Intra- versus intermolecular electron transfer in radical nucleophilic aromatic substitution of dihalo(hetero)arenes – a tool for estimating π-conjugation in aromatic systems† †Electronic supplementary information (ESI) available: Experimental details and procedures, 1H and 13C NMR data, GC traces and mass spectra. CCDC 1526301 and 1526302. For ESI and crystallographic data in CIF or other electronic format see DOI: 10.1039/c7sc00100b Click here for additional data file. Click here for additional data file.

PubMed Central

Janhsen, B.; Daniliuc, C. G.

2017-01-01

In this paper, the application of the double radical nucleophilic aromatic substitution (SRN1) in various dihalogenated, mostly diiodinated, π-conjugated systems as a tool for qualitatively estimating their π-conjugation is described. This approach uses electron delocalisation as a measure of π-conjugation. Electron injection into the π-system is achieved via reaction of an intermediate aryl radical, itself generated from a dihalogenated π-system via SET-reduction of the C–I bond and subsequent reaction with a thiolate anion. The generated arene radical anion can then further react with the second aryl-halogen moiety within the π-system via an intramolecular electron transfer process. The efficiency of this intramolecular electron transfer is related to the π-conjugation of the radical anion. If the π-conjugation within the aromatic unit is weak, the arene radical anion reacts via an intermolecular ET with the starting dihalide. The intramolecular ET process delivers a product of a double SRN1 substitution whereas the intermolecular ET pathway provides a product of a mono- SRN1 substitution. By simple product analysis of mono- versus double substitution, π-conjugation can be qualitatively evaluated. This mechanistic tool is applied to various dihalogenated π-conjugated systems and the results are discussed within the context of π-conjugation. The conjugation mode within the π-system and the length of the aromatic system are varied, and the effect of relative positioning of the two halides within small π-systems is also addressed. PMID:28580099

Proton conduction within the reaction centers of Rhodobacter capsulatus: the electrostatic role of the protein.

PubMed

Maróti, P; Hanson, D K; Baciou, L; Schiffer, M; Sebban, P

1994-06-07

Light-induced charge separation in the photosynthetic reaction center results in delivery of two electrons and two protons to the terminal quinone acceptor QB. In this paper, we have used flash-induced absorbance spectroscopy to study three strains that share identical amino acid sequences in the QB binding site, all of which lack the protonatable amino acids Glu-L212 and Asp-L213. These strains are the photosynthetically incompetent site-specific mutant Glu-L212/Asp-L213-->Ala-L212/Ala-L213 and two different photocompetent derivatives that carry both alanine substitutions and an intergenic suppressor mutation located far from QB (class 3 strain, Ala-Ala + Arg-M231-->Leu; class 4 strain, Ala-Ala + Asn-M43-->Asp). At pH 8 in the double mutant, we observe a concomitant decrease of nearly 4 orders of magnitude in the rate constants of second electron and proton transfer to QB compared to the wild type. Surprisingly, these rates are increased to about the same extent in both types of suppressor strains but remain > 2 orders of magnitude smaller than those of the wild type. In the double mutant, at pH 8, the loss of Asp-L213 and Glu-L212 leads to a substantial stabilization (> or = 60 meV) of the semiquinone energy level. Both types of compensatory mutations partially restore, to nearly the same level, the original free energy difference for electron transfer from primary quinone QA to QB. The pH dependence of the electron and proton transfer processes in the double-mutant and the suppressor strains suggests that when reaction centers of the double mutant are shifted to lower pH (1.5-2 units), they function like those of the suppressor strains at physiological pH. Our data suggest that the main effect of the compensatory mutations is to partially restore the negative electrostatic environment of QB and to increase an apparent "functional" pK of the system for efficient proton transfer to the active site. This emphasizes the role of the protein in tuning the electrostatic environment of its cofactors and highlights the possible long-range electrostatic effects.

Effect of the δ-potential on spin-dependent electron tunneling in double barrier semiconductor heterostructure

NASA Astrophysics Data System (ADS)

Chandrasekar, L. Bruno; Gnanasekar, K.; Karunakaran, M.

2018-06-01

The effect of δ-potential was studied in GaAs/Ga0.6Al0·4As double barrier heterostructure with Dresselhaus spin-orbit interaction. The role of barrier height and position of the δ- potential in the well region was analysed on spin-dependent electron tunneling using transfer matrix method. The spin-separation between spin-resonances on energy scale depends on both height and position of the δ- potential, whereas the tunneling life time of electrons highly influenced by the position of the δ- potential and not on the height. These results might be helpful for the fabrication of spin-filters.

Photoinduced electron transfer in a molecular dyad by nanosecond pump-pump-probe spectroscopy.

PubMed

Ha-Thi, M-H; Pham, V-T; Pino, T; Maslova, V; Quaranta, A; Lefumeux, C; Leibl, W; Aukauloo, A

2018-06-01

The design of robust and inexpensive molecular photocatalysts for the conversion of abundant stable molecules like H2O and CO2 into an energetic carrier is one of the major fundamental questions for scientists nowadays. The outstanding challenge is to couple single photoinduced charge separation events with the sequential accumulation of redox equivalents at the catalytic unit for performing multielectronic catalytic reactions. Herein, double excitation by nanosecond pump-pump-probe experiments was used to interrogate the photoinduced charge transfer and charge accumulation on a molecular dyad composed of a porphyrin chromophore and a ruthenium-based catalyst in the presence of a reversible electron acceptor. An accumulative charge transfer state is unattainable because of rapid reverse electron transfer to the photosensitizer upon the second excitation and the low driving force of the forward photodriven electron transfer reaction. Such a method allows the fundamental understanding of the relaxation mechanism after two sequential photon absorptions, deciphering the undesired electron transfer reactions that limit the charge accumulation efficiency. This study is a step toward the improvement of synthetic strategies of molecular photocatalysts for light-induced charge accumulation and more generally, for solar energy conversion.

Transfer matrix approach to electron transport in monolayer MoS2/MoO x heterostructures

NASA Astrophysics Data System (ADS)

Li, Gen

2018-05-01

Oxygen plasma treatment can introduce oxidation into monolayer MoS2 to transfer MoS2 into MoO x , causing the formation of MoS2/MoO x heterostructures. We find the MoS2/MoO x heterostructures have the similar geometry compared with GaAs/Ga1‑x Al x As semiconductor superlattice. Thus, We employ the established transfer matrix method to analyse the electron transport in the MoS2/MoO x heterostructures with double-well and step-well geometries. We also considere the coupling between transverse and longitudinal kinetic energy because the electron effective mass changes spatially in the MoS2/MoO x heterostructures. We find the resonant peaks show red shift with the increasing of transverse momentum, which is similar to the previous work studying the transverse-momentum-dependent transmission in GaAs/Ga1‑x Al x As double-barrier structure. We find electric field can enhance the magnitude of peaks and intensify the coupling between longitudinal and transverse momentums. Moreover, higher bias is applied to optimize resonant tunnelling condition to show negative differential effect can be observed in the MoS2/MoO x system.

Electrochemical capacitance modulation in an interacting mesoscopic capacitor induced by internal charge transfer

NASA Astrophysics Data System (ADS)

Liu, Wei; He, Jianhong; Guo, Huazhong; Gao, Jie

2018-04-01

We report experiments on the dynamic response of an interacting mesoscopic capacitor consisting of a quantum dot with two confined spin-split levels of the lowest Landau level. In high magnetic fields, states inside the dot are regulated by a mixture of Coulomb interaction and Landau-level quantization, and electrons distribute on two spatially separated regions. Quantum point contact voltage and magnetic field are employed to manipulate the number and distribution of electrons inside the quantum dot. We find that the periodicity of the electrochemical capacitance oscillations is dominated by the charging energy, and their amplitudes, due to internal charge transfer and strong internal capacitive coupling, show rich variations of modulations. Magnetocapacitance displays a sawtoothlike manner and may differ in tooth directions for different voltages, which, we demonstrate, result from a sawtoothlike electrochemical potential change induced by internal charge transfer and field-sensitive electrostatic potential. We further build a charge stability diagram, which, together with all other capacitance properties, is consistently interpreted in terms of a double-dot model. The demonstrated technique is of interest as a tool for fast and sensitive charge state readout of a double-quantum-dot qubit in the gigahertz frequency quantum electronics.

Spin qubit transport in a double quantum dot

NASA Astrophysics Data System (ADS)

Zhao, Xinyu; Hu, Xuedong

Long distance spin communication is a crucial ingredient to scalable quantum computer architectures based on electron spin qubits. One way to transfer spin information over a long distance on chip is via electron transport. Here we study the transport of an electron spin qubit in a double quantum dot by tuning the interdot detuning voltage. We identify a parameter regime where spin relaxation hot-spots can be avoided and high-fidelity spin transport is possible. Within this parameter space, the spin transfer fidelity is determined by the operation speed and the applied magnetic field. In particular, near zero detuning, a proper choice of operation speed is essential to high fidelity. In addition, we also investigate the modification of the effective g-factor by the interdot detuning, which could lead to a phase error between spin up and down states. The results presented in this work could be a useful guidance for experimentally achieving high-fidelity spin qubit transport. We thank financial support by US ARO via Grant W911NF1210609.

Organic doping of rotated double layer graphene

DOE Office of Scientific and Technical Information (OSTI.GOV)

George, Lijin; Jaiswal, Manu, E-mail: manu.jaiswal@iitm.ac.in

2016-05-06

Charge transfer techniques have been extensively used as knobs to tune electronic properties of two- dimensional systems, such as, for the modulation of conductivity \\ mobility of single layer graphene and for opening the bandgap in bilayer graphene. The charge injected into the graphene layer shifts the Fermi level away from the minimum density of states point (Dirac point). In this work, we study charge transfer in rotated double-layer graphene achieved by the use of organic dopant, Tetracyanoquinodimethane. Naturally occurring bilayer graphene has a well-defined A-B stacking whereas in rotated double-layer the two graphene layers are randomly stacked with differentmore » rotational angles. This rotation is expected to significantly alter the interlayer interaction. Double-layer samples are prepared using layer-by-layer assembly of chemical vapor deposited single-layer graphene and they are identified by characteristic resonance in the Raman spectrum. The charge transfer and distribution of charges between the two graphene layers is studied using Raman spectroscopy and the results are compared with that for single-layer and A-B stacked bilayer graphene doped under identical conditions.« less

Electron transfer flavoprotein domain II orientation monitored using double electron-electron resonance between an enzymatically reduced, native FAD cofactor, and spin labels

PubMed Central

Swanson, Michael A; Kathirvelu, Velavan; Majtan, Tomas; Frerman, Frank E; Eaton, Gareth R; Eaton, Sandra S

2011-01-01

Human electron transfer flavoprotein (ETF) is a soluble mitochondrial heterodimeric flavoprotein that links fatty acid β-oxidation to the main respiratory chain. The crystal structure of human ETF bound to medium chain acyl-CoA dehydrogenase indicates that the flavin adenine dinucleotide (FAD) domain (αII) is mobile, which permits more rapid electron transfer with donors and acceptors by providing closer access to the flavin and allows ETF to accept electrons from at least 10 different flavoprotein dehydrogenases. Sequence homology is high and low-angle X-ray scattering is identical for Paracoccus denitrificans (P. denitrificans) and human ETF. To characterize the orientations of the αII domain of P. denitrificans ETF, distances between enzymatically reduced FAD and spin labels in the three structural domains were measured by double electron-electron resonance (DEER) at X- and Q-bands. An FAD to spin label distance of 2.8 ± 0.15 nm for the label in the FAD-containing αII domain (A210C) agreed with estimates from the crystal structure (3.0 nm), molecular dynamics simulations (2.7 nm), and rotamer library analysis (2.8 nm). Distances between the reduced FAD and labels in αI (A43C) were between 4.0 and 4.5 ± 0.35 nm and for βIII (A111C) the distance was 4.3 ± 0.15 nm. These values were intermediate between estimates from the crystal structure of P. denitrificans ETF and a homology model based on substrate-bound human ETF. These distances suggest that the αII domain adopts orientations in solution that are intermediate between those which are observed in the crystal structures of free ETF (closed) and ETF bound to a dehydrogenase (open). PMID:21308847

Tracing the transition of a macro electron shuttle into nonlinear response

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Chulki; Prada, Marta; Qin, Hua

We present a study on a macroscopic electron shuttle in the transition from linear to nonlinear response. The shuttle consists of a classical mechanical pendulum situated between two capacitor plates. The metallic pendulum enables mechanical transfer of electrons between the plates, hence allowing to directly trace electron shuttling in the time domain. By applying a high voltage to the plates, we drive the system into a controlled nonlinear response, where we observe period doubling.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ghosh, Soumya; Soudackov, Alexander V.; Hammes-Schiffer, Sharon

Electron transfer and proton coupled electron transfer (PCET) reactions at electrochemical interfaces play an essential role in a broad range of energy conversion processes. The reorganization energy, which is a measure of the free energy change associated with solute and solvent rearrangements, is a key quantity for calculating rate constants for these reactions. We present a computational method for including the effects of the double layer and ionic environment of the diffuse layer in calculations of electrochemical solvent reorganization energies. This approach incorporates an accurate electronic charge distribution of the solute within a molecular-shaped cavity in conjunction with a dielectricmore » continuum treatment of the solvent, ions, and electrode using the integral equations formalism polarizable continuum model. The molecule-solvent boundary is treated explicitly, but the effects of the electrode-double layer and double layer-diffuse layer boundaries, as well as the effects of the ionic strength of the solvent, are included through an external Green’s function. The calculated total reorganization energies agree well with experimentally measured values for a series of electrochemical systems, and the effects of including both the double layer and ionic environment are found to be very small. This general approach was also extended to electrochemical PCET and produced total reorganization energies in close agreement with experimental values for two experimentally studied PCET systems. This research was supported as part of the Center for Molecular Electrocatalysis, an Energy Frontier Research Center, funded by the U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences.« less

Direct electron-impact mechanism of excitation of mercury monobromide in a double-pulse dielectric-barrier-discharge HgBr lamp

NASA Astrophysics Data System (ADS)

Datsyuk, V. V.; Izmailov, I. A.; Naumov, V. V.; Kochelap, V. A.

2016-08-01

In a nonequlibrium plasma of a gas-discharge HgBr lamp, the terminal electronic state of the HgBr(B-X) radiative transition with a peak wavelength of 502 nm remains populated for a relatively long time and is repeatedly excited to the B state in collisions with plasma electrons. This transfer of the HgBr molecules from the ground state X to the excited state B is the main mechanism of formation of the light-emitting molecules especially when the lamp is excited by double current pulses. According to our simulations, due to the electron-induced transitions between HgBr(X) and HgBr(B), the output characteristics of the DBD lamp operating in a double-pulse regime are better than those of the lamp operating in a single-pulse regime. In the considered case, the peak power is calculated to increase by a factor of about 2 and the lamp efficiency increases by about 50%.

Critical Assessment of Theoretical Methods for Li3+ Collisions with He at Intermediate and High Impact Energies

NASA Astrophysics Data System (ADS)

Belkić, Dževad; Mančev, Ivan; Milojevićb, Nenad

2013-09-01

The total cross sections for the various processes for Li3+-He collisions at intermediate-to-high impact energies are compared with the corresponding theories. The possible reasons for the discrepancies among various theoretical predictions are thoroughly discussed. Special attention has been paid to single and double electron capture, simultaneous transfer and ionization, as well as to single and double ionization.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watanabe, N.; Takahashi, M.; Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, Sendai 980-8577

The double processes of He in electron-impact ionization, single ionization with simultaneous excitation and double ionization, have been studied at large momentum transfer using an energy- and momentum-dispersive binary (e,2e) spectrometer. The experiment has been performed at an impact energy of 2080 eV in the symmetric noncoplanar geometry. In this way we have achieved a large momentum transfer of 9 a.u., a value that has never been realized so far for the study on double ionization. The measured (e,2e) and (e,3-1e) cross sections for transitions to the n=2 excited state of He{sup +} and to doubly ionized He{sup 2+} aremore » presented as normalized intensities relative to that to the n=1 ground state of He{sup +}. The results are compared with first-order plane-wave impulse approximation (PWIA) calculations using various He ground-state wave functions. It is shown that shapes of the momentum-dependent (e,2e) and (e,3-1e) cross sections are well reproduced by the PWIA calculations only when highly correlated wave functions are employed. However, noticeable discrepancies between experiment and theory remain in magnitude for both the double processes, suggesting the importance of higher-order effects under the experimental conditions examined as well as of acquiring more complete knowledge of electron correlation in the target.« less

The mechanism and regularity of quenching the effect of bases on fluorophores: the base-quenched probe method.

PubMed

Mao, Huihui; Luo, Guanghua; Zhan, Yuxia; Zhang, Jun; Yao, Shuang; Yu, Yang

2018-04-30

The base-quenched probe method for detecting single nucleotide polymorphisms (SNPs) relies on real-time PCR and melting-curve analysis, which might require only one pair of primers and one probe. At present, it has been successfully applied to detect SNPs of multiple genes. However, the mechanism of the base-quenched probe method remains unclear. Therefore, we investigated the possible mechanism of fluorescence quenching by DNA bases in aqueous solution using spectroscopic techniques. It showed that the possible mechanism might be photo-induced electron transfer. We next analyzed electron transfer or transmission between DNA bases and fluorophores. The data suggested that in single-stranded DNA, the electrons of the fluorophore are transferred to the orbital of pyrimidine bases (thymine (T) and cytosine (C)), or that the electron orbitals of the fluorophore are occupied by electrons from purine bases (guanine (G) and adenine (A)), which lead to fluorescence quenching. In addition, the electrons of a fluorophore excited by light can be transmitted along double-stranded DNA, which gives rise to stronger fluorescence quenching. Furthermore, we demonstrated that the quenching efficiency of bases is in the order of G > C ≥ A ≥ T and the capability of electron transmission of base-pairs in double-stranded DNA is in the order of CG[combining low line] ≥ GC[combining low line] > TA[combining low line] ≥ AT[combining low line] (letters representing bases on the complementary strand of the probe are bold and underlined), and the most common commercial fluorophores including FAM, HEX, TET, JOE, and TAMRA could be influenced by bases and are in line with this mechanism and regularity.

Quantitative analysis of intramolecular exciplex and electron transfer in a double-linked zinc porphyrin-fullerene dyad.

PubMed

Al-Subi, Ali Hanoon; Niemi, Marja; Tkachenko, Nikolai V; Lemmetyinen, Helge

2012-10-04

Photoinduced charge transfer in a double-linked zinc porphyrin-fullerene dyad is studied. When the dyad is excited at the absorption band of the charge-transfer complex (780 nm), an intramolecular exciplex is formed, followed by the complete charge separated (CCS) state. By analyzing the results obtained from time-resolved transient absorption and emission decay measurements in a range of solvents with different polarities, we derived a dependence between the observable lifetimes and internal parameters controlling the reaction rate constants based on the semiquantum Marcus electron-transfer theory. The critical value of the solvent polarity was found to be ε(r) ≈ 6.5: in solvents with higher dielectric constants, the energy of the CCS state is lower than that of the exciplex and the relaxation takes place via the CCS state predominantly, whereas in solvents with lower polarities the energy of the CCS state is higher and the exciplex relaxes directly to the ground state. In solvents with moderate polarities the exciplex and the CCS state are in equilibrium and cannot be separated spectroscopically. The degree of the charge shift in the exciplex relative to that in the CCS state was estimated to be 0.55 ± 0.02. The electronic coupling matrix elements for the charge recombination process and for the direct relaxation of the exciplex to the ground state were found to be 0.012 ± 0.001 and 0.245 ± 0.022 eV, respectively.

Mechanistic information from the first volume profile analysis for a reversible intermolecular electron-transfer reaction involving pentaammine(isonicotinamide)ruthenium and cytochrome c

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baensch, B.; Meier, M.; Martinez, P.

1994-10-12

The reversible intermolecular electron-transfer reaction between pentaammine(isonicotinamide)ruthenium(II/III) and horse-heart cytochrome c iron(III/II) was subjected to a detailed kinetic and thermodynamic study as a function of temperature and pressure. Theoretical calculations based on the Marcus-Hush theory were employed to predict all rate and equilibrium constants as well as activation parameters. There is an excellent agreement between the kinetically and thermodynamically determined equilibrium constants and associated pressure parameters. These data are used to construct a volume profile for the overall process, from which it follows that the transition state lies halfway between the reactant and product states on a volume basis. Themore » reorganization in the transition state has reached a similar degree in both directions of the electron-transfer process and corresponds to a {lambda}{sup {double_dagger}} value of 0.44 for this reversible reaction. This is the first complete volume profile analysis for a reversible intermolecular electron-transfer reaction.« less

Effect of magnetic exchange, double exchange, vibronic coupling, and asymmetry on magnetic properties in d2-d3 mixed-valence dimers

NASA Astrophysics Data System (ADS)

Yang, Xiaohua; Hu, Haiquan; Chen, Zhida

The effect of magnetic exchange, double exchange, vibronic coupling, and asymmetry on magnetic properties of d2-d3 systems is discussed. The temperature-dependent magnetic moment was calculated with the semiclassical adiabatic approach. The results show that the vibronic coupling from the out-of-phase breathing vibration on the metal sites (Piepho, Krausz, and Schatz [PKS] model) and the vibronic coupling from the stretching vibration between the metal sites (P model) favor the localization and delocalization of the "extra" electron in mixed-valence dimers, respectively. The magnetic properties are determined by the interplay among magnetic exchange, double exchange, and vibronic coupling. The results obtained by analyzing d2-d3 systems can be generalized to other full delocalized dinuclear mixed valence systems with a unique transferable electron.

DEER distance measurement between a spin label and a native FAD semiquinone in electron transfer flavoprotein.

PubMed

Swanson, Michael A; Kathirvelu, Velavan; Majtan, Tomas; Frerman, Frank E; Eaton, Gareth R; Eaton, Sandra S

2009-11-11

The human mitochondrial electron transfer flavoprotein (ETF) accepts electrons from at least 10 different flavoprotein dehydrogenases and transfers electrons to a single electron acceptor in the inner membrane. Paracoccus denitrificans ETF has the identical function, shares the same three-dimensional structure and functional domains, and exhibits the same conformational mobility. It has been proposed that the mobility of the alphaII domain permits the promiscuous behavior of ETF with respect to a variety of redox partners. Double electron-electron resonance (DEER) measurements between a spin label and an enzymatically reduced flavin adenine dinucleotide (FAD) cofactor in P. denitrificans ETF gave two distributions of distances: a major component centered at 4.2 +/- 0.1 nm and a minor component centered at 5.1 +/- 0.2 nm. Both components had widths of approximately 0.3 nm. A distance of 4.1 nm was calculated using the crystal structure of P. denitrificans ETF, which agrees with the major component obtained from the DEER measurement. The observation of a second distribution suggests that ETF, in the absence of substrate, adopts some conformations that are intermediate between the predominant free and substrate-bound states.

DEER Distance Measurement Between a Spin Label and a Native FAD Semiquinone in Electron Transfer Flavoprotein

PubMed Central

Swanson, Michael A.; Kathirvelu, Velavan; Majtan, Tomas; Frerman, Frank E.; Eaton, Gareth R.; Eaton, Sandra S.

2009-01-01

The human mitochondrial electron transfer flavoprotein (ETF) accepts electrons from at least 10 different flavoprotein dehydrogenases and transfers electrons to a single electron acceptor in the inner membrane. Paracoccus denitrificans ETF has the identical function, shares the same three dimensional structure and functional domains, and exhibits the same conformational mobility. It has been proposed that the mobility of the αII domain permits the promiscuous behavior of ETF with respect to a variety of redox partners. Double electron-electron resonance (DEER) measurements between a spin label and an enzymatically reduced flavin adenine dinucleotide (FAD) cofactor in P. denitrificans ETF gave two distributions of distances: a major component centered at 4.2 ± 0.1 nm and a minor component centered at 5.1 ± 0.2 nm. Both components had widths of approximately 0.3 nm. A distance of 4.1 nm was calculated using the crystal structure of P. denitrificans ETF, which agrees with the major component obtained from the DEER measurement. The observation of a second distribution suggests that ETF, in the absence of substrate, adopts some conformations that are intermediate between the predominant free and substrate-bound states. PMID:19886689

Copper-Containing Nitrite Reductase Employing Proton-Coupled Spin-Exchanged Electron-Transfer and Multiproton Synchronized Transfer to Reduce Nitrite.

PubMed

Qin, Xin; Deng, Li; Hu, Caihong; Li, Li; Chen, Xiaohua

2017-10-20

The possible catalytic mechanism of the reduction of nitrite by copper-containing nitrite reductases (CuNiRs) is examined by using the M06 function according to two copper models, which include type-one copper (T1Cu) and type-two copper (T2Cu) sites. Examinations confirm that the protonation of two residues, His255 and Asp98, near the T2Cu site, can modulate the redox states of T1Cu and T2Cu, but cannot directly cause electron transfer from T1Cu to T2Cu. The electron hole remains at the T2Cu site when only one residue, His255 or Asp98, is protonated. However, the hole resides at the T1Cu site when both His255 and Asp98 are protonated. Then, the first protonation of nitrite takes place through indirect proton transfer from protonated His255 through the bridging H 2 O and Asp98 with three protons moving together, which cannot cause the cleavage of the HO-NO bond. Subsequently, the substrate is required to obtain another proton from reprotonated His255 through the bridging H 2 O. The reprotonation of nitrite induces the generation of nitric oxide (NO) and H 2 O at the T2Cu site through a special double-proton-coupled spin-exchanged electron-transfer mechanism with indirect proton transfer from His255 to the substrate, a beta-electron of T2Cu I shift to the NO cation, and the remaining alpha-electron changing spin direction at the same time. These results may provide useful information to better understand detailed proton-/electron-transfer reactions for the catalytic processes of CuNiR. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Inner- and outer-wall sorting of double-walled carbon nanotubes

NASA Astrophysics Data System (ADS)

Li, Han; Gordeev, Georgy; Wasserroth, Sören; Chakravadhanula, Venkata Sai Kiran; Neelakandhan, Shyam Kumar Chethala; Hennrich, Frank; Jorio, Ado; Reich, Stephanie; Krupke, Ralph; Flavel, Benjamin Scott

2017-12-01

Double-walled carbon nanotubes (DWCNTs) consist of two coaxially aligned single-walled carbon nanotubes (SWCNTs), and previous sorting methods only achieved outer-wall electronic-type selectivity. Here, a separation technique capable of sorting DWCNTs by semiconducting (S) or metallic (M) inner- and outer-wall electronic type is presented. Electronic coupling between the inner and outer wall is used to alter the surfactant coating around each of the DWCNT types, and aqueous gel permeation is used to separate them. Aqueous methods are used to remove SWCNT species from the raw material and prepare enriched DWCNT fractions. The enriched DWCNT fractions are then transferred into either chlorobenzene or toluene using the copolymer PFO-BPy to yield the four inner@outer combinations of M@M, M@S, S@M and S@S. The high purity of the resulting fractions is verified by absorption measurements, transmission electron microscopy, atomic force microscopy, resonance Raman mapping and high-density field-effect transistor devices.

Inner- and outer-wall sorting of double-walled carbon nanotubes.

PubMed

Li, Han; Gordeev, Georgy; Wasserroth, Sören; Chakravadhanula, Venkata Sai Kiran; Neelakandhan, Shyam Kumar Chethala; Hennrich, Frank; Jorio, Ado; Reich, Stephanie; Krupke, Ralph; Flavel, Benjamin Scott

2017-12-01

Double-walled carbon nanotubes (DWCNTs) consist of two coaxially aligned single-walled carbon nanotubes (SWCNTs), and previous sorting methods only achieved outer-wall electronic-type selectivity. Here, a separation technique capable of sorting DWCNTs by semiconducting (S) or metallic (M) inner- and outer-wall electronic type is presented. Electronic coupling between the inner and outer wall is used to alter the surfactant coating around each of the DWCNT types, and aqueous gel permeation is used to separate them. Aqueous methods are used to remove SWCNT species from the raw material and prepare enriched DWCNT fractions. The enriched DWCNT fractions are then transferred into either chlorobenzene or toluene using the copolymer PFO-BPy to yield the four inner@outer combinations of M@M, M@S, S@M and S@S. The high purity of the resulting fractions is verified by absorption measurements, transmission electron microscopy, atomic force microscopy, resonance Raman mapping and high-density field-effect transistor devices.

Electron transfer flavoprotein domain II orientation monitored using double electron-electron resonance between an enzymatically reduced, native FAD cofactor, and spin labels.

PubMed

Swanson, Michael A; Kathirvelu, Velavan; Majtan, Tomas; Frerman, Frank E; Eaton, Gareth R; Eaton, Sandra S

2011-03-01

Human electron transfer flavoprotein (ETF) is a soluble mitochondrial heterodimeric flavoprotein that links fatty acid β-oxidation to the main respiratory chain. The crystal structure of human ETF bound to medium chain acyl-CoA dehydrogenase indicates that the flavin adenine dinucleotide (FAD) domain (αII) is mobile, which permits more rapid electron transfer with donors and acceptors by providing closer access to the flavin and allows ETF to accept electrons from at least 10 different flavoprotein dehydrogenases. Sequence homology is high and low-angle X-ray scattering is identical for Paracoccus denitrificans (P. denitrificans) and human ETF. To characterize the orientations of the αII domain of P. denitrificans ETF, distances between enzymatically reduced FAD and spin labels in the three structural domains were measured by double electron-electron resonance (DEER) at X- and Q-bands. An FAD to spin label distance of 2.8 ± 0.15 nm for the label in the FAD-containing αII domain (A210C) agreed with estimates from the crystal structure (3.0 nm), molecular dynamics simulations (2.7 nm), and rotamer library analysis (2.8 nm). Distances between the reduced FAD and labels in αI (A43C) were between 4.0 and 4.5 ± 0.35 nm and for βIII (A111C) the distance was 4.3 ± 0.15 nm. These values were intermediate between estimates from the crystal structure of P. denitrificans ETF and a homology model based on substrate-bound human ETF. These distances suggest that the αII domain adopts orientations in solution that are intermediate between those which are observed in the crystal structures of free ETF (closed) and ETF bound to a dehydrogenase (open). Copyright © 2011 The Protein Society.

Micellar control over tautomerization and photo-induced electron transfer of Lumichrome in the presence of aliphatic and aromatic amines: a transient absorption study

NASA Astrophysics Data System (ADS)

Sengupta, Chaitrali; Sarangi, Manas Kumar; Sau, Abhishek; Basu, Samita

2017-03-01

Lumichrome (Lc), a molecule consisting of a trinuclear alloxazine moiety is our present subject of interest. This molecule is subjected to tautomerization in the presence of pyridine, acetic acid, etc, through the formation of an eight-membered ring. In our present contribution, we have attempted to analyze the influence of the presence of an aliphatic amine, triethylamine (TEA) and an aromatic amine, N,N-dimethylaniline (DMA) in the double proton transfer step of the tautomerization as well as the photo-induced electron transfer (PET) from those amines to Lc. We have studied these phenomena within micelles, anionic and neutral, to observe the effect of confinement. Through our experiments, it could be stated that along with tautomerization and proton transfer, there is also evidence of PET in triplet excited state.

A molecularly based theory for electron transfer reorganization energy.

PubMed

Zhuang, Bilin; Wang, Zhen-Gang

2015-12-14

Using field-theoretic techniques, we develop a molecularly based dipolar self-consistent-field theory (DSCFT) for charge solvation in pure solvents under equilibrium and nonequilibrium conditions and apply it to the reorganization energy of electron transfer reactions. The DSCFT uses a set of molecular parameters, such as the solvent molecule's permanent dipole moment and polarizability, thus avoiding approximations that are inherent in treating the solvent as a linear dielectric medium. A simple, analytical expression for the free energy is obtained in terms of the equilibrium and nonequilibrium electrostatic potential profiles and electric susceptibilities, which are obtained by solving a set of self-consistent equations. With no adjustable parameters, the DSCFT predicts activation energies and reorganization energies in good agreement with previous experiments and calculations for the electron transfer between metallic ions. Because the DSCFT is able to describe the properties of the solvent in the immediate vicinity of the charges, it is unnecessary to distinguish between the inner-sphere and outer-sphere solvent molecules in the calculation of the reorganization energy as in previous work. Furthermore, examining the nonequilibrium free energy surfaces of electron transfer, we find that the nonequilibrium free energy is well approximated by a double parabola for self-exchange reactions, but the curvature of the nonequilibrium free energy surface depends on the charges of the electron-transferring species, contrary to the prediction by the linear dielectric theory.

Double proton transfer behavior and one-electron oxidation effect in double H-bonded glycinamide-formic acid complex.

PubMed

Li, Ping; Bu, Yuxiang

2004-11-22

The behavior of double proton transfer occurring in a representative glycinamide-formic acid complex has been investigated at the B3LYP/6-311 + + G( * *) level of theory. Thermodynamic and, especially, kinetic parameters, such as tautomeric energy, equilibrium constant, and barrier heights have been discussed, respectively. The relevant quantities involved in the double proton transfer process, such as geometrical changes, interaction energies, and intrinsic reaction coordinate calculations have also been studied. Computational results show that the participation of a formic acid molecule favors the proceeding of the proton transfer for glycinamide compared with that without mediate-assisted case. The double proton transfer process proceeds with a concerted mechanism rather than a stepwise one since no ion-pair complexes have been located during the proton transfer process. The calculated barrier heights are 11.48 and 0.85 kcal/mol for the forward and reverse directions, respectively. However, both of them have been reduced by 2.95 and 2.61 kcal/mol to 8.53 and -1.76 kcal/mol if further inclusion of zero-point vibrational energy corrections, where the negative barrier height implies that the reverse reaction should proceed with barrierless spontaneously, analogous to that occurring between glycinamide and formamide. Furthermore, solvent effects on the thermodynamic and kinetic processes have also been predicted qualitatively employing the isodensity surface polarized continuum model within the framework of the self-consistent reaction field theory. Additionally, the oxidation process for the double H-bonded glycinamide-formic acid complex has also been investigated. Contrary to that neutral form possessing a pair of two parallel intermolecular H bonds, only a single H bond with a comparable strength has been found in its ionized form. The vertical and adiabatic ionization potentials for the neutral complex have been determined to be about 9.40 and 8.69 eV, respectively, where ionization is mainly localized on the glycinamide fragment. Like that ionized glycinamide-formamide complex, the proton transfer in the ionized complex is characterized by a single-well potential, implying that the proton initially attached to amide N4 in the glycinamide fragment cannot be transferred to carbonyl O13 in the formic acid fragment at the geometry of the optimized complex. Copyright 2004 American Institute of Physics.

Design of butterfly type organic dye sensitizers with double electron donors: The first principle study

NASA Astrophysics Data System (ADS)

Yang, Zhenqing; Shao, Di; Li, Juan; Tang, Lian; Shao, Changjin

2018-05-01

In this work, we designed a series of butterfly type organic dyes, named ME07-ME13 by introducing such as triphenylamine, phenothiazine, coumarin groups etc. as electron donors and further investigated their absorption spectra using density functional theory (DFT) and time-dependent DFT (TDDFT). All designed dyes cover the entire visible absorption spectrum from 300 to 800 nm. It's fascinating that ME13 molecule has two absorption peak and the molar coefficient of two absorption peaks are above 4.645 × 104 M-1·cm-1. The light absorption area of ME13 exhibits an increment of 16.5-19.1% compared to ME07-ME12. Furthermore, we performed a detailed analysis on their geometrical and electronic properties, including molecular structures, energy levels, light harvesting efficiency (LHE), driving force (ΔGinject), regeneration (ΔGregen),electron dipole moments (μnormal), intermolecular electron transfer and dye/(TiO2)38 system electron transitions. The results of calculation reveal that double coumarin donors in ME13 are promising functional groups for butterfly type organic dye sensitizers. It is expected that the design of double donors can provide a new strategy and guidance for the investigation in high efficiency dye-sensitized devices.

Enhanced one-photon double ionization of atoms and molecules in an environment of different species.

PubMed

Stumpf, V; Kryzhevoi, N V; Gokhberg, K; Cederbaum, L S

2014-05-16

The correlated nature of electronic states in atoms and molecules is manifested in the simultaneous emission of two electrons after absorption of a single photon close to the respective threshold. Numerous observations in atoms and small molecules demonstrate that the double ionization efficiency close to threshold is rather small. In this Letter we show that this efficiency can be dramatically enhanced in the environment. To be specific, we concentrate on the case where the species in question has one or several He atoms as neighbors. The enhancement is achieved by an indirect process, where a He atom of the environment absorbs a photon and the resulting He(+) cation is neutralized fast by a process known as electron transfer mediated decay, producing thereby doubly ionized species. The enhancement of the double ionization is demonstrated in detail for the example of the Mg · He cluster. We show that the double ionization cross section of Mg becomes 3 orders of magnitude larger than the respective cross section of the isolated Mg atom. The impact of more neighbors is discussed and the extension to other species and environments is addressed.

Two-Photon Study on the Electronic Interactions between the First Excited Singlet States in Carotenoid-Tetrapyrrole Dyads

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liao, Pen-Nan; Pillai, Smitha; Gust, Devens

Electronic interactions between the first excited states (S 1) of carotenoids (Car) of different conjugation lengths (8-11 double bonds) and phthalocyanines (Pc) in different Car-Pc dyad molecules were investigated by two-photon spectroscopy and compared with Car S 1-chlorophyll (Chl) interactions in photosynthetic light harvesting complexes (LHCs). The observation of Chl/Pc fluorescence after selective two-photon excitation of the Car S 1 state allowed sensitive monitoring of the flow of energy between Car S 1 and Pc or Chl. It is found that two-photon excitation excites to about 80% to 100% exclusively the carotenoid state Car S 1 and that only amore » small fraction of direct tetrapyrrole two-photon excitation occurs. Amide-linked Car-Pc dyads in tetrahydrofuran demonstrate a molecular gear shift mechanism in that effective Car S 1 → Pc energy transfer is observed in a dyad with 9 double bonds in the carotenoid, whereas in similar dyads with 11 double bonds in the carotenoid, the Pc fluorescence is strongly quenched by Pc → Car S 1 energy transfer. In phenylamino-linked Car-Pc dyads in toluene extremely large electronic interactions between the Car S 1 state and Pc were observed, particularly in the case of a dyad in which the carotenoid contained 10 double bonds. This observation together with previous findings in the same system provides strong evidence for excitonic Car S 1-Pc Q y interactions. Very similar results were observed with photosynthetic LHC II complexes in the past, supporting an important role of such interactions in photosynthetic down-regulation.« less

High-level ab initio potential energy surface and dynamics of the F- + CH3I SN2 and proton-transfer reactions.

PubMed

Olasz, Balázs; Szabó, István; Czakó, Gábor

2017-04-01

Bimolecular nucleophilic substitution (S N 2) and proton transfer are fundamental processes in chemistry and F - + CH 3 I is an important prototype of these reactions. Here we develop the first full-dimensional ab initio analytical potential energy surface (PES) for the F - + CH 3 I system using a permutationally invariant fit of high-level composite energies obtained with the combination of the explicitly-correlated CCSD(T)-F12b method, the aug-cc-pVTZ basis, core electron correlation effects, and a relativistic effective core potential for iodine. The PES accurately describes the S N 2 channel producing I - + CH 3 F via Walden-inversion, front-side attack, and double-inversion pathways as well as the proton-transfer channel leading to HF + CH 2 I - . The relative energies of the stationary points on the PES agree well with the new explicitly-correlated all-electron CCSD(T)-F12b/QZ-quality benchmark values. Quasiclassical trajectory computations on the PES show that the proton transfer becomes significant at high collision energies and double-inversion as well as front-side attack trajectories can occur. The computed broad angular distributions and hot internal energy distributions indicate the dominance of indirect mechanisms at lower collision energies, which is confirmed by analyzing the integration time and leaving group velocity distributions. Comparison with available crossed-beam experiments shows usually good agreement.

Improving the efficiency of water splitting in dye-sensitized solar cells by using a biomimetic electron transfer mediator

PubMed Central

Zhao, Yixin; Swierk, John R.; Megiatto, Jackson D.; Sherman, Benjamin; Youngblood, W. Justin; Qin, Dongdong; Lentz, Deanna M.; Moore, Ana L.; Moore, Thomas A.; Gust, Devens; Mallouk, Thomas E.

2012-01-01

Photoelectrochemical water splitting directly converts solar energy to chemical energy stored in hydrogen, a high energy density fuel. Although water splitting using semiconductor photoelectrodes has been studied for more than 40 years, it has only recently been demonstrated using dye-sensitized electrodes. The quantum yield for water splitting in these dye-based systems has, so far, been very low because the charge recombination reaction is faster than the catalytic four-electron oxidation of water to oxygen. We show here that the quantum yield is more than doubled by incorporating an electron transfer mediator that is mimetic of the tyrosine-histidine mediator in Photosystem II. The mediator molecule is covalently bound to the water oxidation catalyst, a colloidal iridium oxide particle, and is coadsorbed onto a porous titanium dioxide electrode with a Ruthenium polypyridyl sensitizer. As in the natural photosynthetic system, this molecule mediates electron transfer between a relatively slow metal oxide catalyst that oxidizes water on the millisecond timescale and a dye molecule that is oxidized in a fast light-induced electron transfer reaction. The presence of the mediator molecule in the system results in photoelectrochemical water splitting with an internal quantum efficiency of approximately 2.3% using blue light. PMID:22547794

Electronic phase transition in hollandite titanates BaxTi8O16 +δ

NASA Astrophysics Data System (ADS)

Murata, R.; Sato, T.; Okuda, T.; Horibe, Y.; Tsukasaki, H.; Mori, S.; Yamaguchi, N.; Sugimoto, K.; Kawaguchi, S.; Takata, M.; Katsufuji, T.

2015-12-01

We studied the physical properties of hollandite titanates, BaxTi8O16 +δ , which have double chains of edge-sharing TiO6 octahedra with d electrons in the t2 g states. We found that there is an electronic phase transition at ˜220 K, at which various properties exhibit anomalies. This phase transition is characterized by a modulation in the TiO6 chains and a spectral weight transfer of over 2 eV in the optical conductivity spectrum, which are presumably caused by charge and orbital ordering of the Ti t2 g electrons.

Interdigitated Array microelectrode-based electrochemical impedance immunosensor for detection of Escherichia coli O157:H7.

PubMed

Yang, Liju; Li, Yanbin; Erf, Gisela F

2004-02-15

A label-free electrochemical impedance immunosensor for rapid detection of Escherichia coli O157:H7 was developed by immobilizing anti-E. coli antibodies onto an indium-tin oxide interdigitated array (IDA) microelectrode. Based on the general electronic equivalent model of an electrochemical cell and the behavior of the IDA microelectrode, an equivalent circuit, consisting of an ohmic resistor of the electrolyte between two electrodes and a double layer capacitor, an electron-transfer resistor, and a Warburg impedance around each electrode, was introduced for interpretation of the impedance components of the IDA microelectrode system. The results showed that the immobilization of antibodies and the binding of E. coli cells to the IDA microelectrode surface increased the electron-transfer resistance, which was directly measured with electrochemical impedance spectroscopy in the presence of [Fe(CN)(6)](3-/4-) as a redox probe. The electron-transfer resistance was correlated with the concentration of E. coli cells in a range from 4.36 x 10(5) to 4.36 x 10(8) cfu/mL with the detection limit of 10(6) cfu/mL.

A Structural Model of a P450-Ferredoxin Complex from Orientation-Selective Double Electron-Electron Resonance Spectroscopy.

PubMed

Bowen, Alice M; Johnson, Eachan O D; Mercuri, Francesco; Hoskins, Nicola J; Qiao, Ruihong; McCullagh, James S O; Lovett, Janet E; Bell, Stephen G; Zhou, Weihong; Timmel, Christiane R; Wong, Luet Lok; Harmer, Jeffrey R

2018-02-21

Cytochrome P450 (CYP) monooxygenases catalyze the oxidation of chemically inert carbon-hydrogen bonds in diverse endogenous and exogenous organic compounds by atmospheric oxygen. This C-H bond oxy-functionalization activity has huge potential in biotechnological applications. Class I CYPs receive the two electrons required for oxygen activation from NAD(P)H via a ferredoxin reductase and ferredoxin. The interaction of Class I CYPs with their cognate ferredoxin is specific. In order to reconstitute the activity of diverse CYPs, structural characterization of CYP-ferredoxin complexes is necessary, but little structural information is available. Here we report a structural model of such a complex (CYP199A2-HaPux) in frozen solution derived from distance and orientation restraints gathered by the EPR technique of orientation-selective double electron-electron resonance (os-DEER). The long-lived oscillations in the os-DEER spectra were well modeled by a single orientation of the CYP199A2-HaPux complex. The structure is different from the two known Class I CYP-Fdx structures: CYP11A1-Adx and CYP101A1-Pdx. At the protein interface, HaPux residues in the [Fe 2 S 2 ] cluster-binding loop and the α3 helix and the C-terminus residue interact with CYP199A2 residues in the proximal loop and the C helix. These residue contacts are consistent with biochemical data on CYP199A2-ferredoxin binding and electron transfer. Electron-tunneling calculations indicate an efficient electron-transfer pathway from the [Fe 2 S 2 ] cluster to the heme. This new structural model of a CYP-Fdx complex provides the basis for tailoring CYP enzymes for which the cognate ferredoxin is not known, to accept electrons from HaPux and display monooxygenase activity.

Water-chromophore electron transfer determines the photochemistry of cytosine and cytidine.

PubMed

Szabla, Rafał; Kruse, Holger; Šponer, Jiří; Góra, Robert W

2017-07-21

Many of the UV-induced phenomena observed experimentally for aqueous cytidine were lacking the mechanistic interpretation for decades. These processes include the substantial population of the puzzling long-lived dark state, photohydration, cytidine to uridine conversion and oxazolidinone formation. Here, we present quantum-chemical simulations of excited-state spectra and potential energy surfaces of N1-methylcytosine clustered with two water molecules using the second-order approximate coupled cluster (CC2), complete active space with second-order perturbation theory (CASPT2), and multireference configuration interaction with single and double excitation (MR-CISD) methods. We argue that the assignment of the long-lived dark state to a singlet nπ* excitation involving water-chromophore electron transfer might serve as an explanation for the numerous experimental observations. While our simulated spectra for the state are in excellent agreement with experimentally acquired data, the electron-driven proton transfer process occurring on the surface may initiate the subsequent damage in the vibrationally hot ground state of the chromophore.

Cross-benzoin and Stetter-type reactions mediated by KOtBu-DMF via an electron-transfer process.

PubMed

Ragno, Daniele; Zaghi, Anna; Di Carmine, Graziano; Giovannini, Pier Paolo; Bortolini, Olga; Fogagnolo, Marco; Molinari, Alessandra; Venturini, Alessandro; Massi, Alessandro

2016-10-18

The condensation of aromatic α-diketones (benzils) with aromatic aldehydes (benzoin-type reaction) and chalcones (Stetter-type reaction) in DMF in the presence of catalytic (25 mol%) KOtBu is reported. Both types of umpolung processes proceed with good efficiency and complete chemoselectivity. On the basis of spectroscopic evidence (MS analysis) of plausible intermediates and literature reports, the occurrence of different ionic pathways have been evaluated to elucidate the mechanism of a model cross-benzoin-like reaction along with a radical route initiated by an electron-transfer process to benzil from the carbamoyl anion derived from DMF. This mechanistic investigation has culminated in a different proposal, supported by calculations and a trapping experiment, based on double electron-transfer to benzil with formation of the corresponding enediolate anion as the key reactive intermediate. A mechanistic comparison between the activation modes of benzils in KOtBu-DMF and KOtBu-DMSO systems is also described.

Kinetic and thermodynamic hysteresis imposed by intercalation of proflavine in ferrocene-modified double-stranded DNA.

PubMed

Gebala, Magdalena; La Mantia, Fabio; Schuhmann, Wolfgang

2013-07-22

Surface-confined immobilized redox species often do not show the expected zero peak separation in slow-scan cyclic voltammograms. This phenomenon is frequently associated to experimental drawbacks and hence neglected. However, a nonzero peak separation, which is common to many electrochemical systems with high structural flexibility, can be rationally assigned to a thermodynamic hysteresis. To study this phenomenon, a surface-confined redox species was used. Specifically, a DNA strand which is tagged with ferrocene (Fc) moieties at its 5' end and its complementary capture probe is thiolated at the 3' end was self-assembled in a monolayer at a Au electrode with the Fc moieties being located at the bottom plane of the double-stranded DNA (dsDNA). The DNA-bound Fc undergoes rapid electron transfer with the electrode surface as evaluated by fast scan cyclic voltammetry. The electron transfer is sensitive to the ion transport along the DNA strands, a phenomenon which is modulated upon specific intercalation of proflavine into surface-bound dsDNA. The electron transfer rate of the Fc(0/+) redox process is influenced by the cationic permselectivity of the DNA monolayer. In addition to the kinetic hindrance, a thermodynamic effect correlated with changes in the activity coefficients of the Fc(0/+) moieties near the gold-dsDNA interface is observed and discussed as source of the observed hysteresis causing the non-zero peak separation in the voltammograms. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A Comparison of Solvent Effects in the Kinetics of Simple Electron Transfer and Amalgam Formation Reactions

DTIC Science & Technology

1988-10-15

by measuring the temperature dependence of the half-wave potential in a non-isothermal cell. In the case of reduction of p- semiquinones55 and p... electrooxidation of 1,4-diaminobenzene at platinum5 , it was argued that since 16 the reaction occurs close to the p.z.c., double layer effects are negligible...effects would lead to large errors in the apparent transfer coefficient, ou. In the case of kinetic data for the electrooxidation of phenothiazine 4 and

Layered-metal-hydroxide nanosheet arrays with controlled nanostructures to assist direct electronic communication at biointerfaces.

PubMed

An, Zhe; Lu, Shan; Zhao, Liwei; He, Jing

2011-10-18

In this work, ordered vertical arrays of layered double hydroxide (LDH) nanosheets have been developed to achieve electron transfer (eT) at biointerfaces in electrochemical devices. It is found that tailoring the gap size of LDH nanosheet arrays could significantly promote the eT rate. This research has successfully extended nanomaterials for efficient modifications of electrode surfaces from nanoparticles, nanowires, nanorods, and nanotubes to nanosheets. © 2011 American Chemical Society

Coherent pump pulses in Double Electron Electron Resonance Spectroscopy

PubMed Central

Tait, Claudia E.; Stoll, Stefan

2016-01-01

The recent introduction of shaped pulses to Double Electron Electron Resonance (DEER) spectroscopy has led to significant enhancements in sensitivity through increased excitation bandwidths and improved control over spin dynamics. The application of DEER has so far relied on the presence of an incoherent pump channel to average out most undesired coherent effects of the pump pulse(s) on the observer spins. However, in fully coherent EPR spectrometers that are increasingly used to generate shaped pulses, the presence of coherent pump pulses means that these effects need to be explicitly considered. In this paper, we examine the effects of coherent rectangular and sech/tanh pump pulses in DEER experiments with up to three pump pulses. We show that, even in the absence of significant overlap of the observer and pump pulse excitation bandwidths, coherence transfer pathways involving both types of pulses generate spin echoes of considerable intensity. These echoes introduce artefacts, which, if not identified and removed, can easily lead to misinterpretation. We demonstrate that the observed echoes can be quantitatively modelled using a simple spin quantum dynamics approach that includes instrumental transfer functions. Based on an analysis of the echo crossing artefacts, we propose efficient phase cycling schemes for their suppression. This enables the use of advanced DEER experiments, characterized by high sensitivity and increased accuracy for long-distance measurements, on novel fully coherent EPR spectrometers. PMID:27339858

Dispersion of bamboo type multi-wall carbon nanotubes in calf-thymus double stranded DNA.

PubMed

Primo, Emiliano N; Cañete-Rosales, Paulina; Bollo, Soledad; Rubianes, María D; Rivas, Gustavo A

2013-08-01

We report for the first time the use of double stranded calf-thymus DNA (dsDNA) to successfully disperse bamboo-like multi-walled carbon nanotubes (bCNT). The dispersion and the modified electrodes were studied by different spectroscopic, microscopic and electrochemical techniques. The drastic treatment for dispersing the bCNT (45min sonication in a 50% (v/v) ethanol:water solution), produces a partial denaturation and a decrease in the length of dsDNA that facilitates the dispersion of CNT and makes possible an efficient electron transfer of guanine residues to the electrode. A critical analysis of the influence of different experimental conditions on the efficiency of the dispersion and on the performance of glassy carbon electrodes (GCE) modified with bCNT-dsDNA dispersion is also reported. The electron transfer of redox probes and guanine residues was more efficient at GCE modified with bCNT dispersed in dsDNA than at GCE modified with hollow CNT (hCNT) dispersed in dsDNA, demonstrating the importance of the presence of bCNT. Copyright © 2013 Elsevier B.V. All rights reserved.

Direct Observation of Double Hydrogen Transfer via Quantum Tunneling in a Single Porphycene Molecule on a Ag(110) Surface.

PubMed

Koch, Matthias; Pagan, Mark; Persson, Mats; Gawinkowski, Sylwester; Waluk, Jacek; Kumagai, Takashi

2017-09-13

Quantum tunneling of hydrogen atoms (or protons) plays a crucial role in many chemical and biological reactions. Although tunneling of a single particle has been examined extensively in various one-dimensional potentials, many-particle tunneling in high-dimensional potential energy surfaces remains poorly understood. Here we present a direct observation of a double hydrogen atom transfer (tautomerization) within a single porphycene molecule on a Ag(110) surface using a cryogenic scanning tunneling microscope (STM). The tautomerization rates are temperature independent below ∼10 K, and a large kinetic isotope effect (KIE) is observed upon substituting the transferred hydrogen atoms by deuterium, indicating that the process is governed by tunneling. The observed KIE for three isotopologues and density functional theory calculations reveal that a stepwise transfer mechanism is dominant in the tautomerization. It is also found that the tautomerization rate is increased by vibrational excitation via an inelastic electron tunneling process. Moreover, the STM tip can be used to manipulate the tunneling dynamics through modification of the potential landscape.

Mechanism of energy transfer from carotenoids to bacteriochlorophyll : light-harvesting by carotenoids having different extents of {pi}-electron conjugation incorporated into the B850 antenna complex from the carotenoidless bacterium Rhodobacter sphaeroides R-26.1.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Desamero, R. Z. B.; Chynwat, V.; van der Hoef, I.

1998-10-15

Spheroidene and a series of spheroidene analogues with extents of p-electron conjugation ranging from 7 to 13 carbon-carbon double bonds were incorporated into the B850 light-harvesting complex of Rhodobacter sphaeroides R-26.1. The structures and spectroscopic properties of the carotenoids and the dynamics of energy transfer from the carotenoid to bacteriochlorophyll (BChl) in the B850 complex were studied by using steady-state absorption, fluorescence, fluorescence excitation, resonance Raman, and time-resolved absorption spectroscopy. The spheroidene analogues used in this study were 5',6'-dihydro-7',8'-didehydrospheroidene, 7',8'-didehydrospheroidene, and 1',2'-dihydro-3',4',7',8'-tetradehydrospheroidene. These data, taken together with results from 3,4,7,8-tetrahydrospheroidene, 3,4,5,6-tetrahydrospheroidene, 3,4-dihydrospheroidene, and spheroidene already published (Frank, H. A.; Farhoosh,more » R.; Aldema, M. L.; DeCoster, B.; Christensen, R. L.; Gebhard, R.; Lugtenburg, J. Photochem. Photobiol. 1993, 57, 49. Farhoosh, R.; Chynwat, V.; Gebhard, R.; Lugtenburg, J.; Frank, H. A. Photosynth. Res. 1994, 42, 157), provide a systematic series of molecules for understanding the molecular features that determine the mechanism of energy transfer from carotenoids to BChl in photosynthetic bacterial light-harvesting complexes. The data support the hypothesis that only carotenoids having 10 or less carbon-carbon double bonds transfer energy via their 21Ag (S1) states to BChl to any significant degree. Energy transfer via the 11Bu (S2) state of the carotenoid becomes more important than the S1 route as the number of conjugated carbon-carbon double bonds increases. The results also suggest that the S2 state associated with the Qx transition of the B850 BChl is the most likely acceptor state for energy transfer originating from both the 2{sup 1}A{sub g} (S{sub 1}) and 1{sup 1}B{sub u} (S{sub 2}) states of all carotenoids.« less

[Arc spectrum diagnostic and heat coupling mechanism analysis of double wire pulsed MIG welding].

PubMed

Liu, Yong-qiang; Li, Huan; Yang, Li-jun; Zheng, Kai; Gao, Ying

2015-01-01

A double wire pulsed MIG welding test system was built in the present paper, in order to analyze the heat-coupling mechanism of double wire pulsed MIG welding, and study are temperature field. Spectroscopic technique was used in diagnostic analysis of the are, plasma radiation was collected by using hollow probe method to obtain the arc plasma optical signal The electron temperature of double wire pulsed MIG welding arc plasma was calculated by using Boltzmann diagram method, the electron temperature distribution was obtained, a comprehensive analysis of the arc was conducted combined with the high speed camera technology and acquisition means of electricity signal. The innovation of this paper is the combination of high-speed camera image information of are and optical signal of arc plasma to analyze the coupling mechanism for dual arc, and a more intuitive analysis for are temperature field was conducted. The test results showed that a push-pull output was achieved and droplet transfer mode was a drop in a pulse in the welding process; Two arcs attracted each other under the action of a magnetic field, and shifted to the center of the arc in welding process, so a new heat center was formed at the geometric center of the double arc, and flowing up phenomenon occurred on the arc; Dual arc electronic temperature showed an inverted V-shaped distribution overall, and at the geometric center of the double arc, the arc electron temperature at 3 mm off the workpiece surface was the highest, which was 16,887.66 K, about 4,900 K higher than the lowest temperature 11,963.63 K.

Ground-state and magnetocaloric properties of a coupled spin-electron double-tetrahedral chain (exact study at the half filling)

NASA Astrophysics Data System (ADS)

Gálisová, Lucia; Jakubczyk, Dorota

2017-01-01

Ground-state and magnetocaloric properties of a double-tetrahedral chain, in which nodal lattice sites occupied by the localized Ising spins regularly alternate with triangular clusters half filled with mobile electrons, are exactly investigated by using the transfer-matrix method in combination with the construction of the Nth tensor power of the discrete Fourier transformation. It is shown that the ground state of the model is formed by two non-chiral phases with the zero residual entropy and two chiral phases with the finite residual entropy S = NkB ln 2. Depending on the character of the exchange interaction between the localized Ising spins and mobile electrons, one or three magnetization plateaus can be observed in the magnetization process. Their heights basically depend on the values of Landé g-factors of the Ising spins and mobile electrons. It is also evidenced that the system exhibits both the conventional and inverse magnetocaloric effect depending on values of the applied magnetic field and temperature.

Kinetics and mechanism of electron transfer reaction of single and double chain surfactant cobalt(III) complex by Fe2+ ions in liposome (dipalmitoylphosphotidylcholine) vesicles: effects of phase transition

NASA Astrophysics Data System (ADS)

Nagaraj, Karuppiah; Senthil Murugan, Krishnan; Thangamuniyandi, Pilavadi

2015-05-01

In this study, we report the kinetics of reduction reactions of single and double chain surfactant cobalt(III) complexes of octahedral geometry, cis-[Co(en)2(4AMP)(DA)](ClO4)3 and cis-[Co(dmp)2(C12H25NH2)2](ClO4)3 (en = ethylenediamine, dmp = 1,3-diaminopropane, 4AMP = 4-aminopropane, C12H25NH2 = dodecylamine) by Fe2+ ion in dipalmitoylphosphotidylcholine (DPPC) vesicles at different temperatures under pseudo first-order conditions. The kinetics of these reactions is followed by spectrophotometry method. The reactions are found to be second order and the electron transfer is postulated as outer sphere. The remarkable findings in the present investigation are that, below the phase transition temperature of DPPC, the rate decreases with an increase in the concentration of DPPC, while above the phase transition temperature the rate increases with an increase in the concentration of DPPC. The main driving force for this phenomenon is considered to be the intervesicular hydrophobic interaction between vesicles surface and hydrophobic part of the surfactant complexes. Besides, comparing the values of rate constants of these outer-sphere electron transfer reactions in the absence and in the presence of DPPC, the rate constant values in the presence of DPPC are always found to be greater than in the absence of DPPC. This is ascribed to the double hydrophobic fatty acid chain in the DPPC that gives the molecule an overall tubular shape due to the intervesicular hydrophobic interaction between vesicles surface and hydrophobic part of the surfactant complexes more suitable for vesicle aggregation which facilitates lower activation energy, and consequently higher rate is observed in the presence of DPPC. The activation parameters (ΔS# and ΔH#) of the reactions at different temperatures have been calculated which corroborate the kinetics of the reaction.

Synergistic oxygen atom transfer by ruthenium complexes with non-redox metal ions.

PubMed

Lv, Zhanao; Zheng, Wenrui; Chen, Zhuqi; Tang, Zhiming; Mo, Wanling; Yin, Guochuan

2016-07-28

Non-redox metal ions can affect the reactivity of active redox metal ions in versatile biological and heterogeneous oxidation processes; however, the intrinsic roles of these non-redox ions still remain elusive. This work demonstrates the first example of the use of non-redox metal ions as Lewis acids to sharply improve the catalytic oxygen atom transfer efficiency of a ruthenium complex bearing the classic 2,2'-bipyridine ligand. In the absence of Lewis acid, the oxidation of ruthenium(ii) complex by PhI(OAc)2 generates the Ru(iv)[double bond, length as m-dash]O species, which is very sluggish for olefin epoxidation. When Ru(bpy)2Cl2 was tested as a catalyst alone, only 21.2% of cyclooctene was converted, and the yield of 1,2-epoxycyclooctane was only 6.7%. As evidenced by electronic absorption spectra and EPR studies, both the oxidation of Ru(ii) by PhI(OAc)2 and the reduction of Ru(iv)[double bond, length as m-dash]O by olefin are kinetically slow. However, adding non-redox metal ions such as Al(iii) can sharply improve the oxygen transfer efficiency of the catalyst to 100% conversion with 89.9% yield of epoxide under identical conditions. Through various spectroscopic characterizations, an adduct of Ru(iv)[double bond, length as m-dash]O with Al(iii), Ru(iv)[double bond, length as m-dash]O/Al(iii), was proposed to serve as the active species for epoxidation, which in turn generated a Ru(iii)-O-Ru(iii) dimer as the reduced form. In particular, both the oxygen transfer from Ru(iv)[double bond, length as m-dash]O/Al(iii) to olefin and the oxidation of Ru(iii)-O-Ru(iii) back to the active Ru(iv)[double bond, length as m-dash]O/Al(iii) species in the catalytic cycle can be remarkably accelerated by adding a non-redox metal, such as Al(iii). These results have important implications for the role played by non-redox metal ions in catalytic oxidation at redox metal centers as well as for the understanding of the redox mechanism of ruthenium catalysts in the oxygen atom transfer reaction.

Tunneling dynamics of double proton transfer in formic acid and benzoic acid dimers

NASA Astrophysics Data System (ADS)

Smedarchina, Zorka; Fernández-Ramos, Antonio; Siebrand, Willem

2005-04-01

Direct dynamics calculations based on instanton techniques are reported of tunneling splittings due to double proton transfer in formic and benzoic acid dimers. The results are used to assign the observed splittings to levels for which the authors of the high-resolution spectra could not provide a definitive assignment. In both cases the splitting is shown to be due mainly to the zero-point level rather than to the vibrationally or electronically excited level whose spectrum was investigated. This leads to zero-point splittings of 375MHz for (DCOOH)2 and 1107MHz for the benzoic acid dimer. Thus, contrary to earlier calculations, it is found that the splitting is considerably larger in the benzoic than in the formic acid dimer. The calculations are extended to solid benzoic acid where the asymmetry of the proton-transfer potential induced by the crystal can be overcome by suitable doping. This has allowed direct measurement of the interactions responsible for double proton transfer, which were found to be much larger than those in the isolated dimer. To account for this observation both static and dynamic effects of the crystal forces on the intradimer hydrogen bonds are included in the calculations. The same methodology, extended to higher temperatures, is used to calculate rate constants for HH, HD, and DD transfers in neat benzoic acid crystals. The results are in good agreement with reported experimental rate constants measured by NMR relaxometry and, if allowance is made for small structural changes induced by doping, with the transfer matrix elements observed in doped crystals. Hence the method used allows a unified description of tunneling splittings in the gas phase and in doped crystals as well as of transfer rates in neat crystals.

Ultrafast Spectroscopy Reveals Electron-Transfer Cascade That Improves Hydrogen Evolution with Carbon Nitride Photocatalysts.

PubMed

Corp, Kathryn L; Schlenker, Cody W

2017-06-14

Solar hydrogen generation from water represents a compelling component of a future sustainable energy portfolio. Recently, chemically robust heptazine-based polymers known as graphitic carbon nitrides (g-C 3 N 4 ) have emerged as promising photocatalysts for hydrogen evolution using visible light while withstanding harsh chemical environments. However, since g-C 3 N 4 electron-transfer dynamics are poorly understood, rational design rules for improving activity remain unclear. Here, we use visible and near-infrared femtosecond transient absorption (TA) spectroscopy to reveal an electron-transfer cascade that correlates with a near-doubling in photocatalytic activity from 2050 to 3810 μmol h -1 g -1 when we infuse a suspension of bulk g-C 3 N 4 with 10% mass loading of chemically exfoliated carbon nitride. TA spectroscopy indicates that exfoliated carbon nitride quenches photogenerated electrons on g-C 3 N 4 at rates approaching the molecular diffusion limit. The TA signal for photogenerated electrons on g-C 3 N 4 decays with a time constant of 1/k e ' = 660 ps in the mixture versus 1/k e = 4.1 ns in g-C 3 N 4 alone. Our TA measurements suggest that the charge generation efficiency in g-C 3 N 4 is greater than 65%. Exfoliated carbon nitride, which liberates only trace hydrogen levels when photoexcited directly, does not appear to independently sustain appreciable long-lived charge generation. Thus, the activity enhancement in the two-component infusion evidently results from a cooperative effect in which charge is generated on g-C 3 N 4 , followed by electron transfer to exfoliated carbon nitride containing photocatalytic chain terminations. This correlation between electron transfer and photocatalytic activity provides new insight into structural modifications for controlling charge separation dynamics and activity of carbon-based photocatalysts.

Carbon dioxide electron cooling rates in the atmospheres of Mars and Venus

NASA Astrophysics Data System (ADS)

Campbell, L.; Brunger, M. J.; Rescigno, T. N.

2008-08-01

The cooling of electrons in collisions with carbon dioxide in the atmospheres of Venus and Mars is investigated. Calculations are performed with both previously accepted electron energy transfer rates and with new ones determined using more recent theoretical and experimental cross sections for electron impact on CO2. Emulation of a previous model for Venus confirms the validity of the current model and shows that use of the updated cross sections leads to cooling rates that are lower by one third. Application of the same model to the atmosphere of Mars gives more than double the previous cooling rates at altitudes where the electron temperature is very low.

A Chemical-Adsorption Strategy to Enhance the Reaction Kinetics of Lithium-Rich Layered Cathodes via Double-Shell Surface Modification.

PubMed

Guo, Lichao; Li, Jiajun; Cao, Tingting; Wang, Huayu; Zhao, Naiqin; He, Fang; Shi, Chunsheng; He, Chunnian; Liu, Enzuo

2016-09-21

Sluggish surface reaction kinetics hinders the power density of Li-ion battery. Thus, various surface modification techniques have been applied to enhance the electronic/ionic transfer kinetics. However, it is challenging to obtain a continuous and uniform surface modification layer on the prime particles with structure integration at the interface. Instead of classic physical-adsorption/deposition techniques, we propose a novel chemical-adsorption strategy to synthesize double-shell modified lithium-rich layered cathodes with enhanced mass transfer kinetics. On the basis of experimental measurement and first-principles calculation, MoO2S2 ions are proved to joint the layered phase via chemical bonding. Specifically, the Mo-O or Mo-S bonds can flexibly rotate to bond with the cations in the layered phase, leading to the good compatibility between the thiomolybdate adsorption layer and layered cathode. Followed by annealing treatment, the lithium-excess-spinel inner shell forms under the thiomolybdate adsorption layer and functions as favorable pathways for lithium and electron. Meanwhile, the nanothick MoO3-x(SO4)x outer shell protects the transition metal from dissolution and restrains electrolyte decomposition. The double-shell modified sample delivers an enhanced discharge capacity almost twice as much as that of the unmodified one at 1 A g(-1) after 100 cycles, demonstrating the superiority of the surface modification based on chemical adsorption.

Radiative double electron capture in collisions of fully-stripped fluorine ions with thin carbon foils

NASA Astrophysics Data System (ADS)

Elkafrawy, Tamer Mohammad Samy

Radiative double electron capture (RDEC) is a one-step process in ion-atom collisions occurring when two target electrons are captured to a bound state of the projectile simultaneously with the emission of a single photon. The emitted photon has approximately double the energy of the photon emitted due to radiative electron capture (REC), which occurs when a target electron is captured to a projectile bound state with simultaneous emission of a photon. REC and RDEC can be treated as time-reversed photoionization (PI) and double photoionization (DPI), respectively, if loosely-bound target electrons are captured. This concept can be formulated with the principle of detailed balance, in which the processes of our interest can be described in terms of their time-reversed ones. Fully-stripped ions were used as projectiles in the performed RDEC experiments, providing a recipient system free of electron-related Coulomb fields. This allows the target electrons to be transferred without interaction with any of the projectile electrons, enabling accurate investigation of the electron-electron interaction in the vicinity of electromagnetic field. In this dissertation, RDEC was investigated during the collision of fully-stripped fluorine ions with a thin carbon foil and the results are compared with the recent experimental and theoretical studies. In the current work, x rays associated with projectile charge-changing by single and double electron capture and no charge change by F9+ ions were observed and compared with recent work for O8+ ions and with theory. Both the F 9+ and O8+ ions had energies in the ˜MeV/u range. REC, in turn, was investigated as a means to compare with the theoretical predictions of the RDEC/REC cross section ratio. The most significant background processes including various mechanisms of x-ray emission that may interfere with the energy region of interest are addressed in detail. This enables isolation of the contributions of REC and RDEC from the entire continuous spectrum of x-ray emission or at least ensures that the background processes have negligible contribution to the energy range of interest. Special emphasis is given to showing how the data analysis was carried out by the subtraction of the x rays due to contamination lines.

Ultrashort electromagnetic pulse control of intersubband quantum well transitions

PubMed Central

2012-01-01

We study the creation of high-efficiency controlled population transfer in intersubband transitions of semiconductor quantum wells. We give emphasis to the case of interaction of the semiconductor quantum well with electromagnetic pulses with a duration of few cycles and even a single cycle. We numerically solve the effective nonlinear Bloch equations for a specific double GaAs/AlGaAs quantum well structure, taking into account the ultrashort nature of the applied field, and show that high-efficiency population inversion is possible for specific pulse areas. The dependence of the efficiency of population transfer on the electron sheet density and the carrier envelope phase of the pulse is also explored. For electromagnetic pulses with a duration of several cycles, we find that the change in the electron sheet density leads to a very different response of the population in the two subbands to pulse area. However, for pulses with a duration equal to or shorter than 3 cycles, we show that efficient population transfer between the two subbands is possible, independent of the value of electron sheet density, if the pulse area is Π. PMID:22916956

Ultrashort electromagnetic pulse control of intersubband quantum well transitions.

PubMed

Paspalakis, Emmanuel; Boviatsis, John

2012-08-23

: We study the creation of high-efficiency controlled population transfer in intersubband transitions of semiconductor quantum wells. We give emphasis to the case of interaction of the semiconductor quantum well with electromagnetic pulses with a duration of few cycles and even a single cycle. We numerically solve the effective nonlinear Bloch equations for a specific double GaAs/AlGaAs quantum well structure, taking into account the ultrashort nature of the applied field, and show that high-efficiency population inversion is possible for specific pulse areas. The dependence of the efficiency of population transfer on the electron sheet density and the carrier envelope phase of the pulse is also explored. For electromagnetic pulses with a duration of several cycles, we find that the change in the electron sheet density leads to a very different response of the population in the two subbands to pulse area. However, for pulses with a duration equal to or shorter than 3 cycles, we show that efficient population transfer between the two subbands is possible, independent of the value of electron sheet density, if the pulse area is Π.

Intramolecular and Lattice Dynamics in V6-nIVVnV O7(OCH3)12 Crystal

NASA Astrophysics Data System (ADS)

Yablokov, Yu. V.; Augustyniak-Jabłokow, M. A.; Borshch, S.; Daniel, C.; Hartl, H.

2006-08-01

Multi-nuclear mixed-valence clusters V4IVV2VO7(OCH3)12 were studied by X-band EPR in the temperature range 4.2-300 K. An isotropic exchange interactions between four VIV ions with individual spin Si=1/2 determine the energy levels structure of the compound with the total spin states S=0, 1, and 2, which are doubled and split due to the extra electron transfer. The spin-Hamiltonian approach was used for the analysis of the temperature dependences of the EPR spectra parameters and the cluster dynamics. Two types of the electron transfer are assumed: the single jump transfer leading to the splitting of the total spin states by intervals comparable in magnitude with the exchange parameter J≈100-150cm-1 and the double jump one resulting in dynamics. The dependence of the transition ratesνtr on the energy of the total spin states was observed. In particular, in the range 300-220 K the νtr ≈0.7×1010 cm-1 and below 180 K the νtr≈1×1010 cm-1 was estimated. The g-factors of the spin states were shown to depend on the values of the intermediate spins. A phase transition in the T-range 210-180 K leading to the change in the initial VIV ions localization was discovered.

Cavity Born-Oppenheimer Approximation for Correlated Electron-Nuclear-Photon Systems.

PubMed

Flick, Johannes; Appel, Heiko; Ruggenthaler, Michael; Rubio, Angel

2017-04-11

In this work, we illustrate the recently introduced concept of the cavity Born-Oppenheimer approximation [ Flick et al. PNAS 2017 , 10.1073/pnas.1615509114 ] for correlated electron-nuclear-photon problems in detail. We demonstrate how an expansion in terms of conditional electronic and photon-nuclear wave functions accurately describes eigenstates of strongly correlated light-matter systems. For a GaAs quantum ring model in resonance with a photon mode we highlight how the ground-state electronic potential-energy surface changes the usual harmonic potential of the free photon mode to a dressed mode with a double-well structure. This change is accompanied by a splitting of the electronic ground-state density. For a model where the photon mode is in resonance with a vibrational transition, we observe in the excited-state electronic potential-energy surface a splitting from a single minimum to a double minimum. Furthermore, for a time-dependent setup, we show how the dynamics in correlated light-matter systems can be understood in terms of population transfer between potential energy surfaces. This work at the interface of quantum chemistry and quantum optics paves the way for the full ab initio description of matter-photon systems.

Electron capture in collisions of S4+ with helium

NASA Astrophysics Data System (ADS)

Wang, J. G.; Turner, A. R.; Cooper, D. L.; Schultz, D. R.; Rakovic, M. J.; Fritsch, W.; Stancil, P. C.; Zygelman, B.

2002-07-01

Charge transfer due to collisions of ground-state S4+(3s2 1S) ions with helium is investigated for energies between 0.1 meV u-1 and 10 MeV u-1. Total and state-selective single electron capture (SEC) cross sections and rate coefficients are obtained utilizing the quantum mechanical molecular-orbital close-coupling (MOCC), atomic-orbital close-coupling (AOCC), classical trajectory Monte Carlo (CTMC) and continuum distorted wave methods. The MOCC calculations utilize ab initio adiabatic potentials and nonadiabatic radial coupling matrix elements obtained with the spin-coupled valence-bond approach. Previous data are limited to a calculation of the total SEC rate coefficient using the Landau-Zener model that is, in comparison to the results presented here, three orders of magnitude smaller. The MOCC SEC cross sections at low energy reveal a multichannel interference effect. True double capture is also investigated with the AOCC and CTMC approaches while autoionizing double capture and transfer ionization (TI) is explored with CTMC. SEC is found to be the dominant process except for E>200 keV u-1 when TI becomes the primary capture channel. Astrophysical implications are briefly discussed.

Electron kinetics at the plasma interface

NASA Astrophysics Data System (ADS)

Bronold, Franz Xaver; Fehske, Holger; Pamperin, Mathias; Thiessen, Elena

2018-05-01

The most fundamental response of an ionized gas to a macroscopic object is the formation of the plasma sheath. It is an electron depleted space charge region, adjacent to the object, which screens the object's negative charge arising from the accumulation of electrons from the plasma. The plasma sheath is thus the positively charged part of an electric double layer whose negatively charged part is inside the wall. In the course of the Transregional Collaborative Research Center SFB/TRR24 we investigated, from a microscopic point of view, the elementary charge transfer processes responsible for the electric double layer at a floating plasma-wall interface and made first steps towards a description of the negative part of the layer inside the wall. Below we review our work in a colloquial manner, describe possible extensions, and identify key issues which need to be resolved to make further progress in the understanding of the electron kinetics across plasma-wall interfaces. Contribution to the Topical Issue "Fundamentals of Complex Plasmas", edited by Jürgen Meichsner, Michael Bonitz, Holger Fehske, Alexander Piel.

On the dynamical nature of the active center in a single-site photocatalyst visualized by 4D ultrafast electron microscopy

PubMed Central

Yoo, Byung-Kuk; Su, Zixue; Thomas, John Meurig; Zewail, Ahmed H.

2016-01-01

Understanding the dynamical nature of the catalytic active site embedded in complex systems at the atomic level is critical to developing efficient photocatalytic materials. Here, we report, using 4D ultrafast electron microscopy, the spatiotemporal behaviors of titanium and oxygen in a titanosilicate catalytic material. The observed changes in Bragg diffraction intensity with time at the specific lattice planes, and with a tilted geometry, provide the relaxation pathway: the Ti4+=O2− double bond transformation to a Ti3+−O1− single bond via the individual atomic displacements of the titanium and the apical oxygen. The dilation of the double bond is up to 0.8 Å and occurs on the femtosecond time scale. These findings suggest the direct catalytic involvement of the Ti3+−O1− local structure, the significance of nonthermal processes at the reactive site, and the efficient photo-induced electron transfer that plays a pivotal role in many photocatalytic reactions. PMID:26729878

Analysis of a Range of Catabolic Mutants Provides Evidence That Phytanoyl-Coenzyme A Does Not Act as a Substrate of the Electron-Transfer Flavoprotein/Electron-Transfer Flavoprotein:Ubiquinone Oxidoreductase Complex in Arabidopsis during Dark-Induced Senescence1[W][OA

PubMed Central

Araújo, Wagner L.; Ishizaki, Kimitsune; Nunes-Nesi, Adriano; Tohge, Takayuki; Larson, Tony R.; Krahnert, Ina; Balbo, Ilse; Witt, Sandra; Dörmann, Peter; Graham, Ian A.; Leaver, Christopher J.; Fernie, Alisdair R.

2011-01-01

The process of dark-induced senescence in plants is not fully understood, however, the functional involvement of an electron-transfer flavoprotein/electron-transfer flavoprotein:ubiquinone oxidoreductase (ETF/ETFQO), has been demonstrated. Recent studies have revealed that the enzymes isovaleryl-coenzyme A (CoA) dehydrogenase and 2-hydroxyglutarate dehydrogenase act as important electron donors to this complex. In addition both enzymes play a role in the breakdown of cellular carbon storage reserves with isovaleryl-CoA dehydrogenase being involved in degradation of the branched-chain amino acids, phytol, and lysine while 2-hydroxyglutarate dehydrogenase is exclusively involved in lysine degradation. Given that the chlorophyll breakdown intermediate phytanoyl-CoA accumulates dramatically both in knockout mutants of the ETF/ETFQO complex and of isovaleryl-CoA dehydrogenase following growth in extended dark periods we have investigated the direct importance of chlorophyll breakdown for the supply of carbon and electrons during this process. For this purpose we isolated three independent Arabidopsis (Arabidopsis thaliana) knockout mutants of phytanoyl-CoA 2-hydroxylase and grew them under the same extended darkness regime as previously used. Despite the fact that these mutants accumulated phytanoyl-CoA and also 2-hydroxyglutarate they exhibited no morphological changes in comparison to the other mutants previously characterized. These results are consistent with a single entry point of phytol breakdown into the ETF/ETFQO system and furthermore suggest that phytol is not primarily metabolized by this pathway. Furthermore analysis of isovaleryl-CoA dehydrogenase/2-hydroxyglutarate dehydrogenase double mutants generated here suggest that these two enzymes essentially account for the entire electron input via the ETF complex. PMID:21788362

Transfer in motion discrimination learning was no greater in double training than in single training.

PubMed

Huang, Jinfeng; Liang, Ju; Zhou, Yifeng; Liu, Zili

2017-06-01

We investigated the controversy regarding double training in motion discrimination learning. We collected data from 43 participants in a motion direction discrimination learning task with either double training (i.e., training plus exposure) or single training (i.e., no exposure). By pooling these data with those in the literature, we had data in double training from 28 participants and in single training from 36 participants. We found that, in double training, the transfer along the exposed direction was less than that along the trained direction, indicating incomplete transfer. Importantly, the transfer in double training was not reliably greater than that in single training.

Insights on energy selective contacts for thermal energy harvesting using double resonant tunneling contacts and numerical modeling

NASA Astrophysics Data System (ADS)

Julian, A.; Jehl, Z.; Miyashita, N.; Okada, Y.; Guillemoles, J.-F.

2016-12-01

Energy selective electrical contacts have been proposed as a way to approach ultimate efficiencies both for thermoelectric and photovoltaic devices as they allow a reduction of the entropy production during the energy conversion process. A self-consistent numerical model based on the transfer matrix approach in the effective mass and envelope function approximation has been developed to calculate the electronic properties of double resonant tunneling barriers used as energy selective contacts in hot carrier solar cells. It is found that the application of an external electric bias significantly degrades the electronic transmission of the structure, and thus the tunneling current in the current-voltage characteristic. This is due to a symmetry breaking which can be offset using finely tuned asymmetric double resonant tunneling barriers, leading to a full recovery of the tunneling current in our model. Moreover, we model the heterostructure using electrons temperature in the emitter higher than that of the lattice, providing insights on the interpretation of experimental devices functioning in hot carrier conditions, especially regarding the previously reported shift of the resonance peak (negative differential resistance), which we interpret as related to a shift in the hot electron distribution while the maximum remains at the conduction band edge of the emitter. Finally, experimental results are presented using asymmetric structure showing significantly improved resonant properties at room temperature with very sharp negative differential resistance.

Photoinduced Oxidative DNA Damage Revealed by an Agarose Gel Nicking Assay: A Biophysical Chemistry Laboratory Experiment

NASA Astrophysics Data System (ADS)

Shafirovich, Vladimir; Singh, Carolyn; Geacintov, Nicholas E.

2003-11-01

Oxidative damage of DNA molecules associated with electron-transfer reactions is an important phenomenon in living cells, which can lead to mutations and contribute to carcinogenesis and the aging processes. This article describes the design of several simple experiments to explore DNA damage initiated by photoinduced electron-transfer reactions sensitized by the acridine derivative, proflavine (PF). A supercoiled DNA agarose gel nicking assay is employed as a sensitive probe of DNA strand cleavage. A low-cost experimental and computer-interfaced imaging apparatus is described allowing for the digital recording and analysis of the gel electrophoresis results. The first experiment describes the formation of direct strand breaks in double-stranded DNA induced by photoexcitation of the intercalated PF molecules. The second experiment demonstrates that the addition of the well-known electron acceptor, methylviologen, gives rise to a significant enhancement of the photochemical DNA strand cleavage effect. This occurs by an electron transfer step to methylviologen that renders the inital photoinduced charge separation between photoexcited PF and DNA irreversible. The third experiment demonstrates that the action spectrum of the DNA photocleavage matches the absorption spectrum of DNA-bound, intercalated PF molecules, which differs from that of free PF molecules. This result demonstrates that the photoinduced DNA strand cleavage is initiated by intercalated rather than free PF molecules.

A C-Type Cytochrome and a Transcriptional Regulator Responsible for Enhanced Extracellular Electron Transfer in Geobacter Sulfurreducens Revealed by Adaptive Evolution

DTIC Science & Technology

2010-01-01

dance of pgcA transcripts, consistent with increased expression of pgcA in the adapted strains. One of the mutations doubled the rate of Fe(III) oxide...sequenced bacterial genomes. BMC Genomics 8: 274. Herring, C.D., Raghunathan, A., Honisch, C., Patel, T., Apple- bee , M.K., Joyce, A.R., et al. (2006

Mir 22 flight engineer on the Spacehab module

NASA Image and Video Library

1997-01-16

STS081-E-05482 (16 Jan. 1997) --- Perhaps overwhelmed by a giant stock of supplies (out of frame, left), cosmonaut Aleksandr Y. Kaleri, Mir-22 flight engineer, ponders what parcel to transfer next from the Spacehab Double Module (DM) to the Russian Mir Space Station complex. The photograph was recorded with an Electronic Still Camera (ESC) and later was downlinked to flight controllers in Houston, Texas.

Integration of Indium Phosphide Based Devices with Flexible Substrates

NASA Astrophysics Data System (ADS)

Chen, Wayne Huai

2011-12-01

Flexible substrates have many advantages in applications where bendability, space, or weight play important roles or where rigid circuits are undesirable. However, conventional flexible thin film transistors are typically characterized as having low carrier mobility as compared to devices used in the electronics industry. This is in part due to the limited temperature tolerance of plastic flexible substrates, which commonly reduces the highest processing temperature to below 200°C. Common approaches of implementation include low temperature deposition of organic, amorphous, or polycrystalline semiconductors, all of which result in carrier mobility well below 100 cm2V -1s-1. High quality, single crystalline III-V semiconductors such as indium phosphide (InP), on the other hand, have carrier mobility well over 1000 cm 2V-1s-1 at room temperature, depending on carrier concentration. Recently, the ion-cut process has been used in conjunction with wafer bonding to integrate thin layers of III-V material onto silicon for optoelectronic applications. This approach has the advantage of high scalability, reusability of the initial III-V substrate, and the ability to tailor the location (depth) of the layer splitting. However, the transferred substrate usually suffers from hydrogen implantation damage. This dissertation demonstrates a new approach to enable integration of InP with various substrates, called the double-flip transfer process. The process combines ion-cutting with adhesive bonding. The problem of hydrogen implantation was overcome by patterned ion-cut transfer. In this type of transfer, areas of interest are shielded from implantation but still transferred by surrounding implanted regions. We found that patterned ion-cut transfer is strongly dependent upon crystal orientation and that using cleavage-plane oriented donors can be beneficial in transferring large areas of high quality semiconductor material. InP-based devices were fabricated to demonstrate the transfer process and test functionality following transfer. Passive devices (photodetectors) as well as active transistors were transferred and fabricated on various substrates. The transferred device layers were either implanted through with a blanket implant or protected with an ion-mask during implantation. Results demonstrate the viability of the double-flip ion-cut process in achieving very high electron mobility (˜2800 cm2V-1s-1) transistors on plastic flexible substrates.

Charge reconfiguration in arrays of quantum dots

NASA Astrophysics Data System (ADS)

Bayer, Johannes C.; Wagner, Timo; Rugeramigabo, Eddy P.; Haug, Rolf J.

2017-12-01

Semiconductor quantum dots are potential building blocks for scalable qubit architectures. Efficient control over the exchange interaction and the possibility of coherently manipulating electron states are essential ingredients towards this goal. We studied experimentally the shuttling of electrons trapped in serial quantum dot arrays isolated from the reservoirs. The isolation hereby enables a high degree of control over the tunnel couplings between the quantum dots, while electrons can be transferred through the array by gate voltage variations. Model calculations are compared with our experimental results for double, triple, and quadruple quantum dot arrays. We are able to identify all transitions observed in our experiments, including cotunneling transitions between distant quantum dots. The shuttling of individual electrons between quantum dots along chosen paths is demonstrated.

Double-layered cell transfer technology for bone regeneration

PubMed Central

Akazawa, Keiko; Iwasaki, Kengo; Nagata, Mizuki; Yokoyama, Naoki; Ayame, Hirohito; Yamaki, Kazumasa; Tanaka, Yuichi; Honda, Izumi; Morioka, Chikako; Kimura, Tsuyoshi; Komaki, Motohiro; Kishida, Akio; Izumi, Yuichi; Morita, Ikuo

2016-01-01

For cell-based medicine, to mimic in vivo cellular localization, various tissue engineering approaches have been studied to obtain a desirable arrangement of cells on scaffold materials. We have developed a novel method of cell manipulation called “cell transfer technology”, enabling the transfer of cultured cells onto scaffold materials, and controlling cell topology. Here we show that using this technique, two different cell types can be transferred onto a scaffold surface as stable double layers or in patterned arrangements. Various combinations of adherent cells were transferred to a scaffold, amniotic membrane, in overlapping bilayers (double-layered cell transfer), and transferred cells showed stability upon deformations of the material including folding and trimming. Transplantation of mesenchymal stem cells from periodontal ligaments (PDLSC) and osteoblasts, using double-layered cell transfer significantly enhanced bone formation, when compared to single cell type transplantation. Our findings suggest that this double-layer cell transfer is useful to produce a cell transplantation material that can bear two cell layers. Moreover, the transplantation of an amniotic membrane with PDLSCs/osteoblasts by cell transfer technology has therapeutic potential for bone defects. We conclude that cell transfer technology provides a novel and unique cell transplantation method for bone regeneration. PMID:27624174

Design of a lens table for a double toroidal electron spectrometer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu Xiaojng; Nicolas, Christophe; Miron, Catalin

2013-03-15

We report here on the method we developed to build a lens table for a four-element electrostatic transfer lens operated together with a double toroidal electron energy analyzer designed by one of us, and whose original design and further improvements are described in detail in Miron et al. [Rev. Sci. Instrum. 68, 3728 (1997)] and Le Guen et al. [Rev. Sci. Instrum. 73, 3885 (2002)]. Both computer simulations and laboratory instrument tuning were performed in order to build this lens table. The obtained result was tested for a broad range of electron kinetic energies and analyzer pass energies. Based onmore » this new lens table, allowing to easily computer control the spectrometer working conditions, we could routinely achieve an electron energy resolution ranging between 0.6% and 0.8% of the analyzer pass energy, while the electron count rate was also significantly improved. The establishment of such a lens table is of high importance to relieve experimentalists from the tedious laboring of the lens optimization, which was previously necessary prior to any measurement. The described method can be adapted to any type of electron/ion energy analyzer, and will thus be interesting for all experimentalists who own, or plan to build or improve their charged particle energy analyzers.« less

Exciplex mediated photoinduced electron transfer reactions of phthalocyanine-fullerene dyads.

PubMed

Niemi, Marja; Tkachenko, Nikolai V; Efimov, Alexander; Lehtivuori, Heli; Ohkubo, Kei; Fukuzumi, Shunichi; Lemmetyinen, Helge

2008-07-31

Evidences of an intramolecular exciplex intermediate in a photoinduced electron transfer (ET) reaction of double-linked free-base and zinc phthalocyanine-C60 dyads were found. This was the first time for a dyad with phthalocyanine donor. Excitation of the phthalocyanine moiety of the dyads results in rapid ET from phthalocyanine to fullerene via an exciplex state in both polar and nonpolar solvents. Relaxation of the charge-separated (CS) state Pc(*+)-C60(*-) in a polar solvent occurs directly to the ground state in 30-70 ps. In a nonpolar solvent, roughly 20% of the molecules undergo transition from the CS state to phthalocyanine triplet state (3)Pc*-C60 before relaxation to the ground state. Formation of the CS state was confirmed with electron spin resonance measurements at low temperature in both polar and nonpolar solvent. Reaction schemes for the photoinduced ET reactions of the dyads were completed with rate constants obtained from the time-resolved absorption and emission measurements and with state energies obtained from the fluorescence, phosphorescence, and voltammetric measurements.

Study on Synergistic Mechanism of Inhibitor Mixture Based on Electron Transfer Behavior

PubMed Central

Han, Peng; He, Yang; Chen, Changfeng; Yu, Haobo; Liu, Feng; Yang, Hong; Ma, Yue; Zheng, Yanjun

2016-01-01

Mixing is an important method to improve the performance of surfactants due to their synergistic effect. The changes in bonding interaction and adsorption structure of IM and OP molecules before and after co-adsorbed on Fe(001) surface is calculated by DFTB+ method. It is found that mixture enable the inhibitor molecules with higher EHOMO donate more electrons while the inhibitor molecules with lower ELUMO accept more electrons, which strengthens the bonding interaction of both inhibitor agent and inhibitor additive with metal surface. Meanwhile, water molecules in the compact layer of double electric layer are repulsed and the charge transfer resistance during the corrosion process increases. Accordingly, the correlation between the frontier orbital (EHOMO and ELUMO of inhibitor molecules and the Fermi level of metal) and inhibition efficiency is determined. Finally, we propose a frontier orbital matching principle for the synergistic effect of inhibitors, which is verified by electrochemical experiments. This frontier orbital matching principle provides an effective quantum chemistry calculation method for the optimal selection of inhibitor mixture. PMID:27671332

How the Number of Layers and Relative Position Modulate the Interlayer Electron Transfer in π-Stacked 2D Materials.

PubMed

Biancardi, Alessandro; Caraiani, Claudiu; Chan, Wai-Lun; Caricato, Marco

2017-04-06

Understanding the interfacial electron transfer (IET) between 2D layers is central to technological applications. We present a first-principles study of the IET between a zinc phthalocyanine film and few-layer graphene by using our recent method for the calculation of electronic coupling in periodic systems. The ultimate goal is the development of a predictive in silico approach for designing new 2D materials. We find IET to be critically dependent on the number of layers and their stacking orientation. In agreement with experiment, IET to single-layer graphene is shown to be faster than that to double-layer graphene due to interference effects between layers. We predict that additional graphene layers increase the number of IET pathways, eventually leading to a faster rate. These results shed new light on the subtle interplay between structure and IET, which may lead to more effective "bottom up" design strategies for these materials.

Photosensitized electron transport across lipid vesicle walls: Enhancement of quantum yield by ionophores and transmembrane potentials

PubMed Central

Laane, Colja; Ford, William E.; Otvos, John W.; Calvin, Melvin

1981-01-01

The photosensitized reduction of heptylviologen in the bulk aqueous phase of phosphatidylcholine vesicles containing EDTA inside and a membrane-bound tris(2,2′-bipyridine)ruthenium(2+) derivative is enhanced by a factor of 6.5 by the addition of valinomycin in the presence of K+. A 3-fold stimulation by gramicidin and carbonyl cyanide m-chlorophenylhydrazone is observed. The results suggest that, under these conditions, the rate of photoinduced electron transfer across vesicle walls in the absence of ion carriers is limited by cotransport of cations. The rate of electron transfer across vesicle walls could be influenced further by generating transmembrane potentials with K+ gradients in the presence of valinomycin. When vesicles are made with transmembrane potentials, interior more negative, the quantum yield of heptylviologen reduction is doubled, and, conversely, when vesicles are made with transmembrane potentials, interior more positive, the quantum yield is decreased and approaches the value found in the absence of valinomycin. PMID:16593002

Tautomeric selectivity of the excited-state lifetime of guanine/cytosine base pairs: The role of electron-driven proton-transfer processes

PubMed Central

Sobolewski, Andrzej L.; Domcke, Wolfgang; Hättig, C.

2005-01-01

The UV spectra of three different conformers of the guanine/cytosine base pair were recorded recently with UV-IR double-resonance techniques in a supersonic jet [Abo-Riziq, A., Grace, L., Nir, E., Kabelac, M., Hobza, P. & de Vries, M. S. (2005) Proc. Natl. Acad. Sci. USA 102, 20–23]. The spectra provide evidence for a very efficient excited-state deactivation mechanism that is specific for the Watson–Crick structure and may be essential for the photostability of DNA. Here we report results of ab initio electronic-structure calculations for the excited electronic states of the three lowest-energy conformers of the guanine/cytosine base pair. The calculations reveal that electron-driven interbase proton-transfer processes play an important role in the photochemistry of these systems. The exceptionally short lifetime of the UV-absorbing states of the Watson–Crick conformer is tentatively explained by the existence of a barrierless reaction path that connects the spectroscopic 1π π * excited state with the electronic ground state via two electronic curve crossings. For the non-Watson–Crick structures, the photochemically reactive state is located at higher energies, resulting in a barrier for proton transfer and, thus, a longer lifetime of the UV-absorbing 1π π * state. The computational results support the conjecture that the photochemistry of hydrogen bonds plays a decisive role for the photostability of the molecular encoding of the genetic information in isolated DNA base pairs. PMID:16330778

Involvement of pigment globules containing multiple melanosomes in the transfer of melanosomes from melanocytes to keratinocytes

PubMed Central

Niki, Yoko; Yoshida, Masaki; Ito, Masaaki; Akiyama, Kaoru; Kim, Jin-Hwa; Yoon, Tae-Jin; Matsui, Mary S; Yarosh, Daniel B; Ichihashi, Masamitsu

2011-01-01

The mechanism of melanosome transfer from melanocytes to keratinocytes has not been fully clarified. We now show a route of melanosome transfer using co-cultures of normal human melanocytes and keratinocytes. Substantial levels of melanosome transfer were elicited in co-cultures of melanocytes and keratinocytes separated by a microporous membrane filter. The melanocyte dendrites penetrated into the keratinocyte layer through the filter and many pigment globules were observed in keratinocytes. Electron microscopic observations revealed that melanosomes incorporated in keratinocytes were packed in clusters enclosed by a double membrane. Numerous pigment globules budded off from melanocyte dendrites and were released into the culture medium. Those pigment globules were filled with multiple melanosomes and a few mitochondria but no nuclei. When those globules were added to the culture medium of keratinocytes, they were incorporated and showed double membrane-enclosed melano-phagolysosomes consistent with the structures obtained from the co-culture system. In contrast, when individual naked melanosomes isolated from melanocytes were added to keratinocytes, they were also phagocytosed by keratinocytes but were enclosed by a single membrane in a manner distinct from the co-culture system. These results suggest a novel mechanism of melanosome transfer, wherein melanosomes are packed in membrane globules that bud off from melanocyte dendrites, where they are released into the extracellular space and then phagocytosed by keratinocytes. PMID:21686100

Measurement of scintillation and ionization yield with high-pressure gaseous mixtures of Xe and TMA for improved neutrinoless double beta decay and dark matter searches

DOE PAGES

Nakajima, Y.; Goldschmidt, A.; Matis, H. S.; ...

2016-03-18

The gaseous Xenon(Xe) time projection chamber (TPC) is an attractive detector technique for neutrinoless double beta decay and WIMP dark matter searches. While it is less dense compared to Liquid Xe detectors, it has intrinsic advantages in tracking capability and better energy resolution. The performance of gaseous Xe can be further improved by molecular additives such as trimethylamine(TMA), which is expected to (1) cool down the ionization electrons, (2) convert Xe excitation energy to TMA ionizations through Penning transfer, and (3) produce scintillation and electroluminescence light in a more easily detectable wavelength (300 nm). In order to test the feasibilitymore » of the performance improvements with TMA, in this paper we made the first direct measurement of Penning and fluorescence transfer efficiency with gaseous mixtures of Xe and TMA. While we observed a Penning transfer efficiency up to ~35%, we found strong suppression of primary scintillation light with TMA. We also found that the primary scintillation light with Xe and TMA mixture can be well characterized by ~3% fluorescence transfer from Xe to TMA, with further suppression due to TMA self-quenching. No evidence of the scintillation light produced by recombination of TMA ions was found. This strong suppression of scintillation light makes dark matter searches quite challenging, while the possibility of improved neutrinoless double beta decay searches remains open. Finally, this work has been carried out within the context of the NEXT collaboration.« less

Nonmonotonous electron mobility due to structurally induced resonant coupling of subband states in an asymmetric double quantum well

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nayak, R. K.; Das, S.; Panda, A. K.

We show that sharp nonmonotic variation of low temperature electron mobility μ can be achieved in GaAs/Al{sub x}Ga{sub 1-x}As barrier delta-doped double quantum well structure due to quantum mechanical transfer of subband electron wave functions within the wells. We vary the potential profile of the coupled structure as a function of the doping concentration in order to bring the subbands into resonance such that the subband energy levels anticross and the eigen states of the coupled structure equally share both the wells thereby giving rise to a dip in mobility. When the wells are of equal widths, the dip inmore » mobility occurs under symmetric doping of the side barriers. In case of unequal well widths, the resonance can be obtained by suitable asymmetric variation of the doping concentrations. The dip in mobility becomes sharp and also the wavy nature of mobility takes a rectangular shape by increasing the barrier width. We show that the dip in mobility at resonance is governed by the interface roughness scattering through step like changes in the subband mobilities. It is also gratifying to show that the drop in mobility at the onset of occupation of second subband is substantially supressed through the quantum mechanical transfer of subband wave functions between the wells. Our results can be utilized for performance enhancement of coupled quantum well devices.« less

Double Z-scheme ZnO/ZnS/g-C3N4 ternary structure for efficient photocatalytic H2 production

NASA Astrophysics Data System (ADS)

Dong, Zhifang; Wu, Yan; Thirugnanam, Natarajan; Li, Gonglin

2018-02-01

In the present work, a novel ZnO/ZnS/g-C3N4 ternary nanocomposite with double Z-scheme heterojunction has been designed via a two-step facile chemical conversion route. The spherical ZnS nanoparticles were uniformly loaded onto ZnO nanoflowers surface. And then the ZnO/ZnS nanocomposite was further hybridized with g-C3N4 nanosheets. Ternary ZnO/ZnS/g-C3N4 nanocomposite displays the largest specific surface area (about 76.2 m2/g), which provides plentiful activated sites for photocatalytic reaction. Furthermore, the ternary material exhibits the highest methylene blue photodegradation rate of about 0.0218 min-1 and the optimum photocatalytic H2 production (1205 μmol/g) over water splitting at 4 h under solar light irradiation. Moreover, it showed the highest photocurrent effect and the minimum charge-transfer resistance. These results implied that the higher photoactivity of ZnO/ZnS/g-C3N4 nanocomposite could be attributed to the multi-steps charge transfer and effective electron-hole separation in the double Z-scheme system.

Measurement Of Gas Electron Multiplier (GEM) Detector Characteristics

NASA Astrophysics Data System (ADS)

Park, Seongtae; Baldelomar, Edwin; Park, Kwangjune; Sosebee, Mark; White, Andy; Yu, Jaehoon

2011-06-01

The High Energy Physics group of the University of Texas at Arlington has been developing gas electron multiplier detectors to use them as sensitive gap detectors in digital hadron calorimeters for the International Linear Collider, a future high energy particle accelerator. For this purpose, we constructed numerous GEM detectors that employ double GEM layers. In this study, two kinds of prototype GEM detectors were tested; one with 28×28 cm2 active area double GEM structure with a 3 mm drift gap, a 1 mm transfer gap and a 1 mm induction gap and the other with two 3×3 cm2 GEM foils in the amplifier stage with a 5 mm drift gap, a 2 mm transfer gap and a 1 mm induction gap. The detectors' characteristics from exposure to high-energy charged particles and other radiations were measured using cosmic rays and 55Fe radioactive source. From the 55Fe tests, we observed two well separated characteristic X-ray emission peaks and confirmed the detectors' functionality. We also measured chamber gains to be over 6000 at a high voltage of 395 V across each GEM electrode. The responses to cosmic rays show the spectra that fit well to Landau distributions as expected from minimum ionizing particles.

Distinguishing the Roles of Thylakoid Respiratory Terminal Oxidases in the Cyanobacterium Synechocystis sp. PCC 6803.

PubMed

Ermakova, Maria; Huokko, Tuomas; Richaud, Pierre; Bersanini, Luca; Howe, Christopher J; Lea-Smith, David J; Peltier, Gilles; Allahverdiyeva, Yagut

2016-06-01

Various oxygen-utilizing electron sinks, including the soluble flavodiiron proteins (Flv1/3), and the membrane-localized respiratory terminal oxidases (RTOs), cytochrome c oxidase (Cox) and cytochrome bd quinol oxidase (Cyd), are present in the photosynthetic electron transfer chain of Synechocystis sp. PCC 6803. However, the role of individual RTOs and their relative importance compared with other electron sinks are poorly understood, particularly under light. Via membrane inlet mass spectrometry gas exchange, chlorophyll a fluorescence, P700 analysis, and inhibitor treatment of the wild type and various mutants deficient in RTOs, Flv1/3, and photosystem I, we investigated the contribution of these complexes to the alleviation of excess electrons in the photosynthetic chain. To our knowledge, for the first time, we demonstrated the activity of Cyd in oxygen uptake under light, although it was detected only upon inhibition of electron transfer at the cytochrome b6f site and in ∆flv1/3 under fluctuating light conditions, where linear electron transfer was drastically inhibited due to impaired photosystem I activity. Cox is mostly responsible for dark respiration and competes with P700 for electrons under high light. Only the ∆cox/cyd double mutant, but not single mutants, demonstrated a highly reduced plastoquinone pool in darkness and impaired gross oxygen evolution under light, indicating that thylakoid-based RTOs are able to compensate partially for each other. Thus, both electron sinks contribute to the alleviation of excess electrons under illumination: RTOs continue to function under light, operating on slower time ranges and on a limited scale, whereas Flv1/3 responds rapidly as a light-induced component and has greater capacity. © 2016 American Society of Plant Biologists. All Rights Reserved.

Can HN[double bond, length as m-dash]NH, FN[double bond, length as m-dash]NH, or HN[double bond, length as m-dash]CHOH bridge the σ-hole and the lone pair at P in binary complexes with H2XP, for X = F, Cl, NC, OH, CN, CCH, CH3, and H?

PubMed

Del Bene, Janet E; Alkorta, Ibon; Elguero, José

2015-11-11

Ab initio MP2/aug'-cc-pVTZ calculations have been carried out to investigate the properties of complexes formed between H2XP, for X = F, Cl, NC, OH, CN, CCH, CH3, and H, and the possible bridging molecules HN[double bond, length as m-dash]NH, FN[double bond, length as m-dash]NH, and HN[double bond, length as m-dash]CHOH. H2XP:HNNH and H2XP:FNNH complexes are stabilized by PN pnicogen bonds, except for H2(CH3)P:FNNH and H3P:FNNH which are stabilized by N-HP hydrogen bonds. H2XP:HNCHOH complexes are stabilized by PN pnicogen bonds and nonlinear O-HP hydrogen bonds. For a fixed H2XP molecule, binding energies decrease in the order HNCHOH > HNNH > FNNH, except for the binding energies of H2(CH3)P and H3P with HNNH and FNNH. Binding energies of complexes with HNCHOH and HNNH increase as the P-N1 distance decreases, but binding energies of complexes with FNNH show little dependence on this distance. The large binding energies of H2XP:HNCHOH complexes arise from a cooperative effect involving electron-pair acceptance by P to form a pnicogen bond, and electron-pair donation by P to form a hydrogen bond. The dominant charge-transfer interaction in these complexes involves electron-pair donation by N across the pnicogen bond, except for complexes in which X is one of the more electropositive substituents, CCH, CH3, and H. For these, lone-pair donation by P across the hydrogen bond dominates. AIM and NBO data for these complexes are consistent with their bonding characteristics, showing molecular graphs with bond critical points and charge-transfer interactions associated with hydrogen and pnicogen bonds. EOM-CCSD spin-spin coupling constants (1p)J(P-N) across the pnicogen bond for each series of complexes correlate with the P-N distance. In contrast, (2h)J(O-P) values for complexes H2XP:HNCHOH do not correlate with the O-P distance, a consequence of the nonlinearity of these hydrogen bonds.

Theoretical rate constants of super-exchange hole transfer and thermally induced hopping in DNA.

PubMed

Shimazaki, Tomomi; Asai, Yoshihiro; Yamashita, Koichi

2005-01-27

Recently, the electronic properties of DNA have been extensively studied, because its conductivity is important not only to the study of fundamental biological problems, but also in the development of molecular-sized electronics and biosensors. We have studied theoretically the reorganization energies, the activation energies, the electronic coupling matrix elements, and the rate constants of hole transfer in B-form double-helix DNA in water. To accommodate the effects of DNA nuclear motions, a subset of reaction coordinates for hole transfer was extracted from classical molecular dynamics (MD) trajectories of DNA in water and then used for ab initio quantum chemical calculations of electron coupling constants based on the generalized Mulliken-Hush model. A molecular mechanics (MM) method was used to determine the nuclear Franck-Condon factor. The rate constants for two types of mechanisms of hole transfer-the thermally induced hopping (TIH) and the super-exchange mechanisms-were determined based on Marcus theory. We found that the calculated matrix elements are strongly dependent on the conformations of the nucleobase pairs of hole-transferable DNA and extend over a wide range of values for the "rise" base-step parameter but cluster around a particular value for the "twist" parameter. The calculated activation energies are in good agreement with experimental results. Whereas the rate constant for the TIH mechanism is not dependent on the number of A-T nucleobase pairs that act as a bridge, the rate constant for the super-exchange process rapidly decreases when the length of the bridge increases. These characteristic trends in the calculated rate constants effectively reproduce those in the experimental data of Giese et al. [Nature 2001, 412, 318]. The calculated rate constants were also compared with the experimental results of Lewis et al. [Nature 2000, 406, 51].

Coupled-Double-Quantum-Dot Environmental Information Engines: A Numerical Analysis

NASA Astrophysics Data System (ADS)

Tanabe, Katsuaki

2016-06-01

We conduct numerical simulations for an autonomous information engine comprising a set of coupled double quantum dots using a simple model. The steady-state entropy production rate in each component, heat and electron transfer rates are calculated via the probability distribution of the four electronic states from the master transition-rate equations. We define an information-engine efficiency based on the entropy change of the reservoir, implicating power generators that employ the environmental order as a new energy resource. We acquire device-design principles, toward the realization of corresponding practical energy converters, including that (1) higher energy levels of the detector-side reservoir than those of the detector dot provide significantly higher work production rates by faster states' circulation, (2) the efficiency is strongly dependent on the relative temperatures of the detector and system sides and becomes high in a particular Coulomb-interaction strength region between the quantum dots, and (3) the efficiency depends little on the system dot's energy level relative to its reservoir but largely on the antisymmetric relative amplitudes of the electronic tunneling rates.

Quadratic Electro-optic Effect in a Novel Nano-optical Polymer (iodine-doped polyisoprene)

NASA Astrophysics Data System (ADS)

Swamy, Rajendra; Titus, Jitto; Thakur, Mrinal

2004-03-01

In this report, exceptionally large quadratic electro-optic effect in a novel nano-optical polymer will be discussed. The material involved is cis-1,4-polyisoprene or natural rubber which is a nonconjugated conductive polymer[1,2].Upon doping with an acceptor such as iodine, an electron is transferred from its isolated double bond to the dopant leading to a charge-transfer complex. The positive charge (hole) thus created is localized around the double-bond site, within a nanometer dimension - thus, forming a nano-optical material. The quadratic electro-optic measurement on the doped polyisoprene film was made using field-induced birefringence method. The measured Kerr coefficient is about sixty six times that of nitrobenzene at 632 nm. Significant electroabsorption was also observed in this material at 632 nm. 1. M. Thakur, J. Macromol. Sci. - PAC, 2001, A38(12), 1337. 2. M. Thakur, S. Khatavkar and E.J. Parish, J. Macromol. Sci. - PAC, 2003, A40 (12), 1397.

Biological construction of single-walled carbon nanotube electron transfer pathways in dye-sensitized solar cells.

PubMed

Inoue, Ippei; Watanabe, Kiyoshi; Yamauchi, Hirofumi; Ishikawa, Yasuaki; Yasueda, Hisashi; Uraoka, Yukiharu; Yamashita, Ichiro

2014-10-01

We designed and mass-produced a versatile protein supramolecule that can be used to manufacture a highly efficient dye-sensitized solar cell (DSSC). Twelve single-walled carbon-nanotube (SWNT)-binding and titanium-mineralizing peptides were genetically integrated on a cage-shaped dodecamer protein (CDT1). A process involving simple mixing of highly conductive SWNTs with CDT1 followed by TiO2 biomineralization produces a high surface-area/weight TiO2 -(anatase)-coated intact SWNT nanocomposite under environmentally friendly conditions. A DSSC with a TiO2 photoelectrode containing 0.2 wt % of the SWNT-TiO2 nanocomposite shows a current density improvement by 80% and a doubling of the photoelectric conversion efficiency. The SWNT-TiO2 nanocomposite transfers photon-generated electrons from dye molecules adsorbed on the TiO2 to the anode electrode swiftly. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Ambipolar insulator-to-metal transition in black phosphorus by ionic-liquid gating.

PubMed

Saito, Yu; Iwasa, Yoshihiro

2015-03-24

We report ambipolar transport properties in black phosphorus using an electric-double-layer transistor configuration. The transfer curve clearly exhibits ambipolar transistor behavior with an ON-OFF ratio of ∼5 × 10(3). The band gap was determined as ≅0.35 eV from the transfer curve, and Hall-effect measurements revealed that the hole mobility was ∼190 cm(2)/(V s) at 170 K, which is 1 order of magnitude larger than the electron mobility. By inducing an ultrahigh carrier density of ∼10(14) cm(-2), an electric-field-induced transition from the insulating state to the metallic state was realized, due to both electron and hole doping. Our results suggest that black phosphorus will be a good candidate for the fabrication of functional devices, such as lateral p-n junctions and tunnel diodes, due to the intrinsic narrow band gap.

The Architecture Design of Detection and Calibration System for High-voltage Electrical Equipment

NASA Astrophysics Data System (ADS)

Ma, Y.; Lin, Y.; Yang, Y.; Gu, Ch; Yang, F.; Zou, L. D.

2018-01-01

With the construction of Material Quality Inspection Center of Shandong electric power company, Electric Power Research Institute takes on more jobs on quality analysis and laboratory calibration for high-voltage electrical equipment, and informationization construction becomes urgent. In the paper we design a consolidated system, which implements the electronic management and online automation process for material sampling, test apparatus detection and field test. In the three jobs we use QR code scanning, online Word editing and electronic signature. These techniques simplify the complex process of warehouse management and testing report transferring, and largely reduce the manual procedure. The construction of the standardized detection information platform realizes the integrated management of high-voltage electrical equipment from their networking, running to periodic detection. According to system operation evaluation, the speed of transferring report is doubled, and querying data is also easier and faster.

Operation of a quantum dot in the finite-state machine mode: Single-electron dynamic memory

DOE Office of Scientific and Technical Information (OSTI.GOV)

Klymenko, M. V.; Klein, M.; Levine, R. D.

2016-07-14

A single electron dynamic memory is designed based on the non-equilibrium dynamics of charge states in electrostatically defined metallic quantum dots. Using the orthodox theory for computing the transfer rates and a master equation, we model the dynamical response of devices consisting of a charge sensor coupled to either a single and or a double quantum dot subjected to a pulsed gate voltage. We show that transition rates between charge states in metallic quantum dots are characterized by an asymmetry that can be controlled by the gate voltage. This effect is more pronounced when the switching between charge states correspondsmore » to a Markovian process involving electron transport through a chain of several quantum dots. By simulating the dynamics of electron transport we demonstrate that the quantum box operates as a finite-state machine that can be addressed by choosing suitable shapes and switching rates of the gate pulses. We further show that writing times in the ns range and retention memory times six orders of magnitude longer, in the ms range, can be achieved on the double quantum dot system using experimentally feasible parameters, thereby demonstrating that the device can operate as a dynamic single electron memory.« less

Flux-dependent anti-crossing of resonances in parallel non-coupled double quantum dots

NASA Astrophysics Data System (ADS)

Joe, Yong S.; Hedin, Eric R.; Kim, Jiseok

2008-08-01

We present novel resonant phenomena through parallel non-coupled double quantum dots (QDs) embedded in each arm of an Aharonov-Bohm (AB) ring with magnetic flux passing through its center. The electron transmission through this AB ring with each QD formed by two short-range potential barriers is calculated using a scattering matrix at each junction and a transfer matrix in each arm. We show that as the magnetic flux modulates, a distortion of the grid-like square transmission occurs and an anti-crossing of the resonances appears. Hence, the modulation of magnetic flux in this system can have an equivalent effect to the control of inter-dot coupling between the two QDs.

Support effects on adsorption and catalytic activation of O2 in single atom iron catalysts with graphene-based substrates.

PubMed

Gao, Zheng-Yang; Yang, Wei-Jie; Ding, Xun-Lei; Lv, Gang; Yan, Wei-Ping

2018-03-07

The adsorption and catalytic activation of O 2 on single atom iron catalysts with graphene-based substrates were investigated systematically by density functional theory calculation. It is found that the support effects of graphene-based substrates have a significant influence on the stability of the single atom catalysts, the adsorption configuration, the electron transfer mechanism, the adsorption energy and the energy barrier. The differences in the stable adsorption configuration of O 2 on single atom iron catalysts with different graphene-based substrates can be well understood by the symmetrical matching principle based on frontier molecular orbital analysis. There are two different mechanisms of electron transfer, in which the Fe atom acts as the electron donor in single vacancy graphene-based substrates while the Fe atom mainly acts as the bridge for electron transfer in double vacancy graphene-based substrates. The Fermi softness and work function are good descriptors of the adsorption energy and they can well reveal the relationship between electronic structure and adsorption energy. This single atom iron catalyst with single vacancy graphene modified by three nitrogen atoms is a promising non-noble metal single atom catalyst in the adsorption and catalytic oxidation of O 2 . Furthermore, the findings can lay the foundation for the further study of graphene-based support effects and provide a guideline for the development and design of new non-noble-metal single atom catalysts.

Gas Phase Molecular Spectroscopy: Electronic Spectroscopy of Combustion Intermediates, Chlorine Azide kinetics, and Rovibrational Energy Transfer in Acetylene

NASA Astrophysics Data System (ADS)

Freel, Keith A.

This dissertation is composed of three sections. The first deals with the electronic spectroscopy of combustion intermediates that are related to the formation of polycyclic aromatic hydrocarbons. Absorption spectra for phenyl, phenoxy, benzyl, and phenyl peroxy radicals were recorded using the technique of cavity ring-down spectroscopy. When possible, molecular constants, vibrational frequencies, and excited state lifetimes for these radicals were derived from these data. The results were supported by theoretical predictions. The second section presents a study of electron attachment to chlorine azide (ClN3) using a flowing-afterglow Langmuir-probe apparatus. Electron attachment rates were measured to be 3.5x10-8 and 4.5x10-8 cm3s-1 at 298 and 400 K respectively. The reactions of ClN3 with eighteen cations and seventeen anions were characterized. Rate constants were measured using a selected ion flow tube. The ionization energy (>9.6eV), proton affinity (713+/-41 kJ mol-1), and electron affinity (2.48+/-0.2 eV) for ClN 3 were determined from these data. The third section demonstrates the use of double resonance spectroscopy to observe state-selected rovibrational energy transfer from the first overtone asymmetric stretch of acetylene. The total population removal rate constants from various rotational levels of the (1,0,1,00,00) vibrational state were determined to be in the range of (9-17) x 10 -10 cm3s-1. Rotational energy transfer accounted for approximately 90% of the total removal rate from each state. Therefore, the upper limit of vibrational energy transfer from the (1,0,1,0 0,00) state was 10%.

Quantum tunneling of electron snake states in an inhomogeneous magnetic field.

PubMed

Hoodbhoy, Pervez

2018-05-10

In a two dimensional free electron gas subjected to a perpendicular spatially varying magnetic field, the classical paths of electrons are snake-like trajectories that weave along the line where the field crosses zero. But quantum mechanically this system is described by a symmetric double well potential which, for low excitations, leads to very different electron behavior. We compute the spectrum, as well as the wavefunctions, for states of definite parity in the limit of nearly degenerate states, i.e. for electrons sufficiently far from the B z   =  0 line. Transitions between the states are shown to give rise to a tunneling current. If the well is made asymmetrical by a time-dependent parity breaking perturbation then Rabi-like oscillations between parity states occur. Resonances can be excited and used to stimulate the transfer of electrons from one side of the potential barrier to the other through quantum tunneling.

Quantum tunneling of electron snake states in an inhomogeneous magnetic field

NASA Astrophysics Data System (ADS)

Hoodbhoy, Pervez

2018-05-01

In a two dimensional free electron gas subjected to a perpendicular spatially varying magnetic field, the classical paths of electrons are snake-like trajectories that weave along the line where the field crosses zero. But quantum mechanically this system is described by a symmetric double well potential which, for low excitations, leads to very different electron behavior. We compute the spectrum, as well as the wavefunctions, for states of definite parity in the limit of nearly degenerate states, i.e. for electrons sufficiently far from the B z   =  0 line. Transitions between the states are shown to give rise to a tunneling current. If the well is made asymmetrical by a time-dependent parity breaking perturbation then Rabi-like oscillations between parity states occur. Resonances can be excited and used to stimulate the transfer of electrons from one side of the potential barrier to the other through quantum tunneling.

Amplification of Dynamic Nuclear Polarization at 200 GHz by Arbitrary Pulse Shaping of the Electron Spin Saturation Profile.

PubMed

Kaminker, Ilia; Han, Songi

2018-06-07

Dynamic nuclear polarization (DNP) takes center stage in nuclear magnetic resonance (NMR) as a tool to amplify its signal by orders of magnitude through the transfer of polarization from electron to nuclear spins. In contrast to modern NMR and electron paramagnetic resonance (EPR) that extensively rely on pulses for spin manipulation in the time domain, the current mainstream DNP technology exclusively relies on monochromatic continuous wave (CW) irradiation. This study introduces arbitrary phase shaped pulses that constitute a train of coherent chirp pulses in the time domain at 200 GHz (7 T) to dramatically enhance the saturation bandwidth and DNP performance compared to CW DNP, yielding up to 500-fold in NMR signal enhancements. The observed improvement is attributed to the recruitment of additional electron spins contributing to DNP via the cross-effect mechanism, as experimentally confirmed by two-frequency pump-probe electron-electron double resonance (ELDOR).

Electronic structure and electron-phonon interaction in hexagonal yttrium by density functional calculations

NASA Astrophysics Data System (ADS)

Singh, Prabhakar P.

2007-03-01

To understand the pressure-induced changes in the electronic structure and the electron-phonon interaction in yttrium, we have studied hexagonal-close-packed (hcp) yttrium, stable at ambient pressure, and double hexagonal-close-packed (dhcp) yttrium, stable up to around 44GPa , using density-functional-based methods. Our results show that as one goes from hcp yttrium to dhcp yttrium, there are (i) a substantial charge transfer from s→d with extensive modifications of the d band and a sizable reduction in the density of states at the Fermi energy, (ii) a substantial stiffening of phonon modes with the electron-phonon coupling covering the entire frequency range, and (iii) an increase in the electron-phonon coupling constant λ from 0.55 to 1.24, leading to a change in the superconducting transition temperature Tc from 0.3to15.3K for μ*=0.2 .

Time-dependent calculations of transfer ionization by fast proton-helium collision in one-dimensional kinematics

NASA Astrophysics Data System (ADS)

Serov, Vladislav V.; Kheifets, A. S.

2014-12-01

We analyze a transfer ionization (TI) reaction in the fast proton-helium collision H++He →H0+He2 ++ e- by solving a time-dependent Schrödinger equation (TDSE) under the classical projectile motion approximation in one-dimensional kinematics. In addition, we construct various time-independent analogs of our model using lowest-order perturbation theory in the form of the Born series. By comparing various aspects of the TDSE and the Born series calculations, we conclude that the recent discrepancies of experimental and theoretical data may be attributed to deficiency of the Born models used by other authors. We demonstrate that the correct Born series for TI should include the momentum-space overlap between the double-ionization amplitude and the wave function of the transferred electron.

Spectroscopic study of the charge-transfer complexes TiCl4/styrene and TiCl4/polystyrene

NASA Astrophysics Data System (ADS)

Gonçalves, Norberto S.; Noda, Lúcia. K.

2017-10-01

In this work, solutions of TiCl4/styrene and TiCl4/polystyrene charge-transfer complexes in CHCl3 or CDCl3 were investigated by UV-vis, resonance Raman and 1H NMR spectroscopies in order to study their molecular and electronic structures. Both show a yellow colour due to absorption in the 400 nm region, related to a charge-transfer transition. In Raman spectra, as the excitation approaches the resonance region, the primary enhancement of aromatic ring modes was mainly observed, rather than intensification of the vinylic double-bond stretch. Under the experimental conditions it was observed that formation of polystyrene takes place, as showed by 1H NMR spectra, and the most significant interaction occurs at the aromatic ring, as supported by the results from interaction of TiCl4 with polystyrene, as indicated by the charge-transfer band and resonant intensification of the aromatic ring modes.

The Kinetics of Heterogeneous Electron Transfer Reactions in Polar Solvents

DTIC Science & Technology

1994-04-20

focussed on systems for which rate constants and activation parameters are available as a function of the solvent, and as a function of temperature . The... temperature . The role of reactant structure in determining the kinetic parameters is also considered. Double layer effects both at unmodified and...that the Gibbs activation energy to form a monovalent cation from a neutral molecule via electrooxidation is different from that to form a monovalent

Deformed quantum double realization of the toric code and beyond

NASA Astrophysics Data System (ADS)

Padmanabhan, Pramod; Ibieta-Jimenez, Juan Pablo; Bernabe Ferreira, Miguel Jorge; Teotonio-Sobrinho, Paulo

2016-09-01

Quantum double models, such as the toric code, can be constructed from transfer matrices of lattice gauge theories with discrete gauge groups and parametrized by the center of the gauge group algebra and its dual. For general choices of these parameters the transfer matrix contains operators acting on links which can also be thought of as perturbations to the quantum double model driving it out of its topological phase and destroying the exact solvability of the quantum double model. We modify these transfer matrices with perturbations and extract exactly solvable models which remain in a quantum phase, thus nullifying the effect of the perturbation. The algebra of the modified vertex and plaquette operators now obey a deformed version of the quantum double algebra. The Abelian cases are shown to be in the quantum double phase whereas the non-Abelian phases are shown to be in a modified phase of the corresponding quantum double phase. These are illustrated with the groups Zn and S3. The quantum phases are determined by studying the excitations of these systems namely their fusion rules and the statistics. We then go further to construct a transfer matrix which contains the other Z2 phase namely the double semion phase. More generally for other discrete groups these transfer matrices contain the twisted quantum double models. These transfer matrices can be thought of as being obtained by introducing extra parameters into the transfer matrix of lattice gauge theories. These parameters are central elements belonging to the tensor products of the algebra and its dual and are associated to vertices and volumes of the three dimensional lattice. As in the case of the lattice gauge theories we construct the operators creating the excitations in this case and study their braiding and fusion properties.

Quantifying Environmental Effects on the Decay of Hole Transfer Couplings in Biosystems.

PubMed

Ramos, Pablo; Pavanello, Michele

2014-06-10

In the past two decades, many research groups worldwide have tried to understand and categorize simple regimes in the charge transfer of such biological systems as DNA. Theoretically speaking, the lack of exact theories for electron-nuclear dynamics on one side and poor quality of the parameters needed by model Hamiltonians and nonadiabatic dynamics alike (such as couplings and site energies) on the other are the two main difficulties for an appropriate description of the charge transfer phenomena. In this work, we present an application of a previously benchmarked and linear-scaling subsystem density functional theory (DFT) method for the calculation of couplings, site energies, and superexchange decay factors (β) of several biological donor-acceptor dyads, as well as double stranded DNA oligomers composed of up to five base pairs. The calculations are all-electron and provide a clear view of the role of the environment on superexchange couplings in DNA-they follow experimental trends and confirm previous semiempirical calculations. The subsystem DFT method is proven to be an excellent tool for long-range, bridge-mediated coupling and site energy calculations of embedded molecular systems.

Probing the dependence of electron transfer on size and coverage in carbon nanotube-quantum dot heterostructures

DOE PAGES

Wang, Lei; Wong, Stanislaus S.; Han, Jinkyu; ...

2015-11-16

As a model system for understanding charge transfer in novel architectural designs for solar cells, double-walled carbon nanotube (DWNT)–CdSe quantum dot (QD) (QDs with average diameters of 2.3, 3.0, and 4.1 nm) heterostructures have been fabricated. The individual nanoscale building blocks were successfully attached and combined using a hole-trapping thiol linker molecule, i.e., 4-mercaptophenol (MTH), through a facile, noncovalent π–π stacking attachment strategy. Transmission electron microscopy confirmed the attachment of QDs onto the external surfaces of the DWNTs. We herein demonstrate a meaningful and unique combination of near-edge X-ray absorption fine structure (NEXAFS) and Raman spectroscopies bolstered by complementary electricalmore » transport measurements in order to elucidate the synergistic interactions between CdSe QDs and DWNTs, which are facilitated by the bridging MTH molecules that can scavenge photoinduced holes and potentially mediate electron redistribution between the conduction bands in CdSe QDs and the C 2p-derived states of the DWNTs. Specifically, we correlated evidence of charge transfer as manifested by (i) changes in the NEXAFS intensities of π* resonance in the C K-edge and Cd M3-edge spectra, (ii) a perceptible outer tube G-band downshift in frequency in Raman spectra, as well as (iii) alterations in the threshold characteristics present in transport data as a function of CdSe QD deposition onto the DWNT surface. Furthermore, the separate effects of (i) varying QD sizes and (ii) QD coverage densities on the electron transfer were independently studied.« less

Flagellar membrane fusion and protein exchange in trypanosomes; a new form of cell-cell communication?

PubMed Central

Imhof, Simon; Fragoso, Cristina; Hemphill, Andrew; von Schubert, Conrad; Li, Dong; Legant, Wesley; Betzig, Eric; Roditi, Isabel

2016-01-01

Diverse structures facilitate direct exchange of proteins between cells, including plasmadesmata in plants and tunnelling nanotubes in bacteria and higher eukaryotes.  Here we describe a new mechanism of protein transfer, flagellar membrane fusion, in the unicellular parasite Trypanosoma brucei. When fluorescently tagged trypanosomes were co-cultured, a small proportion of double-positive cells were observed. The formation of double-positive cells was dependent on the presence of extracellular calcium and was enhanced by placing cells in medium supplemented with fresh bovine serum. Time-lapse microscopy revealed that double-positive cells arose by bidirectional protein exchange in the absence of nuclear transfer.  Furthermore, super-resolution microscopy showed that this process occurred in ≤1 minute, the limit of temporal resolution in these experiments. Both cytoplasmic and membrane proteins could be transferred provided they gained access to the flagellum. Intriguingly, a component of the RNAi machinery (Argonaute) was able to move between cells, raising the possibility that small interfering RNAs are transported as cargo. Transmission electron microscopy showed that shared flagella contained two axonemes and two paraflagellar rods bounded by a single membrane. In some cases flagellar fusion was partial and interactions between cells were transient. In other cases fusion occurred along the entire length of the flagellum, was stable for several hours and might be irreversible. Fusion did not appear to be deleterious for cell function: paired cells were motile and could give rise to progeny while fused. The motile flagella of unicellular organisms are related to the sensory cilia of higher eukaryotes, raising the possibility that protein transfer between cells via cilia or flagella occurs more widely in nature. PMID:27239276

High-level ab initio potential energy surface and dynamics of the F– + CH3I SN2 and proton-transfer reactions† †Electronic supplementary information (ESI) available: Benchmark classical and adiabatic relative energies (Table S1), vibrational frequencies of all the stationary points (Tables S2 and S3), direct/indirect trajectory separation function parameters (Table S4), entrance-channel potential (Fig. S1), structures of the minima and saddle points corresponding to the abstraction channel (Fig. S2), reaction probabilities (Fig. S3), trajectory integration time distributions (Fig. S4), trajectory integration time vs. I– velocity distributions (Fig. S5), and mechanism-specific reaction probabilities (Fig. S6). See DOI: 10.1039/c7sc00033b Click here for additional data file.

PubMed Central

Olasz, Balázs; Szabó, István

2017-01-01

Bimolecular nucleophilic substitution (SN2) and proton transfer are fundamental processes in chemistry and F– + CH3I is an important prototype of these reactions. Here we develop the first full-dimensional ab initio analytical potential energy surface (PES) for the F– + CH3I system using a permutationally invariant fit of high-level composite energies obtained with the combination of the explicitly-correlated CCSD(T)-F12b method, the aug-cc-pVTZ basis, core electron correlation effects, and a relativistic effective core potential for iodine. The PES accurately describes the SN2 channel producing I– + CH3F via Walden-inversion, front-side attack, and double-inversion pathways as well as the proton-transfer channel leading to HF + CH2I–. The relative energies of the stationary points on the PES agree well with the new explicitly-correlated all-electron CCSD(T)-F12b/QZ-quality benchmark values. Quasiclassical trajectory computations on the PES show that the proton transfer becomes significant at high collision energies and double-inversion as well as front-side attack trajectories can occur. The computed broad angular distributions and hot internal energy distributions indicate the dominance of indirect mechanisms at lower collision energies, which is confirmed by analyzing the integration time and leaving group velocity distributions. Comparison with available crossed-beam experiments shows usually good agreement. PMID:28507692

A benchmark study of electronic excitation energies, transition moments, and excited-state energy gradients on the nicotine molecule

NASA Astrophysics Data System (ADS)

Egidi, Franco; Segado, Mireia; Koch, Henrik; Cappelli, Chiara; Barone, Vincenzo

2014-12-01

In this work, we report a comparative study of computed excitation energies, oscillator strengths, and excited-state energy gradients of (S)-nicotine, chosen as a test case, using multireference methods, coupled cluster singles and doubles, and methods based on time-dependent density functional theory. This system was chosen because its apparent simplicity hides a complex electronic structure, as several different types of valence excitations are possible, including n-π*, π-π*, and charge-transfer states, and in order to simulate its spectrum it is necessary to describe all of them consistently well by the chosen method.

A benchmark study of electronic excitation energies, transition moments, and excited-state energy gradients on the nicotine molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Egidi, Franco, E-mail: franco.egidi@sns.it; Segado, Mireia; Barone, Vincenzo, E-mail: vincenzo.barone@sns.it

In this work, we report a comparative study of computed excitation energies, oscillator strengths, and excited-state energy gradients of (S)-nicotine, chosen as a test case, using multireference methods, coupled cluster singles and doubles, and methods based on time-dependent density functional theory. This system was chosen because its apparent simplicity hides a complex electronic structure, as several different types of valence excitations are possible, including n-π{sup *}, π-π{sup *}, and charge-transfer states, and in order to simulate its spectrum it is necessary to describe all of them consistently well by the chosen method.

Design and performance of the spin asymmetries of the nucleon experiment

NASA Astrophysics Data System (ADS)

Maxwell, J. D.; Armstrong, W. R.; Choi, S.; Jones, M. K.; Kang, H.; Liyanage, A.; Meziani, Z.-E.; Mulholland, J.; Ndukum, L.; Rondón, O. A.; Ahmidouch, A.; Albayrak, I.; Asaturyan, A.; Ates, O.; Baghdasaryan, H.; Boeglin, W.; Bosted, P.; Brash, E.; Brock, J.; Butuceanu, C.; Bychkov, M.; Carlin, C.; Carter, P.; Chen, C.; Chen, J.-P.; Christy, M. E.; Covrig, S.; Crabb, D.; Danagoulian, S.; Daniel, A.; Davidenko, A. M.; Davis, B.; Day, D.; Deconinck, W.; Deur, A.; Dunne, J.; Dutta, D.; El Fassi, L.; Elaasar, M.; Ellis, C.; Ent, R.; Flay, D.; Frlez, E.; Gaskell, D.; Geagla, O.; German, J.; Gilman, R.; Gogami, T.; Gomez, J.; Goncharenko, Y. M.; Hashimoto, O.; Higinbotham, D. W.; Horn, T.; Huber, G. M.; Jones, M.; Kalantarians, N.; Kang, H. K.; Kawama, D.; Keith, C.; Keppel, C.; Khandaker, M.; Kim, Y.; King, P. M.; Kohl, M.; Kovacs, K.; Kubarovsky, V.; Li, Y.; Liyanage, N.; Luo, W.; Mamyan, V.; Markowitz, P.; Maruta, T.; Meekins, D.; Melnik, Y. M.; Mkrtchyan, A.; Mkrtchyan, H.; Mochalov, V. V.; Monaghan, P.; Narayan, A.; Nakamura, S. N.; Nuruzzaman; Pentchev, L.; Pocanic, D.; Posik, M.; Puckett, A.; Qiu, X.; Reinhold, J.; Riordan, S.; Roche, J.; Sawatzky, B.; Shabestari, M.; Slifer, K.; Smith, G.; Soloviev, L.; Solvignon, P.; Tadevosyan, V.; Tang, L.; Vasiliev, A. N.; Veilleux, M.; Walton, T.; Wesselmann, F.; Wood, S. A.; Yao, H.; Ye, Z.; Zhu, L.

2018-03-01

The Spin Asymmetries of the Nucleon Experiment (SANE) performed inclusive, double-polarized electron scattering measurements of the proton at the Continuous Electron Beam Accelerator Facility at Jefferson Lab. A novel detector array observed scattered electrons of four-momentum transfer 2 . 5

Coupling a single electron spin to a microwave resonator: Part I: controlling transverse and longitudinal couplings

NASA Astrophysics Data System (ADS)

Lachance-Quirion, Dany; Beaudoin, Félix; Camirand Lemyre, Julien; Coish, William A.; Pioro-Ladrière, Michel

Novel quantum technologies can be combined within hybrid systems to benefit from the complementary capabilities of individual components. For example, microwave-frequency superconducting resonators are ideally suited to perform qubit readout and to mediate two-qubit gates, while spin qubits offer long coherence times and high-fidelity single-qubit gates. In this talk, we consider strong coupling between a microwave resonator and an electron-spin qubit in a double quantum dot due to an inhomogeneous magnetic field generated by a nearby nanomagnet.. Considering realistic parameters, we estimate spin-resonator couplings of order 1 MHz. Further, we show that the position of the double dot relative to the nanomagnet allows us to select between purely longitudinal and transverse couplings. While the transverse coupling may be used for quantum state transfer between the spin qubit and the resonator, the longitudinal coupling could be used in a new qubit readout scheme recently introduced for superconducting qubits.

Study of energetic particle physics with advanced ECEI system on the HL-2A tokamak

NASA Astrophysics Data System (ADS)

Shi, Zhongbing; Jiang, Min; Yu, Liming; Chen, Wei; Shi, Peiwan; Zhong, Wulyu; Yang, Zengchen; Zhang, Boyu; Ji, Xiaoquan; Li, Yonggao; Zhou, Yan; Song, Shaodong; Huang, Mei; Song, Xianming; Li, Jiaxuan; Yuan, Baoshan; Fu, Bingzhong; Liu, Zetian; Ding, Xuantong; Xu, Yuhong; Yang, Qingwei; Duan, Xuru

2017-07-01

Understanding the physics of energetic particles (EP) is crucial for the burning plasmas in next generation fusion devices such as ITER. In this work, three types of internal kink modes (a saturated internal kink mode (SK), a resonant internal kink mode (RK), and a double e-fishbone) excited by energetic particles in the low density discharges during ECRH/ECCD heating have been studied by the newly developed 24(poloidal) × 16(radial) = 384 channel ECEI system on the HL-2A tokamak. The SK and RK rotate in the electron diamagnetic direction poloidally and are destabilized by the energetic trapped electrons. The SK is destabilized in the case of qmin > 1, while the RK is destabilized in the case of qmin < 1. The double e-fishbone, which has two m/n = 1/1 modes propagating in the opposite directions poloidally, has been observed during plasma current ramp-up with counter-ECCD. Strong thermal transfer and mode coupling between the two m/n = 1/1 modes have been studied.

δ-Deuterium Isotope Effects as Probes for Transition-State Structures of Isoprenoid Substrates

PubMed Central

2015-01-01

The biosynthetic pathways to isoprenoid compounds involve transfer of the prenyl moiety in allylic diphosphates to electron-rich (nucleophilic) acceptors. The acceptors can be many types of nucleophiles, while the allylic diphosphates only differ in the number of isoprene units and stereochemistry of the double bonds in the hydrocarbon moieties. Because of the wide range of nucleophilicities of naturally occurring acceptors, the mechanism for prenyltransfer reactions may be dissociative or associative with early to late transition states. We have measured δ-secondary kinetic isotope effects operating through four bonds for substitution reactions with dimethylallyl derivatives bearing deuterated methyl groups at the distal (C3) carbon atom in the double bond under dissociative and associative conditions. Computational studies with density functional theory indicate that the magnitudes of the isotope effects correlate with the extent of bond formation between the allylic moiety and the electron-rich acceptor in the transition state for alkylation and provide insights into the structures of the transition states for associative and dissociative alkylation reactions. PMID:24665882

Electronic transmission in non-linear potential profile of GaAs/AlxGa1-xAs biased quantum well structure

NASA Astrophysics Data System (ADS)

Meghoufel, F. Z.; Bentata, S.; Terkhi, S.; Bendahma, F.; Cherid, S.

2013-05-01

We study the effect of the nonlinearity on electrons transmission properties in a double barriers structure GaAs/AlxGa1-xAs superlattices. The nonlinearity is introduced as an effective potential in the Schrödinger equation and translates the electronic Colombian repulsion. We have used the transfer matrix formalism and the plane wave functions approximation to solve numerically the equation and calculate the electronic transmission coefficient. We have shown the occurrence of two allowed states within the same well instead of a single, translating the presence of two resonant states at two different energies. The first allowed state intensity strongly decreases with increasing the nonlinear parameter, whereas the second one called the degeneracy state increases. Both the two states evolve towards higher resonances energies.

Cytochrome oxidase assembly does not require catalytically active cytochrome C.

PubMed

Barrientos, Antoni; Pierre, Danielle; Lee, Johnson; Tzagoloff, Alexander

2003-03-14

Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the transfer of electrons from reduced cytochrome c to molecular oxygen. COX assembly requires the coming together of nuclear- and mitochondrial-encoded subunits and the assistance of a large number of nuclear gene products acting at different stages of maturation of the enzyme. In Saccharomyces cerevisiae, expression of cytochrome c, encoded by CYC1 and CYC7, is required not only for electron transfer but also for COX assembly through a still unknown mechanism. We have attempted to distinguish between a functional and structural requirement of cytochrome c in COX assembly. A cyc1/cyc7 double null mutant strain was transformed with the cyc1-166 mutant gene (Schweingruber, M. E., Stewart, J. W., and Sherman, F. (1979) J. Biol. Chem. 254, 4132-4143) that expresses stable but catalytically inactive iso-1-cytochrome c. The COX content of the cyc1/cyc7 double mutant strain harboring non-functional iso-1-cytochrome c has been characterized spectrally, functionally, and immunochemically. The results of these studies demonstrate that cytochrome c plays a structural rather than functional role in assembly of cytochrome c oxidase. In addition to its requirement for COX assembly, cytochrome c also affects turnover of the enzyme. Mutants containing wild type apocytochrome c in mitochondria lack COX, suggesting that only the folded and mature protein is able to promote COX assembly.

An Ab Initio Exciton Model Including Charge-Transfer Excited States

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Xin; Parrish, Robert M.; Liu, Fang

Here, the Frenkel exciton model is a useful tool for theoretical studies of multichromophore systems. We recently showed that the exciton model could be used to coarse-grain electronic structure in multichromophoric systems, focusing on singly excited exciton states. However, our previous implementation excluded charge-transfer excited states, which can play an important role in light-harvesting systems and near-infrared optoelectronic materials. Recent studies have also emphasized the significance of charge-transfer in singlet fission, which mediates the coupling between the locally excited states and the multiexcitonic states. In this work, we report on an ab initio exciton model that incorporates charge-transfer excited statesmore » and demonstrate that the model provides correct charge-transfer excitation energies and asymptotic behavior. Comparison with TDDFT and EOM-CC2 calculations shows that our exciton model is robust with respect to system size, screening parameter, and different density functionals. Inclusion of charge-transfer excited states makes the exciton model more useful for studies of singly excited states and provides a starting point for future construction of a model that also includes double-exciton states.« less

An Ab Initio Exciton Model Including Charge-Transfer Excited States

DOE PAGES

Li, Xin; Parrish, Robert M.; Liu, Fang; ...

2017-06-15

Here, the Frenkel exciton model is a useful tool for theoretical studies of multichromophore systems. We recently showed that the exciton model could be used to coarse-grain electronic structure in multichromophoric systems, focusing on singly excited exciton states. However, our previous implementation excluded charge-transfer excited states, which can play an important role in light-harvesting systems and near-infrared optoelectronic materials. Recent studies have also emphasized the significance of charge-transfer in singlet fission, which mediates the coupling between the locally excited states and the multiexcitonic states. In this work, we report on an ab initio exciton model that incorporates charge-transfer excited statesmore » and demonstrate that the model provides correct charge-transfer excitation energies and asymptotic behavior. Comparison with TDDFT and EOM-CC2 calculations shows that our exciton model is robust with respect to system size, screening parameter, and different density functionals. Inclusion of charge-transfer excited states makes the exciton model more useful for studies of singly excited states and provides a starting point for future construction of a model that also includes double-exciton states.« less

An Ab Initio Exciton Model Including Charge-Transfer Excited States.

PubMed

Li, Xin; Parrish, Robert M; Liu, Fang; Kokkila Schumacher, Sara I L; Martínez, Todd J

2017-08-08

The Frenkel exciton model is a useful tool for theoretical studies of multichromophore systems. We recently showed that the exciton model could be used to coarse-grain electronic structure in multichromophoric systems, focusing on singly excited exciton states [ Acc. Chem. Res. 2014 , 47 , 2857 - 2866 ]. However, our previous implementation excluded charge-transfer excited states, which can play an important role in light-harvesting systems and near-infrared optoelectronic materials. Recent studies have also emphasized the significance of charge-transfer in singlet fission, which mediates the coupling between the locally excited states and the multiexcitonic states. In this work, we report on an ab initio exciton model that incorporates charge-transfer excited states and demonstrate that the model provides correct charge-transfer excitation energies and asymptotic behavior. Comparison with TDDFT and EOM-CC2 calculations shows that our exciton model is robust with respect to system size, screening parameter, and different density functionals. Inclusion of charge-transfer excited states makes the exciton model more useful for studies of singly excited states and provides a starting point for future construction of a model that also includes double-exciton states.

Electron transport in single molecules: from benzene to graphene.

PubMed

Chen, F; Tao, N J

2009-03-17

Electron movement within and between molecules--that is, electron transfer--is important in many chemical, electrochemical, and biological processes. Recent advances, particularly in scanning electrochemical microscopy (SECM), scanning-tunneling microscopy (STM), and atomic force microscopy (AFM), permit the study of electron movement within single molecules. In this Account, we describe electron transport at the single-molecule level. We begin by examining the distinction between electron transport (from semiconductor physics) and electron transfer (a more general term referring to electron movement between donor and acceptor). The relation between these phenomena allows us to apply our understanding of single-molecule electron transport between electrodes to a broad range of other electron transfer processes. Electron transport is most efficient when the electron transmission probability via a molecule reaches 100%; the corresponding conductance is then 2e(2)/h (e is the charge of the electron and h is the Planck constant). This ideal conduction has been observed in a single metal atom and a string of metal atoms connected between two electrodes. However, the conductance of a molecule connected to two electrodes is often orders of magnitude less than the ideal and strongly depends on both the intrinsic properties of the molecule and its local environment. Molecular length, means of coupling to the electrodes, the presence of conjugated double bonds, and the inclusion of possible redox centers (for example, ferrocene) within the molecular wire have a pronounced effect on the conductance. This complex behavior is responsible for diverse chemical and biological phenomena and is potentially useful for device applications. Polycyclic aromatic hydrocarbons (PAHs) afford unique insight into electron transport in single molecules. The simplest one, benzene, has a conductance much less than 2e(2)/h due to its large LUMO-HOMO gap. At the other end of the spectrum, graphene sheets and carbon nanotubes--consisting of infinite numbers of aromatic rings--have small or even zero energy gaps between the conduction and valence bands. Between these two limits are intermediate molecules with rich properties, such as perylene derivatives made of seven aromatic rings; the properties of these types of molecules have yet to be fully explored. Studying PAHs is important not only in answering fundamental questions about electron transport but also in the ongoing quest for molecular-scale electronic devices. This line of research also helps bridge the gap between electron transfer phenomena in small redox molecules and electron transport properties in nanostructures.

Analysis of the heat transfer in double and triple concentric tube heat exchangers

NASA Astrophysics Data System (ADS)

Rădulescu, S.; Negoiţă, L. I.; Onuţu, I.

2016-08-01

The tubular heat exchangers (shell and tube heat exchangers and concentric tube heat exchangers) represent an important category of equipment in the petroleum refineries and are used for heating, pre-heating, cooling, condensation and evaporation purposes. The paper presents results of analysis of the heat transfer to cool a petroleum product in two types of concentric tube heat exchangers: double and triple concentric tube heat exchangers. The cooling agent is water. The triple concentric tube heat exchanger is a modified constructive version of double concentric tube heat exchanger by adding an intermediate tube. This intermediate tube improves the heat transfer by increasing the heat area per unit length. The analysis of the heat transfer is made using experimental data obtained during the tests in a double and triple concentric tube heat exchanger. The flow rates of fluids, inlet and outlet temperatures of water and petroleum product are used in determining the performance of both heat exchangers. Principally, for both apparatus are calculated the overall heat transfer coefficients and the heat exchange surfaces. The presented results shows that triple concentric tube heat exchangers provide better heat transfer efficiencies compared to the double concentric tube heat exchangers.

Fluid flow and heat transfer characteristics of an enclosure with fin as a top cover of a solar collector

NASA Astrophysics Data System (ADS)

Ambarita, H.; Ronowikarto, A. D.; Siregar, R. E. T.; Setyawan, E. Y.

2018-03-01

To reduce heat loses in a flat plate solar collector, double glasses cover is employed. Several studies show that the heat loss from the glass cover is still very significant in comparison with other losses. Here, double glasses cover with attached fins is proposed. In the present work, the fluid flow and heat transfer characteristics of the enclosure between the double glass cover are investigated numerically. The objective is to examine the effect of the fin to the heat transfer rate of the cover. Two-dimensional governing equations are developed. The governing equations and the boundary conditions are solved using commercial Computational Fluid Dynamics code. The fluid flow and heat transfer characteristics are plotted, and numerical results are compared with empirical correlation. The results show that the presence of the fin strongly affects the fluid flow and heat transfer characteristics. The fin can reduce the heat transfer rate up to 22.42% in comparison with double glasses cover without fins.

Electron capture in collisions of N^+ with H and H^+ with N

NASA Astrophysics Data System (ADS)

Lin, C. Y.; Stancil, P. C.; Gu, J. P.; Buenker, R. J.; Kimura, M.

2004-05-01

Charge transfer processes due to collisions of N^+ with atomic hydrogen and H^+ with atomic nitrogen are investigated using the quantum-mechanical molecular-orbital close-coupling (MOCC) method. The MOCC calculations utilize ab initio adiabatic potential curves and nonadiabatic radial and rotational coupling matrix elements obtained with the multireference single- and double-excitation configuration interaction approach. Total and state-selective cross sections for the energy range 0.1-500 eV/u will be presented and compared with existing experimental and theoretical data.

Power Scaling and Frequency Stabilization of an Injection-Locked Laser

DTIC Science & Technology

2000-05-01

In Chapter 4,1 alter the well -documented theory of locking a laser to a Fabry- Perot by performing the PDH error signal derivation in a new manner...the well -documented modulation transfer scheme to lock the frequency-doubled NPRO to a hyperfine component of an electronic transition in I2. 33 I...generally true at very low noise frequencies, well within the feedback loop bandwidth. However, when G0L(V„) « 1 and thus GCL(vn) « 1, Equation 3.9

Electrochemical Advanced Oxidation Process for Shipboard Final Purification of Filtered Black Water, Gray Water, and Bilge Water, Vol. 1

DTIC Science & Technology

2001-08-01

doped SnO2 developed by Memming and M`llers (1972) is most directly applicable to our electrodes. This model ignores the effect of ions in the...electron transfer model of Memming and M`llers (1972) with the surface charging/ ion complexation model of Davis et al. (1978). The combined model...model of Memming and M`llers. The model of Davis et al. represents the diffuse double layer by an analytical expression which describes only pure

Radiation-Tolerant, SpaceWire-Compatible Switching Fabric

NASA Technical Reports Server (NTRS)

Katzman, Vladimir

2011-01-01

Current and future near-Earth and deep space exploration programs and space defense programs require the development of robust intra-spacecraft serial data transfer electronics that must be reconfigurable, fault-tolerant, and have the ability to operate effectively for long periods of time in harsh environmental conditions. Existing data transfer systems based on state-of-the-art serial data transfer protocols or passive backplanes are slow, power-hungry, and poorly reconfigurable. They provide limited expandability and poor tolerance to radiation effects and total ionizing dose (TID) in particular, which presents harmful threats to modern submicron electronics. This novel approach is based on a standard library of differential cells tolerant to TID, and patented, multi-level serial interface architecture that ensures the reliable operation of serial interconnects without application of a data-strobe or other encoding techniques. This proprietary, high-speed differential interface presents a lowpower solution fully compatible with the SpaceWire (SW) protocol. It replaces a dual data-strobe link with two identical independent data channels, thus improving the system s tolerance to harsh environments through additional double redundancy. Each channel incorporates an automatic line integrity control circuitry that delivers error signals in case of broken or shorted lines.

The role of double TiO 2 layers at the interface of FeSe/SrTiO 3 superconductors

DOE PAGES

Zou, Ke; Bozovic, Ian; Mandal, Subhasish; ...

2016-05-16

We determine the surface reconstruction of SrTiO 3 used to achieve superconducting FeSe films in experiments, which is different from the 1×1 TiO 2-terminated SrTiO 3 assumed by most previous theoretical studies. In particular, we identify the existence of a double TiO 2 layer at the FeSe/SrTiO 3 interface that plays two important roles. First, it facilitates the epitaxial growth of FeSe. Second, ab initio calculations reveal a strong tendency for electrons to transfer from an oxygen deficient SrTiO 3 surface to FeSe when the double TiO 2 layer is present. The double layer helps to remove the hole pocketmore » in the FeSe at the Γ point of the Brillouin zone and leads to a band structure characteristic of superconducting samples. The characterization of the interface structure presented here is a key step towards the resolution of many open questions about this superconductor.« less

Enhanced spin-torque in double tunnel junctions using a nonmagnetic-metal spacer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, C. H.; Cheng, Y. H.; Ko, C. W.

2015-10-12

This study proposes an enhancement in the spin-transfer torque of a magnetic tunnel junction (MTJ) designed with double-barrier layer structure using a nonmagnetic metal spacer, as a replacement for the ferromagnetic material, which is traditionally used in these double-barrier stacks. Our calculation results show that the spin-transfer torque and charge current density of the proposed double-barrier MTJ can be as much as two orders of magnitude larger than the traditional double-barrier one. In other words, the proposed double-barrier MTJ has a spin-transfer torque that is three orders larger than that of the single-barrier stack. This improvement may be attributed tomore » the quantum-well states that are formed in the nonmagnetic metal spacer and the resonant tunneling mechanism that exists throughout the system.« less

Direct Experimental Probe of the Ni(II)/Ni(III)/Ni(IV) Redox Evolution in LiNi 0.5Mn 1.5O 4 Electrodes

DOE PAGES

Qiao, Ruimin; Wray, L. Andrew; Kim, Jung -Hyun; ...

2015-11-11

The LiNi 0.5Mn 1.5O 4 spinel is an appealing cathode material for next generation rechargeable Li-ion batteries due to its high operating voltage of ~4.7 V (vs Li/Li +). Although it is widely believed that the full range of electrochemical cycling involves the redox of Ni(II)/(IV), it has not been experimentally clarified whether Ni(III) exists as the intermediate state or a double-electron transfer takes place. Here, combined with theoretical calculations, we show unambiguous spectroscopic evidence of the Ni(III) state when the LiNi 0.5Mn 1.5O 4 electrode is half charged. This provides a direct verification of single-electron-transfer reactions in LiNi 0.5Mnmore » 1.5O 4 upon cycling, namely, from Ni(II) to Ni(III), then to Ni(IV). Additionally, by virtue of its surface sensitivity, soft X-ray absorption spectroscopy also reveals the electrochemically inactive Ni 2+ and Mn 2+ phases on the electrode surface. Our work provides the long-awaited clarification of the single-electron transfer mechanism in LiNi 0.5Mn 1.5O 4 electrodes. Furthermore, the experimental results serve as a benchmark for further spectroscopic characterizations of Ni-based battery electrodes.« less

The Role of Superthermal Electrons in the Formation of Double Layers and their Application in Space Plasmas

NASA Astrophysics Data System (ADS)

Singh, N.

2014-12-01

It is now widely recognized that superthermal electrons commonly exist with the thermal population in most space plasmas. When plasmas consisting of such electron population expand, double layers (DLs) naturally forma due to charge separation; the more mobile superthermal electrons march ahead of the thermal population, leaving a positive charge behind and generating electric fields. Under certain conditions such fields evolve into thin double layers or shocks. The double layers accelerate ions. Such double-layer formation was first invoked to explain expansion of laser produced plasmas. Since then it has been studied in laboratory experiments, and applied to (i) polar wind acceleration,(ii) the existence of low-altitude double layers in the auroral acceleration, (iii) a possible mechanism for the origination of the solar wind, (iv) the helicon double layer thrusters, and (v) the deceleration of electrons after their acceleration in solar flare events. The role of superthermal-electron driven double layers, also known as the low-altitude auroral double layers in the upward current region, in the upward acceleration of ionospheric ions is well-known. In the auroral application the upward moving superthermal electrons consist of backscattered downgoing primary energetic electrons as well as the secondary electrons. Similarly we suggest that such double layers might play roles in the acceleration of ions in the solar wind across the coronal transition region, where the superthermal electrons are supplied by magnetic reconnection events. We will present a unified theoretical view of the superthermal electron-driven double layers and their applications. We will summarize theoretical, experimental, simulation and observational results highlighting the common threads running through the various existing studies.

Charge-Transfer Processes in Warm Dense Matter: Selective Spectral Filtering for Laser-Accelerated Ion Beams

NASA Astrophysics Data System (ADS)

Braenzel, J.; Barriga-Carrasco, M. D.; Morales, R.; Schnürer, M.

2018-05-01

We investigate, both experimentally and theoretically, how the spectral distribution of laser accelerated carbon ions can be filtered by charge exchange processes in a double foil target setup. Carbon ions at multiple charge states with an initially wide kinetic energy spectrum, from 0.1 to 18 MeV, were detected with a remarkably narrow spectral bandwidth after they had passed through an ultrathin and partially ionized foil. With our theoretical calculations, we demonstrate that this process is a consequence of the evolution of the carbon ion charge states in the second foil. We calculated the resulting spectral distribution separately for each ion species by solving the rate equations for electron loss and capture processes within a collisional radiative model. We determine how the efficiency of charge transfer processes can be manipulated by controlling the ionization degree of the transfer matter.

Flavins in Coastal Marine Sediments: New Perspectives on Diagenetic Electron Transfer

NASA Astrophysics Data System (ADS)

Monteverde, D.; Berelson, W.; Baronas, J. J.; Sanudo-Wilhelmy, S. A.

2016-02-01

Coastal marine sediments play a critical role in the global cycling of metals and nutrients, many of which undergo diagenetic alteration. Central to these transformations are redox reactions where electron-rich organic matter is oxidized via transfer to terminal electron acceptors (NO3-, MnOx, FeOx, SO42-). The flavins (flavin adenine dinucleotide [FAD], flavin mononucleotide [FMN], and riboflavin [B2]) are microbially synthesized organic coenzymes that perform both single and double electron transfer and are known to mediate reduction of insoluble metal oxides. Culture experiments have found high rates of flavin excretion in metal-reducing Shewanella and Geobacter species, however environmental measurements of these highly labile molecules have not been previously reported. Here we present porewater measurements of FAD, FMN, and B2 from San Pedro Basin. This California Borderland basin is silled, suboxic, 900 m deep, and experiences high sedimentation. Flavin concentrations ranged from pico- (FAD: 0- 60 pM; B2: 40 - 90 pM) to nanomolar (FMN: 0.4 - 1.2 nM). The concentration cascade of FMN>B2>FAD fits well within culture experiments. Interestingly, profiles of all three flavins show a near linear increase with depth from 0-30 cm and a relatively steady concentration from 30-45 cm, supporting likely in situ production. Additionally, the flavins showed a negative correlation with dissolved Fe (R2 = 0.7 for FMN, 0.8 for FAD, and 0.9 for B2), which decreased linearly with depth from 160µM to 65µM. We discuss hypothesized mechanisms controlling flavin concentrations based on a suite of sediment geochemical parameters (dissolved Fe, Mn, TCO2, δ13C, NH3, DOM, and SO42-) as well as implications for microbial redox syntrophy. These data provide a critical link between the extensive culture-based mechanistic understanding of flavin function and the sedimentary environment. Furthermore, these results demonstrate that flavins likely serve as a significant electron transfer intermediaries in the marine sediment carbon cycle.

Observation of a stationary, current-free double layer in a plasma

NASA Technical Reports Server (NTRS)

Hairapetian, G.; Stenzel, R. L.

1990-01-01

A stationary, current-free, potential double layer is formed in a two-electron-population plasma due to self-consistent separation of the two electron species. The position and amplitude of the double layer are controlled by the relative densities of the two electron populations. The steady-state double layer traps the colder electrons on the high potential side, and generates a neutralized, monoenergetic ion beam on the low potential side. The field-aligned double layer is annihilated when an electron current is drawn through the plasma.

First measurement of the double spin asymmetry in (-->)e(-->)p-->e(prime)pi(+)n in the resonance region.

PubMed

De Vita, R; Anghinolfi, M; Burkert, V D; Dodge, G E; Minehart, R; Taiuti, M; Weller, H; Adams, G; Amaryan, M J; Anciant, E; Armstrong, D S; Asavapibhop, B; Asryan, G; Audit, G; Auger, T; Avakian, H; Bagdasaryan, H; Ball, J P; Barrow, S; Battaglieri, M; Beard, K; Bektasoglu, M; Bianchi, N; Biselli, A S; Boiarinov, S; Bonner, B E; Bosted, P; Bouchigny, S; Branford, D; Brooks, W K; Bueltmann, S; Calarco, J R; Capitani, G P; Carman, D S; Carnahan, B; Cazes, A; Ciciani, L; Cole, P L; Coleman, A; Connelly, J; Cords, D; Corvisiero, P; Crabb, D; Crannell, H; Cummings, J P; De Sanctis, E; Degtyarenko, P V; Demirchyan, R; Denizli, H; Dennis, L; Dharmawardane, K V; Dhuga, K S; Djalali, C; Doughty, D; Dragovitsch, P; Dugger, M; Dytman, S; Eckhause, M; Egiyan, H; Egiyan, K S; Elouadrhiri, L; Empl, A; Farhi, L; Fatemi, R; Feuerbach, R J; Ficenec, J; Forest, T A; Frolov, V; Funsten, H; Gaff, S J; Gai, M; Garçon, M; Gavalian, G; Gilad, S; Gilfoyle, G P; Giovanetti, K L; Girard, P; Golovatch, E; Griffioen, K; Guidal, M; Guillo, M; Gyurjyan, V; Hadjidakis, C; Hancock, D; Hardie, J; Heddle, D; Heimberg, P; Hersman, F W; Hicks, K; Hicks, R S; Holtrop, M; Hu, J; Hyde-Wright, C E; Ishkanov, B S; Ito, M M; Jenkins, D; Joo, K; Kelley, J H; Kellie, J D; Khandaker, M; Kim, K Y; Kim, K; Kim, W; Klein, A; Klein, F J; Klusman, M; Kossov, M; Kramer, L H; Kuang, Y; Kuhn, S E; Lachniet, J; Laget, J M; Lawrence, D; Li, Ji; Livingston, K; Longhi, A; Loukachine, K; Lucas, M; Major, W; Manak, J J; Marchand, C; McAleer, S; McCarthy, J; McNabb, J W C; Mecking, B A; Mestayer, M D; Meyer, C A; Mikhailov, K; Mirazita, M; Miskimen, R; Mokeev, V; Muccifora, V; Mueller, J; Mutchler, G S; Napolitano, J; Nelson, S O; Niculescu, G; Niculescu, I; Niczyporuk, B B; Niyazov, R A; Opper, A K; O'Rielly, G V; Osipenko, M; Park, K; Pasyuk, E; Peterson, G; Philips, S A; Pivnyuk, N; Pocanic, D; Pogorelko, O; Polli, E; Pozdniakov, S; Preedom, B M; Price, J W; Prok, Y; Protopopescu, D; Qin, L M; Raue, B A; Reolon, A R; Riccardi, G; Ricco, G; Ripani, M; Ritchie, B G; Rock, S; Ronchetti, F; Rossi, P; Rowntree, D; Rubin, P D; Sabatié, F; Sabourov, K; Salgado, C; Sapunenko, V; Sargsyan, M; Schumacher, R A; Serov, V S; Shafi, A; Sharabian, Y G; Shaw, J; Skabelin, A V; Smith, E S; Smith, T; Smith, L C; Sober, D I; Sorrell, L; Spraker, M; Stavinsky, A; Stepanyan, S; Stoler, P; Strakovsky, I I; Taylor, S; Tedeschi, D J; Thompson, R; Todor, L; Ungaro, M; Vineyard, M F; Vlassov, A V; Wang, K; Weinstein, L B; Weisberg, A; Weygand, D P; Whisnant, C S; Wolin, E; Yegneswaran, A; Yun, J; Zhang, B; Zhao, J; Zhou, Z

2002-02-25

The double spin asymmetry in the (-->)e(-->)p --> e(prime)pi(+)n reaction has been measured for the first time in the resonance region for four-momentum transfer Q2 = 0.35-1.5 GeV(2). Data were taken at Jefferson Lab with the CLAS detector using a 2.6 GeV polarized electron beam incident on a polarized solid NH3 target. Comparison with predictions of phenomenological models shows strong sensitivity to resonance contributions. Helicity-1/2 transitions are found to be dominant in the second and third resonance regions. The measured asymmetry is consistent with a faster rise with Q(2) of the helicity asymmetry A1 for the F(15)(1680) resonance than expected from the analysis of the unpolarized data.

Impact of double counting and transfer bias on estimated rates and outcomes of acute myocardial infarction.

PubMed

Westfall, J M; McGloin, J

2001-05-01

Ischemic heart disease is the leading cause of death in the United States. Recent studies report inconsistent findings on the changes in the incidence of hospitalizations for ischemic heart disease. These reports have relied primarily on hospital discharge data. Preliminary data suggest that a significant percentage of patients suffering acute myocardial infarction (MI) in rural communities are transferred to urban centers for care. Patients transferred to a second hospital may be counted twice for one episode of ischemic heart disease. To describe the impact of double counting and transfer bias on the estimation of incidence rates and outcomes of ischemic heart disease, specifically acute MI, in the United States. Analysis of state hospital discharge data from Kansas, Colorado (State Inpatient Database [SID]), Nebraska, Arizona, New Jersey, Michigan, Pennsylvania, and Illinois (SID) for the years 1995 to 1997. A matching algorithm was developed for hospital discharges to determine patients counted twice for one episode of ischemic heart disease. Validation of our matching algorithm. Patients reported to have suffered ischemic heart disease (ICD9 codes 410-414, 786.5). Number of patients counted twice for one episode of acute MI. It is estimated that double count rates range from 10% to 15% for all states and increased over the 3 years. Moderate sized rural counties had the highest estimated double count rates at 15% to 20% with a few counties having estimated double count rates a high as 35% to 50%. Older patients and females were less likely to be double counted (P <0.05). Double counting patients has resulted in a significant overestimation in the incidence rate for hospitalization for acute MI. Correction of this double counting reveals a significantly lower incidence rate and a higher in-hospital mortality rate for acute MI. Transferred patients differ significantly from nontransferred patients, introducing significant bias into MI outcome studies. Double counting and transfer bias should be considered when conducting and interpreting research on ischemic heart disease, particularly in rural regions.

High-surface-area architectures for improved charge transfer kinetics at the dark electrode in dye-sensitized solar cells.

PubMed

Hoffeditz, William L; Katz, Michael J; Deria, Pravas; Martinson, Alex B F; Pellin, Michael J; Farha, Omar K; Hupp, Joseph T

2014-06-11

Dye-sensitized solar cell (DSC) redox shuttles other than triiodide/iodide have exhibited significantly higher charge transfer resistances at the dark electrode. This often results in poor fill factor, a severe detriment to device performance. Rather than moving to dark electrodes of untested materials that may have higher catalytic activity for specific shuttles, the surface area of platinum dark electrodes could be increased, improving the catalytic activity by simply presenting more catalyst to the shuttle solution. A new copper-based redox shuttle that experiences extremely high charge-transfer resistance at conventional Pt dark electrodes yields cells having fill-factors of less than 0.3. By replacing the standard Pt dark electrode with an inverse opal Pt electrode fabricated via atomic layer deposition, the dark electrode surface area is boosted by ca. 50-fold. The resulting increase in interfacial electron transfer rate (decrease in charge-transfer resistance) nearly doubles the fill factor and therefore the overall energy conversion efficiency, illustrating the utility of this high-area electrode for DSCs.

Electron transfer of plurimodified DNA SAMs.

PubMed

Rospigliosi, Alessandro; Ehlich, Rudolf; Hoerber, Heinrich; Middelberg, Anton; Moggridge, Geoff

2007-07-17

An STM-based current-voltage (I/V) investigation of deoxyribonucleic acid (DNA) 18 base pair (bp) oligonucleotide monolayers on gold is presented. Three bases of each of the immobilized and complementary strands were modified with either iodine or phenylethylene moieties. The oligonucleotides were immobilized on template stripped gold (tsg) surfaces and characterized by atomic force microscopy (AFM) and scanning tunneling microscopy (STM). AFM imaging showed that monolayers of the expected height were formed. A comparative study of normal, halogenated, and phenyl-modified DNA was made with the STM in tunneling spectroscopy (TS) mode. I/V spectroscopic measurements in the range +/-250 mV on both single- and double-stranded (ds) DNA monolayers (modified and unmodified) showed that for negative substrate bias (U(sub)) electron transfer is more efficient through a phenyl-modified monolayer than through normal or halogenated DNA. This effect was particularly clear below a threshold bias of -100 mV. For positive U(sub), unmodified ds DNA was found to conduct slightly better than the modified strands. This is presumably caused by greater order in the unmodified versus modified DNA monolayers. Modifications on the immobilized (thiolated) strand seem to improve electron transport through the DNA monolayer more than modifications on the complementary (not surface-bound) strand.

Interface-Dependent Effective Mobility in Graphene Field-Effect Transistors

NASA Astrophysics Data System (ADS)

Ahlberg, Patrik; Hinnemo, Malkolm; Zhang, Shi-Li; Olsson, Jörgen

2018-03-01

By pretreating the substrate of a graphene field-effect transistor (G-FET), a stable unipolar transfer characteristic, instead of the typical V-shape ambipolar behavior, has been demonstrated. This behavior is achieved through functionalization of the SiO2/Si substrate that changes the SiO2 surface from hydrophilic to hydrophobic, in combination with postdeposition of an Al2O3 film by atomic layer deposition (ALD). Consequently, the back-gated G-FET is found to have increased apparent hole mobility and suppressed apparent electron mobility. Furthermore, with addition of a top-gate electrode, the G-FET is in a double-gate configuration with independent top- or back-gate control. The observed difference in mobility is shown to also be dependent on the top-gate bias, with more pronounced effect at higher electric field. Thus, the combination of top and bottom gates allows control of the G-FET's electron and hole mobilities, i.e., of the transfer behavior. Based on these observations, it is proposed that polar ligands are introduced during the ALD step and, depending on their polarization, result in an apparent increase of the effective hole mobility and an apparent suppressed effective electron mobility.

pH-dependent reduction potentials and proton-coupled electron transfer mechanisms in hydrogen-producing nickel molecular electrocatalysts.

PubMed

Horvath, Samantha; Fernandez, Laura E; Appel, Aaron M; Hammes-Schiffer, Sharon

2013-04-01

The nickel-based P2(Ph)N2(Bn) electrocatalysts comprised of a nickel atom and two 1,5-dibenzyl-3,7-diphenyl-1,5-diaza-3,7-diphosphacyclooctane ligands catalyze H2 production in acetonitrile. Recent electrochemical experiments revealed a linear dependence of the Ni(II/I) reduction potential on pH with a slope of 57 mV/pH unit, implicating a proton-coupled electron transfer (PCET) process with the same number of electrons and protons transferred. The combined theoretical and experimental studies herein provide an explanation for this pH dependence in the context of the overall proposed catalytic mechanism. In the proposed mechanisms, the catalytic cycle begins with a series of intermolecular proton transfers from an acid to the pendant amine ligand and electrochemical electron transfers to the nickel center to produce the doubly protonated Ni(0) species, a precursor to H2 evolution. The calculated Ni(II/I) reduction potentials of the doubly protonated species are in excellent agreement with the experimentally observed reduction potential in the presence of strong acid, suggesting that the catalytically active species leading to the peak observed in these cyclic voltammetry (CV) experiments is doubly protonated. The Ni(I/0) reduction potential was found to be slightly more positive than the Ni(II/I) reduction potential, indicating that the Ni(I/0) reduction occurs spontaneously after the Ni(II/I) reduction, as implied by the experimental observation of a single CV peak. These results suggest that the PCET process observed in the CV experiments is a two-electron/two-proton process corresponding to an initial double protonation followed by two reductions. On the basis of the experimental and theoretical data, the complete thermodynamic scheme and the Pourbaix diagram were generated for this catalyst. The Pourbaix diagram, which identifies the most thermodynamically stable species at each reduction potential and pH value, illustrates that this catalyst undergoes different types of PCET processes for various pH ranges. These thermodynamic insights will aid in the design of more effective molecular catalysts for H2 production.

Origin of the 900 cm{sup −1} broad double-hump OH vibrational feature of strongly hydrogen-bonded carboxylic acids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Van Hoozen, Brian L.; Petersen, Poul B.

2015-03-14

Medium and strong hydrogen bonds are common in biological systems. Here, they provide structural support and can act as proton transfer relays to drive electron and/or energy transfer. Infrared spectroscopy is a sensitive probe of molecular structure and hydrogen bond strength but strongly hydrogen-bonded structures often exhibit very broad and complex vibrational bands. As an example, strong hydrogen bonds between carboxylic acids and nitrogen-containing aromatic bases commonly display a 900 cm{sup −1} broad feature with a remarkable double-hump structure. Although previous studies have assigned this feature to the OH, the exact origin of the shape and width of this unusualmore » feature is not well understood. In this study, we present ab initio calculations of the contributions of the OH stretch and bend vibrational modes to the vibrational spectrum of strongly hydrogen-bonded heterodimers of carboxylic acids and nitrogen-containing aromatic bases, taking the 7-azaindole—acetic acid and pyridine—acetic acid dimers as examples. Our calculations take into account coupling between the OH stretch and bend modes as well as how both of these modes are affected by lower frequency dimer stretch modes, which modulate the distance between the monomers. Our calculations reproduce the broadness and the double-hump structure of the OH vibrational feature. Where the spectral broadness is primarily caused by the dimer stretch modes strongly modulating the frequency of the OH stretch mode, the double-hump structure results from a Fermi resonance between the out of the plane OH bend and the OH stretch modes.« less

Comparative study of inelastic squared form factors of the vibronic states of B 1Σu+ , C 1Πu , and E F 1Σg+ for molecular hydrogen: Inelastic x-ray and electron scattering

NASA Astrophysics Data System (ADS)

Xu, Long-Quan; Kang, Xu; Peng, Yi-Geng; Xu, Xin; Liu, Ya-Wei; Wu, Yong; Yang, Ke; Hiraoka, Nozomu; Tsuei, Ku-Ding; Wang, Jian-Guo; Zhu, Lin-Fan

2018-03-01

A joint experimental and theoretical investigation of the valence-shell excitations of hydrogen has been performed by the high-resolution inelastic x-ray scattering and electron scattering as well as the multireference single- and double-excitation configuration-interaction method. Momentum-transfer-dependent inelastic squared form factors for the vibronic series belonging to the B 1Σu+ ,C 1Πu , and E F 1Σg+ electronic states of molecular hydrogen have been derived from the inelastic x-ray scattering method at an impact photon energy around 10 keV, and the electron energy-loss spectra measured at an incident electron energy of 1500 eV. It is found that both the present and the previous calculations cannot satisfactorily reproduce the inelastic squared form-factor profiles for the higher vibronic transitions of the B 1Σu+ state of molecular hydrogen, which may be due to the electronic-vibrational coupling for the higher vibronic states. For the C 1Πu state and some vibronic excitations of E F 1Σg+ state, the present experimental results are in good agreement with the present and previous calculations, while the slight differences between the inelastic x-ray scattering and electron energy-loss spectroscopy results in the larger squared momentum-transfer region may be attributed to the increasing role of the higher-order Born terms in the electron-scattering process.

Emerging critical roles of Fe-S clusters in DNA replication and repair

PubMed Central

Fuss, Jill O.; Tsai, Chi-Lin; Ishida, Justin P.; Tainer, John A.

2015-01-01

Fe-S clusters are partners in the origin of life that predate cells, acetyl-CoA metabolism, DNA, and the RNA world. The double helix solved the mystery of DNA replication by base pairing for accurate copying. Yet, for genome stability necessary to life, the double helix has equally important implications for damage repair. Here we examine striking advances that uncover Fe-S cluster roles both in copying the genetic sequence by DNA polymerases and in crucial repair processes for genome maintenance, as mutational defects cause cancer and degenerative disease. Moreover, we examine an exciting, controversial role for Fe-S clusters in a third element required for life – the long-range coordination and regulation of replication and repair events. By their ability to delocalize electrons over both Fe and S centers, Fe-S clusters have unbeatable features for protein conformational control and charge transfer via double-stranded DNA that may fundamentally transform our understanding of life, replication, and repair. PMID:25655665

Dewar Lesion Formation in Single- and Double-Stranded DNA is Quenched by Neighboring Bases.

PubMed

Bucher, Dominik B; Pilles, Bert M; Carell, Thomas; Zinth, Wolfgang

2015-07-16

UV-induced Dewar lesion formation is investigated in single- and double-stranded oligonucleotides with ultrafast vibrational spectroscopy. The quantum yield for the conversion of the (6-4) lesion to the Dewar isomer in DNA strands is reduced by a factor of 4 in comparison to model dinucleotides. Time resolved spectroscopy reveals a fast process in the excited state with spectral characteristics of bases which are adjacent to the excited (6-4) lesion. These kinetic components have large amplitudes and indicate that an additional quenching channel acts in the stranded DNA systems and reduces the Dewar formation yield. Presumably relaxation evolves via a charge transfer to the neighboring guanine and the paired cytosine participates in a double-stranded oligomer. Changes in the decay of the relaxed excited electronic state of the (6-4) chromophore point to modifications in the excited state energy landscape which may lead to an additional reduction of the Dewar formation yield.

Reversible double oxidation and protonation of the non-innocent bridge in a nickel(II) salophen complex.

PubMed

de Bellefeuille, David; Askari, Mohammad S; Lassalle-Kaiser, Benedikt; Journaux, Yves; Aukauloo, Ally; Orio, Maylis; Thomas, Fabrice; Ottenwaelder, Xavier

2012-12-03

Substitution on the aromatic bridge of a nickel(II) salophen complex with electron-donating dimethylamino substituents creates a ligand with three stable, easily and reversibly accessible oxidation states. The one-electron-oxidized product is characterized as a nickel(II) radical complex with the radical bore by the central substituted aromatic ring, in contrast to other nickel(II) salen or salophen complexes that oxidize on the phenolate moieties. The doubly oxidized product, a singlet species, is best described as having an iminobenzoquinone bridge with a vinylogous distribution of bond lengths between the dimethylamino substituents. Protonation of the dimethylamino substituents inhibits these redox processes on the time scale of cyclovoltammetry, but electrolysis and chemical oxidation are consistent with deprotonation occurring concomitantly with electron transfer to yield the mono- and dioxidized species described above.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Design and performance of the spin asymmetries of the nucleon experiment

DOE PAGES

Maxwell, J. D.; Armstrong, W. R.; Choi, S.; ...

2018-03-01

The Spin Asymmetries of the Nucleon Experiment (SANE) performed inclusive, double-polarized electron scattering measurements of the proton at the Continuous Electron Beam Facility at Jefferson Lab. A novel detector array observed scattered electrons of four-momentum transfer 2.5 < Q 2 < 6.5 GeV 2 and Bjorken scaling 0.3 < x < 0.8 from initial beam energies of 4.7 and 5.9 GeV. Employing a polarized proton target which could be rotated with respect to the incident electron beam, both parallel and near perpendicular spin asymmetries were measured, allowing model-independent access to transverse polarization observables A 1, A 2, g 1, gmore » 2 and moment d 2 of the proton. This article summarizes the operation and performance of the polarized target, polarized electron beam, and novel detector systems used during the course of the experiment, and describes analysis techniques utilized to access the physics observables of interest.« less

Coherence parameter measurements for neon and hydrogen

NASA Astrophysics Data System (ADS)

Wright, Robert; Hargreaves, Leigh; Khakoo, Murtadha; Zatsarinny, Oleg; Bartschat, Klaus; Stauffer, Al

2015-09-01

We present recent coherence parameter measurements for excitation of neon and hydrogen by 50 eV electrons. The measurements were made using a crossed electron/gas beam spectrometer, featuring a hemispherically selected electron energy analyzer for detecting scattered electrons and double-reflection VUV polarization analyzer to register fluorescence photons. Time-coincidence counting methods on the electron and photon signals were employed to determine Stokes Parameters at each scattering angle, with data measured at angles between 20 - 115 degrees. The data are compared with calculated results using the B-Spline R-Matrix (BSR) and Relativistic Distorted Wave (RDW) approaches. Measurements were made of both the linear (Plin and γ) and circular (Lperp) parameters for the lowest lying excited states in these two targets. We particularly focus on results in the Lperp parameter, which shows unusual behavior in these particular targets, including strong sign changes implying reversal of the angular momentum transfer. In the case of neon, the unusual behavior is well captured by the BSR, but not by other models.

Design and performance of the spin asymmetries of the nucleon experiment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, J. D.; Armstrong, W. R.; Choi, S.

The Spin Asymmetries of the Nucleon Experiment (SANE) performed inclusive, double-polarized electron scattering measurements of the proton at the Continuous Electron Beam Facility at Jefferson Lab. A novel detector array observed scattered electrons of four-momentum transfer 2.5 < Q 2 < 6.5 GeV 2 and Bjorken scaling 0.3 < x < 0.8 from initial beam energies of 4.7 and 5.9 GeV. Employing a polarized proton target which could be rotated with respect to the incident electron beam, both parallel and near perpendicular spin asymmetries were measured, allowing model-independent access to transverse polarization observables A 1, A 2, g 1, gmore » 2 and moment d 2 of the proton. This article summarizes the operation and performance of the polarized target, polarized electron beam, and novel detector systems used during the course of the experiment, and describes analysis techniques utilized to access the physics observables of interest.« less

Electron spin resonance and proton matrix electron nuclear double resonance studies of N,N,N[prime],N[prime]-tetramethylbenzidine photoionization in sodium and lithium dodecyl sulfate micelles: Structural effects of crown ethers

DOE Office of Scientific and Technical Information (OSTI.GOV)

McManus, H.J.D.; Young Soo Kang; Kevan, L.

1993-01-07

The study of model membrane systems enjoys increasing attention within the area of solar energy research. An electron nuclear double resonance and electron spin resonance study of photogenerated N,N,N[prime],N[prime]-tetramethylbenzidine (TMB) cation in frozen suspensions of lithium (LDS) and sodium (SDS) dodecyl sulfate micelles containing various concentrations of cyclic polyethers was undertaken. The relative location of the TMB cation within the organic aggregate was determined from the proton matrix ENDOR line width at 142 K. A broader line width was observed in LDS compared to SDS micelles, which is due to the fact that the larger lithium cation opens the micellarmore » interface resulting in increased hydration and deeper solubilization of TMB. The proton matrix ENDOR line width decreased upon addition of crown ethers. This decrease may be explained by displacement of the TMB toward the interface as a result of the decrease in ionic strength caused by the complexation of the countercations. The photoyield shows a slight increase with addition of crown ethers. This increase is most likely caused by the increase in the effective anionic charge of the micelle effected by the complexation of the sodium or lithium ions by the crown ethers. This increase in the anionic charge mitigates the rate of thermal back electron transfer resulting in an increased photoyield. 54 refs., 6 figs., 2 tabs.« less

Phospholipid bilayer relaxation dynamics as revealed by the pulsed electron-electron double resonance of spin labels

NASA Astrophysics Data System (ADS)

Syryamina, V. N.; Dzuba, S. A.

2012-10-01

Electron paramagnetic resonance (EPR) spectroscopy in the form of pulsed electron-electron double resonance (ELDOR) was applied to 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) phospholipid bilayers containing lipids that were spin-labeled at different carbon positions along the lipid acyl chain. Pulsed ELDOR detects motionally induced spin flips of nitrogen nuclei in the nitroxide spin labels, which manifests itself as magnetization transfer (MT) in the nitroxide EPR spectrum. The MT effect was observed over a wide temperature range (100-225 K) on a microsecond time scale. In line with a previous study on molecular glasses [N. P. Isaev and S. A. Dzuba, J. Chem. Phys. 135, 094508 (2011), 10.1063/1.3633241], the motions that induce MT effect were suggested to have the same nature as those in dielectric secondary (β) Johari-Goldstein fast relaxation. The results were compared with literature dielectric relaxation data for POPC bilayers, revealing some common features. Molecular motions resulting in MT are faster for deeper spin labels in the membrane interior. The addition of cholesterol to the bilayer suppresses the lipid motions near the steroid nucleus and accelerates the lipid motions beyond the steroid nucleus, in the bilayer interior. This finding was attributed to the lipid acyl chains being more ordered near the steroid nucleus and less ordered in the bilayer interior. The motions are absent in dry lipids, indicating that the motions are determined by intermolecular interactions in the bilayer.

Tungsten Hydride Phosphorus- and Arsenic-Bearing Molecules with Double and Triple W-P and W-As Bonds.

PubMed

Andrews, Lester; Cho, Han-Gook; Fang, Zongtang; Vasiliu, Monica; Dixon, David A

2018-05-07

Laser ablation of tungsten metal provides W atoms which react with phosphine and arsine during condensation in excess argon and neon, leading to major new infrared (IR) absorptions. Annealing, UV irradiation, and deuterium substitution experiments coupled with electronic structure calculations at the density functional theory level led to the assignment of the observed IR absorptions to the E≡WH 3 and HE═WH 2 molecules for E = P and As. The potential energy surfaces for hydrogen transfer from PH 3 to the W were calculated at the coupled-cluster CCSD(T)/complete basis set level. Additional weak bands in the phosphide and arsenide W-H stretching region are assigned to the molecules with loss of H from W, E≡WH 2 . The electronic structure calculations show that the E≡WH 3 molecules have a W-E triple bond, the HE═WH 2 molecules have a W-E double bond, and the H 2 E-WH molecules have a W-E single bond. The formation of multiple E-W bonds leads to increasing stability for the isomers.

Single and double spin asymmetries for pion electro-production from the deuteron in the resonance region

NASA Astrophysics Data System (ADS)

Careccia, Sharon L.

The single and double spin asymmetries At and Aet have been measured in pi- electro-production off the deuteron using a longitudinally polarized electron beam and a polarized ND3 target. The electron beam was polarized using a strained GaAs cathode and the target was polarized using Dynamic Nuclear Polarization. The data were collected at beam energies of 1.6, 1.7, 2.5 and 4.2 GeV in Hall B at Jefferson Lab in the spring of 2001. The final state particles were detected in the CEBAF Large Acceptance Spectrometer (CLAS). The d(e,e'pi-p)p exclusive channel was identified using the missing mass technique and the asymmetries were extracted as a function of the momentum transfer Q2, invariant mass W, and center of mass pion angles cos(theta*) and φ*. The results are generally in agreement with the phenomenological model MAID at low energies, but there are discrepancies in the 2nd and 3rd resonance regions, as well as at forward angles.

Gas sensors boosted by two-dimensional h-BN enabled transfer on thin substrate foils: towards wearable and portable applications.

PubMed

Ayari, Taha; Bishop, Chris; Jordan, Matthew B; Sundaram, Suresh; Li, Xin; Alam, Saiful; ElGmili, Youssef; Patriarche, Gilles; Voss, Paul L; Salvestrini, Jean Paul; Ougazzaden, Abdallah

2017-11-09

The transfer of GaN based gas sensors to foreign substrates provides a pathway to enhance sensor performance, lower the cost and extend the applications to wearable, mobile or disposable systems. The main keys to unlocking this pathway is to grow and fabricate the sensors on large h-BN surface and to transfer them to the flexible substrate without any degradation of the performances. In this work, we develop a new generation of AlGaN/GaN gas sensors with boosted performances on a low cost flexible substrate. We fabricate 2-inch wafer scale AlGaN/GaN gas sensors on sacrificial two-dimensional (2D) nano-layered h-BN without any delamination or cracks and subsequently transfer sensors to an acrylic surface on metallic foil. This technique results in a modification of relevant device properties, leading to a doubling of the sensitivity to NO 2 gas and a response time that is more than 6 times faster than before transfer. This new approach for GaN-based sensor design opens new avenues for sensor improvement via transfer to more suitable substrates, and is promising for next-generation wearable and portable opto-electronic devices.

Cytotoxicity of InP/ZnS quantum dots related to reactive oxygen species generation.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chibli, H.; Carlini, L.; Park, S.

Indium phosphide (InP) quantum dots (QDs) have emerged as a presumably less hazardous alternative to cadmium-based particles, but their cytotoxicity has not been well examined. Although their constituent elements are of very low toxicity to cells in culture, they nonetheless exhibit phototoxicity related to generation of reactive oxygen species by excited electrons and/or holes interacting with water and molecular oxygen. Using spin-trap electron paramagnetic resonance (EPR) spectroscopy and reporter assays, we find a considerable amount of superoxide and a small amount of hydroxyl radical formed under visible illumination of biocompatible InP QDs with a single ZnS shell, comparable to whatmore » is seen with CdTe. A double thickness shell reduces the reactive oxygen species concentration approximately two-fold. Survival assays in five cell lines correspondingly indicate a distinct reduction in toxicity with the double-shell InP QDs. Toxicity varies significantly across cell lines according to the efficiency of uptake, being overall significantly less than what is seen with CdTe or CdSe/ZnS. This indicates that InP QDs are a useful alternative to cadmium-containing QDs, while remaining capable of electron-transfer processes that may be undesirable or which may be exploited for photosensitization applications.« less

Cytotoxicity of InP/ZnS quantum dots related to reactive oxygen species generation.

PubMed

Chibli, Hicham; Carlini, Lina; Park, Soonhyang; Dimitrijevic, Nada M; Nadeau, Jay L

2011-06-01

Indium phosphide (InP) quantum dots (QDs) have emerged as a presumably less hazardous alternative to cadmium-based particles, but their cytotoxicity has not been well examined. Although their constituent elements are of very low toxicity to cells in culture, they nonetheless exhibit phototoxicity related to generation of reactive oxygen species by excited electrons and/or holes interacting with water and molecular oxygen. Using spin-trap electron paramagnetic resonance (EPR) spectroscopy and reporter assays, we find a considerable amount of superoxide and a small amount of hydroxyl radical formed under visible illumination of biocompatible InP QDs with a single ZnS shell, comparable to what is seen with CdTe. A double thickness shell reduces the reactive oxygen species concentration approximately two-fold. Survival assays in five cell lines correspondingly indicate a distinct reduction in toxicity with the double-shell InP QDs. Toxicity varies significantly across cell lines according to the efficiency of uptake, being overall significantly less than what is seen with CdTe or CdSe/ZnS. This indicates that InP QDs are a useful alternative to cadmium-containing QDs, while remaining capable of electron-transfer processes that may be undesirable or which may be exploited for photosensitization applications.

Cytotoxicity of InP/ZnS quantum dots related to reactive oxygen species generation

NASA Astrophysics Data System (ADS)

Chibli, Hicham; Carlini, Lina; Park, Soonhyang; Dimitrijevic, Nada M.; Nadeau, Jay L.

2011-06-01

Indium phosphide (InP) quantum dots (QDs) have emerged as a presumably less hazardous alternative to cadmium-based particles, but their cytotoxicity has not been well examined. Although their constituent elements are of very low toxicity to cells in culture, they nonetheless exhibit phototoxicity related to generation of reactive oxygen species by excited electrons and/or holes interacting with water and molecular oxygen. Using spin-trap electron paramagnetic resonance (EPR) spectroscopy and reporter assays, we find a considerable amount of superoxide and a small amount of hydroxyl radical formed under visible illumination of biocompatible InP QDs with a single ZnS shell, comparable to what is seen with CdTe. A double thickness shell reduces the reactive oxygen species concentration approximately two-fold. Survival assays in five cell lines correspondingly indicate a distinct reduction in toxicity with the double-shell InP QDs. Toxicity varies significantly across cell lines according to the efficiency of uptake, being overall significantly less than what is seen with CdTe or CdSe/ZnS. This indicates that InP QDs are a useful alternative to cadmium-containing QDs, while remaining capable of electron-transfer processes that may be undesirable or which may be exploited for photosensitization applications.

TDDFT study of twisted intramolecular charge transfer and intermolecular double proton transfer in the excited state of 4‧-dimethylaminoflavonol in ethanol solvent

NASA Astrophysics Data System (ADS)

Wang, Ye; Shi, Ying; Cong, Lin; Li, Hui

2015-02-01

Time-dependent density functional theory method at the def-TZVP/B3LYP level was employed to investigate the intramolecular and intermolecular hydrogen bonding dynamics in the first excited (S1) state of 4‧-dimethylaminoflavonol (DMAF) monomer and in ethanol solution. In the DMAF monomer, we demonstrated that the intramolecular charge transfer (ICT) takes place in the S1 state. This excited state ICT process was followed by intramolecular proton transfer. Our calculated results are in good agreement with the mechanism proposed in experimental work. For the hydrogen-bonded DMAF-EtOH complex, it was demonstrated that the intermolecular hydrogen bonds can induce the formation of the twisted intramolecular charge transfer (TICT) state and the conformational twisting is along the C3-C4 bond. Moreover, the intermolecular hydrogen bonds can also facilitate the intermolecular double proton transfer in the TICT state. A stepwise intermolecular double proton transfer process was revealed. Therefore, the intermolecular hydrogen bonds can alter the mechanism of intramolecular charge transfer and proton transfer in the excited state for the DMAF molecule.

Interference experiment with asymmetric double slit by using 1.2-MV field emission transmission electron microscope.

PubMed

Harada, Ken; Akashi, Tetsuya; Niitsu, Kodai; Shimada, Keiko; Ono, Yoshimasa A; Shindo, Daisuke; Shinada, Hiroyuki; Mori, Shigeo

2018-01-17

Advanced electron microscopy technologies have made it possible to perform precise double-slit interference experiments. We used a 1.2-MV field emission electron microscope providing coherent electron waves and a direct detection camera system enabling single-electron detections at a sub-second exposure time. We developed a method to perform the interference experiment by using an asymmetric double-slit fabricated by a focused ion beam instrument and by operating the microscope under a "pre-Fraunhofer" condition, different from the Fraunhofer condition of conventional double-slit experiments. Here, pre-Fraunhofer condition means that each single-slit observation was performed under the Fraunhofer condition, while the double-slit observations were performed under the Fresnel condition. The interference experiments with each single slit and with the asymmetric double slit were carried out under two different electron dose conditions: high-dose for calculation of electron probability distribution and low-dose for each single electron distribution. Finally, we exemplified the distribution of single electrons by color-coding according to the above three types of experiments as a composite image.

Electron transfer dynamics of bistable single-molecule junctions.

PubMed

Danilov, Andrey V; Kubatkin, Sergey E; Kafanov, Sergey G; Flensberg, Karsten; Bjørnholm, Thomas

2006-10-01

We present transport measurements of single-molecule junctions bridged by a molecule with three benzene rings connected by two double bonds and with thiol end-groups that allow chemical binding to gold electrodes. The I-V curves show switching behavior between two distinct states. By statistical analysis of the switching events, we show that a 300 meV mode mediates the transition between the two states. We propose that breaking and reformation of a S-H bond in the contact zone between molecule and electrode explains the observed bistability.

Chemical exchange rotation transfer (CERT) on human brain at 3 Tesla.

PubMed

Lin, Eugene C; Li, Hua; Zu, Zhongliang; Louie, Elizabeth A; Lankford, Christopher L; Dortch, Richard D; Does, Mark D; Gore, John C; Gochberg, Daniel F

2018-05-25

To test the ability of a novel pulse sequence applied in vivo at 3 Tesla to separate the contributions to the water signal from amide proton transfer (APT) and relayed nuclear Overhauser enhancement (rNOE) from background direct water saturation and semisolid magnetization transfer (MT). The lack of such signal source isolation has confounded conventional chemical exchange saturation transfer (CEST) imaging. We quantified APT and rNOE signals using a chemical exchange rotation transfer (CERT) metric, MTR double . A range of duty cycles and average irradiation powers were applied, and results were compared with conventional CEST analyses using asymmetry (MTR asym ) and extrapolated magnetization transfer (EMR). Our results indicate that MTR double is more specific than MTR asym and, because it requires as few as 3 data points, is more rapid than methods requiring a complete Z-spectrum, such as EMR. In white matter, APT (1.5 ± 0.5%) and rNOE (2.1 ± 0.7%) were quantified by using MTR double with a 30% duty cycle and a 0.5-µT average power. In addition, our results suggest that MTR double is insensitive to B 0 inhomogeneity, further magnifying its speed advantage over CEST metrics that require a separate B 0 measurement. However, MTR double still has nontrivial sensitivity to B 1 inhomogeneities. We demonstrated that MTR double is an alternative metric to evaluate APT and rNOE, which is fast, robust to B 0 inhomogeneity, and easy to process. © 2018 International Society for Magnetic Resonance in Medicine.

Measurement of polarization-transfer to bound protons in carbon and its virtuality dependence

NASA Astrophysics Data System (ADS)

Izraeli, D.; Brecelj, T.; Achenbach, P.; Ashkenazi, A.; Böhm, R.; Cohen, E. O.; Distler, M. O.; Esser, A.; Gilman, R.; Kolar, T.; Korover, I.; Lichtenstadt, J.; Mardor, I.; Merkel, H.; Mihovilovič, M.; Müller, U.; Olivenboim, M.; Piasetzky, E.; Ron, G.; Schlimme, B. S.; Schoth, M.; Sfienti, C.; Širca, S.; Štajner, S.; Strauch, S.; Thiel, M.; Weber, A.; Yaron, I.; A1 Collaboration

2018-06-01

We measured the ratio Px /Pz of the transverse to longitudinal components of polarization transferred from electrons to bound protons in 12C by the 12C (e → ,e‧ p →) process at the Mainz Microtron (MAMI). We observed consistent deviations from unity of this ratio normalized to the free-proton ratio, (Px /Pz) 12C /(Px /Pz) 1H, for both s- and p-shell knocked out protons, even though they are embedded in averaged local densities that differ by about a factor of two. The dependence of the double ratio on proton virtuality is similar to the one for knocked out protons from 2H and 4He, suggesting a universal behavior. It further implies no dependence on average local nuclear density.

Excited-State Charge Separation in the Photochemical Mechanism of the Light-Driven Enzyme Protochlorophyllide Oxidoreductase**

PubMed Central

Heyes, Derren J; Hardman, Samantha J O; Hedison, Tobias M; Hoeven, Robin; Greetham, Greg M; Towrie, Michael; Scrutton, Nigel S

2015-01-01

The unique light-driven enzyme protochlorophyllide oxidoreductase (POR) is an important model system for understanding how light energy can be harnessed to power enzyme reactions. The ultrafast photochemical processes, essential for capturing the excitation energy to drive the subsequent hydride- and proton-transfer chemistry, have so far proven difficult to detect. We have used a combination of time-resolved visible and IR spectroscopy, providing complete temporal resolution over the picosecond–microsecond time range, to propose a new mechanism for the photochemistry. Excited-state interactions between active site residues and a carboxyl group on the Pchlide molecule result in a polarized and highly reactive double bond. This so-called “reactive” intramolecular charge-transfer state creates an electron-deficient site across the double bond to trigger the subsequent nucleophilic attack of NADPH, by the negatively charged hydride from nicotinamide adenine dinucleotide phosphate. This work provides the crucial, missing link between excited-state processes and chemistry in POR. Moreover, it provides important insight into how light energy can be harnessed to drive enzyme catalysis with implications for the design of light-activated chemical and biological catalysts. PMID:25488797

Excited-state charge separation in the photochemical mechanism of the light-driven enzyme protochlorophyllide oxidoreductase.

PubMed

Heyes, Derren J; Hardman, Samantha J O; Hedison, Tobias M; Hoeven, Robin; Greetham, Greg M; Towrie, Michael; Scrutton, Nigel S

2015-01-26

The unique light-driven enzyme protochlorophyllide oxidoreductase (POR) is an important model system for understanding how light energy can be harnessed to power enzyme reactions. The ultrafast photochemical processes, essential for capturing the excitation energy to drive the subsequent hydride- and proton-transfer chemistry, have so far proven difficult to detect. We have used a combination of time-resolved visible and IR spectroscopy, providing complete temporal resolution over the picosecond-microsecond time range, to propose a new mechanism for the photochemistry. Excited-state interactions between active site residues and a carboxyl group on the Pchlide molecule result in a polarized and highly reactive double bond. This so-called "reactive" intramolecular charge-transfer state creates an electron-deficient site across the double bond to trigger the subsequent nucleophilic attack of NADPH, by the negatively charged hydride from nicotinamide adenine dinucleotide phosphate. This work provides the crucial, missing link between excited-state processes and chemistry in POR. Moreover, it provides important insight into how light energy can be harnessed to drive enzyme catalysis with implications for the design of light-activated chemical and biological catalysts. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Photoisomerization around a fulvene double bond: coherent population transfer to the electronic ground state?

PubMed

Ioffe, Ilya; Dobryakov, Alexander L; Granovsky, Alexander A; Ernsting, Nikolaus P; Lustres, J Luis Pérez

2011-07-11

Photoisomerization around a central fulvene-type double bond is known to proceed through a conical intersection at the perpendicular geometry. The process is studied with an indenylidene-dihydropyridine model compound, allowing the use of visible excitation pulses. Transient absorption shows that 1) stimulated emission shifts to the red and loses oscillator strength on a 50 fs timescale, and 2) bleach recovery is highly nonexponential and not affected by solvent viscosity or methyl substitution at the dihydropyridine ring. Quantum-chemical calculations are used to explain point 1 as a result of initial elongation of the central C=C bond with mixing of S(2) and S(1) states. From point 2 it is concluded that internal conversion of S(1)→S(0) does not require torsional motion to the fully perpendicular state. The S(1) population appears to encounter a sink on the torsional coordinate before the conical intersection is reached. Rate equations cannot model the observed ground-state recovery adequately. Instead the dynamics are best described with a strongly damped oscillatory contribution, which could indicate coherent S(1)-S(0) population transfer. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Interaction of emitted sonar pulses and simulated echoes in a false killer whale: an evoked-potential study.

PubMed

Supin, Alexander Ya; Nachtigall, Paul E; Breese, Marlee

2011-09-01

Auditory evoked potentials (AEP) were recorded during echolocation in a false killer whale Pseudorca crassidens. An electronically synthesized and played-back (simulated) echo was triggered by an emitted biosonar pulse, and its intensity was proportional to that of the emitted click. The delay and transfer factor of the echo relative to the emitted click was controlled by the operator. The echo delay varied from 2 to 16 ms (by two-fold steps), and the transfer factor varied within ranges from -45 to -30 dB at the 2-ms delay to -60 to -45 dB at the 16-ms delay. Echo-related AEPs featured amplitude dependence both on echo delay at a constant transfer factor (the longer the delay, the higher amplitude) and on echo transfer factor at a constant delay (the higher transfer factor, the higher amplitude). Conjunctional variation of the echo transfer factor and delay kept the AEP amplitude constant when the delay to transfer factor trade was from -7.1 to -8.4 dB per delay doubling. The results confirm the hypothesis that partial forward masking of the echoes by the preceding emitted sonar pulses serves as a time-varying automatic gain control in the auditory system of echolocating odontocetes. © 2011 Acoustical Society of America

Magnetic circular dichroism of UCl 6– in the ligand-to-metal charge-transfer spectral region

DOE PAGES

Gendron, Frederic; Fleischauer, Valerie R.; Duignan, Thomas J.; ...

2017-06-23

Here, we present a combined ab initio theoretical and experimental study of the magnetic circular dichroism (MCD) spectrum of the octahedral UCl 6- complex ion in the UV-Vis spectral region. The ground state is an orbitally non-degenerate doublet E 5/2u and the MCD is a $C$-term spectrum caused by spin–orbit coupling. Calculations of the electronic spectrum at various levels of theory indicate that differential dynamic electron correlation has a strong influence on the energies of the dipole-allowed transitions and the envelope of the MCD spectrum. The experimentally observed bands are assigned to dipole-allowed ligand-to-metal charge transfer into the 5f shell,more » and 5f to 6d transitions. Charge transfer excitations into the U 6d shell appear at much higher energies. The MCD-allowed transitions can be assigned via their signs of the $C$-terms: Under O h double group symmetry, E 5/2u → E 5/2g transitions have negative $C$-terms whereas E 5/2u → F 3/2g transitions have positive $C$-terms if the ground state g-factor is negative, as it is the case for UCl 6-.« less

The effect of the welding direction on the plasma and metal transfer behavior of CO2 laser+GMAW-P hybrid welding processes

NASA Astrophysics Data System (ADS)

Zhang, Wang; Hua, Xueming; Liao, Wei; Li, Fang; Wang, Min

2014-07-01

During laser-arc hybrid welding, the welding direction exerts direct effects on the plasma properties, the transient behavior of the droplet, the weld pool behavior, and the temperature field. Ultimately, it will affect the welding process and the weld quality. However, the behavior of the CO2 laser+GMAW-P hybrid welding process has not been systematically studied. In this paper, the current-voltage characteristics of different welding processes were analyzed and compared. The dynamics of the droplet transfer, the plasma behavior, and the weld pool behavior were observed by using two high-speed camera systems. Moreover, an optical emission spectroscopy was applied to analyze the plasma temperature and the electron number density. The results indicated that the electrical resistance of the arc plasma reduced in the laser leading mode. For the same pulse duration, the metal transfer mode was the spray type with the laser leading arrangement. The temperature and electron density distribution showed bimodal behavior in the case of arc leading mode, while this phenomenon does not exist in the caser of laser leading mode. The double elliptic-planar distribution which conventional simulation process used was not applicable in the laser leading mode.

QLog Solar-Cell Mode Photodiode Logarithmic CMOS Pixel Using Charge Compression and Readout †

PubMed Central

Ni, Yang

2018-01-01

In this paper, we present a new logarithmic pixel design currently under development at New Imaging Technologies SA (NIT). This new logarithmic pixel design uses charge domain logarithmic signal compression and charge-transfer-based signal readout. This structure gives a linear response in low light conditions and logarithmic response in high light conditions. The charge transfer readout efficiently suppresses the reset (KTC) noise by using true correlated double sampling (CDS) in low light conditions. In high light conditions, thanks to charge domain logarithmic compression, it has been demonstrated that 3000 electrons should be enough to cover a 120 dB dynamic range with a mobile phone camera-like signal-to-noise ratio (SNR) over the whole dynamic range. This low electron count permits the use of ultra-small floating diffusion capacitance (sub-fF) without charge overflow. The resulting large conversion gain permits a single photon detection capability with a wide dynamic range without a complex sensor/system design. A first prototype sensor with 320 × 240 pixels has been implemented to validate this charge domain logarithmic pixel concept and modeling. The first experimental results validate the logarithmic charge compression theory and the low readout noise due to the charge-transfer-based readout. PMID:29443903

QLog Solar-Cell Mode Photodiode Logarithmic CMOS Pixel Using Charge Compression and Readout.

PubMed

Ni, Yang

2018-02-14

In this paper, we present a new logarithmic pixel design currently under development at New Imaging Technologies SA (NIT). This new logarithmic pixel design uses charge domain logarithmic signal compression and charge-transfer-based signal readout. This structure gives a linear response in low light conditions and logarithmic response in high light conditions. The charge transfer readout efficiently suppresses the reset (KTC) noise by using true correlated double sampling (CDS) in low light conditions. In high light conditions, thanks to charge domain logarithmic compression, it has been demonstrated that 3000 electrons should be enough to cover a 120 dB dynamic range with a mobile phone camera-like signal-to-noise ratio (SNR) over the whole dynamic range. This low electron count permits the use of ultra-small floating diffusion capacitance (sub-fF) without charge overflow. The resulting large conversion gain permits a single photon detection capability with a wide dynamic range without a complex sensor/system design. A first prototype sensor with 320 × 240 pixels has been implemented to validate this charge domain logarithmic pixel concept and modeling. The first experimental results validate the logarithmic charge compression theory and the low readout noise due to the charge-transfer-based readout.

Correlation between energy deposition and molecular damage from Auger electrons: A case study of ultra-low energy (5-18 eV) electron interactions with DNA.

PubMed

Rezaee, Mohammad; Hunting, Darel J; Sanche, Léon

2014-07-01

The present study introduces a new method to establish a direct correlation between biologically related physical parameters (i.e., stopping and damaging cross sections, respectively) for an Auger-electron emitting radionuclide decaying within a target molecule (e.g., DNA), so as to evaluate the efficacy of the radionuclide at the molecular level. These parameters can be applied to the dosimetry of Auger electrons and the quantification of their biological effects, which are the main criteria to assess the therapeutic efficacy of Auger-electron emitting radionuclides. Absorbed dose and stopping cross section for the Auger electrons of 5-18 eV emitted by(125)I within DNA were determined by developing a nanodosimetric model. The molecular damages induced by these Auger electrons were investigated by measuring damaging cross section, including that for the formation of DNA single- and double-strand breaks. Nanoscale films of pure plasmid DNA were prepared via the freeze-drying technique and subsequently irradiated with low-energy electrons at various fluences. The damaging cross sections were determined by employing a molecular survival model to the measured exposure-response curves for induction of DNA strand breaks. For a single decay of(125)I within DNA, the Auger electrons of 5-18 eV deposit the energies of 12.1 and 9.1 eV within a 4.2-nm(3) volume of a hydrated or dry DNA, which results in the absorbed doses of 270 and 210 kGy, respectively. DNA bases have a major contribution to the deposited energies. Ten-electronvolt and high linear energy transfer 100-eV electrons have a similar cross section for the formation of DNA double-strand break, while 100-eV electrons are twice as efficient as 10 eV in the induction of single-strand break. Ultra-low-energy electrons (<18 eV) substantially contribute to the absorbed dose and to the molecular damage from Auger-electron emitting radionuclides; hence, they should be considered in the dosimetry calculation of such radionuclides. Moreover, absorbed dose is not an appropriate physical parameter for nanodosimetry. Instead, stopping cross section, which describes the probability of energy deposition in a target molecule can be an appropriate nanodosimetric parameter. The stopping cross section is correlated with a damaging cross section (e.g., cross section for the double-strand break formation) to quantify the number of each specific lesion in a target molecule for each nuclear decay of a single Auger-electron emitting radionuclide.

Unravelling electronic and structural requisites of triplet-triplet energy transfer by advanced electron paramagnetic resonance and density functional theory

NASA Astrophysics Data System (ADS)

Di Valentin, M.; Salvadori, E.; Barone, V.; Carbonera, D.

2013-10-01

Advanced electron paramagnetic resonance (EPR) techniques, in combination with Density Functional theory (DFT), have been applied to the comparative study of carotenoid triplet states in two major photosynthetic antenna complexes, the Peridinin-chlorophyll a-protein of dinoflagellates and the light-harvesting complex II of higher plants. Carotenoid triplet states are populated by triplet-triplet energy transfer (TTET) from chlorophyll molecules to photoprotect the system from singlet oxygen formation under light-stress conditions. The TTET process is strongly dependent on the relative arrangement and on the electronic properties of the triplet states involved. The proposed spectroscopic approach exploits the concept of spin conservation during TTET, which leads to recognisable spin polarisation effects in the time-resolved and field-swept echo-detected EPR spectra. The electron spin polarisation produced at the carotenoid acceptor site depends on the initial polarisation of the chlorophyll donor and on the relative geometrical arrangement of the donor-acceptor zero-field splitting axes. We have demonstrated that a proper analysis of the spectra in the framework of spin angular momentum conservation allows to derive the pathways of TTET and to gain insight into the structural requirements of this mechanism for those antenna complexes, whose X-ray structure is available. We have further proved that this method, developed for natural antenna complexes of known X-ray structure, can be extended to systems lacking structural information in order to derive the relative arrangement of the partners in the energy transfer process. The structural requirements for efficient TTET, obtained from time-resolved and pulse EPR, have been complemented by a detailed description of the electronic structure of the carotenoid triplet state, provided by pulse Electron-Nuclear DOuble Resonance (ENDOR) experiments. Triplet-state hyperfine couplings of the α- and β-protons of the carotenoid conjugated chain have been assigned with the aid of quantum chemical calculation. DFT predictions of the electronic structure of the carotenoid triplet state, in terms of spin density distribution, frontier orbital description and orbital excitation represent suitable building blocks toward a deeper understanding of electronic requirements for efficient TTET.

Highly Efficient Inverted Perovskite Solar Cells with CdSe QDs/LiF Electron Transporting Layer

NASA Astrophysics Data System (ADS)

Tan, Furui; Xu, Weizhe; Hu, Xiaodong; Yu, Ping; Zhang, Weifeng

2017-12-01

Organic/inorganic hybrid perovskite solar cell has emerged as a very promising candidate for the next generation of near-commercial photovoltaic devices. Here in this work, we focus on the inverted perovskite solar cells and have found that remarkable photovoltaic performance could be obtained when using cadmium selenide (CdSe) quantum dots (QDs) as electron transporting layer (ETL) and lithium fluoride (LiF) as the buffer, with respect to the traditionally applied and high-cost [6,6]-phenyl-C61-butyric acid methyl ester (PCBM). The easily processed and low-cost CdSe QDs/LiF double layer could facilitate convenient electron-transfer and collection at the perovskite/cathode interface, promoting an optoelectric conversion efficiency of as high as 15.1%, very close to that with the traditional PCBM ETL. Our work provides another promising choice on the ETL materials for the highly efficient and low-cost perovskite solar cells.

Ultrafast Molecular Three-Electron Auger Decay.

PubMed

Feifel, Raimund; Eland, John H D; Squibb, Richard J; Mucke, Melanie; Zagorodskikh, Sergey; Linusson, Per; Tarantelli, Francesco; Kolorenč, Přemysl; Averbukh, Vitali

2016-02-19

Three-electron Auger decay is an exotic and elusive process, in which two outer-shell electrons simultaneously refill an inner-shell double vacancy with emission of a single Auger electron. Such transitions are forbidden by the many-electron selection rules, normally making their decay lifetimes orders of magnitude longer than the few-femtosecond lifetimes of normal (two-electron) Auger decay. Here we present theoretical predictions and direct experimental evidence for a few-femtosecond three-electron Auger decay of a double inner-valence-hole state in CH_{3}F. Our analysis shows that in contrast to double core holes, double inner-valence vacancies in molecules can decay exclusively by this ultrafast three-electron Auger process, and we predict that this phenomenon occurs widely.

Energy Level Alignment of N-Doping Fullerenes and Fullerene Derivatives Using Air-Stable Dopant.

PubMed

Bao, Qinye; Liu, Xianjie; Braun, Slawomir; Li, Yanqing; Tang, Jianxin; Duan, Chungang; Fahlman, Mats

2017-10-11

Doping has been proved to be one of the powerful technologies to achieve significant improvement in the performance of organic electronic devices. Herein, we systematically map out the interface properties of solution-processed air-stable n-type (4-(1,3-dimethyl-2,3-dihydro-1H-benzoimidazol-2-yl)phenyl) doping fullerenes and fullerene derivatives and establish a universal energy level alignment scheme for this class of n-doped system. At low doping levels at which the charge-transfer doping induces mainly bound charges, the energy level alignment of the n-doping organic semiconductor can be described by combining integer charger transfer-induced shifts with a so-called double-dipole step. At high doping levels, significant densities of free charges are generated and the charge flows between the organic film and the conducting electrodes equilibrating the Fermi level in a classic "depletion layer" scheme. Moreover, we demonstrate that the model holds for both n- and p-doping of π-backbone molecules and polymers. With the results, we provide wide guidance for identifying the application of the current organic n-type doping technology in organic electronics.

Electron trapping data storage system and applications

NASA Technical Reports Server (NTRS)

Brower, Daniel; Earman, Allen; Chaffin, M. H.

1993-01-01

The advent of digital information storage and retrieval has led to explosive growth in data transmission techniques, data compression alternatives, and the need for high capacity random access data storage. Advances in data storage technologies are limiting the utilization of digitally based systems. New storage technologies will be required which can provide higher data capacities and faster transfer rates in a more compact format. Magnetic disk/tape and current optical data storage technologies do not provide these higher performance requirements for all digital data applications. A new technology developed at the Optex Corporation out-performs all other existing data storage technologies. The Electron Trapping Optical Memory (ETOM) media is capable of storing as much as 14 gigabytes of uncompressed data on a single, double-sided 54 inch disk with a data transfer rate of up to 12 megabits per second. The disk is removable, compact, lightweight, environmentally stable, and robust. Since the Write/Read/Erase (W/R/E) processes are carried out 100 percent photonically, no heating of the recording media is required. Therefore, the storage media suffers no deleterious effects from repeated Write/Read/Erase cycling.

Different catalytic effects of a single water molecule: the gas-phase reaction of formic acid with hydroxyl radical in water vapor.

PubMed

Anglada, Josep M; Gonzalez, Javier

2009-12-07

The effect of a single water molecule on the reaction mechanism of the gas-phase reaction between formic acid and the hydroxyl radical was investigated with high-level quantum mechanical calculations using DFT-B3LYP, MP2 and CCSD(T) theoretical approaches in concert with the 6-311+G(2df,2p) and aug-cc-pVTZ basis sets. The reaction between HCOOH and HO has a very complex mechanism involving a proton-coupled electron transfer process (pcet), two hydrogen-atom transfer reactions (hat) and a double proton transfer process (dpt). The hydroxyl radical predominantly abstracts the acidic hydrogen of formic acid through a pcet mechanism. A single water molecule affects each one of these reaction mechanisms in different ways, depending on the way the water interacts. Very interesting is also the fact that our calculations predict that the participation of a single water molecule results in the abstraction of the formyl hydrogen of formic acid through a hydrogen atom transfer process (hat).

Quasi-four-body treatment of charge transfer in the collision of protons with atomic helium: II. Second-order non-Thomas mechanisms and the cross sections

NASA Astrophysics Data System (ADS)

Safarzade, Zohre; Akbarabadi, Farideh Shojaei; Fathi, Reza; Brunger, Michael J.; Bolorizadeh, Mohammad A.

2018-05-01

A fully quantum mechanical four-body treatment of charge transfer collisions between energetic protons and atomic helium is developed here. The Pauli exclusion principle is applied to both the wave function of the initial and final states as well as the operators involved in the interaction. Prior to the collision, the helium atom is assumed as a two-body system composed of the nucleus, He2+, and an electron cloud composed of two electrons. Nonetheless, four particles are assumed in the final state. As the double interactions contribute extensively in single charge transfer collisions, the Faddeev-Lovelace-Watson scattering formalism describes it best physically. The treatment of the charge transfer cross section, under this quasi-four-body treatment within the FWL formalism, showed that other mechanisms leading to an effect similar to the Thomas one occur at the same scattering angle. Here, we study the two-body interactions which are not classically described but which lead to an effect similar to the Thomas mechanism and finally we calculate the total singlet and triplet amplitudes as well as the angular distributions of the charge transfer cross sections. As the incoming projectiles are assumed to be plane waves, the present results are calculated for high energies; specifically a projectile energy of 7.42 MeV was assumed as this is where experimental results are available in the literature for comparison. Finally, when possible we compare the present results with the other available theoretical data.

A theoretical study of structural, opto-electronic and nonlinear properties of arylboroxine derivatives

NASA Astrophysics Data System (ADS)

Islam, Nasarul; Pandith, Altaf Hussain

2018-01-01

Density functional theory at CAM-B3LYP/6-311G++ (2d, 2p) level was employed to study the Triphenylboroxine derivatives ( TB) containing electron donating and electron substituents, for their charge transfer and nonlinear optical properties. The results reveal that electron donating groups facilitate the rapid electron injection as compared to unsubstituted TB. It was observed that upon substitution with electron donating groups, the TB derivatives show an increased double bond character in the B3-C18 bond indicating an increase in the degree of conjugation. The Frontier molecular orbital studies indicate that highest occupied molecular orbitals of the neutral molecules delocalize primarily over the three phenyl rings and bridging oxygen atoms, whereas the lowest unoccupied molecular orbitals localize largely on the two phenyl rings and the boron atoms. Further, the TD-DFT studies indicate that the maximum absorption band results from the electron transitions from the initial states that are contributed by the HOMO and HOMO-1 to the final states that are mainly contributed by the LUMOs. In addition, we have observed that the introduction of electron donating group to the TB-7 leads to more active nonlinear performance.

State-to-state time-of-flight measurements of NO scattering from Au(111): direct observation of translation-to-vibration coupling in electronically nonadiabatic energy transfer.

PubMed

Golibrzuch, Kai; Shirhatti, Pranav R; Altschäffel, Jan; Rahinov, Igor; Auerbach, Daniel J; Wodtke, Alec M; Bartels, Christof

2013-09-12

Translational motion is believed to be a spectator degree of freedom in electronically nonadiabatic vibrational energy transfer between molecules and metal surfaces, but the experimental evidence available to support this view is limited. In this work, we have experimentally determined the translational inelasticity in collisions of NO molecules with a single-crystal Au(111) surface-a system with strong electronic nonadiabaticity. State-to-state molecular beam surface scattering was combined with an IR-UV double resonance scheme to obtain high-resolution time-of-flight data. The measurements include vibrationally elastic collisions (v = 3→3, 2→2) as well as collisions where one or two quanta of molecular vibration are excited (2→3, 2→4) or de-excited (2→1, 3→2, 3→1). In addition, we have carried out comprehensive measurements of the effects of rotational excitation on the translational energy of the scattered molecules. We find that under all conditions of this work, the NO molecules lose a large fraction (∼0.45) of their incidence translational energy to the surface. Those molecules that undergo vibrational excitation (relaxation) during the collision recoil slightly slower (faster) than vibrationally elastically scattered molecules. The amount of translational energy change depends on the surface temperature. The translation-to-rotation coupling, which is well-known for v = 0→0 collisions, is found to be significantly weaker for vibrationally inelastic than elastic channels. Our results clearly show that the spectator view of the translational motion in electronically nonadiabatic vibrational energy transfer between NO and Au(111) is only approximately correct.

In Vivo Application of Proton-Electron Double-Resonance Imaging

PubMed Central

Kishimoto, Shun; Krishna, Murali C.; Khramtsov, Valery V.; Utsumi, Hideo

2018-01-01

Abstract Significance: Proton-electron double-resonance imaging (PEDRI) employs electron paramagnetic resonance irradiation with low-field magnetic resonance imaging so that the electron spin polarization is transferred to nearby protons, resulting in higher signals. PEDRI provides information about free radical distribution and, indirectly, about the local microenvironment such as partial pressure of oxygen (pO2), tissue permeability, redox status, and acid-base balance. Recent Advances: Local acid-base balance can be imaged by exploiting the different resonance frequency of radical probes between R and RH+ forms. Redox status can also be imaged by using the loss of radical-related signal after reduction. These methods require optimized radical probes and pulse sequences. Critical Issues: High-power radio frequency irradiation is needed for optimum signal enhancement, which may be harmful to living tissue by unwanted heat deposition. Free radical probes differ depending on the purpose of PEDRI. Some probes are less effective for enhancing signal than others, which can reduce image quality. It is so far not possible to image endogenous radicals by PEDRI because low concentrations and broad line widths of the radicals lead to negligible signal enhancement. Future Directions: PEDRI has similarities with electron paramagnetic resonance imaging (EPRI) because both techniques observe the EPR signal, directly in the case of EPRI and indirectly with PEDRI. PEDRI provides information that is vital to research on homeostasis, development of diseases, or treatment responses in vivo. It is expected that the development of new EPR techniques will give insights into novel PEDRI applications and vice versa. Antioxid. Redox Signal. 28, 1345–1364. PMID:28990406

Charge-transfer mechanism for electrophilic aromatic nitration and nitrosation via the convergence of (ab initio) molecular-orbital and Marcus-Hush theories with experiments.

PubMed

Gwaltney, Steven R; Rosokha, Sergiy V; Head-Gordon, Martin; Kochi, Jay K

2003-03-19

The highly disparate rates of aromatic nitrosation and nitration, despite the very similar (electrophilic) properties of the active species: NO(+) and NO(2)(+) in Chart 1, are quantitatively reconciled. First, the thorough mappings of the potential-energy surfaces by high level (ab initio) molecular-orbital methodologies involving extensive coupled-cluster CCSD(T)/6-31G optimizations establish the intervention of two reactive intermediates in nitration (Figure 8) but only one in nitrosation (Figure 7). Second, the same distinctive topologies involving double and single potential-energy minima (Figures 6 and 5) also emerge from the semiquantitative application of the Marcus-Hush theory to the transient spectral data. Such a striking convergence from quite different theoretical approaches indicates that the molecular-orbital and Marcus-Hush (potential-energy) surfaces are conceptually interchangeable. In the resultant charge-transfer mechanism, the bimolecular interactions of arene donors with both NO(+) and NO(2)(+) spontaneously lead (barrierless) to pi-complexes in which electron transfer is concurrent with complexation. Such a pi-complex in nitration is rapidly converted to the sigma-complex, whereas this Wheland adduct in nitrosation merely represents a high energy (transition-state) structure. Marcus-Hush analysis thus demonstrates how the strongly differentiated (arene) reactivities toward NO(+) and NO(2)(+) can actually be exploited in the quantitative development of a single coherent (electron-transfer) mechanism for both aromatic nitrosation and nitration.

Comment on 'The diatomic dication CuZn{sup 2+} in the gas phase' [J. Chem. Phys. 135, 034306 (2011)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fiser, Jiri; Diez, Reinaldo Pis; Franzreb, Klaus

2013-02-21

In this Comment, the density functional theory (DFT) calculations carried out by Diez et al. [J. Chem. Phys. 135, 034306 (2011)] are revised within the framework of the coupled-cluster single double triple method. These more sophisticated calculations allow us to show that the {sup 2}{Sigma}{sup +} electronic ground state of CuZn{sup 2+}, characterized as the metastable ground state by DFT calculations, is a repulsive state instead. The {sup 2}{Delta} and {sup 2}{Pi} metastable states of CuZn{sup 2+}, on the other hand, should be responsible for the formation mechanism of the dication through the near-resonant electron transfer CuZn{sup +}+ Ar{sup +}{yields}more » CuZn{sup 2+}+ Ar reaction.« less

THREE-DIMENSIONAL NON-VACUUM PULSAR OUTER-GAP MODEL: LOCALIZED ACCELERATION ELECTRIC FIELD IN THE HIGHER ALTITUDES

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hirotani, Kouichi

2015-01-10

We investigate the particle accelerator that arises in a rotating neutron-star magnetosphere. Simultaneously solving the Poisson equation for the electro-static potential, the Boltzmann equations for relativistic electrons and positrons, and the radiative transfer equation, we demonstrate that the electric field is substantially screened along the magnetic field lines by pairs that are created and separated within the accelerator. As a result, the magnetic-field-aligned electric field is localized in higher altitudes near the light cylinder and efficiently accelerates the positrons created in the lower altitudes outward but does not accelerate the electrons inward. The resulting photon flux becomes predominantly outward, leadingmore » to typical double-peak light curves, which are commonly observed from many high-energy pulsars.« less

Transfer functions of double- and multiple-cavity Fabry-Perot filters driven by Lorentzian sources.

PubMed

Marti, J; Capmany, J

1996-12-20

We derive expressions for the transfer functions of double- and multiple-cavity Fabry-Perot filters driven by laser sources with Lorentzian spectrum. These are of interest because of their applications in sensing and channel filtering in optical frequency-division multiplexing networks.

Transfer functions of double- and multiple-cavity Fabry Perot filters driven by Lorentzian sources

NASA Astrophysics Data System (ADS)

Marti, Javier; Capmany, Jose

1996-12-01

We derive expressions for the transfer functions of double- and multiple-cavity Fabry Perot filters driven by laser sources with Lorentzian spectrum. These are of interest because of their applications in sensing and channel filtering in optical frequency-division multiplexing networks.

Configurable double-sided modular jet impingement assemblies for electronics cooling

DOEpatents

Zhou, Feng; Dede, Ercan Mehmet

2018-05-22

A modular jet impingement assembly includes an inlet tube fluidly coupled to a fluid inlet, an outlet tube fluidly coupled to a fluid outlet, and a modular manifold having a first distribution recess extending into a first side of the modular manifold, a second distribution recess extending into a second side of the modular manifold, a plurality of inlet connection tubes positioned at an inlet end of the modular manifold, and a plurality of outlet connection tubes positioned at an outlet end of the modular manifold. A first manifold insert is removably positioned within the first distribution recess, a second manifold insert is removably positioned within the second distribution recess, and a first and second heat transfer plate each removably coupled to the modular manifold. The first and second heat transfer plates each comprise an impingement surface.

Modeling Insight into Battery Electrolyte Electrochemical Stability and Interfacial Structure.

PubMed

Borodin, Oleg; Ren, Xiaoming; Vatamanu, Jenel; von Wald Cresce, Arthur; Knap, Jaroslaw; Xu, Kang

2017-12-19

Electroactive interfaces distinguish electrochemistry from chemistry and enable electrochemical energy devices like batteries, fuel cells, and electric double layer capacitors. In batteries, electrolytes should be either thermodynamically stable at the electrode interfaces or kinetically stable by forming an electronically insulating but ionically conducting interphase. In addition to a traditional optimization of electrolytes by adding cosolvents and sacrificial additives to preferentially reduce or oxidize at the electrode surfaces, knowledge of the local electrolyte composition and structure within the double layer as a function of voltage constitutes the basis of manipulating an interphase and expanding the operating windows of electrochemical devices. In this work, we focus on how the molecular-scale insight into the solvent and ion partitioning in the electrolyte double layer as a function of applied potential could predict changes in electrolyte stability and its initial oxidation and reduction reactions. In molecular dynamics (MD) simulations, highly concentrated lithium aqueous and nonaqueous electrolytes were found to exclude the solvent molecules from directly interacting with the positive electrode surface, which provides an additional mechanism for extending the electrolyte oxidation stability in addition to the well-established simple elimination of "free" solvent at high salt concentrations. We demonstrate that depending on their chemical structures, the anions could be designed to preferentially adsorb or desorb from the positive electrode with increasing electrode potential. This provides additional leverage to dictate the order of anion oxidation and to effectively select a sacrificial anion for decomposition. The opposite electrosorption behaviors of bis(trifluoromethane)sulfonimide (TFSI) and trifluoromethanesulfonate (OTF) as predicted by MD simulation in highly concentrated aqueous electrolytes were confirmed by surface enhanced infrared spectroscopy. The proton transfer (H-transfer) reactions between solvent molecules on the cathode surface coupled with solvent oxidation were found to be ubiquitous for common Li-ion electrolyte components and dependent on the local molecular environment. Quantum chemistry (QC) calculations on the representative clusters showed that the majority of solvents such as carbonates, phosphates, sulfones, and ethers have significantly lower oxidation potential when oxidation is coupled with H-transfer, while without H-transfer their oxidation potentials reside well beyond battery operating potentials. Thus, screening of the solvent oxidation limits without considering H-transfer reactions is unlikely to be relevant, except for solvents containing unsaturated functionalities (such as C═C) that oxidize without H-transfer. On the anode, the F-transfer reaction and LiF formation during anion and fluorinated solvent reduction could be enhanced or diminished depending on salt and solvent partitioning in the double layer, again giving an additional tool to manipulate the order of reductive decompositions and interphase chemistry. Combined with experimental efforts, modeling results highlight the promise of interphasial compositional control by either bringing the desired components closer to the electrode surface to facilitate redox reaction or expelling them so that they are kinetically shielded from the potential of the electrode.

Double photoionization of atoms

NASA Astrophysics Data System (ADS)

Wiedenhoeft, Marco

2003-10-01

Double photoionization studies of atoms and molecules are new state-of-the-art studies providing a deeper knowledge of multi-electron excitations. This type of work advances the understanding of many-body problems. Double photoionization of atoms is of great interest to learn about electron-electron correlation and relaxation effects in atoms and molecules. In order to study double photoionization processes, a new electron-electron coincidence apparatus was built to carry out the measurements. I will present the apparatus I built as well as the results of the measurement of the triply-differential-cross-section (TDCS) for the predicted interference and Post-Collision-Interaction (PCI) effects in the Xenon N5O2,3 O2,3 Auger decay after 4d5/2 photoionization. Furthermore I present measurements for direct double photoionization of Helium at various photon energies.

Surface Charge-Transfer Doping of Graphene Nanoflakes Containing Double-Vacancy (5-8-5) and Stone-Wales (55-77) Defects through Molecular Adsorption.

PubMed

Shakourian-Fard, Mehdi; Jamshidi, Zahra; Kamath, Ganesh

2016-10-18

The adsorption of six electron donor-acceptor (D/A) organic molecules on various sizes of graphene nanoflakes (GNFs) containing two common defects, double-vacancy (5-8-5) and Stone-Wales (55-77), are investigated by means of ab initio DFT [M06-2X(-D3)/cc-pVDZ]. Different D/A molecules adsorb on a defect graphene (DG) surface with binding energies (ΔE b ) of about -12 to -28 kcal mol -1 . The ΔE b values for adsorption of molecules on the Stone-Wales GNF surface are higher than those on the double vacancy GNF surface. Moreover, binding energies increase by about 10 % with an increase in surface size. The nature of cooperative weak interactions is analyzed based on quantum theory of atoms in molecules, noncovalent interactions plot, and natural bond order analyses, and the dominant interaction is compared for different molecules. Electron density population analysis is used to explain the n- and p-type character of defect graphene nanoflakes (DGNFs) and also the change in electronic properties and reactivity parameters of DGNFs upon adsorption of different molecules and with increasing DGNF size. Results indicate that the HOMO-LUMO energy gap (E g ) of DGNFs decreases upon adsorption of molecules. However, by increasing the size of DGNFs, the E g and chemical hardness of all complexes decrease and the electrophilicity index increases. Furthermore, the values of the chemical potential of acceptor-DGNF complexes decrease with increasing size, whereas those of donor-DGNF complexes increase. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Combined effects of metal complexation and size expansion in the electronic structure of DNA base pairs

NASA Astrophysics Data System (ADS)

Brancolini, Giorgia; Di Felice, Rosa

2011-05-01

Novel DNA derivatives have been recently investigated in the pursuit of modified DNA duplexes to tune the electronic structure of DNA-based assemblies for nanotechnology applications. Size-expanded DNAs (e.g., xDNA) and metalated DNAs (M-DNA) may enhance stacking interactions and induce metallic conductivity, respectively. Here we explore possible ways of tailoring the DNA electronic structure by combining the aromatic size expansion with the metal-doping. We select the salient structures from our recent study on natural DNA pairs complexed with transition metal ions and consider the equivalent model configurations for xDNA pairs. We present the results of density functional theory electronic structure calculations of the metalated expanded base-pairs with various localized basis sets and exchange-correlation functionals. Implicit solvent and coordination water molecules are also included. Our results indicate that the effect of base expansion is largest in Ag-xGC complexes, while Cu-xGC complexes are the most promising candidates for nanowires with enhanced electron transfer and also for on-purpose modification of the DNA double-helix for signal detection.

First measurements of electron temperature in the D region with a symmetric double probe

NASA Technical Reports Server (NTRS)

Szuszczewicz, E. P.

1973-01-01

Measurement of the altitude profile of electron temperature in the ionospheric D region with the aid of a symmetric double probe flown on a Nike-Cajun payload launched on Oct. 13, 1971. The procedure for determining the electron temperature from the parameters of the double probe's current-voltage characteristic under conditions of nonnegligible ion-atom collision frequencies is described. It is shown that in its first lower ionospheric application the technique of the symmetric double probe has yielded the lowest values of electron temperature yet measured and has provided the very first direct measurement of electron temperature in the D region.

An Inexpensive Co-Intercalated Layered Double Hydroxide Composite with Electron Donor-Acceptor Character for Photoelectrochemical Water Splitting

PubMed Central

Zheng, Shufang; Lu, Jun; Yan, Dongpeng; Qin, Yumei; Li, Hailong; Evans, David G.; Duan, Xue

2015-01-01

In this paper, the inexpensive 4,4-diaminostilbene-2,2-disulfonate (DAS) and 4,4-dinitro-stilbene-2,2- disulfonate (DNS) anions with arbitrary molar ratios were successfully co-intercalated into Zn2Al-layered double hydroxides (LDHs). The DAS(50%)-DNS/LDHs composite exhibited the broad UV-visible light absorption and fluorescence quenching, which was a direct indication of photo-induced electron transfer (PET) process between the intercalated DAS (donor) and DNS (acceptor) anions. This was confirmed by the matched HOMO/LUMO energy levels alignment of the intercalated DAS and DNS anions, which was also compatible for water splitting. The DAS(50%)-DNS/LDHs composite was fabricated as the photoanode and Pt as the cathode. Under the UV-visible light illumination, the enhanced photo-generated current (4.67 mA/cm2 at 0.8 V vs. SCE) was generated in the external circuit, and the photoelectrochemical water split was realized. Furthermore, this photoelectrochemical water splitting performance had excellent crystalline, electrochemical and optical stability. Therefore, this novel inorganic/organic hybrid photoanode exhibited potential application prospect in photoelectrochemical water splitting. PMID:26174201

Hollow Pd/MOF Nanosphere with Double Shells as Multifunctional Catalyst for Hydrogenation Reaction.

PubMed

Wan, Mingming; Zhang, Xinlu; Li, Meiyan; Chen, Bo; Yin, Jie; Jin, Haichao; Lin, Lin; Chen, Chao; Zhang, Ning

2017-10-01

A new type of hollow nanostructure featured double metal-organic frameworks shells with metal nanoparticles (MNPs) is designed and fabricated by the methods of ship in a bottle and bottle around the ship. The nanostructure material, hereinafter denoted as Void@HKUST-1/Pd@ZIF-8, is confirmed by the analyses of photograph, transmission electron microscopy, scanning electron microscopy, powder X-ray diffraction, inductively coupled plasma, and N 2 sorption. It possesses various multifunctionally structural characteristics such as hollow cavity which can improve mass transfer, the adjacent of the inner HKUST-1 shell to the void which enables the matrix of the shell to host and well disperse MNPs, and an outer ZIF-8 shell which acts as protective layer against the leaching of MNPs and a sieve to guarantee molecular-size selectivity. This makes the material eligible candidates for the heterogeneous catalyst. As a proof of concept, the liquid-phase hydrogenation of olefins with different molecular sizes as a model reaction is employed. It demonstrates the efficient catalytic activity and size-selectivity of Void@HKUST-1/Pd@ZIF-8. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Infrared laser driven double proton transfer. An optimal control theory study

NASA Astrophysics Data System (ADS)

Abdel-Latif, Mahmoud K.; Kühn, Oliver

2010-02-01

Laser control of ultrafast double proton transfer is investigated for a two-dimensional model system describing stepwise and concerted transfer pathways. The pulse design has been done by employing optimal control theory in combination with the multiconfiguration time-dependent Hartree wave packet propagation. The obtained laser fields correspond to multiple pump-dump pulse sequences. Special emphasis is paid to the relative importance of stepwise and concerted transfer pathways for the driven wave packet and its dependence on the parameters of the model Hamiltonian as well as on the propagation time. While stepwise transfer is dominating in all cases considered, for high barrier systems concerted transfer proceeding via tunneling can make a contribution.

Ultrafast time-resolved carotenoid to-bacteriochlorophyll energy transfer in LH2 complexes from photosynthetic bacteria.

PubMed

Cong, Hong; Niedzwiedzki, Dariusz M; Gibson, George N; LaFountain, Amy M; Kelsh, Rhiannon M; Gardiner, Alastair T; Cogdell, Richard J; Frank, Harry A

2008-08-28

Steady-state and ultrafast time-resolved optical spectroscopic investigations have been carried out at 293 and 10 K on LH2 pigment-protein complexes isolated from three different strains of photosynthetic bacteria: Rhodobacter (Rb.) sphaeroides G1C, Rb. sphaeroides 2.4.1 (anaerobically and aerobically grown), and Rps. acidophila 10050. The LH2 complexes obtained from these strains contain the carotenoids, neurosporene, spheroidene, spheroidenone, and rhodopin glucoside, respectively. These molecules have a systematically increasing number of pi-electron conjugated carbon-carbon double bonds. Steady-state absorption and fluorescence excitation experiments have revealed that the total efficiency of energy transfer from the carotenoids to bacteriochlorophyll is independent of temperature and nearly constant at approximately 90% for the LH2 complexes containing neurosporene, spheroidene, spheroidenone, but drops to approximately 53% for the complex containing rhodopin glucoside. Ultrafast transient absorption spectra in the near-infrared (NIR) region of the purified carotenoids in solution have revealed the energies of the S1 (2(1)Ag-)-->S2 (1(1)Bu+) excited-state transitions which, when subtracted from the energies of the S0 (1(1)Ag-)-->S2 (1(1)Bu+) transitions determined by steady-state absorption measurements, give precise values for the positions of the S1 (2(1)Ag-) states of the carotenoids. Global fitting of the ultrafast spectral and temporal data sets have revealed the dynamics of the pathways of de-excitation of the carotenoid excited states. The pathways include energy transfer to bacteriochlorophyll, population of the so-called S* state of the carotenoids, and formation of carotenoid radical cations (Car*+). The investigation has found that excitation energy transfer to bacteriochlorophyll is partitioned through the S1 (1(1)Ag-), S2 (1(1)Bu+), and S* states of the different carotenoids to varying degrees. This is understood through a consideration of the energies of the states and the spectral profiles of the molecules. A significant finding is that, due to the low S1 (2(1)Ag-) energy of rhodopin glucoside, energy transfer from this state to the bacteriochlorophylls is significantly less probable compared to the other complexes. This work resolves a long-standing question regarding the cause of the precipitous drop in energy transfer efficiency when the extent of pi-electron conjugation of the carotenoid is extended from ten to eleven conjugated carbon-carbon double bonds in LH2 complexes from purple photosynthetic bacteria.

Two-dimensional Electronic Double-Quantum Coherence Spectroscopy

PubMed Central

Kim, Jeongho; Mukamel, Shaul

2009-01-01

CONSPECTUS The theory of electronic structure of many-electron systems like molecules is extraordinarily complicated. A lot can be learned by considering how electron density is distributed, on average, in the average field of the other electrons in the system. That is, mean field theory. However, to describe quantitatively chemical bonds, reactions, and spectroscopy requires consideration of the way that electrons avoid each other by the way they move; this is called electron correlation (or in physics, the many-body problem for fermions). While great progress has been made in theory, there is a need for incisive experimental tests that can be undertaken for large molecular systems in the condensed phase. Here we report a two-dimensional (2D) optical coherent spectroscopy that correlates the double excited electronic states to constituent single excited states. The technique, termed two-dimensional double-coherence spectroscopy (2D-DQCS), makes use of multiple, time-ordered ultrashort coherent optical pulses to create double- and single-quantum coherences over time intervals between the pulses. The resulting two-dimensional electronic spectrum maps the energy correlation between the first excited state and two-photon allowed double-quantum states. The principle of the experiment is that when the energy of the double-quantum state, viewed in simple models as a double HOMO to LUMO excitation, equals twice that of a single excitation, then no signal is radiated. However, electron-electron interactions—a combination of exchange interactions and electron correlation—in real systems generates a signal that reveals precisely how the energy of the double-quantum resonance differs from twice the single-quantum resonance. The energy shift measured in this experiment reveals how the second excitation is perturbed by both the presence of the first excitation and the way that the other electrons in the system have responded to the presence of that first excitation. We compare a series of organic dye molecules and find that the energy offset for adding a second electronic excitation to the system relative to the first excitation is on the order of tens of milli-electronvolts, and it depends quite sensitively on molecular geometry. These results demonstrate the effectiveness of 2D-DQCS for elucidating quantitative information about electron-electron interactions, many-electron wavefunctions, and electron correlation in electronic excited states and excitons. PMID:19552412

Improved bio-hydrogen production from glucose by adding a specific methane inhibitor to microbial electrolysis cells with a double anode arrangement.

PubMed

Zhang, Jingnan; Bai, Yanxia; Fan, Yaoting; Hou, Hongwei

2016-10-01

Improved hydrogen production from glucose was achieved by adding a specific methane inhibitor (such as chloroform) to repress the activity of methanogens in a single-chamber microbial electrolysis cells (MECs) with a double anode arrangement. A maximum hydrogen production of 8.4±0.2 mol H2/mol-G (G represents glucose), a hydrogen production rate of 2.39±0.3 m(3) H2/m3/d and a high energy efficiency (relative to the electrical input) of ηE=165±5% had been recorded from 1 g/L glucose at a low dosage of chloroform (5‰, v:v) and an applied voltage of 0.8 V. Almost all of the glucose was removed within 4 h, with 66% of the electrons in intermediates (mainly including acetate and ethanol), and methane gas was not detected in the MECs through 11 batch cycles. The experimental results confirmed that chloroform was an effective methane inhibitor that improved hydrogen production from glucose in the MECs. In addition, the cyclic voltammetry tests demonstrated that the electron transfer in the MECs was mainly due to the biofilm-bound redox compounds rather than soluble electron shuttles. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Effects of redox-active interlayer anions on the oxygen evolution reactivity of NiFe-layered double hydroxide nanosheets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Daojin; Cai, Zhao; Bi, Yongmin

Nickel-iron layered double hydroxide (NiFe-LDH) nanosheets have shown optimal oxygen evolution reaction (OER) performance; however, the role of the intercalated ions in the OER activity remains unclear. In this work, we show that the activity of the NiFe-LDHs can be tailored by the intercalated anions with different redox potentials. The intercalation of anions with low redox potential (high reducing ability), such as hypophosphites, leads to NiFe-LDHs with low OER overpotential of 240 mV and a small Tafel slope of 36.9 mV/dec, whereas NiFe-LDHs intercalated with anions of high redox potential (low reducing ability), such as fluorion, show a high overpotentialmore » of 370 mV and a Tafel slope of 80.8 mV/dec. The OER activity shows a surprising linear correlation with the standard redox potential. Density functional theory calculations and X-ray photoelectron spectroscopy analysis indicate that the intercalated anions alter the electronic structure of metal atoms which exposed at the surface. Anions with low standard redox potential and strong reducing ability transfer more electrons to the hydroxide layers. Finally, this increases the electron density of the surface metal sites and stabilizes their high-valence states, whose formation is known as the critical step prior to the OER process.« less

Effects of redox-active interlayer anions on the oxygen evolution reactivity of NiFe-layered double hydroxide nanosheets

DOE PAGES

Zhou, Daojin; Cai, Zhao; Bi, Yongmin; ...

2018-02-02

Nickel-iron layered double hydroxide (NiFe-LDH) nanosheets have shown optimal oxygen evolution reaction (OER) performance; however, the role of the intercalated ions in the OER activity remains unclear. In this work, we show that the activity of the NiFe-LDHs can be tailored by the intercalated anions with different redox potentials. The intercalation of anions with low redox potential (high reducing ability), such as hypophosphites, leads to NiFe-LDHs with low OER overpotential of 240 mV and a small Tafel slope of 36.9 mV/dec, whereas NiFe-LDHs intercalated with anions of high redox potential (low reducing ability), such as fluorion, show a high overpotentialmore » of 370 mV and a Tafel slope of 80.8 mV/dec. The OER activity shows a surprising linear correlation with the standard redox potential. Density functional theory calculations and X-ray photoelectron spectroscopy analysis indicate that the intercalated anions alter the electronic structure of metal atoms which exposed at the surface. Anions with low standard redox potential and strong reducing ability transfer more electrons to the hydroxide layers. Finally, this increases the electron density of the surface metal sites and stabilizes their high-valence states, whose formation is known as the critical step prior to the OER process.« less

The improved electrochemical performance of cross-linked 3D graphene nanoribbon monolith electrodes

NASA Astrophysics Data System (ADS)

Vineesh, Thazhe Veettil; Alwarappan, Subbiah; Narayanan, Tharangattu N.

2015-04-01

Technical advancement in the field of ultra-small sensors and devices demands the development of novel micro- or nano-based architectures. Here we report the design and assembly of cross-linked three dimensional graphene nanoribbons (3D GNRs) using solution based covalent binding of individual 2D GNRs and demonstrate its electrochemical application as a 3D electrode. The enhanced performance of 3D GNRs over individual 2D GNRs is established using standard redox probes - [Ru(NH3)6]3+/2+, [Fe(CN)6]3-/4- and important bio-analytes - dopamine and ascorbic acid. 3D GNRs are found to have high double layer capacitance (2482 μF cm-2) and faster electron transfer kinetics; their exceptional electrocatalytic activity towards the oxygen reduction reaction is indicative of their potential over a wide range of electrochemical applications. Moreover, this study opens a new platform for the design of novel point-of-care devices and electrodes for energy devices.Technical advancement in the field of ultra-small sensors and devices demands the development of novel micro- or nano-based architectures. Here we report the design and assembly of cross-linked three dimensional graphene nanoribbons (3D GNRs) using solution based covalent binding of individual 2D GNRs and demonstrate its electrochemical application as a 3D electrode. The enhanced performance of 3D GNRs over individual 2D GNRs is established using standard redox probes - [Ru(NH3)6]3+/2+, [Fe(CN)6]3-/4- and important bio-analytes - dopamine and ascorbic acid. 3D GNRs are found to have high double layer capacitance (2482 μF cm-2) and faster electron transfer kinetics; their exceptional electrocatalytic activity towards the oxygen reduction reaction is indicative of their potential over a wide range of electrochemical applications. Moreover, this study opens a new platform for the design of novel point-of-care devices and electrodes for energy devices. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr07315k

Hydrogen Bond Network between Amino Acid Radical Intermediates on the Proton-Coupled Electron Transfer Pathway of E. coli α2 Ribonucleotide Reductase

PubMed Central

2015-01-01

Ribonucleotide reductases (RNRs) catalyze the conversion of ribonucleotides to deoxyribonucleotides in all organisms. In all Class Ia RNRs, initiation of nucleotide diphosphate (NDP) reduction requires a reversible oxidation over 35 Å by a tyrosyl radical (Y122•, Escherichia coli) in subunit β of a cysteine (C439) in the active site of subunit α. This radical transfer (RT) occurs by a specific pathway involving redox active tyrosines (Y122 ⇆ Y356 in β to Y731 ⇆ Y730 ⇆ C439 in α); each oxidation necessitates loss of a proton coupled to loss of an electron (PCET). To study these steps, 3-aminotyrosine was site-specifically incorporated in place of Y356-β, Y731- and Y730-α, and each protein was incubated with the appropriate second subunit β(α), CDP and effector ATP to trap an amino tyrosyl radical (NH2Y•) in the active α2β2 complex. High-frequency (263 GHz) pulse electron paramagnetic resonance (EPR) of the NH2Y•s reported the gx values with unprecedented resolution and revealed strong electrostatic effects caused by the protein environment. 2H electron–nuclear double resonance (ENDOR) spectroscopy accompanied by quantum chemical calculations provided spectroscopic evidence for hydrogen bond interactions at the radical sites, i.e., two exchangeable H bonds to NH2Y730•, one to NH2Y731• and none to NH2Y356•. Similar experiments with double mutants α-NH2Y730/C439A and α-NH2Y731/Y730F allowed assignment of the H bonding partner(s) to a pathway residue(s) providing direct evidence for colinear PCET within α. The implications of these observations for the PCET process within α and at the interface are discussed. PMID:25516424

Double Electron Processes in Collisions of Partially Stripped Ions Cq+(q = 1-4) with Helium

NASA Astrophysics Data System (ADS)

Ding, Bao-Wei; Chen, Xi-Meng; Yu, De-Yang; Fu, Hong-Bin; Liu, Zhao-Yuan; Sun, Guang-Zhi; Liu, Yu-Wen; Lu, Yan-Xia; Xie, Jiang-Shan; Du, Juan; Gao, Zhi-Min; Chen, Lin; Cui, Ying; Shao, Jian-Xiong; He, Zi-Feng; Cai, Xiao-Hong

2007-01-01

The multi-electron processes are investigated for 17.9-120 keV/u C1+, 30-323 keV/u C2+, 120-438 keV/u C3+, 287-480 keV/u C4+ incident on a helium target. The cross-section ratios of double electron (DE) process to the total of the single electron (SE) and the double electron process (i.e. SE+DE), the direct double electron (DDI) to the direct single ionization (DSI) as well as the contributions of DDI to DE and of TI to DE are measured using coincidence techniques. The energy and charge state dependences of the measured cross-section ratios are studied and discussed.

Enhanced Oxidative and Adsorptive Removal of Diclofenac in Heterogeneous Fenton-like Reaction with Sulfide Modified Nanoscale Zerovalent Iron.

PubMed

Su, Yiming; Jassby, David; Song, Shikun; Zhou, Xuefei; Zhao, Hongying; Filip, Jan; Petala, Eleni; Zhang, Yalei

2018-06-05

Sulfidation of nanoscale zerovalent iron (nZVI) has shown some fundamental improvements on reactivity and selectivity toward pollutants in dissolved-oxygen (DO)-stimulated Fenton-like reaction systems (DO/S-nZVI system). However, the pristine microstructure of sulfide-modified nanoscale zerovalent iron (S-nZVI) remains uncovered. In addition, the relationship between pollutant removal and the oxidation of the S-nZVI is largely unknown. The present study confirms that sulfidation not only imparts sulfide and sulfate groups onto the surface of the nanoparticle (both on the oxide shell and on flake-like structures) but also introduces sulfur into the Fe(0) core region. Sulfidation greatly inhibits the four-electron transfer pathway between Fe(0) and oxygen but facilitates the electron transfer from Fe(0) to surface-bound Fe(III) and consecutive single-electron transfer for the generation of H 2 O 2 and hydroxyl radical. In the DO/S-nZVI system, slight sulfidation (S/Fe molar ratio = 0.1) is able to nearly double the oxidative removal efficacy of diclofenac (DCF) (from 17.8 to 34.2%), whereas moderate degree of sulfidation (S/Fe molar ratio = 0.3) significantly enhances both oxidation and adsorption of DCF. Furthermore, on the basis of the oxidation model of S-nZVI, the DCF removal process can be divided into two steps, which are well modeled by parabolic and logarithmic law separately. This study bridges the knowledge gap between pollutant removal and the oxidation process of chemically modified iron-based nanomaterials.

Numerical modeling of heat transfer during hydrogen absorption in thin double-layered annular ZrCo beds

NASA Astrophysics Data System (ADS)

Cui, Yehui; Zeng, Xiangguo; Kou, Huaqin; Ding, Jun; Wang, Fang

2018-06-01

In this work a three-dimensional (3D) hydrogen absorption model was proposed to study the heat transfer behavior in thin double-layered annular ZrCo beds. Numerical simulations were performed to investigate the effects of conversion layer thickness, thermal conductivity, cooling medium and its flow velocity on the efficiency of heat transfer. Results reveal that decreasing the layer thickness and improving the thermal conductivity enhance the ability of heat transfer. Compared with nitrogen and helium, water appears to be a better medium for cooling. In order to achieve the best efficiency of heat transfer, the flow velocity needs to be maximized.

Electron temperature differences and double layers

NASA Technical Reports Server (NTRS)

Chan, C.; Hershkowitz, N.; Lonngren, K. E.

1983-01-01

Electron temperature differences across plasma double layers are studied experimentally. It is shown that the temperature differences across a double layer can be varied and are not a result of thermalization of the bump-on-tail distribution. The implications of these results for electron thermal energy transport in laser-pellet and tandem-mirror experiments are also discussed.

Vibronic Wavepackets and Energy Transfer in Cryptophyte Light-Harvesting Complexes.

PubMed

Jumper, Chanelle C; van Stokkum, Ivo H M; Mirkovic, Tihana; Scholes, Gregory D

2018-06-21

Determining the key features of high-efficiency photosynthetic energy transfer remains an ongoing task. Recently, there has been evidence for the role of vibronic coherence in linking donor and acceptor states to redistribute oscillator strength for enhanced energy transfer. To gain further insights into the interplay between vibronic wavepackets and energy-transfer dynamics, we systematically compare four structurally related phycobiliproteins from cryptophyte algae by broad-band pump-probe spectroscopy and extend a parametric model based on global analysis to include vibrational wavepacket characterization. The four phycobiliproteins isolated from cryptophyte algae are two "open" structures and two "closed" structures. The closed structures exhibit strong exciton coupling in the central dimer. The dominant energy-transfer pathway occurs on the subpicosecond timescale across the largest energy gap in each of the proteins, from central to peripheral chromophores. All proteins exhibit a strong 1585 cm -1 coherent oscillation whose relative amplitude, a measure of vibronic intensity borrowing from resonance between donor and acceptor states, scales with both energy-transfer rates and damping rates. Central exciton splitting may aid in bringing the vibronically linked donor and acceptor states into better resonance resulting in the observed doubled rate in the closed structures. Several excited-state vibrational wavepackets persist on timescales relevant to energy transfer, highlighting the importance of further investigation of the interplay between electronic coupling and nuclear degrees of freedom in studies on high-efficiency photosynthesis.

Detecting RNA/DNA hybridization using double-labeled donor probes with enhanced fluorescence resonance energy transfer signals.

PubMed

Okamura, Yukio; Watanabe, Yuichiro

2006-01-01

Fluorescence resonance energy transfer (FRET) occurs when two fluorophores are in close proximity, and the emission energy of a donor fluorophore is transferred to excite an acceptor fluorophore. Using such fluorescently labeled oligonucleotides as FRET probes, makes possible specific detection of RNA molecules even if similar sequences are present in the environment. A higher ratio of signal to background fluorescence is required for more sensitive probe detection. We found that double-labeled donor probes labeled with BODIPY dye resulted in a remarkable increase in fluorescence intensity compared to single-labeled donor probes used in conventional FRET. Application of this double-labeled donor system can improve a variety of FRET techniques.

Efficient and portable acceleration of quantum chemical many-body methods in mixed floating point precision using OpenACC compiler directives

NASA Astrophysics Data System (ADS)

Eriksen, Janus J.

2017-09-01

It is demonstrated how the non-proprietary OpenACC standard of compiler directives may be used to compactly and efficiently accelerate the rate-determining steps of two of the most routinely applied many-body methods of electronic structure theory, namely the second-order Møller-Plesset (MP2) model in its resolution-of-the-identity approximated form and the (T) triples correction to the coupled cluster singles and doubles model (CCSD(T)). By means of compute directives as well as the use of optimised device math libraries, the operations involved in the energy kernels have been ported to graphics processing unit (GPU) accelerators, and the associated data transfers correspondingly optimised to such a degree that the final implementations (using either double and/or single precision arithmetics) are capable of scaling to as large systems as allowed for by the capacity of the host central processing unit (CPU) main memory. The performance of the hybrid CPU/GPU implementations is assessed through calculations on test systems of alanine amino acid chains using one-electron basis sets of increasing size (ranging from double- to pentuple-ζ quality). For all but the smallest problem sizes of the present study, the optimised accelerated codes (using a single multi-core CPU host node in conjunction with six GPUs) are found to be capable of reducing the total time-to-solution by at least an order of magnitude over optimised, OpenMP-threaded CPU-only reference implementations.

Curie temperature behavior in half-metallic ferromagnetic double perovskites within the electronic correlation picture

NASA Astrophysics Data System (ADS)

Estrada, F.; Guzmán, E. J.; Navarro, O.; Avignon, M.

2018-05-01

The half-metallic ferromagnetic compound Sr2FeMoO6 is considered a fundamental material to understand the role of electronic parameters controlling the half-metallic ground state and high Curie temperature in double perovskite. We present an electronic approach using the Green's function technique and the renormalization perturbation expansion method to study the thermodynamical properties of double perovskites. The model is based on a correlated electron picture with localized Fe spins and conduction electrons interacting with the local spins via a double-exchange-type mechanism. Electron correlations within the conduction band are also included in order to study the Curie temperature TC. Our results show an increases of TC by increasing the carrier density in La-doped Sr2FeMoO6 compounds in contrast to the case of uncorrelated itinerant electrons.

Effect of methyl substituents on the electronic transitions in simple meso-aniline-BODIPY based dyes: RI-CC2 and TD-CAM-B3LYP computational investigation

NASA Astrophysics Data System (ADS)

Petrushenko, Igor K.; Petrushenko, Konstantin B.

2018-02-01

The S0 → Si, i = 1-5 electronic transitions of four 8-(4-aniline)-BODIPY and four 8-(N,N-dimethyl)-BODIPY dyes, differ by number and position of methyl substituents in the BODIPY frame, were investigated theoretically using ab initio the coupled cluster doubles (CC2) and TD-CAM-B3LYP methods. Methyl substituents in the BODIPY frame and the aniline fragment at the meso position disturb energy of local excitations S0 → S1, S0 → S3, and S0 → S4 weakly in comparison with the fully unsubstituted BODIPY molecule. These transitions in experimental spectra form the most long-wave absorption bands at ca. 500 nm as well as absorption bands in the region of 300-400 nm. At the same time, the presence of aniline fragments leads to the appearance of new S0 → S2 transitions of the charge transfer character in electronic spectra of BODIPYs. We also found a linear relationship between vertical energy of these charge transfer transitions and the electron donating power of an aniline fragment and electron accepting power of the BODIPY core depending on the number and position of methyl groups. The CC2 method provides the best overall description of the excitation energies in line with the experimental observations. On average, the quality of TD-CAM-B3LYP is almost equal to that of CC2, however the TD method with the CAM-B3LYP functional slightly underestimates the CT excitation energy.

Ligand-induced dependence of charge transfer in nanotube–quantum dot heterostructures

DOE PAGES

Wang, Lei; Han, Jinkyu; Sundahl, Bryan; ...

2016-07-01

As a model system to probe ligand-dependent charge transfer in complex composite heterostructures, we fabricated double-walled carbon nanotube (DWNT) – CdSe quantum dot (QD) composites. Whereas the average diameter of the QDs probed was kept fixed at ~4.1 nm and the nanotubes analyzed were similarly oxidatively processed, by contrast, the ligands used to mediate the covalent attachment between the QDs and DWNTs were systematically varied to include p-phenylenediamine (PPD), 2-aminoethanethiol (AET), and 4-aminothiophenol (ATP). Herein, we have put forth a unique compilation of complementary data from experiment and theory, including results from transmission electron microscopy (TEM), near-edge X-ray absorption finemore » structure (NEXAFS) spectroscopy, Raman spectroscopy, electrical transport measurements, and theoretical modeling studies, in order to fundamentally assess the nature of the charge transfer between CdSe QDs and DWNTs, as a function of the structure of various, intervening bridging ligand molecules. Specifically, we correlated evidence of charge transfer as manifested by changes and shifts associated with NEXAFS intensities, Raman peak positions, and threshold voltages both before and after CdSe QD deposition onto the underlying DWNT surface. Importantly, for the first time ever in these types of nanoscale composite systems, we have sought to use theoretical modeling to justify and account for our experimental results. Finally, our overall data suggest that (i) QD coverage density on the DWNTs varies, based upon the different ligand pendant groups used and that (ii) the presence of a π-conjugated carbon framework within the ligands themselves and the electron affinity of the pendant groups collectively play important roles in the resulting charge transfer from QDs to the underlying CNTs.« less

Correlation between energy deposition and molecular damage from Auger electrons: A case study of ultra-low energy (5–18 eV) electron interactions with DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rezaee, Mohammad, E-mail: Mohammad.Rezaee@USherbrooke.ca; Hunting, Darel J.; Sanche, Léon

2014-07-15

Purpose: The present study introduces a new method to establish a direct correlation between biologically related physical parameters (i.e., stopping and damaging cross sections, respectively) for an Auger-electron emitting radionuclide decaying within a target molecule (e.g., DNA), so as to evaluate the efficacy of the radionuclide at the molecular level. These parameters can be applied to the dosimetry of Auger electrons and the quantification of their biological effects, which are the main criteria to assess the therapeutic efficacy of Auger-electron emitting radionuclides. Methods: Absorbed dose and stopping cross section for the Auger electrons of 5–18 eV emitted by{sup 125}I withinmore » DNA were determined by developing a nanodosimetric model. The molecular damages induced by these Auger electrons were investigated by measuring damaging cross section, including that for the formation of DNA single- and double-strand breaks. Nanoscale films of pure plasmid DNA were prepared via the freeze-drying technique and subsequently irradiated with low-energy electrons at various fluences. The damaging cross sections were determined by employing a molecular survival model to the measured exposure–response curves for induction of DNA strand breaks. Results: For a single decay of{sup 125}I within DNA, the Auger electrons of 5–18 eV deposit the energies of 12.1 and 9.1 eV within a 4.2-nm{sup 3} volume of a hydrated or dry DNA, which results in the absorbed doses of 270 and 210 kGy, respectively. DNA bases have a major contribution to the deposited energies. Ten-electronvolt and high linear energy transfer 100-eV electrons have a similar cross section for the formation of DNA double-strand break, while 100-eV electrons are twice as efficient as 10 eV in the induction of single-strand break. Conclusions: Ultra-low-energy electrons (<18 eV) substantially contribute to the absorbed dose and to the molecular damage from Auger-electron emitting radionuclides; hence, they should be considered in the dosimetry calculation of such radionuclides. Moreover, absorbed dose is not an appropriate physical parameter for nanodosimetry. Instead, stopping cross section, which describes the probability of energy deposition in a target molecule can be an appropriate nanodosimetric parameter. The stopping cross section is correlated with a damaging cross section (e.g., cross section for the double-strand break formation) to quantify the number of each specific lesion in a target molecule for each nuclear decay of a single Auger-electron emitting radionuclide.« less

Correlation between energy deposition and molecular damage from Auger electrons: A case study of ultra-low energy (5–18 eV) electron interactions with DNA

PubMed Central

Rezaee, Mohammad; Hunting, Darel J.; Sanche, Léon

2015-01-01

Purpose The present study introduces a new method to establish a direct correlation between biologically related physical parameters (i.e., stopping and damaging cross sections, respectively) for an Auger-electron emitting radionuclide decaying within a target molecule (e.g., DNA), so as to evaluate the efficacy of the radionuclide at the molecular level. These parameters can be applied to the dosimetry of Auger electrons and the quantification of their biological effects, which are the main criteria to assess the therapeutic efficacy of Auger-electron emitting radionuclides. Methods Absorbed dose and stopping cross section for the Auger electrons of 5–18 eV emitted by 125I within DNA were determined by developing a nanodosimetric model. The molecular damages induced by these Auger electrons were investigated by measuring damaging cross section, including that for the formation of DNA single- and double-strand breaks. Nanoscale films of pure plasmid DNA were prepared via the freeze-drying technique and subsequently irradiated with low-energy electrons at various fluences. The damaging cross sections were determined by employing a molecular survival model to the measured exposure–response curves for induction of DNA strand breaks. Results For a single decay of 125I within DNA, the Auger electrons of 5–18 eV deposit the energies of 12.1 and 9.1 eV within a 4.2-nm3 volume of a hydrated or dry DNA, which results in the absorbed doses of 270 and 210 kGy, respectively. DNA bases have a major contribution to the deposited energies. Ten-electronvolt and high linear energy transfer 100-eV electrons have a similar cross section for the formation of DNA double-strand break, while 100-eV electrons are twice as efficient as 10 eV in the induction of single-strand break. Conclusions Ultra-low-energy electrons (<18 eV) substantially contribute to the absorbed dose and to the molecular damage from Auger-electron emitting radionuclides; hence, they should be considered in the dosimetry calculation of such radionuclides. Moreover, absorbed dose is not an appropriate physical parameter for nanodosimetry. Instead, stopping cross section, which describes the probability of energy deposition in a target molecule can be an appropriate nanodosimetric parameter. The stopping cross section is correlated with a damaging cross section (e.g., cross section for the double-strand break formation) to quantify the number of each specific lesion in a target molecule for each nuclear decay of a single Auger-electron emitting radionuclide. PMID:24989405

Demonstration of β-(AlxGa1-x)2O3/Ga2O3 double heterostructure field effect transistors

NASA Astrophysics Data System (ADS)

Zhang, Yuewei; Joishi, Chandan; Xia, Zhanbo; Brenner, Mark; Lodha, Saurabh; Rajan, Siddharth

2018-06-01

In this work, we demonstrate modulation-doped β-(AlxGa1-x)2O3/Ga2O3 double heterostructure field effect transistors. The maximum sheet carrier density for a two-dimensional electron gas (2DEG) in a β-(AlxGa1-x)2O3/Ga2O3 heterostructure is limited by the conduction band offset and parasitic channel formation in the barrier layer. We demonstrate a double heterostructure to realize a β-(AlxGa1-x)2O3/Ga2O3/(AlxGa1-x)2O3 quantum well, where electrons can be transferred from below and above the β-Ga2O3 quantum well. The confined 2DEG charge density of 3.85 × 1012 cm-2 was estimated from the low-temperature Hall measurement, which is higher than that achievable in a single heterostructure. Hall mobilities of 1775 cm2/V.s at 40 K and 123 cm2/V.s at room temperature were measured. Modulation-doped double heterostructure field effect transistors showed a maximum drain current of IDS = 257 mA/mm, a peak transconductance (gm) of 39 mS/mm, and a pinch-off voltage of -7.0 V at room temperature. The three-terminal off-state breakdown measurement on the device with a gate-drain spacing (LGD) of 1.55 μm showed a breakdown voltage of 428 V, corresponding to an average breakdown field of 2.8 MV/cm. The breakdown measurement on the device with a scaled gate-drain spacing of 196 nm indicated an average breakdown field of 3.2 MV/cm. The demonstrated modulation-doped β-(AlxGa1-x)2O3/Ga2O3 double heterostructure field effect transistor could act as a promising candidate for high power and high frequency device applications.

Concise synthesis of the bryostatin A-ring via consecutive C-C bond forming transfer hydrogenations.

PubMed

Lu, Yu; Krische, Michael J

2009-07-16

Under the conditions of C-C bond forming transfer hydrogenation, 1,3-propanediol 1 engages in double asymmetric carbonyl allylation to furnish the C(2)-symmetric diol 2. Double ozonolysis of 2 followed by TBS protection delivers aldehyde 3, which is subject to catalyst directed carbonyl reverse prenylation via transfer hydrogenation to deliver neopentyl alcohol 4 and, ultimately, the bryostatin A-ring 7. Through use of two consecutive C-C bond forming transfer hydrogenations, the Evans' bryostatin A-ring 7 is prepared in less than half the manipulations previously reported.

pH-Dependent Regulation of the Relaxation Rate of the Radical Anion of the Secondary Quinone Electron Acceptor QB in Photosystem II As Revealed by Fourier Transform Infrared Spectroscopy.

PubMed

Nozawa, Yosuke; Noguchi, Takumi

2018-05-15

Photosystem II (PSII) is a protein complex that performs water oxidation using light energy during photosynthesis. In PSII, electrons abstracted from water are eventually transferred to the secondary quinone electron acceptor, Q B , and upon double reduction, Q B is converted to quinol by binding two protons. Thus, excess electron transfer in PSII increases the pH of the stroma. In this study, to investigate the pH-dependent regulation of the electron flow in PSII, we have estimated the relaxation rate of the Q B - radical anion in the pH region between 5 and 8 by direct monitoring of its population using light-induced Fourier transform infrared difference spectroscopy. The decay of Q B - by charge recombination with the S 2 state of the water oxidation center in PSII membranes was shown to be accelerated at higher pH, whereas that of Q A - examined in the presence of a herbicide was virtually unaffected at pH ≤7.5 and slightly slowed at pH 8. These observations were consistent with the previous studies that included rather indirect monitoring of the Q B - and Q A - decays using fluorescence detection. The accelerated relaxation of Q B - was explained by the shift of a redox equilibrium between Q A - and Q B - to the Q A - side due to the decrease in the redox potential of Q B at higher pH, which is induced by deprotonation of a single amino acid residue near Q B . It is proposed that this pH-dependent Q B - relaxation is one of the mechanisms of electron flow regulation in PSII for its photoprotection.

Coulomb-repulsion-assisted double ionization from doubly excited states of argon

NASA Astrophysics Data System (ADS)

Liao, Qing; Winney, Alexander H.; Lee, Suk Kyoung; Lin, Yun Fei; Adhikari, Pradip; Li, Wen

2017-08-01

We report a combined experimental and theoretical study to elucidate nonsequential double-ionization dynamics of argon atoms at laser intensities near and below the recollision-induced ionization threshold. Three-dimensional momentum measurements of two electrons arising from strong-field nonsequential double ionization are achieved with a custom-built electron-electron-ion coincidence apparatus, showing laser intensity-dependent Coulomb repulsion effect between the two outgoing electrons. Furthermore, a previously predicted feature of double ionization from doubly excited states is confirmed in the distributions of sum of two-electron momenta. A classical ensemble simulation suggests that Coulomb-repulsion-assisted double ionization from doubly excited states is at play at low laser intensity. This mechanism can explain the dependence of Coulomb repulsion effect on the laser intensity, as well as the transition from side-by-side to back-to-back dominant emission along the laser polarization direction.

Search for neutrinoless double-electron capture of 156Dy

NASA Astrophysics Data System (ADS)

Finch, S. W.; Tornow, W.

2015-12-01

Background: Multiple large collaborations are currently searching for neutrinoless double-β decay, with the ultimate goal of differentiating the Majorana-Dirac nature of the neutrino. Purpose: Investigate the feasibility of resonant neutrinoless double-electron capture, an experimental alternative to neutrinoless double-β decay. Method: Two clover germanium detectors were operated underground in coincidence to search for the de-excitation γ rays of 156Gd following the neutrinoless double-electron capture of 156Dy. 231.95 d of data were collected at the Kimballton underground research facility with a 231.57 mg enriched 156Dy sample. Results: No counts were seen above background and half-life limits are set at O (1016-1018) yr for the various decay modes of 156Dy. Conclusion: Low background spectra were efficiently collected in the search for neutrinoless double-electron capture of 156Dy, although the low natural abundance and associated lack of large quantities of enriched samples hinders the experimental reach.

Molecular Engineering for Enhanced Charge Transfer in Thin-Film Photoanode.

PubMed

Kim, Jeong Soo; Kim, Byung-Man; Kim, Un-Young; Shin, HyeonOh; Nam, Jung Seung; Roh, Deok-Ho; Park, Jun-Hyeok; Kwon, Tae-Hyuk

2017-10-11

We developed three types of dithieno[3,2-b;2',3'-d]thiophene (DTT)-based organic sensitizers for high-performance thin photoactive TiO 2 films and investigated the simple but powerful molecular engineering of different types of bonding between the triarylamine electron donor and the conjugated DTT π-bridge by the introduction of single, double, and triple bonds. As a result, with only 1.3 μm transparent and 2.5-μm TiO 2 scattering layers, the triple-bond sensitizer (T-DAHTDTT) shows the highest power conversion efficiency (η = 8.4%; V OC = 0.73 V, J SC = 15.4 mA·cm -2 , and FF = 0.75) in an iodine electrolyte system under one solar illumination (AM 1.5, 1000 W·m -2 ), followed by the single-bond sensitizer (S-DAHTDTT) (η = 7.6%) and the double-bond sensitizer (D-DAHTDTT) (η = 6.4%). We suggest that the superior performance of T-DAHTDTT comes from enhanced intramolecular charge transfer (ICT) induced by the triple bond. Consequently, T-DAHTDTT exhibits the most active photoelectron injection and charge transport on a TiO 2 film during operation, which leads to the highest photocurrent density among the systems studied. We analyzed these correlations mainly in terms of charge injection efficiency, level of photocharge storage, and charge-transport kinetics. This study suggests that the molecular engineering of a triple bond between the electron donor and the π-bridge of a sensitizer increases the performance of dye-sensitized solar cell (DSC) with a thin photoactive film by enhancing not only J SC through improved ICT but also V OC through the evenly distributed sensitizer surface coverage.

Electrostatic interaction between an enzyme and electrodes in the electric double layer examined in a view of direct electron transfer-type bioelectrocatalysis.

PubMed

Sugimoto, Yu; Kitazumi, Yuki; Tsujimura, Seiya; Shirai, Osamu; Yamamoto, Masahiro; Kano, Kenji

2015-01-15

Effects of the electrode poential on the activity of an adsorbed enzyme has been examined by using copper efflux oxidase (CueO) as a model enzyme and by monitoring direct electron transfer (DET)-type bioelectrocatalysis of oxygen reduction. CueO adsorbed on bare Au electrodes at around the point of zero charge (E(pzc)) shows the highest DET activity, and the activity decreases as the adsorption potential (E(ad); at which the enzyme adsorbs) is far from E(pzc). We propose a model to explain the phenomena in which the electrostatic interaction between the enzyme and electrodes in the electric double layer affects the orientation and the stability of the adsorbed enzyme. The self-assembled monolayer of butanethiol on Au electrodes decreases the electric field in the outside of the inner Helmholtz plane and drastically diminishes the E(ad) dependence of the DET activity of CueO. When CueO is adsorbed on bare Au electrodes under open circuit potential and then is held at hold potentials (E(ho)) more positive than E(pzc), the DET activity of the CueO rapidly decreases with the hold time. The strong electric field with positive surface charge density on the metallic electrode (σ(M)) leads to fatal denaturation of the adsorbed CueO. Such denaturation effect is not so serious at E(ho)

Affinity of the interface between hydroxyapatite (0001) and titanium (0001) surfaces: a first-principles investigation.

PubMed

Sun, Jin P; Dai, Jianhong; Song, Yan; Wang, You; Yang, Rui

2014-12-10

A basic understanding of the affinity between the hydroxyapatite (HA) and α-Ti surfaces is obtained through electronic structure calculations by first-principles method. The surface energies of HA(0001), HA (011̅0), HA (101̅1), and Ti(0001) surfaces have been calculated. The HA(0001) presents the most thermodynamically stable of HA. The HA/Ti interfaces were constructed by two kinds of interface models, the single interface (denoted as SI) and the double-interface (denoted as DI). Two methods, the full relaxation and the UBER, were applied to determine the interfacial separation and the atomic arrangement in the interfacial zone. The works of adhesion of interfaces with various stoichiometric HA surfaces were evaluated. For the HA(0001)/Ti(0001) interfaces, the work of adhesion is strongly dependent on the chemical environment of the HA surface. The values are -2.33, -1.52, and -0.80 J/m(2) for the none-, single-, and double-Ca terminated HA/Ti interfaces, respectively. The influence of atomic relaxation on the work of adhesion and interface separation is discussed. Full relaxation results include -1.99 J/m(2) work of adhesion and 0.220 nm separation between HA and Ti for the DI of 1-Ca-HA/Ti interface, while they are -1.14 J/m(2) and 0.235 nm by partial relaxation. Analysis of electronic structure reveals that charge transfer between HA and Ti slabs occurs during the formation of the HA/Ti interface. The transfer generates the Ti-O or Ti-Ca bonds across the interface and drives the HA/Ti interface system to metallic characteristic. The energetically favorable interfaces are formed when the outmost layer of HA comprises more O atoms at the interface.

Multiconfiguration pair-density functional theory investigation of the electronic spectrum of MnO4-

NASA Astrophysics Data System (ADS)

Sharma, Prachi; Truhlar, Donald G.; Gagliardi, Laura

2018-03-01

The electronic spectrum of permanganate ions contains various highly multiconfigurational ligand-to-metal charge transfer states and is notorious for being one of the most challenging systems to be treated by quantum-chemical methods. Here we studied the lowest nine vertical excitation energies using restricted active space second-order perturbation theory (RASPT2) and multiconfiguration pair-density functional theory (MC-PDFT) to test and compare these two theories in computing such a challenging spectrum. The results are compared to literature data, including time-dependent density functional theory, completely renormalized equation-of-motion couple-cluster theory with single and double excitations, symmetry-adapted-cluster configuration interaction, and experimental spectra in the gas phase and solution. Our results show that MC-PDFT accurately predicts the spectrum at a significantly reduced cost as compared to RASPT2.

Multiconfiguration pair-density functional theory investigation of the electronic spectrum of MnO4.

PubMed

Sharma, Prachi; Truhlar, Donald G; Gagliardi, Laura

2018-03-28

The electronic spectrum of permanganate ions contains various highly multiconfigurational ligand-to-metal charge transfer states and is notorious for being one of the most challenging systems to be treated by quantum-chemical methods. Here we studied the lowest nine vertical excitation energies using restricted active space second-order perturbation theory (RASPT2) and multiconfiguration pair-density functional theory (MC-PDFT) to test and compare these two theories in computing such a challenging spectrum. The results are compared to literature data, including time-dependent density functional theory, completely renormalized equation-of-motion couple-cluster theory with single and double excitations, symmetry-adapted-cluster configuration interaction, and experimental spectra in the gas phase and solution. Our results show that MC-PDFT accurately predicts the spectrum at a significantly reduced cost as compared to RASPT2.

Attosecond Electron Correlation Dynamics in Double Ionization of Benzene Probed with Two-Electron Angular Streaking

NASA Astrophysics Data System (ADS)

Winney, Alexander H.; Lee, Suk Kyoung; Lin, Yun Fei; Liao, Qing; Adhikari, Pradip; Basnayake, Gihan; Schlegel, H. Bernhard; Li, Wen

2017-09-01

With a novel three-dimensional electron-electron coincidence imaging technique and two-electron angular streaking method, we show that the emission time delay between two electrons can be measured from tens of attoseconds to more than 1 fs. Surprisingly, in benzene, the double ionization rate decays as the time delay between the first and second electron emission increases during the first 500 as. This is further supported by the decay of the Coulomb repulsion in the direction perpendicular to the laser polarization. This result reveals that laser-induced electron correlation plays a major role in strong field double ionization of benzene driven by a nearly circularly polarized field.

Proton-deuteron double scattering

NASA Technical Reports Server (NTRS)

Wilson, J. W.

1974-01-01

A simple but accurate form for the proton-deuteron elastic double scattering amplitude, which includes both projectile and target recoil motion and is applicable at all momentum transfer, is derived by taking advantage of the restricted range of Fermi momentum allowed by the deuteron wave function. This amplitude can be directly compared to approximations which have neglected target recoil or are limited to small momentum transfer; the target recoil and large momentum transfer effects are evaluated explicitly within the context of a Gaussian model.

Observation of warm, higher energy electrons transiting a double layer in a helicon plasma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sung, Yung-Ta, E-mail: ysung2@wisc.edu; Li, Yan; Scharer, John E.

2015-03-15

Measurements of an inductive RF helicon argon plasma double layer with two temperature electron distributions including a fast (>80 eV) tail are observed at 0.17 mTorr Ar pressure. The fast, untrapped electrons observed downstream of the double layer have a higher temperature (13 eV) than the trapped (T{sub e} = 4 eV) electrons. The reduction of plasma potential and density observed in the double layer region would require an upstream temperature ten times the measured 4 eV if occurring via Boltzmann ambipolar expansion. The experimental observation in Madison helicon experiment indicates that fast electrons with substantial density fractions can be created at low helicon operating pressures.

Retrocausation acting in the single-electron double-slit interference experiment

NASA Astrophysics Data System (ADS)

Hokkyo, Noboru

The single electron double-slit interference experiment is given a time-symmetric interpretation and visualization in terms of the intermediate amplitude of transition between the particle source and the detection point. It is seen that the retarded (causal) amplitude of the electron wave expanding from the source shows an advanced (retrocausal) bifurcation and merging in passing through the double-slit and converges towards the detection point as if guided by the advanced (retrocausal) wave from the detected electron. An experiment is proposed to confirm the causation-retrocausation symmetry of the electron behavior by observing the insensitivity of the interference pattern to non-magnetic obstacles placed in the shadows of the retarded and advanced waves appearing on the rear and front sides of the double-slit.

Application of double-hybrid density functionals to charge transfer in N-substituted pentacenequinones.

PubMed

Sancho-García, J C

2012-05-07

A set of N-heteroquinones, deriving from oligoacenes, have been recently proposed as n-type organic semiconductors with high electron mobilities in thin-film transistors. Generally speaking, this class of compounds self-assembles in neighboring π-stacks linked by weak hydrogen bonds. We aim at theoretically characterizing here the sequential charge transport (hopping) process expected to take place across these arrays of molecules. To do so, we need to accurately address the preferred packing of these materials simultaneously to single-molecule properties related to charge-transfer events, carefully employing dispersion-corrected density functional theory methods to accurately extract the key molecular parameters governing this phenomenon at the nanoscale. This study confirms the great deal of interest around these compounds, since controlled functionalization of model molecules (i.e., pentacene) allows to efficiently tune the corresponding charge mobilities, and the capacity of modern quantum-chemical methods to predict it after rationalizing the underlying structure-property relationships.

On the use of electrokinetic phenomena of the second kind for probing electrode kinetic properties of modified electron-conducting surfaces.

PubMed

Duval, Jérôme F L; Sorrenti, Estelle; Waldvogel, Yves; Görner, Tatiana; De Donato, Philippe

2007-04-14

The electrokinetic features of electron-conducting substrates, as measured in a conventional thin-layer electrokinetic cell, strongly depend on the extent of bipolar faradaic depolarisation of the interface formed with the adjacent electrolytic solution. Streaming potential versus applied pressure data obtained for metallic substrates must generally be interpreted on the basis of a modified Helmholtz-Smoluchowski equation corrected by an electronic conduction term-non linear with respect to the lateral potential and applied pressure gradient-that stems from the bipolar electrodic behavior of the metallic surface. In the current study, streaming potential measurements have been performed in KNO(3) solutions on porous plugs made of electron-conducting grains of pyrite (FeS(2)) covered by humic acids. For zero coverage, the extensive bipolar electronic conduction taking place in the plug-depolarized by concomitant and spatially distributed oxidation and reduction reactions of Fe(2+) and Fe(3+) species-leads to the complete extinction of the streaming potential over the entire range of applied pressure examined. For low to intermediate coverage, the local electron-transfer kinetics on the covered regions of the plug becomes more sluggish. The overall bipolar electronic conduction is then diminished which leads to an increase in the streaming potential with a non-linear dependence on the pressure. For significant coverage, a linear response is observed which basically reflects the interfacial double layer properties of the humics surface layer. A tractable, semi-analytical model is presented that reproduces the electrokinetic peculiarities of the complex and composite system FeS(2)/humics investigated. The study demonstrates that the streaming potential technique is a fast and valuable tool for establishing how well the electron transfer kinetics at a partially or completely depolarised bare electron-conducting substrate/electrolyte solution interface is either promoted (catalysis) or blocked (passivation) by the presence of a discontinuous surface layer.

12 CFR 1005.14 - Electronic fund transfer service provider not holding consumer's account.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 12 Banks and Banking 8 2012-01-01 2012-01-01 false Electronic fund transfer service provider not... PROTECTION ELECTRONIC FUND TRANSFERS (REGULATION E) § 1005.14 Electronic fund transfer service provider not holding consumer's account. (a) Provider of electronic fund transfer service. A person that provides an...

12 CFR 1005.14 - Electronic fund transfer service provider not holding consumer's account.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 12 Banks and Banking 8 2013-01-01 2013-01-01 false Electronic fund transfer service provider not... PROTECTION ELECTRONIC FUND TRANSFERS (REGULATION E) General § 1005.14 Electronic fund transfer service provider not holding consumer's account. (a) Provider of electronic fund transfer service. A person that...

12 CFR 1005.14 - Electronic fund transfer service provider not holding consumer's account.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 12 Banks and Banking 8 2014-01-01 2014-01-01 false Electronic fund transfer service provider not... PROTECTION ELECTRONIC FUND TRANSFERS (REGULATION E) General § 1005.14 Electronic fund transfer service provider not holding consumer's account. (a) Provider of electronic fund transfer service. A person that...

Limit on the radiative neutrinoless double electron capture of ^{36}Ar from GERDA Phase I

NASA Astrophysics Data System (ADS)

Agostini, M.; Allardt, M.; Bakalyarov, A. M.; Balata, M.; Barabanov, I.; Barros, N.; Baudis, L.; Bauer, C.; Bellotti, E.; Belogurov, S.; Belyaev, S. T.; Benato, G.; Bettini, A.; Bezrukov, L.; Bode, T.; Borowicz, D.; Brudanin, V.; Brugnera, R.; Caldwell, A.; Cattadori, C.; Chernogorov, A.; D'Andrea, V.; Demidova, E. V.; di Vacri, A.; Domula, A.; Doroshkevich, E.; Egorov, V.; Falkenstein, R.; Fedorova, O.; Freund, K.; Frodyma, N.; Gangapshev, A.; Garfagnini, A.; Gooch, C.; Grabmayr, P.; Gurentsov, V.; Gusev, K.; Hakenmüller, J.; Hegai, A.; Heisel, M.; Hemmer, S.; Heusser, G.; Hofmann, W.; Hult, M.; Inzhechik, L. V.; Csáthy, J. Janicskó; Jochum, J.; Junker, M.; Kazalov, V.; Kihm, T.; Kirpichnikov, I. V.; Kirsch, A.; Kish, A.; Klimenko, A.; Kneißl, R.; Knöpfle, K. T.; Kochetov, O.; Kornoukhov, V. N.; Kuzminov, V. V.; Laubenstein, M.; Lazzaro, A.; Lebedev, V. I.; Lehnert, B.; Liao, H. Y.; Lindner, M.; Lippi, I.; Lubashevskiy, A.; Lubsandorzhiev, B.; Lutter, G.; Macolino, C.; Majorovits, B.; Maneschg, W.; Medinaceli, E.; Miloradovic, M.; Mingazheva, R.; Misiaszek, M.; Moseev, P.; Nemchenok, I.; Palioselitis, D.; Panas, K.; Pandola, L.; Pelczar, K.; Pullia, A.; Riboldi, S.; Rumyantseva, N.; Sada, C.; Salamida, F.; Salathe, M.; Schmitt, C.; Schneider, B.; Schönert, S.; Schreiner, J.; Schütz, A.-K.; Schulz, O.; Schwingenheuer, B.; Selivanenko, O.; Shirchenko, M.; Simgen, H.; Smolnikov, A.; Stanco, L.; Stepaniuk, M.; Vanhoefer, L.; Vasenko, A. A.; Veresnikova, A.; von Sturm, K.; Wagner, V.; Walter, M.; Wegmann, A.; Wester, T.; Wiesinger, C.; Wilsenach, H.; Wojcik, M.; Yanovich, E.; Zhitnikov, I.; Zhukov, S. V.; Zinatulina, D.; Zuber, K.; Zuzel, G.

2016-12-01

Neutrinoless double electron capture is a process that, if detected, would give evidence of lepton number violation and the Majorana nature of neutrinos. A search for neutrinoless double electron capture of ^{36}Ar has been performed with germanium detectors installed in liquid argon using data from Phase I of the GERmanium Detector Array ( Gerda) experiment at the Gran Sasso Laboratory of INFN, Italy. No signal was observed and an experimental lower limit on the half-life of the radiative neutrinoless double electron capture of ^{36}Ar was established: T_{1/2} > 3.6 × 10^{21} years at 90% CI.

Limit on the radiative neutrinoless double electron capture of 36Ar from GERDA Phase I

DOE PAGES

Agostini, M.; Allardt, M.; Bakalyarov, A. M.; ...

2016-11-28

Neutrinoless double electron capture is a process that, if detected, would give evidence of lepton number violation and the Majorana nature of neutrinos. Here, a search for neutrinoless double electron capture of 36Ar has been performed with germanium detectors installed in liquid argon using data from Phase I of the GERmanium Detector Array (Gerda) experiment at the Gran Sasso Laboratory of INFN, Italy. No signal was observed and an experimental lower limit on the half-life of the radiative neutrinoless double electron capture of 36 Ar was established: T 1/2 > 3.6 × 10 21 years at 90% CI.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gendron, Frederic; Fleischauer, Valerie R.; Duignan, Thomas J.

Here, we present a combined ab initio theoretical and experimental study of the magnetic circular dichroism (MCD) spectrum of the octahedral UCl 6- complex ion in the UV-Vis spectral region. The ground state is an orbitally non-degenerate doublet E 5/2u and the MCD is a $C$-term spectrum caused by spin–orbit coupling. Calculations of the electronic spectrum at various levels of theory indicate that differential dynamic electron correlation has a strong influence on the energies of the dipole-allowed transitions and the envelope of the MCD spectrum. The experimentally observed bands are assigned to dipole-allowed ligand-to-metal charge transfer into the 5f shell,more » and 5f to 6d transitions. Charge transfer excitations into the U 6d shell appear at much higher energies. The MCD-allowed transitions can be assigned via their signs of the $C$-terms: Under O h double group symmetry, E 5/2u → E 5/2g transitions have negative $C$-terms whereas E 5/2u → F 3/2g transitions have positive $C$-terms if the ground state g-factor is negative, as it is the case for UCl 6-.« less

Theoretical studies for the rates and kinetic isotope effects of the excited-state double proton transfer in the 1:1 7-azaindole:H2O complex using variational transition state theory including multidimensional tunneling.

PubMed

Duong, My Phu Thi; Kim, Yongho

2010-03-18

Variational transition state theory calculations including multidimensional tunneling (VTST/MT) for excited-state tautomerization in the 1:1 7-azaindole:H(2)O complex were performed. Electronic structures and energies for reactant, product, transition state, and potential energy curves along the reaction coordinate were computed at the CASSCF(10,9)/6-31G(d,p) level of theory. The potential energies were corrected by second-order multireference perturbation theory to take the dynamic electron correlation into consideration. The final potential energy curves along the reaction coordinate were generated at the MRPT2//CASSCF(10,9)/6-31G(d,p) level. Two protons in the excited-state tautomerization are transferred concertedly, albeit asynchronously. The position of the variational transition state is very different from the conventional transition state, and is highly dependent on isotopic substitution. Rate constants were calculated using VTST/MT, and were on the order of 10(-6) s(-1) at room temperature. The HH/DD kinetic isotope effects are consistent with experimental observations; consideration of both tunneling and variational effects was essential to predict the experimental values correctly.

Thermodynamic Study on Plasma Expansion along a Divergent Magnetic Field.

PubMed

Zhang, Yunchao; Charles, Christine; Boswell, Rod

2016-01-15

Thermodynamic properties are revisited for electrons that are governed by nonlocal electron energy probability functions in a plasma of low collisionality. Measurements in a laboratory helicon double layer experiment have shown that the effective electron temperature and density show a polytropic correlation with an index of γ_{e}=1.17±0.02 along the divergent magnetic field, implying a nearly isothermal plasma (γ_{e}=1) with heat being brought into the system. However, the evolution of electrons along the divergent magnetic field is essentially an adiabatic process, which should have a γ_{e}=5/3. The reason for this apparent contradiction is that the nearly collisionless plasma is very far from local thermodynamic equilibrium and the electrons behave nonlocally. The corresponding effective electron enthalpy has a conservation relation with the potential energy, which verifies that there is no heat transferred into the system during the electron evolution. The electrons are shown in nonlocal momentum equilibrium under the electric field and the gradient of the effective electron pressure. The convective momentum of ions, which can be assumed as a cold species, is determined by the effective electron pressure and the effective electron enthalpy is shown to be the source for ion acceleration. For these nearly collisionless plasmas, the use of traditional thermodynamic concepts can lead to very erroneous conclusions regarding the thermal conductivity.

Effect of chemical substitutions on photo-switching properties of 3-hydroxy-picolinic acid studied by ab initio methods

NASA Astrophysics Data System (ADS)

Rode, Michał F.; Sobolewski, Andrzej L.

2014-02-01

Effect of chemical substitutions to the molecular structure of 3-hydroxy-picolinic acid on photo-switching properties of the system operating on excited-state intramolecular double proton transfer (d-ESIPT) process [M. F. Rode and A. L. Sobolewski, Chem. Phys. 409, 41 (2012)] was studied with the aid of electronic structure theory methods. It was shown that simultaneous application of electron-donating and electron-withdrawing substitutions at certain positions of the molecular frame increases the height of the S0-state tautomerization barrier (ensuring thermal stability of isomers) and facilitates a barrierless access to the S1/S0 conical intersection from the Franck-Condon region of the S1 potential-energy surface. Results of study point to the conclusion that the most challenging issue for practical design of a fast molecular photoswitch based on d-ESIPT phenomenon are to ensure a selectivity of optical excitation of a given tautomeric form of the system.

Optical determination of the electronic coupling and intercalation geometry of thiazole orange homodimer in DNA

NASA Astrophysics Data System (ADS)

Cunningham, Paul D.; Bricker, William P.; Díaz, Sebastián A.; Medintz, Igor L.; Bathe, Mark; Melinger, Joseph S.

2017-08-01

Sequence-selective bis-intercalating dyes exhibit large increases in fluorescence in the presence of specific DNA sequences. This property makes this class of fluorophore of particular importance to biosensing and super-resolution imaging. Here we report ultrafast transient anisotropy measurements of resonance energy transfer (RET) between thiazole orange (TO) molecules in a complex formed between the homodimer TOTO and double-stranded (ds) DNA. Biexponential homo-RET dynamics suggest two subpopulations within the ensemble: 80% intercalated and 20% non-intercalated. Based on the application of the transition density cube method to describe the electronic coupling and Monte Carlo simulations of the TOTO/dsDNA geometry, the dihedral angle between intercalated TO molecules is estimated to be 81° ± 5°, corresponding to a coupling strength of 45 ± 22 cm-1. Dye intercalation with this geometry is found to occur independently of the underlying DNA sequence, despite the known preference of TOTO for the nucleobase sequence CTAG. The non-intercalated subpopulation is inferred to have a mean inter-dye separation distance of 19 Å, corresponding to coupling strengths between 0 and 25 cm-1. This information is important to enable the rational design of energy transfer systems that utilize TOTO as a relay dye. The approach used here is generally applicable to determining the electronic coupling strength and intercalation configuration of other dimeric bis-intercalators.

Gene Transfer Efficiency in Gonococcal Biofilms: Role of Biofilm Age, Architecture, and Pilin Antigenic Variation.

PubMed

Kouzel, Nadzeya; Oldewurtel, Enno R; Maier, Berenike

2015-07-01

Extracellular DNA is an important structural component of many bacterial biofilms. It is unknown, however, to which extent external DNA is used to transfer genes by means of transformation. Here, we quantified the acquisition of multidrug resistance and visualized its spread under selective and nonselective conditions in biofilms formed by Neisseria gonorrhoeae. The density and architecture of the biofilms were controlled by microstructuring the substratum for bacterial adhesion. Horizontal transfer of antibiotic resistance genes between cocultured strains, each carrying a single resistance, occurred efficiently in early biofilms. The efficiency of gene transfer was higher in early biofilms than between planktonic cells. It was strongly reduced after 24 h and independent of biofilm density. Pilin antigenic variation caused a high fraction of nonpiliated bacteria but was not responsible for the reduced gene transfer at later stages. When selective pressure was applied to dense biofilms using antibiotics at their MIC, the double-resistant bacteria did not show a significant growth advantage. In loosely connected biofilms, the spreading of double-resistant clones was prominent. We conclude that multidrug resistance readily develops in early gonococcal biofilms through horizontal gene transfer. However, selection and spreading of the multiresistant clones are heavily suppressed in dense biofilms. Biofilms are considered ideal reaction chambers for horizontal gene transfer and development of multidrug resistances. The rate at which genes are exchanged within biofilms is unknown. Here, we quantified the acquisition of double-drug resistance by gene transfer between gonococci with single resistances. At early biofilm stages, the transfer efficiency was higher than for planktonic cells but then decreased with biofilm age. The surface topography affected the architecture of the biofilm. While the efficiency of gene transfer was independent of the architecture, spreading of double-resistant bacteria under selective conditions was strongly enhanced in loose biofilms. We propose that while biofilms help generating multiresistant strains, selection takes place mostly after dispersal from the biofilm. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Bromine-doped DWNTs: A Molecular Faraday Cage

NASA Astrophysics Data System (ADS)

Chen, Gugang; Margine, Roxana; Gupta, Rajeev; Crespi, Vincent; Eklund, Peter; Sumanasekera, Gamini; Bandow, Shunji; Iijima, S.

2003-03-01

Raman scattering is used to probe the charge transfer distribution in Bromine-doped double-walled carbon nanotubes (DWNT). Using 1064 nm and 514.5 nm laser excitation we are able to study the charge-transfer sensitive phonons in the inner ( (5,5)) and outer ( (10,10)) tubes of the double-walled pair. The experimental results are compared to our tight binding band structure calculations that include a self-consistent electrostatic term sensitive to the average net charge density on each tube. Upon doping, the nanotube tangential and radial Raman bands from the outer (primary) tubes were observed to shift dramatically to higher frequencies, consistent with a C-C bond contraction driven by the acceptor-doping. The peak intensities of these bands significantly decreased with increasing doping exposure, and they eventually vanished, consistent with a deep depression in the Fermi energy that extinguishes the resonant Raman effect. Interestingly, at the same time, we observed little or no change for the tangential and radial Raman features identified with the inner (secondary) tubes during the bromine doping. Our electronic structure calculations show that the charge distribution between the outer and inner tubes depends on doping level and also, to some extent, on specific tube chirality combinations. In general, in agreement with experiment, the calculations find a very small net charge on the inner tube, consistent with a "Molecular Faraday Effect", e.g., a DWNT of (10, 10)/ (5, 5) configuration that exhibits 0.5 holes/Å total charge transfer, has only 0.04 holes/Å on the inner (secondary) tube.

Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

PubMed

Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

2015-12-01

Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A 1D radiative transfer benchmark with polarization via doubling and adding

NASA Astrophysics Data System (ADS)

Ganapol, B. D.

2017-11-01

Highly precise numerical solutions to the radiative transfer equation with polarization present a special challenge. Here, we establish a precise numerical solution to the radiative transfer equation with combined Rayleigh and isotropic scattering in a 1D-slab medium with simple polarization. The 2-Stokes vector solution for the fully discretized radiative transfer equation in space and direction derives from the method of doubling and adding enhanced through convergence acceleration. Updates to benchmark solutions found in the literature to seven places for reflectance and transmittance as well as for angular flux follow. Finally, we conclude with the numerical solution in a partially randomly absorbing heterogeneous medium.

Quantum tunneling resonant electron transfer process in Lorentzian plasmas

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hong, Woo-Pyo; Jung, Young-Dae, E-mail: ydjung@hanyang.ac.kr; Department of Applied Physics and Department of Bionanotechnology, Hanyang University, Ansan, Kyunggi-Do 426-791

The quantum tunneling resonant electron transfer process between a positive ion and a neutral atom collision is investigated in nonthermal generalized Lorentzian plasmas. The result shows that the nonthermal effect enhances the resonant electron transfer cross section in Lorentzian plasmas. It is found that the nonthermal effect on the classical resonant electron transfer cross section is more significant than that on the quantum tunneling resonant charge transfer cross section. It is shown that the nonthermal effect on the resonant electron transfer cross section decreases with an increase of the Debye length. In addition, the nonthermal effect on the quantum tunnelingmore » resonant electron transfer cross section decreases with increasing collision energy. The variation of nonthermal and plasma shielding effects on the quantum tunneling resonant electron transfer process is also discussed.« less

Ultrafast direct electron transfer at organic semiconductor and metal interfaces.

PubMed

Xiang, Bo; Li, Yingmin; Pham, C Huy; Paesani, Francesco; Xiong, Wei

2017-11-01

The ability to control direct electron transfer can facilitate the development of new molecular electronics, light-harvesting materials, and photocatalysis. However, control of direct electron transfer has been rarely reported, and the molecular conformation-electron dynamics relationships remain unclear. We describe direct electron transfer at buried interfaces between an organic polymer semiconductor film and a gold substrate by observing the first dynamical electric field-induced vibrational sum frequency generation (VSFG). In transient electric field-induced VSFG measurements on this system, we observe dynamical responses (<150 fs) that depend on photon energy and polarization, demonstrating that electrons are directly transferred from the Fermi level of gold to the lowest unoccupied molecular orbital of organic semiconductor. Transient spectra further reveal that, although the interfaces are prepared without deliberate alignment control, a subensemble of surface molecules can adopt conformations for direct electron transfer. Density functional theory calculations support the experimental results and ascribe the observed electron transfer to a flat-lying polymer configuration in which electronic orbitals are found to be delocalized across the interface. The present observation of direct electron transfer at complex interfaces and the insights gained into the relationship between molecular conformations and electron dynamics will have implications for implementing novel direct electron transfer in energy materials.

Electron Capture in Slow Collisions of Si4+ With Atomic Hydrogen

NASA Astrophysics Data System (ADS)

Joseph, D. C.; Gu, J. P.; Saha, B. C.

2009-10-01

In recent years the charge transfer involving Si4+ and H at low energies has drawn considerable attention both theoretically and experimentally due to its importance not only in astronomical environments but also in modern semiconductor industries. Accurate information regarding its molecular structures and interactions are essential to understand the low energy collision dynamics. Ab initio calculations are performed using the multireference single- and double-excitation configuration-interaction (MRD-CI) method to evaluate potential energies. State selective cross sections are calculate using fully quantum and semi-classical molecular-orbital close coupling (MOCC) methods in the adiabatic representation. Detail results will be presented in the conference.

EPR/ENDOR and Theoretical Study of the Jahn-Teller-Active [HIPTN3N]MoVL Complexes (L = N-, NH).

PubMed

Sharma, Ajay; Roemelt, Michael; Reithofer, Michael; Schrock, Richard R; Hoffman, Brian M; Neese, Frank

2017-06-19

The molybdenum trisamidoamine (TAA) complex [Mo] {[3,5-(2,4,6-i-Pr 3 C 6 H 2 ) 2 C 6 H 3 NCH 2 CH 2 N]Mo} carries out catalytic reduction of N 2 to ammonia (NH 3 ) by protons and electrons at room temperature. A key intermediate in the proposed [Mo] nitrogen reduction cycle is nitridomolybdenum(VI), [Mo(VI)]N. The addition of [e - /H + ] to [Mo(VI)]N to generate [Mo(V)]NH might, in principle, follow one of three possible pathways: direct proton-coupled electron transfer; H + first and then e - ; e - and then H + . In this study, the paramagnetic Mo(V) intermediate {[Mo]N} - and the [Mo]NH transfer product were generated by irradiating the diamagnetic [Mo]N and {[Mo]NH} + Mo(VI) complexes, respectively, with γ-rays at 77 K, and their electronic and geometric structures were characterized by electron paramagnetic resonance and electron nuclear double resonance spectroscopies, combined with quantum-chemical computations. In combination with previous X-ray studies, this creates the rare situation in which each one of the four possible states of [e - /H + ] delivery has been characterized. Because of the degeneracy of the electronic ground states of both {[Mo(V)]N} - and [Mo(V)]NH, only multireference-based methods such as the complete active-space self-consistent field (CASSCF) and related methods provide a qualitatively correct description of the electronic ground state and vibronic coupling. The molecular g values of {[Mo]N} - and [Mo]NH exhibit large deviations from the free-electron value g e . Their actual values reflect the relative strengths of vibronic and spin-orbit coupling. In the course of the computational treatment, the utility and limitations of a formal two-state model that describes this competition between couplings are illustrated, and the implications of our results for the chemical reactivity of these states are discussed.

Robust techniques for polarization and detection of nuclear spin ensembles

NASA Astrophysics Data System (ADS)

Scheuer, Jochen; Schwartz, Ilai; Müller, Samuel; Chen, Qiong; Dhand, Ish; Plenio, Martin B.; Naydenov, Boris; Jelezko, Fedor

2017-11-01

Highly sensitive nuclear spin detection is crucial in many scientific areas including nuclear magnetic resonance spectroscopy, magnetic resonance imaging (MRI), and quantum computing. The tiny thermal nuclear spin polarization represents a major obstacle towards this goal which may be overcome by dynamic nuclear spin polarization (DNP) methods. The latter often rely on the transfer of the thermally polarized electron spins to nearby nuclear spins, which is limited by the Boltzmann distribution of the former. Here we utilize microwave dressed states to transfer the high (>92 % ) nonequilibrium electron spin polarization of a single nitrogen-vacancy center (NV) induced by short laser pulses to the surrounding 13C carbon nuclear spins. The NV is repeatedly repolarized optically, thus providing an effectively infinite polarization reservoir. A saturation of the polarization of the nearby nuclear spins is achieved, which is confirmed by the decay of the polarization transfer signal and shows an excellent agreement with theoretical simulations. Hereby we introduce the polarization readout by polarization inversion method as a quantitative magnetization measure of the nuclear spin bath, which allows us to observe by ensemble averaging macroscopically hidden polarization dynamics like Landau-Zener-Stückelberg oscillations. Moreover, we show that using the integrated solid effect both for single- and double-quantum transitions nuclear spin polarization can be achieved even when the static magnetic field is not aligned along the NV's crystal axis. This opens a path for the application of our DNP technique to spins in and outside of nanodiamonds, enabling their application as MRI tracers. Furthermore, the methods reported here can be applied to other solid state systems where a central electron spin is coupled to a nuclear spin bath, e.g., phosphor donors in silicon and color centers in silicon carbide.

Heat Transfer of Nanofluid in a Double Pipe Heat Exchanger.

PubMed

Aghayari, Reza; Maddah, Heydar; Zarei, Malihe; Dehghani, Mehdi; Kaskari Mahalle, Sahar Ghanbari

2014-01-01

This paper investigates the enhancement of heat transfer coefficient and Nusselt number of a nanofluid containing nanoparticles (γ-AL2O3) with a particle size of 20 nm and volume fraction of 0.1%-0.3% (V/V). Effects of temperature and concentration of nanoparticles on Nusselt number changes and heat transfer coefficient in a double pipe heat exchanger with counter turbulent flow are investigated. Comparison of experimental results with valid theoretical data based on semiempirical equations shows an acceptable agreement. Experimental results show a considerable increase in heat transfer coefficient and Nusselt number up to 19%-24%, respectively. Also, it has been observed that the heat transfer coefficient increases with the operating temperature and concentration of nanoparticles.

Experimental study of heat transfer enhancement due to the surface vibrations in a flexible double pipe heat exchanger

NASA Astrophysics Data System (ADS)

Hosseinian, A.; Meghdadi Isfahani, A. H.

2018-04-01

In this study, the heat transfer enhancement due to the surface vibration for a double pipe heat exchanger, made of PVDF, is investigated. In order to create forced vibrations (3-9 m/s2, 100 Hz) on the outer surface of the heat exchanger electro-dynamic vibrators are used. Experiments were performed at inner Reynolds numbers ranging from 2533 to 9960. The effects of volume flow rate and temperature on heat transfer performance are evaluated. Results demonstrated that heat transfer coefficient increases by increasing vibration level and mass flow rate. The most increase in heat transfer coefficient is 97% which is obtained for the highest vibration level (9 m/s2) in the experiment range.

Slow electron acoustic double layer (SEADL) structures in bi-ion plasma with trapped electrons

NASA Astrophysics Data System (ADS)

Shan, Shaukat Ali; Imtiaz, Nadia

2018-05-01

The properties of ion acoustic double layer (IADL) structures in bi-ion plasma with electron trapping are investigated by using the quasi-potential analysis. The κ-distributed trapped electrons number density expression is truncated to some finite order of the electrostatic potential. By utilizing the reductive perturbation method, a modified Schamel equation which describes the evolution of the slow electron acoustic double layer (SEADL) with the modified speed due to the presence of bi-ion species is investigated. The Sagdeev-like potential has been derived which accounts for the effect of the electron trapping and superthermality in a bi-ion plasma. It is found that the superthermality index, the trapping efficiency of electrons, and ion to electron temperature ratio are the inhibiting parameters for the amplitude of the slow electron acoustic double layers (SEADLs). However, the enhanced population of the cold ions is found to play a supportive role for the low frequency DLs in bi-ion plasmas. The illustrations have been presented with the help of the bi-ion plasma parameters in the Earth's ionosphere F-region.

Enhanced long-distance transport of periodic electron beams in an advanced double layer cone-channel target

NASA Astrophysics Data System (ADS)

Ji, Yanling; Duan, Tao; Zhou, Weimin; Li, Boyuan; Wu, Fengjuan; Zhang, Zhimeng; Ye, Bin; Wang, Rong; Wu, Chunrong; Tang, Yongjian

2018-02-01

An enhanced long-distance transport of periodic electron beams in an advanced double layer cone-channel target is investigated using two-dimensional particle-in-cell simulations. The target consists of a cone attached to a double-layer hollow channel with a near-critical-density inner layer. The periodic electron beams are generated by the combination of ponderomotive force and longitudinal laser electric field. Then a stable electron propagation is achieved in the double-layer channel over a much longer distance without evident divergency, compared with a normal cone-channel target. Detailed simulations show that the much better long-distance collimation and guidance of energetic electrons is attributed to the much stronger electromagnetic fields at the inner wall surfaces. Furthermore, a continuous electron acceleration is obtained by the more intense laser electric fields and extended electron acceleration length in the channel. Our investigation shows that by employing this advanced target, both the forward-going electron energy flux in the channel and the energy coupling efficiency from laser to electrons are about threefold increased in comparison with the normal case.

Attosecond Spectroscopy Probing Electron Correlation Dynamics

NASA Astrophysics Data System (ADS)

Winney, Alexander H.

Electrons are the driving force behind every chemical reaction. The exchange, ionization, or even relaxation of electrons is behind every bond broken or formed. According to the Bohr model of the atom, it takes an electron 150 as to orbit a proton[6]. With this as a unit time scale for an electron, it is clear that a pulse duration of several femtoseconds will not be sufficient to understanding electron dynamics. Our work demonstrates both technical and scientific achievements that push the boundaries of attosecond dynamics. TDSE studies show that amplification the yield of high harmonic generation (HHG) may be possible with transverse confinement of the electron. XUV-pump-XUV-probe shows that the yield of APT train can be sufficient for 2-photon double ionization studies. A zero dead-time detection system allows for the measurement of state-resolved double ionization for the first time. Exploiting attosecond angular streaking[7] probes sequential and non-sequential double ionization via electron-electron correlations with attosecond time resolution. Finally, using recoil frame momentum correlation, the fast dissociation of CH 3I reveals important orbital ionization dynamics of non-dissociative & dissociative, single & double ionization.

Contribution of direct electron transfer mechanisms to overall electron transfer in microbial fuel cells utilising Shewanella oneidensis as biocatalyst.

PubMed

Fapetu, Segun; Keshavarz, Taj; Clements, Mark; Kyazze, Godfrey

2016-09-01

To investigate the contribution of direct electron transfer mechanisms to electricity production in microbial fuel cells by physically retaining Shewanella oneidensis cells close to or away from the anode electrode. A maximum power output of 114 ± 6 mWm(-2) was obtained when cells were retained close to the anode using a dialysis membrane. This was 3.5 times more than when the cells were separated away from the anode. Without the membrane the maximum power output was 129 ± 6 mWm(-2). The direct mechanisms of electron transfer contributed significantly to overall electron transfer from S. oneidensis to electrodes, a result that was corroborated by another experiment where S. oneidensis cells were entrapped in alginate gels. S. oneidensis transfers electrons primarily by direct electron transfer as opposed to mediated electron transfer.

A high-finesse Fabry-Perot cavity with a frequency-doubled green laser for precision Compton polarimetry at Jefferson Lab

DOE PAGES

Rakhman, A.; Hafez, Mohamed A.; Nanda, Sirish K.; ...

2016-03-31

Here, a high-finesse Fabry-Perot cavity with a frequency-doubled continuous wave green laser (532 nm) has been built and installed in Hall A of Jefferson Lab for high precision Compton polarimetry. The infrared (1064 nm) beam from a ytterbium-doped fiber amplifier seeded by a Nd:YAG nonplanar ring oscillator laser is frequency doubled in a single-pass periodically poled MgO:LiNbO 3 crystal. The maximum achieved green power at 5 W infrared pump power is 1.74 W with a total conversion efficiency of 34.8%. The green beam is injected into the optical resonant cavity and enhanced up to 3.7 kW with a corresponding enhancementmore » of 3800. The polarization transfer function has been measured in order to determine the intra-cavity circular laser polarization within a measurement uncertainty of 0.7%. The PREx experiment at Jefferson Lab used this system for the first time and achieved 1.0% precision in polarization measurements of an electron beam with energy and current of 1.0 GeV and 50 μA.« less

Electronic structure and spectroscopic properties of mononuclear manganese(III) Schiff base complexes: a systematic study on [Mn(acen)X] complexes by EPR, UV/vis, and MCD spectroscopy (X = Hal, NCS).

PubMed

Westphal, Anne; Klinkebiel, Arne; Berends, Hans-Martin; Broda, Henning; Kurz, Philipp; Tuczek, Felix

2013-03-04

The manganese(III) Schiff base complexes [Mn(acen)X] (H2acen: N,N'-ethylenebis(acetylacetone)imine, X: I(-), Br(-), Cl(-), NCS(-)) are considered as model systems for a combined study of the electronic structure using vibrational, UV/vis absorption, parallel-mode electron paramagnetic resonance (EPR) and low-temperature magnetic circular dichroism (MCD) spectroscopy. By variation of the co-ligand X, the influence of the axial ligand field within a given square-pyramidal coordination geometry on the UV/vis, EPR, and MCD spectra of the title compounds is investigated. Between 25000 and 35000 cm(-1), the low-temperature MCD spectra are dominated by two very intense, oppositely signed pseudo-A terms, referred to as "double pseudo-A terms", which change their signs within the [Mn(acen)X] series dependent on the axial ligand X. Based on molecular orbital (MO) and symmetry considerations, these features are assigned to π(n.b.)(s, a) → yz, z(2) ligand-to-metal charge transfer transitions. The individual MCD signs are directly determined from the calculated MOs of the [Mn(acen)X] complexes. The observed sign change is explained by an inversion of symmetry among the π(n.b.)(s, a) donor orbitals which leads to an interchange of the positive and negative pseudo-A terms constituting the "double pseudo-A term".

Visible-light-responsive photocatalysts toward water oxidation based on NiTi-layered double hydroxide/reduced graphene oxide composite materials.

PubMed

Li, Bei; Zhao, Yufei; Zhang, Shitong; Gao, Wa; Wei, Min

2013-10-23

A visible-light responsive photocatalyst was fabricated by anchoring NiTi-layered double hydroxide (NiTi-LDH) nanosheets to the surface of reduced graphene oxide sheets (RGO) via an in situ growth method; the resulting NiTi-LDH/RGO composite displays excellent photocatalytic activity toward water splitting into oxygen with a rate of 1.968 mmol g(-1) h(-1) and a quantum efficiency as high as 61.2% at 500 nm, which is among the most effective visible-light photocatalysts. XRD patterns and SEM images indicate that the NiTi-LDH nanosheets (diameter: 100-200 nm) are highly dispersed on the surface of RGO. UV-vis absorption spectroscopy exhibits that the introduction of RGO enhances the visible-light absorption range of photocatalysts, which is further verified by the largely decreased band gap (∼1.78 eV) studied by cyclic voltammetry measurements. Moreover, photoluminescence (PL) measurements indicate a more efficient separation of electron-hole pairs; electron spin resonance (ESR) and Raman scattering spectroscopy confirm the electrons transfer from NiTi-LDH nanosheets to RGO, accounting for the largely enhanced carrier mobility and the resulting photocatalytic activity in comparison with pristine NiTi-LDH material. Therefore, this work demonstrates a facile approach for the fabrication of visible-light responsive NiTi-LDH/RGO composite photocatalysts, which can be used as a promising candidate in solar energy conversion and environmental science.

Suppression of BRCA2 by Mutant Mitochondrial DNA in Prostate Cancer

DTIC Science & Technology

2011-05-01

Briefly, the electron transfer activities of complex I/III (NADH dehydrogenase/cytochrome bc1 complex: catalyzes the electron transfer from NADH to...ferricytochrome c) and complex II/III (succinate dehydrogenase/cytochrome bc1 complex: catalyzes the electron transfer from succinate to ferricytochrome...The electron transfer activity of complex IV (cytochrome c oxidase: catalyzes the final step of the respiratory chain by transferring electrons from

Self-consistent electrostatic simulations of reforming double layers in the downward current region of the aurora

NASA Astrophysics Data System (ADS)

Gunell, H.; Andersson, L.; De Keyser, J.; Mann, I.

2015-10-01

The plasma on a magnetic field line in the downward current region of the aurora is simulated using a Vlasov model. It is found that an electric field parallel to the magnetic fields is supported by a double layer moving toward higher altitude. The double layer accelerates electrons upward, and these electrons give rise to plasma waves and electron phase-space holes through beam-plasma interaction. The double layer is disrupted when reaching altitudes of 1-2 Earth radii where the Langmuir condition no longer can be satisfied due to the diminishing density of electrons coming up from the ionosphere. During the disruption the potential drop is in part carried by the electron holes. The disruption creates favourable conditions for double layer formation near the ionosphere and double layers form anew in that region. The process repeats itself with a period of approximately 1 min. This period is determined by how far the double layer can reach before being disrupted: a higher disruption altitude corresponds to a longer repetition period. The disruption altitude is, in turn, found to increase with ionospheric density and to decrease with total voltage. The current displays oscillations around a mean value. The period of the oscillations is the same as the recurrence period of the double layer formations. The oscillation amplitude increases with increasing voltage, whereas the mean value of the current is independent of voltage in the 100 to 800 V range covered by our simulations. Instead, the mean value of the current is determined by the electron density at the ionospheric boundary.

Cost-effectiveness of single versus double embryo transfer in IVF in relation to female age.

PubMed

van Loendersloot, Laura L; Moolenaar, Lobke M; van Wely, Madelon; Repping, Sjoerd; Bossuyt, Patrick M; Hompes, Peter G A; van der Veen, Fulco; Mol, Ben Willem J

2017-07-01

To evaluate the cost-effectiveness of single embryo transfer followed by an additional frozen-thawed single embryo transfer, if more embryos are available, as compared to double embryo transfer in relation to female age. We used a decision tree model to evaluate the costs from a healthcare provider perspective and the pregnancy rates of two embryo transfer policies: one fresh single embryo transfer followed by an additional frozen-thawed single embryo transfer, if more embryos are available (strategy I), and double embryo transfer (strategy II). The analysis was performed on an intention-to-treat basis. Sensitivity analyses were carried out to evaluate the robustness of our model and to identify which model parameters had the strongest impact on the results. SET followed by an additional frozen-thawed single embryo transfer if available was dominant, less costly and more effective, over DET in women under 32 years. In women aged 32 or older DET was more effective than SET followed by an additional frozen-thawed single embryo transfer if available but also more costly. SET followed by an additional frozen-thawed single embryo transfer should be the preferred strategy in women under 32 undergoing IVF. The choice for SET followed by an additional frozen-thawed single embryo transfer or DET in women aged 32 or older depends on individual patient preferences and on how much society is willing to pay for an extra child. There is a strong need for a randomized clinical trial comparing the cost and effects of SET followed by an additional frozen-thawed single embryo transfer and DET in the latter category of women. Copyright © 2017 Elsevier B.V. All rights reserved.

Active pore space utilization in nanoporous carbon-based supercapacitors: Effects of conductivity and pore accessibility

NASA Astrophysics Data System (ADS)

Seredych, Mykola; Koscinski, Mikolaj; Sliwinska-Bartkowiak, Malgorzata; Bandosz, Teresa J.

2012-12-01

Composites of commercial graphene and nanoporous sodium-salt-polymer-derived carbons were prepared with 5 or 20 weight% graphene. The materials were characterized using the adsorption of nitrogen, SEM/EDX, thermal analysis, Raman spectroscopy and potentiometric titration. The samples' conductivity was also measured. The performance of the carbon composites in energy storage was linked to their porosity and electronic conductivity. The small pores (<0.7) were found as very active for double layer capacitance. It was demonstrated that when double layer capacitance is a predominant mechanism of charge storage, the degree of the pore space utilization for that storage can be increased by increasing the conductivity of the carbons. That active pore space utilization is defined as gravimetric capacitance per unit pore volume in pores smaller than 0.7 nm. Its magnitude is affected by conductivity of the carbon materials. The functional groups, besides pseudocapacitive contribution, increased the wettability and thus the degree of the pore space utilization. Graphene phase, owing to its conductivity, also took part in an insitu increase of the small pore accessibility and thus the capacitance of the composites via enhancing an electron transfer to small pores and thus imposing the reduction of groups blocking the pores for electrolyte ions.

26 CFR 25.2701-5 - Adjustments to mitigate double taxation.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 26 Internal Revenue 14 2010-04-01 2010-04-01 false Adjustments to mitigate double taxation. 25....2701-5 Adjustments to mitigate double taxation. (a) Reduction of transfer tax base—(1) In general. This... − $187,500). (g) Double taxation otherwise avoided. No reduction is available under this section if— (1...

26 CFR 25.2701-5 - Adjustments to mitigate double taxation.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 26 Internal Revenue 14 2011-04-01 2010-04-01 true Adjustments to mitigate double taxation. 25.2701... Adjustments to mitigate double taxation. (a) Reduction of transfer tax base—(1) In general. This section... − $187,500). (g) Double taxation otherwise avoided. No reduction is available under this section if— (1...

Double second toe transfer in congenital hand anomalies.

PubMed

Van Holder, C; Giele, H; Gilbert, A

1999-08-01

A series of 14 patients with congenital hand anomalies who received staged double second toe transfers to the same hand for restoration of function or form were reviewed retrospectively. There were three children with constriction ring syndrome, two with symbrachydactyly and nine with transverse absence (failure of formation). There were different indications, technical difficulties and results with the various anomalies. All transferred toes were mobile and sensate, and were reported to be of benefit in both function and appearance. However, secondary surgical procedures were required in all patients.

Hydrated Electron Transfer to Nucleobases in Aqueous Solutions Revealed by Ab Initio Molecular Dynamics Simulations.

PubMed

Zhao, Jing; Wang, Mei; Fu, Aiyun; Yang, Hongfang; Bu, Yuxiang

2015-08-03

We present an ab initio molecular dynamics (AIMD) simulation study into the transfer dynamics of an excess electron from its cavity-shaped hydrated electron state to a hydrated nucleobase (NB)-bound state. In contrast to the traditional view that electron localization at NBs (G/A/C/T), which is the first step for electron-induced DNA damage, is related only to dry or prehydrated electrons, and a fully hydrated electron no longer transfers to NBs, our AIMD simulations indicate that a fully hydrated electron can still transfer to NBs. We monitored the transfer dynamics of fully hydrated electrons towards hydrated NBs in aqueous solutions by using AIMD simulations and found that due to solution-structure fluctuation and attraction of NBs, a fully hydrated electron can transfer to a NB gradually over time. Concurrently, the hydrated electron cavity gradually reorganizes, distorts, and even breaks. The transfer could be completed in about 120-200 fs in four aqueous NB solutions, depending on the electron-binding ability of hydrated NBs and the structural fluctuation of the solution. The transferring electron resides in the π*-type lowest unoccupied molecular orbital of the NB, which leads to a hydrated NB anion. Clearly, the observed transfer of hydrated electrons can be attributed to the strong electron-binding ability of hydrated NBs over the hydrated electron cavity, which is the driving force, and the transfer dynamics is structure-fluctuation controlled. This work provides new insights into the evolution dynamics of hydrated electrons and provides some helpful information for understanding the DNA-damage mechanism in solution. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Measurement of the spectra of low energy electrons resulting from Auger transitions induced by the annihilation of low energy positrons implanted at The Ag (100) surface

NASA Astrophysics Data System (ADS)

Shastry, Karthik; Joglekar, Prasad; Weiss, A. H.; Fazleev, N. G.

2013-04-01

A few percent of positrons bound to a solid surface annihilate with core electrons resulting in highly excited atoms containing core holes. These core holes may be filled in an auto-ionizing process in which a less tightly bound electron drops into the hole and the energy difference transferred to an outgoing "Auger electron." Because the core holes are created by annihilation and not impact it is possible to use very low energy positron beams to obtain annihilation induced Auger signals. The Auger signals so obtained have little or none of the large impact induced secondary electron background that interferes with measurements of the low energy Auger spectra obtained using the much higher incident energies necessary when using electron or photon beams. Here we present the results of measurements of the energy spectrum of low energy electrons emitted as a result of Positron Annihilation Induce Auger Electron Emission [1] from a clean Ag (100) surface. The measurements were performed using the University of Texas Arlington Time of Flight Positron Annihilation induced Auger Electron Spectrometer (T-O-F-PAES) System [2]. A strong double peak was observed at ˜35eV corresponding to the N2VV and N3VV Auger transitions in agreement with previous PAES studies [3].

An Inner Membrane Cytochrome Required Only for Reduction of High Redox Potential Extracellular Electron Acceptors

PubMed Central

Levar, Caleb E.; Chan, Chi Ho; Mehta-Kolte, Misha G.

2014-01-01

ABSTRACT Dissimilatory metal-reducing bacteria, such as Geobacter sulfurreducens, transfer electrons beyond their outer membranes to Fe(III) and Mn(IV) oxides, heavy metals, and electrodes in electrochemical devices. In the environment, metal acceptors exist in multiple chelated and insoluble forms that span a range of redox potentials and offer different amounts of available energy. Despite this, metal-reducing bacteria have not been shown to alter their electron transfer strategies to take advantage of these energy differences. Disruption of imcH, encoding an inner membrane c-type cytochrome, eliminated the ability of G. sulfurreducens to reduce Fe(III) citrate, Fe(III)-EDTA, and insoluble Mn(IV) oxides, electron acceptors with potentials greater than 0.1 V versus the standard hydrogen electrode (SHE), but the imcH mutant retained the ability to reduce Fe(III) oxides with potentials of ≤−0.1 V versus SHE. The imcH mutant failed to grow on electrodes poised at +0.24 V versus SHE, but switching electrodes to −0.1 V versus SHE triggered exponential growth. At potentials of ≤−0.1 V versus SHE, both the wild type and the imcH mutant doubled 60% slower than at higher potentials. Electrodes poised even 100 mV higher (0.0 V versus SHE) could not trigger imcH mutant growth. These results demonstrate that G. sulfurreducens possesses multiple respiratory pathways, that some of these pathways are in operation only after exposure to low redox potentials, and that electron flow can be coupled to generation of different amounts of energy for growth. The redox potentials that trigger these behaviors mirror those of metal acceptors common in subsurface environments where Geobacter is found. PMID:25425235

An inner membrane cytochrome required only for reduction of high redox potential extracellular electron acceptors

DOE PAGES

Levar, Caleb E.; Chan, Chi Ho; Mehta-Kolte, Misha G.; ...

2014-10-28

Dissimilatory metal-reducing bacteria, such as Geobacter sulfurreducens, transfer electrons beyond their outer membranes to Fe(III) and Mn(IV) oxides, heavy metals, and electrodes in electrochemical devices. In the environment, metal acceptors exist in multiple chelated and insoluble forms that span a range of redox potentials and offer different amounts of available energy. Despite this, metal-reducing bacteria have not been shown to alter their electron transfer strategies to take advantage of these energy differences. Disruption of imcH, encoding an inner membrane c-type cytochrome, eliminated the ability of G. sulfurreducens to reduce Fe(III) citrate, Fe(III)-EDTA, and insoluble Mn(IV) oxides, electron acceptors with potentialsmore » greater than 0.1 V versus the standard hydrogen electrode (SHE), but the imcH mutant retained the ability to reduce Fe(III) oxides with potentials of ≤–0.1 V versus SHE. The imcH mutant failed to grow on electrodes poised at +0.24 V versus SHE, but switching electrodes to –0.1 V versus SHE triggered exponential growth. At potentials of ≤–0.1 V versus SHE, both the wild type and the imcH mutant doubled 60% slower than at higher potentials. Electrodes poised even 100 mV higher (0.0 V versus SHE) could not trigger imcH mutant growth. These results demonstrate that G. sulfurreducens possesses multiple respiratory pathways, that some of these pathways are in operation only after exposure to low redox potentials, and that electron flow can be coupled to generation of different amounts of energy for growth. Redox potentials that trigger these behaviors mirror those of metal acceptors common in subsurface environments where Geobacter is found.« less

The Self-Association of Graphane Is Driven by London Dispersion and Enhanced Orbital Interactions.

PubMed

Wang, Changwei; Mo, Yirong; Wagner, J Philipp; Schreiner, Peter R; Jemmis, Eluvathingal D; Danovich, David; Shaik, Sason

2015-04-14

We investigated the nature of the cohesive energy between graphane sheets via multiple CH···HC interactions, using density functional theory (DFT) including dispersion correction (Grimme's D3 approach) computations of [n]graphane σ dimers (n = 6-73). For comparison, we also evaluated the binding between graphene sheets that display prototypical π/π interactions. The results were analyzed using the block-localized wave function (BLW) method, which is a variant of ab initio valence bond (VB) theory. BLW interprets the intermolecular interactions in terms of frozen interaction energy (ΔE(F)) composed of electrostatic and Pauli repulsion interactions, polarization (ΔE(pol)), charge-transfer interaction (ΔE(CT)), and dispersion effects (ΔE(disp)). The BLW analysis reveals that the cohesive energy between graphane sheets is dominated by two stabilizing effects, namely intermolecular London dispersion and two-way charge transfer energy due to the σ(CH) → σ*(HC) interactions. The shift of the electron density around the nonpolar covalent C-H bonds involved in the intermolecular interaction decreases the C-H bond lengths uniformly by 0.001 Å. The ΔE(CT) term, which accounts for ∼15% of the total binding energy, results in the accumulation of electron density in the interface area between two layers. This accumulated electron density thus acts as an electronic "glue" for the graphane layers and constitutes an important driving force in the self-association and stability of graphane under ambient conditions. Similarly, the "double faced adhesive tape" style of charge transfer interactions was also observed among graphene sheets in which it accounts for ∼18% of the total binding energy. The binding energy between graphane sheets is additive and can be expressed as a sum of CH···HC interactions, or as a function of the number of C-H bonds.

Electron transfer and conformational change in complexes of trimethylamine dehydrogenase and electron transferring flavoprotein.

PubMed

Jones, Matthew; Talfournier, Francois; Bobrov, Anton; Grossmann, J Günter; Vekshin, Nikolai; Sutcliffe, Michael J; Scrutton, Nigel S

2002-03-08

The trimethylamine dehydrogenase-electron transferring flavoprotein (TMADH.ETF) electron transfer complex has been studied by fluorescence and absorption spectroscopies. These studies indicate that a series of conformational changes occur during the assembly of the TMADH.ETF electron transfer complex and that the kinetics of assembly observed with mutant TMADH (Y442F/L/G) or ETF (alpha R237A) complexes are much slower than are the corresponding rates of electron transfer in these complexes. This suggests that electron transfer does not occur in the thermodynamically most favorable state (which takes too long to form), but that one or more metastable states (which are formed more rapidly) are competent in transferring electrons from TMADH to ETF. Additionally, fluorescence spectroscopy studies of the TMADH.ETF complex indicate that ETF undergoes a stable conformational change (termed structural imprinting) when it interacts transiently with TMADH to form a second, distinct, structural form. The mutant complexes compromise imprinting of ETF, indicating a dependence on the native interactions present in the wild-type complex. The imprinted form of semiquinone ETF exhibits an enhanced rate of electron transfer to the artificial electron acceptor, ferricenium. Overall molecular conformations as probed by small-angle x-ray scattering studies are indistinguishable for imprinted and non-imprinted ETF, suggesting that changes in structure likely involve confined reorganizations within the vicinity of the FAD. Our results indicate a series of conformational events occur during the assembly of the TMADH.ETF electron transfer complex, and that the properties of electron transfer proteins can be affected lastingly by transient interaction with their physiological redox partners. This may have significant implications for our understanding of biological electron transfer reactions in vivo, because ETF encounters TMADH at all times in the cell. Our studies suggest that caution needs to be exercised in extrapolating the properties of in vitro interprotein electron transfer reactions to those occurring in vivo.

31 CFR 208.3 - Payment by electronic funds transfer.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 31 Money and Finance:Treasury 2 2011-07-01 2011-07-01 false Payment by electronic funds transfer... DISBURSEMENTS § 208.3 Payment by electronic funds transfer. Subject to § 208.4, and notwithstanding any other... electronic funds transfer. ...

48 CFR 18.124 - Electronic funds transfer.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 48 Federal Acquisition Regulations System 1 2011-10-01 2011-10-01 false Electronic funds transfer. 18.124 Section 18.124 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Electronic funds transfer. Electronic funds transfer payments may be waived for acquisitions to support...

48 CFR 18.124 - Electronic funds transfer.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 48 Federal Acquisition Regulations System 1 2013-10-01 2013-10-01 false Electronic funds transfer. 18.124 Section 18.124 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Electronic funds transfer. Electronic funds transfer payments may be waived for acquisitions to support...

31 CFR 208.3 - Payment by electronic funds transfer.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 31 Money and Finance:Treasury 2 2012-07-01 2012-07-01 false Payment by electronic funds transfer... DISBURSEMENTS § 208.3 Payment by electronic funds transfer. Subject to § 208.4, and notwithstanding any other... electronic funds transfer. ...

48 CFR 18.123 - Electronic funds transfer.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Electronic funds transfer. 18.123 Section 18.123 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Electronic funds transfer. Electronic funds transfer payments may be waived for acquisitions to support...

48 CFR 18.124 - Electronic funds transfer.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 48 Federal Acquisition Regulations System 1 2012-10-01 2012-10-01 false Electronic funds transfer. 18.124 Section 18.124 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Electronic funds transfer. Electronic funds transfer payments may be waived for acquisitions to support...

48 CFR 18.124 - Electronic funds transfer.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 48 Federal Acquisition Regulations System 1 2014-10-01 2014-10-01 false Electronic funds transfer. 18.124 Section 18.124 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Electronic funds transfer. Electronic funds transfer payments may be waived for acquisitions to support...

DOE Office of Scientific and Technical Information (OSTI.GOV)

Verheest, Frank, E-mail: frank.verheest@ugent.be; School of Chemistry and Physics, University of KwaZulu-Natal, Durban 4000; Hellberg, Manfred A., E-mail: hellberg@ukzn.ac.za

The propagation of arbitrary amplitude electron-acoustic solitons and double layers is investigated in a plasma containing cold positive ions, cool adiabatic and hot isothermal electrons, with the retention of full inertial effects for all species. For analytical tractability, the resulting Sagdeev pseudopotential is expressed in terms of the hot electron density, rather than the electrostatic potential. The existence domains for Mach numbers and hot electron densities clearly show that both rarefactive and compressive solitons can exist. Soliton limitations come from the cool electron sonic point, followed by the hot electron sonic point, until a range of rarefactive double layers occurs.more » Increasing the relative cool electron density further yields a switch to compressive double layers, which ends when the model assumptions break down. These qualitative results are but little influenced by variations in compositional parameters. A comparison with a Boltzmann distribution for the hot electrons shows that only the cool electron sonic point limit remains, giving higher maximum Mach numbers but similar densities, and a restricted range in relative hot electron density before the model assumptions are exceeded. The Boltzmann distribution can reproduce neither the double layer solutions nor the switch in rarefactive/compressive character or negative/positive polarity.« less

Photoinduced electron transfer from semiconductor quantum dots to metal oxide nanoparticles

PubMed Central

Tvrdy, Kevin; Frantsuzov, Pavel A.; Kamat, Prashant V.

2011-01-01

Quantum dot-metal oxide junctions are an integral part of next-generation solar cells, light emitting diodes, and nanostructured electronic arrays. Here we present a comprehensive examination of electron transfer at these junctions, using a series of CdSe quantum dot donors (sizes 2.8, 3.3, 4.0, and 4.2 nm in diameter) and metal oxide nanoparticle acceptors (SnO2, TiO2, and ZnO). Apparent electron transfer rate constants showed strong dependence on change in system free energy, exhibiting a sharp rise at small driving forces followed by a modest rise further away from the characteristic reorganization energy. The observed trend mimics the predicted behavior of electron transfer from a single quantum state to a continuum of electron accepting states, such as those present in the conduction band of a metal oxide nanoparticle. In contrast with dye-sensitized metal oxide electron transfer studies, our systems did not exhibit unthermalized hot-electron injection due to relatively large ratios of electron cooling rate to electron transfer rate. To investigate the implications of these findings in photovoltaic cells, quantum dot-metal oxide working electrodes were constructed in an identical fashion to the films used for the electron transfer portion of the study. Interestingly, the films which exhibited the fastest electron transfer rates (SnO2) were not the same as those which showed the highest photocurrent (TiO2). These findings suggest that, in addition to electron transfer at the quantum dot-metal oxide interface, other electron transfer reactions play key roles in the determination of overall device efficiency. PMID:21149685

Photoinduced electron transfer from semiconductor quantum dots to metal oxide nanoparticles.

PubMed

Tvrdy, Kevin; Frantsuzov, Pavel A; Kamat, Prashant V

2011-01-04

Quantum dot-metal oxide junctions are an integral part of next-generation solar cells, light emitting diodes, and nanostructured electronic arrays. Here we present a comprehensive examination of electron transfer at these junctions, using a series of CdSe quantum dot donors (sizes 2.8, 3.3, 4.0, and 4.2 nm in diameter) and metal oxide nanoparticle acceptors (SnO(2), TiO(2), and ZnO). Apparent electron transfer rate constants showed strong dependence on change in system free energy, exhibiting a sharp rise at small driving forces followed by a modest rise further away from the characteristic reorganization energy. The observed trend mimics the predicted behavior of electron transfer from a single quantum state to a continuum of electron accepting states, such as those present in the conduction band of a metal oxide nanoparticle. In contrast with dye-sensitized metal oxide electron transfer studies, our systems did not exhibit unthermalized hot-electron injection due to relatively large ratios of electron cooling rate to electron transfer rate. To investigate the implications of these findings in photovoltaic cells, quantum dot-metal oxide working electrodes were constructed in an identical fashion to the films used for the electron transfer portion of the study. Interestingly, the films which exhibited the fastest electron transfer rates (SnO(2)) were not the same as those which showed the highest photocurrent (TiO(2)). These findings suggest that, in addition to electron transfer at the quantum dot-metal oxide interface, other electron transfer reactions play key roles in the determination of overall device efficiency.

The Silicon Tracking System of the CBM experiment at FAIR

NASA Astrophysics Data System (ADS)

Teklishyn, Maksym

2018-03-01

The Silicon Tracking System (STS) is the central detector in the Compressed Baryonic Matter (CBM) experiment at FAIR. Operating in the 1Tm dipole magnetic field, the STS will enable pile-up free detection and momentum measurement of the charged particles originating from beam-target nuclear interactions at rates up to 10 MHz. The STS consists of 8 tracking stations based on double-sided silicon micro-strip sensors equipped with fast, self-triggering read-out electronics. With about two million read-out channels, the STS will deliver a high-rate stream of time-stamped data that is transferred to a computing farm for on-line event determination and analysis. The functional building block is a detector module consisting of a sensor, micro-cables and two front-end electronics boards. In this contribution, the development status of the STS components and the system integration is discussed and an outlook on the detector construction is given.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pereyra, Pedro, E-mail: pereyrapedro@gmail.com; Mendoza-Figueroa, M. G.

Transport properties of electrons through biased double barrier semiconductor structures with finite transverse width w{sub y}, in the presence of a channel-mixing transverse electric field E{sub T} (along the y-axis), were studied. We solve the multichannel Schrödinger equation using the transfer matrix method and transport properties, like the conductance G and the transmission coefficients T{sub ij} have been evaluated as functions of the electrons' energy E and the transverse and longitudinal (bias) electric forces, f{sub T} and f{sub b}. We show that peak-suppression effects appear, due to the applied bias. Similarly, coherent interference of wave-guide states induced by the transversemore » field is obtained. We show also that the coherent interference of resonant wave-guide states gives rise to resonant conductance, which can be tuned to produce broad resonant peaks, implying operation frequencies of the order of 10 THz or larger.« less

Free-electron laser spectroscopy in biology, medicine, and materials science; Proceedings of the Meeting, Los Angeles, CA, Jan. 22, 1993

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schwettman, H.A.

1993-01-01

Various papers on FEL spectroscopy in biology, medicine, and materials science are presented. Individual topics addressed include: Vanderbilt University FEL Center, FIR FEL facility at the University of California/Santa Barbara, FEL research facilities and opportunities at Duke, facilities at the Stanford Picosecond FEL Center, FIR nonlinear response of electrons in semiconductor nanostructures, FIR harmonic generation from semiconductor heterostructures, intrinsic response times of double-barrier resonant tunneling diodes at tetrahertz frequencies, semiconductor spectroscopy and ablation processes with the Vanderbilt FEL. Also discussed are: picosecond nonlinear optics in semiconductor quantum wells with the SCA FEL, excitation spectroscopy of thin-film disordered semiconductors, biophysical applicationmore » of FELs, FEL investigation of energy transfer in condensed phase systems, probing protein photochemistry and dynamics with ultrafast infrared spectroscopy, plasma ablation of hard tissues by FEL, FEL irradiation of the cornea.« less

Novel perovskite coating of strontium zirconate in Inconel substrate

NASA Astrophysics Data System (ADS)

Venkatesh, G.; Blessto, B.; Rao, C. Santhosh Kumar; Subramanian, R.; Berchmans, L. John

2018-02-01

Thermal Barrier Coatings (TBC) provides a low thermal conductivity barrier to heat transfer from the hot gas in the engine to the surface of the coated alloy component. SrZrO3 powder are prepared by Sol Gel synthesis method. The synthesized powder sample is characterized by X Ray Diffraction Technique (XRD), Scanning Electron Microscope (SEM) and Transmission Electron Microscope (TEM) and the results are interpreted. The Polycrystalline nature of SrZrO3 is confirmed and lattice spacing are determined in XRD. SEM shows sub-micron sized particles and a fringed pattern is observed in TEM. The IN718 specimen is Wire Cut and Sand Blasted. A SrZrO3 double layer is coated over the Inconel specimen through a Bond Coat made of NiCoCrAlY by Plasma spraying Process and also characterized. SEM analysis of the Coating shows diffusion of Fe, Sr into the substrate.

Measurements of the electric form factor of the neutron up to Q2=3.4 GeV2 using the reaction 3He(e,e'n)pp.

PubMed

Riordan, S; Abrahamyan, S; Craver, B; Kelleher, A; Kolarkar, A; Miller, J; Cates, G D; Liyanage, N; Wojtsekhowski, B; Acha, A; Allada, K; Anderson, B; Aniol, K A; Annand, J R M; Arrington, J; Averett, T; Beck, A; Bellis, M; Boeglin, W; Breuer, H; Calarco, J R; Camsonne, A; Chen, J P; Chudakov, E; Coman, L; Crowe, B; Cusanno, F; Day, D; Degtyarenko, P; Dolph, P A M; Dutta, C; Ferdi, C; Fernández-Ramírez, C; Feuerbach, R; Fraile, L M; Franklin, G; Frullani, S; Fuchs, S; Garibaldi, F; Gevorgyan, N; Gilman, R; Glamazdin, A; Gomez, J; Grimm, K; Hansen, J-O; Herraiz, J L; Higinbotham, D W; Holmes, R; Holmstrom, T; Howell, D; de Jager, C W; Jiang, X; Jones, M K; Katich, J; Kaufman, L J; Khandaker, M; Kelly, J J; Kiselev, D; Korsch, W; LeRose, J; Lindgren, R; Markowitz, P; Margaziotis, D J; Beck, S May-Tal; Mayilyan, S; McCormick, K; Meziani, Z-E; Michaels, R; Moffit, B; Nanda, S; Nelyubin, V; Ngo, T; Nikolenko, D M; Norum, B; Pentchev, L; Perdrisat, C F; Piasetzky, E; Pomatsalyuk, R; Protopopescu, D; Puckett, A J R; Punjabi, V A; Qian, X; Qiang, Y; Quinn, B; Rachek, I; Ransome, R D; Reimer, P E; Reitz, B; Roche, J; Ron, G; Rondon, O; Rosner, G; Saha, A; Sargsian, M M; Sawatzky, B; Segal, J; Shabestari, M; Shahinyan, A; Shestakov, Yu; Singh, J; Sirca, S; Souder, P; Stepanyan, S; Stibunov, V; Sulkosky, V; Tajima, S; Tobias, W A; Udias, J M; Urciuoli, G M; Vlahovic, B; Voskanyan, H; Wang, K; Wesselmann, F R; Vignote, J R; Wood, S A; Wright, J; Yao, H; Zhu, X

2010-12-31

The electric form factor of the neutron was determined from studies of the reaction 3He(e,e'n)pp in quasielastic kinematics in Hall A at Jefferson Lab. Longitudinally polarized electrons were scattered off a polarized target in which the nuclear polarization was oriented perpendicular to the momentum transfer. The scattered electrons were detected in a magnetic spectrometer in coincidence with neutrons that were registered in a large-solid-angle detector. More than doubling the Q2 range over which it is known, we find G(E)(n)=0.0236±0.0017(stat)±0.0026(syst), 0.0208±0.0024±0.0019, and 0.0147±0.0020±0.0014 for Q(2)=1.72, 2.48, and 3.41 GeV2, respectively.

Measurement of the neutron electric to magnetic form factor ratio at Q2=1.58  GeV2 using the reaction 3He[over →](e[over →],e'n)pp.

PubMed

Schlimme, B S; Achenbach, P; Ayerbe Gayoso, C A; Bernauer, J C; Böhm, R; Bosnar, D; Challand, Th; Distler, M O; Doria, L; Fellenberger, F; Fonvieille, H; Gómez Rodríguez, M; Grabmayr, P; Hehl, T; Heil, W; Kiselev, D; Krimmer, J; Makek, M; Merkel, H; Middleton, D G; Müller, U; Nungesser, L; Ott, B A; Pochodzalla, J; Potokar, M; Sánchez Majos, S; Sargsian, M M; Sick, I; Sirca, S; Weinriefer, M; Wendel, M; Yoon, C J

2013-09-27

A measurement of beam helicity asymmetries in the reaction 3He[over →](e[over →],e'n)pp is performed at the Mainz Microtron in quasielastic kinematics to determine the electric to magnetic form factor ratio of the neutron GEn/GMn at a four-momentum transfer Q2=1.58  GeV2. Longitudinally polarized electrons are scattered on a highly polarized 3He gas target. The scattered electrons are detected with a high-resolution magnetic spectrometer, and the ejected neutrons are detected with a dedicated neutron detector composed of scintillator bars. To reduce systematic errors, data are taken for four different target polarization orientations allowing the determination of GEn/GMn from a double ratio. We find μnGEn/GMn=0.250±0.058(stat)±0.017(syst).

Measurements of the Electric Form Factor of the Neutron up to Q2 = 3.4 GeV2 using the Reaction He-3(e,e'n)pp

DOE Office of Scientific and Technical Information (OSTI.GOV)

Riordan, Seamus; Craver, Brandon; Kelleher, Aidan

The electric form factor of the neutron was determined from studies of the reaction \\rea{} in quasi-elastic kinematics in Hall A at Jefferson Lab. Longitudinally polarized electrons were scattered off a polarized target in which the nuclear polarization was oriented perpendicular to the momentum transfer. The scattered electrons were detected in a magnetic spectrometer in coincidence with neutrons that were registered in a large-solid-angle detector. More than doubling themore » $Q^2$$-range over which it is known, we find \\GEn{}$$ = 0.0225 \\pm 0.0017 (stat) \\pm 0.0024 (syst)$, $$0.0200 \\pm 0.0023 \\pm 0.0018$$, and $$0.0142 \\pm 0.0019 \\pm 0.0013$$ for $Q^2$ = 1.72, 2.48, and 3.41~\\gevsq, respectively.« less

Ab initio density functional theory investigation of structural and electronic properties of double-walled silicon carbide nanotubes

NASA Astrophysics Data System (ADS)

Moradian, Rostam; Behzad, Somayeh; Chegel, Raad

2009-12-01

By using ab initio density functional theory, the structural and electronic properties of (n,n)@(11,11) double-walled silicon carbide nanotubes (SiCNTs) are investigated. Our calculations reveal the existence of an energetically favorable double-walled nanotube whose interwall distance is about 4.3 Å. Interwall spacing and curvature difference are found to be essential for the electronic states around the Fermi level.

Electron-helium S-wave model benchmark calculations. II. Double ionization, single ionization with excitation, and double excitation

NASA Astrophysics Data System (ADS)

Bartlett, Philip L.; Stelbovics, Andris T.

2010-02-01

The propagating exterior complex scaling (PECS) method is extended to all four-body processes in electron impact on helium in an S-wave model. Total and energy-differential cross sections are presented with benchmark accuracy for double ionization, single ionization with excitation, and double excitation (to autoionizing states) for incident-electron energies from threshold to 500 eV. While the PECS three-body cross sections for this model given in the preceding article [Phys. Rev. A 81, 022715 (2010)] are in good agreement with other methods, there are considerable discrepancies for these four-body processes. With this model we demonstrate the suitability of the PECS method for the complete solution of the electron-helium system.

Modular electron transfer circuits for synthetic biology

PubMed Central

Agapakis, Christina M

2010-01-01

Electron transfer is central to a wide range of essential metabolic pathways, from photosynthesis to fermentation. The evolutionary diversity and conservation of proteins that transfer electrons makes these pathways a valuable platform for engineered metabolic circuits in synthetic biology. Rational engineering of electron transfer pathways containing hydrogenases has the potential to lead to industrial scale production of hydrogen as an alternative source of clean fuel and experimental assays for understanding the complex interactions of multiple electron transfer proteins in vivo. We designed and implemented a synthetic hydrogen metabolism circuit in Escherichia coli that creates an electron transfer pathway both orthogonal to and integrated within existing metabolism. The design of such modular electron transfer circuits allows for facile characterization of in vivo system parameters with applications toward further engineering for alternative energy production. PMID:21468209

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rakhman, A.; Hafez, Mohamed A.; Nanda, Sirish K.

Here, a high-finesse Fabry-Perot cavity with a frequency-doubled continuous wave green laser (532 nm) has been built and installed in Hall A of Jefferson Lab for high precision Compton polarimetry. The infrared (1064 nm) beam from a ytterbium-doped fiber amplifier seeded by a Nd:YAG nonplanar ring oscillator laser is frequency doubled in a single-pass periodically poled MgO:LiNbO 3 crystal. The maximum achieved green power at 5 W infrared pump power is 1.74 W with a total conversion efficiency of 34.8%. The green beam is injected into the optical resonant cavity and enhanced up to 3.7 kW with a corresponding enhancementmore » of 3800. The polarization transfer function has been measured in order to determine the intra-cavity circular laser polarization within a measurement uncertainty of 0.7%. The PREx experiment at Jefferson Lab used this system for the first time and achieved 1.0% precision in polarization measurements of an electron beam with energy and current of 1.0 GeV and 50 μA.« less

Enhanced photoelectrical performance of dye-sensitized solar cells with double-layer TiO2 on perovskite SrTiO3 substrate

NASA Astrophysics Data System (ADS)

Liu, Qiuhong; Sun, Qiong; Zhang, Min; Li, Yang; Zhao, Mei; Dong, Lifeng

2016-04-01

In this research, perovskite SrTiO3 particles are synthesized by a hydrothermal method, and TiO2 with a double-layer structure is grown on the SrTiO3 surface by a hydrolysis-condensation process. Structural characterizations reveal that TiO2 comprises of two phases: anatase film at the bottom and single-crystal rutile nanorods grown along the [110] direction on top. The TiO2-SrTiO3 composite film is investigated as photoanode material for dye-sensitized solar cells. In comparison with pure TiO2 and SrTiO3, the composite photoanode shows a much better performance in photoelectric conversion efficiency (1.35 %), which is about 2 and 100 times as efficient as pure TiO2 and SrTiO3, respectively. This indicates that the composite structure can facilitate charge carrier transfer and reduce electron-hole recombination to enhance photoelectrical properties of TiO2-based photoanode materials.

Resonant and nondissipative tunneling in independently contacted graphene structures

NASA Astrophysics Data System (ADS)

Vasko, F. T.

2013-02-01

The tunneling processes between independently contacted graphene sheets separated by thin insulator are restricted by the momentum and energy conservation laws. Because of this, both dissipative tunneling transitions, with momentum transfer due to disorder scattering, and nondissipative regime of tunneling, which appears due to intersection of electron and hole branches of energy spectrum, must be taken into account. The tunneling current density is calculated for the graphene-boron nitride-graphene layers, which is described by the tight-binding approach, and for the predominant momentum scattering by static disorder. Dependencies of current on concentrations in top and bottom graphene layers, which are governed by the voltages applied through independent contacts and gates, are considered for the back- and double-gated structures. The current-voltage characteristics of the back-gated structure are in agreement with the recent experiment [ScienceSCIEAS0036-807510.1126/science.1218461 335, 947 (2012)]. For the double-gated structures, the resonant dissipative tunneling causes a 10-fold enhancement of response which is important for transistor applications.

Sequential Double lonization: The Timing of Release

NASA Astrophysics Data System (ADS)

Pfeiffer, A.

2011-05-01

The timing of electron release in strong field double ionization poses great challenges both for conceptual definition and for conducting experimental measurement. Here we present coincidence momentum measurements of the doubly charged ion and of the two electrons arising from double ionization of Argon using elliptically (close to circularly) polarized laser pulses. Based on a semi-classical model, the ionization times are calculated from the measured electron momenta across a large intensity range. Exploiting the attoclock technique we have direct access to timings on a coarse and on a fine scale, similar to the hour and the minute hand of a clock. In our attoclock, the magnitude of the electron momenta follows the envelope of the laser pulse and gives a coarse timing for the electron releases (the hour hand), while the fine timing (the minute hand) is provided by the emission angle of the electrons. The first of our findings is that due to depletion the averaged ionization time moves towards the beginning of the pulse with increasing intensity, confirming the results of Maharjan et al., and that the ion momentum distribution projected onto the minor polarization axis shows a bifurcation from a 3-peak to a 4-peak structure. This effect can be fully understood by modeling the process semi-classically in the independent electron approximation following the simple man's model. The ionization time measurement performed with the attoclock shows that the release time of the first electron is in good agreement with the semi-classical simulation performed on the basis of Sequential Double lonization (SDI), whereas the ionization of the second electron occurs significantly earlier than predicted. This observation suggests that electron correlation and other Non-Sequential Double lonization (NSDI) mechanisms may play an important role also in the case of strong field double ionization by close-to-circularly polarized laser pulses. The timing of electron release in strong field double ionization poses great challenges both for conceptual definition and for conducting experimental measurement. Here we present coincidence momentum measurements of the doubly charged ion and of the two electrons arising from double ionization of Argon using elliptically (close to circularly) polarized laser pulses. Based on a semi-classical model, the ionization times are calculated from the measured electron momenta across a large intensity range. Exploiting the attoclock technique we have direct access to timings on a coarse and on a fine scale, similar to the hour and the minute hand of a clock. In our attoclock, the magnitude of the electron momenta follows the envelope of the laser pulse and gives a coarse timing for the electron releases (the hour hand), while the fine timing (the minute hand) is provided by the emission angle of the electrons. The first of our findings is that due to depletion the averaged ionization time moves towards the beginning of the pulse with increasing intensity, confirming the results of Maharjan et al., and that the ion momentum distribution projected onto the minor polarization axis shows a bifurcation from a 3-peak to a 4-peak structure. This effect can be fully understood by modeling the process semi-classically in the independent electron approximation following the simple man's model. The ionization time measurement performed with the attoclock shows that the release time of the first electron is in good agreement with the semi-classical simulation performed on the basis of Sequential Double lonization (SDI), whereas the ionization of the second electron occurs significantly earlier than predicted. This observation suggests that electron correlation and other Non-Sequential Double lonization (NSDI) mechanisms may play an important role also in the case of strong field double ionization by close-to-circularly polarized laser pulses. In collaboration with C. Cirelli and M. Smolarski, Physics Department, ETH Zurich, 8093 Zurich, Switzerland; R. Doerner, Institut fiir Kernphysik, Johann Wolfgang Goethe Universitat, 60438 Frankfurt am Main, Germany; and U. Keller, ETH Zurich.

Electrochemical control over photoinduced electron transfer and trapping in CdSe-CdTe quantum-dot solids.

PubMed

Boehme, Simon C; Walvis, T Ardaan; Infante, Ivan; Grozema, Ferdinand C; Vanmaekelbergh, Daniël; Siebbeles, Laurens D A; Houtepen, Arjan J

2014-07-22

Understanding and controlling charge transfer between different kinds of colloidal quantum dots (QDs) is important for devices such as light-emitting diodes and solar cells and for thermoelectric applications. Here we study photoinduced electron transfer between CdTe and CdSe QDs in a QD film. We find that very efficient electron trapping in CdTe QDs obstructs electron transfer to CdSe QDs under most conditions. Only the use of thiol ligands results in somewhat slower electron trapping; in this case the competition between trapping and electron transfer results in a small fraction of electrons being transferred to CdSe. However, we demonstrate that electron trapping can be controlled and even avoided altogether by using the unique combination of electrochemistry and transient absorption spectroscopy. When the Fermi level is raised electrochemically, traps are filled with electrons and electron transfer from CdTe to CdSe QDs occurs with unity efficiency. These results show the great importance of knowing and controlling the Fermi level in QD films and open up the possibility of studying the density of trap states in QD films as well as the systematic investigation of the intrinsic electron transfer rates in donor-acceptor films.

NMR studies of double proton transfer in hydrogen bonded cyclic N,N'-diarylformamidine dimers: conformational control, kinetic HH/HD/DD isotope effects and tunneling.

PubMed

Lopez, Juan Miguel; Männle, Ferdinand; Wawer, Iwona; Buntkowsky, Gerd; Limbach, Hans-Heinrich

2007-08-28

Using dynamic NMR spectroscopy, the kinetics of the degenerate double proton transfer in cyclic dimers of polycrystalline (15)N,(15)N'-di-(4-bromophenyl)-formamidine (DBrFA) have been studied including the kinetic HH/HD/DD isotope effects in a wide temperature range. This transfer is controlled by intermolecular interactions, which in turn are controlled by the molecular conformation and hence the molecular structure. At low temperatures, rate constants were determined by line shape analysis of (15)N NMR spectra obtained using cross-polarization (CP) and magic angle spinning (MAS). At higher temperatures, in the microsecond time scale, rate constants and kinetic isotope effects were obtained by a combination of longitudinal (15)N and (2)H relaxation measurements. (15)N CPMAS line shape analysis was also employed to study the non-degenerate double proton transfer of polycrystalline (15)N,(15)N'-diphenyl-formamidine (DPFA). The kinetic results are in excellent agreement with the kinetics of DPFA and (15)N,(15)N'-di-(4-fluorophenyl)-formamidine (DFFA) studied previously for solutions in tetrahydrofuran. Two large HH/HD and HD/DD isotope effects are observed in the whole temperature range which indicates a concerted double proton transfer mechanism in the domain of the reaction energy surface. The Arrhenius curves are non-linear indicating a tunneling mechanism. Arrhenius curve simulations were performed using the Bell-Limbach tunneling model. The role of the phenyl group conformation and hydrogen bond compression on the barrier of the proton transfer is discussed.

A practical theoretical formalism for atomic multielectron processes: direct multiple ionization by a single auger decay or by impact of a single electron or photon

NASA Astrophysics Data System (ADS)

Liu, Pengfei; Zeng, Jiaolong; Yuan, Jianmin

2018-04-01

Multiple electron processes occur widely in atoms, molecules, clusters, and condensed matters when they are interacting with energetic particles or intense laser fields. Direct multielectron processes (DMEP) are the most complicated among the general multiple electron processes and are the most difficult to describe theoretically. In this work, a unified and accurate theoretical formalism is proposed on the DMEP of atoms including the multiple auger decay and multiple ionization by an impact of a single electron or a single photon based on the atomic collision theory described by a correlated many-body Green's function. Such a practical treatment is made possible by taking consideration of the different coherence features of the atoms (matter waves) in the initial and final states. We first explain how the coherence characteristics of the ejected continuum electrons is largely destructed, by taking the electron impact direct double ionization process as an example. The direct double ionization process is completely different from the single ionization where the complete interference can be maintained. The detailed expressions are obtained for the energy correlations among the continuum electrons and energy resolved differential and integral cross sections according to the separation of knock-out (KO) and shake-off (SO) mechanisms for the electron impact direct double ionization, direct double and triple auger decay, and double and triple photoionization (TPI) processes. Extension to higher order DMEP than triple ionization is straight forward by adding contributions of the following KO and SO processes. The approach is applied to investigate the electron impact double ionization processes of C+, N+, and O+, the direct double and triple auger decay of the K-shell excited states of C+ 1s2{s}22{p}2{}2D and {}2P, and the double and TPI of lithium. Comparisons with the experimental and other theoretical investigations wherever available in the literature show that our theoretical formalism is accurate and effective in treating the atomic multielectron processes.

Hot-electron transfer in quantum-dot heterojunction films.

PubMed

Grimaldi, Gianluca; Crisp, Ryan W; Ten Brinck, Stephanie; Zapata, Felipe; van Ouwendorp, Michiko; Renaud, Nicolas; Kirkwood, Nicholas; Evers, Wiel H; Kinge, Sachin; Infante, Ivan; Siebbeles, Laurens D A; Houtepen, Arjan J

2018-06-13

Thermalization losses limit the photon-to-power conversion of solar cells at the high-energy side of the solar spectrum, as electrons quickly lose their energy relaxing to the band edge. Hot-electron transfer could reduce these losses. Here, we demonstrate fast and efficient hot-electron transfer between lead selenide and cadmium selenide quantum dots assembled in a quantum-dot heterojunction solid. In this system, the energy structure of the absorber material and of the electron extracting material can be easily tuned via a variation of quantum-dot size, allowing us to tailor the energetics of the transfer process for device applications. The efficiency of the transfer process increases with excitation energy as a result of the more favorable competition between hot-electron transfer and electron cooling. The experimental picture is supported by time-domain density functional theory calculations, showing that electron density is transferred from lead selenide to cadmium selenide quantum dots on the sub-picosecond timescale.

Aminoacyl transfer from an adenylate anhydride to polyribonucleotides

NASA Technical Reports Server (NTRS)

Weber, A. L.; Lacey, J. C., Jr.

1975-01-01

Imidazole catalysis of phenylalanyl transfer from phenylalanine adenylate to hydroxyl groups of homopolyribonucleotides is studied as a possible chemical model of biochemical aminoacylation of transfer RNA (tRNA). The effect of pH on imidazole-catalyzed transfer of phenylalanyl residues to poly(U) and poly(A) double helix strands, the number of peptide linkages and their lability to base and neutral hydroxylamine, and the nature of adenylate condensation products are investigated. The chemical model entertained exhibits a constraint by not acylating the hydroxyl groups of polyribonucleotides in a double helix. The constraint is consistent with selective biochemical aminoacylation at the tRNA terminus. Interest in imidazole as a model of histidine residue in protoenzymes participating in prebiotic aminoacyl transfer to polyribonucleotides, and in rendering the tRNA a more efficient adaptor, is indicated.

The extraction of the spin structure function, g2 (and g1) at low Bjorken x

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ndukum, Luwani Z.

2015-08-01

The Spin Asymmetries of the Nucleon Experiment (SANE) used the Continuous Electron Beam Accelerator Facility at Jefferson Laboratory in Newport News, VA to investigate the spin structure of the proton. The experiment measured inclusive double polarization electron asymmetries using a polarized electron beam, scattered off a solid polarized ammonia target with target polarization aligned longitudinal and near transverse to the electron beam, allowing the extraction of the spin asymmetries A1 and A2, and spin structure functions g1 and g2. Polarized electrons of energies of 4.7 and 5.9 GeV were used. The scattered electrons were detected by a novel, non-magnetic arraymore » of detectors observing a four-momentum transfer range of 2.5 to 6.5 GeV*V. This document addresses the extraction of the spin asymmetries and spin structure functions, with a focus on spin structure function, g2 (and g1) at low Bjorken x. The spin structure functions were measured as a function of x and W in four Q square bins. A full understanding of the low x region is necessary to get clean results for SANE and extend our understanding of the kinematic region at low x.« less

FROM THE HISTORY OF PHYSICS: Electrolysis and surface phenomena. To the bicentenary of Volta's publication on the first direct-current source

NASA Astrophysics Data System (ADS)

Gokhshtein, Aleksandr Ya

2000-07-01

The development of knowledge about electric current, potential, and the conversion of energy at the interface between electronic- and ionic-conductivity phases is briefly reviewed. Although soon after its discovery it was realized that electric current is the motion of charged particles, the double-layer field promoting charge transfer through the interface was considered for a long time to be as uniform as in a capacitor. One-dimensional ion discharge theory failed to explain the observed dependence of the current on the potential jump across the interface. The spatial segmentation of energy in the double layer due to the quantum evolution of the layer's periphery puts a limit on the charge transfer work the field may perform locally, and creates conditions for the ionic atmosphere being spontaneously compressed after the critical potential jump has been reached. A discrete interchange of states also occurs due to the adsorption of discharged particles and corresponds to the consecutive exclusion of the d-wave function nodes of metal surface atoms, the exclusion manifesting itself in the larger longitudinal and smaller lateral sizes of the atomic orbital. The elastic extension of the metal surface reduces the d-function overlap thus intensifying adsorption. Advances in experimentation, in particular new techniques capable of detecting alternating surface tension of solids, enabled these and some other phenomena to be observed.

14 CFR 1274.931 - Electronic funds transfer payment methods.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 14 Aeronautics and Space 5 2011-01-01 2010-01-01 true Electronic funds transfer payment methods... COOPERATIVE AGREEMENTS WITH COMMERCIAL FIRMS Other Provisions and Special Conditions § 1274.931 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods July 2002 Payments under this...

77 FR 40459 - Electronic Fund Transfers (Regulation E); Correction

Federal Register 2010, 2011, 2012, 2013, 2014

2012-07-10

... Electronic Fund Transfers (Regulation E); Correction AGENCY: Bureau of Consumer Financial Protection. ACTION... published the Final Rule (77 FR 6194), which implements the Electronic Fund Transfer Act, and the official... Sec. 1005.3(a) in the interim final rule, Electronic Fund Transfers (Regulation E), published on...

14 CFR 1274.931 - Electronic funds transfer payment methods.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 14 Aeronautics and Space 5 2013-01-01 2013-01-01 false Electronic funds transfer payment methods... COOPERATIVE AGREEMENTS WITH COMMERCIAL FIRMS Other Provisions and Special Conditions § 1274.931 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods July 2002 Payments under this...

Two-dimensional quasi-double-layers in two-electron-temperature, current-free plasmas

NASA Astrophysics Data System (ADS)

Merino, Mario; Ahedo, Eduardo

2013-02-01

The expansion of a plasma with two disparate electron populations into vacuum and channeled by a divergent magnetic nozzle is analyzed with an axisymmetric model. The purpose is to study the formation and two-dimensional shape of a current-free double-layer in the case when the electric potential steepening can still be treated within the quasineutral approximation. The properties of this quasi-double-layer are investigated in terms of the relative fraction of the high-energy electron population, its radial distribution when injected into the nozzle, and the geometry and intensity of the applied magnetic field. The two-dimensional double layer presents a curved shape, which is dependent on the natural curvature of the equipotential lines in a magnetically expanded plasma and the particular radial distribution of high-energy electrons at injection. The double layer curvature increases the higher the nozzle divergence is, the lower the magnetic strength is, and the more peripherally hot electrons are injected. A central application of the study is the operation of a helicon plasma thruster in space. To this respect, it is shown that the curvature of the double layer does not increment the thrust, it does not modify appreciably the downstream divergence of the plasma beam, but it increases the magnetic-to-pressure thrust ratio. The present study does not attempt to cover current-free double layers involving plasmas with multiple populations of positive ions.

A unifying model for non-adiabatic coupling at metallic surfaces beyond the local harmonic approximation: From vibrational relaxation to scanning tunneling microscopy

NASA Astrophysics Data System (ADS)

Tremblay, Jean Christophe

2013-06-01

A model for treating excitation and relaxation of adsorbates at metallic surfaces induced by non-adiabatic coupling is developed. The derivation is based on the concept of resonant electron transfer, where the adsorbate serves as a molecular bridge for the inelastic transition between an electron source and a sink. In this picture, energy relaxation and scanning tunneling microscopy (STM) at metallic surfaces are treated on an equal footing as a quasi-thermal process. The model goes beyond the local harmonic approximation and allows for an unbiased description of floppy systems with multiple potential wells. Further, the limitation of the product ansatz for the vibronic wave function to include the position-dependence of the non-adiabatic couplings is avoided by explicitly enforcing detailed balance. The theory is applied to the excitation of hydrogen on palladium, which has multiple local potential minima connected by low energy barriers. The main aspects investigated are the lifetimes of adsorbate vibrations in different adsorption sites, as well as the dependence of the excitation, response, and transfer rates on an applied potential bias. The excitation and relaxation simulations reveal intricate population dynamics that depart significantly from the simplistic tunneling model in a truncated harmonic potential. In particular, the population decay from an initially occupied local minimum induced by the contact with an STM tip is found to be better described by a double exponential. The two rates are interpreted as a response to the system perturbation and a transfer rate following the perturbation. The transfer rate is found to obey a power law, as was the case in previous experimental and theoretical work.

14 CFR § 1260.69 - Electronic funds transfer payment methods.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 14 Aeronautics and Space 5 2014-01-01 2014-01-01 false Electronic funds transfer payment methods... GRANTS AND COOPERATIVE AGREEMENTS General Special Conditions § 1260.69 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods October 2000 (a) Payments under this grant will be made...

14 CFR 1260.69 - Electronic funds transfer payment methods.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 14 Aeronautics and Space 5 2013-01-01 2013-01-01 false Electronic funds transfer payment methods... COOPERATIVE AGREEMENTS General Special Conditions § 1260.69 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods October 2000 (a) Payments under this grant will be made by the...

14 CFR 1260.69 - Electronic funds transfer payment methods.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 14 Aeronautics and Space 5 2012-01-01 2012-01-01 false Electronic funds transfer payment methods... COOPERATIVE AGREEMENTS General Special Conditions § 1260.69 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods October 2000 (a) Payments under this grant will be made by the...

14 CFR 1260.69 - Electronic funds transfer payment methods.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 14 Aeronautics and Space 5 2011-01-01 2010-01-01 true Electronic funds transfer payment methods... COOPERATIVE AGREEMENTS General Special Conditions § 1260.69 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods October 2000 (a) Payments under this grant will be made by the...

Single-Photon, Double Photodetachment of Nickel Phthalocyanine Tetrasulfonic Acid 4- Anions.

PubMed

Daly, Steven; Girod, Marion; Vojkovic, Marin; Giuliani, Alexandre; Antoine, Rodolphe; Nahon, Laurent; O'Hair, Richard A J; Dugourd, Philippe

2016-07-07

Single-photon, two-electron photodetachment from nickel phthalocyanine tetrasulfonic acid tetra anions, [NiPc](4-), was examined in the gas-phase using a linear ion trap coupled to the DESIRS VUV beamline of the SOLEIL Synchrotron. This system was chosen since it has a low detachment energy, known charge localization, and well-defined geometrical and electronic structures. A threshold for two-electron loss is observed at 10.2 eV, around 1 eV lower than previously observed double detachment thresholds on multiple charged protein anions. The photodetachment energy of [NiPc](4-) has been previously determined to be 3.5 eV and the photodetachment energy of [NiPc](3-•) is determined in this work to be 4.3 eV. The observed single photon double electron detachment threshold is hence 5.9 eV higher than the energy required for sequential single electron loss. Possible mechanisms are for double photodetachment are discussed. These observations pave the way toward new, exciting experiments for probing double photodetachment at relatively low energies, including correlation measurements on emitted photoelectrons.

Saturated fluorescence measurements of the hydroxyl radical in laminar high-pressure flames

NASA Technical Reports Server (NTRS)

Carter, Campbell D.; King, Galen B.; Laurendeau, Normand M.

1990-01-01

The efficacy of laser saturated fluorescence (LSF) for OH concentration measurements in high pressure flames was studied theoretically and experimentally. Using a numerical model describing the interaction of hydroxyl with nonuniform laser excitation, the effect of pressure on the validity of the balanced cross-rate model was studied along with the sensitivity of the depopulation of the laser-coupled levels to the ratio of rate coefficients describing: (1) electronic quenching to (sup 2) Sigma (+) (v double prime greater than 0), and (2) vibrational relaxation from v double prime greater than 0 to v double prime = 0. At sufficiently high pressures and near-saturated conditions, the total population of the laser-coupled levels reaches an asymptotic value, which is insensitive to the degree of saturation. When the ratio of electronic quenching to vibrational relaxation is small and the rate of coefficients for rotational transfer in the ground and excited electronic states are nearly the same, the balanced cross-rate model remains a good approximation for all pressures. When the above ratio is large, depopulation of the laser-coupled levels becomes significant at high pressures, and thus the balanced cross-rate model no longer holds. Under these conditions, however, knowledge of the depletion of the laser-coupled levels can be used to correct the model. A combustion facility for operation up to 20 atm was developed to allow LSF measurements of OH in high pressure flames. Using this facility, partial saturation in laminar high pressure (less than or equal to 12.3 atm) C2H6/O2/N2 flames was achieved. To evaluate the limits of the balanced cross-rate model, absorption and calibrated LSF measurements at 3.1 and 6.1 atm were compared. The fluorescence voltages were calibrated with absorption measurements in an atmospheric flame and corrected for their finite sensitivity to quenching with: (1) estimated quenching rate coefficients, and (2) an in situ measurement from a technique employing two fluorescence detection geometries.

Car-Parrinello molecular dynamics study of the intramolecular vibrational mode-sensitive double proton-transfer mechanisms in porphycene.

PubMed

Walewski, Łukasz; Waluk, Jacek; Lesyng, Bogdan

2010-02-18

Car-Parrinello molecular dynamics simulations were carried out to help interpret proton-transfer processes observed experimentally in porphycene under thermodynamic equilibrium conditions (NVT ensemble) as well as during selective, nonequilibrium vibrational excitations of the molecular scaffold (NVE ensemble). In the NVT ensemble, the population of the trans form in the gas phase at 300 K is 96.5%, and of the cis-1 form is 3.5%, in agreement with experimental data. Approximately 70% of the proton-transfer events are asynchronous double proton transfers. According to the high resolution simulation data they consist of two single transfer events that rapidly take place one after the other. The average time-period between the two consecutive jumps is 220 fs. The gas phase reaction rate estimate at 300 K is 3.6 ps, which is comparable to experimentally determined rates. The NVE ensemble nonequilibrium ab initio MD simulations, which correspond to selective vibrational excitations of the molecular scaffold generated with high resolution laser spectroscopy techniques, exhibit an enhancing property of the 182 cm(-1) vibrational mode and an inhibiting property of the 114 cm(-1) one. Both of them influence the proton-transfer rate, in qualitative agreement with experimental findings. Our ab initio simulations provide new predictions regarding the influence of double-mode vibrational excitations on proton-transfer processes. They can help in setting up future programmable spectroscopic experiments for the proton-transfer translocations.

Advanced Doubling Adding Method for Radiative Transfer in Planetary Atmospheres

NASA Astrophysics Data System (ADS)

Liu, Quanhua; Weng, Fuzhong

2006-12-01

The doubling adding method (DA) is one of the most accurate tools for detailed multiple-scattering calculations. The principle of the method goes back to the nineteenth century in a problem dealing with reflection and transmission by glass plates. Since then the doubling adding method has been widely used as a reference tool for other radiative transfer models. The method has never been used in operational applications owing to tremendous demand on computational resources from the model. This study derives an analytical expression replacing the most complicated thermal source terms in the doubling adding method. The new development is called the advanced doubling adding (ADA) method. Thanks also to the efficiency of matrix and vector manipulations in FORTRAN 90/95, the advanced doubling adding method is about 60 times faster than the doubling adding method. The radiance (i.e., forward) computation code of ADA is easily translated into tangent linear and adjoint codes for radiance gradient calculations. The simplicity in forward and Jacobian computation codes is very useful for operational applications and for the consistency between the forward and adjoint calculations in satellite data assimilation.

Interfacial hydration, dynamics and electron transfer: multi-scale ET modeling of the transient [myoglobin, cytochrome b5] complex.

PubMed

Keinan, Shahar; Nocek, Judith M; Hoffman, Brian M; Beratan, David N

2012-10-28

Formation of a transient [myoglobin (Mb), cytochrome b(5) (cyt b(5))] complex is required for the reductive repair of inactive ferri-Mb to its functional ferro-Mb state. The [Mb, cyt b(5)] complex exhibits dynamic docking (DD), with its cyt b(5) partner in rapid exchange at multiple sites on the Mb surface. A triple mutant (Mb(3M)) was designed as part of efforts to shift the electron-transfer process to the simple docking (SD) regime, in which reactive binding occurs at a restricted, reactive region on the Mb surface that dominates the docked ensemble. An electrostatically-guided brownian dynamics (BD) docking protocol was used to generate an initial ensemble of reactive configurations of the complex between unrelaxed partners. This ensemble samples a broad and diverse array of heme-heme distances and orientations. These configurations seeded all-atom constrained molecular dynamics simulations (MD) to generate relaxed complexes for the calculation of electron tunneling matrix elements (T(DA)) through tunneling-pathway analysis. This procedure for generating an ensemble of relaxed complexes combines the ability of BD calculations to sample the large variety of available conformations and interprotein distances, with the ability of MD to generate the atomic level information, especially regarding the structure of water molecules at the protein-protein interface, that defines electron-tunneling pathways. We used the calculated T(DA) values to compute ET rates for the [Mb(wt), cyt b(5)] complex and for the complex with a mutant that has a binding free energy strengthened by three D/E → K charge-reversal mutations, [Mb(3M), cyt b(5)]. The calculated rate constants are in agreement with the measured values, and the mutant complex ensemble has many more geometries with higher T(DA) values than does the wild-type Mb complex. Interestingly, water plays a double role in this electron-transfer system, lowering the tunneling barrier as well as inducing protein interface remodeling that screens the repulsion between the negatively-charged propionates of the two hemes.

Effect of metal shielding on a wireless power transfer system

NASA Astrophysics Data System (ADS)

Li, Jiacheng; Huang, Xueliang; Chen, Chen; Tan, Linlin; Wang, Wei; Guo, Jinpeng

2017-05-01

In this paper, the effect of non-ferromagnetic metal shielding (NFMS) material on the resonator of wireless power transfer (WPT) is studied by modeling, simulation and experimental analysis. And, the effect of NFMS material on the power transfer efficiency (PTE) of WPT systems is investigated by circuit model. Meanwhile, the effect of ferromagnetic metal shielding material on the PTE of WPT systems is analyzed through simulation. A double layer metal shield structure is designed. Experimental results demonstrate that by applying the novel double layer metal shielding method, the system PTE increases significantly while the electromagnetic field of WPT systems declines dramatically.

The influence of dielectric relaxation on intramolecular electron transfer

NASA Astrophysics Data System (ADS)

Heitele, H.; Michel-Beyerle, M. E.; Finckh, P.

1987-07-01

An unusually strong temperature dependence on the intramolecular electron-transfer rate has been observed for bridged donor-acceptor compounds in propylene glycol solution. In the frame of recent electron-transfer theories this effect reflects the influence of dielectric relaxation dynamics on electron transfer. With increasing dielectric relaxation time a smooth transition from non-adiabatic to solvent-controlled adiabatic behaviour is observed. The electron transfer rate in the solvent-controlled adiabatic limit is dominated by an inhomogeneous distribution of relaxation times.

Dissipation kinetics of beta-cyfluthrin and imidacloprid in tea and their transfer from processed tea to infusion.

PubMed

Paramasivam, M; Deepa, M; Selvi, C; Chandrasekaran, S

2017-10-01

Dissipation kinetics of mixed formulation consisting beta-cyfluthrin and imidacloprid in tea crop under an open field ecosystem was investigated. The mixed formulation was applied on tea plant at recommended (27 + 63) and double the recommended (54 + 126g a.i./ha) dose and residues were determined using gas chromatography-electron capture detector and high performance liquid chromatography-photodiode array detector for beta-cyfluthrin and imidacloprid, respectively. The limit of quantification of analytical method was 0.05µg/g and the average recoveries were ranged from 88.36% to 103.49% with relative standard deviations of less than 6% at three spiked levels. The experimental results showed that in the green tea leaves imidacloprid dissipated faster than beta-cyfluthrin with the half-life ranging between 1.20-1.39 and 2.89-3.15days, respectively. The beta-cyfluthrin residues present in the processed tea not transferred into the tea infusion during the infusion process and imidacloprid transferred in the range 43.12-49.7%. On the basis of the transfer of residues from processed tea to infusion, a waiting period of 17 days for tea plucking after pesticide application at recommended dose may be suggested. Copyright © 2017 Elsevier Inc. All rights reserved.

Understanding Rubredoxin Redox Sites by Density Functional Theory Studies of Analogues

PubMed Central

Luo, Yan; Niu, Shuqiang; Ichiye, Toshiko

2012-01-01

Determining the redox energetics of redox site analogues of metalloproteins is essential in unraveling the various contributions to electron transfer properties of these proteins. Since studies of the [4Fe-4S] analogues show that the energies are dependent on the ligand dihedral angles, broken symmetry density functional theory (BS-DFT) with the B3LYP functional and double-ζ basis sets calculations of optimized geometries and electron detachment energies of [1Fe] rubredoxin analogues are compared to crystal structures and gas-phase photoelectron spectroscopy data, respectively, for [Fe(SCH3)4]0/1-/2-, [Fe(S2-o-xyl2)]0/1-/2-, and Na+[Fe(S2-o-xyl)2]1-/2- in different conformations. In particular, the study of Na+[Fe(S2-o-xyl)2]1-/2- is the only direct comparison of calculated and experimental gas phase detachment energies for the 1-/2- couple found in the rubredoxins. These results show that variations in the inner sphere energetics by up to ~0.4 eV can be caused by differences in the ligand dihedral angles in either or both redox states. Moreover, these results indicate that the protein stabilizes the conformation that favors reduction. In addition, the free energies and reorganization energies of oxidation and reduction as well as electrostatic potential charges are calculated, which can be used as estimates in continuum electrostatic calculations of electron transfer properties of [1Fe] proteins. PMID:22881577

AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.

PubMed

Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej

2005-05-04

The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.

12 CFR 205.15 - Electronic fund transfer of government benefits.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 12 Banks and Banking 2 2011-01-01 2011-01-01 false Electronic fund transfer of government benefits. 205.15 Section 205.15 Banks and Banking FEDERAL RESERVE SYSTEM BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.15 Electronic fund transfer of government...

12 CFR 1005.3 - Coverage.

Code of Federal Regulations, 2014 CFR

2014-01-01

...-time electronic fund transfer from a consumer's account. The consumer must authorize the transfer. (ii... one-time electronic fund transfer (in providing a check to a merchant or other payee for the MICR... transfer. A consumer authorizes a one-time electronic fund transfer from his or her account to pay the fee...

Flexible Textile-Based Organic Transistors Using Graphene/Ag Nanoparticle Electrode

PubMed Central

Kim, Youn; Kwon, Yeon Ju; Lee, Kang Eun; Oh, Youngseok; Um, Moon-Kwang; Seong, Dong Gi; Lee, Jea Uk

2016-01-01

Highly flexible and electrically-conductive multifunctional textiles are desirable for use in wearable electronic applications. In this study, we fabricated multifunctional textile composites by vacuum filtration and wet-transfer of graphene oxide films on a flexible polyethylene terephthalate (PET) textile in association with embedding Ag nanoparticles (AgNPs) to improve the electrical conductivity. A flexible organic transistor can be developed by direct transfer of a dielectric/semiconducting double layer on the graphene/AgNP textile composite, where the textile composite was used as both flexible substrate and conductive gate electrode. The thermal treatment of a textile-based transistor enhanced the electrical performance (mobility = 7.2 cm2·V−1·s−1, on/off current ratio = 4 × 105, and threshold voltage = −1.1 V) due to the improvement of interfacial properties between the conductive textile electrode and the ion-gel dielectric layer. Furthermore, the textile transistors exhibited highly stable device performance under extended bending conditions (with a bending radius down to 3 mm and repeated tests over 1000 cycles). We believe that our simple methods for the fabrication of graphene/AgNP textile composite for use in textile-type transistors can potentially be applied to the development of flexible large-area electronic clothes. PMID:28335276

Double ionization of helium by ion impact: second Born order treatment at the fully differential level

NASA Astrophysics Data System (ADS)

López, S. D.; Otranto, S.; Garibotti, C. R.

2015-01-01

In this work, a theoretical study of the double ionization of He by ion impact at the fully differential level is presented. Emphasis is made in the role played by the projectile in the double emission process depending on its charge and the amount of momentum transferred to the target. A Born-CDW model including a second-order term in the projectile charge is introduced and evaluated within an on-shell treatment. We find that emission geometries for which the second-order term dominates lead to asymmetric structures around the momentum transfer direction, a typical characteristic of higher order transitions.

Measurement of transverse emittance and coherence of double-gate field emitter array cathodes

PubMed Central

Tsujino, Soichiro; Das Kanungo, Prat; Monshipouri, Mahta; Lee, Chiwon; Miller, R.J. Dwayne

2016-01-01

Achieving small transverse beam emittance is important for high brightness cathodes for free electron lasers and electron diffraction and imaging experiments. Double-gate field emitter arrays with on-chip focussing electrode, operating with electrical switching or near infrared laser excitation, have been studied as cathodes that are competitive with photocathodes excited by ultraviolet lasers, but the experimental demonstration of the low emittance has been elusive. Here we demonstrate this for a field emitter array with an optimized double-gate structure by directly measuring the beam characteristics. Further we show the successful application of the double-gate field emitter array to observe the low-energy electron beam diffraction from suspended graphene in minimal setup. The observed low emittance and long coherence length are in good agreement with theory. These results demonstrate that our all-metal double-gate field emitters are highly promising for applications that demand extremely low-electron bunch-phase space volume and large transverse coherence. PMID:28008918

Measurement of transverse emittance and coherence of double-gate field emitter array cathodes

NASA Astrophysics Data System (ADS)

Tsujino, Soichiro; Das Kanungo, Prat; Monshipouri, Mahta; Lee, Chiwon; Miller, R. J. Dwayne

2016-12-01

Achieving small transverse beam emittance is important for high brightness cathodes for free electron lasers and electron diffraction and imaging experiments. Double-gate field emitter arrays with on-chip focussing electrode, operating with electrical switching or near infrared laser excitation, have been studied as cathodes that are competitive with photocathodes excited by ultraviolet lasers, but the experimental demonstration of the low emittance has been elusive. Here we demonstrate this for a field emitter array with an optimized double-gate structure by directly measuring the beam characteristics. Further we show the successful application of the double-gate field emitter array to observe the low-energy electron beam diffraction from suspended graphene in minimal setup. The observed low emittance and long coherence length are in good agreement with theory. These results demonstrate that our all-metal double-gate field emitters are highly promising for applications that demand extremely low-electron bunch-phase space volume and large transverse coherence.

Revealing the Sub-Barrier Phase using a Spatiotemporal Interferometer with Orthogonal Two-Color Laser Fields of Comparable Intensity

NASA Astrophysics Data System (ADS)

Han, Meng; Ge, Peipei; Shao, Yun; Liu, Ming-Ming; Deng, Yongkai; Wu, Chengyin; Gong, Qihuang; Liu, Yunquan

2017-08-01

We measure photoelectron momentum distributions of Ar atoms in orthogonally polarized two-color laser fields with comparable intensities. The synthesized laser field is used to manipulate the oscillating tunneling barrier and the subsequent motion of electrons onto two spatial dimensions. The subcycle structures associated with the temporal double-slit interference are spatially separated and enhanced. We use such a spatiotemporal interferometer to reveal sub-barrier phase of strong-field tunneling ionization. This study shows that the tunneling process transfers the initial phase onto momentum distribution. Our work has the implication that the sub-barrier phase plays an indispensable role in photoelectron interference processes.

On the efficiency of the golf swing

NASA Astrophysics Data System (ADS)

White, Rod

2006-12-01

A non-driven double pendulum model is used to explain the principle underlying the surprising efficiency of the golf swing. The principle can be described as a parametric energy transfer between the arms and the club head due to the changing moment of inertia of the club. The transfer is a consequence of conservation of energy and angular momentum. Because the pendulum is not driven by an external force, it shows that the golfer need do little more than accelerate the arms with the wrists cocked and let the double pendulum transfer kinetic energy to the club head. A driven double pendulum model is used to study factors affecting the efficiency of a real golf swing. It is concluded that the wrist-cock angle is the most significant efficiency-determining parameter under the golfer's control and that improvements in golf technology have had a significant impact on driving distance.

Liouville master equation for multi-electron dynamics during ion-surface interactions

NASA Astrophysics Data System (ADS)

Wirtz, L.; Reinhold, C. O.; Lemell, C.; Burgdorfer, J.

2003-05-01

We present a simulation of the neutralization of highly charged ions in front of a LiF(100) surface including the close-collision regime above the surface. Our approach employs a Monte-Carlo solution of the Liouville master equation for the joint probability density of the ionic motion and the electronic population of the projectile and the target surface. It includes single as well as double particle-hole (de)excitation processes and incorporates electron correlation effects through the conditional dynamics of population strings. The input in terms of elementary one- and two-electron transfer rates is determined from CTMC calculations as well as quantum mechanical Auger calculations. For slow projectiles and normal incidence, the ionic motion depends sensitively on the interplay between image acceleration towards the surface and repulsion by an ensemble of positive hole charges in the surface (``trampoline effect"). For Ne10+ ions we find that image acceleration dominates and no collective backscattering high above the surface takes place. For grazing incidence, our simulation delineates the pathways to complete neutralization. In accordance with recent experimental observations, most ions are reflected as neutrals or even as singly charged negative particles, irrespective of the charge state of the incoming ion.

12 CFR 205.14 - Electronic fund transfer service provider not holding consumer's account.

Code of Federal Regulations, 2010 CFR

2010-01-01

... consumer learns of the loss or theft; and extends the time periods for reporting unauthorized transfers or... 12 Banks and Banking 2 2010-01-01 2010-01-01 false Electronic fund transfer service provider not... GOVERNORS OF THE FEDERAL RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.14 Electronic fund...

12 CFR 205.14 - Electronic fund transfer service provider not holding consumer's account.

Code of Federal Regulations, 2013 CFR

2013-01-01

... consumer learns of the loss or theft; and extends the time periods for reporting unauthorized transfers or... 12 Banks and Banking 2 2013-01-01 2013-01-01 false Electronic fund transfer service provider not... GOVERNORS OF THE FEDERAL RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.14 Electronic fund...

12 CFR 205.14 - Electronic fund transfer service provider not holding consumer's account.

Code of Federal Regulations, 2014 CFR

2014-01-01

... consumer learns of the loss or theft; and extends the time periods for reporting unauthorized transfers or... 12 Banks and Banking 2 2014-01-01 2014-01-01 false Electronic fund transfer service provider not... GOVERNORS OF THE FEDERAL RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.14 Electronic fund...

12 CFR 205.14 - Electronic fund transfer service provider not holding consumer's account.

Code of Federal Regulations, 2011 CFR

2011-01-01

... consumer learns of the loss or theft; and extends the time periods for reporting unauthorized transfers or... 12 Banks and Banking 2 2011-01-01 2011-01-01 false Electronic fund transfer service provider not... GOVERNORS OF THE FEDERAL RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.14 Electronic fund...

12 CFR 205.14 - Electronic fund transfer service provider not holding consumer's account.

Code of Federal Regulations, 2012 CFR

2012-01-01

... consumer learns of the loss or theft; and extends the time periods for reporting unauthorized transfers or... 12 Banks and Banking 2 2012-01-01 2012-01-01 false Electronic fund transfer service provider not... GOVERNORS OF THE FEDERAL RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.14 Electronic fund...

Fundamental Insights into Proton-Coupled Electron Transfer in Soybean Lipoxygenase from Quantum Mechanical/Molecular Mechanical Free Energy Simulations.

PubMed

Li, Pengfei; Soudackov, Alexander V; Hammes-Schiffer, Sharon

2018-02-28

The proton-coupled electron transfer (PCET) reaction catalyzed by soybean lipoxygenase has served as a prototype for understanding hydrogen tunneling in enzymes. Herein this PCET reaction is studied with mixed quantum mechanical/molecular mechanical (QM/MM) free energy simulations. The free energy surfaces are computed as functions of the proton donor-acceptor (C-O) distance and the proton coordinate, and the potential of mean force is computed as a function of the C-O distance, inherently including anharmonicity. The simulation results are used to calculate the kinetic isotope effects for the wild-type enzyme (WT) and the L546A/L754A double mutant (DM), which have been measured experimentally to be ∼80 and ∼700, respectively. The PCET reaction is found to be exoergic for WT and slightly endoergic for the DM, and the equilibrium C-O distance for the reactant is found to be ∼0.2 Å greater for the DM than for WT. The larger equilibrium distance for the DM, which is due mainly to less optimal substrate binding in the expanded binding cavity, is primarily responsible for its higher kinetic isotope effect. The calculated potentials of mean force are anharmonic and relatively soft at shorter C-O distances, allowing efficient thermal sampling of the shorter distances required for effective hydrogen tunneling. The primarily local electrostatic field at the transferring hydrogen is ∼100 MV/cm in the direction to facilitate proton transfer and increases dramatically as the C-O distance decreases. These simulations suggest that the overall protein environment is important for conformational sampling of active substrate configurations aligned for proton transfer, but the PCET reaction is influenced primarily by local electrostatic effects that facilitate conformational sampling of shorter proton donor-acceptor distances required for effective hydrogen tunneling.

Numerical investigation of the double-arcing phenomenon in a cutting arc torch

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mancinelli, B. R., E-mail: bmancinelli@frvt.utn.edu.ar; Minotti, F. O.; Kelly, H.

2014-07-14

A numerical investigation of the double-arcing phenomenon in a cutting arc torch is reported. The dynamics of the double-arcing were simulated by using a two-dimensional model of the gas breakdown development in the space-charge layer contiguous to the nozzle of a cutting arc torch operated with oxygen. The kinetic scheme includes ionization of heavy particles by electron impact, electron attachment, electron detachment, electron–ion recombination, and ion–ion recombination. Complementary measurements during double-arcing phenomena were also conducted. A marked rise of the nozzle voltage was found. The numerical results showed that the dynamics of a cathode spot at the exit of themore » nozzle inner surface play a key role in the raising of the nozzle voltage, which in turn allows more electrons to return to the wall at the nozzle inlet. The return flow of electrons thus closes the current loop of the double-arcing. The increase in the (floating) nozzle voltage is due to the fact that the increased electron emission at the spot is mainly compensated by the displacement current (the ions do not play a relevant role due to its low-mobility) until that the stationary state is achieved and the electron return flow fully-compensates the electron emission at the spot. A fairly good agreement was found between the model and the experiment for a spot emission current growth rate of the order of 7 × 10{sup 4} A/s.« less

Activation of a medical emergency team using an electronic medical recording-based screening system*.

PubMed

Huh, Jin Won; Lim, Chae-Man; Koh, Younsuck; Lee, Jury; Jung, Youn-Kyung; Seo, Hyun-Suk; Hong, Sang-Bum

2014-04-01

To evaluate the efficacy of a medical emergency team activated using 24-hour monitoring by electronic medical record-based screening criteria followed by immediate intervention by a skilled team. Retrospective cohort study. Academic tertiary care hospital with approximately 2,700 beds. A total of 3,030 events activated by a medical emergency team from March 1, 2008, to February 28, 2010. None. We collected data for all medical emergency team activations: patient characteristics, trigger type for medical emergency team (electronic medical record-based screening vs calling criteria), interventions during each event, outcomes of the medical emergency team intervention, and 28-day mortality after medical emergency team activation. We analyzed data for 2009, when the medical emergency team functioned 24 hours a day, 7 days a week (period 2), compared with that for 2008, when the medical emergency team functioned 12 hours a day, 7 days a week (period 1). The commonest cause of medical emergency team activation was respiratory distress (43.6%), and the medical emergency team performed early goal-directed therapy (21.3%), respiratory care (19.9%), and difficult airway management (12.3%). For patients on general wards, 51.3% (period 1) and 38.4% (period 2) of medical emergency team activations were triggered by the electronic medical record-based screening system (electronic medical record-triggered group). In 23.4%, activation occurred because of an abnormality in laboratory screening criteria. The commonest activation criterion from electronic medical record-based screening was respiratory rate (39.4%). Over half the patients were treated in the general ward, and one third of the patients were transferred to the ICU. The electronic medical record-triggered group had lower ICU admission with an odds ratio of 0.35 (95% CI, 0.22-0.55). In surgical patients, the electronic medical record-triggered group showed the lower 28-day mortality (10.5%) compared with the call-triggered group (26.7%) or the double-triggered group (33.3%) (odds ratio 0.365 with 95% CI, 0.154-0.867, p = 0.022). We successful managed the medical emergency team with electronic medical record-based screening criteria and a skilled intervention team. The electronic medical record-triggered group had lower ICU admission than the call-triggered group or the double-triggered group. In surgical patients, the electronic medical record-triggered group showed better outcome than other groups.

Ratios of double to single ionization of He and Ne by strong 400-nm laser pulses using the quantitative rescattering theory

NASA Astrophysics Data System (ADS)

Chen, Zhangjin; Li, Xiaojin; Zatsarinny, Oleg; Bartschat, Klaus; Lin, C. D.

2018-01-01

We present numerical simulations of the ratio between double and single ionization of He and Ne by intense laser pulses at wavelengths of 390 and 400 nm, respectively. The yields of doubly charged ions due to nonsequential double ionization (NSDI) are obtained by employing the quantitative rescattering (QRS) model. In this model, the NSDI ionization probability is expressed as a product of the returning electron wave packet (RWP) and the total scattering cross sections for laser-free electron impact excitation and electron impact ionization of the parent ion. According to the QRS theory, the same RWP is also responsible for the emission of high-energy above-threshold ionization photoelectrons. To obtain absolute double-ionization yields, the RWP is generated by solving the time-dependent Schrödinger equation (TDSE) within a one-electron model. The same TDSE results can also be taken to obtain single-ionization yields. By using the TDSE results to calibrate single ionization and the RWP obtained from the strong-field approximation, we further simplify the calculation such that the nonuniform laser intensity distribution in the focused laser beam can be accounted for. In addition, laser-free electron impact excitation and ionization cross sections are calculated using the state-of-the-art many-electron R -matrix theory. The simulation results for double-to-single-ionization ratios are found to compare well with experimental data and support the validity of the nonsequential double-ionization mechanism for the covered intensity region.

Anomalous single-electron transfer in common-gate quadruple-dot single-electron devices with asymmetric junction capacitances

NASA Astrophysics Data System (ADS)

Imai, Shigeru; Ito, Masato

2018-06-01

In this paper, anomalous single-electron transfer in common-gate quadruple-dot turnstile devices with asymmetric junction capacitances is revealed. That is, the islands have the same total number of excess electrons at high and low gate voltages of the swing that transfers a single electron. In another situation, two electrons enter the islands from the source and two electrons leave the islands for the source and drain during a gate voltage swing cycle. First, stability diagrams of the turnstile devices are presented. Then, sequences of single-electron tunneling events by gate voltage swings are investigated, which demonstrate the above-mentioned anomalous single-electron transfer between the source and the drain. The anomalous single-electron transfer can be understood by regarding the four islands as “three virtual islands and a virtual source or drain electrode of a virtual triple-dot device”. The anomalous behaviors of the four islands are explained by the normal behavior of the virtual islands transferring a single electron and the behavior of the virtual electrode.

Pulsed-High Field/High-Frequency EPR Spectroscopy

NASA Astrophysics Data System (ADS)

Fuhs, Michael; Moebius, Klaus

Pulsed high-field/high-frequency electron paramagnetic resonance (EPR) spectroscopy is used to disentangle many kinds of different effects often obscured in continuous wave (cw) EPR spectra at lower magnetic fields/microwave frequencies. While the high magnetic field increases the resolution of G tensors and of nuclear Larmor frequencies, the high frequencies allow for higher time resolution for molecular dynamics as well as for transient paramagnetic intermediates studied with time-resolved EPR. Pulsed EPR methods are used for example for relaxation-time studies, and pulsed Electron Nuclear DOuble Resonance (ENDOR) is used to resolve unresolved hyperfine structure hidden in inhomogeneous linewidths. In the present article we introduce the basic concepts and selected applications to structure and mobility studies on electron transfer systems, reaction centers of photosynthesis as well as biomimetic models. The article concludes with an introduction to stochastic EPR which makes use of an other concept for investigating resonance systems in order to increase the excitation bandwidth of pulsed EPR. The limited excitation bandwidth of pulses at high frequency is one of the main limitations which, so far, made Fourier transform methods hardly feasible.

X-ray imaging spectroscopic diagnostics on Nike

NASA Astrophysics Data System (ADS)

Aglitskiy, Y.; Karasik, M.; Serlin, V.; Weaver, J. L.; Oh, J.; Obenschain, S. P.; Ralchenko, Yu.

2017-10-01

Electron temperature and density diagnostics of the laser plasma produced within the focal spot of the NRL's Nike laser are being explored with the help of X-ray imaging spectroscopy. Spectra of He-like and H-like ions were taken by Nike focusing spectrometers in a range of lower (1.8 kev, Si XIV) and higher (6.7 kev, Fe XXV) x-ray energies. Data that were obtained with spatial resolution were translated into the temperature and density as functions of distance from the target. As an example electron density was determined from He-like satellites to Ly-alpha in Si XIV. The dielectronic satellites with intensity ratios that are sensitive to collisional transfer of population between different triplet groups of double-excited states 2l2l' in Si XIII were observed with high spatial and spectral resolution Lineouts taken at different axial distances from the planar Si target show changing spectral shapes due to the different electron densities as determined by supporting non-LTE simulations. These shapes are relatively insensitive to the plasma temperature which was measured using different spectral lines. This work was supported by the US DOE/NNSA.

Anharmonicity in a double hydrogen transfer reaction studied in a single porphycene molecule on a Cu(110) surface.

PubMed

Liu, S; Baugh, D; Motobayashi, K; Zhao, X; Levchenko, S V; Gawinkowski, S; Waluk, J; Grill, L; Persson, M; Kumagai, T

2018-05-07

Anharmonicity plays a crucial role in hydrogen transfer reactions in hydrogen-bonding systems, which leads to a peculiar spectral line shape of the hydrogen stretching mode as well as highly complex intra/intermolecular vibrational energy relaxation. Single-molecule study with a well-defined model is necessary to elucidate a fundamental mechanism. Recent low-temperature scanning tunnelling microscopy (STM) experiments revealed that the cis↔cis tautomerization in a single porphycene molecule on Cu(110) at 5 K can be induced by vibrational excitation via an inelastic electron tunnelling process and the N-H(D) stretching mode couples with the tautomerization coordinate [Kumagai et al. Phys. Rev. Lett. 2013, 111, 246101]. Here we discuss a pronounced anharmonicity of the N-H stretching mode observed in the STM action spectra and the conductance spectra. Density functional theory calculations find a strong intermode coupling of the N-H stretching with an in-plane bending mode within porphycene on Cu(110).

Absorption and Emission of the Apigenin and Luteolin Flavonoids: A TDDFT Investigation

NASA Astrophysics Data System (ADS)

Amat, Anna; Clementi, Catia; de Angelis, Filippo; Sgamellotti, Antonio; Fantacci, Simona

2009-09-01

The absorption and emission properties of the two components of the yellow color extracted from weld (Reseda luteola L.), apigenin and luteolin, have been extensively investigated by means of DFT and TDDFT calculations. Our calculations reproduce the absorption spectra of both flavonoids in good agreement with the experimental data and allow us to assign the transitions giving rise to the main spectral features. For apigenin, we have also computed the electronic spectrum of the monodeprotonated species, providing a rationale for the red-shift of the experimental spectrum with increasing pH. The fluorescence emission of both apigenin and luteolin has then been investigated. Excited-state TDDFT geometry optimizations have highlighted an excited-state intramolecular proton transfer (ESIPT) from the 5-hydroxyl to the 4-carbonyl oxygen of the substituted benzopyrone moiety. By computing the potential energy curves at the ground and excited states as a function of an approximate proton transfer coordinate for apigenin, we have been able to trace an ESIPT pathway and thus explain the double emission observed experimentally.

Origin of the Two Bands in the B800 Ring and Their Involvement in the Energy Transfer Network of Allochromatium vinosum.

PubMed

Schröter, Marco; Alcocer, Marcelo J P; Cogdell, Richard J; Kühn, Oliver; Zigmantas, Donatas

2018-03-15

Bacterial photosynthesis features robust and adaptable energy-harvesting processes in which light-harvesting proteins play a crucial role. The peripheral light-harvesting complex of the purple bacterium Allochromatium vinosum is particularly distinct, featuring a double peak structure in its B800 absorption band. Two hypotheses-not necessarily mutually exclusive-concerning the origin of this splitting have been proposed; either two distinct B800 bacteriochlorophyll site energies are involved, or an excitonic dimerization of bacteriochlorophylls within the B800 ring takes place. Through the use of two-dimensional electronic spectroscopy, we present unambiguous evidence that excitonic interaction shapes the split band. We further identify and characterize all of the energy transfer pathways within this complex by using a global kinetic fitting procedure. Our approach demonstrates how the combination of two-dimensional spectral resolution and self-consistent fitting allows for extraction of information on light-harvesting processes, which would otherwise be inaccessible due to signal congestion.

In vitro assembly of a prohead-like structure of the Rhodobacter capsulatus gene transfer agent

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spano, Anthony J.; Chen, Frank S.; Goodman, Benjamin E.

2007-07-20

The gene transfer agent (GTA) is a phage-like particle capable of exchanging double-stranded DNA fragments between cells of the photosynthetic bacterium Rhodobacter capsulatus. Here we show that the major capsid protein of GTA, expressed in E. coli, can be assembled into prohead-like structures in the presence of calcium ions in vitro. Transmission electron microscopy (TEM) of uranyl acetate staining material and thin sections of glutaraldehyde-fixed material demonstrates that these associates have spherical structures with diameters in the range of 27-35 nm. The analysis of scanning TEM images revealed particles of mass {approx} 4.3 MDa, representing 101 {+-} 11 copies ofmore » the monomeric subunit. The establishment of this simple and rapid method to form prohead-like particles permits the GTA system to be used for genome manipulation within the photosynthetic bacterium, for specific targeted drug delivery, and for the construction of biologically based distributed autonomous sensors for environmental monitoring.« less

Apparatus and method of direct water cooling several parallel circuit cards each containing several chip packages

DOEpatents

Cipolla, Thomas M [Katonah, NY; Colgan, Evan George [Chestnut Ridge, NY; Coteus, Paul W [Yorktown Heights, NY; Hall, Shawn Anthony [Pleasantville, NY; Tian, Shurong [Mount Kisco, NY

2011-12-20

A cooling apparatus, system and like method for an electronic device includes a plurality of heat producing electronic devices affixed to a wiring substrate. A plurality of heat transfer assemblies each include heat spreaders and thermally communicate with the heat producing electronic devices for transferring heat from the heat producing electronic devices to the heat transfer assemblies. The plurality of heat producing electronic devices and respective heat transfer assemblies are positioned on the wiring substrate having the regions overlapping. A heat conduit thermally communicates with the heat transfer assemblies. The heat conduit circulates thermally conductive fluid therethrough in a closed loop for transferring heat to the fluid from the heat transfer assemblies via the heat spreader. A thermally conductive support structure supports the heat conduit and thermally communicates with the heat transfer assemblies via the heat spreader transferring heat to the fluid of the heat conduit from the support structure.

Acid/base-regulated reversible electron transfer disproportionation of N–N linked bicarbazole and biacridine derivatives† †Electronic supplementary information (ESI) available: Experimental information, synthesis and characterization data, NMR spectra, solid state NMR data, X-ray data, ESR spectra, UV-Vis-NIR spectra, fluorescence spectra, kinetic experiments, theoretical calculations, Tables S1–S8, Scheme S1, Fig. S1–12, References. CCDC 1025063, 1038914, 1049677 and 1040722. For ESI and crystallographic data in CIF or other electronic format see DOI: 10.1039/c5sc00946d

PubMed Central

Pandit, Palash; Yamamoto, Koji; Nakamura, Toshikazu; Nishimura, Katsuyuki; Kurashige, Yuki; Yanai, Takeshi; Nakamura, Go; Masaoka, Shigeyuki; Furukawa, Ko; Yakiyama, Yumi; Kawano, Masaki

2015-01-01

Regulation of electron transfer on organic substances by external stimuli is a fundamental issue in science and technology, which affects organic materials, chemical synthesis, and biological metabolism. Nevertheless, acid/base-responsive organic materials that exhibit reversible electron transfer have not been well studied and developed, owing to the difficulty in inventing a mechanism to associate acid/base stimuli and electron transfer. We discovered a new phenomenon in which N–N linked bicarbazole (BC) and tetramethylbiacridine (TBA) derivatives undergo electron transfer disproportionation by acid stimulus, forming their stable radical cations and reduced species. The reaction occurs through a biradical intermediate generated by the acid-triggered N–N bond cleavage reaction of BC or TBA, which acts as a two electron acceptor to undergo electron transfer reactions with two equivalents of BC or TBA. In addition, in the case of TBA the disproportionation reaction is highly reversible through neutralization with NEt3, which recovers TBA through back electron transfer and N–N bond formation reactions. This highly reversible electron transfer reaction is possible due to the association between the acid stimulus and electron transfer via the acid-regulated N–N bond cleavage/formation reactions which provide an efficient switching mechanism, the ability of the organic molecules to act as multi-electron donors and acceptors, the extraordinary stability of the radical species, the highly selective reactivity, and the balance of the redox potentials. This discovery provides new design concepts for acid/base-regulated organic electron transfer systems, chemical reagents, or organic materials. PMID:29218181

Rate of Interfacial Electron Transfer through the 1,2,3-Triazole Linkage

PubMed Central

Devaraj, Neal K.; Decreau, Richard A.; Ebina, Wataru; Collman, James P.; Chidsey, Christopher E. D.

2012-01-01

The rate of electron transfer is measured to two ferrocene and one iron tetraphenylporphyrin redox species coupled through terminal acetylenes to azide-terminated thiol monolayers by the Cu(I)-catalyzed azide–alkyne cycloaddition (a Sharpless “click” reaction) to form the 1,2,3-triazole linkage. The high yield, chemoselectivity, convenience, and broad applicability of this triazole formation reaction make such a modular assembly strategy very attractive. Electron-transfer rate constants from greater than 60,000 to 1 s−1 are obtained by varying the length and conjugation of the electron-transfer bridge and by varying the surrounding diluent thiols in the monolayer. Triazole and the triazole carbonyl linkages provide similar electronic coupling for electron transfer as esters. The ability to vary the rate of electron transfer to many different redox species over many orders of magnitude by using modular coupling chemistry provides a convenient way to study and control the delivery of electrons to multielectron redox catalysts and similar interfacial systems that require controlled delivery of electrons. PMID:16898751

26 CFR 25.2701-5 - Adjustments to mitigate double taxation.

Code of Federal Regulations, 2012 CFR

2012-04-01

... time of the initial transfer (or the remaining portion thereof). (b) Amount of reduction. Except as...) duplicated in the transfer tax base at the time of the transfer of the section 2701 interest (the duplicated... tax value of the section 2701 interest at the time of the subsequent transfer exceeds the value of...

26 CFR 25.2701-5 - Adjustments to mitigate double taxation.

Code of Federal Regulations, 2013 CFR

2013-04-01

... time of the initial transfer (or the remaining portion thereof). (b) Amount of reduction. Except as...) duplicated in the transfer tax base at the time of the transfer of the section 2701 interest (the duplicated... tax value of the section 2701 interest at the time of the subsequent transfer exceeds the value of...

On the physics of electron transfer (drift) in the substance: about the reason of “abnormal” fast transfer of electrons in the plasma of tokamak and at known Bohm’s diffusion

NASA Astrophysics Data System (ADS)

Boriev, I. A.

2018-03-01

An analysis of the problem of so-called “abnormal” fast transfer of electrons in tokamak plasma, which turned out much faster than the result of accepted calculation, is given. Such transfer of hot electrons leads to unexpectedly fast destruction of the inner tokamak wall with ejection of its matter in plasma volume, what violates a condition of plasma confinement for controlled thermonuclear fusion. It is shown, taking into account real physics of electron drift in the gas (plasma) and using the conservation law for momentum of electron transfer (drift), that the drift velocity of elastically scattered electrons should be significantly greater than that of accepted calculation. The reason is that the relaxation time of the momentum of electron transfer, to which the electron drift velocity is proportional, is significantly greater (from 16 up to 4 times) than the electron free path time. Therefore, generally accepted replacement of the relaxation time, which is unknown a priori, by the electron free path time, leads to significant (16 times for thermal electrons) underestimation of electron drift velocity (mobility). This result means, that transfer of elastically (and isotropically) scattered electrons in the gas phase should be so fast, and corresponds to multiplying coefficient (16), introduced by D. Bohm to explain the observed by him “abnormal” fast diffusion of electrons.

Automatic alignment of double optical paths in excimer laser amplifier

NASA Astrophysics Data System (ADS)

Wang, Dahui; Zhao, Xueqing; Hua, Hengqi; Zhang, Yongsheng; Hu, Yun; Yi, Aiping; Zhao, Jun

2013-05-01

A kind of beam automatic alignment method used for double paths amplification in the electron pumped excimer laser system is demonstrated. In this way, the beams from the amplifiers can be transferred along the designated direction and accordingly irradiate on the target with high stabilization and accuracy. However, owing to nonexistence of natural alignment references in excimer laser amplifiers, two cross-hairs structure is used to align the beams. Here, one crosshair put into the input beam is regarded as the near-field reference while the other put into output beam is regarded as the far-field reference. The two cross-hairs are transmitted onto Charge Coupled Devices (CCD) by image-relaying structures separately. The errors between intersection points of two cross-talk images and centroid coordinates of actual beam are recorded automatically and sent to closed loop feedback control mechanism. Negative feedback keeps running until preset accuracy is reached. On the basis of above-mentioned design, the alignment optical path is built and the software is compiled, whereafter the experiment of double paths automatic alignment in electron pumped excimer laser amplifier is carried through. Meanwhile, the related influencing factors and the alignment precision are analyzed. Experimental results indicate that the alignment system can achieve the aiming direction of automatic aligning beams in short time. The analysis shows that the accuracy of alignment system is 0.63μrad and the beam maximum restoration error is 13.75μm. Furthermore, the bigger distance between the two cross-hairs, the higher precision of the system is. Therefore, the automatic alignment system has been used in angular multiplexing excimer Main Oscillation Power Amplification (MOPA) system and can satisfy the requirement of beam alignment precision on the whole.

Marcus equation

DOE R&D Accomplishments Database

1998-09-21

In the late 1950s to early 1960s Rudolph A. Marcus developed a theory for treating the rates of outer-sphere electron-transfer reactions. Outer-sphere reactions are reactions in which an electron is transferred from a donor to an acceptor without any chemical bonds being made or broken. (Electron-transfer reactions in which bonds are made or broken are referred to as inner-sphere reactions.) Marcus derived several very useful expressions, one of which has come to be known as the Marcus cross-relation or, more simply, as the Marcus equation. It is widely used for correlating and predicting electron-transfer rates. For his contributions to the understanding of electron-transfer reactions, Marcus received the 1992 Nobel Prize in Chemistry. This paper discusses the development and use of the Marcus equation. Topics include self-exchange reactions; net electron-transfer reactions; Marcus cross-relation; and proton, hydride, atom and group transfers.

Coupled sensitizer-catalyst dyads: electron-transfer reactions in a perylene-polyoxometalate conjugate.

PubMed

Odobel, Fabrice; Séverac, Marjorie; Pellegrin, Yann; Blart, Errol; Fosse, Céline; Cannizzo, Caroline; Mayer, Cédric R; Elliott, Kristopher J; Harriman, Anthony

2009-01-01

Ultrafast discharge of a single-electron capacitor: A variety of intramolecular electron-transfer reactions are apparent for polyoxometalates functionalized with covalently attached perylene monoimide chromophores, but these are restricted to single-electron events. (et=electron transfer, cr=charge recombination, csr=charge-shift reaction, PER=perylene, POM=polyoxometalate).A new strategy is introduced that permits covalent attachment of an organic chromophore to a polyoxometalate (POM) cluster. Two examples are reported that differ according to the nature of the anchoring group and the flexibility of the linker. Both POMs are functionalized with perylene monoimide units, which function as photon collectors and form a relatively long-lived charge-transfer state under illumination. They are reduced to a stable pi-radical anion by electrolysis or to a protonated dianion under photolysis in the presence of aqueous triethanolamine. The presence of the POM opens up an intramolecular electron-transfer route by which the charge-transfer state reduces the POM. The rate of this process depends on the molecular conformation and appears to involve through-space interactions. Prior reduction of the POM leads to efficient fluorescence quenching, again due to intramolecular electron transfer. In most cases, it is difficult to resolve the electron-transfer products because of relatively fast reverse charge shift that occurs within a closed conformer. Although the POM can store multiple electrons, it has not proved possible to use these systems as molecular-scale capacitors because of efficient electron transfer from the one-electron-reduced POM to the excited singlet state of the perylene monoimide.

Directing the path of light-induced electron transfer at a molecular fork using vibrational excitation

NASA Astrophysics Data System (ADS)

Delor, Milan; Archer, Stuart A.; Keane, Theo; Meijer, Anthony J. H. M.; Sazanovich, Igor V.; Greetham, Gregory M.; Towrie, Michael; Weinstein, Julia A.

2017-11-01

Ultrafast electron transfer in condensed-phase molecular systems is often strongly coupled to intramolecular vibrations that can promote, suppress and direct electronic processes. Recent experiments exploring this phenomenon proved that light-induced electron transfer can be strongly modulated by vibrational excitation, suggesting a new avenue for active control over molecular function. Here, we achieve the first example of such explicit vibrational control through judicious design of a Pt(II)-acetylide charge-transfer donor-bridge-acceptor-bridge-donor 'fork' system: asymmetric 13C isotopic labelling of one of the two -C≡C- bridges makes the two parallel and otherwise identical donor→acceptor electron-transfer pathways structurally distinct, enabling independent vibrational perturbation of either. Applying an ultrafast UVpump(excitation)-IRpump(perturbation)-IRprobe(monitoring) pulse sequence, we show that the pathway that is vibrationally perturbed during UV-induced electron transfer is dramatically slowed down compared to its unperturbed counterpart. One can thus choose the dominant electron transfer pathway. The findings deliver a new opportunity for precise perturbative control of electronic energy propagation in molecular devices.

The corrosion mechanism of the sintered (Ce, Nd)-Fe-B magnets prepared by double main phase and single main phase approaches

NASA Astrophysics Data System (ADS)

Shi, Xiaoning; Zhu, Minggang; Zhou, Dong; Song, Liwei; Guo, Zhaohui; Li, Jia; Li, Wei

2018-05-01

The sintered (Ce, Nd)-Fe-B magnets were produced widely by Double Main Phase (DMP) method in China as the magnetic properties of the DMP magnets are superior to those of single main phase (SMP) magnets with the same nominal composition. In this work, the microstructure and corrosion mechanism of the sintered (Ce0.2Nd0.8)30FebalB (wt.%) magnets prepared by DMP and SMP method were studied in detail. Compared to SMP magnets, the DMP magnets have more positive corrosion potential, lower corrosion current density, larger electron transfer resistance, and lower mass loss of the free corrosion experiment in 0.5mol/l Na2SO4 aqueous solution. All of the results show that the DMP magnets have better corrosion resistance than SMP magnets. The back scattered electron images show that the crystalline grains of the DMP magnets are sphericity with a smooth surface while the SMP ones have plenty of edges and corners. Besides, the distribution of Ce/Nd is much more uneven in both magnetic phase and rare earth (Re)-rich phase of the DMP magnets than those of SMP magnets. After corrosion, DMP magnets show eroded magnetic phase and intact Re-rich phase, which indicate that galvanic corrosion of the Re-rich phase acting as the cathode appears.

The double helium-white dwarf channel for the formation of AM CVn binaries

NASA Astrophysics Data System (ADS)

Zhang, Xian-Fei; Liu, Jin-Zhong; Jeffery, C. Simon; Hall, Philip D.; Bi, Shao-Lan

2018-01-01

Most close double helium white dwarfs will merge within a Hubble time due to orbital decay by gravitational wave radiation. However, a significant fraction with low mass ratios will survive for a long time as a consequence of stable mass transfer. Such stable mass transfer between two helium white dwarfs (HeWDs) provides one channel for the production of AM CVn binary stars. In previous calculations of double HeWD progenitors, the accreting HeWD was treated as a point mass. We have computed the evolution of 16 double HeWD models in order to investigate the consequences of treating the evolution of both components in detail. We find that the boundary between binaries having stable and unstable mass transfer is slightly modified by this approach. By comparing with observed periods and mass ratios, we redetermine masses of eight known AM CVn stars by our double HeWDs channel, i.e. HM Cnc, AM CVn, V406 Hya, J0926, J1240, GP Com, Gaia14aae and V396 Hya.We propose that central spikes in the triple-peaked emission spectra of J1240, GP Com and V396 Hya and the surface abundance ratios of N/C/O in GP Com can be explained by the stable double HeWD channel. The mass estimates derived from our calculations are used to discuss the predicted gravitational wave signal in the context of the Laser Interferometer Space Antenna (LISA) project.

EVERY INTERACTING DOUBLE WHITE DWARF BINARY MAY MERGE

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shen, Ken J.

2015-05-20

Interacting double white dwarf (WD) binaries can give rise to a wide variety of astrophysical outcomes ranging from faint thermonuclear and Type Ia supernovae to the formation of neutron stars and stably accreting AM Canum Venaticorum systems. One key factor affecting the final outcome is whether mass transfer remains dynamically stable or instead diverges, leading to the tidal disruption of the donor and the merger of the binary. It is typically thought that for low ratios of the donor mass to the accretor mass, mass transfer remains stable, especially if accretion occurs via a disk. In this Letter, we examinemore » low mass ratio double WD binaries and find that the initial phase of hydrogen-rich mass transfer leads to a classical nova-like outburst on the accretor. Dynamical friction within the expanding nova shell shrinks the orbit and causes the mass transfer rate to increase dramatically above the accretor's Eddington limit, possibly resulting in a binary merger. If the binary survives the first hydrogen-rich nova outbursts, dynamical friction within the subsequent helium-powered nova shells pushes the system even more strongly toward merger. While further calculations are necessary to confirm this outcome for the entire range of binaries previously thought to be dynamically stable, it appears likely that most, if not all, interacting double WD binaries will merge during the course of their evolution.« less

State-resolved three-dimensional electron-momentum correlation in nonsequential double ionization of benzene

NASA Astrophysics Data System (ADS)

Winney, Alexander H.; Lin, Yun Fei; Lee, Suk Kyoung; Adhikari, Pradip; Li, Wen

2016-03-01

We report state-resolved electron-momentum correlation measurement of strong-field nonsequential double ionization in benzene. With a novel coincidence detection apparatus, highly efficient triple coincidence (electron-electron dication) and quadruple coincidence (electron-electron-cation-cation) are used to resolve the final ionic states and to characterize three-dimensional (3D) electron-momentum correlation. The primary states associated with dissociative and nondissociative dications are assigned. A 3D momentum anticorrelation is observed for the electrons in coincidence with dissociative benzene dication states whereas such a correlation is absent for nondissociative dication states.

Modulation of spin transfer torque amplitude in double barrier magnetic tunnel junctions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Clément, P.-Y.; Baraduc, C., E-mail: claire.baraduc@cea.fr; Chshiev, M.

2015-09-07

Magnetization switching induced by spin transfer torque is used to write magnetic memories (Magnetic Random Access Memory, MRAM) but can be detrimental to the reading process. It would be quite convenient therefore to modulate the efficiency of spin transfer torque. A solution is adding an extra degree of freedom by using double barrier magnetic tunnel junctions with two spin-polarizers, with controllable relative magnetic alignment. We demonstrate, for these structures, that the amplitude of in-plane spin transfer torque on the middle free layer can be efficiently tuned via the magnetic configuration of the electrodes. Using the proposed design could thus pavemore » the way towards more reliable read/write schemes for MRAM. Moreover, our results suggest an intriguing effect associated with the out-of-plane (field-like) spin transfer torque, which has to be further investigated.« less

Thermal transfer structures coupling electronics card(s) to coolant-cooled structure(s)

DOEpatents

David, Milnes P; Graybill, David P; Iyengar, Madhusudan K; Kamath, Vinod; Kochuparambil, Bejoy J; Parida, Pritish R; Schmidt, Roger R

2014-12-16

Cooling apparatuses and coolant-cooled electronic systems are provided which include thermal transfer structures configured to engage with a spring force one or more electronics cards with docking of the electronics card(s) within a respective socket(s) of the electronic system. A thermal transfer structure of the cooling apparatus includes a thermal spreader having a first thermal conduction surface, and a thermally conductive spring assembly coupled to the conduction surface of the thermal spreader and positioned and configured to reside between and physically couple a first surface of an electronics card to the first surface of the thermal spreader with docking of the electronics card within a socket of the electronic system. The thermal transfer structure is, in one embodiment, metallurgically bonded to a coolant-cooled structure and facilitates transfer of heat from the electronics card to coolant flowing through the coolant-cooled structure.

Local Gate Control of a Carbon Nanotube Double Quantum Dot

DTIC Science & Technology

2016-04-04

Nanotube Double Quantum Dot N. Mason,*† M. J. Biercuk,* C. M. Marcus† We have measured carbon nanotube quantum dots with multiple electro- static gates and...computation. Carbon nanotubes have been considered lead- ing candidates for nanoscale electronic applica- tions (1, 2). Previous measurements of nano- tube...electronics have shown electron confine- ment (quantum dot) effects such as single- electron charging and energy-level quantization (3–5). Nanotube

Azophenine as Central Core for Efficient Light Harvesting Devices.

PubMed

Lei, Hu; Karsenti, Paul-Ludovic; Harvey, Pierre D

2018-03-05

The notoriously non-luminescent uncycled azophenine (Q) was harnessed with Bodipy and zinc(II)porphyrin antennas to probe its fluorescence properties, its ability to act as a singlet excited state energy acceptor and to mediate the transfer. Two near-IR emissions are depicted from time-resolved fluorescence spectroscopy, which are most likely due to the presence of tautomers of very similar calculated total energies (350 cm -1 ; DFT; B3LYP). The rates for energy transfer, k ET (S 1 ), for 1 Bodipy*→Q are in the order of 10 10 -10 11  s -1 and are surprisingly fast when considering the low absorptivity properties of the lowest energy charge transfer excited state of azophenine. The rational is provided by the calculated frontier molecular orbitals (MOs) which show atomic contributions in the C 6 H 4 C≡CC 6 H 4 arms, thus favoring the double electron exchange mechanism. In the mixed-antenna Bodipy-porphyrin star molecule, the rate for 1 Bodipy*→porphyrin has also been evaluated (≈16×10 10  s -1 ) and is among the fastest rates reported for Bodipy-zinc(II)porphyrin pairs. This astonishing result is again explained from the atomic contributions of the C 6 H 4 C≡CC 6 H 4 and C≡CC 6 H 4 arms thus favouring the Dexter process. Here, for the first time, this process is found to be sensitively temperature-dependent. The azophenine turns out to be excellent for electronic communication. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

A single-phase white light emitting Pr3+ doped Ba2CaWO6 phosphor: synthesis, photoluminescence and optical properties

NASA Astrophysics Data System (ADS)

Sreeja, E.; Vidyadharan, Viji; Jose, Saritha K.; George, Anns; Joseph, Cyriac; Unnikrishnan, N. V.; Biju, P. R.

2018-04-01

Pr3+ doped Ba2CaWO6 phosphor were prepared by traditional high-temperature solid-state reaction technique. The structure evolution was systematically investigated by X-ray diffraction (XRD), energy-dispersive X-ray spectroscopy (EDS), Fourier-transform infrared spectroscopy (FTIR), scanning electron microscopy (SEM) and transmission electron microscopy (TEM) analysis. The X-ray powder diffraction patterns indicate that the prepared phosphors crystallized in the cubic double-perovskite structure. The functional groups were identified using FTIR spectra and the elements present in the composition were confirmed by the EDS profile. The morphology of the phosphor was identified using SEM and TEM analysis. The PL spectra illustrated that these phosphors could be efficiently excited by charge transfer band of host and the maximum luminescence intensity was observed at 0.06 wt% of Pr3+ ion. Upon the charge transfer band excitation, emission spectra showed peaks at 489, 532, 647, 685 and 737 nm corresponding to 3P0→3H4, 3P1→3H5, 3P0→3F2, 3P0→3F3 and 3P0→3F4 transitions respectively. The concentration quenching of Ba2CaWO6:Pr3+ phosphor can be mainly attributed to dipole-dipole interaction. The CIE coordinates were estimated to be close to the white region. The decay curves are well fitted with double exponential decay models. The standard and modified Judd-Ofelt (JO) theories were used to determine the Judd-Ofelt intensity parameters, radiative transition probabilities and branching ratios. The optical properties indicate that Ba2CaWO6:Pr3+ phosphors can produce white light emission from a single phase host and its potential application for solid-state lighting and display devices.

Solvent Dependence of Double Proton Transfer in the Formic Acid-Formamidine Complex: Path Integral Molecular Dynamics Investigation.

PubMed

Kungwan, Nawee; Ngaojampa, Chanisorn; Ogata, Yudai; Kawatsu, Tsutomu; Oba, Yuki; Kawashima, Yukio; Tachikawa, Masanori

2017-10-05

Solvent dependence of double proton transfer in the formic acid-formamidine (FA-FN) complex at room temperature was investigated by means of ab initio path integral molecular dynamics (AIPIMD) simulation with taking nuclear quantum and thermal effects into account. The conductor-like screening model (COSMO) was applied for solvent effect. In comparison with gas phase, double proton delocalization between two heavy atoms (O and N) in FA-FN were observed with reduced proton transfer barrier height in low dielectric constant medium (<4.8). For dielectric constant medium at 4.8, the chance of finding these two protons are more pronounced due to the solvent effect which completely washes out the proton transfer barrier. In the case of higher dielectric constant medium (>4.8), the ionic species becomes more stable than the neutral ones and the formate anion and formamidium cation are thermodynamically stable. For ab initio molecular dynamics simulation, in low dielectric constant medium (<4.8) a reduction of proton transfer barrier with solvent effect is found to be less pronounced than the AIPIMD due to the absence of nuclear quantum effect. Moreover, the motions of FA-FN complex are significantly different with increasing dielectric constant medium. Such a difference is revealed in detail by the principal component analysis.

Influence of forced internal air circulation on airflow distribution and heat transfer in a gas double-dynamic solid-state fermentation bioreactor.

PubMed

Chen, Hongzhang; Qin, Lanzhi; Li, Hongqiang

2014-02-01

Internal air circulation affects the temperature field distribution in a gas double-dynamic solid-state fermentation bioreactor (GDSFB). To enhance heat transfer through strengthening internal air circulation in a GDSFB, we put an air distribution plate (ADP) into the bioreactor and studied the effects of forced internal air circulation on airflow, heat transfer, and cellulase activity of Trichoderma viride L3. Results showed that ADP could help form a steady and uniform airflow distribution, and with gas-guide tubes, air reversal was formed inside the bioreactor, thus resulting in a smaller temperature difference between medium and air by enhancing convective heat transfer inside the bioreactor. Using an ADP of 5.35 % aperture ratio caused a 1 °C decrease in the average temperature difference during the solid-state fermentation process of T. viride L3. Meanwhile, the cellulase activity of T. viride L3 increased by 13.5 %. The best heat-transfer effect was attained when using an ADP of 5.35 % aperture ratio and setting the fan power to 125 V (4.81 W) in the gas double-dynamic solid-state fermentation (GDSF) process. An option of suitable aperture ratio and fan power may be conducive to ADPs' industrial amplification.

Stable continuous-wave single-frequency Nd:YAG blue laser at 473 nm considering the influence of the energy-transfer upconversion.

PubMed

Wang, Yaoting; Liu, Jianli; Liu, Qin; Li, Yuanji; Zhang, Kuanshou

2010-06-07

We report a continuous-wave (cw) single frequency Nd:YAG blue laser at 473 nm end-pumped by a laser diode. A ring laser resonator was designed, the frequency doubling efficiency and the length of nonlinear crystal were optimized based on the investigation of the influence of the frequency doubling efficiency on the thermal lensing effect induced by energy-transfer upconversion. By intracavity frequency doubling with PPKTP crystal, an output power of 1 W all-solid-state cw blue laser of single-frequency operation was achieved. The stability of the blue output power was better than +/- 1.8% in the given four hours.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baalrud, S. D.; Lafleur, T.; Boswell, R. W.

Current-free double layers of the type reported in plasmas in the presence of an expanding magnetic field [C. Charles and R. W. Boswell, Appl. Phys. Lett. 82, 1356 (2003)] are modeled theoretically and with particle-in-cell/Monte Carlo simulations. Emphasis is placed on determining what mechanisms affect the electron velocity distribution function (EVDF) and how the EVDF influences the double layer. A theoretical model is developed based on depletion of electrons in certain velocity intervals due to wall losses and repletion of these intervals due to ionization and elastic electron scattering. This model is used to predict the range of neutral pressuresmore » over which a double layer can form and the electrostatic potential drop of the double layer. These predictions are shown to compare well with simulation results.« less

26 CFR 25.2701-1 - Special valuation rules in the case of transfers of certain interests in corporations and...

Code of Federal Regulations, 2010 CFR

2010-04-01

... double taxation when an applicable retained interest is subsequently transferred. (2) Effect of section... individual transfers an equity interest in a corporation or partnership to a member of the individual's... time of the initial transfer, § 25.2701-4 provides a special rule to increase the individual's later...

Ultrafast forward and backward electron transfer dynamics of coumarin 337 in hydrogen-bonded anilines as studied with femtosecond UV-pump/IR-probe spectroscopy.

PubMed

Ghosh, Hirendra N; Verma, Sandeep; Nibbering, Erik T J

2011-02-10

Femtosecond infrared spectroscopy is used to study both forward and backward electron transfer (ET) dynamics between coumarin 337 (C337) and the aromatic amine solvents aniline (AN), N-methylaniline (MAN), and N,N-dimethylaniline (DMAN), where all the aniline solvents can donate an electron but only AN and MAN can form hydrogen bonds with C337. The formation of a hydrogen bond with AN and MAN is confirmed with steady state FT-IR spectroscopy, where the C═O stretching vibration is a direct marker mode for hydrogen bond formation. Transient IR absorption measurements in all solvents show an absorption band at 2166 cm(-1), which has been attributed to the C≡N stretching vibration of the C337 radical anion formed after ET. Forward electron transfer dynamics is found to be biexponential with time constants τ(ET)(1) = 500 fs, τ(ET)(2) = 7 ps in all solvents. Despite the presence of hydrogen bonds of C337 with the solvents AN and MAN, no effect has been found on the forward electron transfer step. Because of the absence of an H/D isotope effect on the forward electron transfer reaction of C337 in AN, hydrogen bonds are understood to play a minor role in mediating electron transfer. In contrast, direct π-orbital overlap between C337 and the aromatic amine solvents causes ultrafast forward electron transfer dynamics. Backward electron transfer dynamics, in contrast, is dependent on the solvent used. Standard Marcus theory explains the observed backward electron transfer rates.

Optical impedance spectroscopy with single-mode electro-active-integrated optical waveguides.

PubMed

Han, Xue; Mendes, Sergio B

2014-02-04

An optical impedance spectroscopy (OIS) technique based on a single-mode electro-active-integrated optical waveguide (EA-IOW) was developed to investigate electron-transfer processes of redox adsorbates. A highly sensitive single-mode EA-IOW device was used to optically follow the time-dependent faradaic current originated from a submonolayer of cytochrome c undergoing redox exchanges driven by a harmonic modulation of the electric potential at several dc bias potentials and at several frequencies. To properly retrieve the faradaic current density from the ac-modulated optical signal, we introduce here a mathematical formalism that (i) accounts for intrinsic changes that invariably occur in the optical baseline of the EA-IOW device during potential modulation and (ii) provides accurate results for the electro-chemical parameters. We are able to optically reconstruct the faradaic current density profile against the dc bias potential in the working electrode, identify the formal potential, and determine the energy-width of the electron-transfer process. In addition, by combining the optically reconstructed faradaic signal with simple electrical measurements of impedance across the whole electrochemical cell and the capacitance of the electric double-layer, we are able to determine the time-constant connected to the redox reaction of the adsorbed protein assembly. For cytochrome c directly immobilized onto the indium tin oxide (ITO) surface, we measured a reaction rate constant of 26.5 s(-1). Finally, we calculate the charge-transfer resistance and pseudocapacitance associated with the electron-transfer process and show that the frequency dependence of the redox reaction of the protein submonolayer follows as expected the electrical equivalent of an RC-series admittance diagram. Above all, we show here that OIS with single-mode EA-IOW's provide strong analytical signals that can be readily monitored even for small surface-densities of species involved in the redox process (e.g., fmol/cm(2), 0.1% of a full protein monolayer). This experimental approach, when combined with the analytical formalism described here, brings additional sensitivity, accuracy, and simplicity to electro-chemical analysis and is expected to become a useful tool in investigations of redox processes.

Photo-induced electron transfer method

DOEpatents

Wohlgemuth, R.; Calvin, M.

1984-01-24

The efficiency of photo-induced electron transfer reactions is increased and the back transfer of electrons in such reactions is greatly reduced when a photo-sensitizer zinc porphyrin-surfactant and an electron donor manganese porphyrin-surfactant are admixed into phospholipid membranes. The phospholipids comprising said membranes are selected from phospholipids whose head portions are negatively charged. Said membranes are contacted with an aqueous medium in which an essentially neutral viologen electron acceptor is admixed. Catalysts capable of transferring electrons from reduced viologen electron acceptor to hydrogen to produce elemental hydrogen are also included in the aqueous medium. An oxidizable olefin is also admixed in the phospholipid for the purpose of combining with oxygen that coordinates with oxidized electron donor manganese porphyrin-surfactant.

Observation of the effects of stronger magnetic fields on warm, higher energy electrons and ion beams transiting a double layer in a helicon plasma

NASA Astrophysics Data System (ADS)

Scharer, John; Sung, Yung-Ta; Li, Yan

2017-10-01

Fast, two-temperature electrons (>80 eV, Te =13 eV tail, 4 eV bulk) with substantial tail density fractions are created at low (< = 1.7 mtorr) Ar pressure @ 340 G in the antenna region with nozzle mirror ratio of 1.4 on MadHeX @ 900W. These distributions including a fast tail are observed upstream of a double layer. The fast, untrapped tail electrons measured downstream of the double layer have a higher temperature of 13 eV than the trapped, upstream electrons of 4 eV temperature. Upstream plasma potential fluctuations of + - 30 percent are observed. An RF-compensated Langmuir probe is used to measure the electron temperatures and densities and OES, mm wave IF and an RPA for the IEDF are also utilized. As the magnetic field is increased to 1020 G, an increase in the electron temperature and density upstream of the double layer is observed with Te= 15-25 eV with a primarily single temperature mode. Accelerated ion beam energies in the range of 65-120 eV are observed as the magnetic field is increased from 340 to 850 G. The role of the nozzle, plasma double layer and helicon wave coupling on the EEDF and ion acceleration will be discussed. Research supported in part by the University of Wisconsin.

Allosteric control of internal electron transfer in cytochrome cd1 nitrite reductase

PubMed Central

Farver, Ole; Kroneck, Peter M. H.; Zumft, Walter G.; Pecht, Israel

2003-01-01

Cytochrome cd1 nitrite reductase is a bifunctional multiheme enzyme catalyzing the one-electron reduction of nitrite to nitric oxide and the four-electron reduction of dioxygen to water. Kinetics and thermodynamics of the internal electron transfer process in the Pseudomonas stutzeri enzyme have been studied and found to be dominated by pronounced interactions between the c and the d1 hemes. The interactions are expressed both in dramatic changes in the internal electron-transfer rates between these sites and in marked cooperativity in their electron affinity. The results constitute a prime example of intraprotein control of the electron-transfer rates by allosteric interactions. PMID:12802018

Dynamics driving function: new insights from electron transferring flavoproteins and partner complexes.

PubMed

Toogood, Helen S; Leys, David; Scrutton, Nigel S

2007-11-01

Electron transferring flavoproteins (ETFs) are soluble heterodimeric FAD-containing proteins that function primarily as soluble electron carriers between various flavoprotein dehydrogenases. ETF is positioned at a key metabolic branch point, responsible for transferring electrons from up to 10 primary dehydrogenases to the membrane-bound respiratory chain. Clinical mutations of ETF result in the often fatal disease glutaric aciduria type II. Structural and biophysical studies of ETF in complex with partner proteins have shown that ETF partitions the functions of partner binding and electron transfer between (a) a 'recognition loop', which acts as a static anchor at the ETF-partner interface, and (b) a highly mobile redox-active FAD domain. Together, this enables the FAD domain of ETF to sample a range of conformations, some compatible with fast interprotein electron transfer. This 'conformational sampling' enables ETF to recognize structurally distinct partners, whilst also maintaining a degree of specificity. Complex formation triggers mobility of the FAD domain, an 'induced disorder' mechanism contrasting with the more generally accepted models of protein-protein interaction by induced fit mechanisms. We discuss the implications of the highly dynamic nature of ETFs in biological interprotein electron transfer. ETF complexes point to mechanisms of electron transfer in which 'dynamics drive function', a feature that is probably widespread in biology given the modular assembly and flexible nature of biological electron transfer systems.

Parallel Large-scale Semidefinite Programming for Strong Electron Correlation: Using Correlation and Entanglement in the Design of Efficient Energy-Transfer Mechanisms

DTIC Science & Technology

2014-09-24

which nature uses strong electron correlation for efficient energy transfer, particularly in photosynthesis and bioluminescence, (ii) providing an...strong electron correlation for efficient energy transfer, particularly in photosynthesis and bioluminescence, (ii) providing an innovative paradigm...efficient energy transfer, particularly in photosynthesis and bioluminescence, (ii) providing an innovative paradigm for energy transfer in photovoltaic

VESUVIO-the double difference inverse geometry spectrometer at ISIS

NASA Astrophysics Data System (ADS)

Mayers, J.; Tomkinson, J.; Abdul-Redah, T.; Stirling, W. G.; Andreani, C.; Senesi, R.; Nardone, M.; Colognesi, D.; Degiorgi, E.

2004-07-01

The VESUVIO spectrometer at the ISIS pulsed neutron source performs inelastic neutron scattering at high-energy and wave vector transfers, employing gold and uranium resonant foils. A factor of two improvement in the instrumental resolution has been achieved by making use of the double filter difference method. Experimental results are presented for measurements on polycrystalline Pb, which indicate that accurate measurements of single-particle momentum distribution n(p) in quantum fluids are now possible at eV energy transfers.

Electron Tunneling in Lithium Ammonia Solutions Probed by Frequency-Dependent Electron-Spin Relaxation Studies

PubMed Central

Maeda, Kiminori; Lodge, Matthew T.J.; Harmer, Jeffrey; Freed, Jack H.; Edwards, Peter P.

2012-01-01

Electron transfer or quantum tunneling dynamics for excess or solvated electrons in dilute lithium-ammonia solutions have been studied by pulse electron paramagnetic resonance (EPR) spectroscopy at both X- (9.7 GHz) and W-band (94 GHz) frequencies. The electron spin-lattice (T1) and spin-spin (T2) relaxation data indicate an extremely fast transfer or quantum tunneling rate of the solvated electron in these solutions which serves to modulate the hyperfine (Fermi-contact) interaction with nitrogen nuclei in the solvation shells of ammonia molecules surrounding the localized, solvated electron. The donor and acceptor states of the solvated electron in these solutions are the initial and final electron solvation sites found before, and after, the transfer or tunneling process. To interpret and model our electron spin relaxation data from the two observation EPR frequencies requires a consideration of a multi-exponential correlation function. The electron transfer or tunneling process that we monitor through the correlation time of the nitrogen Fermi-contact interaction has a time scale of (1–10)×10−12 s over a temperature range 230–290K in our most dilute solution of lithium in ammonia. Two types of electron-solvent interaction mechanisms are proposed to account for our experimental findings. The dominant electron spin relaxation mechanism results from an electron tunneling process characterized by a variable donor-acceptor distance or range (consistent with such a rapidly fluctuating liquid structure) in which the solvent shell that ultimately accepts the transferring electron is formed from random, thermal fluctuations of the liquid structure in, and around, a natural hole or Bjerrum-like defect vacancy in the liquid. Following transfer and capture of the tunneling electron, further solvent-cage relaxation with a timescale of ca. 10−13 s results in a minor contribution to the electron spin relaxation times. This investigation illustrates the great potential of multi-frequency EPR measurements to interrogate the microscopic nature and dynamics of ultra fast electron transfer or quantum-tunneling processes in liquids. Our results also impact on the universal issue of the role of a host solvent (or host matrix, e.g. a semiconductor) in mediating long-range electron transfer processes and we discuss the implications of our results with a range of other materials and systems exhibiting the phenomenon of electron transfer. PMID:22568866

Opto-electronic conversion logic behaviour through dynamic modulation of electron/energy transfer states at the TiO2-carbon quantum dot interface.

PubMed

Wang, Fang; Zhang, Yonglai; Liu, Yang; Wang, Xuefeng; Shen, Mingrong; Lee, Shuit-Tong; Kang, Zhenhui

2013-03-07

Here we show a bias-mediated electron/energy transfer process at the CQDs-TiO(2) interface for the dynamic modulation of opto-electronic properties. Different energy and electron transfer states have been observed in the CQDs-TNTs system due to the up-conversion photoluminescence and the electron donation/acceptance properties of the CQDs decorated on TNTs.

Double ionization in R -matrix theory using a two-electron outer region

NASA Astrophysics Data System (ADS)

Wragg, Jack; Parker, J. S.; van der Hart, H. W.

2015-08-01

We have developed a two-electron outer region for use within R -matrix theory to describe double ionization processes. The capability of this method is demonstrated for single-photon double ionization of He in the photon energy region between 80 and 180 eV. The cross sections are in agreement with established data. The extended R -matrix with time dependence method also provides information on higher-order processes, as demonstrated by the identification of signatures for sequential double ionization processes involving an intermediate He+ state with n =2 .

Experimental insights on the electron transfer and energy transfer processes between Ce{sup 3+}-Yb{sup 3+} and Ce{sup 3+}-Tb{sup 3+} in borate glass

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sontakke, Atul D., E-mail: sontakke.atul.55a@st.kyoto-u.ac.jp; Katayama, Yumiko; Tanabe, Setsuhisa

2015-03-30

A facile method to describe the electron transfer and energy transfer processes among lanthanide ions is presented based on the temperature dependent donor luminescence decay kinetics. The electron transfer process in Ce{sup 3+}-Yb{sup 3+} exhibits a steady rise with temperature, whereas the Ce{sup 3+}-Tb{sup 3+} energy transfer remains nearly unaffected. This feature has been investigated using the rate equation modeling and a methodology for the quantitative estimation of interaction parameters is presented. Moreover, the overall consequences of electron transfer and energy transfer process on donor-acceptor luminescence behavior, quantum efficiency, and donor luminescence decay kinetics are discussed in borate glass host.more » The results in this study propose a straight forward approach to distinguish the electron transfer and energy transfer processes between lanthanide ions in dielectric hosts, which is highly advantageous in view of the recent developments on lanthanide doped materials for spectral conversion, persistent luminescence, and related applications.« less

Simulation of plasma double-layer structures

NASA Technical Reports Server (NTRS)

Borovsky, J. E.; Joyce, G.

1982-01-01

Electrostatic plasma double layers are numerically simulated by means of a magnetized 2 1/2 dimensional particle in cell method. The investigation of planar double layers indicates that these one dimensional potential structures are susceptible to periodic disruption by instabilities in the low potential plasmas. Only a slight increase in the double layer thickness with an increase in its obliqueness to the magnetic field is observed. Weak magnetization results in the double layer electric field alignment of accelerated particles and strong magnetization results in their magnetic field alignment. The numerical simulations of spatially periodic two dimensional double layers also exhibit cyclical instability. A morphological invariance in two dimensional double layers with respect to the degree of magnetization implies that the potential structures scale with Debye lengths rather than with gyroradii. Electron beam excited electrostatic electron cyclotron waves and (ion beam driven) solitary waves are present in the plasmas adjacent to the double layers.

Verification of the electron/proton coupled mechanism for phenolic H-atom transfer using a triplet π,π ∗ carbonyl

NASA Astrophysics Data System (ADS)

Yamaji, Minoru; Oshima, Juro; Hidaka, Motohiko

2009-06-01

Evidence for the coupled electron/proton transfer mechanism of the phenolic H-atom transfer between triplet π,π ∗ 3,3'-carbonylbis(7-diethylaminocoumarin) and phenol derivatives is obtained by using laser photolysis techniques. It was confirmed that the quenching rate constants of triplet CBC by phenols having positive Hammett constants do not follow the Rehm-Weller equation for electron transfer while those by phenols with negative Hammett constants do it. From the viewpoint of thermodynamic parameters for electron transfer, the crucial factors for phenolic H-atom transfer to π,π ∗ triplet are discussed.

Ion-acoustic double-layers in a magnetized plasma with nonthermal electrons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rios, L. A.; Galvão, R. M. O.; Instituto de Física, Universidade de São Paulo, 05508-900 São Paulo

2013-11-15

In the present work we investigate the existence of obliquely propagating ion-acoustic double layers in magnetized two-electron plasmas. The fluid model is used to describe the ion dynamics, and the hot electron population is modeled via a κ distribution function, which has been proved to be appropriate for modeling non-Maxwellian plasmas. A quasineutral condition is assumed to investigate these nonlinear structures, which leads to the formation of double-layers propagating with slow ion-acoustic velocity. The problem is investigated numerically, and the influence of parameters such as nonthermality is discussed.

Bridge-mediated hopping or superexchange electron-transfer processes in bis(triarylamine) systems

NASA Astrophysics Data System (ADS)

Lambert, Christoph; Nöll, Gilbert; Schelter, Jürgen

2002-09-01

Hopping and superexchange are generally considered to be alternative electron-transfer mechanisms in molecular systems. In this work we used mixed-valence radical cations as model systems for the investigation of electron-transfer pathways. We show that substituents attached to a conjugated bridge connecting two triarylamine redox centres have a marked influence on the near-infrared absorption spectra of the corresponding cations. Spectral analysis, followed by evaluation of the electron-transfer parameters using the Generalized Mulliken-Hush theory and simulation of the potential energy surfaces, indicate that hopping and superexchange are not alternatives, but are both present in the radical cation with a dimethoxybenzene bridge. We found that the type of electron-transfer mechanism depends on the bridge-reorganization energy as well as on the bridge-state energy. Because superexchange and hopping follow different distance laws, our findings have implications for the design of new molecular and polymeric electron-transfer materials.

Flyer Target Acceleration and Energy Transfer at its Collision with Massive Targets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Borodziuk, S.; Kasperczuk, A.; Pisarczyk, T.

2006-01-15

Numerical modelling was aimed at simulation of successive events resulting from interaction of laser beam-single and double targets. It was performed by means of the 2D Lagrangian hydrodynamics code ATLANT-HE. This code is based on one-fluid and two-temperature model of plasma with electron and ion heat conductivity considerations. The code has an advanced treatment of laser light propagation and absorption. This numerical modelling corresponds to the experiment, which was carried out with the use of the PALS facility. Two types of planar solid targets, i.e. single massive Al slabs and double targets consisting of 6 {mu}m thick Al foil andmore » Al slab were applied. The targets were irradiated by the iodine laser pulses of two wavelengths: 1.315 and 0.438 {mu}m. A pulse duration of 0.4 ns and a focal spot diameter of 250 {mu}m at a laser energy of 130 J were used. The numerical modelling allowed us to obtain a more detailed description of shock wave propagation and crater formation.« less

Measurement of Single and Double Spin Asymmetries in p(e, e' pi(+/-,0))X Semi-Inclusive Deep-Inelastic Scattering

NASA Astrophysics Data System (ADS)

Jawalkar, Sucheta Shrikant

Measurements in the late 1980s at CERN revealed that quark spins account for a small fraction of the proton's spin. This so-called spin crisis spurred a number of new experiments to identify the proton's silent spin contributors, namely, the spin of the gluons, which hold the quarks together, and the orbital angular momentum of both quarks and gluons. One such experiment was eg1-dvcs at the Thomas Jefferson National Accelerator Facility in Newport News, Va., which ran in 2009 and collected approximately 19 billion electron triggers for hydrogen. I will present new measurements of the single and double-spin asymmetries ALU, AUL and ALL for pi+, pi - and pi0, measured as a function of Bjorken xB, squared momentum transfer Q2, hadron energy fraction z, and hadron transverse momentum Ph ⊥. These asymmetries, which are convolutions of transverse-momentum-dependent parton distributions and fragmentation functions, correlate with the transverse momentum, and therefore with the orbital motion, of the struck quark.

State-to-state rotational energy-transfer measurements in the nu(2) = 1 state of ammonia by infrared-infrared double resonance

NASA Technical Reports Server (NTRS)

Abel, Bernd; Coy, Stephen L.; Klaassen, Jody J.; Steinfeld, Jeffrey I.

1992-01-01

The state-resolved rotational (R-R, R-T) energy transfer in (N-14)H3 (for NH3-NH3 and NH3-Ar collisions) was studied using an IR double-resonance laser spectroscopic technique. Measurements of both the total rate of depopulation by collisions, and the rates of transfer into specific final rovibrational states (v,J,K) were performed using time-resolved tunable diode laser absorption spectroscopy. A kinetic master-equation analysis of time-resolved level populatons was carried out, yielding state-to-state rate constants and propensity rules for NH3-NH3 and NH3-Ar collisions.

Double diffusive conjugate heat transfer: Part II

NASA Astrophysics Data System (ADS)

Azeem, Soudagar, Manzoor Elahi M.

2018-05-01

Conjugate heat transfer in porous medium is an important study involved in many practical applications. The current study is aimed to investigate the double diffusive flow in a square porous cavity subjected to left vertical surface heating and right vertical surface cooling respectively along with left and right surfaces maintained at high and low concentration. The three governing equations are converted into algebraic form of equations by applying finite element method and solved in iterative manner. The study is focused to investigate the effect of presence of solid inside the cavity with respect to varying buoyancy ratio. It is found that the local heat and mass transfer rate decreases along the height of cavity.

Direct Electron Transfer of Dehydrogenases for Development of 3rd Generation Biosensors and Enzymatic Fuel Cells.

PubMed

Bollella, Paolo; Gorton, Lo; Antiochia, Riccarda

2018-04-24

Dehydrogenase based bioelectrocatalysis has been increasingly exploited in recent years in order to develop new bioelectrochemical devices, such as biosensors and biofuel cells, with improved performances. In some cases, dehydrogeases are able to directly exchange electrons with an appropriately designed electrode surface, without the need for an added redox mediator, allowing bioelectrocatalysis based on a direct electron transfer process. In this review we briefly describe the electron transfer mechanism of dehydrogenase enzymes and some of the characteristics required for bioelectrocatalysis reactions via a direct electron transfer mechanism. Special attention is given to cellobiose dehydrogenase and fructose dehydrogenase, which showed efficient direct electron transfer reactions. An overview of the most recent biosensors and biofuel cells based on the two dehydrogenases will be presented. The various strategies to prepare modified electrodes in order to improve the electron transfer properties of the device will be carefully investigated and all analytical parameters will be presented, discussed and compared.

Selectivity of Electronic Coherence and Attosecond Ionization Delays in Strong-Field Double Ionization

NASA Astrophysics Data System (ADS)

Kobayashi, Yuki; Reduzzi, Maurizio; Chang, Kristina F.; Timmers, Henry; Neumark, Daniel M.; Leone, Stephen R.

2018-06-01

Experiments are presented on real-time probing of coherent electron dynamics in xenon initiated by strong-field double ionization. Attosecond transient absorption measurements allow for characterization of electronic coherences as well as relative ionization timings in multiple electronic states of Xe+ and Xe2 + . A high degree of coherence g =0.4 is observed between P3 2 0-P3 0 0 of Xe2 + , whereas for other possible pairs of states the coherences are below the detection limits of the experiments. A comparison of the experimental results with numerical simulations based on an uncorrelated electron-emission model shows that the coherences produced by strong-field double ionization are more selective than predicted. Surprisingly short ionization time delays, 0.85 fs, 0.64 fs, and 0.75 fs relative to Xe+ formation, are also measured for the P2 3 , P0 3 , and P1 3 states of Xe2 + , respectively. Both the unpredicted selectivity in the formation of coherence and the subfemtosecond time delays of specific states provide new insight into correlated electron dynamics in strong-field double ionization.

Study of ring influence and electronic response to proton transfer reactions. Reaction electronic flux analysis.

PubMed

Herrera, Barbara

2011-05-01

In this article, a theoretical study of 1-5 proton transfers is presented. Two model systems which represent 1-5 proton transfer, 3-hidroxy-2-propenimine and salicyldenaniline have been studied as shown in Fig. 1. For this purpose, a DFT/B3LYP/6-311+G**, reaction force and reaction electronic flux analysis is made. The obtained results indicate that both proton transfers exhibit energetic and electronic differences emphasizing the role of the neighbor ring and the impact of conjugation on electronic properties.

Effect of mood states and infertility stress on patients' attitudes toward embryo transfer and multiple pregnancy.

PubMed

Newton, Christopher; Feyles, Valter; Asgary-Eden, Veronica

2013-08-01

To examine whether mood state or infertility stress influences perceptions of risk, preferences for embryo transfer, or views on multiple pregnancy. Observational cohort study. Hospital-based fertility clinic. One hundred seventy-six women participating in IVF treatment. None. Mood scores, ratings of risk, preference for multiple embryo transfer, and attitudes toward multiple pregnancy. Growing feelings of tension across the cycle corresponded with increases in the perceived riskiness of double-embryo transfer, but there was no change in strength of transfer preferences. Women experiencing negative moods, such as depression, viewed twin and triplet pregnancy as less likely, whereas increasing positive feelings across the cycle were associated with increasing desire for twin pregnancy. Overall, women perceived double- and triple-embryo transfer as less risky by cycle end than at cycle beginning and felt more certain about multiple-embryo transfer. The dyssynchrony observed among changes in mood, perceptions of risk, and transfer preferences challenges assumptions about the way medical risk information influences transfer preferences, and the findings suggest that mood states experienced during an IVF cycle might affect transfer preferences by influencing attitudes toward multiple pregnancy. Additional considerations beyond providing risk information are needed to facilitate effective patient decision making. Crown Copyright © 2013. Published by Elsevier Inc. All rights reserved.

Coherent Electron Transfer at the Ag / Graphite Heterojunction Interface

NASA Astrophysics Data System (ADS)

Tan, Shijing; Dai, Yanan; Zhang, Shengmin; Liu, Liming; Zhao, Jin; Petek, Hrvoje

2018-03-01

Charge transfer in transduction of light to electrical or chemical energy at heterojunctions of metals with semiconductors or semimetals is believed to occur by photogenerated hot electrons in metal undergoing incoherent internal photoemission through the heterojunction interface. Charge transfer, however, can also occur coherently by dipole coupling of electronic bands at the heterojunction interface. Microscopic physical insights into how transfer occurs can be elucidated by following the coherent polarization of the donor and acceptor states on the time scale of electronic dephasing. By time-resolved multiphoton photoemission spectroscopy (MPP), we investigate the coherent electron transfer from an interface state that forms upon chemisorption of Ag nanoclusters onto graphite to a σ symmetry interlayer band of graphite. Multidimensional MPP spectroscopy reveals a resonant two-photon transition, which dephases within 10 fs completing the coherent transfer.

On the calculation of charge transfer transitions with standard density functionals using constrained variational density functional theory.

PubMed

Ziegler, Tom; Krykunov, Mykhaylo

2010-08-21

It is well known that time-dependent density functional theory (TD-DFT) based on standard gradient corrected functionals affords both a quantitative and qualitative incorrect picture of charge transfer transitions between two spatially separated regions. It is shown here that the well known failure can be traced back to the use of linear response theory. Further, it is demonstrated that the inclusion of higher order terms readily affords a qualitatively correct picture even for simple functionals based on the local density approximation. The inclusion of these terms is done within the framework of a newly developed variational approach to excitation energies called constrained variational density functional theory (CV-DFT). To second order [CV(2)-DFT] this theory is identical to adiabatic TD-DFT within the Tamm-Dancoff approximation. With inclusion of fourth order corrections [CV(4)-DFT] it affords a qualitative correct description of charge transfer transitions. It is finally demonstrated that the relaxation of the ground state Kohn-Sham orbitals to first order in response to the change in density on excitation together with CV(4)-DFT affords charge transfer excitations in good agreement with experiment. The new relaxed theory is termed R-CV(4)-DFT. The relaxed scheme represents an effective way in which to introduce double replacements into the description of single electron excitations, something that would otherwise require a frequency dependent kernel.

Food Antioxidants: Chemical Insights at the Molecular Level.

PubMed

Galano, Annia; Mazzone, Gloria; Alvarez-Diduk, Ruslán; Marino, Tiziana; Alvarez-Idaboy, J Raúl; Russo, Nino

2016-01-01

In this review, we briefly summarize the reliability of the density functional theory (DFT)-based methods to accurately predict the main antioxidant properties and the reaction mechanisms involved in the free radical-scavenging reactions of chemical compounds present in food. The analyzed properties are the bond dissociation energies, in particular those involving OH bonds, electron transfer enthalpies, adiabatic ionization potentials, and proton affinities. The reaction mechanisms are hydrogen-atom transfer, proton-coupled electron transfer, radical adduct formation, single electron transfer, sequential electron proton transfer, proton-loss electron transfer, and proton-loss hydrogen-atom transfer. Furthermore, the chelating ability of these compounds and its role in decreasing or inhibiting the oxidative stress induced by Fe(III) and Cu(II) are considered. Comparisons between theoretical and experimental data confirm that modern theoretical tools are not only able to explain controversial experimental facts but also to predict chemical behavior.

On generalized Mulliken-Hush approach of electronic transfer: Inclusion of non-zero off-diagonal diabatic dipole moment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kryachko, E.S.

1999-06-03

The electronic coupling between the initial and final diabatic states is the major factor that determines the rate of electron transfer. A general formula for the adiabatic-to-diabatic mixing angle in terms of the electronic dipole moments is derived within a two-state model. It expresses the electronic coupling determining the rate of electronic transfer in terms of the off-diagonal diabatic dipole moment.

Photo-induced electron transfer method

DOEpatents

Wohlgemuth, Roland; Calvin, Melvin

1984-01-01

The efficiency of photo-induced electron transfer reactions is increased and the back transfer of electrons in such reactions is greatly reduced when a photo-sensitizer zinc porphyrin-surfactant and an electron donor manganese porphyrin-surfactant are admixed into phospho-lipid membranes. The phospholipids comprising said membranes are selected from phospholipids whose head portions are negatively charged. Said membranes are contacted with an aqueous medium in which an essentially neutral viologen electron acceptor is admixed. Catalysts capable of transfering electrons from reduced viologen electron acceptor to hydrogen to produce elemental hydrogen are also included in the aqueous medium. An oxidizable olefin is also admixed in the phospholipid for the purpose of combining with oxygen that coordinates with oxidized electron donor manganese porphyrin-surfactant.

Quantum free energy landscapes from ab initio path integral metadynamics: Double proton transfer in the formic acid dimer is concerted but not correlated.

PubMed

Ivanov, Sergei D; Grant, Ian M; Marx, Dominik

2015-09-28

With the goal of computing quantum free energy landscapes of reactive (bio)chemical systems in multi-dimensional space, we combine the metadynamics technique for sampling potential energy surfaces with the ab initio path integral approach to treating nuclear quantum motion. This unified method is applied to the double proton transfer process in the formic acid dimer (FAD), in order to study the nuclear quantum effects at finite temperatures without imposing a one-dimensional reaction coordinate or reducing the dimensionality. Importantly, the ab initio path integral metadynamics technique allows one to treat the hydrogen bonds and concomitant proton transfers in FAD strictly independently and thus provides direct access to the much discussed issue of whether the double proton transfer proceeds via a stepwise or concerted mechanism. The quantum free energy landscape we compute for this H-bonded molecular complex reveals that the two protons move in a concerted fashion from initial to product state, yet world-line analysis of the quantum correlations demonstrates that the protons are as quantum-uncorrelated at the transition state as they are when close to the equilibrium structure.

Photoelectron spectrum of valence anions of uracil and first-principles calculations of excess electron binding energies.

PubMed

Bachorz, Rafał A; Klopper, Wim; Gutowski, Maciej; Li, Xiang; Bowen, Kit H

2008-08-07

The photoelectron spectrum (PES) of the uracil anion is reported and discussed from the perspective of quantum chemical calculations of the vertical detachment energies (VDEs) of the anions of various tautomers of uracil. The PES peak maximum is found at an electron binding energy of 2.4 eV, and the width of the main feature suggests that the parent anions are in a valence rather than a dipole-bound state. The canonical tautomer as well as four tautomers that result from proton transfer from an NH group to a C atom were investigated computationally. At the Hartree-Fock and second-order Moller-Plesset perturbation theory levels, the adiabatic electron affinity (AEA) and the VDE have been converged to the limit of a complete basis set to within +/-1 meV. Post-MP2 electron-correlation effects have been determined at the coupled-cluster level of theory including single, double, and noniterative triple excitations. The quantum chemical calculations suggest that the most stable valence anion of uracil is the anion of a tautomer that results from a proton transfer from N1H to C5. It is characterized by an AEA of 135 meV and a VDE of 1.38 eV. The peak maximum is as much as 1 eV larger, however, and the photoelectron intensity is only very weak at 1.38 eV. The PES does not lend support either to the valence anion of the canonical tautomer, which is the second most stable anion, and whose VDE is computed at about 0.60 eV. Agreement between the peak maximum and the computed VDE is only found for the third most stable tautomer, which shows an AEA of approximately -0.1 eV and a VDE of 2.58 eV. This tautomer results from a proton transfer from N3H to C5. The results illustrate that the characteristics of biomolecular anions are highly dependent on their tautomeric form. If indeed the third most stable anion is observed in the experiment, then it remains an open question why and how this species is formed under the given conditions.

Electron trapping optical data storage system and applications

NASA Technical Reports Server (NTRS)

Brower, Daniel; Earman, Allen; Chaffin, M. H.

1993-01-01

A new technology developed at Optex Corporation out-performs all other existing data storage technologies. The Electron Trapping Optical Memory (ETOM) media stores 14 gigabytes of uncompressed data on a single, double-sided 130 mm disk with a data transfer rate of up to 120 megabits per second. The disk is removable, compact, lightweight, environmentally stable, and robust. Since the Write/Read/Erase (W/R/E) processes are carried out photonically, no heating of the recording media is required. Therefore, the storage media suffers no deleterious effects from repeated W/R/E cycling. This rewritable data storage technology has been developed for use as a basis for numerous data storage products. Industries that can benefit from the ETOM data storage technologies include: satellite data and information systems, broadcasting, video distribution, image processing and enhancement, and telecommunications. Products developed for these industries are well suited for the demanding store-and-forward buffer systems, data storage, and digital video systems needed for these applications.

Structure assignment, electronic properties, and magnetism quenching of endohedrally doped neutral silicon clusters, Si(n)Co (n = 10-12).

PubMed

Li, Yejun; Tam, Nguyen Minh; Claes, Pieterjan; Woodham, Alex P; Lyon, Jonathan T; Ngan, Vu Thi; Nguyen, Minh Tho; Lievens, Peter; Fielicke, André; Janssens, Ewald

2014-09-18

The structures of neutral cobalt-doped silicon clusters have been assigned by a combined experimental and theoretical study. Size-selective infrared spectra of neutral Si(n)Co (n = 10-12) clusters are measured using a tunable IR-UV two-color ionization scheme. The experimental infrared spectra are compared with calculated spectra of low-energy structures predicted at the B3P86 level of theory. It is shown that the Si(n)Co (n = 10-12) clusters have endohedral caged structures, where the silicon frameworks prefer double-layered structures encapsulating the Co atom. Electronic structure analysis indicates that the clusters are stabilized by an ionic interaction between the Co dopant atom and the silicon cage due to the charge transfer from the silicon valence sp orbitals to the cobalt 3d orbitals. Strong hybridization between the Co dopant atom and the silicon host quenches the local magnetic moment on the encapsulated Co atom.

Deciphering structural and functional roles of individual disulfide bonds of the mitochondrial sulfhydryl oxidase Erv1p.

PubMed

Ang, Swee Kim; Lu, Hui

2009-10-16

Erv1p is a FAD-dependent sulfhydryl oxidase of the mitochondrial intermembrane space. It contains three conserved disulfide bonds arranged in two CXXC motifs and one CX(16)C motif. Experimental evidence for the specific roles of the individual disulfide bonds is lacking. In this study, structural and functional roles of the disulfides were dissected systematically using a wide range of biochemical and biophysical methods. Three double cysteine mutants with each pair of cysteines mutated to serines were generated. All of the mutants were purified with the normal FAD binding properties as the wild type Erv1p, showing that none of the three disulfides are essential for FAD binding. Thermal denaturation and trypsin digestion studies showed that the CX(16)C disulfide plays an important role in stabilizing the folding of Erv1p. To understand the functional role of each disulfide, small molecules and the physiological substrate protein Mia40 were used as electron donors in oxygen consumption assays. We show that both CXXC disulfides are required for Erv1 oxidase activity. The active site disulfide is well protected thus requires the shuttle disulfide for its function. Although both mutants of the CXXC motifs were individually inactive, Erv1p activity was partially recovered by mixing these two mutants together, and the recovery was rapid. Thus, we provided the first experimental evidence of electron transfer between the shuttle and active site disulfides of Erv1p, and we propose that both intersubunit and intermolecular electron transfer can occur.

Deciphering Structural and Functional Roles of Individual Disulfide Bonds of the Mitochondrial Sulfhydryl Oxidase Erv1p*

PubMed Central

Ang, Swee Kim; Lu, Hui

2009-01-01

Erv1p is a FAD-dependent sulfhydryl oxidase of the mitochondrial intermembrane space. It contains three conserved disulfide bonds arranged in two CXXC motifs and one CX16C motif. Experimental evidence for the specific roles of the individual disulfide bonds is lacking. In this study, structural and functional roles of the disulfides were dissected systematically using a wide range of biochemical and biophysical methods. Three double cysteine mutants with each pair of cysteines mutated to serines were generated. All of the mutants were purified with the normal FAD binding properties as the wild type Erv1p, showing that none of the three disulfides are essential for FAD binding. Thermal denaturation and trypsin digestion studies showed that the CX16C disulfide plays an important role in stabilizing the folding of Erv1p. To understand the functional role of each disulfide, small molecules and the physiological substrate protein Mia40 were used as electron donors in oxygen consumption assays. We show that both CXXC disulfides are required for Erv1 oxidase activity. The active site disulfide is well protected thus requires the shuttle disulfide for its function. Although both mutants of the CXXC motifs were individually inactive, Erv1p activity was partially recovered by mixing these two mutants together, and the recovery was rapid. Thus, we provided the first experimental evidence of electron transfer between the shuttle and active site disulfides of Erv1p, and we propose that both intersubunit and intermolecular electron transfer can occur. PMID:19679655

Effect of photocurrent enhancement in porphyrin-graphene covalent hybrids.

PubMed

Tang, Jianguo; Niu, Lin; Liu, Jixian; Wang, Yao; Huang, Zhen; Xie, Shiqiang; Huang, Linjun; Xu, Qingsong; Wang, Yuan; Belfiore, Laurence A

2014-01-01

Graphene oxide (GO) sheets were covalently functionalized with 5-p-aminophenyl-10,15,20-triphenylporphyrin (NH2TPP) by an amidation reaction between the amino group in NH2TPP and carboxyl groups in GO. The Fourier transform infrared spectroscopy, nuclear magnetic resonance, scanning and transmission electron microscopies reveal that NH2TPP covalent bonds form on the double surface of graphene oxide sheets, generating a unique nano-framework, i.e., NH2TPP-graphene-NH2TPP. Its UV-visible spectroscopy reveals that the absorption spectrum is not a linear superposition of the spectra of NH2TPP and graphene oxide, because a 59nm red shift of the strong graphene oxide absorption is observed from 238 to 297nm, with significant spectral broadening between 300 and 700nm. Fluorescence emission spectroscopy indicates efficient quenching of NH2TPP photoluminescence in this hybrid material, suggesting that photo-induced electron transfer occurs at the interface between NH2TPP and GO. A reversible on/off photo-current density of 47mA/cm(2) is observed when NH2TPP-graphene-NH2TPP hybrid sandwiches are subjected to pulsed white-light illumination. Covalently-bound porphyrins decrease the optical HOMO/LUMO band gap of graphene oxide by ≈1eV, according to UV-visible spectroscopy. Cyclic voltammetry predicts a small HOMO/LUMO band gap of 0.84eV for NH2TPP-graphene-NH2TPP hybrid sandwiches, which is consistent with efficient electron transfer and fluorescence quenching. © 2013. Published by Elsevier B.V. All rights reserved.

The protonation of N2O reexamined - A case study on the reliability of various electron correlation methods for minima and transition states

NASA Technical Reports Server (NTRS)

Martin, J. M. L.; Lee, Timothy J.

1993-01-01

The protonation of N2O and the intramolecular proton transfer in N2OH(+) are studied using various basis sets and a variety of methods, including second-order many-body perturbation theory (MP2), singles and doubles coupled cluster (CCSD), the augmented coupled cluster (CCSD/T/), and complete active space self-consistent field (CASSCF) methods. For geometries, MP2 leads to serious errors even for HNNO(+); for the transition state, only CCSD/T/ produces a reliable geometry due to serious nondynamical correlation effects. The proton affinity at 298.15 K is estimated at 137.6 kcal/mol, in close agreement with recent experimental determinations of 137.3 +/- 1 kcal/mol.

Downhole tool

DOEpatents

Hall, David R.; Muradov, Andrei; Pixton, David S.; Dahlgren, Scott Steven; Briscoe, Michael A.

2007-03-20

A double shouldered downhole tool connection comprises box and pin connections having mating threads intermediate mating primary and secondary shoulders. The connection further comprises a secondary shoulder component retained in the box connection intermediate a floating component and the primary shoulders. The secondary shoulder component and the pin connection cooperate to transfer a portion of makeup load to the box connection. The downhole tool may be selected from the group consisting of drill pipe, drill collars, production pipe, and reamers. The floating component may be selected from the group consisting of electronics modules, generators, gyroscopes, power sources, and stators. The secondary shoulder component may comprises an interface to the box connection selected from the group consisting of radial grooves, axial grooves, tapered grooves, radial protrusions, axial protrusions, tapered protrusions, shoulders, and threads.

Application of Electron-Transfer Theory to Several Systems of Biological Interest

DOE R&D Accomplishments Database

Marcus, R. A.; Sutin, N.

1985-03-23

Electron-transfer reaction rates are compared with theoretically calculated values for several reactions in the bacterial photosynthetic reaction center. A second aspect of the theory, the cross-relation, is illustrated using protein-protein electron transfers.

Electron-Impact Ionization and Dissociative Ionization of Biomolecules

NASA Technical Reports Server (NTRS)

Huo, Winifred M.; Chaban, Galina M.; Dateo, Christopher E.

2006-01-01

It is well recognized that secondary electrons play an important role in radiation damage to humans. Particularly important is the damage of DNA by electrons, potentially leading to mutagenesis. Molecular-level study of electron interaction with DNA provides information on the damage pathways and dominant mechanisms. Our study of electron-impact ionization of DNA fragments uses the improved binary-encounter dipole model and covers DNA bases, sugar phosphate backbone, and nucleotides. An additivity principle is observed. For example, the sum of the ionization cross sections of the separate deoxyribose and phosphate fragments is in close agreement with the C3(sup prime)- and C5 (sup prime)-deoxyribose-phospate cross sections, differing by less than 5%. Investigation of tandem double lesion initiated by electron-impact dissociative ionization of guanine, followed by proton reaction with the cytosine in the Watson-Crick pair, is currently being studied to see if tandem double lesion can be initiated by electron impact. Up to now only OH-induced tandem double lesion has been studied.

Dual-circuit, multiple-effect refrigeration system and method

DOEpatents

DeVault, Robert C.

1995-01-01

A dual circuit absorption refrigeration system comprising a high temperature single-effect refrigeration loop and a lower temperature double-effect refrigeration loop separate from one another and provided with a double-condenser coupling therebetween. The high temperature condenser of the single-effect refrigeration loop is double coupled to both of the generators in the double-effect refrigeration loop to improve internal heat recovery and a heat and mass transfer additive such as 2-ethyl-1-hexanol is used in the lower temperature double-effect refrigeration loop to improve the performance of the absorber in the double-effect refrigeration loop.

Double-Resonance Facilitated Decomposion of Emission Spectra

NASA Astrophysics Data System (ADS)

Kato, Ryota; Ishikawa, Haruki

2016-06-01

Emission spectra provide us with rich information about the excited-state processes such as proton-transfer, charge-transfer and so on. In the cases that more than one excited states are involved, emission spectra from different excited states sometimes overlap and a decomposition of the overlapped spectra is desired. One of the methods to perform a decomposition is a time-resolved fluorescence technique. It uses a difference in time evolutions of components involved. However, in the gas-phase, a concentration of the sample is frequently too small to carry out this method. On the other hand, double-resonance technique is a very powerful tool to discriminate or identify a common species in the spectra in the gas-phase. Thus, in the present study, we applied the double-resonance technique to resolve the overlapped emission spectra. When transient IR absorption spectra of the excited state are available, we can label the population of the certain species by the IR excitation with a proper selection of the IR wavenumbers. Thus, we can obtain the emission spectra of labeled species by subtracting the emission spectra with IR labeling from that without IR. In the present study, we chose the charge-transfer emission spectra of cyanophenyldisilane (CPDS) as a test system. One of us reported that two charge-transfer (CT) states are involved in the intramolecular charge-transfer (ICT) process of CPDS-water cluster and recorded the transient IR spectra. As expected, we have succeeded in resolving the CT emission spectra of CPDS-water cluster by the double resonance facilitated decomposion technique. In the present paper, we will report the details of the experimental scheme and the results of the decomposition of the emission spectra. H. Ishikawa, et al., Chem. Phys. Phys. Chem., 9, 117 (2007).

Double proton transfer in the complex of acetic acid with methanol: Theory versus experiment

NASA Astrophysics Data System (ADS)

Fernández-Ramos, Antonio; Smedarchina, Zorka; Rodríguez-Otero, Jesús

2001-01-01

To test the approximate instanton approach to intermolecular proton-transfer dynamics, we report multidimensional ab initio bimolecular rate constants of HH, HD, and DD exchange in the complex of acetic acid with methanol in tetrahydrofuran-d8, and compare them with the NMR (nuclear magnetic resonance) experiments of Gerritzen and Limbach. The bimolecular rate constants are evaluated as products of the exchange rates and the equilibrium rate constants of complex formation in solution. The two molecules form hydrogen-bond bridges and the exchange occurs via concerted transfer of two protons. The dynamics of this transfer is evaluated in the complete space of 36 vibrational degrees of freedom. The geometries of the two isolated molecules, the complex, and the transition states corresponding to double proton transfer are fully optimized at QCISD (quadratic configuration interaction including single and double substitutions) level of theory, and the normal-mode frequencies are calculated at MP2 (Møller-Plesset perturbation theory of second order) level with the 6-31G (d,p) basis set. The presence of the solvent is taken into account via single-point calculations over the gas phase geometries with the PCM (polarized continuum model). The proton exchange rate constants, calculated with the instanton method, show the effect of the structure and strength of the hydrogen bonds, reflected in the coupling between the tunneling motion and the other vibrations of the complex. Comparison with experiment, which shows substantial kinetic isotopic effects (KIE), indicates that tunneling prevails over classic exchange for the whole temperature range of observation. The unusual behavior of the experimental KIE upon single and double deuterium substitution is well reproduced and is related to the synchronicity of two-atom tunneling.

Effect of cooler electrons on a compressive ion acoustic solitary wave in a warm ion plasma — Forbidden regions, double layers, and supersolitons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ghosh, S. S., E-mail: sukti@iigs.iigm.res.in; Sekar Iyengar, A. N.

It is observed that the presence of a minority component of cooler electrons in a three component plasma plays a deterministic role in the evolution of solitary waves, double layers, or the newly discovered structures called supersolitons. The inclusion of the cooler component of electrons in a single electron plasma produces sharp increase in nonlinearity in spite of a decrease in the overall energy of the system. The effect maximizes at certain critical value of the number density of the cooler component (typically 15%–20%) giving rise to a hump in the amplitude variation profile. For larger amplitudes, the hump leadsmore » to a forbidden region in the ambient cooler electron concentration which dissociates the overall existence domain of solitary wave solutions in two distinct parameter regime. It is observed that an inclusion of the cooler component of electrons as low as < 1% affects the plasma system significantly resulting in compressive double layers. The solution is further affected by the cold to hot electron temperature ratio. In an adequately hotter bulk plasma (i.e., moderately low cold to hot electron temperature ratio), the parameter domain of compressive double layers is bounded by a sharp discontinuity in the corresponding amplitude variation profile which may lead to supersolitons.« less

Synergistic electron transfer effect-based signal amplification strategy for the ultrasensitive detection of dopamine.

PubMed

Lu, Qiujun; Chen, Xiaogen; Liu, Dan; Wu, Cuiyan; Liu, Meiling; Li, Haitao; Zhang, Youyu; Yao, Shouzhuo

2018-05-15

The selective and sensitive detection of dopamine (DA) is of great significance for the identification of schizophrenia, Huntington's disease, and Parkinson's disease from the perspective of molecular diagnostics. So far, most of DA fluorescence sensors are based on the electron transfer from the fluorescence nanomaterials to DA-quinone. However, the limited electron transfer ability of the DA-quinone affects the level of detection sensitivity of these sensors. In this work, based on the DA can reduce Ag + into AgNPs followed by oxidized to DA-quinone, we developed a novel silicon nanoparticles-based electron transfer fluorescent sensor for the detection of DA. As electron transfer acceptor, the AgNPs and DA-quinone can quench the fluorescence of silicon nanoparticles effectively through the synergistic electron transfer effect. Compared with traditional fluorescence DA sensors, the proposed synergistic electron transfer-based sensor improves the detection sensitivity to a great extent (at least 10-fold improvement). The proposed sensor shows a low detection limit of DA, which is as low as 0.1 nM under the optimal conditions. This sensor has potential applicability for the detection of DA in practical sample. This work has been demonstrated to contribute to a substantial improvement in the sensitivity of the sensors. It also gives new insight into design electron transfer-based sensors. Copyright © 2018. Published by Elsevier B.V.

Quantifying electron transfer reactions in biological systems: what interactions play the major role?

NASA Astrophysics Data System (ADS)

Sjulstok, Emil; Olsen, Jógvan Magnus Haugaard; Solov'Yov, Ilia A.

2015-12-01

Various biological processes involve the conversion of energy into forms that are usable for chemical transformations and are quantum mechanical in nature. Such processes involve light absorption, excited electronic states formation, excitation energy transfer, electrons and protons tunnelling which for example occur in photosynthesis, cellular respiration, DNA repair, and possibly magnetic field sensing. Quantum biology uses computation to model biological interactions in light of quantum mechanical effects and has primarily developed over the past decade as a result of convergence between quantum physics and biology. In this paper we consider electron transfer in biological processes, from a theoretical view-point; namely in terms of quantum mechanical and semi-classical models. We systematically characterize the interactions between the moving electron and its biological environment to deduce the driving force for the electron transfer reaction and to establish those interactions that play the major role in propelling the electron. The suggested approach is seen as a general recipe to treat electron transfer events in biological systems computationally, and we utilize it to describe specifically the electron transfer reactions in Arabidopsis thaliana cryptochrome-a signaling photoreceptor protein that became attractive recently due to its possible function as a biological magnetoreceptor.

Plasma contactor research, 1990

NASA Technical Reports Server (NTRS)

Williams, John D.; Wilbur, Paul J.

1991-01-01

Emissive and Langmuir probes were used to measure plasma potential profiles, plasma densities, electron energy distributions, and plasma noise levels near a hollow cathode-based plasma contactor emitting electrons. The effects of electron emission current (100 to 1500 mA) and contactor flowrate (2 to 10 sccm (Xenon)) on these data are examined. Retarding potential analyzer (RPA) measurements showing that high energy ions generally stream from a contactor along with the electrons being emitted are also presented, and a mechanism by which this occurs is postulated. This mechanism, which involves a high rate of ionization induced between electrons and atoms flowing together from the hollow cathode orifice, results in a region of high positive space charge and high positive potential. Langmuir and RPA probe data suggests that both electrons and ions expand spherically from this potential hill region. In addition to experimental observations, a simple one-dimensional model which describes the electron emission process and predicts the phenomena just mentioned is presented and is shown to agree qualitatively with these observations. Experimental results of the first stage of bilateral cooperation with the Italian Institute of Interplanetary Space Physics (IFSI CNR) are presented. Sharp, well-defined double layers were observed downstream of a contactor collecting electrons from an ambient plasma created in the IFSI Facility. The voltage drop across these double layers was observed to increase with the current drawn from the ambient plasma. This observation, which was not as clear in previous IFSI tests conducted at higher neutral pressures, is in agreement with previous experimental observations made at both Colorado State University and NASA Lewis Research Center. Greater double layer voltage drops, multiple double layers, and higher noise levels in the region near the double layers were also observed when a magnetic field was imposed and oriented perpendicular to the line joining the contactor and simulator.

Laboratory-scale photoredox catalysis using hydrated electrons sustainably generated with a single green laser.

PubMed

Naumann, Robert; Kerzig, Christoph; Goez, Martin

2017-11-01

The ruthenium-tris-bipyridyl dication as catalyst combined with the ascorbate dianion as bioavailable sacrificial donor provides the first regenerative source of hydrated electrons for chemical syntheses on millimolar scales. This electron generator is operated simply by illumination with a frequency-doubled Nd:YAG laser (532 nm) running at its normal repetition rate. Much more detailed information than by product studies alone was obtained by photokinetical characterization from submicroseconds (time-resolved laser flash photolysis) up to one hour (preparative photolysis). The experiments on short timescales established a reaction mechanism more complex than previously thought, and proved the catalytic action by unchanged concentration traces of the key transients over a number of flashes so large that the accumulated electron total surpassed the catalyst concentration many times. Preparative photolyses revealed that the sacrificial donor greatly enhances the catalyst stability through quenching the initial metal-to-ligand charge-transfer state before destructive dd states can be populated from it, such that the efficiency of this electron generator is no longer limited by catalyst decomposition but by electron scavenging by the accumulating oxidation products of the ascorbate. Applications covered dechlorinations of selected aliphatic and aromatic chlorides and the reduction of a model ketone. All these substrates are impervious to photoredox catalysts exhibiting lower reducing power than the hydrated electron, but the combination of an extremely negative standard potential and a long unquenched life allowed turnover numbers up to 1400 with our method.

Cisplatin enhances the formation of DNA single- and double-strand breaks by hydrated electrons and hydroxyl radicals.

PubMed

Rezaee, Mohammad; Sanche, Léon; Hunting, Darel J

2013-03-01

The synergistic interaction of cisplatin with ionizing radiation is the clinical rationale for the treatment of several cancers including head and neck, cervical and lung cancer. The underlying molecular mechanism of the synergy has not yet been identified, although both DNA damage and repair processes are likely involved. Here, we investigate the indirect effect of γ rays on strand break formation in a supercoiled plasmid DNA (pGEM-3Zf-) covalently modified by cisplatin. The yields of single- and double-strand breaks were determined by irradiation of DNA and cisplatin/DNA samples with (60)Co γ rays under four different scavenging conditions to examine the involvement of hydrated electrons and hydroxyl radicals in inducing the DNA damage. At 5 mM tris in an N2 atmosphere, the presence of an average of two cisplatins per plasmid increased the yields of single- and double-strand breaks by factors of 1.9 and 2.2, respectively, relative to the irradiated unmodified DNA samples. Given that each plasmid of 3,200 base pairs contained an average of two cisplatins, this represents an increase in radiosensitivity of 3,200-fold on a per base pair basis. When hydrated electrons were scavenged by saturating the samples with N2O, these enhancement factors decreased to 1.5 and 1.2, respectively, for single- and double-strand breaks. When hydroxyl radicals were scavenged using 200 mM tris, the respective enhancement factors were 1.2 and 1.6 for single- and double-strand breaks, respectively. Furthermore, no enhancement in DNA damage by cisplatin was observed after scavenging both hydroxyl radicals and hydrated electrons. These findings show that hydrated electrons can induce both single- and double-strand breaks in the platinated DNA, but not in unmodified DNA. In addition, cisplatin modification is clearly an extremely efficient means of increasing the formation of both single- and double-strand breaks by the hydrated electrons and hydroxyl radicals created by ionizing radiation.

ELECTRON TRANSFER MECHANISM AT THE SOLID-LIQUID INTERFACE OF PHYLLOSILICATES

EPA Science Inventory

Interfacial electron transfer processes on clay minerals have significant impact in natural environments and geochemical systems. Nitrobenzene was used as molecular probes to study the electron transfer mechanism at the solid-water interfaces of Fe-containing phyllosicates. For...

Tunneling induced electron transfer between separated protons

NASA Astrophysics Data System (ADS)

Vindel-Zandbergen, Patricia; Meier, Christoph; Sola, Ignacio R.

2018-04-01

We study electron transfer between two separated protons using local control theory. In this symmetric system one can favour a slow transfer by biasing the algorithm, achieving high efficiencies for fixed nuclei. The solution can be parametrized using a sequence of a pump followed by a dump pulse that lead to tunneling-induced electron transfer. Finally, we study the effect of the nuclear kinetic energy on the efficiency. Even in the absence of relative motion between the protons, the spreading of the nuclear wave function is enough to reduce the yield of electronic transfer to less than one half.

Carbon nanostructures modified LiFePO4 cathodes for lithium ion battery applications: optimized porosity and composition

NASA Astrophysics Data System (ADS)

Mahmoud, Lama; Singh Lalia, Boor; Hashaikeh, Raed

2016-12-01

Lithium iron phosphate (LiFePO4) battery cathode was fabricated without using any metallic current collector and polymeric binder. Carbon nanostructures (CNS) were used as microbinders for LiFePO4 particles and at the same time as a 3D current collector. A facile and cost effective method of fabricating composite cathodes of CNS and LiFePO4 was developed. Thick electrodes with high loading of active material (20-25 mg cm-2) were obtained that are almost 2-3 folds higher than commercial electrodes. SEM images confirm that the 3D CNS conductive network encapsulated the LiFePO4 particles homogenously facilitating the charge transfer at the electrode-CNS interface. The composition, scan rate and porosity of the paper-like cathode were sequentially varied and their influence was systematically monitored by means of linear sweep cyclic voltammetry and AC electrochemical impedance spectroscopy. Addition of CNS improved the electrode’s bulk electronic conductivity, mechanical integrity, surface area and double layer capacitance, yet compromised the charge transfer resistance at the electrode-electrolyte interface. Based on a range of the tested binder-free electrodes, this study proposes that electrodes with 20 wt% CNS having 49 ± 2.5% porosity had realized best improvements of two folds and four folds in the electronic conductivity and diffusion coefficient, respectively.

X.400: The Standard for Message Handling Systems.

ERIC Educational Resources Information Center

Swain, Leigh; Tallim, Paula

1990-01-01

Profiles X.400, the Open Systems Interconnection (OSI) Application layer standard that supports interpersonal electronic mail services, facsimile transfer, electronic data interchange, electronic funds transfer, electronic publishing, and electronic invoicing. Also discussed are an electronic directory to support message handling, compatibility…

Application of Degenerately Doped Metal Oxides in the Study of Photoinduced Interfacial Electron Transfer.

PubMed

Farnum, Byron H; Morseth, Zachary A; Brennaman, M Kyle; Papanikolas, John M; Meyer, Thomas J

2015-06-18

Degenerately doped In2O3:Sn semiconductor nanoparticles (nanoITO) have been used to study the photoinduced interfacial electron-transfer reactivity of surface-bound [Ru(II)(bpy)2(4,4'-(PO3H2)2-bpy)](2+) (RuP(2+)) molecules as a function of driving force over a range of 1.8 eV. The metallic properties of the ITO nanoparticles, present within an interconnected mesoporous film, allowed for the driving force to be tuned by controlling their Fermi level with an external bias while their optical transparency allowed for transient absorption spectroscopy to be used to monitor electron-transfer kinetics. Photoinduced electron transfer from excited-state -RuP(2+*) molecules to nanoITO was found to be dependent on applied bias and competitive with nonradiative energy transfer to nanoITO. Back electron transfer from nanoITO to oxidized -RuP(3+) was also dependent on the applied bias but without complication from inter- or intraparticle electron diffusion in the oxide nanoparticles. Analysis of the electron injection kinetics as a function of driving force using Marcus-Gerischer theory resulted in an experimental estimate of the reorganization energy for the excited-state -RuP(3+/2+*) redox couple of λ* = 0.83 eV and an electronic coupling matrix element, arising from electronic wave function overlap between the donor orbital in the molecule and the acceptor orbital(s) in the nanoITO electrode, of Hab = 20-45 cm(-1). Similar analysis of the back electron-transfer kinetics yielded λ = 0.56 eV for the ground-state -RuP(3+/2+) redox couple and Hab = 2-4 cm(-1). The use of these wide band gap, degenerately doped materials provides a unique experimental approach for investigating single-site electron transfer at the surface of oxide nanoparticles.

NIF Double Shell outer/inner shell collision experiments

NASA Astrophysics Data System (ADS)

Merritt, E. C.; Loomis, E. N.; Wilson, D. C.; Cardenas, T.; Montgomery, D. S.; Daughton, W. S.; Dodd, E. S.; Desjardins, T.; Renner, D. B.; Palaniyappan, S.; Batha, S. H.; Khan, S. F.; Smalyuk, V.; Ping, Y.; Amendt, P.; Schoff, M.; Hoppe, M.

2017-10-01

Double shell capsules are a potential low convergence path to substantial alpha-heating and ignition on NIF, since they are predicted to ignite and burn at relatively low temperatures via volume ignition. Current LANL NIF double shell designs consist of a low-Z ablator, low-density foam cushion, and high-Z inner shell with liquid DT fill. Central to the Double Shell concept is kinetic energy transfer from the outer to inner shell via collision. The collision determines maximum energy available for compression and implosion shape of the fuel. We present results of a NIF shape-transfer study: two experiments comparing shape and trajectory of the outer and inner shells at post-collision times. An outer-shell-only target shot measured the no-impact shell conditions, while an `imaging' double shell shot measured shell conditions with impact. The `imaging' target uses a low-Z inner shell and is designed to perform in similar collision physics space to a high-Z double shell but can be radiographed at 16keV, near the viable 2DConA BL energy limit. Work conducted under the auspices of the U.S. DOE by LANL under contract DE-AC52-06NA25396.

Chemical and charge transfer studies on interfaces of a conjugated polymer and ITO

NASA Astrophysics Data System (ADS)

David, Tanya M. S.; Arasho, Wondwosson; Smith, O'Neil; Hong, Kunlun; Bonner, Carl; Sun, Sam-Shajing

2017-08-01

Conjugated oligomers and polymers are very attractive for potential future plastic electronic and opto-electronic device applications such as plastic photo detectors and solar cells, thermoelectric devices, field effect transistors, and light emitting diodes. Understanding and optimizing charge transport between an active polymer layer and conductive substrate is critical to the optimization of polymer based electronic and opto-electronic devices. This study focused on the design, synthesis, self-assembly, and electron transfers and transports of a phosphonic acid end-functionalized polyphenylenevinylene (PPV) that was covalently attached and self-assembled onto an Indium Tin Oxide (ITO) substrate. This study demonstrated how atomic force microscopy (AFM) can be an effective characterization technique in conjunction with conventional electron transfer methods, including cyclic voltammetry (CV), towards determining electron transfer rates in polymer and polymer/conductor interface systems. This study found that the electron transfer rates of covalently attached and self-assembled films were much faster than the spin coated films. The knowledge from this study can be very useful for designing potential polymer based electronic and opto-electronic thin film devices.

Electron transfer by excited benzoquinone anions: slow rates for two-electron transitions.

PubMed

Zamadar, Matibur; Cook, Andrew R; Lewandowska-Andralojc, Anna; Holroyd, Richard; Jiang, Yan; Bikalis, Jin; Miller, John R

2013-09-05

Electron transfer (ET) rate constants from the lowest excited state of the radical anion of benzoquinone, BQ(-•)*, were measured in THF solution. Rate constants for bimolecular electron transfer reactions typically reach the diffusion-controlled limit when the free-energy change, ΔG°, reaches -0.3 eV. The rate constants for ET from BQ(-•)* are one-to-two decades smaller at this energy and do not reach the diffusion-controlled limit until -ΔG° is 1.5-2.0 eV. The rates are so slow probably because a second electron must also undergo a transition to make use of the energy of the excited state. Similarly, ET, from solvated electrons to neutral BQ to form the lowest excited state, is slow, while fast ET is observed at a higher excited state, which can be populated in a transition involving only one electron. A simple picture based on perturbation theory can roughly account for the control of electron transfer by the need for transition of a second electron. The picture also explains how extra driving force (-ΔG°) can restore fast rates of electron transfer.

Chemically assembled double-dot single-electron transistor analyzed by the orthodox model considering offset charge

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kano, Shinya; Maeda, Kosuke; Majima, Yutaka, E-mail: majima@msl.titech.ac.jp

2015-10-07

We present the analysis of chemically assembled double-dot single-electron transistors using orthodox model considering offset charges. First, we fabricate chemically assembled single-electron transistors (SETs) consisting of two Au nanoparticles between electroless Au-plated nanogap electrodes. Then, extraordinary stable Coulomb diamonds in the double-dot SETs are analyzed using the orthodox model, by considering offset charges on the respective quantum dots. We determine the equivalent circuit parameters from Coulomb diamonds and drain current vs. drain voltage curves of the SETs. The accuracies of the capacitances and offset charges on the quantum dots are within ±10%, and ±0.04e (where e is the elementary charge),more » respectively. The parameters can be explained by the geometrical structures of the SETs observed using scanning electron microscopy images. Using this approach, we are able to understand the spatial characteristics of the double quantum dots, such as the relative distance from the gate electrode and the conditions for adsorption between the nanogap electrodes.« less

Economic evaluations of single- versus double-embryo transfer in IVF.

PubMed

Fiddelers, A A A; Severens, J L; Dirksen, C D; Dumoulin, J C M; Land, J A; Evers, J L H

2007-01-01

Multiple pregnancies lead to complications and induce high costs. The most successful way to decrease multiple pregnancies in IVF is to transfer only one embryo, which might reduce the efficacy of treatment. The objective of this review is to determine which embryo-transfer policy is most cost-effective: elective single-embryo transfer (eSET) or double-embryo transfer (DET). Several databases were searched for (cost* or econ*) and (single embryo* or double embryo* or one embryo* or two embryo* or elect* embryo or multip* embryo*). On the basis of five exclusion criteria, titles and abstracts were screened by two individual reviewers. The remaining papers were read for further selection, and data were extracted from the selected studies. A total of 496 titles were identified through the searches and resulted in the selection of one observational study and three randomized studies. Study characteristics, total costs and probability of live births were extracted. Besides this, cost-effectiveness and incremental cost-effectiveness were derived. It can be concluded that DET is the most expensive strategy. DET is also most effective if performed in one fresh cycle. eSET is only preferred from a cost-effectiveness point of view when performed in good prognosis patients and when frozen/thawed cycles are included. If frozen/thawed cycles are excluded, the choice between eSET and DET depends on how much society is willing to pay for one extra successful pregnancy.

Evidence that Additions of Grignard Reagents to Aliphatic Aldehydes Do Not Involve Single-Electron-Transfer Processes.

PubMed

Otte, Douglas A L; Woerpel, K A

2015-08-07

Addition of allylmagnesium reagents to an aliphatic aldehyde bearing a radical clock gave only addition products and no evidence of ring-opened products that would suggest single-electron-transfer reactions. The analogous Barbier reaction also did not provide evidence for a single-electron-transfer mechanism in the addition step. Other Grignard reagents (methyl-, vinyl-, t-Bu-, and triphenylmethylmagnesium halides) also do not appear to add to an alkyl aldehyde by a single-electron-transfer mechanism.

Evidence for protein conformational change at a Au(110)/protein interface

NASA Astrophysics Data System (ADS)

Messiha, H. L.; Smith, C. I.; Scrutton, N. S.; Weightman, P.

2008-07-01

Evidence is presented that reflection anisotropy spectroscopy (RAS) can provide real-time measurements of conformational change in proteins induced by electron transfer reactions. A bacterial electron transferring flavoprotein (ETF) has been modified so as to adsorb on an Au(110) electrode and enable reversible electron transfer to the protein cofactor in the absence of mediators. Reversible changes are observed in the RAS of this protein that are interpreted as arising from conformational changes accompanying the transfer of electrons.

Electron-electron correlation in two-photon double ionization of He-like ions [Counterintuitive electron correlation in two-photon double ionization of He-like ions

DOE PAGES

Hu, S. X.

2018-01-18

Electron correlation plays a crucial role in quantum many-body physics ranging from molecular bonding, strong-field–induced multi-electron ionization, to superconducting in materials. Understanding the dynamic electron correlation in the photoionization of relatively simple quantum three-body systems, such as He and He-like ions, is an important step toward manipulating complex systems through photo-induced processes. Here we have performed ab initio investigations of two-photon double ionization (TPDI) of He and He-like ions [Li +, Be 2+, and C 4+] exposed to intense attosecond x-ray pulses. Results from such fully correlated quantum calculations show weaker and weaker electron correlation effects in TPDI spectra asmore » the ionic charge increases, which is counterintuitive to the belief that the strongly correlated ground state and the strong Coulomb field of He-like ions should lead to more equal-energy sharing in photoionization. Lastly, these findings indicate that the final-state electron–electron correlation ultimately determines their energy sharing in TPDI.« less

Electron-electron correlation in two-photon double ionization of He-like ions [Counterintuitive electron correlation in two-photon double ionization of He-like ions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, S. X.

Electron correlation plays a crucial role in quantum many-body physics ranging from molecular bonding, strong-field–induced multi-electron ionization, to superconducting in materials. Understanding the dynamic electron correlation in the photoionization of relatively simple quantum three-body systems, such as He and He-like ions, is an important step toward manipulating complex systems through photo-induced processes. Here we have performed ab initio investigations of two-photon double ionization (TPDI) of He and He-like ions [Li +, Be 2+, and C 4+] exposed to intense attosecond x-ray pulses. Results from such fully correlated quantum calculations show weaker and weaker electron correlation effects in TPDI spectra asmore » the ionic charge increases, which is counterintuitive to the belief that the strongly correlated ground state and the strong Coulomb field of He-like ions should lead to more equal-energy sharing in photoionization. Lastly, these findings indicate that the final-state electron–electron correlation ultimately determines their energy sharing in TPDI.« less

Enhanced electron transfer kinetics through hybrid graphene-carbon nanotube films.

PubMed

Henry, Philémon A; Raut, Akshay S; Ubnoske, Stephen M; Parker, Charles B; Glass, Jeffrey T

2014-11-01

We report the first study of the electrochemical reactivity of a graphenated carbon nanotube (g-CNT) film. The electron transfer kinetics of the ferri-ferrocyanide couple were examined for a g-CNT film and compared to the kinetics to standard carbon nanotubes (CNTs). The g-CNT film exhibited much higher catalytic activity, with a heterogeneous electron-transfer rate constant, k 0 , approximately two orders of magnitude higher than for standard CNTs. Scanning electron microscopy and Raman spectroscopy were used to correlate the higher electron transfer kinetics with the higher edge-density of the g-CNT film.

Enzymatic cellulose oxidation is linked to lignin by long-range electron transfer

PubMed Central

Westereng, Bjørge; Cannella, David; Wittrup Agger, Jane; Jørgensen, Henning; Larsen Andersen, Mogens; Eijsink, Vincent G.H.; Felby, Claus

2015-01-01

Enzymatic oxidation of cell wall polysaccharides by lytic polysaccharide monooxygenases (LPMOs) plays a pivotal role in the degradation of plant biomass. While experiments have shown that LPMOs are copper dependent enzymes requiring an electron donor, the mechanism and origin of the electron supply in biological systems are only partly understood. We show here that insoluble high molecular weight lignin functions as a reservoir of electrons facilitating LPMO activity. The electrons are donated to the enzyme by long-range electron transfer involving soluble low molecular weight lignins present in plant cell walls. Electron transfer was confirmed by electron paramagnetic resonance spectroscopy showing that LPMO activity on cellulose changes the level of unpaired electrons in the lignin. The discovery of a long-range electron transfer mechanism links the biodegradation of cellulose and lignin and sheds new light on how oxidative enzymes present in plant degraders may act in concert. PMID:26686263

CymA and Exogenous Flavins Improve Extracellular Electron Transfer and Couple It to Cell Growth in Mtr-Expressing Escherichia coli

DOE PAGES

Jensen, Heather M.; TerAvest, Michaela A.; Kokish, Mark G.; ...

2016-03-22

Introducing extracellular electron transfer pathways into heterologous organisms offers the opportunity to explore fundamental biogeochemical processes and to biologically alter redox states of exogenous metals for various applications. While expression of the MtrCAB electron nanoconduit from Shewanella oneidensis MR-1 permits extracellular electron transfer in Escherichia coli, the low electron flux and absence of growth in these cells limits their practicality for such applications. In this paper, we investigate how the rate of electron transfer to extracellular Fe(III) and cell survival in engineered E. coli are affected by mimicking different features of the S. oneidensis pathway: the number of electron nanoconduits,more » the link between the quinol pool and MtrA, and the presence of flavin-dependent electron transfer. While increasing the number of pathways does not significantly improve the extracellular electron transfer rate or cell survival, using the native inner membrane component, CymA, significantly improves the reduction rate of extracellular acceptors and increases cell viability. Strikingly, introducing both CymA and riboflavin to Mtr-expressing E. coli also allowed these cells to couple metal reduction to growth, which is the first time an increase in biomass of an engineered E. coli has been observed under Fe 2O 3 (s) reducing conditions. Overall and finally, this work provides engineered E. coli strains for modulating extracellular metal reduction and elucidates critical factors for engineering extracellular electron transfer in heterologous organisms.« less

CymA and Exogenous Flavins Improve Extracellular Electron Transfer and Couple It to Cell Growth in Mtr-Expressing Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jensen, Heather M.; TerAvest, Michaela A.; Kokish, Mark G.

Introducing extracellular electron transfer pathways into heterologous organisms offers the opportunity to explore fundamental biogeochemical processes and to biologically alter redox states of exogenous metals for various applications. While expression of the MtrCAB electron nanoconduit from Shewanella oneidensis MR-1 permits extracellular electron transfer in Escherichia coli, the low electron flux and absence of growth in these cells limits their practicality for such applications. In this paper, we investigate how the rate of electron transfer to extracellular Fe(III) and cell survival in engineered E. coli are affected by mimicking different features of the S. oneidensis pathway: the number of electron nanoconduits,more » the link between the quinol pool and MtrA, and the presence of flavin-dependent electron transfer. While increasing the number of pathways does not significantly improve the extracellular electron transfer rate or cell survival, using the native inner membrane component, CymA, significantly improves the reduction rate of extracellular acceptors and increases cell viability. Strikingly, introducing both CymA and riboflavin to Mtr-expressing E. coli also allowed these cells to couple metal reduction to growth, which is the first time an increase in biomass of an engineered E. coli has been observed under Fe 2O 3 (s) reducing conditions. Overall and finally, this work provides engineered E. coli strains for modulating extracellular metal reduction and elucidates critical factors for engineering extracellular electron transfer in heterologous organisms.« less

Flavin Charge Transfer Transitions Assist DNA Photolyase Electron Transfer

NASA Astrophysics Data System (ADS)

Skourtis, Spiros S.; Prytkova, Tatiana; Beratan, David N.

2007-12-01

This contribution describes molecular dynamics, semi-empirical and ab-initio studies of the primary photo-induced electron transfer reaction in DNA photolyase. DNA photolyases are FADH--containing proteins that repair UV-damaged DNA by photo-induced electron transfer. A DNA photolyase recognizes and binds to cyclobutatne pyrimidine dimer lesions of DNA. The protein repairs a bound lesion by transferring an electron to the lesion from FADH-, upon photo-excitation of FADH- with 350-450 nm light. We compute the lowest singlet excited states of FADH- in DNA photolyase using INDO/S configuration interaction, time-dependent density-functional, and time-dependent Hartree-Fock methods. The calculations identify the lowest singlet excited state of FADH- that is populated after photo-excitation and that acts as the electron donor. For this donor state we compute conformationally-averaged tunneling matrix elements to empty electron-acceptor states of a thymine dimer bound to photolyase. The conformational averaging involves different FADH--thymine dimer confromations obtained from molecular dynamics simulations of the solvated protein with a thymine dimer docked in its active site. The tunneling matrix element computations use INDO/S-level Green's function, energy splitting, and Generalized Mulliken-Hush methods. These calculations indicate that photo-excitation of FADH- causes a π→π* charge-transfer transition that shifts electron density to the side of the flavin isoalloxazine ring that is adjacent to the docked thymine dimer. This shift in electron density enhances the FADH--to-dimer electronic coupling, thus inducing rapid electron transfer.

Photoinduced electron transfer between benzyloxy dendrimer phthalocyanine and benzoquinone

NASA Astrophysics Data System (ADS)

Zhang, Tiantian; Ma, Dongdong; Pan, Sujuan; Wu, Shijun; Jiang, Yufeng; Zeng, Di; Yang, Hongqin; Peng, Yiru

2016-10-01

Photo-induced electron transfer (PET) is an important and fundamental process in natural photosynthesis. To mimic such interesting PET process, a suitable donor and acceptor couple were properly chosen. Dendrimer phthalocyanines and their derivatives have emerged as promising materials for artificial photosynthesis systems. In this paper, the electron transfer between the light harvest dendrimer phthalocyanine (donor) and the 1,4-benzoquinone (acceptor) was studied by UV/Vis and fluorescence spectroscopic methods. It was found that fluorescence of phthalocyanine was quenched by benzoquinone (BQ) via excited state electron transfer, from the phthalocyanine to the BQ upon excitation at 610 nm. The Stern-Volmer constant (KSV) of electron transfer was calculated. Our study suggests that this dendritic phthalocyanine is an effective new electron donor and transmission complex and could be used as a potential artificial photosynthesis system.

Auroral-particle precipitation and trapping caused by electrostatic double layers in the ionosphere.

PubMed

Albert, R D; Lindstrom, P J

1970-12-25

Interpretation of high-resolution angular distribution measurements of the primary auroral electron flux detected by a rocket probe launched into a visible aurora from Fort Churchill in the fall of 1966 leads to the following conclusions. The auroral electron flux is nearly monoenergetic and has a quasi-trapped as well as a precipitating component. The quasi-trapped flux appears to be limited to a region defined by magnetic-mirror points and multiple electrostatic double layers in the ionosphere. The electrostatic field of the double-layer distribution enhances the aurora by lowering the magnetic-mirror points and supplying energy to the primary auroral electrons.

Long-range electron transfer in porphyrin-containing [2]-rotaxanes: tuning the rate by metal cation coordination.

PubMed

Andersson, Mikael; Linke, Myriam; Chambron, Jean-Claude; Davidsson, Jan; Heitz, Valérie; Hammarström, Leif; Sauvage, Jean-Pierre

2002-04-24

A series of [2]-rotaxanes has been synthesized in which two Zn(II)-porphyrins (ZnP) electron donors were attached as stoppers on the rod. A macrocycle attached to a Au(III)-porphyrin (AuP+) acceptor was threaded on the rod. By selective excitation of either porphyrin, we could induce an electron transfer from the ZnP to the AuP+ unit that generated the same ZnP*+-AuP* charge-transfer state irrespective of which porphyrin was excited. Although the reactants were linked only by mechanical or coordination bonds, electron-transfer rate constants up to 1.2x10(10) x s(-1) were obtained over a 15-17 A edge-to-edge distance between the porphyrins. The resulting charge-transfer state had a relatively long lifetime of 10-40 ns and was formed in high yield (>80%) in most cases. By a simple variation of the link between the reactants, viz. a coordination of the phenanthroline units on the rotaxane rod and ring by either Ag+ or Cu+, we could enhance the electron-transfer rate from the ZnP to the excited 3AuP+. We interpret our data in terms of an enhanced superexchange mechanism with Ag+ and a change to a stepwise hopping mechanism with Cu+, involving the oxidized Cu(phen)22+ unit as a real intermediate. When the ZnP unit was excited instead, electron transfer from the excited 1ZnP to AuP+ was not affected, or even slowed, by Ag+ or Cu+. We discuss this asymmetry in terms of the different orbitals involved in mediating the reaction in an electron- and a hole-transfer mechanism. Our results show the possibility to tune the rates of electron transfer between noncovalently linked reactants by a convenient modification of the link. The different effect of Ag+ and Cu+ on the rate with ZnP and AuP+ excitation shows an additional possibility to control the electron-transfer reactions by selective excitation. We also found that coordination of the Cu+ introduced an energy-transfer reaction from 1ZnP to Cu(phen)2+ (k = 5.1x10(9) x s(-1)) that proceeded in competition with electron transfer to AuP+ and was followed by a quantitative energy transfer to give the 3ZnP state (k = 1.5x10(9) x s(-1)).

A molecular shift register based on electron transfer

NASA Technical Reports Server (NTRS)

Hopfield, J. J.; Onuchic, Josenelson; Beratan, David N.

1988-01-01

An electronic shift-register memory at the molecular level is described. The memory elements are based on a chain of electron-transfer molecules and the information is shifted by photoinduced electron-transfer reactions. This device integrates designed electronic molecules onto a very large scale integrated (silicon microelectronic) substrate, providing an example of a 'molecular electronic device' that could actually be made. The design requirements for such a device and possible synthetic strategies are discussed. Devices along these lines should have lower energy usage and enhanced storage density.

Generating cycle flow between dark and light zones with double paddlewheels to improve microalgal growth in a flat plate photo-bioreactor.

PubMed

Cheng, Jun; Xu, Junchen; Lu, Hongxiang; Ye, Qing; Liu, Jianzhong; Zhou, Junhu

2018-08-01

Double paddlewheels were proposed to generate cycle flow for increasing horizontal fluid velocity between dark and light zones in a flat plate photo-bioreactor, which strengthened the mass transfer and the mixing effect to improve microalgal growth with 15% CO 2 . Numerical fluid dynamics were used to simulate the cycle flow field with double paddlewheels. The local flow field measured with particle image velocimetry fitted well with the numerical simulation results. The horizontal fluid velocity in the photo-bioreactor was markedly increased from 5.8 × 10 -5  m/s to 0.45 m/s with the rotation of double paddlewheels, resulting in a decreased dark/light cycle period. Therefore, bubble formation time and diameter reduced by 24.4% and 27.4%, respectively. Meanwhile, solution mixing time reduced by 31.3% and mass transfer coefficient increased by 41.2%. The biomass yield of microalgae Nannochloropsis Oceanic increased by 127.1% with double paddlewheels under 15% CO 2 condition. Copyright © 2018 Elsevier Ltd. All rights reserved.

12 CFR 1005.6 - Liability of consumer for unauthorized transfers.

Code of Federal Regulations, 2012 CFR

2012-01-01

... transfers. 1005.6 Section 1005.6 Banks and Banking BUREAU OF CONSUMER FINANCIAL PROTECTION ELECTRONIC FUND TRANSFERS (REGULATION E) § 1005.6 Liability of consumer for unauthorized transfers. (a) Conditions for..., for an unauthorized electronic fund transfer involving the consumer's account only if the financial...

Stabilization of non-productive conformations underpins rapid electron transfer to electron-transferring flavoprotein.

PubMed

Toogood, Helen S; van Thiel, Adam; Scrutton, Nigel S; Leys, David

2005-08-26

Crystal structures of protein complexes with electron-transferring flavoprotein (ETF) have revealed a dual protein-protein interface with one region serving as anchor while the ETF FAD domain samples available space within the complex. We show that mutation of the conserved Glu-165beta in human ETF leads to drastically modulated rates of interprotein electron transfer with both medium chain acyl-CoA dehydrogenase and dimethylglycine dehydrogenase. The crystal structure of free E165betaA ETF is essentially identical to that of wild-type ETF, but the crystal structure of the E165betaA ETF.medium chain acyl-CoA dehydrogenase complex reveals clear electron density for the FAD domain in a position optimal for fast interprotein electron transfer. Based on our observations, we present a dynamic multistate model for conformational sampling that for the wild-type ETF. medium chain acyl-CoA dehydrogenase complex involves random motion between three distinct positions for the ETF FAD domain. ETF Glu-165beta plays a key role in stabilizing positions incompatible with fast interprotein electron transfer, thus ensuring high rates of complex dissociation.

77 FR 34127 - Financial Management Service; Proposed Collection of Information: Electronic Transfer Account...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-06-08

... Information: Electronic Transfer Account (ETA) Financial Agency Agreement AGENCY: Financial Management Service... of information described below: Title: Electronic Transfer Account (ETA) Financial Agency Agreement... public and other Federal agencies to take this opportunity to comment on a continuing information...

31 CFR 208.4 - Waivers.

Code of Federal Regulations, 2011 CFR

2011-07-01

...) Payment by electronic funds transfer is not required in the following cases: (1) Where an individual: (i... are not required to be made by electronic funds transfer, unless and until such payments become... waiver request with Treasury certifying that payment by electronic funds transfer would impose a hardship...

12 CFR 1005.7 - Initial disclosures.

Code of Federal Regulations, 2012 CFR

2012-01-01

... disclosures required by this section at the time a consumer contracts for an electronic fund transfer service or before the first electronic fund transfer is made involving the consumer's account. (b) Content of... Banks and Banking BUREAU OF CONSUMER FINANCIAL PROTECTION ELECTRONIC FUND TRANSFERS (REGULATION E...

Solvent effects on the oxidation (electron transfer) reaction of [Fe(CN) 6] 4- by [Co(NH 3) 5pz] 3+

NASA Astrophysics Data System (ADS)

Muriel, F.; Jiménez, R.; López, M.; Prado-Gotor, R.; Sánchez, F.

2004-03-01

Solvent effects on the title reaction were studied in different reaction media constituted by water and organic cosolvents (methanol, tert-butyl alcohol, ethyleneglycol and glucose) at 298.2 K. The results are considered in light of the Marcus-Hush approach for electron transfer reactions. Variations of the electron transfer rate constant are shown to be mainly due to changes in the reaction free energy. On the other hand the energies of the MMCT band, corresponding to the optical electron transfer within the ion pair [Fe(CN) 6] 4-/[Co(NH 3) 5pz] 3+, in the different reaction media, have been obtained. The activation free energies of the thermal electron transfer process have been calculated from the band ( Eop) data, and compared with those obtained from the kinetic study. Quantitative agreement is found between the two series of data. This shows the possibility of estimating activation free energies for electron transfer reactions from static (optical) measurements.

Container lid gasket protective strip for double door transfer system

DOEpatents

Allen, Jr., Burgess M

2013-02-19

An apparatus and a process for forming a protective barrier seal along a "ring of concern" of a transfer container used with double door systems is provided. A protective substrate is supplied between a "ring of concern" and a safety cover in which an adhesive layer of the substrate engages the "ring of concern". A compressive foam strip along an opposite side of the substrate engages a safety cover such that a compressive force is maintained between the "ring of concern" and the adhesive layer of the substrate.

Heat-transfer analysis of double-pipe heat exchangers for indirect-cycle SCW NPP

NASA Astrophysics Data System (ADS)

Thind, Harwinder

SuperCritical-Water-cooled Reactors (SCWRs) are being developed as one of the Generation-IV nuclear-reactor concepts. SuperCritical Water (SCW) Nuclear Power Plants (NPPs) are expected to have much higher operating parameters compared to current NPPs, i.e., pressure of about 25 MPa and outlet temperature up to 625 °C. This study presents the heat transfer analysis of an intermediate Heat exchanger (HX) design for indirect-cycle concepts of Pressure-Tube (PT) and Pressure-Vessel (PV) SCWRs. Thermodynamic configurations with an intermediate HX gives a possibility to have a single-reheat option for PT and PV SCWRs without introducing steam-reheat channels into a reactor. Similar to the current CANDU and Pressurized Water Reactor (PWR) NPPs, steam generators separate the primary loop from the secondary loop. In this way, the primary loop can be completely enclosed in a reactor containment building. This study analyzes the heat transfer from a SCW primary (reactor) loop to a SCW and Super-Heated Steam (SHS) secondary (turbine) loop using a double-pipe intermediate HX. The numerical model is developed with MATLAB and NIST REFPROP software. Water from the primary loop flows through the inner pipe, and water from the secondary loop flows through the annulus in the counter direction of the double-pipe HX. The analysis on the double-pipe HX shows temperature and profiles of thermophysical properties along the heated length of the HX. It was found that the pseudocritical region has a significant effect on the temperature profiles and heat-transfer area of the HX. An analysis shows the effect of variation in pressure, temperature, mass flow rate, and pipe size on the pseudocritical region and the heat-transfer area of the HX. The results from the numerical model can be used to optimize the heat-transfer area of the HX. The higher pressure difference on the hot side and higher temperature difference between the hot and cold sides reduces the pseudocritical-region length, thus decreases the heat-transfer surface area of the HX.

The effect of the number of transferred embryos, the interval between nuclear transfer and embryo transfer, and the transfer pattern on pig cloning efficiency.

PubMed

Rim, Chol Ho; Fu, Zhixin; Bao, Lei; Chen, Haide; Zhang, Dan; Luo, Qiong; Ri, Hak Chol; Huang, Hefeng; Luan, Zhidong; Zhang, Yan; Cui, Chun; Xiao, Lei; Jong, Ui Myong

2013-12-01

To improve the efficiency of producing cloned pigs, we investigated the influence of the number of transferred embryos, the culturing interval between nuclear transfer (NT) and embryo transfer, and the transfer pattern (single oviduct or double oviduct) on cloning efficiency. The results demonstrated that transfer of either 150-200 or more than 200NT embryos compared to transfer of 100-150 embryos resulted in a significantly higher pregnancy rate (48 ± 16, 50 ± 16 vs. 29 ± 5%, p<0.05) and average litter size (4.1 ± 2.3, 7 ± 3.6 vs. 2.5 ± 0.5). In vitro culture of reconstructed embryos for a longer time (40 h vs. 20 h) resulted in higher (p<0.05) pregnancy rate (44 ± 9 vs. 31 ± 3%) and delivery rate (44 ± 9 vs. 25 ± 9%). Furthermore, double oviductal transfer dramatically increased pregnancy rate (83 ± 6 vs. 27+8%, p<0.05), delivery rate (75 ± 2 vs. 27+8%, p<0.05) and average litter size (6.5 ± 2.8 vs. 2.6 ± 1.2) compared to single oviductal transfer. Our study demonstrated that an improvement in pig cloning efficiency is achieved by adjusting the number and in vitro culture time of reconstructed embryos as well as the embryo transfer pattern. Copyright © 2013 Elsevier B.V. All rights reserved.

Numerically simulated two-dimensional auroral double layers

NASA Technical Reports Server (NTRS)

Borovsky, J. E.; Joyce, G.

1983-01-01

A magnetized 2 1/2-dimensional particle-in-cell system which is periodic in one direction and bounded by reservoirs of Maxwellian plasma in the other is used to numerically simulate electrostatic plasma double layers. For the cases of both oblique and two-dimensional double layers, the present results indicate periodic instability, Debye length rather than gyroradii scaling, and low frequency electrostatic turbulence together with electron beam-excited electrostatatic electron-cyclotron waves. Estimates are given for the thickness of auroral doule layers, as well as the separations within multiple auroral arcs. Attention is given to the temporal modulation of accelerated beams, and the possibilities for ion precipitation and ion conic production by the double layer are hypothesized. Simulations which include the atmospheric backscattering of electrons imply the action of an ionospheric sheath which accelerates ionospheric ions upward.

Bidirectional Photoinduced Electron Transfer in Ruthenium(II)-Tris-bipyridyl-Modified PpcA, a Multi-heme c -Type Cytochrome from Geobacter sulfurreducens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kokhan, Oleksandr; Ponomarenko, Nina S.; Pokkuluri, P. Raj

PpcA, a tri-heme cytochrome c7 from Geobacter sulfurreducens was investigated as a model for photosensitizer-initiated electron transfer within a multi-heme "molecular wire" protein architecture. E. coli expression of PpcA was found to be tolerant of cysteine site-directed mutagenesis, demonstrated by the successful expression of natively folded proteins bearing cysteine mutations at a series of sites selected to vary characteristically with respect to the three -CXXCH- heme binding domains. A preliminary survey of 5 selected mutants found that the introduced cysteines can be readily covalently linked to a Ru(II)-(2,2'-bpy)2(4-bromomethyl-4’-methyl-2,2'-bpy) photosensitizer (where bpy = bipyridine), and that the linked constructs support bothmore » photo-oxidative and photo-reductive quenching of the photosensitizer excited-state, depending upon the initial heme redox state. For photo-oxidative electron transfer, apparent heme reduction risetimes were found to vary from 7 x 10-12 s to 5 x 10-8 s, depending upon the site of photosensitizer linking. The excited-state electron transfers are about 103-fold faster than any previously reported photosensitizer-redox protein covalently linked construct. Preliminary conformational analysis using molecular dynamics simulations shows that rates for electron transfer track both the distance and pathways for electron transfer. Two mutants with the fastest charge transfer rates, A23C and K29C, showed a significant role of specific paths for electron transfer. While K29C labeled mutant was expected to have approximately 0.8Å greater donor-acceptor distance, it showed 20-fold faster charge separation rate. Clear evidence for inter-heme electron transfer within the multi-heme protein is not detected within the lifetimes of the charge separated states. These results demonstrate an opportunity to develop multi-heme c-cytochromes for investigation of electron transfer in protein "molecular wires" and to serve as frameworks for metalloprotein designs that support multiple electron transfer redox chemistry.« less

Photoemission of Energetic Hot Electrons Produced via Up-Conversion in Doped Quantum Dots.

PubMed

Dong, Yitong; Parobek, David; Rossi, Daniel; Son, Dong Hee

2016-11-09

The benefits of the hot electrons from semiconductor nanostructures in photocatalysis or photovoltaics result from their higher energy compared to that of the band-edge electrons facilitating the electron-transfer process. The production of high-energy hot electrons usually requires short-wavelength UV or intense multiphoton visible excitation. Here, we show that highly energetic hot electrons capable of above-threshold ionization are produced via exciton-to-hot-carrier up-conversion in Mn-doped quantum dots under weak band gap excitation (∼10 W/cm 2 ) achievable with the concentrated solar radiation. The energy of hot electrons is as high as ∼0.4 eV above the vacuum level, much greater than those observed in other semiconductor or plasmonic metal nanostructures, which are capable of performing energetically and kinetically more-challenging electron transfer. Furthermore, the prospect of generating solvated electron is unique for the energetic hot electrons from up-conversion, which can open a new door for long-range electron transfer beyond short-range interfacial electron transfer.

Towards a comprehensive model for the electronic and vibrational structure of the Creutz-Taube ion.

PubMed

Reimers, Jeffrey R; Wallace, Brett B; Hush, Noel S

2008-01-13

Since the synthesis of the Creutz-Taube ion, the nature of its charge localization has been of immense scientific interest, this molecule providing a model system for the understanding of the operation of biological photosynthetic and electron-transfer processes. However, recent work has shown that its nature remains an open question. Many systems of this type, including photosynthetic reaction centres, are of current research interest, and thereby the Creutz-Taube ion provides an important chemical paradigm: the key point of interest is the details of how such molecules behave. We lay the groundwork for the construction of a comprehensive model for its chemical and spectroscopic properties. Advances are described in some of the required areas including: simulation of electronic absorption spectra; quantitative depiction of the large interaction of the ion's electronic description with solvent motions; and the physics of Ru-NH3 spectator-mode vibrations. We show that details of the solvent electron-phonon coupling are critical in the interpretation of the spectator-mode vibrations, as these strongly mix with solvent motions when 0.75<2J/lambda<1. In this regime, a double-well potential exists which does not support localized zero-point vibration, and many observed properties of the Creutz-Taube ion are shown to be consistent with the hypothesis that the ion has this character.

Determination of molecular spectroscopic parameters and energy-transfer rates by double-resonance spectroscopy

NASA Technical Reports Server (NTRS)

Steinfeld, J. I.; Foy, B.; Hetzler, J.; Flannery, C.; Klaassen, J.; Mizugai, Y.; Coy, S.

1990-01-01

The spectroscopy of small to medium-size polyatomic molecules can be extremely complex, especially in higher-lying overtone and combination vibrational levels. The high density of levels also complicates the understanding of inelastic collision processes, which is required to model energy transfer and collision broadening of spectral lines. Both of these problems can be addressed by double-resonance spectroscopy, i.e., time-resolved pump-probe measurements using microwave, infrared, near-infrared, and visible-wavelength sources. Information on excited-state spectroscopy, transition moments, inelastic energy transfer rates and propensity rules, and pressure-broadening parameters may be obtained from such experiments. Examples are given for several species of importance in planetary atmospheres, including ozone, silane, ethane, and ammonia.

Quantum Calculations of Electron Tunneling in Respiratory Complex III.

PubMed

Hagras, Muhammad A; Hayashi, Tomoyuki; Stuchebrukhov, Alexei A

2015-11-19

The most detailed and comprehensive to date study of electron transfer reactions in the respiratory complex III of aerobic cells, also known as bc1 complex, is reported. In the framework of the tunneling current theory, electron tunneling rates and atomistic tunneling pathways between different redox centers were investigated for all electron transfer reactions comprising different stages of the proton-motive Q-cycle. The calculations reveal that complex III is a smart nanomachine, which under certain conditions undergoes conformational changes gating electron transfer, or channeling electrons to specific pathways. One-electron tunneling approximation was adopted in the tunneling calculations, which were performed using hybrid Broken-Symmetry (BS) unrestricted DFT/ZINDO levels of theory. The tunneling orbitals were determined using an exact biorthogonalization scheme that uniquely separates pairs of tunneling orbitals with small overlaps out of the remaining Franck-Condon orbitals with significant overlap. Electron transfer rates in different redox pairs show exponential distance dependence, in agreement with the reported experimental data; some reactions involve coupled proton transfer. Proper treatment of a concerted two-electron bifurcated tunneling reaction at the Q(o) site is given.

Structural and electronic properties of double-walled boron nitride nanocones

NASA Astrophysics Data System (ADS)

Brito, E.; Silva, T. S.; Guerra, T.; Leite, L.; Azevedo, S.; Freitas, A.; Kaschny, J. R.

2018-01-01

First principles calculations were applied to study the structural and electronic properties of different configurations of double-walled boron nitride nanocones with a disclination angle of 60°. The analysis includes different rotation angles, distance between apexes, as well as distinct types of antiphase boundaries. The calculations indicate that the non-rotated configuration of double-walled nanocone with a defective line composed by C and N atoms, forming C-N bonds, is the most stable configuration. It was found that the yam angle, apexes distance and defective line composition present significant influence on the electronic properties of such structures. Moreover, analyzing the spin charge density, for the electronic states near the Fermi level, it was also found that the configuration with a defective line containing C atoms presents a net magnetic moment.

Charge transfer from TiO2 into adsorbed benzene diazonium compounds

NASA Astrophysics Data System (ADS)

Merson, A.; Dittrich, Th.; Zidon, Y.; Rappich, J.; Shapira, Yoram

2004-08-01

Electron transfer from sol-gel-prepared TiO2 into adsorbed benzene diazonium compounds has been investigated using cyclic voltammetry, x-ray photoelectron spectroscopy, contact potential difference, and surface photovoltage spectroscopy. The results show that the potential of maximum electron transfer depends strongly on the dipole moment of the benzene compound. Two reactive surface sites at which electron transfer occurs have been identified.

Direct Observation of Excimer-Mediated Intramolecular Electron Transfer in a Cofacially-Stacked Perylene Bisimide Pair.

PubMed

Sung, Jooyoung; Nowak-Król, Agnieszka; Schlosser, Felix; Fimmel, Benjamin; Kim, Woojae; Kim, Dongho; Würthner, Frank

2016-07-27

We have elucidated excimer-mediated intramolecular electron transfer in cofacially stacked PBIs tethered by two phenylene-butadiynylene loops. The electron transfer between energetically equivalent PBIs is revealed by the simultaneous observation of the PBI radical anion and cation bands in the transient absorption spectra. The fluorescence decay time of the excimer states is in good agreement with the rise time of PBI radical bands in transient absorption spectra suggesting that the electron transfer dynamics proceed via the excimer state. We can conclude that the excimer state effectuates the efficient charge transfer in the cofacially stacked PBI dimer.

Role of cash in conditional cash transfer programmes for child health, growth, and development: an analysis of Mexico's Oportunidades.

PubMed

Fernald, Lia C H; Gertler, Paul J; Neufeld, Lynnette M

2008-03-08

Many governments have implemented conditional cash transfer (CCT) programmes with the goal of improving options for poor families through interventions in health, nutrition, and education. Families enrolled in CCT programmes receive cash in exchange for complying with certain conditions: preventive health requirements and nutrition supplementation, education, and monitoring designed to improve health outcomes and promote positive behaviour change. Our aim was to disaggregate the effects of cash transfer from those of other programme components. In an intervention that began in 1998 in Mexico, low-income communities (n=506) were randomly assigned to be enrolled in a CCT programme (Oportunidades, formerly Progresa) immediately or 18 months later. In 2003, children (n=2449) aged 24-68 months who had been enrolled in the programme their entire lives were assessed for a wide variety of outcomes. We used linear and logistic regression to determine the effect size for each outcome that is associated with a doubling of cash transfers while controlling for a wide range of covariates, including measures of household socioeconomic status. A doubling of cash transfers was associated with higher height-for-age Z score (beta 0.20, 95% CI 0.09-0.30; p<0.0001), lower prevalence of stunting (-0.10, -0.16 to -0.05; p<0.0001), lower body-mass index for age percentile (-2.85, -5.54 to -0.15; p=0.04), and lower prevalence of being overweight (-0.08, -0.13 to -0.03; p=0.001). A doubling of cash transfers was also associated with children doing better on a scale of motor development, three scales of cognitive development, and with receptive language. Our results suggest that the cash transfer component of Oportunidades is associated with better outcomes in child health, growth, and development.

12 CFR 1005.6 - Liability of consumer for unauthorized transfers.

Code of Federal Regulations, 2014 CFR

2014-01-01

... transfers. 1005.6 Section 1005.6 Banks and Banking BUREAU OF CONSUMER FINANCIAL PROTECTION ELECTRONIC FUND TRANSFERS (REGULATION E) General § 1005.6 Liability of consumer for unauthorized transfers. (a) Conditions... this section, for an unauthorized electronic fund transfer involving the consumer's account only if the...

12 CFR 1005.6 - Liability of consumer for unauthorized transfers.

Code of Federal Regulations, 2013 CFR

2013-01-01

... transfers. 1005.6 Section 1005.6 Banks and Banking BUREAU OF CONSUMER FINANCIAL PROTECTION ELECTRONIC FUND TRANSFERS (REGULATION E) General § 1005.6 Liability of consumer for unauthorized transfers. (a) Conditions... this section, for an unauthorized electronic fund transfer involving the consumer's account only if the...

Quantum mechanical design of efficient second-order nonlinear optical materials based on heteroaromatic imido-substituted hexamolybdates: first theoretical framework of POM-based heterocyclic aromatic rings.

PubMed

Janjua, Muhammad Ramzan Saeed Ashraf

2012-11-05

This work was inspired by a previous report (Janjua et al. J. Phys. Chem. A 2009, 113, 3576-3587) in which the nonlinear-optical (NLO) response strikingly improved with an increase in the conjugation path of the ligand and the nature of hexamolybdates (polyoxometalates, POMs) was changed into a donor by altering the direction of charge transfer with a second aromatic ring. Herein, the first theoretical framework of POM-based heteroaromatic rings is found to be another class of excellent NLO materials having double heteroaromatic rings. First hyperpolarizabilities of a large number of push-pull-substituted conjugated systems with heteroaromatic rings have been calculated. The β components were computed at the density functional theory (DFT) level (BP86 geometry optimizations and LB94 time-dependent DFT). The largest β values are obtained with a donor (hexamolybdates) on the benzene ring and an acceptor (-NO(2)) on pyrrole, thiophene, and furan rings. The pyrrole imido-substituted hexamolybdate (system 1c) has a considerably large first hyperpolarizability, 339.00 × 10(-30) esu, and it is larger than that of (arylimido)hexamolybdate, calculated as 0.302 × 10(-30) esu (reference system 1), because of the double aromatic rings in the heteroaromatic imido-substituted hexamolybdates. The heteroaromatic rings act as a conjugation bridge between the electron acceptor (-NO(2)) and donor (polyanion). The introduction of an electron donor into heteroaromatic rings significantly enhances the first hyperpolarizabilities because the electron-donating ability is substantially enhanced when the electron donor is attached to the heterocyclic aromatic rings. Interposing five-membered auxiliary fragments between strong donor (polyanion) or acceptor (-NO(2)) groups results in a large computed second-order NLO response. The present investigation provides important insight into the NLO properties of (heteroaromatic) imido-substituted hexamolybdate derivatives because these compounds exhibit enhanced hyperpolarizabilities compared to typical NLO arylimido hexamolybdates and heterocyclic aromatic rings reported in the literature.

Single-Molecule Interfacial Electron Transfer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, H. Peter

This project is focused on the use of single-molecule high spatial and temporal resolved techniques to study molecular dynamics in condensed phase and at interfaces, especially, the complex reaction dynamics associated with electron and energy transfer rate processes. The complexity and inhomogeneity of the interfacial ET dynamics often present a major challenge for a molecular level comprehension of the intrinsically complex systems, which calls for both higher spatial and temporal resolutions at ultimate single-molecule and single-particle sensitivities. Combined single-molecule spectroscopy and electrochemical atomic force microscopy approaches are unique for heterogeneous and complex interfacial electron transfer systems because the static andmore » dynamic inhomogeneities can be identified and characterized by studying one molecule at a specific nanoscale surface site at a time. The goal of our project is to integrate and apply these spectroscopic imaging and topographic scanning techniques to measure the energy flow and electron flow between molecules and substrate surfaces as a function of surface site geometry and molecular structure. We have been primarily focusing on studying interfacial electron transfer under ambient condition and electrolyte solution involving both single crystal and colloidal TiO 2 and related substrates. The resulting molecular level understanding of the fundamental interfacial electron transfer processes will be important for developing efficient light harvesting systems and broadly applicable to problems in fundamental chemistry and physics. We have made significant advancement on deciphering the underlying mechanism of the complex and inhomogeneous interfacial electron transfer dynamics in dyesensitized TiO 2 nanoparticle systems that strongly involves with and regulated by molecule-surface interactions. We have studied interfacial electron transfer on TiO 2 nanoparticle surfaces by using ultrafast single-molecule spectroscopy and electrochemical AFM metal tip scanning microscopy, focusing on understanding the interfacial electron transfer dynamics at specific nanoscale electron transfer sites with high-spatially and temporally resolved topographic-and-spectroscopic characterization at individual molecule basis, characterizing single-molecule rate processes, reaction driving force, and molecule-substrate electronic coupling. One of the most significant characteristics of our new approach is that we are able to interrogate the complex interfacial electron transfer dynamics by actively pin-point energetic manipulation of the surface interaction and electronic couplings, beyond the conventional excitation and observation.« less

Double exposure using 193nm negative tone photoresist

NASA Astrophysics Data System (ADS)

Kim, Ryoung-han; Wallow, Tom; Kye, Jongwook; Levinson, Harry J.; White, Dave

2007-03-01

Double exposure is one of the promising methods for extending lithographic patterning into the low k I regime. In this paper, we demonstrate double patterning of k 1-effective=0.25 with improved process window using a negative resist. Negative resist (TOK N- series) in combination with a bright field mask is proven to provide a large process window in generating 1:3 = trench:line resist features. By incorporating two etch transfer steps into the hard mask material, frequency doubled patterns could be obtained.

Carotenoid Photoprotection in Artificial Photosynthetic Antennas

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kloz, Miroslav; Pillai, Smitha; Kodis, Gerdenis

A series of phthalocyanine-carotenoid dyads in which a phenylamino group links a phthalocyanine to carotenoids having 8-11 backbone double bonds were examined by visible and near-infrared femtosecond pump-probe spectroscopy combined with global fitting analysis. The series of molecules has permitted investigation of the role of carotenoids in the quenching of excited states of cyclic tetrapyrroles. The transient behavior varied dramatically with the length of the carotenoid and the solvent environment. Clear spectroscopic signatures of radical species revealed photoinduced electron transfer as the main quenching mechanism for all dyads dissolved in a polar solvent (THF), and the quenching rate was almostmore » independent of carotenoid length. However, in a nonpolar solvent (toluene), quenching rates displayed a strong dependence on the conjugation length of the carotenoid and the mechanism did not include charge separation. The lack of any rise time components of a carotenoid S 1 signature in all experiments in toluene suggests that an excitonic coupling between the carotenoid S 1 state and phthalocyanine Q state, rather than a conventional energy transfer process, is the major mechanism of quenching. A pronounced inhomogeneity of the system was observed and attributed to the presence of a phenyl-amino linker between phthalocyanine and carotenoids. On the basis of accumulated work on various caroteno-phthalocyanine dyads and triads, we have now identified three mechanisms of tetrapyrrole singlet excited state quenching by carotenoids in artificial systems: (i) Car-Pc electron transfer and recombination; (ii) 1Pc to Car S 1 energy transfer and fast internal conversion to the Car ground state; (iii) excitonic coupling between 1Pc and Car S 1 and ensuing internal conversion to the ground state of the carotenoid. The dominant mechanism depends upon the exact molecular architecture and solvent environment. These synthetic systems are providing a deeper understanding of structural and environmental effects on the interactions between carotenoids and tetrapyrroles and thereby better defining their role in controlling natural photosynthetic systems.« less

Space plasma contactor research, 1987

NASA Technical Reports Server (NTRS)

Wilbur, Paul J.

1988-01-01

A simple model describing the process of electron collection from a low pressure ambient plasma in the absence of magnetic field and contactor velocity effects is presented. Experimental measurments of the plasma surrounding the contactor are used to demonstrate that a double-sheath generally develops and separates the ambient plasma from a higher density, anode plasma located adjacent to the contactor. Agreement between the predictions of the model and experimental measurements obtained at the electron collection current levels ranging to 1 A suggests the surface area at the ambient plasma boundary of the double-sheath is equal to the electron current being collected divided by the ambient plasma random electron current density; the surface area of the higher density anode plasma boundary of the double-sheath is equal to the ion current being emitted across this boundary divided by the ion current density required to sustain a stable sheath; and the voltage drop across the sheath is determined by the requirement that the ion and electron currents counterflowing across the boundaries be at space-charge limited levels. The efficiency of contactor operation is shown to improve when significant ionization and excitation is induced by electrons that stream from the ambient plasma through the double-sheath and collide with neutral atoms being supplied through the hollow cathode.

What Hinders Electron Transfer Dissociation (ETD) of DNA Cations?

NASA Astrophysics Data System (ADS)

Hari, Yvonne; Leumann, Christian J.; Schürch, Stefan

2017-12-01

Radical activation methods, such as electron transfer dissociation (ETD), produce structural information complementary to collision-induced dissociation. Herein, electron transfer dissociation of 3-fold protonated DNA hexamers was studied to gain insight into the fragmentation mechanism. The fragmentation patterns of a large set of DNA hexamers confirm cytosine as the primary target of electron transfer. The reported data reveal backbone cleavage by internal electron transfer from the nucleobase to the phosphate linker leading either to a•/ w or d/ z• ion pairs. This reaction pathway contrasts with previous findings on the dissociation processes after electron capture by DNA cations, suggesting multiple, parallel dissociation channels. However, all these channels merely result in partial fragmentation of the precursor ion because the charge-reduced DNA radical cations are quite stable. Two hypotheses are put forward to explain the low dissociation yield of DNA radical cations: it is either attributed to non-covalent interactions between complementary fragments or to the stabilization of the unpaired electron in stacked nucleobases. MS3 experiments suggest that the charge-reduced species is the intact oligonucleotide. Moreover, introducing abasic sites significantly increases the dissociation yield of DNA cations. Consequently, the stabilization of the unpaired electron by π-π-stacking provides an appropriate rationale for the high intensity of DNA radical cations after electron transfer. [Figure not available: see fulltext.

Ion acceleration and non-Maxwellian electron distributions in a low collisionality, high power helicon plasma source

NASA Astrophysics Data System (ADS)

Li, Yan; Sung, Yung-Ta; Scharer, John

2015-11-01

Ion acceleration through plasma double layer and non-Maxwellian two temperature electron distributions have been observed in Madison Helicon Experiment (MadHeX) operated in high RF power (>1000 W) and low Ar pressure (0.17 mtorr) inductive mode. By applying Optical Emission Spectroscopy (OES) cross-checked with an RF-compensated Langmuir probe (at 13.56 MHz and its second and third harmonics), the fast (>80 eV), untrapped electrons downstream of the double layer have a higher temperature of 13 eV than the trapped bulk electrons upstream with a temperature of 4 eV. The reduction of plasma potential and density observed in the double layer region require an upstream temperature ten times the measured 4 eV if occurring via Boltzmann ambipolar expansion. The hot tail electrons of the non-Maxwellian electron distribution affect the formation and the potential drop of the double layer region. The mechanism behind this has been explored via several non-invasive plasma diagnostics tools. The OES measured electron temperatures and densities are also cross-checked with Atomic Data and Analysis Structure (ADAS) and a millimeter wave interferometer respectively. The IEDF is measured by a four-grid RPA and also cross-checked with argon 668 nm Laser Induced Fluorescence (LIF). An emissive probe has been used to measure the plasma potential.

75 FR 33681 - Electronic Fund Transfers

Federal Register 2010, 2011, 2012, 2013, 2014

2010-06-15

... FEDERAL RESERVE SYSTEM 12 CFR Part 205 [Regulation E; Docket No. R-1343] Electronic Fund Transfers June 4, 2010. AGENCY: Board of Governors of the Federal Reserve System. ACTION: Final rule; correction..., published on June 4, 2010 (75 FR 31665) make the following correction: PART 205--ELECTRONIC FUND TRANSFERS...

Relativistic Tennis with Photons: Frequency Up-Shifting, Light Intensification and Ion Acceleration with Flying Mirrors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bulanov, S. V.; Esirkepov, T. Zh.; Kando, M.

2011-01-04

We formulate the Flying Mirror Concept for relativistic interaction of ultra-intense electromagnetic waves with plasmas, present its theoretical description and the results of computer simulations and laboratory experiments. In collisionless plasmas, the relativistic flying mirrors are thin and dense electron or electron-ion layers accelerated by the high intensity electromagnetic waves up to velocity close to the speed of light in vacuum; in nonlinear-media and in nonlinear vacuum they are the ionization fronts and the refraction index modulations induced by a strong electromagnetic wave. The reflection of the electromagnetic wave at the relativistic mirror results in its energy and frequency changemore » due to the double Doppler effect. In the co-propagating configuration, in the radiation pressure dominant regime, the energy of the electromagnetic wave is transferred to the ion energy providing a highly efficient acceleration mechanism. In the counter-propagation configuration the frequency of the reflected wave is multiplied by the factor proportional to the gamma-factor squared. If the relativistic mirror performs an oscillatory motion as in the case of the electron motion at the plasma-vacuum interface, the reflected light spectrum is enriched with high order harmonics.« less

Recovery from First-Language Transfer: The Second Language Acquisition of English Double Objects by Korean Speakers

ERIC Educational Resources Information Center

Oh, Eunjeong

2010-01-01

Previous studies on second language (L2) acquisition of English dative alternation by Korean speakers (Oh and Zubizarreta, 2003, 2006a, 2006b) have shown that the acquisition of English benefactive double object (DO) (e.g. "John baked Mary a cake") lags behind that of its counterpart goal double object (e.g. "John sent Mary the letter"). This…

Two-parameter double-oscillator model of Mathews-Lakshmanan type: Series solutions and supersymmetric partners

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schulze-Halberg, Axel, E-mail: axgeschu@iun.edu, E-mail: xbataxel@gmail.com; Wang, Jie, E-mail: wangjie@iun.edu

2015-07-15

We obtain series solutions, the discrete spectrum, and supersymmetric partners for a quantum double-oscillator system. Its potential features a superposition of the one-parameter Mathews-Lakshmanan interaction and a one-parameter harmonic or inverse harmonic oscillator contribution. Furthermore, our results are transferred to a generalized Pöschl-Teller model that is isospectral to the double-oscillator system.

Layer and doping tunable ferromagnetic order in two-dimensional Cr S2 layers

NASA Astrophysics Data System (ADS)

Wang, Cong; Zhou, Xieyu; Pan, Yuhao; Qiao, Jingsi; Kong, Xianghua; Kaun, Chao-Cheng; Ji, Wei

2018-06-01

Interlayer coupling is of vital importance for manipulating physical properties, e.g., electronic band gap, in two-dimensional materials. However, tuning magnetic properties in these materials is yet to be addressed. Here, we found the in-plane magnetic orders of Cr S2 mono and few layers are tunable between striped antiferromagnetic (sAFM) and ferromagnetic (FM) orders by manipulating charge transfer between Cr t2 g and eg orbitals. Such charge transfer is realizable through interlayer coupling, direct charge doping, or substituting S with Cl atoms. In particular, the transferred charge effectively reduces a portion of Cr4 + to Cr3 +, which, together with delocalized S p orbitals and their resulting direct S-S interlayer hopping, enhances the double-exchange mechanism favoring the FM rather than sAFM order. An exceptional interlayer spin-exchange parameter was revealed over -10 meV , an order of magnitude stronger than available results of interlayer magnetic coupling. It addition, the charge doping could tune Cr S2 between p - and n -doped magnetic semiconductors. Given these results, several prototype devices were proposed for manipulating magnetic orders using external electric fields or mechanical motion. These results manifest the role of interlayer coupling in modifying magnetic properties of layered materials and shed considerable light on manipulating magnetism in these materials.

Synthesis and adsorption properties of flower-like layered double hydroxide by a facile one-pot reaction with an eggshell membrane as assistant

NASA Astrophysics Data System (ADS)

Li, Songnan; Zhang, Jiawei; Jamil, Saba; Cai, Qinghai; Zang, Shuying

In this paper, flower-like layered double hydroxides were synthesized with eggshell membrane assistant. The as-prepared samples were characterized by a series of techniques including X-ray diffraction (XRD), Fourier transform infrared spectroscopy, Scanning electron microscopy (SEM), Transmission electron microscopy (TEM), Thermal gravity-differential thermal analysis and Nitrogen sorption/desorption. The resulting layered double hydroxides were composed of nanoplates with edge-to-face particle interactions. The specific surface area and total pore volume of the as-prepared flower-like layered double hydroxides were 160m2/g and 0.65m3/g, respectively. The adsorption capacity of flower-like layered double hydroxides to Congo Red was 258mg/g, which was higher than that of layered double hydroxides synthesized by the traditional method.

Balancing the benefits and risks of public-private partnerships to address the global double burden of malnutrition.

PubMed

Kraak, Vivica I; Harrigan, Paige B; Lawrence, Mark; Harrison, Paul J; Jackson, Michaela A; Swinburn, Boyd

2012-03-01

Transnational food, beverage and restaurant companies, and their corporate foundations, may be potential collaborators to help address complex public health nutrition challenges. While UN system guidelines are available for private-sector engagement, non-governmental organizations (NGO) have limited guidelines to navigate diverse opportunities and challenges presented by partnering with these companies through public-private partnerships (PPP) to address the global double burden of malnutrition. We conducted a search of electronic databases, UN system websites and grey literature to identify resources about partnerships used to address the global double burden of malnutrition. A narrative summary provides a synthesis of the interdisciplinary literature identified. We describe partnership opportunities, benefits and challenges; and tools and approaches to help NGO engage with the private sector to address global public health nutrition challenges. PPP benefits include: raising the visibility of nutrition and health on policy agendas; mobilizing funds and advocating for research; strengthening food-system processes and delivery systems; facilitating technology transfer; and expanding access to medications, vaccines, healthy food and beverage products, and nutrition assistance during humanitarian crises. PPP challenges include: balancing private commercial interests with public health interests; managing conflicts of interest; ensuring that co-branded activities support healthy products and healthy eating environments; complying with ethical codes of conduct; assessing partnership compatibility; and evaluating partnership outcomes. NGO should adopt a systematic and transparent approach using available tools and processes to maximize benefits and minimize risks of partnering with transnational food, beverage and restaurant companies to effectively target the global double burden of malnutrition.

Energy transfer, orbital angular momentum, and discrete current in a double-ring fiber array

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alexeyev, C. N.; Volyar, A. V.; Yavorsky, M. A.

We study energy transfer and orbital angular momentum of supermodes in a double-ring array of evanescently coupled monomode optical fibers. The structure of supermodes and the spectra of their propagation constants are obtained. The geometrical parameters of the array, at which the energy is mostly confined within the layers, are determined. The developed method for finding the supermodes of concentric arrays is generalized for the case of multiring arrays. The orbital angular momentum carried by a supermode of a double-ring array is calculated. The discrete lattice current is introduced. It is shown that the sum of discrete currents over themore » array is a conserved quantity. The connection of the total discrete current with orbital angular momentum of discrete optical vortices is made.« less

Inner reorganization limiting electron transfer controlled hydrogen bonding: intra- vs. intermolecular effects.

PubMed

Martínez-González, Eduardo; Frontana, Carlos

2014-05-07

In this work, experimental evidence of the influence of the electron transfer kinetics during electron transfer controlled hydrogen bonding between anion radicals of metronidazole and ornidazole, derivatives of 5-nitro-imidazole, and 1,3-diethylurea as the hydrogen bond donor, is presented. Analysis of the variations of voltammetric EpIcvs. log KB[DH], where KB is the binding constant, allowed us to determine the values of the binding constant and also the electron transfer rate k, confirmed by experiments obtained at different scan rates. Electronic structure calculations at the BHandHLYP/6-311++G(2d,2p) level for metronidazole, including the solvent effect by the Cramer/Truhlar model, suggested that the minimum energy conformer is stabilized by intramolecular hydrogen bonding. In this structure, the inner reorganization energy, λi,j, contributes significantly (0.5 eV) to the total reorganization energy of electron transfer, thus leading to a diminishment of the experimental k.

Development of a Simple Electron Transfer and Polarization Model and Its Application to Biological Systems.

PubMed

Diller, David J

2017-01-10

Here we present a new method for point charge calculation which we call Q ET (charges by electron transfer). The intent of this work is to develop a method that can be useful for studying charge transfer in large biological systems. It is based on the intuitive framework of the Q EQ method with the key difference being that the Q ET method tracks all pairwise electron transfers by augmenting the Q EQ pseudoenergy function with a distance dependent cost function for each electron transfer. This approach solves the key limitation of the Q EQ method which is its handling of formally charged groups. First, we parametrize the Q ET method by fitting to electrostatic potentials calculated using ab initio quantum mechanics on over 11,000 small molecules. On an external test set of over 2500 small molecules the Q ET method achieves a mean absolute error of 1.37 kcal/mol/electron when compared to the ab initio electrostatic potentials. Second, we examine the conformational dependence of the charges on over 2700 tripeptides. With the tripeptide data set, we show that the conformational effects account for approximately 0.4 kcal/mol/electron on the electrostatic potentials. Third, we test the Q ET method for its ability to reproduce the effects of polarization and electron transfer on 1000 water clusters. For the water clusters, we show that the Q ET method captures about 50% of the polarization and electron transfer effects. Finally, we examine the effects of electron transfer and polarizability on the electrostatic interaction between p38 and 94 small molecule ligands. When used in conjunction with the Generalized-Born continuum solvent model, polarization and electron transfer with the Q ET model lead to an average change of 17 kcal/mol on the calculated electrostatic component of ΔG.

Phylogenetic analysis of proteins associated in the four major energy metabolism systems: photosynthesis, aerobic respiration, denitrification, and sulfur respiration.

PubMed

Tomiki, Takeshi; Saitou, Naruya

2004-08-01

The four electron transfer energy metabolism systems, photosynthesis, aerobic respiration, denitrification, and sulfur respiration, are thought to be evolutionarily related because of the similarity of electron transfer patterns and the existence of some homologous proteins. How these systems have evolved is elusive. We therefore conducted a comprehensive homology search using PSI-BLAST, and phylogenetic analyses were conducted for the three homologous groups (groups 1-3) based on multiple alignments of domains defined in the Pfam database. There are five electron transfer types important for catalytic reaction in group 1, and many proteins bind molybdenum. Deletions of two domains led to loss of the function of binding molybdenum and ferredoxin, and these deletions seem to be critical for the electron transfer pattern changes in group 1. Two types of electron transfer were found in group 2, and all its member proteins bind siroheme and ferredoxin. Insertion of the pyridine nucleotide disulfide oxidoreductase domain seemed to be the critical point for the electron transfer pattern change in this group. The proteins belonging to group 3 are all flavin enzymes, and they bind flavin adenine dinucleotide (FAD) or flavin mononucleotide (FMN). Types of electron transfer in this group are divergent, but there are two common characteristics. NAD(P)H works as an electron donor or acceptor, and FAD or FMN transfers electrons from/to NAD(P)H. Electron transfer functions might be added to these common characteristics by the addition of functional domains through the evolution of group 3 proteins. Based on the phylogenetic analyses in this study and previous studies, we inferred the phylogeny of the energy metabolism systems as follows: photosynthesis (and possibly aerobic respiration) and the sulfur/nitrogen assimilation system first diverged, then the sulfur/nitrogen dissimilation system was produced from the latter system.

Observation of two-center interference effects for electron impact ionization of N2

NASA Astrophysics Data System (ADS)

Chaluvadi, Hari; Nur Ozer, Zehra; Dogan, Mevlut; Ning, Chuangang; Colgan, James; Madison, Don

2015-08-01

In 1966, Cohen and Fano (1966 Phys. Rev. 150 30) suggested that one should be able to observe the equivalent of Young’s double slit interference if the double slits were replaced by a diatomic molecule. This suggestion inspired many experimental and theoretical studies searching for double slit interference effects both for photon and particle ionization of diatomic molecules. These effects turned out to be so small for particle ionization that this work proceeded slowly and evidence for interference effects were only found by looking at cross section ratios. Most of the early particle work concentrated on double differential cross sections for heavy particle scattering and the first evidence for two-center interference for electron-impact triple differential cross section (TDCS) did not appear until 2006 for ionization of H2. Subsequent work has now firmly established that two-center interference effects can be seen in the TDCS for electron-impact ionization of H2. However, in spite of several experimental and theoretical studies, similar effects have not been found for electron-impact ionization of N2. Here we report the first evidence for two-center interference for electron-impact ionization of N2.

Predicting the Rate Constant of Electron Tunneling Reactions at the CdSe-TiO2 Interface.

PubMed

Hines, Douglas A; Forrest, Ryan P; Corcelli, Steven A; Kamat, Prashant V

2015-06-18

Current interest in quantum dot solar cells (QDSCs) motivates an understanding of the electron transfer dynamics at the quantum dot (QD)-metal oxide (MO) interface. Employing transient absorption spectroscopy, we have monitored the electron transfer rate (ket) at this interface as a function of the bridge molecules that link QDs to TiO2. Using mercaptoacetic acid, 3-mercaptopropionic acid, 8-mercaptooctanoic acid, and 16-mercaptohexadecanoic acid, we observe an exponential attenuation of ket with increasing linker length, and attribute this to the tunneling of the electron through the insulating linker molecule. We model the electron transfer reaction using both rectangular and trapezoidal barrier models that have been discussed in the literature. The one-electron reduction potential (equivalent to the lowest unoccupied molecular orbital) of each molecule as determined by cyclic voltammetry (CV) was used to estimate the effective barrier height presented by each ligand at the CdSe-TiO2 interface. The electron transfer rate (ket) calculated for each CdSe-ligand-TiO2 interface using both models showed the results in agreement with the experimentally determined trend. This demonstrates that electron transfer between CdSe and TiO2 can be viewed as electron tunneling through a layer of linking molecules and provides a useful method for predicting electron transfer rate constants.

Proton-coupled electron transfer versus hydrogen atom transfer: generation of charge-localized diabatic states.

PubMed

Sirjoosingh, Andrew; Hammes-Schiffer, Sharon

2011-03-24

The distinction between proton-coupled electron transfer (PCET) and hydrogen atom transfer (HAT) mechanisms is important for the characterization of many chemical and biological processes. PCET and HAT mechanisms can be differentiated in terms of electronically nonadiabatic and adiabatic proton transfer, respectively. In this paper, quantitative diagnostics to evaluate the degree of electron-proton nonadiabaticity are presented. Moreover, the connection between the degree of electron-proton nonadiabaticity and the physical characteristics distinguishing PCET from HAT, namely, the extent of electronic charge redistribution, is clarified. In addition, a rigorous diabatization scheme for transforming the adiabatic electronic states into charge-localized diabatic states for PCET reactions is presented. These diabatic states are constructed to ensure that the first-order nonadiabatic couplings with respect to the one-dimensional transferring hydrogen coordinate vanish exactly. Application of these approaches to the phenoxyl-phenol and benzyl-toluene systems characterizes the former as PCET and the latter as HAT. The diabatic states generated for the phenoxyl-phenol system possess physically meaningful, localized electronic charge distributions that are relatively invariant along the hydrogen coordinate. These diabatic electronic states can be combined with the associated proton vibrational states to generate the reactant and product electron-proton vibronic states that form the basis of nonadiabatic PCET theories. Furthermore, these vibronic states and the corresponding vibronic couplings may be used to calculate rate constants and kinetic isotope effects of PCET reactions.