBSA-based component, and an additional set of statistical terms delivered from statistical investigation of physico-chemical properties of protein complexes. While the approach is rigid body approach and does not explicitly consider plausible conformational changes caused by the binding, the effect of conformational changes, including changes away from binding interface, on electrostatics are mimicked with amino acid specific dielectric constants. This provides significant improvement of SAAMBE predictions as indicated by better match against experimentally determined binding free energy changes over 1300 mutations in 43 proteins. The final benchmarking resulted in a very good agreement with experimental data (correlation coefficient 0.624) while the algorithm being fast enough to allow for large-scale calculations (the average time is less than a minute per mutation).

The HSP90 binding mode of a radicicol-like E-oxime from docking, binding free energy estimations, and NMR 15N chemical shifts

PubMed Central

Spichty, Martin; Taly, Antoine; Hagn, Franz; Kessler, Horst; Barluenga, Sofia; Winssinger, Nicolas; Karplus, Martin

2009-01-01

We determine the binding mode of a macrocyclic radicicol-like oxime to yeast HSP90 by combining computer simulations and experimental measurements. We sample the macrocyclic scaffold of the unbound ligand by parallel tempering simulations and dock the most populated conformations to yeast HSP90. Docking poses are then evaluated by the use of binding free energy estimations with the linear interaction energy method. Comparison of QM/MM-calculated NMR chemical shifts with experimental shift data for a selective subset of back-bone 15N provides an additional evaluation criteria. As a last test we check the binding modes against available structure-activity-relationships. We find that the most likely binding mode of the oxime to yeast HSP90 is very similar to the known structure of the radicicol-HSP90 complex. PMID:19482409

Free energy changes and components implicit in the MWC allosteric model for the cooperative oxygen binding of hemoglobin.#

PubMed Central

Bucci, Enrico

2013-01-01

Hill’s plots of oxygen binding isotherms reveal the presence of a transition between two different oxygen affinities at the beginning and end of the isotherm. They correspond to the two conformations anticipated by the MWC model, namely the T and R conformations at the beginning and end of oxygen binding, when the lower affinity of the T form develops into the higher affinity of the R form. The difference between the binding Gibbs free energies changes of the two affinities (ΔGL) is the free energy of binding cooperativity. Notably ΔGL is positive in favor of the T form, that moves to a higher energy level upon oxygen release. Osmotic stress reveals a higher volume/surface ratio of deoxyHb, with a positive ΔGW also in favor of the T form . Increasing protein concentration shifts the isotherms to the right indicating the formation of intermediate polymeric forms. Enthalpy of the intermediates show a strong absorption of heat at the third oxygenation step due to polymers formation with quinary, and above, structures. The disassembly of intermediate polymers releases energy with a negative ΔG that compensates and allow the positivity of ΔGL. High energy polymers are the barrier preventing the relaxation of the T and R conformations into one another. The MWC allosteric model is the best justification of oxygen binding cooperativity . PMID:23710673

Factors driving stable growth of He clusters in W: first-principles study

NASA Astrophysics Data System (ADS)

Feng, Y. J.; Xin, T. Y.; Xu, Q.; Wang, Y. X.

2018-07-01

The evolution of helium (He) bubbles is responsible for the surface morphology variation and subsequent degradation of the properties of plasma-facing materials (PFMs) in nuclear fusion reactors. These severe problems unquestionably trace back to the behavior of He in PFMs, which is closely associated with the interaction between He and the matrix. In this paper, we decomposed the binding energy of the He cluster into three parts, those from W–W, W–He, and He–He interactions, using density functional theory. As a result, we clearly identified the main factors that determine a steplike decrease in the binding energy with increasing number of He atoms, which explains the process of self-trapping and athermal vacancy generation during He cluster growth in the PFM tungsten. The three interactions were found to synergetically shape the features of the steplike decrease in the binding energy. Fairly strong He–He repulsive forces at a short distance, which stem from antibonding states between He atoms, need to be released when additional He atoms are continuously bonded to the He cluster. This causes the steplike feature in the binding energy. The bonding states between W and He atoms in principle facilitate the decreasing trend of the binding energy. The decrease in binding energy with increasing number of He atoms implies that He clusters can grow stably.

Tinker-OpenMM: Absolute and relative alchemical free energies using AMOEBA on GPUs.

PubMed

Harger, Matthew; Li, Daniel; Wang, Zhi; Dalby, Kevin; Lagardère, Louis; Piquemal, Jean-Philip; Ponder, Jay; Ren, Pengyu

2017-09-05

The capabilities of the polarizable force fields for alchemical free energy calculations have been limited by the high computational cost and complexity of the underlying potential energy functions. In this work, we present a GPU-based general alchemical free energy simulation platform for polarizable potential AMOEBA. Tinker-OpenMM, the OpenMM implementation of the AMOEBA simulation engine has been modified to enable both absolute and relative alchemical simulations on GPUs, which leads to a ∼200-fold improvement in simulation speed over a single CPU core. We show that free energy values calculated using this platform agree with the results of Tinker simulations for the hydration of organic compounds and binding of host-guest systems within the statistical errors. In addition to absolute binding, we designed a relative alchemical approach for computing relative binding affinities of ligands to the same host, where a special path was applied to avoid numerical instability due to polarization between the different ligands that bind to the same site. This scheme is general and does not require ligands to have similar scaffolds. We show that relative hydration and binding free energy calculated using this approach match those computed from the absolute free energy approach. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Investigating actinomycin D binding to G-quadruplex, i-motif and double-stranded DNA in 27-nt segment of c-MYC gene promoter.

PubMed

Niknezhad, Zhila; Hassani, Leila; Norouzi, Davood

2016-01-01

c-MYC DNA is an attractive target for drug design, especially for cancer chemotherapy. Around 90% of c-MYC transcription is controlled by NHE III1, whose 27-nt purine-rich strand has the ability to form G-quadruplex structure. In this investigation, interaction of ActD with 27-nt G-rich strand (G/c-MYC) and its equimolar mixture with the complementary sequence, (GC/c-MYC) as well as related C-rich oligonucleotide (C/c-MYC) was evaluated. Molecular dynamic simulations showed that phenoxazine and lactone rings of ActD come close to the outer G-tetrad nucleotides indicating that ActD binds through end-stacking to the quadruplex DNA. RMSD and RMSF revealed that fluctuation of the quadruplex DNA increases upon interaction with the drug. The results of spectrophotometry and spectrofluorometry indicated that ActD most probably binds to the c-MYC quadruplex and duplex DNA via end-stacking and intercalation, respectively and polarity of ActD environment decreases due to the interaction. It was also found that binding of ActD to the GC-rich DNA is stronger than the two other forms of DNA. Circular dichroism results showed that the type of the three forms of DNA structures doesn't change, but their compactness alters due to their interaction with ActD. Finally, it can be concluded that ActD binds differently to double stranded DNA, quadruplex DNA and i-motif. Copyright © 2015 Elsevier B.V. All rights reserved.