Watson-Crick base pairing controls excited-state decay in natural DNA.

PubMed

Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

2014-10-13

Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Double heterojunction nanowire photocatalysts for hydrogen generation.

PubMed

Tongying, P; Vietmeyer, F; Aleksiuk, D; Ferraudi, G J; Krylova, G; Kuno, M

2014-04-21

Charge separation and charge transfer across interfaces are key aspects in the design of efficient photocatalysts for solar energy conversion. In this study, we investigate the hydrogen generating capabilities and underlying photophysics of nanostructured photocatalysts based on CdSe nanowires (NWs). Systems studied include CdSe, CdSe/CdS core/shell nanowires and their Pt nanoparticle-decorated counterparts. Femtosecond transient differential absorption measurements reveal how semiconductor/semiconductor and metal/semiconductor heterojunctions affect the charge separation and hydrogen generation efficiencies of these hybrid photocatalysts. In turn, we unravel the role of surface passivation, charge separation at semiconductor interfaces and charge transfer to metal co-catalysts in determining photocatalytic H2 generation efficiencies. This allows us to rationalize why Pt nanoparticle decorated CdSe/CdS NWs, a double heterojunction system, performs best with H2 generation rates of ∼434.29 ± 27.40 μmol h(-1) g(-1) under UV/Visible irradiation. In particular, we conclude that the CdS shell of this double heterojunction system serves two purposes. The first is to passivate CdSe NW surface defects, leading to long-lived charges at the CdSe/CdS interface capable of carrying out reduction chemistries. Upon photoexcitation, we also find that CdS selectively injects charges into Pt NPs, enabling simultaneous reduction chemistries at the Pt NP/solvent interface. Pt nanoparticle decorated CdSe/CdS NWs thus enable reduction chemistries at not one, but rather two interfaces, taking advantage of each junction's optimal catalytic activities.

Photoinduced electron transfer in a molecular dyad by nanosecond pump-pump-probe spectroscopy.

PubMed

Ha-Thi, M-H; Pham, V-T; Pino, T; Maslova, V; Quaranta, A; Lefumeux, C; Leibl, W; Aukauloo, A

2018-06-01

The design of robust and inexpensive molecular photocatalysts for the conversion of abundant stable molecules like H2O and CO2 into an energetic carrier is one of the major fundamental questions for scientists nowadays. The outstanding challenge is to couple single photoinduced charge separation events with the sequential accumulation of redox equivalents at the catalytic unit for performing multielectronic catalytic reactions. Herein, double excitation by nanosecond pump-pump-probe experiments was used to interrogate the photoinduced charge transfer and charge accumulation on a molecular dyad composed of a porphyrin chromophore and a ruthenium-based catalyst in the presence of a reversible electron acceptor. An accumulative charge transfer state is unattainable because of rapid reverse electron transfer to the photosensitizer upon the second excitation and the low driving force of the forward photodriven electron transfer reaction. Such a method allows the fundamental understanding of the relaxation mechanism after two sequential photon absorptions, deciphering the undesired electron transfer reactions that limit the charge accumulation efficiency. This study is a step toward the improvement of synthetic strategies of molecular photocatalysts for light-induced charge accumulation and more generally, for solar energy conversion.

Spectroscopic study of the charge-transfer complexes TiCl4/styrene and TiCl4/polystyrene

NASA Astrophysics Data System (ADS)

Gonçalves, Norberto S.; Noda, Lúcia. K.

2017-10-01

In this work, solutions of TiCl4/styrene and TiCl4/polystyrene charge-transfer complexes in CHCl3 or CDCl3 were investigated by UV-vis, resonance Raman and 1H NMR spectroscopies in order to study their molecular and electronic structures. Both show a yellow colour due to absorption in the 400 nm region, related to a charge-transfer transition. In Raman spectra, as the excitation approaches the resonance region, the primary enhancement of aromatic ring modes was mainly observed, rather than intensification of the vinylic double-bond stretch. Under the experimental conditions it was observed that formation of polystyrene takes place, as showed by 1H NMR spectra, and the most significant interaction occurs at the aromatic ring, as supported by the results from interaction of TiCl4 with polystyrene, as indicated by the charge-transfer band and resonant intensification of the aromatic ring modes.

Quantitative analysis of intramolecular exciplex and electron transfer in a double-linked zinc porphyrin-fullerene dyad.

PubMed

Al-Subi, Ali Hanoon; Niemi, Marja; Tkachenko, Nikolai V; Lemmetyinen, Helge

2012-10-04

Photoinduced charge transfer in a double-linked zinc porphyrin-fullerene dyad is studied. When the dyad is excited at the absorption band of the charge-transfer complex (780 nm), an intramolecular exciplex is formed, followed by the complete charge separated (CCS) state. By analyzing the results obtained from time-resolved transient absorption and emission decay measurements in a range of solvents with different polarities, we derived a dependence between the observable lifetimes and internal parameters controlling the reaction rate constants based on the semiquantum Marcus electron-transfer theory. The critical value of the solvent polarity was found to be ε(r) ≈ 6.5: in solvents with higher dielectric constants, the energy of the CCS state is lower than that of the exciplex and the relaxation takes place via the CCS state predominantly, whereas in solvents with lower polarities the energy of the CCS state is higher and the exciplex relaxes directly to the ground state. In solvents with moderate polarities the exciplex and the CCS state are in equilibrium and cannot be separated spectroscopically. The degree of the charge shift in the exciplex relative to that in the CCS state was estimated to be 0.55 ± 0.02. The electronic coupling matrix elements for the charge recombination process and for the direct relaxation of the exciplex to the ground state were found to be 0.012 ± 0.001 and 0.245 ± 0.022 eV, respectively.

Electric Double-Layer Interaction between Dissimilar Charge-Conserved Conducting Plates.

PubMed

Chan, Derek Y C

2015-09-15

Small metallic particles used in forming nanostructured to impart novel optical, catalytic, or tribo-rheological can be modeled as conducting particles with equipotential surfaces that carry a net surface charge. The value of the surface potential will vary with the separation between interacting particles, and in the absence of charge-transfer or electrochemical reactions across the particle surface, the total charge of each particle must also remain constant. These two physical conditions require the electrostatic boundary condition for metallic nanoparticles to satisfy an equipotential whole-of-particle charge conservation constraint that has not been studied previously. This constraint gives rise to a global charge conserved constant potential boundary condition that results in multibody effects in the electric double-layer interaction that are either absent or are very small in the familiar constant potential or constant charge or surface electrochemical equilibrium condition.

Photoelectrodes based on 2D opals assembled from Cu-delafossite double-shelled microspheres for an enhanced photoelectrochemical response.

PubMed

Oh, Yunjung; Yang, Wooseok; Tan, Jeiwan; Lee, Hyungsoo; Park, Jaemin; Moon, Jooho

2018-02-22

Although a unique light-harvesting property was recently demonstrated in a photocathode based on 2-dimensional (2D) opals of CuFeO 2 -shelled SiO 2 microspheres, the performance of a monolayer of ultra-thin CuFeO 2 -shelled microspheres is limited by ineffective charge separation. Herein, we propose an innovative design rule, in which an inner CuFeO 2 /outer CuAlO 2 double-shelled heterojunction is formed on each partially etched microsphere to obtain a hexagonally assembled 2D opal photoelectrode. Our Cu-delafossite double-shelled photocathode shows a dramatically improved charge separation capability, with a 9-fold increase in the photocurrent compared to that of the single-shelled counterpart. Electrochemical impedance spectroscopy clearly confirms the reduced charge transport/transfer resistance associated with the Cu-delafossite double-shelled photocathode, while surface photovoltage spectra reveal enhanced polarization of the photogenerated carrier, indicating improved charge separation capability with the aid of the heterojunction. Our finding sheds light on the importance of heterojunction interfaces in achieving optimal charge separation in opal architectures as well as the inner-shell/electrolyte interface to expedite charge separation/transport.

Effect of proton transfer on the electronic coupling in DNA

NASA Astrophysics Data System (ADS)

Rak, Janusz; Makowska, Joanna; Voityuk, Alexander A.

2006-06-01

The effects of single and double proton transfer within Watson-Crick base pairs on donor-acceptor electronic couplings, Vda, in DNA are studied on the bases of quantum chemical calculations. Four dimers [AT,AT], [GC,GC], [GC,AT] and [GC,TA)] are considered. Three techniques - the generalized Mulliken-Hush scheme, the fragment charge method and the diabatic states method - are employed to estimate Vda for hole transfer between base pairs. We show that both single- and double proton transfer (PT) reactions may substantially affect the electronic coupling in DNA. The electronic coupling in [AT,AT] is predicted to be most sensitive to PT. Single PT within the first base pair in the dimer leads to increase in the hole transfer efficiency by a factor of 4, while proton transfer within the second pair should substantially, by 2.7 times, decrease the rate of charge transfer. Thus, directional asymmetry of the PT effects on the electronic coupling is predicted. The changes in the Vda matrix elements correlate with the topological properties of orbitals of donor and acceptor and can be qualitatively rationalized in terms of resonance structures of donor and acceptor. Atomic pair contributions to the Vda matrix elements are also analyzed.

Charge-Transfer Processes in Warm Dense Matter: Selective Spectral Filtering for Laser-Accelerated Ion Beams

NASA Astrophysics Data System (ADS)

Braenzel, J.; Barriga-Carrasco, M. D.; Morales, R.; Schnürer, M.

2018-05-01

We investigate, both experimentally and theoretically, how the spectral distribution of laser accelerated carbon ions can be filtered by charge exchange processes in a double foil target setup. Carbon ions at multiple charge states with an initially wide kinetic energy spectrum, from 0.1 to 18 MeV, were detected with a remarkably narrow spectral bandwidth after they had passed through an ultrathin and partially ionized foil. With our theoretical calculations, we demonstrate that this process is a consequence of the evolution of the carbon ion charge states in the second foil. We calculated the resulting spectral distribution separately for each ion species by solving the rate equations for electron loss and capture processes within a collisional radiative model. We determine how the efficiency of charge transfer processes can be manipulated by controlling the ionization degree of the transfer matter.

Ultrafast electronic dynamics driven by nuclear motion

NASA Astrophysics Data System (ADS)

Vendrell, Oriol

2016-05-01

The transfer of electrical charge on a microscopic scale plays a fundamental role in chemistry, in biology, and in technological applications. In this contribution, we will discuss situations in which nuclear motion plays a central role in driving the electronic dynamics of photo-excited or photo-ionized molecular systems. In particular, we will explore theoretically the ultrafast transfer of a double electron hole between the functional groups of glycine after K-shell ionization and subsequent Auger decay. Although a large energy gap of about 15 eV initially exists between the two electronic states involved and coherent electronic dynamics play no role in the hole transfer, we will illustrate how the double hole can be transferred within 3 to 4 fs between both functional ends of the glycine molecule driven solely by specific nuclear displacements and non-Born-Oppenheimer effects. This finding challenges the common wisdom that nuclear dynamics of the molecular skeleton are unimportant for charge transfer processes at the few-femtosecond time scale and shows that they can even play a prominent role. We thank the Hamburg Centre for Ultrafast Imaging and the Volkswagen Foundation for financial support.

Charge Transfer in Saturation Doping of Double-Wall Carbon Nanotubes

NASA Astrophysics Data System (ADS)

Tchernatinsky, Alexander; Jayanthi, Chakram; Sumanasekera, Gamini; Wu, Shi-Yu

2004-03-01

Recent experimental evidences suggest that the outer tube of a double-wall carbon nanotube (DWCNT) may serve as a 'Faraday' cage (G. Chen, et al., Phys. Rev. Lett., 90, 257403 (2003)). In this presentation, we report the result of our systematic study of the effect of saturation doping of a (10,10) single-wall carbon nanotube, a (5,5)@(10,10) DWCNT, and a C_60@(10,10) peapod using DFT-based VASP computational package (G. Kresse and J. Hafner, Phys. Rev. B, 47, 558 (1993)). By comparing the resulting charge transfer of the above mentioned cases we shall provide the physics underlying the Faraday cage behavior of DWCNTs. Acknowledgments: This work was supported by the NSF (DMR-0112824) and the U.S.DOE (DE-FG02-00ER45832).

High-surface-area architectures for improved charge transfer kinetics at the dark electrode in dye-sensitized solar cells.

PubMed

Hoffeditz, William L; Katz, Michael J; Deria, Pravas; Martinson, Alex B F; Pellin, Michael J; Farha, Omar K; Hupp, Joseph T

2014-06-11

Dye-sensitized solar cell (DSC) redox shuttles other than triiodide/iodide have exhibited significantly higher charge transfer resistances at the dark electrode. This often results in poor fill factor, a severe detriment to device performance. Rather than moving to dark electrodes of untested materials that may have higher catalytic activity for specific shuttles, the surface area of platinum dark electrodes could be increased, improving the catalytic activity by simply presenting more catalyst to the shuttle solution. A new copper-based redox shuttle that experiences extremely high charge-transfer resistance at conventional Pt dark electrodes yields cells having fill-factors of less than 0.3. By replacing the standard Pt dark electrode with an inverse opal Pt electrode fabricated via atomic layer deposition, the dark electrode surface area is boosted by ca. 50-fold. The resulting increase in interfacial electron transfer rate (decrease in charge-transfer resistance) nearly doubles the fill factor and therefore the overall energy conversion efficiency, illustrating the utility of this high-area electrode for DSCs.

Bromine-doped DWNTs: A Molecular Faraday Cage

NASA Astrophysics Data System (ADS)

Chen, Gugang; Margine, Roxana; Gupta, Rajeev; Crespi, Vincent; Eklund, Peter; Sumanasekera, Gamini; Bandow, Shunji; Iijima, S.

2003-03-01

Raman scattering is used to probe the charge transfer distribution in Bromine-doped double-walled carbon nanotubes (DWNT). Using 1064 nm and 514.5 nm laser excitation we are able to study the charge-transfer sensitive phonons in the inner ( (5,5)) and outer ( (10,10)) tubes of the double-walled pair. The experimental results are compared to our tight binding band structure calculations that include a self-consistent electrostatic term sensitive to the average net charge density on each tube. Upon doping, the nanotube tangential and radial Raman bands from the outer (primary) tubes were observed to shift dramatically to higher frequencies, consistent with a C-C bond contraction driven by the acceptor-doping. The peak intensities of these bands significantly decreased with increasing doping exposure, and they eventually vanished, consistent with a deep depression in the Fermi energy that extinguishes the resonant Raman effect. Interestingly, at the same time, we observed little or no change for the tangential and radial Raman features identified with the inner (secondary) tubes during the bromine doping. Our electronic structure calculations show that the charge distribution between the outer and inner tubes depends on doping level and also, to some extent, on specific tube chirality combinations. In general, in agreement with experiment, the calculations find a very small net charge on the inner tube, consistent with a "Molecular Faraday Effect", e.g., a DWNT of (10, 10)/ (5, 5) configuration that exhibits 0.5 holes/Å total charge transfer, has only 0.04 holes/Å on the inner (secondary) tube.

Study of the Charge Transfer Process of LaNi5 Type Electrodes in Ni-MH Batteries

NASA Astrophysics Data System (ADS)

Le, Xuan Que; Nguyen, Phu Thuy

2002-12-01

As a result of the charge process of LaNi5 type electrode, hydrogen is reversibly absorbed on the electrode surface. The process consists two principal steps. During the both processes, the first reaction step occurs in the interface solid/liquid, negatively charged, with high static electric field, where the double layer structure became more compact. The transfer of charge under high electric field depends on many factors, principally on compositions of the electrode materials. Effects on that of Co, Fe, Mn substitutes, with different concentrations, have been comparatively studied using electrochemical technique. The analyse of interface C -.V study results has been realised, respecting Mott-Schottky relation. Optimal contents of some additives have been discussed. Some advantages of the applied electrochemical methods have been confirmed. The mechanism of the charges transfer and of the hydrogen reversible storage in the crystal structure in the batteries has been discussed. With the proposed mechanism, one can more explicitly understand the difference of the magnetic effect of the electrode materials before and after charge-discharge process can be explained.

QLog Solar-Cell Mode Photodiode Logarithmic CMOS Pixel Using Charge Compression and Readout †

PubMed Central

Ni, Yang

2018-01-01

In this paper, we present a new logarithmic pixel design currently under development at New Imaging Technologies SA (NIT). This new logarithmic pixel design uses charge domain logarithmic signal compression and charge-transfer-based signal readout. This structure gives a linear response in low light conditions and logarithmic response in high light conditions. The charge transfer readout efficiently suppresses the reset (KTC) noise by using true correlated double sampling (CDS) in low light conditions. In high light conditions, thanks to charge domain logarithmic compression, it has been demonstrated that 3000 electrons should be enough to cover a 120 dB dynamic range with a mobile phone camera-like signal-to-noise ratio (SNR) over the whole dynamic range. This low electron count permits the use of ultra-small floating diffusion capacitance (sub-fF) without charge overflow. The resulting large conversion gain permits a single photon detection capability with a wide dynamic range without a complex sensor/system design. A first prototype sensor with 320 × 240 pixels has been implemented to validate this charge domain logarithmic pixel concept and modeling. The first experimental results validate the logarithmic charge compression theory and the low readout noise due to the charge-transfer-based readout. PMID:29443903

QLog Solar-Cell Mode Photodiode Logarithmic CMOS Pixel Using Charge Compression and Readout.

PubMed

Ni, Yang

2018-02-14

In this paper, we present a new logarithmic pixel design currently under development at New Imaging Technologies SA (NIT). This new logarithmic pixel design uses charge domain logarithmic signal compression and charge-transfer-based signal readout. This structure gives a linear response in low light conditions and logarithmic response in high light conditions. The charge transfer readout efficiently suppresses the reset (KTC) noise by using true correlated double sampling (CDS) in low light conditions. In high light conditions, thanks to charge domain logarithmic compression, it has been demonstrated that 3000 electrons should be enough to cover a 120 dB dynamic range with a mobile phone camera-like signal-to-noise ratio (SNR) over the whole dynamic range. This low electron count permits the use of ultra-small floating diffusion capacitance (sub-fF) without charge overflow. The resulting large conversion gain permits a single photon detection capability with a wide dynamic range without a complex sensor/system design. A first prototype sensor with 320 × 240 pixels has been implemented to validate this charge domain logarithmic pixel concept and modeling. The first experimental results validate the logarithmic charge compression theory and the low readout noise due to the charge-transfer-based readout.

Double Transfer Voltammetry in Two-Polarizable Interface Systems: Effects of the Lipophilicity and Charge of the Target and Compensating Ions.

PubMed

Molina, Ángela; Laborda, Eduardo; Olmos, José Manuel; Millán-Barrios, Enrique

2018-03-06

Analytical expressions are obtained for the study of the net current and individual fluxes across macro- and micro-liquid/liquid interfaces in series as those found in ion sensing with solvent polymeric membranes and in ion-transfer batteries. The mathematical solutions deduced are applicable to any voltammetric technique, independently of the lipophilicity and charge number of the target and compensating ions. When supporting electrolytes of semihydrophilic ions are employed, the so-called double transfer voltammograms have a tendency to merge into a single signal, which complicates notably the modeling and analysis of the electrochemical response. The present theoretical results point out that the appearance of one or two voltammetric waves is highly dependent on the size of the interfaces and on the viscosity of the organic solution. Hence, the two latter can be adjusted experimentally in order to "split" the voltammograms and extract information about the ions involved. This has been illustrated in this work with the experimental study in water | 1,2-dichloroethane | water cells of the transfer of the monovalent tetraethylammonium cation compensated by anions of different lipophilicity, and also of the divalent hexachloroplatinate anion.

A Double Decarboxylation in Superfolder Green Fluorescent Protein Leads to High Contrast Photoactivation.

PubMed

Slocum, Joshua D; Webb, Lauren J

2017-07-06

A photoactivatable variant of superfolder green fluorescent protein (GFP) was created by replacing the threonine at position 203 with aspartic acid. Photoactivation by exposure of this mutant to UV light resulted in conversion of the fluorophore from the neutral to the negatively charged form, accompanied by a ∼95-fold increase in fluorescence under 488 nm excitation. Mass spectrometry before and after exposure to UV light revealed a change in mass of 88 Da, attributed to the double decarboxylation of Glu 222 and Asp 203. Kinetics studies and nonlinear power-dependence of the initial rate of photoconversion indicated that the double decarboxylation occurred via a multiphoton absorption process at 254 nm. In addition to providing a photoactivatable GFP with robust folding properties, a detailed mechanistic understanding of this double decarboxylation in GFP will lead to a better understanding of charge transfer in fluorescent proteins.

BiVO4/WO3/SnO2 Double-Heterojunction Photoanode with Enhanced Charge Separation and Visible-Transparency for Bias-Free Solar Water-Splitting with a Perovskite Solar Cell.

PubMed

Baek, Ji Hyun; Kim, Byeong Jo; Han, Gill Sang; Hwang, Sung Won; Kim, Dong Rip; Cho, In Sun; Jung, Hyun Suk

2017-01-18

Coupling dissimilar oxides in heterostructures allows the engineering of interfacial, optical, charge separation/transport and transfer properties of photoanodes for photoelectrochemical (PEC) water splitting. Here, we demonstrate a double-heterojunction concept based on a BiVO 4 /WO 3 /SnO 2 triple-layer planar heterojunction (TPH) photoanode, which shows simultaneous improvements in the charge transport (∼93% at 1.23 V vs RHE) and transmittance at longer wavelengths (>500 nm). The TPH photoanode was prepared by a facile solution method: a porous SnO 2 film was first deposited on a fluorine-doped tin oxide (FTO)/glass substrate followed by WO 3 deposition, leading to the formation of a double layer of dense WO 3 and a WO 3 /SnO 2 mixture at the bottom. Subsequently, a BiVO 4 nanoparticle film was deposited by spin coating. Importantly, the WO 3 /(WO 3 +SnO 2 ) composite bottom layer forms a disordered heterojunction, enabling intimate contact, lower interfacial resistance, and efficient charge transport/transfer. In addition, the top BiVO 4 /WO 3 heterojunction layer improves light absorption and charge separation. The resultant TPH photoanode shows greatly improved internal quantum efficiency (∼80%) and PEC water oxidation performance (∼3.1 mA/cm 2 at 1.23 V vs RHE) compared to the previously reported BiVO 4 /WO 3 photoanodes. The PEC performance was further improved by a reactive-ion etching treatment and CoO x electrocatalyst deposition. Finally, we demonstrated a bias-free and stable solar water-splitting by constructing a tandem PEC device with a perovskite solar cell (STH ∼3.5%).

Application of double-hybrid density functionals to charge transfer in N-substituted pentacenequinones.

PubMed

Sancho-García, J C

2012-05-07

A set of N-heteroquinones, deriving from oligoacenes, have been recently proposed as n-type organic semiconductors with high electron mobilities in thin-film transistors. Generally speaking, this class of compounds self-assembles in neighboring π-stacks linked by weak hydrogen bonds. We aim at theoretically characterizing here the sequential charge transport (hopping) process expected to take place across these arrays of molecules. To do so, we need to accurately address the preferred packing of these materials simultaneously to single-molecule properties related to charge-transfer events, carefully employing dispersion-corrected density functional theory methods to accurately extract the key molecular parameters governing this phenomenon at the nanoscale. This study confirms the great deal of interest around these compounds, since controlled functionalization of model molecules (i.e., pentacene) allows to efficiently tune the corresponding charge mobilities, and the capacity of modern quantum-chemical methods to predict it after rationalizing the underlying structure-property relationships.

Double Z-scheme ZnO/ZnS/g-C3N4 ternary structure for efficient photocatalytic H2 production

NASA Astrophysics Data System (ADS)

Dong, Zhifang; Wu, Yan; Thirugnanam, Natarajan; Li, Gonglin

2018-02-01

In the present work, a novel ZnO/ZnS/g-C3N4 ternary nanocomposite with double Z-scheme heterojunction has been designed via a two-step facile chemical conversion route. The spherical ZnS nanoparticles were uniformly loaded onto ZnO nanoflowers surface. And then the ZnO/ZnS nanocomposite was further hybridized with g-C3N4 nanosheets. Ternary ZnO/ZnS/g-C3N4 nanocomposite displays the largest specific surface area (about 76.2 m2/g), which provides plentiful activated sites for photocatalytic reaction. Furthermore, the ternary material exhibits the highest methylene blue photodegradation rate of about 0.0218 min-1 and the optimum photocatalytic H2 production (1205 μmol/g) over water splitting at 4 h under solar light irradiation. Moreover, it showed the highest photocurrent effect and the minimum charge-transfer resistance. These results implied that the higher photoactivity of ZnO/ZnS/g-C3N4 nanocomposite could be attributed to the multi-steps charge transfer and effective electron-hole separation in the double Z-scheme system.

Excited-State Charge Separation in the Photochemical Mechanism of the Light-Driven Enzyme Protochlorophyllide Oxidoreductase**

PubMed Central

Heyes, Derren J; Hardman, Samantha J O; Hedison, Tobias M; Hoeven, Robin; Greetham, Greg M; Towrie, Michael; Scrutton, Nigel S

2015-01-01

The unique light-driven enzyme protochlorophyllide oxidoreductase (POR) is an important model system for understanding how light energy can be harnessed to power enzyme reactions. The ultrafast photochemical processes, essential for capturing the excitation energy to drive the subsequent hydride- and proton-transfer chemistry, have so far proven difficult to detect. We have used a combination of time-resolved visible and IR spectroscopy, providing complete temporal resolution over the picosecond–microsecond time range, to propose a new mechanism for the photochemistry. Excited-state interactions between active site residues and a carboxyl group on the Pchlide molecule result in a polarized and highly reactive double bond. This so-called “reactive” intramolecular charge-transfer state creates an electron-deficient site across the double bond to trigger the subsequent nucleophilic attack of NADPH, by the negatively charged hydride from nicotinamide adenine dinucleotide phosphate. This work provides the crucial, missing link between excited-state processes and chemistry in POR. Moreover, it provides important insight into how light energy can be harnessed to drive enzyme catalysis with implications for the design of light-activated chemical and biological catalysts. PMID:25488797

Excited-state charge separation in the photochemical mechanism of the light-driven enzyme protochlorophyllide oxidoreductase.

PubMed

Heyes, Derren J; Hardman, Samantha J O; Hedison, Tobias M; Hoeven, Robin; Greetham, Greg M; Towrie, Michael; Scrutton, Nigel S

2015-01-26

The unique light-driven enzyme protochlorophyllide oxidoreductase (POR) is an important model system for understanding how light energy can be harnessed to power enzyme reactions. The ultrafast photochemical processes, essential for capturing the excitation energy to drive the subsequent hydride- and proton-transfer chemistry, have so far proven difficult to detect. We have used a combination of time-resolved visible and IR spectroscopy, providing complete temporal resolution over the picosecond-microsecond time range, to propose a new mechanism for the photochemistry. Excited-state interactions between active site residues and a carboxyl group on the Pchlide molecule result in a polarized and highly reactive double bond. This so-called "reactive" intramolecular charge-transfer state creates an electron-deficient site across the double bond to trigger the subsequent nucleophilic attack of NADPH, by the negatively charged hydride from nicotinamide adenine dinucleotide phosphate. This work provides the crucial, missing link between excited-state processes and chemistry in POR. Moreover, it provides important insight into how light energy can be harnessed to drive enzyme catalysis with implications for the design of light-activated chemical and biological catalysts. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Quadratic Electro-optic Effect in a Novel Nano-optical Polymer (iodine-doped polyisoprene)

NASA Astrophysics Data System (ADS)

Swamy, Rajendra; Titus, Jitto; Thakur, Mrinal

2004-03-01

In this report, exceptionally large quadratic electro-optic effect in a novel nano-optical polymer will be discussed. The material involved is cis-1,4-polyisoprene or natural rubber which is a nonconjugated conductive polymer[1,2].Upon doping with an acceptor such as iodine, an electron is transferred from its isolated double bond to the dopant leading to a charge-transfer complex. The positive charge (hole) thus created is localized around the double-bond site, within a nanometer dimension - thus, forming a nano-optical material. The quadratic electro-optic measurement on the doped polyisoprene film was made using field-induced birefringence method. The measured Kerr coefficient is about sixty six times that of nitrobenzene at 632 nm. Significant electroabsorption was also observed in this material at 632 nm. 1. M. Thakur, J. Macromol. Sci. - PAC, 2001, A38(12), 1337. 2. M. Thakur, S. Khatavkar and E.J. Parish, J. Macromol. Sci. - PAC, 2003, A40 (12), 1397.

Macroscopic acoustoelectric charge transport in graphene

NASA Astrophysics Data System (ADS)

Bandhu, L.; Lawton, L. M.; Nash, G. R.

2013-09-01

We demonstrate macroscopic acoustoelectric transport in graphene, transferred onto piezoelectric lithium niobate substrates, between electrodes up to 500 μm apart. Using double finger interdigital transducers we have characterised the acoustoelectric current as a function of both surface acoustic wave intensity and frequency. The results are consistent with a relatively simple classical relaxation model, in which the acoustoelectric current is proportional to both the surface acoustic wave intensity and the attenuation of the wave caused by the charge transport.

Chiroptical Properties of Imines Derived from R-(+)-Norbornenone: The Role of Electronegativity Differences.

PubMed

Wiberg, Kenneth B

2017-11-02

To allow a comparison with the specific rotations of R-(+)-5-methylenenorbornene (1) and R-(+)-norbornenone (2) we performed calculations at the LC-wPBE/aug-cc-pVTZ level for the imines (5a and 5b) derived from norbornenone and also for their protonated derivative (6). In accord with our results for simpler systems, the specific rotations increase in the order of 1 < 5 < 2 ≈ 6. In addition, the specific rotation of the protonated ketone was calculated and found to be considerably larger than that for 2 or 6. These rotations were found to be linearly dependent on the Hirshfeld charges at the carbon of the exocyclic double bond. This leads to the conclusion that charge transfer from the endocyclic double bond to the π* MO of the exocyclic double bond is an important component of the process that leads to the optical activity of these compounds.

Electron kinetics at the plasma interface

NASA Astrophysics Data System (ADS)

Bronold, Franz Xaver; Fehske, Holger; Pamperin, Mathias; Thiessen, Elena

2018-05-01

The most fundamental response of an ionized gas to a macroscopic object is the formation of the plasma sheath. It is an electron depleted space charge region, adjacent to the object, which screens the object's negative charge arising from the accumulation of electrons from the plasma. The plasma sheath is thus the positively charged part of an electric double layer whose negatively charged part is inside the wall. In the course of the Transregional Collaborative Research Center SFB/TRR24 we investigated, from a microscopic point of view, the elementary charge transfer processes responsible for the electric double layer at a floating plasma-wall interface and made first steps towards a description of the negative part of the layer inside the wall. Below we review our work in a colloquial manner, describe possible extensions, and identify key issues which need to be resolved to make further progress in the understanding of the electron kinetics across plasma-wall interfaces. Contribution to the Topical Issue "Fundamentals of Complex Plasmas", edited by Jürgen Meichsner, Michael Bonitz, Holger Fehske, Alexander Piel.

Studies on interaction of an intramolecular charge transfer fluorescence probe: 4'-dimethylamino-2,5-dihydroxychalcone with DNA.

PubMed

Xu, Zhicheng; Bai, Guan; Dong, Chuan

2005-10-15

The interaction of a new intramolecular charge transfer probe, namely 4'-dimethylamino-2,5-dihydroxychalcone (DMADHC), with calf thymus DNA has been studied. Compared to the spectral characteristics of the free form in aqueous solution, the fluorescence of DMADHC enhanced dramatically accompanying a blueshift of the emission maxima in the presence of DNA. The absorption and fluorescence spectra, salt concentration effect, KI quenching, fluorescence polarization, and DNA denaturation experiments were given. These results give evidence that the DMADHC molecule is inserted into the base-stacking domain of the DNA double helix. The intrinsic binding constant and the binding site number were estimated. The analytical characteristics were also given.

Modeling of electrochemical flow capacitors using Stokesian dynamics

NASA Astrophysics Data System (ADS)

Karzar Jeddi, Mehdi; Luo, Haoxiang; Cummings, Peter; Hatzell, Kelsey

2017-11-01

Electrochemical flow capacitors (EFCs) are supercapacitors designed to store electrical energy in the form of electrical double layer (EDL) near the surface of porous carbon particles. During its operation, a slurry of activated carbon beads and smaller carbon black particles is pumped between two flat and parallel electrodes. In the charging phase, ions in the electrolyte diffuse to the EDL, and electrical charges percolate through the dynamic network of particles from the flat electrodes; during the discharging phase, the process is reversed with the ions released to the bulk fluid and electrical charges percolating back through the network. In these processes, the relative motion and contact of particle of different sizes affect not only the rheology of the slurry but also charge transfer of the percolation network. In this study, we use Stoekesian dynamics simulation to investigate the role of hydrodynamic interactions of packed carbon particles in the charging/discharging behaviors of EFCs. We derived mobility functions for polydisperse spheres near a no-slip wall. A code is implemented and validated, and a simple charging model has been incorporated to represent charge transfer. Theoretical formulation and results demonstration will be presented in this talk.

Layer and doping tunable ferromagnetic order in two-dimensional Cr S2 layers

NASA Astrophysics Data System (ADS)

Wang, Cong; Zhou, Xieyu; Pan, Yuhao; Qiao, Jingsi; Kong, Xianghua; Kaun, Chao-Cheng; Ji, Wei

2018-06-01

Interlayer coupling is of vital importance for manipulating physical properties, e.g., electronic band gap, in two-dimensional materials. However, tuning magnetic properties in these materials is yet to be addressed. Here, we found the in-plane magnetic orders of Cr S2 mono and few layers are tunable between striped antiferromagnetic (sAFM) and ferromagnetic (FM) orders by manipulating charge transfer between Cr t2 g and eg orbitals. Such charge transfer is realizable through interlayer coupling, direct charge doping, or substituting S with Cl atoms. In particular, the transferred charge effectively reduces a portion of Cr4 + to Cr3 +, which, together with delocalized S p orbitals and their resulting direct S-S interlayer hopping, enhances the double-exchange mechanism favoring the FM rather than sAFM order. An exceptional interlayer spin-exchange parameter was revealed over -10 meV , an order of magnitude stronger than available results of interlayer magnetic coupling. It addition, the charge doping could tune Cr S2 between p - and n -doped magnetic semiconductors. Given these results, several prototype devices were proposed for manipulating magnetic orders using external electric fields or mechanical motion. These results manifest the role of interlayer coupling in modifying magnetic properties of layered materials and shed considerable light on manipulating magnetism in these materials.

Charge transfer between O6+ and atomic hydrogen

NASA Astrophysics Data System (ADS)

Wu, Y.; Stancil, P. C.; Liebermann, H. P.; Buenker, R. J.; Schultz, D. R.; Hui, Y.

2011-05-01

The charge exchange process has been found to play a dominant role in the production of X-rays and/or EUV photons observed in cometary and planetary atmospheres and from the heliosphere. Charge transfer cross sections, especially state-selective cross sections, are necessary parameters in simulations of X-ray emission. In the present work, charge transfer due to collisions of ground state O6+(1s2 1 S) with atomic hydrogen has been investigated theoretically using the quantum-mechanical molecular-orbital close-coupling method (QMOCC). The multi-reference single- and double-excitation configuration interaction approach (MRDCI) has been applied to compute the adiabatic potential and nonadiabatic couplings, and the atomic basis sets used have been optimized with the method proposed previously to obtain precise potential data. Total and state-selective cross sections are calculated for energies between 10 meV/u and 10 keV/u. The QMOCC results are compared to available experimental and theoretical data as well as to new atomic-orbital close-coupling (AOCC) and classical trajectory Monte Carlo (CTMC) calculations. A recommended set of cross sections, based on the MOCC, AOCC, and CTMC calculations, is deduced which should aid in X-ray modeling studies.

Boundary layer charge dynamics in ionic liquid-ionic polymer transducers

NASA Astrophysics Data System (ADS)

Davidson, Jacob D.; Goulbourne, N. C.

2011-01-01

Ionic polymer transducers (IPTs), also known as ionic polymer-metal composites, are soft sensors and actuators which operate through a coupling of microscale chemical, electrical, and mechanical interactions. The use of an ionic liquid as solvent for an IPT has been shown to dramatically increase transducer lifetime in free-air use, while also allowing for higher applied voltages without electrolysis. In this work, we apply Nernst-Planck/Poisson theory to model charge transport in an ionic liquid IPT by considering a certain fraction of the ionic liquid ions as mobile charge carriers, a phenomenon which is unique to ionic liquid IPTs compared to their water-based counterparts. Numerical simulations are performed using the finite element method to examine how the introduction of another pair of mobile ions affects boundary layer charge dynamics, concentration, and charge density distributions in the electric double layer, and the overall charge transferred and current response of the IPT. Due to interactions with the Nafion ionomer, not all of the ionic liquid ions will function as mobile charge carriers; only a certain fraction will exist as "free" ions. The presence of mobile ionic liquid ions in the transducer will increase the overall charge transferred when a voltage is applied, and cause the current in the transducer to decay more slowly. The additional mobile ions also cause the ionic concentration profiles to exhibit a nonlinear dynamic response, characterized by nonmonotonic ionic concentration profiles in space and time. Although the presence of mobile ionic liquid ions increases the overall amount of charge transferred, this additional charge transfer occurs in a somewhat symmetric manner. Therefore, the additional charge transferred due to the ionic liquid ions does not greatly increase the net bending moment of the transducer; in fact, it is possible that ionic liquid ion movement actually decreases the observed bending response. This suggests that an optimal electromechanical conversion efficiency for bending actuation is achieved by using an ionic liquid where only a relatively small fraction of the ionic liquid ions exist as free ions. Conversely, if it is desired to increase the overall amount of charge transferred, an ionic liquid with a large fraction of free ions should be used. These theoretical considerations are found to be in good qualitative agreement with recent experimental results.

Quasi-four-body treatment of charge transfer in the collision of protons with atomic helium: II. Second-order non-Thomas mechanisms and the cross sections

NASA Astrophysics Data System (ADS)

Safarzade, Zohre; Akbarabadi, Farideh Shojaei; Fathi, Reza; Brunger, Michael J.; Bolorizadeh, Mohammad A.

2018-05-01

A fully quantum mechanical four-body treatment of charge transfer collisions between energetic protons and atomic helium is developed here. The Pauli exclusion principle is applied to both the wave function of the initial and final states as well as the operators involved in the interaction. Prior to the collision, the helium atom is assumed as a two-body system composed of the nucleus, He2+, and an electron cloud composed of two electrons. Nonetheless, four particles are assumed in the final state. As the double interactions contribute extensively in single charge transfer collisions, the Faddeev-Lovelace-Watson scattering formalism describes it best physically. The treatment of the charge transfer cross section, under this quasi-four-body treatment within the FWL formalism, showed that other mechanisms leading to an effect similar to the Thomas one occur at the same scattering angle. Here, we study the two-body interactions which are not classically described but which lead to an effect similar to the Thomas mechanism and finally we calculate the total singlet and triplet amplitudes as well as the angular distributions of the charge transfer cross sections. As the incoming projectiles are assumed to be plane waves, the present results are calculated for high energies; specifically a projectile energy of 7.42 MeV was assumed as this is where experimental results are available in the literature for comparison. Finally, when possible we compare the present results with the other available theoretical data.

Double heterojunction nanowire photocatalysts for hydrogen generation

NASA Astrophysics Data System (ADS)

Tongying, P.; Vietmeyer, F.; Aleksiuk, D.; Ferraudi, G. J.; Krylova, G.; Kuno, M.

2014-03-01

Charge separation and charge transfer across interfaces are key aspects in the design of efficient photocatalysts for solar energy conversion. In this study, we investigate the hydrogen generating capabilities and underlying photophysics of nanostructured photocatalysts based on CdSe nanowires (NWs). Systems studied include CdSe, CdSe/CdS core/shell nanowires and their Pt nanoparticle-decorated counterparts. Femtosecond transient differential absorption measurements reveal how semiconductor/semiconductor and metal/semiconductor heterojunctions affect the charge separation and hydrogen generation efficiencies of these hybrid photocatalysts. In turn, we unravel the role of surface passivation, charge separation at semiconductor interfaces and charge transfer to metal co-catalysts in determining photocatalytic H2 generation efficiencies. This allows us to rationalize why Pt nanoparticle decorated CdSe/CdS NWs, a double heterojunction system, performs best with H2 generation rates of ~434.29 +/- 27.40 μmol h-1 g-1 under UV/Visible irradiation. In particular, we conclude that the CdS shell of this double heterojunction system serves two purposes. The first is to passivate CdSe NW surface defects, leading to long-lived charges at the CdSe/CdS interface capable of carrying out reduction chemistries. Upon photoexcitation, we also find that CdS selectively injects charges into Pt NPs, enabling simultaneous reduction chemistries at the Pt NP/solvent interface. Pt nanoparticle decorated CdSe/CdS NWs thus enable reduction chemistries at not one, but rather two interfaces, taking advantage of each junction's optimal catalytic activities.Charge separation and charge transfer across interfaces are key aspects in the design of efficient photocatalysts for solar energy conversion. In this study, we investigate the hydrogen generating capabilities and underlying photophysics of nanostructured photocatalysts based on CdSe nanowires (NWs). Systems studied include CdSe, CdSe/CdS core/shell nanowires and their Pt nanoparticle-decorated counterparts. Femtosecond transient differential absorption measurements reveal how semiconductor/semiconductor and metal/semiconductor heterojunctions affect the charge separation and hydrogen generation efficiencies of these hybrid photocatalysts. In turn, we unravel the role of surface passivation, charge separation at semiconductor interfaces and charge transfer to metal co-catalysts in determining photocatalytic H2 generation efficiencies. This allows us to rationalize why Pt nanoparticle decorated CdSe/CdS NWs, a double heterojunction system, performs best with H2 generation rates of ~434.29 +/- 27.40 μmol h-1 g-1 under UV/Visible irradiation. In particular, we conclude that the CdS shell of this double heterojunction system serves two purposes. The first is to passivate CdSe NW surface defects, leading to long-lived charges at the CdSe/CdS interface capable of carrying out reduction chemistries. Upon photoexcitation, we also find that CdS selectively injects charges into Pt NPs, enabling simultaneous reduction chemistries at the Pt NP/solvent interface. Pt nanoparticle decorated CdSe/CdS NWs thus enable reduction chemistries at not one, but rather two interfaces, taking advantage of each junction's optimal catalytic activities. Electronic supplementary information (ESI) available: Details of NW syntheses, processing and characterization. Additional TEM images of CdS, CdSe and CdSe/CdS core/shell NWs. NW concentration and cross section estimates. Details of the Pt NP decoration. Additional TEM images of Pt NP decorated CdS, CdSe and CdSe/CdS core/shell NWs. Size distribution of Pt NPs for CdSe/Pt NP and CdSe/CdS/Pt NP NWs. Xe arc lamp spectrum. Details of H2 generation experiments. Estimated photon absorption rate. Details of TDA measurements. TDA spectra and kinetics of CdS and CdS/Pt NP NWs. Plot illustrating CdSe NW band edge bleach kinetics. Comparison of CdSe band edge bleach kinetics in CdSe/CdS core/shell NWs when excited at λexc = 387 nm and λexc = 560 nm. Comparison of CdSe band edge bleach kinetics in CdSe/Pt NP NWs when excited at λexc = 387 nm and λexc = 560 nm. Bar graph showing H2 generation efficiencies of CdS and CdS/Pt NP NWs. Bleach kinetics of CdSe/CdS/Pt NP NWs at λexc = 387 nm and λexc = 560 nm. Comparison of CdS band edge bleach kinetics in CdS/Pt NP, and CdSe/CdS core/shell NWs when excited at λexc = 387 nm. See DOI: 10.1039/c4nr00298a

Spin Transfer Torque in Graphene

NASA Astrophysics Data System (ADS)

Lin, Chia-Ching; Chen, Zhihong

2014-03-01

Graphene is an idea channel material for spin transport due to its long spin diffusion length. To develop graphene based spin logic, it is important to demonstrate spin transfer torque in graphene. Here, we report the experimental measurement of spin transfer torque in graphene nonlocal spin valve devices. Assisted by a small external in-plane magnetic field, the magnetization reversal of the receiving magnet is induced by pure spin diffusion currents from the injector magnet. The magnetization switching is reversible between parallel and antiparallel configurations by controlling the polarity of the applied charged currents. Current induced heating and Oersted field from the nonlocal charge flow have also been excluded in this study. Next, we further enhance the spin angular momentum absorption at the interface of the receiving magnet and graphene channel by removing the tunneling barrier in the receiving magnet. The device with a tunneling barrier only at the injector magnet shows a comparable nonlocal spin valve signal but lower electrical noise. Moreover, in the same preset condition, the critical charge current density for spin torque in the single tunneling barrier device shows a substantial reduction if compared to the double tunneling barrier device.

On the calculation of charge transfer transitions with standard density functionals using constrained variational density functional theory.

PubMed

Ziegler, Tom; Krykunov, Mykhaylo

2010-08-21

It is well known that time-dependent density functional theory (TD-DFT) based on standard gradient corrected functionals affords both a quantitative and qualitative incorrect picture of charge transfer transitions between two spatially separated regions. It is shown here that the well known failure can be traced back to the use of linear response theory. Further, it is demonstrated that the inclusion of higher order terms readily affords a qualitatively correct picture even for simple functionals based on the local density approximation. The inclusion of these terms is done within the framework of a newly developed variational approach to excitation energies called constrained variational density functional theory (CV-DFT). To second order [CV(2)-DFT] this theory is identical to adiabatic TD-DFT within the Tamm-Dancoff approximation. With inclusion of fourth order corrections [CV(4)-DFT] it affords a qualitative correct description of charge transfer transitions. It is finally demonstrated that the relaxation of the ground state Kohn-Sham orbitals to first order in response to the change in density on excitation together with CV(4)-DFT affords charge transfer excitations in good agreement with experiment. The new relaxed theory is termed R-CV(4)-DFT. The relaxed scheme represents an effective way in which to introduce double replacements into the description of single electron excitations, something that would otherwise require a frequency dependent kernel.

A novel radiation hard pixel design for space applications

NASA Astrophysics Data System (ADS)

Aurora, A. M.; Marochkin, V. V.; Tuuva, T.

2017-11-01

We have developed a novel radiation hard photon detector concept based on Modified Internal Gate Field Effect Transistor (MIGFET) wherein a buried Modified Internal Gate (MIG) is implanted underneath a channel of a FET. In between the MIG and the channel of the FET there is depleted semiconductor material forming a potential barrier between charges in the channel and similar type signal charges located in the MIG. The signal charges in the MIG have a measurable effect on the conductance of the channel. In this paper a radiation hard double MIGFET pixel is investigated comprising two MIGFETs. By transferring the signal charges between the two MIGs Non-Destructive Correlated Double Sampling Readout (NDCDSR) is enabled. The radiation hardness of the proposed double MIGFET structure stems from the fact that interface related issues can be considerably mitigated. The reason for this is, first of all, that interface generated dark noise can be completely avoided and secondly, that interface generated 1/f noise can be considerably reduced due to a deep buried channel readout configuration. Electrical parameters of the double MIGFET pixel have been evaluated by 3D TCAD simulation study. Simulation results show the absence of interface generated dark noise, significantly reduced interface generated 1/f noise, well performing NDCDSR operation, and blooming protection due to an inherent vertical anti-blooming structure. In addition, the backside illuminated thick fully depleted pixel design results in low crosstalk due to lack of diffusion and good quantum efficiency from visible to Near Infra-Red (NIR) light. These facts result in excellent Signal-to-Noise Ratio (SNR) and very low crosstalk enabling thus excellent image quality. The simulation demonstrates the charge to current conversion gain for source current read-out to be 1.4 nA/e.

Ligand-induced dependence of charge transfer in nanotube–quantum dot heterostructures

DOE PAGES

Wang, Lei; Han, Jinkyu; Sundahl, Bryan; ...

2016-07-01

As a model system to probe ligand-dependent charge transfer in complex composite heterostructures, we fabricated double-walled carbon nanotube (DWNT) – CdSe quantum dot (QD) composites. Whereas the average diameter of the QDs probed was kept fixed at ~4.1 nm and the nanotubes analyzed were similarly oxidatively processed, by contrast, the ligands used to mediate the covalent attachment between the QDs and DWNTs were systematically varied to include p-phenylenediamine (PPD), 2-aminoethanethiol (AET), and 4-aminothiophenol (ATP). Herein, we have put forth a unique compilation of complementary data from experiment and theory, including results from transmission electron microscopy (TEM), near-edge X-ray absorption finemore » structure (NEXAFS) spectroscopy, Raman spectroscopy, electrical transport measurements, and theoretical modeling studies, in order to fundamentally assess the nature of the charge transfer between CdSe QDs and DWNTs, as a function of the structure of various, intervening bridging ligand molecules. Specifically, we correlated evidence of charge transfer as manifested by changes and shifts associated with NEXAFS intensities, Raman peak positions, and threshold voltages both before and after CdSe QD deposition onto the underlying DWNT surface. Importantly, for the first time ever in these types of nanoscale composite systems, we have sought to use theoretical modeling to justify and account for our experimental results. Finally, our overall data suggest that (i) QD coverage density on the DWNTs varies, based upon the different ligand pendant groups used and that (ii) the presence of a π-conjugated carbon framework within the ligands themselves and the electron affinity of the pendant groups collectively play important roles in the resulting charge transfer from QDs to the underlying CNTs.« less

Molecular Engineering for Enhanced Charge Transfer in Thin-Film Photoanode.

PubMed

Kim, Jeong Soo; Kim, Byung-Man; Kim, Un-Young; Shin, HyeonOh; Nam, Jung Seung; Roh, Deok-Ho; Park, Jun-Hyeok; Kwon, Tae-Hyuk

2017-10-11

We developed three types of dithieno[3,2-b;2',3'-d]thiophene (DTT)-based organic sensitizers for high-performance thin photoactive TiO 2 films and investigated the simple but powerful molecular engineering of different types of bonding between the triarylamine electron donor and the conjugated DTT π-bridge by the introduction of single, double, and triple bonds. As a result, with only 1.3 μm transparent and 2.5-μm TiO 2 scattering layers, the triple-bond sensitizer (T-DAHTDTT) shows the highest power conversion efficiency (η = 8.4%; V OC = 0.73 V, J SC = 15.4 mA·cm -2 , and FF = 0.75) in an iodine electrolyte system under one solar illumination (AM 1.5, 1000 W·m -2 ), followed by the single-bond sensitizer (S-DAHTDTT) (η = 7.6%) and the double-bond sensitizer (D-DAHTDTT) (η = 6.4%). We suggest that the superior performance of T-DAHTDTT comes from enhanced intramolecular charge transfer (ICT) induced by the triple bond. Consequently, T-DAHTDTT exhibits the most active photoelectron injection and charge transport on a TiO 2 film during operation, which leads to the highest photocurrent density among the systems studied. We analyzed these correlations mainly in terms of charge injection efficiency, level of photocharge storage, and charge-transport kinetics. This study suggests that the molecular engineering of a triple bond between the electron donor and the π-bridge of a sensitizer increases the performance of dye-sensitized solar cell (DSC) with a thin photoactive film by enhancing not only J SC through improved ICT but also V OC through the evenly distributed sensitizer surface coverage.

FROM THE HISTORY OF PHYSICS: Electrolysis and surface phenomena. To the bicentenary of Volta's publication on the first direct-current source

NASA Astrophysics Data System (ADS)

Gokhshtein, Aleksandr Ya

2000-07-01

The development of knowledge about electric current, potential, and the conversion of energy at the interface between electronic- and ionic-conductivity phases is briefly reviewed. Although soon after its discovery it was realized that electric current is the motion of charged particles, the double-layer field promoting charge transfer through the interface was considered for a long time to be as uniform as in a capacitor. One-dimensional ion discharge theory failed to explain the observed dependence of the current on the potential jump across the interface. The spatial segmentation of energy in the double layer due to the quantum evolution of the layer's periphery puts a limit on the charge transfer work the field may perform locally, and creates conditions for the ionic atmosphere being spontaneously compressed after the critical potential jump has been reached. A discrete interchange of states also occurs due to the adsorption of discharged particles and corresponds to the consecutive exclusion of the d-wave function nodes of metal surface atoms, the exclusion manifesting itself in the larger longitudinal and smaller lateral sizes of the atomic orbital. The elastic extension of the metal surface reduces the d-function overlap thus intensifying adsorption. Advances in experimentation, in particular new techniques capable of detecting alternating surface tension of solids, enabled these and some other phenomena to be observed.

Energy Level Alignment of N-Doping Fullerenes and Fullerene Derivatives Using Air-Stable Dopant.

PubMed

Bao, Qinye; Liu, Xianjie; Braun, Slawomir; Li, Yanqing; Tang, Jianxin; Duan, Chungang; Fahlman, Mats

2017-10-11

Doping has been proved to be one of the powerful technologies to achieve significant improvement in the performance of organic electronic devices. Herein, we systematically map out the interface properties of solution-processed air-stable n-type (4-(1,3-dimethyl-2,3-dihydro-1H-benzoimidazol-2-yl)phenyl) doping fullerenes and fullerene derivatives and establish a universal energy level alignment scheme for this class of n-doped system. At low doping levels at which the charge-transfer doping induces mainly bound charges, the energy level alignment of the n-doping organic semiconductor can be described by combining integer charger transfer-induced shifts with a so-called double-dipole step. At high doping levels, significant densities of free charges are generated and the charge flows between the organic film and the conducting electrodes equilibrating the Fermi level in a classic "depletion layer" scheme. Moreover, we demonstrate that the model holds for both n- and p-doping of π-backbone molecules and polymers. With the results, we provide wide guidance for identifying the application of the current organic n-type doping technology in organic electronics.

A molecularly based theory for electron transfer reorganization energy.

PubMed

Zhuang, Bilin; Wang, Zhen-Gang

2015-12-14

Using field-theoretic techniques, we develop a molecularly based dipolar self-consistent-field theory (DSCFT) for charge solvation in pure solvents under equilibrium and nonequilibrium conditions and apply it to the reorganization energy of electron transfer reactions. The DSCFT uses a set of molecular parameters, such as the solvent molecule's permanent dipole moment and polarizability, thus avoiding approximations that are inherent in treating the solvent as a linear dielectric medium. A simple, analytical expression for the free energy is obtained in terms of the equilibrium and nonequilibrium electrostatic potential profiles and electric susceptibilities, which are obtained by solving a set of self-consistent equations. With no adjustable parameters, the DSCFT predicts activation energies and reorganization energies in good agreement with previous experiments and calculations for the electron transfer between metallic ions. Because the DSCFT is able to describe the properties of the solvent in the immediate vicinity of the charges, it is unnecessary to distinguish between the inner-sphere and outer-sphere solvent molecules in the calculation of the reorganization energy as in previous work. Furthermore, examining the nonequilibrium free energy surfaces of electron transfer, we find that the nonequilibrium free energy is well approximated by a double parabola for self-exchange reactions, but the curvature of the nonequilibrium free energy surface depends on the charges of the electron-transferring species, contrary to the prediction by the linear dielectric theory.

Theory of nanotube faraday cage

NASA Astrophysics Data System (ADS)

Roxana Margine, Elena; Nisoli, Cristiano; Kolmogorov, Aleksey; Crespi, Vincent H.

2003-03-01

Charge transfer between dopants and double-wall carbon nanotubes is examined theoretically. We model the system as a triple cylindrical capacitor with the dopants forming a shell around the outer wall of the nanotube. The total energy of the system contains three terms: the band structure energies of the inner and outer tube, calculated in a tight-binding model with rigid bands, and the electrostatic energy of the tri-layer distribution. Even for metallic inner and outer tube walls, wherein the diameter dependence of the bandgap does not favor the outer wall, nearly all of the dopant charge resides on the outer layer, a nanometer-scale Faraday cage. The calculated charge distribution is in agreement with recent experimental measurements.

Diffuse charge and Faradaic reactions in porous electrodes

NASA Astrophysics Data System (ADS)

Biesheuvel, P. M.; Fu, Yeqing; Bazant, Martin Z.

2011-06-01

Porous electrodes instead of flat electrodes are widely used in electrochemical systems to boost storage capacities for ions and electrons, to improve the transport of mass and charge, and to enhance reaction rates. Existing porous electrode theories make a number of simplifying assumptions: (i) The charge-transfer rate is assumed to depend only on the local electrostatic potential difference between the electrode matrix and the pore solution, without considering the structure of the double layer (DL) formed in between; (ii) the charge-transfer rate is generally equated with the salt-transfer rate not only at the nanoscale of the matrix-pore interface, but also at the macroscopic scale of transport through the electrode pores. In this paper, we extend porous electrode theory by including the generalized Frumkin-Butler-Volmer model of Faradaic reaction kinetics, which postulates charge transfer across the molecular Stern layer located in between the electron-conducting matrix phase and the plane of closest approach for the ions in the diffuse part of the DL. This is an elegant and purely local description of the charge-transfer rate, which self-consistently determines the surface charge and does not require consideration of reference electrodes or comparison with a global equilibrium. For the description of the DLs, we consider the two natural limits: (i) the classical Gouy-Chapman-Stern model for thin DLs compared to the macroscopic pore dimensions, e.g., for high-porosity metallic foams (macropores >50 nm) and (ii) a modified Donnan model for strongly overlapping DLs, e.g., for porous activated carbon particles (micropores <2 nm). Our theory is valid for electrolytes where both ions are mobile, and it accounts for voltage and concentration differences not only on the macroscopic scale of the full electrode, but also on the local scale of the DL. The model is simple enough to allow us to derive analytical approximations for the steady-state and early transients. We also present numerical solutions to validate the analysis and to illustrate the evolution of ion densities, pore potential, surface charge, and reaction rates in response to an applied voltage.

Adsorption and oxidation of oxalic acid on anatase TiO2 (001) surface: A density functional theory study.

PubMed

Sun, Tao; Wang, Yun; Zhang, Haimin; Liu, Porun; Zhao, Huijun

2015-09-15

Anatase TiO2 (001) surfaces have attracted great interest for photo-degradation of organic species recently due to their high reactivity. In this work, adsorption properties and oxidation mechanisms of oxalic acid on the anatase TiO2 (001) surface have been theoretically investigated using the first-principles density functional theory. Various possible adsorption configurations are considered by diversifying the connectivity of carboxylic groups with the surface. It is found that the adsorption of oxalic acid on the anatase (001) surface prefer the dissociative states. A novel double-bidentate configuration has been found due to the structural match between oxalic acid and the (001) surface. More charge is transferred from the adsorbed oxalic acid to the surface with the double-bidentate configuration when comparing with other adsorption structures. Thus, there is a positive correlation relationship between the transferred charge amount and the interfacial bond numbers when oxalic acid adsorbs on the anatase TiO2 (001) surface. The adsorption energies with dispersion corrections have demonstrated that the van der Waals interactions play an important role in the adsorption, especially when adsorbates are close to the surface. Copyright © 2015 Elsevier Inc. All rights reserved.

On Practical Charge Injection at the Metal/Organic Semiconductor Interface

PubMed Central

Kumatani, Akichika; Li, Yun; Darmawan, Peter; Minari, Takeo; Tsukagoshi, Kazuhito

2013-01-01

We have revealed practical charge injection at metal and organic semiconductor interface in organic field effect transistor configurations. We have developed a facile interface structure that consisted of double-layer electrodes in order to investigate the efficiency through contact metal dependence. The metal interlayer with few nanometers thickness between electrode and organic semiconductor drastically reduces the contact resistance at the interface. The improvement has clearly obtained when the interlayer is a metal with lower standard electrode potential of contact metals than large work function of the contact metals. The electrode potential also implies that the most dominant effect on the mechanism at the contact interface is induced by charge transfer. This mechanism represents a step forward towards understanding the fundamental physics of intrinsic charge injection in all organic devices. PMID:23293741

Performance of Liquid Phase Exfoliated Graphene As Electrochemical Double Layer Capacitors Electrodes

NASA Astrophysics Data System (ADS)

Huffstutler, Jacob; Wasala, Milinda; Richie, Julianna; Winchester, Andrew; Ghosh, Sujoy; Kar, Swastik; Talapatra, Saikat

2014-03-01

We will present the results of our investigations of electrochemical double layer capacitors (EDLCs) or supercapacitors (SC) fabricated using liquid-phase exfoliated graphene. Several electrolytes, such as aqueous potassium hydroxide KOH (6M), ionic 1-Butyl-3-methylimidazolium hexafluorophosphate [BMIM][PF6], and ionic 1-butyl-1-methylpyrrolidinium tris(pentafluoroethyl)trifluorophosphate[BMP][FAP] were used. These EDLC's show good performance compared to other carbon nanomaterials based EDLC's devices. We found that the liquid phase exfoliated graphene based devices possess specific capacitance values as high as 262 F/g, when used with ionic liquid electrolyte[BMP][FAP], with power densities (~ 454 W/kg) and energy densities (~ 0.38Wh/kg). Further, these devices indicated rapid charge transfer response even without the use of any binders or specially prepared current collectors. A detailed electrochemical impedance spectroscopy analysis in order to understand the phenomenon of charge storage in these materials will be presented.

Active latent heat storage with a screw heat exchanger - experimental results for heat transfer and concept for high pressure steam

NASA Astrophysics Data System (ADS)

Zipf, Verena; Willert, Daniel; Neuhäuser, Anton

2016-05-01

An innovative active latent heat storage concept was invented and developed at Fraunhofer ISE. It uses a screw heat exchanger (SHE) for the phase change during the transport of a phase change material (PCM) from a cold to a hot tank or vice versa. This separates heat transfer and storage tank in comparison to existing concepts. A test rig has been built in order to investigate the heat transfer coefficients of the SHE during melting and crystallization of the PCM. The knowledge of these characteristics is crucial in order to assess the performance of the latent heat storage in a thermal system. The test rig contains a double shafted SHE, which is heated or cooled with thermal oil. The overall heat transfer coefficient U and the convective heat transfer coefficient on the PCM side hPCM both for charging and discharging have been calculated based on the measured data. For charging, the overall heat transfer coefficient in the tested SHE was Uch = 308 W/m2K and for discharging Udis = 210 W/m2K. Based on the values for hPCM the overall heat transfer coefficients for a larger SHE with steam as heat transfer fluid and an optimized geometry were calculated with Uch = 320 W/m2K for charging and Udis = 243 W/m2K for discharging. For pressures as high as p = 100 bar, an SHE concept has been developed, which uses an organic fluid inside the flight of the SHE as working media. With this concept, the SHE can also be deployed for very high pressure, e.g. as storage in solar thermal power plants.

A new type of high energy asymmetric capacitor with nanoporous carbon electrodes in aqueous electrolyte

NASA Astrophysics Data System (ADS)

Khomenko, V.; Raymundo-Piñero, E.; Béguin, F.

A new type of low cost and high energy asymmetric capacitor based on only activated carbons for both electrodes has been developed in a safe and environment friendly aqueous electrolyte. In such electrolyte, the charges are stored in the electrical double-layer and through fast faradaic charge transfer processes. By taking profit of different redox reactions occurring in the positive and negative ranges of potential, it is possible to optimize the capacitor either by balancing the mass of the electrodes or by using different optimized carbons for the positive and negative electrodes. The best results are obtained in the latter case, by utilizing different pseudo-faradaic properties of carbons in order to increase the capacitance and to shift the potentials of water decomposition and destructive oxidation of activated carbon to more negative and positive values, respectively. After an additional adjustment of potentials by mass-balancing the two electrodes, the electrochemical capacitor can be reversibly charged/discharged at 1.6 V in aqueous medium, with energy densities close to the values obtained with electrical double-layer capacitors working in organic electrolytes, while avoiding their disadvantages.

Applications of Charge Transfer Devices in Spectroscopy.

DTIC Science & Technology

1988-02-04

Langmuir - Blodgett films deposited on glass and silicon substrates. A direct comparison by Pemberton and Sobocinski (18) of the Raman spectra obtained...wavelength. The measurements are then repeated with an uncoated sheet of poly - ester serving as the reference blank. The double monochromator...give the best sensitivity at trace concentration levels. The less intense lines resulting from non-reson- -’ ance and ionic transitions are used for

Ultrafast Spectroscopy Reveals Electron-Transfer Cascade That Improves Hydrogen Evolution with Carbon Nitride Photocatalysts.

PubMed

Corp, Kathryn L; Schlenker, Cody W

2017-06-14

Solar hydrogen generation from water represents a compelling component of a future sustainable energy portfolio. Recently, chemically robust heptazine-based polymers known as graphitic carbon nitrides (g-C 3 N 4 ) have emerged as promising photocatalysts for hydrogen evolution using visible light while withstanding harsh chemical environments. However, since g-C 3 N 4 electron-transfer dynamics are poorly understood, rational design rules for improving activity remain unclear. Here, we use visible and near-infrared femtosecond transient absorption (TA) spectroscopy to reveal an electron-transfer cascade that correlates with a near-doubling in photocatalytic activity from 2050 to 3810 μmol h -1 g -1 when we infuse a suspension of bulk g-C 3 N 4 with 10% mass loading of chemically exfoliated carbon nitride. TA spectroscopy indicates that exfoliated carbon nitride quenches photogenerated electrons on g-C 3 N 4 at rates approaching the molecular diffusion limit. The TA signal for photogenerated electrons on g-C 3 N 4 decays with a time constant of 1/k e ' = 660 ps in the mixture versus 1/k e = 4.1 ns in g-C 3 N 4 alone. Our TA measurements suggest that the charge generation efficiency in g-C 3 N 4 is greater than 65%. Exfoliated carbon nitride, which liberates only trace hydrogen levels when photoexcited directly, does not appear to independently sustain appreciable long-lived charge generation. Thus, the activity enhancement in the two-component infusion evidently results from a cooperative effect in which charge is generated on g-C 3 N 4 , followed by electron transfer to exfoliated carbon nitride containing photocatalytic chain terminations. This correlation between electron transfer and photocatalytic activity provides new insight into structural modifications for controlling charge separation dynamics and activity of carbon-based photocatalysts.

A pair natural orbital implementation of the coupled cluster model CC2 for excitation energies.

PubMed

Helmich, Benjamin; Hättig, Christof

2013-08-28

We demonstrate how to extend the pair natural orbital (PNO) methodology for excited states, presented in a previous work for the perturbative doubles correction to configuration interaction singles (CIS(D)), to iterative coupled cluster methods such as the approximate singles and doubles model CC2. The original O(N(5)) scaling of the PNO construction is reduced by using orbital-specific virtuals (OSVs) as an intermediate step without spoiling the initial accuracy of the PNO method. Furthermore, a slower error convergence for charge-transfer states is analyzed and resolved by a numerical Laplace transformation during the PNO construction, so that an equally accurate treatment of local and charge-transfer excitations is achieved. With state-specific truncated PNO expansions, the eigenvalue problem is solved by combining the Davidson algorithm with deflation to project out roots that have already been determined and an automated refresh with a generation of new PNOs to achieve self-consistency of the PNO space. For a large test set, we found that truncation errors for PNO-CC2 excitation energies are only slightly larger than for PNO-CIS(D). The computational efficiency of PNO-CC2 is demonstrated for a large organic dye, where a reduction of the doubles space by a factor of more than 1000 is obtained compared to the canonical calculation. A compression of the doubles space by a factor 30 is achieved by a unified OSV space only. Moreover, calculations with the still preliminary PNO-CC2 implementation on a series of glycine oligomers revealed an early break even point with a canonical RI-CC2 implementation between 100 and 300 basis functions.

Mesoporous nanocrystalline film architecture for capacitive storage devices

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dunn, Bruce S.; Tolbert, Sarah H.; Wang, John

A mesoporous, nanocrystalline, metal oxide construct particularly suited for capacitive energy storage that has an architecture with short diffusion path lengths and large surface areas and a method for production are provided. Energy density is substantially increased without compromising the capacitive charge storage kinetics and electrode demonstrates long term cycling stability. Charge storage devices with electrodes using the construct can use three different charge storage mechanisms immersed in an electrolyte: (1) cations can be stored in a thin double layer at the electrode/electrolyte interface (non-faradaic mechanism); (2) cations can interact with the bulk of an electroactive material which then undergoesmore » a redox reaction or phase change, as in conventional batteries (faradaic mechanism); or (3) cations can electrochemically adsorb onto the surface of a material through charge transfer processes (faradaic mechanism).« less

“Capacitive Sensor” to Measure Flow Electrification and Prevent Electrostatic Hazards

PubMed Central

Paillat, Thierry; Touchard, Gerard; Bertrand, Yves

2012-01-01

At a solid/liquid interface, physico-chemical phenomena occur that lead to the separation of electrical charges, establishing a zone called electrical double layer. The convection of one part of these charges by the liquid flow is the cause of the flow electrification phenomenon which is suspected of being responsible of incidents in the industry. The P' Institute of Poitiers University and CNRS has developed an original sensor called “capacitive sensor” that allows the characterization of the mechanisms involved in the generation, accumulation and transfer of charges. As an example, this sensor included in the design of high power transformers, could easily show the evolution of electrostatic charge generation developed during the operating time of the transformer and, therefore, point out the operations leading to electrostatic hazards and, then, monitor the transformer to prevent such risks. PMID:23202162

Optimization design of wireless charging system for autonomous robots based on magnetic resonance coupling

NASA Astrophysics Data System (ADS)

Wang, Junhua; Hu, Meilin; Cai, Changsong; Lin, Zhongzheng; Li, Liang; Fang, Zhijian

2018-05-01

Wireless charging is the key technology to realize real autonomy of mobile robots. As the core part of wireless power transfer system, coupling mechanism including coupling coils and compensation topology is analyzed and optimized through simulations, to achieve stable and practical wireless charging suitable for ordinary robots. Multi-layer coil structure, especially double-layer coil is explored and selected to greatly enhance coupling performance, while shape of ferrite shielding goes through distributed optimization to guarantee coil fault tolerance and cost effectiveness. On the basis of optimized coils, primary compensation topology is analyzed to adopt composite LCL compensation, to stabilize operations of the primary side under variations of mutual inductance. Experimental results show the optimized system does make sense for wireless charging application for robots based on magnetic resonance coupling, to realize long-term autonomy of robots.

Can direct electron detectors outperform phosphor-CCD systems for TEM?

NASA Astrophysics Data System (ADS)

Moldovan, G.; Li, X.; Kirkland, A.

2008-08-01

A new generation of imaging detectors is being considered for application in TEM, but which device architectures can provide the best images? Monte Carlo simulations of the electron-sensor interaction are used here to calculate the expected modulation transfer of monolithic active pixel sensors (MAPS), hybrid active pixel sensors (HAPS) and double sided Silicon strip detectors (DSSD), showing that ideal and nearly ideal transfer can be obtained using DSSD and MAPS sensors. These results highly recommend the replacement of current phosphor screen and charge coupled device imaging systems with such new directly exposed position sensitive electron detectors.

Specialized CCDs for high-frame-rate visible imaging and UV imaging applications

NASA Astrophysics Data System (ADS)

Levine, Peter A.; Taylor, Gordon C.; Shallcross, Frank V.; Tower, John R.; Lawler, William B.; Harrison, Lorna J.; Socker, Dennis G.; Marchywka, Mike

1993-11-01

This paper reports recent progress by the authors in two distinct charge coupled device (CCD) technology areas. The first technology area is high frame rate, multi-port, frame transfer imagers. A 16-port, 512 X 512, split frame transfer imager and a 32-port, 1024 X 1024, split frame transfer imager are described. The thinned, backside illuminated devices feature on-chip correlated double sampling, buried blooming drains, and a room temperature dark current of less than 50 pA/cm2, without surface accumulation. The second technology area is vacuum ultraviolet (UV) frame transfer imagers. A developmental 1024 X 640 frame transfer imager with 20% quantum efficiency at 140 nm is described. The device is fabricated in a p-channel CCD process, thinned for backside illumination, and utilizes special packaging to achieve stable UV response.

Concentration polarization-based nonlinear electrokinetics in porous media: induced-charge electroosmosis.

PubMed

Leinweber, Felix C; Tallarek, Ulrich

2005-11-24

We have investigated induced-charge electroosmotic flow in a fixed bed of ion-permselective glass beads by quantitative confocal laser scanning microscopy. Externally applied electrical fields induce concentration polarization (CP) in the porous medium due to coupled mass and charge transport normal to the charge-selective interfaces. These data reveal the generation of a nonequilibrium electrical double layer in the depleted CP zones and the adjoining anodic hemispheres of the (cation-selective) glass beads above a critical field strength. This initiates CP-based induced-charge electroosmosis along curved interfaces of the quasi-electroneutral macropore space between glass beads. Caused by mutual interference of resulting nonlinear flow with (flow-inducing) space charge regions, an electrohydrodynamic instability can appear locally and realize turbulent flow behavior at low Reynolds numbers. It is characterized by a local destruction of the CP zones and concomitant removal of diffusion-limited mass transfer. More efficient pore-scale lateral mixing also improves macroscopic transport, which is reflected in the significantly reduced axial dispersion of a passive tracer.

Investigation of Charge Transfer Kinetics at Carbon/Hydroquinone Interfaces for Redox-Active-Electrolyte Supercapacitors.

PubMed

Park, Jinwoo; Kumar, Vipin; Wang, Xu; Lee, Pooi See; Kim, Woong

2017-10-04

The redox-active electrolyte supercapacitor (RAES) is a relatively new type of energy storage device. Simple addition of selected redox species in the electrolyte can greatly enhance the energy density of supercapacitors relative to traditional electric double layer capacitors (EDLCs) owing to redox reactions. Studies on the kinetics at the interface of the electrode and redox mediator are important when developing RAESs. In this work, we employ highly accurate scanning electrochemical microscopy (SECM) to extract the kinetic constants at carbon/hydroquinone interfaces. The charge transfer rate constants are 1.2 × 10 -2 and 1.3 × 10 -2 cm s -1 for the carbon nanotube/hydroquinone and reduced graphene oxide/hydroquinone interfaces, respectively. These values are higher than those obtained by the conventional cyclic voltammetry method, approximately by an order of magnitude. The evaluation of heterogeneous rate constants with SECM would be the cornerstone for understanding and developing high performance RAESs.

Towards a model of pion generalized parton distributions from Dyson-Schwinger equations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moutarde, H.

2015-04-10

We compute the pion quark Generalized Parton Distribution H{sup q} and Double Distributions F{sup q} and G{sup q} in a coupled Bethe-Salpeter and Dyson-Schwinger approach. We use simple algebraic expressions inspired by the numerical resolution of Dyson-Schwinger and Bethe-Salpeter equations. We explicitly check the support and polynomiality properties, and the behavior under charge conjugation or time invariance of our model. We derive analytic expressions for the pion Double Distributions and Generalized Parton Distribution at vanishing pion momentum transfer at a low scale. Our model compares very well to experimental pion form factor or parton distribution function data.

Theoretical explanation of spin-Hamiltonian parameters and local structure for the orthorhombic MnO2 -4 clusters in K2CrO4 : Mn6 + crystal

NASA Astrophysics Data System (ADS)

Wang, Ning; Xie, Linhua

2017-12-01

In this paper, the spin-Hamiltonian parameters (g factors gx, gy, gz and hyperfine structure constants A Ax, Ay, Az) and the absorption spectrum of K2CrO4 : Mn6 + crystal are theoretically explained by using the high-order perturbation theory, the double-spin-orbit-coupling model theory and the double-mechanism theory (the crystal field mechanism and the charge-transfer (CT) mechanism). The calculation results show that the contribution of the CT mechanism cannot be neglected for Mn6 + ions in orthorhombic clusters with the ground state ?.

Charge Transfer Rate in Collisions of H + Ions with Si Atoms

NASA Astrophysics Data System (ADS)

Kimura, M.; Sannigrahi, A. B.; Gu, J. P.; Hirsch, G.; Buenker, R. J.; Shimamura, I.

1996-12-01

Charge transfer in Si(3P, 1D) + H+ collisions is studied theoretically by using a semiclassical molecular representation with six molecular channels for the triplet manifold and four channels for the singlet manifold at collision energies above 30 eV, and by using a fully quantum mechanical approach with two molecular channels for both triplet and singlet manifolds below 30 eV. The ab initio potential curves and nonadiabatic coupling matrix elements for the HSi+ system are obtained from multireference single- and double-excitation configuration interaction (MRD-CI) calculations employing a relatively large basis set. The present rate coefficients for charge transfer to Si+(4P) formation resulting from H+ + Si(3P) collisions are found to be large with values from 1 x 10-10 cm-3 s-1 at 1000 K to 1 x 10-8 cm-3 s-1 at 100,000 K. The rate coefficient for Si+(2P) formation, resulting from H+ + Si(3P) collisions, is found to be much smaller because of a larger energy defect from the initial state. These calculated rates are much larger than those reported by Baliunas & Butler, who estimated a value of 10-11 cm-3 s-1 in their coronal plasma study. The present result may be relevant to the description of the silicon ionization equilibrium.

Magnetic circular dichroism of UCl 6– in the ligand-to-metal charge-transfer spectral region

DOE PAGES

Gendron, Frederic; Fleischauer, Valerie R.; Duignan, Thomas J.; ...

2017-06-23

Here, we present a combined ab initio theoretical and experimental study of the magnetic circular dichroism (MCD) spectrum of the octahedral UCl 6- complex ion in the UV-Vis spectral region. The ground state is an orbitally non-degenerate doublet E 5/2u and the MCD is a $C$-term spectrum caused by spin–orbit coupling. Calculations of the electronic spectrum at various levels of theory indicate that differential dynamic electron correlation has a strong influence on the energies of the dipole-allowed transitions and the envelope of the MCD spectrum. The experimentally observed bands are assigned to dipole-allowed ligand-to-metal charge transfer into the 5f shell,more » and 5f to 6d transitions. Charge transfer excitations into the U 6d shell appear at much higher energies. The MCD-allowed transitions can be assigned via their signs of the $C$-terms: Under O h double group symmetry, E 5/2u → E 5/2g transitions have negative $C$-terms whereas E 5/2u → F 3/2g transitions have positive $C$-terms if the ground state g-factor is negative, as it is the case for UCl 6-.« less

Operation of a quantum dot in the finite-state machine mode: Single-electron dynamic memory

DOE Office of Scientific and Technical Information (OSTI.GOV)

Klymenko, M. V.; Klein, M.; Levine, R. D.

2016-07-14

A single electron dynamic memory is designed based on the non-equilibrium dynamics of charge states in electrostatically defined metallic quantum dots. Using the orthodox theory for computing the transfer rates and a master equation, we model the dynamical response of devices consisting of a charge sensor coupled to either a single and or a double quantum dot subjected to a pulsed gate voltage. We show that transition rates between charge states in metallic quantum dots are characterized by an asymmetry that can be controlled by the gate voltage. This effect is more pronounced when the switching between charge states correspondsmore » to a Markovian process involving electron transport through a chain of several quantum dots. By simulating the dynamics of electron transport we demonstrate that the quantum box operates as a finite-state machine that can be addressed by choosing suitable shapes and switching rates of the gate pulses. We further show that writing times in the ns range and retention memory times six orders of magnitude longer, in the ms range, can be achieved on the double quantum dot system using experimentally feasible parameters, thereby demonstrating that the device can operate as a dynamic single electron memory.« less

[Effect of Charge-Transfer Complex on Ultraviolet-Visible (UV-Vis) Absorption Property of Chromophoric Dissolved Organic Matter (CDOM) in Waters of Typical Water-Level Fluctuation Zones of the Three Gorges Reservoir Areas].

PubMed

Jiang, Tao; Liang, Jian; Zhang, Mu-xue; Wang, Ding-yong; Wei, Shi-qiang; Lu, Song

2016-02-15

As an important fraction of dissolved organic matter (DOM), chromophoric dissolved organic matter (CDOM) plays a key role in decision of the optical properties and photogeochemistry of DOM, and further affects pollutant fate and global carbon cycle. These optical properties are ascribed to two chromophoric systems including superposition of individual chromophores and charge-transfer (CT) complexation between electron donor (e.g., phenols and indoles) and acceptor (e.g., quinones and other oxidized aromatics) in DOM structures. Thus in this study, based on the "double-chromophoric system" model, DOM samples from four typical water-level fluctuation zones of Three Gorges Reservoir (TGR) areas were selected, to investigate the effect and contribution of charge-transfer complex to ultraviolet-visible (UV-Vis) absorption property of CDOM. Using NaBH, reduction method, original featureless absorption curve was classified into two independent curves caused by individual chromophoric group, which were derived from a simple superposition of independent chromophore and charge-transfer complex, respectively. Also, the changes in curve properties and specific parameters before and after NaBH4 reduction were compared. The results showed that in all DOM samples from the four sites of TGR, more than 35% of absorption was attributed from CT complex. Shibaozhai of Zhongxian and Zhenxi of Fuling showed the highest proportion ( > 50%). It suggested that the role of CT complex in CDOM property could not be neglected. After removal of CT complex, absorption curve showed blue-shift and CDOM concentration [a (355)] decreased significantly. Meanwhile, because of deforming of bonds by reduction, DOM structures became more dispersive and the molecular size was decreased, resulting in the lower spectral slope (S) observed, which evidentially supported that the supermolecular association structure of DOM was self-assembled through CT complex. Meanwhile, deceasing hydrophobic components led to decreased apparent aromaticity (lower SUVA values), whereas specific parameters including SUVA, CDOM and SR still were applicable for comparison among different DOM samples instead of the same sample without consideration of "double-cbromopboric system" model involving tbe role of CT complex. Comparatively, S(275-295) was dynamic due to tbe impact of CT effect. Furtbermore, establisbing DOC estimation model by short-wavelength range of CDOM was recommended because of its stability despite of CT complex.

Antineutrino Charged-Current Reactions on Hydrocarbon with Low Momentum Transfer

NASA Astrophysics Data System (ADS)

Gran, R.; Betancourt, M.; Elkins, M.; Rodrigues, P. A.; Akbar, F.; Aliaga, L.; Andrade, D. A.; Bashyal, A.; Bellantoni, L.; Bercellie, A.; Bodek, A.; Bravar, A.; Budd, H.; Vera, G. F. R. Caceres; Cai, T.; Carneiro, M. F.; Coplowe, D.; da Motta, H.; Dytman, S. A.; Díaz, G. A.; Felix, J.; Fields, L.; Fine, R.; Gallagher, H.; Ghosh, A.; Haider, H.; Han, J. Y.; Harris, D. A.; Henry, S.; Jena, D.; Kleykamp, J.; Kordosky, M.; Le, T.; Leistico, J. R.; Lovlein, A.; Lu, X.-G.; Maher, E.; Manly, S.; Mann, W. A.; Marshall, C. M.; McFarland, K. S.; McGowan, A. M.; Messerly, B.; Miller, J.; Mislivec, A.; Morfín, J. G.; Mousseau, J.; Naples, D.; Nelson, J. K.; Nguyen, C.; Norrick, A.; Nuruzzaman, Olivier, A.; Paolone, V.; Patrick, C. E.; Perdue, G. N.; Ramírez, M. A.; Ransome, R. D.; Ray, H.; Ren, L.; Rimal, D.; Ruterbories, D.; Schellman, H.; Salinas, C. J. Solano; Su, H.; Sultana, M.; Falero, S. Sánchez; Valencia, E.; Wolcott, J.; Wospakrik, M.; Yaeggy, B.; Minerva Collaboration

2018-06-01

We report on multinucleon effects in low momentum transfer (<0.8 GeV /c ) antineutrino interactions on plastic (CH) scintillator. These data are from the 2010-2011 antineutrino phase of the MINERvA experiment at Fermilab. The hadronic energy spectrum of this inclusive sample is well described when a screening effect at a low energy transfer and a two-nucleon knockout process are added to a relativistic Fermi gas model of quasielastic, Δ resonance, and higher resonance processes. In this analysis, model elements introduced to describe previously published neutrino results have quantitatively similar benefits for this antineutrino sample. We present the results as a double-differential cross section to accelerate the investigation of alternate models for antineutrino scattering off nuclei.

Antineutrino Charged-Current Reactions on Hydrocarbon with Low Momentum Transfer.

PubMed

Gran, R; Betancourt, M; Elkins, M; Rodrigues, P A; Akbar, F; Aliaga, L; Andrade, D A; Bashyal, A; Bellantoni, L; Bercellie, A; Bodek, A; Bravar, A; Budd, H; Vera, G F R Caceres; Cai, T; Carneiro, M F; Coplowe, D; da Motta, H; Dytman, S A; Díaz, G A; Felix, J; Fields, L; Fine, R; Gallagher, H; Ghosh, A; Haider, H; Han, J Y; Harris, D A; Henry, S; Jena, D; Kleykamp, J; Kordosky, M; Le, T; Leistico, J R; Lovlein, A; Lu, X-G; Maher, E; Manly, S; Mann, W A; Marshall, C M; McFarland, K S; McGowan, A M; Messerly, B; Miller, J; Mislivec, A; Morfín, J G; Mousseau, J; Naples, D; Nelson, J K; Nguyen, C; Norrick, A; Nuruzzaman; Olivier, A; Paolone, V; Patrick, C E; Perdue, G N; Ramírez, M A; Ransome, R D; Ray, H; Ren, L; Rimal, D; Ruterbories, D; Schellman, H; Salinas, C J Solano; Su, H; Sultana, M; Falero, S Sánchez; Valencia, E; Wolcott, J; Wospakrik, M; Yaeggy, B

2018-06-01

We report on multinucleon effects in low momentum transfer (<0.8  GeV/c) antineutrino interactions on plastic (CH) scintillator. These data are from the 2010-2011 antineutrino phase of the MINERvA experiment at Fermilab. The hadronic energy spectrum of this inclusive sample is well described when a screening effect at a low energy transfer and a two-nucleon knockout process are added to a relativistic Fermi gas model of quasielastic, Δ resonance, and higher resonance processes. In this analysis, model elements introduced to describe previously published neutrino results have quantitatively similar benefits for this antineutrino sample. We present the results as a double-differential cross section to accelerate the investigation of alternate models for antineutrino scattering off nuclei.

Quantifying Environmental Effects on the Decay of Hole Transfer Couplings in Biosystems.

PubMed

Ramos, Pablo; Pavanello, Michele

2014-06-10

In the past two decades, many research groups worldwide have tried to understand and categorize simple regimes in the charge transfer of such biological systems as DNA. Theoretically speaking, the lack of exact theories for electron-nuclear dynamics on one side and poor quality of the parameters needed by model Hamiltonians and nonadiabatic dynamics alike (such as couplings and site energies) on the other are the two main difficulties for an appropriate description of the charge transfer phenomena. In this work, we present an application of a previously benchmarked and linear-scaling subsystem density functional theory (DFT) method for the calculation of couplings, site energies, and superexchange decay factors (β) of several biological donor-acceptor dyads, as well as double stranded DNA oligomers composed of up to five base pairs. The calculations are all-electron and provide a clear view of the role of the environment on superexchange couplings in DNA-they follow experimental trends and confirm previous semiempirical calculations. The subsystem DFT method is proven to be an excellent tool for long-range, bridge-mediated coupling and site energy calculations of embedded molecular systems.

Electrosorption capacitance of nanostructured carbon-based materials.

PubMed

Hou, Chia-Hung; Liang, Chengdu; Yiacoumi, Sotira; Dai, Sheng; Tsouris, Costas

2006-10-01

The fundamental mechanism of electrosorption of ions developing a double layer inside nanopores was studied via a combination of experimental and theoretical studies. A novel graphitized-carbon monolithic material has proven to be a good electrical double-layer capacitor that can be applied in the separation of ions from aqueous solutions. An extended electrical double-layer model indicated that the pore size distribution plays a key role in determining the double-layer capacitance in an electrosorption process. Because of the occurrence of double-layer overlapping in narrow pores, mesopores and micropores make significantly different contributions to the double-layer capacitance. Mesopores show good electrochemical accessibility. Micropores present a slow mass transfer of ions and a considerable loss of double-layer capacitance, associated with a shallow potential distribution inside pores. The formation of the diffuse layer inside the micropores determines the magnitude of the double-layer capacitance at low electrolyte concentrations and at conditions close to the point of zero charge of the material. The effect of the double-layer overlapping on the electrosorption capacitance can be reduced by increasing the pore size, electrolyte concentration, and applied potential. The results are relevant to water deionization.

Effects of convergent diffusion and charge transfer kinetics on the diffusion layer thickness of spherical micro- and nanoelectrodes.

PubMed

Molina, A; Laborda, E; González, J; Compton, R G

2013-05-21

Nuances of the linear diffusion layer approximation are examined for slow charge transfer reactions at (hemi)spherical micro- and nanoelectrodes. This approximation is widely employed in Electrochemistry to evaluate the extent of electrolyte solution perturbed by the electrode process, which is essential to the understanding of the effects arising from thin-layer diffusion, convergent diffusion, convection, coupled chemical reactions and the double layer. The concept was well established for fast charge transfer processes at macroelectrodes, but remains unclear under other conditions such that a thorough assessment of its meaning was necessary. In a previous publication [A. Molina, J. González, E. Laborda and R. G. Compton, Phys. Chem. Chem. Phys., 2013, 15, 2381-2388] we shed some light on the influence of the reversibility degree. In the present work, the meaning of the diffusion layer thickness is investigated when very small electrodes are employed and so the contribution of convergent diffusion to the mass transport is very important. An analytical expression is given to calculate the linear diffusion layer thickness at (hemi)spherical electrodes and its behaviour is studied for a wide range of conditions of reversibility (from reversible to fully-irreversible processes) and electrode size (from macro- to nano-electrodes). Rigorous analytical solutions are deduced for true concentration profiles, surface concentrations, linear diffusion layer thickness and current densities when a potential pulse is applied at (hemi)spherical electrodes. The expressions for the magnitudes mentioned above are valid for electrodes of any size (including (hemi)spherical nanoelectrodes) and for any degree of reversibility, provided that mass transport occurs exclusively via diffusion. The variation of the above with the electrode size, applied potential and charge transfer kinetics is studied.

X-ray Structure of a Hg 2+ Complex of Mercuric Reductase (MerA) and Quantum Mechanical/Molecular Mechanical Study of Hg 2+ Transfer between the C-Terminal and Buried Catalytic Site Cysteine Pairs

DOE PAGES

Lian, Peng; Guo, Hao-Bo; Riccardi, Demian; ...

2014-10-24

Here we report that mercuric reductase, MerA, is a key enzyme in bacterial mercury resistance. This homodimeric enzyme captures and reduces toxic Hg 2+ to Hg 0, which is relatively unreactive and can exit the cell passively. Prior to reduction, the Hg 2+ is transferred from a pair of cysteines (C558' and C559' using Tn501 numbering) at the C-terminus of one monomer to another pair of cysteines (C136 and C141) in the catalytic site of the other monomer. Here, we present the X-ray structure of the C-terminal Hg 2+ complex of the C136A/C141A double mutant of the Tn501 MerA catalyticmore » core and explore the molecular mechanism of this Hg transfer with quantum mechanical/molecular mechanical (QM/MM) calculations. The transfer is found to be nearly thermoneutral and to pass through a stable tricoordinated intermediate that is marginally less stable than the two end states. For the overall process, Hg 2+ is always paired with at least two thiolates and thus is present at both the C-terminal and catalytic binding sites as a neutral complex. Prior to Hg 2+ transfer, C141 is negatively charged. As Hg 2+ is transferred into the catalytic site, a proton is transferred from C136 to C559' while C558' becomes negatively charged, resulting in the net transfer of a negative charge over a distance of ~7.5 Å. Thus, the transport of this soft divalent cation is made energetically feasible by pairing a competition between multiple Cys thiols and/or thiolates for Hg 2+ with a competition between the Hg 2+ and protons for the thiolates.« less

Ultrathin Graphene Membranes as Flexible Electrodes for Electrochemical Double Layer Capacitors

NASA Astrophysics Data System (ADS)

Talapatra, Saikat; Kar, Swastik; Shah, Rakesh; Ghosh, Sujoy; An, Xiaohong; Simmons, Trevor; Washington, Morris; Nayak, Saroj

2010-03-01

We will present the results of our investigations of electrochemical double layer capacitors (EDLCs) or supercapacitors (SC) fabricated using graphene based ultra thin membranes. These EDLC's show far superior performance compared to other carbon nanomaterials based EDLC's devices. We found that the graphene based devices possess specific capacitance values as high as 120 F/g, with impressive power densities (˜105 kW/kg) and energy densities (˜9.2 Wh/kg). Further, these devices indicated rapid charge transfer response even without the use of any binders or specially prepared current collectors. Our ultracapacitors reflect a significant improvement over previously reported graphene-based ultracapacitors and are substantially better than those obtained with carbon nanotubes.

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

NASA Astrophysics Data System (ADS)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Frequency domain analysis of droplet-based electrostatic transducers

NASA Astrophysics Data System (ADS)

Allegretto, Graham; Dobashi, Yuta; Dixon, Katelyn; Wyss, Justin; Yao, Dickson; Madden, John D. W.

2018-07-01

Squeezing a water droplet between two electrodes can generate a potential difference by converting some of the mechanical energy in vibrations into electrical energy. By utilizing the high capacitance inherent to electric double layers, and the surface charging at a polymer/water interface, we demonstrate a sensor that generates up to 892 mV peak-to-peak between 1 and 100 Hz, in response to a 250 μm deformation. This frequency response is described and explained using a linearized model in which the interfacial charge acts as the priming voltage, removing the need for external charging normally required in capacitive generators. The model suggests how to design the cell for maximum power output and provides an intuitive understanding of the high pass nature of the sensor. It successfully predicts the point of maximum power transfer.

Antineutrino Charged-Current Reactions on Hydrocarbon with Low Momentum Transfer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gran, R.; Betancourt, M.; Elkins, M.

We report on multi-nucleon effects in low momentum transfer (more » $< 0.8$ GeV/c) anti-neutrino interactions on scintillator. These data are from the 2010-11 anti-neutrino phase of the MINERvA experiment at Fermilab. The hadronic energy spectrum of this inclusive sample is well-described when a screening effect at low energy transfer and a two-nucleon knockout process are added to a relativistic Fermi gas model of quasi-elastic, $$\\Delta$$ resonance, and higher resonance processes. In this analysis, model elements introduced to describe previously published neutrino results have quantitatively similar benefits for this anti-neutrino sample. We present the results as a double-differential cross section to accelerate investigation of alternate models for anti-neutrino scattering off nuclei.« less

Anti-Neutrino Charged-Current Reactions on Scintillator with Low Momentum Transfer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gran, R.; et al.

2018-03-25

We report on multi-nucleon effects in low momentum transfer (more » $< 0.8$ GeV/c) anti-neutrino interactions on scintillator. These data are from the 2010-11 anti-neutrino phase of the MINERvA experiment at Fermilab. The hadronic energy spectrum of this inclusive sample is well-described when a screening effect at low energy transfer and a two-nucleon knockout process are added to a relativistic Fermi gas model of quasi-elastic, $$\\Delta$$ resonance, and higher resonance processes. In this analysis, model elements introduced to describe previously published neutrino results have quantitatively similar benefits for this anti-neutrino sample. We present the results as a double-differential cross section to accelerate investigation of alternate models for anti-neutrino scattering off nuclei.« less

Anti-Neutrino Charged-Current Reactions on Scintillator with Low Momentum Transfer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gran, R.; et al.

2018-06-01

We report on multi-nucleon effects in low momentum transfer (more » $< 0.8$ GeV/c) anti-neutrino interactions on scintillator. These data are from the 2010-11 anti-neutrino phase of the MINERvA experiment at Fermilab. The hadronic energy spectrum of this inclusive sample is well-described when a screening effect at low energy transfer and a two-nucleon knockout process are added to a relativistic Fermi gas model of quasi-elastic, $$\\Delta$$ resonance, and higher resonance processes. In this analysis, model elements introduced to describe previously published neutrino results have quantitatively similar benefits for this anti-neutrino sample. We present the results as a double-differential cross section to accelerate investigation of alternate models for anti-neutrino scattering off nuclei.« less

Antineutrino Charged-Current Reactions on Hydrocarbon with Low Momentum Transfer

DOE PAGES

Gran, R.; Betancourt, M.; Elkins, M.; ...

2018-06-01

We report on multi-nucleon effects in low momentum transfer (more » $< 0.8$ GeV/c) anti-neutrino interactions on scintillator. These data are from the 2010-11 anti-neutrino phase of the MINERvA experiment at Fermilab. The hadronic energy spectrum of this inclusive sample is well-described when a screening effect at low energy transfer and a two-nucleon knockout process are added to a relativistic Fermi gas model of quasi-elastic, $$\\Delta$$ resonance, and higher resonance processes. In this analysis, model elements introduced to describe previously published neutrino results have quantitatively similar benefits for this anti-neutrino sample. We present the results as a double-differential cross section to accelerate investigation of alternate models for anti-neutrino scattering off nuclei.« less

Two Photon Absorption in a Novel Nano-optical Material Based on the Nonconjugated Conductive Polymer, Poly(beta-pinene)

NASA Astrophysics Data System (ADS)

Titus, Jitto; Thakur, Mrinal

2006-03-01

As recently reported, the electrical conductivity of the nonconjugated polymer, poly(beta-pinene) increases by more than ten orders of magnitude upon doping with iodine [1]. The FTIR, optical absorption and EPR measurements have shown that radical cations are formed upon doping and charge-transfer involving the isolated double-bond in poly(beta-pinene). In this report, exceptionally large two-photon absorption in iodine-doped poly(beta-pinene) will be discussed. The linear absorption spectrum of medium-doped poly(beta-pinene) have peaks at about 4 eV and 3.1 eV. The first peak is due to the radical cation and the second due to the charge-transfer between the double bond and the dopant. The two-photon absorption of the medium-doped polymer has been measured at 730-860 nm using open-aperture z-scan with 150 femtosecond pulses from a Ti:Sapphire laser. A two-photon peak at about 1.5 eV with a magnitude of more than 1 cm/MW has been observed. The large magnitude of the two-photon absorption coefficient which is proportional to the imaginary part of the third order susceptibility has been attributed to the special structure of the radical cation and the confinement within a sub-nanometer dimension. [1] Vippa, Rajagopalan and Thakur, J. Poly. Sci. Part B: Poly. Phys., 43, 3695 (2005).

Nonmetallic electronegativity equalization and point-dipole interaction model including exchange interactions for molecular dipole moments and polarizabilities.

PubMed

Smalø, Hans S; Astrand, Per-Olof; Jensen, Lasse

2009-07-28

The electronegativity equalization model (EEM) has been combined with a point-dipole interaction model to obtain a molecular mechanics model consisting of atomic charges, atomic dipole moments, and two-atom relay tensors to describe molecular dipole moments and molecular dipole-dipole polarizabilities. The EEM has been phrased as an atom-atom charge-transfer model allowing for a modification of the charge-transfer terms to avoid that the polarizability approaches infinity for two particles at infinite distance and for long chains. In the present work, these shortcomings have been resolved by adding an energy term for transporting charges through individual atoms. A Gaussian distribution is adopted for the atomic charge distributions, resulting in a damping of the electrostatic interactions at short distances. Assuming that an interatomic exchange term may be described as the overlap between two electronic charge distributions, the EEM has also been extended by a short-range exchange term. The result is a molecular mechanics model where the difference of charge transfer in insulating and metallic systems is modeled regarding the difference in bond length between different types of system. For example, the model is capable of modeling charge transfer in both alkanes and alkenes with alternating double bonds with the same set of carbon parameters only relying on the difference in bond length between carbon sigma- and pi-bonds. Analytical results have been obtained for the polarizability of a long linear chain. These results show that the model is capable of describing the polarizability scaling both linearly and nonlinearly with the size of the system. Similarly, a linear chain with an end atom with a high electronegativity has been analyzed analytically. The dipole moment of this model system can either be independent of the length or increase linearly with the length of the chain. In addition, the model has been parametrized for alkane and alkene chains with data from density functional theory calculations, where the polarizability behaves differently with the chain length. For the molecular dipole moment, the same two systems have been studied with an aldehyde end group. Both the molecular polarizability and the dipole moment are well described as a function of the chain length for both alkane and alkene chains demonstrating the power of the presented model.

Influence of the charge double layer on solid oxide fuel cell stack behavior

NASA Astrophysics Data System (ADS)

Whiston, Michael M.; Bilec, Melissa M.; Schaefer, Laura A.

2015-10-01

While the charge double layer effect has traditionally been characterized as a millisecond phenomenon, longer timescales may be possible under certain operating conditions. This study simulates the dynamic response of a previously developed solid oxide fuel cell (SOFC) stack model that incorporates the charge double layer via an equivalent circuit. The model is simulated under step load changes. Baseline conditions are first defined, followed by consideration of minor and major deviations from the baseline case. This study also investigates the behavior of the SOFC stack with a relatively large double layer capacitance value, as well as operation of the SOFC stack under proportional-integral (PI) control. Results indicate that the presence of the charge double layer influences the SOFC stack's settling time significantly under the following conditions: (i) activation and concentration polarizations are significantly increased, or (ii) a large value of the double layer capacitance is assumed. Under normal (baseline) operation, on the other hand, the charge double layer effect diminishes within milliseconds, as expected. It seems reasonable, then, to neglect the charge double layer under normal operation. However, careful consideration should be given to potential variations in operation or material properties that may give rise to longer electrochemical settling times.

Gate tunable parallel double quantum dots in InAs double-nanowire devices

NASA Astrophysics Data System (ADS)

Baba, S.; Matsuo, S.; Kamata, H.; Deacon, R. S.; Oiwa, A.; Li, K.; Jeppesen, S.; Samuelson, L.; Xu, H. Q.; Tarucha, S.

2017-12-01

We report fabrication and characterization of InAs nanowire devices with two closely placed parallel nanowires. The fabrication process we develop includes selective deposition of the nanowires with micron scale alignment onto predefined finger bottom gates using a polymer transfer technique. By tuning the double nanowire with the finger bottom gates, we observed the formation of parallel double quantum dots with one quantum dot in each nanowire bound by the normal metal contact edges. We report the gate tunability of the charge states in individual dots as well as the inter-dot electrostatic coupling. In addition, we fabricate a device with separate normal metal contacts and a common superconducting contact to the two parallel wires and confirm the dot formation in each wire from comparison of the transport properties and a superconducting proximity gap feature for the respective wires. With the fabrication techniques established in this study, devices can be realized for more advanced experiments on Cooper-pair splitting, generation of Parafermions, and so on.

Electrostatic interaction between an enzyme and electrodes in the electric double layer examined in a view of direct electron transfer-type bioelectrocatalysis.

PubMed

Sugimoto, Yu; Kitazumi, Yuki; Tsujimura, Seiya; Shirai, Osamu; Yamamoto, Masahiro; Kano, Kenji

2015-01-15

Effects of the electrode poential on the activity of an adsorbed enzyme has been examined by using copper efflux oxidase (CueO) as a model enzyme and by monitoring direct electron transfer (DET)-type bioelectrocatalysis of oxygen reduction. CueO adsorbed on bare Au electrodes at around the point of zero charge (E(pzc)) shows the highest DET activity, and the activity decreases as the adsorption potential (E(ad); at which the enzyme adsorbs) is far from E(pzc). We propose a model to explain the phenomena in which the electrostatic interaction between the enzyme and electrodes in the electric double layer affects the orientation and the stability of the adsorbed enzyme. The self-assembled monolayer of butanethiol on Au electrodes decreases the electric field in the outside of the inner Helmholtz plane and drastically diminishes the E(ad) dependence of the DET activity of CueO. When CueO is adsorbed on bare Au electrodes under open circuit potential and then is held at hold potentials (E(ho)) more positive than E(pzc), the DET activity of the CueO rapidly decreases with the hold time. The strong electric field with positive surface charge density on the metallic electrode (σ(M)) leads to fatal denaturation of the adsorbed CueO. Such denaturation effect is not so serious at E(ho)

Photon induced non-linear quantized double layer charging in quaternary semiconducting quantum dots.

PubMed

Nair, Vishnu; Ananthoju, Balakrishna; Mohapatra, Jeotikanta; Aslam, M

2018-03-15

Room temperature quantized double layer charging was observed in 2 nm Cu 2 ZnSnS 4 (CZTS) quantum dots. In addition to this we observed a distinct non-linearity in the quantized double layer charging arising from UV light modulation of double layer. UV light irradiation resulted in a 26% increase in the integral capacitance at the semiconductor-dielectric (CZTS-oleylamine) interface of the quantum dot without any change in its core size suggesting that the cause be photocapacitive. The increasing charge separation at the semiconductor-dielectric interface due to highly stable and mobile photogenerated carriers cause larger electrostatic forces between the quantum dot and electrolyte leading to an enhanced double layer. This idea was supported by a decrease in the differential capacitance possible due to an enhanced double layer. Furthermore the UV illumination enhanced double layer gives us an AC excitation dependent differential double layer capacitance which confirms that the charging process is non-linear. This ultimately illustrates the utility of a colloidal quantum dot-electrolyte interface as a non-linear photocapacitor. Copyright © 2017 Elsevier Inc. All rights reserved.

Electron capture in collisions of N^+ with H and H^+ with N

NASA Astrophysics Data System (ADS)

Lin, C. Y.; Stancil, P. C.; Gu, J. P.; Buenker, R. J.; Kimura, M.

2004-05-01

Charge transfer processes due to collisions of N^+ with atomic hydrogen and H^+ with atomic nitrogen are investigated using the quantum-mechanical molecular-orbital close-coupling (MOCC) method. The MOCC calculations utilize ab initio adiabatic potential curves and nonadiabatic radial and rotational coupling matrix elements obtained with the multireference single- and double-excitation configuration interaction approach. Total and state-selective cross sections for the energy range 0.1-500 eV/u will be presented and compared with existing experimental and theoretical data.

Graphene hydrogels deposited in nickel foams for high-rate electrochemical capacitors.

PubMed

Chen, Ji; Sheng, Kaixuan; Luo, Peihui; Li, Chun; Shi, Gaoquan

2012-08-28

Graphene hydrogel/nickel foam composite electrodes for high-rate electrochemical capacitors are produced by reduction of an aqueous dispersion of graphene oxide in a nickel foam (upper half of figure). The micropores of the hydrogel are exposed to the electrolyte so that ions can enter and form electrochemical double-layers. The nickel framework shortens the distances of charge transfer. Therefore, the electrochemical capacitor exhibits highrate performance (see plots). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Electrochemical Advanced Oxidation Process for Shipboard Final Purification of Filtered Black Water, Gray Water, and Bilge Water, Vol. 1

DTIC Science & Technology

2001-08-01

doped SnO2 developed by Memming and M`llers (1972) is most directly applicable to our electrodes. This model ignores the effect of ions in the...electron transfer model of Memming and M`llers (1972) with the surface charging/ ion complexation model of Davis et al. (1978). The combined model...model of Memming and M`llers. The model of Davis et al. represents the diffuse double layer by an analytical expression which describes only pure

Non-mean-field theory of anomalously large double layer capacitance

NASA Astrophysics Data System (ADS)

Loth, M. S.; Skinner, Brian; Shklovskii, B. I.

2010-07-01

Mean-field theories claim that the capacitance of the double layer formed at a metal/ionic conductor interface cannot be larger than that of the Helmholtz capacitor, whose width is equal to the radius of an ion. However, in some experiments the apparent width of the double layer capacitor is substantially smaller. We propose an alternate non-mean-field theory of the ionic double layer to explain such large capacitance values. Our theory allows for the binding of discrete ions to their image charges in the metal, which results in the formation of interface dipoles. We focus primarily on the case where only small cations are mobile and other ions form an oppositely charged background. In this case, at small temperature and zero applied voltage dipoles form a correlated liquid on both contacts. We show that at small voltages the capacitance of the double layer is determined by the transfer of dipoles from one electrode to the other and is therefore limited only by the weak dipole-dipole repulsion between bound ions so that the capacitance is very large. At large voltages the depletion of bound ions from one of the capacitor electrodes triggers a collapse of the capacitance to the much smaller mean-field value, as seen in experimental data. We test our analytical predictions with a Monte Carlo simulation and find good agreement. We further argue that our “one-component plasma” model should work well for strongly asymmetric ion liquids. We believe that this work also suggests an improved theory of pseudocapacitance.

Fundamental performance differences between CMOS and CCD imagers: Part II

NASA Astrophysics Data System (ADS)

Janesick, James; Andrews, James; Tower, John; Grygon, Mark; Elliott, Tom; Cheng, John; Lesser, Michael; Pinter, Jeff

2007-09-01

A new class of CMOS imagers that compete with scientific CCDs is presented. The sensors are based on deep depletion backside illuminated technology to achieve high near infrared quantum efficiency and low pixel cross-talk. The imagers deliver very low read noise suitable for single photon counting - Fano-noise limited soft x-ray applications. Digital correlated double sampling signal processing necessary to achieve low read noise performance is analyzed and demonstrated for CMOS use. Detailed experimental data products generated by different pixel architectures (notably 3TPPD, 5TPPD and 6TPG designs) are presented including read noise, charge capacity, dynamic range, quantum efficiency, charge collection and transfer efficiency and dark current generation. Radiation damage data taken for the imagers is also reported.

Quantum effects in energy and charge transfer in an artificial photosynthetic complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ghosh, Pulak Kumar; Smirnov, Anatoly Yu.; Nori, Franco

2011-06-28

We investigate the quantum dynamics of energy and charge transfer in a wheel-shaped artificial photosynthetic antenna-reaction center complex. This complex consists of six light-harvesting chromophores and an electron-acceptor fullerene. To describe quantum effects on a femtosecond time scale, we derive the set of exact non-Markovian equations for the Heisenberg operators of this photosynthetic complex in contact with a Gaussian heat bath. With these equations we can analyze the regime of strong system-bath interactions, where reorganization energies are of the order of the intersite exciton couplings. We show that the energy of the initially excited antenna chromophores is efficiently funneled tomore » the porphyrin-fullerene reaction center, where a charge-separated state is set up in a few picoseconds, with a quantum yield of the order of 95%. In the single-exciton regime, with one antenna chromophore being initially excited, we observe quantum beatings of energy between two resonant antenna chromophores with a decoherence time of {approx}100 fs. We also analyze the double-exciton regime, when two porphyrin molecules involved in the reaction center are initially excited. In this regime we obtain pronounced quantum oscillations of the charge on the fullerene molecule with a decoherence time of about 20 fs (at liquid nitrogen temperatures). These results show a way to directly detect quantum effects in artificial photosynthetic systems.« less

DNA fragmentation by charged particle tracks.

PubMed

Stenerlow, B; Hoglund, E; Carlsson, J

2002-01-01

High-LET (linear energy transfer) charged particles induce DNA double-strand breaks (DSB) in a non-random fashion in mammalian cells. The clustering of DSB, probably determined by track structure as well as chromatin conformation, results in an excess of small- and intermediate-sized DNA fragments. DNA fragmentation in normal human fibroblasts (GM5758) was analyzed by pulsed-field gel electrophoresis after irradiation with photons (60Co) or 125 keV/micrometers nitrogen ions. Compared to conventional DSB analysis, i.e. assays only measuring the fraction of DNA smaller than a single threshold, the relative biological effectiveness (RBE) for DSB induction increased with 100%. Further, the size distribution of DNA fragments showed a significant dependence on radiation quality, with an excess of fragments up to 1 Mbp. Irradiation of naked genomic DNA without histone proteins increased the DSB yields 25 and 13 times for photons and nitrogen ions, respectively. The results suggest possible roles of both track structure and chromatin organization in the distribution of DNA double-strand breaks along the chromosome. c2002 COSPAR. Published by Elsevier Science Ltd. All rights reserved.

Strongly nonlinear dynamics of electrolytes in large ac voltages.

PubMed

Højgaard Olesen, Laurits; Bazant, Martin Z; Bruus, Henrik

2010-07-01

We study the response of a model microelectrochemical cell to a large ac voltage of frequency comparable to the inverse cell relaxation time. To bring out the basic physics, we consider the simplest possible model of a symmetric binary electrolyte confined between parallel-plate blocking electrodes, ignoring any transverse instability or fluid flow. We analyze the resulting one-dimensional problem by matched asymptotic expansions in the limit of thin double layers and extend previous work into the strongly nonlinear regime, which is characterized by two features--significant salt depletion in the electrolyte near the electrodes and, at very large voltage, the breakdown of the quasiequilibrium structure of the double layers. The former leads to the prediction of "ac capacitive desalination" since there is a time-averaged transfer of salt from the bulk to the double layers, via oscillating diffusion layers. The latter is associated with transient diffusion limitation, which drives the formation and collapse of space-charge layers, even in the absence of any net Faradaic current through the cell. We also predict that steric effects of finite ion sizes (going beyond dilute-solution theory) act to suppress the strongly nonlinear regime in the limit of concentrated electrolytes, ionic liquids, and molten salts. Beyond the model problem, our reduced equations for thin double layers, based on uniformly valid matched asymptotic expansions, provide a useful mathematical framework to describe additional nonlinear responses to large ac voltages, such as Faradaic reactions, electro-osmotic instabilities, and induced-charge electrokinetic phenomena.

Pion single and double charge exchange in the resonance region: Dynamical corrections

NASA Astrophysics Data System (ADS)

Johnson, Mikkel B.; Siciliano, E. R.

1983-04-01

We consider pion-nucleus elastic scattering and single- and double-charge-exchange scattering to isobaric analog states near the (3,3) resonance within an isospin invariant framework. We extend previous theories by introducing terms into the optical potential U that are quadratic in density and consistent with isospin invariance of the strong interaction. We study the sensitivity of single and double charge exchange angular distributions to parameters of the second-order potential both numerically, by integrating the Klein-Gordon equation, and analytically, by using semiclassical approximations that explicate the dependence of the exact numerical results to the parameters of U. The magnitude and shape of double charge exchange angular distributions are more sensitive to the isotensor term in U than has been hitherto appreciated. An examination of recent experimental data shows that puzzles in the shape of the 18O(π+, π-)18Ne angular distribution at 164 MeV and in the A dependence of the forward double charge exchange scattering on 18O, 26Mg, 42Ca, and 48Ca at the same energy may be resolved by adding an isotensor term in U. NUCLEAR REACTIONS Scattering theory for elastic, single-, and double-charge-exchange scattering to IAS in the region of the P33 resonance. Second-order effects on charge-exchange calculations of σ(A, θ).

Charge transfer in TATB and HMX under extreme conditions.

PubMed

Zhang, Chaoyang; Ma, Yu; Jiang, Daojian

2012-11-01

Charge transfer is usually accompanied by structural changes in materials under different conditions. However, the charge transfer in energetic materials that are subjected to extreme conditions has seldom been explored by researchers. In the work described here, the charge transfer in single molecules and unit cells of the explosives TATB and HMX under high temperatures and high pressures was investigated by performing static and dynamic calculations using three DFT methods, including the PWC functional of LDA, and the BLYP and PBE functionals of GGA. The results showed that negative charge is transferred from the nitro groups of molecular or crystalline TATB and HMX when they are heated. All DFT calculations for the compressed TATB unit cell indicate that, generally, negative charge transfer occurs to its nitro groups as the compression increases. PWC and PBE calculations for crystalline HMX show that negative charge is first transferred to the nitro groups but, as the compression increases, the negative charge is transferred from the nitro groups. However, the BLYP calculations indicated that there was gradual negative charge transfer to the nitro groups of HMX, similar to the case for TATB. The unrelaxed state of the uniformly compressed TATB causes negative charge to be transferred from its nitro groups, in contrast to what is seen in the relaxed state. Charge transfer in TATB is predicted to occur much more easily than in HMX.

Configuration interaction calculations for the region of 76Ge

NASA Astrophysics Data System (ADS)

Brown, Alex

2017-09-01

I will present a short history of the configuration interaction Hamiltonians that have been developed for the (0f5 / 2 , 1p3 / 2 , 1p1 / 2 , 0g9 / 2) (jj 44) model space. This model space is appropriate for the region of nuclei bounded by the nickel isotopes for Z = 28 and the isotones with N = 50 . I will discuss results for the double-beta decay of 76Ge that lies in the jj 44 region. I will show results for the structure of nuclei around 76Ge for some selected data from gamma decay, Gamow-Teller beta decay, charge-exchange reactions, one-nucleon transfer reactions, and two-nucleon transfer reactions. This work was supported by NSF Grant PHY-1404442.

Molecular control of pentacene/ZnO photoinduced charge transfer

NASA Astrophysics Data System (ADS)

Spalenka, Josef W.; Paoprasert, Peerasak; Franking, Ryan; Hamers, Robert J.; Gopalan, Padma; Evans, Paul G.

2011-03-01

Photoinduced charge transfer modifies the device properties of illuminated pentacene field effect transistors (FETs) incorporating ZnO quantum dots at the gate insulator/pentacene interface. The transferred charge is trapped on electronic states associated with the ZnO quantum dots, with a steady state population approximately proportional to the rate of organic-inorganic charge transfer. Trapped charge shifts the threshold voltage of the FETs, providing the means to evaluate the rate of organic/inorganic charge transfer and the effects of interface modification. Monolayers of the wide-gap alkane stearic acid and the conjugated oligomer terthiophene attached to the ZnO suppress or permit charge transfer, respectively.

Intramolecular charge transfer and trans-cis isomerization of the DCM styrene dye in polar solvents. A CS INDO MRCI study

NASA Astrophysics Data System (ADS)

Marguet, S.; Mialocq, J. C.; Millie, P.; Berthier, G.; Momicchioli, F.

1992-03-01

The solvent-induced changes of trans-cis isomerization efficiency and electronic structure of the excited state of the DCM dye have been considered by means of CS INDO MRCI calculations. The potential energy curves, dipole moments and atomic charge densities as a function of two internal coordinates, namely the rotation angle about the central "double" bond and the twisting of the dimethylamino group, have been obtained for the ground state and the lowest excited states. The structural requirements for the existence of ICT (intramolecular charge transfer) excited states have been investigated by considering internal rotations about three single bonds. The reliability of the potential surfaces and of the solvation models has been discussed with reference to test-calculations on the DMABN molecule. In the first excited singlet state of DCM, the low-energy barrier for the trans-cis isomerization has been found unaffected by the solvent polarity. The only singlet excited state presenting a large ICT character has been found to be the S 2 state for a perpendicularly twisted conformation of the dimethylamino group (TICT state). The assumption of a deactivation of the trans-isomer in the locally excited state through the TICT funnel has been largely discussed with reference to the simplifications of the present theoretical approach.

Photoisomerization of Trans Ortho-, Meta-, Para-Nitro Diarylbutadienes: A Case of Regioselectivity.

PubMed

Agnihotri, Harsha; Paramasivam, Mahalingavelar; Palakollu, Veerabhadraiah; Kanvah, Sriram

2015-11-01

A series of ortho-, meta- and para-substituted trans-nitro aryl (phenyl and pyridyl) butadienes have been synthesized and characterized. The effect of substitution and positional selectivity on their fluorescence and photoisomerization were systematically investigated. Among all dienes, meta- and para-nitro phenyl-substituted derivatives exhibit remarkable solvatochromic emission shifts due to intramolecular charge transfer. On the other hand, ortho derivatives undergo regioselective isomerization upon photoexcitation in contrast to inefficient isomerization of para and meta nitro-substituted dienes. Single crystal X-ray analysis revealed existence of intramolecular hydrogen bonding between the nitro group and the hydrogen of the proximal double bond. This restricts the rotation of the proximal double bond thereby allowing regioselective isomerization. The observations were also supported by NMR spectroscopic studies. © 2015 The American Society of Photobiology.

Manipulating quantum coherence of charge states in interacting double-dot Aharonov–Bohm interferometers

NASA Astrophysics Data System (ADS)

Jin, Jinshuang; Wang, Shikuan; Zhou, Jiahuan; Zhang, Wei-Min; Yan, YiJing

2018-04-01

We investigate the dynamics of charge-state coherence in a degenerate double-dot Aharonov–Bohm interferometer with finite inter-dot Coulomb interactions. The quantum coherence of the charge states is found to be sensitive to the transport setup configurations, involving both the single-electron impurity channels and the Coulomb-assisted ones. We numerically demonstrate the emergence of a complete coherence between the two charge states, with the relative phase being continuously controllable through the magnetic flux. Interestingly, a fully coherent charge qubit arises at the double-dots electron pair tunneling resonance condition, where the chemical potential of one electrode is tuned at the center between a single-electron impurity channel and the related Coulomb-assisted channel. This pure quantum state of charge qubit could be experimentally realized at the current–voltage characteristic turnover position, where differential conductance sign changes. We further elaborate the underlying mechanism for both the real-time and the stationary charge-states coherence in the double-dot systems of study.

Theoretical Insights Into the Excited State Double Proton Transfer Mechanism of Deep Red Pigment Alkannin.

PubMed

Zhao, Jinfeng; Dong, Hao; Zheng, Yujun

2018-02-08

As the most important component of deep red pigments, alkannin is investigated theoretically in detail based on time-dependent density functional theory (TDDFT) method. Exploring the dual intramolecular hydrogen bonds (O1-H2···O3 and O4-H5···O6) of alkannin, we confirm the O1-H2···O3 may play a more important role in the first excited state than the O4-H5···O6 one. Infrared (IR) vibrational analyses and subsequent charge redistribution also support this viewpoint. Via constructing the S 1 -state potential energy surface (PES) and searching transition state (TS) structures, we illuminate the excited state double proton transfer (ESDPT) mechanism of alkannin is the stepwise process that can be first launched by the O1-H2···O3 hydrogen bond wire in gas state, acetonitrile (CH 3 CN) and cyclohexane (CYH) solvents. We present a novel mechanism that polar aprotic solvents can contribute to the first-step proton transfer (PT) process in the S 1 state, and nonpolar solvents play important roles in lowering the potential energy barrier of the second-step PT reaction.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ghosh, Soumya; Soudackov, Alexander V.; Hammes-Schiffer, Sharon

Electron transfer and proton coupled electron transfer (PCET) reactions at electrochemical interfaces play an essential role in a broad range of energy conversion processes. The reorganization energy, which is a measure of the free energy change associated with solute and solvent rearrangements, is a key quantity for calculating rate constants for these reactions. We present a computational method for including the effects of the double layer and ionic environment of the diffuse layer in calculations of electrochemical solvent reorganization energies. This approach incorporates an accurate electronic charge distribution of the solute within a molecular-shaped cavity in conjunction with a dielectricmore » continuum treatment of the solvent, ions, and electrode using the integral equations formalism polarizable continuum model. The molecule-solvent boundary is treated explicitly, but the effects of the electrode-double layer and double layer-diffuse layer boundaries, as well as the effects of the ionic strength of the solvent, are included through an external Green’s function. The calculated total reorganization energies agree well with experimentally measured values for a series of electrochemical systems, and the effects of including both the double layer and ionic environment are found to be very small. This general approach was also extended to electrochemical PCET and produced total reorganization energies in close agreement with experimental values for two experimentally studied PCET systems. This research was supported as part of the Center for Molecular Electrocatalysis, an Energy Frontier Research Center, funded by the U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences.« less

Study of the slope of the linear relationship between retention and mobile phase composition (Snyder-Soczewiñski model) in normal phase liquid chromatography with bonded and charge-transfer phases.

PubMed

Wu, Di; Lucy, Charles A

2016-12-02

The Snyder model and the Soczewiñski model are compared on classic NPLC bonded phases using literature data, and on the charge transfer 2, 4-dinitroanilinopropyl (DNAP) column using experimentally collected data. Overall, the Snyder model slightly better predicts the n-slope than the Soczewiñski model. However, both models give comparable uncertainty in predicting n-slope for a given compound. The number of aromatic double bonds was the most suitable descriptor for estimating the relative n-slope of PAHs, as it correlated with behavior better than the number of aromatic rings and is simpler to calculate than the solute adsorption area. On the DNAP phase, a modified Soczewiñski model is suggested to allow for the significant contribution of the aromatic rings to the n-slope. For classic NPLC bonded phases and DNAP columns, the contribution of polar group to the n-slope parallels the adsorption energy of each polar group. Copyright © 2016 Elsevier B.V. All rights reserved.

Double-pulse dichromatic photolysis of fac-CIRe(CO){sub 3}L{sub 2} (L=4-phenylpyridine or 4-cyanopyridine): Photohomolysis of Re-L bonds insuced by irradiation of photochemically unreactive charge transfer states

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feliz, M.; Ferraudi, G.

1992-04-02

Photochemical reactions of fac-ClRe(CO){sub 3}L{sub 2} (L=4-phenylpyridine or 4-cyanopyridine), were investigated by sequential biphotonic excitations: one laser flash was used for the preparation of the compounds in the lowest lying MLCT (Re{r_arrow}) state and another flash for the irradiation of the compounds in such excited states. These photolyses led to photodecompostions into CIRe(CO){sub 3}L{sup +} and L{sup .} in a charge transfer state placed 40 Kk above ground state. Quantum yields determined or various excitation energies show that not all the excited state populated in monophotonic excitations can be reached under the sequential biphotonic regime. Therefore, photogeneration of the biradicalmore » intermediate, ClRe(CO){sub 3}L{sup +} and L{sup .}, from ligand-centered states has not been detected in these experiments. Results from monophotonic and biphotonic excitations have been used for a semiquantitative mapping of the excited-state potential surfaces. 41 refs., 6 figs.« less

Dynamics of charge-transfer excitons in type-II semiconductor heterostructures

NASA Astrophysics Data System (ADS)

Stein, M.; Lammers, C.; Richter, P.-H.; Fuchs, C.; Stolz, W.; Koch, M.; Vänskä, O.; Weseloh, M. J.; Kira, M.; Koch, S. W.

2018-03-01

The formation, decay, and coherence properties of charge-transfer excitons in semiconductor heterostructures are investigated by applying four-wave-mixing and terahertz spectroscopy in combination with a predictive microscopic theory. A charge-transfer process is identified where the optically induced coherences decay directly into a charge-transfer electron-hole plasma and exciton states. It is shown that charge-transfer excitons are more sensitive to the fermionic electron-hole substructure than regular excitons.

Charge-transfer cross sections in collisions of ground-state Ca and H+

NASA Astrophysics Data System (ADS)

Dutta, C. M.; Oubre, C.; Nordlander, P.; Kimura, M.; Dalgarno, A.

2006-03-01

We have investigated collisions of Ca(4s2) with H+ in the energy range of 200eV/u-10keV/u using the semiclassical molecular-orbital close-coupling (MOCC) method with 18 coupled molecular states ( 11Σ+1 and seven Π+1 states) to determine charge-transfer cross sections. Except for the incoming channel 6Σ+1 , the molecular states all correspond to charge-transfer channels. Inclusion of Ca2+-H- is crucial in the configuration-interaction calculation for generating the molecular wave functions and potentials. Because of the Coulomb attraction, the state separating to Ca2+-H- creates many avoided crossings, even though at infinite separation it lies energetically above all other states that we included. Because of the avoided crossings between the incoming channel 6Σ+1 and the energetically close charge-transfer channel 7Σ+1 the charge-transfer interaction occurs at long range. This makes calculations of charge-transfer cross sections by the MOCC method very challenging. The total charge-transfer cross sections increase monotonically from 3.4×10-15cm2 at 200eV/u to 4.5×10-15cm2 at 10keV/u . Charge transfer occurs mostly to the excited Ca+(5p) state in the entire energy range, which is the sum of the charge transfer to 7Σ+1 and 4Π+1 . It accounts for ˜47% of the total charge transfer cross sections at 200eV/u . However, as the energy increases, transfer to Ca+(4d) increases, and at 10keV/u the charge-transfer cross sections for Ca+(5p) and Ca+(4d) become comparable, each giving ˜38% of the total cross section.

LET spectra measurements of charged particles in the P0006 experiment on LDEF

NASA Technical Reports Server (NTRS)

Benton, E. V.; Csige, I.; Oda, K.; Henke, R. P.; Frank, A. L.; Benton, E. R.; Frigo, L. A.; Parnell, T. A.; Watts, J. W., Jr.; Derrickson, J. H.

1993-01-01

Measurements are under way of the charged particle radiation environment of the Long Duration Exposure Facility (LDEF) satellite using stacks of plastic nuclear track detectors (PNTD's) placed in different locations of the satellite. In the initial work the charge, energy, and linear energy transfer (LET) spectra of charged particles were measured with CR-39 double layer PNTD's located on the west side of the satellite (Experiment P0006). Primary and secondary stopping heavy ions were measured separately from the more energetic particles. Both trapped and galactic cosmic ray (GCR) particles are included, with the latter component being dominated by relativistic iron particles. The results from the P0006 experiment will be compared with similar measurements in other locations on LDEF with different orientation and shielding conditions. The remarkably detailed investigation of the charged particle radiation environment of the LDEF satellite will lead to a better understanding of the radiation environment of the Space Station Freedom. It will enable more accurate prediction of single event upsets (SEU's) in microelectronics and, especially, more accurate assessment of the risk - contributed by different components of the radiation field (GCR's, trapped protons, secondaries and heavy recoils, etc.) - to the health and safety of crew members.

Emerging critical roles of Fe-S clusters in DNA replication and repair

PubMed Central

Fuss, Jill O.; Tsai, Chi-Lin; Ishida, Justin P.; Tainer, John A.

2015-01-01

Fe-S clusters are partners in the origin of life that predate cells, acetyl-CoA metabolism, DNA, and the RNA world. The double helix solved the mystery of DNA replication by base pairing for accurate copying. Yet, for genome stability necessary to life, the double helix has equally important implications for damage repair. Here we examine striking advances that uncover Fe-S cluster roles both in copying the genetic sequence by DNA polymerases and in crucial repair processes for genome maintenance, as mutational defects cause cancer and degenerative disease. Moreover, we examine an exciting, controversial role for Fe-S clusters in a third element required for life – the long-range coordination and regulation of replication and repair events. By their ability to delocalize electrons over both Fe and S centers, Fe-S clusters have unbeatable features for protein conformational control and charge transfer via double-stranded DNA that may fundamentally transform our understanding of life, replication, and repair. PMID:25655665

Dewar Lesion Formation in Single- and Double-Stranded DNA is Quenched by Neighboring Bases.

PubMed

Bucher, Dominik B; Pilles, Bert M; Carell, Thomas; Zinth, Wolfgang

2015-07-16

UV-induced Dewar lesion formation is investigated in single- and double-stranded oligonucleotides with ultrafast vibrational spectroscopy. The quantum yield for the conversion of the (6-4) lesion to the Dewar isomer in DNA strands is reduced by a factor of 4 in comparison to model dinucleotides. Time resolved spectroscopy reveals a fast process in the excited state with spectral characteristics of bases which are adjacent to the excited (6-4) lesion. These kinetic components have large amplitudes and indicate that an additional quenching channel acts in the stranded DNA systems and reduces the Dewar formation yield. Presumably relaxation evolves via a charge transfer to the neighboring guanine and the paired cytosine participates in a double-stranded oligomer. Changes in the decay of the relaxed excited electronic state of the (6-4) chromophore point to modifications in the excited state energy landscape which may lead to an additional reduction of the Dewar formation yield.

Entropic effects in the electric double layer of model colloids with size-asymmetric monovalent ions

NASA Astrophysics Data System (ADS)

Guerrero-García, Guillermo Iván; González-Tovar, Enrique; Olvera de la Cruz, Mónica

2011-08-01

The structure of the electric double layer of charged nanoparticles and colloids in monovalent salts is crucial to determine their thermodynamics, solubility, and polyion adsorption. In this work, we explore the double layer structure and the possibility of charge reversal in relation to the size of both counterions and coions. We examine systems with various size-ratios between counterions and coions (ion size asymmetries) as well as different total ion volume fractions. Using Monte Carlo simulations and integral equations of a primitive-model electric double layer, we determine the highest charge neutralization and electrostatic screening near the electrified surface. Specifically, for two binary monovalent electrolytes with the same counterion properties but differing only in the coion's size surrounding a charged nanoparticle, the one with largest coion size is found to have the largest charge neutralization and screening. That is, in size-asymmetric double layers with a given counterion's size the excluded volume of the coions dictates the adsorption of the ionic charge close to the colloidal surface for monovalent salts. Furthermore, we demonstrate that charge reversal can occur at low surface charge densities, given a large enough total ion concentration, for systems of monovalent salts in a wide range of ion size asymmetries. In addition, we find a non-monotonic behavior for the corresponding maximum charge reversal, as a function of the colloidal bare charge. We also find that the reversal effect disappears for binary salts with large-size counterions and small-size coions at high surface charge densities. Lastly, we observe a good agreement between results from both Monte Carlo simulations and the integral equation theory across different colloidal charge densities and 1:1-elec-trolytes with different ion sizes.

Consideration of Cost of Care in Pediatric Emergency Transfer-An Opportunity for Improvement.

PubMed

Gattu, Rajender K; De Fee, Ann-Sophie; Lichenstein, Richard; Teshome, Getachew

2017-05-01

Pediatric interhospital transfers are an economic burden to the health care, especially when deemed unnecessary. Physicians may be unaware of the cost implications of pediatric emergency transfers. A cost analysis may be relevant to reduce cost. To characterize children transferred from outlying emergency departments (EDs) to pediatric ED (PED) with a specific focus on transfers who were discharged home in 12 hours or less after transfer without intervention in PED and analyze charges associated with them. Charts of 352 patients (age, 0-18 years) transferred from 31 outlying EDs to PED during July 2009 to June 2010 were reviewed. Data were collected on the range, unit charge and volume of services provided in PED, length of stay, and final disposition. The average charge per patient transfer is calculated based on unit charge times total service units per 1000 patients per year and divided by 1000. Hospital charges were divided into fixed and variable. Of 352 patients transferred, 108 (30.7%) were admitted to pediatric inpatient service, 42 (11.9%) to intensive care; 36 (10.2%) went to the operating room, and 166 (47.2%) were discharged home. The average hospital charge per transfer was US $4843. Most (89%) of the charges were fixed, and 11% were variable. One hundred one (28.7%) patients were discharged home from PED in 12 hours or less without intervention. The hospital charges for these transfers were US $489,143. Significant number of transfers was discharged 12 hours or less without any additional intervention in PED. Fixed charges contribute to majority of total charges. Cost saving can be achieved by preventing unnecessary transfer.

Quantum Theory of Atoms in Molecules Charge-Charge Transfer-Dipolar Polarization Classification of Infrared Intensities.

PubMed

Duarte, Leonardo J; Richter, Wagner E; Silva, Arnaldo F; Bruns, Roy E

2017-10-26

Fundamental infrared vibrational transition intensities of gas-phase molecules are sensitive probes of changes in electronic structure accompanying small molecular distortions. Models containing charge, charge transfer, and dipolar polarization effects are necessary for a successful classification of the C-H, C-F, and C-Cl stretching and bending intensities. C-H stretching and in-plane bending vibrations involving sp 3 carbon atoms have small equilibrium charge contributions and are accurately modeled by the charge transfer-counterpolarization contribution and its interaction with equilibrium charge movement. Large C-F and C═O stretching intensities have dominant equilibrium charge movement contributions compared to their charge transfer-dipolar polarization ones and are accurately estimated by equilibrium charge and the interaction contribution. The C-F and C-Cl bending modes have charge and charge transfer-dipolar polarization contribution sums that are of similar size but opposite sign to their interaction values resulting in small intensities. Experimental in-plane C-H bends have small average intensities of 12.6 ± 10.4 km mol -1 owing to negligible charge contributions and charge transfer-counterpolarization cancellations, whereas their average out-of-plane experimental intensities are much larger, 65.7 ± 20.0 km mol -1 , as charge transfer is zero and only dipolar polarization takes place. The C-F bending intensities have large charge contributions but very small intensities. Their average experimental out-of-plane intensity of 9.9 ± 12.6 km mol -1 arises from the cancellation of large charge contributions by dipolar polarization contributions. The experimental average in-plane C-F bending intensity, 5.8 ± 7.3 km mol -1 , is also small owing to charge and charge transfer-counterpolarization sums being canceled by their interaction contributions. Models containing only atomic charges and their fluxes are incapable of describing electronic structure changes for simple molecular distortions that are of interest in classifying infrared intensities. One can expect dipolar polarization effects to also be important for larger distortions of chemical interest.

In situ Raman study on single- and double-walled carbon nanotubes as a function of lithium insertion.

PubMed

Kim, Yoong Ahm; Kojima, Masahito; Muramatsu, Hiroyuki; Umemoto, Souichiro; Watanabe, Takaaki; Yoshida, Kazuto; Sato, Keigo; Ikeda, Takuya; Hayashi, Takuya; Endo, Morinobu; Terrones, Mauricio; Dresselhaus, Mildred S

2006-05-01

We investigated the electrochemical lithium ion (Li(+)) insertion/desertion behavior on highly pure and bundled single- and double-walled carbon nanotubes (SWNTs and DWNTs) using an in situ Raman technique. In general, two storage sites could host Li(+) in SWNT and DWNT bundles when varying an external potential: a) the outer surface sites, and b) the interstitial spaces within the bundles. The most sensitive changes in the tangential mode (TM) of the Raman spectra upon doping with Li(+) can be divided into two regions. The first region was found from 2.8 to 1.0 V (the coverage of Li(+) on the outer surface of a bundled nanotube) and was characterized by the loss of resonant conditions via partial charge transfer, where the G(+) line of the SWNT and the TM of the outer tube of DWNTs experienced a highly depressed intensity, but remained almost constant in frequency. The appearance of a Breit-Wigner-Fano (BWF) profile provided strong evidence of metallic inner tubes within DWNTs. The second region was observed when the applied potentials ranged from 0.9 to 0 V and was characterized by Li(+) diffusion into the interstitial sites of the bundled nanotube material. This phenomenon invoked a large downshift of the G(-) band in SWNTs, and a small downshift of the TM of the inner tube of DWNTs caused by expansion of the C--C bonds due to the charge transferred to the nanotubes, and the disappearance of the BWF profile through the screening effect of the interstitial Li(+) layers.

Capturing the radical ion-pair intermediate in DNA guanine oxidation

PubMed Central

Jie, Jialong; Liu, Kunhui; Wu, Lidan; Zhao, Hongmei; Song, Di; Su, Hongmei

2017-01-01

Although the radical ion pair has been frequently invoked as a key intermediate in DNA oxidative damage reactions and photoinduced electron transfer processes, the unambiguous detection and characterization of this species remain formidable and unresolved due to its extremely unstable nature and low concentration. We use the strategy that, at cryogenic temperatures, the transient species could be sufficiently stabilized to be detectable spectroscopically. By coupling the two techniques (the cryogenic stabilization and the time-resolved laser flash photolysis spectroscopy) together, we are able to capture the ion-pair transient G+•⋯Cl− in the chlorine radical–initiated DNA guanine (G) oxidation reaction, and provide direct evidence to ascertain the intricate type of addition/charge separation mechanism underlying guanine oxidation. The unique spectral signature of the radical ion-pair G+•⋯Cl− is identified, revealing a markedly intense absorption feature peaking at 570 nm that is distinctive from G+• alone. Moreover, the ion-pair spectrum is found to be highly sensitive to the protonation equilibria within guanine-cytosine base pair (G:C), which splits into two resolved bands at 480 and 610 nm as the acidic proton transfers along the central hydrogen bond from G+• to C. We thus use this exquisite sensitivity to track the intrabase-pair proton transfer dynamics in the double-stranded DNA oligonucleotides, which is of critical importance for the description of the proton-coupled charge transfer mechanisms in DNA. PMID:28630924

Charge-transfer mechanism for electrophilic aromatic nitration and nitrosation via the convergence of (ab initio) molecular-orbital and Marcus-Hush theories with experiments.

PubMed

Gwaltney, Steven R; Rosokha, Sergiy V; Head-Gordon, Martin; Kochi, Jay K

2003-03-19

The highly disparate rates of aromatic nitrosation and nitration, despite the very similar (electrophilic) properties of the active species: NO(+) and NO(2)(+) in Chart 1, are quantitatively reconciled. First, the thorough mappings of the potential-energy surfaces by high level (ab initio) molecular-orbital methodologies involving extensive coupled-cluster CCSD(T)/6-31G optimizations establish the intervention of two reactive intermediates in nitration (Figure 8) but only one in nitrosation (Figure 7). Second, the same distinctive topologies involving double and single potential-energy minima (Figures 6 and 5) also emerge from the semiquantitative application of the Marcus-Hush theory to the transient spectral data. Such a striking convergence from quite different theoretical approaches indicates that the molecular-orbital and Marcus-Hush (potential-energy) surfaces are conceptually interchangeable. In the resultant charge-transfer mechanism, the bimolecular interactions of arene donors with both NO(+) and NO(2)(+) spontaneously lead (barrierless) to pi-complexes in which electron transfer is concurrent with complexation. Such a pi-complex in nitration is rapidly converted to the sigma-complex, whereas this Wheland adduct in nitrosation merely represents a high energy (transition-state) structure. Marcus-Hush analysis thus demonstrates how the strongly differentiated (arene) reactivities toward NO(+) and NO(2)(+) can actually be exploited in the quantitative development of a single coherent (electron-transfer) mechanism for both aromatic nitrosation and nitration.

Can HN[double bond, length as m-dash]NH, FN[double bond, length as m-dash]NH, or HN[double bond, length as m-dash]CHOH bridge the σ-hole and the lone pair at P in binary complexes with H2XP, for X = F, Cl, NC, OH, CN, CCH, CH3, and H?

PubMed

Del Bene, Janet E; Alkorta, Ibon; Elguero, José

2015-11-11

Ab initio MP2/aug'-cc-pVTZ calculations have been carried out to investigate the properties of complexes formed between H2XP, for X = F, Cl, NC, OH, CN, CCH, CH3, and H, and the possible bridging molecules HN[double bond, length as m-dash]NH, FN[double bond, length as m-dash]NH, and HN[double bond, length as m-dash]CHOH. H2XP:HNNH and H2XP:FNNH complexes are stabilized by PN pnicogen bonds, except for H2(CH3)P:FNNH and H3P:FNNH which are stabilized by N-HP hydrogen bonds. H2XP:HNCHOH complexes are stabilized by PN pnicogen bonds and nonlinear O-HP hydrogen bonds. For a fixed H2XP molecule, binding energies decrease in the order HNCHOH > HNNH > FNNH, except for the binding energies of H2(CH3)P and H3P with HNNH and FNNH. Binding energies of complexes with HNCHOH and HNNH increase as the P-N1 distance decreases, but binding energies of complexes with FNNH show little dependence on this distance. The large binding energies of H2XP:HNCHOH complexes arise from a cooperative effect involving electron-pair acceptance by P to form a pnicogen bond, and electron-pair donation by P to form a hydrogen bond. The dominant charge-transfer interaction in these complexes involves electron-pair donation by N across the pnicogen bond, except for complexes in which X is one of the more electropositive substituents, CCH, CH3, and H. For these, lone-pair donation by P across the hydrogen bond dominates. AIM and NBO data for these complexes are consistent with their bonding characteristics, showing molecular graphs with bond critical points and charge-transfer interactions associated with hydrogen and pnicogen bonds. EOM-CCSD spin-spin coupling constants (1p)J(P-N) across the pnicogen bond for each series of complexes correlate with the P-N distance. In contrast, (2h)J(O-P) values for complexes H2XP:HNCHOH do not correlate with the O-P distance, a consequence of the nonlinearity of these hydrogen bonds.

Charge Transfer Inefficiency in Pinned Photodiode CMOS image sensors: Simple Montecarlo modeling and experimental measurement based on a pulsed storage-gate method

NASA Astrophysics Data System (ADS)

Pelamatti, Alice; Goiffon, Vincent; Chabane, Aziouz; Magnan, Pierre; Virmontois, Cédric; Saint-Pé, Olivier; de Boisanger, Michel Breart

2016-11-01

The charge transfer time represents the bottleneck in terms of temporal resolution in Pinned Photodiode (PPD) CMOS image sensors. This work focuses on the modeling and estimation of this key parameter. A simple numerical model of charge transfer in PPDs is presented. The model is based on a Montecarlo simulation and takes into account both charge diffusion in the PPD and the effect of potential obstacles along the charge transfer path. This work also presents a new experimental approach for the estimation of the charge transfer time, called pulsed Storage Gate (SG) method. This method, which allows reproduction of a ;worst-case; transfer condition, is based on dedicated SG pixel structures and is particularly suitable to compare transfer efficiency performances for different pixel geometries.

Charge transfer efficiency improvement of 4T pixel for high speed CMOS image sensor

NASA Astrophysics Data System (ADS)

Jin, Xiangliang; Liu, Weihui; Yang, Hongjiao; Tang, Lizhen; Yang, Jia

2015-03-01

The charge transfer efficiency improvement method is proposed by optimizing the electrical potential distribution along the transfer path from the PPD to the FD. In this work, we present a non-uniform doped transfer transistor channel, with the adjustments to the overlap length between the CPIA layer and the transfer gate, and the overlap length between the SEN layer and transfer gate. Theory analysis and TCAD simulation results show that the density of the residual charge reduces from 1e11 /cm3 to 1e9 /cm3, and the transfer time reduces from 500 ns to 143 ns, and the charge transfer efficiency is about 77 e-/ns. This optimizing design effectively improves the charge transfer efficiency of 4T pixel and the performance of 4T high speed CMOS image sensor.

The role of collective motion in the ultrafast charge transfer in van der Waals heterostructures

DOE PAGES

Wang, Han; Bang, Junhyeok; Sun, Yiyang; ...

2016-05-10

Here, the success of van der Waals (vdW) heterostructures, made of graphene, metal dichalcogenides, and other layered materials, hinges on the understanding of charge transfer across the interface as the foundation for new device concepts and applications. In contrast to conventional heterostructures, where a strong interfacial coupling is essential to charge transfer, recent experimental findings indicate that vdW heterostructues can exhibit ultra-fast charge transfer despite the weak binding of the heterostructure. Using time-dependent density functional theory molecular dynamics, we identify a strong dynamic coupling between the vdW layers associated with charge transfer. This dynamic coupling results in rapid nonlinear coherentmore » charge oscillations which constitute a purely electronic phenomenon and are shown to be a general feature of vdW heterostructures provided they have a critical minimum dipole coupling. Application to MoS2/WS2 heterostructure yields good agreement with experiment, indicating near complete charge transfer within a timescale of 100 fs.The success of van der Waals heterostructures made of graphene, metal dichalcogenides and other layered materials, hinges on the understanding of charge transfer across the interface as the foundation for new device concepts and applications. In contrast to conventional heterostructures, where a strong interfacial coupling is essential to charge transfer, recent experimental findings indicate that van der Waals heterostructues can exhibit ultrafast charge transfer despite the weak binding of these heterostructures. Here we find, using time-dependent density functional theory molecular dynamics, that the collective motion of excitons at the interface leads to plasma oscillations associated with optical excitation. By constructing a simple model of the van der Waals heterostructure, we show that there exists an unexpected criticality of the oscillations, yielding rapid charge transfer across the interface. Application to the MoS2/WS2 heterostructure yields good agreement with experiments, indicating near complete charge transfer within a timescale of 100 fs.« less

The role of collective motion in the ultrafast charge transfer in van der Waals heterostructures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Han; Bang, Junhyeok; Sun, Yiyang

Here, the success of van der Waals (vdW) heterostructures, made of graphene, metal dichalcogenides, and other layered materials, hinges on the understanding of charge transfer across the interface as the foundation for new device concepts and applications. In contrast to conventional heterostructures, where a strong interfacial coupling is essential to charge transfer, recent experimental findings indicate that vdW heterostructues can exhibit ultra-fast charge transfer despite the weak binding of the heterostructure. Using time-dependent density functional theory molecular dynamics, we identify a strong dynamic coupling between the vdW layers associated with charge transfer. This dynamic coupling results in rapid nonlinear coherentmore » charge oscillations which constitute a purely electronic phenomenon and are shown to be a general feature of vdW heterostructures provided they have a critical minimum dipole coupling. Application to MoS2/WS2 heterostructure yields good agreement with experiment, indicating near complete charge transfer within a timescale of 100 fs.The success of van der Waals heterostructures made of graphene, metal dichalcogenides and other layered materials, hinges on the understanding of charge transfer across the interface as the foundation for new device concepts and applications. In contrast to conventional heterostructures, where a strong interfacial coupling is essential to charge transfer, recent experimental findings indicate that van der Waals heterostructues can exhibit ultrafast charge transfer despite the weak binding of these heterostructures. Here we find, using time-dependent density functional theory molecular dynamics, that the collective motion of excitons at the interface leads to plasma oscillations associated with optical excitation. By constructing a simple model of the van der Waals heterostructure, we show that there exists an unexpected criticality of the oscillations, yielding rapid charge transfer across the interface. Application to the MoS2/WS2 heterostructure yields good agreement with experiments, indicating near complete charge transfer within a timescale of 100 fs.« less

Cation Valence Control in La0.7Sr0.3Co0.5Mn0.5O3 Thin Films and Bilayers

NASA Astrophysics Data System (ADS)

Kane, Alex; Chopdekar, Rajesh; Arenholz, Elke; Mehta, Apurva; Takamura, Yayoi

The unique interplay between spin, orbital, charge, and lattice degrees of freedom at interfaces in perovskite oxides makes them model systems to probe and exert magnetic control at the nanoscale. Previous work revealed exchange coupling in bilayers composed of a hard ferromagnetic (FM) La0.7Sr0.3CoO3 (LSCO) layer and a soft FM La0.7Sr0.3MnO3 (LSMO) layer, coincident with charge transfer across the LSCO/LSMO interface. An interfacial Co2+-rich LSCO layer produced a FM superexchange interaction with Mn4+ ions in the adjacent LSMO layer, mimicking the behavior of ordered Co2+/Mn4 + ions in the double perovskite La2CoMnO6. In an attempt to manipulate the extent of charge transfer in this system, La0.7Sr0.3Co0.5Mn0.5O3 (LSCMO)/LSMO and LSCMO/LSCO bilayers were deposited by pulsed laser deposition. Bulk magnetometry and soft x-ray magnetic spectroscopy were used to investigate the Mn/Co magnetic and electronic structures, comparing the surface/interface dominant effects vs. the film average. The LSCMO/LSMO bilayer enhanced the magnetically soft Co2+ population at the interface, while the LSCMO/LSCO bilayers strongly suppressed the Co2+ state in the LSCMO layer.

Preparation of high-aspect-ratio ZnO nanorod arrays for the detection of several organic solvents at room working temperature

NASA Astrophysics Data System (ADS)

Lee, Yi-Mu; Zheng, Min-Ren

2013-11-01

Chemical sensors based on ZnO nanorod arrays were prepared using chemical bath deposition (CBD) to investigate the sensing performance for the detection of several organic solvents with low concentrations (0.1%, 0.5%, 1%, v/v) at room temperature. High quality and high aspect-ratio (value ˜28) ZnO nanorods have a diameter of about 74 nm and average length of 2.1 μm. Nyquist plots and Bode plots of the ZnO sensors under different organic solvents were obtained by electrical impedance spectroscopy (EIS). The sensing properties such as charge-transfer resistance, double-layer capacitance and dielectric parameters were determined from the impedance spectra to explore the charge transport in low-concentration aqueous solutions. The decreasing trend of the charge-transfer resistance (Rct) as decreasing solvent concentrations is observed, and a straight line at low frequency regime indicates adsorption of water molecules on the oxide surface. The sensitivity of the ZnO sensors was calculated from the resistance variation in target solvents and in deionized water. We demonstrated the use of ZnO nanorod arrays as a chemical sensor capable of generating a different response upon exposure to methanol, ethanol, isopropyl alcohol, acetone and water, wherein the methanol sensing exhibited highest sensitivity. In addition, the ZnO sensor also demonstrates good stability and reproducibility for detection of methanol and ethanol.

Proton conduction within the reaction centers of Rhodobacter capsulatus: the electrostatic role of the protein.

PubMed

Maróti, P; Hanson, D K; Baciou, L; Schiffer, M; Sebban, P

1994-06-07

Light-induced charge separation in the photosynthetic reaction center results in delivery of two electrons and two protons to the terminal quinone acceptor QB. In this paper, we have used flash-induced absorbance spectroscopy to study three strains that share identical amino acid sequences in the QB binding site, all of which lack the protonatable amino acids Glu-L212 and Asp-L213. These strains are the photosynthetically incompetent site-specific mutant Glu-L212/Asp-L213-->Ala-L212/Ala-L213 and two different photocompetent derivatives that carry both alanine substitutions and an intergenic suppressor mutation located far from QB (class 3 strain, Ala-Ala + Arg-M231-->Leu; class 4 strain, Ala-Ala + Asn-M43-->Asp). At pH 8 in the double mutant, we observe a concomitant decrease of nearly 4 orders of magnitude in the rate constants of second electron and proton transfer to QB compared to the wild type. Surprisingly, these rates are increased to about the same extent in both types of suppressor strains but remain > 2 orders of magnitude smaller than those of the wild type. In the double mutant, at pH 8, the loss of Asp-L213 and Glu-L212 leads to a substantial stabilization (> or = 60 meV) of the semiquinone energy level. Both types of compensatory mutations partially restore, to nearly the same level, the original free energy difference for electron transfer from primary quinone QA to QB. The pH dependence of the electron and proton transfer processes in the double-mutant and the suppressor strains suggests that when reaction centers of the double mutant are shifted to lower pH (1.5-2 units), they function like those of the suppressor strains at physiological pH. Our data suggest that the main effect of the compensatory mutations is to partially restore the negative electrostatic environment of QB and to increase an apparent "functional" pK of the system for efficient proton transfer to the active site. This emphasizes the role of the protein in tuning the electrostatic environment of its cofactors and highlights the possible long-range electrostatic effects.

Transfer in motion discrimination learning was no greater in double training than in single training.

PubMed

Huang, Jinfeng; Liang, Ju; Zhou, Yifeng; Liu, Zili

2017-06-01

We investigated the controversy regarding double training in motion discrimination learning. We collected data from 43 participants in a motion direction discrimination learning task with either double training (i.e., training plus exposure) or single training (i.e., no exposure). By pooling these data with those in the literature, we had data in double training from 28 participants and in single training from 36 participants. We found that, in double training, the transfer along the exposed direction was less than that along the trained direction, indicating incomplete transfer. Importantly, the transfer in double training was not reliably greater than that in single training.

Charge migration and charge transfer in molecular systems

PubMed Central

Wörner, Hans Jakob; Arrell, Christopher A.; Banerji, Natalie; Cannizzo, Andrea; Chergui, Majed; Das, Akshaya K.; Hamm, Peter; Keller, Ursula; Kraus, Peter M.; Liberatore, Elisa; Lopez-Tarifa, Pablo; Lucchini, Matteo; Meuwly, Markus; Milne, Chris; Moser, Jacques-E.; Rothlisberger, Ursula; Smolentsev, Grigory; Teuscher, Joël; van Bokhoven, Jeroen A.; Wenger, Oliver

2017-01-01

The transfer of charge at the molecular level plays a fundamental role in many areas of chemistry, physics, biology and materials science. Today, more than 60 years after the seminal work of R. A. Marcus, charge transfer is still a very active field of research. An important recent impetus comes from the ability to resolve ever faster temporal events, down to the attosecond time scale. Such a high temporal resolution now offers the possibility to unravel the most elementary quantum dynamics of both electrons and nuclei that participate in the complex process of charge transfer. This review covers recent research that addresses the following questions. Can we reconstruct the migration of charge across a molecule on the atomic length and electronic time scales? Can we use strong laser fields to control charge migration? Can we temporally resolve and understand intramolecular charge transfer in dissociative ionization of small molecules, in transition-metal complexes and in conjugated polymers? Can we tailor molecular systems towards specific charge-transfer processes? What are the time scales of the elementary steps of charge transfer in liquids and nanoparticles? Important new insights into each of these topics, obtained from state-of-the-art ultrafast spectroscopy and/or theoretical methods, are summarized in this review. PMID:29333473

Effects of image charges, interfacial charge discreteness, and surface roughness on the zeta potential of spherical electric double layers.

PubMed

Gan, Zecheng; Xing, Xiangjun; Xu, Zhenli

2012-07-21

We investigate the effects of image charges, interfacial charge discreteness, and surface roughness on spherical electric double layer structures in electrolyte solutions with divalent counterions in the setting of the primitive model. By using Monte Carlo simulations and the image charge method, the zeta potential profile and the integrated charge distribution function are computed for varying surface charge strengths and salt concentrations. Systematic comparisons were carried out between three distinct models for interfacial charges: (1) SURF1 with uniform surface charges, (2) SURF2 with discrete point charges on the interface, and (3) SURF3 with discrete interfacial charges and finite excluded volume. By comparing the integrated charge distribution function and the zeta potential profile, we argue that the potential at the distance of one ion diameter from the macroion surface is a suitable location to define the zeta potential. In SURF2 model, we find that image charge effects strongly enhance charge inversion for monovalent interfacial charges, and strongly suppress charge inversion for multivalent interfacial charges. For SURF3, the image charge effect becomes much smaller. Finally, with image charges in action, we find that excluded volumes (in SURF3) suppress charge inversion for monovalent interfacial charges and enhance charge inversion for multivalent interfacial charges. Overall, our results demonstrate that all these aspects, i.e., image charges, interfacial charge discreteness, their excluding volumes, have significant impacts on zeta potentials of electric double layers.

On integrable boundaries in the 2 dimensional O(N) σ-models

NASA Astrophysics Data System (ADS)

Aniceto, Inês; Bajnok, Zoltán; Gombor, Tamás; Kim, Minkyoo; Palla, László

2017-09-01

We make an attempt to map the integrable boundary conditions for 2 dimensional non-linear O(N) σ-models. We do it at various levels: classically, by demanding the existence of infinitely many conserved local charges and also by constructing the double row transfer matrix from the Lax connection, which leads to the spectral curve formulation of the problem; at the quantum level, we describe the solutions of the boundary Yang-Baxter equation and derive the Bethe-Yang equations. We then show how to connect the thermodynamic limit of the boundary Bethe-Yang equations to the spectral curve.

Electronic phase transition in hollandite titanates BaxTi8O16 +δ

NASA Astrophysics Data System (ADS)

Murata, R.; Sato, T.; Okuda, T.; Horibe, Y.; Tsukasaki, H.; Mori, S.; Yamaguchi, N.; Sugimoto, K.; Kawaguchi, S.; Takata, M.; Katsufuji, T.

2015-12-01

We studied the physical properties of hollandite titanates, BaxTi8O16 +δ , which have double chains of edge-sharing TiO6 octahedra with d electrons in the t2 g states. We found that there is an electronic phase transition at ˜220 K, at which various properties exhibit anomalies. This phase transition is characterized by a modulation in the TiO6 chains and a spectral weight transfer of over 2 eV in the optical conductivity spectrum, which are presumably caused by charge and orbital ordering of the Ti t2 g electrons.

Excited-State Dynamics of a DNA Duplex in a Deep Eutectic Solvent Probed by Femtosecond Time-Resolved IR Spectroscopy.

PubMed

de La Harpe, Kimberly; Kohl, Forrest R; Zhang, Yuyuan; Kohler, Bern

2018-03-08

To better understand how the solvent influences excited-state deactivation in DNA strands, femtosecond time-resolved IR (fs-TRIR) pump-probe measurements were performed on a d(AT) 9 ·d(AT) 9 duplex dissolved in a deep eutectic solvent (DES) made from choline chloride and ethylene glycol in a 1:2 mol ratio. This solvent, known as ethaline, is a member of a class of ionic liquids capable of solubilizing DNA with minimal disruption to its secondary structure. UV melting analysis reveals that the duplex studied here melts at 18 °C in ethaline compared to 50 °C in aqueous solution. Ethaline has an excellent transparency window that facilitates TRIR measurements in the double-bond stretching region. Transient spectra recorded in deuterated ethaline at room temperature indicate that photoinduced intrastrand charge transfer occurs from A to T, yielding the same exciplex state previously detected in aqueous solution. This state decays via charge recombination with a lifetime of 380 ± 10 ps compared to the 300 ± 10 ps lifetime measured earlier in D 2 O solution. The TRIR data strongly suggest that the long-lived exciplex forms exclusively in the solvated duplex, and not in the denatured single strands, which appear to have little, if any, base stacking. The longer lifetime of the exciplex state in the DES compared to aqueous solution is suggested to arise from reduced stabilization of the charge transfer state, resulting in slower charge recombination on account of Marcus inverted behavior.

Electron capture in collisions of S4+ with helium

NASA Astrophysics Data System (ADS)

Wang, J. G.; Turner, A. R.; Cooper, D. L.; Schultz, D. R.; Rakovic, M. J.; Fritsch, W.; Stancil, P. C.; Zygelman, B.

2002-07-01

Charge transfer due to collisions of ground-state S4+(3s2 1S) ions with helium is investigated for energies between 0.1 meV u-1 and 10 MeV u-1. Total and state-selective single electron capture (SEC) cross sections and rate coefficients are obtained utilizing the quantum mechanical molecular-orbital close-coupling (MOCC), atomic-orbital close-coupling (AOCC), classical trajectory Monte Carlo (CTMC) and continuum distorted wave methods. The MOCC calculations utilize ab initio adiabatic potentials and nonadiabatic radial coupling matrix elements obtained with the spin-coupled valence-bond approach. Previous data are limited to a calculation of the total SEC rate coefficient using the Landau-Zener model that is, in comparison to the results presented here, three orders of magnitude smaller. The MOCC SEC cross sections at low energy reveal a multichannel interference effect. True double capture is also investigated with the AOCC and CTMC approaches while autoionizing double capture and transfer ionization (TI) is explored with CTMC. SEC is found to be the dominant process except for E>200 keV u-1 when TI becomes the primary capture channel. Astrophysical implications are briefly discussed.

Impact of charge-transfer excitons in regioregular polythiophene on the charge separation at polythiophene-fullerene heterojunctions

NASA Astrophysics Data System (ADS)

Polkehn, M.; Tamura, H.; Burghardt, I.

2018-01-01

This study addresses the mechanism of ultrafast charge separation in regioregular oligothiophene-fullerene assemblies representative of poly-3-hexylthiophene (P3HT)-[6,6]-phenyl-C61 butyric acid methyl ester (PCBM) heterojunctions, with special emphasis on the inclusion of charge transfer excitons in the oligothiophene phase. The formation of polaronic inter-chain charge separated species in highly ordered oligothiophene has been demonstrated in recent experiments and could have a significant impact on the net charge transfer to the fullerene acceptor. The present approach combines a first-principles parametrized multi-site Hamiltonian, based on time-dependent density functional theory calculations, with accurate quantum dynamics simulations using the multi-layer multi-configuration time-dependent Hartree method. Quantum dynamical studies are carried out for up to 182 electronic states and 112 phonon modes. The present analysis follows up on our previous study of (Huix-Rotllant et al 2015 J. Phys. Chem. Lett. 6 1702) and significantly expands the scope of this analysis by including the dynamical role of charge transfer excitons. Our investigation highlights the pronounced mixing of photogenerated Frenkel excitons with charge transfer excitons in the oligothiophene domain, and the opening of new transfer channels due the creation of such charge-separated species. As a result, it turns out that the interfacial donor/acceptor charge transfer state can be largely circumvented due to the presence of charge transfer excitons. However, the latter states in turn act as a trap, such that the free carrier yield observed on ultrafast time scales is tangibly reduced. The present analysis underscores the complexity of the transfer pathways at P3HT-PCBM type junctions.

Anomalous double-stripe charge ordering in β -NaFe2O3 with double triangular layers consisting of almost perfect regular Fe4 tetrahedra

NASA Astrophysics Data System (ADS)

Kobayashi, Shintaro; Ueda, Hiroaki; Michioka, Chishiro; Yoshimura, Kazuyoshi; Nakamura, Shin; Katsufuji, Takuro; Sawa, Hiroshi

2018-05-01

The physical properties of the mixed-valent iron oxide β -NaFe2O3 were investigated by means of synchrotron radiation x-ray diffraction, magnetization, electrical resistivity, differential scanning calorimetry, 23Na NMR, and 57FeM o ̈ssbauer measurements. This compound has double triangular layers consisting of almost perfect regular Fe4 tetrahedra, which suggests geometrical frustration. We found that this compound exhibits an electrostatically unstable double-stripe-type charge ordering, which is stabilized by the cooperative compression of Fe3 +O6 octahedra, owing to a valence change and Fe2 +O6 octahedra due to Jahn-Teller distortion. Our results indicate the importance of electron-phonon coupling for charge ordering in the region of strong charge frustration.

Substituent and Solvent Effects on Excited State Charge Transfer Behavior of Highly Fluorescent Dyes Containing Thiophenylimidazole-Based Aldehydes

NASA Technical Reports Server (NTRS)

Santos, Javier; Bu, Xiu R.; Mintz, Eric A.

2001-01-01

The excited state charge transfer for a series of highly fluorescent dyes containing thiophenylimidazole moiety was investigated. These systems follow the Twisted Intramolecular Charge Transfer (TICT) model. Dual fluorescence was observed for each substituted dye. X-ray structures analysis reveals a twisted ground state geometry for the donor substituted aryl on the 4 and 5 position at the imidazole ring. The excited state charge transfer was modeled by a linear solvation energy relationship using Taft's pi and Dimroth's E(sub T)(30) as solvent parameters. There is linear relation between the energy of the fluorescence transition and solvent polarity. The degree of stabilization of the excited state charge transfer was found to be consistent with the intramolecular molecular charge transfer. Excited dipole moment was studied by utilizing the solvatochromic shift method.

Chemically assembled double-dot single-electron transistor analyzed by the orthodox model considering offset charge

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kano, Shinya; Maeda, Kosuke; Majima, Yutaka, E-mail: majima@msl.titech.ac.jp

2015-10-07

We present the analysis of chemically assembled double-dot single-electron transistors using orthodox model considering offset charges. First, we fabricate chemically assembled single-electron transistors (SETs) consisting of two Au nanoparticles between electroless Au-plated nanogap electrodes. Then, extraordinary stable Coulomb diamonds in the double-dot SETs are analyzed using the orthodox model, by considering offset charges on the respective quantum dots. We determine the equivalent circuit parameters from Coulomb diamonds and drain current vs. drain voltage curves of the SETs. The accuracies of the capacitances and offset charges on the quantum dots are within ±10%, and ±0.04e (where e is the elementary charge),more » respectively. The parameters can be explained by the geometrical structures of the SETs observed using scanning electron microscopy images. Using this approach, we are able to understand the spatial characteristics of the double quantum dots, such as the relative distance from the gate electrode and the conditions for adsorption between the nanogap electrodes.« less

Nonequilibrium electrokinetic effects in beds of ion-permselective particles.

PubMed

Leinweber, Felix C; Tallarek, Ulrich

2004-12-21

Electrokinetic transport of fluorescent tracer molecules in a bed of porous glass beads was investigated by confocal laser scanning microscopy. Refractive index matching between beads and the saturating fluid enabled a quantitative analysis of intraparticle and extraparticle fluid-side concentration profiles. Kinetic data were acquired for the uptake and release of electroneutral and counterionic tracer under devised conditions with respect to constant pressure-driven flow through the device and the effect of superimposed electrical fields. Transport of neutral tracer is controlled by intraparticle mass transfer resistance which can be strongly reduced by electroosmotic flow, while steady-state distributions and bead-averaged concentrations are unaffected by the externally applied fields. Electrolytes of low ionic strength caused the transport through the charged (mesoporous) beads to become highly ion-permselective, and concentration polarization is induced in the bulk solution due to the superimposed fields. The depleted concentration polarization zone comprises extraparticle fluid-side mass transfer resistance. Ionic concentrations in this diffusion boundary layer decrease at increasing field strength, and the flux densities approach an upper limit. Meanwhile, intraparticle transport of counterions by electromigration and electroosmosis continues to increase and finally exceeds the transport from bulk solution into the beads. A nonequilibrium electrical double layer is induced which consists of mobile and immobile space charge regions in the extraparticle bulk solution and inside a bead, respectively. These electrical field-induced space charges form the basis for nonequilibrium electrokinetic phenomena. Caused by the underlying transport discrimination (intraparticle electrokinetic vs extraparticle boundary-layer mass transfer), the dynamic adsorption capacity for counterions can be drastically reduced. Further, the extraparticle mobile space charge region leads to nonlinear electroosmosis. Flow patterns can become highly chaotic, and electrokinetic instability mixing is shown to increase lateral dispersion. Under these conditions, the overall axial dispersion of counterionic tracer can be reduced by more than 2 orders of magnitude, as demonstrated by pulse injections.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gendron, Frederic; Fleischauer, Valerie R.; Duignan, Thomas J.

Here, we present a combined ab initio theoretical and experimental study of the magnetic circular dichroism (MCD) spectrum of the octahedral UCl 6- complex ion in the UV-Vis spectral region. The ground state is an orbitally non-degenerate doublet E 5/2u and the MCD is a $C$-term spectrum caused by spin–orbit coupling. Calculations of the electronic spectrum at various levels of theory indicate that differential dynamic electron correlation has a strong influence on the energies of the dipole-allowed transitions and the envelope of the MCD spectrum. The experimentally observed bands are assigned to dipole-allowed ligand-to-metal charge transfer into the 5f shell,more » and 5f to 6d transitions. Charge transfer excitations into the U 6d shell appear at much higher energies. The MCD-allowed transitions can be assigned via their signs of the $C$-terms: Under O h double group symmetry, E 5/2u → E 5/2g transitions have negative $C$-terms whereas E 5/2u → F 3/2g transitions have positive $C$-terms if the ground state g-factor is negative, as it is the case for UCl 6-.« less

Nanostructured pseudocapacitive materials decorated 3D graphene foam electrodes for next generation supercapacitors.

PubMed

Patil, Umakant; Lee, Su Chan; Kulkarni, Sachin; Sohn, Ji Soo; Nam, Min Sik; Han, Suhyun; Jun, Seong Chan

2015-04-28

Nowadays, advancement in performance of proficient multifarious electrode materials lies conclusively at the core of research concerning energy storage devices. To accomplish superior capacitance performance the requirements of high capacity, better cyclic stability and good rate capability can be expected from integration of electrochemical double layer capacitor based carbonaceous materials (high power density) and pseudocapacitive based metal hydroxides/oxides or conducting polymers (high energy density). The envisioned three dimensional (3D) graphene foams are predominantly advantageous to extend potential applicability by offering a large active surface area and a highly conductive continuous porous network for fast charge transfer with decoration of nanosized pseudocapacitive materials. In this article, we review the latest methodologies and performance evaluation for several 3D graphene based metal oxides/hydroxides and conducting polymer electrodes with improved electrochemical properties for next-generation supercapacitors. The most recent research advancements of our and other groups in the field of 3D graphene based electrode materials for supercapacitors are discussed. To assess the studied materials fully, a careful interpretation and rigorous scrutiny of their electrochemical characteristics is essential. Auspiciously, both nano-structuration as well as confinement of metal hydroxides/oxides and conducting polymers onto a conducting porous 3D graphene matrix play a great role in improving the performance of electrodes mainly due to: (i) active material access over large surface area with fast charge transportation; (ii) synergetic effect of electric double layer and pseudocapacitive based charge storing.

Spontaneous charged lipid transfer between lipid vesicles.

PubMed

Richens, Joanna L; Tyler, Arwen I I; Barriga, Hanna M G; Bramble, Jonathan P; Law, Robert V; Brooks, Nicholas J; Seddon, John M; Ces, Oscar; O'Shea, Paul

2017-10-03

An assay to study the spontaneous charged lipid transfer between lipid vesicles is described. A donor/acceptor vesicle system is employed, where neutrally charged acceptor vesicles are fluorescently labelled with the electrostatic membrane probe Fluoresceinphosphatidylethanolamine (FPE). Upon addition of charged donor vesicles, transfer of negatively charged lipid occurs, resulting in a fluorescently detectable change in the membrane potential of the acceptor vesicles. Using this approach we have studied the transfer properties of a range of lipids, varying both the headgroup and the chain length. At the low vesicle concentrations chosen, the transfer follows a first-order process where lipid monomers are transferred presumably through the aqueous solution phase from donor to acceptor vesicle. The rate of transfer decreases with increasing chain length which is consistent with energy models previously reported for lipid monomer vesicle interactions. Our assay improves on existing methods allowing the study of a range of unmodified lipids, continuous monitoring of transfer and simplified experimental procedures.

High-efficiency piezoelectric micro harvester for collecting low-frequency mechanical energy.

PubMed

Li, Xin; Song, Jinhui; Feng, Shuanglong; Xie, Xiong; Li, Zhenhu; Wang, Liang; Pu, Yayun; Soh, Ai Kah; Shen, Jun; Lu, Wenqiang; Liu, Shuangyi

2016-12-02

A single-layer zinc oxide (ZnO) nanorod array-based micro energy harvester was designed and integrated with a piezoelectric metacapacitor. The device presents outstanding low-frequency (1-10 Hz) mechanical energy harvesting capabilities. When compared with conventional pristine ZnO nanostructured piezoelectric harvesters or generators, both open-circuit potential and short-circuit current are significantly enhanced (up to 3.1 V and 124 nA cm -2 ) for a single mechanical knock (∼34 kPa). Higher electromechanical conversion efficiency (1.3 pC/Pa) is also observed. The results indicate that the integration of the piezoelectric metacapacitor is a crucial factor for improving the low-frequency energy harvesting performance. A double piezoelectric-driven mechanism is proposed to explain current higher output power, in which the metacapacitor plays the multiple roles of charge pumping, storing and transferring. An as-fabricated prototype device for lighting an LED demonstrates high power transference capability, with over 95% transference efficiency to the external load.

Controlling Emergent Ferromagnetism at Complex Oxide Interfaces

NASA Astrophysics Data System (ADS)

Grutter, Alexander

The emergence of complex magnetic ground states at ABO3 perovskite heterostructure interfaces is among the most promising routes towards highly tunable nanoscale materials for spintronic device applications. Despite recent progress, isolating and controlling the underlying mechanisms behind these emergent properties remains a highly challenging materials physics problems. In particular, generating and tuning ferromagnetism localized at the interface of two non-ferromagnetic materials is of fundamental and technological interest. An ideal model system in which to study such effects is the CaRuO3/CaMnO3 interface, where the constituent materials are paramagnetic and antiferromagnetic in the bulk, respectively. Due to small fractional charge transfer to the CaMnO3 (0.07 e-/Mn) from the CaRuO3, the interfacial Mn ions are in a canted antiferromagnetic state. The delicate balance between antiferromagnetic superexchange and ferromagnetic double exchange results in a magnetic ground state which is extremely sensitive to perturbations. We exploit this sensitivity to achieve control of the magnetic interface, tipping the balance between ferromagnetic and antiferromagnetic interactions through octahedral connectivity modification. Such connectivity effects are typically tightly confined to interfaces, but by targeting a purely interfacial emergent magnetic system, we achieve drastic alterations to the magnetic ground state. These results demonstrate the extreme sensitivity of the magnetic state to the magnitude of the charge transfer, suggesting the potential for direct electric field control. We achieve such electric field control through direct back gating of a CaRuO3/CaMnO3 bilayer. Thus, the CaRuO3/CaMnO3 system provides new insight into how charge transfer, interfacial symmetry, and electric fields may be used to control ferromagnetism at the atomic scale.

Laboratory Studies of Thermal Energy Charge Transfer of Silicon and Iron Ions in Astrophysical Plasmas

NASA Technical Reports Server (NTRS)

Kwong, Victor H. S.

1996-01-01

Charge transfer at electron-volt energies between multiply charged atomic ions and neutral atoms and molecules is of considerable importance in astrophysics, plasma physics, and in particular, fusion plasmas. In the year covered by this report, several major tasks were completed. These include: (1) the re-calibration of the ion gauge to measure the absolute particle densities of H2, He, N2, and CO for our current measurements; (2) the analysis of data for charge transfer reactions of N(exp 2 plus) ion and He, H2, N2, and CO; (3) measurement and data analysis of the charge transfer reaction of (Fe(exp 2 plus) ion and H2; (4) charge transfer measurement of Fe(exp 2 plus) ion and H2; and (5) redesign and modification of the ion detection and data acquisition system for the low energy beam facility (reflection time of flight mass spectrometer) dedicated to the study of state select charge transfer.

Double-layered cell transfer technology for bone regeneration

PubMed Central

Akazawa, Keiko; Iwasaki, Kengo; Nagata, Mizuki; Yokoyama, Naoki; Ayame, Hirohito; Yamaki, Kazumasa; Tanaka, Yuichi; Honda, Izumi; Morioka, Chikako; Kimura, Tsuyoshi; Komaki, Motohiro; Kishida, Akio; Izumi, Yuichi; Morita, Ikuo

2016-01-01

For cell-based medicine, to mimic in vivo cellular localization, various tissue engineering approaches have been studied to obtain a desirable arrangement of cells on scaffold materials. We have developed a novel method of cell manipulation called “cell transfer technology”, enabling the transfer of cultured cells onto scaffold materials, and controlling cell topology. Here we show that using this technique, two different cell types can be transferred onto a scaffold surface as stable double layers or in patterned arrangements. Various combinations of adherent cells were transferred to a scaffold, amniotic membrane, in overlapping bilayers (double-layered cell transfer), and transferred cells showed stability upon deformations of the material including folding and trimming. Transplantation of mesenchymal stem cells from periodontal ligaments (PDLSC) and osteoblasts, using double-layered cell transfer significantly enhanced bone formation, when compared to single cell type transplantation. Our findings suggest that this double-layer cell transfer is useful to produce a cell transplantation material that can bear two cell layers. Moreover, the transplantation of an amniotic membrane with PDLSCs/osteoblasts by cell transfer technology has therapeutic potential for bone defects. We conclude that cell transfer technology provides a novel and unique cell transplantation method for bone regeneration. PMID:27624174

Liouville master equation for multielectron dynamics: Neutralization of highly charged ions near a LiF surface

NASA Astrophysics Data System (ADS)

Wirtz, Ludger; Reinhold, Carlos O.; Lemell, Christoph; Burgdörfer, Joachim

2003-01-01

We present a simulation of the neutralization of highly charged ions in front of a lithium fluoride surface including the close-collision regime above the surface. The present approach employs a Monte Carlo solution of the Liouville master equation for the joint probability density of the ionic motion and the electronic population of the projectile and the target surface. It includes single as well as double particle-hole (de)excitation processes and incorporates electron correlation effects through the conditional dynamics of population strings. The input in terms of elementary one- and two-electron transfer rates is determined from classical trajectory Monte Carlo calculations as well as quantum-mechanical Auger calculations. For slow projectiles and normal incidence, the ionic motion depends sensitively on the interplay between image acceleration towards the surface and repulsion by an ensemble of positive hole charges in the surface (“trampoline effect”). For Ne10+ we find that image acceleration is dominant and no collective backscattering high above the surface takes place. For grazing incidence, our simulation delineates the pathways to complete neutralization. In accordance with recent experimental observations, most ions are reflected as neutral or even as singly charged negative particles, irrespective of the charge state of the incoming ions.

Structure and Energetics of Clusters Relevant to Thorium Tetrachloride Melts

NASA Astrophysics Data System (ADS)

Akdeniz, Z.; Tosi, M. P.

2000-10-01

We study within an ionic model the structure and energetics of neutral and charged molecular clusters which may be relevant to molten ThCl4 and to its liquid mixtures with alkali chlorides, with reference to Raman scattering experiments by Photiadis and Papatheodorou. As stressed by these authors, the most striking facts for ThCl4 in comparison to other tetrachloride compounds (and in particular to ZrCl4) are the appreciable ionic conductivity of the pure melt and the continuous structural changes which occur in the melt mixtures with varying composition. After adjusting our model to data on the isolated ThCl4 tetrahedral molecule, we evaluate (i) the Th2Cl8 dimer and the singly charged species obtained from it by chlorine-ion transfer between two such neutral dimers; (ii) the ThCl6 and ThCl7 clusters both as charged anions and as alkali-compensated species; and (iii) various oligomers carrying positive or negative double charges. Our study shows that the characteristic structural properties of the ThCl4 compound and of the alkali-Th chloride systems are the consequence of the relatively high ionic character of the binding, which is already evident in the isolated ThCl4 monomer.

Liouville master equation for multi-electron dynamics during ion-surface interactions

NASA Astrophysics Data System (ADS)

Wirtz, L.; Reinhold, C. O.; Lemell, C.; Burgdorfer, J.

2003-05-01

We present a simulation of the neutralization of highly charged ions in front of a LiF(100) surface including the close-collision regime above the surface. Our approach employs a Monte-Carlo solution of the Liouville master equation for the joint probability density of the ionic motion and the electronic population of the projectile and the target surface. It includes single as well as double particle-hole (de)excitation processes and incorporates electron correlation effects through the conditional dynamics of population strings. The input in terms of elementary one- and two-electron transfer rates is determined from CTMC calculations as well as quantum mechanical Auger calculations. For slow projectiles and normal incidence, the ionic motion depends sensitively on the interplay between image acceleration towards the surface and repulsion by an ensemble of positive hole charges in the surface (``trampoline effect"). For Ne10+ ions we find that image acceleration dominates and no collective backscattering high above the surface takes place. For grazing incidence, our simulation delineates the pathways to complete neutralization. In accordance with recent experimental observations, most ions are reflected as neutrals or even as singly charged negative particles, irrespective of the charge state of the incoming ion.

Molecular orbital (SCF-Xα-SW) theory of metal-metal charge transfer processes in minerals - II. Application to Fe2+ --> Ti4+ charge transfer transitions in oxides and silicates

USGS Publications Warehouse

Sherman, David M.

1987-01-01

A molecular orbital description, based on Xα-Scattered wave calculations on a (FeTiO10)14− cluster, is given for Fe2+ → Ti4+ charge transfer transitions in minerals. The calculated energy for the lowest Fe2+ → Ti4+ metal-metal charge transfer transition is 18040 cm−1 in reasonable agreement with energies observed in the optical spectra of Fe-Ti oxides and silicates. As in the case of Fe2+ → Fe3+ charge transfer in mixed-valence iron oxides and silicates, Fe2+ → Ti4+ charge transfer is associated with Fe-Ti bonding across shared polyhedral edges. Such bonding results from the overlap of the Fe(t 2g ) and Ti(t 2g ) 3d orbitals.

Charge transfer transitions in optical spectra of NicMg1-cO oxides

NASA Astrophysics Data System (ADS)

Churmanov, V. N.; Sokolov, V. I.; Pustovarov, V. A.; Gruzdev, N. B.; Uimin, M. A.; Byzov, I. V.; Druzhinin, A. V.; Korolyov, A. V.; Kim, G. A.; Zatsepin, A. F.; Kuznetsova, J. A.

2017-04-01

Radiative recombination with charge transfer was observed in NicMg1-cO (c = 0.008) oxides over the 8-300 K temperature range. This recombination occurs as a result of strong hybridization of the Ni2+ ion 3d-states and the band states. The charge transfer radiation excitation spectrum shows vibrational LO repeats of two exciton lines having charge transfer energy intervals of about 35 meV. The NiO nanocrystal absorption spectrum shows two weak peaks with energies of 3.510 and 3.543 eV, which are highly dependent on temperature. They are interpreted as charge transfer excitons at the edge of NiO fundamental absorption. The distance between the charge transfer exciton lines in the NicMg1-cO oxide spectra are caused by spin-orbit splitting of the valence band peak that was formed by the p-states of the oxygen ion.

Calculation of rates of exciton dissociation into hot charge-transfer states in model organic photovoltaic interfaces

NASA Astrophysics Data System (ADS)

Vázquez, Héctor; Troisi, Alessandro

2013-11-01

We investigate the process of exciton dissociation in ordered and disordered model donor/acceptor systems and describe a method to calculate exciton dissociation rates. We consider a one-dimensional system with Frenkel states in the donor material and states where charge transfer has taken place between donor and acceptor. We introduce a Green's function approach to calculate the generation rates of charge-transfer states. For disorder in the Frenkel states we find a clear exponential dependence of charge dissociation rates with exciton-interface distance, with a distance decay constant β that increases linearly with the amount of disorder. Disorder in the parameters that describe (final) charge-transfer states has little effect on the rates. Exciton dissociation invariably leads to partially separated charges. In all cases final states are “hot” charge-transfer states, with electron and hole located far from the interface.

Initiation of oncogenic transformation in human mammary epithelial cells by charged particles

NASA Technical Reports Server (NTRS)

Yang, T. C.; Georgy, K. A.; Craise, L. M.; Durante, M.

1997-01-01

Experimental studies have shown that high linear-energy transfer (LET) charged particles can be more effective than x-rays and gamma-rays in inducing oncogenic transformation in cultured cells and tumors in animals. Based on these results, experiments were designed and performed with an immortal human mammary epithelial cell line (H184B5), and several clones transformed by heavy ions were obtained. Cell fusion experiments were subsequently done, and results indicate that the transforming gene(s) is recessive. Chromosome analysis with fluorescence in situ hybridization (FISH) techniques also showed additional translocations in transformed human mammary epithelial cells. In addition, studies with these cell lines indicate that heavy ions can effectively induce deletion, break, and dicentrics. Deletion of tumor suppressor gene(s) and/or formation of translocation through DNA double strand breaks is a likely mechanism for the initiation of oncogenic transformation in human mammary epithelial cells.

Capillary electrophoresis electrospray ionization mass spectrometry interface

DOEpatents

Smith, Richard D.; Severs, Joanne C.

1999-01-01

The present invention is an interface between a capillary electrophoresis separation capillary end and an electrospray ionization mass spectrometry emitter capillary end, for transporting an anolyte sample from a capillary electrophoresis separation capillary to a electrospray ionization mass spectrometry emitter capillary. The interface of the present invention has: (a) a charge transfer fitting enclosing both of the capillary electrophoresis capillary end and the electrospray ionization mass spectrometry emitter capillary end; (b) a reservoir containing an electrolyte surrounding the charge transfer fitting; and (c) an electrode immersed into the electrolyte, the electrode closing a capillary electrophoresis circuit and providing charge transfer across the charge transfer fitting while avoiding substantial bulk fluid transfer across the charge transfer fitting. Advantages of the present invention have been demonstrated as effective in providing high sensitivity and efficient analyses.

A theoretical consideration of ion size effects on the electric double layer and voltammetry of nanometer-sized disk electrodes.

PubMed

Gao, Yu; Liu, Yuwen; Chen, Shengli

2016-12-12

Considering that an electric-double-layer (EDL) structure may significantly impact on the mass transport and charge transfer kinetics at the interfaces of nanometer-sized electrodes, while EDL structures could be altered by the finite sizes of electrolyte and redox ions, the possible effects of ion sizes on EDL structures and voltammetric responses of nanometer-sized disk (nanodisk) electrodes are investigated. Modified Boltzmann and Nernst-Planck (NP) equations, which include the influence of the finite ion volumes, are combined with the Poisson equation and modified Butler-Volmer equation to gain knowledge on how the finite sizes of ions and the nanometer sizes of electrodes may couple with each other to affect the structures and reactivities of a nanoscale electrochemical interface. Two typical ion radii, 0.38 nm and 0.68 nm, which could represent the sizes of the commonly used aqueous electrolyte ions (e.g., the solvated K + ) and the organic electrolyte ions (e.g., the solvated TEA + ) respectively, are considered. The finite size of ions can result in decreased screening of electrode charges, therefore magnifying EDL effects on the ion transport and the electron transfer at electrochemical interfaces. This finite size effect of ions becomes more pronounced for larger ions and at smaller electrodes as the electrode radii is larger than 10 nm. For electrodes with radii smaller than 10 nm, however, the ion size effect may be less pronounced with decreasing the electrode size. This can be explained in terms of the increased edge effect of disk electrodes at nanometer scales, which could relax the ion crowding at/near the outer Helmholtz plane. The conditions and situations under which the ion sizes may have a significant effect on the voltammetry of electrodes are discussed.

Probing the dependence of electron transfer on size and coverage in carbon nanotube-quantum dot heterostructures

DOE PAGES

Wang, Lei; Wong, Stanislaus S.; Han, Jinkyu; ...

2015-11-16

As a model system for understanding charge transfer in novel architectural designs for solar cells, double-walled carbon nanotube (DWNT)–CdSe quantum dot (QD) (QDs with average diameters of 2.3, 3.0, and 4.1 nm) heterostructures have been fabricated. The individual nanoscale building blocks were successfully attached and combined using a hole-trapping thiol linker molecule, i.e., 4-mercaptophenol (MTH), through a facile, noncovalent π–π stacking attachment strategy. Transmission electron microscopy confirmed the attachment of QDs onto the external surfaces of the DWNTs. We herein demonstrate a meaningful and unique combination of near-edge X-ray absorption fine structure (NEXAFS) and Raman spectroscopies bolstered by complementary electricalmore » transport measurements in order to elucidate the synergistic interactions between CdSe QDs and DWNTs, which are facilitated by the bridging MTH molecules that can scavenge photoinduced holes and potentially mediate electron redistribution between the conduction bands in CdSe QDs and the C 2p-derived states of the DWNTs. Specifically, we correlated evidence of charge transfer as manifested by (i) changes in the NEXAFS intensities of π* resonance in the C K-edge and Cd M3-edge spectra, (ii) a perceptible outer tube G-band downshift in frequency in Raman spectra, as well as (iii) alterations in the threshold characteristics present in transport data as a function of CdSe QD deposition onto the DWNT surface. Furthermore, the separate effects of (i) varying QD sizes and (ii) QD coverage densities on the electron transfer were independently studied.« less

Site energies and charge transfer rates near pentacene grain boundaries from first-principles calculations

NASA Astrophysics Data System (ADS)

Kobayashi, Hajime; Tokita, Yuichi

2015-03-01

Charge transfer rates near pentacene grain boundaries are derived by calculating the site energies and transfer integrals of 37 pentacene molecules using first-principles calculations. The site energies decrease considerably near the grain boundaries, and electron traps of up to 300 meV and hole barriers of up to 400 meV are generated. The charge transfer rates across the grain boundaries are found to be reduced by three to five orders of magnitude with a grain boundary gap of 4 Å because of the reduction in the transfer integrals. The electron traps and hole barriers also reduce the electron and hole transfer rates by factors of up to 10 and 50, respectively. It is essential to take the site energies into consideration to determine charge transport near the grain boundaries. We show that the complex site energy distributions near the grain boundaries can be represented by an equivalent site energy difference, which is a constant for any charge transfer pass. When equivalent site energy differences are obtained for various grain boundary structures by first-principles calculations, the effects of the grain boundaries on the charge transfer rates are introduced exactly into charge transport simulations, such as the kinetic Monte Carlo method.

Double Charge Exchange Reactions and Double Beta Decay

NASA Astrophysics Data System (ADS)

Auerbach, N.

2018-05-01

The subject of this presentation is at the forefront of nuclear physics, namely double beta decay. In particular one is most interested in the neutrinoless process of double beta decay, when the decay proceeds without the emission of two neutrinos. The observation of such decay would mean that the lepton conservation symmetry is violated and that the neutrinos are of Majorana type, meaning that they are their own anti-particles. The life time of this process has two unknowns, the mass of the neutrino and the nuclear matrix element. Determining the nuclear matrix element and knowing the cross-section well will set limits on the neutrino mass. There is a concentrated effort among the nuclear physics community to calculate this matrix element. Usually these matrix elements are a very small part of the total strength of the transition operators involved in the process. There is no simple way to “calibrate” the nuclear double beta decay matrix element. The double beta decay is a double charge exchange process, therefore it is proposed that double charge exchange reactions using ion projectiles on nuclei that are candidates for double beta decay, will provide additional necessary information about the nuclear matrix elements.

Charge Transfer and Orbital Level Alignment at Inorganic/Organic Interfaces: The Role of Dielectric Interlayers.

PubMed

Hollerer, Michael; Lüftner, Daniel; Hurdax, Philipp; Ules, Thomas; Soubatch, Serguei; Tautz, Frank Stefan; Koller, Georg; Puschnig, Peter; Sterrer, Martin; Ramsey, Michael G

2017-06-27

It is becoming accepted that ultrathin dielectric layers on metals are not merely passive decoupling layers, but can actively influence orbital energy level alignment and charge transfer at interfaces. As such, they can be important in applications ranging from catalysis to organic electronics. However, the details at the molecular level are still under debate. In this study, we present a comprehensive analysis of the phenomenon of charge transfer promoted by a dielectric interlayer with a comparative study of pentacene adsorbed on Ag(001) with and without an ultrathin MgO interlayer. Using scanning tunneling microscopy and photoemission tomography supported by density functional theory, we are able to identify the orbitals involved and quantify the degree of charge transfer in both cases. Fractional charge transfer occurs for pentacene adsorbed on Ag(001), while the presence of the ultrathin MgO interlayer promotes integer charge transfer with the lowest unoccupied molecular orbital transforming into a singly occupied and singly unoccupied state separated by a large gap around the Fermi energy. Our experimental approach allows a direct access to the individual factors governing the energy level alignment and charge-transfer processes for molecular adsorbates on inorganic substrates.

Multiconfiguration Pair-Density Functional Theory Outperforms Kohn-Sham Density Functional Theory and Multireference Perturbation Theory for Ground-State and Excited-State Charge Transfer.

PubMed

Ghosh, Soumen; Sonnenberger, Andrew L; Hoyer, Chad E; Truhlar, Donald G; Gagliardi, Laura

2015-08-11

The correct description of charge transfer in ground and excited states is very important for molecular interactions, photochemistry, electrochemistry, and charge transport, but it is very challenging for Kohn-Sham (KS) density functional theory (DFT). KS-DFT exchange-correlation functionals without nonlocal exchange fail to describe both ground- and excited-state charge transfer properly. We have recently proposed a theory called multiconfiguration pair-density functional theory (MC-PDFT), which is based on a combination of multiconfiguration wave function theory with a new type of density functional called an on-top density functional. Here we have used MC-PDFT to study challenging ground- and excited-state charge-transfer processes by using on-top density functionals obtained by translating KS exchange-correlation functionals. For ground-state charge transfer, MC-PDFT performs better than either the PBE exchange-correlation functional or CASPT2 wave function theory. For excited-state charge transfer, MC-PDFT (unlike KS-DFT) shows qualitatively correct behavior at long-range with great improvement in predicted excitation energies.

Review on charge transfer and chemical activity of TiO2: Mechanism and applications

NASA Astrophysics Data System (ADS)

Cai, Yongqing; Feng, Yuan Ping

2016-12-01

Charge separation and transfer at the interface between two materials play a significant role in various atomic-scale processes and energy conversion systems. In this review, we present the mechanism and outcome of charge transfer in TiO2, which is extensively explored for photocatalytic applications in the field of environmental science. We list several experimental and computational methods to estimate the amount of charge transfer. The effects of the work function, defects and doping, and employment of external electric field on modulating the charge transfer are presented. The interplay between the band bending and carrier transport across the surface and interface consisting of TiO2 is discussed. We show that the charge transfer can also strongly affect the behavior of deposited nanoparticles on TiO2 through built-in electric field that it creates. This review encompasses several advances of composite materials where TiO2 is combined with two-dimensional materials like graphene, MoS2, phosphorene, etc. The charge transport in the TiO2-organohalide perovskite with respect to the electron-hole separation at the interface is also discussed.

Measurements of 2νββ decay-matrix elements for mass A=64,76 and A=96 through charge-exchange reactions

NASA Astrophysics Data System (ADS)

Grewe, E.-W.; Frekers, D.

2006-07-01

We have used the (d,He2) charge-exchange reaction to obtain GT +-strength distributions in the nuclei 64Cu, 76As and 96Nb. These nuclei are the intermediate nuclei in the second-order perturbative description of the 64Zn double-beta plus ( β+β+) and the 76Ge and 96Zr double-beta minus ( β-β-) decays. By means of charge-exchange reactions on parent and daughter nucleus the double-beta decay matrix element can be deduced. In this contribution the measured excitation energy spectra are presented.

What Controls the Rate of Ultrafast Charge Transfer and Charge Separation Efficiency in Organic Photovoltaic Blends.

PubMed

Jakowetz, Andreas C; Böhm, Marcus L; Zhang, Jiangbin; Sadhanala, Aditya; Huettner, Sven; Bakulin, Artem A; Rao, Akshay; Friend, Richard H

2016-09-14

In solar energy harvesting devices based on molecular semiconductors, such as organic photovoltaics (OPVs) and artificial photosynthetic systems, Frenkel excitons must be dissociated via charge transfer at heterojunctions to yield free charges. What controls the rate and efficiency of charge transfer and charge separation is an important question, as it determines the overall power conversion efficiency (PCE) of these systems. In bulk heterojunctions between polymer donor and fullerene acceptors, which provide a model system to understand the fundamental dynamics of electron transfer in molecular systems, it has been established that the first step of photoinduced electron transfer can be fast, of order 100 fs. But here we report the first study which correlates differences in the electron transfer rate with electronic structure and morphology, achieved with sub-20 fs time resolution pump-probe spectroscopy. We vary both the fullerene substitution and donor/fullerene ratio which allow us to control both aggregate size and the energetic driving force for charge transfer. We observe a range of electron transfer times from polymer to fullerene, from 240 fs to as short as 37 fs. Using ultrafast electro-optical pump-push-photocurrent spectroscopy, we find the yield of free versus bound charges to be weakly dependent on the energetic driving force, but to be very strongly dependent on fullerene aggregate size and packing. Our results point toward the importance of state accessibility and charge delocalization and suggest that energetic offsets between donor and acceptor levels are not an important criterion for efficient charge generation. This provides design rules for next-generation materials to minimize losses related to driving energy and boost PCE.

The electrostatic properties of Fiber-Reinforced-Plastics double wall underground storage gasoline tanks

NASA Astrophysics Data System (ADS)

Li, Yipeng; Liu, Quanzhen; Meng, He; Sun, Lifu; Zhang, Yunpeng

2013-03-01

At present Fiber Reinforced Plastics (FRP) double wall underground storage gasoline tanks are wildly used. An FRP product with a resistance of more than 1011 Ω is a static non-conductor, so it is difficult for the static electricity in the FRP product to decay into the earth. In this paper an experimental system was built to simulate an automobile gasoline filling station. Some electrostatic parameters of the gasoline, including volume charge density, were tested when gasoline was unloaded into a FRP double wall underground storage tank. Measurements were taken to make sure the volume charge density in the oil-outlet was similar to the volume charge density in the tank. In most cases the volume charge density of the gasoline was more than 22.7 μC m-3, which is likely to cause electrostatic discharge in FRP double wall underground storage gasoline tanks. On the other hand, it would be hard to ignite the vapor by electrostatic discharge since the vapor pressure in the tanks is over the explosion limit. But when the tank is repaired or re-used, the operators must pay attention to the static electricity and some measurements should be taken to avoid electrostatic accident. Besides the relaxation time of charge in the FRP double wall gasoline storage tanks should be longer.

Double layer of platinum electrodes: Non-monotonic surface charging phenomena and negative double layer capacitance

NASA Astrophysics Data System (ADS)

Huang, Jun; Zhou, Tao; Zhang, Jianbo; Eikerling, Michael

2018-01-01

In this study, a refined double layer model of platinum electrodes accounting for chemisorbed oxygen species, oriented interfacial water molecules, and ion size effects in solution is presented. It results in a non-monotonic surface charging relation and a peculiar capacitance vs. potential curve with a maximum and possibly negative values in the potential regime of oxide-formation.

Incorporation of charge transfer into the explicit polarization fragment method by grand canonical density functional theory.

PubMed

Isegawa, Miho; Gao, Jiali; Truhlar, Donald G

2011-08-28

Molecular fragmentation algorithms provide a powerful approach to extending electronic structure methods to very large systems. Here we present a method for including charge transfer between molecular fragments in the explicit polarization (X-Pol) fragment method for calculating potential energy surfaces. In the conventional X-Pol method, the total charge of each fragment is preserved, and charge transfer between fragments is not allowed. The description of charge transfer is made possible by treating each fragment as an open system with respect to the number of electrons. To achieve this, we applied Mermin's finite temperature method to the X-Pol wave function. In the application of this method to X-Pol, the fragments are open systems that partially equilibrate their number of electrons through a quasithermodynamics electron reservoir. The number of electrons in a given fragment can take a fractional value, and the electrons of each fragment obey the Fermi-Dirac distribution. The equilibrium state for the electrons is determined by electronegativity equalization with conservation of the total number of electrons. The amount of charge transfer is controlled by re-interpreting the temperature parameter in the Fermi-Dirac distribution function as a coupling strength parameter. We determined this coupling parameter so as to reproduce the charge transfer energy obtained by block localized energy decomposition analysis. We apply the new method to ten systems, and we show that it can yield reasonable approximations to potential energy profiles, to charge transfer stabilization energies, and to the direction and amount of charge transferred. © 2011 American Institute of Physics

Incorporation of charge transfer into the explicit polarization fragment method by grand canonical density functional theory

PubMed Central

Isegawa, Miho; Gao, Jiali; Truhlar, Donald G.

2011-01-01

Molecular fragmentation algorithms provide a powerful approach to extending electronic structure methods to very large systems. Here we present a method for including charge transfer between molecular fragments in the explicit polarization (X-Pol) fragment method for calculating potential energy surfaces. In the conventional X-Pol method, the total charge of each fragment is preserved, and charge transfer between fragments is not allowed. The description of charge transfer is made possible by treating each fragment as an open system with respect to the number of electrons. To achieve this, we applied Mermin's finite temperature method to the X-Pol wave function. In the application of this method to X-Pol, the fragments are open systems that partially equilibrate their number of electrons through a quasithermodynamics electron reservoir. The number of electrons in a given fragment can take a fractional value, and the electrons of each fragment obey the Fermi–Dirac distribution. The equilibrium state for the electrons is determined by electronegativity equalization with conservation of the total number of electrons. The amount of charge transfer is controlled by re-interpreting the temperature parameter in the Fermi–Dirac distribution function as a coupling strength parameter. We determined this coupling parameter so as to reproduce the charge transfer energy obtained by block localized energy decomposition analysis. We apply the new method to ten systems, and we show that it can yield reasonable approximations to potential energy profiles, to charge transfer stabilization energies, and to the direction and amount of charge transferred. PMID:21895159

Characteristic Features of Double Layers in Rotating, Magnetized Plasma Contaminated with Dust Grains with Varying Charges

NASA Astrophysics Data System (ADS)

Paul, Jaydeep; Nag, Apratim; Devi, Karabi; Das, Himadri Sekhar

2018-03-01

The evolution and the characteristic features of double layers in a plasma under slow rotation and contaminated with dust grains with varying charges under the effect of an external magnetic field are studied. The Coriolis force resulting from the slow rotation is responsible for the generation of an equivalent magnetic field. A comparatively new pseudopotential approach has been used to derive the small amplitude double layers. The effect of the relative electron-ion concentration, as well as the temperature ratio, on the formation of the double layers has also been investigated. The study reveals that compressive, as well as rarefactive, double layers can be made to co-exist in plasma by controlling the dust charge fluctuation effect supplemented by variations of the plasma constituents. The effectiveness of slow rotation in causing double layers to exist has also emanated from the study. The results obtained could be of interest because of their possible applications in both laboratories and space.

Performing the Millikan experiment at the molecular scale: Determination of atomic Millikan-Thomson charges by computationally measuring atomic forces.

PubMed

Rogers, T Ryan; Wang, Feng

2017-10-28

An atomic version of the Millikan oil drop experiment is performed computationally. It is shown that for planar molecules, the atomic version of the Millikan experiment can be used to define an atomic partial charge that is free from charge flow contributions. We refer to this charge as the Millikan-Thomson (MT) charge. Since the MT charge is directly proportional to the atomic forces under a uniform electric field, it is the most relevant charge for force field developments. The MT charge shows good stability with respect to different choices of the basis set. In addition, the MT charge can be easily calculated even at post-Hartree-Fock levels of theory. With the MT charge, it is shown that for a planar water dimer, the charge transfer from the proton acceptor to the proton donor is about -0.052 e. While both planar hydrated cations and anions show signs of charge transfer, anions show a much more significant charge transfer to the hydration water than the corresponding cations. It might be important to explicitly model the ion charge transfer to water in a force field at least for the anions.

Structure of an electric double layer containing a 2:2 valency dimer electrolyte

DOE PAGES

Silvestre-Alcantara, Whasington; Henderson, Douglas; Wu, Jianzhong; ...

2014-12-05

In this study, the structure of a planar electric double layer formed by a 2:2 valency dimer electrolyte in the vicinity of a uniformly charged planar hard electrode is investigated using density functional theory and Monte Carlo simulations. The dimer electrolyte consists of a mixture of charged divalent dimers and charged divalent monomers in a dielectric continuum. A dimer is constructed by two tangentially tethered rigid spheres, one of which is divalent and positively charged and the other neutral, whereas the monomer is a divalent and negatively charged rigid sphere. The density functional theory reproduces well the simulation results formore » (i) the singlet distributions of the various ion species with respect to the electrode, and (ii) the mean electrostatic potential. Lastly, comparison with earlier results for a 2:1/1:2 dimer electrolyte shows that the double layer structure is similar when the counterion has the same valency.« less

Effects of Charge-Transfer Excitons on the Photophysics of Organic Semiconductors

NASA Astrophysics Data System (ADS)

Hestand, Nicholas J.

The field of organic electronics has received considerable attention over the past several years due to the promise of novel electronic materials that are cheap, flexible and light weight. While some devices based on organic materials have already emerged on the market (e.g. organic light emitting diodes), a deeper understanding of the excited states within the condensed phase is necessary both to improve current commercial products and to develop new materials for applications that are currently in the commercial pipeline (e.g. organic photovoltaics, wearable displays, and field effect transistors). To this end, a model for pi-conjugated molecular aggregates and crystals is developed and analyzed. The model considers two types of electronic excitations, namely Frenkel and charge-transfer excitons, both of which play a prominent role in determining the nature of the excited states within tightly-packed organic systems. The former consist of an electron-hole pair bound to the same molecule while in the later the electron and hole are located on different molecules. The model also considers the important nuclear reorganization that occurs when the system switches between electronic states. This is achieved using a Holstein-style Hamiltonian that includes linear vibronic coupling of the electronic states to the nuclear motion associated with the high frequency vinyl-stretching and ring-breathing modes. Analysis of the model reveals spectroscopic signatures of charge-transfer mediated J- and H-aggregation in systems where the photophysical properties are determined primarily by charge-transfer interactions. Importantly, such signatures are found to be sensitive to the relative phase of the intermolecular electron and hole transfer integrals, and the relative energy of the Frenkel and charge-transfer states. When the charge-transfer integrals are in phase and the energy of the charge-transfer state is higher than the Frenkel state, the system exhibits J-aggregate characteristics including a positive band curvature, a red shifted main absorption peak, and an increase in the ratio of the first two vibronic peaks relative to the monomer. On the other hand, when the charge-transfer integrals are out of phase and the energy of the charge-transfer state is higher than the Frenkel state, the system exhibits H-aggregate characteristics including a negative band curvature, a blue shifted main absorption peak, and a decrease in the ratio of the first two vibronic peaks relative to the monomer. Notably, these signatures are consistent with those exhibited by Coulombically coupled J- and H-aggregates. Additional signatures of charge-transfer J- and H-aggregation are also discovered, the most notable of which is the appearance of a second absorption band when the charge-transfer integrals are in phase and the charge-transfer and Frenkel excitons are near resonance. In such instances, the peak-to-peak spacing is found to be proportional to the sum of the electron and hole transfer integrals. Further analysis of the charge-transfer interactions within the context of an effective Frenkel exciton coupling reveals that the charge-transfer interactions interfere directly with the intermolecular Coulombic coupling. The interference can be either constructive or destructive resulting in either enhanced or suppressed J- or H- aggregate behavior relative to what is expected based on Coulombic coupling alone. Such interferences result in four new aggregate types, namely HH-, HJ-, JH-, and JJ-aggregates, where the first letter indicates the nature of the Coulombic coupling and the second indicates the nature of the charge-transfer coupling. Vibronic signatures of such aggregates are developed and provide a means by which to rapidly screen materials for certain electronic characteristics. Notably, a large total (Coulombic plus charge-transfer) exciton coupling is associated with an absorption spectrum in which the ratio of the first two vibronic peaks deviates significantly from that of the unaggregated monomer. Hence, strongly coupled, high exciton mobility aggregates can be readily distinguished from low mobility aggregates by the ratio of their first two vibronic peaks. (Abstract shortened by ProQuest.).

Creating and optimizing interfaces for electric-field and photon-induced charge transfer.

PubMed

Park, Byoungnam; Whitham, Kevin; Cho, Jiung; Reichmanis, Elsa

2012-11-27

We create and optimize a structurally well-defined electron donor-acceptor planar heterojunction interface in which electric-field and/or photon-induced charge transfer occurs. Electric-field-induced charge transfer in the dark and exciton dissociation at a pentacene/PCBM interface were probed by in situ thickness-dependent threshold voltage shift measurements in field-effect transistor devices during the formation of the interface. Electric-field-induced charge transfer at the interface in the dark is correlated with development of the pentacene accumulation layer close to PCBM, that is, including interface area, and dielectric relaxation time in PCBM. Further, we demonstrate an in situ test structure that allows probing of both exciton diffusion length and charge transport properties, crucial for optimizing optoelectronic devices. Competition between the optical absorption length and the exciton diffusion length in pentacene governs exciton dissociation at the interface. Charge transfer mechanisms in the dark and under illumination are detailed.

Electron Capture in Slow Collisions of Si4+ With Atomic Hydrogen

NASA Astrophysics Data System (ADS)

Joseph, D. C.; Gu, J. P.; Saha, B. C.

2009-10-01

In recent years the charge transfer involving Si4+ and H at low energies has drawn considerable attention both theoretically and experimentally due to its importance not only in astronomical environments but also in modern semiconductor industries. Accurate information regarding its molecular structures and interactions are essential to understand the low energy collision dynamics. Ab initio calculations are performed using the multireference single- and double-excitation configuration-interaction (MRD-CI) method to evaluate potential energies. State selective cross sections are calculate using fully quantum and semi-classical molecular-orbital close coupling (MOCC) methods in the adiabatic representation. Detail results will be presented in the conference.

A benchmark study of electronic excitation energies, transition moments, and excited-state energy gradients on the nicotine molecule

NASA Astrophysics Data System (ADS)

Egidi, Franco; Segado, Mireia; Koch, Henrik; Cappelli, Chiara; Barone, Vincenzo

2014-12-01

In this work, we report a comparative study of computed excitation energies, oscillator strengths, and excited-state energy gradients of (S)-nicotine, chosen as a test case, using multireference methods, coupled cluster singles and doubles, and methods based on time-dependent density functional theory. This system was chosen because its apparent simplicity hides a complex electronic structure, as several different types of valence excitations are possible, including n-π*, π-π*, and charge-transfer states, and in order to simulate its spectrum it is necessary to describe all of them consistently well by the chosen method.

A benchmark study of electronic excitation energies, transition moments, and excited-state energy gradients on the nicotine molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Egidi, Franco, E-mail: franco.egidi@sns.it; Segado, Mireia; Barone, Vincenzo, E-mail: vincenzo.barone@sns.it

In this work, we report a comparative study of computed excitation energies, oscillator strengths, and excited-state energy gradients of (S)-nicotine, chosen as a test case, using multireference methods, coupled cluster singles and doubles, and methods based on time-dependent density functional theory. This system was chosen because its apparent simplicity hides a complex electronic structure, as several different types of valence excitations are possible, including n-π{sup *}, π-π{sup *}, and charge-transfer states, and in order to simulate its spectrum it is necessary to describe all of them consistently well by the chosen method.

The NEXT-A (N-terminal EXtension with Transferase and ARS) reaction.

PubMed

Taki, Masumi; Kuroiwa, Hiroyuki; Sisido, Masahiko

2009-01-01

L/F-transferase is known to catalyze transfer of hydrophobic amino acids from aminoacyl tRNA to the N-terminus of a protein possessing lysine or arginine as the N-terminus. Combining L/F-transferase with E. coli phenylalanyl-tRNA synthetase (ARS), we achieved non-ribosomal N-terminal-specific introduction of various kinds of nonnatural amino acids to a protein. A nonnatural amino acid is once charged onto an E. coli tRNA(Phe) by a mutant ARS in situ, and successively transferred from the tRNA to a target protein, namely the NEXT-A reaction. Besides alphaA294G mutation on the ARS, alphaT251A, betaG318W, or betaA356W double-mutation were effective to increase the introduction efficiency through the NEXT-A reaction. Protein specific fluorescence labelling via the NEXT-A reaction followed by Huisgen cycloaddition was also demonstrated.

Megawatt level electric propulsion perspectives

NASA Technical Reports Server (NTRS)

Jahn, Robert G.; Kelly, Arnold J.

1987-01-01

For long range space missions, deliverable payload fraction is an inverse exponential function of the propellant exhaust velocity or specific impulse of the propulsion system. The exhaust velocity of chemical systems are limited by their combustion chemistry and heat transfer to a few km/s. Nuclear rockets may achieve double this range, but are still heat transfer limited and ponderous to develop. Various electric propulsion systems can achieve exhaust velocities in the 10 km/s range, at considerably lower thrust densities, but require an external electrical power source. A general overview is provided of the currently available electric propulsion systems from the perspective of their characteristics as a terminal load for space nuclear systems. A summary of the available electric propulsion options is shown and generally characterized in the power vs. exhaust velocity plot. There are 3 general classes of electric thruster devices: neutral gas heaters, plasma devices, and space charge limited electrostatic or ion thrusters.

Solvent effects on the excited-state double proton transfer mechanism in the 7-azaindole dimer: a TDDFT study with the polarizable continuum model.

PubMed

Yu, Xue-Fang; Yamazaki, Shohei; Taketsugu, Tetsuya

2017-08-30

Solvent effects on the excited-state double proton transfer (ESDPT) mechanism in the 7-azaindole (7AI) dimer were investigated using the time-dependent density functional theory (TDDFT) method. Excited-state potential energy profiles along the reaction paths in a locally excited (LE) state and a charge transfer (CT) state were calculated using the polarizable continuum model (PCM) to include the solvent effect. A series of non-polar and polar solvents with different dielectric constants were used to examine the polarity effect on the ESDPT mechanism. The present results suggest that in a non-polar solvent and a polar solvent with a small dielectric constant, ESDPT follows a concerted mechanism, similar to the case in the gas phase. In a polar solvent with a relatively large dielectric constant, however, ESDPT is likely to follow a stepwise mechanism via a stable zwitterionic intermediate in the LE state on the adiabatic potential energy surface, although inclusion of zero-point vibrational energy (ZPE) corrections again suggests the concerted mechanism. In the meantime, the stepwise reaction path involving the CT state with neutral intermediates is also examined, and is found to be less competitive than the concerted or stepwise path in the LE state in both non-polar and polar solvents. The present study provides a new insight into the experimental controversy of the ESDPT mechanism of the 7AI dimer in a solution.

Robust Stacking-Independent Ultrafast Charge Transfer in MoS2/WS2 Bilayers.

PubMed

Ji, Ziheng; Hong, Hao; Zhang, Jin; Zhang, Qi; Huang, Wei; Cao, Ting; Qiao, Ruixi; Liu, Can; Liang, Jing; Jin, Chuanhong; Jiao, Liying; Shi, Kebin; Meng, Sheng; Liu, Kaihui

2017-12-26

Van der Waals-coupled two-dimensional (2D) heterostructures have attracted great attention recently due to their high potential in the next-generation photodetectors and solar cells. The understanding of charge-transfer process between adjacent atomic layers is the key to design optimal devices as it directly determines the fundamental response speed and photon-electron conversion efficiency. However, general belief and theoretical studies have shown that the charge transfer behavior depends sensitively on interlayer configurations, which is difficult to control accurately, bringing great uncertainties in device designing. Here we investigate the ultrafast dynamics of interlayer charge transfer in a prototype heterostructure, the MoS 2 /WS 2 bilayer with various stacking configurations, by optical two-color ultrafast pump-probe spectroscopy. Surprisingly, we found that the charge transfer is robust against varying interlayer twist angles and interlayer coupling strength, in time scale of ∼90 fs. Our observation, together with atomic-resolved transmission electron characterization and time-dependent density functional theory simulations, reveals that the robust ultrafast charge transfer is attributed to the heterogeneous interlayer stretching/sliding, which provides additional channels for efficient charge transfer previously unknown. Our results elucidate the origin of transfer rate robustness against interlayer stacking configurations in optical devices based on 2D heterostructures, facilitating their applications in ultrafast and high-efficient optoelectronic and photovoltaic devices in the near future.

Supramolecular networks with electron transfer in two dimensions

DOEpatents

Stupp, Samuel I.; Stoddart, J. Fraser; Shveyd, Alexander K.; Tayi, Alok S.; Sue, Chi-Hau; Narayanan, Ashwin

2016-09-13

Organic charge-transfer (CT) co-crystals in a crossed stack system are disclosed. The co-crystals exhibit bidirectional charge transfer interactions where one donor molecule shares electrons with two different acceptors, one acceptor face-to-face and the other edge-to-face. The assembly and charge transfer interaction results in a pleochroic material whereby the optical absorption continuously changes depending on the polarization angle of incident light.

Charge transfer polarisation wave and carrier pairing in the high T(sub c) copper oxides

NASA Technical Reports Server (NTRS)

Chakraverty, B. K.

1990-01-01

The High T(sub c) oxides are highly polarizable materials and are charge transfer insulators. The charge transfer polarization wave formalism is developed in these oxides. The dispersion relationships due to long range dipole-dipole interaction of a charge transfer dipole lattice are obtained in 3-D and 2-D. These are high frequency bosons and their coupling with carriers is weak and antiadiabatic in nature. As a result, the mass renormalization of the carriers is negligible in complete contrast to conventional electron-phonon interaction, that give polarons and bipolarons. Both bound and superconducting pairing is discussed for a model Hamiltonian valid in the antiadiabatic regime, both in 3-D and 2-D. The stability of the charge transfer dipole lattice has interesting consequences that are discussed.

Quantifying the thickness of the electrical double layer neutralizing a planar electrode: the capacitive compactness.

PubMed

Guerrero-García, Guillermo Iván; González-Tovar, Enrique; Chávez-Páez, Martín; Kłos, Jacek; Lamperski, Stanisław

2017-12-20

The spatial extension of the ionic cloud neutralizing a charged colloid or an electrode is usually characterized by the Debye length associated with the supporting charged fluid in the bulk. This spatial length arises naturally in the linear Poisson-Boltzmann theory of point charges, which is the cornerstone of the widely used Derjaguin-Landau-Verwey-Overbeek formalism describing the colloidal stability of electrified macroparticles. By definition, the Debye length is independent of important physical features of charged solutions such as the colloidal charge, electrostatic ion correlations, ionic excluded volume effects, or specific short-range interactions, just to mention a few. In order to include consistently these features to describe more accurately the thickness of the electrical double layer of an inhomogeneous charged fluid in planar geometry, we propose here the use of the capacitive compactness concept as a generalization of the compactness of the spherical electrical double layer around a small macroion (González-Tovar et al., J. Chem. Phys. 2004, 120, 9782). To exemplify the usefulness of the capacitive compactness to characterize strongly coupled charged fluids in external electric fields, we use integral equations theory and Monte Carlo simulations to analyze the electrical properties of a model molten salt near a planar electrode. In particular, we study the electrode's charge neutralization, and the maximum inversion of the net charge per unit area of the electrode-molten salt system as a function of the ionic concentration, and the electrode's charge. The behaviour of the associated capacitive compactness is interpreted in terms of the charge neutralization capacity of the highly correlated charged fluid, which evidences a shrinking/expansion of the electrical double layer at a microscopic level. The capacitive compactness and its first two derivatives are expressed in terms of experimentally measurable macroscopic properties such as the differential and integral capacity, the electrode's surface charge density, and the mean electrostatic potential at the electrode's surface.

Experimental challenges for the measurement of the 116Cd(20Ne,20O)116Sn double charge exchange reaction at 15 AMeV

NASA Astrophysics Data System (ADS)

Carbone, D.; Cappuzzello, F.; Agodi, C.; Cavallaro, M.; Acosta, L.; Bonanno, D.; Bongiovanni, D.; Borello, T.; Boztosun, I.; Calabrese, S.; Calvo, D.; Chávez Lomelí, E. R.; Deshmukh, N.; de Faria, P. N.; Finocchiaro, P.; Fisichella, M.; Foti, A.; Gallo, G.; Hacisalihoglu, A.; Iazzi, F.; Introzzi, R.; Lanzalone, G.; Linares, R.; Longhitano, F.; Lo Presti, D.; Medina, N.; Muoio, A.; Oliveira, J. R. B.; Pakou, A.; Pandola, L.; Pinna, F.; Reito, S.; Russo, G.; Santagati, G.; Sgouros, O.; Solakcı, S. O.; Soukeras, V.; Souliotis, G.; Spatafora, A.; Torresi, D.; Tudisco, S.; Yildirim, A.; Zagatto, V. A. B.;

2018-05-01

The knowledge of the nuclear matrix elements (NME) entering in the expression of the half-life of the neutrinoless double beta decay is fundamental for neutrino physics. Information on the nuclear matrix elements can be obtained by measuring the absolute cross section of double charge exchange nuclear reactions. The two processes present some similarities, the initial and final-state wave functions are the same and the transition operators are similar. The experimental measurements of double charge exchange reactions induced by heavy ions present a number of challenging aspects, since such reactions are characterized by very low cross sections. Such difficulties are discussed for the measurement of the 116Cd(20Ne,20O)116Sn reaction at 15 AMeV.

Deformed quantum double realization of the toric code and beyond

NASA Astrophysics Data System (ADS)

Padmanabhan, Pramod; Ibieta-Jimenez, Juan Pablo; Bernabe Ferreira, Miguel Jorge; Teotonio-Sobrinho, Paulo

2016-09-01

Quantum double models, such as the toric code, can be constructed from transfer matrices of lattice gauge theories with discrete gauge groups and parametrized by the center of the gauge group algebra and its dual. For general choices of these parameters the transfer matrix contains operators acting on links which can also be thought of as perturbations to the quantum double model driving it out of its topological phase and destroying the exact solvability of the quantum double model. We modify these transfer matrices with perturbations and extract exactly solvable models which remain in a quantum phase, thus nullifying the effect of the perturbation. The algebra of the modified vertex and plaquette operators now obey a deformed version of the quantum double algebra. The Abelian cases are shown to be in the quantum double phase whereas the non-Abelian phases are shown to be in a modified phase of the corresponding quantum double phase. These are illustrated with the groups Zn and S3. The quantum phases are determined by studying the excitations of these systems namely their fusion rules and the statistics. We then go further to construct a transfer matrix which contains the other Z2 phase namely the double semion phase. More generally for other discrete groups these transfer matrices contain the twisted quantum double models. These transfer matrices can be thought of as being obtained by introducing extra parameters into the transfer matrix of lattice gauge theories. These parameters are central elements belonging to the tensor products of the algebra and its dual and are associated to vertices and volumes of the three dimensional lattice. As in the case of the lattice gauge theories we construct the operators creating the excitations in this case and study their braiding and fusion properties.

Repair of DNA double-strand breaks and cell killing by charged particles

NASA Astrophysics Data System (ADS)

Eguchi-Kasai, K.; Murakami, M.; Itsukaichi, H.; Fukutsu, K.; Yatagai, F.; Kanai, T.; Ohara, H.; Sato, K.

It has been suggested that it is not simple double-strand breaks (dsb) but the non-reparable breaks which correlate well with the high biological effectiveness of high LET radiations for cell killing. We have compared the effects of charged particles on cell death in 3 pairs of cell lines which are normal or defective in the repair of DNA dsbs. For the cell lines SL3-147, M10, and SX10 which are deficient in DNA dsb repair, RBE values were close to unity for cell killing induced by charged particles with linear energy transfer (LET) up to 200 keV/mum and were even smaller than unity for the LET region greater than 300 keV/mum. The inactivation cross section (ICS) increased with LET for all 3 pairs. The ICS of dsb repair deficient mutants was always larger than that of their parents for all the LET ranges, but with increasing LET the difference in ICS between the mutant and its parent became smaller. Since a small difference in ICS remained at LET of about 300 keV/mum, dsb repair may still take place at this high LET, even if its role is apparently small. These results suggest that the DNA repair system does not play a major role in protection against the attack of high LET radiations and that a main cause of cell death is non-reparable dsb which are produced at a higher yield compared with low LET radiations. No correlation was observed between DNA content or nuclear area and ICS.

Two-phase charge-coupled device

NASA Technical Reports Server (NTRS)

Kosonocky, W. F.; Carnes, J. E.

1973-01-01

A charge-transfer efficiency of 99.99% per stage was achieved in the fat-zero mode of operation of 64- and 128-stage two-phase charge-coupled shift registers at 1.0-MHz clock frequency. The experimental two-phase charge-coupled shift registers were constructed in the form of polysilicon gates overlapped by aluminum gates. The unidirectional signal flow was accomplished by using n-type substrates with 0.5 to 1.0 ohm-cm resistivity in conjunction with a channel oxide thickness of 1000 A for the polysilicon gates and 3000 A for the aluminum gates. The operation of the tested shift registers with fat zero is in good agreement with the free-charge transfer characteristics expected for the tested structures. The charge-transfer losses observed when operating the experimental shift registers without the fat zero are attributed to fast interface state trapping. The analytical part of the report contains a review backed up by an extensive appendix of the free-charge transfer characteristics of CCD's in terms of thermal diffusion, self-induced drift, and fringing field drift. Also, a model was developed for the charge-transfer losses resulting from charge trapping by fast interface states. The proposed model was verified by the operation of the experimental two-phase charge-coupled shift registers.

A quantum mechanical-Poisson-Boltzmann equation approach for studying charge flow between ions and a dielectric continuum

NASA Astrophysics Data System (ADS)

Gogonea, Valentin; Merz, Kenneth M.

2000-02-01

This paper presents a theoretical model for the investigation of charge transfer between ions and a solvent treated as a dielectric continuum media. The method is a combination of a semiempirical effective Hamiltonian with a modified Poisson-Boltzmann equation which includes charge transfer in the form of a surface charge density positioned at the dielectric interface. The new Poisson-Boltzmann equation together with new boundary conditions results in a new set of equations for the electrostatic potential (or polarization charge densities). Charge transfer adds a new free energy component to the solvation free energy term, which accounts for all interactions between the transferred charge at the dielectric interface, the solute wave function and the solvent polarization charges. Practical calculations on a set of 19 anions and 17 cations demonstrate that charge exchange with a dielectric is present and it is in the range of 0.06-0.4 eu. Furthermore, the pattern of the magnitudes of charge transfer can be related to the acid-base properties of the ions in many cases, but exceptions are also found. Finally, we show that the method leads to an energy decomposition scheme of the total electrostatic energy, which can be used in mechanistic studies on protein and DNA interaction with water.

Charge-transfer potentials for ionic crystals: Cauchy violation, LO-TO splitting, and the necessity of an ionic reference state.

PubMed

Sukhomlinov, Sergey V; Müser, Martin H

2015-12-14

In this work, we study how including charge transfer into force fields affects the predicted elastic and vibrational Γ-point properties of ionic crystals, in particular those of rock salt. In both analytical and numerical calculations, we find that charge transfer generally leads to a negative contribution to the Cauchy pressure, P(C) ≡ C12 - C66, where C12 and C66 are elements of the elastic tensor. This contribution increases in magnitude with pressure for different charge-transfer approaches in agreement with results obtained with density functional theory (DFT). However, details of the charge-transfer models determine the pressure dependence of the longitudinal optical-transverse optical splitting and that for partial charges. These last two quantities increase with density as long as the chemical hardness depends at most weakly on the environment while experiments and DFT find a decrease. In order to reflect the correct trends, the charge-transfer expansion has to be made around ions and the chemical (bond) hardness has to increase roughly exponentially with inverse density or bond lengths. Finally, the adjustable force-field parameters only turn out meaningful, when the expansion is made around ions.

Charge-transfer potentials for ionic crystals: Cauchy violation, LO-TO splitting, and the necessity of an ionic reference state

NASA Astrophysics Data System (ADS)

Sukhomlinov, Sergey V.; Müser, Martin H.

2015-12-01

In this work, we study how including charge transfer into force fields affects the predicted elastic and vibrational Γ-point properties of ionic crystals, in particular those of rock salt. In both analytical and numerical calculations, we find that charge transfer generally leads to a negative contribution to the Cauchy pressure, PC ≡ C12 - C66, where C12 and C66 are elements of the elastic tensor. This contribution increases in magnitude with pressure for different charge-transfer approaches in agreement with results obtained with density functional theory (DFT). However, details of the charge-transfer models determine the pressure dependence of the longitudinal optical-transverse optical splitting and that for partial charges. These last two quantities increase with density as long as the chemical hardness depends at most weakly on the environment while experiments and DFT find a decrease. In order to reflect the correct trends, the charge-transfer expansion has to be made around ions and the chemical (bond) hardness has to increase roughly exponentially with inverse density or bond lengths. Finally, the adjustable force-field parameters only turn out meaningful, when the expansion is made around ions.

Measurement Of Gas Electron Multiplier (GEM) Detector Characteristics

NASA Astrophysics Data System (ADS)

Park, Seongtae; Baldelomar, Edwin; Park, Kwangjune; Sosebee, Mark; White, Andy; Yu, Jaehoon

2011-06-01

The High Energy Physics group of the University of Texas at Arlington has been developing gas electron multiplier detectors to use them as sensitive gap detectors in digital hadron calorimeters for the International Linear Collider, a future high energy particle accelerator. For this purpose, we constructed numerous GEM detectors that employ double GEM layers. In this study, two kinds of prototype GEM detectors were tested; one with 28×28 cm2 active area double GEM structure with a 3 mm drift gap, a 1 mm transfer gap and a 1 mm induction gap and the other with two 3×3 cm2 GEM foils in the amplifier stage with a 5 mm drift gap, a 2 mm transfer gap and a 1 mm induction gap. The detectors' characteristics from exposure to high-energy charged particles and other radiations were measured using cosmic rays and 55Fe radioactive source. From the 55Fe tests, we observed two well separated characteristic X-ray emission peaks and confirmed the detectors' functionality. We also measured chamber gains to be over 6000 at a high voltage of 395 V across each GEM electrode. The responses to cosmic rays show the spectra that fit well to Landau distributions as expected from minimum ionizing particles.

Charge Transfer from n-Doped Nanocrystals: Mimicking Intermediate Events in Multielectron Photocatalysis.

PubMed

Wang, Junhui; Ding, Tao; Wu, Kaifeng

2018-06-12

In multielectron photocatalytic reactions, an absorbed photon triggers charge transfer from the light-harvester to the attached catalyst, leaving behind a charge of the opposite sign in the light-harvester. If this charge is not scavenged before the absorption of the following photons, photoexcitation generates not neutral but charged excitons from which the extraction of charges should become more difficult. This is potentially an efficiency-limiting intermediate event in multielectron photocatalysis. To study the charge dynamics in this event, we doped CdS nanocrystal quantum dots (QDs) with an extra electron and measured hole transfer from n-doped QDs to attached acceptors. We find that the Auger decay of charged excitons lowers the charge separation yield to 68.6% from 98.4% for neutral excitons. In addition, the hole transfer rate in the presence of two electrons (1290 ps) is slower than that in the presence one electron (776 ps), and the recombination rate of charge separated states is about 2 times faster in the former case. This model study provides important insights into possible efficiency-limiting intermediate events involved in photocatalysis.

Artificial Neural Network with Hardware Training and Hardware Refresh

NASA Technical Reports Server (NTRS)

Duong, Tuan A. (Inventor)

2003-01-01

A neural network circuit is provided having a plurality of circuits capable of charge storage. Also provided is a plurality of circuits each coupled to at least one of the plurality of charge storage circuits and constructed to generate an output in accordance with a neuron transfer function. Each of a plurality of circuits is coupled to one of the plurality of neuron transfer function circuits and constructed to generate a derivative of the output. A weight update circuit updates the charge storage circuits based upon output from the plurality of transfer function circuits and output from the plurality of derivative circuits. In preferred embodiments, separate training and validation networks share the same set of charge storage circuits and may operate concurrently. The validation network has a separate transfer function circuits each being coupled to the charge storage circuits so as to replicate the training network s coupling of the plurality of charge storage to the plurality of transfer function circuits. The plurality of transfer function circuits may be constructed each having a transconductance amplifier providing differential currents combined to provide an output in accordance with a transfer function. The derivative circuits may have a circuit constructed to generate a biased differential currents combined so as to provide the derivative of the transfer function.

Tuning charge transfer in the LaTiO3/RO/LaNiO3 (R = rare-earth) superlattices by the rare-earth oxides interfaces from a first-principles calculation

NASA Astrophysics Data System (ADS)

Yao, Fen; Zhang, Lifang; Meng, Junling; Liu, Xiaojuan; Zhang, Xiong; Zhang, Wenwen; Meng, Jian; Zhang, Hongjie

2018-03-01

We investigate the internal charge transfer at the isopolar interfaces in LaTiO3/RO/LaNiO3 (R = La, Ce, Pr, Nd, Sm, Gd, Tb, Dy, Ho, Er, Tm, and Lu) superlattices by means of density functional theory calculations. The charge transfer from Ti sites to Ni sites in all superlattices is induced by the electronegativity difference between the elements Ti and Ni, and the lanthanide oxides interfaces can modulate the amount of charge transfer. Comparison of the perovskite heterostructures with the different rare-earth interfaces shows that increasing the deviations of bond angles from 180.0° and the oxygen motions near the interfaces enhance charge transfer. The 4f electrons themselves of rare-earth elements have faint influences on charge transfer. In addition, the reasons why our calculated 4f states of Sm and Tm elements disagree with the experimental systems have been provided. It is hoped that all the calculated results could be used to design new functional nanoelectronic devices in perovskite oxides.

Interlayer‐State‐Coupling Dependent Ultrafast Charge Transfer in MoS2/WS2 Bilayers

PubMed Central

Zhang, Jin; Hong, Hao; Lian, Chao; Ma, Wei; Xu, Xiaozhi; Zhou, Xu; Fu, Huixia

2017-01-01

Light‐induced interlayer ultrafast charge transfer in 2D heterostructures provides a new platform for optoelectronic and photovoltaic applications. The charge separation process is generally hypothesized to be dependent on the interlayer stackings and interactions, however, the quantitative characteristic and detailed mechanism remain elusive. Here, a systematical study on the interlayer charge transfer in model MoS2/WS2 bilayer system with variable stacking configurations by time‐dependent density functional theory methods is demonstrated. The results show that the slight change of interlayer geometry can significantly modulate the charge transfer time from 100 fs to 1 ps scale. Detailed analysis further reveals that the transfer rate in MoS2/WS2 bilayers is governed by the electronic coupling between specific interlayer states, rather than the interlayer distances, and follows a universal dependence on the state‐coupling strength. The results establish the interlayer stacking as an effective freedom to control ultrafast charge transfer dynamics in 2D heterostructures and facilitate their future applications in optoelectronics and light harvesting. PMID:28932669

Nanoscale charge transfer and diffusion at the MoS2/SiO2 interface by atomic force microscopy: contact injection versus triboelectrification.

PubMed

Xu, Rui; Ye, Shili; Xu, Kunqi; Lei, Le; Hussain, Sabir; Zheng, Zhiyue; Pang, Fei; Xing, Shuya; Liu, Xinmeng; Ji, Wei; Cheng, Zhihai

2018-08-31

Understanding the process of charge generation, transfer, and diffusion between two-dimensional (2D) materials and their supporting substrates is very important for potential applications of 2D materials. Compared with the systematic studies of triboelectric charging in a bulk sample, a fundamental understanding of the triboelectrification of the 2D material/insulator system is rather limited. Here, the charge transfer and diffusion of both the SiO 2 surface and MoS 2 /SiO 2 interface through contact electrification and frictional electrification are investigated systematically in situ by scanning Kelvin probe microscopy and dual-harmonic electrostatic force microscopy. Different from the simple static charge transfer between SiO 2 and the PtSi alloy atomic force microscope (AFM) tip, the charge transfer between the tip and the MoS 2 /SiO 2 system is complicated. Triboelectric charges, generated by contact or frictional electrification with the AFM tip, are trapped at the MoS 2 /SiO 2 interface and act as floating gates. The local charge discharge processes can be obtained by monitoring the surface potential. The charge decay time (τ) of the MoS 2 /SiO 2 interface is one (or two) orders of magnitude larger than the decay time τ of the SiO 2 surface. This work facilitates an understanding of the triboelectric and de-electrification of the interface between 2D materials and substrates. In addition to the charge transfer and diffusion, we demonstrate the nanopatterns of surface and interfacial charges, which have great potential for the application of self-assembly of charged nanostructures.

Unusual photoelectric behaviors of Mo-doped TiO2 multilayer thin films prepared by RF magnetron co-sputtering: effect of barrier tunneling on internal charge transfer

NASA Astrophysics Data System (ADS)

Yan, B. X.; Luo, S. Y.; Mao, X. G.; Shen, J.; Zhou, Q. F.

2013-01-01

Mo-doped TiO2 multilayer thin films were prepared by RF magnetron co-sputtering. Microstructures, crystallite parameters and the absorption band were investigated with atomic force microscopy, X-ray diffraction and ultraviolet-visible spectroscopy. Internal carrier transport characteristics and the photoelectric property of different layer-assemble modes were examined on an electrochemical workstation under visible light. The result indicates that the double-layer structure with an undoped surface layer demonstrated a red-shifted absorption edge and a much stronger photocurrent compared to the uniformly doped sample, signifying that the electric field implanted at the interface between particles in different layers accelerated internal charge transfer effectively. However, a heavily doped layer implanted at the bottom of the three-layer film merely brought about negative effects on the photoelectric property, mainly because of the Schottky junction existing above the substrate. Nevertheless, this obstacle was successfully eliminated by raising the Mo concentration to 1020 cm-3, where the thickness of the depletion layer fell into the order of angstroms and the tunneling coefficient manifested a dramatic increase. Under this circumstance, the Schottky junction disappeared and the strongest photocurrent was observed in the three-layer film.

The mechanisms of delayed fluorescence in charge-transfer crystal of tetracyanobenzene-hexamethylbenzene

NASA Astrophysics Data System (ADS)

Kozankiewicz, B.; Prochorow, J.

1989-08-01

Fluorescence, phosphorescence and delayed fluorescence emission characteristics of tetracyanobenzene-hexamethylbenzene (TCNB-HMB) charge-transfer crystal have been studied in the 1.7-340 K temperature range. Delayed fluorescence, originating from heterogeneous triplet-triplet annihilation indicates the presence of mobile charge-transfer triplet excitons at a temperature as low as 1.7 K. However, the behaviour of triplet excitons in TCNB-HMB crystal is strongly controlled by a very efficient trapping process in the whole temperature range investigated. It was found that thermally activated delayed fluorescence, which is a dominating emission of the crystal at elevated temperatures (>60 K), has a different origin (a different initial state) at different temperatures. These observations were analysed and interpreted in terms of a photokinetic model, which is considered to be typical for charge-transfer crystals with high charge-transfer character of triplet excitons.

Lowest energy Frenkel and charge transfer exciton intermixing in one-dimensional copper phthalocyanine molecular lattice

NASA Astrophysics Data System (ADS)

Bondarev, I. V.; Popescu, A.; Younts, R. A.; Hoffman, B.; McAfee, T.; Dougherty, D. B.; Gundogdu, K.; Ade, H. W.

2016-11-01

We report the results of the combined experimental and theoretical studies of the low-lying exciton states in crystalline copper phthalocyanine. We derive the eigen energy spectrum for the two lowest intramolecular Frenkel excitons coupled to the intermolecular charge transfer exciton state and compare it with temperature dependent optical absorption spectra measured experimentally, to obtain the parameters of the Frenkel-charge-transfer exciton intermixing. The two Frenkel exciton states are spaced apart by 0.26 eV, and the charge transfer exciton state is 50 meV above the lowest Frenkel exciton. Both Frenkel excitons are strongly mixed with the charge transfer exciton, showing the coupling constant 0.17 eV which agrees with earlier experimental measurements. These results can be used for the proper interpretation of the physical properties of crystalline phthalocyanines.

33 CFR 156.115 - Person in charge: Limitations.

Code of Federal Regulations, 2011 CFR

2011-07-01

... transfer operations on more than one vessel at a time during transfers between vessels or between two or... (CONTINUED) POLLUTION OIL AND HAZARDOUS MATERIAL TRANSFER OPERATIONS Oil and Hazardous Material Transfer... charge of both a vessel and a facility during transfer operations unless authorized by the COTP. [CGD 75...

33 CFR 156.115 - Person in charge: Limitations.

Code of Federal Regulations, 2012 CFR

2012-07-01

... transfer operations on more than one vessel at a time during transfers between vessels or between two or... (CONTINUED) POLLUTION OIL AND HAZARDOUS MATERIAL TRANSFER OPERATIONS Oil and Hazardous Material Transfer... charge of both a vessel and a facility during transfer operations unless authorized by the COTP. [CGD 75...

33 CFR 156.115 - Person in charge: Limitations.

Code of Federal Regulations, 2010 CFR

2010-07-01

... transfer operations on more than one vessel at a time during transfers between vessels or between two or... (CONTINUED) POLLUTION OIL AND HAZARDOUS MATERIAL TRANSFER OPERATIONS Oil and Hazardous Material Transfer... charge of both a vessel and a facility during transfer operations unless authorized by the COTP. [CGD 75...

33 CFR 156.115 - Person in charge: Limitations.

Code of Federal Regulations, 2013 CFR

2013-07-01

... transfer operations on more than one vessel at a time during transfers between vessels or between two or... (CONTINUED) POLLUTION OIL AND HAZARDOUS MATERIAL TRANSFER OPERATIONS Oil and Hazardous Material Transfer... charge of both a vessel and a facility during transfer operations unless authorized by the COTP. [CGD 75...

33 CFR 156.115 - Person in charge: Limitations.

Code of Federal Regulations, 2014 CFR

2014-07-01

... transfer operations on more than one vessel at a time during transfers between vessels or between two or... (CONTINUED) POLLUTION OIL AND HAZARDOUS MATERIAL TRANSFER OPERATIONS Oil and Hazardous Material Transfer... charge of both a vessel and a facility during transfer operations unless authorized by the COTP. [CGD 75...

High Pressure Optical Studies of the Thallous Halides and of Charge-Transfer Complexes

NASA Astrophysics Data System (ADS)

Jurgensen, Charles Willard

High pressure was used to study the insulator -to-metal transition in sulfur and the thallous halides and to study the intermolecular interactions in charge -transfer complexes. The approach to the band overlap insulator -to-metal transition was studied in three thallous halides and sulfur by optical absorption measurements of the band gap as a function of pressure. The band gap of sulfur continuously decreases with pressure up to the insulator -to-metal transition which occurs between 450 and 485 kbars. The results on the thallous halides indicate that the indirect gap decreases more rapidly than the direct gap; the closing of the indirect gap is responsible for the observed insulator -to-metal transitions. High pressure electronic and vibrational spectroscopic measurements on the solid-state complexes of HMB-TCNE were used to study the intermolecular interactions of charge -transfer complexes. The vibrational frequency shifts indicate that the degree of charge transfer increases with pressure which is independently confirmed by an increase in the molar absorptivity of the electronic charge-transfer peak. Induction and dispersion forces contribute towards a red shift of the charge-transfer peak; however, charge-transfer resonance contributes toward a blue shift and this effect is dominant for the HMB-TCNE complexes. High pressure electronic spectra were used to study the effect of intermolecular interactions on the electronic states of TCNQ and its complexes. The red shifts with pressure of the electronic spectra of TCNQ and (TCNQ)(' -) in polymer media and of crystalline TCNQ can be understood in terms of Van der Waals interactions. None of the calculations which considered intradimer distance obtained the proper behavior for either the charge-transfer of the locally excited states of the complexes. The qualitative behavior of both states can be interpreted as the effect of increased mixing of the locally excited and charge transfer states.

Investigations on the charge transfer mechanism at donor/acceptor interfaces in the quest for descriptors of organic solar cell performance.

PubMed

Muraoka, Azusa; Fujii, Mikiya; Mishima, Kenji; Matsunaga, Hiroki; Benten, Hiroaki; Ohkita, Hideo; Ito, Shinzaburo; Yamashita, Koichi

2018-05-07

Herein, we theoretically and experimentally investigated the mechanisms of charge separation processes of organic thin-film solar cells. PTB7, PTB1, and PTBF2 have been chosen as donors and PC 71 BM has been chosen as an acceptor considering that effective charge generation depends on the difference between the material combinations. Experimental results of transient absorption spectroscopy show that the hot process is a key step for determining external quantum efficiency (EQE) in these systems. From the quantum chemistry calculations, it has been found that EQE tends to increase as the transferred charge, charge transfer distance, and variation of dipole moments between the ground and excited states of the donor/acceptor complexes increase; this indicates that these physical quantities are a good descriptor to assess the donor-acceptor charge transfer quality contributing to the solar cell performance. We propose that designing donor/acceptor interfaces with large values of charge transfer distance and variation of dipole moments of the donor/acceptor complexes is a prerequisite for developing high-efficiency polymer/PCBM solar cells.

Effective charges of ionic liquid determined self-consistently through combination of molecular dynamics simulation and density-functional theory.

PubMed

Ishizuka, Ryosuke; Matubayasi, Nobuyuki

2017-11-15

A self-consistent scheme combining the molecular dynamics (MD) simulation and density functional theory (DFT) was recently proposed to incorporate the effects of the charge transfer and polarization of ions into non-poralizable force fields of ionic liquids for improved description of energetics and dynamics. The purpose of the present work is to analyze the detailed setups of the MD/DFT scheme by focusing on how the basis set, exchange-correlation (XC) functional, charge-fitting method or force field for the intramolecular and Lennard-Jones interactions affects the MD/DFT results of 1,3-dimethylimidazolium bis(trifluoromethylsulfonyl) imide ( [C1mim][NTf2]) and 1-ethyl-3-methylimidazolium glycinate ( [C2mim][Gly]). It was found that the double-zeta valence polarized or larger size of basis set is required for the convergence of the effective charge of the ion. The choice of the XC functional was further not influential as far as the generalized gradient approximation is used. The charge-fitting method and force field govern the accuracy of the MD/DFT scheme, on the other hand. We examined the charge-fitting methods of Blöchl, the iterative Hirshfeld (Hirshfeld-I), and REPEAT in combination with Lopes et al.'s force field and general AMBER force field. There is no single combination of charge fitting and force field that provides good agreements with the experiments, while the MD/DFT scheme reduces the effective charges of the ions and leads to better description of energetics and dynamics compared to the original force field with unit charges. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Reduced Charge Transfer Exciton Recombination in Organic Semiconductor Heterojunctions by Molecular Doping

NASA Astrophysics Data System (ADS)

Deschler, Felix; da Como, Enrico; Limmer, Thomas; Tautz, Raphael; Godde, Tillmann; Bayer, Manfred; von Hauff, Elizabeth; Yilmaz, Seyfullah; Allard, Sybille; Scherf, Ullrich; Feldmann, Jochen

2011-09-01

We investigate the effect of molecular doping on the recombination of electrons and holes localized at conjugated-polymer-fullerene interfaces. We demonstrate that a low concentration of p-type dopant molecules (<4% weight) reduces the interfacial recombination via charge transfer excitons and results in a favored formation of separated carriers. This is observed by the ultrafast quenching of photoluminescence from charge transfer excitons and the increase in photoinduced polaron density by ˜70%. The results are consistent with a reduced formation of emissive charge transfer excitons, induced by state filling of tail states.

Spontaneous electrorheological effect in nematic liquid crystals under Taylor-Couette flow configuration

NASA Astrophysics Data System (ADS)

Dhar, Jayabrata; Chakraborty, Suman

2017-09-01

Electrorheological (ER) characteristics of Nematic Liquid Crystals (NLCs) have been a topic of immense interest in the field of soft matter physics owing to its rheological modulation capabilities. Here we explore the augmentation in rheological characteristics of the nematic fluid confined within the annular region of the concentric cylindrical space with an Electrical Double Layer (EDL) induced at the fluid-substrate interface due to certain physico-chemical interactions. Using a Taylor-Couette flow configuration associated with an EDL induced at the inner cylinder wall, we show that a spontaneous electrorheological effect is generated owing to the intrinsic director anisotropy and structural order of complex nematic fluids. We seek to find the enhancement in torque transfer capability due to the inherent electrorheological nature of the nematic medium, apart from exploiting the innate nature of such homogeneous media to remain free of coagulation, a fact which makes it an excellent candidate for the applications in microfluidic environment. Our analysis reveals that with stronger induced charge density within the EDL, the apparent viscosity enhances, which, in turn, augments torque transfer across the concentric cylinder. The velocity profile tends to flatten in comparison to the classical circular Couette flow in annular geometry as one increases the surface charge density. We further observe a more pronounced ER effect for the nematic medium having larger electrical permittivity anisotropy. Besides the torque transfer qualifications, we also explore the distinct scenarios, wherein the same NLC medium exhibits shear thinning and shear thickening characteristics. The present configuration of the efficient torque transfer mechanism may be proficiently downscaled to micro-level and is relevant in the fabrication of micro-clutch and micro-dampers.

Scientific Computation Application Partnerships in Materials and Chemical Sciences, Charge Transfer and Charge Transport in Photoactivated Systems, Developing Electron-Correlated Methods for Excited State Structure and Dynamics in the NWChem Software Suite

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cramer, Christopher J.

Charge transfer and charge transport in photoactivated systems are fundamental processes that underlie solar energy capture, solar energy conversion, and photoactivated catalysis, both organometallic and enzymatic. We developed methods, algorithms, and software tools needed for reliable treatment of the underlying physics for charge transfer and charge transport, an undertaking with broad applicability to the goals of the fundamental-interaction component of the Department of Energy Office of Basic Energy Sciences and the exascale initiative of the Office of Advanced Scientific Computing Research.

Topological Effects of Charge Transfer in Telomere G-Quadruplex Mechanism on Telomerase Activation and Inhibition

NASA Astrophysics Data System (ADS)

Wang, Xin; Liang, Shi-Dong

2013-02-01

We explore the charge transfer in the telomere G-Quadruplex (TG4) DNA theoretically by the nonequilibrium Green's function method, and reveal the topological effect of the charge transport in TG4 DNA. The consecutive TG4 (CTG4) is semiconducting with 0.2 0.3 eV energy gap. Charges transfer favorably in the CTG4, but are trapped in the nonconsecutive TG4 (NCTG4). The global conductance is inversely proportional to the local conductance for NCTG4. The topological structure transition from NCTG4 to CTG4 induces abruptly 3nA charge current, which provide a microscopic clue to understand the telomerase activated or inhibited by TG4. Our findings reveal the fundamental property of charge transfer in TG4 and its relationship with the topological structure of TG4.

Identification of nuclear effects in neutrino-carbon interactions at low three-momentum transfer

DOE PAGES

Rodrigues, P. A.

2016-02-17

Two different nuclear-medium effects are isolated using a low three-momentum transfer subsample of neutrino-carbon scattering data from the MINERvA neutrino experiment. The observed hadronic energy in charged-current νμ interactions is combined with muon kinematics to permit separation of the quasielastic and Δ(1232) resonance processes. First, we observe a small cross section at very low energy transfer that matches the expected screening effect of long-range nucleon correlations. Second, additions to the event rate in the kinematic region between the quasielastic and Δ resonance processes are needed to describe the data. The data in this kinematic region also have an enhanced populationmore » of multiproton final states. Contributions predicted for scattering from a nucleon pair have both properties; the model tested in this analysis is a significant improvement but does not fully describe the data. We present the results as a double-differential cross section to enable further investigation of nuclear models. Furthermore, improved description of the effects of the nuclear environment are required by current and future neutrino oscillation experiments.« less

78 FR 63268 - Self-Regulatory Organizations; Financial Industry Regulatory Authority, Inc.; Notice of Filing...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-10-23

... Transfer Transaction Fees Charged by One Member to Another Member October 17, 2013. Pursuant to Section 19... Facility (the ``FINRA/NYSE TRF'') to transfer transaction fees charged by one member to another member on... agree in advance to transfer a transaction fee charged by one member to another member on over-the...

33 CFR 155.710 - Qualifications of person in charge.

Code of Federal Regulations, 2010 CFR

2010-07-01

... available to the PIC on the tankship at all times during the transfer or cargo-tank cleaning; and (iii) Is... Transfer Personnel, Procedures, Equipment, and Records § 155.710 Qualifications of person in charge. (a) On... the vessel, or the person who arranges and hires a person to be in charge either of a transfer of...

Effect of the surface charge discretization on electric double layers: a Monte Carlo simulation study.

PubMed

Madurga, Sergio; Martín-Molina, Alberto; Vilaseca, Eudald; Mas, Francesc; Quesada-Pérez, Manuel

2007-06-21

The structure of the electric double layer in contact with discrete and continuously charged planar surfaces is studied within the framework of the primitive model through Monte Carlo simulations. Three different discretization models are considered together with the case of uniform distribution. The effect of discreteness is analyzed in terms of charge density profiles. For point surface groups, a complete equivalence with the situation of uniformly distributed charge is found if profiles are exclusively analyzed as a function of the distance to the charged surface. However, some differences are observed moving parallel to the surface. Significant discrepancies with approaches that do not account for discreteness are reported if charge sites of finite size placed on the surface are considered.

Charge transfer in model peptides: obtaining Marcus parameters from molecular simulation.

PubMed

Heck, Alexander; Woiczikowski, P Benjamin; Kubař, Tomáš; Giese, Bernd; Elstner, Marcus; Steinbrecher, Thomas B

2012-02-23

Charge transfer within and between biomolecules remains a highly active field of biophysics. Due to the complexities of real systems, model compounds are a useful alternative to study the mechanistic fundamentals of charge transfer. In recent years, such model experiments have been underpinned by molecular simulation methods as well. In this work, we study electron hole transfer in helical model peptides by means of molecular dynamics simulations. A theoretical framework to extract Marcus parameters of charge transfer from simulations is presented. We find that the peptides form stable helical structures with sequence dependent small deviations from ideal PPII helices. We identify direct exposure of charged side chains to solvent as a cause of high reorganization energies, significantly larger than typical for electron transfer in proteins. This, together with small direct couplings, makes long-range superexchange electron transport in this system very slow. In good agreement with experiment, direct transfer between the terminal amino acid side chains can be dicounted in favor of a two-step hopping process if appropriate bridging groups exist. © 2012 American Chemical Society

Evaluating charge noise acting on semiconductor quantum dots in the circuit quantum electrodynamics architecture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Basset, J.; Stockklauser, A.; Jarausch, D.-D.

2014-08-11

We evaluate the charge noise acting on a GaAs/GaAlAs based semiconductor double quantum dot dipole-coupled to the voltage oscillations of a superconducting transmission line resonator. The in-phase (I) and the quadrature (Q) components of the microwave tone transmitted through the resonator are sensitive to charging events in the surrounding environment of the double dot with an optimum sensitivity of 8.5×10{sup −5} e/√(Hz). A low frequency 1/f type noise spectrum combined with a white noise level of 6.6×10{sup −6} e{sup 2}/Hz above 1 Hz is extracted, consistent with previous results obtained with quantum point contact charge detectors on similar heterostructures. The slope ofmore » the 1/f noise allows to extract a lower bound for the double-dot charge qubit dephasing rate which we compare to the one extracted from a Jaynes-Cummings Hamiltonian approach. The two rates are found to be similar emphasizing that charge noise is the main source of dephasing in our system.« less

Structure and capacitance of an electric double layer of an asymmetric valency dimer electrolyte: A comparison of the density functional theory with Monte Carlo simulations

DOE PAGES

Henderson, Douglas; Silvestre-Alcantara, Whasington; Kaja, Monika; ...

2016-08-18

Here, the density functional theory is applied to a study of the structure and differential capacitance of a planar electric double layer formed by a valency asymmetric mixture of charged dimers and monomers. The dimer consists of two tangentially tethered hard spheres of equal diameters of which one is charged and the other is neutral, while the monomer is a charged hard sphere of the same size. The dimer electrolyte is next to a uniformly charged, smooth planar electrode. The electrode-particle singlet distributions, the mean electrostatic potential, and the differential capacitance for the model double layer are evaluated for amore » 2:1/1:2 valency electrolyte at a given concentration. Important consequences of asymmetry in charges and in ion shapes are (i) a finite, non-zero potential of zero charge, and (ii) asymmetric shaped 2:1 and 1:2 capacitance curves which are not mirror images of each other. Comparisons of the density functional results with the corresponding Monte Carlo simulations show the theoretical predictions to be in good agreement with the simulations overall except near zero surface charge.« less

Charge transfer induced by MoO3 at boron subphthalocyanine chloride/α-sexithiophene heterojunction interface

NASA Astrophysics Data System (ADS)

Foggiatto, Alexandre L.; Sakurai, Takeaki

2018-03-01

The energy-level alignment of boron subphthalocyanine chloride (SubPc)/α-sexithiophene (6T) grown on MoO3 was investigated using ultraviolet and X-ray photoelectron spectroscopy (UPS and XPS). We demonstrated that the p-doping effect generated by the MoO3 layer can induce charge transfer at the organic-organic heterojunction interface. After the deposition of 6T on MoO3, the fermi level becomes pinned close to the 6T highest occupied molecular orbital (HOMO) level and when SubPc is deposited, owing to its tail states, charge transfer occurs in order to achieve thermodynamic equilibrium. We also demonstrated that the charge transfer can be reduced by annealing the film. We suggested that the reduction of the misalignment on the film induces a reduction in the density of gap states, which controls the charge transfer.

Understanding the Charge Transfer at the Interface of Electron Donors and Acceptors: TTF–TCNQ as an Example

DOE Office of Scientific and Technical Information (OSTI.GOV)

Park, Changwon; Atalla, Viktor; Smith, Sean

Charge transfer between an electron donor and an electron acceptor is widely accepted as being independent of their relative configurations if the interaction between them is weak; however, the limit of this concept for an interacting system has not yet been well established. Our study of prototypical electron donor–acceptor molecules, tetrathiafulvalene–tetracyanoquinodimethane, using density functional theory based on an advanced functional, clearly demonstrates that for interacting molecules, their configurational arrangement is as important as their individual electronic properties in the asymptotic limit to determine the charge transfer direction. For the first time, we demonstrate that by changing their relative orientation, onemore » can reverse the charge transfer direction of the pair, causing the molecules to exchange roles as donor and acceptor. In conclusion, our theory has important implications for understanding the interfacial charge-transfer mechanism of hybrid systems and related phenomena.« less

Interfacial charge transfer absorption: Application to metal molecule assemblies

NASA Astrophysics Data System (ADS)

Creutz, Carol; Brunschwig, Bruce S.; Sutin, Norman

2006-05-01

Optically induced charge transfer between adsorbed molecules and a metal electrode was predicted by Hush to lead to new electronic absorption features, but has been only rarely observed experimentally. Interfacial charge transfer absorption (IFCTA) provides information concerning the barriers to charge transfer between molecules and the metal/semiconductor and the magnitude of the electronic coupling and could thus provide a powerful tool for understanding interfacial charge-transfer kinetics. Here, we utilize a previously published model [C. Creutz, B.S. Brunschwig, N. Sutin, J. Phys. Chem. B 109 (2005) 10251] to predict IFCTA spectra of metal-molecule assemblies and compare the literature observations to these predictions. We conclude that, in general, the electronic coupling between molecular adsorbates and the metal levels is so small that IFCTA is not detectable. However, few experiments designed to detect IFCTA have been done. We suggest approaches to optimizing the conditions for observing the process.

Understanding the Charge Transfer at the Interface of Electron Donors and Acceptors: TTF–TCNQ as an Example

DOE PAGES

Park, Changwon; Atalla, Viktor; Smith, Sean; ...

2017-06-16

Charge transfer between an electron donor and an electron acceptor is widely accepted as being independent of their relative configurations if the interaction between them is weak; however, the limit of this concept for an interacting system has not yet been well established. Our study of prototypical electron donor–acceptor molecules, tetrathiafulvalene–tetracyanoquinodimethane, using density functional theory based on an advanced functional, clearly demonstrates that for interacting molecules, their configurational arrangement is as important as their individual electronic properties in the asymptotic limit to determine the charge transfer direction. For the first time, we demonstrate that by changing their relative orientation, onemore » can reverse the charge transfer direction of the pair, causing the molecules to exchange roles as donor and acceptor. In conclusion, our theory has important implications for understanding the interfacial charge-transfer mechanism of hybrid systems and related phenomena.« less

Collisional charging of individual submillimeter particles: Using ultrasonic levitation to initiate and track charge transfer

NASA Astrophysics Data System (ADS)

Lee, Victor; James, Nicole M.; Waitukaitis, Scott R.; Jaeger, Heinrich M.

2018-03-01

Electrostatic charging of insulating fine particles can be responsible for numerous phenomena ranging from lightning in volcanic plumes to dust explosions. However, even basic aspects of how fine particles become charged are still unclear. Studying particle charging is challenging because it usually involves the complexities associated with many-particle collisions. To address these issues, we introduce a method based on acoustic levitation, which makes it possible to initiate sequences of repeated collisions of a single submillimeter particle with a flat plate, and to precisely measure the particle charge in situ after each collision. We show that collisional charge transfer between insulators is dependent on the hydrophobicity of the contacting surfaces. We use glass, which we modify by attaching nonpolar molecules to the particle, the plate, or both. We find that hydrophilic surfaces develop significant positive charges after contacting hydrophobic surfaces. Moreover, we demonstrate that charging between a hydrophilic and a hydrophobic surface is suppressed in an acidic environment and enhanced in a basic one. Application of an electric field during each collision is found to modify the charge transfer, again depending on surface hydrophobicity. We discuss these results within the context of contact charging due to ion transfer, and we show that they lend strong support to O H- ions as the charge carriers.

Electron Transfer Dissociation: Effects of Cation Charge State on Product Partitioning in Ion/Ion Electron Transfer to Multiply Protonated Polypeptides

PubMed Central

Liu, Jian; McLuckey, Scott A.

2012-01-01

The effect of cation charge state on product partitioning in the gas-phase ion/ion electron transfer reactions of multiply protonated tryptic peptides, model peptides, and relatively large peptides with singly charged radical anions has been examined. In particular, partitioning into various competing channels, such as proton transfer (PT) versus electron transfer (ET), electron transfer with subsequent dissociation (ETD) versus electron transfer with no dissociation (ET,noD), and fragmentation of backbone bonds versus fragmentation of side chains, was measured quantitatively as a function of peptide charge state to allow insights to be drawn about the fundamental aspects of ion/ion reactions that lead to ETD. The ET channel increases relative to the PT channel, ETD increases relative to ET,noD, and fragmentation at backbone bonds increases relative to side-chain cleavages as cation charge state increases. The increase in ET versus PT with charge state is consistent with a Landau-Zener based curve-crossing model. An optimum charge state for ET is predicted by the model for the ground state-to-ground state reaction. However, when the population of excited product ion states is considered, it is possible that a decrease in ET efficiency as charge state increases will not be observed due to the possibility of the population of excited electronic states of the products. Several factors can contribute to the increase in ETD versus ET,noD and backbone cleavage versus side-chain losses. These factors include an increase in reaction exothermicity and charge state dependent differences in precursor and product ion structures, stabilities, and sites of protonation. PMID:23264749

DNA Damage by Ionizing Radiation: Tandem Double Lesions by Charged Particles

NASA Technical Reports Server (NTRS)

Huo, Winifred M.; Chaban, Galina M.; Wang, Dunyou; Dateo, Christopher E.

2005-01-01

Oxidative damages by ionizing radiation are the source of radiation-induced carcinogenesis, damage to the central nervous system, lowering of the immune response, as well as other radiation-induced damages to human health. Monte Carlo track simulations and kinetic modeling of radiation damages to the DNA employ available molecular and cellular data to simulate the biological effect of high and low LET radiation io the DNA. While the simulations predict single and double strand breaks and base damages, so far all complex lesions are the result of stochastic coincidence from independent processes. Tandem double lesions have not yet been taken into account. Unlike the standard double lesions that are produced by two separate attacks by charged particles or radicals, tandem double lesions are produced by one single attack. The standard double lesions dominate at the high dosage regime. On the other hand, tandem double lesions do not depend on stochastic coincidences and become important at the low dosage regime of particular interest to NASA. Tandem double lesions by hydroxyl radical attack of guanine in isolated DNA have been reported at a dosage of radiation as low as 10 Gy. The formation of two tandem base lesions was found to be linear with the applied doses, a characteristic of tandem lesions. However, tandem double lesions from attack by a charged particle have not been reported.

The double-layer of penetrable ions: an alternative route to charge reversal.

PubMed

Frydel, Derek; Levin, Yan

2013-05-07

We investigate a double-layer of penetrable ions near a charged wall. We find a new mechanism for charge reversal that occurs in the weak-coupling regime and, accordingly, the system is suitable for the mean-field analysis. The penetrability is achieved by smearing-out the ionic charge inside a sphere, so there is no need to introduce non-electrostatic forces and the system in the low coupling limit can be described by a modified version of the Poisson-Boltzmann equation. The predictions of the theory are compared with the Monte Carlo simulations.

Through-Space Intervalence Charge Transfer as a Mechanism for Charge Delocalisation in Metal-Organic Frameworks.

PubMed

Hua, Carol; Doheny, Patrick William; Ding, Bowen; Chan, Bun; Yu, Michelle; Kepert, Cameron J; D'Alessandro, Deanna M

2018-05-04

Understanding the nature of charge transfer mechanisms in 3-dimensional Metal-Organic Frameworks (MOFs) is an important goal owing to the possibility of harnessing this knowledge to design conductive frameworks. These materials have been implicated as the basis for the next generation of technological devices for applications in energy storage and conversion, including electrochromic devices, electrocatalysts, and battery materials. After nearly two decades of intense research into MOFs, the mechanisms of charge transfer remain relatively poorly understood, and new strategies to achieve charge mobility remain elusive and challenging to experimentally explore, validate and model. We now demonstrate that aromatic stacking interactions in Zn(II) frameworks containing cofacial thiazolo[5,4-d]thiazole units lead to a mixed-valence state upon electrochemical or chemical reduction. This through-space Intervalence Charge Transfer (IVCT) phenomenon represents a new mechanism for charge delocalisation in MOFs. Computational modelling of the optical data combined with application of Marcus-Hush theory to the IVCT bands for the mixed-valence framework has enabled quantification of the degree of delocalisation using both in situ and ex situ electro- and spectro-electrochemical methods. A distance dependence for the through-space electron transfer has also been identified on the basis of experimental studies and computational calculations. This work provides a new window into electron transfer phenomena in 3-dimensional coordination space, of relevance to electroactive MOFs where new mechanisms for charge transfer are highly sought after, and to understanding biological light harvesting systems where through-space mixed-valence interactions are operative.

Hydrolysis-controlled protein adsorption and antifouling behaviors of mixed charged self-assembled monolayer: A molecular simulation study.

PubMed

Liu, Jie; Zhou, Jian

2016-08-01

Understanding the mechanism of the antimicrobial and antifouling properties of mixed charged materials is of great significance. The interactions between human gamma fibrinogen (γFg) and mixed carboxylic methyl ether-terminated (COOCH3-) and trimethylamino-terminated (N(CH3)3(+)-) SAMs and the influence of hydrolysis were studied by molecular simulations. After hydrolysis, the mixed SAMs exhibit behaviors from antimicrobial to antifouling, since the COOCH3-thiols were translated into carboxylic acid (COO(-)-) terminated thiols, which carried a net charge of -1 e. Simulation results showed that the main differences between COOCH3-/N(CH3)3(+)-SAM and COO(-)-/N(CH3)3(+)-SAM are the charged property and the hydration layer above the surface. γFg could stably adsorb on the positively-charged COOCH3-/N(CH3)3(+)-SAM. The adsorption behavior is mainly induced by the strong electrostatic attraction. There is a single hydration layer bound to the surface, which is related to the N(CH3)3(+) groups. The van der Waals repulsion between γFg and the single hydration layer are not strong enough to compensate the strong electrostatic attraction. After hydrolysis, the positively-charged SAM was transferred to a neutral mixed charged surface, the electrostatic attraction between γFg and the surface disappears. Meanwhile, the SAM surface is covered by double hydration layers, which is induced by the N(CH3)3(+) and COO(-) groups; water molecules around COO(-) groups are obviously denser than that around N(CH3)3(+) groups. With the combined contribution from double hydration layers and the vanishment of electrostatic attraction, γFg is forced to desorb from the surface. After hydrolysis, the internal structure of mixed SAM appears more ordered due to the electrostatic interactions between charged groups on the top of SAMs. The antimicrobial and antifouling materials are of great importance in many biological applications. The strong hydration property of surfaces and the interactions between proteins and surfaces play a key role in resisting protein adsorption. The mixed SAMs, constructed from a 1:1 combination of COOCH3- and N(CH3)3(+)-terminated thiols, can induce protein adsorption mainly through the electrostatic interaction. When the COOCH3-terminated thiols were hydrolyzed to negatively charged COO(-)-terminated thiols, the mixed-charged SAMs switched from antimicrobial to antifouling. Due to the strong hydration property of the mixed charged SAMs, the adsorbed γFg moved away from the surface. Understanding the interactions between protein and mixed-charged SAMs in the atomistic level is important for the practical design and development of new antimicrobial and antifouling materials. Copyright © 2016 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Proton transfer complexes based on some π-acceptors having acidic protons with 3-amino-6-[2-(2-thienyl)vinyl]-1,2,4-triazin-5(4 H)-one donor: Synthesis and spectroscopic characterizations

NASA Astrophysics Data System (ADS)

Refat, Moamen S.; Saad, Hosam A.; Adam, Abdel Majid A.

2011-05-01

Charge transfer complexes based on 3-amino-6-[2-(2-thienyl)vinyl]-1,2,4-triazin-5(4 H)-one (ArNH 2) organic basic donor and pi-acceptors having acidic protons such as picric acid (PiA), hydroquinone (Q(OH) 2) and 3,5-dinitrobenzene (DNB) have been synthesized and spectroscopically studied. The sbnd NH3+ ammonium ion was formed under the acid-base theory through proton transfer from an acidic to basic centers in all charge transfer complexes resulted. The values of formation constant ( KCT) and molar extinction coefficient ( ɛCT) which were estimated from the spectrophotometric studies have a dramatic effect for the charge transfer complexes with differentiation of pi-acceptors. For further studies the vibrational spectroscopy of the [( ArNH3+)(PiA -)] (1), [( ArNH3+)(Q (OH)2-)] (2) and [( ArNH3+)(DNB -)] (3) of (1:1) charge transfer complexes of (donor: acceptor) were characterized by elemental analysis, infrared spectra, Raman spectra, 1H and 13CNMR spectra. The experimental data of elemental analyses of the charge transfer complexes (1), (2) and (3) were in agreement with calculated data. The IR and Raman spectra of (1), (2) and (3) are indicated to the presence of bands around 3100 and 1600 cm -1 distinguish to sbnd NH3+. The thermogravimetric analysis (TG) and differential scanning calorimetry (DSC) techniques were performed to give knowledge about thermal stability behavior of the synthesized charge transfer complexes. The morphological features of start materials and charge transfer complexes were investigated using scanning electron microscopy (SEM) and optical microscopy.

The adsorption-desorption transition of double-stranded DNA interacting with an oppositely charged dendrimer induced by multivalent anions.

PubMed

Jiang, Yangwei; Zhang, Dong; Zhang, Yaoyang; Deng, Zhenyu; Zhang, Linxi

2014-05-28

The adsorption-desorption transition of DNA in DNA-dendrimer solutions is observed when high-valence anions, such as hexavalent anions, are added to the DNA-dendrimer solutions. In the DNA-dendrimer solutions with low-valence anions, dendrimers bind tightly with the V-shaped double-stranded DNA. When high-valence anions, such as pentavalent or hexavalent anions, are added to the DNA-dendrimer solutions, the double-stranded DNA chains can be stretched straightly and the dendrimers are released from the double-stranded DNA chains. In fact, adding high-valence anions to the solutions can change the charge spatial distribution in the DNA-dendrimer solutions, and weaken the electrostatic interactions between the positively charged dendrimers and the oppositely charged DNA chains. Adsorption-desorption transition of DNA is induced by the overcharging of dendrimers. This investigation is capable of helping us understand how to control effectively the release of DNA in gene/drug delivery because an effective gene delivery for dendrimers includes non-covalent DNA-dendrimer binding and the effective release of DNA in gene therapy.

Efficient carbon dots/NiFe-layered double hydroxide/BiVO4 photoanodes for photoelectrochemical water splitting

NASA Astrophysics Data System (ADS)

Lv, Xiaowei; Xiao, Xin; Cao, Minglei; Bu, Yi; Wang, Chuanqing; Wang, Mingkui; Shen, Yan

2018-05-01

Modification of semiconductor photoanodes with oxygen evolution catalyst (OEC) is an effective approach for improving photoelectrochemical (PEC) water splitting efficiency. In the configuration, how to increase the activity of OEC is crucial to further improve PEC performance. Herein, a ternary photoanode system was designed to enhance PEC efficiency of photoelectrodes through introducing carbon dots (CDs), NiFe-layered double hydroxide (NiFe-LDH) nanosheets on BiVO4 particles. Systematic research shows that NiFe-LDH serves as an OEC which accelerates oxygen evolution kinetics, while the introduction of CDs can further reduce charge transfer resistance and overpotential for oxygen evolution. Under the synergistic effect of NiFe-LDH and CDs, the photocurrent and incident photon to current conversion efficiency (IPCE) of the resulting CDs/NiFe-LDH/BiVO4 photoanode is improved significantly than those of the NiFe-LDH/BiVO4 electrode. Consequently, such a ternary heterostructure could be an alternative way to further enhance PEC water splitting performance.

Enhanced photoelectrical performance of dye-sensitized solar cells with double-layer TiO2 on perovskite SrTiO3 substrate

NASA Astrophysics Data System (ADS)

Liu, Qiuhong; Sun, Qiong; Zhang, Min; Li, Yang; Zhao, Mei; Dong, Lifeng

2016-04-01

In this research, perovskite SrTiO3 particles are synthesized by a hydrothermal method, and TiO2 with a double-layer structure is grown on the SrTiO3 surface by a hydrolysis-condensation process. Structural characterizations reveal that TiO2 comprises of two phases: anatase film at the bottom and single-crystal rutile nanorods grown along the [110] direction on top. The TiO2-SrTiO3 composite film is investigated as photoanode material for dye-sensitized solar cells. In comparison with pure TiO2 and SrTiO3, the composite photoanode shows a much better performance in photoelectric conversion efficiency (1.35 %), which is about 2 and 100 times as efficient as pure TiO2 and SrTiO3, respectively. This indicates that the composite structure can facilitate charge carrier transfer and reduce electron-hole recombination to enhance photoelectrical properties of TiO2-based photoanode materials.

Process techniques of charge transfer time reduction for high speed CMOS image sensors

NASA Astrophysics Data System (ADS)

Zhongxiang, Cao; Quanliang, Li; Ye, Han; Qi, Qin; Peng, Feng; Liyuan, Liu; Nanjian, Wu

2014-11-01

This paper proposes pixel process techniques to reduce the charge transfer time in high speed CMOS image sensors. These techniques increase the lateral conductivity of the photo-generated carriers in a pinned photodiode (PPD) and the voltage difference between the PPD and the floating diffusion (FD) node by controlling and optimizing the N doping concentration in the PPD and the threshold voltage of the reset transistor, respectively. The techniques shorten the charge transfer time from the PPD diode to the FD node effectively. The proposed process techniques do not need extra masks and do not cause harm to the fill factor. A sub array of 32 × 64 pixels was designed and implemented in the 0.18 μm CIS process with five implantation conditions splitting the N region in the PPD. The simulation and measured results demonstrate that the charge transfer time can be decreased by using the proposed techniques. Comparing the charge transfer time of the pixel with the different implantation conditions of the N region, the charge transfer time of 0.32 μs is achieved and 31% of image lag was reduced by using the proposed process techniques.

Nonlocal Poisson-Fermi double-layer models: Effects of nonuniform ion sizes on double-layer structure

NASA Astrophysics Data System (ADS)

Xie, Dexuan; Jiang, Yi

2018-05-01

This paper reports a nonuniform ionic size nonlocal Poisson-Fermi double-layer model (nuNPF) and a uniform ionic size nonlocal Poisson-Fermi double-layer model (uNPF) for an electrolyte mixture of multiple ionic species, variable voltages on electrodes, and variable induced charges on boundary segments. The finite element solvers of nuNPF and uNPF are developed and applied to typical double-layer tests defined on a rectangular box, a hollow sphere, and a hollow rectangle with a charged post. Numerical results show that nuNPF can significantly improve the quality of the ionic concentrations and electric fields generated from uNPF, implying that the effect of nonuniform ion sizes is a key consideration in modeling the double-layer structure.

Proton transfer to charged platinum electrodes. A molecular dynamics trajectory study.

PubMed

Wilhelm, Florian; Schmickler, Wolfgang; Spohr, Eckhard

2010-05-05

A recently developed empirical valence bond (EVB) model for proton transfer on Pt(111) electrodes (Wilhelm et al 2008 J. Phys. Chem. C 112 10814) has been applied in molecular dynamics (MD) simulations of a water film in contact with a charged Pt surface. A total of seven negative surface charge densities σ between -7.5 and -18.9 µC cm(-2) were investigated. For each value of σ, between 30 and 84 initial conditions of a solvated proton within a water slab were sampled, and the trajectories were integrated until discharge of a proton occurred on the charged surfaces. We have calculated the mean rates for discharge and for adsorption of solvated protons within the adsorbed water layer in contact with the metal electrode as a function of surface charge density. For the less negative values of σ we observe a Tafel-like exponential increase of discharge rate with decreasing σ. At the more negative values this exponential increase levels off and the discharge process is apparently transport limited. Mechanistically, the Tafel regime corresponds to a stepwise proton transfer: first, a proton is transferred from the bulk into the contact water layer, which is followed by transfer of a proton to the charged surface and concomitant discharge. At the more negative surface charge densities the proton transfer into the contact water layer and the transfer of another proton to the surface and its discharge occur almost simultaneously.

A 7 ke-SD-FWC 1.2 e-RMS Temporal Random Noise 128×256 Time-Resolved CMOS Image Sensor With Two In-Pixel SDs for Biomedical Applications.

PubMed

Seo, Min-Woong; Kawahito, Shoji

2017-12-01

A large full well capacity (FWC) for wide signal detection range and low temporal random noise for high sensitivity lock-in pixel CMOS image sensor (CIS) embedded with two in-pixel storage diodes (SDs) has been developed and presented in this paper. For fast charge transfer from photodiode to SDs, a lateral electric field charge modulator (LEFM) is used for the developed lock-in pixel. As a result, the time-resolved CIS achieves a very large SD-FWC of approximately 7ke-, low temporal random noise of 1.2e-rms at 20 fps with true correlated double sampling operation and fast intrinsic response less than 500 ps at 635 nm. The proposed imager has an effective pixel array of and a pixel size of . The sensor chip is fabricated by Dongbu HiTek 1P4M 0.11 CIS process.

Charge transport in electrically doped amorphous organic semiconductors.

PubMed

Yoo, Seung-Jun; Kim, Jang-Joo

2015-06-01

This article reviews recent progress on charge generation by doping and its influence on the carrier mobility in organic semiconductors (OSs). The doping induced charge generation efficiency is generally low in OSs which was explained by the integer charge transfer model and the hybrid charge transfer model. The ionized dopants formed by charge transfer between hosts and dopants can act as Coulomb traps for mobile charges, and the presence of Coulomb traps in OSs broadens the density of states (DOS) in doped organic films. The Coulomb traps strongly reduce the carrier hopping rate and thereby change the carrier mobility, which was confirmed by experiments in recent years. In order to fully understand the doping mechanism in OSs, further quantitative and systematic analyses of charge transport characteristics must be accomplished. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Frequency response of electrochemical cells

NASA Technical Reports Server (NTRS)

Thomas, Daniel L.

1990-01-01

The main objective was to examine the feasibility of using frequency response techniques (1) as a tool in destructive physical analysis of batteries, particularly for estimating electrode structural parameters such as specific area, porosity, and tortuosity and (2) as a non-destructive testing technique for obtaining information such as state of charge and acceptability for space flight. The phenomena that contribute to the frequency response of an electrode include: (1) double layer capacitance; (2) Faradaic reaction resistance; (3) mass transfer of Warburg impedance; and (4) ohmic solution resistance. Nickel cadmium cells were investigated in solutions of KOH. A significant amount of data was acquired. Quantitative data analysis, using the developed software, is planned for the future.

Voltage and frequency dependence of prestin-associated charge transfer

PubMed Central

Sun, Sean X.; Farrell, Brenda; Chana, Matthew S.; Oster, George; Brownell, William E.; Spector, Alexander A.

2009-01-01

Membrane protein prestin is a critical component of the motor complex that generates forces and dimensional changes in cells in response to changes in the cell membrane potential. In its native cochlear outer hair cell, prestin is crucial to the amplification and frequency selectivity of the mammalian ear up to frequencies of tens of kHz. Other cells transfected with prestin acquire voltage-dependent properties similar to those of the native cell. The protein performance is critically dependent on chloride ions, and intrinsic protein charges also play a role. We propose an electro-diffusion model to reveal the frequency and voltage dependence of electric charge transfer by prestin. The movement of the combined charge (i.e., anion and protein charges) across the membrane is described with a Fokker-Planck equation coupled to a kinetic equation that describes the binding of chloride ions to prestin. We found a voltage-and frequency-dependent phase shift between the transferred charge and the applied electric field that determines capacitive and resistive components of the transferred charge. The phase shift monotonically decreases from zero to -90 degree as a function of frequency. The capacitive component as a function of voltage is bell-shaped, and decreases with frequency. The resistive component is bell-shaped for both voltage and frequency. The capacitive and resistive components are similar to experimental measurements of charge transfer at high frequencies. The revealed nature of the transferred charge can help reconcile the high-frequency electrical and mechanical observations associated with prestin, and it is important for further analysis of the structure and function of this protein. PMID:19490917

Chemically Doped Double-Walled Carbon Nanotubes: Cylindrical Molecular Capacitors

NASA Astrophysics Data System (ADS)

Chen, Gugang; Bandow, S.; Margine, E. R.; Nisoli, C.; Kolmogorov, A. N.; Crespi, Vincent H.; Gupta, R.; Sumanasekera, G. U.; Iijima, S.; Eklund, P. C.

2003-06-01

A double-walled carbon nanotube is used to study the radial charge distribution on the positive inner electrode of a cylindrical molecular capacitor. The outer electrode is a shell of bromine anions. Resonant Raman scattering from phonons on each carbon shell reveals the radial charge distribution. A self-consistent tight-binding model confirms the observed molecular Faraday cage effect, i.e., most of the charge resides on the outer wall, even when this wall was originally semiconducting and the inner wall was metallic.

Chemically doped double-walled carbon nanotubes: cylindrical molecular capacitors.

PubMed

Chen, Gugang; Bandow, S; Margine, E R; Nisoli, C; Kolmogorov, A N; Crespi, Vincent H; Gupta, R; Sumanasekera, G U; Iijima, S; Eklund, P C

2003-06-27

A double-walled carbon nanotube is used to study the radial charge distribution on the positive inner electrode of a cylindrical molecular capacitor. The outer electrode is a shell of bromine anions. Resonant Raman scattering from phonons on each carbon shell reveals the radial charge distribution. A self-consistent tight-binding model confirms the observed molecular Faraday cage effect, i.e., most of the charge resides on the outer wall, even when this wall was originally semiconducting and the inner wall was metallic.

Molecular Structures and Momentum Transfer Cross Sections: The Influence of the Analyte Charge Distribution.

PubMed

Young, Meggie N; Bleiholder, Christian

2017-04-01

Structure elucidation by ion mobility spectrometry-mass spectrometry methods is based on the comparison of an experimentally measured momentum transfer cross-section to cross-sections calculated for model structures. Thus, it is imperative that the calculated cross-section must be accurate. However, it is not fully understood how important it is to accurately model the charge distribution of an analyte ion when calculating momentum transfer cross-sections. Here, we calculate and compare momentum transfer cross-sections for carbon clusters that differ in mass, charge state, and mode of charge distribution, and vary temperature and polarizability of the buffer gas. Our data indicate that the detailed distribution of the ion charge density is intimately linked to the contribution of glancing collisions to the momentum transfer cross-section. The data suggest that analyte ions with molecular mass ~3 kDa or momentum transfer cross-section 400-500 Å 2 would be significantly influenced by the charge distribution in nitrogen buffer gas. Our data further suggest that accurate structure elucidation on the basis of IMS-MS data measured in nitrogen buffer gas must account for the molecular charge distribution even for systems as large as C 960 (~12 kDa) when localized charges are present and/or measurements are conducted under cryogenic temperatures. Finally, our data underscore that accurate structure elucidation is unlikely if ion mobility data recorded in one buffer gas is converted into other buffer gases when electronic properties of the buffer gases differ. Graphical Abstract ᅟ.

The Self-Association of Graphane Is Driven by London Dispersion and Enhanced Orbital Interactions.

PubMed

Wang, Changwei; Mo, Yirong; Wagner, J Philipp; Schreiner, Peter R; Jemmis, Eluvathingal D; Danovich, David; Shaik, Sason

2015-04-14

We investigated the nature of the cohesive energy between graphane sheets via multiple CH···HC interactions, using density functional theory (DFT) including dispersion correction (Grimme's D3 approach) computations of [n]graphane σ dimers (n = 6-73). For comparison, we also evaluated the binding between graphene sheets that display prototypical π/π interactions. The results were analyzed using the block-localized wave function (BLW) method, which is a variant of ab initio valence bond (VB) theory. BLW interprets the intermolecular interactions in terms of frozen interaction energy (ΔE(F)) composed of electrostatic and Pauli repulsion interactions, polarization (ΔE(pol)), charge-transfer interaction (ΔE(CT)), and dispersion effects (ΔE(disp)). The BLW analysis reveals that the cohesive energy between graphane sheets is dominated by two stabilizing effects, namely intermolecular London dispersion and two-way charge transfer energy due to the σ(CH) → σ*(HC) interactions. The shift of the electron density around the nonpolar covalent C-H bonds involved in the intermolecular interaction decreases the C-H bond lengths uniformly by 0.001 Å. The ΔE(CT) term, which accounts for ∼15% of the total binding energy, results in the accumulation of electron density in the interface area between two layers. This accumulated electron density thus acts as an electronic "glue" for the graphane layers and constitutes an important driving force in the self-association and stability of graphane under ambient conditions. Similarly, the "double faced adhesive tape" style of charge transfer interactions was also observed among graphene sheets in which it accounts for ∼18% of the total binding energy. The binding energy between graphane sheets is additive and can be expressed as a sum of CH···HC interactions, or as a function of the number of C-H bonds.

Experimental exploration of the Mulliken-Hush relationship for intramolecular electron transfer reactions.

PubMed

Mukherjee, Tamal; Ito, Naoki; Gould, Ian R

2011-03-17

The Mulliken-Hush (M-H) relationship provides the critical link between optical and thermal electron transfer processes, and yet very little direct experimental support for its applicability has been provided. Dicyanovinylazaadamantane (DCVA) represents a simple two-state (neutral/charge-transfer) intramolecular electron transfer system that exhibits charge-transfer absorption and emission spectra that are readily measurable in solvents with a wide range of polarities. In this regard it represents an ideal model system for studying the factors that control both optical charge separation (absorption) and recombination (emission) processes in solution. Here we explore the applicability of the M-H relation to quantitative descriptions of the optical charge-transfer processes in DCVA. For DCVA, the measured radiative rate constants exhibit a linear dependence on transition energy, and transition dipole moments exhibit an inverse dependence on transition energy, consistent with the M-H relationship.

Density functional plus dynamical mean-field theory of the metal-insulator transition in early transition-metal oxides

NASA Astrophysics Data System (ADS)

Dang, Hung T.; Ai, Xinyuan; Millis, Andrew J.; Marianetti, Chris A.

2014-09-01

The combination of density functional theory and single-site dynamical mean-field theory, using both Hartree and full continuous-time quantum Monte Carlo impurity solvers, is used to study the metal-insulator phase diagram of perovskite transition-metal oxides of the form ABO3 with a rare-earth ion A =Sr, La, Y and transition metal B =Ti, V, Cr. The correlated subspace is constructed from atomiclike d orbitals defined using maximally localized Wannier functions derived from the full p-d manifold; for comparison, results obtained using a projector method are also given. Paramagnetic DFT + DMFT computations using full charge self-consistency along with the standard "fully localized limit" (FLL) double counting are shown to incorrectly predict that LaTiO3, YTiO3, LaVO3, and SrMnO3 are metals. A more general examination of the dependence of physical properties on the mean p-d energy splitting, the occupancy of the correlated d states, the double-counting correction, and the lattice structure demonstrates the importance of charge-transfer physics even in the early transition-metal oxides and elucidates the factors underlying the failure of the standard approximations. If the double counting is chosen to produce a p-d splitting consistent with experimental spectra, single-site dynamical mean-field theory provides a reasonable account of the materials properties. The relation of the results to those obtained from "d-only" models in which the correlation problem is based on the frontier orbital p-d antibonding bands is determined. It is found that if an effective interaction U is properly chosen the d-only model provides a good account of the physics of the d1 and d2 materials.

Analysis of the heat transfer in double and triple concentric tube heat exchangers

NASA Astrophysics Data System (ADS)

Rădulescu, S.; Negoiţă, L. I.; Onuţu, I.

2016-08-01

The tubular heat exchangers (shell and tube heat exchangers and concentric tube heat exchangers) represent an important category of equipment in the petroleum refineries and are used for heating, pre-heating, cooling, condensation and evaporation purposes. The paper presents results of analysis of the heat transfer to cool a petroleum product in two types of concentric tube heat exchangers: double and triple concentric tube heat exchangers. The cooling agent is water. The triple concentric tube heat exchanger is a modified constructive version of double concentric tube heat exchanger by adding an intermediate tube. This intermediate tube improves the heat transfer by increasing the heat area per unit length. The analysis of the heat transfer is made using experimental data obtained during the tests in a double and triple concentric tube heat exchanger. The flow rates of fluids, inlet and outlet temperatures of water and petroleum product are used in determining the performance of both heat exchangers. Principally, for both apparatus are calculated the overall heat transfer coefficients and the heat exchange surfaces. The presented results shows that triple concentric tube heat exchangers provide better heat transfer efficiencies compared to the double concentric tube heat exchangers.

Fluid flow and heat transfer characteristics of an enclosure with fin as a top cover of a solar collector

NASA Astrophysics Data System (ADS)

Ambarita, H.; Ronowikarto, A. D.; Siregar, R. E. T.; Setyawan, E. Y.

2018-03-01

To reduce heat loses in a flat plate solar collector, double glasses cover is employed. Several studies show that the heat loss from the glass cover is still very significant in comparison with other losses. Here, double glasses cover with attached fins is proposed. In the present work, the fluid flow and heat transfer characteristics of the enclosure between the double glass cover are investigated numerically. The objective is to examine the effect of the fin to the heat transfer rate of the cover. Two-dimensional governing equations are developed. The governing equations and the boundary conditions are solved using commercial Computational Fluid Dynamics code. The fluid flow and heat transfer characteristics are plotted, and numerical results are compared with empirical correlation. The results show that the presence of the fin strongly affects the fluid flow and heat transfer characteristics. The fin can reduce the heat transfer rate up to 22.42% in comparison with double glasses cover without fins.

Photoinduced charge-transfer electronic excitation of tetracyanoethylene/tetramethylethylene complex in dichloromethane

NASA Astrophysics Data System (ADS)

Xu, Long-Kun; Bi, Ting-Jun; Ming, Mei-Jun; Wang, Jing-Bo; Li, Xiang-Yuan

2017-07-01

Based on the previous work on nonequilibrium solvation model by the authors, Intermolecular charge-transfer electronic excitation of tetracyanoethylene (TCE)/tetramethylethylene (TME) π -stacked complex in dichloromethane (DCM) has been investigated. For weak interaction correction, dispersion corrected functional DFT-D3 is adopted for geometry optimization. In order to identify the excitation metric, dipole moment components of each Cartesian direction, atomic charge, charge separation and Δr index are analyzed for TCE/TME complex. Calculation shows that the calculated excitation energy is dependent on the functional choice, when conjuncted with suitable time-dependent density functional, the modified nonequilibrium expression gives satisfied results for intermolecular charge-transfer electronic excitation.

Charge Transfer and Catalysis at the Metal Support Interface

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baker, Lawrence Robert

Kinetic, electronic, and spectroscopic characterization of model Pt–support systems are used to demonstrate the relationship between charge transfer and catalytic activity and selectivity. The results show that charge flow controls the activity and selectivity of supported metal catalysts. This dissertation builds on extensive existing knowledge of metal–support interactions in heterogeneous catalysis. The results show the prominent role of charge transfer at catalytic interfaces to determine catalytic activity and selectivity. Further, this research demonstrates the possibility of selectively driving catalytic chemistry by controlling charge flow and presents solid-state devices and doped supports as novel methods for obtaining electronic control over catalyticmore » reaction kinetics.« less

Surfactant-enhanced singlet energy transfer from the charge-transfer excited state of tris(2,2-bipyridine) ruthenium(II)

NASA Astrophysics Data System (ADS)

Mandal, Krishnagopal; Demas, J. N.

1981-12-01

Very efficient (45-75%) sodium lauryl sulfate (NaLS) enhanced singlet enengy transfer has been demonstrated from the spin-orbit charge-transfer excited state of [Ru(bpy) 3] 2+ (bpy = 2,2'-bipyridine) to the xxx violet, oxazine 1, and rhodamine 101 at concentrations of 10 -5 M, Energy transfer occurs in xxx.

Laboratory Studies of Thermal Energy Charge Transfer of Silicon and Iron Ions in Astrophysical Plasmas

NASA Technical Reports Server (NTRS)

Kwong, Victor H. S.

1997-01-01

The laser ablation/ion storage facility at the UNLV Physics Department is dedicated to the study of atomic processes in low temperature plasmas. Our current program is directed to the study of charge transfer of multiply charged ions and neutrals that are of importance to astrophysics at energies less than 1 eV (about 10(exp 4) K). Specifically, we measure the charge transfer rate coefficient of ions such as N(2+), Si(3+), Si(3+), with helium and Fe(2+) with molecular and atomic hydrogen. All these ions are found in a variety of astrophysical plasmas. Their electron transfer reactions with neutral atoms can affect the ionization equilibrium of the plasma.

Molecular orbital (SCF-X-α-SW) theory of Fe2+-Mn3+, Fe3+-Mn2+, and Fe3+-Mn3+ charge transfer and magnetic exchange in oxides and silicates

USGS Publications Warehouse

Sherman, David M.

1990-01-01

Metal-metal charge-transfer and magnetic exchange interactions have important effects on the optical spectra, crystal chemistry, and physics of minerals. Previous molecular orbital calculations have provided insight on the nature of Fe2+-Fe3+ and Fe2+-Ti4+ charge-transfer transitions in oxides and silicates. In this work, spin-unrestricted molecular orbital calculations on (FeMnO10) clusters are used to study the nature of magnetic exchange and electron delocalization (charge transfer) associated with Fe3+-Mn2+, Fe3+-Mn3+, and Fe2+-Mn3+ interactions in oxides and silicates. 

Improving nanoparticle dispersion and charge transfer in cadmium telluride tetrapod and conjugated polymer blends.

PubMed

Monson, Todd C; Hollars, Christopher W; Orme, Christine A; Huser, Thomas

2011-04-01

The dispersion of CdTe tetrapods in a conducting polymer and the resulting charge transfer is studied using a combination of confocal fluorescence microscopy and atomic force microscopy (AFM). The results of this work show that both the tetrapod dispersion and charge transfer between the CdTe and conducting polymer (P3HT) are greatly enhanced by exchanging the ligands on the surface of the CdTe and by choosing proper solvent mixtures. The ability to experimentally probe the relationship between particle dispersion and charge transfer through the combination of AFM and fluorescence microscopy provides another avenue to assess the performance of polymer/semiconductor nanoparticle composites. © 2011 American Chemical Society

Spectral resolution of states relevant to photoinduced charge transfer in modified pentacene/ZnO field-effect transistors

NASA Astrophysics Data System (ADS)

Spalenka, Josef W.; Mannebach, Ehren M.; Bindl, Dominick J.; Arnold, Michael S.; Evans, Paul G.

2011-11-01

Pentacene field-effect transistors incorporating ZnO quantum dots can be used as a sensitive probe of the optical properties of a buried donor-acceptor interface. Photoinduced charge transfer between pentacene and ZnO in these devices varies with incident photon energy and reveals which energies will contribute most to charge transfer in other structures. A subsequent slow return to the dark state following the end of illumination arises from near-interface traps. Charge transfer has a sharp onset at 1.7 eV and peaks at 1.82 and 2.1 eV due to transitions associated with excitons, features absent in pentacene FETs without ZnO.

Investigation of ground state charge transfer complex between paracetamol and p-chloranil through DFT and UV-visible studies

NASA Astrophysics Data System (ADS)

Shukla, Madhulata; Srivastava, Nitin; Saha, Satyen

2012-08-01

The present report deals with the theoretical investigation on ground state structure and charge transfer (CT) transitions in paracetamol (PA)/p-chloranil (CA) complex using Density Functional Theory (DFT) and Time Dependent Density Functional Theory (TD-DFT) method. It is found that Cdbnd O bond length of p-chloranil increases on complexation with paracetamol along with considerable amount of charge transfer from PA to CA. TD-DFT calculations have been performed to analyse the observed UV-visible spectrum of PA-CA charge transferred complex. Interestingly, in addition to expected CT transition, a weak symmetry relieved π-π* transition in the chloranil is also observed.

Charge transfer in iridate-manganite superlattices

DOE PAGES

Okamoto, Satoshi; Nichols, John; Sohn, Changhee; ...

2017-03-03

Charge transfer in superlattices consisting of SrIrOmore » $$_3$$ and SrMnO$$_3$$ is investigated using density functional theory. Despite the nearly identical work function and non-polar interfaces between SrIrO$$_3$$ and SrMnO$$_3$$, rather large charge transfer was experimentally reported between them. Our results provide a qualitative understanding to such experimental reports. We further develop a microscopic model that captures the mechanism behind this phenomenon. This leads to unique strain dependence of such charge transfer in iridate-manganite superlattices. The predicted behavior is consistently verified by experiment. Lastly, our work thus demonstrates a new route to control electronic states in non-polar oxide heterostructures.« less

How can we make stable linear monoatomic chains? Gold-cesium binary subnanowires as an example of a charge-transfer-driven approach to alloying.

PubMed

Choi, Young Cheol; Lee, Han Myoung; Kim, Woo Youn; Kwon, S K; Nautiyal, Tashi; Cheng, Da-Yong; Vishwanathan, K; Kim, Kwang S

2007-02-16

On the basis of first-principles calculations of clusters and one dimensional infinitely long subnanowires of the binary systems, we find that alkali-noble metal alloy wires show better linearity and stability than either pure alkali metal or noble metal wires. The enhanced alternating charge buildup on atoms by charge transfer helps the atoms line up straight. The cesium doped gold wires showing significant charge transfer from cesium to gold can be stabilized as linear or circular monoatomic chains.

Inductive High Power Transfer Technologies for Electric Vehicles

NASA Astrophysics Data System (ADS)

Madzharov, Nikolay D.; Tonchev, Anton T.

2014-03-01

Problems associated with "how to charge the battery pack of the electric vehicle" become more important every passing day. Most logical solution currently is the non-contact method of charge, possessing a number of advantages over standard contact methods for charging. This article focuses on methods for Inductive high power contact-less transfer of energy at relatively small distances, their advantages and disadvantages. Described is a developed Inductive Power Transfer (IPT) system for fast charging of electric vehicles with nominal power of 30 kW over 7 to 9 cm air gap.

Charge-pump voltage converter

DOEpatents

Brainard, John P [Albuquerque, NM; Christenson, Todd R [Albuquerque, NM

2009-11-03

A charge-pump voltage converter for converting a low voltage provided by a low-voltage source to a higher voltage. Charge is inductively generated on a transfer rotor electrode during its transit past an inductor stator electrode and subsequently transferred by the rotating rotor to a collector stator electrode for storage or use. Repetition of the charge transfer process leads to a build-up of voltage on a charge-receiving device. Connection of multiple charge-pump voltage converters in series can generate higher voltages, and connection of multiple charge-pump voltage converters in parallel can generate higher currents. Microelectromechanical (MEMS) embodiments of this invention provide a small and compact high-voltage (several hundred V) voltage source starting with a few-V initial voltage source. The microscale size of many embodiments of this invention make it ideally suited for MEMS- and other micro-applications where integration of the voltage or charge source in a small package is highly desirable.

Tuning the role of charge-transfer states in intramolecular singlet exciton fission through side-group engineering.

PubMed

Lukman, Steven; Chen, Kai; Hodgkiss, Justin M; Turban, David H P; Hine, Nicholas D M; Dong, Shaoqiang; Wu, Jishan; Greenham, Neil C; Musser, Andrew J

2016-12-07

Understanding the mechanism of singlet exciton fission, in which a singlet exciton separates into a pair of triplet excitons, is crucial to the development of new chromophores for efficient fission-sensitized solar cells. The challenge of controlling molecular packing and energy levels in the solid state precludes clear determination of the singlet fission pathway. Here, we circumvent this difficulty by utilizing covalent dimers of pentacene with two types of side groups. We report rapid and efficient intramolecular singlet fission in both molecules, in one case via a virtual charge-transfer state and in the other via a distinct charge-transfer intermediate. The singlet fission pathway is governed by the energy gap between singlet and charge-transfer states, which change dynamically with molecular geometry but are primarily set by the side group. These results clearly establish the role of charge-transfer states in singlet fission and highlight the importance of solubilizing groups to optimize excited-state photophysics.

Tuning the role of charge-transfer states in intramolecular singlet exciton fission through side-group engineering

PubMed Central

Lukman, Steven; Chen, Kai; Hodgkiss, Justin M.; Turban, David H. P.; Hine, Nicholas D. M.; Dong, Shaoqiang; Wu, Jishan; Greenham, Neil C.; Musser, Andrew J.

2016-01-01

Understanding the mechanism of singlet exciton fission, in which a singlet exciton separates into a pair of triplet excitons, is crucial to the development of new chromophores for efficient fission-sensitized solar cells. The challenge of controlling molecular packing and energy levels in the solid state precludes clear determination of the singlet fission pathway. Here, we circumvent this difficulty by utilizing covalent dimers of pentacene with two types of side groups. We report rapid and efficient intramolecular singlet fission in both molecules, in one case via a virtual charge-transfer state and in the other via a distinct charge-transfer intermediate. The singlet fission pathway is governed by the energy gap between singlet and charge-transfer states, which change dynamically with molecular geometry but are primarily set by the side group. These results clearly establish the role of charge-transfer states in singlet fission and highlight the importance of solubilizing groups to optimize excited-state photophysics. PMID:27924819

Chemical and physical investigations on the charge transfer interaction of organic donors with iodine and its application as non-traditional organic conductors

NASA Astrophysics Data System (ADS)

Refat, Moamen S.; Sharshar, T.; Adam, Abdel Majid A.; Elsabawy, Khaled M.; Hemeda, O. M.

2014-09-01

The iso-leucine-iodide and methionine-iodide charge-transfer complexes were prepared and characterized using different spectroscopic techniques. The iodide charge-transfer complexes were synthesized by grinding KI-I2-amino acid with 1:1:1 M ratio in presence of few drops of methanol solvent. The structures of both solid amino acid iodide charge-transfer complexes are discussed with the help of the obtained results of the infrared and Raman laser spectra, Uv-vis. electronic spectra and thermal analyses. The electrical properties (AC resistivity and dielectric constant) of both complexes were investigated. The positron annihilation Doppler broadening (PADB) spectroscopies were also used to probe the structural changes of both complexes. The PADB line-shape parameters (S and W) were found to be dependent on the structure, electronic configuration of the charge transfer complex. The PADB technique is a powerful tool to probe the structural features of the KI-I2-amino acid complexes.

Opposites Attract: Organic Charge Transfer Salts

ERIC Educational Resources Information Center

van de Wouw, Heidi L.; Chamorro, Juan; Quintero, Michael; Klausen, Rebekka S.

2015-01-01

A laboratory experiment is described that introduces second-year undergraduate organic chemistry students to organic electronic materials. The discovery of metallic conductivity in the charge transfer salt tetrathiafulvalene tetracyanoquinodimethane (TTF-TCNQ) is a landmark result in the history of organic electronics. The charge transfer…

Optimisation of stability and charge transferability of ferrocene-encapsulated carbon nanotubes

NASA Astrophysics Data System (ADS)

Prajongtat, Pongthep; Sriyab, Suwannee; Zentgraf, Thomas; Hannongbua, Supa

2018-01-01

Ferrocene-encapsulated carbon nanotubes (Fc@CNTs) became promising nanocomposite materials for a wide range of applications due to their superior catalytic, mechanical and electronic properties. To open up new windows of applications, the highly stable and charge transferable encapsulation complexes are required. In this work, we designed the new encapsulation complexes formed from ferrocene derivatives (FcR, where R = -CHO, -CH2OH, -CON3 and -PCl2) and single-walled carbon nanotubes (SWCNTs). The influence of diameter and chirality of the nanotubes on the stability, charge transferability and electronic properties of such complexes has been investigated using density functional theory. The calculations suggest that the encapsulation stability and charge transferability of the encapsulation complexes depend on the size and chirality of the nanotubes. FcR@SWCNTs are more stable than Fc@SWCNTs at the optimum tube diameter. The greatest charge transfer was observed for FcCH2OH@SWCNTs and Fc@SWCNTs since the Fe d levels of FcCH2OH and Fc are nearly equal and close to the Fermi energy level of the nanotubes. The obtained results pave the way to the design of new encapsulated ferrocene derivatives which can give rise to higher stability and charge transferability of the encapsulation complexes.

Effect of a Dual Charge on the DNA-Conjugated Redox Probe on DNA Sensing by Short Hairpin Beacons Tethered to Gold Electrodes.

PubMed

Kékedy-Nagy, László; Shipovskov, Stepan; Ferapontova, Elena E

2016-08-16

Charges of redox species can critically affect both the interfacial state of DNA and electrochemistry of DNA-conjugated redox labels and, as a result, the electroanalytical performance of those systems. Here, we show that the kinetics of electron transfer (ET) between the gold electrode and methylene blue (MB) label conjugated to a double-stranded (ds) DNA tethered to gold strongly depend on the charge of the MB molecule, and that affects the performance of genosensors exploiting MB-labeled hairpin DNA beacons. Positively charged MB binds to dsDNA via electrostatic and intercalative/groove binding, and this binding allows the DNA-mediated electrochemistry of MB intercalated into the duplex and, as a result, a complex mode of the electrochemical signal change upon hairpin hybridization to the target DNA, dominated by the "on-off" signal change mode at nanomolar levels of the analyzed DNA. When MB bears an additional carboxylic group, the negative charge provided by this group prevents intimate interactions between MB and DNA, and then the ET in duplexes is limited by the diffusion of the MB-conjugated dsDNA (the phenomenon first shown in Farjami , E. ; Clima , L. ; Gothelf , K. ; Ferapontova , E. E. Anal. Chem. 2011 , 83 , 1594 ) providing the robust "off-on" nanomolar DNA sensing. Those results can be extended to other intercalating redox probes and are of strategic importance for design and development of electrochemical hybridization sensors exploiting DNA nanoswitchable architectures.

A physics-based model of the electrical impedance of ionic polymer metal composites

NASA Astrophysics Data System (ADS)

Cha, Youngsu; Aureli, Matteo; Porfiri, Maurizio

2012-06-01

In this paper, we analyze the chemoelectrical behavior of ionic polymer metal composites (IPMCs) in the small voltage range with a novel hypothesis on the charge dynamics in proximity of the electrodes. In particular, we homogenize the microscopic properties of the interfacial region through a so-called composite layer which extends between the polymer membrane and the metal electrode. This layer accounts for the dissimilar properties of its constituents by describing the charge distribution via two species of charge carriers, that is, electrons and mobile counterions. We model the charge dynamics in the IPMC by adapting the multiphysics formulation based on the Poisson-Nernst-Planck (PNP) framework, which is enriched through an additional term to capture the electron transport in the composite layer. Under the hypothesis of small voltage input, we use the linearized PNP model to derive an equivalent IPMC circuit model with lumped elements. The equivalent model comprises a resistor connected in series with the parallel of a capacitor and a Warburg impedance element. These elements idealize the phenomena of charge build up in the double layer region and the faradaic impedance related to mass transfer, respectively. We validate the equivalent model through measurements on in-house fabricated samples addressing both IPMC step response and impedance, while assessing the influence of repeated plating cycles on the electrical properties of IPMCs. Experimental results are compared with theoretical findings to identify the equivalent circuit parameters. Findings from this study are compared with alternative impedance models proposed in the literature.

Charge-transfer channel in quantum dot-graphene hybrid materials

NASA Astrophysics Data System (ADS)

Cao, Shuo; Wang, Jingang; Ma, Fengcai; Sun, Mengtao

2018-04-01

The energy band theory of a classical semiconductor can qualitatively explain the charge-transfer process in low-dimensional hybrid colloidal quantum dot (QD)-graphene (GR) materials; however, the definite charge-transfer channels are not clear. Using density functional theory (DFT) and time-dependent DFT, we simulate the hybrid QD-GR nanostructure, and by constructing its orbital interaction diagram, we show the quantitative coupling characteristics of the molecular orbitals (MOs) of the hybrid structure. The main MOs are derived from the fragment MOs (FOs) of GR, and the Cd13Se13 QD FOs merge with the GR FOs in a certain proportion to afford the hybrid system. Upon photoexcitation, electrons in the GR FOs jump to the QD FOs, leaving holes in the GR FOs, and the definite charge-transfer channels can be found by analyzing the complex MOs coupling. The excited electrons and remaining holes can also be localized in the GR or the QD or transfer between the QD and GR with different absorption energies. The charge-transfer process for the selected excited states of the hybrid QD-GR structure are testified by the charge difference density isosurface. The natural transition orbitals, charge-transfer length analysis and 2D site representation of the transition density matrix also verify the electron-hole delocalization, localization, or coherence chacracteristics of the selected excited states. Therefore, our research enhances understanding of the coupling mechanism of low-dimensional hybrid materials and will aid in the design and manipulation of hybrid photoelectric devices for practical application in many fields.

Charge-transfer channel in quantum dot-graphene hybrid materials.

PubMed

Cao, Shuo; Wang, Jingang; Ma, Fengcai; Sun, Mengtao

2018-04-06

The energy band theory of a classical semiconductor can qualitatively explain the charge-transfer process in low-dimensional hybrid colloidal quantum dot (QD)-graphene (GR) materials; however, the definite charge-transfer channels are not clear. Using density functional theory (DFT) and time-dependent DFT, we simulate the hybrid QD-GR nanostructure, and by constructing its orbital interaction diagram, we show the quantitative coupling characteristics of the molecular orbitals (MOs) of the hybrid structure. The main MOs are derived from the fragment MOs (FOs) of GR, and the Cd 13 Se 13 QD FOs merge with the GR FOs in a certain proportion to afford the hybrid system. Upon photoexcitation, electrons in the GR FOs jump to the QD FOs, leaving holes in the GR FOs, and the definite charge-transfer channels can be found by analyzing the complex MOs coupling. The excited electrons and remaining holes can also be localized in the GR or the QD or transfer between the QD and GR with different absorption energies. The charge-transfer process for the selected excited states of the hybrid QD-GR structure are testified by the charge difference density isosurface. The natural transition orbitals, charge-transfer length analysis and 2D site representation of the transition density matrix also verify the electron-hole delocalization, localization, or coherence chacracteristics of the selected excited states. Therefore, our research enhances understanding of the coupling mechanism of low-dimensional hybrid materials and will aid in the design and manipulation of hybrid photoelectric devices for practical application in many fields.

Open-Circuit Voltage Losses in Selenium-Substituted Organic Photovoltaic Devices from Increased Density of Charge-Transfer States

DOE PAGES

Sulas, Dana B.; Yao, Kai; Intemann, Jeremy J.; ...

2015-09-12

Using an analysis based on Marcus theory, we characterize losses in open-circuit voltage (V OC) due to changes in charge-transfer state energy, electronic coupling, and spatial density of charge-transfer states in a series of polymer/fullerene solar cells. Here, we use a series of indacenodithiophene polymers and their selenium-substituted analogs as electron donor materials and fullerenes as the acceptors. By combining device measurements and spectroscopic studies (including subgap photocurrent, electroluminescence, and, importantly, time-resolved photoluminescence of the charge-transfer state) we are able to isolate the values for electronic coupling and the density of charge-transfer states (NCT), rather than the more commonly measuredmore » product of these values. We find values for NCT that are surprisingly large (~4.5 × 10 21–6.2 × 10 22 cm -3), and we find that a significant increase in N CT upon selenium substitution in donor polymers correlates with lower VOC for bulk heterojunction photovoltaic devices. The increase in N CT upon selenium substitution is also consistent with nanoscale morphological characterization. Using transmission electron microscopy, selected area electron diffraction, and grazing incidence wide-angle X-ray scattering, we find evidence of more intermixed polymer and fullerene domains in the selenophene blends, which have higher densities of polymer/fullerene interfacial charge-transfer states. Our results provide an important step toward understanding the spatial nature of charge-transfer states and their effect on the open-circuit voltage of polymer/fullerene solar cells« less

Theoretical studies of charge transfer and proton transfer complex formation between 3,5-dinitrobenzic acid and 1,2-dimethylimidazole

NASA Astrophysics Data System (ADS)

Afroz, Ziya; Faizan, Mohd.; Alam, Mohammad Jane; Ahmad, Shabbir; Ahmad, Afaq

2018-05-01

Natural atomic charge analysis and molecular electrostatic potential (MEP) surface analysis of hydrogen bonded charge transfer (HBCT) and proton transfer (PT) complex of 3,5-dinitrobenzoic acid (DNBA) and 1,2-dimethylimidazole (DMI) have been investigated by theoretical modelling using widely employed DFT/B3LYP/6-311G(d,p) level of theory. Along with this analysis, Hirshfeld surface study of the intermolecular interactions and associated 2D finger plot for reported PT complex between DNBA and DMI have been explored.

Frenkel versus charge-transfer exciton dispersion in molecular crystals

NASA Astrophysics Data System (ADS)

Cudazzo, Pierluigi; Gatti, Matteo; Rubio, Angel; Sottile, Francesco

2013-11-01

By solving the many-body Bethe-Salpeter equation at finite momentum transfer, we characterize the exciton dispersion in two prototypical molecular crystals, picene and pentacene, in which localized Frenkel excitons compete with delocalized charge-transfer excitons. We explain the exciton dispersion on the basis of the interplay between electron and hole hopping and electron-hole exchange interaction, unraveling a simple microscopic description to distinguish Frenkel and charge-transfer excitons. This analysis is general and can be applied to other systems in which the electron wave functions are strongly localized, as in strongly correlated insulators.

Time-dependent density functional theory for the charging kinetics of electric double layer containing room-temperature ionic liquids

DOE PAGES

Lian, Cheng; Univ. of California, Riverside, CA; Zhao, Shuangliang; ...

2016-11-29

Understanding the charging kinetics of electric double layers is of fundamental importance for the design and development of novel electrochemical devices such as supercapacitors and field-effect transistors. In this paper, we study the dynamic behavior of room-temperature ionic liquids using a classical time-dependent density functional theory that accounts for the molecular excluded volume effects, the electrostatic correlations, and the dispersion forces. While the conventional models predict a monotonic increase of the surface charge with time upon application of an electrode voltage, our results show that dispersion between ions results in a non-monotonic increase of the surface charge with the durationmore » of charging. Finally and furthermore, we investigate the effects of van der Waals attraction between electrode/ionic-liquid interactions on the charging processes.« less

The influence of electric charge transferred during electro-mechanical reshaping on mechanical behavior of cartilage

NASA Astrophysics Data System (ADS)

Protsenko, Dimitry E.; Lim, Amanda; Wu, Edward C.; Manuel, Cyrus; Wong, Brian J. F.

2011-03-01

Electromechanical reshaping (EMR) of cartilage has been suggested as an alternative to the classical surgical techniques of modifying the shape of facial cartilages. The method is based on exposure of mechanically deformed cartilaginous tissue to a low level electric field. Electro-chemical reactions within the tissue lead to reduction of internal stress, and establishment of a new equilibrium shape. The same reactions offset the electric charge balance between collagen and proteoglycan matrix and interstitial fluid responsible for maintenance of cartilage mechanical properties. The objective of this study was to investigate correlation between the electric charge transferred during EMR and equilibrium elastic modulus. We used a finite element model based on the triphasic theory of cartilage mechanical properties to study how electric charges transferred in the electro-chemical reactions in cartilage can change its mechanical responses to step displacements in unconfined compression. The concentrations of the ions, the strain field and the fluid and ion velocities within the specimen subject to an applied mechanical deformation were estimated and apparent elastic modulus (the ratio of the equilibrium axial stress to the axial strain) was calculated as a function of transferred charge. The results from numerical calculations showed that the apparent elastic modulus decreases with increase in electric charge transfer. To compare numerical model with experimental observation we measured elastic modulus of cartilage as a function of electric charge transferred in electric circuit during EMR. Good correlation between experimental and theoretical data suggests that electric charge disbalance is responsible for alteration of cartilage mechanical properties.

Sol–gel synthesis, structure and luminescence properties of Ba{sub 2}ZnMoO{sub 6}:Eu{sup 3+} phosphors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Yuntong; Liu, Xiaohua, E-mail: xhliuxhliu@tom.com

2015-04-15

Graphical abstract: The phosphor powders of Ba{sub 2}ZnMoO{sub 6}:Eu{sup 3+} were prepared by sol–gel method. The dependence of luminescence intensity on the Eu{sup 3+} concentration was investigated. - Highlights: • We synthesize Ba{sub 2}ZnMoO{sub 6}:Eu{sup 3+} phosphors by the sol–gel method. • The effect of temperature on the crystallinity and morphology is investigated. • The phosphor presents an intense CT band in near UV range (370–410 nm). • The concentration quenching mechanism is the exchange interaction. - Abstract: Double-perovskite Ba{sub 2}Zn{sub 1−x}MoO{sub 6}:xEu{sup 3+} (x = 0, 0.02, 0.04, 0.06, 0.08, 0.1) orange–red emitting phosphors were synthesized by using themore » sol–gel method. The crystalline structure and photoluminescence properties of the phosphors were investigated. The X-ray diffraction (XRD) patterns indicate that the structure of matrix Ba{sub 2}ZnMoO{sub 6} is cubic double-perovskite with space group Fm-3m. The Ba{sub 2}ZnMoO{sub 6}:Eu{sup 3+} phosphors present an intense broad charge transfer (CT) band absorption in near UV range (370–410 nm), which attributes to the charge transfer state of MoO{sub 6}, and performs orange–red emission of Eu{sup 3+} ({sup 5}D{sub 0} → {sup 7}F{sub 1} transition) at around 596 nm. A low concentration quenching occurs in Ba{sub 2}ZnMoO{sub 6}:Eu{sup 3+} and the optimal doping concentration is about 6 mol%. The Ba{sub 2}ZnMoO{sub 6}:Eu{sup 3+} phosphors are considered to be a promising orange–red emitting phosphor for near ultraviolet GaN-based white light emitting diode.« less

A single-phase white light emitting Pr3+ doped Ba2CaWO6 phosphor: synthesis, photoluminescence and optical properties

NASA Astrophysics Data System (ADS)

Sreeja, E.; Vidyadharan, Viji; Jose, Saritha K.; George, Anns; Joseph, Cyriac; Unnikrishnan, N. V.; Biju, P. R.

2018-04-01

Pr3+ doped Ba2CaWO6 phosphor were prepared by traditional high-temperature solid-state reaction technique. The structure evolution was systematically investigated by X-ray diffraction (XRD), energy-dispersive X-ray spectroscopy (EDS), Fourier-transform infrared spectroscopy (FTIR), scanning electron microscopy (SEM) and transmission electron microscopy (TEM) analysis. The X-ray powder diffraction patterns indicate that the prepared phosphors crystallized in the cubic double-perovskite structure. The functional groups were identified using FTIR spectra and the elements present in the composition were confirmed by the EDS profile. The morphology of the phosphor was identified using SEM and TEM analysis. The PL spectra illustrated that these phosphors could be efficiently excited by charge transfer band of host and the maximum luminescence intensity was observed at 0.06 wt% of Pr3+ ion. Upon the charge transfer band excitation, emission spectra showed peaks at 489, 532, 647, 685 and 737 nm corresponding to 3P0→3H4, 3P1→3H5, 3P0→3F2, 3P0→3F3 and 3P0→3F4 transitions respectively. The concentration quenching of Ba2CaWO6:Pr3+ phosphor can be mainly attributed to dipole-dipole interaction. The CIE coordinates were estimated to be close to the white region. The decay curves are well fitted with double exponential decay models. The standard and modified Judd-Ofelt (JO) theories were used to determine the Judd-Ofelt intensity parameters, radiative transition probabilities and branching ratios. The optical properties indicate that Ba2CaWO6:Pr3+ phosphors can produce white light emission from a single phase host and its potential application for solid-state lighting and display devices.

The effect of charge transfer fluctuation on superconductivity in high temperature superconductors

NASA Astrophysics Data System (ADS)

Liu, Yihsuan; Wu, Huan-Kuang; Lee, Ting-Kuo

H i g h - Tc Cuprates have been studied quite often as an effective one band t - J model that neglects charge fluctuation between oxygen 2p6 band and copper 3d10 band, and Zhang-Rice singlet is just a hole in the model. However, recent Scanning Tunneling Spectra(STS) measurement on underdoped Cuprate shows that charge transfer gap is only of order 12 eV. This small gap necessitates a re-examination of the charge transfer fluctuation. Here we modify the t-J model by including charge transfer fluctuation allowing the formation of doubly occupied sites. For certain parameters it is similar with the t-J-U model. This model is studied via variational Monte Carlo method(VMC). Our result shows that this model can give a unified behavior of superconducting dome with different long rang hopping parameters. The anti-correlation between charge transfer gap and pairing is also confirmed. More interestingly the charge fluctuation is found to affect pairing order parameter in different ways in underdoped and overdoped regions. This work is partially supported by Taiwan Ministry of Science and Technology with Grant. MOST 105-2112-M-001-008 and calculation was supported by a National Center of High Performance Computing in Taiwan.

New instrument for tribocharge measurement due to single particle impacts.

PubMed

Watanabe, Hideo; Ghadiri, Mojtaba; Matsuyama, Tatsushi; Ding, Yu Long; Pitt, Kendal G

2007-02-01

During particulate solid processing, particle-particle and particle-wall collisions can generate electrostatic charges. This may lead to a variety of problems ranging from fire and explosion hazards to segregation, caking, and blocking. A fundamental understanding of the particle charging in such situations is therefore essential. For this purpose we have developed a new device that can measure charge transfer due to impact between a single particle and a metal plate. The device consists of an impact test system and two sets of Faraday cage and preamplifier for charge measurement. With current amplifiers, high-resolution measurements of particle charges of approximately 1 and 10 fC have been achieved before and after the impact, respectively. The device allows charge measurements of single particles with a size as small as approximately 100 microm impacting on the target at different incident angles with a velocity up to about 80 m/s. Further analyses of the charge transfer as a function of particle initial charge define an equilibrium charge, i.e., an initial charge level prior to impact for which no net charge transfer would occur as a result of impact.

New instrument for tribocharge measurement due to single particle impacts

NASA Astrophysics Data System (ADS)

Watanabe, Hideo; Ghadiri, Mojtaba; Matsuyama, Tatsushi; Long Ding, Yu; Pitt, Kendal G.

2007-02-01

During particulate solid processing, particle-particle and particle-wall collisions can generate electrostatic charges. This may lead to a variety of problems ranging from fire and explosion hazards to segregation, caking, and blocking. A fundamental understanding of the particle charging in such situations is therefore essential. For this purpose we have developed a new device that can measure charge transfer due to impact between a single particle and a metal plate. The device consists of an impact test system and two sets of Faraday cage and preamplifier for charge measurement. With current amplifiers, high-resolution measurements of particle charges of approximately 1 and 10fC have been achieved before and after the impact, respectively. The device allows charge measurements of single particles with a size as small as ˜100μm impacting on the target at different incident angles with a velocity up to about 80m/s. Further analyses of the charge transfer as a function of particle initial charge define an equilibrium charge, i.e., an initial charge level prior to impact for which no net charge transfer would occur as a result of impact.

Magnetic field enhancement of organic photovoltaic cells performance.

PubMed

Oviedo-Casado, S; Urbina, A; Prior, J

2017-06-27

Charge separation is a critical process for achieving high efficiencies in organic photovoltaic cells. The initial tightly bound excitonic electron-hole pair has to dissociate fast enough in order to avoid photocurrent generation and thus power conversion efficiency loss via geminate recombination. Such process takes place assisted by transitional states that lie between the initial exciton and the free charge state. Due to spin conservation rules these intermediate charge transfer states typically have singlet character. Here we propose a donor-acceptor model for a generic organic photovoltaic cell in which the process of charge separation is modulated by a magnetic field which tunes the energy levels. The impact of a magnetic field is to intensify the generation of charge transfer states with triplet character via inter-system crossing. As the ground state of the system has singlet character, triplet states are recombination-protected, thus leading to a higher probability of successful charge separation. Using the open quantum systems formalism we demonstrate that the population of triplet charge transfer states grows in the presence of a magnetic field, and discuss the impact on carrier population and hence photocurrent, highlighting its potential as a tool for research on charge transfer kinetics in this complex systems.

An empirical study of estimating vehicle emissions under cordon and distance based road user charging in Leeds, UK.

PubMed

Namdeo, Anil; Mitchell, Gordon

2008-01-01

This paper presents the impact of road user charging (RUC) on vehicle emissions through application of traffic assignment and pollutant emission models. It presents results of an analysis of five RUC schemes on vehicle emissions in Leeds, UK for 2005. The schemes were: a 3 pound sterling inner ring road cordon charge; a double cordon with a 2 pound sterling inner ring road and a 1 pound sterling outer ring road charge; and distance charges of 2, 10 and 20 p/km levied for travel within the outer cordon. Schemes were compared to a no charge option and results presented here. Emissions are significantly reduced within the inner cordon, whilst beyond the cordon, localised increases and decreases occur. The double cordon exhibits a similar but less marked pattern. Distance charging reduces city-wide emissions by 10% under a 2 p/km charge, 42-49% under a 10 p/km charge and 52-59% under a 20 p/km charge. The higher distance charges reduce emissions within the charge zone, and are also associated with elevated emissions outside the zone, but to a lesser extent than that observed for cordon charging.

Exciplex mediated photoinduced electron transfer reactions of phthalocyanine-fullerene dyads.

PubMed

Niemi, Marja; Tkachenko, Nikolai V; Efimov, Alexander; Lehtivuori, Heli; Ohkubo, Kei; Fukuzumi, Shunichi; Lemmetyinen, Helge

2008-07-31

Evidences of an intramolecular exciplex intermediate in a photoinduced electron transfer (ET) reaction of double-linked free-base and zinc phthalocyanine-C60 dyads were found. This was the first time for a dyad with phthalocyanine donor. Excitation of the phthalocyanine moiety of the dyads results in rapid ET from phthalocyanine to fullerene via an exciplex state in both polar and nonpolar solvents. Relaxation of the charge-separated (CS) state Pc(*+)-C60(*-) in a polar solvent occurs directly to the ground state in 30-70 ps. In a nonpolar solvent, roughly 20% of the molecules undergo transition from the CS state to phthalocyanine triplet state (3)Pc*-C60 before relaxation to the ground state. Formation of the CS state was confirmed with electron spin resonance measurements at low temperature in both polar and nonpolar solvent. Reaction schemes for the photoinduced ET reactions of the dyads were completed with rate constants obtained from the time-resolved absorption and emission measurements and with state energies obtained from the fluorescence, phosphorescence, and voltammetric measurements.

Study on Synergistic Mechanism of Inhibitor Mixture Based on Electron Transfer Behavior

PubMed Central

Han, Peng; He, Yang; Chen, Changfeng; Yu, Haobo; Liu, Feng; Yang, Hong; Ma, Yue; Zheng, Yanjun

2016-01-01

Mixing is an important method to improve the performance of surfactants due to their synergistic effect. The changes in bonding interaction and adsorption structure of IM and OP molecules before and after co-adsorbed on Fe(001) surface is calculated by DFTB+ method. It is found that mixture enable the inhibitor molecules with higher EHOMO donate more electrons while the inhibitor molecules with lower ELUMO accept more electrons, which strengthens the bonding interaction of both inhibitor agent and inhibitor additive with metal surface. Meanwhile, water molecules in the compact layer of double electric layer are repulsed and the charge transfer resistance during the corrosion process increases. Accordingly, the correlation between the frontier orbital (EHOMO and ELUMO of inhibitor molecules and the Fermi level of metal) and inhibition efficiency is determined. Finally, we propose a frontier orbital matching principle for the synergistic effect of inhibitors, which is verified by electrochemical experiments. This frontier orbital matching principle provides an effective quantum chemistry calculation method for the optimal selection of inhibitor mixture. PMID:27671332

Time delay and integration array (TDI) using charge transfer device technology. Phase 2, volume 1: Technical

NASA Technical Reports Server (NTRS)

1977-01-01

The 20x9 TDI array was developed to meet the LANDSAT Thematic Mapper Requirements. This array is based upon a self-aligned, transparent gate, buried channel process. The process features: (1) buried channel, four phase, overlapping gate CCD's for high transfer efficiency without fat zero; (2) self-aligned transistors to minimize clock feedthrough and parasitic capacitance; and (3) transparent tin oxide electrode for high quantum efficiency with front surface irradiation. The requirements placed on the array and the performance achieved are summarized. This data is the result of flat field measurements only, no imaging or dynamic target measurements were made during this program. Measurements were performed with two different test stands. The bench test equipment fabricated for this program operated at the 8 micro sec line time and employed simple sampling of the gated MOSFET output video signal. The second stand employed Correlated Doubled Sampling (CDS) and operated at 79.2 micro sec line time.

State-conditional coherent charge qubit oscillations in a Si/SiGe quadruple quantum dot

NASA Astrophysics Data System (ADS)

Ward, Daniel R.; Kim, Dohun; Savage, Donald E.; Lagally, Max G.; Foote, Ryan H.; Friesen, Mark; Coppersmith, Susan N.; Eriksson, Mark A.

2016-10-01

Universal quantum computation requires high-fidelity single-qubit rotations and controlled two-qubit gates. Along with high-fidelity single-qubit gates, strong efforts have been made in developing robust two-qubit logic gates in electrically gated quantum dot systems to realise a compact and nanofabrication-compatible architecture. Here we perform measurements of state-conditional coherent oscillations of a charge qubit. Using a quadruple quantum dot formed in a Si/SiGe heterostructure, we show the first demonstration of coherent two-axis control of a double quantum dot charge qubit in undoped Si/SiGe, performing Larmor and Ramsey oscillation measurements. We extract the strength of the capacitive coupling between a pair of double quantum dots by measuring the detuning energy shift (≈75 μeV) of one double dot depending on the excess charge configuration of the other double dot. We further demonstrate that the strong capacitive coupling allows fast, state-conditional Landau-Zener-Stückelberg oscillations with a conditional π phase flip time of about 80 ps, showing a promising pathway towards multi-qubit entanglement and control in semiconductor quantum dots.

Improving the efficiency of water splitting in dye-sensitized solar cells by using a biomimetic electron transfer mediator

PubMed Central

Zhao, Yixin; Swierk, John R.; Megiatto, Jackson D.; Sherman, Benjamin; Youngblood, W. Justin; Qin, Dongdong; Lentz, Deanna M.; Moore, Ana L.; Moore, Thomas A.; Gust, Devens; Mallouk, Thomas E.

2012-01-01

Photoelectrochemical water splitting directly converts solar energy to chemical energy stored in hydrogen, a high energy density fuel. Although water splitting using semiconductor photoelectrodes has been studied for more than 40 years, it has only recently been demonstrated using dye-sensitized electrodes. The quantum yield for water splitting in these dye-based systems has, so far, been very low because the charge recombination reaction is faster than the catalytic four-electron oxidation of water to oxygen. We show here that the quantum yield is more than doubled by incorporating an electron transfer mediator that is mimetic of the tyrosine-histidine mediator in Photosystem II. The mediator molecule is covalently bound to the water oxidation catalyst, a colloidal iridium oxide particle, and is coadsorbed onto a porous titanium dioxide electrode with a Ruthenium polypyridyl sensitizer. As in the natural photosynthetic system, this molecule mediates electron transfer between a relatively slow metal oxide catalyst that oxidizes water on the millisecond timescale and a dye molecule that is oxidized in a fast light-induced electron transfer reaction. The presence of the mediator molecule in the system results in photoelectrochemical water splitting with an internal quantum efficiency of approximately 2.3% using blue light. PMID:22547794

Multi-layered nanocomposite dielectrics for high density organic memory devices

NASA Astrophysics Data System (ADS)

Kang, Moonyeong; Chung, Kyungwha; Baeg, Kang-Jun; Kim, Dong Ha; Kim, Choongik

2015-01-01

We fabricated organic memory devices with metal-pentacene-insulator-silicon structure which contain double dielectric layers comprising 3D pattern of Au nanoparticles (Au NPs) and block copolymer (PS-b-P2VP). The role of Au NPs is to charge/discharge carriers upon applied voltage, while block copolymer helps to form highly ordered Au NP patterns in the dielectric layer. Double-layered nanocomposite dielectrics enhanced the charge trap density (i.e., trapped charge per unit area) by Au NPs, resulting in increase of the memory window (ΔVth).

Carbon nanostructures modified LiFePO4 cathodes for lithium ion battery applications: optimized porosity and composition

NASA Astrophysics Data System (ADS)

Mahmoud, Lama; Singh Lalia, Boor; Hashaikeh, Raed

2016-12-01

Lithium iron phosphate (LiFePO4) battery cathode was fabricated without using any metallic current collector and polymeric binder. Carbon nanostructures (CNS) were used as microbinders for LiFePO4 particles and at the same time as a 3D current collector. A facile and cost effective method of fabricating composite cathodes of CNS and LiFePO4 was developed. Thick electrodes with high loading of active material (20-25 mg cm-2) were obtained that are almost 2-3 folds higher than commercial electrodes. SEM images confirm that the 3D CNS conductive network encapsulated the LiFePO4 particles homogenously facilitating the charge transfer at the electrode-CNS interface. The composition, scan rate and porosity of the paper-like cathode were sequentially varied and their influence was systematically monitored by means of linear sweep cyclic voltammetry and AC electrochemical impedance spectroscopy. Addition of CNS improved the electrode’s bulk electronic conductivity, mechanical integrity, surface area and double layer capacitance, yet compromised the charge transfer resistance at the electrode-electrolyte interface. Based on a range of the tested binder-free electrodes, this study proposes that electrodes with 20 wt% CNS having 49 ± 2.5% porosity had realized best improvements of two folds and four folds in the electronic conductivity and diffusion coefficient, respectively.

Local CC2 response method for triplet states based on Laplace transform: excitation energies and first-order properties.

PubMed

Freundorfer, Katrin; Kats, Daniel; Korona, Tatiana; Schütz, Martin

2010-12-28

A new multistate local CC2 response method for calculating excitation energies and first-order properties of excited triplet states in extended molecular systems is presented. The Laplace transform technique is employed to partition the left/right local CC2 eigenvalue problems as well as the linear equations determining the Lagrange multipliers needed for the properties. The doubles part in the equations can then be inverted on-the-fly and only effective equations for the singles part must be solved iteratively. The local approximation presented here is adaptive and state-specific. The density-fitting method is utilized to approximate the electron-repulsion integrals. The accuracy of the new method is tested by comparison to canonical reference values for a set of 12 test molecules and 62 excited triplet states. As an illustrative application example, the lowest four triplet states of 3-(5-(5-(4-(bis(4-(hexyloxy)phenyl)amino)phenyl)thiophene-2-yl)thiophene-2-yl)-2-cyanoacrylic acid, an organic sensitizer for solar-cell applications, are computed in the present work. No triplet charge-transfer states are detected among these states. This situation contrasts with the singlet states of this molecule, where the lowest singlet state has been recently found to correspond to an excited state with a pronounced charge-transfer character having a large transition strength.

33 CFR 127.1317 - Declaration of Inspection.

Code of Federal Regulations, 2010 CFR

2010-07-01

...— (1) The name of the vessel and that of the facility; (2) The date and time that the transfer begins... to begin transfer; and (5) The signature of each relief person in charge and the date and time of... Inspection. (a) Each person in charge of transfer for the facility shall ensure that no person transfers LHG...

33 CFR 127.1317 - Declaration of Inspection.

Code of Federal Regulations, 2013 CFR

2013-07-01

...— (1) The name of the vessel and that of the facility; (2) The date and time that the transfer begins... to begin transfer; and (5) The signature of each relief person in charge and the date and time of... Inspection. (a) Each person in charge of transfer for the facility shall ensure that no person transfers LHG...

Cascading electron and hole transfer dynamics in a CdS/CdTe core-shell sensitized with bromo-pyrogallol red (Br-PGR): slow charge recombination in type II regime.

PubMed

Maity, Partha; Debnath, Tushar; Chopra, Uday; Ghosh, Hirendra Nath

2015-02-14

Ultrafast cascading hole and electron transfer dynamics have been demonstrated in a CdS/CdTe type II core-shell sensitized with Br-PGR using transient absorption spectroscopy and the charge recombination dynamics have been compared with those of CdS/Br-PGR composite materials. Steady state optical absorption studies suggest that Br-PGR forms strong charge transfer (CT) complexes with both the CdS QD and CdS/CdTe core-shell. Hole transfer from the photo-excited QD and QD core-shell to Br-PGR was confirmed by both steady state and time-resolved emission spectroscopy. Charge separation was also confirmed by detecting electrons in the conduction band of the QD and the cation radical of Br-PGR as measured from femtosecond transient absorption spectroscopy. Charge separation in the CdS/Br-PGR composite materials was found to take place in three different pathways, by transferring the photo-excited hole of CdS to Br-PGR, electron injection from the photo-excited Br-PGR to the CdS QD, and direct electron transfer from the HOMO of Br-PGR to the conduction band of the CdS QD. However, in the CdS/CdTe/Br-PGR system hole transfer from the photo-excited CdS to Br-PGR and electron injection from the photo-excited Br-PGR to CdS take place after cascading through the CdTe shell QD. Charge separation also takes place via direct electron transfer from the Br-PGR HOMO to the conduction band of CdS/CdTe. Charge recombination (CR) dynamics between the electron in the conduction band of the CdS QD and the Br-PGR cation radical were determined by monitoring the bleach recovery kinetics. The CR dynamics were found to be much slower in the CdS/CdTe/Br-PGR system than in the CdS/Br-PGR system. The formation of the strong CT complex and the separation of charges cascading through the CdTe shell help to slow down charge recombination in the type II regime.

Intramolecular Charge Transfer of Conjugated Liquid Crystal Ferrocene Macromolecules - Synthesis and Characterization

DTIC Science & Technology

2016-04-12

AFRL-AFOSR-CL-TR-2016-0012 Intramolecular Charge Transfer of Conjugated Liquid Crystal Ferrocene Macromolecules Ronald Ziolo CIQA Final Report 07/07...3. DATES COVERED (From - To)  15 Aug 2014 to 14 Jan 2016 4. TITLE AND SUBTITLE Intramolecular Charge Transfer of Conjugated Liquid Crystal Ferrocene...characterization of a new series of conjugated macromolecules bearing ferrocene as a highly efficient electron donor material coupled to 2,5-di(alcoxy) benzene

Excited state electron transfer in systems with a well-defined geometry. [cyclophane

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaufmann, K.J.

1980-12-01

The effect of temperature, dielectric strength and ligand on the structure of the mesopyropheophorbide cyclophanes will be studied. ESR, NMR, emission and absorption spectroscopy, as well as circular dichroism will be used. The changes in structure will be correlated with changes in the photochemical activity. Electron acceptors such as benzoquinone will be utilized to stabilize the charge separation. Charge separation in porphyrin quinone dimers will also be studied. It was found that electron transfer in the cyclophane system is relatively slow. This is presumably due to an orientation requirement for fast electron transfer. Solvent dielectric also is important in producingmore » a charge separation. Decreasing the temperature effects the yield of charge transfer, but not the kinetics.« less

The low-energy, charge-transfer excited states of 4-amino-4-prime-nitrodiphenyl sulfide

NASA Technical Reports Server (NTRS)

O'Connor, Donald B.; Scott, Gary W.; Tran, Kim; Coulter, Daniel R.; Miskowski, Vincent M.; Stiegman, Albert E.; Wnek, Gary E.

1992-01-01

Absorption and emission spectra of 4-amino-4-prime-nitrodiphenyl sulfide in polar and nonpolar solvents were used to characterize and assign the low-energy excited states of the molecule. Fluorescence-excitation anisotropy spectra and fluorescence quantum yields were also used to characterize the photophysics of these states. The lowest-energy fluorescent singlet state was determined to be an intramolecular charge transfer (ICT) state involving transfer of a full electron charge from the amino to the nitro group yielding a dipole moment of about 50 D. A low-energy, intense absorption band is assigned as a transition to a different ICT state involving a partial electron charge transfer from sulfur to the nitro group.

Topologically protected charge transfer along the edge of a chiral p -wave superconductor

NASA Astrophysics Data System (ADS)

Gnezdilov, N. V.; van Heck, B.; Diez, M.; Hutasoit, Jimmy A.; Beenakker, C. W. J.

2015-09-01

The Majorana fermions propagating along the edge of a topological superconductor with px+i py pairing deliver a shot noise power of 1/2 ×e2/h per eV of voltage bias. We calculate the full counting statistics of the transferred charge and find that it becomes trinomial in the low-temperature limit, distinct from the binomial statistics of charge-e transfer in a single-mode nanowire or charge-2 e transfer through a normal-superconductor interface. All even-order correlators of current fluctuations have a universal quantized value, insensitive to disorder and decoherence. These electrical signatures are experimentally accessible, because they persist for temperatures and voltages large compared to the Thouless energy.

Superconductivity, phase separation, and charge-transfer instability in the U = infinity limit of the three-band model of the CuO sub 2 planes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grilli, M.; Raimondi, R.; Castellani, C.

1991-07-08

The {ital U}={infinity} limit of the three-band Hubbard model with nearest-neighbor repulsion {ital V} is studied using the slave-boson approach and the large-{ital N} expansion technique to order 1/{ital N}. A charge-transfer instability is found as in weak-coupling theory. The charge-transfer instability is always associated with a diverging compressibility leading to a phase separation. Near the phase-separation, charge-transfer-instability region we find superconducting instabilities in the {ital s}- and {ital d}-wave channel. The requirement for superconductivity is that {ital V} be on the scale of the Cu-O hopping as suggested by Varma, Schmitt-Rink, and Abrahams.

Field Effect Modulation of Heterogeneous Charge Transfer Kinetics at Back-Gated Two-Dimensional MoS2 Electrodes.

PubMed

Wang, Yan; Kim, Chang-Hyun; Yoo, Youngdong; Johns, James E; Frisbie, C Daniel

2017-12-13

The ability to improve and to modulate the heterogeneous charge transfer kinetics of two-dimensional (2D) semiconductors, such as MoS 2 , is a major challenge for electrochemical and photoelectrochemical applications of these materials. Here we report a continuous and reversible physical method for modulating the heterogeneous charge transfer kinetics at a monolayer MoS 2 working electrode supported on a SiO 2 /p-Si substrate. The heavily doped p-Si substrate serves as a back gate electrode; application of a gate voltage (V BG ) to p-Si tunes the electron occupation in the MoS 2 conduction band and shifts the conduction band edge position relative to redox species dissolved in electrolyte in contact with the front side of the MoS 2 . The gate modulation of both charge density and energy band alignment impacts charge transfer kinetics as measured by cyclic voltammetry (CV). Specifically, cyclic voltammograms combined with numerical simulations suggest that the standard heterogeneous charge transfer rate constant (k 0 ) for MoS 2 in contact with the ferrocene/ferrocenium (Fc 0/+ ) redox couple can be modulated by over 2 orders of magnitude from 4 × 10 -6 to 1 × 10 -3 cm/s, by varying V BG . In general, the field effect offers the potential to tune the electrochemical properties of 2D semiconductors, opening up new possibilities for fundamental studies of the relationship between charge transfer kinetics and independently controlled electronic band alignment and band occupation.

Control of single-electron charging of metallic nanoparticles onto amorphous silicon surface.

PubMed

Weis, Martin; Gmucová, Katarína; Nádazdy, Vojtech; Capek, Ignác; Satka, Alexander; Kopáni, Martin; Cirák, Július; Majková, Eva

2008-11-01

Sequential single-electron charging of iron oxide nanoparticles encapsulated in oleic acid/oleyl amine envelope and deposited by the Langmuir-Blodgett technique onto Pt electrode covered with undoped hydrogenated amorphous silicon film is reported. Single-electron charging (so-called quantized double-layer charging) of nanoparticles is detected by cyclic voltammetry as current peaks and the charging effect can be switched on/off by the electric field in the surface region induced by the excess of negative/positive charged defect states in the amorphous silicon layer. The particular charge states in amorphous silicon are created by the simultaneous application of a suitable bias voltage and illumination before the measurement. The influence of charged states on the electric field in the surface region is evaluated by the finite element method. The single-electron charging is analyzed by the standard quantized double layer model as well as two weak-link junctions model. Both approaches are in accordance with experiment and confirm single-electron charging by tunnelling process at room temperature. This experiment illustrates the possibility of the creation of a voltage-controlled capacitor for nanotechnology.

Impact of double counting and transfer bias on estimated rates and outcomes of acute myocardial infarction.

PubMed

Westfall, J M; McGloin, J

2001-05-01

Ischemic heart disease is the leading cause of death in the United States. Recent studies report inconsistent findings on the changes in the incidence of hospitalizations for ischemic heart disease. These reports have relied primarily on hospital discharge data. Preliminary data suggest that a significant percentage of patients suffering acute myocardial infarction (MI) in rural communities are transferred to urban centers for care. Patients transferred to a second hospital may be counted twice for one episode of ischemic heart disease. To describe the impact of double counting and transfer bias on the estimation of incidence rates and outcomes of ischemic heart disease, specifically acute MI, in the United States. Analysis of state hospital discharge data from Kansas, Colorado (State Inpatient Database [SID]), Nebraska, Arizona, New Jersey, Michigan, Pennsylvania, and Illinois (SID) for the years 1995 to 1997. A matching algorithm was developed for hospital discharges to determine patients counted twice for one episode of ischemic heart disease. Validation of our matching algorithm. Patients reported to have suffered ischemic heart disease (ICD9 codes 410-414, 786.5). Number of patients counted twice for one episode of acute MI. It is estimated that double count rates range from 10% to 15% for all states and increased over the 3 years. Moderate sized rural counties had the highest estimated double count rates at 15% to 20% with a few counties having estimated double count rates a high as 35% to 50%. Older patients and females were less likely to be double counted (P <0.05). Double counting patients has resulted in a significant overestimation in the incidence rate for hospitalization for acute MI. Correction of this double counting reveals a significantly lower incidence rate and a higher in-hospital mortality rate for acute MI. Transferred patients differ significantly from nontransferred patients, introducing significant bias into MI outcome studies. Double counting and transfer bias should be considered when conducting and interpreting research on ischemic heart disease, particularly in rural regions.

Charge-transfer crystallites as molecular electrical dopants

PubMed Central

Méndez, Henry; Heimel, Georg; Winkler, Stefanie; Frisch, Johannes; Opitz, Andreas; Sauer, Katrein; Wegner, Berthold; Oehzelt, Martin; Röthel, Christian; Duhm, Steffen; Többens, Daniel; Koch, Norbert; Salzmann, Ingo

2015-01-01

Ground-state integer charge transfer is commonly regarded as the basic mechanism of molecular electrical doping in both, conjugated polymers and oligomers. Here, we demonstrate that fundamentally different processes can occur in the two types of organic semiconductors instead. Using complementary experimental techniques supported by theory, we contrast a polythiophene, where molecular p-doping leads to integer charge transfer reportedly localized to one quaterthiophene backbone segment, to the quaterthiophene oligomer itself. Despite a comparable relative increase in conductivity, we observe only partial charge transfer for the latter. In contrast to the parent polymer, pronounced intermolecular frontier-orbital hybridization of oligomer and dopant in 1:1 mixed-stack co-crystallites leads to the emergence of empty electronic states within the energy gap of the surrounding quaterthiophene matrix. It is their Fermi–Dirac occupation that yields mobile charge carriers and, therefore, the co-crystallites—rather than individual acceptor molecules—should be regarded as the dopants in such systems. PMID:26440403

Role of coherence and delocalization in photo-induced electron transfer at organic interfaces

NASA Astrophysics Data System (ADS)

Abramavicius, V.; Pranculis, V.; Melianas, A.; Inganäs, O.; Gulbinas, V.; Abramavicius, D.

2016-09-01

Photo-induced charge transfer at molecular heterojunctions has gained particular interest due to the development of organic solar cells (OSC) based on blends of electron donating and accepting materials. While charge transfer between donor and acceptor molecules can be described by Marcus theory, additional carrier delocalization and coherent propagation might play the dominant role. Here, we describe ultrafast charge separation at the interface of a conjugated polymer and an aggregate of the fullerene derivative PCBM using the stochastic Schrödinger equation (SSE) and reveal the complex time evolution of electron transfer, mediated by electronic coherence and delocalization. By fitting the model to ultrafast charge separation experiments, we estimate the extent of electron delocalization and establish the transition from coherent electron propagation to incoherent hopping. Our results indicate that even a relatively weak coupling between PCBM molecules is sufficient to facilitate electron delocalization and efficient charge separation at organic interfaces.

Theoretical Investigation of Charge Transfer in Metal Organic Frameworks for Electrochemical Device Applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patwardhan, Sameer; Schatz, George C.

For electrochemical device applications metal organic frameworks (MOFs) must exhibit suitable conduction properties. To this end, we have performed computational studies of intermolecular charge transfer in MOFs consisting of hexa-ZrIV nodes and tetratopic carboxylate linkers. This includes an examination of the electronic structure of linkers that are derived from tetraphenyl benzene 1, tetraphenyl pyrene 2, and tetraphenyl porphyrin 3 molecules. These results are used to determine charge transfer propensities in MOFs, within the framework of Marcus theory, including an analysis of the key parameters (charge transfer integral t, reorganization energy λ, and free energy change ΔG0) and evaluation of figuresmore » of merit for charge transfer based on the chemical structures of the linkers. This qualitative analysis indicates that delocalization of the HOMO/LUMO on terminal substituents increases t and decreases λ, while weaker binding to counterions decreases ΔG0, leading to better charge transfer propensity. Subsequently, we study hole transfer in the linker 2 containing MOFs, NU-901 and NU-1000, in detail and describe mechanisms (hopping and superexchange) that may be operative under different electrochemical conditions. Comparisons with experiment are provided where available. On the basis of the redox and catalytic activity of nodes and linkers, we propose three possible schemes for constructing electrochemical devices for catalysis. We believe that the results of this study will lay the foundation for future experimental work on this topic.« less

Neutralized ion beam modification of cellulose membranes for study of ion charge effect on ion-beam-induced DNA transfer

NASA Astrophysics Data System (ADS)

Prakrajang, K.; Sangwijit, K.; Anuntalabhochai, S.; Wanichapichart, P.; Yu, L. D.

2012-02-01

Low-energy ion beam biotechnology (IBBT) has recently been rapidly developed worldwide. Ion-beam-induced DNA transfer is one of the important applications of IBBT. However, mechanisms involved in this application are not yet well understood. In this study plasma-neutralized ion beam was applied to investigate ion charge effect on induction of DNA transfer. Argon ion beam at 7.5 keV was neutralized by RF-driven plasma in the beam path and then bombarded cellulose membranes which were used as the mimetic plant cell envelope. Electrical properties such as impedance and capacitance of the membranes were measured after the bombardment. An in vitro experiment on plasmid DNA transfer through the cellulose membrane was followed up. The results showed that the ion charge input played an important role in the impedance and capacitance changes which would affect DNA transfer. Generally speaking, neutral particle beam bombardment of biologic cells was more effective in inducing DNA transfer than charged ion beam bombardment.

Ultrafast investigation of photoinduced charge transfer in aminoanthraquinone pharmaceutical product

NASA Astrophysics Data System (ADS)

Zhang, Song; Sun, Simei; Zhou, Miaomiao; Wang, Lian; Zhang, Bing

2017-02-01

We investigated the mechanism of intramolecular charge transfer and the following radiationless dynamics of the excited states of 1-aminoanthraquinone using steady state and time-resolved absorption spectroscopy combined with quantum chemical calculations. Following photoexcitation with 460 nm, conformational relaxation via twisting of the amino group, charge transfer and the intersystem crossing (ISC) processes have been established to be the major relaxation pathways responsible for the ultrafast nonradiative of the excited S1 state. Intramolecular proton transfer, which could be induced by intramolecular hydrogen bonding is inspected and excluded. Time-dependent density functional theory (TDDFT) calculations reveal the change of the dipole moments of the S0 and S1 states along the twisted coordinate of the amino group, indicating the mechanism of twisted intra-molecular charge transfer (TICT). The timescale of TICT is measured to be 5 ps due to the conformational relaxation and a barrier on the S1 potential surface. The ISC from the S1 state to the triplet manifold is a main deactivation pathway with the decay time of 28 ps. Our results observed here have yield a physically intuitive and complete picture of the photoinduced charge transfer and radiationless dynamics in anthraquinone pharmaceutial products.

Interfacial characteristics and leakage current transfer mechanisms in organometal trihalide perovskite gate-controlled devices via doping of PCBM

NASA Astrophysics Data System (ADS)

Wang, Yucheng; Zhang, Yuming; Liu, Yintao; Pang, Tiqiang; Hu, Ziyang; Zhu, Yuejin; Luan, Suzhen; Jia, Renxu

2017-11-01

Two types of perovskite (with and without doping of PCBM) based metal-oxide-semiconductor (MOS) gate-controlled devices were fabricated and characterized. The study of the interfacial characteristics and charge transfer mechanisms by doping of PCBM were analyzed by material and electrical measurements. Doping of PCBM does not affect the size and crystallinity of perovskite films, but has an impact on carrier extraction in perovskite MOS devices. The electrical hysteresis observed in capacitance-voltage and current-voltage measurements can be alleviated by doping of PCBM. Experimental results demonstrate that extremely low trap densities are found for the perovskite device without doping, while the doped sample leads to higher density of interface state. Three mechanisms including Ohm’s law, trap-filled-limit (TFL) emission, and child’s law were used to analyze possible charge transfer mechanisms. Ohm’s law mechanism is well suitable for charge transfer of both the perovskite MOS devices under light condition at large voltage, while TFL emission well addresses the behavior of charge transfer under dark at small voltage. This change of charge transfer mechanism is attributed to the impact of the ion drift within perovskites.

Simulation of diffuse-charge capacitance in electric double layer capacitors

NASA Astrophysics Data System (ADS)

Sun, Ning; Gersappe, Dilip

2017-01-01

We use a Lattice Boltzmann Model (LBM) in order to simulate diffuse-charge dynamics in Electric Double Layer Capacitors (EDLCs). Simulations are carried out for both the charge and the discharge processes on 2D systems of complex random electrode geometries (pure random, random spheres and random fibers). The steric effect of concentrated solutions is considered by using a Modified Poisson-Nernst-Planck (MPNP) equations and compared with regular Poisson-Nernst-Planck (PNP) systems. The effects of electrode microstructures (electrode density, electrode filler morphology, filler size, etc.) on the net charge distribution and charge/discharge time are studied in detail. The influence of applied potential during discharging process is also discussed. Our studies show how electrode morphology can be used to tailor the properties of supercapacitors.

Spatial distribution of transferred charges across the heterointerface between perovskite transition metal oxides LaNiO{sub 3} and LaMnO{sub 3}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kitamura, Miho; Photon Factory, Institute of Materials Structure Science, High Energy Accelerator Research Organization; Horiba, Koji

2016-03-14

To investigate the interfacial charge-transfer phenomena between perovskite transition metal oxides LaNiO{sub 3} (LNO) and LaMnO{sub 3} (LMO), we have performed in situ x-ray absorption spectroscopy (XAS) measurements on LNO/LMO multilayers. The Ni-L{sub 2,3} and Mn-L{sub 2,3} XAS spectra clearly show the occurrence of electron transfer from Mn to Ni ions in the interface region. Detailed analysis of the thickness dependence of these XAS spectra has revealed that the spatial distribution of the transferred charges across the interface is significantly different between the two constituent layers. The observed spatial distribution is presumably described by the charge spreading model that treatsmore » the transfer integral between neighboring transition metal ions and the Coulomb interaction, rather than the Thomas–Fermi screening model.« less

Streaming potential generated by a pressure-driven flow over a super-hydrophobic surface

NASA Astrophysics Data System (ADS)

Zhao, Hui

2010-11-01

The streaming potential generated by a pressured-driven flow over a weakly charged striped slip-stick surface (the zeta potential of the surface is smaller than the thermal potential (25 mV) with an arbitrary double layer thickness is theoretically studied by solving the Poisson-Boltzmann equation and Stokes equation. A series solution of the streaming potential is derived. Approximate expressions for the streaming potential in the limits of thin double layers and thick double layers are also presented, in excellent agreement with the full solution. The streaming potential is compared against that over a homogenously charged smooth surface. Our results indicate that the streaming potential over a super-hydrophobic surface only can be enhanced when the liquid-gas interface is charged. In addition, as the double layer thickness increases, the advantage of the super-hydrophobic surface diminishes. The impact of a slip-stick surface on the streaming potential might provide guidance for designing novel and efficient microfludic energy conversion devices using a super-hydrophobic surface.

Extraction of the neutron electric form factor from measurements of inclusive double spin asymmetries

NASA Astrophysics Data System (ADS)

Sulkosky, V.; Jin, G.; Long, E.; Zhang, Y.-W.; Mihovilovic, M.; Kelleher, A.; Anderson, B.; Higinbotham, D. W.; Širca, S.; Allada, K.; Annand, J. R. M.; Averett, T.; Bertozzi, W.; Boeglin, W.; Bradshaw, P.; Camsonne, A.; Canan, M.; Cates, G. D.; Chen, C.; Chen, J.-P.; Chudakov, E.; De Leo, R.; Deng, X.; Deur, A.; Dutta, C.; El Fassi, L.; Flay, D.; Frullani, S.; Garibaldi, F.; Gao, H.; Gilad, S.; Gilman, R.; Glamazdin, O.; Golge, S.; Gomez, J.; Hansen, J.-O.; Holmstrom, T.; Huang, J.; Ibrahim, H.; de Jager, C. W.; Jensen, E.; Jiang, X.; Jones, M.; Kang, H.; Katich, J.; Khanal, H. P.; King, P.; Korsch, W.; LeRose, J.; Lindgren, R.; Lu, H.-J.; Luo, W.; Markowitz, P.; Meekins, D.; Meziane, M.; Michaels, R.; Moffit, B.; Monaghan, P.; Muangma, N.; Nanda, S.; Norum, B. E.; Pan, K.; Parno, D.; Piasetzky, E.; Posik, M.; Punjabi, V.; Puckett, A. J. R.; Qian, X.; Qiang, Y.; Qui, X.; Riordan, S.; Saha, A.; Sawatzky, B.; Shabestari, M.; Shahinyan, A.; Shoenrock, B.; John, J. St.; Subedi, R.; Tobias, W. A.; Tireman, W.; Urciuoli, G. M.; Wang, D.; Wang, K.; Wang, Y.; Watson, J.; Wojtsekhowski, B.; Ye, Z.; Zhan, X.; Zhang, Y.; Zheng, X.; Zhao, B.; Zhu, L.; Jefferson Lab Hall A Collaboration

2017-12-01

Background: Measurements of the neutron charge form factor, GEn, are challenging because the neutron has no net charge. In addition, measurements of the neutron form factors must use nuclear targets which require accurately accounting for nuclear effects. Extracting GEn with different targets and techniques provides an important test of our handling of these effects. Purpose: The goal of the measurement was to use an inclusive asymmetry measurement technique to extract the neutron charge form factor at a four-momentum transfer of 1 (GeV/c ) 2 . This technique has very different systematic uncertainties than traditional exclusive measurements and thus serves as an independent check of whether nuclear effects have been taken into account correctly. Method: The inclusive quasielastic reaction 3He ⃗(e ⃗,e') was measured at Jefferson Laboratory. The neutron electric form factor, GEn, was extracted at Q2=0.98 (GeV/c ) 2 from ratios of electron-polarization asymmetries measured for two orthogonal target spin orientations. This Q2 is high enough that the sensitivity to GEn is not overwhelmed by the neutron magnetic contribution, and yet low enough that explicit neutron detection is not required to suppress pion production. Results: The neutron electric form factor, GEn, was determined to be 0.0414 ±0.0077 (stat)±0.0022 (syst) , providing the first high-precision inclusive extraction of the neutron's charge form factor. Conclusions: The use of the inclusive quasielastic 3He ⃗(e ⃗,e') with a four-momentum transfer near 1 (GeV/c ) 2 has been used to provide a unique measurement of GEn. This new result provides a systematically independent validation of the exclusive extraction technique results and implies that the nuclear corrections are understood. This is contrary to the proton form factor where asymmetry and differential cross section measurements have been shown to have large systematic differences.

Semiconducting double-dot exchange-only qubit dynamics in the presence of magnetic and charge noises

NASA Astrophysics Data System (ADS)

Ferraro, E.; Fanciulli, M.; De Michielis, M.

2018-06-01

The effects of magnetic and charge noises on the dynamical evolution of the double-dot exchange-only qubit (DEOQ) is theoretically investigated. The DEOQ consisting of three electrons arranged in an electrostatically defined double quantum dot deserves special interest in quantum computation applications. Its advantages are in terms of fabrication, control and manipulation in view of implementation of fast single and two-qubit operations through only electrical tuning. The presence of the environmental noise due to nuclear spins and charge traps, in addition to fluctuations in the applied magnetic field and charge fluctuations on the electrostatic gates adopted to confine the electrons, is taken into account including random magnetic field and random coupling terms in the Hamiltonian. The behavior of the return probability as a function of time for initial conditions of interest is presented. Moreover, through an envelope-fitting procedure on the return probabilities, coherence times are extracted when model parameters take values achievable experimentally in semiconducting devices.

Carbon-, sulfur-, and phosphorus-based charge transfer reactions in inductively coupled plasma-atomic emission spectrometry

NASA Astrophysics Data System (ADS)

Grindlay, Guillermo; Gras, Luis; Mora, Juan; de Loos-Vollebregt, Margaretha T. C.

2016-01-01

In this work, the influence of carbon-, sulfur-, and phosphorus-based charge transfer reactions on the emission signal of 34 elements (Ag, Al, As, Au, B, Ba, Be, Ca, Cd, Co, Cr, Cu, Fe, Ga, Hg, I, In, Ir, K, Li, Mg, Mn, Na, Ni, P, Pb, Pd, Pt, S, Sb, Se, Sr, Te, and Zn) in axially viewed inductively coupled plasma-atomic emission spectrometry has been investigated. To this end, atomic and ionic emission signals for diluted glycerol, sulfuric acid, and phosphoric acid solutions were registered and results were compared to those obtained for a 1% w w- 1 nitric acid solution. Experimental results show that the emission intensities of As, Se, and Te atomic lines are enhanced by charge transfer from carbon, sulfur, and phosphorus ions. Iodine and P atomic emission is enhanced by carbon- and sulfur-based charge transfer whereas the Hg atomic emission signal is enhanced only by carbon. Though signal enhancement due to charge transfer reactions is also expected for ionic emission lines of the above-mentioned elements, no experimental evidence has been found with the exception of Hg ionic lines operating carbon solutions. The effect of carbon, sulfur, and phosphorus charge transfer reactions on atomic emission depends on (i) wavelength characteristics. In general, signal enhancement is more pronounced for electronic transitions involving the highest upper energy levels; (ii) plasma experimental conditions. The use of robust conditions (i.e. high r.f. power and lower nebulizer gas flow rates) improves carbon, sulfur, and phosphorus ionization in the plasma and, hence, signal enhancement; and (iii) the presence of other concomitants (e.g. K or Ca). Easily ionizable elements reduce ionization in the plasma and consequently reduce signal enhancement due to charge transfer reactions.

Theoretical investigation of the charge-transfer properties in different meso-linked zinc porphyrins for highly efficient dye-sensitized solar cells.

PubMed

Namuangruk, Supawadee; Sirithip, Kanokkorn; Rattanatwan, Rattanawelee; Keawin, Tinnagon; Kungwan, Nawee; Sudyodsuk, Taweesak; Promarak, Vinich; Surakhot, Yaowarat; Jungsuttiwong, Siriporn

2014-06-28

The charge transfer effect of different meso-substituted linkages on porphyrin analogue 1 (A1, B1 and C1) was theoretically investigated using density functional theory (DFT) and time-dependent DFT (TDDFT) calculations. The calculated geometry parameters and natural bond orbital analysis reveal that the twisted conformation between porphyrin macrocycle and meso-substituted linkages leads to blocking of the conjugation of the conjugated backbone, and the frontier molecular orbital plot shows that the intramolecular charge transfer of A1, B1 and C1 hardly takes place. In an attempt to improve the photoinduced intramolecular charge transfer ability of the meso-linked zinc porphyrin sensitizer, a strong electron-withdrawing group (CN) was introduced into the anchoring group of analogue 1 forming analogue 2 (A2, B2 and C2). The density difference plot of A2, B2 and C2 shows that the charge transfer properties dramatically improved. The electron injection process has been performed using TDDFT; the direct charge-transfer transition in the A2-(TiO2)38 interacting system takes place; our results strongly indicated that introducing electron-withdrawing groups into the acceptor part of porphyrin dyes can fine-tune the effective conjugation length of the π-spacer and improve intramolecular charge transfer properties, consequently inducing the electron injection process from the anchoring group of the porphyrin dye to the (TiO2)38 surface which may improve the conversion efficiency of the DSSCs. Our calculated results can provide valuable information and a promising outlook for computation-aided sensitizer design with anticipated good properties in further experimental synthesis.

Transition from capacitive coupling to direct charge transfer in asymmetric terahertz plasmonic assemblies.

PubMed

Ahmadivand, Arash; Sinha, Raju; Gerislioglu, Burak; Karabiyik, Mustafa; Pala, Nezih; Shur, Michael

2016-11-15

We experimentally and numerically analyze the charge transfer THz plasmons using an asymmetric plasmonic assembly of metallic V-shaped blocks. The asymmetric design of the blocks allows for the excitation of classical dipolar and multipolar modes due to the capacitive coupling. Introducing a conductive microdisk between the blocks, we facilitated the excitation of the charge transfer plasmons and studied their characteristics along with the capacitive coupling by varying the size of the disk.

Variationally consistent approximation scheme for charge transfer

NASA Technical Reports Server (NTRS)

Halpern, A. M.

1978-01-01

The author has developed a technique for testing various charge-transfer approximation schemes for consistency with the requirements of the Kohn variational principle for the amplitude to guarantee that the amplitude is correct to second order in the scattering wave functions. Applied to Born-type approximations for charge transfer it allows the selection of particular groups of first-, second-, and higher-Born-type terms that obey the consistency requirement, and hence yield more reliable approximation to the amplitude.

Double matrix effect in Low Energy Ion Scattering from La surfaces

NASA Astrophysics Data System (ADS)

Zameshin, Andrey A.; Yakshin, Andrey E.; Sturm, Jacobus M.; Brongerma, Hidde H.; Bijkerk, Fred

2018-05-01

Low Energy Ion Scattering (LEIS) has been performed on several lanthanum-based surfaces. Strong subsurface matrix effects - dependence of surface scattered He+ ion yield on the composition of subsurface layer - have been observed. The ion yield of He+ scattered by La differed by a factor of up to 2.5 for different surfaces, while only the La peak was visible in the spectra. To study these effects and enable surface quantification, He+ ion yields have been measured in a range of incident He+ energies from 1000 to 7500 eV for LaB6, La2O3, oxidized La and pure La surfaces. The investigation showed that as many as two simultaneous matrix effects are present, each one driven by a separate charge exchange mechanism. The first one is a resonant neutralization from the conduction band of La to an excited state of the He+ ion. It depends on the work function of the surface, which is lowered significantly when La interacts with O or B. The second mechanism is quasiresonant charge transfer between bound La levels and He 1s, which creates characteristic oscillations in the energy dependence of ion yields. The exact structure of the oscillations depends on small changes in binding energies of interacting La levels. This is the first time quasiresonant charge transfer is proven to be present in La. It is likely that La 5p orbitals participate in this resonance, which can be the first clear observation of a resonance between p and s orbitals in LEIS. This type of resonance was previously believed to be absent because of strong damping. We also demonstrated that despite the complex matrix effect precise measurements over a wide energy range allow quantification of the atomic composition of La-based surfaces.

Excited State Charge Transfer reaction with dual emission from 5-(4-dimethylamino-phenyl)-penta-2,4-dienenitrile: Spectral measurement and theoretical density functional theory calculation

NASA Astrophysics Data System (ADS)

Jana, Sankar; Dalapati, Sasanka; Ghosh, Shalini; Kar, Samiran; Guchhait, Nikhil

2011-07-01

The excited state intramolecular charge transfer process in donor-chromophore-acceptor system 5-(4-dimethylamino-phenyl)-penta-2,4-dienenitrile (DMAPPDN) has been investigated by steady state absorption and emission spectroscopy in combination with Density Functional Theory (DFT) calculations. This flexible donor acceptor molecule DMAPPDN shows dual fluorescence corresponding to emission from locally excited and charge transfer state in polar solvent. Large solvatochromic emission shift, effect of variation of pH and HOMO-LUMO molecular orbital pictures support excited state intramolecular charge transfer process. The experimental findings have been correlated with the calculated structure and potential energy surfaces based on the Twisted Intramolecular Charge Transfer (TICT) model obtained at DFT level using B3LYP functional and 6-31+G( d, p) basis set. The theoretical potential energy surfaces for the excited states have been generated in vacuo and acetonitrile solvent using Time Dependent Density Functional Theory (TDDFT) and Time Dependent Density Functional Theory Polarized Continuum Model (TDDFT-PCM) method, respectively. All the theoretical results show well agreement with the experimental observations.

Quasi-four-body treatment of charge transfer in the collision of protons with atomic helium: I. Thomas related mechanisms

NASA Astrophysics Data System (ADS)

Safarzade, Zohre; Fathi, Reza; Shojaei Akbarabadi, Farideh; Bolorizadeh, Mohammad A.

2018-04-01

The scattering of a completely bare ion by atoms larger than hydrogen is at least a four-body interaction, and the charge transfer channel involves a two-step process. Amongst the two-step interactions of the high-velocity single charge transfer in an anion-atom collision, there is one whose amplitude demonstrates a peak in the angular distribution of the cross sections. This peak, the so-called Thomas peak, was predicted by Thomas in a two-step interaction, classically, which could also be described through three-body quantum mechanical models. This work discusses a four-body quantum treatment of the charge transfer in ion-atom collisions, where two-step interactions illustrating a Thomas peak are emphasized. In addition, the Pauli exclusion principle is taken into account for the initial and final states as well as the operators. It will be demonstrated that there is a momentum condition for each two-step interaction to occur in a single charge transfer channel, where new classical interactions lead to the Thomas mechanism.

Charge-Transfer Analysis of 2p3d Resonant Inelastic X-ray Scattering of Cobalt Sulfide and Halides

PubMed Central

2017-01-01

We show that with 2p3d resonant inelastic X-ray scattering (RIXS) we can accurately determine the charge-transfer parameters of CoF2, CoCl2, CoBr2, and CoS. The 160 meV resolution RIXS results are compared with charge-transfer multiplet calculations. The improved resolution and the direct observation of the crystal field and charge-transfer excitations allow the determination of more accurate parameters than could be derived from X-ray absorption and X-ray photoemission, both limited in resolution by their lifetime broadening. We derive the crystal field and charge-transfer parameters of the Co2+ ions, which provides the nature of the ground state of the Co2+ ions with respect to symmetry and hybridization. In addition, the increased spectral resolution allows the more accurate determination of the atomic Slater integrals. The results show that the crystal field energy decreases with increasing ligand covalency. The L2 edge RIXS spectra show that the intensity of the (Coster–Kronig induced) nonresonant X-ray emission is a measure of ligand covalency. PMID:29170686

Charge reconfiguration in arrays of quantum dots

NASA Astrophysics Data System (ADS)

Bayer, Johannes C.; Wagner, Timo; Rugeramigabo, Eddy P.; Haug, Rolf J.

2017-12-01

Semiconductor quantum dots are potential building blocks for scalable qubit architectures. Efficient control over the exchange interaction and the possibility of coherently manipulating electron states are essential ingredients towards this goal. We studied experimentally the shuttling of electrons trapped in serial quantum dot arrays isolated from the reservoirs. The isolation hereby enables a high degree of control over the tunnel couplings between the quantum dots, while electrons can be transferred through the array by gate voltage variations. Model calculations are compared with our experimental results for double, triple, and quadruple quantum dot arrays. We are able to identify all transitions observed in our experiments, including cotunneling transitions between distant quantum dots. The shuttling of individual electrons between quantum dots along chosen paths is demonstrated.

Investigation of surface charge density on solid-liquid interfaces by modulating the electrical double layer.

PubMed

Moon, Jong Kyun; Song, Myung Won; Pak, Hyuk Kyu

2015-05-20

A solid surface in contact with water or aqueous solution usually carries specific electric charges. These surface charges attract counter ions from the liquid side. Since the geometry of opposite charge distribution parallel to the solid-liquid interface is similar to that of a capacitor, it is called an electrical double layer capacitor (EDLC). Therefore, there is an electrical potential difference across an EDLC in equilibrium. When a liquid bridge is formed between two conducting plates, the system behaves as two serially connected EDLCs. In this work, we propose a new method for investigating the surface charge density on solid-liquid interfaces. By mechanically modulating the electrical double layers and simultaneously applying a dc bias voltage across the plates, an ac electric current can be generated. By measuring the voltage drop across a load resistor as a function of bias voltage, we can study the surface charge density on solid-liquid interfaces. Our experimental results agree very well with the simple equivalent electrical circuit model proposed here. Furthermore, using this method, one can determine the polarity of the adsorbed state on the solid surface depending on the material used. We expect this method to aid in the study of electrical phenomena on solid-liquid interfaces.

Mechanism of charge transfer and its impacts on Fermi-level pinning for gas molecules adsorbed on monolayer WS2.

PubMed

Zhou, Changjie; Yang, Weihuang; Zhu, Huili

2015-06-07

Density functional theory calculations were performed to assess changes in the geometric and electronic structures of monolayer WS2 upon adsorption of various gas molecules (H2, O2, H2O, NH3, NO, NO2, and CO). The most stable configuration of the adsorbed molecules, the adsorption energy, and the degree of charge transfer between adsorbate and substrate were determined. All evaluated molecules were physisorbed on monolayer WS2 with a low degree of charge transfer and accept charge from the monolayer, except for NH3, which is a charge donor. Band structure calculations showed that the valence and conduction bands of monolayer WS2 are not significantly altered upon adsorption of H2, H2O, NH3, and CO, whereas the lowest unoccupied molecular orbitals of O2, NO, and NO2 are pinned around the Fermi-level when these molecules are adsorbed on monolayer WS2. The phenomenon of Fermi-level pinning was discussed in light of the traditional and orbital mixing charge transfer theories. The impacts of the charge transfer mechanism on Fermi-level pinning were confirmed for the gas molecules adsorbed on monolayer WS2. The proposed mechanism governing Fermi-level pinning is applicable to the systems of adsorbates on recently developed two-dimensional materials, such as graphene and transition metal dichalcogenides.

Charge transfer properties of pentacene adsorbed on silver: DFT study

NASA Astrophysics Data System (ADS)

N, Rekha T.; Rajkumar, Beulah J. M.

2015-06-01

Charge transfer properties of pentacene adsorbed on silver is investigated using DFT methods. Optimized geometry of pentacene after adsorption on silver indicates distortion in hexagonal structure of the ring close to the silver cluster and deviations in co-planarity of carbon atoms due to the variations in bond angles and dihedral angles. Theoretically simulated absorption spectrum has a symmetric surface plasmon resonance peak around 486nm corresponding to the transfer of charge from HOMO-2 to LUMO. Theoretical SERS confirms the process of adsorption, tilted orientation of pentacene on silver surface and the charge transfers reported. Localization of electron density arising from redistribution of electrostatic potential together with a reduced bandgap of pentacene after adsorption on silver suggests its utility in the design of electro active organic semiconducting devices.

Cell survival fraction estimation based on the probability densities of domain and cell nucleus specific energies using improved microdosimetric kinetic models.

PubMed

Sato, Tatsuhiko; Furusawa, Yoshiya

2012-10-01

Estimation of the survival fractions of cells irradiated with various particles over a wide linear energy transfer (LET) range is of great importance in the treatment planning of charged-particle therapy. Two computational models were developed for estimating survival fractions based on the concept of the microdosimetric kinetic model. They were designated as the double-stochastic microdosimetric kinetic and stochastic microdosimetric kinetic models. The former model takes into account the stochastic natures of both domain and cell nucleus specific energies, whereas the latter model represents the stochastic nature of domain specific energy by its approximated mean value and variance to reduce the computational time. The probability densities of the domain and cell nucleus specific energies are the fundamental quantities for expressing survival fractions in these models. These densities are calculated using the microdosimetric and LET-estimator functions implemented in the Particle and Heavy Ion Transport code System (PHITS) in combination with the convolution or database method. Both the double-stochastic microdosimetric kinetic and stochastic microdosimetric kinetic models can reproduce the measured survival fractions for high-LET and high-dose irradiations, whereas a previously proposed microdosimetric kinetic model predicts lower values for these fractions, mainly due to intrinsic ignorance of the stochastic nature of cell nucleus specific energies in the calculation. The models we developed should contribute to a better understanding of the mechanism of cell inactivation, as well as improve the accuracy of treatment planning of charged-particle therapy.

Electron spin resonance and proton matrix electron nuclear double resonance studies of N,N,N[prime],N[prime]-tetramethylbenzidine photoionization in sodium and lithium dodecyl sulfate micelles: Structural effects of crown ethers

DOE Office of Scientific and Technical Information (OSTI.GOV)

McManus, H.J.D.; Young Soo Kang; Kevan, L.

1993-01-07

The study of model membrane systems enjoys increasing attention within the area of solar energy research. An electron nuclear double resonance and electron spin resonance study of photogenerated N,N,N[prime],N[prime]-tetramethylbenzidine (TMB) cation in frozen suspensions of lithium (LDS) and sodium (SDS) dodecyl sulfate micelles containing various concentrations of cyclic polyethers was undertaken. The relative location of the TMB cation within the organic aggregate was determined from the proton matrix ENDOR line width at 142 K. A broader line width was observed in LDS compared to SDS micelles, which is due to the fact that the larger lithium cation opens the micellarmore » interface resulting in increased hydration and deeper solubilization of TMB. The proton matrix ENDOR line width decreased upon addition of crown ethers. This decrease may be explained by displacement of the TMB toward the interface as a result of the decrease in ionic strength caused by the complexation of the countercations. The photoyield shows a slight increase with addition of crown ethers. This increase is most likely caused by the increase in the effective anionic charge of the micelle effected by the complexation of the sodium or lithium ions by the crown ethers. This increase in the anionic charge mitigates the rate of thermal back electron transfer resulting in an increased photoyield. 54 refs., 6 figs., 2 tabs.« less

The MAGNEX spectrometer: Results and perspectives

NASA Astrophysics Data System (ADS)

Cappuzzello, F.; Agodi, C.; Carbone, D.; Cavallaro, M.

2016-06-01

This review discusses the main achievements and future perspectives of the MAGNEX spectrometer at the INFN-LNS laboratory in Catania (Italy). MAGNEX is a large-acceptance magnetic spectrometer for the detection of the ions emitted in nuclear collisions below Fermi energy. In the first part of the paper an overview of the MAGNEX features is presented. The successful application to the precise reconstruction of the momentum vector, to the identification of the ion masses and to the determination of the transport efficiency is demonstrated by in-beam tests. In the second part, an overview of the most relevant scientific achievements is given. Results from nuclear elastic and inelastic scattering as well as from transfer and charge-exchange reactions in a wide range of masses of the colliding systems and incident energies are shown. The role of MAGNEX in solving old and new puzzles in nuclear structure and direct reaction mechanisms is emphasized. One example is the recently observed signature of the long searched Giant Pairing Vibration. Finally, the new challenging opportunities to use MAGNEX for future experiments are briefly reported. In particular, the use of double charge-exchange reactions toward the determination of the nuclear matrix elements entering in the expression of the half-life of neutrinoless double beta decay is discussed. The new NUMEN project of INFN, aiming at these investigations, is introduced. The challenges connected to the major technical upgrade required by the project in order to investigate rare processes under high fluxes of detected heavy ions are outlined.

Diffuse-charge dynamics of ionic liquids in electrochemical systems.

PubMed

Zhao, Hui

2011-11-01

We employ a continuum theory of solvent-free ionic liquids accounting for both short-range electrostatic correlations and steric effects (finite ion size) [Bazant et al., Phys. Rev. Lett. 106, 046102 (2011)] to study the response of a model microelectrochemical cell to a step voltage. The model problem consists of a 1-1 symmetric ionic liquid between two parallel blocking electrodes, neglecting any transverse transport phenomena. Matched asymptotic expansions in the limit of thin double layers are applied to analyze the resulting one-dimensional equations and study the overall charge-time relation in the weakly nonlinear regime. One important conclusion is that our simple scaling analysis suggests that the length scale √(λ*(D)l*(c)) accurately characterizes the double-layer structure of ionic liquids with strong electrostatic correlations where l*(c) is the electrostatic correlation length (in contrast, the Debye screening length λ*(D) is the primary double-layer length for electrolytes) and the response time of λ(D)(*3/2)L*/(D*l(c)(1/2)) (not λ*(D)L*/D* that is the primary charging time of electrolytes) is the correct charging time scale of ionic liquids with strong electrostatic correlations where D* is the diffusivity and L* is the separation length of the cell. With these two new scales, data of both electric potential versus distance from the electrode and the total diffuse charge versus time collapse onto each individual master curve in the presence of strong electrostatic correlations. In addition, the dependance of the total diffuse charge on steric effects, short-range correlations, and driving voltages is thoroughly examined. The results from the asymptotic analysis are compared favorably with those from full numerical simulations. Finally, the absorption of excess salt by the double layer creates a depletion region outside the double layer. Such salt depletion may bring a correction to the leading order terms and break down the weakly nonlinear analysis. A criterion which justifies the weakly nonlinear analysis is verified with numerical simulations.

Double Carbon Nano Coating of LiFePO4 Cathode Material for High Performance of Lithium Ion Batteries.

PubMed

Ding, Yan-Hong; Huang, Guo-Long; Li, Huan-Huan; Xie, Hai-Ming; Sun, Hai-Zhu; Zhang, Jing-Ping

2015-12-01

Double carbon-coated LiFePO4 (D-LiFePO4/C) composite with sphere-like structure was synthesized through combination of co-precipitation and solid-state methods. Cetyl-trimethyl-ammonium bromide (CTAB) and citric acid served as two kinds of carbon sources in sequence. SEM images demonstrated that double carbon coating had certain influence on the morphology. The thickness of carbon coating on D-LiFePO4/C was about 1.7 nm and the content of carbon was 2.48 wt%, according to HRTEM and TG analysis. The electrochemical impedance spectroscopy analysis indicated that the D-LiFePO4/C composite presented the charge-transfer resistance of 68 Ω and Li ion diffusion coefficient of 2.68 x 10(-13) cm2 S(-1), while the single carbon-coated LiFePO4 (S-LiFePO4/C) exhibited 135.5Ω and 4.03 x 10(-14) cm2 S(-1). Especially, the prepared D-LiFePO4/C electrode showed discharge capacities of 102.9 (10C) and 87.1 (20C) mA h g(-1), respectively, with almost no capacity lost after 400 cycles at 10C, which were much better than those of S-LiFePO4/C composite.

A fluid description of plasma double-layers

NASA Technical Reports Server (NTRS)

Levine, J. S.; Crawford, F. W.

1979-01-01

The space-charge double-layer that forms between two plasmas with different densities and thermal energies was investigated using three progressively realistic models which are treated by fluid theory, and take into account four species of particles: electrons and ions reflected by the double-layer, and electrons and ions transmitted through it. The two plasmas are assumed to be cold, and the self-consistent potential, electric field and space-charge distributions within the double-layer are determined. The effects of thermal velocities are taken into account for the reflected particles, and the modifications to the cold plasma solutions are established. Further modifications due to thermal velocities of the transmitted particles are examined. The applicability of a one dimensional fluid description, rather than plasma kinetic theory, is discussed. Theoretical predictions are compared with double layer potentials and lengths deduced from laboratory and space plasma experiments.

Femtochemistry of Intramolecular Charge and Proton Transfer Reactions in Solution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Douhal, Abderrazzak; Sanz, Mikel; Carranza, Maria Angeles

2005-03-17

We report on the first observation of ultrafast intramolecular charge- and proton-transfer reactions in 4'-dimethylaminoflavonol (DAMF) in solution. Upon femtosecond excitation of a non-planar structure of DMAF in apolar medium, the intramolecular charge transfer (ICT) does not occur, and a slow (2 ps) proton motion takes place. However, in polar solvents, the ICT is very fast (100-200 fs) and the produced structure is stabilized that proton motion takes place in few or tens of ps.

Azimuthally and radially excited charge transfer plasmon and Fano lineshapes in conductive sublayer-mediated nanoassemblies.

PubMed

Ahmadivand, Arash; Gerislioglu, Burak; Pala, Nezih

2017-11-01

Here, the plasmon responses of both symmetric and antisymmetric oligomers on a conductive substrate under linear, azimuthal, and radial polarization excitations are analyzed numerically. By observing charge transfer plasmons under cylindrical vector beam (CVB) illumination for what we believe is the first time, we show that our studies open new horizons to induce significant charge transfer plasmons and antisymmetric Fano resonance lineshapes in metallic substrate-mediated plasmonic nanoclusters under both azimuthal and radial excitation as CVBs.

DDT: participation in ultraviolet-detectable, charge-transfer complexation.

PubMed

Wilson, W E; Fishbein, L; Clements, S T

1971-01-15

The chlorophenyl groups of DDT and several of its metabolites are capable of participating in a charge-transfer interaction with tetracyanoethylene detectable in the ultraviolet region of the spectrum. In addition, during a change of state DDT undergoes ultraviolet spectral alterations that closely resemble those previously claimed to support the hypothesis suggesting charge-transfer interaction between this pesticide and a component of insect nerve tissue. The pesticide DDT possesses structural characteristics that would permit it to participate in several types of molecular association.

Coherence, Energy and Charge Transfers in De-Excitation Pathways of Electronic Excited State of Biomolecules in Photosynthesis

NASA Astrophysics Data System (ADS)

Bohr, Henrik G.; Malik, F. Bary

2013-11-01

The observed multiple de-excitation pathways of photo-absorbed electronic excited state in the peridinin-chlorophyll complex, involving both energy and charge transfers among its constituents, are analyzed using the bio-Auger (B-A) theory. It is also shown that the usually used Förster-Dexter theory, which does not allow for charge transfer, is a special case of B-A theory. The latter could, under appropriate circumstances, lead to excimers.

Synthesis and electrochemical studies of charge-transfer complexes of thiazolidine-2,4-dione with σ and π acceptors

NASA Astrophysics Data System (ADS)

Singh, Prashant; Kumar, Pradeep; Katyal, Anju; Kalra, Rashmi; Dass, Sujata K.; Prakash, Satya; Chandra, Ramesh

2010-03-01

In the present work, we report the synthesis and characterization of novel charge-transfer complexes of thiazolidine-2,4-dione (TZD) with sigma acceptor (iodine) and pi acceptors (chloranil, dichlorodicyanoquinone, picric acid and duraquinone). We also evaluated their thermal and electrochemical properties and we conclude that these complexes are frequency dependent. Charge-transfer complex between thiazolidine-2,4-dione and iodine give best conductivity. In conclusion, complex with sigma acceptors are more conducting than with pi acceptors.

Measurement techniques and applications of charge transfer to aerospace research

NASA Technical Reports Server (NTRS)

Smith, A.

1978-01-01

A technique of developing high-velocity low-intensity neutral gas beams for use in aerospace research problems is described. This technique involves ionization of gaseous species with a mass spectrometer and focusing the resulting primary ion beam into a collision chamber containing a static gas at a known pressure and temperature. Equations are given to show how charge-transfer cross sections are obtained from a total-current measurement technique. Important parameters are defined for the charge-transfer process.

Effect of Induced Charge Electroosmosis on the Dielectrophoretic Motion of Particles

NASA Astrophysics Data System (ADS)

Swaminathan, T.; Hu, Howard

2006-11-01

Most suspensions involve the formation of ionic double layers next to the surface of particles due to the induced-charge on the surface. These double layers affect the motion of the particle even under AC electric fields. They modify the net dipole moment of the particle and at the same time produce slip velocities on the surfaces of these particles. A method to numerically evaluate the effect of the double layer on the dielectrophoretic motion of particles has been previously developed to study these two effects. The technique involves a matched asymptotic expansion of the electric field near the particle surface, where the double layer is formed, and is written as a jump-boundary-condition for the electric potential when the thickness of the double layer is small compared to the size of the particle. The developed jump-boundary-condition is then used to calculate an effective zeta potential on the particle surface. Unlike classical electroosmosis, this zeta potential is no longer constant on every part of the surface and is dependent on the applied electric field. The effect of the induced-charge electroosmotic slip velocity on the dielectrophoretic motion of particles has been observed using this technique.

Application of Electric Double-layer Capacitors for Energy Storage on Electric Railway

NASA Astrophysics Data System (ADS)

Hase, Shin-Ichi; Konishi, Takeshi; Okui, Akinobu; Nakamichi, Yoshinobu; Nara, Hidetaka; Uemura, Tadashi

The methods to stabilize power sources, which are the measures against voltage drop, power loading fluctuation, regeneration power lapse and so on, have been important issues in DC feeding circuits. Therefore, an energy storage medium that uses power efficiently and reduces above-mentioned problems is much concerned about. In recent years, development of energy storage medium is remarkable for drive-power supplies of electric vehicles. A number of applications of energy storage, for instance, battery and flywheel, have been investigated so far. A large-scale electric double-layer capacitor which is rapidly charged and discharged and offers long life, maintenance-free, low pollution and high efficiency, has been developed in wide range. We have compared the ability to charge batteries and electric double-layer capacitors. Therefore, we carried out fundamental studies about electric double-layer capacitors and its control. And we produced a prototype of energy storage for the DC electric railway system that consists of electric double-layer capacitors, diode bridge rectifiers, chopper system and PWM converters. From the charge and discharge tests of the prototype, useful information was obtained. This paper describes its characteristics and experimental results of energy storage system.

CCD charge collection efficiency and the photon transfer technique

NASA Technical Reports Server (NTRS)

Janesick, J.; Klaasen, K.; Elliott, T.

1985-01-01

The charge-coupled device (CCD) has shown unprecendented performance as a photon detector in the areas of spectral response, charge transfer, and readout noise. Recent experience indicates, however, that the full potential for the CCD's charge collection efficiency (CCE) lies well beyond that which is realized in currently available devices. A definition of CCE performance is presented and a standard test tool (the photon transfer technique) for measuring and optimizing this important CCD parameter is introduced. CCE characteristics for different types of CCDs are compared; the primary limitations in achieving high CCE performance are discussed, and the prospects for future improvement are outlined.

Charge-transfer modified embedded atom method dynamic charge potential for Li-Co-O system

NASA Astrophysics Data System (ADS)

Kong, Fantai; Longo, Roberto C.; Liang, Chaoping; Nie, Yifan; Zheng, Yongping; Zhang, Chenxi; Cho, Kyeongjae

2017-11-01

To overcome the limitation of conventional fixed charge potential methods for the study of Li-ion battery cathode materials, a dynamic charge potential method, charge-transfer modified embedded atom method (CT-MEAM), has been developed and applied to the Li-Co-O ternary system. The accuracy of the potential has been tested and validated by reproducing a variety of structural and electrochemical properties of LiCoO2. A detailed analysis on the local charge distribution confirmed the capability of this potential for dynamic charge modeling. The transferability of the potential is also demonstrated by its reliability in describing Li-rich Li2CoO2 and Li-deficient LiCo2O4 compounds, including their phase stability, equilibrium volume, charge states and cathode voltages. These results demonstrate that the CT-MEAM dynamic charge potential could help to overcome the challenge of modeling complex ternary transition metal oxides. This work can promote molecular dynamics studies of Li ion cathode materials and other important transition metal oxides systems that involve complex electrochemical and catalytic reactions.

Charge-transfer modified embedded atom method dynamic charge potential for Li-Co-O system.

PubMed

Kong, Fantai; Longo, Roberto C; Liang, Chaoping; Nie, Yifan; Zheng, Yongping; Zhang, Chenxi; Cho, Kyeongjae

2017-11-29

To overcome the limitation of conventional fixed charge potential methods for the study of Li-ion battery cathode materials, a dynamic charge potential method, charge-transfer modified embedded atom method (CT-MEAM), has been developed and applied to the Li-Co-O ternary system. The accuracy of the potential has been tested and validated by reproducing a variety of structural and electrochemical properties of LiCoO 2 . A detailed analysis on the local charge distribution confirmed the capability of this potential for dynamic charge modeling. The transferability of the potential is also demonstrated by its reliability in describing Li-rich Li 2 CoO 2 and Li-deficient LiCo 2 O 4 compounds, including their phase stability, equilibrium volume, charge states and cathode voltages. These results demonstrate that the CT-MEAM dynamic charge potential could help to overcome the challenge of modeling complex ternary transition metal oxides. This work can promote molecular dynamics studies of Li ion cathode materials and other important transition metal oxides systems that involve complex electrochemical and catalytic reactions.

Delaminating and restacking MgAl-layered double hydroxide monitored and characterized by a range of instrumental methods

NASA Astrophysics Data System (ADS)

Muráth, Szabolcs; Somosi, Zoltán; Tóth, Ildikó Y.; Tombácz, Etelka; Sipos, Pál; Pálinkó, István

2017-07-01

The delamination-restacking properties of MgAl-layered double hydroxide (MgAl-LDH) were studied in various solvents. The LDH samples were successfully delaminated in polar amides (formamide, N-methylformamide, N-methylacetamide). Usually, delamination was finalized by ultrasonic treatment. As rehydrating solutions, numerous Na-salts with single-, double- and triple-charged anions were used. Reconstruction was accomplished with anions of one or two negative charges, but triple-charged ones generally disrupted the rebuilding process, likely, because their salts with the metals of the LDH are very stable, and the thin layers can more readily transform to salts than the ordered materials. Samples and delamination-restacking processes were characterized by X-ray diffractometry (XRD), infrared spectroscopy (IR), dynamic light scattering (DLS), scanning electron microscopy (SEM) and energy-dispersive X-ray analysis (EDX).

Long-lived, charge-shift states in heterometallic, porphyrin-based dendrimers formed via click chemistry.

PubMed

Le Pleux, Loïc; Pellegrin, Yann; Blart, Errol; Odobel, Fabrice; Harriman, Anthony

2011-05-26

A series of multiporphyrin clusters has been synthesized and characterized in which there exists a logical gradient for either energy or electron transfer between the porphyrins. A central free-base porphyrin (FbP), for example, is equipped with peripheral zinc(II) porphyrins (ZnP) which act as ancillary light harvesters and transfer excitation energy to the FbP under visible light illumination. Additional energy-transfer steps occur at the triplet level, and the series is expanded by including magnesium(II) porphyrins and/or tin(IV) porphyrins as chromophores. Light-induced electron transfer is made possible by incorporating a gold(III) porphyrin (AuP(+)) into the array. Although interesting by themselves, these clusters serve as control compounds by which to understand the photophysical processes occurring within a three-stage dendrimer comprising an AuP(+) core, a second layer formed from four FbP units, and an outer layer containing 12 ZnP residues. Here, illumination into a peripheral ZnP leads to highly efficient electronic energy transfer to FbP, followed by charge transfer to the central AuP(+). Charge recombination within the resultant charge-shift state is intercepted by secondary hole transfer to the ZnP, which occurs with a quantum yield of around 20%. The final charge-shift state survives for some microseconds in fluid solution at room temperature.

Coupled sensitizer-catalyst dyads: electron-transfer reactions in a perylene-polyoxometalate conjugate.

PubMed

Odobel, Fabrice; Séverac, Marjorie; Pellegrin, Yann; Blart, Errol; Fosse, Céline; Cannizzo, Caroline; Mayer, Cédric R; Elliott, Kristopher J; Harriman, Anthony

2009-01-01

Ultrafast discharge of a single-electron capacitor: A variety of intramolecular electron-transfer reactions are apparent for polyoxometalates functionalized with covalently attached perylene monoimide chromophores, but these are restricted to single-electron events. (et=electron transfer, cr=charge recombination, csr=charge-shift reaction, PER=perylene, POM=polyoxometalate).A new strategy is introduced that permits covalent attachment of an organic chromophore to a polyoxometalate (POM) cluster. Two examples are reported that differ according to the nature of the anchoring group and the flexibility of the linker. Both POMs are functionalized with perylene monoimide units, which function as photon collectors and form a relatively long-lived charge-transfer state under illumination. They are reduced to a stable pi-radical anion by electrolysis or to a protonated dianion under photolysis in the presence of aqueous triethanolamine. The presence of the POM opens up an intramolecular electron-transfer route by which the charge-transfer state reduces the POM. The rate of this process depends on the molecular conformation and appears to involve through-space interactions. Prior reduction of the POM leads to efficient fluorescence quenching, again due to intramolecular electron transfer. In most cases, it is difficult to resolve the electron-transfer products because of relatively fast reverse charge shift that occurs within a closed conformer. Although the POM can store multiple electrons, it has not proved possible to use these systems as molecular-scale capacitors because of efficient electron transfer from the one-electron-reduced POM to the excited singlet state of the perylene monoimide.

Organic solar cells: understanding the role of Förster resonance energy transfer.

PubMed

Feron, Krishna; Belcher, Warwick J; Fell, Christopher J; Dastoor, Paul C

2012-12-12

Organic solar cells have the potential to become a low-cost sustainable energy source. Understanding the photoconversion mechanism is key to the design of efficient organic solar cells. In this review, we discuss the processes involved in the photo-electron conversion mechanism, which may be subdivided into exciton harvesting, exciton transport, exciton dissociation, charge transport and extraction stages. In particular, we focus on the role of energy transfer as described by F¨orster resonance energy transfer (FRET) theory in the photoconversion mechanism. FRET plays a major role in exciton transport, harvesting and dissociation. The spectral absorption range of organic solar cells may be extended using sensitizers that efficiently transfer absorbed energy to the photoactive materials. The limitations of F¨orster theory to accurately calculate energy transfer rates are discussed. Energy transfer is the first step of an efficient two-step exciton dissociation process and may also be used to preferentially transport excitons to the heterointerface, where efficient exciton dissociation may occur. However, FRET also competes with charge transfer at the heterointerface turning it in a potential loss mechanism. An energy cascade comprising both energy transfer and charge transfer may aid in separating charges and is briefly discussed. Considering the extent to which the photo-electron conversion efficiency is governed by energy transfer, optimisation of this process offers the prospect of improved organic photovoltaic performance and thus aids in realising the potential of organic solar cells.

Theoretical study on naphthobischalcogenadiazole conjugated polymer systems and C61 derivative as organic photovoltaic semiconductors

NASA Astrophysics Data System (ADS)

Fujita, Takehiro; Matsui, Toru; Sumita, Masato; Imamura, Yutaka; Morihashi, Kenji

2018-02-01

We investigated the charge-transfer reactions of solar cells including a quaterthiophene copolymer with naphtho-bis-thiadiazole (PNTz4T) and naphtho-bis-oxadiazole (PNOz4T) using constrained density functional theory (CDFT). According to our calculations, the high electron-transfer rate results in a highly efficient solar cell, and the stable charge-transfer state results in low energy loss. Our computations imply that the following three factors are crucial to improve the performance of semiconducting polymers: (i) large structural changes following charge-transfer, (ii) narrow band gap, and (iii) spatially delocalized lowest unoccupied molecular orbital (LUMO) of the ground state.

Chemical exchange rotation transfer (CERT) on human brain at 3 Tesla.

PubMed

Lin, Eugene C; Li, Hua; Zu, Zhongliang; Louie, Elizabeth A; Lankford, Christopher L; Dortch, Richard D; Does, Mark D; Gore, John C; Gochberg, Daniel F

2018-05-25

To test the ability of a novel pulse sequence applied in vivo at 3 Tesla to separate the contributions to the water signal from amide proton transfer (APT) and relayed nuclear Overhauser enhancement (rNOE) from background direct water saturation and semisolid magnetization transfer (MT). The lack of such signal source isolation has confounded conventional chemical exchange saturation transfer (CEST) imaging. We quantified APT and rNOE signals using a chemical exchange rotation transfer (CERT) metric, MTR double . A range of duty cycles and average irradiation powers were applied, and results were compared with conventional CEST analyses using asymmetry (MTR asym ) and extrapolated magnetization transfer (EMR). Our results indicate that MTR double is more specific than MTR asym and, because it requires as few as 3 data points, is more rapid than methods requiring a complete Z-spectrum, such as EMR. In white matter, APT (1.5 ± 0.5%) and rNOE (2.1 ± 0.7%) were quantified by using MTR double with a 30% duty cycle and a 0.5-µT average power. In addition, our results suggest that MTR double is insensitive to B 0 inhomogeneity, further magnifying its speed advantage over CEST metrics that require a separate B 0 measurement. However, MTR double still has nontrivial sensitivity to B 1 inhomogeneities. We demonstrated that MTR double is an alternative metric to evaluate APT and rNOE, which is fast, robust to B 0 inhomogeneity, and easy to process. © 2018 International Society for Magnetic Resonance in Medicine.

Three-dimensional nonsteady heat-transfer analysis of an indirect heating furnace

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ito, H.; Umeda, Y.; Nakamura, Y.

1991-01-01

This paper reports on an accurate design method for industrial furnaces from the viewpoint of heat transfer. The authors carried out a three-dimensional nonsteady heat-transfer analysis for a practical-size heat- treatment furnace equipped with radiant heaters. The authors applied three software package programs, STREAM, MORSE, and TRUMP, for the analysis of the combined heat-transfer problems of radiation, conduction, and convection. The authors also carried out experiments of the heating of a charge consisting of packed bolts. The authors found that the air swirled inside the furnace. As for the temperature in each part in the furnace, analytical results were generallymore » in close agreement with the experimental ones. This suggests that our analytical method is useful for a fundamental heat- transfer-based design of a practical-size industrial furnace with an actual charge such as packed bolts. As for the temperature distribution inside the bolt charge (work), the analytical results were also in close agreement with the experimental ones. Consequently, it was found that the heat transfer in the bolt charge could be described with an effective thermal conductivity.« less

Communication: Charge transfer dominates over proton transfer in the reaction of nitric acid with gas-phase hydrated electrons

NASA Astrophysics Data System (ADS)

Lengyel, Jozef; Med, Jakub; Slavíček, Petr; Beyer, Martin K.

2017-09-01

The reaction of HNO3 with hydrated electrons (H2O)n- (n = 35-65) in the gas phase was studied using Fourier transform ion cyclotron resonance (FT-ICR) mass spectrometry and ab initio molecular dynamics simulations. Kinetic analysis of the experimental data shows that OH-(H2O)m is formed primarily via a reaction of the hydrated electron with HNO3 inside the cluster, while proton transfer is not observed and NO3-(H2O)m is just a secondary product. The reaction enthalpy was determined using nanocalorimetry, revealing a quite exothermic charge transfer with -241 ± 69 kJ mol-1. Ab initio molecular dynamics simulations indicate that proton transfer is an allowed reaction pathway, but the overall thermochemistry favors charge transfer.

Thermal energy and charge currents in multi-terminal nanorings

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kramer, Tobias; Konrad-Zuse-Zentrum für Informationstechnik Berlin, 14195 Berlin; Kreisbeck, Christoph

2016-06-15

We study in experiment and theory thermal energy and charge transfer close to the quantum limit in a ballistic nanodevice, consisting of multiply connected one-dimensional electron waveguides. The fabricated device is based on an AlGaAs/GaAs heterostructure and is covered by a global top-gate to steer the thermal energy and charge transfer in the presence of a temperature gradient, which is established by a heating current. The estimate of the heat transfer by means of thermal noise measurements shows the device acting as a switch for charge and thermal energy transfer. The wave-packet simulations are based on the multi-terminal Landauer-Büttiker approachmore » and confirm the experimental finding of a mode-dependent redistribution of the thermal energy current, if a scatterer breaks the device symmetry.« less

Absorption spectrometric study of charge transfer complex formation between 4-acetamidophenol (paracetamol) and a series of quinones including Vitamin K 3

NASA Astrophysics Data System (ADS)

Saha, Avijit; Mukherjee, Asok K.

2004-07-01

The formation of charge transfer (CT) complexes of 4-acetamidophenol (commonly called 'paracetamol') and a series of quinones (including Vitamin K 3) has been studied spectrophotometrically in ethanol medium. The vertical ionisation potential of paracetamol and the degrees of charge transfer of the complexes in their ground state has been estimated from the trends in the charge transfer bands. The oscillator and transition dipole strengths of the complexes have been determined from the CT absorption spectra at 298 K. The complexes have been found by Job's method of continuous variation to have the uncommon 2:1 (paracetamol:quinone) stoichiometry in each case. The enthalpies and entropies of formation of the complexes have been obtained by determining their formation constants at five different temperatures.

Probe-based measurement of lateral single-electron transfer between individual molecules

PubMed Central

Steurer, Wolfram; Fatayer, Shadi; Gross, Leo; Meyer, Gerhard

2015-01-01

The field of molecular electronics aims at using single molecules as functional building blocks for electronics components, such as switches, rectifiers or transistors. A key challenge is to perform measurements with atomistic control over the alignment of the molecule and its contacting electrodes. Here we use atomic force microscopy to examine charge transfer between weakly coupled pentacene molecules on insulating films with single-electron sensitivity and control over the atomistic details. We show that, in addition to the imaging capability, the probe tip can be used to control the charge state of individual molecules and to detect charge transfers to/from the tip, as well as between individual molecules. Our approach represents a novel route for molecular charge transfer studies with a host of opportunities, especially in combination with single atom/molecule manipulation and nanopatterning techniques. PMID:26387533

Preparation and spectroscopic studies on charge-transfer complexes of 2,2'-bipyridine with picric and chloranilic acids

NASA Astrophysics Data System (ADS)

Teleb, Said M.; Gaballa, Akmal S.

2005-11-01

Charge-transfer (CT) complexes formed on the reaction of 2,2'-bipyridine with some acceptors such as picric acid (HPA) and chloranilic acid (H 2CA) have been studied in CHCl 3 and MeOH at room temperature. Based on elemental analysis and IR spectra of the solid CT complexes along with the photometric titration curves for the reactions, the data obtained indicate the formation of 1:1 charge-transfer complexes [(bpyH)(PA)] and [(bpyH 2)(CA)], respectively. The infrared and 1H NMR spectroscopic data indicate a charge-transfer interaction associated with a proton migration from the acceptor to the donor followed by intramolecular hydrogen bonding. The formation constants ( KC) for the complexes were shown to be dependent on the structure of the electron acceptors used.

Preparation and spectroscopic studies on charge-transfer complexes of 2,2'-bipyridine with picric and chloranilic acids.

PubMed

Teleb, Said M; Gaballa, Akmal S

2005-11-01

Charge-transfer (CT) complexes formed on the reaction of 2,2'-bipyridine with some acceptors such as picric acid (HPA) and chloranilic acid (H(2)CA) have been studied in CHCl(3) and MeOH at room temperature. Based on elemental analysis and IR spectra of the solid CT complexes along with the photometric titration curves for the reactions, the data obtained indicate the formation of 1:1 charge-transfer complexes [(bpyH)(PA)] and [(bpyH(2))(CA)], respectively. The infrared and (1)H NMR spectroscopic data indicate a charge-transfer interaction associated with a proton migration from the acceptor to the donor followed by intramolecular hydrogen bonding. The formation constants (K(C)) for the complexes were shown to be dependent on the structure of the electron acceptors used.

TiO2/water Nanofluid Heat Transfer in Heat Exchanger Equipped with Double Twisted-Tape Inserts

NASA Astrophysics Data System (ADS)

Eiamsa-ard, S.; Ketrain, R.; Chuwattanakul, V.

2018-05-01

Nowadays, heat transfer enhancement plays an important role in improving efficiency of heat transfer and thermal systems for numerous areas such as heat recovery processes, chemical reactors, air-conditioning/refrigeration system, food engineering, solar air/water heater, cooling of high power electronics etc. The present work presents the experimental results of the heat transfer enhancement of TiO2/water nanofluid in a heat exchanger tube fitted with double twisted tapes. The study covered twist ratios of twisted tapes (y/w) of 1.5, 2.0, and 2.5) while the concentration of the nanofluid was kept constant at 0.05% by volume. Observations show that heat transfer, friction loss and thermal performance increase as twist ratio (y/w) decreases. The use of the nanofluid in the tube equipped with the double twisted-tapes with the smallest twist ratio (y/w = 1.5) results in the increases of heat transfer rates and friction factor up to 224.8% and 8.98 times, respectively as compared to those of water. In addition, the experimental results performed that double twisted tapes induced dual swirling-flows which played an important role in improving fluid mixing and heat transfer enhancement. It is also observed that the TiO2/water nanofluid was responsible for low pressure loss behaviors.

Charge Transport and Thermoelectric Properties of (Nd1- z Yb z ) y Fe4- x Co x Sb12 Skutterudites

NASA Astrophysics Data System (ADS)

Shin, Dong-Kil; Jang, Kyung-Wook; Choi, Soon-Mok; Lee, Soonil; Seo, Won-Seon; Kim, Il-Ho

2018-06-01

Partially double-filled (Nd1- z Yb z ) y Fe4- x Co x Sb12 ( z = 0.25, 0.75, y = 0.8, and x = 0, 0.5, 1.0) skutterudites were prepared by encapsulated melting, annealing, and hot pressing, and the effects of Nd/Yb partial double filling and Co charge compensation on the microstructure, charge transport, and thermoelectric properties were investigated. All the specimens were transformed to the skutterudite phase together with a few secondary phases such as FeSb2, but FeSb2 formation was suppressed on increasing Co content. Nd and Yb were successfully double-filled in the voids of the skutterudite lattice and Co was well substituted at Fe sites, as indicated by changes in the lattice constant with Nd/Yb filling and Fe/Co substitution. All the specimens showed p-type conduction and exhibited degenerate semiconductor characteristics at temperatures from 323 K to 823 K, and the charge transport properties depended on the filling ratio of Nd and Yb because of the difference between the valencies of Nd and Yb. The electrical conductivity decreased and the Seebeck coefficient increased owing to a decrease in the carrier concentration with increasing Co content. The lattice thermal conductivity decreased because phonon scattering was enhanced by Nd and Yb partial double filling, but partially double-filled specimens did not exhibit a further significant reduction in the lattice thermal conductivity compared with the completely double-filled specimens. A maximum ZT of 0.83 was obtained for (Nd0.75Yb0.25)0.8Fe3CoSb12 at 723 K.

Energy gap law of electron transfer in nonpolar solvents.

PubMed

Tachiya, M; Seki, Kazuhiko

2007-09-27

We investigate the energy gap law of electron transfer in nonpolar solvents for charge separation and charge recombination reactions. In polar solvents, the reaction coordinate is given in terms of the electrostatic potentials from solvent permanent dipoles at solutes. In nonpolar solvents, the energy fluctuation due to solvent polarization is absent, but the energy of the ion pair state changes significantly with the distance between the ions as a result of the unscreened strong Coulomb potential. The electron transfer occurs when the final state energy coincides with the initial state energy. For charge separation reactions, the initial state is a neutral pair state, and its energy changes little with the distance between the reactants, whereas the final state is an ion pair state and its energy changes significantly with the mutual distance; for charge recombination reactions, vice versa. We show that the energy gap law of electron-transfer rates in nonpolar solvents significantly depends on the type of electron transfer.

The Role of FRET in Non-Fullerene Organic Solar Cells: Implications for Molecular Design.

PubMed

Gautam, Bhoj R; Younts, Robert; Carpenter, Joshua; Ade, Harald; Gundogdu, Kenan

2018-04-19

Non-fullerene acceptors (NFAs) have been demonstrated to be promising candidates for highly efficient organic photovoltaic (OPV) devices. The tunability of absorption characteristics of NFAs can be used to make OPVs with complementary donor-acceptor absorption to cover a broad range of the solar spectrum. However, both charge transfer from donor to acceptor moieties and energy (energy) transfer from high-bandgap to low-bandgap materials are possible in such structures. Here, we show that when charge transfer and exciton transfer processes are both present, the coexistence of excitons in both domains can cause a loss mechanism. Charge separation of excitons in a low-bandgap material is hindered due to exciton population in the larger bandgap acceptor domains. Our results further show that excitons in low-bandgap material should have a relatively long lifetime compared to the transfer time of excitons from higher bandgap material in order to contribute to the charge separation. These observations provide significant guidance for design and development of new materials in OPV applications.

Electrically active induced energy levels and metastability of B and N vacancy-complexes in 4H–SiC

NASA Astrophysics Data System (ADS)

Igumbor, E.; Olaniyan, O.; Mapasha, R. E.; Danga, H. T.; Omotoso, E.; Meyer, W. E.

2018-05-01

Electrically active induced energy levels in semiconductor devices could be beneficial to the discovery of an enhanced p or n-type semiconductor. Nitrogen (N) implanted into 4H–SiC is a high energy process that produced high defect concentrations which could be removed during dopant activation annealing. On the other hand, boron (B) substituted for silicon in SiC causes a reduction in the number of defects. This scenario leads to a decrease in the dielectric properties and induced deep donor and shallow acceptor levels. Complexes formed by the N, such as the nitrogen-vacancy centre, have been reported to play a significant role in the application of quantum bits. In this paper, results of charge states thermodynamic transition level of the N and B vacancy-complexes in 4H–SiC are presented. We explore complexes where substitutional N/N or B/B sits near a Si (V) or C (V) vacancy to form vacancy-complexes (NV, NV, NV, NV, BV, BV, BV and BV). The energies of formation of the N related vacancy-complexes showed the NV to be energetically stable close to the valence band maximum in its double positive charge state. The NV is more energetically stable in the double negative charge state close to the conduction band minimum. The NV on the other hand, induced double donor level and the NV induced a double acceptor level. For B related complexes, the BV and BV were energetically stable in their single positive charge state close to the valence band maximum. As the Fermi energy is varied across the band gap, the neutral and single negative charge states of the BV become more stable at different energy levels. B and N related complexes exhibited charge state controlled metastability behaviour.

Cyclically optimized electrochemical processes

NASA Astrophysics Data System (ADS)

Ruedisueli, Robert Louis

It has been frequently observed in experiment and industry practice that electrochemical processes (deposition, dissolution, fuel cells) operated in an intermittent or cyclic (AC) mode show improvements in efficiency and/or quality and yield over their steady (DC) mode of operation. Whether rationally invoked by design or empirically tuned-in, the optimal operating frequency and duty cycle is dependent upon the dominant relaxation time constant for the process in question. The electrochemical relaxation time constant is a function of: double-layer and reaction intermediary pseudo-capacitances, ion (charge) transport via electrical migration (mobility), and diffusion across a concentration gradient to electrode surface reaction sites where charge transfer and species incorporation or elimination occurs. The rate determining step dominates the time constant for the reaction or process. Electrochemical impedance spectroscopy (EIS) and piezoelectric crystal electrode (PCE) response analysis have proven to be useful tools in the study and identification of reaction mechanisms. This work explains and demonstrates with the electro-deposition of copper the application of EIS and PCE measurement and analysis to the selection of an optimum cyclic operating schedule, an optimum driving frequency for efficient, sustained cyclic (pulsed) operation.

Modeling the Partial Atomic Charges in Inorganometallic Molecules and Solids and Charge Redistribution in Lithium-Ion Cathodes

DOE PAGES

Wang, Bo; Li, Shaohong L.; Truhlar, Donald G.

2014-10-30

Partial atomic charges are widely used for the description of charge distributions of molecules and solids. These charges are useful to indicate the extent of charge transfer and charge flow during chemical reactions in batteries, fuel cells, and catalysts and to characterize charge distributions in capacitors, liquid-phase electrolytes, and solids and at electrochemical interfaces. However, partial atomic charges given by various charge models differ significantly, especially for systems containing metal atoms. In the present study, we have compared various charge models on both molecular systems and extended systems, including Hirshfeld, CM5, MK, ChElPG, Mulliken, MBS, NPA, DDEC, LoProp, and Badermore » charges. Their merits and drawbacks are compared. The CM5 charge model is found to perform well on the molecular systems, with a mean unsigned percentage deviation of only 9% for the dipole moments. We therefore formulated it for extended systems and applied it to study charge flow during the delithiation process in lithium-containing oxides used as cathodes. Our calculations show that the charges given by the CM5 charge model are reasonable and that during the delithiation process, the charge flow can occur not only on the transition metal but also on the anions. The oxygen atoms can lose a significant density of electrons, especially for deeply delithiated materials. We also discuss other methods in current use to analyze the charge transfer and charge flow in batteries, in particular the use of formal charge, spin density, and orbital occupancy. Here, we conclude that CM5 charges provide useful information in describing charge distributions in various materials and are very promising for the study of charge transfer and charge flows in both molecules and solids.« less

Modeling the Partial Atomic Charges in Inorganometallic Molecules and Solids and Charge Redistribution in Lithium-Ion Cathodes.

PubMed

Wang, Bo; Li, Shaohong L; Truhlar, Donald G

2014-12-09

Partial atomic charges are widely used for the description of charge distributions of molecules and solids. These charges are useful to indicate the extent of charge transfer and charge flow during chemical reactions in batteries, fuel cells, and catalysts and to characterize charge distributions in capacitors, liquid-phase electrolytes, and solids and at electrochemical interfaces. However, partial atomic charges given by various charge models differ significantly, especially for systems containing metal atoms. In the present study, we have compared various charge models on both molecular systems and extended systems, including Hirshfeld, CM5, MK, ChElPG, Mulliken, MBS, NPA, DDEC, LoProp, and Bader charges. Their merits and drawbacks are compared. The CM5 charge model is found to perform well on the molecular systems, with a mean unsigned percentage deviation of only 9% for the dipole moments. We therefore formulated it for extended systems and applied it to study charge flow during the delithiation process in lithium-containing oxides used as cathodes. Our calculations show that the charges given by the CM5 charge model are reasonable and that during the delithiation process, the charge flow can occur not only on the transition metal but also on the anions. The oxygen atoms can lose a significant density of electrons, especially for deeply delithiated materials. We also discuss other methods in current use to analyze the charge transfer and charge flow in batteries, in particular the use of formal charge, spin density, and orbital occupancy. We conclude that CM5 charges provide useful information in describing charge distributions in various materials and are very promising for the study of charge transfer and charge flows in both molecules and solids.

Atomic and electronic structure of trilayer graphene/SiC(0001): Evidence of Strong Dependence on Stacking Sequence and charge transfer.

PubMed

Pierucci, Debora; Brumme, Thomas; Girard, Jean-Christophe; Calandra, Matteo; Silly, Mathieu G; Sirotti, Fausto; Barbier, Antoine; Mauri, Francesco; Ouerghi, Abdelkarim

2016-09-15

The transport properties of few-layer graphene are the directly result of a peculiar band structure near the Dirac point. Here, for epitaxial graphene grown on SiC, we determine the effect of charge transfer from the SiC substrate on the local density of states (LDOS) of trilayer graphene using scaning tunneling microscopy/spectroscopy and angle resolved photoemission spectroscopy (ARPES). Different spectra are observed and are attributed to the existence of two stable polytypes of trilayer: Bernal (ABA) and rhomboedreal (ABC) staking. Their electronic properties strongly depend on the charge transfer from the substrate. We show that the LDOS of ABC stacking shows an additional peak located above the Dirac point in comparison with the LDOS of ABA stacking. The observed LDOS features, reflecting the underlying symmetry of the two polytypes, were reproduced by explicit calculations within density functional theory (DFT) including the charge transfer from the substrate. These findings demonstrate the pronounced effect of stacking order and charge transfer on the electronic structure of trilayer or few layer graphene. Our approach represents a significant step toward understand the electronic properties of graphene layer under electrical field.

Electroluminescence Properties of IrQ(ppy)2 Dual-Emitter Organometallic Compound in Organic Light-Emitting Devices

NASA Astrophysics Data System (ADS)

Ciobotaru, Constantin Claudiu; Polosan, Silviu; Ciobotaru, Iulia Corina

2018-02-01

This paper reports the influence of the charge carrier mobility on the electroluminescent properties of a dual-emitter organometallic compound dispersed in two conjugated organic small-molecule host materials and embedded in organic light-emitting devices (OLEDs). The electroluminescent processes in OLEDs are strongly influenced by the host-guest interaction. The charge carrier mobility in the host material plays an important role in the electroluminescent processes but also depends on the triplet-triplet interaction with the organometallic compound. The low charge carrier mobility in 4,4'-bis( N-carbazolyl)-1,1'-biphenyl (CBP) host material reduces the electroluminescent processes, but they are slightly enhanced by the triplet-triplet exothermic charge transfer. The higher charge carrier mobility in the case of N, N'-bis(3-methylphenyl)- N, N'-diphenylbenzidine (TPD) host material influences the electroluminescent processes by the endothermic energy transfer at room temperature, which facilitates the triplet-triplet harvesting in the host-guest system. The excitation is transferred to the guest molecules by triplet-triplet interaction as a Dexter transfer, which occurs by endothermic transfer from the triplet exciton in the host to the triplet exciton in the guest.

Intermolecular hydrogen bond complexes by in situ charge transfer complexation of o-tolidine with picric and chloranilic acids

NASA Astrophysics Data System (ADS)

Refat, Moamen S.; Saad, Hosam A.; Adam, Abdel Majid A.

2011-08-01

A two new charge transfer complexes formed from the interactions between o-tolidine (o-TOL) and picric (PA) or chloranilic (CA) acids, with the compositions, [(o-TOL)(PA) 2] and [(o-TOL)(CA) 2] have been prepared. The 13C NMR, 1H NMR, 1H-Cosy, and IR show that the charge-transfer chelation occurs via the formation of chain structures O-H⋯N intermolecular hydrogen bond between 2NH 2 groups of o-TOL molecule and OH group in each PA or CA units. Photometric titration measurements concerning the two reactions in methanol were performed and the measurements show that the donor-acceptor molar ratio was found to be 1:2 using the modified Benesi-Hildebrand equation. The spectroscopic data were discussed in terms of formation constant, molar extinction coefficient, oscillator strength, dipole moment, standard free energy, and ionization potential. Thermal behavior of both charge transfer complexes showed that the complexes were more stable than their parents. The thermodynamic parameters were estimated from the differential thermogravimetric curves. The results indicated that the formation of molecular charge transfer complexes is spontaneous and endothermic.

Intermolecular hydrogen bond complexes by in situ charge transfer complexation of o-tolidine with picric and chloranilic acids.

PubMed

Refat, Moamen S; Saad, Hosam A; Adam, Abdel Majid A

2011-08-01

A two new charge transfer complexes formed from the interactions between o-tolidine (o-TOL) and picric (PA) or chloranilic (CA) acids, with the compositions, [(o-TOL)(PA)(2)] and [(o-TOL)(CA)(2)] have been prepared. The (13)C NMR, (1)H NMR, (1)H-Cosy, and IR show that the charge-transfer chelation occurs via the formation of chain structures O-H⋯N intermolecular hydrogen bond between 2NH(2) groups of o-TOL molecule and OH group in each PA or CA units. Photometric titration measurements concerning the two reactions in methanol were performed and the measurements show that the donor-acceptor molar ratio was found to be 1:2 using the modified Benesi-Hildebrand equation. The spectroscopic data were discussed in terms of formation constant, molar extinction coefficient, oscillator strength, dipole moment, standard free energy, and ionization potential. Thermal behavior of both charge transfer complexes showed that the complexes were more stable than their parents. The thermodynamic parameters were estimated from the differential thermogravimetric curves. The results indicated that the formation of molecular charge transfer complexes is spontaneous and endothermic. Copyright © 2011 Elsevier B.V. All rights reserved.

Atomistic Molecular Dynamics Simulations of Charged Latex Particle Surfaces in Aqueous Solution.

PubMed

Li, Zifeng; Van Dyk, Antony K; Fitzwater, Susan J; Fichthorn, Kristen A; Milner, Scott T

2016-01-19

Charged particles in aqueous suspension form an electrical double layer at their surfaces, which plays a key role in suspension properties. For example, binder particles in latex paint remain suspended in the can because of repulsive forces between overlapping double layers. Existing models of the double layer assume sharp interfaces bearing fixed uniform charge, and so cannot describe aqueous binder particle surfaces, which are soft and diffuse, and bear mobile charge from ionic surfactants as well as grafted multivalent oligomers. To treat this industrially important system, we use atomistic molecular dynamics simulations to investigate a structurally realistic model of commercial binder particle surfaces, informed by extensive characterization of particle synthesis and surface properties. We determine the interfacial profiles of polymer, water, bound and free ions, from which the charge density and electrostatic potential can be calculated. We extend the traditional definitions of the inner and outer Helmholtz planes to our diffuse interfaces. Beyond the Stern layer, the simulated electrostatic potential is well described by the Poisson-Boltzmann equation. The potential at the outer Helmholtz plane compares well to the experimental zeta potential. We compare particle surfaces bearing two types of charge groups, ionic surfactant and multivalent oligomers, with and without added salt. Although the bare charge density of a surface bearing multivalent oligomers is much higher than that of a surfactant-bearing surface at realistic coverage, greater counterion condensation leads to similar zeta potentials for the two systems.

Protein-membrane interaction and fatty acid transfer from intestinal fatty acid-binding protein to membranes. Support for a multistep process.

PubMed

Falomir-Lockhart, Lisandro J; Laborde, Lisandro; Kahn, Peter C; Storch, Judith; Córsico, Betina

2006-05-19

Fatty acid transfer from intestinal fatty acid-binding protein (IFABP) to phospholipid membranes occurs during protein-membrane collisions. Electrostatic interactions involving the alpha-helical "portal" region of the protein have been shown to be of great importance. In the present study, the role of specific lysine residues in the alpha-helical region of IFABP was directly examined. A series of point mutants in rat IFABP was engineered in which the lysine positive charges in this domain were eliminated or reversed. Using a fluorescence resonance energy transfer assay, we analyzed the rates and mechanism of fatty acid transfer from wild type and mutant proteins to acceptor membranes. Most of the alpha-helical domain mutants showed slower absolute fatty acid transfer rates to zwitterionic membranes, with substitution of one of the lysines of the alpha2 helix, Lys27, resulting in a particularly dramatic decrease in the fatty acid transfer rate. Sensitivity to negatively charged phospholipid membranes was also reduced, with charge reversal mutants in the alpha2 helix the most affected. The results support the hypothesis that the portal region undergoes a conformational change during protein-membrane interaction, which leads to release of the bound fatty acid to the membrane and that the alpha2 segment is of particular importance in the establishment of charge-charge interactions between IFABP and membranes. Cross-linking experiments with a phospholipid-photoactivable reagent underscored the importance of charge-charge interactions, showing that the physical interaction between wild-type intestinal fatty acid-binding protein and phospholipid membranes is enhanced by electrostatic interactions. Protein-membrane interactions were also found to be enhanced by the presence of ligand, suggesting different collisional complex structures for holo- and apo-IFABP.

Associative charge transfer reactions. Temperature effects and mechanism of the gas-phase polymerization of propene initiated by a benzene radical cation.

PubMed

Ibrahim, Yehia; Meot-Ner Mautner, Michael; El-Shall, M Samy

2006-07-13

In associative charge transfer (ACT) reactions, a core ion activates ligand molecules by partial charge transfer. The activated ligand polymerizes, and the product oligomer takes up the full charge from the core ion. In the present system, benzene(+*) (Bz(+*)) reacts with two propene (Pr) molecules to form a covalently bonded ion, C(6)H(6)(+*) + 2 C(3)H(6) --> C(6)H(12)(+*) + C(6)H(6). The ACT reaction is activated by a partial charge transfer from Bz(+*) to Pr in the complex, and driven to completion by the formation of a covalent bond in the polymerized product. An alternative channel forms a stable association product (Bz.Pr)(+*), with an ACT/association product ratio of 60:40% that is independent of pressure and temperature. In contrast to the Bz(+*)/propene system, ACT polymerization is not observed in the Bz(+*)/ethylene (Et) system since charge transfer in the Bz(+*)(Et) complex is inefficient to activate the reaction. The roles of charge transfer in these complexes are verified by ab initio calculations. The overall reaction of Bz(+*) with Pr follows second-order kinetics with a rate constant of k (304 K) = 2.1 x 10(-12) cm(3) s(-1) and a negative temperature coefficient of k = aT(-5.9) (or an activation energy of -3 kcal/mol). The kinetic behavior is similar to sterically hindered reactions and suggests a [Bz(+*) (Pr)]* activated complex that proceeds to products through a low-entropy transition state. The temperature dependence shows that ACT reactions can reach a unit collision efficiency below 100 K, suggesting that ACT can initiate polymerization in cold astrochemical environments.

Advanced investigation of two-phase charge-coupled devices

NASA Technical Reports Server (NTRS)

Kosonocky, W. F.; Carnes, J. E.

1973-01-01

The performance of experimental two phase, charge-coupled shift registers constructed using polysilicon gates overlapped by aluminum gates was studied. Shift registers with 64, 128, and 500 stages were built and operated. Devices were operated at the maximum clock frequency of 20 MHz. Loss per transfer of less than .0001 was demonstrated for fat zero operation. The effect upon transfer efficiency of various structural and materials parameters was investigated including substrate orientation, resistivity, and conductivity type; channel width and channel length; and method of channel confinement. Operation of the devices with and without fat zero was studied as well as operation in the complete charge transfer mode and the bias charge, or bucket brigade mode.

Development of a Si/ SiO 2-based double quantum dot charge qubit with dispersive microwave readout

NASA Astrophysics Data System (ADS)

House, M. G.; Henry, E.; Schmidt, A.; Naaman, O.; Siddiqi, I.; Pan, H.; Xiao, M.; Jiang, H. W.

2011-03-01

Coupling of a high-Q microwave resonator to superconducting qubits has been successfully used to prepare, manipulate, and read out the state of a single qubit, and to mediate interactions between qubits. Our work is geared toward implementing this architecture in a semiconductor qubit. We present the design and development of a lateral quantum dot in which a superconducting microwave resonator is capacitively coupled to a double dot charge qubit. The device is a silicon MOSFET structure with a global gate which is used to accumulate electrons at a Si/ Si O2 interface. A set of smaller gates are used to deplete these electrons to define a double quantum dot and adjacent conduction channels. Two of these depletion gates connect directly to the conductors of a 6 GHz co-planar stripline resonator. We present measurements of transport and conventional charge sensing used to characterize the double quantum dot, and demonstrate that it is possible to reach the few-electron regime in this system. This work is supported by the DARPA-QuEST program.

Electrostatic Structure and Double-Probe Performance in Tenuous Plasmas

NASA Astrophysics Data System (ADS)

Cully, C. M.; Ergun, R. E.

2006-12-01

Many in-situ plasma instruments are affected by the local electrostatic structure surrounding the spacecraft. In order to better understand this structure, we have developed a fully 3-dimensional self-consistent model that uses realistic spacecraft geometry, including thin (<1 mm) wires and long (>100m) booms, with open boundary conditions. One of the more surprising results is that in tenuous plasmas, the charge on the booms can dominate over the charge on the spacecraft body. For instruments such as electric field double probes and boom-mounted low-energy particle detectors, this challenges the existing paradigm: long booms do not allow the probes to escape the spacecraft potential. Instead, the potential structure simply expands as the boom is deployed. We then apply our model to the double-probe Electric Field and Waves (EFW) instruments on Cluster, and predict the magnitudes of the main error sources. The overall error budget is consistent with experiment, and the model yields some additional interesting insights. We show that the charge in the photoelectron cloud is relatively unimportant, and that the spacecraft potential is typically underestimated by about 20% by double-probe experiments.

Influence of Processing Additives on Charge-Transfer Time Scales and Sound Velocity in Organic Bulk Heterojunction Films.

PubMed

Kaake, Loren G; Welch, Gregory C; Moses, Daniel; Bazan, Guillermo C; Heeger, Alan J

2012-05-17

The role of processing additives in organic bulk heterojunction thin films was investigated by means of transient absorption spectroscopy. The rate of ultrafast charge transfer was found to increase when a small amount of diiodooctane was used during film formation. In addition, coherent acoustic phonons were observed, and their velocity was determined. A strong correlation between the sound velocity and the charge-transfer time scale was observed, both of which could be explained by a subtle increase in thin film density.

Ion-atom charge-transfer reactions and a hot intercloud medium. [in interstellar space

NASA Technical Reports Server (NTRS)

Steigman, G.

1975-01-01

An investigation is conducted concerning the ionization equilibrium of carbon in a hot intercloud medium (ICM), taking into account various charge-transfer reactions. Attention is given to problems related to observations of carbon along the lines of sight to several unreddened stars. It is pointed out that the observed underabundance of C III and overabundance of C I can be consistent with the presence of a hot, partially ionized ICM, provided that two of the charge-transfer reactions considered are rapid at thermal energies.

Interface reconstruction with emerging charge ordering in hexagonal manganite

PubMed Central

Xu, Changsong; Han, Myung-Geun; Bao, Shanyong; Nan, Cewen; Bellaiche, Laurent

2018-01-01

Multiferroic materials, which simultaneously have multiple orderings, hold promise for use in the next generation of memory devices. We report a novel self-assembled MnO double layer forming at the interface between a multiferroic YMnO3 film and a c-Al2O3 substrate. The crystal structures and the valence states of this MnO double layer were studied by atomically resolved scanning transmission electron microscopy and spectroscopy, as well as density functional theory (DFT) calculations. A new type of charge ordering has been identified within this MnO layer, which also contributes to a polarization along the [001] direction. DFT calculations further establish the occurrence of multiple couplings between charge and lattice in this novel double layer, in addition to the polarization in nearby YMnO3 single layer. The interface reconstruction reported here creates a new playground for emergent physics, such as giant ferroelectricity and strong magnetoelectric coupling, in manganite systems. PMID:29795782

Single helically folded aromatic oligoamides that mimic the charge surface of double-stranded B-DNA

NASA Astrophysics Data System (ADS)

Ziach, Krzysztof; Chollet, Céline; Parissi, Vincent; Prabhakaran, Panchami; Marchivie, Mathieu; Corvaglia, Valentina; Bose, Partha Pratim; Laxmi-Reddy, Katta; Godde, Frédéric; Schmitter, Jean-Marie; Chaignepain, Stéphane; Pourquier, Philippe; Huc, Ivan

2018-05-01

Numerous essential biomolecular processes require the recognition of DNA surface features by proteins. Molecules mimicking these features could potentially act as decoys and interfere with pharmacologically or therapeutically relevant protein-DNA interactions. Although naturally occurring DNA-mimicking proteins have been described, synthetic tunable molecules that mimic the charge surface of double-stranded DNA are not known. Here, we report the design, synthesis and structural characterization of aromatic oligoamides that fold into single helical conformations and display a double helical array of negatively charged residues in positions that match the phosphate moieties in B-DNA. These molecules were able to inhibit several enzymes possessing non-sequence-selective DNA-binding properties, including topoisomerase 1 and HIV-1 integrase, presumably through specific foldamer-protein interactions, whereas sequence-selective enzymes were not inhibited. Such modular and synthetically accessible DNA mimics provide a versatile platform to design novel inhibitors of protein-DNA interactions.

Rate of Bubble Coalescence following Quasi-Static Approach: Screening and Neutralization of the Electric Double Layer

PubMed Central

Katsir, Yael; Marmur, Abraham

2014-01-01

Air-bubble coalescence in aqueous electrolytic solutions, following quasi-static approach, was studied in order to understand its slow rate in purified water and high rate in electrolytic solutions. The former is found to be due to surface charges, originating from the speciation of dissolved CO2, which sustain the electric double layer repulsion. Rapid coalescence in electrolytic solutions is shown to occur via two different mechanisms: (1) neutralization of the carbonaceous, charged species by acids; or (2) screening of the repulsive charge effects by salts and bases. The results do not indicate any ion specificity. They can be explained within the DLVO theory for the van der Waals and electric double layer interactions between particles, in contrast to observations of coalescence following dynamic approach. The present conclusions should serve as a reference point to understanding the dynamic behavior. PMID:24589528

Numerical analysis of finite Debye-length effects in induced-charge electro-osmosis.

PubMed

Gregersen, Misha Marie; Andersen, Mathias Baekbo; Soni, Gaurav; Meinhart, Carl; Bruus, Henrik

2009-06-01

For a microchamber filled with a binary electrolyte and containing a flat unbiased center electrode at one wall, we employ three numerical models to study the strength of the resulting induced-charge electro-osmotic (ICEO) flow rolls: (i) a full nonlinear continuum model resolving the double layer, (ii) a linear slip-velocity model not resolving the double layer and without tangential charge transport inside this layer, and (iii) a nonlinear slip-velocity model extending the linear model by including the tangential charge transport inside the double layer. We show that, compared to the full model, the slip-velocity models significantly overestimate the ICEO flow. This provides a partial explanation of the quantitative discrepancy between observed and calculated ICEO velocities reported in the literature. The discrepancy increases significantly for increasing Debye length relative to the electrode size, i.e., for nanofluidic systems. However, even for electrode dimensions in the micrometer range, the discrepancies in velocity due to the finite Debye length can be more than 10% for an electrode of zero height and more than 100% for electrode heights comparable to the Debye length.

Electric field changes on Au nanoparticles on semiconductor supports--the molecular voltmeter and other methods to observe adsorbate-induced charge-transfer effects in Au/TiO2 nanocatalysts.

PubMed

McEntee, Monica; Stevanovic, Ana; Tang, Wenjie; Neurock, Matthew; Yates, John T

2015-02-11

Infrared (IR) studies of Au/TiO2 catalyst particles indicate that charge transfer from van der Waals-bound donor or acceptor molecules on TiO2 to or from Au occurs via transport of charge carriers in the semiconductor TiO2 support. The ΔνCO on Au is shown to be proportional to the polarizability of the TiO2 support fully covered with donor or acceptor molecules, producing a proportional frequency shift in νCO. Charge transfer through TiO2 is associated with the population of electron trap sites in the bandgap of TiO2 and can be independently followed by changes in photoluminescence intensity and by shifts in the broad IR absorbance region for electron trap sites, which is also proportional to the polarizability of donors by IR excitation. Density functional theory calculations show that electron transfer from the donor molecules to TiO2 and to supported Au particles produces a negative charge on the Au, whereas the transfer from the Au particles to the TiO2 support into acceptor molecules results in a positive charge on the Au. These changes along with the magnitudes of the shifts are consistent with the Stark effect. A number of experiments show that the ∼3 nm Au particles act as "molecular voltmeters" in influencing ΔνCO. Insulator particles, such as SiO2, do not display electron-transfer effects to Au particles on their surface. These studies are preliminary to doping studies of semiconductor-oxide particles by metal ions which modify Lewis acid/base oxide properties and possibly strongly modify the electron-transfer and catalytic activity of supported metal catalyst particles.

Role of Au(NPs) in the enhanced response of Au(NPs)-decorated MWCNT electrochemical biosensor

PubMed Central

Mehmood, Shahid; Ciancio, Regina; Carlino, Elvio; Bhatti, Arshad S

2018-01-01

Background The combination of Au-metallic-NPs and CNTs are a new class of hybrid nanomaterials for the development of electrochemical biosensor. Concentration of Au(nanoparticles [NPs]) in the electrochemical biosensor is crucial for the efficient charge transfer between the Au-NPs-MWCNTs modified electrode and electrolytic solution. Methods In this work, the charge transfer kinetics in the glassy carbon electrode (GCE) modified with Au(NPs)–multiwalled carbon nanotube (MWCNT) nanohybrid with varied concentrations of Au(NPs) in the range 40–100 nM was studied using electrochemical impedance spectroscopy (EIS). Field emission scanning electron microscopy and transmission electron microscopy confirmed the attachment of Au(NPs) on the surface of MWCNTs. Results The cyclic voltammetry and EIS results showed that the charge transfer mechanism was diffusion controlled and the rate of charge transfer was dependent on the concentration of Au(NPs) in the nanohybrid. The formation of spherical diffusion zone, which was dependent on the concentration of Au(NPs) in nanohybrids, was attributed to result in 3 times the increase in the charge transfer rate ks, 5 times increase in mass transfer, and 5% (9%) increase in Ipa (Ipc) observed in cyclic voltammetry in 80 nM Au(NP) nanohybrid-modified GCE from MWCNT-modified GCE. The work was extended to probe the effect of charge transfer rates at various concentrations of Au(NPs) in the nanohybrid-modified electrodes in the presence of Escherichia coli. The cyclic voltammetry results clearly showed the best results for 80 nM Au(NPs) in nanohybrid electrode. Conclusion The present study suggested that the formation of spherical diffusion zone in nanohybrid-modified electrodes is critical for the enhanced electrochemical biosensing applications. PMID:29713161

Characterizing the surface charge of synthetic nanomembranes by the streaming potential method

PubMed Central

Datta, Subhra; Conlisk, A. T.; Kanani, Dharmesh M.; Zydney, Andrew L.; Fissell, William H.; Roy, Shuvo

2010-01-01

The inference of the surface charge of polyethylene glycol (PEG)-coated and uncoated silicon membranes with nanoscale pore sizes from streaming potential measurements in the presence of finite electric double layer (EDL) effects is studied theoretically and experimentally. The developed theoretical model for inferring the pore wall surface charge density from streaming potential measurements is applicable to arbitrary pore cross-sectional shapes and accounts for the effect of finite salt concentration on the ionic mobilities and the thickness of the deposited layer of PEG. Theoretical interpretation of the streaming potential data collected from silicon membranes having nanoscale pore sizes, with/without pore wall surface modification with PEG, indicates that finite electric double layer (EDL) effects in the pore-confined electrolyte significantly affect the interpretation of the membrane charge and that surface modification with PEG leads to a reduction in the pore wall surface charge density. The theoretical model is also used to study the relative significance of the following uniquely nanoscale factors affecting the interpretation of streaming potential in moderate to strongly charged pores: altered net charge convection by applied pressure differentials, surface-charge effects on ionic conduction, and electroosmotic convection of charges. PMID:20462592

Charged-pion cross sections and double-helicity asymmetries in polarized p + p collisions at √s = 200 GeV

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adare, A.; Aidala, C.; Ajitanand, N. N.

2015-02-02

We present midrapidity charged-pion invariant cross sections, the ratio of the π⁻ to π⁺ cross sections and the charge-separated double-spin asymmetries in polarized p+p collisions at √s = 200 GeV. While the cross section measurements are consistent within the errors of next-to-leadingorder (NLO) perturbative quantum chromodynamics predictions (pQCD), the same calculations over estimate the ratio of the charged-pion cross sections. This discrepancy arises from the cancellation of the substantial systematic errors associated with the NLO-pQCD predictions in the ratio and highlights the constraints these data will place on flavor dependent pion fragmentation functions. Thus, the charge-separated pion asymmetries presented heremore » sample an x range of ~0.03–0.16 and provide unique information on the sign of the gluon-helicity distribution.« less

Simulation of electric double-layer capacitors: evaluation of constant potential method

NASA Astrophysics Data System (ADS)

Wang, Zhenxing; Laird, Brian; Yang, Yang; Olmsted, David; Asta, Mark

2014-03-01

Atomistic simulations can play an important role in understanding electric double-layer capacitors (EDLCs) at a molecular level. In such simulations, typically the electrode surface is modeled using fixed surface charges, which ignores the charge fluctuation induced by local fluctuations in the electrolyte solution. In this work we evaluate an explicit treatment of charges, namely constant potential method (CPM)[1], in which the electrode charges are dynamically updated to maintain constant electrode potential. We employ a model system with a graphite electrode and a LiClO4/acetonitrile electrolyte, examined as a function of electrode potential differences. Using various molecular and macroscopic properties as metrics, we compare CPM simulations on this system to results using fixed surface charges. Specifically, results for predicted capacity, electric potential gradient and solvent density profile are identical between the two methods; However, ion density profiles and solvation structure yield significantly different results.

Charged-pion cross sections and double-helicity asymmetries in polarized p +p collisions at √{s }=200 GeV

NASA Astrophysics Data System (ADS)

Adare, A.; Aidala, C.; Ajitanand, N. N.; Akiba, Y.; Akimoto, R.; Al-Ta'Ani, H.; Alexander, J.; Andrews, K. R.; Angerami, A.; Aoki, K.; Apadula, N.; Appelt, E.; Aramaki, Y.; Armendariz, R.; Aschenauer, E. C.; Atomssa, E. T.; Awes, T. C.; Azmoun, B.; Babintsev, V.; Bai, M.; Bannier, B.; Barish, K. N.; Bassalleck, B.; Basye, A. T.; Bathe, S.; Baublis, V.; Baumann, C.; Bazilevsky, A.; Belmont, R.; Ben-Benjamin, J.; Bennett, R.; Blau, D. S.; Bok, J. S.; Boyle, K.; Brooks, M. L.; Broxmeyer, D.; Buesching, H.; Bumazhnov, V.; Bunce, G.; Butsyk, S.; Campbell, S.; Castera, P.; Chen, C.-H.; Chi, C. Y.; Chiu, M.; Choi, I. J.; Choi, J. B.; Choudhury, R. K.; Christiansen, P.; Chujo, T.; Chvala, O.; Cianciolo, V.; Citron, Z.; Cole, B. A.; Conesa Del Valle, Z.; Connors, M.; Csanád, M.; Csörgő, T.; Dairaku, S.; Datta, A.; David, G.; Dayananda, M. K.; Denisov, A.; Deshpande, A.; Desmond, E. J.; Dharmawardane, K. V.; Dietzsch, O.; Dion, A.; Donadelli, M.; Drapier, O.; Drees, A.; Drees, K. A.; Durham, J. M.; Durum, A.; D'Orazio, L.; Efremenko, Y. V.; Engelmore, T.; Enokizono, A.; En'yo, H.; Esumi, S.; Fadem, B.; Fields, D. E.; Finger, M.; Finger, M.; Fleuret, F.; Fokin, S. L.; Frantz, J. E.; Franz, A.; Frawley, A. D.; Fukao, Y.; Fusayasu, T.; Gal, C.; Garishvili, I.; Giordano, F.; Glenn, A.; Gong, X.; Gonin, M.; Goto, Y.; Granier de Cassagnac, R.; Grau, N.; Greene, S. V.; Grosse Perdekamp, M.; Gunji, T.; Guo, L.; Gustafsson, H.-Å.; Haggerty, J. S.; Hahn, K. I.; Hamagaki, H.; Hamblen, J.; Han, R.; Hanks, J.; Harper, C.; Hashimoto, K.; Haslum, E.; Hayano, R.; He, X.; Hemmick, T. K.; Hester, T.; Hill, J. C.; Hollis, R. S.; Holzmann, W.; Homma, K.; Hong, B.; Horaguchi, T.; Hori, Y.; Hornback, D.; Huang, S.; Ichihara, T.; Ichimiya, R.; Iinuma, H.; Ikeda, Y.; Imai, K.; Inaba, M.; Iordanova, A.; Isenhower, D.; Ishihara, M.; Issah, M.; Ivanischev, D.; Iwanaga, Y.; Jacak, B. V.; Jia, J.; Jiang, X.; John, D.; Johnson, B. M.; Jones, T.; Joo, K. S.; Jouan, D.; Kamin, J.; Kaneti, S.; Kang, B. H.; Kang, J. H.; Kang, J. S.; Kapustinsky, J.; Karatsu, K.; Kasai, M.; Kawall, D.; Kazantsev, A. V.; Kempel, T.; Khanzadeev, A.; Kijima, K. M.; Kim, B. I.; Kim, D. J.; Kim, E.-J.; Kim, Y.-J.; Kim, Y. K.; Kinney, E.; Kiss, Á.; Kistenev, E.; Kleinjan, D.; Kline, P.; Kochenda, L.; Komkov, B.; Konno, M.; Koster, J.; Kotov, D.; Král, A.; Kunde, G. J.; Kurita, K.; Kurosawa, M.; Kwon, Y.; Kyle, G. S.; Lacey, R.; Lai, Y. S.; Lajoie, J. G.; Lebedev, A.; Lee, D. M.; Lee, J.; Lee, K. B.; Lee, K. S.; Lee, S. H.; Lee, S. R.; Leitch, M. J.; Leite, M. A. L.; Li, X.; Lim, S. H.; Linden Levy, L. A.; Liu, H.; Liu, M. X.; Love, B.; Lynch, D.; Maguire, C. F.; Makdisi, Y. I.; Manion, A.; Manko, V. I.; Mannel, E.; Mao, Y.; Masui, H.; McCumber, M.; McGaughey, P. L.; McGlinchey, D.; McKinney, C.; Means, N.; Mendoza, M.; Meredith, B.; Miake, Y.; Mibe, T.; Mignerey, A. C.; Miki, K.; Milov, A.; Mitchell, J. T.; Miyachi, Y.; Mohanty, A. K.; Moon, H. J.; Morino, Y.; Morreale, A.; Morrison, D. P.; Motschwiller, S.; Moukhanova, T. V.; Murakami, T.; Murata, J.; Nagamiya, S.; Nagle, J. L.; Naglis, M.; Nagy, M. I.; Nakagawa, I.; Nakamiya, Y.; Nakamura, K. R.; Nakamura, T.; Nakano, K.; Newby, J.; Nguyen, M.; Nihashi, M.; Nouicer, R.; Nyanin, A. S.; Oakley, C.; O'Brien, E.; Ogilvie, C. A.; Oka, M.; Okada, K.; Oskarsson, A.; Ouchida, M.; Ozawa, K.; Pak, R.; Pantuev, V.; Papavassiliou, V.; Park, B. H.; Park, I. H.; Park, S. K.; Pate, S. F.; Patel, L.; Pei, H.; Peng, J.-C.; Pereira, H.; Peressounko, D. Yu.; Petti, R.; Pinkenburg, C.; Pisani, R. P.; Proissl, M.; Purschke, M. L.; Qu, H.; Rak, J.; Ravinovich, I.; Read, K. F.; Reygers, K.; Riabov, V.; Riabov, Y.; Richardson, E.; Roach, D.; Roche, G.; Rolnick, S. D.; Rosati, M.; Rosendahl, S. S. E.; Rubin, J. G.; Sahlmueller, B.; Saito, N.; Sakaguchi, T.; Samsonov, V.; Sano, S.; Sarsour, M.; Sato, T.; Savastio, M.; Sawada, S.; Sedgwick, K.; Seidl, R.; Seto, R.; Sharma, D.; Shein, I.; Shibata, T.-A.; Shigaki, K.; Shim, H. H.; Shimomura, M.; Shoji, K.; Shukla, P.; Sickles, A.; Silva, C. L.; Silvermyr, D.; Silvestre, C.; Sim, K. S.; Singh, B. K.; Singh, C. P.; Singh, V.; Slunečka, M.; Sodre, T.; Soltz, R. A.; Sondheim, W. E.; Sorensen, S. P.; Sourikova, I. V.; Stankus, P. W.; Stenlund, E.; Stoll, S. P.; Sugitate, T.; Sukhanov, A.; Sun, J.; Sziklai, J.; Takagui, E. M.; Takahara, A.; Taketani, A.; Tanabe, R.; Tanaka, Y.; Taneja, S.; Tanida, K.; Tannenbaum, M. J.; Tarafdar, S.; Taranenko, A.; Tennant, E.; Themann, H.; Thomas, D.; Togawa, M.; Tomášek, L.; Tomášek, M.; Torii, H.; Towell, R. S.; Tserruya, I.; Tsuchimoto, Y.; Utsunomiya, K.; Vale, C.; van Hecke, H. W.; Vazquez-Zambrano, E.; Veicht, A.; Velkovska, J.; Vértesi, R.; Virius, M.; Vossen, A.; Vrba, V.; Vznuzdaev, E.; Wang, X. R.; Watanabe, D.; Watanabe, K.; Watanabe, Y.; Watanabe, Y. S.; Wei, F.; Wei, R.; Wessels, J.; White, S. N.; Winter, D.; Woody, C. L.; Wright, R. M.; Wysocki, M.; Yamaguchi, Y. L.; Yang, R.; Yanovich, A.; Ying, J.; Yokkaichi, S.; Yoo, J. S.; You, Z.; Young, G. R.; Younus, I.; Yushmanov, I. E.; Zajc, W. A.; Zelenski, A.; Zhou, S.; Phenix Collaboration

2015-02-01

We present midrapidity charged-pion invariant cross sections, the ratio of the π- to π+ cross sections and the charge-separated double-spin asymmetries in polarized p +p collisions at √{s }=200 GeV . While the cross section measurements are consistent within the errors of next-to-leading-order (NLO) perturbative quantum chromodynamics predictions (pQCD), the same calculations overestimate the ratio of the charged-pion cross sections. This discrepancy arises from the cancellation of the substantial systematic errors associated with the NLO-pQCD predictions in the ratio and highlights the constraints these data will place on flavor-dependent pion fragmentation functions. The charge-separated pion asymmetries presented here sample an x range of ˜0.03 - 0.16 and provide unique information on the sign of the gluon-helicity distribution.

Charge transfer in dissociating iodomethane and fluoromethane molecules ionized by intense femtosecond X-ray pulses

PubMed Central

Boll, Rebecca; Erk, Benjamin; Coffee, Ryan; Trippel, Sebastian; Kierspel, Thomas; Bomme, Cédric; Bozek, John D.; Burkett, Mitchell; Carron, Sebastian; Ferguson, Ken R.; Foucar, Lutz; Küpper, Jochen; Marchenko, Tatiana; Miron, Catalin; Patanen, Minna; Osipov, Timur; Schorb, Sebastian; Simon, Marc; Swiggers, Michelle; Techert, Simone; Ueda, Kiyoshi; Bostedt, Christoph; Rolles, Daniel; Rudenko, Artem

2016-01-01

Ultrafast electron transfer in dissociating iodomethane and fluoromethane molecules was studied at the Linac Coherent Light Source free-electron laser using an ultraviolet-pump, X-ray-probe scheme. The results for both molecules are discussed with respect to the nature of their UV excitation and different chemical properties. Signatures of long-distance intramolecular charge transfer are observed for both species, and a quantitative analysis of its distance dependence in iodomethane is carried out for charge states up to I21+. The reconstructed critical distances for electron transfer are in good agreement with a classical over-the-barrier model and with an earlier experiment employing a near-infrared pump pulse. PMID:27051675

Laboratory Studies of Thermal Energy Charge Transfer of Multiply Charged Ions in Astrophysical Plasmas

NASA Technical Reports Server (NTRS)

Kwong, Victor H. S.

2003-01-01

The laser ablation/ion storage facility at the UNLV Physics Department has been dedicated to the study of atomic and molecular processes in low temperature plasmas. Our program focuses on the charge transfer (electron capture) of multiply charged ions and neutrals important in astrophysics. The electron transfer reactions with atoms and molecules is crucial to the ionization condition of neutral rich photoionized plasmas. With the successful deployment of the Far Ultraviolet Spectroscopic Explorer (FUSE) and the Chandra X-ray Observatory by NASA high resolution VUV and X-ray emission spectra fiom various astrophysical objects have been collected. These spectra will be analyzed to determine the source of the emission and the chemical and physical environment of the source. The proper interpretation of these spectra will require complete knowledge of all the atomic processes in these plasmas. In a neutral rich environment, charge transfer can be the dominant process. The rate coefficients need to be known accurately. We have also extended our charge transfer measurements to KeV region with a pulsed ion beam. The inclusion of this facility into our current program provides flexibility in extending the measurement to higher energies (KeV) if needed. This flexibility enables us to address issues of immediate interest to the astrophysical community as new observations are made by high resolution space based observatories.

Charge Transfer Reactions

NASA Astrophysics Data System (ADS)

Dennerl, Konrad

2010-12-01

Charge transfer, or charge exchange, describes a process in which an ion takes one or more electrons from another atom. Investigations of this fundamental process have accompanied atomic physics from its very beginning, and have been extended to astrophysical scenarios already many decades ago. Yet one important aspect of this process, i.e. its high efficiency in generating X-rays, was only revealed in 1996, when comets were discovered as a new class of X-ray sources. This finding has opened up an entirely new field of X-ray studies, with great impact due to the richness of the underlying atomic physics, as the X-rays are not generated by hot electrons, but by ions picking up electrons from cold gas. While comets still represent the best astrophysical laboratory for investigating the physics of charge transfer, various studies have already spotted a variety of other astrophysical locations, within and beyond our solar system, where X-rays may be generated by this process. They range from planetary atmospheres, the heliosphere, the interstellar medium and stars to galaxies and clusters of galaxies, where charge transfer may even be observationally linked to dark matter. This review attempts to put the various aspects of the study of charge transfer reactions into a broader historical context, with special emphasis on X-ray astrophysics, where the discovery of cometary X-ray emission may have stimulated a novel look at our universe.

A simple model of solvent-induced symmetry-breaking charge transfer in excited quadrupolar molecules

NASA Astrophysics Data System (ADS)

Ivanov, Anatoly I.; Dereka, Bogdan; Vauthey, Eric

2017-04-01

A simple model has been developed to describe the symmetry-breaking of the electronic distribution of AL-D-AR type molecules in the excited state, where D is an electron donor and AL and AR are identical acceptors. The origin of this process is usually associated with the interaction between the molecule and the solvent polarization that stabilizes an asymmetric and dipolar state, with a larger charge transfer on one side than on the other. An additional symmetry-breaking mechanism involving the direct Coulomb interaction of the charges on the acceptors is proposed. At the same time, the electronic coupling between the two degenerate states, which correspond to the transferred charge being localised either on AL or AR, favours a quadrupolar excited state with equal amount of charge-transfer on both sides. Because of these counteracting effects, symmetry breaking is only feasible when the electronic coupling remains below a threshold value, which depends on the solvation energy and the Coulomb repulsion energy between the charges located on AL and AR. This model allows reproducing the solvent polarity dependence of the symmetry-breaking reported recently using time-resolved infrared spectroscopy.

Organic Solar Cells: Understanding the Role of Förster Resonance Energy Transfer

PubMed Central

Feron, Krishna; Belcher, Warwick J.; Fell, Christopher J.; Dastoor, Paul C.

2012-01-01

Organic solar cells have the potential to become a low-cost sustainable energy source. Understanding the photoconversion mechanism is key to the design of efficient organic solar cells. In this review, we discuss the processes involved in the photo-electron conversion mechanism, which may be subdivided into exciton harvesting, exciton transport, exciton dissociation, charge transport and extraction stages. In particular, we focus on the role of energy transfer as described by Förster resonance energy transfer (FRET) theory in the photoconversion mechanism. FRET plays a major role in exciton transport, harvesting and dissociation. The spectral absorption range of organic solar cells may be extended using sensitizers that efficiently transfer absorbed energy to the photoactive materials. The limitations of Förster theory to accurately calculate energy transfer rates are discussed. Energy transfer is the first step of an efficient two-step exciton dissociation process and may also be used to preferentially transport excitons to the heterointerface, where efficient exciton dissociation may occur. However, FRET also competes with charge transfer at the heterointerface turning it in a potential loss mechanism. An energy cascade comprising both energy transfer and charge transfer may aid in separating charges and is briefly discussed. Considering the extent to which the photo-electron conversion efficiency is governed by energy transfer, optimisation of this process offers the prospect of improved organic photovoltaic performance and thus aids in realising the potential of organic solar cells. PMID:23235328

Delocalization Drives Free Charge Generation in Conjugated Polymer Films

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pace, Natalie A.; Reid, Obadiah G.; Rumbles, Garry

We demonstrate that the product of photoinduced electron transfer between a conjugated polymer host and a dilute molecular sensitizer is controlled by the structural state of the polymer. Ordered semicrystalline solids exhibit free charge generation, while disordered polymers in the melt phase do not. We use photoluminescence (PL) and time-resolved microwave conductivity (TRMC) measurements to sweep through polymer melt transitions in situ. Free charge generation measured by TRMC turns off upon melting, whereas PL quenching of the molecular sensitizers remains constant, implying unchanged electron transfer efficiency. The key difference is the intermolecular order of the polymer host in the solidmore » state compared to the melt. We propose that this order-disorder transition modulates the localization length of the initial charge-transfer state, which controls the probability of free charge formation.« less

Delocalization Drives Free Charge Generation in Conjugated Polymer Films

DOE PAGES

Pace, Natalie A.; Reid, Obadiah G.; Rumbles, Garry

2018-02-19

We demonstrate that the product of photoinduced electron transfer between a conjugated polymer host and a dilute molecular sensitizer is controlled by the structural state of the polymer. Ordered semicrystalline solids exhibit free charge generation, while disordered polymers in the melt phase do not. We use photoluminescence (PL) and time-resolved microwave conductivity (TRMC) measurements to sweep through polymer melt transitions in situ. Free charge generation measured by TRMC turns off upon melting, whereas PL quenching of the molecular sensitizers remains constant, implying unchanged electron transfer efficiency. The key difference is the intermolecular order of the polymer host in the solidmore » state compared to the melt. We propose that this order-disorder transition modulates the localization length of the initial charge-transfer state, which controls the probability of free charge formation.« less

46 CFR 153.957 - Persons in charge of transferring liquid cargo in bulk or cleaning cargo tanks.

Code of Federal Regulations, 2014 CFR

2014-10-01

... SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SHIPS CARRYING BULK LIQUID, LIQUEFIED GAS, OR COMPRESSED GAS HAZARDOUS MATERIALS Operations Cargo Transfer Procedures § 153.957 Persons in charge of...

46 CFR 153.957 - Persons in charge of transferring liquid cargo in bulk or cleaning cargo tanks.

Code of Federal Regulations, 2010 CFR

2010-10-01

... SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SHIPS CARRYING BULK LIQUID, LIQUEFIED GAS, OR COMPRESSED GAS HAZARDOUS MATERIALS Operations Cargo Transfer Procedures § 153.957 Persons in charge of...

46 CFR 153.957 - Persons in charge of transferring liquid cargo in bulk or cleaning cargo tanks.

Code of Federal Regulations, 2013 CFR

2013-10-01

... SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SHIPS CARRYING BULK LIQUID, LIQUEFIED GAS, OR COMPRESSED GAS HAZARDOUS MATERIALS Operations Cargo Transfer Procedures § 153.957 Persons in charge of...

46 CFR 153.957 - Persons in charge of transferring liquid cargo in bulk or cleaning cargo tanks.

Code of Federal Regulations, 2012 CFR

2012-10-01

... SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SHIPS CARRYING BULK LIQUID, LIQUEFIED GAS, OR COMPRESSED GAS HAZARDOUS MATERIALS Operations Cargo Transfer Procedures § 153.957 Persons in charge of...

46 CFR 153.957 - Persons in charge of transferring liquid cargo in bulk or cleaning cargo tanks.

Code of Federal Regulations, 2011 CFR

2011-10-01

... SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SHIPS CARRYING BULK LIQUID, LIQUEFIED GAS, OR COMPRESSED GAS HAZARDOUS MATERIALS Operations Cargo Transfer Procedures § 153.957 Persons in charge of...

Polyoxometalate active charge-transfer material for mediated redox flow battery

DOEpatents

Anderson, Travis Mark; Hudak, Nicholas; Staiger, Chad; Pratt, Harry

2017-01-17

Redox flow batteries including a half-cell electrode chamber coupled to a current collecting electrode are disclosed herein. In a general embodiment, a separator is coupled to the half-cell electrode chamber. The half-cell electrode chamber comprises a first redox-active mediator and a second redox-active mediator. The first redox-active mediator and the second redox-active mediator are circulated through the half-cell electrode chamber into an external container. The container includes an active charge-transfer material. The active charge-transfer material has a redox potential between a redox potential of the first redox-active mediator and a redox potential of the second redox-active mediator. The active charge-transfer material is a polyoxometalate or derivative thereof. The redox flow battery may be particularly useful in energy storage solutions for renewable energy sources and for providing sustained power to an electrical grid.

Ab initio treatment of ion-induced charge transfer dynamics of isolated 2-deoxy-D-ribose.

PubMed

Bacchus-Montabonel, Marie-Christine

2014-08-21

Modeling-induced radiation damage in biological systems, in particular, in DNA building blocks, is of major concern in cancer therapy studies. Ion-induced charge-transfer dynamics may indeed be involved in proton and hadrontherapy treatments. We have thus performed a theoretical approach of the charge-transfer dynamics in collision of C(4+) ions and protons with isolated 2-deoxy-D-ribose in a wide collision energy range by means of ab initio quantum chemistry molecular methods. The comparison of both projectile ions has been performed with regard to previous theoretical and experimental results. The charge transfer appears markedly less efficient with the 2-deoxy-D-ribose target than that with pyrimidine nucleobases, which would induce an enhancement of the fragmentation process in agreement with experimental measurements. The mechanism has been analyzed with regard to inner orbital excitations, and qualitative tendencies have been pointed out for studies on DNA buiding block damage.

Designing a Spin-one Mott Insulator: Complete Charge Transfer in Nickelate-Titanate Heterostructures

NASA Astrophysics Data System (ADS)

Chen, Hanghui; Marianetti, Chris; Millis, Andrew

2013-03-01

Ab initio calculations are performed to show that complete charge transfer may occur from the TiO2 to the NiO2 layers in (LaTiO3)1/(LaNiO3)1 superlattices. Although the two component materials are an S = 1 / 2 Mott insulator and a weakly correlated paramagnetic metal, strong correlation effects on Ni d states can render the superlattice an unusual S = 1 charge transfer insulator, with the Ti- d band empty, the Ni in the d8 state and the oxygen bands filled. The charge transfer gap is set by the Ti/Ni d level splitting. Magnetic, photoemission and x-ray scattering experiments are suggested to test the theory. The results show that heterostructuring can lead to very high levels of electron doping of oxides. This research was supported by the Army Research Office under ARO-Ph 56032 and DOE-ER-046169.

Engineering the Charge Transfer in all 2D Graphene-Nanoplatelets Heterostructure Photodetectors

PubMed Central

Robin, A.; Lhuillier, E.; Xu, X. Z.; Ithurria, S.; Aubin, H.; Ouerghi, A.; Dubertret, B.

2016-01-01

Two dimensional layered (i.e. van der Waals) heterostructures open up great prospects, especially in photodetector applications. In this context, the control of the charge transfer between the constituting layers is of crucial importance. Compared to bulk or 0D system, 2D materials are characterized by a large exciton binding energy (0.1–1 eV) which considerably affects the magnitude of the charge transfer. Here we investigate a model system made from colloidal 2D CdSe nanoplatelets and epitaxial graphene in a phototransistor configuration. We demonstrate that using a heterostructured layered material, we can tune the magnitude and the direction (i.e. electron or hole) of the charge transfer. We further evidence that graphene functionalization by nanocrystals only leads to a limited change in the magnitude of the 1/f noise. These results draw some new directions to design van der Waals heterostructures with enhanced optoelectronic properties. PMID:27143413

Oxygen vacancies promoted interfacial charge carrier transfer of CdS/ZnO heterostructure for photocatalytic hydrogen generation.

PubMed

Xie, Ying Peng; Yang, Yongqiang; Wang, Guosheng; Liu, Gang

2017-10-01

The solid-state Z-scheme trinary/binary heterostructures show the advantage of utilizing the high-energy photogenerated charge carriers in photocatalysis. However, the key factors controlling such Z-scheme in the binary heterostructures are still unclear. In this paper, we showed that oxygen vacancies could act as an interface electron transfer mediator to promote the direct Z-scheme charge transfer process in binary semiconductor heterostructures of CdS/ZnS. Increasing the concentration of surface oxygen vacancies of ZnO crystal can greatly enhance photocatalytic hydrogen generation of CdS/ZnO heterostructure. This was attributed to the strengthened direct Z-scheme charge transfer process in CdS/ZnO, as evidenced by steady-state/time-resolved photoluminescence spectroscopy and selective photodeposition of metal particles on the heterostructure. Copyright © 2017 Elsevier Inc. All rights reserved.

Metal-to-metal charge transfer transitions - Interpretation of visible-region spectra of the moon and lunar materials

NASA Technical Reports Server (NTRS)

Loeffler, B. M.; Burns, R. G.; Tossell, J. A.

1975-01-01

Prominent bands in the spectral profiles of Fe-Ti phases in lunar samples have been attributed to charge-transfer transitions between Fe and Ti cations, and a model is presented for calculating charge transfer energies from energy levels computed by the SCF-X(alpha) scattered wave molecular orbital method for isolated MO6 octahedral coordination clusters containing Fe(2+), Fe(3+), Ti(3+), and Ti(4+) cations. The calculated charge transfer energy for the Fe(2+) to Ti(4+) transition correlates well with a measured spectral feature around 0.6 micron in ilmenite, and, since ilmenite is a major constituent of mare basalts and dark-mantling material, the observed darkness and blueness of the regolith in lunar black spots is attributed primarily to this transition. The Ti(3+) to Ti(4+) transition is thought to contribute to some phases.

Atomic charge transfer-counter polarization effects determine infrared CH intensities of hydrocarbons: a quantum theory of atoms in molecules model.

PubMed

Silva, Arnaldo F; Richter, Wagner E; Meneses, Helen G C; Bruns, Roy E

2014-11-14

Atomic charge transfer-counter polarization effects determine most of the infrared fundamental CH intensities of simple hydrocarbons, methane, ethylene, ethane, propyne, cyclopropane and allene. The quantum theory of atoms in molecules/charge-charge flux-dipole flux model predicted the values of 30 CH intensities ranging from 0 to 123 km mol(-1) with a root mean square (rms) error of only 4.2 km mol(-1) without including a specific equilibrium atomic charge term. Sums of the contributions from terms involving charge flux and/or dipole flux averaged 20.3 km mol(-1), about ten times larger than the average charge contribution of 2.0 km mol(-1). The only notable exceptions are the CH stretching and bending intensities of acetylene and two of the propyne vibrations for hydrogens bound to sp hybridized carbon atoms. Calculations were carried out at four quantum levels, MP2/6-311++G(3d,3p), MP2/cc-pVTZ, QCISD/6-311++G(3d,3p) and QCISD/cc-pVTZ. The results calculated at the QCISD level are the most accurate among the four with root mean square errors of 4.7 and 5.0 km mol(-1) for the 6-311++G(3d,3p) and cc-pVTZ basis sets. These values are close to the estimated aggregate experimental error of the hydrocarbon intensities, 4.0 km mol(-1). The atomic charge transfer-counter polarization effect is much larger than the charge effect for the results of all four quantum levels. Charge transfer-counter polarization effects are expected to also be important in vibrations of more polar molecules for which equilibrium charge contributions can be large.

Intramolecular charge transfer of 4-(dimethylamino)benzonitrile probed by time-resolved fluorescence and transient absorption: No evidence for two ICT states and a {pi}{sigma}{sup *} reaction intermediate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zachariasse, Klaas A.; Druzhinin, Sergey I.; Senyushkina, Tamara

2009-12-14

For the double exponential fluorescence decays of the locally excited (LE) and intramolecular charge transfer (ICT) states of 4-(dimethylamino)benzonitrile (DMABN) in acetonitrile (MeCN) the same times {tau}{sub 1} and {tau}{sub 2} are observed. This means that the reversible LE<-->ICT reaction, starting from the initially excited LE state, can be adequately described by a two state mechanism. The most important factor responsible for the sometimes experimentally observed differences in the nanosecond decay time, with {tau}{sub 1}(LE)<{tau}{sub 1}(ICT), is photoproduct formation. By employing a global analysis of the LE and ICT fluorescence response functions with a time resolution of 0.5 ps/channel inmore » 1200 channels reliable kinetic and thermodynamic data can be obtained. The arguments presented in the literature in favor of a {pi}{sigma}* state with a bent CN group as an intermediate in the ICT reaction of DMABN are discussed. From the appearance of an excited state absorption (ESA) band in the spectral region between 700 and 800 nm in MeCN for N,N-dimethylanilines with CN, Br, F, CF{sub 3}, and C(=O)OC{sub 2}H{sub 2} p-substituents, it is concluded that this ESA band cannot be attributed to a {pi}{sigma}{sup *} state, as only the C-C{identical_to}N group can undergo the required 120 deg. bending.« less

Theoretical studies of the nucleophilic substitution of halides and amine at a sulfonyl center.

PubMed

Sung, Dae Dong; Kim, Tae Joon; Lee, Ikchoon

2009-06-25

Gas-phase nucleophilic substitution reactions, F(-) + CH(3)SO(2)F, Cl(-) + CH(3)SO(2)Cl, Cl(-) + CH(3)SO(2)F, and NH(3) + CH(3)SO(2)Cl, have been investigated at the B3LYP/6-311+G** and MP2/6-31+G* levels of theory. A very shallow well for the reaction intermediate in a triple-well potential energy surface (PES) was observed for the identity fluoride exchange, but double well PESs were obtained for the other three reactions with three different PES profiles. NBO analyses of the transition states showed substantial charge transfer interactions in all cases which provided a much larger amount of stabilization energy compared with the corresponding species at the carbon center of methyl halides. This difference is primarily caused by the strong electropositive nature of the sulfur center. The F-S-F axial linkage in the distorted TBP type intermediate in the identity fluoride exchange reaction exhibited a weak three-center, four-electron omega-bonding, which is considered to provide stability of the intermediate. All the reactant (RC) and product complexes (PC) have Cs symmetry. The symmetry plane bisects angles HCH (of methyl group), OSO (of sulfonyl group), and HNH (of ammonia). Vicinal charge transfer interactions between the two out-of-plane C-H, S-O, and N-H bonds provide extra stabilization to the ion-dipole complexes together with H-bond formation of in-plane H atom with the nucleophile and/or leaving group.

Radiative double electron capture in collisions of fully-stripped fluorine ions with thin carbon foils

NASA Astrophysics Data System (ADS)

Elkafrawy, Tamer Mohammad Samy

Radiative double electron capture (RDEC) is a one-step process in ion-atom collisions occurring when two target electrons are captured to a bound state of the projectile simultaneously with the emission of a single photon. The emitted photon has approximately double the energy of the photon emitted due to radiative electron capture (REC), which occurs when a target electron is captured to a projectile bound state with simultaneous emission of a photon. REC and RDEC can be treated as time-reversed photoionization (PI) and double photoionization (DPI), respectively, if loosely-bound target electrons are captured. This concept can be formulated with the principle of detailed balance, in which the processes of our interest can be described in terms of their time-reversed ones. Fully-stripped ions were used as projectiles in the performed RDEC experiments, providing a recipient system free of electron-related Coulomb fields. This allows the target electrons to be transferred without interaction with any of the projectile electrons, enabling accurate investigation of the electron-electron interaction in the vicinity of electromagnetic field. In this dissertation, RDEC was investigated during the collision of fully-stripped fluorine ions with a thin carbon foil and the results are compared with the recent experimental and theoretical studies. In the current work, x rays associated with projectile charge-changing by single and double electron capture and no charge change by F9+ ions were observed and compared with recent work for O8+ ions and with theory. Both the F 9+ and O8+ ions had energies in the ˜MeV/u range. REC, in turn, was investigated as a means to compare with the theoretical predictions of the RDEC/REC cross section ratio. The most significant background processes including various mechanisms of x-ray emission that may interfere with the energy region of interest are addressed in detail. This enables isolation of the contributions of REC and RDEC from the entire continuous spectrum of x-ray emission or at least ensures that the background processes have negligible contribution to the energy range of interest. Special emphasis is given to showing how the data analysis was carried out by the subtraction of the x rays due to contamination lines.

A multi-state fragment charge difference approach for diabatic states in electron transfer: Extension and automation

NASA Astrophysics Data System (ADS)

Yang, Chou-Hsun; Hsu, Chao-Ping

2013-10-01

The electron transfer (ET) rate prediction requires the electronic coupling values. The Generalized Mulliken-Hush (GMH) and Fragment Charge Difference (FCD) schemes have been useful approaches to calculate ET coupling from an excited state calculation. In their typical form, both methods use two eigenstates in forming the target charge-localized diabatic states. For problems involve three or four states, a direct generalization is possible, but it is necessary to pick and assign the locally excited or charge-transfer states involved. In this work, we generalize the 3-state scheme for a multi-state FCD without the need of manual pick or assignment for the states. In this scheme, the diabatic states are obtained separately in the charge-transfer or neutral excited subspaces, defined by their eigenvalues in the fragment charge-difference matrix. In each subspace, the Hamiltonians are diagonalized, and there exist off-diagonal Hamiltonian matrix elements between different subspaces, particularly the charge-transfer and neutral excited diabatic states. The ET coupling values are obtained as the corresponding off-diagonal Hamiltonian matrix elements. A similar multi-state GMH scheme can also be developed. We test the new multi-state schemes for the performance in systems that have been studied using more than two states with FCD or GMH. We found that the multi-state approach yields much better charge-localized states in these systems. We further test for the dependence on the number of state included in the calculation of ET couplings. The final coupling values are converged when the number of state included is increased. In one system where experimental value is available, the multi-state FCD coupling value agrees better with the previous experimental result. We found that the multi-state GMH and FCD are useful when the original two-state approach fails.

Charge transfer during individual collisions in ice growing by riming

NASA Technical Reports Server (NTRS)

Avila, Eldo E.; Caranti, Giorgio M.

1991-01-01

The charging of a target by riming in the wind was studied in the temperature range of (-10, -18 C). For each temperature, charge transfers of both signs are observed and, according to the environmental conditions, one of them prevails. The charge is more positive as the liquid water concentration is increased at any particular temperature. It is found that even at the low impact velocities used (5 m/s) there is abundant evidence of fragmentation following the collision.

Efficiently accounting for ion correlations in electrokinetic nanofluidic devices using density functional theory.

PubMed

Gillespie, Dirk; Khair, Aditya S; Bardhan, Jaydeep P; Pennathur, Sumita

2011-07-15

The electrokinetic behavior of nanofluidic devices is dominated by the electrical double layers at the device walls. Therefore, accurate, predictive models of double layers are essential for device design and optimization. In this paper, we demonstrate that density functional theory (DFT) of electrolytes is an accurate and computationally efficient method for computing finite ion size effects and the resulting ion-ion correlations that are neglected in classical double layer theories such as Poisson-Boltzmann. Because DFT is derived from liquid-theory thermodynamic principles, it is ideal for nanofluidic systems with small spatial dimensions, high surface charge densities, high ion concentrations, and/or large ions. Ion-ion correlations are expected to be important in these regimes, leading to nonlinear phenomena such as charge inversion, wherein more counterions adsorb at the wall than is necessary to neutralize its surface charge, leading to a second layer of co-ions. We show that DFT, unlike other theories that do not include ion-ion correlations, can predict charge inversion and other nonlinear phenomena that lead to qualitatively different current densities and ion velocities for both pressure-driven and electro-osmotic flows. We therefore propose that DFT can be a valuable modeling and design tool for nanofluidic devices as they become smaller and more highly charged. Copyright © 2011 Elsevier Inc. All rights reserved.

Charge exchange molecular ion source

DOEpatents

Vella, Michael C.

2003-06-03

Ions, particularly molecular ions with multiple dopant nucleons per ion, are produced by charge exchange. An ion source contains a minimum of two regions separated by a physical barrier and utilizes charge exchange to enhance production of a desired ion species. The essential elements are a plasma chamber for production of ions of a first species, a physical separator, and a charge transfer chamber where ions of the first species from the plasma chamber undergo charge exchange or transfer with the reactant atom or molecules to produce ions of a second species. Molecular ions may be produced which are useful for ion implantation.

Direct Observation of Charge Transfer at a MgO(111) Surface

NASA Astrophysics Data System (ADS)

Subramanian, A.; Marks, L. D.; Warschkow, O.; Ellis, D. E.

2004-01-01

Transmission electron diffraction (TED) combined with direct methods have been used to study the √(3)×√(3)R30° reconstruction on the polar (111) surface of MgO and refine the valence charge distribution. The surface is nonstoichiometric and is terminated by a single magnesium atom. A charge-compensating electron hole is localized in the next oxygen layer and there is a nominal charge transfer from the oxygen atoms to the top magnesium atom. The partial charges that we obtain for the surface atoms are in reasonable agreement with empirical bond-valence estimations.

The study of surface acoustic wave charge transfer device

NASA Technical Reports Server (NTRS)

Papanicolaou, N.; Lin, H. C.

1978-01-01

A surface acoustic wave-charge transfer device, consisting of an n-type silicon substrate, a thermally grown silicon dioxide layer, and a sputtered film of piezoelectric zinc oxide is proposed as a means of circumventing problems associated with charge-coupled device (CCD) applications in memory, signal processing, and imaging. The proposed device creates traveling longitudinal electric fields in the silicon and replaces the multiphase clocks in CCD's. The traveling electric fields create potential wells which carry along charges stored there. These charges may be injected into the wells by light or by using a p-n junction as in conventional CCD's.

The photophysical properties of 1H-pyrazolo[3,4-b]quinoxalines derivatives and their possible optoelectronic application

NASA Astrophysics Data System (ADS)

Uchacz, Tomasz; Wojtasik, Katarzyna; Szlachcic, Paweł; Gondek, Ewa; Pokladko-Kowar, Monika; Danel, Andrzej; Stadnicka, Katarzyna

2018-06-01

In the manuscript, photophysical, electrochemical and electroluminescent properties of the series of phenyl/methyl substituted 1H-pyrazolo[3,4-b]quinoxalines have been investigated. The fluorescent properties of these compounds varied significantly depending on the presence of phenyl substituent and its position in the molecule. Compared with the 1,3-dimethylpyrazoloquinoxaline (parent molecule), phenyl at the third position of pyrazole ring enhanced the fluorescence by increasing contribution of π-π* transitions, whereas 1-phenyl substituent led to the formation of polarity-dependent charge transfer state. The molecules were also tested as potential luminophores in double layer OLED devices fabricated by solution processing techniques. The investigated pyrazoloquinoxaline based OLED's emitted green light with appreciable brightness up to 2820 cd/m2.

An abnormally slow proton transfer reaction in a simple HBO derivative due to ultrafast intramolecular-charge transfer events.

PubMed

Alarcos, Noemí; Gutierrez, Mario; Liras, Marta; Sánchez, Félix; Douhal, Abderrazzak

2015-07-07

We report on the steady-state, picosecond and femtosecond time-resolved studies of a charge and proton transfer dye 6-amino-2-(2'-hydroxyphenyl)benzoxazole (6A-HBO) and its methylated derivative 6-amino-2-(2'-methoxyphenyl)benzoxazole (6A-MBO), in different solvents. With femtosecond resolution and comparison with the photobehaviour of 6A-MBO, we demonstrate for 6A-HBO in solution, the photoproduction of an intramolecular charge-transfer (ICT) process at S1 taking place in ∼140 fs or shorter, followed by solvent relaxation in the charge transferred species. The generated structure (syn-enol charge transfer conformer) experiences an excited-state intramolecular proton-transfer (ESIPT) reaction to produce a keto-type tautomer. This subsequent proton motion occurs in 1.2 ps (n-heptane), 14 ps (DCM) and 35 ps (MeOH). In MeOH, it is assisted by the solvent molecules and occurs through tunneling for which we got a large kinetic isotope effect (KIE) of about 13. For the 6A-DBO (deuterated sample in CD3OD) the global proton-transfer reaction takes place in 200 ps, showing a remarkable slow KIE regime. The slow ESIPT reaction in DCM (14 ps), not through tunnelling as it is not sensitive to OH/OD exchange, has however to overcome an energy barrier using intramolecular as well as solvent coordinates. The rich ESIPT dynamics of 6A-HBO in the used solutions is governed by an ICT reaction, triggered by the amino group, and it is solvent dependent. Thus, the charge injection to a 6A-HBO molecular frame makes the ICT species more stable, and the phenol group less acidic, slowing down the subsequent ESIPT reaction. Our findings bring new insights into the coupling between ICT and ESIPT reactions on the potential-energy surfaces of several barriers.

Orbitally dependent kinetic exchange in a heterobimetallic pair: Ferromagnetic spin alignment and magnetic anisotropy in the cyano-bridged Cr(III)Fe(II) dimer

NASA Astrophysics Data System (ADS)

Palii, A. V.; Tsukerblat, B. S.; Verdaguer, M.

2002-11-01

The problem of the kinetic exchange interaction in the cyanide-bridged heterobinuclear dimers involving orbitally degenerate transition metal ions is considered. The developed approach is based on the concept of the effective Hamiltonian of the orbitally dependent kinetic exchange. We deduce this many-electron Hamiltonian on the microscopic background so that all relevant biorbital transfer processes are taken into account as well as the properties of the many-electron states. The bioctahedral cyanide-bridged Cr(III)Fe(II) dimer is considered in detail as an example distinctly exhibiting new quantitative and qualitative features of the orbitally dependent exchange and as a structural unit of three-dimensional ferromagnetic crystals {Fe(II)3)Cr(III)(CN62}[middle dot]13H2O. The proposed mechanism of the kinetic exchange involves the electron transfer from the double occupied t2 orbitals of Fe(II) [ground state 5T2(t2)4e2] to the half occupied t2 orbitals of Cr(III) [ground state 4A2(t2)3] resulting in the charge transfer state 3T1(t2)4Cr(II)- 6A1(t2)3e2 Fe(III) and the transfer between the half-occupied t2 orbitals of the metal ions resulting in the charge transfer state 3T1(t2)4Cr(II)- 4T2(t2)3e2 Fe(III). The effective Hamiltonian of the orbitally dependent exchange for the Cr(III)Fe(II) pair deduced within this theoretical framework describes competitive ferro- and antiferromagnetic contributions arising from these two charge transfer states. This Hamiltonian leads to a complex energy pattern, consisting of two interpenetrating Heisenberg-like schemes, one exhibiting ferromagnetic and another one antiferromagnetic splitting. The condition for the ferromagnetic spin alignment in the ground state is deduced. The orbitally dependent terms of the Hamiltonian are shown to give rise to a strong magnetic anisotropy of the system, this result as well as the condition for the spin alignment in the ground term are shown to be out of the scope of the Goodenough-Kanamori rules. Along with the full spin S the energy levels are labeled by the orbital quantum numbers providing thus the direct information about the magnetic anisotropy of the system. Under a reasonable estimation of the excitation energies based on the optical absorption data we conclude that the kinetic exchange in the cyanide-bridged Cr(III)Fe(II) pair leads to the ferromagnetic spin alignment exhibiting at the same time strong axial magnetic anisotropy with C4 easy axis of magnetization.

An experimental approach to determine the heat transfer coefficient in directional solidification furnaces

NASA Technical Reports Server (NTRS)

Banan, Mohsen; Gray, Ross T.; Wilcox, William R.

1992-01-01

The heat transfer coefficient between a molten charge and its surroundings in a Bridgman furnace was experimentally determined using in-situ temperature measurement. The ampoule containing an isothermal melt was suddenly moved from a higher temperature zone to a lower temperature zone. The temperature-time history was used in a lumped-capacity cooling model to evaluate the heat transfer coefficient between the charge and the furnace. The experimentally determined heat transfer coefficient was of the same order of magnitude as the theoretical value estimated by standard heat transfer calculations.

Integrated exhaust gas recirculation and charge cooling system

DOEpatents

Wu, Ko-Jen

2013-12-10

An intake system for an internal combustion engine comprises an exhaust driven turbocharger configured to deliver compressed intake charge, comprising exhaust gas from the exhaust system and ambient air, through an intake charge conduit and to cylinders of the internal combustion engine. An intake charge cooler is in fluid communication with the intake charge conduit. A cooling system, independent of the cooling system for the internal combustion engine, is in fluid communication with the intake charge cooler through a cooling system conduit. A coolant pump delivers a low temperature cooling medium from the cooling system to and through the intake charge cooler for the transfer of heat from the compressed intake charge thereto. A low temperature cooler receives the heated cooling medium through the cooling system conduit for the transfer or heat therefrom.

Epitaxial growth and electronic properties of well ordered phthalocyanine heterojunctions MnPc/F{sub 16}CoPc

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lindner, Susi; Mahns, Benjamin; Treske, Uwe

2014-09-07

We have prepared phthalocyanine heterojunctions out of MnPc and F{sub 16}CoPc, which were studied by means of X-ray absorption spectroscopy. This heterojunction is characterized by a charge transfer at the interface, resulting in charged MnPc{sup δ} {sup +} and F{sub 16}CoPc{sup δ} {sup −} species. Our data reveal that the molecules are well ordered and oriented parallel to the substrate surface. Furthermore, we demonstrate the filling of the Co 3d{sub z{sup 2}} orbital due to the charge transfer, which supports the explanation of the density functional theory, that the charge transfer is local and affects the metal centers only.

Solvent Dependence of Lateral Charge Transfer in a Porphyrin Monolayer

DOE PAGES

Brennan, Bradley J.; Regan, Kevin P.; Durrell, Alec C.; ...

2016-12-19

Lateral charge transport in a redox)active monolayer can be utilized for solar energy harvesting. We chose the porphyrin system to study the influence of the solvent on lateral hole hopping, which plays a crucial role in the charge)transfer kinetics. We also examined the influence of water, acetonitrile, and propylene carbonate as solvents. Hole)hopping lifetimes varied by nearly three orders of magnitude among solvents, ranging from 3 ns in water to 2800 ns in propylene carbonate, and increased nonlinearly as a function of added acetonitrile in aqueous solvent mixtures. Our results elucidate the important roles of solvation, molecular packing dynamics, andmore » lateral charge)transfer mechanisms that have implications for all dye)sensitized photoelectrochemical device designs.« less

Polysulfide intercalated layered double hydroxides for metal capture applications

DOEpatents

Kanatzidis, Mercouri G.; Ma, Shulan

2017-04-04

Polysulfide intercalated layered double hydroxides and methods for their use in vapor and liquid-phase metal capture applications are provided. The layered double hydroxides comprise a plurality of positively charged host layers of mixed metal hydroxides separated by interlayer spaces. Polysulfide anions are intercalated in the interlayer spaces.

Substitution effects on the absorption spectra of nitrophenolate isomers.

PubMed

Wanko, Marius; Houmøller, Jørgen; Støchkel, Kristian; Suhr Kirketerp, Maj-Britt; Petersen, Michael Åxman; Nielsen, Mogens Brøndsted; Nielsen, Steen Brøndsted; Rubio, Angel

2012-10-05

Charge-transfer excitations highly depend on the electronic coupling between the donor and acceptor groups. Nitrophenolates are simple examples of charge-transfer systems where the degree of coupling differs between ortho, meta and para isomers. Here we report the absorption spectra of the isolated anions in vacuo to avoid the complications of solvent effects. Gas-phase action spectroscopy was done with two different setups, an electrostatic ion storage ring and an accelerator mass spectrometer. The results are interpreted on the basis of CC2 quantum chemical calculations. We identified absorption maxima at 393, 532, and 399 nm for the para, meta, and ortho isomer, respectively, with the charge-transfer transition into the lowest excited singlet state. In the meta isomer, this π-π* transition is strongly redshifted and its oscillator strength reduced, which is related to the pronounced charge-transfer character, as a consequence of the topology of the conjugated π-system. Each isomer's different charge distribution in the ground state leads to a very different solvent shift, which in acetonitrile is bathochromic for the para and ortho, but hypsochromic for the meta isomer.

Charge transfer in low-energy collisions of H with He+ and H+ with He in excited states

NASA Astrophysics Data System (ADS)

Loreau, J.; Ryabchenko, S.; Muñoz Burgos, J. M.; Vaeck, N.

2018-04-01

The charge transfer process in collisions of excited (n = 2, 3) hydrogen atoms with He+ and in collisions of excited helium atoms with H+ is studied theoretically. A combination of a fully quantum-mechanical method and a semi-classical approach is employed to calculate the charge-exchange cross sections at collision energies from 0.1 eV u‑1 up to 1 keV u‑1. These methods are based on accurate ab initio potential energy curves and non-adiabatic couplings for the molecular ion HeH+. Charge transfer can occur either in singlet or in triplet states, and the differences between the singlet and triplet spin manifolds are discussed. The dependence of the cross section on the quantum numbers n and l of the initial state is demonstrated. The isotope effect on the charge transfer cross sections, arising at low collision energy when H is substituted by D or T, is investigated. Rate coefficients are calculated for all isotopes up to 106 K. Finally, the impact of the present calculations on models of laboratory plasmas is discussed.

Electron-lattice interactions strongly renormalize the charge-transfer energy in the spin-chain cuprate Li 2CuO 2

DOE PAGES

Johnston, Steve; Monney, Claude; Bisogni, Valentina; ...

2016-02-17

Strongly correlated insulators are broadly divided into two classes: Mott–Hubbard insulators, where the insulating gap is driven by the Coulomb repulsion U on the transition-metal cation, and charge-transfer insulators, where the gap is driven by the charge-transfer energy Δ between the cation and the ligand anions. The relative magnitudes of U and Δ determine which class a material belongs to, and subsequently the nature of its low-energy excitations. These energy scales are typically understood through the local chemistry of the active ions. Here we show that the situation is more complex in the low-dimensional charge-transfer insulator Li 2CuO 2, wheremore » Δ has a large non-electronic component. Combining resonant inelastic X-ray scattering with detailed modelling, we determine how the elementary lattice, charge, spin and orbital excitations are entangled in this material. This results in a large lattice-driven renormalization of Δ, which significantly reshapes the fundamental electronic properties of Li 2CuO 2.« less

Frenkel and Charge-Transfer Excitations in Donor-acceptor Complexes from Many-Body Green's Functions Theory.

PubMed

Baumeier, Björn; Andrienko, Denis; Rohlfing, Michael

2012-08-14

Excited states of donor-acceptor dimers are studied using many-body Green's functions theory within the GW approximation and the Bethe-Salpeter equation. For a series of prototypical small-molecule based pairs, this method predicts energies of local Frenkel and intermolecular charge-transfer excitations with the accuracy of tens of meV. Application to larger systems is possible and allowed us to analyze energy levels and binding energies of excitons in representative dimers of dicyanovinyl-substituted quarterthiophene and fullerene, a donor-acceptor pair used in state of the art organic solar cells. In these dimers, the transition from Frenkel to charge transfer excitons is endothermic and the binding energy of charge transfer excitons is still of the order of 1.5-2 eV. Hence, even such an accurate dimer-based description does not yield internal energetics favorable for the generation of free charges either by thermal energy or an external electric field. These results confirm that, for qualitative predictions of solar cell functionality, accounting for the explicit molecular environment is as important as the accurate knowledge of internal dimer energies.

Molecular dynamics and charge transport in organic semiconductors: a classical approach to modeling electron transfer

DOE PAGES

Pelzer, Kenley M.; Vázquez-Mayagoitia, Álvaro; Ratcliff, Laura E.; ...

2017-01-01

Organic photovoltaics (OPVs) are a promising carbon-neutral energy conversion technology, with recent improvements pushing power conversion efficiencies over 10%. A major factor limiting OPV performance is inefficiency of charge transport in organic semiconducting materials (OSCs). Due to strong coupling with lattice degrees of freedom, the charges form polarons, localized quasi-particles comprised of charges dressed with phonons. These polarons can be conceptualized as pseudo-atoms with a greater effective mass than a bare charge. Here we propose that due to this increased mass, polarons can be modeled with Langevin molecular dynamics (LMD), a classical approach with a computational cost much lower thanmore » most quantum mechanical methods. Here we present LMD simulations of charge transfer between a pair of fullerene molecules, which commonly serve as electron acceptors in OSCs. We find transfer rates consistent with experimental measurements of charge mobility, suggesting that this method may provide quantitative predictions of efficiency when used to simulate materials on the device scale. Our approach also offers information that is not captured in the overall transfer rate or mobility: in the simulation data, we observe exactly when and why intermolecular transfer events occur. In addition, we demonstrate that these simulations can shed light on the properties of polarons in OSCs. In conclusion, much remains to be learned about these quasi-particles, and there are no widely accepted methods for calculating properties such as effective mass and friction. Lastly, our model offers a promising approach to exploring mass and friction as well as providing insight into the details of polaron transport in OSCs.« less

First principles molecular dynamics of molten NaI: Structure, self-diffusion, polarization effects, and charge transfer

NASA Astrophysics Data System (ADS)

Galamba, N.; Costa Cabral, B. J.

2007-09-01

The structure and self-diffusion of NaI and NaCl at temperatures close to their melting points are studied by first principles Hellmann-Feynman molecular dynamics (HFMD). The results are compared with classical MD using rigid-ion (RI) and shell-model (ShM) interionic potentials. HFMD for NaCl was reported before at a higher temperature [N. Galamba and B. J. Costa Cabral, J. Chem. Phys. 126, 124502 (2007)]. The main differences between the structures predicted by HFMD and RI MD for NaI concern the cation-cation and the anion-cation pair correlation functions. A ShM which allows only for the polarization of I- reproduces the main features of the HFMD structure of NaI. The inclusion of polarization effects for both ionic species leads to a more structured ionic liquid, although a good agreement with HFMD is also observed. HFMD Green-Kubo self-diffusion coefficients are larger than those obtained from RI and ShM simulations. A qualitative study of charge transfer in molten NaI and NaCl was also carried out with the Hirshfeld charge partitioning method. Charge transfer in molten NaI is comparable to that in NaCl, and results for NaCl at two temperatures support the view that the magnitude of charge transfer is weakly state dependent for ionic systems. Finally, Hirshfeld charge distributions indicate that differences between RI and HFMD results are mainly related to polarization effects, while the influence of charge transfer fluctuations is minimal for these systems.

Physical stage of photosynthesis charge separation

NASA Astrophysics Data System (ADS)

Yakovlev, A. G.; Shuvalov, V. A.

2016-06-01

An analytical review is given concerning the biophysical aspects of light-driven primary charge separation in photosynthesis reaction centers (RCs) which are special pigment-protein complexes residing in a cell membrane. The primary (physical) stage of charge separation occurs in the pico- and femtosecond ranges and consists of transferring an electron along the active A-branch of pigments. The review presents vast factual material on both the general issues of primary photosynthesis and some more specific topics, including (1) the role of the inactive B-branch of pigments, (2) the effect of the protein environment on the charge separation, and (3) the participation of monomeric bacteriochlorophyll BA in primary electron acceptance. It is shown that the electron transfer and stabilization are strongly influenced by crystallographic water and tyrosine M210 molecules from the nearest environment of BA. A linkage between collective nuclear motions and electron transfer upon charge separation is demonstrated. The nature of the high quantum efficiency of primary charge separation reactions is discussed.

Electron transfer beyond the static picture: A TDDFT/TD-ZINDO study of a pentacene dimer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reslan, Randa; Lopata, Kenneth; Arntsen, Christopher

2012-12-14

We use time-dependent density functional theory and time-dependent ZINDO (a semi-empirical method) to study transfer of an extra electron between a pair of pentacene molecules. A measure of the electronic transfer integral is computed in a dynamic picture via the vertical excitation energy from a delocalized anionic ground state. With increasing dimer separation, this dynamical measurement of charge transfer is shown to be significantly larger than the commonly used static approximation (i.e., LUMO+1–LUMO of the neutral dimer, or HOMO–LUMO of the charged dimer), up to an order of magnitude higher at 6 Å. These results offer a word of cautionmore » for calculations involving large separations, as in organic photovoltaics, where care must be taken when using a static picture to model charge transfer.« less

Electron transfer beyond the static picture: A TDDFT/TD-ZINDO study of a pentacene dimer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reslan, Randa; Lopata, Kenneth A.; Arntsen, Christopher D.

2012-12-14

We use time-dependent density functional theory and time-dependent ZINDO (a semi-empirical method) to study transfer of an extra electron between a pair of pentacene dimers. A measure of the electronic transfer integral is computed in a dynamic picture via the vertical excitation energy from a delocalized anionic ground state. With increasing dimer separation, this dynamical measurement of charge transfer is shown to be significantly larger than the commonly used static approximation (i.e., LUMO+1 - LUMO of the neutral dimer, or HOMO - LUMO of the charged dimer), up to an order of magnitude higher at 6 Å. These results offermore » a word of caution for calculations involving large separations, as in organic photovoltaics, where care must be taken when using a static picture to model charge transfer.« less

Transfer functions of double- and multiple-cavity Fabry-Perot filters driven by Lorentzian sources.

PubMed

Marti, J; Capmany, J

1996-12-20

We derive expressions for the transfer functions of double- and multiple-cavity Fabry-Perot filters driven by laser sources with Lorentzian spectrum. These are of interest because of their applications in sensing and channel filtering in optical frequency-division multiplexing networks.

Transfer functions of double- and multiple-cavity Fabry Perot filters driven by Lorentzian sources

NASA Astrophysics Data System (ADS)

Marti, Javier; Capmany, Jose

1996-12-01

We derive expressions for the transfer functions of double- and multiple-cavity Fabry Perot filters driven by laser sources with Lorentzian spectrum. These are of interest because of their applications in sensing and channel filtering in optical frequency-division multiplexing networks.

Characterization of Boron Contamination in Fluorine Implantation using Boron Trifluoride as a Source Material

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schmeide, Matthias; Kondratenko, Serguei

2011-01-07

Fluorine implantation process purity was considered on different types of high current implanters. It was found that implanters equipped with an indirectly heated cathode ion source show an enhanced deep boron contamination compared to a high current implanter using a cold RF-driven multicusp ion source when boron trifluoride is used for fluorine implantations. This contamination is directly related to the source technology and thus, should be considered potentially for any implanter design using hot cathode/hot filament ion source, independently of the manufacturer.The boron contamination results from the generation of double charged boron ions in the arc chamber and the subsequentmore » charge exchange reaction to single charged boron ions taking place between the arc chamber and the extraction electrode. The generation of the double charged boron ions depends mostly on the source parameters, whereas the pressure in the region between the arc chamber and the extraction electrode is mostly responsible for the charge exchange from double charged to single charged ions. The apparent mass covers a wide range, starting at mass 11. A portion of boron ions with energies of (19/11) times higher than fluorine energy has the same magnetic rigidity as fluorine beam and cannot be separated by the analyzer magnet. The earlier described charge exchange effects between the extraction electrode and the entrance to the analyzer magnet, however, generates boron beam with a higher magnetic rigidity compared to fluorine beam and cannot cause boron contamination after mass-separation.The energetic boron contamination was studied as a function of the ion source parameters, such as gas flow, arc voltage, and source magnet settings, as well as analyzing magnet aperture resolution. This allows process optimization reducing boron contamination to the level acceptable for device performance.« less

Free energy gap laws for the pulse-induced and stationary fluorescence quenching by reversible charge transfer in polar solutions.

PubMed

Khokhlova, Svetlana S; Burshtein, Anatoly I

2011-01-21

The Stern-Volmer constants for either pulse-induced or stationary fluorescence being quenched by a contact charge transfer are calculated and their free energy dependencies (the free energy gap laws) are specified. The reversibility of charge transfer is taken into account as well as spin conversion in radical ion pairs, followed by their recombination in either singlet or triplet neutral products. The natural decay of triplets as well as their impurity quenching by ionization are accounted for when estimating the fluorescence quantum yield and its free energy dependence.

Change of electric dipole moment in charge transfer transitions of ferrocene oligomers studied by ultrafast two-photon absorption

NASA Astrophysics Data System (ADS)

Mikhaylov, Alexander; Arias, Eduardo; Moggio, Ivana; Ziolo, Ronald; Uudsemaa, Merle; Trummal, Aleksander; Cooper, Thomas; Rebane, Aleksander

2017-02-01

Change of permanent electric dipole moment in the lower-energy charge transfer transitions for a series of symmetrical and non-symmetrical ferrocene-phenyleneethynylene oligomers were studied by measuring the corresponding femtosecond two-photon absorption cross section spectra, and were determined to be in the range Δμ = 3 - 10 D. Quantum-chemical calculations of Δμ for the non-symmetrical oligomers show good quantitative agreement with the experimental results, thus validating two-photon absorption spectroscopy as a viable experimental approach to study electrostatic properties of organometallics and other charge transfer systems.

Molecular implementation of molecular shift register memories

NASA Technical Reports Server (NTRS)

Beratan, David N. (Inventor); Onuchic, Jose N. (Inventor)

1991-01-01

An electronic shift register memory (20) at the molecular level is described. The memory elements are based on a chain of electron transfer molecules (22) and the information is shifted by photoinduced (26) electron transfer reactions. Thus, multi-step sequences of charge transfer reactions are used to move charge with high efficiency down a molecular chain. The device integrates compositions of the invention onto a VLSI substrate (36), providing an example of a molecular electronic device which may be fabricated. Three energy level schemes, molecular implementation of these schemes, optical excitation strategies, charge amplification strategies, and error correction strategies are described.

Intramolecular Charge Transfer States in the Condensed Phase

NASA Astrophysics Data System (ADS)

Williams, C. F.; Herbert, J. M.

2009-06-01

Time-Dependent Density Functional Theory (TDDFT) with long range corrected functionals can give accurate results for the energies of electronically excited states involving Intramolecular Charge Transfer (ICT) in large molecules. If this is combined with a Molecular Mechanics (MM) representation of the surrounding solvent this technique can be used to interpret the results of condensed phase UV-Vis Spectroscopy. Often the MM region is represented by a set of point charges, however this means that the solvent cannot repolarize to adapt to the new charge distribution as a result of ICT and so the excitation energies to ICT states are overestimated. To solve this problem an algorithm that interfaces TDDFT with the polarizable force-field AMOEBA is presented; the effect of solvation on charge transfer in species such as 4,4'dimethylaminobenzonitrile (DMABN) is discussed. M.A. Rohrdanz, K.M. Martins, and J.M. Herbert, J. Chem. Phys. 130 034107 (2008).

Charge transfer in photorefractive CdTe:Ge at different wavelengths

NASA Astrophysics Data System (ADS)

Shcherbin, K.; Odoulov, S.; Ramaz, F.; Farid, B.; Briat, B.; von Bardeleben, H. J.; Delaye, P.; Roosen, G.

2001-10-01

The charge transfer processes in photorefractive CdTe:Ge were modeled using the data of optical absorption, magnetic circular dichroism (MCD) and electron paramagnetic resonance (EPR) spectroscopies. Within the developed model the variations in the photorefractive properties of different CdTe:Ge samples are explained by differences in the relative concentrations of donor and trap centers. The existence of two different centers of comparable concentrations, each in two charge states, allows charge redistribution between them and gives rise to optical sensitization of some CdTe:Ge samples for photorefractive recording under an auxiliary illumination. In the present article we follow the proposal of pseudo-3D presentation of light-induced absorption to distinguish the main charge transfer processes at different excitation energies and explain the sensitization of CdTe:Ge for photorefractive recording at 1.06, 1.32 and 1.55 μm by light with appropriate wavelength.

Structural and spectroscopic characterizations on the charge-transfer interactions of the second generation poly(propylene amine) dendrimers with iodine and picric acid acceptors

NASA Astrophysics Data System (ADS)

El-Sayed, Mohamed Y.; Refat, Moamen S.

2015-02-01

Herein, this study was focused to get a knowledge about the intermolecular charge transfer complexes between the second generation of poly(propylene amine) dendrimer (PPD2) with picric acid (PA) and iodine (I2) as π and σ-acceptors. The charge-transfer interaction of the PPD2 electron donor and the PA acceptor has been studied in CHCl3. The resulted data refereed to the formation of the new CT-complex with the general formula [(PPD2)(PA)4]. The 1:4 stoichiometry of the reaction was discussed upon the on elemental analysis and photometric titration. On the other hand, the 1:3½ iodine-PPD2 heptaiodide (I7-) charge-transfer complex has been studied spectrophotometrically in chloroform at room temperature with general formula [(PPD2)]+I7-. The electronic absorption bands of 2I2·I3- (I7-) are observed at 358 and 294 nm. Raman laser spectrum of the brown solid heptaiodide complex has two clearly vibration bands at 155 and 110 cm-1 due to symmetric stretching νs(Isbnd I) outer and inner bonds, respectively. The 1H NMR spectra and differential scanning calorimetry (DSC) data of PPD2 charge-transfer complexes were discussed.

Abnormal Magnetic Field Effects on Electrogenerated Chemiluminescence

NASA Astrophysics Data System (ADS)

Pan, Haiping; Shen, Yan; Wang, Hongfeng; He, Lei; Hu, Bin

2015-03-01

We report abnormal magnetic field effects on electrogenerated chemiluminescence (MFEECL) based on triplet emission from the Ru(bpy)3Cl2-TPrA electrochemical system: the appearance of MFEECL after magnetic field ceases. In early studies the normal MFEECL have been observed from electrochemical systems during the application of magnetic field. Here, the abnormal MFEECL suggest that the activated charge-transfer [Ru(bpy)33+ … TPrA•] complexes may become magnetized in magnetic field and experience a long magnetic relaxation after removing magnetic field. Our analysis indicates that the magnetic relaxation can gradually increase the density of charge-transfer complexes within reaction region due to decayed magnetic interactions, leading to a positive component in the abnormal MFEECL. On the other hand, the magnetic relaxation facilitates an inverse conversion from triplets to singlets within charge-transfer complexes. The inverse triplet --> singlet conversion reduces the density of triplet light-emitting states through charge-transfer complexes and gives rise to a negative component in the abnormal MFEECL. The combination of positive and negative components can essentially lead to a non-monotonic profile in the abnormal MFEECL after ceasing magnetic field. Nevertheless, our experimental studies may reveal un-usual magnetic behaviors with long magnetic relaxation from the activated charge-transfer [Ru(bpy)33+ … TPrA•] complexes in solution at room temperature.

Charging of Proteins in Native Mass Spectrometry

DOE PAGES

Susa, Anna C.; Xia, Zijie; Tang, Henry Y. H.; ...

2016-10-12

Factors that influence the charging of protein ions formed by electrospray ionization from aqueous solutions in which proteins have native structures and function were investigated. Protein ions ranging in molecular weight from 12.3 to 79.7 kDa and pI values from 5.4 to 9.6 were formed from different solutions and reacted with volatile bases of gas-phase basicities higher than that of ammonia in the cell of a Fourier-transform ion cyclotron resonance mass spectrometer. The charge-state distribution of cytochrome c ions formed from aqueous ammonium or potassium acetate is the same. Moreover, ions formed from these two solutions do not undergo protonmore » transfer to 2-fluoropyridine, which is 8 kcal/mol more basic than ammonia. These results provide compelling evidence that proton transfer between ammonia and protein ions does not limit protein ion charge in native electrospray ionization. Both circular dichroism and ion mobility measurements indicate that there are differences in conformations of proteins in pure water and aqueous ammonium acetate, and these differences can account for the difference in the extent of charging and proton-transfer reactivities of protein ions formed from these solutions. The extent of proton transfer of the protein ions with higher gas-phase basicity bases trends with how closely the protein ions are charged to the value predicted by the Rayleigh limit for spherical water droplets approximately the same size as the proteins. These results indicate that droplet charge limits protein ion charge in native mass spectrometry and are consistent with these ions being formed by the charged residue mechanism.« less

Charging of Proteins in Native Mass Spectrometry

NASA Astrophysics Data System (ADS)

Susa, Anna C.; Xia, Zijie; Tang, Henry Y. H.; Tainer, John A.; Williams, Evan R.

2017-02-01

Factors that influence the charging of protein ions formed by electrospray ionization from aqueous solutions in which proteins have native structures and function were investigated. Protein ions ranging in molecular weight from 12.3 to 79.7 kDa and pI values from 5.4 to 9.6 were formed from different solutions and reacted with volatile bases of gas-phase basicities higher than that of ammonia in the cell of a Fourier-transform ion cyclotron resonance mass spectrometer. The charge-state distribution of cytochrome c ions formed from aqueous ammonium or potassium acetate is the same. Moreover, ions formed from these two solutions do not undergo proton transfer to 2-fluoropyridine, which is 8 kcal/mol more basic than ammonia. These results provide compelling evidence that proton transfer between ammonia and protein ions does not limit protein ion charge in native electrospray ionization. Both circular dichroism and ion mobility measurements indicate that there are differences in conformations of proteins in pure water and aqueous ammonium acetate, and these differences can account for the difference in the extent of charging and proton-transfer reactivities of protein ions formed from these solutions. The extent of proton transfer of the protein ions with higher gas-phase basicity bases trends with how closely the protein ions are charged to the value predicted by the Rayleigh limit for spherical water droplets approximately the same size as the proteins. These results indicate that droplet charge limits protein ion charge in native mass spectrometry and are consistent with these ions being formed by the charged residue mechanism.

Larry car for a coking oven battery

DOE Office of Scientific and Technical Information (OSTI.GOV)

Corry, D.B.

A larry car (3) for transporting a charge of pre-heated coal along the top of a battery of coke ovens, from a storage installation including a group of metering bins (1) at one or more filling stations above the battery, to a corresponding group of charge holes for the oven chamber to be charged, the car including a corresponding group of coal transfer hoppers (4) each having valved inlet and discharge apertures (5,21), a sealed connection (2) between each metering bin and transfer hopper, an inert gas reservoir (10) connectable via a valved manifold (13,14) to each transfer hopper, amore » valved connection (7,8,9) for charging the reservoir, and a valved connection (15,16,17) to permit dusty gas to be displaced into the storage bunkers, and control means for the various valved connections to maintain continuous isolation of the interior of each transfer hopper from the atmosphere, to permit dust-laden gases to escape into the storage installation, and to cause inert medium to displace coal discharged from the transfer hoppers.« less

Delayed Triplet-State Formation through Hybrid Charge Transfer Exciton at Copper Phthalocyanine/GaAs Heterojunction.

PubMed

Lim, Heeseon; Kwon, Hyuksang; Kim, Sang Kyu; Kim, Jeong Won

2017-10-05

Light absorption in organic molecules on an inorganic substrate and subsequent electron transfer to the substrate create so-called hybrid charge transfer exciton (HCTE). The relaxation process of the HCTE states largely determines charge separation efficiency or optoelectronic device performance. Here, the study on energy and time-dispersive behavior of photoelectrons at the hybrid interface of copper phthalocyanine (CuPc)/p-GaAs(001) upon light excitation of GaAs reveals a clear pathway for HCTE relaxation and delayed triplet-state formation. According to the ground-state energy level alignment at the interface, CuPc/p-GaAs(001) shows initially fast hole injection from GaAs to CuPc. Thus, the electrons in GaAs and holes in CuPc form an unusual HCTE state manifold. Subsequent electron transfer from GaAs to CuPc generates the formation of the triplet state in CuPc with a few picoseconds delay. Such two-step charge transfer causes delayed triplet-state formation without singlet excitation and subsequent intersystem crossing within the CuPc molecules.

Mediated Electron Transfer at Vertically Aligned Single-Walled Carbon Nanotube Electrodes During Detection of DNA Hybridization.

PubMed

Wallen, Rachel; Gokarn, Nirmal; Bercea, Priscila; Grzincic, Elissa; Bandyopadhyay, Krisanu

2015-12-01

Vertically aligned single-walled carbon nanotube (VASWCNT) assemblies are generated on cysteamine and 2-mercaptoethanol (2-ME)-functionalized gold surfaces through amide bond formation between carboxylic groups generated at the end of acid-shortened single-walled carbon nanotubes (SWCNTs) and amine groups present on the gold surfaces. Atomic force microscopy (AFM) imaging confirms the vertical alignment mode of SWCNT attachment through significant changes in surface roughness compared to bare gold surfaces and the lack of any horizontally aligned SWCNTs present. These SWCNT assemblies are further modified with an amine-terminated single-stranded probe-DNA. Subsequent hybridization of the surface-bound probe-DNA in the presence of complementary strands in solution is followed using impedance measurements in the presence of Fe(CN)6 (3-/4-) as the redox probe in solution, which show changes in the interfacial electrochemical properties, specifically the charge-transfer resistance, due to hybridization. In addition, hybridization of the probe-DNA is also compared when it is attached directly to the gold surfaces without any intermediary SWCNTs. Contrary to our expectations, impedance measurements show a decrease in charge-transfer resistance with time due to hybridization with 300 nM complementary DNA in solution with the probe-DNA attached to SWCNTs. In contrast, an increase in charge-transfer resistance is observed with time during hybridization when the probe-DNA is attached directly to the gold surfaces. The decrease in charge-transfer resistance during hybridization in the presence of VASWCNTs indicates an enhancement in the electron transfer process of the redox probe at the VASWCNT-modified electrode. The results suggest that VASWCNTs are acting as mediators of electron transfer, which facilitate the charge transfer of the redox probe at the electrode-solution interface.

Mediated Electron Transfer at Vertically Aligned Single-Walled Carbon Nanotube Electrodes During Detection of DNA Hybridization

NASA Astrophysics Data System (ADS)

Wallen, Rachel; Gokarn, Nirmal; Bercea, Priscila; Grzincic, Elissa; Bandyopadhyay, Krisanu

2015-06-01

Vertically aligned single-walled carbon nanotube (VASWCNT) assemblies are generated on cysteamine and 2-mercaptoethanol (2-ME)-functionalized gold surfaces through amide bond formation between carboxylic groups generated at the end of acid-shortened single-walled carbon nanotubes (SWCNTs) and amine groups present on the gold surfaces. Atomic force microscopy (AFM) imaging confirms the vertical alignment mode of SWCNT attachment through significant changes in surface roughness compared to bare gold surfaces and the lack of any horizontally aligned SWCNTs present. These SWCNT assemblies are further modified with an amine-terminated single-stranded probe-DNA. Subsequent hybridization of the surface-bound probe-DNA in the presence of complementary strands in solution is followed using impedance measurements in the presence of Fe(CN)6 3-/4- as the redox probe in solution, which show changes in the interfacial electrochemical properties, specifically the charge-transfer resistance, due to hybridization. In addition, hybridization of the probe-DNA is also compared when it is attached directly to the gold surfaces without any intermediary SWCNTs. Contrary to our expectations, impedance measurements show a decrease in charge-transfer resistance with time due to hybridization with 300 nM complementary DNA in solution with the probe-DNA attached to SWCNTs. In contrast, an increase in charge-transfer resistance is observed with time during hybridization when the probe-DNA is attached directly to the gold surfaces. The decrease in charge-transfer resistance during hybridization in the presence of VASWCNTs indicates an enhancement in the electron transfer process of the redox probe at the VASWCNT-modified electrode. The results suggest that VASWCNTs are acting as mediators of electron transfer, which facilitate the charge transfer of the redox probe at the electrode-solution interface.

Dependence of triboelectric charging behavior on material microstructure

NASA Astrophysics Data System (ADS)

Wang, Andrew E.; Gil, Phwey S.; Holonga, Moses; Yavuz, Zelal; Baytekin, H. Tarik; Sankaran, R. Mohan; Lacks, Daniel J.

2017-08-01

We demonstrate that differences in the microstructure of chemically identical materials can lead to distinct triboelectric charging behavior. Contact charging experiments are carried out between strained and unstrained polytetrafluoroethylene samples. Whereas charge transfer is random between samples of identical strain, when one of the samples is strained, systematic charge transfer occurs. No significant changes in the molecular-level structure of the polymer are observed by XRD and micro-Raman spectroscopy after deformation. However, the strained surfaces are found to exhibit void and craze formation spanning the nano- to micrometer length scales by molecular dynamics simulations, SEM, UV-vis spectroscopy, and naked-eye observations. This suggests that material microstructure (voids and crazes) can govern the triboelectric charging behavior of materials.

Spacecraft Charging in Geostationary Transfer Orbit

NASA Technical Reports Server (NTRS)

Parker, Linda Neergaard; Minow, Joseph I.

2014-01-01

The 700 km x 5.8 Re orbit of the two Van Allen Probes spacecraft provide a unique opportunity to investigate spacecraft charging in geostationary transfer orbits. We use records from the Helium Oxygen Proton Electron (HOPE) plasma spectrometer to identify candidate surface charging events based on the "ion line" charging signature in the ion records. We summarize the energetic particle environment and the conditions necessary for charging to occur in this environment. We discuss the altitude, duration, and magnitude of events observed in the Van Allen Probes from the beginning of the mission to present time. In addition, we explore what information the dual satellites provide on the spatial and temporal variations in the charging environments.

Electrostatic Charging and Particle Interactions in Microscopic Insulating Grains

NASA Astrophysics Data System (ADS)

Lee, Victor

In this thesis, we experimentally investigate the electrostatic charging as well as the particle interactions in microscopic insulating grains. First, by tracking individual grains accelerated in an electric field, we quantitatively demonstrate that tribocharging of same-material grains depends on particle size. Large grains tend to charge positively, and small ones tend to charge negatively. Theories based on the transfer of trapped electrons can explain this tendency but have not been validated. Here we show that the number of trapped electrons, measured independently by a thermoluminescence technique, is orders of magnitude too small to be responsible for the amount of charge transferred. This result reveals that trapped electrons are not responsible for same-material tribocharging of dielectric particles. Second, same-material tribocharging in grains can result in important long-range electrostatic interactions. However, how these electrostatic interactions contribute to particle clustering remains elusive, primarily due to the lack of direct, detailed observations. Using a high-speed camera that falls with a stream charged grains, we observe for the first time how charged grains can undergo attractive as well as repulsive Kepler-like orbits. Charged particles can be captured in their mutual electrostatic potential and form clusters via multiple bounces. Dielectric polarization effects are directly observed, which lead to additional attractive forces and stabilize "molecule-like" arrangements of charged particles. Third, we have developed a new method to study the charge transfer of microscopic particles based on acoustic levitation techniques. This method allows us to narrow the complex problem of many-particle charging down to precise charge measurements of a single sub-millimeter particle colliding with a target plate. By simply attaching nonpolar groups onto glass surfaces, we show that the contact charging of a particle is highly dependent on hydrophobicity. Charging between a hydrophilic and a hydrophobic surface is enhanced in a basic atmosphere and suppressed in an acidic one. Moreover, hydrophobicity is also found to play a key role in particle charging driven by an external electric field. These results strongly support the idea that aqueous-ion transfer is responsible for the particle contact charging phenomenon.

Separation of Single-stranded DNA, Double-stranded DNA and RNA from an Environmental Viral Community Using Hydroxyapatite Chromatography

PubMed Central

Fadrosh, Douglas W.; Andrews-Pfannkoch, Cynthia; Williamson, Shannon J.

2011-01-01

Viruses, particularly bacteriophages (phages), are the most numerous biological entities on Earth1,2. Viruses modulate host cell abundance and diversity, contribute to the cycling of nutrients, alter host cell phenotype, and influence the evolution of both host cell and viral communities through the lateral transfer of genes 3. Numerous studies have highlighted the staggering genetic diversity of viruses and their functional potential in a variety of natural environments. Metagenomic techniques have been used to study the taxonomic diversity and functional potential of complex viral assemblages whose members contain single-stranded DNA (ssDNA), double-stranded DNA (dsDNA) and RNA genotypes 4-9. Current library construction protocols used to study environmental DNA-containing or RNA-containing viruses require an initial nuclease treatment in order to remove nontargeted templates 10. However, a comprehensive understanding of the collective gene complement of the virus community and virus diversity requires knowledge of all members regardless of genome composition. Fractionation of purified nucleic acid subtypes provides an effective mechanism by which to study viral assemblages without sacrificing a subset of the community’s genetic signature. Hydroxyapatite, a crystalline form of calcium phosphate, has been employed in the separation of nucleic acids, as well as proteins and microbes, since the 1960s11. By exploiting the charge interaction between the positively-charged Ca2+ ions of the hydroxyapatite and the negatively charged phosphate backbone of the nucleic acid subtypes, it is possible to preferentially elute each nucleic acid subtype independent of the others. We recently employed this strategy to independently fractionate the genomes of ssDNA, dsDNA and RNA-containing viruses in preparation of DNA sequencing 12. Here, we present a method for the fractionation and recovery of ssDNA, dsDNA and RNA viral nucleic acids from mixed viral assemblages using hydroxyapatite chromotography. PMID:21989424

Electrical double layer modulation of hybrid room temperature ionic liquid/aqueous buffer interface for enhanced sweat based biosensing.

PubMed

Jagannath, Badrinath; Muthukumar, Sriram; Prasad, Shalini

2018-08-03

We have investigated the role of kosmotropic anionic moieties and chaotropic cationic moieties of room temperature hydrophilic ionic liquids in enhancing the biosensing performance of affinity based immunochemical biosensors in human sweat. Two ionic liquids, 1-butyl-3-methylimidazolium tetrafluoroborate (BMIM[BF 4 ]) and choline dihydrogen phosphate (Choline[DHP]) were investigated in this study with Choline[DHP] being more kosmotropic in nature having a more protein stabilizing effect based on the hofmeister series. Non-faradaic interfacial charge transfer has been employed as the mechanism for evaluating the formation and the biosensing of capture probe antibodies in room temperature ionic liquids (RTILs)/aqueous human sweat interface. The charge of the ionic moieties were utilized to form compact electrical double layers around the antibodies for enhancing the stability of the antibody capture probes, which was evaluated through zeta potential measurements. The zeta potential measurements indicated stability of antibodies due to electrostatic repulsion of the RTIL charged moieties encompassing the antibodies, thus preventing any aggregation. Here, we report for the first time of non-faradaic electrochemical impedance spectroscopy equivalent circuit model analysis for analyzing and interpreting affinity based biosensing at hybrid electrode/ionic liquid-aqueous sweat buffer interface guided by the choice of the ionic liquid. Interleukin-6 (IL-6) and cortisol two commonly occurring biomarkers in human sweat were evaluated using this method. The limit of detection (LOD) obtained using both ionic liquids for IL-6 was 0.2 pg mL -1 with cross-reactivity studies indicating better performance of IL-6 detection using Choline[DHP] and no response to cross-reactive molecule. The LOD of 0.1 ng/mL was achieved for cortisol and the cross-reactivity studies indicated that cortisol antibody in BMIM[BF 4 ] did not show any signal response to cross-reactive molecules. Furthermore, improved sensitivity and LOD was achieved using ionic liquids as compared to capture probes in aqueous buffer. Copyright © 2018 Elsevier B.V. All rights reserved.

Photoinduced Oxidative DNA Damage Revealed by an Agarose Gel Nicking Assay: A Biophysical Chemistry Laboratory Experiment

NASA Astrophysics Data System (ADS)

Shafirovich, Vladimir; Singh, Carolyn; Geacintov, Nicholas E.

2003-11-01

Oxidative damage of DNA molecules associated with electron-transfer reactions is an important phenomenon in living cells, which can lead to mutations and contribute to carcinogenesis and the aging processes. This article describes the design of several simple experiments to explore DNA damage initiated by photoinduced electron-transfer reactions sensitized by the acridine derivative, proflavine (PF). A supercoiled DNA agarose gel nicking assay is employed as a sensitive probe of DNA strand cleavage. A low-cost experimental and computer-interfaced imaging apparatus is described allowing for the digital recording and analysis of the gel electrophoresis results. The first experiment describes the formation of direct strand breaks in double-stranded DNA induced by photoexcitation of the intercalated PF molecules. The second experiment demonstrates that the addition of the well-known electron acceptor, methylviologen, gives rise to a significant enhancement of the photochemical DNA strand cleavage effect. This occurs by an electron transfer step to methylviologen that renders the inital photoinduced charge separation between photoexcited PF and DNA irreversible. The third experiment demonstrates that the action spectrum of the DNA photocleavage matches the absorption spectrum of DNA-bound, intercalated PF molecules, which differs from that of free PF molecules. This result demonstrates that the photoinduced DNA strand cleavage is initiated by intercalated rather than free PF molecules.

Effect of multiple plasmon excitation on single, double and multiple ionizations of C60 in collisions with fast highly charged Si ions

NASA Astrophysics Data System (ADS)

Kelkar, A. H.; Kadhane, U.; Misra, D.; Kumar, A.; Tribedi, L. C.

2007-06-01

We have investigated the single and multiple ionizations of the C60 molecule in collisions with fast Siq+ projectiles for various projectile charge states (q) between q = 6 and 14. The q-dependence of the ionization cross sections and their ratios is compared with the giant dipole plasmon resonance (GDPR) model. The excellent qualitative agreement with the model in case of single and double ionizations and also a reasonable agreement with the triple (and to some extent with quadruple) ionization (without evaporation) yields signify dominant contributions of the single-, double- and triple-plasmon excitations on the single- and multiple-ionization process.

Multiple ionization of C 60 in collisions with 2.33 MeV/u O-ions and giant plasmon excitation

NASA Astrophysics Data System (ADS)

Kelkar, A. H.; Kadhane, U.; Misra, D.; Kumar, Ajay; Tribedi, L. C.

2007-03-01

Single and multiple ionization of C60 in collisions with fast (v = 9.7 a.u.) Oq+ ions have been studied. Relative cross sections for production of C 601+ to C 604+ have been measured. The intensity ratios of double-to-single ionization agree very well with a model based on giant dipole plasmon resonance (GDPR). Almost linear increasing trend of the yields of single and double ionizations with projectile charge state is well reproduced by the single and double plasmon excitation mechanisms. The observed charge state independence of triple and quadruple ionization is in sharp contrast to the GDPR model.

A Double-Pole High Voltage High Current Switch

DTIC Science & Technology

2005-12-01

NAVAL POSTGRADUATE SCHOOL MONTEREY, CALIFORNIA THESIS Approved for public release; distribution is unlimited A DOUBLE- POLE HIGH...December 2005 3. REPORT TYPE AND DATES COVERED Master’s Thesis 4. TITLE AND SUBTITLE: A Double- Pole High Voltage High Current Switch 6. AUTHOR(S...to divert heavy charged particles, e.g. Cu+. 15. NUMBER OF PAGES 68 14. SUBJECT TERMS Double- Pole , Pulse Forming Inductive Network, PFIN

Negative kinetic temperature effect on the hydride transfer from NADH analogue BNAH to the radical cation of N-benzylphenothiazine in acetonitrile.

PubMed

Zhu, Xiao-Qing; Zhang, Jian-Yu; Cheng, Jin-Pei

2006-09-01

The reaction rates of 1-(p-substituted benzyl)-1,4-dihydronicotinamide (G-BNAH) with N-benzylphenothiazine radical cation (PTZ(*+)) in acetonitrile were determined. The results show that the reaction rates (k(obs)) decreased from 2.80 x 10(7) to 2.16 x 10(7) M(-1) s(-1) for G = H as the reaction temperature increased from 298 to 318 K. The activation enthalpies of the reactions were estimated according to Eyring equation to give negative values (-3.4 to -2.9 kcal/mol). Investigation of the reaction intermediate shows that the charge-transfer complex (CT-complex) between G-BNAH and PTZ(*+) was formed in front of the hydride transfer from G-BNAH to PTZ(*+). The formation enthalpy of the CT-complex was estimated by using the Benesi-Hildebrand equation to give the values from -6.4 to -6.0 kcal/mol when the substituent G in G-BNAH changes from CH(3)O to Br. Detailed thermodynamic analyses on each elementary step in the possible reaction pathways suggest that the hydride transfer from G-BNAH to PTZ(*+) occurs by a concerted hydride transfer via a CT-complex. The effective charge distribution on the pyridine ring in G-BNAH at the various stages-the reactant G-BNAH, the charge-transfer complex, the transition-state, and the product G-BNA(+)-was estimated by using the method of Hammett-type linear free energy analysis, and the results show that the pyridine ring carries relative effective positive charges of 0.35 in the CT-complex and 0.45 in the transition state, respectively, which indicates that the concerted hydride transfer from G-BNAH to PTZ(*+) was practically performed by the initial charge (-0.35) transfer from G-BNAH to PTZ(*+) and then followed by the transfer of hydrogen atom with partial negative charge (-0.65). It is evident that the present work would be helpful in understanding the nature of the negative temperature effect, especially on the reaction of NADH coenzyme with the drug phenothiazine in vivo.

Infrared laser driven double proton transfer. An optimal control theory study

NASA Astrophysics Data System (ADS)

Abdel-Latif, Mahmoud K.; Kühn, Oliver

2010-02-01

Laser control of ultrafast double proton transfer is investigated for a two-dimensional model system describing stepwise and concerted transfer pathways. The pulse design has been done by employing optimal control theory in combination with the multiconfiguration time-dependent Hartree wave packet propagation. The obtained laser fields correspond to multiple pump-dump pulse sequences. Special emphasis is paid to the relative importance of stepwise and concerted transfer pathways for the driven wave packet and its dependence on the parameters of the model Hamiltonian as well as on the propagation time. While stepwise transfer is dominating in all cases considered, for high barrier systems concerted transfer proceeding via tunneling can make a contribution.

Large Ice Crystal Charge Transfer Studies

DTIC Science & Technology

1988-10-28

electrification. However, the extra- polation using qcd 4 was completely unjustified. With corrected values of the separation probability of ice crystals...contact to leak away from the local area or become trapped in the crystal lattice . Obviously, larger initial charge transfers, with larger 6 crystals

Single and multiple ionization of C60 fullerenes and collective effects in collisions with highly charged C, F, and Si ions with energy 3 MeV/u

NASA Astrophysics Data System (ADS)

Kelkar, A. H.; Kadhane, U.; Misra, D.; Gulyas, L.; Tribedi, L. C.

2010-10-01

We have measured absolute cross sections for single, double, triple, and quadruple ionization of C60 in collisions with 3 MeV/u C, F, and Si projectile ions at various projectile charge states. The experiment was performed using the recoil-ion time-of-flight technique. Projectile charge state dependence of the ionization yields was compared mainly with a model based on the giant dipole plasmon resonance (GDPR). In some cases, the continuum-distorted-wave-eikonal-initial-state (CDW-EIS) model which is normally applied for ion-atom collisions was also used as a reference. An excellent qualitative agreement between the experimental data for single and double ionization and the GDPR model predictions was found for all projectile charge states.

Layering and Ordering in Electrochemical Double Layers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Yihua; Kawaguchi, Tomoya; Pierce, Michael S.

Electrochemical double layers (EDL) form at electrified interfaces. While Gouy-Chapman model describes moderately charged EDL, formation of Stern layers was predicted for highly charged EDL. Our results provide structural evidence for a Stern layer of cations, at potentials close to hydrogen evolution in alkali fluoride and chloride electrolytes. Layering was observed by x-ray crystal truncation rods and atomic-scale recoil responses of Pt(111) surface layers. Ordering in the layer is confirmed by glancing-incidence in-plane diffraction measurements.

A reconfigurable gate architecture for Si/SiGe quantum dots

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zajac, D. M.; Hazard, T. M.; Mi, X.

2015-06-01

We demonstrate a reconfigurable quantum dot gate architecture that incorporates two interchangeable transport channels. One channel is used to form quantum dots, and the other is used for charge sensing. The quantum dot transport channel can support either a single or a double quantum dot. We demonstrate few-electron occupation in a single quantum dot and extract charging energies as large as 6.6 meV. Magnetospectroscopy is used to measure valley splittings in the range of 35–70 μeV. By energizing two additional gates, we form a few-electron double quantum dot and demonstrate tunable tunnel coupling at the (1,0) to (0,1) interdot charge transition.

Solvophilic and solvophobic surfaces and non-Coulombic surface interactions in charge regulating electric double layers

NASA Astrophysics Data System (ADS)

Vangara, R.; van Swol, F.; Petsev, D. N.

2018-01-01

The properties of electric double layers are governed by the interface between the substrate and the adjacent electrolyte solution. This interface is involved in chemical, Coulombic, and non-Coulombic (e.g., van der Waals or Lennard-Jones) interactions with all components of the fluid phase. We present a detailed study of these interactions using a classical density functional approach. A particular focus is placed on the non-Coulombic interactions and their effect on the surface chemistry and charge regulation. The solution structure near the charged interface is also analyzed and used to offer a thorough interpretation of established concepts such as the Stern and diffuse ionic layers.

Conjugated block copolymers as model materials to examine charge transfer in donor-acceptor systems

NASA Astrophysics Data System (ADS)

Gomez, Enrique; Aplan, Melissa; Lee, Youngmin

Weak intermolecular interactions and disorder at junctions of different organic materials limit the performance and stability of organic interfaces and hence the applicability of organic semiconductors to electronic devices. The lack of control of interfacial structure has also prevented studies of how driving forces promote charge photogeneration, leading to conflicting hypotheses in the organic photovoltaic literature. Our approach has focused on utilizing block copolymer architectures -where critical interfaces are controlled and stabilized by covalent bonds- to provide the hierarchical structure needed for high-performance organic electronics from self-assembled soft materials. For example, we have demonstrated control of donor-acceptor heterojunctions through microphase-separated conjugated block copolymers to achieve 3% power conversion efficiencies in non-fullerene photovoltaics. Furthermore, incorporating the donor-acceptor interface within the molecular structure facilitates studies of charge transfer processes. Conjugated block copolymers enable studies of the driving force needed for exciton dissociation to charge transfer states, which must be large to maximize charge photogeneration but must be minimized to prevent losses in photovoltage in solar cell devices. Our work has systematically varied the chemical structure, energetics, and dielectric constant to perturb charge transfer. As a consequence, we predict a minimum dielectric constant needed to minimize the driving force and therefore simultaneously maximize photocurrent and photovoltage in organic photovoltaic devices.

Understanding How Isotopes Affect Charge Transfer in P3HT/PCBM: A Quantum Trajectory-Electronic Structure Study with Nonlinear Quantum Corrections

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Lei; Jakowski, Jacek; Garashchuk, Sophya

The experimentally observed effect of selective deuterium substitution on the open circuit voltage for a blend of poly(3-hexylthiophene)(P3HT) and [6,6]-phenyl-C 61- butyric acid methyl ester (PCBM) (Nat. Commun. 5:3180, 2014) is explored using a 221-atom model of a polymer-wrapped PCBM molecule. We describe the protonic and deuteronic wavefunctions for the H/D isotopologues of the hexyl side chains within a Quantum Trajectory/Electronic Structure approach where the dynamics is performed with newly developed nonlinear corrections to the quantum forces, necessary to describe the nuclear wavefunctions; the classical forces are generated with a Density Functional Tight Binding method. We used the resulting protonicmore » and deuteronic time-dependent wavefunctions to assess the effects of isotopic substitution (deuteration) on the energy gaps relevant to the charge transfer for the donor and acceptor electronic states. Furthermore, while the isotope effect on the electronic energy levels is found negligible, the quantum-induced fluctuations of the energy gap between the charge transfer and charge separated states due to nuclear wavefunctions may account for experimental trends by promoting charge transfer in P3HT/PCBM and increasing charge recombination on the donor in the deuterium substituted P3HT/PCBM.« less

Understanding How Isotopes Affect Charge Transfer in P3HT/PCBM: A Quantum Trajectory-Electronic Structure Study with Nonlinear Quantum Corrections

DOE PAGES

Wang, Lei; Jakowski, Jacek; Garashchuk, Sophya; ...

2016-08-09

The experimentally observed effect of selective deuterium substitution on the open circuit voltage for a blend of poly(3-hexylthiophene)(P3HT) and [6,6]-phenyl-C 61- butyric acid methyl ester (PCBM) (Nat. Commun. 5:3180, 2014) is explored using a 221-atom model of a polymer-wrapped PCBM molecule. We describe the protonic and deuteronic wavefunctions for the H/D isotopologues of the hexyl side chains within a Quantum Trajectory/Electronic Structure approach where the dynamics is performed with newly developed nonlinear corrections to the quantum forces, necessary to describe the nuclear wavefunctions; the classical forces are generated with a Density Functional Tight Binding method. We used the resulting protonicmore » and deuteronic time-dependent wavefunctions to assess the effects of isotopic substitution (deuteration) on the energy gaps relevant to the charge transfer for the donor and acceptor electronic states. Furthermore, while the isotope effect on the electronic energy levels is found negligible, the quantum-induced fluctuations of the energy gap between the charge transfer and charge separated states due to nuclear wavefunctions may account for experimental trends by promoting charge transfer in P3HT/PCBM and increasing charge recombination on the donor in the deuterium substituted P3HT/PCBM.« less

Jet Formation and Penetration Study of Double-Layer Shaped Charge

NASA Astrophysics Data System (ADS)

Wang, Zhe; Jiang, Jian-Wei; Wang, Shu-You; Liu, Han

2018-04-01

A theoretical analysis on detonation wave propagation in a double-layer shaped charge (DLSC) is performed. Numerical simulations using the AUTODYN software are carried out to compare the distinctions between jet formations in DLSC and ordinary shaped charge (OSC), in particular, the OSC made using a higher detonation velocity explosive, which is treated as the outer layer charge in the DLSC. The results show that the improved detonation velocity ratio and radial charge percentage of outer-to-inner layer charge are conducive to the formation of a convergent detonation wave, which contributes to enhancement of jet tip velocity in DLSC. The thickness and mass percentages of liner flowing into jet in DLSC closely follow the exponential distribution along the radial direction, but the percentages in DLSC and the mass of effective jet, which have significant influence on the penetration depth, are lower than those in OSC with the outer layer charge. This implies that the total charge energy is the major factor controlling the effective jet formation, which is confirmed by the verification tests using flash X-ray system and following penetration tests. The numerical simulation and test results compare well, while penetration test results indicate that the performance of DLSC is not better than that of OSC with the outer layer charge, due to the differences in jet formation.

Charge transfer complex of some nervous and brain drugs - Part 1: Synthesis, spectroscopic, analytical and biological studies on the reaction between haloperidol antipsychotic drugs with π-acceptors

NASA Astrophysics Data System (ADS)

El-Habeeb, Abeer A.; Al-Saif, Foziah A.; Refat, Moamen S.

2013-02-01

Donor-acceptor interactions between the electron donor haloperidol (HPL) and π-acceptors like 7,7,8,8-tetracyanoquinodimethane (TCNQ) and picric acid (PA) have been studied spectrophotometrically in CH3OH solvent. The donor-acceptor (charge transfer complexes) were discussed in terms of formation constant (KCT), molar extinction coefficient (ɛCT), standard free energy (ΔGo), oscillator strength (ƒ), transition dipole moment (μ), resonance energy (RN) and ionization potential (ID). The stoichiometry of these complexes was found to be 1:1 M ratio and having the formulas [(HPL)(TCNQ)] and [(HPL)(PA)], respectively. The charge transfer interaction was successfully applied to determine of HPL drug using mentioned common π-acceptors also, the results obtained herein are satisfactory for estimation of HPL compound in the pharmaceutical form. The formed solid charge-transfer complexes were also isolated and characterized using elemental analysis, conductivity, (infrared, Raman, and 1H NMR) spectra and X-ray powder diffraction (XRD). The experimental data of elemental analyses are in agreement with calculated data. The infrared spectra of both HPL complexes are confirming the participation of sbnd OH of 4-hydroxy-1-piperidyl moiety in the donor-acceptor chelation. The morphological surface of the resulted charge transfer complexes were investigated using scanning electron microscopy (SEM). The thermogravimetric analysis (TG/DTG) and differential scanning calorimetry (DSC) techniques were performed to give knowledge about the thermal stability behavior of the synthesized charge transfer complexes. Thermodynamic parameters were computed from the thermal decomposition data. These complexes were also tested for their antimicrobial activity against six different microorganisms, and the results were compared with the parent drug.

DFT and TD-DFT computation of charge transfer complex between o-phenylenediamine and 3,5-dinitrosalicylic acid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Afroz, Ziya; Zulkarnain,; Ahmad, Afaq, E-mail: afaqahmad3@gmail.com

2016-05-23

DFT and TD-DFT studies of o-phenylenediamine (PDA), 3,5-dinitrosalicylic acid (DNSA) and their charge transfer complex have been carried out at B3LYP/6-311G(d,p) level of theory. Molecular geometry and various other molecular properties like natural atomic charges, ionization potential, electron affinity, band gap, natural bond orbital (NBO) and frontier molecular analysis have been presented at same level of theory. Frontier molecular orbital and natural bond orbital analysis show the charge delocalization from PDA to DNSA.

Crystallochromy of perylene pigments: Interference between Frenkel excitons and charge-transfer states

NASA Astrophysics Data System (ADS)

Gisslén, Linus; Scholz, Reinhard

2009-09-01

The optical properties of perylene-based pigments are arising from the interplay between neutral molecular excitations and charge transfer between adjacent molecules. In the crystalline phase, these excitations are coupled via electron and hole transfer, two quantities relating directly to the width of the conduction and valence band in the crystalline phase. Based on the crystal structure determined by x-ray diffraction, density-functional theory (DFT) and Hartree-Fock are used for the calculation of the electronic states of a dimer of stacked molecules. The resulting transfer parameters for electron and hole are used in an exciton model for the coupling between Frenkel excitons and charge-transfer states. The deformation of the positively or negatively charged molecular ions with respect to the neutral ground state is calculated with DFT and the geometry in the optically excited state is deduced from time-dependent DFT and constrained DFT. All of these deformations are interpreted in terms of the elongation of an effective internal vibration which is used subsequently in the exciton model for the crystalline phase. A comparison between the calculated dielectric function and the observed optical spectra allows to deduce the relative energetic position of Frenkel excitons and the charge-transfer state involving stack neighbors, a key parameter for various electronic and optoelectronic device applications. For five out of six perylene pigments studied in the present work, this exciton model results in excellent agreement between calculated and observed optical properties.

Ultrafast Charge Transfer and Hybrid Exciton Formation in 2D/0D Heterostructures

DOE PAGES

Boulesbaa, Abdelaziz; Wang, Kai; Mahjouri-Samani, Masoud; ...

2016-10-18

We report that photoinduced interfacial charge transfer is at the heart of many applications, including photovoltaics, photocatalysis, and photodetection. With the emergence of a new class of semiconductors such as monolayer two-dimensional transition metal dichalcogenides (2D-TMDs), charge transfer at the 2D/2D heterojunctions attracted several efforts due to the remarkable optical and electrical properties of 2D-TMDs. Unfortunately, in 2D/2D heterojunctions, for a given combination of two materials, the relative energy band alignment and the charge transfer efficiency are locked. Due to their large variety and broad size tunability, semiconductor quantum dots (0D-QDs) interfaced with 2D-TMDs may become an attractive heterostructure formore » optoelectronic applications. Here, we incorporate femtosecond pump-probe spectroscopy to reveal the sub-45 fs charge transfer at a 2D/0D heterostructure composed of tungsten disulfide monolayers (2D-WS 2) and a single layer of cadmium selenide (CdSe)/zinc sulfide (ZnS) core/shell 0D-QDs. Furthermore, ultrafast dynamics and steady-state measurements suggested that following electron transfer from the 2D to the 0D, hybrid excitons (HXs), wherein the electron resides in the 0D and hole resides in the 2D-TMD monolayer, are formed with a binding energy on the order of ~140 meV, which is several times lower than that of tightly bound excitons in 2D-TMDs.« less

Ultrafast Charge Transfer and Hybrid Exciton Formation in 2D/0D Heterostructures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boulesbaa, Abdelaziz; Wang, Kai; Mahjouri-Samani, Masoud

We report that photoinduced interfacial charge transfer is at the heart of many applications, including photovoltaics, photocatalysis, and photodetection. With the emergence of a new class of semiconductors such as monolayer two-dimensional transition metal dichalcogenides (2D-TMDs), charge transfer at the 2D/2D heterojunctions attracted several efforts due to the remarkable optical and electrical properties of 2D-TMDs. Unfortunately, in 2D/2D heterojunctions, for a given combination of two materials, the relative energy band alignment and the charge transfer efficiency are locked. Due to their large variety and broad size tunability, semiconductor quantum dots (0D-QDs) interfaced with 2D-TMDs may become an attractive heterostructure formore » optoelectronic applications. Here, we incorporate femtosecond pump-probe spectroscopy to reveal the sub-45 fs charge transfer at a 2D/0D heterostructure composed of tungsten disulfide monolayers (2D-WS 2) and a single layer of cadmium selenide (CdSe)/zinc sulfide (ZnS) core/shell 0D-QDs. Furthermore, ultrafast dynamics and steady-state measurements suggested that following electron transfer from the 2D to the 0D, hybrid excitons (HXs), wherein the electron resides in the 0D and hole resides in the 2D-TMD monolayer, are formed with a binding energy on the order of ~140 meV, which is several times lower than that of tightly bound excitons in 2D-TMDs.« less

Ab Initio Simulation of Charge Transfer at the Semiconductor Quantum Dot/TiO 2 Interface in Quantum Dot-Sensitized Solar Cells

DOE PAGES

Xin, Xukai; Li, Bo; Jung, Jaehan; ...

2014-07-24

Quantum dot-sensitized solar cells (QDSSCs) have emerged as a promising solar architecture for next-generation solar cells. The QDSSCs exhibit a remarkably fast electron transfer from the quantum dot (QD) donor to the TiO 2 acceptor with size quantization properties of QDs that allows for the modulation of band energies to control photoresponse and photoconversion efficiency of solar cells. In order to understand the mechanisms that underpin this rapid charge transfer, the electronic properties of CdSe and PbSe QDs with different sizes on the TiO 2 substrate are simulated using a rigorous ab initio density functional method. Our method capitalizes onmore » localized orbital basis set, which is computationally less intensive. Quite intriguingly, a remarkable set of electron bridging states between QDs and TiO 2 occurring via the strong bonding between the conduction bands of QDs and TiO 2 is revealed. Such bridging states account for the fast adiabatic charge transfer from the QD donor to the TiO 2 acceptor, and may be a general feature for strongly coupled donor/acceptor systems. All the QDs/TiO 2 systems exhibit type II band alignments, with conduction band offsets that increase with the decrease in QD size. This facilitates the charge transfer from QDs donors to TiO 2 acceptors and explains the dependence of the increased charge transfer rate with the decreased QD size.« less

Space confinement and rotation stress induced self-organization of double-helix nanostructure: a nanotube twist with a moving catalyst head.

PubMed

Zhao, Meng-Qiang; Zhang, Qiang; Tian, Gui-Li; Huang, Jia-Qi; Wei, Fei

2012-05-22

Inorganic materials with double-helix structure have attracted intensive attention due to not only their elegant morphology but also their amazing morphology-related potential applications. The investigation on the formation mechanism of the inorganic double-helix nanostructure is the first step for the fundamental studies of their materials or physical properties. Herein, we demonstrated the space confinement and rotation stress induced self-organization mechanism of the carbon nanotube (CNT)-array double helices under scanning electron microscopy by directly observing their formation process from individual layered double hydroxide flakes, which is a kind of hydrotalcite-like material composed of positively charged layers and charge-balancing interlayer anions. Space confinement is considered to be the most important extrinsic factor for the formation of CNT-array double helices. Synchronous growth of the CNT arrays oppositely from LDH flakes with space confinement on both sides at the same time is essential for the growth of CNT-array double helices. Coiling of the as-grown CNT arrays into double helices will proceed by self-organization, tending to the most stable morphology in order to release their internal rotation stress. Based on the demonstrated mechanism, effective routes were carried out to improve the selectivity for CNT-array double helices. The work provides a promising method for the fabrication of double-helix nanostructures with their two helices connected at the end by self-assembly.

Using quantum dynamics simulations to follow the competition between charge migration and charge transfer in polyatomic molecules

NASA Astrophysics Data System (ADS)

Spinlove, K. E.; Vacher, M.; Bearpark, M.; Robb, M. A.; Worth, G. A.

2017-01-01

Recent work, particularly by Cederbaum and co-workers, has identified the phenomenon of charge migration, whereby charge flow occurs over a static molecular framework after the creation of an electronic wavepacket. In a real molecule, this charge migration competes with charge transfer, whereby the nuclear motion also results in the re-distribution of charge. To study this competition, quantum dynamics simulations need to be performed. To break the exponential scaling of standard grid-based algorithms, approximate methods need to be developed that are efficient yet able to follow the coupled electronic-nuclear motion of these systems. Using a simple model Hamiltonian based on the ionisation of the allene molecule, the performance of different methods based on Gaussian Wavepackets is demonstrated.

Damage to cellular DNA from particulate radiations, the efficacy of its processing and the radiosensitivity of mammalian cells. Emphasis on DNA double strand breaks and chromatin breaks

NASA Technical Reports Server (NTRS)

Lett, J. T.

1992-01-01

For several years, it has been evident that cellular radiation biology is in a necessary period of consolidation and transition (Lett 1987, 1990; Lett et al. 1986, 1987). Both changes are moving apace, and have been stimulated by studies with heavy charged particles. From the standpoint of radiation chemistry, there is now a consensus of opinion that the DNA hydration shell must be distinguished from bulk water in the cell nucleus and treated as an integral part of DNA (chromatin) (Lett 1987). Concomitantly, sentiment is strengthening for the abandonment of the classical notions of "direct" and "indirect" action (Fielden and O'Neill 1991; O'Neill 1991; O'Neill et al. 1991; Schulte-Frohlinde and Bothe 1991 and references therein). A layer of water molecules outside, or in the outer edge of, the DNA (chromatin) hydration shell influences cellular radiosensitivity in ways not fully understood. Charge and energy transfer processes facilitated by, or involving, DNA hydration must be considered in rigorous theories of radiation action on cells. The induction and processing of double stand breaks (DSBs) in DNA (chromatin) seem to be the predominant determinants of the radiotoxicity of normally radioresistant mammalian cells, the survival curves of which reflect the patterns of damage induced and the damage present after processing ceases, and can be modelled in formal terms by the use of reaction (enzyme) kinetics. Incongruities such as sublethal damage are neither scientifically sound nor relevant to cellular radiation biology (Calkins 1991; Lett 1990; Lett et al. 1987a). Increases in linear energy transfer (LET infinity) up to 100-200 keV micron-1 cause increases in the extents of neighboring chemical and physical damage in DNA denoted by the general term DSB. Those changes are accompanied by decreasing abilities of cells normally radioresistant to sparsely ionizing radiations to process DSBs in DNA and chromatin and to recover from radiation exposure, so they make significant contributions to the relative biological effectiveness (RBE) of a given radiation.(ABSTRACT TRUNCATED AT 400 WORDS).

Very low doses of heavy oxygen ion radiation induce premature ovarian failure.

PubMed

Mishra, Birendra; Ripperdan, Ryan; Ortiz, Laura; Luderer, Ulrike

2017-08-01

Astronauts are exposed to charged particles during space travel, and charged particles are also used for cancer radiotherapy. Premature ovarian failure is a well-known side effect of conventional, low linear energy transfer (LET) cancer radiotherapy, but little is known about the effects of high LET charged particles on the ovary. We hypothesized that lower LET (16.5 keV/µm) oxygen particles would be less damaging to the ovary than we previously found for iron (LET = 179 keV/µm). Adult female mice were irradiated with 0, 5, 30 or 50 cGy oxygen ions or 50 cGy oxygen plus dietary supplementation with the antioxidant alpha lipoic acid (ALA). Six-hour after irradiation, percentages of ovarian follicles immunopositive for γH2AX, a marker of DNA double strand breaks, 4-HNE, a marker of oxidative lipid damage and BBC3 (PUMA), a proapoptotic BCL-2 family protein, were dose dependently increased in irradiated mice compared to controls. One week after irradiation, numbers of primordial, primary and secondary follicles per ovary were dose dependently decreased, with complete absence of follicles in the 50 cGy groups. The ED 50 for primordial follicle destruction was 4.6 cGy for oxygen compared to 27.5 cGy for iron in our previous study. Serum FSH and LH concentrations were significantly elevated in 50 cGy groups at 8 week. Supplementation with ALA mitigated the early effects, but not the ultimate depletion of ovarian follicles. In conclusion, oxygen charged particles are even more potent inducers of ovarian follicle depletion than charged iron particles, raising concern for premature ovarian failure in astronauts exposed to both particles during space travel. © 2017 Society for Reproduction and Fertility.

Design of latex-layered double hydroxide composites by tuning the aggregation in suspensions.

PubMed

Pavlovic, Marko; Rouster, Paul; Bourgeat-Lami, Elodie; Prevot, Vanessa; Szilagyi, Istvan

2017-01-25

Colloidal stability of polymeric latex particles was studied in the presence of oppositely charged layered double hydroxide (LDH) platelets of different interlayer anions. Adsorption of the LDH particles led to charge neutralization and to overcharging of the latex at appropriate concentrations. Mixing stable colloidal suspensions of individual particles results in rapid aggregation once the LDH adsorption neutralizes the negative charges of the polymer spheres, while stable suspensions were observed at high and low LDH doses. The governing interparticle interactions included repulsive electrical double layer forces as well as van der Waals and patch-charge attractions, whose strength depended on the amount of LDH particles adsorbed on the latex surface. The type of the LDH interlayer anions did not affect the colloidal stability of the samples. Structural investigation of the obtained latex-LDH composites revealed that the polymer spheres were completely coated with the inorganic platelets once their concentration was sufficiently high. These results are especially important for designing synthetic routes for hybrid systems in suspensions, where stable colloids are required for uniform film-formation and for the homogeneous distribution of the inorganic filler within the composite materials.

State-conditional coherent charge qubit oscillations in a Si/SiGe quadruple quantum dot

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ward, Daniel R.; Kim, Dohun; Savage, Donald E.

Universal quantum computation requires high-fidelity single-qubit rotations and controlled two-qubit gates. Along with high-fidelity single-qubit gates, strong efforts have been made in developing robust two-qubit logic gates in electrically gated quantum dot systems to realise a compact and nanofabrication-compatible architecture. Here we perform measurements of state-conditional coherent oscillations of a charge qubit. Using a quadruple quantum dot formed in a Si/SiGe heterostructure, we show the first demonstration of coherent two-axis control of a double quantum dot charge qubit in undoped Si/SiGe, performing Larmor and Ramsey oscillation measurements. We extract the strength of the capacitive coupling between a pair of doublemore » quantum dots by measuring the detuning energy shift (≈75 μeV) of one double dot depending on the excess charge configuration of the other double dot. Finally, we further demonstrate that the strong capacitive coupling allows fast, state-conditional Landau–Zener–Stückelberg oscillations with a conditional π phase flip time of about 80 ps, showing a promising pathway towards multi-qubit entanglement and control in semiconductor quantum dots.« less

State-conditional coherent charge qubit oscillations in a Si/SiGe quadruple quantum dot

DOE PAGES

Ward, Daniel R.; Kim, Dohun; Savage, Donald E.; ...

2016-10-18

Universal quantum computation requires high-fidelity single-qubit rotations and controlled two-qubit gates. Along with high-fidelity single-qubit gates, strong efforts have been made in developing robust two-qubit logic gates in electrically gated quantum dot systems to realise a compact and nanofabrication-compatible architecture. Here we perform measurements of state-conditional coherent oscillations of a charge qubit. Using a quadruple quantum dot formed in a Si/SiGe heterostructure, we show the first demonstration of coherent two-axis control of a double quantum dot charge qubit in undoped Si/SiGe, performing Larmor and Ramsey oscillation measurements. We extract the strength of the capacitive coupling between a pair of doublemore » quantum dots by measuring the detuning energy shift (≈75 μeV) of one double dot depending on the excess charge configuration of the other double dot. Finally, we further demonstrate that the strong capacitive coupling allows fast, state-conditional Landau–Zener–Stückelberg oscillations with a conditional π phase flip time of about 80 ps, showing a promising pathway towards multi-qubit entanglement and control in semiconductor quantum dots.« less

Piezo-phototronic effect enhanced UV photodetector based on CuI/ZnO double-shell grown on flexible copper microwire.

PubMed

Liu, Jingyu; Zhang, Yang; Liu, Caihong; Peng, Mingzeng; Yu, Aifang; Kou, Jinzong; Liu, Wei; Zhai, Junyi; Liu, Juan

2016-12-01

In this work, we present a facile, low-cost, and effective approach to fabricate the UV photodetector with a CuI/ZnO double-shell nanostructure which was grown on common copper microwire. The enhanced performances of Cu/CuI/ZnO core/double-shell microwire photodetector resulted from the formation of heterojunction. Benefiting from the piezo-phototronic effect, the presentation of piezocharges can lower the barrier height and facilitate the charge transport across heterojunction. The photosensing abilities of the Cu/CuI/ZnO core/double-shell microwire detector are investigated under different UV light densities and strain conditions. We demonstrate the I-V characteristic of the as-prepared core/double-shell device; it is quite sensitive to applied strain, which indicates that the piezo-phototronic effect plays an essential role in facilitating charge carrier transport across the CuI/ZnO heterojunction, then the performance of the device is further boosted under external strain.

Giant plasmon excitation in single and double ionization of C60 by fast highly charged Si and O ions

NASA Astrophysics Data System (ADS)

Kelkar, A. H.; Kadhane, U.; Misra, D.; Tribedi, L. C.

2007-09-01

Se have investigated single and double ionization of C60 molecule in collisions with 2.33 MeV/u Siq+ (q=6-14) and 3.125 MeV/u Oq+ (q=5-8) projectiles. The projectile charge state dependence of the single and double ionization yields of C60 are then compared to those for an ion-atom collision system using Ne gas as a target. A large difference between the gas and the cluster target behaviour was partially explained in terms of a model based on collective excitation namely the giant dipole plasmon resonance (GDPR). The qualitative agreement between the data and GDPR model prediction for single and double ionization signifies the importance of single and double plasmon excitations in the ionization process. A large deviation of the GDPR model for triple and quadruple ionization from the experimental data imply the importance of the other low impact parameter processes such as evaporation, fragmentation and a possible solid-like dynamical screening.

Charge transfer kinetics at the solid-solid interface in porous electrodes

NASA Astrophysics Data System (ADS)

Bai, Peng; Bazant, Martin Z.

2014-04-01

Interfacial charge transfer is widely assumed to obey the Butler-Volmer kinetics. For certain liquid-solid interfaces, the Marcus-Hush-Chidsey theory is more accurate and predictive, but it has not been applied to porous electrodes. Here we report a simple method to extract the charge transfer rates in carbon-coated LiFePO4 porous electrodes from chronoamperometry experiments, obtaining curved Tafel plots that contradict the Butler-Volmer equation but fit the Marcus-Hush-Chidsey prediction over a range of temperatures. The fitted reorganization energy matches the Born solvation energy for electron transfer from carbon to the iron redox site. The kinetics are thus limited by electron transfer at the solid-solid (carbon-LixFePO4) interface rather than by ion transfer at the liquid-solid interface, as previously assumed. The proposed experimental method generalizes Chidsey’s method for phase-transforming particles and porous electrodes, and the results show the need to incorporate Marcus kinetics in modelling batteries and other electrochemical systems.

Resolution of concerted versus sequential mechanisms in photo-induced double-proton transfer reaction in 7-azaindole H-bonded dimer

PubMed Central

Catalán, Javier; del Valle, Juan Carlos; Kasha, Michael

1999-01-01

The experimental and theoretical bases for a synchronous or concerted double-proton transfer in centro-symmetric H-bonded electronically excited molecular dimers are presented. The prototype model is the 7-azaindole dimer. New research offers confirmation of a concerted mechanism for excited-state biprotonic transfer. Recent femtosecond photoionization and coulombic explosion techniques have given rise to time-of-flight MS observations suggesting sequential two-step biprotonic transfer for the same dimer. We interpret the overall species observed in the time-of-flight experiments as explicable without conflict with the concerted mechanism of proton transfer. PMID:10411876

Numerical modeling of heat transfer during hydrogen absorption in thin double-layered annular ZrCo beds

NASA Astrophysics Data System (ADS)

Cui, Yehui; Zeng, Xiangguo; Kou, Huaqin; Ding, Jun; Wang, Fang

2018-06-01

In this work a three-dimensional (3D) hydrogen absorption model was proposed to study the heat transfer behavior in thin double-layered annular ZrCo beds. Numerical simulations were performed to investigate the effects of conversion layer thickness, thermal conductivity, cooling medium and its flow velocity on the efficiency of heat transfer. Results reveal that decreasing the layer thickness and improving the thermal conductivity enhance the ability of heat transfer. Compared with nitrogen and helium, water appears to be a better medium for cooling. In order to achieve the best efficiency of heat transfer, the flow velocity needs to be maximized.

Charge states of ions, and mechanisms of charge ordering transitions

NASA Astrophysics Data System (ADS)

Pickett, Warren E.; Quan, Yundi; Pardo, Victor

2014-07-01

To gain insight into the mechanism of charge ordering transitions, which conventionally are pictured as a disproportionation of an ion M as 2Mn+→M(n+1)+ + M(n-1)+, we (1) review and reconsider the charge state (or oxidation number) picture itself, (2) introduce new results for the putative charge ordering compound AgNiO2 and the dual charge state insulator AgO, and (3) analyze the cationic occupations of the actual (not formal) charge, and work to reconcile the conundrums that arise. We establish that several of the clearest cases of charge ordering transitions involve no disproportion (no charge transfer between the cations, and hence no charge ordering), and that the experimental data used to support charge ordering can be accounted for within density functional-based calculations that contain no charge transfer between cations. We propose that the charge state picture retains meaning and importance, at least in many cases, if one focuses on Wannier functions rather than atomic orbitals. The challenge of modeling charge ordering transitions with model Hamiltonians isdiscussed.

Spectroscopy of charge transfer states in Mg1 - x Ni x O

NASA Astrophysics Data System (ADS)

Churmanov, V. N.; Sokolov, V. I.; Pustovarov, V. A.; Gruzdev, N. B.; Mironova-Ulmane, N.

2016-10-01

Photoluminescence and photoluminescence excitation spectra of solid solution Mg1- x Ni x O ( x = 0.008) have been analyzed. The contributions of charge transfer electronic states and nonradiative Auger relaxation to the formation of the photoluminescence spectrum are discussed.

Charge-transfer complexes and their role in exciplex emission and near-infrared photovoltaics.

PubMed

Ng, Tsz-Wai; Lo, Ming-Fai; Fung, Man-Keung; Zhang, Wen-Jun; Lee, Chun-Sing

2014-08-20

Charge transfer and interactions at organic heterojunctions (OHJs) are known to have critical influences on various properties of organic electronic devices. In this Research News article, a short review is given from the electronic viewpoint on how the local molecular interactions and interfacial energetics at P/N OHJs contribute to the recombination/dissociation of electron-hole pairs. Very often, the P-type materials donate electrons to the N-type materials, giving rise to charge-transfer complexes (CTCs) with a P(δ+) -N(δ-) configuration. A recently observed opposite charge-transfer direction in OHJs is also discussed (i.e., N-type material donates electrons to P-type material to form P(δ-) -N(δ+) ). Recent studies on the electronic structures of CTC-forming material pairs are also summarized. The formation of P(δ-) -N(δ+) -type CTCs and their correlations with exciplex emission are examined. Furthermore, the potential applications of CTCs in NIR photovoltaic devices are reviewed. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Charge transfer and adsorption-desorption kinetics in carbon nanotube and graphene gas sensing

NASA Astrophysics Data System (ADS)

Liang, Sang-Zi; Chen, Gugang; Harutyunyan, Avetik; Cole, Milton; Sofo, Jorge

2014-03-01

Detection of molecules in the gas phase by carbon nanotube and graphene has great application potentials due to the high sensitivity and surface-to-volume ratio. In chemiresistor, the conductance of the materials has been proposed to change as a result of charge transfer from the adsorbed molecules. Due to self-interaction errors, calculations using LDA or GGA density functionals have an innate disadvantage in dealing with charge transfer situations. A model which takes into consideration the dielectric interaction between the graphene surface and the molecule is employed to estimate the distance where charge transfer becomes favorable. Adsorption-desorption kinetics is studied with a modified Langmuir model, including sites from which the molecules do not desorb within the experimental time. Assuming a constant mobility, the model reproduces existing experimental conductance data. Its parameters provide information about the microscopic process during the detection and varying them allows optimization of aspects of sensor performance, including sensitivity, detection limit and response time. This work is supported by Honda Research Institute USA, Inc.

Charge transfer in photorechargeable composite films of TiO2 and polyaniline

NASA Astrophysics Data System (ADS)

Nomiyama, Teruaki; Sasabe, Kenichi; Sakamoto, Kenta; Horie, Yuji

2015-07-01

A photorechargeable battery (PRB) is a photovoltaic device having an energy storage function in a single cell. The photoactive electrode of PRB is a bilayer film consisting of bare porous TiO2 and a TiO2-polyaniline (PANi) mixture that work as a photovoltaic current generator and an electrochemical energy storage by ion dedoping, respectively. To study the charge transfer between TiO2 and PANi, the photorechargeable quantum efficiency QE ([electron count on discharge]/[incident photon count on photocharge]) was measured by varying the thickness LS of the TiO2-PANi mixture. The quantum efficiency QEuv for UV photons had a maximum of ˜7% at LS ˜ 7 µm. The time constant τTP for the charge transfer was about 10-1 s, which was longer ten times or more than the lifetime of excited electrons within TiO2. These facts reveal that the main rate-limiting factor in the photocharging process is the charge transfer between TiO2 and PANi.