Science.gov

Sample records for double hit method

  1. How I treat double-hit lymphoma.

    PubMed

    Friedberg, Jonathan W

    2017-08-03

    The 2016 revision of the World Health Organization (WHO) classification for lymphoma has included a new category of lymphoma, separate from diffuse large B-cell lymphoma, termed high-grade B-cell lymphoma with translocations involving myc and bcl-2 or bcl-6. These lymphomas, which occur in <10% of cases of diffuse large B-cell lymphoma, have been referred to as double-hit lymphomas (or triple-hit lymphomas if all 3 rearrangements are present). It is important to differentiate these lymphomas from the larger group of double-expressor lymphomas, which have increased expression of MYC and BCL-2 and/or BCL-6 by immunohistochemistry, by using variable cutoff percentages to define positivity. Patients with double-hit lymphomas have a poor prognosis when treated with standard chemoimmunotherapy and have increased risk of central nervous system involvement and progression. Double-hit lymphomas may arise as a consequence of the transformation of the underlying indolent lymphoma. There are no published prospective trials in double-hit lymphoma, however retrospective studies strongly suggest that aggressive induction regimens may confer a superior outcome. In this article, I review my approach to the evaluation and treatment of double-hit lymphoma, with an eye toward future clinical trials incorporating rational targeted agents into the therapeutic armamentarium. © 2017 by The American Society of Hematology.

  2. The Spectrum of Double Hit Lymphomas.

    PubMed

    Abramson, Jeremy S

    2016-12-01

    Double-hit lymphomas (DHLs) characterize a unique subset of B-cell non-Hodgkin lymphomas. DHL typically presents in older adults with high-risk clinical features. This entity carries a significantly inferior prognosis compared with typical cases of diffuse large B-cell lymphoma; however, emerging literature can identify discrete clinical features within DHL that are associated with a favorable prognosis. Emerging literature is also demonstrating that intensive upfront treatment strategies may improve outcome. Diagnosis, prognostication, and management of DHL are reviewed, as well as potential future directions incorporating novel biologically targeted therapies. Finally, double-expressing lymphomas (DELs) will be discussed and contrasted with DHL. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Cutaneous presentation of Double Hit Lymphoma

    PubMed Central

    Khelfa, Yousef; Lebowicz, Yehuda

    2016-01-01

    Diffuse large B-cell lymphoma (DLBCL) is the most common type of non-Hodgkin lymphoma (NHL), representing approximately 25% of diagnosed NHL. DLBCL is heterogeneous disease both clinically and genetically. The 3 most common chromosomal translocations in DLBCL involve the oncogenes BCL2, BCL6, and MYC. Double hit (DH) DLBCL is an aggressive form in which MYC rearrangement is associated with either BCL2 or BCL6 rearrangement. Patients typically present with a rapidly growing mass, often with B symptoms. Extranodal disease is often present. Though there is a paucity of prospective trials in this subtype, double hit lymphoma (DHL) has been linked to very poor outcomes when patients are treated with standard R-CHOP. There is, therefore, a lack of consensus regarding the standard treatment for DHL. Several retrospective analyses have been conducted to help guide treatment of this disease. These suggest that DA EPOCH-R may be the most promising regimen and that achievement of complete resolution predicts better long-term outcomes. PMID:27115017

  4. Emerging Strategies in Treating Double Hit Lymphomas.

    PubMed

    Nabhan, Chadi; Mato, Anthony R

    2017-09-01

    Double hit lymphomas (DHLs) are a new category in the World Health Organization newest classification for lymphoid malignancies. DHL encompasses various histologies of lymphomas where the MYC oncogene and either BCL2 or BCL6 oncogenes are present concomitantly. Several observational studies and retrospective series have demonstrated that patients with DHL carry a poor prognosis and respond less and for a shorter duration to standard R-CHOP (rituximab, cyclophosphamide, vincristine, adriamycin, and prednisone). These studies have also proposed that dose intensification (with Burkitt-like regimens such as DA-EPOCH-R [dose-adjusted rituximab, etoposide, vincristine, Adriamycin, cyclophosphamide, and prednisone]) might offer patients with DHL better outcomes and improved prognosis. In this timely review, we discuss incidence of DHL, testing implications of MYC translocation, current treatment strategies, and future directions. Understanding this entity and its therapeutic consequences is essential to improve patients' outcomes. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Double-Hit Large B Cell Lymphoma.

    PubMed

    Khelfa, Yousef; Lebowicz, Yehuda; Jamil, Muhammad Omer

    2017-09-26

    Diffuse large B cell lymphoma (DLBCL) is the most common type of non-Hodgkin lymphoma (NHL), accounting for approximately 25% of NHL cases. It is a heterogeneous group of diseases. BCL2, BCL6, and MYC are the most frequent mutated genes in DLBCL. Double-hit lymphoma (DHL) is an aggressive form of DLBCL with an unmet treatment need, in which MYC rearrangement is present with either BCL2 or BCL6 rearrangement. Patients typically present with a rapidly growing mass with B symptoms. DHL has been linked to very poor outcomes when treated with RCHOP chemotherapy. Dual-expressor lymphoma is a form of DLBCL with overexpression of MYC and BCL2/BCL6. There is a paucity of prospective trials evaluating the treatment of DHL. Retrospective series suggest that more aggressive treatment regimens such as DA-EPOCH and hyper CVAD may be more efficacious. However, there remains a lack of consensus regarding optimal treatment for DHL. Further clinical trials, including novel agents, are needed for improvement in outcomes.

  6. Tolosa-Hunt Syndrome in Double-Hit Lymphoma

    PubMed Central

    Peddi, Prakash; Gallagher, Kevin M.; Chandrasekharan, Chandrikha; Wang, Qi; Gonzalez-Toledo, Eduardo; Nair, Binu S.; Munker, Reinhold; Mills, Glenn M.; Koshy, Nebu V.

    2015-01-01

    Tolosa-Hunt syndrome (THS) is a painful condition characterized by hemicranial pain, retroorbital pain, loss of vision, oculomotor nerve paralysis, and sensory loss in distribution of ophthalmic and maxillary division of trigeminal nerve. Lymphomas rarely involve cavernous sinus and simulate Tolosa-Hunt syndrome. Here we present a first case of double-hit B cell lymphoma (DHL) relapsing and masquerading as Tolosa-Hunt syndrome. The neurological findings were explained by a lymphomatous infiltration of the right Gasserian ganglion which preceded systemic relapse. As part of this report, the diagnostic criteria for Tolosa-Hunt syndrome and double-hit lymphoma are reviewed and updated treatment recommendations are presented. PMID:25918657

  7. Current challenges and novel treatment strategies in double hit lymphomas

    PubMed Central

    Anderson, Mary Ann; Tsui, Alpha; Wall, Meaghan; Huang, David C. S.; Roberts, Andrew W.

    2016-01-01

    High-grade B-cell lymphomas with recurrent chromosomal break points have been termed ‘double hit lymphoma’ (DHL). The most commonly seen DHL is diffuse large B-cell lymphoma (DLBCL) with t(14;18) and t(8;14) or t(8;22) resulting in overexpression of BCL2 and MYC, respectively. The increased proliferation due to MYC overexpression, without the ability for an apoptotic brake as a result of BCL2 overexpression, results in ‘the perfect storm of oncogenesis’. Thus this disease presents a number of diagnostic and therapeutic challenges for the hematologist. The first and foremost challenge is to recognize the DHL. As different morphological entities can be affected it is incumbent on pathologists and clinicians to maintain a high index of suspicion especially in disease that appears unusually aggressive or refractory to therapy. Diagnosis by fluorescence in situ hybridization (FISH) is a sensitive and specific method for detection of the disease but is time-consuming and expensive. While detection by immunohistochemistry (IHC) is sensitive and correlates with survival, standardized methods for this are not widely agreed upon. The second and equally important challenge in DHL is optimizing clinical outcome in a group of patients for whom the prognosis is widely regarded as poor. While improvements have been achieved by dose escalating standard chemotherapeutic regimens, many patients continue to do badly. Furthermore as a disease of aging many patients are unsuitable for dose-intensive chemotherapy regimens. There are now multiple novel targeted agents in various stages of clinical development that offer hope for better outcomes without undue toxicity. Among the most exciting of these developments include specific inhibitors of both BCL2 and MYC. PMID:26834954

  8. Current challenges and novel treatment strategies in double hit lymphomas.

    PubMed

    Anderson, Mary Ann; Tsui, Alpha; Wall, Meaghan; Huang, David C S; Roberts, Andrew W

    2016-02-01

    High-grade B-cell lymphomas with recurrent chromosomal break points have been termed 'double hit lymphoma' (DHL). The most commonly seen DHL is diffuse large B-cell lymphoma (DLBCL) with t(14;18) and t(8;14) or t(8;22) resulting in overexpression of BCL2 and MYC, respectively. The increased proliferation due to MYC overexpression, without the ability for an apoptotic brake as a result of BCL2 overexpression, results in 'the perfect storm of oncogenesis'. Thus this disease presents a number of diagnostic and therapeutic challenges for the hematologist. The first and foremost challenge is to recognize the DHL. As different morphological entities can be affected it is incumbent on pathologists and clinicians to maintain a high index of suspicion especially in disease that appears unusually aggressive or refractory to therapy. Diagnosis by fluorescence in situ hybridization (FISH) is a sensitive and specific method for detection of the disease but is time-consuming and expensive. While detection by immunohistochemistry (IHC) is sensitive and correlates with survival, standardized methods for this are not widely agreed upon. The second and equally important challenge in DHL is optimizing clinical outcome in a group of patients for whom the prognosis is widely regarded as poor. While improvements have been achieved by dose escalating standard chemotherapeutic regimens, many patients continue to do badly. Furthermore as a disease of aging many patients are unsuitable for dose-intensive chemotherapy regimens. There are now multiple novel targeted agents in various stages of clinical development that offer hope for better outcomes without undue toxicity. Among the most exciting of these developments include specific inhibitors of both BCL2 and MYC.

  9. Double hit lymphoma: from biology to therapeutic implications.

    PubMed

    Burotto, Mauricio; Berkovits, Alejandro; Dunleavy, Kieron

    2016-07-01

    Diffuse large B-cell lymphoma (DLBCL) is a molecularly heterogeneous disease defined by different cellular origins and mechanisms of oncogenic activation. Approximately 10% of DLBCL cases harbor a MYC rearrangement and this has been associated with a more aggressive clinical course following standard therapy. So-called 'double-hit lymphomas' (DHL) or 'triple hit lymphomas' (THL) occur when MYC is concurrently rearranged with BCL2 and/or BCL6. These tumors are characterized by high proliferation rate and a very poor outcome following standard R-CHOP (rituximab, cyclophosphamide, doxorubicin vincristine and prednisone) therapy, in most (though not all) studies that have looked at this. Though there is a paucity of published experience with other chemotherapy regimens, there is emerging evidence that more intensive approaches may improve outcome. Recently, there has been a lot of focus in the literature on 'double-expresser lymphomas' (DEL) with high MYC, BCL2 and/or BCL6 expression but typically without rearrangements of these genes. These DEL cases, have a poor outcome with R-CHOP and there is little consensus on how they should be approached. Expert commentary: This review will focus on the biology and treatment of DHL and DEL, discuss the outcome of these diseases with current standard as well as promising new approaches and conclude with a section on novel agents that are in development for these diseases.

  10. Cytopathology of "double-hit" non-Hodgkin lymphoma.

    PubMed

    Elkins, Camille T; Wakely, Paul E

    2011-08-25

    B-cell lymphomas with concurrent IGH-BCL2 and c-MYC rearrangements (so-called "double-hit lymphomas" [DHL]) are a relatively rare, recently described category in the 2008 World Health Organization classification of hematopoietic neoplasms. Response to chemotherapy and survival are poor. The authors reviewed files of cytogenetically documented DHL to identify cytologic features that would allow its possible recognition. Twelve fine-needle aspirates (FNAs), 2 pleural fluids, and 1 touch imprint of cytogenetically proven DHL were uncovered. Primary DHL was correctly recognized in 3 of 12 FNA cases using Ki-67 staining coupled with a positive bcl-2 result as the basis for performing fluorescence in situ hybridization (FISH) analysis of c-MYC and IGH-BCL2 rearrangements. Remaining FNAs and non-FNA cases were diagnosed as non-Hodgkin lymphoma, B-cell lymphoma, or atypical lymphocytosis. Ten cases had cell block material available. All cases had high cellularity with a dissociated smear pattern and background lymphoglandular bodies. Cell size ranged from intermediate to large. Nuclei were predominantly rounded or slightly irregular in contour; 4 FNAs had markedly cleaved nuclei. Some nuclei harbored discrete but small nucleoli, whereas in others coarse chromatin and indistinct or multiple small nucleoli existed. A variable number of mitotic figures, tingible body macrophages, and background apoptotic cells were also present. No specific cytomorphologic feature(s) were found to reliably identify DHL using FNA or exfoliative cytology. A high Ki-67 proliferation index and positive bcl-2 staining (on cytospin slides or cell block material) of cases not conforming to typical Burkitt lymphoma morphology should prompt FISH analysis for c-MYC and/or IGH-BCL2 rearrangements to identify DHL, particularly if tissue biopsy is not expected. Copyright © 2011 American Cancer Society.

  11. Human Umbilical Cord Blood Mononuclear Cells in a Double-Hit Model of Bronchopulmonary Dysplasia in Neonatal Mice

    PubMed Central

    Mildau, Céline; Shen, Jie; Kasoha, Mariz; Laschke, Matthias W.; Roolfs, Torge; Schmiedl, Andreas; Tschernig, Thomas; Bieback, Karen; Gortner, Ludwig

    2013-01-01

    Background Bronchopulmonary dysplasia (BPD) presents a major threat of very preterm birth and treatment options are still limited. Stem cells from different sources have been used successfully in experimental BPD, induced by postnatal hyperoxia. Objectives We investigated the effect of umbilical cord blood mononuclear cells (MNCs) in a new double-hit mouse model of BPD. Methods For the double-hit, date mated mice were subjected to hypoxia and thereafter the offspring was exposed to hyperoxia. Human umbilical cord blood MNCs were given intraperitoneally by day P7. As outcome variables were defined: physical development (auxology), lung structure (histomorphometry), expression of markers for lung maturation and inflammation on mRNA and protein level. Pre- and postnatal normoxic pups and sham treated double-hit pups served as control groups. Results Compared to normoxic controls, sham treated double-hit animals showed impaired physical and lung development with reduced alveolarization and increased thickness of septa. Electron microscopy revealed reduced volume density of lamellar bodies. Pulmonary expression of mRNA for surfactant proteins B and C, Mtor and Crabp1 was reduced. Expression of Igf1 was increased. Treatment with umbilical cord blood MNCs normalized thickness of septa and mRNA expression of Mtor to levels of normoxic controls. Tgfb3 mRNA expression and pro-inflammatory IL-1β protein concentration were decreased. Conclusion The results of our study demonstrate the therapeutic potential of umbilical cord blood MNCs in a new double-hit model of BPD in newborn mice. We found improved lung structure and effects on molecular level. Further studies are needed to address the role of systemic administration of MNCs in experimental BPD. PMID:24069341

  12. Double hit diffuse large B-cell lymphomas: diagnostic and therapeutic challenges.

    PubMed

    Friedberg, Jonathan W

    2015-03-01

    Although diffuse large B-cell lymphoma (DLBCL) is curable with standard chemoimmunotherapy, over 30% of patients with advanced stage disease experience refractory disease or progression. Recent studies suggest that rearrangement of the myc oncogene occurs in approximately 10% of patients with DLBCL, and confers a very poor prognosis, particularly when there is concomitant rearrangement of bcl-2, a condition referred to as "double hit DLBCL". Using immunohistochemistry, up to 30% of patients have evidence of increased expression of myc, which occurs in both activated B-cell and germinal center type DLBCL. When bcl-2 is also positive by immunohistochemistry, prognosis is also poor. There are no randomized studies guiding treatment for patients with double hit DLBCL, but new datasets are emerging suggesting a possible role for dose-adjusted EPOCH infusional chemotherapy with rituximab. This review will conclude with a survey of novel agents which may be rationally incorporated into chemotherapy platforms for this high risk subset of DLBCL.

  13. High grade B-cell lymphoma with rearrangements of MYC and BCL2 and/or BCL6: Double hit and triple hit lymphomas and double expressing lymphoma

    PubMed Central

    Rosenthal, Allison; Younes, Anas

    2017-01-01

    Diffuse large B-cell lymphomas with aberrations in MYC, BCL2 and/or BCL6 by genetic alterations or protein expression represent a group of high grade B-cell lymphomas with inferior outcomes when treated with standard RCHOP chemotherapy. As a result, intensified induction regimens have been suggested in an effort to improve outcomes. Conclusions to date have largely been drawn from retrospective data although prospective data is slowly starting to emerge. Chemoimmunotherapy refractoriness is problematic and relapse rates are high. Patients with double hit lymphoma appear to have increased risk of CNS involvement and prophylaxis is recommended. There is insufficient evidence available to date to strongly recommend for or against consolidative stem cell transplant in this population. Collaborative clinical trials will be needed to establish a preferred therapeutic regimen and an appropriate standard of care in this unique group of patients with DLBCL. PMID:27717585

  14. Outcomes of Patients With Double-Hit Lymphoma Who Achieve First Complete Remission.

    PubMed

    Landsburg, Daniel J; Falkiewicz, Marissa K; Maly, Joseph; Blum, Kristie A; Howlett, Christina; Feldman, Tatyana; Mato, Anthony R; Hill, Brian T; Li, Shaoying; Medeiros, L Jeffrey; Torka, Pallawi; Hernandez-Ilizaliturri, Francisco; Reddy, Nishitha M; Singavi, Arun; Fenske, Timothy S; Chavez, Julio C; Kaplan, Jason B; Behdad, Amir; Petrich, Adam M; Bast, Martin A; Vose, Julie M; Olszewski, Adam J; Costa, Cristiana; Lansigan, Frederick; Gerson, James N; Barta, Stefan K; Calzada, Oscar; Cohen, Jonathon B; Lue, Jennifer K; Amengual, Jennifer E; Rivera, Xavier; Persky, Daniel O; Peace, David J; Nathan, Sunita; Cassaday, Ryan D

    2017-07-10

    Purpose Patients with double-hit lymphoma (DHL) rarely achieve long-term survival following disease relapse. Some patients with DHL undergo consolidative autologous stem-cell transplantation (autoSCT) to reduce the risk of relapse, although the benefit of this treatment strategy is unclear. Methods Patients with DHL who achieved first complete remission following completion of front-line therapy with either rituximab plus cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP) or intensive front-line therapy, and deemed fit for autoSCT, were included. A landmark analysis was performed, with time zero defined as 3 months after completion of front-line therapy. Patients who experienced relapse before or who were not followed until that time were excluded. Results Relapse-free survival (RFS) and overall survival (OS) rates at 3 years were 80% and 87%, respectively, for all patients (n = 159). Three-year RFS and OS rates did not differ significantly for autoSCT (n = 62) versus non-autoSCT patients (n = 97), but 3-year RFS was inferior in patients who received R-CHOP compared with intensive therapy (56% v 88%; P = .002). Three-year RFS and OS did not differ significantly for patients in the R-CHOP or intensive therapy cohorts when analyzed by receipt of autoSCT. The median OS following relapse was 8.6 months. Conclusion In the largest reported series, to our knowledge, of patients with DHL to achieve first complete remission, consolidative autoSCT was not associated with improved 3-year RFS or OS. In addition, patients treated with R-CHOP experienced inferior 3-year RFS compared with those who received intensive front-line therapy. When considered in conjunction with reports of patients with newly diagnosed DHL, which demonstrate lower rates of disease response to R-CHOP compared with intensive front-line therapy, our findings further support the use of intensive front-line therapy for this patient population.

  15. Chromosome doubling method

    DOEpatents

    Kato, Akio

    2006-11-14

    The invention provides methods for chromosome doubling in plants. The technique overcomes the low yields of doubled progeny associated with the use of prior techniques for doubling chromosomes in plants such as grasses. The technique can be used in large scale applications and has been demonstrated to be highly effective in maize. Following treatment in accordance with the invention, plants remain amenable to self fertilization, thereby allowing the efficient isolation of doubled progeny plants.

  16. Hepatitis C and double-hit B cell lymphoma successfully treated by antiviral therapy

    PubMed Central

    Galati, Giovanni; Rampa, Lorenzo; Vespasiani-Gentilucci, Umberto; Marino, Mirella; Pisani, Francesco; Cota, Carlo; Guidi, Alessandro; Picardi, Antonio

    2016-01-01

    B cells lymphoma is one of the most challenging extra-hepatic manifestations of hepatitis C virus (HCV). Recently, a new kind of B-cell lymphoma, named double-hit B (DHL), was characterized with an aggressive clinical course whereas a potential association with HCV was not investigated. The new antiviral direct agents (DAAs) against HCV are effective and curative in the majority of HCV infections. We report the first case, to our knowledge, of DHL and HCV-infection successfully treated by new DAAs. According to our experience, a DHL must be suspected in case of HCV-related lymphoma, and an early diagnosis could direct towards a different hematological management because a worse prognosis might be expected. A possible effect of DAAs on DHL regression should be investigated, but eradicating HCV would avoid life-threatening reactivation of viral hepatitis during pharmacological immunosuppression in onco-haematological diseases. PMID:27803769

  17. Hepatitis C and double-hit B cell lymphoma successfully treated by antiviral therapy.

    PubMed

    Galati, Giovanni; Rampa, Lorenzo; Vespasiani-Gentilucci, Umberto; Marino, Mirella; Pisani, Francesco; Cota, Carlo; Guidi, Alessandro; Picardi, Antonio

    2016-10-18

    B cells lymphoma is one of the most challenging extra-hepatic manifestations of hepatitis C virus (HCV). Recently, a new kind of B-cell lymphoma, named double-hit B (DHL), was characterized with an aggressive clinical course whereas a potential association with HCV was not investigated. The new antiviral direct agents (DAAs) against HCV are effective and curative in the majority of HCV infections. We report the first case, to our knowledge, of DHL and HCV-infection successfully treated by new DAAs. According to our experience, a DHL must be suspected in case of HCV-related lymphoma, and an early diagnosis could direct towards a different hematological management because a worse prognosis might be expected. A possible effect of DAAs on DHL regression should be investigated, but eradicating HCV would avoid life-threatening reactivation of viral hepatitis during pharmacological immunosuppression in onco-haematological diseases.

  18. A double hit model for the distribution of time to AIDS onset

    NASA Astrophysics Data System (ADS)

    Chillale, Nagaraja Rao

    2013-09-01

    Incubation time is a key epidemiologic descriptor of an infectious disease. In the case of HIV infection this is a random variable and is probably the longest one. The probability distribution of incubation time is the major determinant of the relation between the incidences of HIV infection and its manifestation to Aids. This is also one of the key factors used for accurate estimation of AIDS incidence in a region. The present article i) briefly reviews the work done, points out uncertainties in estimation of AIDS onset time and stresses the need for its precise estimation, ii) highlights some of the modelling features of onset distribution including immune failure mechanism, and iii) proposes a 'Double Hit' model for the distribution of time to AIDS onset in the cases of (a) independent and (b) dependent time variables of the two markers and examined the applicability of a few standard probability models.

  19. Double-hit lymphoma at second relapse of Burkitt-like lymphoma: a case report.

    PubMed

    Tanaka, Hiroaki; Hashimoto, Shinichiro; Abe, Daijiro; Sakai, Shio; Takagi, Toshiyuki

    2011-01-01

    Double-hit lymphoma (DHL) is a rare and extremely unfavorable type of lymphoma with concurrent chromosomal translocations of BCL2 and MYC. It is considered that BCL2 translocation precedes MYC events in lymphomagenesis of DHL. In fact, most cases of DHL arise de novo or following FL. We describe a very rare case of DHL arising from Burkitt-like lymphoma according to the revised European-American classification of lymphoid neoplasms. A 67-year-old Japanese male presented with persistent fever. [(18)F]-fluorodeoxyglucose positron emission tomography revealed multiple abnormal accumulations in the bone marrow, pancreas, and periphery of the left kidney. The patient was diagnosed with Burkitt-like lymphoma according to a bone marrow biopsy. At the disease onset and the first relapse, chemotherapy was effective and the patient experienced sustained and complete remission. At the second relapse, however, the clinical presentation and morphology of lymphoma cells were nearly identical, but a high level of chemoresistance was acquired, and the patient succumbed almost 1 month after hospitalization. Chromosomal analyses revealed a complex karyotype with concurrent t(14;18) and t(8;22) translocations, which have not been previously detected. It is therefore important to note that DHL cannot be diagnosed without chromosomal analysis. Cytogenetic analyses should thus be performed for patients with high-grade B-cell lymphoma and who experience a recurrence of this lymphoma.

  20. MYC/BCL2 double-hit high-grade B-cell lymphoma.

    PubMed

    Li, Shaoying; Lin, Pei; Young, Ken H; Kanagal-Shamanna, Rashmi; Yin, C Cameron; Medeiros, L Jeffrey

    2013-09-01

    Double-hit lymphoma (DHL) has been defined by others as a B-cell lymphoma with MYC/8q24 rearrangement in combination with a translocation involving another gene, such as BCL2, BCL3, or BCL6. The most common form of DHL has translocations involving MYC and BCL2, also known as MYC/BCL2 DHL. In recent years, a number of case series of MYC/BCL2 DHL have been published. Most cases of MYC/BCL2 DHL morphologically resemble diffuse large B-cell lymphoma (DLBCL) or B-cell lymphoma, unclassifiable, with features intermediate between DLBCL and Burkitt lymphoma. These tumors are of B-cell lineage, have a germinal center B-cell immunophenotype with a high proliferation rate, and a complex karyotype. Patients with these tumors have an aggressive clinical course and poor prognosis despite high-intensity chemotherapy. More recently, studies have suggested expanding the spectrum of MYC/BCL2 DHL to include cases that have concurrent MYC and BCL2 cytogenetic abnormalities, but not necessarily translocations. In addition, overexpression of MYC and BCL2 has been shown in an appreciable subset of DLBCL tumors. These tumors show overlap with MYC/BCL2 DHL, but are not equivalent. In this review, we discuss the clinicopathologic, immunophenotypic, cytogenetic, and prognostic features of MYC/BCL2 DHL.

  1. ID3 mutations are recurrent events in double-hit B-cell lymphomas.

    PubMed

    Gebauer, Niklas; Bernard, Veronica; Feller, Alfred C; Merz, Hartmut

    2013-11-01

    Double-hit lymphomas (DHL) with chromosomal rearrangements affecting the avian myelocytomatosis viral oncogene homolog (cMYC) and either the B-cell lymphoma-2 (BCL2) or -6 (BCL6) locus are uncommon neoplasms with an aggressive clinical course and dismal prognosis. Most cases exhibit a phenotype intermediate between diffuse large B-cell lymphoma (DLBCL) and Burkitt lymphoma. Recently mutations affecting the inhibitor of DNA binding 3 (ID3), a helix-loop-helix protein regulating cell cycle progression and B-cell differentiation, were identified as being molecular hallmarks in Burkitt lymphoma, with only rare mutations being found in other lymphomas with translocations affecting cMYC. In the present study, we evaluated the mutational status of ID3 in 37 cases of DHL and 16 cases of sporadic Burkitt lymphoma in order to identify a possible association of this new found hallmark with the rare and insufficiently-defined entity of DHL, seeking to broaden the understanding of these lymphomas at a molecular level. We identified ID3 mutations in lymphomas with chromosomal aberrations at cMYC and either BCL2 or BCL6 at a frequency intermediate between that of DLBCL and Burkitt lymphoma, hinting at a common pathway in lymphomagenesis for a subset of patients with DHL. The results of this study assist in the molecular characterization of these highly aggressive lymphomas, potentially giving rise to novel therapeutic approaches.

  2. Low incidence of MYC/BCL2 double-hit in Burkitt lymphoma.

    PubMed

    Yoshida, Maki; Ichikawa, Ayako; Miyoshi, Hiroaki; Kiyasu, Junichi; Kimura, Yoshizo; Niino, Daisuke; Ohshima, Koichi

    2015-09-01

    Translocations involving MYC are highly characteristic for Burkitt lymphoma (BL). BCL2 expression has also been found previously in about 10 to 20% of BL cases, and BCL2 translocation is a major mechanism for the deregulation of BCL2 expression in non-Hodgkin lymphomas. However, we know little about the incidence of MYC/BCL2 double-hit (DH) in BL. We examined BL cases to determine how frequently they contained BCL2 translocations in combination with MYC translocations using fluorescence in situ hybridization. We also determined the effect of BCL2 expression on clinical outcomes of BL. BCL2 translocations were detected in 3.5% (2/57 cases) of the cases, and BCL2 expression was detected in 33%. Two cases with BCL2 translocation also showed BCL2 expression. The incidence of BCL2 expression was significantly higher in patients 16 years of age and older (46%) than in patients under 16 years of age (6%). Among patients 16 years of age and older, we did not detect significant differences in overall survival with respect to BCL2 expression status. In conclusion, BCL2 translocation is a rare cytogenetic abnormality in BL, and BL probably accounts for only a small fraction of MYC/BCL2 DH lymphomas. BCL2 expression in BL is probably not associated with BCL2 translocations.

  3. Concurrent inhibition of MYC and BCL2 is a potentially effective treatment strategy for double hit and triple hit B-cell lymphomas.

    PubMed

    Cinar, Munevver; Rosenfelt, Fred; Rokhsar, Sepehr; Lopategui, Jean; Pillai, Raju; Cervania, Melissa; Pao, Andy; Cinar, Bekir; Alkan, Serhan

    2015-07-01

    Double hit lymphoma or triple hit lymphoma (DHL/THL) is a rare form of aggressive B-Cell Lymphoma. Overexpression of MYC, BCL2 or/and BCL6 due to genomic rearrangements are the key molecular features of DHL/THL. Patients with DHL/THL show very aggressive disease course and poor survival due to the lack of effective treatment modalities. Here, we established new THL cell model and assessed its in vitro growth characteristics along with the DHL cell line in response to potent MYC inhibitors, 10058-F4 and JQ-1, and a BCL2 inhibitor, ABT-199, with or without chemotherapeutic agent vincristine or doxorubicin. We found that 10058-F4, JQ-1 or ABT-199 exposure as a single agent inhibited the growth of DHL/THL cells in a dose-dependent manner. Combined exposure of 10058-F4 or JQ-1 and ABT-199 as well as vincristine or doxorubicin markedly suppressed the growth of DHL/THL cells compared with the single treatment. As assessed by multiple approaches, apoptosis induced by ABT-199, 10058-F4 or JQ-1 was underlying cause of the observed growth suppression. These findings suggest that co-inhibition of MYC and BCL2 signaling is a promising therapeutic strategy for patients with DHL/THL lymphomas. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. A double hit implicates DIAPH3 as an autism risk gene.

    PubMed

    Vorstman, J A S; van Daalen, E; Jalali, G R; Schmidt, E R E; Pasterkamp, R J; de Jonge, M; Hennekam, E A M; Janson, E; Staal, W G; van der Zwaag, B; Burbach, J P H; Kahn, R S; Emanuel, B S; van Engeland, H; Ophoff, R A

    2011-04-01

    Recent studies have shown that more than 10% of autism cases are caused by de novo structural genomic rearrangements. Given that some heritable copy number variants (CNVs) have been observed in patients as well as in healthy controls, to date little attention has been paid to the potential function of these non-de novo CNVs in causing autism. A normally intelligent patient with autism, with non-affected parents, was identified with a maternally inherited 10 Mb deletion at 13q21.2. Sequencing of the genes within the deletion identified a paternally inherited nonsynonymous amino-acid substitution at position 614 of diaphanous homolog 3 (DIAPH3) (proline to threonine; Pro614Thr). This variant, present in a highly conserved domain, was not found in 328 healthy subjects. Experiments showed a transient expression of Diaph3 in the developing murine cerebral cortex, indicating it has a function in brain development. Transfection of Pro614Thr in murine fibroblasts showed a significant reduction in the number of induced filopodia in comparison to the wild-type gene. DIAPH3 is involved in cell migration, axon guidance and neuritogenesis, and is suggested to function downstream of SHANK3. Our findings strongly suggest DIAPH3 as a novel autism susceptibility gene. Moreover, this report of a 'double-hit' compound heterozygote for a large, maternally inherited, genomic deletion and a paternally inherited rare missense mutation shows that not only de novo genomic variants in patients should be taken seriously in further study but that inherited CNVs may also provide valuable information.

  5. Middle age exacerbates acute respiratory distress syndrome in a double hit murine model.

    PubMed

    Voiriot, Guillaume; Contou, Damien; Tran Van Nhieu, Jeanne; Amsellem, Valerie; Marcos, Elisabeth; Latiri, Mehdi; Adnot, Serge; Maitre, Bernard; Mekontso Dessap, Armand

    2017-10-01

    In a recent systematic review, aging has been identified as the only factor independently associated with mortality during human acute respiratory distress syndrome (ARDS). We explored this age-dependent severity in a clinically relevant double hit murine ARDS model. Young adult (Y, 10-12weeks) and middle-old (O, 12-13months) male C57BL6 mice underwent an aspiration of Escherichia coli lipopolysaccharide (LPS) or control saline vehicle. Twenty hours later, four groups of mice were sacrificed [Y(control), O(control), Y(LPS) and O(LPS)]. Four other groups of mice underwent 3h of low tidal volume (8mL/kg) mechanical ventilation (MV) [Y(MV), O(MV), Y(LPS+MV) and O(LPS+MV)]. Lung mechanics were assessed hourly during MV. Right ventricular pressure and cardiac output were measured at the end of the MV. After sacrifice, lung inflammation, edema and injury were explored with bronchoalveolar lavage (BAL) and histology. After saline aspiration, middle-old mice had a higher respiratory system compliance than young adult mice. LPS aspiration dramatically altered the baseline compliance in middle-old (O(LPS)), but not in young adult (Y(LPS)) mice. Middle-old mice had a more pronounced alteration in lungs mechanics during MV as compared to young adult mice. Lung inflammation (as assessed by the total cell count, IL-6, TNFα and MIP-2 concentrations in BAL fluid), systemic inflammation (as assessed by plasma IL-6 concentration) and alveolocapillary leak (as assessed by the total protein concentration of BAL fluid) were higher in O(LPS) and O(LPS+MV) mice as compared to Y(LPS) and Y(LPS+MV) mice, respectively. The combination of LPS+MV induced a higher lung injury as compared to LPS alone in middle-old mice but not in young adult mice. Hemodynamics (systemic blood pressure, cardiac output and pulmonary vascular resistances) were similar between Y(MV) and O(MV) on the one hand and between Y(LPS+MV) and O(LPS+MV) on the other hand. Middle-old mice were more susceptible to both LPS

  6. Relapsed or Refractory Double-Expressor and Double-Hit Lymphomas Have Inferior Progression-Free Survival After Autologous Stem-Cell Transplantation.

    PubMed

    Herrera, Alex F; Mei, Matthew; Low, Lawrence; Kim, Haesook T; Griffin, Gabriel K; Song, Joo Y; Merryman, Reid W; Bedell, Victoria; Pak, Christine; Sun, Heather; Paris, Tanya; Stiller, Tracey; Brown, Jennifer R; Budde, Lihua E; Chan, Wing C; Chen, Robert; Davids, Matthew S; Freedman, Arnold S; Fisher, David C; Jacobsen, Eric D; Jacobson, Caron A; LaCasce, Ann S; Murata-Collins, Joyce; Nademanee, Auayporn P; Palmer, Joycelynne M; Pihan, German A; Pillai, Raju; Popplewell, Leslie; Siddiqi, Tanya; Sohani, Aliyah R; Zain, Jasmine; Rosen, Steven T; Kwak, Larry W; Weinstock, David M; Forman, Stephen J; Weisenburger, Dennis D; Kim, Young; Rodig, Scott J; Krishnan, Amrita; Armand, Philippe

    2017-01-01

    Purpose Double-hit lymphomas (DHLs) and double-expressor lymphomas (DELs) are subtypes of diffuse large B-cell lymphoma (DLBCL) associated with poor outcomes after standard chemoimmunotherapy. Data are limited regarding outcomes of patients with relapsed or refractory (rel/ref) DEL or DHL who undergo autologous stem-cell transplantation (ASCT). We retrospectively studied the prognostic impact of DEL and DHL status on ASCT outcomes in patients with rel/ref DLBCL. Methods Patients with chemotherapy-sensitive rel/ref DLBCL who underwent ASCT at two institutions and in whom archival tumor material was available were enrolled. Immunohistochemistry for MYC, BCL2, and BCL6 and fluorescence in situ hybridization (FISH) for MYC were performed. In cases with MYC rearrangement or copy gain, FISH for BCL2 and BCL6 was also performed. Results A total of 117 patients were included; 44% had DEL and 10% had DHL. DEL and DHL were associated with inferior progression-free survival (PFS), and DHL was associated with poorer overall survival (OS). The 4-year PFS in patients with DEL compared with those with non-DEL was 48% versus 59% ( P = .049), and the 4-year OS was 56% versus 67% ( P = .10); 4-year PFS in patients with DHL compared with those with non-DHL was 28% versus 57% ( P = .013), and 4-year OS was 25% versus 61% ( P = .002). The few patients with concurrent DEL and DHL had a poor outcome (4-year PFS, 0%). In multivariable models, DEL and DHL were independently associated with inferior PFS, whereas DHL and partial response ( v complete response) at transplant were associated with inferior OS. Conclusion DEL and DHL are both associated with inferior outcomes after ASCT in patients with rel/ref DLBCL. Although ASCT remains a potentially curative approach, these patients, particularly those with DHL, are a high-risk subset who should be targeted for investigational strategies other than standard ASCT.

  7. Relapsed or Refractory Double-Expressor and Double-Hit Lymphomas Have Inferior Progression-Free Survival After Autologous Stem-Cell Transplantation

    PubMed Central

    Herrera, Alex F.; Mei, Matthew; Low, Lawrence; Kim, Haesook T.; Griffin, Gabriel K.; Song, Joo Y.; Merryman, Reid W.; Bedell, Victoria; Pak, Christine; Sun, Heather; Paris, Tanya; Stiller, Tracey; Brown, Jennifer R.; Budde, Lihua E.; Chan, Wing C.; Chen, Robert; Davids, Matthew S.; Freedman, Arnold S.; Fisher, David C.; Jacobsen, Eric D.; Jacobson, Caron A.; LaCasce, Ann S.; Murata-Collins, Joyce; Nademanee, Auayporn P.; Palmer, Joycelynne M.; Pihan, German A.; Pillai, Raju; Popplewell, Leslie; Siddiqi, Tanya; Sohani, Aliyah R.; Zain, Jasmine; Rosen, Steven T.; Kwak, Larry W.; Weinstock, David M.; Forman, Stephen J.; Weisenburger, Dennis D.; Kim, Young; Rodig, Scott J.; Krishnan, Amrita

    2017-01-01

    Purpose Double-hit lymphomas (DHLs) and double-expressor lymphomas (DELs) are subtypes of diffuse large B-cell lymphoma (DLBCL) associated with poor outcomes after standard chemoimmunotherapy. Data are limited regarding outcomes of patients with relapsed or refractory (rel/ref) DEL or DHL who undergo autologous stem-cell transplantation (ASCT). We retrospectively studied the prognostic impact of DEL and DHL status on ASCT outcomes in patients with rel/ref DLBCL. Methods Patients with chemotherapy-sensitive rel/ref DLBCL who underwent ASCT at two institutions and in whom archival tumor material was available were enrolled. Immunohistochemistry for MYC, BCL2, and BCL6 and fluorescence in situ hybridization (FISH) for MYC were performed. In cases with MYC rearrangement or copy gain, FISH for BCL2 and BCL6 was also performed. Results A total of 117 patients were included; 44% had DEL and 10% had DHL. DEL and DHL were associated with inferior progression-free survival (PFS), and DHL was associated with poorer overall survival (OS). The 4-year PFS in patients with DEL compared with those with non-DEL was 48% versus 59% (P = .049), and the 4-year OS was 56% versus 67% (P = .10); 4-year PFS in patients with DHL compared with those with non-DHL was 28% versus 57% (P = .013), and 4-year OS was 25% versus 61% (P = .002). The few patients with concurrent DEL and DHL had a poor outcome (4-year PFS, 0%). In multivariable models, DEL and DHL were independently associated with inferior PFS, whereas DHL and partial response (v complete response) at transplant were associated with inferior OS. Conclusion DEL and DHL are both associated with inferior outcomes after ASCT in patients with rel/ref DLBCL. Although ASCT remains a potentially curative approach, these patients, particularly those with DHL, are a high-risk subset who should be targeted for investigational strategies other than standard ASCT. PMID:28034071

  8. ABC, GCB, and Double-Hit Diffuse Large B-Cell Lymphoma: Does Subtype Make a Difference in Therapy Selection?

    PubMed

    Nowakowski, Grzegorz S; Czuczman, Myron S

    2015-01-01

    Personalized therapy for the treatment of patients with cancer is rapidly approaching and is an achievable goal in the near future. A substantial number of novel targets have been developed into therapeutic agents. There is a substantial variability to antitumor activity by novel therapeutics because of the unique heterogeneity and biology that exists both between and within lymphoma subtypes. Diffuse large B-cell lymphoma (DLBCL) is the most common subtype of non-Hodgkin lymphoma (NHL). Approximately 40% of patients have refractory disease or disease that will relapse after an initial response, and the majority of patients with relapsed DLBCL will succumb to the disease. There are two major biologically distinct molecular subtypes of DLBCL: germinal center B-cell (GCB) and activated B-cell (ABC). ABC DLBCL is associated with substantially worse outcomes when treated with standard chemoimmunotherapy. In addition to GCB and ABC subtypes, double-hit lymphomas (approximately 5% to 10% of patients) and double-expressor lymphomas, which overexpress MYC and BCL2 protein, are aggressive DLBCLs and are also associated with a poor prognosis. Double-hit lymphomas have concurrent chromosomal rearrangements of MYC plus BCL2 (or less likely, BCL6). Advances in molecular characterization techniques and the development of novel agents targeting specific subtypes of DLBCL have provided a foundation for personalized therapy of DLBCL based on molecular subtype. A number of early clinical trials evaluating combinations of novel targeted agents with standard chemotherapy (R-CHOP) have been completed and have demonstrated the feasibility of this approach with encouraging efficacy. As such, molecular classification of DLBCL is not only important for prognostication, but moves to center stage for personalization of therapy for DLBCL.

  9. Double hit lymphoma - a case of unusual response after sequential aggressive chemotherapy and review of the literature.

    PubMed

    Cheema, Faisal N; Agloria, Maliha; Koshy, Nebu; Hildebrandt, Gerhard C

    2014-01-01

    Lymphomas with recurrent chromosomal breakpoints activating multiple oncogenes, including MYC, BCL2, and BCL6 are often referred to as "Dual Hit" or "Double Hit" lymphomas (DHL). In the updated classification for malignant lymphomas by the World Health Organization (WHO), the novel category of "B-cell lymphoma unclassifiable with features intermediate between diffuse large B-cell lymphoma (DLBCL) and Burkitt's lymphoma (BL)" was proposed in an attempt to create a (temporary) container for aggressive mature B-cell lymphomas that should not be diagnosed as either BL or DLBCL. DHL make up an important part of this novel WHO category, the other part representing heterogeneous cases of aggressive B-cell lymphoma that have features of BL. DHL are highly aggressive lymphomas with generally poor response to first line and salvage treatment. Limited data is available to guide therapeutic decisions, and despite aggressive measures including high dose (HD) chemotherapy followed by autologous hematopoietic cell transplantation (AHCT), outcome is unsatisfyingly poor. Herein, we report a case of a patient with DHL and review the relevant literature.

  10. Combining Computational Methods for Hit to Lead Optimization in Mycobacterium tuberculosis Drug Discovery

    PubMed Central

    Ekins, Sean; Freundlich, Joel S.; Hobrath, Judith V.; White, E. Lucile; Reynolds, Robert C

    2013-01-01

    Purpose Tuberculosis treatments need to be shorter and overcome drug resistance. Our previous large scale phenotypic high-throughput screening against Mycobacterium tuberculosis (Mtb) has identified 737 active compounds and thousands that are inactive. We have used this data for building computational models as an approach to minimize the number of compounds tested. Methods A cheminformatics clustering approach followed by Bayesian machine learning models (based on publicly available Mtb screening data) was used to illustrate that application of these models for screening set selections can enrich the hit rate. Results In order to explore chemical diversity around active cluster scaffolds of the dose-response hits obtained from our previous Mtb screens a set of 1924 commercially available molecules have been selected and evaluated for antitubercular activity and cytotoxicity using Vero, THP-1 and HepG2 cell lines with 4.3%, 4.2% and 2.7% hit rates, respectively. We demonstrate that models incorporating antitubercular and cytotoxicity data in Vero cells can significantly enrich the selection of non-toxic actives compared to random selection. Across all cell lines, the Molecular Libraries Small Molecule Repository (MLSMR) and cytotoxicity model identified ~10% of the hits in the top 1% screened (>10 fold enrichment). We also showed that seven out of nine Mtb active compounds from different academic published studies and eight out of eleven Mtb active compounds from a pharmaceutical screen (GSK) would have been identified by these Bayesian models. Conclusion Combining clustering and Bayesian models represents a useful strategy for compound prioritization and hit-to lead optimization of antitubercular agents. PMID:24132686

  11. Methods to identify, study and understand End-user participation in HIT development

    PubMed Central

    2011-01-01

    Background Experience has shown that for new health-information-technology (HIT) to be suc-cessful clinicians must obtain positive clinical benefits as a result of its implementation and joint-ownership of the decisions made during the development process. A prerequisite for achieving both success criteria is real end-user-participation. Experience has also shown that further research into developing improved methods to collect more detailed information on social groups participating in HIT development is needed in order to support, facilitate and improve real end-user participation. Methods A case study of an EHR planning-process in a Danish county from October 2003 until April 2006 was conducted using process-analysis. Three social groups (physicians, IT-professionals and administrators) were identified and studied in the local, present perspective. In order to understand the interactions between the three groups, the national, historic perspective was included through a literature-study. Data were collected through observations, interviews, insight gathered from documents and relevant literature. Results In the local, present perspective, the administrator's strategy for the EHR planning process meant that there was no clinical workload-reduction. This was seen as one of the main barriers to the physicians to achieving real influence. In the national, historic perspective, physicians and administrators have had/have different perceptions of the purpose of the patient record and they have both struggled to influence this definition. To date, the administrators have won the battle. This explains the conditions made available for the physicians' participation in this case, which led to their role being reduced to that of clinical consultants - rather than real participants. Conclusion In HIT-development the interests of and the balance of power between the different social groups involved are decisive in determining whether or not the end-users become real

  12. Impact of oncogene rearrangement patterns on outcomes in patients with double-hit non-Hodgkin lymphoma.

    PubMed

    Landsburg, Daniel J; Petrich, Adam M; Abramson, Jeremy S; Sohani, Aliyah R; Press, Oliver; Cassaday, Ryan; Chavez, Julio C; Song, Kevin; Zelenetz, Andrew D; Gandhi, Mitul; Shah, Namrata; Fenske, Timothy S; Jaso, Jesse; Medeiros, L Jeffrey; Yang, David T; Nabhan, Chadi

    2016-02-15

    Double-hit lymphomas (DHLs) are collectively defined as B-cell non-Hodgkin lymphomas harboring rearrangements of MYC as well as B-cell lymphoma 2 (BCL2) and/or B-cell lymphoma 6 (BCL6). To the authors' knowledge, the impact of specific oncogene rearrangements on outcomes of patients with DHL who are treated with immunochemotherapy has not been previously described. The authors identified patients whose diagnostic tissue specimens underwent metaphase karyotyping or fluorescence in situ hybridization for MYC as well as both BCL2 and BCL6 rearrangements. Cohorts were defined by the presence (+) or absence (-) of rearrangements: MYC+/BCL2+/BCL6- (BCL2-DHL), MYC+/BCL2-/BCL6+ (BCL6-DHL), and MYC+/BCL2+/BCL6+ (triple-hit lymphoma; THL). A total of 117 patients were included in the current analysis (76 BCL2-DHL patients, 16 BCL6-DHL patients, and 25 THL patients). Compared with patients with BCL2-DHL, those with BCL6-DHL were more likely to be classified as having a non-germinal center cell of origin, presented with extranodal disease, and appeared to achieve higher rates of complete response despite receiving intensive induction therapy less frequently. However, patients with BCL6-DHL experienced a shorter median overall survival if achieving an initial complete response compared with patients with BCL2-DHL. Patients with THL experienced survival outcomes similar to those of patients with BCL2-DHL. Recognition of the specific oncogene rearrangements may be of prognostic value and potentially guide future therapeutic strategies for patients with DHL. © 2015 American Cancer Society.

  13. One Question, Multiple Answers: Biochemical and Biophysical Screening Methods Retrieve Deviating Fragment Hit Lists.

    PubMed

    Schiebel, Johannes; Radeva, Nedyalka; Köster, Helene; Metz, Alexander; Krotzky, Timo; Kuhnert, Maren; Diederich, Wibke E; Heine, Andreas; Neumann, Lars; Atmanene, Cedric; Roecklin, Dominique; Vivat-Hannah, Valérie; Renaud, Jean-Paul; Meinecke, Robert; Schlinck, Nina; Sitte, Astrid; Popp, Franziska; Zeeb, Markus; Klebe, Gerhard

    2015-09-01

    Fragment-based lead discovery is gaining momentum in drug development. Typically, a hierarchical cascade of several screening techniques is consulted to identify fragment hits which are then analyzed by crystallography. Because crystal structures with bound fragments are essential for the subsequent hit-to-lead-to-drug optimization, the screening process should distinguish reliably between binders and non-binders. We therefore investigated whether different screening methods would reveal similar collections of putative binders. First we used a biochemical assay to identify fragments that bind to endothiapepsin, a surrogate for disease-relevant aspartic proteases. In a comprehensive screening approach, we then evaluated our 361-entry library by using a reporter-displacement assay, saturation-transfer difference NMR, native mass spectrometry, thermophoresis, and a thermal shift assay. While the combined results of these screening methods retrieve 10 of the 11 crystal structures originally predicted by the biochemical assay, the mutual overlap of individual hit lists is surprisingly low, highlighting that each technique operates on different biophysical principles and conditions.

  14. A novel finite element method based biomechanical model for HIT-Robot Assisted Orthopedic Surgery System.

    PubMed

    Jia, Zhiheng; Du, Zhijiang; Monan, Wang

    2006-01-01

    To build a biomechanical human model can make much sense for surgical training and surgical rehearse. Especially, it will be more meaningful to develop a biomechanical model to guide the control strategy for the medical robots in HIT-Robot Assisted Orthopedic Surgery System (HIT-RAOS). In this paper, based the successful work of others, a novel reliable finite element method based biomechanical model for HIT-RAOS was developed to simulate the force needed in reposition procedure. Geometrical model was obtained from 3D reconstruction from CT images of a just died man. Using this boundary information, the finite element model of the leg including part of femur, broken upper tibia, broken lower tibia, talus, calcaneus, Kirschner nail, muscles and other soft tissues was created in ANSYS. Furthermore, as it was too difficult to reconstruct the accurate geometry model from CT images, a new simplified muscle model was presented. The bony structures and tendons were defined as linearly elastic, while soft tissues and muscle fibers were assumed to be hyper elastic. To validate this model, the same dead man was involved to simulate the patient, and a set of data of the force needed to separate the two broken bones and the distance between them in reposition procedure was recorded. Then, another set of data was acquired from the finite element analysis. After comparison, the two sets of data matched well. The Finite Element model was proved to be acceptable.

  15. Novel Double-Hit Model of Radiation and Hyperoxia-Induced Oxidative Cell Damage Relevant to Space Travel

    PubMed Central

    Pietrofesa, Ralph A.; Velalopoulou, Anastasia; Lehman, Stacey L.; Arguiri, Evguenia; Solomides, Pantelis; Koch, Cameron J.; Mishra, Om P.; Koumenis, Constantinos; Goodwin, Thomas J.; Christofidou-Solomidou, Melpo

    2016-01-01

    Spaceflight occasionally requires multiple extravehicular activities (EVA) that potentially subject astronauts to repeated changes in ambient oxygen superimposed on those of space radiation exposure. We thus developed a novel in vitro model system to test lung cell damage following repeated exposure to radiation and hyperoxia. Non-tumorigenic murine alveolar type II epithelial cells (C10) were exposed to >95% O2 for 8 h only (O2), 0.25 Gy ionizing γ-radiation (IR) only, or a double-hit combination of both challenges (O2 + IR) followed by 16 h of normoxia (ambient air containing 21% O2 and 5% CO2) (1 cycle = 24 h, 2 cycles = 48 h). Cell survival, DNA damage, apoptosis, and indicators of oxidative stress were evaluated after 1 and 2 cycles of exposure. We observed a significant (p < 0.05) decrease in cell survival across all challenge conditions along with an increase in DNA damage, determined by Comet analysis and H2AX phosphorylation, and apoptosis, determined by Annexin-V staining, relative to cells unexposed to hyperoxia or radiation. DNA damage (GADD45α and cleaved-PARP), apoptotic (cleaved caspase-3 and BAX), and antioxidant (HO-1 and Nqo1) proteins were increased following radiation and hyperoxia exposure after 1 and 2 cycles of exposure. Importantly, exposure to combination challenge O2 + IR exacerbated cell death and DNA damage compared to individual exposures O2 or IR alone. Additionally levels of cell cycle proteins phospho-p53 and p21 were significantly increased, while levels of CDK1 and Cyclin B1 were decreased at both time points for all exposure groups. Similarly, proteins involved in cell cycle arrest was more profoundly changed with the combination challenges as compared to each stressor alone. These results correlate with a significant 4- to 6-fold increase in the ratio of cells in G2/G1 after 2 cycles of exposure to hyperoxic conditions. We have characterized a novel in vitro model of double-hit, low-level radiation and hyperoxia exposure that

  16. Novel Double-Hit Model of Radiation and Hyperoxia-Induced Oxidative Cell Damage Relevant to Space Travel.

    PubMed

    Pietrofesa, Ralph A; Velalopoulou, Anastasia; Lehman, Stacey L; Arguiri, Evguenia; Solomides, Pantelis; Koch, Cameron J; Mishra, Om P; Koumenis, Constantinos; Goodwin, Thomas J; Christofidou-Solomidou, Melpo

    2016-06-16

    Spaceflight occasionally requires multiple extravehicular activities (EVA) that potentially subject astronauts to repeated changes in ambient oxygen superimposed on those of space radiation exposure. We thus developed a novel in vitro model system to test lung cell damage following repeated exposure to radiation and hyperoxia. Non-tumorigenic murine alveolar type II epithelial cells (C10) were exposed to >95% O₂ for 8 h only (O₂), 0.25 Gy ionizing γ-radiation (IR) only, or a double-hit combination of both challenges (O₂ + IR) followed by 16 h of normoxia (ambient air containing 21% O₂ and 5% CO₂) (1 cycle = 24 h, 2 cycles = 48 h). Cell survival, DNA damage, apoptosis, and indicators of oxidative stress were evaluated after 1 and 2 cycles of exposure. We observed a significant (p < 0.05) decrease in cell survival across all challenge conditions along with an increase in DNA damage, determined by Comet analysis and H2AX phosphorylation, and apoptosis, determined by Annexin-V staining, relative to cells unexposed to hyperoxia or radiation. DNA damage (GADD45α and cleaved-PARP), apoptotic (cleaved caspase-3 and BAX), and antioxidant (HO-1 and Nqo1) proteins were increased following radiation and hyperoxia exposure after 1 and 2 cycles of exposure. Importantly, exposure to combination challenge O₂ + IR exacerbated cell death and DNA damage compared to individual exposures O₂ or IR alone. Additionally levels of cell cycle proteins phospho-p53 and p21 were significantly increased, while levels of CDK1 and Cyclin B1 were decreased at both time points for all exposure groups. Similarly, proteins involved in cell cycle arrest was more profoundly changed with the combination challenges as compared to each stressor alone. These results correlate with a significant 4- to 6-fold increase in the ratio of cells in G2/G1 after 2 cycles of exposure to hyperoxic conditions. We have characterized a novel in vitro model of double-hit, low-level radiation and hyperoxia

  17. A double hit implicates DIAPH3 as an autism risk gene

    PubMed Central

    Vorstman, JAS; van Daalen, E; Jalali, GR; Schmidt, ERE; Pasterkamp, RJ; de Jonge, M; Hennekam, EAM; Janson, E; Staal, WG; van der Zwaag, B; Burbach, JPH; Kahn, RS; Emanuel, BS; van Engeland, H; Ophoff, RA

    2012-01-01

    Recent studies have shown that more than 10% of autism cases are caused by de novo structural genomic rearrangements. Given that some heritable copy number variants (CNVs) have been observed in patients as well as in healthy controls, to date little attention has been paid to the potential function of these non-de novo CNVs in causing autism. A normally intelligent patient with autism, with non-affected parents, was identified with a maternally inherited 10 Mb deletion at 13q21.2. Sequencing of the genes within the deletion identified a paternally inherited nonsynonymous amino-acid substitution at position 614 of diaphanous homolog 3 (DIAPH3) (proline to threonine; Pro614Thr). This variant, present in a highly conserved domain, was not found in 328 healthy subjects. Experiments showed a transient expression of Diaph3 in the developing murine cerebral cortex, indicating it has a function in brain development. Transfection of Pro614Thr in murine fibroblasts showed a significant reduction in the number of induced filopodia in comparison to the wild-type gene. DIAPH3 is involved in cell migration, axon guidance and neuritogenesis, and is suggested to function downstream of SHANK3. Our findings strongly suggest DIAPH3 as a novel autism susceptibility gene. Moreover, this report of a ‘double-hit’ compound heterozygote for a large, maternally inherited, genomic deletion and a paternally inherited rare missense mutation shows that not only de novo genomic variants in patients should be taken seriously in further study but that inherited CNVs may also provide valuable information. PMID:20308993

  18. Refractory double-hit lymphoma/leukemia in childhood mimicking B-precursor acute lymphoblastic leukemia at initial presentation.

    PubMed

    Uemura, Suguru; Hasegawa, Daiichiro; Yokoi, Takehito; Nino, Nanako; Tahara, Teppei; Tamura, Akihiro; Saito, Atsuro; Kozaki, Aiko; Kishimoto, Kenji; Ishida, Toshiaki; Kawasaki, Keiichiro; Yamamoto, Nobuyuki; Mori, Takeshi; Nishimura, Noriyuki; Kosaka, Yoshiyuki

    A 10-year-old girl was referred to our hospital with left preauricular adenopathy and gingival swelling. She was diagnosed with B-cell precursor acute lymphoblastic leukemia (BCP-ALL) based on being positive for expressions of CD10, CD19, TdT and HLA-DR. She showed no CD20 expression at the time of diagnosis. Based on the initial diagnosis of BCP-ALL, induction chemotherapy for BCP-ALL was initiated. However, the blasts did not disappear from her peripheral blood. Bone marrow examination on day 33 identified 81.3% residual blasts with positive expressions of CD19, 20 and HLA-DR and negative CD10 and TdT expressions; these cells were morphologically and phenotypically different from those at the initial diagnosis. Based on cytogenetic studies, the final diagnosis was double-hit lymphoma/leukemia (DHL) with IgH-BCL2 and Igλ-MYC. Although dose intensive chemotherapy, including rituximab, led to complete remission, bone marrow and central nervous system relapse occurred. At relapse, blasts expressed CD10, CD19 and HLA-DR, but not CD20, findings the same as those at the onset. The patient died of the disease 44 days after cord blood transplantation with non-remission status. DHL in childhood is extremely rare and its prognosis is poor. The establishment of an effective treatment for DHL is highly anticipated.

  19. Impact of induction regimen and stem cell transplantation on outcomes in double-hit lymphoma: a multicenter retrospective analysis.

    PubMed

    Petrich, Adam M; Gandhi, Mitul; Jovanovic, Borko; Castillo, Jorge J; Rajguru, Saurabh; Yang, David T; Shah, Khushboo A; Whyman, Jeremy D; Lansigan, Frederick; Hernandez-Ilizaliturri, Francisco J; Lee, Lisa X; Barta, Stefan K; Melinamani, Shruthi; Karmali, Reem; Adeimy, Camille; Smith, Scott; Dalal, Neil; Nabhan, Chadi; Peace, David; Vose, Julie; Evens, Andrew M; Shah, Namrata; Fenske, Timothy S; Zelenetz, Andrew D; Landsburg, Daniel J; Howlett, Christina; Mato, Anthony; Jaglal, Michael; Chavez, Julio C; Tsai, Judy P; Reddy, Nishitha; Li, Shaoying; Handler, Caitlin; Flowers, Christopher R; Cohen, Jonathon B; Blum, Kristie A; Song, Kevin; Sun, Haowei Linda; Press, Oliver; Cassaday, Ryan; Jaso, Jesse; Medeiros, L Jeffrey; Sohani, Aliyah R; Abramson, Jeremy S

    2014-10-09

    Patients with double-hit lymphoma (DHL), which is characterized by rearrangements of MYC and either BCL2 or BCL6, face poor prognoses. We conducted a retrospective multicenter study of the impact of baseline clinical factors, induction therapy, and stem cell transplant (SCT) on the outcomes of 311 patients with previously untreated DHL. At median follow-up of 23 months, the median progression-free survival (PFS) and overall survival (OS) rates among all patients were 10.9 and 21.9 months, respectively. Forty percent of patients remain disease-free and 49% remain alive at 2 years. Intensive induction was associated with improved PFS, but not OS, and SCT was not associated with improved OS among patients achieving first complete remission (P = .14). By multivariate analysis, advanced stage, central nervous system involvement, leukocytosis, and LDH >3 times the upper limit of normal were associated with higher risk of death. Correcting for these, intensive induction was associated with improved OS. We developed a novel risk score for DHL, which divides patients into high-, intermediate-, and low-risk groups. In conclusion, a subset of DHL patients may be cured, and some patients may benefit from intensive induction. Further investigations into the roles of SCT and novel agents are needed. © 2014 by The American Society of Hematology.

  20. Flow cytometry is of limited utility in the early identification of "double-hit" B-cell lymphomas.

    PubMed

    Platt, Mia Y; DeLelys, Michelle E; Preffer, Frederic I; Sohani, Aliyah R

    2013-05-01

    B-cell lymphomas with concurrent translocations of MYC and BCL2 or BCL6, also known as "double-hit" lymphomas (DHL), are rare malignancies characterized by aggressive clinical behavior and poor prognosis. Previous reports suggest that decreased CD20 and/or CD19 expression by flow cytometry is relatively common in DHL and may help to identify cases requiring additional cytogenetic analysis. We conducted a retrospective analysis of 26 cases of DHL, and compared their flow cytometric characteristics to cases of Burkitt lymphoma (BL) and diffuse large B-cell lymphoma (DLBCL). Cases were analyzed by four-color flow cytometry, and bivariate dot-plots were reviewed for light scatter characteristics, CD19, CD20, CD45, and surface light chain. Relatively few DHL cases showed dim expression of CD19 or CD20, and statistically significant differences were found only in the frequency of dim CD19 expression between DHL and BL or DLBCL. Although concomitant dim CD19 and CD20 expression was exclusive to DHL, it was present in only a minority of cases. We conclude that although a subset of DHL expresses aberrant levels of CD19 and/or CD20 by flow cytometry, these findings are of limited utility in identifying cases requiring cytogenetic analysis due to their low frequency. Until more sensitive pathologic parameters can be identified and validated, the decision to perform cytogenetic analysis should rest on a combination of clinical, morphologic, and immunophenotypic features suggestive of high-grade, aggressive disease. Copyright © 2013 International Clinical Cytometry Society.

  1. B-cell lymphomas with concurrent MYC and BCL2 abnormalities other than translocations behave similarly to MYC/BCL2 double-hit lymphomas.

    PubMed

    Li, Shaoying; Seegmiller, Adam C; Lin, Pei; Wang, Xuan J; Miranda, Roberto N; Bhagavathi, Sharathkumar; Medeiros, L Jeffrey

    2015-02-01

    Large B-cell lymphomas with IGH@BCL2 and MYC rearrangement, known as double-hit lymphoma (DHL), are clinically aggressive neoplasms with a poor prognosis. Some large B-cell lymphomas have concurrent abnormalities of MYC and BCL2 other than coexistent translocations. Little is known about patients with these lymphomas designated here as atypical DHL. We studied 40 patients of atypical DHL including 21 men and 19 women, with a median age of 60 years. Nine (23%) patients had a history of B-cell non-Hodgkin lymphoma. There were 30 diffuse large B-cell lymphoma (DLBCL), 7 B-cell lymphoma, unclassifiable, with features intermediate between DLBCL and Burkitt lymphoma, and 3 DLBCL with coexistent follicular lymphoma. CD10, BCL2, and MYC were expressed in 28/39 (72%), 33/35 (94%), and 14/20 (70%) cases, respectively. Patients were treated with standard (n=14) or more aggressive chemotherapy regimens (n=17). We compared the atypical DHL group with 76 patients with DHLand 35 patients with DLBCL lacking MYC and BCL2 abnormalities. The clinicopathologic features and therapies were similar between patients with atypical and typical DHL. The overall survival of patients with atypical double-hit lymphoma was similar to that of patients with double-hit lymphoma (P=0.47) and significantly worse than that of patients with DLBCL with normal MYC and BCL2 (P=0.02). There were some minor differences. Cases of atypical double-hit lymphoma more often have DLBCL morphology (P<0.01), less frequently expressed CD10 (P<0.01), and patients less often had an elevated serum lactate dehydrogenase level (P=0.01). In aggregate, these results support expanding the category of MYC/BCL2 DHL to include large B-cell lymphomas with coexistent MYC and BCL2 abnormalities other than concurrent translocations.

  2. Two Methods for Efficient Solution of the Hitting-Set Problem

    NASA Technical Reports Server (NTRS)

    Vatan, Farrokh; Fijany, Amir

    2005-01-01

    A paper addresses much of the same subject matter as that of Fast Algorithms for Model-Based Diagnosis (NPO-30582), which appears elsewhere in this issue of NASA Tech Briefs. However, in the paper, the emphasis is more on the hitting-set problem (also known as the transversal problem), which is well known among experts in combinatorics. The authors primary interest in the hitting-set problem lies in its connection to the diagnosis problem: it is a theorem of model-based diagnosis that in the set-theory representation of the components of a system, the minimal diagnoses of a system are the minimal hitting sets of the system. In the paper, the hitting-set problem (and, hence, the diagnosis problem) is translated from a combinatorial to a computational problem by mapping it onto the Boolean satisfiability and integer- programming problems. The paper goes on to describe developments nearly identical to those summarized in the cited companion NASA Tech Briefs article, including the utilization of Boolean-satisfiability and integer- programming techniques to reduce the computation time and/or memory needed to solve the hitting-set problem.

  3. Comparison of Document Index Graph Using TextRank and HITS Weighting Method in Automatic Text Summarization

    NASA Astrophysics Data System (ADS)

    Hadyan, Fadhlil; Shaufiah; Arif Bijaksana, Moch.

    2017-01-01

    Automatic summarization is a system that can help someone to take the core information of a long text instantly. The system can help by summarizing text automatically. there’s Already many summarization systems that have been developed at this time but there are still many problems in those system. In this final task proposed summarization method using document index graph. This method utilizes the PageRank and HITS formula used to assess the web page, adapted to make an assessment of words in the sentences in a text document. The expected outcome of this final task is a system that can do summarization of a single document, by utilizing document index graph with TextRank and HITS to improve the quality of the summary results automatically.

  4. ABT-199, a BH3 mimetic that specifically targets Bcl-2, enhances the antitumor activity of chemotherapy, bortezomib and JQ1 in "double hit" lymphoma cells.

    PubMed

    Johnson-Farley, Nadine; Veliz, Jonny; Bhagavathi, S; Bertino, Joseph R

    2015-07-01

    Double hit lymphoma (DHL) is a recently recognized lymphoma with a survival of less than 2 years. Both ABT-737, a Bcl-2/Bcl-XL inhibitor, and ABT-199, which selectively targets Bcl-2, were potently cytotoxic against DHL cell lines Sc-1 and OcI-LY18, the RL cell line and primary human DHL cells, but not Ramos cells, which lack Bcl-2 expression. ABT-199 was more potent than ABT-737, and is the most promising of the BH3 mimetics to date. The DHL cell lines were also sensitive (< 200 nM) to doxorubicin, methotrexate, cytarabine and the proteosome inhibitor, bortezomib. The combination of chemotherapy with ABT-199 and doxorubicin or cytarabine, bortezomib, YM-155 and JQ1 produced synergistic cell kill against the DHL cell lines. Cells from a patient with DHL were also sensitive to JQ1 and bortezomib, providing a rationale for a clinical trial of these combinations in patients with relapsed DHL.

  5. In silico prediction of anti-malarial hit molecules based on machine learning methods.

    PubMed

    Kumari, Madhulata; Chandra, Subhash

    2015-01-01

    Machine learning techniques have been widely used in drug discovery and development in the areas of cheminformatics. Aspartyl aminopeptidase (M18AAP) of Plasmodium falciparum is crucial for survival of malaria parasite. We have created predictive models using weka and evaluated their performance based on various statistical parameters. Random Forest based model was found to be the most specificity (97.94%), with best accuracy (97.3%), MCC (0.306) as well as ROC (86.1%). The accuracy and MCC of these models indicated that they could be used to classify huge dataset of unknown compounds to predict their antimalarial compounds to develop effective drugs. Further, we deployed best predictive model on NCI diversity set IV. As result we found 59 bioactive anti-malarial molecules inhibiting M18AAP. Further, we obtained 18 non-toxic hit molecules out of 59 bioactive compounds. We suggest that such machine learning approaches could be applied to reduce the cost and length of time of drug discovery.

  6. TP53 mutations are frequent events in double-hit B-cell lymphomas with MYC and BCL2 but not MYC and BCL6 translocations.

    PubMed

    Gebauer, Niklas; Bernard, Veronica; Gebauer, Wolfgang; Thorns, Christoph; Feller, Alfred C; Merz, Hartmut

    2015-01-01

    Double-hit lymphomas (DHL) with MYC and either BCL2 or BCL6 rearrangements are rare neoplasms with an aggressive clinical presentation and grim prognosis. Moreover, molecular characterization of DHL remains insufficient, and especially the role of TP53 pathway disruption is unknown. We employed a next-generation sequencing approach to investigate the mutational status of TP53 in DHL and correlated genomic data with immunohistochemical reactivity for p53. We identified TP53 mutations in MYC+/BCL2+ lymphomas at a frequency intermediate between diffuse large B-cell lymphoma (DLBCL) and Burkitt lymphoma. Remarkably, TP53 mutations were particularly scarce in MYC+/BCL6+ lymphomas. Our findings indicate a significant difference between these two types of DHL at a molecular level with pathogenetic implications, as arguably, TP53 mutations inhibiting p53 mediated promotion of apoptosis pose a synergistic advantage in clonal evolution of cells with malignantly enforced overexpression of BCL2. Immunohistochemical staining appears to be a sensitive surrogate of TP53 mutation status with moderate specificity.

  7. Double- and triple-hit lymphomas can present with features suggestive of immaturity, including TdT expression, and create diagnostic challenges.

    PubMed

    Moench, Laura; Sachs, Zohar; Aasen, Garth; Dolan, Michelle; Dayton, Vanessa; Courville, Elizabeth L

    2016-11-01

    Double- and triple-hit lymphomas (DHL/THL) are aggressive B-cell neoplasms characterized by translocation of MYC with concurrent BCL2 and/or BCL6 translocation. In this retrospective study from one institution, we report clinicopathologic features of 13 cases (9 DHL/4 THL). The median age was 59 years (range 30-74) and patients included eight females and five males. Presentation included enlarging lymphadenopathy/masses (11 patients) and abnormal peripheral blood findings (2 patients). Features which raised the differential of an immature neoplasm included terminal deoxynucleotidyl transferase positivity (four cases, two THL/two DHL); dim CD45 expression (seven cases), lack of CD20 (two cases), or lack of surface immunoglobulin light chain (three cases) by flow cytometry; and blastoid morphology (two cases). We conclude that expression of TdT in a B-cell lymphoma with mature features or expression of surface light chain in a case otherwise suggestive of B-lymphoblastic leukemia/lymphoma should prompt an expedited evaluation for DHL/THL.

  8. T cells bearing anti-CD19 and/or anti-CD38 chimeric antigen receptors effectively abrogate primary double-hit lymphoma cells.

    PubMed

    Mihara, Keichiro; Yoshida, Tetsumi; Takei, Yoshifumi; Sasaki, Naomi; Takihara, Yoshihiro; Kuroda, Junya; Ichinohe, Tatsuo

    2017-06-08

    Patients with B cell lymphomas bearing MYC translocation combined with translocation involving other genes, such as BCL2, BCL3, or BCL6, defined as double-hit lymphoma (DHL), have a poor prognosis. Recent studies expanded the concept to include double-expressing lymphoma (DEL) that co-overexpresses MYC protein with either of those proteins. Accordingly, we defined cytogenetic DHL and DEL as primary DHL. An adoptive T cell immunotherapy with a chimeric antigen receptor (CAR) has been clinically shown to exhibit cytotoxicity in refractory neoplasias. We revealed the marked cytotoxicity of anti-CD19- and/or anti-CD38-CAR T cells against primary DHL cells from patients. CD19- and/or CD38-specific T cells were co-cultured with cytogenetic DHL (n = 3) or DEL (n = 2) cells from five patients for 3 days. We examined whether T cells retrovirally transduced with each vector showed cytotoxicity against DHL cells. Anti-CD19- and/or anti-CD38-CAR T cells were co-cultured with primary DHL cells at an E:T ratio of 1:2 for 3 days. Anti-CD19- and anti-CD38-CAR T cells completely abrogated these DHL cells, respectively. Anti-CD19-CAR T cells synergistically exerted collaborative cytotoxicity against these primary DHL cells with anti-CD38-CAR T cells. Therefore, refractory DHL cells can be efficiently abrogated by the clinical use of T cells with anti-CD19- and/or anti-CD38-CAR.

  9. Impact of normalization methods on high-throughput screening data with high hit rates and drug testing with dose-response data.

    PubMed

    Mpindi, John-Patrick; Swapnil, Potdar; Dmitrii, Bychkov; Jani, Saarela; Saeed, Khalid; Wennerberg, Krister; Aittokallio, Tero; Östling, Päivi; Kallioniemi, Olli

    2015-12-01

    Most data analysis tools for high-throughput screening (HTS) seek to uncover interesting hits for further analysis. They typically assume a low hit rate per plate. Hit rates can be dramatically higher in secondary screening, RNAi screening and in drug sensitivity testing using biologically active drugs. In particular, drug sensitivity testing on primary cells is often based on dose-response experiments, which pose a more stringent requirement for data quality and for intra- and inter-plate variation. Here, we compared common plate normalization and noise-reduction methods, including the B-score and the Loess a local polynomial fit method under high hit-rate scenarios of drug sensitivity testing. We generated simulated 384-well plate HTS datasets, each with 71 plates having a range of 20 (5%) to 160 (42%) hits per plate, with controls placed either at the edge of the plates or in a scattered configuration. We identified 20% (77/384) as the critical hit-rate after which the normalizations started to perform poorly. Results from real drug testing experiments supported this estimation. In particular, the B-score resulted in incorrect normalization of high hit-rate plates, leading to poor data quality, which could be attributed to its dependency on the median polish algorithm. We conclude that a combination of a scattered layout of controls per plate and normalization using a polynomial least squares fit method, such as Loess helps to reduce column, row and edge effects in HTS experiments with high hit-rates and is optimal for generating accurate dose-response curves. john.mpindi@helsinki.fi. Supplementary information: R code and Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

  10. A simple method for analyzing actives in random RNAi screens: introducing the “H Score” for hit nomination & gene prioritization

    PubMed Central

    Bhinder, Bhavneet; Djaballah, Hakim

    2013-01-01

    Due to the numerous challenges in hit identification from random RNAi screening, we have examined current practices with a discovery of a variety of methodologies employed and published in many reports; majority of them, unfortunately, do not address the minimum associated criteria for hit nomination, as this could potentially have been the cause or may well be the explanation as to the lack of confirmation and follow up studies, currently facing the RNAi field. Overall, we find that these criteria or parameters are not well defined, in most cases arbitrary in nature, and hence rendering it extremely difficult to judge the quality of and confidence in nominated hits across published studies. For this purpose, we have developed a simple method to score actives independent of assay readout; and provide, for the first time, a homogenous platform enabling cross-comparison of active gene lists resulting from different RNAi screening technologies. Here, we report on our recently developed method dedicated to RNAi data output analysis referred to as the BDA method applicable to both arrayed and pooled RNAi technologies; wherein the concerns pertaining to inconsistent hit nomination and off-target silencing in conjugation with minimal activity criteria to identify a high value target are addressed. In this report, a combined hit rate per gene, called “H score”, is introduced and defined. The H score provides a very useful tool for stringent active gene nomination, gene list comparison across multiple studies, prioritization of hits, and evaluation of the quality of the nominated gene hits. PMID:22934950

  11. Prognostic impact of history of follicular lymphoma, induction regimen and stem cell transplant in patients with MYC/BCL2 double hit lymphoma.

    PubMed

    Li, Shaoying; Saksena, Annapurna; Desai, Parth; Xu, Jie; Zuo, Zhuang; Lin, Pei; Tang, Guilin; Yin, C Cameron; Seegmiller, Adam; Jorgensen, Jeffrey L; Miranda, Roberto N; Reddy, Nishitha M; Bueso-Ramos, Carlos; Medeiros, L Jeffrey

    2016-06-21

    MYC/BCL2 double hit lymphoma (DHL) has been the subject of many studies; however, no study has systemically compared the clinicopathologic features and prognostic factors between patients with de novo disease versus those with a history of follicular lymphoma (FL). In addition, the prognostic importance of several other issues remains controversial in these patients. In this retrospective study, we assess 157 patients with MYC/BCL2 DHL including 108 patients with de novo disease and 49 patients with a history of FL or rarely other types of low-grade B-cell lymphoma. Patients received induction chemotherapy regimens including 61 R-CHOP, 31 R-EPOCH, 29 R-Hyper-CVAD, and 23 other regimens. Thirty-nine patients received a stem cell transplant (SCT) including 31 autologous and 8 allogeneic. Sixty-two patients achieved complete remission (CR) after induction chemotherapy. Median overall survival (OS) was 19 months. Clinicopathologic features were similar between patients with de novo tumors versus those with a history of FL (P > 0.05). Using multivariate analysis, achieving CR, undergoing SCT, stage and the International Prognostic Index were independent prognostic factors for OS. Stem cell transplantion was associated with improved OS in patients who failed to achieve CR, but not in patients who achieved CR after induction chemotherapy. In conclusion, patients with MYC/BCL2 DHL who present with de novo disease and patients with a history of FL have a similarly poor prognosis. Achievement of CR, regardless of the induction chemotherapy regimen used, is the most important independent prognostic factor. Patients who do not achieve CR after induction chemotherapy may benefit from SCT.

  12. Double-hit lymphomas: clinical, morphological, immunohistochemical and cytogenetic study in a series of Brazilian patients with high-grade non-Hodgkin lymphoma.

    PubMed

    Oliveira, Cristiano Claudino; Maciel-Guerra, Helena; Kucko, Luan; Hirama, Eric Jun; Brilhante, Américo Delgado; Quevedo, Francisco Carlos; da Cunha, Isabela Werneck; Soares, Fernando Augusto; Niero-Melo, Ligia; Dos Reis, Patrícia Pintor; Domingues, Maria Aparecida Custodio

    2017-01-07

    Double-hit lymphomas (DHL) are rare high-grade neoplasms characterized by two translocations: one involving the gene MYC and another involving genes BCL2 or BCL6, whose diagnosis depends on cytogenetic examination. This research studied DHL and morphological and/or immunophenotypic factors associated with the detection of these translocations in a group of high-grade non-Hodgkin lymphoma cases. Clinical and morphological reviews of 120 cases diagnosed with diffuse large B-cell lymphoma and Burkitt lymphoma were conducted. Immunohistochemistry (CD20, CD79a, PAX5, CD10, Bcl6, Bcl2, MUM1, TDT and Myc) and fluorescence in situ hybridization for detection of MYC, BCL2 and BCL6 gene translocations were performed in a tissue microarray platform. Three cases of DHL were detected: two with translocations of MYC and BCL2 and one with translocations of MYC and BCL6, all leading to death in less than six months. Among 90 cytogenetically evaluable biopsies, associations were determined between immunohistochemistry and fluorescence in situ hybridization for MYC (p = 0.036) and BCL2 (p = 0.001). However, these showed only regular agreement, indicated by Kappa values of 0.23 [0.0;0.49] and 0.35 [0.13;0.56], respectively. "Starry sky" morphology was strongly associated with MYC positivity (p = 0.01). The detection of three cases of DHL, all resulting in death, confirms the rarity and aggressiveness of this neoplasm. The "starry sky" morphological pattern and immunohistochemical expression of Myc and Bcl2 represent possible selection factors for additional cytogenetic diagnostic testing.

  13. Inflammatory and apoptotic alterations in serum and injured tissue after experimental polytrauma in mice: distinct early response compared with single trauma or "double-hit" injury.

    PubMed

    Weckbach, Sebastian; Hohmann, Christoph; Braumueller, Sonja; Denk, Stephanie; Klohs, Bettina; Stahel, Philip F; Gebhard, Florian; Huber-Lang, Markus S; Perl, Mario

    2013-02-01

    The exact alterations of the immune system after polytrauma leading to sepsis and multiple-organ failure are poorly understood. Thus, the early local and systemic inflammatory and apoptotic response was characterized in a new polytrauma model and compared with the alterations seen after single or combined injuries. Anesthetized C57BL/6 mice were subjected to either blunt bilateral chest trauma (Tx), closed head injury, right femur fracture including contralateral soft tissue injury, or a combination of injuries (PTx). After 2 hours or 6 hours, animals were sacrificed, and the systemic as well as the local pulmonary immune response (bronchoalveolar lavage [BAL]/plasma cytokines, lung myeloperoxidase [MPO] activity, and alveolocapillary barrier dysfunction) were evaluated along with lung/brain apoptosis (lung caspase 3 Western blotting, immunohistochemistry, and polymorphonuclear leukocytes [PMN] Annexin V). Hemoglobin, PO2 saturation, and pH did not differ between the experimental groups. Local BAL cytokines/chemokines were significantly increased in almost all groups, which included Tx. There was no further enhancement of this local inflammatory response in the lungs in case of PTx. At 2 hours, all groups except sham and closed head injury alone revealed an increased activity of lung MPO. However, 6 hours after injury, lung MPO remained increased only in the PTx group. Increased BAL protein levels were found, reflecting enhanced lung leakage in all groups with Tx 6 hours after trauma. Only after PTx was neutrophil apoptosis significantly decreased, whereas lung caspase 3 and plasma interleukin 6/keratinocyte chemoattractant (KC) were substantially increased. The combination of different injuries leads to an earlier systemic inflammatory response when compared with the single insults. Interestingly, only after PTx but not after single or double hits was lung apoptosis increased, and PMN apoptosis was decreased along with a prolonged presence of neutrophils in the

  14. A double-hit model of stress dysregulation in rats: implications for limbic corticosteroid receptors and anxious behavior under amitriptyline treatment.

    PubMed

    Cotella, Evelin M; Durando, Patricia E; Suárez, Marta M

    2014-05-01

    Adversity during early life can lead to diverging endocrine and behavioral responses to stress in adulthood. In our laboratory, we evaluated the long-term effects of early life adversity and its interaction with chronic stress during adulthood. We propose this as a model of vulnerability to dysregulation of the stress response. We hypothesized that rats subjected to both protocols would show differential expression of corticosteroid receptors measured as number of neurons immunoreactive for glucocorticoid receptors (GR) or mineralocorticoid receptors (MR), in limbic areas related to the control of anxiety-like behavior. We also evaluated the effect of amitriptyline expecting to prevent the outcomes of the model. Male Wistar rats were separated from the mother (MS) for 4.5 h every day for the first 3 weeks of life. From postnatal day 50, rats were subjected to chronic variable stress (CVS) during 24 d (five types of stressor at different times of day). During the stress protocol, the rats were administered amitriptyline (10 mg/kg i.p.) daily. MS evoked lower MR expression in the central amygdaloid nucleus and this was reversed by amitriptyline. Furthermore, CVS increased MR immunoreactivity in the hippocampal area CA2 and increased anxious behavior; both effects were prevented by the antidepressant. When MS was combined with CVS during adulthood, there was a reduction of locomotor activity, with no corrective effect of amitriptyline. The differential effects among groups could mean that MS would promote an alternative phenotype that is expressed when facing CVS (a double hit) later in life.

  15. Prognostic impact of history of follicular lymphoma, induction regimen and stem cell transplant in patients with MYC/BCL2 double hit lymphoma

    PubMed Central

    Li, Shaoying; Saksena, Annapurna; Desai, Parth; Xu, Jie; Zuo, Zhuang; Lin, Pei; Tang, Guilin; Yin, C. Cameron; Seegmiller, Adam; Jorgensen, Jeffrey L.; Miranda, Roberto N.; Reddy, Nishitha M; Bueso-Ramos, Carlos; Medeiros, L. Jeffrey

    2016-01-01

    MYC/BCL2 double hit lymphoma (DHL) has been the subject of many studies; however, no study has systemically compared the clinicopathologic features and prognostic factors between patients with de novo disease versus those with a history of follicular lymphoma (FL). In addition, the prognostic importance of several other issues remains controversial in these patients. In this retrospective study, we assess 157 patients with MYC/BCL2 DHL including 108 patients with de novo disease and 49 patients with a history of FL or rarely other types of low-grade B-cell lymphoma. Patients received induction chemotherapy regimens including 61 R-CHOP, 31 R-EPOCH, 29 R-Hyper-CVAD, and 23 other regimens. Thirty-nine patients received a stem cell transplant (SCT) including 31 autologous and 8 allogeneic. Sixty-two patients achieved complete remission (CR) after induction chemotherapy. Median overall survival (OS) was 19 months. Clinicopathologic features were similar between patients with de novo tumors versus those with a history of FL (P > 0.05). Using multivariate analysis, achieving CR, undergoing SCT, stage and the International Prognostic Index were independent prognostic factors for OS. Stem cell transplantion was associated with improved OS in patients who failed to achieve CR, but not in patients who achieved CR after induction chemotherapy. In conclusion, patients with MYC/BCL2 DHL who present with de novo disease and patients with a history of FL have a similarly poor prognosis. Achievement of CR, regardless of the induction chemotherapy regimen used, is the most important independent prognostic factor. Patients who do not achieve CR after induction chemotherapy may benefit from SCT. PMID:27203548

  16. Nedley Depression Hit Hypothesis

    PubMed Central

    Nedley, Neil; Ramirez, Francisco E.

    2014-01-01

    Depression is often diagnosed using the Diagnostic and Statistical Manual of Mental Disorders Fifth Edition (DSM-5) criteria. We propose how certain lifestyle choices and non-modifiable factors can predict the development of depression. We identified 10 cause categories (hits or “blows” to the brain) and theorize that four or more active hits could trigger a depression episode. Methods. A sample of 4271 participants from our community-based program (70% female; ages 17-94 years) was assessed at baseline and at the eighth week of the program using a custom test. Ten cause categories were examined as predictors of depression are (1) Genetic, (2)Developmental, (3)Lifestyle, (4)Circadian Rhythm, (5)Addiction, (6)Nutrition, (7)Toxic, (8)Social/Complicated Grief, (9)Medical Condition, and (10)Frontal Lobe. Results. The relationship between the DSM-5 score and a person having four hits categories in the first program week showed a sensitivity of 89.98 % (95% CI: 89.20 % - 90.73%), specificity 48.84% (CI 45.94-51.75) and Matthew Correlation Coefficient (MCC) .41 . For the eight-week test, the results showed a sensitivity 83.6% (CI 81.9-85.5), specificity 53.7% (CI 51.7-55.6) and MCC .38. Overall, the hits that improved the most from baseline after the eighth week were: Nutrition (47%), Frontal lobe (36%), Addiction (24%), Circadian rhythm (24%), Lifestyle (20%), Social (12%) and Medical (10%). Conclusions. The Nedley four-hit hypothesis seems to predict a depressive episode and correlates well with the DSM-5 criteria with good sensitivity and MCC but less specificity. Identifying these factors and applying lifestyle therapies could play an important role in the treatment of depressed individuals. PMID:27885322

  17. A simple two-step, 'hit and fix' method to generate subtle mutations in BACs using short denatured PCR fragments.

    PubMed

    Yang, Yongping; Sharan, Shyam K

    2003-08-01

    The bacteriophage lambda recombination system has proven to be a valuable tool for engineering bacterial artificial chromosomes (BAC). Due to its high efficiency, subtle alterations in the BACs can be generated using oligonucleotides as targeting vectors. Since no selection marker is used, recombinant clones are identified utilizing a selective PCR screening method. However, occasionally the selective PCR screening is not feasible. We describe here a two-step 'hit and fix' method that can be reliably used for generating any subtle alteration in BACs using short denatured PCR fragments as targeting vectors. In the first step of this method, 6-20 nucleotides are changed around the base where the mutation has to be generated. In the second step, these altered nucleotides are reverted to the original sequence and simultaneously a subtle alteration is introduced. Since in each step several nucleotides are changed, PCR primers specific for such alterations can be designed. This two-step method provides a simple and efficient tool for generating subtle alterations in BACs that can be very valuable for functional analysis of genes.

  18. A new method with flexible and balanced control of false negatives and false positives for hit selection in RNA interference high-throughput screening assays.

    PubMed

    Zhang, Xiaohua Douglas

    2007-08-01

    The z-score method and its variants for testing mean difference are commonly used for hit selection in high-throughput screening (HTS) assays. Strictly standardized mean difference (SSMD) offers a way to measure and classify the short interfering RNA (siRNA) effects. In this article, based on SSMD, the authors propose a new testing method for hit selection in RNA interference (RNAi) HTS assays. This SSMD-based method allows the differentiation between siRNAs with large and small effects on the assay output and maintains flexible and balanced control of both the false-negative rate, in which the siRNAs with strong effects are not selected as hits, and the restricted false-positive rate, in which the siRNAs with weak or no effects are selected as hits. This method directly addresses the size of siRNA effects represented by the strength of difference between an siRNA and a negative reference, whereas the classic z-score method and t-test of testing no mean difference address whether the mean of an siRNA is exactly the same as the mean of a negative reference. This method can readily control the false-negative rate, whereas it is nontrivial for the classic z-score method and t-test to control the false-negative rate. Therefore, theoretically, the SSMD-based method offers better control of the sizes of siRNA effects and the associated false-positive and false-negative rates than the commonly used z-score method and t-test for hit selection in HTS assays. The SSMD-based method should generally be applicable to any assay in which the end point is a difference in signal compared to a reference sample, including those for RNAi, receptor, enzyme, and cellular function.

  19. A new double views motion deblurring method

    NASA Astrophysics Data System (ADS)

    Hong, Hanyu; Hua, Xia; Zhang, Wenmo; Shi, Yu

    2015-12-01

    With improving of intelligent and automation in modern industrial production area, the detection and reconstruction of the 3D surface of the product has become an important technology, but the image which acquire on the actual production line has motion blur and this problem will affect the later reconstruction work. In order to solve this problem, a deblurring method which based on double view moving target image is proposed in this paper. We can deduce the relationship of the point spread function(PSF) path between the double view image through the epipolar geometry and the camera model. The experimental results show that deblurring with the PSF path solved by the geometric relationship achieves good results.

  20. Establishment and characterization of a novel MYC/BCL2 "double-hit" diffuse large B cell lymphoma cell line, RC.

    PubMed

    Pham, Lan V; Lu, Gary; Tamayo, Archito T; Chen, Juan; Challagundla, Pramoda; Jorgensen, Jeffrey L; Medeiros, L Jeffrey; Ford, Richard J

    2015-10-29

    Diffuse large B cell lymphoma (DLBCL) is the most common type of lymphoid malignancy worldwide. Approximately 5 % of cases of DLBCL are so-called double-hit lymphomas (DHL), defined by a chromosomal translocation or rearrangement involving MYC/8q24.2 in combination with another recurrent breakpoint, usually BCL2/18q21.3. Patients with MYC/BCL2 DHL are resistant to standard front-line therapy, and currently, there is no consensus for a therapeutic strategy to treat these patients. Lack of clinically relevant or validated human experimental DHL models of any type that would improve our understanding of the biologic basis of MYC/BCL2 DHL pathophysiology continues to hamper identification of valid therapeutic targets. We describe a unique MYC/BCL2 DHL cell line with morphologic features of DLBCL that we have established, designated as RC. We used tissue culture techniques to establish the RC cell line from primary DLBCL cells. We also utilized molecular and cellular biological techniques including flow cytometry, polymerase chain reaction (PCR), DNA fingerprinting, reverse-phase protein array, conventional cytogenetics, and fluorescence in situ hybridization (FISH) analysis to characterize the RC cell line. NSG-severe combined immunodeficiency (SCID) mice were utilized as a model for xeno-transplantation of RC cells. RC cells had the following immunophenotype: positive for CD10, CD19, CD20, CD22, CD38, CD43, CD44, and CD79b and negative for CD3, CD4, CD5, CD8, CD11c, CD14, CD30, CD56, and CD200, which was identical to the primary tumor cells. Conventional cytogenetic analysis showed a t(2;8)(p12;q24.2) and t(14;18)(q32;q21.3), corresponding to MYC and BCL2 gene rearrangements, respectively. DNA fingerprinting authenticated the RC cell line to be of the same clone as the primary tumor cells. In addition, RC cells were established in SCID mice as an in vivo model for translational therapeutics studies. Proteomic analysis showed activation of the mTOR signaling pathway

  1. [PSA doubling time and method of calculation].

    PubMed

    Ruffion, Alain; Rebillard, Xavier; Grima, François

    2005-12-01

    Prostate Specific Antigen (PSA) is currently the best marker for prostate cancer, although it is not very specific for this disease. The use of the PSA kinetic, in addition to its absolute value, is theoretically very attractive in a large number of clinical situations. Based on a review of the literature, the authors report the various methods used to study this kinetic, with particular emphasis on the most reliable method: the PSA doubling time. After describing the definitions and the methods used to calculate this parameter, the authors discuss the various clinical situations in which it could be useful: surveillance of prostatic tumours after the initial diagnosis in high-risk patients or patients refusing treatment, prognostic factor before curative treatment, evaluation of the efficacy of curative treatment, prognostic factor of tumour aggressiveness at the time of biochemical recurrence after curative treatment or during endocrine therapy.

  2. Immunohistochemical double-hit score is a strong predictor of outcome in patients with diffuse large B-cell lymphoma treated with rituximab plus cyclophosphamide, doxorubicin, vincristine, and prednisone.

    PubMed

    Green, Tina Marie; Young, Ken H; Visco, Carlo; Xu-Monette, Zijun Y; Orazi, Attilio; Go, Ronald S; Nielsen, Ole; Gadeberg, Ole V; Mourits-Andersen, Torben; Frederiksen, Mikael; Pedersen, Lars Møller; Møller, Michael Boe

    2012-10-01

    Approximately 5% of diffuse large B-cell lymphomas (DLBCLs) are double-hit lymphomas (DHLs) with translocations of both MYC and BCL2. DHLs are characterized by poor outcome. We tested whether DLBCLs with high expression of MYC protein and BCL2 protein share the clinical features and poor prognosis of DHLs. Paraffin-embedded lymphoma samples from 193 patients with de novo DLBCL who were uniformly treated with rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP) were studied using immunohistochemistry for MYC, BCL2, CD10, BCL6, and MUM1/interferon regulatory factor 4, and fluorescent in situ hybridization (FISH) for MYC and BCL2. FISH analysis identified DHL in 6% of patients, who showed the expected poor overall survival (OS; P = .002). On the basis of immunohistochemical MYC and BCL2 expression, a double-hit score (DHS) was assigned to all patients with DLBCL. The DHS-2 group, defined by high expression of both MYC and BCL2 protein, comprised 29% of the patients. DHS 2 was significantly associated with lower complete response rate (P = .004), shorter OS (P < .001), and shorter progression-free survival (PFS; P < .001). The highly significant correlation with OS and PFS was maintained in multivariate models that controlled for the International Prognostic Index and the cell-of-origin subtype (OS, P < .001; PFS, P < .001). DHS was validated in an independent cohort of 116 patients who were treated with R-CHOP. The immunohistochemical DHS defined a large subset of DLBCLs with double-hit biology and was strongly associated with poor outcome in patients treated with R-CHOP.

  3. Enhanced HTS hit selection via a local hit rate analysis.

    PubMed

    Posner, Bruce A; Xi, Hualin; Mills, James E J

    2009-10-01

    The postprocessing of high-throughput screening (HTS) results is complicated by the occurrence of false positives (inactive compounds misidentified as active by the primary screen) and false negatives (active compounds misidentified as inactive by the primary screen). An activity cutoff is frequently used to select "active" compounds from HTS data; however, this approach is insensitive to both false positives and false negatives. An alternative method that can minimize the occurrence of these artifacts will increase the efficiency of hit selection and therefore lead discovery. In this work, rather than merely using the activity of a given compound, we look at the presence and absence of activity among all compounds in its "chemical space neighborhood" to give a degree of confidence in its activity. We demonstrate that this local hit rate (LHR) analysis method outperforms hit selection based on ranking by primary screen activity values across ten diverse high throughput screens, spanning both cell-based and biochemical assay formats of varying biology and robustness. On average, the local hit rate analysis method was approximately 2.3-fold and approximately 1.3-fold more effective in identifying active compounds and active chemical series, respectively, than selection based on primary activity alone. Moreover, when applied to finding false negatives, this method was 2.3-fold better than ranking by primary activity alone. In most cases, novel hit series were identified that would have otherwise been missed. Additional uses of and observations regarding this HTS analysis approach are also discussed.

  4. HIT paradigms and paradoxes.

    PubMed

    Warkentin, T E

    2011-07-01

    The current major problem with HIT is its overdiagnosis. This concept follows from the HIT central paradigm: HIT is caused by a subset of antibodies against platelet factor 4 (PF4)/heparin complexes that have strong platelet-activating properties. Prospective studies show that only a minority of sera containing such antibodies exhibit platelet-activating properties. Ironically, the earliest tests for HIT--platelet activation assays--remain today the most diagnostically useful, particularly the washed platelet assays. But the wider application of PF4-dependent immunoassays, and their much greater sensitivity for the larger subset of non-platelet-activating (and non-HIT-inducing) antibodies, has resulted in HIT overdiagnosis in many centres. Studies of anti-PF4/heparin immunization in diverse clinical situations have provided insights into the factors that influence the HIT immune response. Besides the conundrum of anticoagulant-induced thrombosis (including its potentiation of coumarin-induced microthrombosis), HIT evinces numerous other paradoxes: (i) it is a platelet-activating disorder with venous thrombosis as its predominant clinical manifestation; (ii) 'delayed-onset' (or 'autoimmune') HIT can lead to dramatic worsening of HIT-associated thrombosis despite cessation of heparin; (iii) partial thromboplastin time (PTT) monitoring of direct thrombin inhibitor treatment - and confounding of PTT monitoring by HIT-associated consumptive coagulopathy - infers that the worst subset of HIT patients may fail this therapeutic approach; (iv) the highly sulfated pentasaccharide anticoagulant, fondaparinux, can (rarely) cause HIT yet appears to be an effective treatment for this disorder; and (v) the transience of the HIT immune response means that many patients with previous HIT can safely receive future heparin. © 2011 International Society on Thrombosis and Haemostasis.

  5. A liquid chromatography/mass spectrometry-based generic detection method for biochemical assay and hit discovery of histone methyltransferases.

    PubMed

    Li, Shu; Gu, X Justin; Hao, Qin; Fan, Hong; Li, Ling; Zhou, Shaolian; Zhao, Kehao; Chan, Ho Man; Wang, Y Karen

    2013-12-15

    Epigenetic modifications of the genome, such as DNA methylation and posttranslational modifications of histone proteins, contribute to gene regulation. Growing evidence suggests that histone methyltransferases are associated with the development of various human diseases, including cancer, and are promising drug targets. High-quality generic assays will facilitate drug discovery efforts in this area. In this article, we present a liquid chromatography/mass spectrometry (LC/MS)-based S-adenosyl homocysteine (SAH) detection assay for histone methyltransferases (HMTs) and its applications in HMT drug discovery, including analyzing the activity of newly produced enzymes, developing and optimizing assays, performing focused compound library screens and orthogonal assays for hit confirmations, selectivity profiling against a panel of HMTs, and studying mode of action of select hits. This LC/MS-based generic assay has become a critical platform for our methyltransferase drug discovery efforts.

  6. Primary Cutaneous Diffuse Large B-Cell Lymphoma With a MYC-IGH Rearrangement and Gain of BCL2: Expanding the Spectrum of MYC/BCL2 Double-Hit Lymphomas.

    PubMed

    Testo, Natalia; Olson, Luke C; Subramaniyam, Shivakumar; Hanson, Ty; Magro, Cynthia M

    2016-10-01

    Aggressive extracutaneous B-cell lymphomas span the various stages of B-cell ontogeny and include B-cell lymphoblastic lymphoma, Burkitt lymphoma, mantle cell lymphoma, and diffuse large B-cell lymphoma. Diffuse large B-cell lymphomas represent the most common histologic subtype of non-Hodgkin lymphomas, comprising 30% of adult non-Hodgkin lymphomas in the United States. A distinctive form of diffuse large B-cell lymphoma is the double-hit lymphoma, with most cases exhibiting a combined MYC and BCL2 rearrangement, leading some hematopathologists to propose the term MYC/BCL2 lymphoma. More recently, MYC rearrangement with multiple copies/gain of BCL2 or multiple copies/gain of MYC with a BCL2 rearrangement have been described and exhibit a very similar clinical course to conventional double-hit lymphomas. We report the seventh case of diffuse large B-cell lymphoma exhibiting this distinct cytogenetic abnormality and the first reported case in the skin. The patient's clinical course was aggressive, succumbing to disease 18 months after his initial presentation.

  7. Study report on a double isotope method of calcium absorption

    NASA Technical Reports Server (NTRS)

    1978-01-01

    Some of the pros and cons of three methods to study gastrointestinal calcium absorption are briefly discussed. The methods are: (1) a balance study; (2) a single isotope method; and (3) a double isotope method. A procedure for the double isotope method is also included.

  8. Computational Physics' Greatest Hits

    NASA Astrophysics Data System (ADS)

    Bug, Amy

    2011-03-01

    The digital computer, has worked its way so effectively into our profession that now, roughly 65 years after its invention, it is virtually impossible to find a field of experimental or theoretical physics unaided by computational innovation. It is tough to think of another device about which one can make that claim. In the session ``What is computational physics?'' speakers will distinguish computation within the field of computational physics from this ubiquitous importance across all subfields of physics. This talk will recap the invited session ``Great Advances...Past, Present and Future'' in which five dramatic areas of discovery (five of our ``greatest hits'') are chronicled: The physics of many-boson systems via Path Integral Monte Carlo, the thermodynamic behavior of a huge number of diverse systems via Monte Carlo Methods, the discovery of new pharmaceutical agents via molecular dynamics, predictive simulations of global climate change via detailed, cross-disciplinary earth system models, and an understanding of the formation of the first structures in our universe via galaxy formation simulations. The talk will also identify ``greatest hits'' in our field from the teaching and research perspectives of other members of DCOMP, including its Executive Committee.

  9. Φ-score: A cell-to-cell phenotypic scoring method for sensitive and selective hit discovery in cell-based assays

    PubMed Central

    Guyon, Laurent; Lajaunie, Christian; fer, Frédéric; bhajun, Ricky; sulpice, Eric; pinna, Guillaume; campalans, Anna; radicella, J. Pablo; rouillier, Philippe; mary, Mélissa; combe, Stéphanie; obeid, Patricia; vert, Jean-Philippe; gidrol, Xavier

    2015-01-01

    Phenotypic screening monitors phenotypic changes induced by perturbations, including those generated by drugs or RNA interference. Currently-used methods for scoring screen hits have proven to be problematic, particularly when applied to physiologically relevant conditions such as low cell numbers or inefficient transfection. Here, we describe the Φ-score, which is a novel scoring method for the identification of phenotypic modifiers or hits in cell-based screens. Φ-score performance was assessed with simulations, a validation experiment and its application to gene identification in a large-scale RNAi screen. Using robust statistics and a variance model, we demonstrated that the Φ-score showed better sensitivity, selectivity and reproducibility compared to classical approaches. The improved performance of the Φ-score paves the way for cell-based screening of primary cells, which are often difficult to obtain from patients in sufficient numbers. We also describe a dedicated merging procedure to pool scores from small interfering RNAs targeting the same gene so as to provide improved visualization and hit selection. PMID:26382112

  10. Method for double-sided processing of thin film transistors

    DOEpatents

    Yuan, Hao-Chih; Wang, Guogong; Eriksson, Mark A.; Evans, Paul G.; Lagally, Max G.; Ma, Zhenqiang

    2008-04-08

    This invention provides methods for fabricating thin film electronic devices with both front- and backside processing capabilities. Using these methods, high temperature processing steps may be carried out during both frontside and backside processing. The methods are well-suited for fabricating back-gate and double-gate field effect transistors, double-sided bipolar transistors and 3D integrated circuits.

  11. Recognition of Hits in a Target

    NASA Astrophysics Data System (ADS)

    Semerak, Vojtech; Drahansky, Martin

    This paper describes two possible ways of hit recognition in a target. First method is based on frame differencing with use of a stabilization algorithm to eliminate movements of a target. Second method uses flood fill with random seed point definition to find hits in the target scene.

  12. Diagnosis of 'double hit' diffuse large B-cell lymphoma and B-cell lymphoma, unclassifiable, with features intermediate between DLBCL and Burkitt lymphoma: when and how, FISH versus IHC.

    PubMed

    Swerdlow, Steven H

    2014-12-05

    Identification of large B-cell lymphomas that are "extra-aggressive" and may require therapy other than that used for diffuse large B-cell lymphoma, not otherwise specified (DLBCL, NOS), is of great interest. Large B-cell lymphomas with MYC plus BCL2 and/or BCL6 rearrangements, so-called 'double hit' (DHL) or 'triple hit' (THL) lymphomas, are one such group of cases often recognized using cytogenetic FISH studies. Whether features such as morphologic classification, BCL2 expression, or type of MYC translocation partner may mitigate the very adverse prognosis of DHL/THL is controversial. Classification of the DHL/THL is also controversial, with most either dividing them up between the DLBCL, NOS and B-cell lymphoma, unclassifiable, with features intermediate between DLBCL and Burkitt lymphoma (BCLU) categories or classifying at least the majority as BCLU. The BCLU category itself has many features that overlap those of DHL/THL. Currently, there is growing interest in the use of MYC and other immunohistochemistry either to help screen for DHL/THL or to identify "double-expressor" (DE) large B-cell lymphomas, defined in most studies as having ≥40% MYC+ and ≥50%-70% BCL2+ cells. DE large B-cell lymphomas are generally aggressive, although not as aggressive as DHL/THL, are more common than DHL/THL, and are more likely to have a nongerminal center phenotype. Whether single MYC rearrangements or MYC expression alone is of clinical importance is controversial. The field of the DHL/THL and DE large B-cell lymphomas is becoming more complex, with many issues left to resolve; however, great interest remains in identifying these cases while more is learned about them. © 2014 by The American Society of Hematology. All rights reserved.

  13. Two hits revisited again

    PubMed Central

    Tomlinson, I; Roylance, R; Houlston, R

    2001-01-01

    INTRODUCTION AND METHODS—Since the concept of the "two hit hypothesis" was introduced over 20 years ago, a wealth of genetic data has accumulated on the mutations found at tumour suppressor loci. Perhaps surprisingly, these data conceal large gaps in our knowledge which genetic and functional studies are beginning to uncover. The "two hit hypothesis" must be updated to take account of this new information.
RESULTS AND DISCUSSION—Here, we discuss both the results of recent studies and some of the questions that they highlight. In particular, how valid are conclusions from inherited Mendelian syndromes when applied to sporadic cancers? Why is allelic loss so common and how does it occur? Are the "two hits" random or interdependent? Is abolition of protein function always optimal for tumorigenesis? Can "third hits" occur and, if so, why? How can mismatch repair deficiency and the methylator phenotype be incorporated into the "two hit" hypothesis? We suggest that the "two hit hypothesis" is not fixed but is evolving as our knowledge expands.


Keywords: two hit model; tumour suppressor; carcinogenesis PMID:11158170

  14. Double-hit mantle cell lymphoma with MYC gene rearrangement or amplification: a report of four cases and review of the literature

    PubMed Central

    Setoodeh, Reza; Schwartz, Stuart; Papenhausen, Peter; Zhang, Ling; Sagatys, Elizabeth M; Moscinski, Lynn C; Shao, Haipeng

    2013-01-01

    Mature B-cell lymphomas with both BCL2 and MYC translocations are known as “double hit” lymphomas. These lymphomas are aggressive and show high proliferation rate due to the growth advantages provided by MYC and BCL2 translocation and overexpression. Mantle cell lymphoma (MCL) is a neoplasm of mature B-lymphocytes with characteristic t(11;14) and subsequent Cyclin D1 overexpression. Secondary cytogenetic changes are frequent in MCL, but MYC translocation has only been rarely reported. In this study, we report four cases of MCL with MYC translocation or MYC gene amplification detected by conventional cytogenetics, fluorescence in situ hybridization and whole genome single nucleotide polymorphism (SNP) array, and determined the clinicopathologic features. Our study provides further evidence supporting the concept of “double hit” MCL with co-involvement of MYC gene rearrangement and/or amplification and CCND1 gene rearrangement. PMID:23330001

  15. Method for limiting heat flux in double-wall tubes

    DOEpatents

    Hwang, Jaw-Yeu

    1982-01-01

    A method of limiting the heat flux in a portion of double-wall tubes including heat treating the tubes so that the walls separate when subjected to high heat flux and supplying an inert gas mixture to the gap at the interface of the double-wall tubes.

  16. Advanced Doubling Adding Method for Radiative Transfer in Planetary Atmospheres

    NASA Astrophysics Data System (ADS)

    Liu, Quanhua; Weng, Fuzhong

    2006-12-01

    The doubling adding method (DA) is one of the most accurate tools for detailed multiple-scattering calculations. The principle of the method goes back to the nineteenth century in a problem dealing with reflection and transmission by glass plates. Since then the doubling adding method has been widely used as a reference tool for other radiative transfer models. The method has never been used in operational applications owing to tremendous demand on computational resources from the model. This study derives an analytical expression replacing the most complicated thermal source terms in the doubling adding method. The new development is called the advanced doubling adding (ADA) method. Thanks also to the efficiency of matrix and vector manipulations in FORTRAN 90/95, the advanced doubling adding method is about 60 times faster than the doubling adding method. The radiance (i.e., forward) computation code of ADA is easily translated into tangent linear and adjoint codes for radiance gradient calculations. The simplicity in forward and Jacobian computation codes is very useful for operational applications and for the consistency between the forward and adjoint calculations in satellite data assimilation.

  17. A new method for the formulation of double nanoemulsions.

    PubMed

    Ding, Shukai; Anton, Nicolas; Akram, Salman; Er-Rafik, Meriem; Anton, Halina; Klymchenko, Andrey; Yu, Wei; Vandamme, Thierry F; Serra, Christophe A

    2017-02-22

    Double emulsions are very attractive systems for many reasons; the most important of these are their capacity to encapsulate hydrophilic and lipophilic molecules simultaneously in a single particle and their potentiality to protect fragile hydrophilic molecules from the continuous phase. Double emulsions represent a technology that is widely present down to the micrometer scale; however, double nanoemulsions, with their new potential applications as nanomedicines or diagnosis agents, currently present a significant challenge. In this study, we propose an original two-step approach for the fabrication of double nanoemulsions with a final size below 200 nm. The process consists of the formulation of a primary water-in-oil (w1/O) nanoemulsion by high-pressure homogenization, followed by the re-emulsification of this primary emulsion by a low-energy method to preserve the double nanostructure. Various characterization techniques were undertaken to confirm the double structure and to evaluate the encapsulation efficiency of a small hydrophilic probe in the inner aqueous droplets. Complementary fluorescence confocal and cryo-TEM microscopy experiments were conducted to characterize and confirm the double structure of the double nanoemulsion.

  18. Cyclone Chris Hits Australia

    NASA Technical Reports Server (NTRS)

    2002-01-01

    This false-color image shows Cyclone Chris shortly after it hit Australia's northwestern coast on February 6, 2002. This scene was acquired by the Moderate-resolution Imaging Spectroradiometer (MODIS), flying aboard NASA's Terra satellite. (Please note that this scene has not been reprojected.) Cyclone Chris is one of the most powerful storms ever to hit Australia. Initially, the storm contained wind gusts of up to 200 km per hour (125 mph), but shortly after making landfall it weakened to a Category 4 storm. Meteorologists expect the cyclone to weaken quickly as it moves further inland.

  19. Hitting Is Contagious in Baseball: Evidence from Long Hitting Streaks

    PubMed Central

    Bock, Joel R.; Maewal, Akhilesh; Gough, David A.

    2012-01-01

    Data analysis is used to test the hypothesis that “hitting is contagious”. A statistical model is described to study the effect of a hot hitter upon his teammates’ batting during a consecutive game hitting streak. Box score data for entire seasons comprising streaks of length games, including a total observations were compiled. Treatment and control sample groups () were constructed from core lineups of players on the streaking batter’s team. The percentile method bootstrap was used to calculate confidence intervals for statistics representing differences in the mean distributions of two batting statistics between groups. Batters in the treatment group (hot streak active) showed statistically significant improvements in hitting performance, as compared against the control. Mean for the treatment group was found to be to percentage points higher during hot streaks (mean difference increased points), while the batting heat index introduced here was observed to increase by points. For each performance statistic, the null hypothesis was rejected at the significance level. We conclude that the evidence suggests the potential existence of a “statistical contagion effect”. Psychological mechanisms essential to the empirical results are suggested, as several studies from the scientific literature lend credence to contagious phenomena in sports. Causal inference from these results is difficult, but we suggest and discuss several latent variables that may contribute to the observed results, and offer possible directions for future research. PMID:23251507

  20. But Can You Hit?

    ERIC Educational Resources Information Center

    Johnson, R. E.

    2009-01-01

    The author shares a story told to him by a colleague more than thirty years ago. The dean of a midsized American university was explaining the path to tenure to a roomful of newly appointed assistant professors. "We know you boys can all "field"," he declared. "Now we want to see if you can hit." A lot has changed over the intervening decades. If…

  1. But Can You Hit?

    ERIC Educational Resources Information Center

    Johnson, R. E.

    2009-01-01

    The author shares a story told to him by a colleague more than thirty years ago. The dean of a midsized American university was explaining the path to tenure to a roomful of newly appointed assistant professors. "We know you boys can all "field"," he declared. "Now we want to see if you can hit." A lot has changed over the intervening decades. If…

  2. The validation of Huffaz Intelligence Test (HIT)

    NASA Astrophysics Data System (ADS)

    Rahim, Mohd Azrin Mohammad; Ahmad, Tahir; Awang, Siti Rahmah; Safar, Ajmain

    2017-08-01

    In general, a hafiz who can memorize the Quran has many specialties especially in respect to their academic performances. In this study, the theory of multiple intelligences introduced by Howard Gardner is embedded in a developed psychometric instrument, namely Huffaz Intelligence Test (HIT). This paper presents the validation and the reliability of HIT of some tahfiz students in Malaysia Islamic schools. A pilot study was conducted involving 87 huffaz who were randomly selected to answer the items in HIT. The analysis method used includes Partial Least Square (PLS) on reliability, convergence and discriminant validation. The study has validated nine intelligences. The findings also indicated that the composite reliabilities for the nine types of intelligences are greater than 0.8. Thus, the HIT is a valid and reliable instrument to measure the multiple intelligences among huffaz.

  3. Hitting is contagious in baseball: evidence from long hitting streaks.

    PubMed

    Bock, Joel R; Maewal, Akhilesh; Gough, David A

    2012-01-01

    Data analysis is used to test the hypothesis that "hitting is contagious". A statistical model is described to study the effect of a hot hitter upon his teammates' batting during a consecutive game hitting streak. Box score data for entire seasons comprising [Formula: see text] streaks of length [Formula: see text] games, including a total [Formula: see text] observations were compiled. Treatment and control sample groups ([Formula: see text]) were constructed from core lineups of players on the streaking batter's team. The percentile method bootstrap was used to calculate [Formula: see text] confidence intervals for statistics representing differences in the mean distributions of two batting statistics between groups. Batters in the treatment group (hot streak active) showed statistically significant improvements in hitting performance, as compared against the control. Mean [Formula: see text] for the treatment group was found to be [Formula: see text] to [Formula: see text] percentage points higher during hot streaks (mean difference increased [Formula: see text] points), while the batting heat index [Formula: see text] introduced here was observed to increase by [Formula: see text] points. For each performance statistic, the null hypothesis was rejected at the [Formula: see text] significance level. We conclude that the evidence suggests the potential existence of a "statistical contagion effect". Psychological mechanisms essential to the empirical results are suggested, as several studies from the scientific literature lend credence to contagious phenomena in sports. Causal inference from these results is difficult, but we suggest and discuss several latent variables that may contribute to the observed results, and offer possible directions for future research.

  4. Double wall vacuum tubing and method of manufacture

    DOEpatents

    Stahl, Charles R.; Gibson, Michael A.; Knudsen, Christian W.

    1989-01-01

    An evacuated double wall tubing is shown together with a method for the manufacture of such tubing which includes providing a first pipe of predetermined larger diameter and a second pipe having an O.D. substantially smaller than the I.D. of the first pipe. An evacuation opening is then in the first pipe. The second pipe is inserted inside the first pipe with an annular space therebetween. The pipes are welded together at one end. A stretching tool is secured to the other end of the second pipe after welding. The second pipe is then prestressed mechanically with the stretching tool an amount sufficient to prevent substantial buckling of the second pipe under normal operating conditions of the double wall pipe. The other ends of the first pipe and the prestressed second pipe are welded together, preferably by explosion welding, without the introduction of mechanical spacers between the pipes. The annulus between the pipes is evacuated through the evacuation opening, and the evacuation opening is finally sealed. The first pipe is preferably of steel and the second pipe is preferably of titanium. The pipes may be of a size and wall thickness sufficient for the double wall pipe to be structurally load bearing or may be of a size and wall thickness insufficient for the double wall pipe to be structurally load bearing, and the double wall pipe positioned with a sliding fit inside a third pipe of a load-bearing size.

  5. Evaluating method for the double image phenomenon of LED lighting

    NASA Astrophysics Data System (ADS)

    Wu, Wen-Hong; Kuo, Chao-Hui; Hung, Min-Wei; Huang, Kuo-Cheng

    In recent years, the overriding advantages long life, high efficiency, small size and short reaction time have made LED become a viable alternative to conventional light sources. LED lighting sources are usually composed of several individual LED cells which must be mounted on a panel as a lighting module. Being composed of several individual LED cells, the LED sources will cause the double image phenomenon. The double image phenomenon is more obvious when the LED sources are more closer, such as LED table lamp, and limits the applications of LED sources. By using a proper secondary optical lens, the double image phenomenon can be reduced. In this research, an evaluating method based on image processing is developed for the double image phenomenon of a LED sources. By analyzing the gray-scale of the grabbed image which is obtained by putting a rob under a LED source, an index of double image can be established and be a criterion to judge different LED sources. Furthermore, a series of LED lighting simulations are shown in this paper and several type of secondary optical lens are compared and discussed in this paper as well.

  6. Multiple-hit parameter estimation in monolithic detectors

    PubMed Central

    Hunter, William C. J.; Barrett, Harrison H.; Miyaoka, Robert S.; Lewellen, Tom K.

    2012-01-01

    We examine a maximum-a-priori (MAP) method for estimating the primary interaction position of gamma rays with multiple-interaction sites (hits) in a monolithic detector. In assessing the performance of a multiple-hit estimator over that of a conventional one-hit estimator, we consider a few different detector and readout configurations of a 50-mm-wide square LSO block. For this study, we use simulated data from SCOUT, a Monte-Carlo tool for photon tracking and modeling scintillation-camera output. With this tool, we determine estimate bias and variance for a multiple-hit estimator and compare these with similar metrics for a conventional ML estimator, which assumes full energy deposition in one hit. We also examine the effect of event filtering on these metrics; for this purpose, we use a likelihood threshold to reject signals that are not likely to have been produced under the assumed likelihood model. Depending on detector design, we observe a 1–12% improvement of intrinsic resolution for a 1-or-2-hit estimator as compared with a 1-hit estimator. We also observe improved differentiation of photopeak events using a 1-or-2-hit estimator as compared with the 1-hit estimator; more than 6% of photopeak events that were rejected by likelihood filtering for the 1-hit estimator were accurately identified as photo peak events and positioned without loss of resolution by a 1-or-2-hit estimator. PMID:23238325

  7. Provenance graph query method based on double layer index structure

    NASA Astrophysics Data System (ADS)

    Cai, Qing Qiu; Cui, Hong Gang; Tang, Hao

    2017-08-01

    Order to solve the problem that the efficiency of the existing source map is low and the resource occupancy rate is high, considering the relationship between the origin information and the data itself and the internal structure of the origin information, a method of provenance graph query based on double layer index structure is proposed. Firstly, we propose a two layer index structure based on the global index of the dictionary table and the local index based on the bitmap. The global index is used to query the server nodes stored in the source map. The local index is used to query the global index. Finally, based on the double-level index structure, a method of starting map query is designed. The experimental results show that the proposed method not only improves the efficiency of query and reduces the waste of memory resources.

  8. Concerning the Video Drift Method to Measure Double Stars

    NASA Astrophysics Data System (ADS)

    Nugent, Richard L.; Iverson, Ernest W.

    2015-05-01

    Classical methods to measure position angles and separations of double stars rely on just a few measurements either from visual observations or photographic means. Visual and photographic CCD observations are subject to errors from the following sources: misalignments from eyepiece/camera/barlow lens/micrometer/focal reducers, systematic errors from uncorrected optical distortions, aberrations from the telescope system, camera tilt, magnitude and color effects. Conventional video methods rely on calibration doubles and graphically calculating the east-west direction plus careful choice of select video frames stacked for measurement. Atmospheric motion is one of the larger sources of error in any exposure/measurement method which is on the order of 0.5-1.5. Ideally, if a data set from a short video can be used to derive position angle and separation, with each data set self-calibrating independent of any calibration doubles or star catalogues, this would provide measurements of high systematic accuracy. These aims are achieved by the video drift method first proposed by the authors in 2011. This self calibrating video method automatically analyzes 1,000's of measurements from a short video clip.

  9. From benchmarking HITS-CLIP peak detection programs to a new method for identification of miRNA-binding sites from Ago2-CLIP data

    PubMed Central

    Bottini, Silvia; Hamouda-Tekaya, Nedra; Tanasa, Bogdan; Zaragosi, Laure-Emmanuelle; Grandjean, Valerie; Repetto, Emanuela

    2017-01-01

    Abstract Experimental evidence indicates that about 60% of miRNA-binding activity does not follow the canonical rule about the seed matching between miRNA and target mRNAs, but rather a non-canonical miRNA targeting activity outside the seed or with a seed-like motifs. Here, we propose a new unbiased method to identify canonical and non-canonical miRNA-binding sites from peaks identified by Ago2 Cross-Linked ImmunoPrecipitation associated to high-throughput sequencing (CLIP-seq). Since the quality of peaks is of pivotal importance for the final output of the proposed method, we provide a comprehensive benchmarking of four peak detection programs, namely CIMS, PIPE-CLIP, Piranha and Pyicoclip, on four publicly available Ago2-HITS-CLIP datasets and one unpublished in-house Ago2-dataset in stem cells. We measured the sensitivity, the specificity and the position accuracy toward miRNA binding sites identification, and the agreement with TargetScan. Secondly, we developed a new pipeline, called miRBShunter, to identify canonical and non-canonical miRNA-binding sites based on de novo motif identification from Ago2 peaks and prediction of miRNA::RNA heteroduplexes. miRBShunter was tested and experimentally validated on the in-house Ago2-dataset and on an Ago2-PAR-CLIP dataset in human stem cells. Overall, we provide guidelines to choose a suitable peak detection program and a new method for miRNA-target identification. PMID:28108660

  10. The Video Drift Method to Measure Double Stars

    NASA Astrophysics Data System (ADS)

    Nugent, Richard

    2017-06-01

    A new video method has been developed to measure double stars. The double star components are video recorded as they drift across the camera’s field of view from east to west with the telescope’s motor drive turned off. Using an existing software program that was specifically written for the analysis of occultation videos (Limovie - Light Measurement Tool for Occultation Observation using Video Recorder), standard (x,y) coordinates are extracted for each component star for each video frame. An Excel program written by author RLN (VidPro - Video Drift Program Reduction) analyses the (x,y) positions for determining position angle (PA), separation and other statistical quantities. Unlike other double star reduction methods, no star catalogue or calibration doubles are needed as each video drift is self-calibrating. The duration of a typical video for an f/10 telescope system ranges between 20 sec - 1 minute; this along with a 30 frame/sec recording rate produces 100’s to 1,000’s of (x,y) pairs for analysis. The video chip’s offset from the true east-west direction (drift angle) is computed simultaneously along with a scale factor for each video. The drift angle and scale factor are used with all (x,y) positions to generate a unique position angle and separation. For 1,800+ doubles measured to date typical standard deviations (our own internal precision) for position angles are 1.1° and for separations 0.35". A comparison was made with the Washington Double Star catalog (WDS) entries that had little or no change in PA and separation for 120 + years. For these doubles our PA’s and separations differed by an average of 0.2 deg and 0.2" respectively. Sources of error are discussed along with tips to maximize the quality of the (x,y) data produced by Limovie. Limovie and VidPro programs are available as free downloads.

  11. Double sided circuit board and a method for its manufacture

    DOEpatents

    Lindenmeyer, Carl W.

    1989-07-04

    Conductance between the sides of a large double sided printed circuit board is provided using a method which eliminates the need for chemical immersion or photographic exposure of the entire large board. A plurality of through-holes are drilled or punched in a substratum according to the desired pattern, conductive laminae are made to adhere to both sides of the substratum covering the holes and the laminae are pressed together and permanently joined within the holes, providing conductive paths.

  12. Double sided circuit board and a method for its manufacture

    DOEpatents

    Lindenmeyer, Carl W.

    1989-01-01

    Conductance between the sides of a large double sided printed circuit board is provided using a method which eliminates the need for chemical immersion or photographic exposure of the entire large board. A plurality of through-holes are drilled or punched in a substratum according to the desired pattern, conductive laminae are made to adhere to both sides of the substratum covering the holes and the laminae are pressed together and permanently joined within the holes, providing conductive paths.

  13. Double sided circuit board and a method for its manufacture

    DOEpatents

    Lindenmeyer, C.W.

    1988-04-14

    Conductance between the sides of a large double sided printed circuit board is provided using a method which eliminates the need for chemical immersion or photographic exposure of the entire large board. A plurality of through-holes are drilled or punched in a substratum according to the desired pattern, conductive laminae are made to adhere to both sides of the substratum covering the holes and the laminae are pressed together and permanently joined within the holes, providing conductive paths. 4 figs.

  14. Double power series method for approximating cosmological perturbations

    NASA Astrophysics Data System (ADS)

    Wren, Andrew J.; Malik, Karim A.

    2017-04-01

    We introduce a double power series method for finding approximate analytical solutions for systems of differential equations commonly found in cosmological perturbation theory. The method was set out, in a noncosmological context, by Feshchenko, Shkil' and Nikolenko (FSN) in 1966, and is applicable to cases where perturbations are on subhorizon scales. The FSN method is essentially an extension of the well known Wentzel-Kramers-Brillouin (WKB) method for finding approximate analytical solutions for ordinary differential equations. The FSN method we use is applicable well beyond perturbation theory to solve systems of ordinary differential equations, linear in the derivatives, that also depend on a small parameter, which here we take to be related to the inverse wave-number. We use the FSN method to find new approximate oscillating solutions in linear order cosmological perturbation theory for a flat radiation-matter universe. Together with this model's well-known growing and decaying Mészáros solutions, these oscillating modes provide a complete set of subhorizon approximations for the metric potential, radiation and matter perturbations. Comparison with numerical solutions of the perturbation equations shows that our approximations can be made accurate to within a typical error of 1%, or better. We also set out a heuristic method for error estimation. A Mathematica notebook which implements the double power series method is made available online.

  15. Front-line, dose-escalated immunochemotherapy is associated with a significant progression-free survival advantage in patients with double-hit lymphomas: a systematic review and meta-analysis.

    PubMed

    Howlett, Christina; Snedecor, Sonya J; Landsburg, Daniel J; Svoboda, Jakub; Chong, Elise A; Schuster, Stephen J; Nasta, Sunita Dwivedy; Feldman, Tatyana; Rago, Allison; Walsh, Kristy M; Weber, Scott; Goy, Andre; Mato, Anthony

    2015-08-01

    'Double-hit lymphomas' (DHL), defined by concurrent MYC and BCL2 (or, alternatively, BCL6) rearrangements, have a very poor outcome compared to standard-risk, diffuse large B-cell lymphomas (DLBCL). Consequently, dose-intensive (DI) therapies and/or consolidation with high-dose therapy and transplant have been explored in DHL, although benefit has been debated. This meta-analysis compared survival outcomes in DHL patients receiving dose-escalated regimens [DI: R-Hyper-CVAD (rituximab, cyclophosphamide, vincristine, doxorubicin, dexamethasone) or R-CODOX-M/IVAC (rituximab, cyclophosphamide, doxorubicin, vincristine, methotrexate/ifosfamide, etoposide, high dose cytarabine); or intermediate-dose: R-EPOCH (rituximab, etoposide, doxorubicin, cyclophosphamide, vincristine, prednisone)] versus standard-dose regimens (R-CHOP; rituximab, cyclophosphamide, doxorubicin, vincristine, prednisone) in the first-line setting. Data were synthesized to estimate hazard ratios of dose-escalated treatments versus R-CHOP using a Weibull proportional hazards model within a Bayesian meta-analysis framework. Eleven studies examining 394 patients were included. Patients were treated with either front-line R-CHOP (n = 180), R-EPOCH (n = 91), or R-Hyper-CVAD/rituximab, methotrexate, cytarabine (R-M/C), R-CODOX-M/R-IVAC (DI) (n = 123). Our meta-analysis revealed that median progression-free survival (n = 350) for the R-CHOP, R-EPOCH and DI groups was 12·1, 22·2, and 18·9 months, respectively. First-line treatment with R-EPOCH significantly reduced the risk of a progression compared with R-CHOP (relative risk reduction of 34%; P = 0·032); however, overall survival (n = 374) was not significantly different across treatment approaches. A subset of patients might benefit from intensive induction with/without transplant. Further investigation into the role of transplant and novel therapy combinations is necessary. © 2015 John Wiley & Sons Ltd.

  16. Inflammatory Effects of Menthol vs. Non-menthol Cigarette Smoke Extract on Human Lung Epithelial Cells: A Double-Hit on TRPM8 by Reactive Oxygen Species and Menthol

    PubMed Central

    Lin, An-Hsuan; Liu, Meng-Han; Ko, Hsin-Kuo B.; Perng, Diahn-Warng; Lee, Tzong-Shyuan; Kou, Yu Ru

    2017-01-01

    in these responses between the both CSE types using HBECs with TRPM8 knockdown and TRPM8 knockout, and using HEK293 cells transfected with hTRPM8. Thus, compared with exposure to Non-M-CSE, exposure to M-CSE induced greater TRPM8-mediated inflammatory responses in HBECs. These augmented effects may be due to a double-hit on lung epithelial TRPM8 by ROS generated from CSE and the menthol in M-CSE. PMID:28496415

  17. Completed double layer boundary element method for periodic suspensions

    NASA Astrophysics Data System (ADS)

    Fan, X.-J.; Phan-Thien, N.; Zheng, R.

    In this paper, a traction-based boundary element method is formulated and implemented for periodic suspensions. Hydrodynamic interaction of particles at infinity is handled by O'Brien's method (1979), which is suitably modified for the adjoint double layer using the mean field values of the traction and the background flow. After a deflation of the extreme eigenvalue -1 of the adjoint double layer operator, an iterative solution strategy is implemented, which solves for the traction field on the surfaces of a group of near-by particles sequentially. Ewald's summation technique is employed, by expressing the adjoint double layer kernel in two sums, one converges rapidly in real space, and the other, in the reciprocal Fourier space. The implementation is tested on a periodic suspension of spheres and spheroids in simple and elongated face-centred cubic arrays, and proved to be very accurate when compared to established results. New results for the intrinsic viscosities of periodic suspensions of cubes and spheroids from moderate to high volume fractions are reported. Based on the numerical data for suspensions of spheroids, a simple modification of the constitutive equation of Hinch and Leal (1972), which was derived for dilute suspension of spheroids, is reported, allowing the constitutive equation to reasonably fit the numerical data at moderate to high concentrations.

  18. A method for generating double-ring-shaped vector beams

    NASA Astrophysics Data System (ADS)

    Huan, Chen; Xiao-Hui, Ling; Zhi-Hong, Chen; Qian-Guang, Li; Hao, Lv; Hua-Qing, Yu; Xu-Nong, Yi

    2016-07-01

    We propose a method for generating double-ring-shaped vector beams. A step phase introduced by a spatial light modulator (SLM) first makes the incident laser beam have a nodal cycle. This phase is dynamic in nature because it depends on the optical length. Then a Pancharatnam-Berry phase (PBP) optical element is used to manipulate the local polarization of the optical field by modulating the geometric phase. The experimental results show that this scheme can effectively create double-ring-shaped vector beams. It provides much greater flexibility to manipulate the phase and polarization by simultaneously modulating the dynamic and the geometric phases. Project supported by the National Natural Science Foundation of China (Grant No. 11547017), the Hubei Engineering University Research Foundation, China (Grant No. z2014001), and the Natural Science Foundation of Hubei Province, China (Grant No. 2014CFB578).

  19. New approaches for efficient solution of hitting set problem

    NASA Technical Reports Server (NTRS)

    Fijany, Amir; Vatan, Farrokh

    2004-01-01

    A new method for solving the hitting set problem is proposed. This method is based on the mapping of the problem onto an integer programming optimization problem. this new approach provides an algorithm with much better performance compare to the algorithms for the hitting set problem that currently are used for solving the diagnosis problem.

  20. RETURN TO HITTING: AN INTERVAL HITTING PROGRESSION AND OVERVIEW OF HITTING MECHANICS FOLLOWING INJURY.

    PubMed

    Monti, Ryan

    2015-12-01

    Participation in baseball is prevalent across all age groups. Baseball injuries are common and can impact a player's ability to participate. An injury to any region can influence the player's ability to swing the bat. As a part of the athlete's rehabilitation, a sports-specific program should be implemented re-introducing the hitting cycle that addresses proper biomechanics as well as providing a progressive atmosphere to return to hitting. Although there are several return to throwing progression programs in the literature, to the author's knowledge no published hitting progression programs exist. Thus, the purpose of this clinical commentary is to propose a progressive return to hitting program that emphasizes proper mechanics for ballplayers who have sustained an injury. This return to hitting program describes in detail the phases of the baseball hitting cycle. Proper biomechanical information is provided on each phase that can be used to assist the clinician in injury prevention. This article gives the healthcare professional guidance for assessment for appropriate readiness for return to sport using impairment measures, patient-report measures, and physical performance measures. The purpose of this hitting progression is to provide a safe, gradual increase in hitting intensity by moving from a fixed position to soft toss and finally to increasing pitch velocity. This interval hitting program guides the clinician from when the patient is ready to begin hitting through a full return to sport. Use of appropriate hitting mechanics must be ensured during rehabilitation to avoid compensation. Similar to the return to throwing programs that exist, this interval hitting progression program can provide a framework to quantify progression and reduce the chance of re-injury from occurring during the return to sport phase of rehab. Level 5.

  1. New Methods for Improved Double Circular-Arc Helical Gears

    NASA Technical Reports Server (NTRS)

    Litvin, Faydor L.; Lu, Jian

    1997-01-01

    The authors have extended the application of double circular-arc helical gears for internal gear drives. The geometry of the pinion and gear tooth surfaces has been determined. The influence of errors of alignment on the transmission errors and the shift of the bearing contact have been investigated. Application of a predesigned parabolic function for the reduction of transmission errors was proposed. Methods of grinding of the pinion-gear tooth surfaces by a disk-shaped tool and a grinding worm were proposed.

  2. Analysis of Double Ring Resonators using Method of Equating Fields

    NASA Astrophysics Data System (ADS)

    Althaf, Shahana

    Optical ring resonators have the potential to be integral parts of large scale photonic circuits. My thesis theoretically analyzes parallel coupled double ring resonators (DRRs) in detail. The analysis is performed using the method of equating fields (MEF) which provides an in depth understanding about the transmitted and reflected light paths in the structure. Equations for the transmitted and reflected fields are derived; these equations allow for unequal ring lengths and coupling coefficients. Sanity checks including comparison with previously studied structures are performed in the final chapter in order to prove the correctness of the obtained results.

  3. Simulating Electric Double Layer Capacitance by Using Lattice Boltzmann Method

    NASA Astrophysics Data System (ADS)

    Sun, Ning; Gersappe, Dilip

    2015-03-01

    By using the Lattice Boltzmann Method (LBM) we studied diffuse-charge dynamics in electrochemical systems. We use the LBM to solve Poisson-Nernst-Planck equations (PNP) and Modified Poisson-Nernst-Planck equations (MPNP). The isotropic permittivity of electrolyte is modeled using the Booth model. The results show that both steric effect (MPNP) and isotropic permittivity (Booth model) can have large influence on diffuse-charge dynamics, especially when electrolyte concentration or applied potential is high. This model can be applied to simulate electric double layer capacitance of super capacitors with complex geometry and also incorporate other effects such as heat convection in a modular manner.

  4. A double-correlation tremor-location method

    NASA Astrophysics Data System (ADS)

    Li, Ka Lok; Sgattoni, Giulia; Sadeghisorkhani, Hamzeh; Roberts, Roland; Gudmundsson, Olafur

    2016-12-01

    A double-correlation method is introduced to locate tremor sources based on stacks of complex, doubly-correlated tremor records of multiple triplets of seismographs back projected to hypothetical source locations in a geographic grid. Peaks in the resulting stack of moduli are inferred source locations. The stack of the moduli is a robust measure of energy radiated from a point source or point sources even when the velocity information is imprecise. Application to real data shows how double correlation focuses the source mapping compared to the common single correlation approach. Synthetic tests demonstrate the robustness of the method and its resolution limitations which are controlled by the station geometry, the finite frequency of the signal, the quality of the used velocity information and noise level. Both random noise and signal or noise correlated at time shifts that are inconsistent with the assumed velocity structure can be effectively suppressed. Assuming a surface-wave velocity, we can constrain the source location even if the surface-wave component does not dominate. The method can also in principle be used with body waves in three dimensions, although this requires more data and seismographs placed near the source for depth resolution.

  5. A double-correlation tremor-location method

    NASA Astrophysics Data System (ADS)

    Li, Ka Lok; Sgattoni, Giulia; Sadeghisorkhani, Hamzeh; Roberts, Roland; Gudmundsson, Olafur

    2017-02-01

    A double-correlation method is introduced to locate tremor sources based on stacks of complex, doubly-correlated tremor records of multiple triplets of seismographs back projected to hypothetical source locations in a geographic grid. Peaks in the resulting stack of moduli are inferred source locations. The stack of the moduli is a robust measure of energy radiated from a point source or point sources even when the velocity information is imprecise. Application to real data shows how double correlation focuses the source mapping compared to the common single correlation approach. Synthetic tests demonstrate the robustness of the method and its resolution limitations which are controlled by the station geometry, the finite frequency of the signal, the quality of the used velocity information and noise level. Both random noise and signal or noise correlated at time shifts that are inconsistent with the assumed velocity structure can be effectively suppressed. Assuming a surface wave velocity, we can constrain the source location even if the surface wave component does not dominate. The method can also in principle be used with body waves in 3-D, although this requires more data and seismographs placed near the source for depth resolution.

  6. Hurricane Iris Hits Belize

    NASA Technical Reports Server (NTRS)

    2002-01-01

    Hurricane Iris hit the small Central American country of Belize around midnight on October 8, 2001. At the time, Iris was the strongest Atlantic hurricane of the season, with sustained winds up to 225 kilometers per hour (140 mph). The hurricane caused severe damage-destroying homes, flooding streets, and leveling trees-in coastal towns south of Belize City. In addition, a boat of American recreational scuba divers docked along the coast was capsized by the storm, leaving 20 of the 28 passengers missing. Within hours the winds had subsided to only 56 kph (35 mph), a modest tropical depression, but Mexico, Guatemala, El Salvador, and Honduras were still expecting heavy rains. The above image is a combination of visible and thermal infrared data (for clouds) acquired by a NOAA Geostationary Operational Environmental Satellite (GOES-8) on October 8, 2001, at 2:45 p.m., and the Moderate-resolution Imaging Spectroradiometer (MODIS) (for the color of the ground). The three-dimensional view is from the south-southeast (north is towards the upper left). Belize is off the image to the left. Image courtesy Marit Jentoft-Nilsen, NASA GSFC Visualization Analysis Lab

  7. Hurricane Iris Hits Belize

    NASA Technical Reports Server (NTRS)

    2002-01-01

    Hurricane Iris hit the small Central American country of Belize around midnight on October 8, 2001. At the time, Iris was the strongest Atlantic hurricane of the season, with sustained winds up to 225 kilometers per hour (140 mph). The hurricane caused severe damage-destroying homes, flooding streets, and leveling trees-in coastal towns south of Belize City. In addition, a boat of American recreational scuba divers docked along the coast was capsized by the storm, leaving 20 of the 28 passengers missing. Within hours the winds had subsided to only 56 kph (35 mph), a modest tropical depression, but Mexico, Guatemala, El Salvador, and Honduras were still expecting heavy rains. The above image is a combination of visible and thermal infrared data (for clouds) acquired by a NOAA Geostationary Operational Environmental Satellite (GOES-8) on October 8, 2001, at 2:45 p.m., and the Moderate-resolution Imaging Spectroradiometer (MODIS) (for the color of the ground). The three-dimensional view is from the south-southeast (north is towards the upper left). Belize is off the image to the left. Image courtesy Marit Jentoft-Nilsen, NASA GSFC Visualization Analysis Lab

  8. Multiple-Hit Parameter Estimation in Monolithic Detectors

    PubMed Central

    Barrett, Harrison H.; Lewellen, Tom K.; Miyaoka, Robert S.

    2014-01-01

    We examine a maximum-a-posteriori method for estimating the primary interaction position of gamma rays with multiple interaction sites (hits) in a monolithic detector. In assessing the performance of a multiple-hit estimator over that of a conventional one-hit estimator, we consider a few different detector and readout configurations of a 50-mm-wide square cerium-doped lutetium oxyorthosilicate block. For this study, we use simulated data from SCOUT, a Monte-Carlo tool for photon tracking and modeling scintillation- camera output. With this tool, we determine estimate bias and variance for a multiple-hit estimator and compare these with similar metrics for a one-hit maximum-likelihood estimator, which assumes full energy deposition in one hit. We also examine the effect of event filtering on these metrics; for this purpose, we use a likelihood threshold to reject signals that are not likely to have been produced under the assumed likelihood model. Depending on detector design, we observe a 1%–12% improvement of intrinsic resolution for a 1-or-2-hit estimator as compared with a 1-hit estimator. We also observe improved differentiation of photopeak events using a 1-or-2-hit estimator as compared with the 1-hit estimator; more than 6% of photopeak events that were rejected by likelihood filtering for the 1-hit estimator were accurately identified as photopeak events and positioned without loss of resolution by a 1-or-2-hit estimator; for PET, this equates to at least a 12% improvement in coincidence-detection efficiency with likelihood filtering applied. PMID:23193231

  9. Double-sensor method for detection of oscillating electric field.

    PubMed

    Ohkuma, Yasunori; Ikeyama, Taeko; Nogi, Yasuyuki

    2011-04-01

    An electric-field sensor consisting of thin copper plates is designed to measure an oscillating electric field produced by charge separations on a plasma column. The sensor installed in a vacuum region around plasma detects charges induced by the electric field on the copper plates. The value of the induced charges depends not only on the strength of the electric field, but also on the design of the sensor. To obtain the correct strength of the electric field, a correction factor arising from the design of the sensor must be known. The factor is calculated numerically using Laplace's equation and compared with a value measured using a uniform electric field in the frequency range of 10-500 kHz. When an external circuit is connected to the sensor to measure the induced charges, the electric field around the sensor is disturbed. Therefore, a double-sensor method for excluding a disturbed component in the measured electric field is proposed. The reliability of the double-sensor method is confirmed by measuring dipole-like and quadrupole-like electric fields. © 2011 American Institute of Physics

  10. Field evaluation of mercury vapor analytical methods: comparison of the "double amalgam method" and ISO 17733.

    PubMed

    Takaya, Mitsutoshi; Joeng, Jee Yeon; Ishihara, Nobuo; Serita, Fumio; Kohyama, Norihiko

    2006-04-01

    In this study, a gold amalgam method called the "Double amalgam method" was compared with the ISO 17733 method for mercury vapor analysis method. In terms of sensitivity and ease of operation, the amalgamation method is superior to the oxidation method. Two parallel samplings were carried out in this research at a button battery factory, where the mercury vapor level in the air was about 0.001 mg/m3 and at a fluorescent lamp factory, where the mercury vapor level was about 0.015 mg/m3. In the both cases, the measured values of the two showed good agreement with each other. As these two workplaces represent typical mercury levels in industries today, the double amalgam method is applicable to working environment measurement.

  11. A new OPC method for double patterning technology

    NASA Astrophysics Data System (ADS)

    Pan, Yijie; Zhang, Hongbo; Chen, Ye

    2008-03-01

    As the VLSI technology scales into deep submicron nodes, Double Patterning Technology (DPT) has shown its necessity for the under 45nm processes. However, the litho-related and process-related issues, such as the overlay control for CD uniformity, decomposition, feature stitching technology and some other problems make up the main challenges for the implementation of DPT. Due to Optical Proximity Correction (OPC), the complexity and data volume of DPT increase dramatically, which severely increase the application cost and create manufacturability problems. In this paper, we mainly talk about the interactions between DPT and OPC and propose a new Model-Based OPC methods for the decomposition in DPT procedures. To address the printing problems with cutting sites for feature split, we introduce an overlap correction method on the stitching locations. For any re-cut and/or redesigned pattern after verification, we categorize DP decompositions and introduce a new Adaptable OPC (Ad-OPC) algorithm by reusing post OPC layout to speed up the correction and improve its convergence according to environment surrounding. The method can be easily incorporated into existing MB-OPC framework. To test this method, total Edge Placement Error (EPE) and runtime are calculated in our experiments. Results show that over 90% runtime can be saved compared with conventional OPC procedure. It increases the robustness and friendliness of pattern correction as well as stitches features back satisfactorily.

  12. Subgroup conflicts? Try the psychodramatic "double triad method".

    PubMed

    Verhofstadt-Denève, Leni M F

    2012-04-01

    The present article suggests the application of a psychodramatic action method for tackling subgroup conflicts in which the direct dialogue between representatives of two opposing subgroups is prepared step by step through an indirect dialogue strategy within two triads, a strategy known as the Double Triad Method (DTM). In order to achieve integration in the group as a whole, it is important that all the members of both subgroups participate actively during the entire process. The first part of the article briefly explores the theoretical background, with a special emphasis on the Phenomenological-Dialectical Personality Model (Phe-Di PModel). In the second part, the DTM procedure is systematically described through its five action stages, each accompanied with 1) a spatial representation of the consecutive actions, 2) some illustrative statements for each stage, and 3) a theoretical interpretation of the dialectically involved personality dimensions in both protagonists. The article concludes with a discussion and suggestions for more extensive applications of the DTM method, including the question of its relationships to Agazarian's functional subgrouping, psychodrama, and sociodrama.

  13. Hg stable isotope analysis by the double-spike method.

    PubMed

    Mead, Chris; Johnson, Thomas M

    2010-06-01

    Recent publications suggest great potential for analysis of Hg stable isotope abundances to elucidate sources and/or chemical processes that control the environmental impact of mercury. We have developed a new MC-ICP-MS method for analysis of mercury isotope ratios using the double-spike approach, in which a solution containing enriched (196)Hg and (204)Hg is mixed with samples and provides a means to correct for instrumental mass bias and most isotopic fractionation that may occur during sample preparation and introduction into the instrument. Large amounts of isotopic fractionation induced by sample preparation and introduction into the instrument (e.g., by batch reactors) are corrected for. This may greatly enhance various Hg pre-concentration methods by correcting for minor fractionation that may occur during preparation and removing the need to demonstrate 100% recovery. Current precision, when ratios are normalized to the daily average, is 0.06 per thousand, 0.06 per thousand, 0.05 per thousand, and 0.05 per thousand (2sigma) for (202)Hg/(198)Hg, (201)Hg/(198)Hg, (200)Hg/(198)Hg, and (199)Hg/(198)Hg, respectively. This is slightly better than previously published methods. Additionally, this precision was attained despite the presence of large amounts of other Hg isotopes (e.g., 5.0% atom percent (198)Hg) in the spike solution; substantially better precision could be achieved if purer (196)Hg were used.

  14. Upscaling of Hydraulic Conductivity using the Double Constraint Method

    NASA Astrophysics Data System (ADS)

    El-Rawy, Mustafa; Zijl, Wouter; Batelaan, Okke

    2013-04-01

    The mathematics and modeling of flow through porous media is playing an increasingly important role for the groundwater supply, subsurface contaminant remediation and petroleum reservoir engineering. In hydrogeology hydraulic conductivity data are often collected at a scale that is smaller than the grid block dimensions of a groundwater model (e.g. MODFLOW). For instance, hydraulic conductivities determined from the field using slug and packer tests are measured in the order of centimeters to meters, whereas numerical groundwater models require conductivities representative of tens to hundreds of meters of grid cell length. Therefore, there is a need for upscaling to decrease the number of grid blocks in a groundwater flow model. Moreover, models with relatively few grid blocks are simpler to apply, especially when the model has to run many times, as is the case when it is used to assimilate time-dependent data. Since the 1960s different methods have been used to transform a detailed description of the spatial variability of hydraulic conductivity to a coarser description. In this work we will investigate a relatively simple, but instructive approach: the Double Constraint Method (DCM) to identify the coarse-scale conductivities to decrease the number of grid blocks. Its main advantages are robustness and easy implementation, enabling to base computations on any standard flow code with some post processing added. The inversion step of the double constraint method is based on a first forward run with all known fluxes on the boundary and in the wells, followed by a second forward run based on the heads measured on the phreatic surface (i.e. measured in shallow observation wells) and in deeper observation wells. Upscaling, in turn is inverse modeling (DCM) to determine conductivities in coarse-scale grid blocks from conductivities in fine-scale grid blocks. In such a way that the head and flux boundary conditions applied to the fine-scale model are also honored at the

  15. Lubrication approximation in completed double layer boundary element method

    NASA Astrophysics Data System (ADS)

    Nasseri, S.; Phan-Thien, N.; Fan, X.-J.

    This paper reports on the results of the numerical simulation of the motion of solid spherical particles in shear Stokes flows. Using the completed double layer boundary element method (CDLBEM) via distributed computing under Parallel Virtual Machine (PVM), the effective viscosity of suspension has been calculated for a finite number of spheres in a cubic array, or in a random configuration. In the simulation presented here, the short range interactions via lubrication forces are also taken into account, via the range completer in the formulation, whenever the gap between two neighbouring particles is closer than a critical gap. The results for particles in a simple cubic array agree with the results of Nunan and Keller (1984) and Stoksian Dynamics of Brady etal. (1988). To evaluate the lubrication forces between particles in a random configuration, a critical gap of 0.2 of particle's radius is suggested and the results are tested against the experimental data of Thomas (1965) and empirical equation of Krieger-Dougherty (Krieger, 1972). Finally, the quasi-steady trajectories are obtained for time-varying configuration of 125 particles.

  16. Extended operator expansion method for neutrinoless double beta decay

    NASA Astrophysics Data System (ADS)

    Hirsch, M.; Kadowaki, O.; Klapdor-Kleingrothaus, H. V.; Muto, K.; Oda, T.

    1995-03-01

    Reliable calculations of nuclear matrix elements are a prerequisite for the determination of the effective neutrino mass and other particle physics parameters from neutrinoless double beta decay. Here, the operator expansion method is improved by including Coulomb, tensor and central interactions simultaneously. Furthermore, the formalism of the OEM is extended to those matrix elements necessary to extract the right-handed parameters < λ > and < η > from 0 νββ decay. OEM includes the dependence of the nuclear matrix elements on the intermediate states implicitly and can therefore be understood as a step beyond the closure approximation. Numerical studies are carried out for the isotope76Ge combining the OEM expressions with ground-state wave functions calculated within a proton-neutron quasiparticle Random Phase Approximation (pn-QRPA) model. The influence and relative importance of central, tensor and Coulomb interactions is investigated. Within the OEM, contributions from the Coulomb force are found to be negligible in 0 νββ decay, while the tensor force leads to a moderate change of the results, of the order of (10 30)%, giving a better agreement between sets of calculations which employ different NN-interactions. Generally, results of the OEM+QRPA calculation are similar to previous calculations of 0 νββ decay matrix elements, indicating that 0 νββ decay is not sensitive to model approximations and might therefore be more accurately calculated than the strongly suppressed 2 νββ decay matrix elements.

  17. 42 CFR 495.344 - Approval of the State Medicaid HIT plan, the HIT PAPD and update, the HIT IAPD and update, and...

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... PAPD and update, the HIT IAPD and update, and the annual HIT IAPD. 495.344 Section 495.344 Public... and update, the HIT IAPD and update, and the annual HIT IAPD. HHS will not approve the State Medicaid HIT plan, HIT PAPD and update, HIT-IAPD and update, or annual IAPD if any of these documents do...

  18. Car Hits Boy on Bicycle

    ERIC Educational Resources Information Center

    Ruiz, Michael J.

    2005-01-01

    In this article we present the fascinating reconstruction of an accident where a car hit a boy riding his bicycle. The boy dramatically flew several metres through the air after the collision and was injured, but made a swift and complete recovery from the accident with no long-term after-effects. Students are challenged to determine the speed of…

  19. Car Hits Boy on Bicycle

    ERIC Educational Resources Information Center

    Ruiz, Michael J.

    2005-01-01

    In this article we present the fascinating reconstruction of an accident where a car hit a boy riding his bicycle. The boy dramatically flew several metres through the air after the collision and was injured, but made a swift and complete recovery from the accident with no long-term after-effects. Students are challenged to determine the speed of…

  20. 76 FR 25355 - HIT Standards Committee; Schedule for the Assessment of HIT Policy Committee Recommendations

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-04

    ... HUMAN SERVICES HIT Standards Committee; Schedule for the Assessment of HIT Policy Committee Recommendations AGENCY: Office of the National Coordinator for Health Information Technology, HHS. ACTION: Notice... information technology standards, implementation specifications, and/or certification criteria. Once the HIT...

  1. Redoublement lexical, procede intensif (Lexical Doubling, Intensive Method).

    ERIC Educational Resources Information Center

    George, Kenneth E. M.

    1983-01-01

    An often-neglected aspect of daily language is syllable doubling or repetition, as in infant language ("nounou"), onomatopoeia ("ronron"), interjections or responses ("oui oui"), names ("Mimi"), or military slang ("coco" for "commandant"). The mechanisms and semantic functions of this phenomenon are outlined, drawing on examples from French…

  2. Redoublement lexical, procede intensif (Lexical Doubling, Intensive Method).

    ERIC Educational Resources Information Center

    George, Kenneth E. M.

    1983-01-01

    An often-neglected aspect of daily language is syllable doubling or repetition, as in infant language ("nounou"), onomatopoeia ("ronron"), interjections or responses ("oui oui"), names ("Mimi"), or military slang ("coco" for "commandant"). The mechanisms and semantic functions of this phenomenon are outlined, drawing on examples from French…

  3. Robust Hitting with Dynamics Shaping

    NASA Astrophysics Data System (ADS)

    Yashima, Masahito; Yamawaki, Tasuku

    The present paper proposes the trajectory planning based on “the dynamics shaping” for a redundant robotic arm to hit a target robustly toward the desired direction, of which the concept is to shape the robot dynamics appropriately by changing its posture in order to achieve the robust motion. The positional error of the end-effector caused by unknown disturbances converges onto near the singular vector corresponding to its maximum singular value of the output controllability matrix of the robotic arm. Therefore, if we can control the direction of the singular vector by applying the dynamics shaping, we will be able to control the direction of the positional error of the end-effector caused by unknown disturbances. We propose a novel trajectory planning based on the dynamics shaping and verify numerically and experimentally that the robotic arm can robustly hit the target toward the desired direction with a simple open-loop control system even though the disturbance is applied.

  4. Manual laterality and hitting performance in major league baseball.

    PubMed

    Grondin, S; Guiard, Y; Ivry, R B; Koren, S

    1999-06-01

    Asymmetrical hand function was examined in the context of expert sports performance: hitting in professional baseball. An archival study was conducted to examine the batting performance of all Major League Baseball players from 1871 to 1992, focusing on those who batted left (n = 1,059) to neutralize the game asymmetry. Among them, left-handers (n = 421) were more likely to hit with power and to strike out than right-handers (n = 638). One possible account, based on the idea of hand dominance and an analogy to tennis, is that batting left involves a double-handed forehand for left-handers and a weaker and more reliable double-handed backhand for right-handers. The results are also interpretable in the light of Y. Guiard's (1987) kinematic chain model of a between-hands asymmetrical division of labor, which provides a detailed account of why left batting is optimal for left-handers.

  5. Method of and apparatus for double-exposure holographic interferometry

    NASA Technical Reports Server (NTRS)

    Witherow, W. K. (Inventor)

    1984-01-01

    Double-exposure holographic interferometry is carried out using first and second lasers responsive to respective applied firing signals for producing respective pulsed output beams. An optical system is provided oriented such that the output beams of the lasers produce coinciding scene and reference beams. An initiator circuit generates and applies a firing signal to the first laser; and a timer/firing device responsive to the generation of a firing signal by the initiator circuit, generates and applies a firing signal to the second laser a predetermined period of time later.

  6. Assessing statistical reliability of phylogenetic trees via a speedy double bootstrap method.

    PubMed

    Ren, Aizhen; Ishida, Takashi; Akiyama, Yutaka

    2013-05-01

    Evaluating the reliability of estimated phylogenetic trees is of critical importance in the field of molecular phylogenetics, and for other endeavors that depend on accurate phylogenetic reconstruction. The bootstrap method is a well-known computational approach to phylogenetic tree assessment, and more generally for assessing the reliability of statistical models. However, it is known to be biased under certain circumstances, calling into question the accuracy of the method. Several advanced bootstrap methods have been developed to achieve higher accuracy, one of which is the double bootstrap approach, but the computational burden of this method has precluded its application to practical problems of phylogenetic tree selection. We address this issue by proposing a simple method called the speedy double bootstrap, which circumvents the second-tier resampling step in the regular double bootstrap approach. We also develop an implementation of the regular double bootstrap for comparison with our speedy method. The speedy double bootstrap suffers no significant loss of accuracy compared with the regular double bootstrap, while performing calculations significantly more rapidly (at minimum around 371 times faster, based on analysis of mammalian mitochondrial amino acid sequences and 12S and 16S rRNA genes). Our method thus enables, for the first time, the practical application of the double bootstrap technique in the context of molecular phylogenetics. The approach can also be used more generally for model selection problems wherever the maximum likelihood criterion is used. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Double Cross-Validation in Multiple Regression: A Method of Estimating the Stability of Results.

    ERIC Educational Resources Information Center

    Rowell, R. Kevin

    In multiple regression analysis, where resulting predictive equation effectiveness is subject to shrinkage, it is especially important to evaluate result replicability. Double cross-validation is an empirical method by which an estimate of invariance or stability can be obtained from research data. A procedure for double cross-validation is…

  8. Interferometric Methods of Measuring Refractive Indices and Double-Refraction of Fibres.

    ERIC Educational Resources Information Center

    Hamza, A. A.; El-Kader, H. I. Abd

    1986-01-01

    Presents two methods used to measure the refractive indices and double-refraction of fibers. Experiments are described, with one involving the use of Pluta microscope in the double-beam interference technique, the other employing the multiple-beam technique. Immersion liquids are discussed that can be used in the experiments. (TW)

  9. Interferometric Methods of Measuring Refractive Indices and Double-Refraction of Fibres.

    ERIC Educational Resources Information Center

    Hamza, A. A.; El-Kader, H. I. Abd

    1986-01-01

    Presents two methods used to measure the refractive indices and double-refraction of fibers. Experiments are described, with one involving the use of Pluta microscope in the double-beam interference technique, the other employing the multiple-beam technique. Immersion liquids are discussed that can be used in the experiments. (TW)

  10. Inverse scattering method and soliton double solution family for the general symplectic gravity model

    SciTech Connect

    Gao Yajun

    2008-08-15

    A previously established Hauser-Ernst-type extended double-complex linear system is slightly modified and used to develop an inverse scattering method for the stationary axisymmetric general symplectic gravity model. The reduction procedures in this inverse scattering method are found to be fairly simple, which makes the inverse scattering method applied fine and effective. As an application, a concrete family of soliton double solutions for the considered theory is obtained.

  11. The Rock that Hit New York

    SciTech Connect

    Meade, Roger Allen; Keksis, August Lawrence

    2016-10-03

    On January 12, 1975, a rock seemed to fall from the sky over New York State’s Schoharie County hitting the tractor of a local farmer, who was “preparing his fields for spring planting.” As the farmer later described the event to a reporter from the UFO INVESTIGATOR, the object glanced off the tractor, fell to the ground, and melted its way through a patch of ice that was two and one half inches thick. The farmer, Leonard Tillapaugh, called the county sheriff, Harvey Stoddard, who recovered the rock, noting that it “was still warm.” Why and how a sample of the rock came to Los Alamos is not known. However, it captivated a wide Laboratory audience, was subjected to rigorous testing and evaluation. Los Alamos used the scientific method in the manner promoted by Hynek. Did Los Alamos solve the mystery of the rock’s origin? Not definitively. Although the exact origin could not be determined, it was shown conclusively that the rock was not from outer space. With that said, the saga of Rock that hit New York came to an end. Nothing more was said or written about it. The principals involved have long since passed from the scene. The NICAP ceased operations in 1980. And, the rock, itself, has disappeared.

  12. Toward the equivalence of the HIT and HIT 25 in community-residing older adults.

    PubMed

    Hayslip, B; Francis, J R

    1991-06-01

    In a study by the first author wherein 102 community-residing older adults were administered the Holtzman Inkblot Technique (HIT), data collected were analyzed regarding the equivalence of the HIT and the HIT 25. Although alpha coefficients and split-half correlations were low when single-response-per-card data were analyzed, corrected Spearman-Brown coefficients were more supportive of the use of the HIT 25 with older adults. These data suggest that although a shortened form of the HIT may be useful with aged persons, research exploring the substantive bases for creating a shortened version of the HIT is nevertheless necessary.

  13. Heparin-induced thrombocytopenia (HIT II) - a drug-associated autoimmune disease.

    PubMed

    Nowak, Götz

    2009-11-01

    Autoimmune thrombocytopenia (ITP) is an acquired autoimmune disease characterised by isolated persistent thrombocytopenia and normal megakaryopoiesis. This definition also applies to heparin-induced thrombocytopenia (HIT II), a frequent side effect of heparin treatment. In HIT II, the immunogen is a coagulation active complex of heparin and platelet factor 4 (PF4). By now, diagnostics of HIT II is often material and time consuming. Three groups of patients were investigated for HIT II antibodies (HIT II-AB): 54 hospitalised stroke patients, 87 hospitalised cardiac patients, and 71 patients on chronic haemodialysis, all treated with heparin. Furthermore, 100 healthy volunteers were investigated. For detection of HIT II-AB the innovative whole blood test PADA-HIT (PADA: platelet adhesion assay) was used. PADA-HIT quantifies the interaction of IgG antibodies with FcgammaIIA receptors by comparing the activation state of platelets in citrated and heparinised whole blood. The occurrence of HIT II-AB in blood was very high with 44 % of stroke patients, 69% of cardiac patients and 38% of haemodialysis patients compared to only 15% of healthy volunteers. This demonstrates a high incidence and a rapid onset of HIT II-AB in patients being acutely treated with heparin. HIT II is one of the most frequent and severe autoimmune diseases bearing a great thrombosis risk. PADA-HIT represents an innovative diagnostic method for detection of autoimmune antibodies of IgG type that are directed against platelet factor 4 (PF4)-heparin-complex. By early and fast diagnostics and appropriate treatment severe complications of HIT II can be prevented.

  14. Mild Ptosis Correction with the Stitch Method During Incisional Double Fold Formation

    PubMed Central

    Lee, Edward Ilho

    2014-01-01

    Background Numerous methods exist for simultaneous correction of mild blepharoptosis during double eyelid surgery. These methods are generally categorized into either incisional (open) or non-incisional (suture) methods. The incisional method is commonly used for the creation of the double eyelid crease in patients with excessive or thick skin. However, concurrent open ptosis correction is often marred by the lengthy period of intraoperative adjustment, causing more swelling, a longer recovery time, and an increased risk of postoperative complications. Methods The authors have devised a new, minimally invasive technique to alleviate mild ptosis during incisional double eyelid surgery. The anterior lamella is approached through the incisional technique for the creation of a double eyelid while the posterior lamella, including Muller's and levator muscles, is approached with the suture method for Muller's plication and ptosis correction. Results The procedure described was utilized in 28 patients from June 2012 to August 2012. Postoperative asymmetry was noted in one patient who had severe preoperative conjunctival scarring. Otherwise, ptosis was corrected as planned in the rest of the cases and all of the patients were satisfied with their postoperative appearance and experienced no complications. Conclusions Our hybrid technique combines the benefits of both the incisional and suture methods, allowing for a predictable and easily reproducible correction of blepharoptosis with an aesthetically pleasing double eyelid. PMID:24511498

  15. Geometric Stitching Method for Double Cameras with Weak Convergence Geometry

    NASA Astrophysics Data System (ADS)

    Zhou, N.; He, H.; Bao, Y.; Yue, C.; Xing, K.; Cao, S.

    2017-05-01

    In this paper, a new geometric stitching method is proposed which utilizes digital elevation model (DEM)-aided block adjustment to solve relative orientation parameters for dual-camera with weak convergence geometry. A rational function model (RFM) with affine transformation is chosen as the relative orientation model. To deal with the weak geometry, a reference DEM is used in this method as an additional constraint in the block adjustment, which only calculates the planimetry coordinates of tie points (TPs). After that we can use the obtained affine transform coefficients to generate virtual grid, and update rational polynomial coefficients (RPCs) to complete the geometric stitching. Our proposed method was tested on GaoFen-2(GF-2) dual-camera panchromatic (PAN) images. The test results show that the proposed method can achieve an accuracy of better than 0.5 pixel in planimetry and have a seamless visual effect. For regions with small relief, when global DEM with 1 km grid, SRTM with 90 m grid and ASTER GDEM V2 with 30 m grid replaced DEM with 1m grid as elevation constraint it is almost no loss of accuracy. The test results proved the effectiveness and feasibility of the stitching method.

  16. Printability beyond the limits: Alternative double printing method for inkjet

    NASA Astrophysics Data System (ADS)

    Parraman, Carinna; Wang, Yu

    2009-01-01

    For artists wishing to print onto heavy weight coated and uncoated papers, the opportunity to improve colour density and saturation is always desirable. The paper presents research into methods for mixing and printing colours using the latest multi-primary inkjet printing system. The objective is to investigate the colour printability of the system printing on a fine art paper. The cellular Yule-Nielsen modified spectral Neugebauer model is employed to characterise the printing process. And the preliminary experiment result shows the effectiveness of the proposed method.

  17. 78 FR 29134 - HIT Standards Committee; Schedule for the Assessment of HIT Policy Committee Recommendations

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-17

    ... HUMAN SERVICES HIT Standards Committee; Schedule for the Assessment of HIT Policy Committee Recommendations AGENCY: Office of the National Coordinator for Health Information Technology, HHS. ACTION: Notice..., implementation, consumer technology, nationwide health information networks and privacy and security. Other...

  18. Direct-space methods in phase extension and phase refinement. IV. The double-histogram method.

    PubMed

    Refaat, L S; Tate, C; Woolfson, M M

    1996-03-01

    In the conventional histogram-matching technique for phase extension and refinement for proteins a simple one-to-one transformation is made in the protein region to modify calculated density so that it will have some target histogram in addition to solvent flattening. This work describes an investigation where the density modification takes into account not only the current calculated density at a grid point but also some characteristic of the environment of the grid point within some distance R. This characteristic can be one of the local maximum density, the local minimum density or the local variance of density. The grid points are divided into ten groups, each containing the same number of grid points, for ten different ranges of value of the local characteristic. The ten groups are modified to give different histograms, each corresponding to that obtained under the same circumstances from a structure similar to the one under investigation. This process is referred to as the double-histogram matching method. Other processes which have been investigated are the weighting of structure factors when calculating maps with estimated phases and also the use of a factor to dampen the change of density and so control the refinement process. Two protein structures were used in numerical trials, RNApl [Bezborodova, Ermekbaeva, Shlyapnikov, Polyakov & Bezborodov (1988). Biokhimiya, 53, 965-973] and 2-Zn insulin [Baker, Blundell, Cutfield, Cutfield, Dodson, Dodson, Hodgkin, Hubbard, lsaacs, Reynolds, Sakabe, Sakabe & Vijayan (1988). Philos. Trans. R. Soc. London Ser. B, 319, 456--469]. Comparison of the proposed procedures with the normal histogram-matching technique without structure-factor weighting or damping gives mean phase errors reduced by up to 10 degrees with map correlation coefficients improved by as much as 0.14. Compared to the normal histogram used with weighting of structure factors and damping, the improvement due to the use of the double-histogram method is

  19. The double-assignment method for the exponential chaotic tabu search in quadratic assignment problems

    NASA Astrophysics Data System (ADS)

    Shibata, Kazuaki; Horio, Yoshihiko; Aihara, Kazuyuki

    The quadratic assignment problem (QAP) is one of the NP-hard combinatorial optimization problems. An exponential chaotic tabu search using a 2-opt algorithm driven by chaotic neuro-dynamics has been proposed as one heuristic method for solving QAPs. In this paper we first propose a new local search, the double-assignment method, suitable for the exponential chaotic tabu search, which adopts features of the Lin-Kernighan algorithm. We then introduce chaotic neuro-dynamics into the double-assignment method to propose a novel exponential chaotic tabu search. We further improve the proposed exponential chaotic tabu search with the double-assignment method by enhancing the effect of chaotic neuro-dynamics.

  20. Applications of Biophysics in High-Throughput Screening Hit Validation.

    PubMed

    Genick, Christine Clougherty; Barlier, Danielle; Monna, Dominique; Brunner, Reto; Bé, Céline; Scheufler, Clemens; Ottl, Johannes

    2014-06-01

    For approximately a decade, biophysical methods have been used to validate positive hits selected from high-throughput screening (HTS) campaigns with the goal to verify binding interactions using label-free assays. By applying label-free readouts, screen artifacts created by compound interference and fluorescence are discovered, enabling further characterization of the hits for their target specificity and selectivity. The use of several biophysical methods to extract this type of high-content information is required to prevent the promotion of false positives to the next level of hit validation and to select the best candidates for further chemical optimization. The typical technologies applied in this arena include dynamic light scattering, turbidometry, resonance waveguide, surface plasmon resonance, differential scanning fluorimetry, mass spectrometry, and others. Each technology can provide different types of information to enable the characterization of the binding interaction. Thus, these technologies can be incorporated in a hit-validation strategy not only according to the profile of chemical matter that is desired by the medicinal chemists, but also in a manner that is in agreement with the target protein's amenability to the screening format. Here, we present the results of screening strategies using biophysics with the objective to evaluate the approaches, discuss the advantages and challenges, and summarize the benefits in reference to lead discovery. In summary, the biophysics screens presented here demonstrated various hit rates from a list of ~2000 preselected, IC50-validated hits from HTS (an IC50 is the inhibitor concentration at which 50% inhibition of activity is observed). There are several lessons learned from these biophysical screens, which will be discussed in this article.

  1. Fabrication of double layer optical tissue phantom by spin coating method: mimicking epidermal and dermal layer

    NASA Astrophysics Data System (ADS)

    Park, Jihoon; Bae, Yunjin; Bae, Youngwoo; Kang, Heesung; Lee, Kyoung-Joung; Jung, Byungjo

    2013-02-01

    Methodologies to fabricate a solid optical tissue phantom (OTP) mimicking epidermal thin-layer have been developed for in vitro human skin experiment. However, there are cumbersome and time-consuming efforts in fabrication process such as a custom-made casting and calculation of solvent volume before curing process. In a previous study, we introduced a new methodology based on spin coating method (SCM) which is utilized to fabricate a thin-layer OTP analogous to epidermal thickness. In this study, a double layer solid OTP which has epidermal and dermal layers was fabricated to mimic the morphological and optical similarity of human tissue. The structural characteristic and optical properties of fabricated double layer OTP were measured using optical coherence tomography and inverse adding doubling algorithms, respectively. It is expected that the new methodology based on the SCM may be usefully used in the fabrication of double layer OTP.

  2. Developing Health Information Technology (HIT) Programs and HIT Curriculum: The Southern Polytechnic State University Experience

    ERIC Educational Resources Information Center

    Zhang, Chi; Reichgelt, Han; Rutherfoord, Rebecca H.; Wang, Andy Ju An

    2014-01-01

    Health Information Technology (HIT) professionals are in increasing demand as healthcare providers need help in the adoption and meaningful use of Electronic Health Record (EHR) systems while the HIT industry needs workforce skilled in HIT and EHR development. To respond to this increasing demand, the School of Computing and Software Engineering…

  3. Developing Health Information Technology (HIT) Programs and HIT Curriculum: The Southern Polytechnic State University Experience

    ERIC Educational Resources Information Center

    Zhang, Chi; Reichgelt, Han; Rutherfoord, Rebecca H.; Wang, Andy Ju An

    2014-01-01

    Health Information Technology (HIT) professionals are in increasing demand as healthcare providers need help in the adoption and meaningful use of Electronic Health Record (EHR) systems while the HIT industry needs workforce skilled in HIT and EHR development. To respond to this increasing demand, the School of Computing and Software Engineering…

  4. Hitting Is Contagious: Experience and Action Induction

    ERIC Educational Resources Information Center

    Gray, Rob; Beilock, Sian L.

    2011-01-01

    In baseball, it is believed that "hitting is contagious," that is, probability of success increases if the previous few batters get a hit. Could this effect be partially explained by action induction--that is, the tendency to perform an action related to one that has just been observed? A simulation was used to investigate the effect of inducing…

  5. Hitting Is Contagious: Experience and Action Induction

    ERIC Educational Resources Information Center

    Gray, Rob; Beilock, Sian L.

    2011-01-01

    In baseball, it is believed that "hitting is contagious," that is, probability of success increases if the previous few batters get a hit. Could this effect be partially explained by action induction--that is, the tendency to perform an action related to one that has just been observed? A simulation was used to investigate the effect of inducing…

  6. Method based on the double sideband technique for the dynamic tracking of micrometric particles

    NASA Astrophysics Data System (ADS)

    Ramirez, Claudio; Lizana, Angel; Iemmi, Claudio; Campos, Juan

    2016-06-01

    Digital holography (DH) methods are of interest in a large number of applications. Recently, the double sideband (DSB) technique was proposed, which is a DH based method that, by using double filtering, provides reconstructed images without distortions and is free of twin images by using an in-line configuration. In this work, we implement a method for the investigation of the mobility of particles based on the DSB technique. Particle holographic images obtained using the DSB method are processed with digital picture recognition methods, allowing us to accurately track the spatial position of particles. The dynamic nature of the method is achieved experimentally by using a spatial light modulator. The suitability of the proposed tracking method is validated by determining the trajectory and velocity described by glass microspheres in movement.

  7. A new hybrid double divisor ratio spectra method for the analysis of ternary mixtures.

    PubMed

    Youssef, Rasha M; Maher, Hadir M

    2008-10-01

    A new spectrophotometric method was developed for the simultaneous determination of ternary mixtures, without prior separation steps. This method is based on convolution of the double divisor ratio spectra, obtained by dividing the absorption spectrum of the ternary mixture by a standard spectrum of two of the three compounds in the mixture, using combined trigonometric Fourier functions. The magnitude of the Fourier function coefficients, at either maximum or minimum points, is related to the concentration of each drug in the mixture. The mathematical explanation of the procedure is illustrated. The method was applied for the assay of a model mixture consisting of isoniazid (ISN), rifampicin (RIF) and pyrazinamide (PYZ) in synthetic mixtures, commercial tablets and human urine samples. The developed method was compared with the double divisor ratio spectra derivative method (DDRD) and derivative ratio spectra-zero-crossing method (DRSZ). Linearity, validation, accuracy, precision, limits of detection, limits of quantitation, and other aspects of analytical validation are included in the text.

  8. A new hybrid double divisor ratio spectra method for the analysis of ternary mixtures

    NASA Astrophysics Data System (ADS)

    Youssef, Rasha M.; Maher, Hadir M.

    2008-10-01

    A new spectrophotometric method was developed for the simultaneous determination of ternary mixtures, without prior separation steps. This method is based on convolution of the double divisor ratio spectra, obtained by dividing the absorption spectrum of the ternary mixture by a standard spectrum of two of the three compounds in the mixture, using combined trigonometric Fourier functions. The magnitude of the Fourier function coefficients, at either maximum or minimum points, is related to the concentration of each drug in the mixture. The mathematical explanation of the procedure is illustrated. The method was applied for the assay of a model mixture consisting of isoniazid (ISN), rifampicin (RIF) and pyrazinamide (PYZ) in synthetic mixtures, commercial tablets and human urine samples. The developed method was compared with the double divisor ratio spectra derivative method (DDRD) and derivative ratio spectra-zero-crossing method (DRSZ). Linearity, validation, accuracy, precision, limits of detection, limits of quantitation, and other aspects of analytical validation are included in the text.

  9. Biophysics: for HTS hit validation, chemical lead optimization, and beyond.

    PubMed

    Genick, Christine C; Wright, S Kirk

    2017-09-01

    There are many challenges to the drug discovery process, including the complexity of the target, its interactions, and how these factors play a role in causing the disease. Traditionally, biophysics has been used for hit validation and chemical lead optimization. With its increased throughput and sensitivity, biophysics is now being applied earlier in this process to empower target characterization and hit finding. Areas covered: In this article, the authors provide an overview of how biophysics can be utilized to assess the quality of the reagents used in screening assays, to validate potential tool compounds, to test the integrity of screening assays, and to create follow-up strategies for compound characterization. They also briefly discuss the utilization of different biophysical methods in hit validation to help avoid the resource consuming pitfalls caused by the lack of hit overlap between biophysical methods. Expert opinion: The use of biophysics early on in the drug discovery process has proven crucial to identifying and characterizing targets of complex nature. It also has enabled the identification and classification of small molecules which interact in an allosteric or covalent manner with the target. By applying biophysics in this manner and at the early stages of this process, the chances of finding chemical leads with novel mechanisms of action are increased. In the future, focused screens with biophysics as a primary readout will become increasingly common.

  10. A double expansion method for the frequency response of finite-length beams with periodic parameters

    NASA Astrophysics Data System (ADS)

    Ying, Z. G.; Ni, Y. Q.

    2017-03-01

    A double expansion method for the frequency response of finite-length beams with periodic distribution parameters is proposed. The vibration response of the beam with spatial periodic parameters under harmonic excitations is studied. The frequency response of the periodic beam is the function of parametric period and then can be expressed by the series with the product of periodic and non-periodic functions. The procedure of the double expansion method includes the following two main steps: first, the frequency response function and periodic parameters are expanded by using identical periodic functions based on the extension of the Floquet-Bloch theorem, and the period-parametric differential equation for the frequency response is converted into a series of linear differential equations with constant coefficients; second, the solutions to the linear differential equations are expanded by using modal functions which satisfy the boundary conditions, and the linear differential equations are converted into algebraic equations according to the Galerkin method. The expansion coefficients are obtained by solving the algebraic equations and then the frequency response function is finally determined. The proposed double expansion method can uncouple the effects of the periodic expansion and modal expansion so that the expansion terms are determined respectively. The modal number considered in the second expansion can be reduced remarkably in comparison with the direct expansion method. The proposed double expansion method can be extended and applied to the other structures with periodic distribution parameters for dynamics analysis. Numerical results on the frequency response of the finite-length periodic beam with various parametric wave numbers and wave amplitude ratios are given to illustrate the effective application of the proposed method and the new frequency response characteristics, including the parameter-excited modal resonance, doubling-peak frequency response

  11. 42 CFR 495.340 - As-needed HIT PAPD update and as-needed HIT IAPD update requirements.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 42 Public Health 5 2010-10-01 2010-10-01 false As-needed HIT PAPD update and as-needed HIT IAPD update requirements. 495.340 Section 495.340 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES...-needed HIT PAPD update and as-needed HIT IAPD update requirements. Each State must submit a HIT...

  12. A FORTRAN Program for Computing Refractive Index Using the Double Variation Method.

    ERIC Educational Resources Information Center

    Blanchard, Frank N.

    1984-01-01

    Describes a computer program which calculates a best estimate of refractive index and dispersion from a large number of observations using the double variation method of measuring refractive index along with Sellmeier constants of the immersion oils. Program listing with examples will be provided on written request to the author. (Author/JM)

  13. Error analysis of mixed finite element methods for wave propagation in double negative metamaterials

    NASA Astrophysics Data System (ADS)

    Li, Jichun

    2007-12-01

    In this paper, we develop both semi-discrete and fully discrete mixed finite element methods for modeling wave propagation in three-dimensional double negative metamaterials. Optimal error estimates are proved for Nedelec spaces under the assumption of smooth solutions. To our best knowledge, this is the first error analysis obtained for Maxwell's equations when metamaterials are involved.

  14. The Effect of Three Methods of Supporting the Double Bass on Muscle Tension.

    ERIC Educational Resources Information Center

    Dennis, Allan

    1984-01-01

    Using different methods of holding the double bass, college students performed Beethoven's Symphony No. 9. Audio recordings of performance were rated. Muscle tension readings from the left arm, right arm, upper back, and lower back were taken, using electromyography. Results suggest nonsignificant differences in both performance quality and muscle…

  15. Service life of fence posts treated by double-diffusion methods

    Treesearch

    Donald C. Markstrom; Lee R. Gjovik

    1999-01-01

    Service-life tests indicate that Engelmann spruce, lodgepole pine, and Rocky Mountain Douglas-fir fence posts treated by double-diffusion methods performed excellently after field exposure of 30 years with no failures. The test site was located in the semiarid Central Plains near Nunn, Colorado. Although Engelmann spruce posts generally defy treatment by other treating...

  16. 42 CFR 495.344 - Approval of the State Medicaid HIT plan, the HIT PAPD and update, the HIT IAPD and update, and...

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 42 Public Health 5 2012-10-01 2012-10-01 false Approval of the State Medicaid HIT plan, the HIT... Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... Requirements Specific to the Medicaid Program § 495.344 Approval of the State Medicaid HIT plan, the HIT PAPD...

  17. 42 CFR 495.344 - Approval of the State Medicaid HIT plan, the HIT PAPD and update, the HIT IAPD and update, and...

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 42 Public Health 5 2011-10-01 2011-10-01 false Approval of the State Medicaid HIT plan, the HIT... Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... Requirements Specific to the Medicaid Program § 495.344 Approval of the State Medicaid HIT plan, the HIT PAPD...

  18. 42 CFR 495.344 - Approval of the State Medicaid HIT plan, the HIT PAPD and update, the HIT IAPD and update, and...

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 42 Public Health 5 2014-10-01 2014-10-01 false Approval of the State Medicaid HIT plan, the HIT... Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... Requirements Specific to the Medicaid Program § 495.344 Approval of the State Medicaid HIT plan, the HIT PAPD...

  19. 42 CFR 495.344 - Approval of the State Medicaid HIT plan, the HIT PAPD and update, the HIT IAPD and update, and...

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 42 Public Health 5 2013-10-01 2013-10-01 false Approval of the State Medicaid HIT plan, the HIT... Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... Requirements Specific to the Medicaid Program § 495.344 Approval of the State Medicaid HIT plan, the HIT PAPD...

  20. Mean centering of double divisor ratio spectra, a novel spectrophotometric method for analysis of ternary mixtures.

    PubMed

    Hassan, Said A; Elzanfaly, Eman S; Salem, Maissa Y; El-Zeany, Badr A

    2016-01-15

    A novel spectrophotometric method was developed for determination of ternary mixtures without previous separation, showing significant advantages over conventional methods. The new method is based on mean centering of double divisor ratio spectra. The mathematical explanation of the procedure is illustrated. The method was evaluated by determination of model ternary mixture and by the determination of Amlodipine (AML), Aliskiren (ALI) and Hydrochlorothiazide (HCT) in laboratory prepared mixtures and in a commercial pharmaceutical preparation. For proper presentation of the advantages and applicability of the new method, a comparative study was established between the new mean centering of double divisor ratio spectra (MCDD) and two similar methods used for analysis of ternary mixtures, namely mean centering (MC) and double divisor of ratio spectra-derivative spectrophotometry (DDRS-DS). The method was also compared with a reported one for analysis of the pharmaceutical preparation. The method was validated according to the ICH guidelines and accuracy, precision, repeatability and robustness were found to be within the acceptable limits.

  1. Mean centering of double divisor ratio spectra, a novel spectrophotometric method for analysis of ternary mixtures

    NASA Astrophysics Data System (ADS)

    Hassan, Said A.; Elzanfaly, Eman S.; Salem, Maissa Y.; El-Zeany, Badr A.

    2016-01-01

    A novel spectrophotometric method was developed for determination of ternary mixtures without previous separation, showing significant advantages over conventional methods. The new method is based on mean centering of double divisor ratio spectra. The mathematical explanation of the procedure is illustrated. The method was evaluated by determination of model ternary mixture and by the determination of Amlodipine (AML), Aliskiren (ALI) and Hydrochlorothiazide (HCT) in laboratory prepared mixtures and in a commercial pharmaceutical preparation. For proper presentation of the advantages and applicability of the new method, a comparative study was established between the new mean centering of double divisor ratio spectra (MCDD) and two similar methods used for analysis of ternary mixtures, namely mean centering (MC) and double divisor of ratio spectra-derivative spectrophotometry (DDRS-DS). The method was also compared with a reported one for analysis of the pharmaceutical preparation. The method was validated according to the ICH guidelines and accuracy, precision, repeatability and robustness were found to be within the acceptable limits.

  2. Optical spectrosopy of HiTS supernovae

    NASA Astrophysics Data System (ADS)

    Anderson, J.; Forster, F.; Smith, C.; Vivas, K.; Pignata, G.; Olivares, F.; Hamuy, M.; Martin, J. San; Maureira, J. C.; Cabrera, G.; Gonzalez-Gaitan, S.; Galbany, L.; Bufano, F.; de Jaeger, T.; Hsiao, E.; Munoz, R.; Vera, E.

    2015-04-01

    We report optical wavelength spectroscopy obtained using the Goodman instrument mounted on the SOAR at CTIO on UT 2015-03-30, for two supernovae discovered by HiTS, the High Cadence Transient Survey (see ATELs #7289, #7290).

  3. Mining Preferred Traversal Paths with HITS

    NASA Astrophysics Data System (ADS)

    Yeh, Jieh-Shan; Lin, Ying-Lin; Chen, Yu-Cheng

    Web usage mining can discover useful information hidden in web logs data. However, many previous algorithms do not consider the structure of web pages, but regard all web pages with the same importance. This paper utilizes HITS values and PNT preferences as measures to mine users' preferred traversal paths. Wë structure mining uses HITS (hypertext induced topic selection) to rank web pages. PNT (preferred navigation tree) is an algorithm that finds users' preferred navigation paths. This paper introduces the Preferred Navigation Tree with HITS (PNTH) algorithm, which is an extension of PNT. This algorithm uses the concept of PNT and takes into account the relationships among web pages using HITS algorithm. This algorithm is suitable for E-commerce applications such as improving web site design and web server performance.

  4. A planar lens in LiNbO3 produced by the double proton exchange method

    NASA Astrophysics Data System (ADS)

    Volkov, V. A.; Gan'shin, V. A.; Kvasha, M. Iu.; Korkishko, Iu. N.; Fedotov, S. M.

    1989-08-01

    Experiments are reported in which a waveguide lens in lithium niobate was produced by the method of double proton-lithium exchange. In this process, the formation of a Ti:LiNbO3 light waveguide is replaced by the formation of an H:LiNbO3 waveguide of identical parameters. The performance characteristics of the waveguide lenses fabricated by the method proposed here are as good as those of TIPE lenses.

  5. Double Fourier Harmonic Balance Method for Nonlinear Oscillators by Means of Bessel Series

    DTIC Science & Technology

    2014-10-16

    Double Fourier harmonic balance method for nonlinear oscillators by means of Bessel series T.C. Lipscombe∗1 and C.E. Mungan†2 1Catholic University of...expressed in terms of a Bessel series, and the sums of many such series are known or can be developed. The method is illustrated for five different... Bessel series, work-energy theorem, nonlinear oscillator, pendulum. 1 Introduction Nonlinear oscillators are ubiquitous in physical and engineering

  6. Two-Particle Coulomb Green Function Method with Projected Potential: Application to He Double Photoionization

    NASA Astrophysics Data System (ADS)

    Argenti, Luca; Colle, Renato

    2009-08-01

    A new method to compute fully differential double photoionization cross sections of atoms has been devised and fully developed for two-electron systems. The method exploits the Green function for two noninteracting electrons in the field of a nuclear charge to infer the effects of the residual potential projected on a set of L2-basis functions. Test calculations on helium at 100 eV excess energy indicate that, as long as the relevant part of the interaction potential is accounted for, the fully differential cross sections calculated in acceleration and velocity gauges converge in absolute value and reproduce measured angular distributions with a tunable accuracy. Generalization of the method to treat double photoionization of many-electron atoms is sketched.

  7. Two-particle coulomb Green function method with projected potential: application to He double photoionization.

    PubMed

    Argenti, Luca; Colle, Renato

    2009-12-31

    A new method to compute fully differential double photoionization cross sections of atoms has been devised and fully developed for two-electron systems. The method exploits the Green function for two noninteracting electrons in the field of a nuclear charge to infer the effects of the residual potential projected on a set of L(2)-basis functions. Test calculations on helium at 100 eV excess energy indicate that, as long as the relevant part of the interaction potential is accounted for, the fully differential cross sections calculated in acceleration and velocity gauges converge in absolute value and reproduce measured angular distributions with a tunable accuracy. Generalization of the method to treat double photoionization of many-electron atoms is sketched.

  8. A joint sparse representation-based method for double-trial evoked potentials estimation.

    PubMed

    Yu, Nannan; Liu, Haikuan; Wang, Xiaoyan; Lu, Hanbing

    2013-12-01

    In this paper, we present a novel approach to solving an evoked potentials estimating problem. Generally, the evoked potentials in two consecutive trials obtained by repeated identical stimuli of the nerves are extremely similar. In order to trace evoked potentials, we propose a joint sparse representation-based double-trial evoked potentials estimation method, taking full advantage of this similarity. The estimation process is performed in three stages: first, according to the similarity of evoked potentials and the randomness of a spontaneous electroencephalogram, the two consecutive observations of evoked potentials are considered as superpositions of the common component and the unique components; second, making use of their characteristics, the two sparse dictionaries are constructed; and finally, we apply the joint sparse representation method in order to extract the common component of double-trial observations, instead of the evoked potential in each trial. A series of experiments carried out on simulated and human test responses confirmed the superior performance of our method.

  9. Double freeform surfaces design for laser beam shaping with Monge-Ampère equation method

    NASA Astrophysics Data System (ADS)

    Zhang, Yaqin; Wu, Rengmao; Liu, Peng; Zheng, Zhenrong; Li, Haifeng; Liu, Xu

    2014-11-01

    This paper presents a method for designing double freeform surfaces to simultaneously control the intensity distribution and phase profile of the laser beam. Based on Snell’s law, the conservation law of energy and the constraint imposed on the optical path length between the input and output wavefronts, the double surfaces design is converted into an elliptic Monge-Ampère (MA) equation with a nonlinear boundary problem. A generalized approach is introduced to find the numerical solution of the design model. Two different layouts of the beam shaping system are introduced and detailed comparisons are also made between the two layouts. Design examples are given and the results indicate that good matching is achieved by the MA method with more than 98% of the energy efficiency. The MA method proposed in this paper provides a reasonably good means for laser beam shaping.

  10. Application of magnetic printing method to hard-disk media with double recording layers

    NASA Astrophysics Data System (ADS)

    Ono, Takuya; Kuboki, Yoshiyuki; Ajishi, Yoshifumi; Saito, Akira

    2003-05-01

    The magnetic printing method, which can duplicate soft magnetic patterns containing digital information such as servosignals formed on a master disk onto recording media, enables signals to be written to hard-disk media having high coercivities above 6000 Oe. We propose the application of the magnetic printing method to a hard-disk medium having double recording layers, one layer of which has high coercivity and is to be printed with digital information. This double recording layer medium is a hard-disk medium that has a magnetic read-only-memory (MROM) layer. In this study, we demonstrated a method for printing to this medium, which has MROM, and discussed the magnetic properties and recording performances of this medium.

  11. Optimal morphological hit-or-miss filtering of gray-level images

    NASA Astrophysics Data System (ADS)

    Dougherty, Edward R.

    1993-05-01

    The binary hit-or-miss transform is applied to filter digital gray-scale signals. This is accomplished by applying a union of hit-or-miss transforms to an observed signal's umbra and then taking the surface of the filtered umbra as the estimate of the ideal signal. The hit-or-miss union is constructed to provide the optimal mean-absolute-error filter for both the ideal signal and its umbra. The method is developed in detail for thinning hit-or-miss filters and applies at once to the dual thickening filters. It requires the output of the umbra filter to be an umbra, which in general is not true. A key aspect of the paper is the complete characterization of umbra-preserving union-of-hit-or-miss thinning and thickening filters. Taken together, the mean-absolute-error theory and the umbra-preservation characterization provide a full characterization of binary hit-or-miss filtering as applied to digital gray-scale signals. The theory is at once applicable to hit-or-miss filtering of digital gray-scale signals via the three- dimensional binary hit-or-miss transform.

  12. Coupled double-distribution-function lattice Boltzmann method for the compressible Navier-Stokes equations.

    PubMed

    Li, Q; He, Y L; Wang, Y; Tao, W Q

    2007-11-01

    A coupled double-distribution-function lattice Boltzmann method is developed for the compressible Navier-Stokes equations. Different from existing thermal lattice Boltzmann methods, this method can recover the compressible Navier-Stokes equations with a flexible specific-heat ratio and Prandtl number. In the method, a density distribution function based on a multispeed lattice is used to recover the compressible continuity and momentum equations, while the compressible energy equation is recovered by an energy distribution function. The energy distribution function is then coupled to the density distribution function via the thermal equation of state. In order to obtain an adjustable specific-heat ratio, a constant related to the specific-heat ratio is introduced into the equilibrium energy distribution function. Two different coupled double-distribution-function lattice Boltzmann models are also proposed in the paper. Numerical simulations are performed for the Riemann problem, the double-Mach-reflection problem, and the Couette flow with a range of specific-heat ratios and Prandtl numbers. The numerical results are found to be in excellent agreement with analytical and/or other solutions.

  13. Novel Microdilution Method to Assess Double and Triple Antibiotic Combination Therapy In Vitro.

    PubMed

    El-Azizi, Mohamed

    2016-01-01

    An in vitro microdilution method was developed to assess double and triple combinations of antibiotics. Five antibiotics including ciprofloxacin, amikacin, ceftazidime, piperacillin, and imipenem were tested against 10 clinical isolates of Pseudomonas aeruginosa. Each isolate was tested against ten double and nine triple combinations of the antibiotics. A 96-well plate was used to test three antibiotics, each one alone and in double and triple combinations against each isolate. The minimum bacteriostatic and bactericidal concentrations in combination were determined with respect to the most potent antibiotic. An Interaction Code (IC) was generated for each combination, where a numerical value was designated based on the 2-fold increase or decrease in the MICs with respect to the most potent antibiotic. The results of the combinations were verified by time-kill assay at constant concentrations of the antibiotics and in a chemostat. Only 13% of the double combinations were synergistic, whereas 5% showed antagonism. Forty-three percent of the triple combinations were synergistic with no antagonism observed, and 100% synergism was observed in combination of ciprofloxacin, amikacin, and ceftazidime. The presented protocol is simple and fast and can help the clinicians in the early selection of the effective antibiotic therapy for treatment of severe infections.

  14. Temperature measurement of wood flame based on the double line method of atomic emission spectra

    NASA Astrophysics Data System (ADS)

    Hao, Xiaojian; Liu, Zhenhua; Sang, Tao

    2016-01-01

    Aimed at the testing requirement of the transient high temperature in explosion field and the bore of barrel weapon, the temperature measurement system of double line of atomic emission spectrum was designed, the method of flame spectrum testing system were used for experimental analysis. The experimental study of wood burning spectra was done with flame spectrum testing system. The measured spectra contained atomic emission spectra of the elements K, Na, and the excitation ease of two kinds atomic emission spectra was analyzed. The temperature was calculated with two spectral lines of K I 766.5nm and 769.9nm. The results show that, compared with Na, the excitation temperature of K atomic emission spectra is lower. By double line method, the temperature of wood burning is 1040K, and error is 3.7%.

  15. Double tracer autoradiographic method for sequential evaluation of regional cerebral perfusion

    SciTech Connect

    Matsuda, H.; Tsuji, S.; Oba, H.; Kinuya, K.; Terada, H.; Sumiya, H.; Shiba, K.; Mori, H.; Hisada, K.; Maeda, T. )

    1989-01-01

    A new double tracer autoradiographic method for the sequential evaluation of altered regional cerebral perfusion in the same animal is presented. This method is based on the sequential injection of two tracers, {sup 99m}Tc-hexamethylpropyleneamine oxime and N-isopropyl-({sup 125}I)p-iodoamphetamine. This method is validated in the assessment of brovincamine effects on regional cerebral perfusion in an experimental model of chronic brain ischemia in the rat. The drug enhanced perfusion recovery in low-flow areas, selectively in surrounding areas of infarction. The results suggest that this technique is of potential use in the study of neuropharmacological effects applied during the experiment.

  16. HIT: time to end behavioral health discrimination.

    PubMed

    Rosenberg, Linda

    2012-10-01

    While the Health Information Technology for Economic and Clinical Health Act, enacted as part of the American Recovery and Reinvestment Act of 2009, provided $20.6 billion for incentive payments to support the adoption and meaningful use of health information technology (HIT), behavioral health organizations were not eligible to receive facility payments. The consequences of excluding behavioral health from HIT incentive payments are found in the results of the "HIT Adoption and Meaningful Use Readiness in Community Behavioral Health" survey. The survey found that only 2% of community behavioral health organizations are able to meet federal meaningful use (MU) requirements-compare this to the 27% of Federally Qualified Health Centers and 20% of hospitals that already meet some level of MU requirements. Behavioral health organizations, serving more than eight million adults, children, and families with mental illnesses and addiction disorders, are ready and eager to adopt HIT to meet the goals of better healthcare, better health, and lower costs. But reaching these goals may prove impossible unless behavioral health achieves "parity" within healthcare and receives resources for the adoption of HIT.

  17. Optical Diagnostics on HIT-SI3

    NASA Astrophysics Data System (ADS)

    Everson, Christopher; Jarboe, Thomas; Morgan, Kyle

    2016-10-01

    Interferometry and Thomson Scattering are implemented on the HIT-SI3 (Helicity Injected Torus - Steady Inductive 3) device to provide time resolved measurements of electron density and spatially resolved measurements of electron temperature, respectively. HIT-SI3 is a modification of the original HIT-SI apparatus that uses three injectors instead of two. The scientific aim of HIT-SI3 is to develop a deeper understanding of how injector behavior and interactions influence current drive and spheromak stability. The interferometer system makes use of an intermediate frequency between two parallel 184.3 μm Far-Infrared (FIR) laser cavities which are optically pumped by a CO2 laser. The phase shift in this beat frequency due to the plasma index of refraction is used to calculate the line-integrated electron density. To measure the electron temperature, Thomson Scattered light from a 20 J (1 GW pulse) Ruby laser off of free electrons in the HIT-SI3 plasma is measured simultaneously at four locations across the spheromak (nominally 23 cm minor radius). Polychromators bin the collected light into 3 spectral bands to detect the relative level of scattering. Work supported by the D.O.E.

  18. A Double-difference Earthquake location algorithm: Method and application to the Northern Hayward Fault, California

    USGS Publications Warehouse

    Waldhauser, F.; Ellsworth, W.L.

    2000-01-01

    We have developed an efficient method to determine high-resolution hypocenter locations over large distances. The location method incorporates ordinary absolute travel-time measurements and/or cross-correlation P-and S-wave differential travel-time measurements. Residuals between observed and theoretical travel-time differences (or double-differences) are minimized for pairs of earthquakes at each station while linking together all observed event-station pairs. A least-squares solution is found by iteratively adjusting the vector difference between hypocentral pairs. The double-difference algorithm minimizes errors due to unmodeled velocity structure without the use of station corrections. Because catalog and cross-correlation data are combined into one system of equations, interevent distances within multiplets are determined to the accuracy of the cross-correlation data, while the relative locations between multiplets and uncorrelated events are simultaneously determined to the accuracy of the absolute travel-time data. Statistical resampling methods are used to estimate data accuracy and location errors. Uncertainties in double-difference locations are improved by more than an order of magnitude compared to catalog locations. The algorithm is tested, and its performance is demonstrated on two clusters of earthquakes located on the northern Hayward fault, California. There it colapses the diffuse catalog locations into sharp images of seismicity and reveals horizontal lineations of hypocenter that define the narrow regions on the fault where stress is released by brittle failure.

  19. SHIELD-HIT12A - a Monte Carlo particle transport program for ion therapy research

    NASA Astrophysics Data System (ADS)

    Bassler, N.; Hansen, D. C.; Lühr, A.; Thomsen, B.; Petersen, J. B.; Sobolevsky, N.

    2014-03-01

    Purpose: The Monte Carlo (MC) code SHIELD-HIT simulates the transport of ions through matter. Since SHIELD-HIT08 we added numerous features that improves speed, usability and underlying physics and thereby the user experience. The "-A" fork of SHIELD-HIT also aims to attach SHIELD-HIT to a heavy ion dose optimization algorithm to provide MC-optimized treatment plans that include radiobiology. Methods: SHIELD-HIT12A is written in FORTRAN and carefully retains platform independence. A powerful scoring engine is implemented scoring relevant quantities such as dose and track-average LET. It supports native formats compatible with the heavy ion treatment planning system TRiP. Stopping power files follow ICRU standard and are generated using the libdEdx library, which allows the user to choose from a multitude of stopping power tables. Results: SHIELD-HIT12A runs on Linux and Windows platforms. We experienced that new users quickly learn to use SHIELD-HIT12A and setup new geometries. Contrary to previous versions of SHIELD-HIT, the 12A distribution comes along with easy-to-use example files and an English manual. A new implementation of Vavilov straggling resulted in a massive reduction of computation time. Scheduled for later release are CT import and photon-electron transport. Conclusions: SHIELD-HIT12A is an interesting alternative ion transport engine. Apart from being a flexible particle therapy research tool, it can also serve as a back end for a MC ion treatment planning system. More information about SHIELD-HIT12A and a demo version can be found on http://www.shieldhit.org.

  20. High resolution image reconstruction method for a double-plane PET system with changeable spacing

    NASA Astrophysics Data System (ADS)

    Gu, Xiao-Yue; Zhou, Wei; Li, Lin; Wei, Long; Yin, Peng-Fei; Shang, Lei-Min; Yun, Ming-Kai; Lu, Zhen-Rui; Huang, Xian-Chao

    2016-05-01

    Breast-dedicated positron emission tomography (PET) imaging techniques have been developed in recent years. Their capacities to detect millimeter-sized breast tumors have been the subject of many studies. Some of them have been confirmed with good results in clinical applications. With regard to biopsy application, a double-plane detector arrangement is practicable, as it offers the convenience of breast immobilization. However, the serious blurring effect of the double-plane PET, with changeable spacing for different breast sizes, should be studied. We investigated a high resolution reconstruction method applicable for a double-plane PET. The distance between the detector planes is changeable. Geometric and blurring components were calculated in real-time for different detector distances, and accurate geometric sensitivity was obtained with a new tube area model. Resolution recovery was achieved by estimating blurring effects derived from simulated single gamma response information. The results showed that the new geometric modeling gave a more finite and smooth sensitivity weight in the double-plane PET. The blurring component yielded contrast recovery levels that could not be reached without blurring modeling, and improved visual recovery of the smallest spheres and better delineation of the structures in the reconstructed images were achieved with the blurring component. Statistical noise had lower variance at the voxel level with blurring modeling at matched resolution, compared to without blurring modeling. In distance-changeable double-plane PET, finite resolution modeling during reconstruction achieved resolution recovery, without noise amplification. Supported by Knowledge Innovation Project of The Chinese Academy of Sciences (KJCX2-EW-N06)

  1. Hitting is contagious: experience and action induction.

    PubMed

    Gray, Rob; Beilock, Sian L

    2011-03-01

    In baseball, it is believed that "hitting is contagious," that is, probability of success increases if the previous few batters get a hit. Could this effect be partially explained by action induction--that is, the tendency to perform an action related to one that has just been observed? A simulation was used to investigate the effect of inducing stimuli on batting performance for more-experienced (ME) and less-experienced (LE) baseball players. Three types of inducing stimuli were compared with a no-induction condition: action (a simulated ball traveling from home plate into left, right, or center field), outcome (a ball resting in either left, right, or center field), and verbal (the word "left", "center", or "right"). For both ME and LE players, fewer pitchers were required for a successful hit in the action condition. For ME players, there was a significant relationship between the inducing stimulus direction and hit direction for both the action and outcome prompts. For LE players, the prompt only had a significant effect on batting performance in the action condition, and the magnitude of the effect was significantly smaller than for ME. The effect of the inducing stimulus decreased as the delay (i.e., no. of pitches between prompt and hit) increased, with the effect being eliminated after roughly 4 pitches for ME and 2 pitches for LE. It is proposed that the differences in the magnitude and time course of action induction as a function of experience occurred because ME have more well-developed perceptual-motor representations for directional hitting.

  2. Earthquake hypocenter relocation using double difference method in East Java and surrounding areas

    SciTech Connect

    C, Aprilia Puspita; Nugraha, Andri Dian; Puspito, Nanang T

    2015-04-24

    Determination of precise hypocenter location is very important in order to provide information about subsurface fault plane and for seismic hazard analysis. In this study, we have relocated hypocenter earthquakes in Eastern part of Java and surrounding areas from local earthquake data catalog compiled by Meteorological, Climatological, and Geophysical Agency of Indonesia (MCGA) in time period 2009-2012 by using the double-difference method. The results show that after relocation processes, there are significantly changes in position and orientation of earthquake hypocenter which is correlated with the geological setting in this region. We observed indication of double seismic zone at depths of 70-120 km within the subducting slab in south of eastern part of Java region. Our results will provide useful information for advance seismological studies and seismic hazard analysis in this study.

  3. A General Method for Computing the Homfly Polynomial of DNA Double Crossover 3-Regular Links

    PubMed Central

    Li, Meilian; Deng, Qingying; Jin, Xian’an

    2015-01-01

    In the last 20 years or so, chemists and molecular biologists have synthesized some novel DNA polyhedra. Polyhedral links were introduced to model DNA polyhedra and study topological properties of DNA polyhedra. As a very powerful invariant of oriented links, the Homfly polynomial of some of such polyhedral links with small number of crossings has been obtained. However, it is a challenge to compute Homfly polynomials of polyhedral links with large number of crossings such as double crossover 3-regular links considered here. In this paper, a general method is given for computing the chain polynomial of the truncated cubic graph with two different labels from the chain polynomial of the original labeled cubic graph by substitutions. As a result, we can obtain the Homfly polynomial of the double crossover 3-regular link which has relatively large number of crossings. PMID:25932998

  4. Single-Mach and double-Mach reflection - Its representation in Ernst Mach's historical soot method

    NASA Astrophysics Data System (ADS)

    Krehl, P.

    In 1875 Ernst Mach discovered the effect of irregular interaction of shock waves, the so-called single Mach reflection (SMR), which for symmetric geometry is characterized by two triple points. He recorded their two trajectories on a soot-covered glass plate. Appearing as two mirror-symmetric V-branches, they form the well-known Mach soot funnel. Combining this soot method with the schlieren technique facilitates the interpretation of soot-recorded interaction phenomena as well as allows to resolve the soot removal mechanism in time. Increasing the dynamic recording range of the soot layer in terms of reflected shock pressures even renders visualization of double-Mach reflection (DMR) which, in the case of symmetric shock interaction, is characterized by a second concentric, external 'double-Mach funnel'. At transition of DMR to SMR it merges into the ordinary 'single-Mach funnel'.

  5. Double images encryption method with resistance against the specific attack based on an asymmetric algorithm.

    PubMed

    Wang, Xiaogang; Zhao, Daomu

    2012-05-21

    A double-image encryption technique that based on an asymmetric algorithm is proposed. In this method, the encryption process is different from the decryption and the encrypting keys are also different from the decrypting keys. In the nonlinear encryption process, the images are encoded into an amplitude cyphertext, and two phase-only masks (POMs) generated based on phase truncation are kept as keys for decryption. By using the classical double random phase encoding (DRPE) system, the primary images can be collected by an intensity detector that located at the output plane. Three random POMs that applied in the asymmetric encryption can be safely applied as public keys. Simulation results are presented to demonstrate the validity and security of the proposed protocol.

  6. EDL configuration on a dissimilarly charged protrusion array via double Fourier series and perturbation method.

    PubMed

    Lin, Sung-Hwa; Hsu, Jyh-Ping; Tseng, Shiojenn; Kuo, Yung-Chih; Liu, Bo-Tau

    2011-11-01

    In this study, through the extension of an one-dimensional, dissimilarly charged protrusions surface model set up in our previous work, a novel dissimilarly charged protrusion array (DCPA) model immersed in an electrolyte solution, which could simulate realistically both the surface morphology and the surface charged condition profoundly concerned on a biological cell membrane, or on the surface of a micro-scale, modified particle used in biomedical engineering and water treatment, is proposed. Considering the condition of small protrusions, the electrical potential field due to the electrical double layer (EDL) on DCPA model is solved semi-analytically using both the double Fourier series and the perturbation method. The analysis from the numerical result reveals that, a small, dissimilarly charged protrusion can lead to a steep variation in the local EDL configuration, especially compared with that in the condition when the charged surface is taken roughly as a flat surface using a lumped, mean surface charge density.

  7. Earthquake hypocenter relocation using double difference method in East Java and surrounding areas

    NASA Astrophysics Data System (ADS)

    C, Aprilia Puspita; Nugraha, Andri Dian; Puspito, Nanang T.

    2015-04-01

    Determination of precise hypocenter location is very important in order to provide information about subsurface fault plane and for seismic hazard analysis. In this study, we have relocated hypocenter earthquakes in Eastern part of Java and surrounding areas from local earthquake data catalog compiled by Meteorological, Climatological, and Geophysical Agency of Indonesia (MCGA) in time period 2009-2012 by using the double-difference method. The results show that after relocation processes, there are significantly changes in position and orientation of earthquake hypocenter which is correlated with the geological setting in this region. We observed indication of double seismic zone at depths of 70-120 km within the subducting slab in south of eastern part of Java region. Our results will provide useful information for advance seismological studies and seismic hazard analysis in this study.

  8. Low-noise multiple watermarks technology based on complex double random phase encoding method

    NASA Astrophysics Data System (ADS)

    Zheng, Jihong; Lu, Rongwen; Sun, Liujie; Zhuang, Songlin

    2010-11-01

    Based on double random phase encoding method (DRPE), watermarking technology may provide a stable and robust method to protect the copyright of the printing. However, due to its linear character, DRPE exist the serious safety risk when it is attacked. In this paper, a complex coding method, which means adding the chaotic encryption based on logistic mapping before the DRPE coding, is provided and simulated. The results testify the complex method will provide better security protection for the watermarking. Furthermore, a low-noise multiple watermarking is studied, which means embedding multiple watermarks into one host printing and decrypt them with corresponding phase keys individually. The Digital simulation and mathematic analysis show that with the same total embedding weight factor, multiply watermarking will improve signal noise ratio (SNR) of the output printing image significantly. The complex multiply watermark method may provide a robust, stability, reliability copyright protection with higher quality printing image.

  9. Hitting Diamonds and Growing Cacti

    NASA Astrophysics Data System (ADS)

    Fiorini, Samuel; Joret, Gwenaël; Pietropaoli, Ugo

    We consider the following NP-hard problem: in a weighted graph, find a minimum cost set of vertices whose removal leaves a graph in which no two cycles share an edge. We obtain a constant-factor approximation algorithm, based on the primal-dual method. Moreover, we show that the integrality gap of the natural LP relaxation of the problem is Θ(logn), where n denotes the number of vertices in the graph.

  10. Double hypernuclei experiment with hybrid emulsion method (J-PARC E07)

    NASA Astrophysics Data System (ADS)

    Ekawa, Hiroyuki; J-APRC E07 Collaboration

    2014-09-01

    Double hypernuclei are important probes to study the system with strangeness -2. In order to search for double hypernuclei, an upgrade experiment is planned at J-PARC K1.8 beam line. In the experiment, the KURAMA spectrometer system will detect Ξ- production in the (K- ,K+) reaction on a diamond target. SSDs located the upstream and the downstream of emulsion plates will record Ξ- tracks which flight toward emulsion plates precisely. Tracks in SSDs and emulsion will be automatically connected by a hybrid method. Discoveries of more than 10 new double hypernuclear species are expected, which enable us to discuss binding energy in terms of mass number dependence. On the other hand, we will also observe X rays from Ξ- atoms with a Germanium detector array installed close to the emulsion by tagging Ξ-stopped events. This will be the first measurement in the world and give information on the Ξ-potential shape at the nuclear surface region. Emulsion production has been completely done and a test experiment for some detectors of KURAMA spectrometer was carried out. In this talk, physics motivation and current status of the J-PARC E07 experiment will be reported.

  11. Statistical properties and pre-hit dynamics of price limit hits in the Chinese stock markets.

    PubMed

    Wan, Yu-Lei; Xie, Wen-Jie; Gu, Gao-Feng; Jiang, Zhi-Qiang; Chen, Wei; Xiong, Xiong; Zhang, Wei; Zhou, Wei-Xing

    2015-01-01

    Price limit trading rules are adopted in some stock markets (especially emerging markets) trying to cool off traders' short-term trading mania on individual stocks and increase market efficiency. Under such a microstructure, stocks may hit their up-limits and down-limits from time to time. However, the behaviors of price limit hits are not well studied partially due to the fact that main stock markets such as the US markets and most European markets do not set price limits. Here, we perform detailed analyses of the high-frequency data of all A-share common stocks traded on the Shanghai Stock Exchange and the Shenzhen Stock Exchange from 2000 to 2011 to investigate the statistical properties of price limit hits and the dynamical evolution of several important financial variables before stock price hits its limits. We compare the properties of up-limit hits and down-limit hits. We also divide the whole period into three bullish periods and three bearish periods to unveil possible differences during bullish and bearish market states. To uncover the impacts of stock capitalization on price limit hits, we partition all stocks into six portfolios according to their capitalizations on different trading days. We find that the price limit trading rule has a cooling-off effect (object to the magnet effect), indicating that the rule takes effect in the Chinese stock markets. We find that price continuation is much more likely to occur than price reversal on the next trading day after a limit-hitting day, especially for down-limit hits, which has potential practical values for market practitioners.

  12. Statistical Properties and Pre-Hit Dynamics of Price Limit Hits in the Chinese Stock Markets

    PubMed Central

    Wan, Yu-Lei; Xie, Wen-Jie; Gu, Gao-Feng; Jiang, Zhi-Qiang; Chen, Wei; Xiong, Xiong; Zhang, Wei; Zhou, Wei-Xing

    2015-01-01

    Price limit trading rules are adopted in some stock markets (especially emerging markets) trying to cool off traders’ short-term trading mania on individual stocks and increase market efficiency. Under such a microstructure, stocks may hit their up-limits and down-limits from time to time. However, the behaviors of price limit hits are not well studied partially due to the fact that main stock markets such as the US markets and most European markets do not set price limits. Here, we perform detailed analyses of the high-frequency data of all A-share common stocks traded on the Shanghai Stock Exchange and the Shenzhen Stock Exchange from 2000 to 2011 to investigate the statistical properties of price limit hits and the dynamical evolution of several important financial variables before stock price hits its limits. We compare the properties of up-limit hits and down-limit hits. We also divide the whole period into three bullish periods and three bearish periods to unveil possible differences during bullish and bearish market states. To uncover the impacts of stock capitalization on price limit hits, we partition all stocks into six portfolios according to their capitalizations on different trading days. We find that the price limit trading rule has a cooling-off effect (object to the magnet effect), indicating that the rule takes effect in the Chinese stock markets. We find that price continuation is much more likely to occur than price reversal on the next trading day after a limit-hitting day, especially for down-limit hits, which has potential practical values for market practitioners. PMID:25874716

  13. Precise timing when hitting falling balls.

    PubMed

    Brenner, Eli; Driesen, Ben; Smeets, Jeroen B J

    2014-01-01

    People are extremely good at hitting falling balls with a baseball bat. Despite the ball's constant acceleration, they have been reported to time hits with a standard deviation of only about 7 ms. To examine how people achieve such precision, we compared performance when there were no added restrictions, with performance when looking with one eye, when vision was blurred, and when various parts of the ball's trajectory were hidden from view. We also examined how the size of the ball and varying the height from which it was dropped influenced temporal precision. Temporal precision did not become worse when vision was blurred, when the ball was smaller, or when balls falling from different heights were randomly interleaved. The disadvantage of closing one eye did not exceed expectations from removing one of two independent estimates. Precision was higher for slower balls, but only if the ball being slower meant that one saw it longer before the hit. It was particularly important to see the ball while swinging the bat. Together, these findings suggest that people time their hits so precisely by using the changing elevation throughout the swing to adjust the bat's movement to that of the ball.

  14. Precise timing when hitting falling balls

    PubMed Central

    Brenner, Eli; Driesen, Ben; Smeets, Jeroen B. J.

    2014-01-01

    People are extremely good at hitting falling balls with a baseball bat. Despite the ball's constant acceleration, they have been reported to time hits with a standard deviation of only about 7 ms. To examine how people achieve such precision, we compared performance when there were no added restrictions, with performance when looking with one eye, when vision was blurred, and when various parts of the ball's trajectory were hidden from view. We also examined how the size of the ball and varying the height from which it was dropped influenced temporal precision. Temporal precision did not become worse when vision was blurred, when the ball was smaller, or when balls falling from different heights were randomly interleaved. The disadvantage of closing one eye did not exceed expectations from removing one of two independent estimates. Precision was higher for slower balls, but only if the ball being slower meant that one saw it longer before the hit. It was particularly important to see the ball while swinging the bat. Together, these findings suggest that people time their hits so precisely by using the changing elevation throughout the swing to adjust the bat's movement to that of the ball. PMID:24904380

  15. Second-order perturbation corrections to singles and doubles coupled-cluster methods: General theory and application to the valence optimized doubles model

    SciTech Connect

    Gwaltney, Steven R.; Sherrill, C. David; Head-Gordon, Martin; Krylov, Anna I.

    2000-09-01

    We present a general perturbative method for correcting a singles and doubles coupled-cluster energy. The coupled-cluster wave function is used to define a similarity-transformed Hamiltonian, which is partitioned into a zeroth-order part that the reference problem solves exactly plus a first-order perturbation. Standard perturbation theory through second-order provides the leading correction. Applied to the valence optimized doubles (VOD) approximation to the full-valence complete active space self-consistent field method, the second-order correction, which we call (2), captures dynamical correlation effects through external single, double, and semi-internal triple and quadruple substitutions. A factorization approximation reduces the cost of the quadruple substitutions to only sixth order in the size of the molecule. A series of numerical tests are presented showing that VOD(2) is stable and well-behaved provided that the VOD reference is also stable. The second-order correction is also general to standard unwindowed coupled-cluster energies such as the coupled-cluster singles and doubles (CCSD) method itself, and the equations presented here fully define the corresponding CCSD(2) energy. (c) 2000 American Institute of Physics.

  16. Cognitive orientations in marathon running and "hitting the wall"

    PubMed Central

    Stevinson, C. D.; Biddle, S. J.

    1998-01-01

    OBJECTIVES: To investigate whether runners' cognitions during a marathon are related to "hitting the wall". To test a new and more comprehensive system for classifying cognition of marathon runners. METHODS: Non-elite runners (n = 66) completed a questionnaire after finishing the 1996 London marathon. The runners were recruited through the charity SPARKS for whom they were raising money by running in the race. RESULTS: Most runners reported that during the race their thoughts were internally associative, with internally dissociative thoughts being the least prevalent. Runners who "hit the wall" used more internal dissociation than other runners, indicating that it is a hazardous strategy, probably because sensory feedback is blocked. However, internal association was related to an earlier onset of "the wall", suggesting that too much attention on physical symptoms may magnify them, thereby exaggerating any discomfort. External dissociation was related to a later onset, probably because it may provide a degree of distraction but keeps attention on the race. CONCLUSIONS: "Hitting the wall" for recreational non-elite marathon runners is associated with their thought patterns during the race. In particular, "the wall" is associated with internal dissociation. 




 PMID:9773172

  17. Arabidopsis HIT4, a regulator involved in heat-triggered reorganization of chromatin and release of transcriptional gene silencing, relocates from chromocenters to the nucleolus in response to heat stress.

    PubMed

    Wang, Lian-Chin; Wu, Jia-Rong; Hsu, Yi-Ju; Wu, Shaw-Jye

    2015-01-01

    Arabidopsis HIT4 is known to mediate heat-induced decondensation of chromocenters and release from transcriptional gene silencing (TGS) with no change in the level of DNA methylation. It is unclear whether HIT4 and MOM1, a well-known DNA methylation-independent transcriptional silencer, have overlapping regulatory functions. A hit4-1/mom1 double mutant strain was generated. Its nuclear morphology and TGS state were compared with those of wild-type, hit4-1, and mom1 plants. Fluorescent protein tagging was employed to track the fates of HIT4, hit4-1 and MOM1 in vivo under heat stress. HIT4- and MOM1-mediated TGS were distinguishable. Both HIT4 and MOM1 were localized normally to chromocenters. Under heat stress, HIT4 relocated to the nucleolus, whereas MOM1 dispersed with the chromocenters. hit4-1 was able to relocate to the nucleolus under heat stress, but its relocation was insufficient to trigger the decompaction of chromocenters. The hypersensitivity to heat associated with the impaired reactivation of TGS in hit4-1 was not alleviated by mom1-induced release from TGS. HIT4 delineates a novel and MOM1-independent TGS regulation pathway. The involvement of a currently unidentified component that links HIT4 relocation and the large-scale reorganization of chromatin, and which is essential for heat tolerance in plants is hypothesized.

  18. Double-Ended Surface Walking Method for Pathway Building and Transition State Location of Complex Reactions.

    PubMed

    Zhang, Xiao-Jie; Shang, Cheng; Liu, Zhi-Pan

    2013-12-10

    Toward the activity prediction with large-scale computations, here a double-ended surface walking (DESW) method is developed for connecting two minima on a potential energy surface (PES) and locating the associated transition state (TS) using only the first derivatives. The method operates two images starting from the initial and the final states, respectively, to walk in a stepwise manner toward each other. The surface walking involves repeated bias potential addition and local relaxation with the constrained Broyden dimer method to correct the walking direction. We apply the method to a model PES, a large set of gas phase Baker reactions, and complex surface catalytic reactions, which demonstrates that the DESW method can establish a low energy pathway linking two minima even without iterative optimization of the pathway, from which the TS can be located readily. By comparing the efficiency of the new method with the existing methods, we show that the DESW method is much less computationally demanding and is applicable for reactions with complex PESs. We hope that the DESW method may be integrated with the PES sampling methods for automated reaction prediction.

  19. Average Temperature Model of Double-Row-Pipe Frozen Soil Wall by Equivalent Trapezoid Method

    NASA Astrophysics Data System (ADS)

    Hu, Xiang-dong

    2010-05-01

    Average temperature is pre-requisite in obtaining the mechanical parameters and bearing capacity of frozen soil, and further evaluation of safety of the frozen soil wall could thus be made. This paper introduced Bakholdin's analytical solution for temperature field under double-row-pipe freezing and its correction when counting for the actual freezing temperature of soil. On the base of all these, an analytical model, namely equivalent trapezoid model was developed to calculate the average temperature of frozen soil wall under double-row-pipe freezing. This approach was to, on the base of Bakholdin formula and using equivalent trapezoid method, calculate the average temperature of a certain section which indicated the condition of the whole freezing soil wall. Furthermore, for possible parameter range of freezing tube layout might be applied in actual construction, this paper compared average temperatures of frozen soil wall obtained by the equivalent trapezoid method and by numerical integration of Bakholdin's analytical solution. The result showed that the discrepancy was small enough (<1.32%) to be ignored and the calculation accuracy of equivalent trapezoid method was competent for engineering practice.

  20. A double staining method using SYTOX green and calcofluor white for studying fungal parasites of phytoplankton.

    PubMed

    Gerphagnon, Mélanie; Latour, Delphine; Colombet, Jonathan; Sime-Ngando, Télesphore

    2013-07-01

    We propose a double staining method based on the combination of two fluorochromes, calcofluor white (CFW; specific chitinous fluorochrome) and SYTOX green (nucleic acid stain), coupled to epifluorescence microscopy for counting, identifying, and investigating the fecundity of parasitic fungi of phytoplankton and the putative relationships established between hosts and their chytrid parasites. The method was applied to freshwater samples collected over two successive years during the terminal period of autumnal cyanobacterial blooms in a eutrophic lake. The study focused on the uncultured host-parasite couple Anabaena macrospora (cyanobacterium) and Rhizosiphon akinetum (Chytridiomycota). Our results showed that up to 36.6% of cyanobacterial akinetes could be parasitized by fungi. Simultaneously, we directly investigated the zoosporic content inside the sporangia and found that both the host size and intensity of infection conditioned the final size and hence fecundity of the chytrids. We found that relationships linking host size, final parasite size, and chytrid fecundity were conserved from year to year and seemed to be host-chytrid couple specific. We concluded that our double staining method was a valid procedure for improving our knowledge of uncultured freshwater phytoplankton-chytrid couples and so of the quantitative ecology of chytrids in freshwater ecosystems.

  1. A Double Staining Method Using SYTOX Green and Calcofluor White for Studying Fungal Parasites of Phytoplankton

    PubMed Central

    Latour, Delphine; Colombet, Jonathan; Sime-Ngando, Télesphore

    2013-01-01

    We propose a double staining method based on the combination of two fluorochromes, calcofluor white (CFW; specific chitinous fluorochrome) and SYTOX green (nucleic acid stain), coupled to epifluorescence microscopy for counting, identifying, and investigating the fecundity of parasitic fungi of phytoplankton and the putative relationships established between hosts and their chytrid parasites. The method was applied to freshwater samples collected over two successive years during the terminal period of autumnal cyanobacterial blooms in a eutrophic lake. The study focused on the uncultured host-parasite couple Anabaena macrospora (cyanobacterium) and Rhizosiphon akinetum (Chytridiomycota). Our results showed that up to 36.6% of cyanobacterial akinetes could be parasitized by fungi. Simultaneously, we directly investigated the zoosporic content inside the sporangia and found that both the host size and intensity of infection conditioned the final size and hence fecundity of the chytrids. We found that relationships linking host size, final parasite size, and chytrid fecundity were conserved from year to year and seemed to be host-chytrid couple specific. We concluded that our double staining method was a valid procedure for improving our knowledge of uncultured freshwater phytoplankton-chytrid couples and so of the quantitative ecology of chytrids in freshwater ecosystems. PMID:23603679

  2. Health Information Technologies-Academic and Commercial Evaluation (HIT-ACE) methodology: description and application to clinical feedback systems.

    PubMed

    Lyon, Aaron R; Lewis, Cara C; Melvin, Abigail; Boyd, Meredith; Nicodimos, Semret; Liu, Freda F; Jungbluth, Nathaniel

    2016-09-22

    Health information technologies (HIT) have become nearly ubiquitous in the contemporary healthcare landscape, but information about HIT development, functionality, and implementation readiness is frequently siloed. Theory-driven methods of compiling, evaluating, and integrating information from the academic and commercial sectors are necessary to guide stakeholder decision-making surrounding HIT adoption and to develop pragmatic HIT research agendas. This article presents the Health Information Technologies-Academic and Commercial Evaluation (HIT-ACE) methodology, a structured, theory-driven method for compiling and evaluating information from multiple sectors. As an example demonstration of the methodology, we apply HIT-ACE to mental and behavioral health measurement feedback systems (MFS). MFS are a specific class of HIT that support the implementation of routine outcome monitoring, an evidence-based practice. HIT-ACE is guided by theories and frameworks related to user-centered design and implementation science. The methodology involves four phases: (1) coding academic and commercial materials, (2) developer/purveyor interviews, (3) linking putative implementation mechanisms to hit capabilities, and (4) experimental testing of capabilities and mechanisms. In the current demonstration, phase 1 included a systematic process to identify MFS in mental and behavioral health using academic literature and commercial websites. Using user-centered design, implementation science, and feedback frameworks, the HIT-ACE coding system was developed, piloted, and used to review each identified system for the presence of 38 capabilities and 18 additional characteristics via a consensus coding process. Bibliometic data were also collected to examine the representation of the systems in the scientific literature. As an example, results are presented for the application of HIT-ACE phase 1 to MFS wherein 49 separate MFS were identified, reflecting a diverse array of characteristics

  3. Health Information Technology (HIT) Adaptation: Refocusing on the Journey to Successful HIT Implementation.

    PubMed

    Yen, Po-Yin; McAlearney, Ann Scheck; Sieck, Cynthia J; Hefner, Jennifer L; Huerta, Timothy R

    2017-09-07

    In past years, policies and regulations required hospitals to implement advanced capabilities of certified electronic health records (EHRs) in order to receive financial incentives. This has led to accelerated implementation of health information technologies (HIT) in health care settings. However, measures commonly used to evaluate the success of HIT implementation, such as HIT adoption, technology acceptance, and clinical quality, fail to account for complex sociotechnical variability across contexts and the different trajectories within organizations because of different implementation plans and timelines. We propose a new focus, HIT adaptation, to illuminate factors that facilitate or hinder the connection between use of the EHR and improved quality of care as well as to explore the trajectory of changes in the HIT implementation journey as it is impacted by frequent system upgrades and optimizations. Future research should develop instruments to evaluate the progress of HIT adaptation in both its longitudinal design and its focus on adaptation progress rather than on one cross-sectional outcome, allowing for more generalizability and knowledge transfer. ©Po-Yin Yen, Ann Scheck McAlearney, Cynthia J Sieck, Jennifer L Hefner, Timothy R Huerta. Originally published in JMIR Medical Informatics (http://medinform.jmir.org), 07.09.2017.

  4. Post-hit dynamics of price limit hits in the Chinese stock markets

    NASA Astrophysics Data System (ADS)

    Wu, Ting; Wang, Yue; Li, Ming-Xia

    2017-01-01

    Price limit trading rules are useful to cool off traders short-term trading mania on individual stocks. The price dynamics approaching the limit boards are known as the magnet effect. However, the price dynamics after opening price limit hits are not well investigated. Here, we provide a detailed analysis on the price dynamics after the hits of up-limit or down-limit is open based on all A-share stocks traded in the Chinese stock markets. A "W" shape is found in the expected return, which reveals high probability of a continuous price limit hit on the following day. We also find that price dynamics after opening limit hits are dependent on the market trends. The time span of continuously hitting the price limit is found to an influence factor of the expected profit after the limit hit is open. Our analysis provides a better understanding of the price dynamics around the limit boards and contributes potential practical values for investors.

  5. The Video Head Impulse Test (vHIT) Detects Vertical Semicircular Canal Dysfunction

    PubMed Central

    MacDougall, Hamish Gavin; McGarvie, Leigh Andrew; Halmagyi, Gabor Michael; Curthoys, Ian Stewart; Weber, Konrad Peter

    2013-01-01

    Background The video head impulse test (vHIT) is a useful clinical tool to detect semicircular canal dysfunction. However vHIT has hitherto been limited to measurement of horizontal canals, while scleral search coils have been the only accepted method to measure head impulses in vertical canals. The goal of this study was to determine whether vHIT can detect vertical semicircular canal dysfunction as identified by scleral search coil recordings. Methods Small unpredictable head rotations were delivered by hand diagonally in the plane of the vertical semicircular canals while gaze was directed along the same plane. The planes were oriented along the left-anterior-right-posterior (LARP) canals and right-anterior-left-posterior (RALP) canals. Eye movements were recorded simultaneously in 2D with vHIT (250 Hz) and in 3D with search coils (1000 Hz). Twelve patients with unilateral, bilateral and individual semicircular canal dysfunction were tested and compared to seven normal subjects. Results Simultaneous video and search coil recordings were closely comparable. Mean VOR gain difference measured with vHIT and search coils was 0.05 (SD = 0.14) for the LARP plane and −0.04 (SD = 0.14) for the RALP plane. The coefficient of determination R2 was 0.98 for the LARP plane and 0.98 for the RALP plane and the results of the two methods were not significantly different. vHIT and search coil measures displayed comparable patterns of covert and overt catch-up saccades. Conclusions vHIT detects dysfunction of individual vertical semicircular canals in vestibular patients as accurately as scleral search coils. Unlike search coils, vHIT is non-invasive, easy to use and hence practical in clinics. PMID:23630593

  6. Hypocenter Relocations of Earthquakes in Central Southern Korea using the Double- Difference Method

    NASA Astrophysics Data System (ADS)

    Choi, M.; Baag, C.; Rhie, J.

    2007-12-01

    The double-difference method is widely used for precise relocations of earthquakes to estimate the extent and attitude of seismogenic faults. In South Korea, it is very difficult to find the location and estimate the extent of seismogenic faults because large earthquakes are rare. Therefore, we applied the double-difference method to small earthquakes occurred in Central Southern Korea and try to find any evidence of well-defined fault planes. Latitude and longitude of earthquakes range from 35¢ªN to 37¢ªN and from 127¢ªE to 129¢ªE, respectively. The seismicity of this region is relatively higher and density of seismic stations is also higher than other regions in South Korea. We used 65 events in the magnitude (ML) 1.9-3.9 range occurred for the period from February 2001 to October 2007 in this region. We obtained the travel time data from 14 broad band and 42 short period seismic stations deployed by two Korean agencies, such as Korea Meteorological Administration (KMA) and Korea Institute of Geoscience and Mineral Resources (KIGAM). We determined P-wave travel times using manual phase picking and also travel time differences among P phases recorded at common station using waveform cross-correlation. The distribution of the earthquake relocations will be compared to the possible fault planes, which are constrained by regional moment tensor solutions.

  7. Double hexagonal graphene ring synthesized using a growth-etching method

    NASA Astrophysics Data System (ADS)

    Liu, Jinyang; Xu, Yangyang; Cai, Hongbing; Zuo, Chuandong; Huang, Zhigao; Lin, Limei; Guo, Xiaomin; Chen, Zhendong; Lai, Fachun

    2016-07-01

    Precisely controlling the layer number, stacking order, edge configuration, shape and structure of graphene is extremely challenging but highly desirable in scientific research. In this report, a new concept named the growth-etching method has been explored to synthesize a graphene ring using the chemical vapor deposition process. The graphene ring is a hexagonal structure, which contains a hexagonal exterior edge and a hexagonal hole in the centre region. The most important concept introduced here is that the oxide nanoparticle derived from annealing is found to play a dual role. Firstly, it acts as a nucleation site to grow the hexagonal graphene domain and then it works as a defect for etching to form a hole. The evolution process of the graphene ring with the etching time was carefully studied. In addition, a double hexagonal graphene ring was successfully synthesized for the first time by repeating the growth-etching process, which not only confirms the validity and repeatability of the method developed here but may also be further extended to grow unique graphene nanostructures with three, four, or even tens of graphene rings. Finally, a schematic model was drawn to illustrate how the double hexagonal graphene ring is generated and propagated. The results shown here may provide valuable guidance for the design and growth of unique nanostructures of graphene and other two-dimensional materials.

  8. Could the novel ‘double-hole’ technique be an alternative for the inflow occlusion method?

    PubMed Central

    Bozok, Sahin; Gokhan, Ilhan; Izmir,, Kazdal; Berkan, Ozpak; Ismail, Yurekli; Mert, Kestelli; Serdar, Bayrak

    2016-01-01

    Summary Background Inflow occlusion on beating heart and cardiopulmonary bypass techniques have been proposed for the removal of foreign material, such as stents, catheters and mass lesions, from cardiac chambers. However, both techniques are not devoid of disadvantages and complications. In this article, we define an alternative, novel ‘double-hole’ technique, which is based on opening the right atrium without cardiopulmonary bypass . Methods Bovine hearts were obtained from a local supermarket. Two purse-string sutures were placed in the right atrium using 2-0 braided, non-absorbable polyester suture material, one close to the auricle, and the other close to the interatrial septum. The guidewire of a haemodialysis catheter was inserted through the superior vena cava into the right atrium and passed all the way through the right ventricle. Results We suggest that the double-hole technique may be useful, especially in revision cases with adhesions. Further research should be performed to document the efficacy and safety of this method. Conclusion We are aware that further extensive research is necessary to investigate the utility of this novel technique in contemporary cardiovascular surgery. We believe the doublehole technique has the potential to become a safe, practical and effective measure in the future. PMID:27078129

  9. Rapid, simple method of preparing rotaviral double-stranded ribonucleic acid for analysis by polyacrylamide gel electrophoresis.

    PubMed Central

    Theil, K W; McCloskey, C M; Saif, L J; Redman, D R; Bohl, E H; Hancock, D D; Kohler, E M; Moorhead, P D

    1981-01-01

    A procedure for extracting rotaviral double-stranded ribonucleic acid (RNA) directly from fecal and intestinal specimens collected from calves and pigs is described. This procedure provides a rapid, simple, reproducible method of obtaining rotaviral double-stranded RNA preparations suitable for electrophoretic analysis in polyacrylamide-agarose composite gels. The rotaviral genome electrophoretic migration pattern produced by double-stranded RNA extracted directly from a specimen by this procedure was qualitatively identical to the electrophoretic migration pattern obtained with double-stranded RNA extracted from purified rotavirus derived from the same specimen. Direct extraction of specimens containing porcine rotavirus-like virus by this procedure gave preparations that had electrophoretic migration patterns similar, but not identical, to the characteristic electrophoretic migration pattern of the rotaviral genome. Sufficient rotaviral double-stranded RNA could be extracted from 6 ml of fecal or intestinal specimen by this procedure to permit 15 or more electrophoretic assays. Images PMID:6270190

  10. Computing Principal Eigenvectors of Large Web Graphs: Algorithms and Accelerations Related to PageRank and HITS

    ERIC Educational Resources Information Center

    Nagasinghe, Iranga

    2010-01-01

    This thesis investigates and develops a few acceleration techniques for the search engine algorithms used in PageRank and HITS computations. PageRank and HITS methods are two highly successful applications of modern Linear Algebra in computer science and engineering. They constitute the essential technologies accounted for the immense growth and…

  11. Computing Principal Eigenvectors of Large Web Graphs: Algorithms and Accelerations Related to PageRank and HITS

    ERIC Educational Resources Information Center

    Nagasinghe, Iranga

    2010-01-01

    This thesis investigates and develops a few acceleration techniques for the search engine algorithms used in PageRank and HITS computations. PageRank and HITS methods are two highly successful applications of modern Linear Algebra in computer science and engineering. They constitute the essential technologies accounted for the immense growth and…

  12. A double-observer method to estimate detection rate during aerial waterfowl surveys

    USGS Publications Warehouse

    Koneff, M.D.; Royle, J. Andrew; Otto, M.C.; Wortham, J.S.; Bidwell, J.K.

    2008-01-01

    We evaluated double-observer methods for aerial surveys as a means to adjust counts of waterfowl for incomplete detection. We conducted our study in eastern Canada and the northeast United States utilizing 3 aerial-survey crews flying 3 different types of fixed-wing aircraft. We reconciled counts of front- and rear-seat observers immediately following an observation by the rear-seat observer (i.e., on-the-fly reconciliation). We evaluated 6 a priori models containing a combination of several factors thought to influence detection probability including observer, seat position, aircraft type, and group size. We analyzed data for American black ducks (Anas rubripes) and mallards (A. platyrhynchos), which are among the most abundant duck species in this region. The best-supported model for both black ducks and mallards included observer effects. Sample sizes of black ducks were sufficient to estimate observer-specific detection rates for each crew. Estimated detection rates for black ducks were 0.62 (SE = 0.10), 0.63 (SE = 0.06), and 0.74 (SE = 0.07) for pilot-observers, 0.61 (SE = 0.08), 0.62 (SE = 0.06), and 0.81 (SE = 0.07) for other front-seat observers, and 0.43 (SE = 0.05), 0.58 (SE = 0.06), and 0.73 (SE = 0.04) for rear-seat observers. For mallards, sample sizes were adequate to generate stable maximum-likelihood estimates of observer-specific detection rates for only one aerial crew. Estimated observer-specific detection rates for that crew were 0.84 (SE = 0.04) for the pilot-observer, 0.74 (SE = 0.05) for the other front-seat observer, and 0.47 (SE = 0.03) for the rear-seat observer. Estimated observer detection rates were confounded by the position of the seat occupied by an observer, because observers did not switch seats, and by land-cover because vegetation and landform varied among crew areas. Double-observer methods with on-the-fly reconciliation, although not without challenges, offer one viable option to account for detection bias in aerial waterfowl

  13. Double modulation pyrometry: A radiometric method to measure surface temperatures of directly irradiated samples

    NASA Astrophysics Data System (ADS)

    Potamias, Dimitrios; Alxneit, Ivo; Wokaun, Alexander

    2017-09-01

    The design, implementation, calibration, and assessment of double modulation pyrometry to measure surface temperatures of radiatively heated samples in our 1 kW imaging furnace is presented. The method requires that the intensity of the external radiation can be modulated. This was achieved by a rotating blade mounted parallel to the optical axis of the imaging furnace. Double modulation pyrometry independently measures the external radiation reflected by the sample as well as the sum of thermal and reflected radiation and extracts the thermal emission as the difference of these signals. Thus a two-step calibration is required: First, the relative gains of the measured signals are equalized and then a temperature calibration is performed. For the latter, we transfer the calibration from a calibrated solar blind pyrometer that operates at a different wavelength. We demonstrate that the worst case systematic error associated with this procedure is about 300 K but becomes negligible if a reasonable estimate of the sample's emissivity is used. An analysis of the influence of the uncertainties in the calibration coefficients reveals that one (out of the five) coefficient contributes almost 50% to the final temperature error. On a low emission sample like platinum, the lower detection limit is around 1700 K and the accuracy typically about 20 K. Note that these moderate specifications are specific for the use of double modulation pyrometry at the imaging furnace. It is mainly caused by the difficulty to achieve and maintain good overlap of the hot zone with a diameter of about 3 mm Full Width at Half Height and the measurement spot both of which are of similar size.

  14. Double modulation pyrometry: A radiometric method to measure surface temperatures of directly irradiated samples.

    PubMed

    Potamias, Dimitrios; Alxneit, Ivo; Wokaun, Alexander

    2017-09-01

    The design, implementation, calibration, and assessment of double modulation pyrometry to measure surface temperatures of radiatively heated samples in our 1 kW imaging furnace is presented. The method requires that the intensity of the external radiation can be modulated. This was achieved by a rotating blade mounted parallel to the optical axis of the imaging furnace. Double modulation pyrometry independently measures the external radiation reflected by the sample as well as the sum of thermal and reflected radiation and extracts the thermal emission as the difference of these signals. Thus a two-step calibration is required: First, the relative gains of the measured signals are equalized and then a temperature calibration is performed. For the latter, we transfer the calibration from a calibrated solar blind pyrometer that operates at a different wavelength. We demonstrate that the worst case systematic error associated with this procedure is about 300 K but becomes negligible if a reasonable estimate of the sample's emissivity is used. An analysis of the influence of the uncertainties in the calibration coefficients reveals that one (out of the five) coefficient contributes almost 50% to the final temperature error. On a low emission sample like platinum, the lower detection limit is around 1700 K and the accuracy typically about 20 K. Note that these moderate specifications are specific for the use of double modulation pyrometry at the imaging furnace. It is mainly caused by the difficulty to achieve and maintain good overlap of the hot zone with a diameter of about 3 mm Full Width at Half Height and the measurement spot both of which are of similar size.

  15. A novel method for strategy acquisition and its application to a double-auction market game.

    PubMed

    Phelps, Steve; McBurney, Peter; Parsons, Simon

    2010-06-01

    We introduce a method for strategy acquisition in nonzero-sum n -player games and empirically validate it by applying it to a well-known benchmark problem in this domain, namely, the double-auction market. Many existing approaches to strategy acquisition focus on attempting to find strategies that are robust in the sense that they are good all-round performers against all-comers. We argue that, in many economic and multiagent scenarios, the robustness criterion is inappropriate; in contrast, our method focuses on searching for strategies that are likely to be adopted by participating agents, which is formalized as the size of a strategy's basins of attraction under the replicator dynamics.

  16. Simulation of electric double-layer capacitors: evaluation of constant potential method

    NASA Astrophysics Data System (ADS)

    Wang, Zhenxing; Laird, Brian; Yang, Yang; Olmsted, David; Asta, Mark

    2014-03-01

    Atomistic simulations can play an important role in understanding electric double-layer capacitors (EDLCs) at a molecular level. In such simulations, typically the electrode surface is modeled using fixed surface charges, which ignores the charge fluctuation induced by local fluctuations in the electrolyte solution. In this work we evaluate an explicit treatment of charges, namely constant potential method (CPM)[1], in which the electrode charges are dynamically updated to maintain constant electrode potential. We employ a model system with a graphite electrode and a LiClO4/acetonitrile electrolyte, examined as a function of electrode potential differences. Using various molecular and macroscopic properties as metrics, we compare CPM simulations on this system to results using fixed surface charges. Specifically, results for predicted capacity, electric potential gradient and solvent density profile are identical between the two methods; However, ion density profiles and solvation structure yield significantly different results.

  17. DSMC calculations for the double ellipse. [direct simulation Monte Carlo method

    NASA Technical Reports Server (NTRS)

    Moss, James N.; Price, Joseph M.; Celenligil, M. Cevdet

    1990-01-01

    The direct simulation Monte Carlo (DSMC) method involves the simultaneous computation of the trajectories of thousands of simulated molecules in simulated physical space. Rarefied flow about the double ellipse for test case 6.4.1 has been calculated with the DSMC method of Bird. The gas is assumed to be nonreacting nitrogen flowing at a 30 degree incidence with respect to the body axis, and for the surface boundary conditions, the wall is assumed to be diffuse with full thermal accommodation and at a constant wall temperature of 620 K. A parametric study is presented that considers the effect of variations of computational domain, gas model, cell size, and freestream density on surface quantities.

  18. Spreading of a heavy ion beam with the dual-ring double scattering method

    NASA Astrophysics Data System (ADS)

    Himukai, T.; Furukawa, T.; Takeshita, E.; Inaniwa, T.; Mizushima, K.; Katagiri, K.; Takada, Y.

    2011-12-01

    A flat radiation field for heavy ion beams is used in research experiments and clinical treatments. When a flat field is required, a beam spreading system must be installed for a beam line; thus a simple and affordable method is desirable. To achieve the carbon ion beam spreading, we employed a dual-ring double scattering method (DDSM), which consists of an initial scattering foil and a dual-ring subsequent scatterer. The scatterers for the DDSM were designed and tested to verify the flatness of the radiation field of the carbon ion beam. We obtained 100 mm of the flat radiation field in the isocenter plane for the 2D radiation field, as expected. For the 3D radiation field, we obtained a field size of 80 mm. With a 60-min setup time, using the DDSM system, and by placing only two scatterers, we can form the flat radiation field.

  19. Linearity improvement of cascode low-noise amplifiers using double DS method with a tuned inductor

    NASA Astrophysics Data System (ADS)

    Park, Chi Wan; Ahn, Youngbin; Lee, Jaehoon; Jeong, Jichai

    2010-07-01

    We propose a highly linear low-noise amplifier (LNA) using the double derivative superposition method with a tuned inductor. This topology has an auxiliary common gate stage of the cascode amplifier to cancel each third-order intermodulation distortion (IMD3) component and can provide a high third-order input intercept point (IIP3) for the 5.25 GHz frequency band. From the simulation results using the TSMC 0.18 μm RF CMOS process, the IIP3 in the proposed cascode LNAs can be improved by 9 dB, compared with the conventional derivative superposition method. The proposed LNA achieves an IIP3 of + 15 dBm with a gain of 10.5 dB, a noise figure of 2.4 dB, and a power consumption of 6 mA at 1.5 V.

  20. [Determination of double bonds in olive and sunflower oils by ozonize method].

    PubMed

    Evteeva, N M

    2007-01-01

    Kinetics of spending double bonds of tocotherol and accumulation of peroxides during oxidation of olive and sunflower oils were investigated. Date on spending double bonds during oxidation of commercial oils were measured for the first time.

  1. Mumps Cases Hit 10-Year High in U.S.

    MedlinePlus

    ... page: https://medlineplus.gov/news/fullstory_162676.html Mumps Cases Hit 10-Year High in U.S. Contagious ... 21, 2016 WEDNESDAY, Dec. 21, 2016 (HealthDay News) -- Mumps cases have hit a 10-year high in ...

  2. The video Head Impulse Test (vHIT) detects vertical semicircular canal dysfunction.

    PubMed

    Macdougall, Hamish Gavin; McGarvie, Leigh Andrew; Halmagyi, Gabor Michael; Curthoys, Ian Stewart; Weber, Konrad Peter

    2013-01-01

    The video head impulse test (vHIT) is a useful clinical tool to detect semicircular canal dysfunction. However vHIT has hitherto been limited to measurement of horizontal canals, while scleral search coils have been the only accepted method to measure head impulses in vertical canals. The goal of this study was to determine whether vHIT can detect vertical semicircular canal dysfunction as identified by scleral search coil recordings. Small unpredictable head rotations were delivered by hand diagonally in the plane of the vertical semicircular canals while gaze was directed along the same plane. The planes were oriented along the left-anterior-right-posterior (LARP) canals and right-anterior-left-posterior (RALP) canals. Eye movements were recorded simultaneously in 2D with vHIT (250 Hz) and in 3D with search coils (1000 Hz). Twelve patients with unilateral, bilateral and individual semicircular canal dysfunction were tested and compared to seven normal subjects. Simultaneous video and search coil recordings were closely comparable. Mean VOR gain difference measured with vHIT and search coils was 0.05 (SD = 0.14) for the LARP plane and -0.04 (SD = 0.14) for the RALP plane. The coefficient of determination R(2) was 0.98 for the LARP plane and 0.98 for the RALP plane and the results of the two methods were not significantly different. vHIT and search coil measures displayed comparable patterns of covert and overt catch-up saccades. vHIT detects dysfunction of individual vertical semicircular canals in vestibular patients as accurately as scleral search coils. Unlike search coils, vHIT is non-invasive, easy to use and hence practical in clinics.

  3. Visual factors in hitting and catching.

    PubMed

    Regan, D

    1997-12-01

    To hit or catch an approaching ball, it is necessary to move a bat or hand to the right place at the right time. The performance of top sports players is remarkable: positional errors of less than 5 cm and temporal errors of less than 2 or 3 ms are reliably maintained. There are three schools of thought about how this is achieved. One holds that predictive visual information about where the ball will be at some future instance (when) is used to achieve the hit or catch. The second holds that the bat or hand is moved to the correct position by exploiting some relation between visual information and the required movement. The third focuses on the use of prior knowledge to supplement inadequate visual information. For a rigid spherical ball travelling at constant speed along or close to the line of sight, the retinal images contain both binocular and monocular correlates of the ball's instantaneous direction of motion in depth. Also, the retinal images contain both binocular and monocular information about time of arrival. Humans can unconfound and use this visual information, but they are unable to estimate the absolute distance of the ball or its approach speed other than crudely. In cricket, this visual inadequacy allows a slow bowler to cause the batsman to misjudge where the ball will hit the ground. Such a bowler uses a three-pronged strategy: first, to deliver the ball in such a way as to prevent the batsman from obtaining the necessary visual information until it is too late to react; secondly, to force the batsman to rely entirely on inadequate retinal image information; thirdly, to allow the batsman to learn a particular relationship between the early part of the ball's flight and the point where the ball hits the ground, and then to change the relationship with such skill that the batsman does not detect the change.

  4. Universal Hitting Time Statistics for Integrable Flows

    NASA Astrophysics Data System (ADS)

    Dettmann, Carl P.; Marklof, Jens; Strömbergsson, Andreas

    2017-02-01

    The perceived randomness in the time evolution of "chaotic" dynamical systems can be characterized by universal probabilistic limit laws, which do not depend on the fine features of the individual system. One important example is the Poisson law for the times at which a particle with random initial data hits a small set. This was proved in various settings for dynamical systems with strong mixing properties. The key result of the present study is that, despite the absence of mixing, the hitting times of integrable flows also satisfy universal limit laws which are, however, not Poisson. We describe the limit distributions for "generic" integrable flows and a natural class of target sets, and illustrate our findings with two examples: the dynamics in central force fields and ellipse billiards. The convergence of the hitting time process follows from a new equidistribution theorem in the space of lattices, which is of independent interest. Its proof exploits Ratner's measure classification theorem for unipotent flows, and extends earlier work of Elkies and McMullen.

  5. Hitting a baseball: a biomechanical description.

    PubMed

    Welch, C M; Banks, S A; Cook, F F; Draovitch, P

    1995-11-01

    A tremendous amount of time and energy has been dedicated to the development of conditioning programs, mechanics drills, and rehabilitation protocols for the throwing athlete. In comparison, a significantly smaller amount has been spent on the needs of the hitting athlete. Before these needs can be addressed, an understanding of mechanics and the demands placed on the body during the swing must be developed. This study uses three-dimensional kinematic and kinetic data to define and quantify biomechanics during the baseball swing. The results show that a hitter starts the swing with a weight shift toward the rear foot and the generation of trunk coil. As the hitter strides forward, force applied by the front foot equal to 123% of body weight promotes segment acceleration around the axis of the trunk. The hip segment rotates to a maximum speed of 714 degrees/sec followed by a maximum shoulder segment velocity of 937 degrees/sec. The product of this kinetic link is a maximum linear bat velocity of 31 m/sec. By quantifying the hitting motion, a more educated approach can be made in developing rehabilitation, strength, and conditioning programs for the hitting athlete.

  6. A new three-dimensional shape measurement method based on double-frequency fringes

    NASA Astrophysics Data System (ADS)

    Li, Biao; Yang, Jie; Wu, Haitao; Fu, Yanjun

    2015-10-01

    Fringe projection profilometry (FPP) is a rapidly developing technique which is widely used for industrial manufacture, heritage conservation, and medicine etc. because of its high speed, high precision, non-contact operation, full-field acquisition, and easy information processing. Among the various FFP methods, the squared binary defocused projection method (SBM) has been promptly expanding with several advantages: (1) high projection speed because of 1-bit grayscale fringe; (2) eliminating nonlinear gamma of the projector for the defocusing effect. Nevertheless, the method is not trouble-free. When the fringe stripe is wide, it brings down the fringe contrast and is difficult to control the defocused degree, resulting in a low measurement accuracy. In order to further improve high-speed and high-precision three-dimensional shape measurement, this paper presents a new three-dimensional shape measurement method based on double-frequency fringes projection. This new method needs to project two sets of 1-bit grayscale fringe patterns (low-frequency fringe and high-frequency fringe) onto the object surface under slightly defocused projection mode. The method has the following advantages: (1) high projection speed because of 1-bit grayscale fringe; (2) high measurement precision for selectively removing undesired harmonics. Low-frequency fringe is produced by error-diffusion dithering (Dithering) technique and high-frequency fringe is generated by optimal pulse-width modulation (OPWM) technique. The two kinds of fringe patterns have each superiorities and flaws. The low-frequency fringe has a low measurement accuracy, but the continue phase can be easily retrieved. However, the property of high-frequency fringe and low-frequency fringe is the opposite. The general idea of this method proposed is as follows: Because the both fringes test the same object, the height is the same. The low-frequency fringe can be used to assist the high frequency fringe to retrieve

  7. Use of finite element analysis to optimize probe design for double sensor method-based thermometer.

    PubMed

    Sim, Soo Young; Joo, Kwang Min; Park, Kwang Suk

    2015-08-01

    Body temperature is an essential vital sign for assessing physiological functions. The double sensor method-based thermometer is a promising technology that may be applicable to body temperature monitoring in daily life. It continuously estimates deep tissue temperature from the intact skin surface. Despite its considerable potential for monitoring body temperature, its key design features have not been investigated. In this study, we considered four design factors: the cover material, insulator material, insulator radius, and insulator height. We also evaluated their effects on the performance of the double sensor thermometer in terms of accuracy, initial waiting time, and the ability to track changes in body temperature. The probe material and size influenced the accuracy and initial waiting time. Finite element analysis revealed that four thermometers of different sizes composed of an aluminum cover and foam insulator provided high accuracy (<0.1°C) under various ambient temperatures and blood perfusion rates: R=20mm, H=5mm; R=15mm, H=10mm; R=20mm, H=10mm; and R=15mm, H=15mm. The initial waiting time was approximately 10min with almost the same traceability of temperature change. Our findings may provide thermometer manufacturers with new insights into probe design and help them fabricate thermometers optimized for specific applications.

  8. Simple Method of Counterclockwise Isthmus Conduction Block by Comparing Double Potentials and Flutter Cycle Length

    PubMed Central

    Rhee, Kyoung-Suk; Kwon, Keun-Sang; Lee, Sun Hwa; Lee, Kang-Hyu; Lee, Sang Rok; Chae, Jei Keon; Kim, Won-Ho; Ko, Jae-Ki; Nam, Gi-Byoung; Kim, You-Ho

    2009-01-01

    Background and Objectives Local wide split double potentials are used as a parameter to determine complete conduction block during cavotricuspid isthmus ablation in patients with isthmus dependent atrial flutter. However, delayed slow conduction in that region can sometimes be very difficult to differentiate from complete block. Flutter cycle length (FCL) can be used to confirm isthmus conduction block, because FCL is a measure of conduction time around the tricuspid annulus (TA). This study was designed to determine which degree of splitting of the local electrograms is adequate to confirm complete isthmus block, using FCL as a reference. Subjects and Methods Cavotricuspid isthmus (CTI) ablation was performed in fifty consecutive patients. The interval between the pacing stimulus on the lateral side of the CTI and the first component of the double potentials on the block line (SD1) corresponded to the counterclockwise conduction time. The interval between the pacing stimulus and second component (SD2) represented the clockwise conduction time to the contralateral side of the ablation line. SD1 and SD2 were measured before and after complete isthmus block. Results An SD1+SD2 reaching 90% of the FCL identified the counterclockwise isthmus conduction block with 94% sensitivity and 100% specificity. Conclusion If the sum of SD1 and SD2 following isthmus ablation was close to the FCL, complete conduction block was predicted with high diagnostic accuracy and positive predictive value for at least counterclockwise conduction. PMID:20049138

  9. Comparing Regional Seismic Location Results Using Kriged Travel Time Correction Surfaces and Double-Difference Methods

    NASA Astrophysics Data System (ADS)

    Begnaud, M. L.; Velasco, A. A.; Steck, L. K.

    2001-12-01

    The use of kriged two-dimensional travel time correction surfaces improves the location of regional seismic events using a sparse network. For more closely-spaced regional events (approximately 150 km), using travel time correction surfaces does not always demonstrate a distinct improvement in relative locations. A new location program HYPODD [Waldhauser and Ellsworth, 2000] uses a double-difference location algorithm with events correlated based on travel times. While this algorithm has been tested on local events with a fairly dense seismic network, it has not been tested with regional networks that have large station-event distances. We will compare locations defined using two-dimensional travel time correction surfaces with those from the double-difference method [Flores et al., this issue]. We will utilize a data set of approximately 142 events for a region around the Mw=7.5 Tibet event of 08NOV1997, with manually-picked P and S arrivals as well as global catalog arrivals having a station-event distance ranging from 5.5 to over 30 degrees. The Tibet event provides a unique ground truth test due to the presence of a related surface rupture identified by Inferometric Synthetic Aperture Radar (InSAR) [Peltzer et al., 1999] and the determination of the Tibet event as associated with a vertical strike/slip fault [Velasco et al., 2000]. We will test which method produces relocations that better align with this surface rupture. In addition, a small (5 km) secondary rupture was identified with the main rupture, but with no associated seismic event. We will also test whether each method relocates any events near to this secondary rupture.

  10. [Effectiveness of a double-tsuge suture method in repairing Achilles tendon ruptures].

    PubMed

    Fu, Chongyang; Qu, Wei; Cheng, Chao; Lu, Ming; Jiang, Huajun; Lü, Decheng

    2011-10-01

    To investigate the effectiveness of a double-tsuge suture method with absorbable polydioxanone-cord (PDS-II) in repair of Achilles tendon ruptures. Between January 2005 and December 2008, 36 patients suffering from Achilles tendon ruptures were treated operatively. Of 36 patients, there were 29 males and 7 females with a mean age of 36 years (range, 21-50 years), including 22 cases of acute closed injuries, 6 cases of fresh open injuries (the time between injury and hospitalization was 1-10 days, mean 6 days), and 8 cases of old closed injuries (the time between injury and hospitalization was 43-63 days, mean 51 days). The injury reasons were sport injury (25 cases), incised injury (6 cases), falling injury (4 cases), and other (1 case). The results of "heel test" and the Thompson sign were positive in all patients. Operation was performed by using a double-tsuge suture method with a No. 0 PDS-II. After the ankle joint was fixed with short leg plaster cast at 30 degrees plantar flexion position for 6 weeks, the cast was removed and then functional exercises were done. Poor healing of incision occurred in 2 cases of old Achilles tendon ruptures and was cured after symptomatic treatment; healing of incision by first intention was achieved in the others. The patients were followed up 12 to 24 months (mean, 15 months). No rerupture, deep venous thromboembolism, or reflex sympathetic dystrophy occurred during follow-up. When compared with the range of motion of ankle joint of normal side, 7 cases had no change, 16 cases had a loss of 1-10 degrees, 12 cases had a loss of 10-20 degrees, and 1 case had a loss of 25 degrees. The average score was 90 (range, 74-96) according to Termann clinical evaluation criterion; the results were excellent in 24 cases, good in 11 cases, and fair in 1 case, and the excellent and good rate was 97.2%. The double-tsuge suture method is easy-to-operate, which has the smallest interference to the blood supply of Achilles tendon because of no

  11. 1-D seismic velocity model and hypocenter relocation using double difference method around West Papua region

    SciTech Connect

    Sabtaji, Agung E-mail: agung.sabtaji@bmkg.go.id; Nugraha, Andri Dian

    2015-04-24

    West Papua region has fairly high of seismicity activities due to tectonic setting and many inland faults. In addition, the region has a unique and complex tectonic conditions and this situation lead to high potency of seismic hazard in the region. The precise earthquake hypocenter location is very important, which could provide high quality of earthquake parameter information and the subsurface structure in this region to the society. We conducted 1-D P-wave velocity using earthquake data catalog from BMKG for April, 2009 up to March, 2014 around West Papua region. The obtained 1-D seismic velocity then was used as input for improving hypocenter location using double-difference method. The relocated hypocenter location shows fairly clearly the pattern of intraslab earthquake beneath New Guinea Trench (NGT). The relocated hypocenters related to the inland fault are also observed more focus in location around the fault.

  12. Equation-of-motion coupled cluster method for high spin double electron attachment calculations

    SciTech Connect

    Musiał, Monika Lupa, Łukasz; Kucharski, Stanisław A.

    2014-03-21

    The new formulation of the equation-of-motion (EOM) coupled cluster (CC) approach applicable to the calculations of the double electron attachment (DEA) states for the high spin components is proposed. The new EOM equations are derived for the high spin triplet and quintet states. In both cases the new equations are easier to solve but the substantial simplification is observed in the case of quintets. Out of 21 diagrammatic terms contributing to the standard DEA-EOM-CCSDT equations for the R{sub 2} and R{sub 3} amplitudes only four terms survive contributing to the R{sub 3} part. The implemented method has been applied to the calculations of the excited states (singlets, triplets, and quintets) energies of the carbon and silicon atoms and potential energy curves for selected states of the Na{sub 2} (triplets) and B{sub 2} (quintets) molecules.

  13. Nonlinear free vibrations of curved double walled carbon nanotubes using differential quadrature method

    NASA Astrophysics Data System (ADS)

    Cigeroglu, Ender; Samandari, Hamed

    2014-11-01

    Nonlinear free vibration analysis of curved double-walled carbon nanotubes (DWNTs) embedded in an elastic medium is studied in this study. Nonlinearities considered are due to large deflection of carbon nanotubes (geometric nonlinearity) and nonlinear interlayer van der Waals forces between inner and outer tubes. The differential quadrature method (DQM) is utilized to discretize the partial differential equations of motion in spatial domain, which resulted in a nonlinear set of algebraic equations of motion. The effect of nonlinearities, different end conditions, initial curvature, and stiffness of the surrounding elastic medium, and vibrational modes on the nonlinear free vibration of DWCNTs is studied. Results show that it is possible to detect different vibration modes occurring at a single vibration frequency when CNTs vibrate in the out-of-phase vibration mode. Moreover, it is observed that boundary conditions have significant effect on the nonlinear natural frequencies of the DWCNT including multiple solutions.

  14. Calculating the reflected radiation error between turbine blades and vanes based on double contour integral method

    NASA Astrophysics Data System (ADS)

    Feng, Chi; Li, Dong; Gao, Shan; Daniel, Ketui

    2016-11-01

    This paper presents a CFD (Computation Fluid Dynamic) simulation and experimental results for the reflected radiation error from turbine vanes when measuring turbine blade's temperature using a pyrometer. In the paper, an accurate reflection model based on discrete irregular surfaces is established. Double contour integral method is used to calculate view factor between the irregular surfaces. Calculated reflected radiation error was found to change with relative position between blades and vanes as temperature distribution of vanes and blades was simulated using CFD. Simulation results indicated that when the vanes suction surface temperature ranged from 860 K to 1060 K and the blades pressure surface average temperature is 805 K, pyrometer measurement error can reach up to 6.35%. Experimental results show that the maximum pyrometer absolute error of three different targets on the blade decreases from 6.52%, 4.15% and 1.35% to 0.89%, 0.82% and 0.69% respectively after error correction.

  15. A Double Perturbation Method for Reducing Dynamical Degradation of the Digital Baker Map

    NASA Astrophysics Data System (ADS)

    Liu, Lingfeng; Lin, Jun; Miao, Suoxia; Liu, Bocheng

    2017-06-01

    The digital Baker map is widely used in different kinds of cryptosystems, especially for image encryption. However, any chaotic map which is realized on the finite precision device (e.g. computer) will suffer from dynamical degradation, which refers to short cycle lengths, low complexity and strong correlations. In this paper, a novel double perturbation method is proposed for reducing the dynamical degradation of the digital Baker map. Both state variables and system parameters are perturbed by the digital logistic map. Numerical experiments show that the perturbed Baker map can achieve good statistical and cryptographic properties. Furthermore, a new image encryption algorithm is provided as a simple application. With a rather simple algorithm, the encrypted image can achieve high security, which is competitive to the recently proposed image encryption algorithms.

  16. Earthquake relocation in Mollucas Sea using teleseismic double difference method for tectonic setting analysis

    NASA Astrophysics Data System (ADS)

    Setiadi, Tio Azhar Prakoso; Rohadi, Supriyanto; Heryandoko, Nova

    2017-07-01

    Earthquake hypocenter relocation is need to be done to get a better earthquake location with high accuracy so tectonic setting, and seismicity analysis can be get and done for further studies. One of some method to relocate earthquake is teleseismic Double-Difference that used 3D velocity model. This research is done by relocating 7042 of 8845 available earthquakes from January 1st 2009 - June 12th 2016 in Moluccas Sea. The result are better earthquake depths, showed by no more fixed depth earthquakes and hypocenter distribution shows subduction pattern which is assossiated to Moluccas Sea Plate. Subducting Plate of Moluccas Sea below Sangihe is getting deeper more way it gets north (± 580 km) and sloping to the south (± 280 km) and the subducting Moluccas Sea below Halmahera Arc is 250 km depth on average. Another result is a rollback of Phillipine plate is found that moves along with Moluccas Sea plate which is subducting below Halmahera Arc.

  17. Study of acoustic field modulation in the regenerator by double loudspeakers method.

    PubMed

    Zhou, Lihua; Xie, Xiujuan; Li, Qing

    2011-11-01

    A model to modulate acoustic field in a regenerator of a thermoacoustic system by the double loudspeakers method is presented in this paper. The equations are derived for acoustic field modulation. They represent the relations among acoustic field (complex pressure p(0), complex velocity u(0), and acoustic impedance Z(0)), driving parameters of loudspeakers (voltage amplitude and its phase difference), and operating parameters involved in a matrix H (frequency, temperature of regenerator). The range of acoustic field is adjustable and limited by the maximal driving voltages of loudspeakers according to driving parameters. The range is simulated and analyzed in the amplitude-phase and complex coordinate planes for a given or variable H. The simulated results indicate that the range has its intrinsic characteristics. The expected acoustic field in a regenerator can be obtained feasibly by the modulation.

  18. A double-observer method for reducing bias in faecal pellet surveys of forest ungulates

    USGS Publications Warehouse

    Jenkins, K.J.; Manly, B.F.J.

    2008-01-01

    1. Faecal surveys are used widely to study variations in abundance and distribution of forest-dwelling mammals when direct enumeration is not feasible. The utility of faecal indices of abundance is limited, however, by observational bias and variation in faecal disappearance rates that obscure their relationship to population size. We developed methods to reduce variability in faecal surveys and improve reliability of faecal indices. 2. We used double-observer transect sampling to estimate observational bias of faecal surveys of Roosevelt elk Cervus elaphus roosevelti and Columbian black-tailed deer Odocoileus hemionus columbianus in Olympic National Park, Washington, USA. We also modelled differences in counts of faecal groups obtained from paired cleared and uncleared transect segments as a means to adjust standing crop faecal counts for a standard accumulation interval and to reduce bias resulting from variable decay rates. 3. Estimated detection probabilities of faecal groups ranged from < 0.2-1.0 depending upon the observer, whether the faecal group was from elk or deer, faecal group size, distance of the faecal group from the sampling transect, ground vegetation cover, and the interaction between faecal group size and distance from the transect. 4. Models of plot-clearing effects indicated that standing crop counts of deer faecal groups required 34% reduction on flat terrain and 53% reduction on sloping terrain to represent faeces accumulated over a standard 100-day interval, whereas counts of elk faecal groups required 0% and 46% reductions on flat and sloping terrain, respectively. 5. Synthesis and applications. Double-observer transect sampling provides a cost-effective means of reducing observational bias and variation in faecal decay rates that obscure the interpretation of faecal indices of large mammal abundance. Given the variation we observed in observational bias of faecal surveys and persistence of faeces, we emphasize the need for future

  19. ISS Double-Gimbaled CMG Subsystem Simulation Using the Agile Development Method

    NASA Technical Reports Server (NTRS)

    Inampudi, Ravi

    2016-01-01

    This paper presents an evolutionary approach in simulating a cluster of 4 Control Moment Gyros (CMG) on the International Space Station (ISS) using a common sense approach (the agile development method) for concurrent mathematical modeling and simulation of the CMG subsystem. This simulation is part of Training systems for the 21st Century simulator which will provide training for crew members, instructors, and flight controllers. The basic idea of how the CMGs on the space station are used for its non-propulsive attitude control is briefly explained to set up the context for simulating a CMG subsystem. Next different reference frames and the detailed equations of motion (EOM) for multiple double-gimbal variable-speed control moment gyroscopes (DGVs) are presented. Fixing some of the terms in the EOM becomes the special case EOM for ISS's double-gimbaled fixed speed CMGs. CMG simulation development using the agile development method is presented in which customer's requirements and solutions evolve through iterative analysis, design, coding, unit testing and acceptance testing. At the end of the iteration a set of features implemented in that iteration are demonstrated to the flight controllers thus creating a short feedback loop and helping in creating adaptive development cycles. The unified modeling language (UML) tool is used in illustrating the user stories, class designs and sequence diagrams. This incremental development approach of mathematical modeling and simulating the CMG subsystem involved the development team and the customer early on, thus improving the quality of the working CMG system in each iteration and helping the team to accurately predict the cost, schedule and delivery of the software.

  20. Method for colorimetric detection of double-stranded nucleic acid using leuco triphenylmethane dyes.

    PubMed

    Miyamoto, Shigehiko; Sano, Sotaro; Takahashi, Koji; Jikihara, Takaaki

    2015-03-15

    Because loop-mediated isothermal amplification (LAMP) can amplify substantial amounts of DNA under isothermal conditions, its applications for simple genetic testing have attracted considerable attention. A positive LAMP reaction is indicated by the turbidity caused by by-products or by the color change after adding a metallochromic indicator to the reaction solution, but these methods have certain limitations. Leuco crystal violet (LCV), a colorless dye obtained after sodium sulfite treatment of crystal violet (CV), was used as a new colorimetric method for detecting LAMP. LCV is reconverted into CV through contact with double-stranded DNA (dsDNA). Therefore, the positive reaction of LAMP is indicated by color change from colorless to violet. The assay is sensitive enough to detect LAMP products, with a detection limit of 7.1 ng/μl for dsDNA. It is also highly selective to dsDNA, and interference with single-stranded DNA and deoxynucleotide triphosphates (dNTPs) is not observed. LCV facilitates direct colorimetric detection of the main product rather than a by-product of the LAMP reaction; therefore, this method can be used under various reaction conditions such as those with added pyrophosphatase in solution. This colorimetric LAMP detection method using LCV is useful for point-of-care genetic testing given its simplicity.

  1. Prenatal cannabis exposure - The "first hit" to the endocannabinoid system.

    PubMed

    Richardson, Kimberlei A; Hester, Allison K; McLemore, Gabrielle L

    As more states and countries legalize medical and/or adult recreational marijuana use, the incidences of prenatal cannabis exposure (PCE) will likely increase. While young people increasingly view marijuana as innocuous, marijuana preparations have been growing in potency in recent years, potentially creating global clinical, public health, and workforce concerns. Unlike fetal alcohol spectrum disorder, there is no phenotypic syndrome associated with PCE. There is also no preponderance of evidence that PCE causes lifelong cognitive, behavioral, or functional abnormalities, and/or susceptibility to subsequent addiction. However, there is compelling circumstantial evidence, based on the principles of teratology and fetal malprogramming, suggesting that pregnant women should refrain from smoking marijuana. The usage of marijuana during pregnancy perturbs the fetal endogenous cannabinoid signaling system (ECSS), which is present and active from the early embryonic stage, modulating neurodevelopment and continuing this role into adulthood. The ECSS is present in virtually every brain structure and organ system, and there is also evidence that this system is important in the regulation of cardiovascular processes. Endocannabinoids (eCBs) undergird a broad spectrum of processes, including the early stages of fetal neurodevelopment and uterine implantation. Delta-9-tetrahydrocannabinol (THC), the psychoactive chemical in cannabis, enters maternal circulation, and readily crosses the placental membrane. THC binds to CB receptors of the fetal ECSS, altering neurodevelopment and possibly rewiring ECSS circuitry. In this review, we discuss the Double-Hit Hypothesis as it relates to PCE. We contend that PCE, similar to a neurodevelopmental teratogen, delivers the first hit to the ECSS, which is compromised in such a way that a second hit (i.e., postnatal stressors) will precipitate the emergence of a specific phenotype. In summary, we conclude that perturbations of the

  2. Dimensional measurement of micro parts with high aspect ratio in HIT-UOI

    NASA Astrophysics Data System (ADS)

    Dang, Hong; Cui, Jiwen; Feng, Kunpeng; Li, Junying; Zhao, Shiyuan; Zhang, Haoran; Tan, Jiubin

    2016-11-01

    Micro parts with high aspect ratios have been widely used in different fields including aerospace and defense industries, while the dimensional measurement of these micro parts becomes a challenge in the field of precision measurement and instrument. To deal with this contradiction, several probes for the micro parts precision measurement have been proposed by researchers in Center of Ultra-precision Optoelectronic Instrument (UOI), Harbin Institute of Technology (HIT). In this paper, optical fiber probes with structures of spherical coupling(SC) with double optical fibers, micro focal-length collimation (MFL-collimation) and fiber Bragg grating (FBG) are described in detail. After introducing the sensing principles, both advantages and disadvantages of these probes are analyzed respectively. In order to improve the performances of these probes, several approaches are proposed. A two-dimensional orthogonal path arrangement is propounded to enhance the dimensional measurement ability of MFL-collimation probes, while a high resolution and response speed interrogation method based on differential method is used to improve the accuracy and dynamic characteristics of the FBG probes. The experiments for these special structural fiber probes are given with a focus on the characteristics of these probes, and engineering applications will also be presented to prove the availability of them. In order to improve the accuracy and the instantaneity of the engineering applications, several techniques are used in probe integration. The effectiveness of these fiber probes were therefore verified through both the analysis and experiments.

  3. Evaluation of the constant potential method in simulating electric double-layer capacitors

    NASA Astrophysics Data System (ADS)

    Wang, Zhenxing; Yang, Yang; Olmsted, David L.; Asta, Mark; Laird, Brian B.

    2014-11-01

    A major challenge in the molecular simulation of electric double layer capacitors (EDLCs) is the choice of an appropriate model for the electrode. Typically, in such simulations the electrode surface is modeled using a uniform fixed charge on each of the electrode atoms, which ignores the electrode response to local charge fluctuations in the electrolyte solution. In this work, we evaluate and compare this Fixed Charge Method (FCM) with the more realistic Constant Potential Method (CPM), [S. K. Reed et al., J. Chem. Phys. 126, 084704 (2007)], in which the electrode charges fluctuate in order to maintain constant electric potential in each electrode. For this comparison, we utilize a simplified LiClO4-acetonitrile/graphite EDLC. At low potential difference (ΔΨ ⩽ 2 V), the two methods yield essentially identical results for ion and solvent density profiles; however, significant differences appear at higher ΔΨ. At ΔΨ ⩾ 4 V, the CPM ion density profiles show significant enhancement (over FCM) of "inner-sphere adsorbed" Li+ ions very close to the electrode surface. The ability of the CPM electrode to respond to local charge fluctuations in the electrolyte is seen to significantly lower the energy (and barrier) for the approach of Li+ ions to the electrode surface.

  4. Evaluation of the constant potential method in simulating electric double-layer capacitors

    SciTech Connect

    Wang, Zhenxing; Laird, Brian B.; Yang, Yang; Olmsted, David L.; Asta, Mark

    2014-11-14

    A major challenge in the molecular simulation of electric double layer capacitors (EDLCs) is the choice of an appropriate model for the electrode. Typically, in such simulations the electrode surface is modeled using a uniform fixed charge on each of the electrode atoms, which ignores the electrode response to local charge fluctuations in the electrolyte solution. In this work, we evaluate and compare this Fixed Charge Method (FCM) with the more realistic Constant Potential Method (CPM), [S. K. Reed et al., J. Chem. Phys. 126, 084704 (2007)], in which the electrode charges fluctuate in order to maintain constant electric potential in each electrode. For this comparison, we utilize a simplified LiClO{sub 4}-acetonitrile/graphite EDLC. At low potential difference (ΔΨ ⩽ 2 V), the two methods yield essentially identical results for ion and solvent density profiles; however, significant differences appear at higher ΔΨ. At ΔΨ ⩾ 4 V, the CPM ion density profiles show significant enhancement (over FCM) of “inner-sphere adsorbed” Li{sup +} ions very close to the electrode surface. The ability of the CPM electrode to respond to local charge fluctuations in the electrolyte is seen to significantly lower the energy (and barrier) for the approach of Li{sup +} ions to the electrode surface.

  5. Evaluation of the constant potential method in simulating electric double-layer capacitors.

    PubMed

    Wang, Zhenxing; Yang, Yang; Olmsted, David L; Asta, Mark; Laird, Brian B

    2014-11-14

    A major challenge in the molecular simulation of electric double layer capacitors (EDLCs) is the choice of an appropriate model for the electrode. Typically, in such simulations the electrode surface is modeled using a uniform fixed charge on each of the electrode atoms, which ignores the electrode response to local charge fluctuations in the electrolyte solution. In this work, we evaluate and compare this Fixed Charge Method (FCM) with the more realistic Constant Potential Method (CPM), [S. K. Reed et al., J. Chem. Phys. 126, 084704 (2007)], in which the electrode charges fluctuate in order to maintain constant electric potential in each electrode. For this comparison, we utilize a simplified LiClO4-acetonitrile/graphite EDLC. At low potential difference (ΔΨ ⩽ 2 V), the two methods yield essentially identical results for ion and solvent density profiles; however, significant differences appear at higher ΔΨ. At ΔΨ ⩾ 4 V, the CPM ion density profiles show significant enhancement (over FCM) of "inner-sphere adsorbed" Li(+) ions very close to the electrode surface. The ability of the CPM electrode to respond to local charge fluctuations in the electrolyte is seen to significantly lower the energy (and barrier) for the approach of Li(+) ions to the electrode surface.

  6. A novel method to get methotrexatum/layered double hydroxides intercalation compounds and their release properties

    NASA Astrophysics Data System (ADS)

    Qi, Fenglin; Zhang, Xiaoqing; Li, Shuping

    2013-08-01

    In this context, the methotrexatum/layered double hydroxides (MTX/LDHs) intercalation compounds have been synthesized by a mechanochemical-hydrothermal method, which involves a grinding process and subsequent hydrothermal treatment. The influence of R (molar ratio of Mg2+ to Al3+ to MTX) values on the structure and morphology of the intercalation compounds and their release properties were investigated systematically. The resulting compounds were characterized by X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR), transmission electron microscopy (TEM), inductively coupled plasma (ICP), thermogravimetric (TG) and differential scanning calorimetry (DSC) analysis. All the results indicate that R value has significant influence on the intercalation of MTX anions into LDH interlayer and the optimal R value is 2:1:0.5. Furthermore, four dissolution-diffusion kinetic models were used to fit the in vitro release of MTX from LDH layers. The release process can be divided into two stages: firstly surface diffusion and secondly intraparticle diffusion. The study also revealed that the properties of the intercalation compounds is comparable to that obtained from standard methods such as co-precipitation method, but with time, solvent and energy saving.

  7. Enrollment Forecasting with Double Exponential Smoothing: Two Methods for Objective Weight Factor Selection. AIR Forum 1980 Paper.

    ERIC Educational Resources Information Center

    Gardner, Don E.

    The merits of double exponential smoothing are discussed relative to other types of pattern-based enrollment forecasting methods. The difficulties associated with selecting an appropriate weight factor are discussed, and their potential effects on prediction results are illustrated. Two methods for objectively selecting the "best" weight…

  8. Estimate of the trigger inefficiency due to extra hits in H1 and H2, using clean Chi(2) events

    SciTech Connect

    Mussa, R.; /INFN, Turin /Turin U.

    1992-07-01

    An accurate study of the inefficiency of the trigger selection criterium based on the multiplicity of hits in the two hodoscopes has been done using {chi}{sub 2} events take during the 1991 run, selected requiring that both electron tracks were associated to a Cherenkov hit (so that no multiplicity requirement at trigger level was asked), and a {chi}{sup 2} probability for the kinematic fit bigger than 0.01. In a table it is shown the number of events found for different multiplicities in the two hodoscopes. They have 554/1819 = 30.5 {+-} 1.3% of the events with extra-hits in the two hodoscopes, and they can think of 3 possible sources for this effect: (1) accidental {delta} rays due to the interactions of the beam halo inside or against the walls of the beam pipe give an extra activity on H1 that should be uncorrelated to the hits due to real tracks; (2) {delta} rays at large angles emitted by the electrons interacting with the inner layers of the detector, so that they expect extra-hits close to the real tracks; and (3) the conversion of the {delta} inside the beam pipe and in the inner detectors can give an extra-hit in H2 or H1 and H2: this also doubles the number of sources of {delta} rays, so that a big number of these events have 4 H2 firing.

  9. New modified multi-level residue harmonic balance method for solving nonlinearly vibrating double-beam problem

    NASA Astrophysics Data System (ADS)

    Rahman, Md. Saifur; Lee, Yiu-Yin

    2017-10-01

    In this study, a new modified multi-level residue harmonic balance method is presented and adopted to investigate the forced nonlinear vibrations of axially loaded double beams. Although numerous nonlinear beam or linear double-beam problems have been tackled and solved, there have been few studies of this nonlinear double-beam problem. The geometric nonlinear formulations for a double-beam model are developed. The main advantage of the proposed method is that a set of decoupled nonlinear algebraic equations is generated at each solution level. This heavily reduces the computational effort compared with solving the coupled nonlinear algebraic equations generated in the classical harmonic balance method. The proposed method can generate the higher-level nonlinear solutions that are neglected by the previous modified harmonic balance method. The results from the proposed method agree reasonably well with those from the classical harmonic balance method. The effects of damping, axial force, and excitation magnitude on the nonlinear vibrational behaviour are examined.

  10. Development of methods for avian oil toxicity studies using the double crested cormorant (Phalacrocorax auritus).

    PubMed

    Cunningham, Fred; Dean, Karen; Hanson-Dorr, Katie; Harr, Kendal; Healy, Kate; Horak, Katherine; Link, Jane; Shriner, Susan; Bursian, Steven; Dorr, Brian

    2017-03-24

    Oral and external dosing methods replicating field exposure were developed using the double crested cormorant (DCCO) to test the toxicity of artificially weathered Deepwater Horizon Mississippi Canyon 252 oil. The majority of previous oil dosing studies conducted on wild-caught birds used gavage methods to dose birds with oil and determine toxicity. However, rapid gut transit time of gavaged oil likely reduces oil absorption. In the present studies, dosing relied on injection of oil into live feeder fish for oral dosing of these piscivorous birds, or applying oil to body contour feathers resulting in transdermal oil exposure and oral exposure through preening. Both oral and external oil dosing studies identified oil-related toxicity endpoints associated with oxidative stress such as hemolytic anemia, liver and kidney damage, and immuno-modulation or compromise. External oil application allowed for controlled study of thermoregulatory stress as well. Infrared thermal images indicated significantly greater surface temperatures and heat loss in treated birds following external oil applications; however, measurements collected by coelomically implanted temperature transmitters showed that internal body temperatures were stable over the course of the study period. Birds exposed to oil externally consumed more fish than control birds, indicating metabolic compensation for thermal stress. Conversely, birds orally dosed with oil experienced hypothermia and consumed less fish compared to control birds.

  11. [Two cases of Paragonimiasis westermani in a Chinese family diagnosed with the Ouchterlony double diffusion method].

    PubMed

    Hoshina, Tokio; Tamura, Kumi; Kawano, Shinji; Kato, Tetsurou; Sato, Fumiya; Horino, Tetsuya; Nakazawa, Yasushi; Yosikawa, Kouji; Yoshida, Masaki; Kumagai, Masahiro; Hori, Seiji

    2014-11-01

    We report two cases of Paragonimus westermani infection in a Chinese family in Japan. A 41-year-old husband and his 40-year-old wife were infected with P. westermani after consuming a homemade Chinese traditional "Drunken Crab." They were a family with two children who had lived in Japan for 19 years. The crabs were Eriocheir japonica sent from the Kyusyu area that they had pickled at home with soy sauce and Chinese liquor for 5 days. Their children did not eat any of the crabs. One month after consuming the crabs, the husband came to our outpatient clinic with fever and chest pain and his wife also presented with a persistent cough. Both patients had a high peripheral blood eosinophil count (husband:18,900/μL, wife:10,600/μL) with pulmonary effusion, nodular shadow, and pneumothorax in chest X-ray findings. Paragonimiasis was suspected from the episode of consuming the crabs. No parasite eggs were seen in their sputum and stool samples. A multiple-dot ELISA was performed with the sera to screen for parasitic infections, but the result was only weakly positive for P. westermani antigen in the husband and a slightly positive reaction in the wife. The diagnosis of P. westermani was achieved with the double diffusion Ouchterlony method using P. westermani antigen and P. miyazakii antigen. Praziquantel administration for three days improved the symptoms in both patients. The Ouchterlony method proved useful in diagnosing paragonimiasis in these cases.

  12. Simple hydraulic conductivity estimation by the Kalman filtered double constraint method.

    PubMed

    El-Rawy, M A; Batelaan, O; Zijl, W

    2015-01-01

    This paper presents the Kalman Filtered Double Constraint Method (DCM-KF) as a technique to estimate the hydraulic conductivities in the grid blocks of a groundwater flow model. The DCM is based on two forward runs with the same initial grid block conductivities, but with alternating flux-head conditions specified on parts of the boundary and the wells. These two runs are defined as: (1) the flux run, with specified fluxes (recharge and well abstractions), and (2) the head run, with specified heads (measured in piezometers). Conductivities are then estimated as the initial conductivities multiplied by the fluxes obtained from the flux run and divided by the fluxes obtained from the head run. The DCM is easy to implement in combination with existing models (e.g., MODFLOW). Sufficiently accurate conductivities are obtained after a few iterations. Because of errors in the specified head-flux couples, repeated estimation under varying hydrological conditions results in different conductivities. A time-independent estimate of the conductivities and their inaccuracy can be obtained by a simple linear KF with modest computational requirements. For the Kleine Nete catchment, Belgium, the DCM-KF yields sufficiently accurate calibrated conductivities. The method also results in distinguishing regions where the head-flux observations influence the calibration from areas where it is not able to influence the hydraulic conductivity.

  13. A NUMERICAL METHOD FOR STUDYING SUPER-EDDINGTON MASS TRANSFER IN DOUBLE WHITE DWARF BINARIES

    SciTech Connect

    Marcello, Dominic C.; Tohline, Joel E. E-mail: tohline@phys.lsu.edu

    2012-04-01

    We present a numerical method for the study of double white dwarf (DWD) binary systems at the onset of super-Eddington mass transfer. We incorporate the physics of ideal inviscid hydrodynamical flow, Newtonian self-gravity, and radiation transport on a three-dimensional uniformly rotating cylindrical Eulerian grid. Care has been taken to conserve the key physical quantities such as angular momentum and energy. Our new method conserves total energy to a higher degree of accuracy than other codes that are presently being used to model mass transfer in DWD systems. We present the results of verification tests and simulate the first 20 + orbits of a binary system of mass ratio q 0.7 at the onset of dynamically unstable direct impact mass transfer. The mass transfer rate quickly exceeds the critical Eddington limit by many orders of magnitude, and thus we are unable to model a trans-Eddington phase. It appears that radiation pressure does not significantly affect the accretion flow in the highly super-Eddington regime. An optically thick common envelope forms around the binary within a few orbits. Although this envelope quickly exceeds the spatial domain of the computational grid, the fraction of the common envelope that exceeds zero gravitational binding energy is extremely small, suggesting that radiation-driven mass loss is insignificant in this regime. It remains to be seen whether simulations that capture the trans-Eddington phase of such flows will lead to the same conclusion or show that substantial material gets expelled.

  14. Maximum ikelihood estimation for the double-count method with independent observers

    USGS Publications Warehouse

    Manly, Bryan F.J.; McDonald, Lyman L.; Garner, Gerald W.

    1996-01-01

    Data collected under a double-count protocol during line transect surveys were analyzed using new maximum likelihood methods combined with Akaike's information criterion to provide estimates of the abundance of polar bear (Ursus maritimus Phipps) in a pilot study off the coast of Alaska. Visibility biases were corrected by modeling the detection probabilities using logistic regression functions. Independent variables that influenced the detection probabilities included perpendicular distance of bear groups from the flight line and the number of individuals in the groups. A series of models were considered which vary from (1) the simplest, where the probability of detection was the same for both observers and was not affected by either distance from the flight line or group size, to (2) models where probability of detection is different for the two observers and depends on both distance from the transect and group size. Estimation procedures are developed for the case when additional variables may affect detection probabilities. The methods are illustrated using data from the pilot polar bear survey and some recommendations are given for design of a survey over the larger Chukchi Sea between Russia and the United States.

  15. Determination of optical properties in dental restorative biomaterials using the inverse-adding-doubling method

    NASA Astrophysics Data System (ADS)

    Fernández-Oliveras, Alicia; Rubiño, Manuel; Pérez, María. M.

    2013-11-01

    Light propagation in biological media is characterized by the absorption coefficient, the scattering coefficient, the scattering phase function, the refractive index, and the surface conditions (roughness). By means of the inverse-adding-doubling (IAD) method, transmittance and reflectance measurements lead to the determination of the absorption coefficient and the reduced scattering coefficient. The additional measurement of the phase function performed by goniometry allows the separation of the reduced scattering coefficient into the scattering coefficient and the scattering anisotropy factor. The majority of techniques, such as the one utilized in this work, involve the use of integrating spheres to measure total transmission and reflection. We have employed an integrating sphere setup to measure the total transmittance and reflectance of dental biomaterials used in restorative dentistry. Dental biomaterials are meant to replace dental tissues, such as enamel and dentine, in irreversibly diseased teeth. In previous works we performed goniometric measurements in order to evaluate the scattering anisotropy factor for these kinds of materials. In the present work we have used the IAD method to combine the measurements performed using the integrating sphere setup with the results of the previous goniometric measurements. The aim was to optically characterize the dental biomaterials analyzed, since whole studies to assess the appropriate material properties are required in medical applications. In this context, complete optical characterizations play an important role in achieving the fulfillment of optimal quality and the final success of dental biomaterials used in restorative dentistry.

  16. 77 FR 23250 - HIT Standards Committee; Schedule for the Assessment of HIT Policy Committee Recommendations

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-18

    ... Nationwide Health Information Network Power Team, the Consumer/Patient Engagement Power Team, and the... Recommendations AGENCY: Office of the National Coordinator for Health Information Technology, HHS. ACTION: Notice... recommendations received from the HIT Policy Committee regarding health information technology standards...

  17. Automated microaneurysm detection method based on double ring filter in retinal fundus images

    NASA Astrophysics Data System (ADS)

    Mizutani, Atsushi; Muramatsu, Chisako; Hatanaka, Yuji; Suemori, Shinsuke; Hara, Takeshi; Fujita, Hiroshi

    2009-02-01

    The presence of microaneurysms in the eye is one of the early signs of diabetic retinopathy, which is one of the leading causes of vision loss. We have been investigating a computerized method for the detection of microaneurysms on retinal fundus images, which were obtained from the Retinopathy Online Challenge (ROC) database. The ROC provides 50 training cases, in which "gold standard" locations of microaneurysms are provided, and 50 test cases without the gold standard locations. In this study, the computerized scheme was developed by using the training cases. Although the results for the test cases are also included, this paper mainly discusses the results for the training cases because the "gold standard" for the test cases is not known. After image preprocessing, candidate regions for microaneurysms were detected using a double-ring filter. Any potential false positives located in the regions corresponding to blood vessels were removed by automatic extraction of blood vessels from the images. Twelve image features were determined, and the candidate lesions were classified into microaneurysms or false positives using the rule-based method and an artificial neural network. The true positive fraction of the proposed method was 0.45 at 27 false positives per image. Forty-two percent of microaneurysms in the 50 training cases were considered invisible by the consensus of two co-investigators. When the method was evaluated for visible microaneurysms, the sensitivity for detecting microaneurysms was 65% at 27 false positives per image. Our computerized detection scheme could be improved for helping ophthalmologists in the early diagnosis of diabetic retinopathy.

  18. Development of ultra-precision micro-cavity measurement technique in HIT-UOI

    NASA Astrophysics Data System (ADS)

    Cui, Jiwen; Li, Lei; Tan, Jiubin

    2010-08-01

    Micro cavities with high aspect ratio are widely used in different fields including aerospace and defense industries with the development of manufacturing technology. So how to measure the dimension of these cavities has become one of the major research subjects in the field of measurement and instrument. This paper describes some activities of the precision micro cavity measurement technique in Center of Ultra-precision Optoelectronic Instrument (UOI), Harbin Institute of Technology (HIT). The key issue of micro cavity measurement in UOI is called touch-trigger measurement method. The first scheme is double optical fiber coupling, in which light coming from the incident optical fiber is transmitted in the reversal direction via the optical fiber coupling into the effluent optical fiber, the lateral displacement of the touch-trigger sensor is transformed into the deflexion of light coming out from the effluent optical fiber, and the deflexion is transformed into an image signal by the object lens and CCD capturing system. And the second scheme is micro focal-length collimation, in which a fiber stem with a ball mounted on its end is used as a probe and a small segment of it is used as a cylindrical lens to collimate a point light source and image it to a camera, the deflection of the fiber stem can be inferred from the change in image acquired by the camera with ultrahigh displacement sensitivity. Experiments for these activities will be given with a focus on the measurement results and repeatability uncertainty.

  19. Phase transfer and point-spread function of the human eye determined by a new asymmetric double-pass method.

    PubMed

    Navarro, R; Losada, M A

    1995-11-01

    A recent study has shown that the double-pass method provides a good estimate of the ocular modulation transfer function (MTF) but that it does not yield the phase transfer function (PTF) [J. Opt. Soc. Am. A 12, 195 (1995)]. Therefore, one cannot recover the true retinal point-spread function (PSF). We present a modification of the double-pass method to overcome this problem. The key is to break the symmetry between the two passes. By using an unexpanded Gaussian input beam, we produce a diffraction-limited PSF for the first passes. Then, by using a large exit pupil, we get an aberrated PSF for the second pass. The double-pass aerial image is the cross correlation of both PSF's, so that the Fourier transform of such an aerial image directly provides the true retinal PTF, up to the cutoff frequency of the effective (small), diffraction-limited entrance pupil. The resulting double-pass aerial image is a blurred version of the true retinal PSF. Thus it shows the effect not only of even symmetric aberrations but also of odd and irregular aberrations such as coma. We have explored two different ways to retrieve the true retinal PSF: (a) deblurring of the aerial image and (b) PSF reconstruction combining PTF data with conventional double-pass MTF. We present promising initial results with both artificial and real eyes.

  20. Symmetrized complex amplitudes for He double photoionization from the time-dependent close coupling and exterior complex scaling methods

    SciTech Connect

    Horner, D.A.; Colgan, J.; Martin, F.; McCurdy, C.W.; Pindzola, M.S.; Rescigno, T.N.

    2004-06-01

    Symmetrized complex amplitudes for the double photoionization of helium are computed by the time-dependent close-coupling and exterior complex scaling methods, and it is demonstrated that both methods are capable of the direct calculation of these amplitudes. The results are found to be in excellent agreement with each other and in very good agreement with results of other ab initio methods and experiment.

  1. HANFORD DOUBLE SHELL TANK (DST) THERMAL & SEISMIC PROJECT BUCKLING EVALUATION METHODS & RESULTS FOR THE PRIMARY TANKS

    SciTech Connect

    MACKEY, T.C.

    2006-03-17

    This report documents a detailed buckling evaluation of the primary tanks in the Hanford double shell waste tanks. The analysis is part of a comprehensive structural review for the Double-Shell Tank Integrity Project. This work also provides information on tank integrity that specifically responds to concerns raise by the Office of Environment, Safety, and Health (ES&H) Oversight (EH-22) during a review (in April and May 2001) of work being performed on the double-shell tank farms, and the operation of the aging waste facility (AWF) primary tank ventilation system.

  2. A Facile Method to Fabricate Double Gyroid as A Polymer Template for Nanohybrids

    NASA Astrophysics Data System (ADS)

    Wang, Hsiao-Fang; Ho, Rong-Ming

    2015-03-01

    Here, we suggest a facile method to acquire double gyroid (DG) phase from the self-assembly of chiral block copolymers (BCPs*), polystyrene- b-poly(L-lactide) (PS-PLLA). A wide region for the formation of DG can be found in the phase diagram of the BCPs*, suggesting that helical phase (H*) from the self-assembly of BCPs* can serve as a stepping stone for the formation of the DG due to an easy path for order-order transition from two-dimensional to three-dimensional (network) structure. Moreover, the order-order transition from metastable H* to stable DG can be expedited by blending the PS-PLLA with compatible entity. Moreover, PS-PLLA blends are prepared by using styrene oligomer (S) to fine-tune the morphologies of the blends at which the molecular weight ratio of the S and compatible PS block (r) is less than 0.1. Owing to the use of the low-molecular-weight oligomer, the increase of BCP chain mobility in the blends significantly reduces the transformation time for the order-order transition from H* to DG. Consequently, nanoporous gyroid SiO2 can be fabricated using hydrolyzed PS-PLLA blends as a template for sol-gel reaction followed by removal of the PS matrix.

  3. Method for analysis of antigen-antibody precipitins in double immunodiffusion.

    PubMed

    Treadwell, E L; Swanson, M S; Byrd, A W

    1988-01-01

    Ribonucleoprotein (RNP) antigen-antibody precipitin bands obtained by two-dimensional double immunodiffusion were systematically analyzed and compared using a microcomputer and a SPSS-PC statistical analysis package. Precipitins rated in respective agarose concentrations ranging from 0.3% to 1.5% were obtained from twofold dilutions of a calf thymus nuclear extract (CTNE) containing RNP antigen. These dilutions were reacted against the same dilutions of plasma containing anti-RNP antibody. A Mean Quality Index Score was calculated at each agarose concentration from the sum of ratings assigned for the intensity (thickness) of precipitin bands times the sum of ratings assigned for the clarity (clearness and sharpness) of the precipitin bands. This product was divided by the total number of possible precipitin reactions. The Mean Quality Index Score for the 0.4% agarose was significantly higher than the other concentrations (p less than or equal to 0.05). This method or similar approaches may allow a more systematic way of comparing precipitins developed in gel immunodiffusion.

  4. Hypocenters relocation using double-difference method around Molucca Collision Zone

    NASA Astrophysics Data System (ADS)

    Yulianto, Yuhanas; Nugraha, Andri Dian; Wiyono, Wandono Samsul

    2017-07-01

    Eastern Indonesia is situated in a very complicated tectonic settings due to the converging of three major plates. Those plates do not have a clear boundary between each other. The boundary zone is covered by many microplates which converging or subducting to each other or create a large dimension of transform fault. Consequently, the region has a relatively higher seismic activity compared to others region in Indonesia, or even we can say, in the world. In this study, we attempt to achieve better hypocenter locations with double-difference method using local earthquake events compiled by MCGA of Indonesia. We selected 3,666 events from 42 stations for time periods of January 2010 to December 2015 which occurred in area around Molucca Collision Zone. Our results show better hypocenter location according to the RMS of time residual shifting. The most significant changes are in the shallow events where fix-depth effect had been removed. Overall, the relocated hypocenter locations show a better distribution to represent the tectonic setting.

  5. Willingness to pay for telemedicine assessed by the double-bounded dichotomous choice method.

    PubMed

    Bradford, W David; Kleit, Andrew N; Krousel-Wood, M A; Re, Richard M

    2004-01-01

    We investigated the willingness of patients with chronic heart failure (CHF) to pay for access to medical care via telemedicine, as an alternative to visits to a physician's office. Willingness to pay was estimated using a double-bounded dichotomous choice contingent valuation method. One hundred and twenty-six patients were surveyed after their discharge from a CHF-related hospital stay. As expected, willingness to pay was negatively related to price. When people are presented with a survey question about value, particularly when the good being valued is not traded in the market, the question itself can affect the person's perception of value. However, the survey results showed no evidence of such a 'framing' effect. We found that 55% of the patients would be willing to pay $20 to access telemedicine instead of travelling to the physician's office, for at least some of their care. When the price was raised to $40, the proportion willing to pay fell to 19%. This suggests that telemedicine may be close to being commercially feasible in the USA.

  6. Relative clock estimation method between two LEO satellites with a double-difference solution constraint

    NASA Astrophysics Data System (ADS)

    Liu, Junhong; Gu, Defeng; Ju, Bing; Lai, Yuwang; Yi, Dongyun

    2015-04-01

    A method of estimating the relative clocks between two spaceborne global positioning system (GPS) receivers based on the single-difference (SD) observations is investigated in this paper. Especially, the advantages of introducing a double-difference (DD) solution constraint, including the orbits and ambiguities, are discussed with the simulated data and the real data of Gravity Recovery And Climate Experiment (GRACE) satellites. The theoretical accuracy analysis shows that the accuracy of the relative clocks is improved and the edge effects are eliminated with a DD solution constraint. The simulations indicate a potential accuracy improvement of at least 30% of the relative clocks with the constraint. Furthermore, one month's real data is processed and the overlapping data arcs are used to validate the accuracy of the relative clock solutions. The average overlapping root mean square (RMS) of the relative clock solutions is approximate 99 ps and 31 ps without and with the DD solution constraint, respectively. Moreover, the jumps of the day boundaries are weakened evidently by adding the DD solution constraint. This paper demonstrates that the accuracy and stability of the estimated relative clocks between two low earth orbit (LEO) satellites from SD observations are improved obviously with the DD solution constraint.

  7. Radiation dose determines the method for quantification of DNA double strand breaks.

    PubMed

    Bulat, Tanja; Keta, Otilija; Korićanac, Lela; Žakula, Jelena; Petrović, Ivan; Ristić-Fira, Aleksandra; Todorović, Danijela

    2016-03-01

    Ionizing radiation induces DNA double strand breaks (DSBs) that trigger phosphorylation of the histone protein H2AX (γH2AX). Immunofluorescent staining visualizes formation of γH2AX foci, allowing their quantification. This method, as opposed to Western blot assay and Flow cytometry, provides more accurate analysis, by showing exact position and intensity of fluorescent signal in each single cell. In practice there are problems in quantification of γH2AX. This paper is based on two issues: the determination of which technique should be applied concerning the radiation dose, and how to analyze fluorescent microscopy images obtained by different microscopes. HTB140 melanoma cells were exposed to γ-rays, in the dose range from 1 to 16 Gy. Radiation effects on the DNA level were analyzed at different time intervals after irradiation by Western blot analysis and immunofluorescence microscopy. Immunochemically stained cells were visualized with two types of microscopes: AxioVision (Zeiss, Germany) microscope, comprising an ApoTome software, and AxioImagerA1 microscope (Zeiss, Germany). Obtained results show that the level of γH2AX is time and dose dependent. Immunofluorescence microscopy provided better detection of DSBs for lower irradiation doses, while Western blot analysis was more reliable for higher irradiation doses. AxioVision microscope containing ApoTome software was more suitable for the detection of γH2AX foci.

  8. Vanadium nitrogenase: a two-hit wonder?

    PubMed

    Hu, Yilin; Lee, Chi Chung; Ribbe, Markus W

    2012-01-28

    Nitrogenase catalyzes the biological conversion of atmospheric dinitrogen to bioavailable ammonia. The molybdenum (Mo)- and vanadium (V)-dependent nitrogenases are two homologous members of this metalloenzyme family. However, despite their similarities in structure and function, the characterization of V-nitrogenase has taken a much longer and more winding path than that of its Mo-counterpart. From the initial discovery of this nitrogen-fixing system, to the recent finding of its CO-reducing capacity, V-nitrogenase has proven to be a two-hit wonder in the over-a-century-long research of nitrogen fixation. This perspective provides a brief account of the catalytic function and structural basis of V-nitrogenase, as well as a short discussion of the theoretical and practical potentials of this unique metalloenzyme.

  9. Vanadium Nitrogenase: A Two-Hit Wonder?

    PubMed Central

    Hu, Yilin; Lee, Chi Chung; Ribbe, Markus W.

    2013-01-01

    Nitrogenase catalyzes the biological conversion of atmospheric dinitrogen to bioavailable ammonia. The molybdenum (Mo)- and vanadium (V)-dependent nitrogenases are two homologous members of this metalloenzyme family. However, despite their similarities in structure and function, the characterization of V-nitrogenase has taken a much longer and more winding path than that of its Mo-counterpart. From the initial discovery of this nitrogen-fixing system, to the recent finding of its CO-reducing capacity, V-nitrogenase has proven to be a two-hit wonder in the over-a-century-long research of nitrogen fixation. This perspective provides a brief account of the catalytic function and structural basis of V-nitrogenase, as well as a short discussion of the theoretical and practical potentials of this unique metalloenzyme. PMID:22101422

  10. Sonic Simulation of Near Projectile Hits

    NASA Technical Reports Server (NTRS)

    Statman, J. I.; Rodemich, E. R.

    1988-01-01

    Measured frequencies identify projectiles and indicate miss distances. Developmental battlefield-simulation system for training soldiers uses sounds emitted by incoming projectiles to identify projectiles and indicate miss distances. Depending on projectile type and closeness of each hit, system generates "kill" or "near-kill" indication. Artillery shell simulated by lightweight plastic projectile launched by compressed air. Flow of air through groove in nose of projectile generates acoustic tone. Each participant carries audio receiver measure and process tone signal. System performs fast Fourier transforms of received tone to obtain dominant frequency during each succeeding interval of approximately 40 ms (an interval determined from practical signal-processing requirements). With modifications, system concept applicable to collision-warning or collision-avoidance systems.

  11. Hit-and-run planetary collisions.

    PubMed

    Asphaug, Erik; Agnor, Craig B; Williams, Quentin

    2006-01-12

    Terrestrial planet formation is believed to have concluded in our Solar System with about 10 million to 100 million years of giant impacts, where hundreds of Moon- to Mars-sized planetary embryos acquired random velocities through gravitational encounters and resonances with one another and with Jupiter. This led to planet-crossing orbits and collisions that produced the four terrestrial planets, the Moon and asteroids. But here we show that colliding planets do not simply merge, as is commonly assumed. In many cases, the smaller planet escapes from the collision highly deformed, spun up, depressurized from equilibrium, stripped of its outer layers, and sometimes pulled apart into a chain of diverse objects. Remnants of these 'hit-and-run' collisions are predicted to be common among remnant planet-forming populations, and thus to be relevant to asteroid formation and meteorite petrogenesis.

  12. [Hit by lightning out of the blue].

    PubMed

    Duppel, H; Löbermann, M; Reisinger, E C

    2009-06-01

    A group of six hikers were hit by lightning out of the blue sky. The biggest harm was done to a 29-year-old man (size: 190 cm) while walking along a high spruce. He experienced a seizure with consecutive sinus tachycardia and hypertensive dysregulation. One year later he still complained about reduced physical strength. The other five hikers had less severe injuries. Burns were detectable in five of six patients. Elevated creatine kinase and myoglobin were indicative for myolysis. Renal parameters were normal. All patients were treated with intravenous fluid and electrolyte substitution during transport to hospital. Two patients were additionally treated with metroprolol. Cardiac arrhythmias, usually tachycardia, myolysis, and seizures require early treatment with beta blockers, sufficient fluid supply, and antiepileptics. In patients with cardiac arrest after a lightning injury immediate cardiac resuscitation is crucial.

  13. Lagrange-type modeling of continuous dielectric permittivity variation in double-higher-order volume integral equation method

    NASA Astrophysics Data System (ADS)

    Chobanyan, E.; Ilić, M. M.; Notaroš, B. M.

    2015-05-01

    A novel double-higher-order entire-domain volume integral equation (VIE) technique for efficient analysis of electromagnetic structures with continuously inhomogeneous dielectric materials is presented. The technique takes advantage of large curved hexahedral discretization elements—enabled by double-higher-order modeling (higher-order modeling of both the geometry and the current)—in applications involving highly inhomogeneous dielectric bodies. Lagrange-type modeling of an arbitrary continuous variation of the equivalent complex permittivity of the dielectric throughout each VIE geometrical element is implemented, in place of piecewise homogeneous approximate models of the inhomogeneous structures. The technique combines the features of the previous double-higher-order piecewise homogeneous VIE method and continuously inhomogeneous finite element method (FEM). This appears to be the first implementation and demonstration of a VIE method with double-higher-order discretization elements and conformal modeling of inhomogeneous dielectric materials embedded within elements that are also higher (arbitrary) order (with arbitrary material-representation orders within each curved and large VIE element). The new technique is validated and evaluated by comparisons with a continuously inhomogeneous double-higher-order FEM technique, a piecewise homogeneous version of the double-higher-order VIE technique, and a commercial piecewise homogeneous FEM code. The examples include two real-world applications involving continuously inhomogeneous permittivity profiles: scattering from an egg-shaped melting hailstone and near-field analysis of a Luneburg lens, illuminated by a corrugated horn antenna. The results show that the new technique is more efficient and ensures considerable reductions in the number of unknowns and computational time when compared to the three alternative approaches.

  14. Sparse constrained wavelet-based double-difference seismic tomography method and its applications

    NASA Astrophysics Data System (ADS)

    Fang, H.; Zhang, H.

    2013-12-01

    resolution matrix simultaneously. We have successfully incorporated the methods of wavelet transform, sparse constraint, and general cross validation into the double-difference tomography code tomoDD. We have applied the new code to both synthetic and real data sets. Compared with the original tomoDD code, the new code can resolve the model contrasts more clearly and is also data adaptive.

  15. Imaging of 3-D seismic velocity structure of Southern Sumatra region using double difference tomographic method

    SciTech Connect

    Lestari, Titik; Nugraha, Andri Dian

    2015-04-24

    Southern Sumatra region has a high level of seismicity due to the influence of the subduction system, Sumatra fault, Mentawai fault and stretching zone activities. The seismic activities of Southern Sumatra region are recorded by Meteorological Climatological and Geophysical Agency (MCGA’s) Seismograph network. In this study, we used earthquake data catalog compiled by MCGA for 3013 events from 10 seismic stations around Southern Sumatra region for time periods of April 2009 – April 2014 in order to invert for the 3-D seismic velocities structure (Vp, Vs, and Vp/Vs ratio). We applied double-difference seismic tomography method (tomoDD) to determine Vp, Vs and Vp/Vs ratio with hypocenter adjustment. For the inversion procedure, we started from the initial 1-D seismic velocity model of AK135 and constant Vp/Vs of 1.73. The synthetic travel time from source to receiver was calculated using ray pseudo-bending technique, while the main tomographic inversion was applied using LSQR method. The resolution model was evaluated using checkerboard test and Derivative Weigh Sum (DWS). Our preliminary results show low Vp and Vs anomalies region along Bukit Barisan which is may be associated with weak zone of Sumatran fault and migration of partial melted material. Low velocity anomalies at 30-50 km depth in the fore arc region may indicated the hydrous material circulation because the slab dehydration. We detected low seismic seismicity in the fore arc region that may be indicated as seismic gap. It is coincides contact zone of high and low velocity anomalies. And two large earthquakes (Jambi and Mentawai) also occurred at the contact of contrast velocity.

  16. Imaging of 3-D seismic velocity structure of Southern Sumatra region using double difference tomographic method

    NASA Astrophysics Data System (ADS)

    Lestari, Titik; Nugraha, Andri Dian

    2015-04-01

    Southern Sumatra region has a high level of seismicity due to the influence of the subduction system, Sumatra fault, Mentawai fault and stretching zone activities. The seismic activities of Southern Sumatra region are recorded by Meteorological Climatological and Geophysical Agency (MCGA's) Seismograph network. In this study, we used earthquake data catalog compiled by MCGA for 3013 events from 10 seismic stations around Southern Sumatra region for time periods of April 2009 - April 2014 in order to invert for the 3-D seismic velocities structure (Vp, Vs, and Vp/Vs ratio). We applied double-difference seismic tomography method (tomoDD) to determine Vp, Vs and Vp/Vs ratio with hypocenter adjustment. For the inversion procedure, we started from the initial 1-D seismic velocity model of AK135 and constant Vp/Vs of 1.73. The synthetic travel time from source to receiver was calculated using ray pseudo-bending technique, while the main tomographic inversion was applied using LSQR method. The resolution model was evaluated using checkerboard test and Derivative Weigh Sum (DWS). Our preliminary results show low Vp and Vs anomalies region along Bukit Barisan which is may be associated with weak zone of Sumatran fault and migration of partial melted material. Low velocity anomalies at 30-50 km depth in the fore arc region may indicated the hydrous material circulation because the slab dehydration. We detected low seismic seismicity in the fore arc region that may be indicated as seismic gap. It is coincides contact zone of high and low velocity anomalies. And two large earthquakes (Jambi and Mentawai) also occurred at the contact of contrast velocity.

  17. Is double-balloon enteroscopy an accurate method to diagnose small-bowel disorders?

    PubMed

    Safatle-Ribeiro, Adriana Vaz; Kuga, Rogério; Ishida, Robson; Furuya, Carlos; Ribeiro, Ulysses; Cecconello, Ivan; Ishioka, Shinichi; Sakai, Paulo

    2007-12-01

    The aim of this study was to analyze the contribution of the double-balloon enteroscopy (DBE) for diagnosis of the small bowel disorders. Forty-four patients (20 women, 24 men; mean age 53.5 years-old, range 21-89 years) with chronic gastrointestinal bleeding, diarrhea, polyposis, weight-loss, Roux-en-Y surgery, and other indications underwent DBE. Twenty patients had occult or obscure gastrointestinal bleeding. The source of bleeding was identified in 15/20 (75%): multiple angiodysplasias in four, arterial-venous malformation beyond the ligament of Treitz in two that could be treated with injection successfully. Other diagnoses included: duodenal adenocarcinoma, jejunal tuberculosis, erosions and ulcer of the jejunum. Of 24 patients with other indications, the diagnosis could be achieved in 18 of them (75%), including: two lymphomas, plasmocytoma, Gardner's syndrome, Peutz-Jeghers' syndrome, familial adenomatous polyposis, Behçet's disease, jejunal submucosal lesion, lymphangiectasia due to blastomycosis and unspecific chronic jejunitis. Of three cases with Roux-en-Y reconstruction, two underwent DBE in order to perform biopsies of the excluded duodenum. Additionally, two patients underwent DBE to exclude Crohn's disease and lymphoma of the small bowel. The mean length of small bowel examination was 240 +/- 50 cm during a single approach. The diagnostic yield was 75% (33/44 cases) and therapeutic yield was 63.6%. No major complications were observed, only minor complication such as sore throat in 4/44 (9.1%). 1. DBE is a safe and and accurate method to diagnose small bowel disorders; 2. this method permits chromoscopy, biopsies and treatment of the lesions.

  18. A Two-Hit Model of Autism: Adolescence as the Second Hit

    PubMed Central

    Picci, Giorgia; Scherf, K. Suzanne

    2015-01-01

    Adolescence brings dramatic changes in behavior and neural organization. Unfortunately, for some 30% of individuals with autism, there is marked decline in adaptive functioning during adolescence. We propose a two-hit model of autism. First, early perturbations in neural development function as a “first hit” that sets up a neural system that is “built to fail” in the face of a second hit. Second, the confluence of pubertal hormones, neural reorganization, and increasing social demands during adolescence provides the “second hit” that interferes with the ability to transition into adult social roles and levels of adaptive functioning. In support of this model, we review evidence about adolescent-specific neural and behavioral development in autism. We conclude with predictions and recommendations for empirical investigation about several domains in which developmental trajectories for individuals with autism may be uniquely deterred in adolescence. PMID:26609500

  19. Schrödinger method as N-body double and UV completion of dust

    NASA Astrophysics Data System (ADS)

    Uhlemann, Cora; Kopp, Michael; Haugg, Thomas

    2014-07-01

    We investigate large-scale structure formation of collisionless dark matter in the phase space description based on the Vlasov (or collisionless Boltzmann) equation whose nonlinearity is induced solely by gravitational interaction according to the Poisson equation. Determining the time evolution of density and peculiar velocity demands solving the full Vlasov hierarchy for the moments of the phase space distribution function. In the presence of long-range interaction no consistent truncation of the hierarchy is known apart from the pressureless fluid (dust) model, which is incapable of describing virialization due to the occurrence of shell-crossing singularities and the inability to generate vorticity and higher cumulants like velocity dispersion. Our goal is to find a simple ansatz for the phase space distribution function that approximates the full Vlasov distribution function without pathologies in a controlled way and therefore can serve as theoretical N-body double and as a replacement for the dust model. We argue that the coarse-grained Wigner probability distribution obtained from a wave function fulfilling the Schrödinger-Poisson equation (SPE) is the sought-after function. We show that its evolution equation approximates the Vlasov equation and therefore also the dust fluid equations before shell crossing, but cures the shell-crossing singularities and is able to describe regions of multistreaming and virialization. This feature was already employed in cosmological simulations of large-scale structure formation by Widrow and Kaiser (1993). The coarse-grained Wigner ansatz allows us to calculate all higher moments from density and velocity analytically, thereby incorporating nonzero higher cumulants in a self-consistent manner. On this basis we are able to show that the Schrödinger method automatically closes the corresponding hierarchy such that it suffices to solve the SPE in order to directly determine density and velocity and all higher cumulants.

  20. Comparison of retention forces with various fabrication methods and materials in double crowns

    PubMed Central

    Tuna, Meral; Bozdağ, Ergun; Öztürk, Gizem Nur; Bayraktar, Gulsen

    2017-01-01

    PURPOSE The purpose of this study was to analyze the retention force changes and wear behaviours of double-crown systems over long-term use. MATERIALS AND METHODS Ten groups, each consisting of six samples, were evaluated. Specifically, casting gold alloy primary crown - casting gold alloy secondary crown (AA), laser sintering primary crown - laser sintering secondary crown (LL), casting Cr alloy primary crown - casting Cr alloy secondary crown, (CC) zirconia primary crown - electroformed secondary crown (ZA), and CAD/CAM titanium alloy primary crown - CAD/CAM titanium alloy secondary crown (TT) groups were evaluated at cone angles of 4° and 6°. The samples were subjected to 5,000 insertion-separation cycles in artificial saliva, and the retention forces were measured every 500 cycles. The wear levels were analyzed via SEM at the beginning and end of the 5,000 cycles. RESULTS In all samples, the retention forces increased when the conus angle decreased. The highest initial and final retention force values were found in the LL-4° group (32.89 N-32.65 N), and the lowest retention force values were found in the ZA6° group (5.41 N-6.27 N). The ZA groups' samples showed the least change in the retention force, and no wear was observed. In the other groups, wear was observed mostly in the primary crowns. CONCLUSION More predictable, clinically relevant, and less excursive retention forces can be observed in the ZA groups. The retention force values of the LL groups were statically similar to those of the other groups, except the ZA groups. PMID:28874999

  1. Design and Hemocompatibility Analysis of a Double-Suction Injection Suspension Blood Pump Using Computational Fluid Dynamics Methods.

    PubMed

    Wu, Yue; Zhu, Liangfan; Luo, Yun

    2017-07-26

    The blood pump has become a possible solution to heart diseases. For the prevention of device failure and hemocompatibility problems, a rotary pump with suspended bearing is a preferred solution. In our previous work, a novel injection suspension method has been introduced to levitate the rotor. The suspension method is totally passive. This study aims to apply this suspension method to a double-suction pump, and the property of the pump was investigated using computational fluid dynamics (CFD) methods. The flow field of the pump is simulated based on the SST k-ω turbulent model. The characteristic curves of the pump were calculated. At the nominal working point of 5 L/min, 100 mm Hg, the suspension force acting on the rotor was detected, which could reach 0.46 N with a gap of 150 µm. We compared the pump with a previously developed single-suction injection pump to evaluate the blood compatibility of the double-suction design. The average scalar shear stress values were 3.13 Pa for the double-suction pump and 7.10 Pa for the single-suction pump. Larger volumes in the single-suction pump were exposed to shear stresses higher than 10 Pa. Thresholds for the von Willebrand factor cleavage, platelet activation, and hemolysis were defined to be 9 Pa, 50 Pa, and 150 Pa, respectively. The volume fractions for the double-suction pump are lower for all thresholds. The normalized index of hemolysis (NIH) values for the two pumps were calculated to be 0.008 g/100 L and 0.016 g/100 L. Results proved that the double-suction pump has a better hemocompatibility compared with the single-suction pump. © 2017 International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.

  2. External validation of the HIT Expert Probability (HEP) score.

    PubMed

    Joseph, Lee; Gomes, Marcelo P V; Al Solaiman, Firas; St John, Julie; Ozaki, Asuka; Raju, Manjunath; Dhariwal, Manoj; Kim, Esther S H

    2015-03-01

    The diagnosis of heparin-induced thrombocytopenia (HIT) can be challenging. The HIT Expert Probability (HEP) Score has recently been proposed to aid in the diagnosis of HIT. We sought to externally and prospectively validate the HEP score. We prospectively assessed pre-test probability of HIT for 51 consecutive patients referred to our Consultative Service for evaluation of possible HIT between August 1, 2012 and February 1, 2013. Two Vascular Medicine fellows independently applied the 4T and HEP scores for each patient. Two independent HIT expert adjudicators rendered a diagnosis of HIT likely or unlikely. The median (interquartile range) of 4T and HEP scores were 4.5 (3.0, 6.0) and 5 (3.0, 8.5), respectively. There were no significant differences between area under receiver-operating characteristic curves of 4T and HEP scores against the gold standard, confirmed HIT [defined as positive serotonin release assay and positive anti-PF4/heparin ELISA] (0.74 vs 0.73, p = 0.97). HEP score ≥ 2 was 100 % sensitive and 16 % specific for determining the presence of confirmed HIT while a 4T score > 3 was 93 % sensitive and 35 % specific. In conclusion, the HEP and 4T scores are excellent screening pre-test probability models for HIT, however, in this prospective validation study, test characteristics for the diagnosis of HIT based on confirmatory laboratory testing and expert opinion are similar. Given the complexity of the HEP scoring model compared to that of the 4T score, further validation of the HEP score is warranted prior to widespread clinical acceptance.

  3. [An ADAA model and its analysis method for agronomic traits based on the double-cross mating design].

    PubMed

    Xu, Z C; Zhu, J

    2000-01-01

    According to the double-cross mating design and using principles of Cockerham's general genetic model, a genetic model with additive, dominance and epistatic effects (ADAA model) was proposed for the analysis of agronomic traits. Components of genetic effects were derived for different generations. Monte Carlo simulation was conducted for analyzing the ADAA model and its reduced AD model by using different generations. It was indicated that genetic variance components could be estimated without bias by MINQUE(1) method and genetic effects could be predicted effectively by AUP method; at least three generations (including parent, F1 of single cross and F1 of double-cross) were necessary for analyzing the ADAA model and only two generations (including parent and F1 of double-cross) were enough for the reduced AD model. When epistatic effects were taken into account, a new approach for predicting the heterosis of agronomic traits of double-crosses was given on the basis of unbiased prediction of genotypic merits of parents and their crosses. In addition, genotype x environment interaction effects and interaction heterosis due to G x E interaction were discussed briefly.

  4. The impact of the heparin-induced thrombocytopenia (HIT) computerized alert on provider behaviors and patient outcomes

    PubMed Central

    Adelman, Jason S; Reissman, Stan H; Cohen, Hillel W; Billett, Henny H

    2011-01-01

    Objective The aim of this study was to measure the effect of an electronic heparin-induced thrombocytopenia (HIT) alert on provider ordering behaviors and on patient outcomes. Materials and Methods A pop-up alert was created for providers when an individual's platelet values had decreased by 50% or to <100 000/mm3 in the setting of recent heparin exposure. The authors retrospectively compared inpatients admitted between January 24, 2008 and August 24, 2008 to a control group admitted 1 year prior to the HIT alert. The primary outcome was a change in HIT antibody testing. Secondary outcomes included an assessment of incidence of HIT antibody positivity, percentage of patients started on a direct thrombin inhibitor (DTI), length of stay and overall mortality. Results There were 1006 and 1081 patients in the control and intervention groups, respectively. There was a 33% relative increase in HIT antibody test orders (p=0.01), and 33% more of these tests were ordered the first day after the criteria were met when a pop-up alert was given (p=0.03). Heparin was discontinued in 25% more patients in the alerted group (p=0.01), and more direct thrombin inhibitors were ordered for them (p=0.03). The number who tested HIT antibody-positive did not differ, however, between the two groups (p=0.99). The length of stay and mortality were similar in both groups. Conclusions The HIT alert significantly impacted provider behaviors. However, the alert did not result in more cases of HIT being detected or an improvement in overall mortality. Our findings do not support implementation of a computerized HIT alert. PMID:21712374

  5. Single vs. double layer suturing method repair of the urethral plate in the rabbit model of hypospadias

    PubMed Central

    Shirazi, Mehdi; Rahimi, Mohammad

    2016-01-01

    Introduction There are different methods of urethroplasty in hypospadias. The present study aimed to compare the repair of the urethral plate by single vs. double layer suturing. Material and methods Fifteen male rabbits were assigned to the control, single layer, and double layer urethral plate suturing groups (n = 5). Experimental hypospadias was induced in the second and third groups and the urethral plates were sutured. After two weeks, the penis was dissected out and underwent histopathological processing. Stereological studies were applied to obtain quantitative histological data regarding the structure of the urethra and the related part of the corpus spongiosum. Results Volume density of the urethral epithelium (the fraction of unit volume of the urethra occupied by its epithelium) was higher in the single layer suturing group when compared to the double layer or control groups (p <0.01). Additionally, the volume density of the urethral lumen (the fraction of the corpus spongiosum that is occupied by the urethral lumen) in the single versus the double layer suturing groups was respectively 2.4 and 2 folds higher than that in the control group (p <0.01). Besides, the volume density of the lumen was significantly higher in the single layer suturing when compared to the double layer suturing group (p <0.01). However, no significant difference was observed among the study groups regarding the volume density of the collagen and vessels in the incised site of the penis which implied that the fraction of the urethra and surrounding corpus spongiosum was occupied by collagen and vessels. Conclusions Urethral plate repair by the single layer suturing method could be accompanied by higher epithelialization and wider lumen in the rabbit model of hypospadias. PMID:28127462

  6. Optoelectronic hit/miss transform for screening cervical smear slides

    NASA Astrophysics Data System (ADS)

    Narayanswamy, R.; Turner, R. M.; McKnight, D. J.; Johnson, K. M.; Sharpe, J. P.

    1995-06-01

    An optoelectronic morphological processor for detecting regions of interest (abnormal cells) on a cervical smear slide using the hit/miss transform is presented. Computer simulation of the algorithm tested on 184 Pap-smear images provided 95% detection and 5% false alarm. An optoelectronic implementation of the hit/miss transform is presented, along with preliminary experimental results.

  7. Object Rotation Effects on the Timing of a Hitting Action

    ERIC Educational Resources Information Center

    Scott, Mark A.; van der Kamp, John; Savelsbergh, Geert J. P.; Oudejans, Raoul R. D.; Davids, Keith

    2004-01-01

    In this article, the authors investigated how perturbing optical information affects the guidance of an unfolding hitting action. Using monocular and binocular vision, six participants were required to hit a rectangular foam object, released from two different heights, under four different approach conditions, two with object rotation (to perturb…

  8. Improved Curveball Hitting through the Enhancement of Visual Cues.

    ERIC Educational Resources Information Center

    Osborne, Kurt; And Others

    1990-01-01

    The study investigated the effectiveness of using visual cues to highlight the seams of baseballs, to improve the hitting of curveballs by five undergraduate varsity baseball team candidates. Results indicated that subjects hit a greater percentage of marked than unmarked balls. (Author/DB)

  9. First Plasma Results from the HIT-SI Spheromak

    NASA Astrophysics Data System (ADS)

    Sieck, P. E.; Hamp, W. T.; Izzo, V. A.; Jarboe, T. R.; Nelson, B. A.; O'Neill, R. G.; Redd, A. J.; Smith, R. J.

    2003-10-01

    HIT-SI is the newest device in the Helicity Injected Torus (HIT) program. HIT-SI is a ``bow tie'' spheromak formed and sustained by Steady Inductive Helicity Injection (SIHI) current drive. SIHI injects helicity at a nearly constant rate with no open field lines intersecting the boundary. (T. R. Jarboe, Fusion Technology 36) (1), p. 85, 1999 HIT-SI has been designed with a bow tie geometry to achieve stable high-β (>10%) spheromak equilibria. (U. Shumlak and T. R. Jarboe, Phys. Plasmas 7) (7), p. 2959, 2000 Diagnostics currently include surface magnetic probes and flux loops, visible light imaging, H-alpha line radiation monitors, voltage measurements across insulating breaks, injector current Rogowski coils, and injector flux loops. HIT-SI is currently operating in parallel with experiments on HIT-II. At the conclusion of HIT-II operations, HIT-SI will inherit a multi-point Thomson Scattering system, a scanning two-chord FIR interferometer, and other advanced diagnostics, as well as more power supplies to extend the discharge duration. Results are presented which characterize injector operation and possible evidence for spheromak formation.

  10. Improved Curveball Hitting through the Enhancement of Visual Cues.

    ERIC Educational Resources Information Center

    Osborne, Kurt; And Others

    1990-01-01

    The study investigated the effectiveness of using visual cues to highlight the seams of baseballs, to improve the hitting of curveballs by five undergraduate varsity baseball team candidates. Results indicated that subjects hit a greater percentage of marked than unmarked balls. (Author/DB)

  11. Layered double hydroxides as the next generation inorganic anion exchangers: Synthetic methods versus applicability.

    PubMed

    Chubar, Natalia; Gilmour, Robert; Gerda, Vasyl; Mičušík, Matej; Omastova, Maria; Heister, Katja; Man, Pascal; Fraissard, Jacques; Zaitsev, Vladimir

    2017-07-01

    This work is the first report that critically reviews the properties of layered double hydroxides (LDHs) on the level of speciation in the context of water treatment application and dynamic adsorption conditions, as well as the first report to associate these properties with the synthetic methods used for LDH preparation. Increasingly stronger maximum allowable concentrations (MAC) of various contaminants in drinking water and liquid foodstuffs require regular upgrades of purification technologies, which might also be useful in the extraction of valuable substances for reuse in accordance with modern sustainability strategies. Adsorption is the main separation technology that allows the selective extraction of target substances from multicomponent solutions. Inorganic anion exchangers arrived in the water business relatively recently to achieve the newly approved standards for arsenic levels in drinking water. LDHs (or hydrotalcites, HTs) are theoretically the best anion exchangers due to their potential to host anions in their interlayer space, which increases their anion removal capacity considerably. This potential of the interlayer space to host additional amounts of target aqueous anions makes the LDHs superior to bulk anion exchanger. The other unique advantage of these layered materials is the flexibility of the chemical composition of the metal oxide-based layers and the interlayer anions. However, until now, this group of "classical" anion exchangers has not found its industrial application in adsorption and catalysis at the industrial scale. To accelerate application of LDHs in water treatment on the industrial scale, the authors critically reviewed recent scientific and technological knowledge on the properties and adsorptive removal of LDHs from water on the fundamental science level. This also includes review of the research tools useful to reveal the adsorption mechanism and the material properties beyond the nanoscale. Further, these properties are

  12. Solution structure of the zinc finger HIT domain in protein FON

    PubMed Central

    He, Fahu; Umehara, Takashi; Tsuda, Kengo; Inoue, Makoto; Kigawa, Takanori; Matsuda, Takayoshi; Yabuki, Takashi; Aoki, Masaaki; Seki, Eiko; Terada, Takaho; Shirouzu, Mikako; Tanaka, Akiko; Sugano, Sumio; Muto, Yutaka; Yokoyama, Shigeyuki

    2007-01-01

    The zinc finger HIT domain is a sequence motif found in many proteins, including thyroid hormone receptor interacting protein 3 (TRIP-3), which is possibly involved in maturity-onset diabetes of the young (MODY). Novel zinc finger motifs are suggested to play important roles in gene regulation and chromatin remodeling. Here, we determined the high-resolution solution structure of the zinc finger HIT domain in ZNHIT2 (protein FON) from Homo sapiens, by an NMR method based on 567 upper distance limits derived from NOE intensities measured in three-dimensional NOESY spectra. The structure yielded a backbone RMSD to the mean coordinates of 0.19 Å for the structured residues 12–48. The fold consists of two consecutive antiparallel β-sheets and two short C-terminal helices packed against the second β-sheet, and binds two zinc ions. Both zinc ions are coordinated tetrahedrally via a CCCC-CCHC motif to the ligand residues of the zf-HIT domain in an interleaved manner. The tertiary structure of the zinc finger HIT domain closely resembles the folds of the B-box, RING finger, and PHD domains with a cross-brace zinc coordination mode, but is distinct from them. The unique three-dimensional structure of the zinc finger HIT domain revealed a novel zinc-binding fold, as a new member of the treble clef domain family. On the basis of the structural data, we discuss the possible functional roles of the zinc finger HIT domain. PMID:17656577

  13. Development of a Double Glass Mounting Method Using Formaldehyde Alcohol Azocarmine Lactophenol (FAAL) and its Evaluation for Permanent Mounting of Small Nematodes

    PubMed Central

    ZAHABIUN, Farzaneh; SADJJADI, Seyed Mahmoud; ESFANDIARI, Farideh

    2015-01-01

    Background: Permanent slide preparation of nematodes especially small ones is time consuming, difficult and they become scarious margins. Regarding this problem, a modified double glass mounting method was developed and compared with classic method. Methods: A total of 209 nematode samples from human and animal origin were fixed and stained with Formaldehyde Alcohol Azocarmine Lactophenol (FAAL) followed by double glass mounting and classic dehydration method using Canada balsam as their mounting media. The slides were evaluated in different dates and times, more than four years. Different photos were made with different magnification during the evaluation time. Results: The double glass mounting method was stable during this time and comparable with classic method. There were no changes in morphologic structures of nematodes using double glass mounting method with well-defined and clear differentiation between different organs of nematodes in this method. Conclusion: Using this method is cost effective and fast for mounting of small nematodes comparing to classic method. PMID:26811729

  14. Nimodipine in traumatic subarachnoid haemorrhage: a re-analysis of the HIT I and HIT II trials.

    PubMed

    Murray, G D; Teasdale, G M; Schmitz, H

    1996-01-01

    Two large randomised controlled trials have been performed to study the effect of the calcium antagonist nimodipine on the outcome of severe head injury, HIT I [1] amd HIT II [4]. Both trials showed a modest and statistically non-significant increase in the proportion of favourable outcomes in patients treated with nimodipine. A subgroup analysis of the HIT II trial [4, 5] suggested, however, that there could be a substantial protective effect of nimodipine in patients with traumatic subarachnoid haemorrhage (SAH). This report provides a re-analysis of the HIT I data to see whether it provides a re-analysis of the HIT I data to see whether in HIT II. This involved performing a central review of the CT scans for the HIT I patients, to identify those individuals with evidence of traumatic SAH. The sample size was small, but the HIT I data gave no support to the hypothesis that nimodipine is protective in the traumatic SAH subgroup, where 69% of patients had a poor outcome on placebo and 74% of patients had a poor outcome on nimodipine. The data do not exclude the possibility of a clinically relevant beneficial effect of nimodipine in the traumatic SAH subgroup, but further data are required to provide a definitive answer. In addition, we present a pooled analysis of the data from the two trials, which suggests that the overall benefit of treating unselected head injured patients with nimodipine is unlikely to be clinically relevant.

  15. 42 CFR 495.332 - State Medicaid health information technology (HIT) plan requirements.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... and future visions: (1) A baseline assessment of the current HIT landscape environment in the State including the inventory of existing HIT in the State. The assessment must include a comprehensive— (i) Description of the HIT “as-is” landscape; (ii) Description of the HIT “to-be” landscape; and (iii) HIT roadmap...

  16. The danger signal plus DNA damage two-hit hypothesis for chronic inflammation in COPD.

    PubMed

    Aoshiba, Kazutetsu; Tsuji, Takao; Yamaguchi, Kazuhiro; Itoh, Masayuki; Nakamura, Hiroyuki

    2013-12-01

    Inflammation in chronic obstructive pulmonary disease (COPD) is thought to originate from the activation of innate immunity by a danger signal (first hit), although this mechanism does not readily explain why the inflammation becomes chronic. Here, we propose a two-hit hypothesis explaining why inflammation becomes chronic in patients with COPD. A more severe degree of inflammation exists in the lungs of patients who develop COPD than in the lungs of healthy smokers, and the large amounts of reactive oxygen species and reactive nitrogen species released from inflammatory cells are likely to induce DNA double-strand breaks (second hit) in the airways and pulmonary alveolar cells, causing apoptosis and cell senescence. The DNA damage response and senescence-associated secretory phenotype (SASP) are also likely to be activated, resulting in the production of pro-inflammatory cytokines. These pro-inflammatory cytokines further stimulate inflammatory cell infiltration, intensifying cell senescence and SASP through a positive-feedback mechanism. This vicious cycle, characterised by mutually reinforcing inflammation and DNA damage, may cause the inflammation in COPD patients to become chronic. Our hypothesis helps explain why COPD tends to occur in the elderly, why the inflammation worsens progressively, why inflammation continues even after smoking cessation, and why COPD is associated with lung cancer.

  17. Double-Staining Method for Differentiation of Morphological Changes and Membrane Integrity of Campylobacter coli Cells

    PubMed Central

    Alonso, Jose L.; Mascellaro, Salvatore; Moreno, Yolanda; Ferrús, María A.; Hernández, Javier

    2002-01-01

    We developed a double-staining procedure involving NanoOrange dye (Molecular Probes, Eugene, Oreg.) and membrane integrity stains (LIVE/DEAD BacLight kit; Molecular Probes) to show the morphological and membrane integrity changes of Campylobacter coli cells during growth. The conversion from a spiral to a coccoid morphology via intermediary forms and the membrane integrity changes of the C. coli cells can be detected with the double-staining procedure. Our data indicate that young or actively growing cells are mainly spiral shaped (green-stained cells), but older cells undergo a degenerative change to coccoid forms (red-stained cells). Club-shaped transition cell forms were observed with NanoOrange stain. Chlorinated drinking water affected the viability but not the morphology of C. coli cells. PMID:12324366

  18. High-field double-pancake superconducting coils and a method of winding

    DOEpatents

    Materna, Peter A.

    1985-01-01

    A double-pancake coil having first and second pancakes may comprise a plurality of conductor means, each conductor means having a different grade and having one or more conductors, wherein each pancake of said double-pancake coil is comprised of inner and outer turns; wherein said inner turns are comprised of at least one of said conductor means wound about an axis and nested within one another; wherein said outer turns are comprised of said inner conductor means and at least one other conductor means co-wound about said inner turns and nested within one another; wherein each of said conductor means is wound along said axis from said first pancake to said second pancake at a different turn.

  19. High-field double-pancake superconducting coils and a method of winding

    DOEpatents

    Materna, P.A.

    1984-01-31

    A double-pancake coil having first and second pancakes may comprise a plurality of conductor means, each conductor means having a different grade and having one or more conductors, wherein each pancake of said double-pancake coil is comprised of inner and outer turns; wherein said inner turns are comprised of at least one of said conductor means wound about an axis and nested within one another; wherein said outer turns are comprised of said inner conductor means and at least one other conductor means co-wound about said inner turns and nested within one another; wherein each of said conductor means is wound along said axis from said first pancake to said second pancake at a different turn.

  20. Double-barreled wet colostomy: a safe and simple method after pelvic exenteration.

    PubMed

    Osorio Gullón, A; de Oca, J; Lopéz Costea, M A; Virgili, J; Ramos, E; del Rio, C; Martí Ragué, J

    1997-01-01

    The clinical and functional outcome of ureteric division to the distal segment of a loop colostomy: the double-barrelled wet colostomy have been analysed. 13 patients (8 female and 5 male, age 37 to 72 years) underwent pelvic exenteration with double-barrelled wet colostomy. The primary tumour included endometrial (n = 6), rectal (n = 1), anal (n = 1), cervical (n = 2), prostatic (n = 1) and bladder (n = 2). Indications for pelvic exenteration were locally advanced disease, recurrence and severe radiation or surgical damage. Six patients had pre-existing colostomy, and three had a Bricker ureteroileal diversion. The double-barrelled-wet colostomy technique consisted in anastomosing both ureters to a colon segment 25 cm distal to the loop colostomy. There was no operative mortality. Complications included one urinary leak which closed with conservative management and one case of recurrent episodes of pyelonephritis which finally required nephrectomy. Intravenous urography in the remaining patients showed good flow through the ureters to the conduit with no reflux. Postoperative plasma electrolytes, urea and creatinine were normal from day seven onwards. Urodynamic studies in four patients showed efficient contraction of the colon conduit with pressure levels similar to those in the colon proximal to the colostomy. In five cases biopsies of the conduit were taken at 3 and 16 months; no dysplasias were found. Four patients died due to disease progression. The overall mean survival was 41.2 months. The remainder are currently disease-free, maximum followup period being 19 months. Double-barrelled wet colostomy is a safe and simple technique with low morbidity. The patient needs to carry only one stoma and functional results are good.

  1. Implicit Hitting Set Problems and Multi-genome Alignment

    NASA Astrophysics Data System (ADS)

    Karp, Richard M.

    Let U be a finite set and S a family of subsets of U. Define a hitting set as a subset of U that intersects every element of S. The optimal hitting set problem is: given a positive weight for each element of U, find a hitting set of minimum total weight. This problem is equivalent to the classic weighted set cover problem.We consider the optimal hitting set problem in the case where the set system S is not explicitly given, but there is an oracle that will supply members of S satisfying certain conditions; for example, we might ask the oracle for a minimum-cardinality set in S that is disjoint from a given set Q. The problems of finding a minimum feedback arc set or minimum feedback vertex set in a digraph are examples of implicit hitting set problems. Our interest is in the number of oracle queries required to find an optimal hitting set. After presenting some generic algorithms for this problem we focus on our computational experience with an implicit hitting set problem related to multi-genome alignment in genomics. This is joint work with Erick Moreno Centeno.

  2. Optimization of the Magnetic Recovery of Hits from One-Bead-One-Compound Library Screens.

    PubMed

    Mendes, Kimberly; Ndungu, J M; Clark, Lorraine F; Kodadek, Thomas

    2015-09-14

    On-bead screening of one-bead-one-compound (OBOC) libraries is a useful procedure for the identification of protein ligands. An important aspect of this experiment is the method by which beads that bind the target protein are separated from those that do not. Ideally, such a method would be rapid and convenient and result in the isolation of 100% of the "hits" with no false positives (beads that display compounds that are not good ligands for the target). We introduced a technique in which beads that have bound a labeled target protein can be magnetized, thus allowing their convenient isolation ( Astle et al. Chem. Biol. 2010 , 17 , 38 - 45 ). However, recent work in our laboratory and others has shown that magnetic hit recovery can result in the isolation of large numbers of false positives and has also suggested that many true hit beads are missed. In this study, we employ a well-defined model system to examine the efficiency of various magnetic hit isolation protocols. We show that the choice of reagents and the particular operations employed are critical for optimal results.

  3. Comparing two methods of plastination and glycerin preservation to study skeletal system after Alizarin red-Alcian blue double staining

    PubMed Central

    Mohsen, Setayesh M.; Esfandiari, Ebrahim; Rabiei, Abbas A.; Hanaei, Mahsa S.; Rashidi, Bahman

    2013-01-01

    Background: Plastination is a new method of preserving tissue samples for a long time. This study aimed to compare the new plastination technique with the conventional preservative method in glycerin for fetus skeleton tissues and young rats dyed by Alizarin red- Alcian blue double staining. Materials and Methods: In this study, 4 groups of 1-day, 3-day, 12-day and mature rats were selected and, after being anesthetized and slaughtered, their skin was completely removed. In Alizarin red- Alcian blue double staining method, first the samples were fixed in 95% ethanol and then their cartilages were dyed by 0.225% Alcian blue solution; after that, they were cleared in 1% KOH. Then, the bones were dyed in 0.003% Alizarin red solution and finally the tissue was decolorized in 95% ethanol. In each group, half of the samples were preserved by the conventional method in a glycerin container and the other half were plastinated. Results: In the present study, the samples preserved by plastination technique were dry, odorless, indecomposable and tangible. Quality of coloring had an inverse relationship with rats’ age. Transparency of the plastinated samples had also an inverse relationship with rats’ age. Therefore, skeletal tissue of younger rats had higher quality and transparency in both preservation methods (glycerin and plastination). Conclusion: This study showed that plastination technique was an appropriate method in comparison with glycerin preservation, which conserved skeletal tissue of fetus and young rats colored by Alizarin red- Alcian blue double staining. And the final result was that plastination technique can generate dry, odorless, indecomposable and tangible samples. PMID:23930264

  4. Geometric Hitting Set for Segments of Few Orientations

    SciTech Connect

    Fekete, Sandor P.; Huang, Kan; Mitchell, Joseph S. B.; Parekh, Ojas D.; Phillips, Cynthia A.

    2016-01-13

    Here we study several natural instances of the geometric hitting set problem for input consisting of sets of line segments (and rays, lines) having a small number of distinct slopes. These problems model path monitoring (e.g., on road networks) using the fewest sensors (the \\hitting points"). We give approximation algorithms for cases including (i) lines of 3 slopes in the plane, (ii) vertical lines and horizontal segments, (iii) pairs of horizontal/vertical segments. Lastly, we give hardness and hardness of approximation results for these problems. We prove that the hitting set problem for vertical lines and horizontal rays is polynomially solvable.

  5. Baseball hitting, binocular vision, and the Pulfrich phenomenon.

    PubMed

    Hofeldt, A J; Hoefle, F B; Bonafede, B

    1996-12-01

    To determine if dimming the light to 1 eye affects baseball hitting (motion-in-depth) and if binocular interaction influences the ability to hit a baseball. The ability to hit baseballs in a batting cage was measured under conditions of (1) no filter before either eye, (2) neutral density filters before both eyes, and (3) a neutral density filter before 1 eye, while viewing with both eyes. Batting scores were based on the number of hits, fouls, and misses. A neutral density filter of 0.6 optical density before both eyes had no significant effect on batting ability compared with no filter (87% vs 94%). While viewing binocularly, a filter before 1 eye caused a significantly greater reduction in hitting scores than when the filter was placed before the opposite eye (36% vs 80%). This greater effect of 1 eye on hitting scores denotes an ocular preference or dominance within the motion stereopsis system. The eye associated with the greater reduction in hitting ability when dimmed by a filter was termed the dominant eye for motion stereopsis. In comparison with placing 0.6-optical density filters before both eyes, the same filter before the dominant eye reduced hitting ability (36% vs 87%), but when the filter was placed before the nondominant eye, the hitting ability was not significantly reduced (80% vs 87%). The batting scores decreased as filter densities increased from 0.3- to 0.6-optical density, and the effect was significantly more for the dominant eye than for the nondominant eye. Binocular vision contributes to the precise localization of a pitched baseball, and one eye influences baseball hitting more than the other eye. The motion-in-depth channel (baseball hitting) shares a sensitivity to unequal binocular illumination with the sideways-motion channel (Pulfrich phenomenon). The timing of the impulses conducted from the eyes appears to be critical for the precise localization of objects processed by either the motion-in-depth (baseball hitting) or the

  6. A particle-in-cell method for studying double-diffusive convection in the liquid layers of planetary interiors

    NASA Astrophysics Data System (ADS)

    Bouffard, Mathieu; Labrosse, Stéphane; Choblet, Gaël; Fournier, Alexandre; Aubert, Julien; Tackley, Paul J.

    2017-10-01

    Many planetary bodies contain internal liquid layers in their metallic cores or as buried water oceans. Convection in these layers is usually driven by buoyancy sources of thermal or compositional origin, with very different molecular diffusivities. Such conditions can potentially trigger double-diffusive instabilities and fundamentally affect the convective features. In numerical models, the weak diffusivity of the compositional field requires the use of a semi-Lagrangian description to produce minimal numerical diffusion. We implemented a ;particle-in-cell; (PIC) method into a pre-existing geodynamo code in 3D spherical geometry to describe the compositional field properly. We developed several numerical strategies to solve various problems inherent to the implementation of a PIC method for convection in spherical geometry and coded a hybrid scheme suitable for massively parallel platforms. We tested our new code on two benchmark cases which validate its applicability to the study of double-diffusive convection in the internal liquid layers of planets. As a first application, we study a case of non-magnetic double-diffusive convection at infinite Lewis number. Major differences emerge both in the compositional field and the convective pattern when the compositional diffusivity is neglected.

  7. Grid-based methods for diatomic quantum scattering problems III: Double photoionization of molecular hydrogen in prolate spheroidal coordinates

    SciTech Connect

    Tao, Liang; McCurdy, Bill; Rescigno, Tom

    2010-06-10

    Our previously developed finite-element/ discrete variable representation in prolate spheroidal coordinates is extended to two-electron systems with a study of double ionization of H$_2$ with fixed-nuclei. Particular attention is paid to the development of fast and accurate methods for treating the electron-electron interaction. The use of exterior complex scaling in the implementation offers a simple way of enforcing Coulomb boundary conditions for the electronic double continuum. While the angular distributions calculated in this study are found to be completely consistent with our earlier treatments that employed single-center expansions in spherical coordinates, we find that the magnitude of the integrated cross sections are sensitive to small changes in the initial-state wave function. The present formulation offers significant advantages with respect to convergence and efficiency and opens the way to calculations on more complicated diatomic targets.

  8. The Kernel Energy Method: Construction of 3 & 4 tuple Kernels from a List of Double Kernel Interactions

    PubMed Central

    Huang, Lulu; Massa, Lou

    2010-01-01

    The Kernel Energy Method (KEM) provides a way to calculate the ab-initio energy of very large biological molecules. The results are accurate, and the computational time reduced. However, by use of a list of double kernel interactions a significant additional reduction of computational effort may be achieved, still retaining ab-initio accuracy. A numerical comparison of the indices that name the known double interactions in question, allow one to list higher order interactions having the property of topological continuity within the full molecule of interest. When, that list of interactions is unpacked, as a kernel expansion, which weights the relative importance of each kernel in an expression for the total molecular energy, high accuracy, and a further significant reduction in computational effort results. A KEM molecular energy calculation based upon the HF/STO3G chemical model, is applied to the protein insulin, as an illustration. PMID:21243065

  9. A method for double-labeling sputum cells for p53 and cytokeratin

    SciTech Connect

    Neft, R.E.; Tierney, L.A.; Belinsky, S.A.

    1995-12-01

    Molecular and immunological techniques may enhance the usefulness of sputum cytology as a screening tool for lung cancer. These techniques may also be useful in detecting and following the early progression of disease from metaplasia to dysplasia, carcinoma in situ, and finally to invasive carcinoma. Longitudinal information on the evolution of these malignant changes in the respiratory epithelium can be gained by prospective study of populations at high risk for lung cancer. This work is significant because double-labeling of cells in sputum with p53 and cytokeratin antibodies facilitates rapid screening of p53 positive neoplastic and preneoplastic lung cells by brightfield and fluorescence microscopy.

  10. Semi-monolithic cavity for external resonant frequency doubling and method of performing the same

    NASA Technical Reports Server (NTRS)

    Hemmati, Hamid (Inventor)

    1999-01-01

    The fabrication of an optical cavity for use in a laser, in a frequency doubling external cavity, or any other type of nonlinear optical device, can be simplified by providing the nonlinear crystal in combination with a surrounding glass having an index of refraction substantially equal to that of the nonlinear crystal. The closed optical path in this cavity is formed in the surrounding glass and through the nonlinear crystal which lies in one of the optical segments of the light path. The light is transmitted through interfaces between the surrounding glass in the nonlinear crystal through interfaces which are formed at the Brewster-angle to minimize or eliminate reflection.

  11. HITS-CLIP yields genome-wide insights into brain alternative RNA processing

    NASA Astrophysics Data System (ADS)

    Licatalosi, Donny D.; Mele, Aldo; Fak, John J.; Ule, Jernej; Kayikci, Melis; Chi, Sung Wook; Clark, Tyson A.; Schweitzer, Anthony C.; Blume, John E.; Wang, Xuning; Darnell, Jennifer C.; Darnell, Robert B.

    2008-11-01

    Protein-RNA interactions have critical roles in all aspects of gene expression. However, applying biochemical methods to understand such interactions in living tissues has been challenging. Here we develop a genome-wide means of mapping protein-RNA binding sites in vivo, by high-throughput sequencing of RNA isolated by crosslinking immunoprecipitation (HITS-CLIP). HITS-CLIP analysis of the neuron-specific splicing factor Nova revealed extremely reproducible RNA-binding maps in multiple mouse brains. These maps provide genome-wide in vivo biochemical footprints confirming the previous prediction that the position of Nova binding determines the outcome of alternative splicing; moreover, they are sufficiently powerful to predict Nova action de novo. HITS-CLIP revealed a large number of Nova-RNA interactions in 3' untranslated regions, leading to the discovery that Nova regulates alternative polyadenylation in the brain. HITS-CLIP, therefore, provides a robust, unbiased means to identify functional protein-RNA interactions in vivo.

  12. A Novel Method for Calculation of Strain Energy Release Rate of Asymmetric Double Cantilever Laminated Composite Beams

    NASA Astrophysics Data System (ADS)

    Shokrieh, M. M.; Zeinedini, A.

    2014-06-01

    In this research, a novel data reduction method for calculation of the strain energy release rate ( SERR) of asymmetric double cantilever beams ( ADCB) is presented. For this purpose the elastic beam theory ( EBT) is modified and the new method is called as the modified elastic beam theory ( MEBT). Also, the ADCB specimens are modeled using ABAQUS/Standard software. Then, the initiation of delamination of ADCB specimens is modeled using the virtual crack closure technique ( VCCT). Furthermore, magnitudes of the SERR for different samples are also calculated by an available data reduction method, called modified beam theory ( MBT). Using the hand lay-up method, different laminated composite samples are manufactured by E-glass/epoxy unidirectional plies. In order to measure the SERR, all samples are tested using an experimental setup. The results determined by the new data reduction method ( MEBT) show good agreements with the results of the VCCT and the MBT.

  13. A noniterative asymmetric triple excitation correction for the density-fitted coupled-cluster singles and doubles method: Preliminary applications

    NASA Astrophysics Data System (ADS)

    Bozkaya, Uǧur

    2016-04-01

    An efficient implementation of the asymmetric triples correction for the coupled-cluster singles and doubles [ΛCCSD(T)] method [S. A. Kucharski and R. J. Bartlett, J. Chem. Phys. 108, 5243 (1998); T. D. Crawford and J. F. Stanton, Int. J. Quantum Chem. 70, 601 (1998)] with the density-fitting [DF-ΛCCSD(T)] approach is presented. The computational time for the DF-ΛCCSD(T) method is compared with that of ΛCCSD(T). Our results demonstrate that the DF-ΛCCSD(T) method provide substantially lower computational costs than ΛCCSD(T). Further application results show that the ΛCCSD(T) and DF-ΛCCSD(T) methods are very beneficial for the study of single bond breaking problems as well as noncovalent interactions and transition states. We conclude that ΛCCSD(T) and DF-ΛCCSD(T) are very promising for the study of challenging chemical systems, where the coupled-cluster singles and doubles with perturbative triples method fails.

  14. A Novel Double Subculture Method and Its Theory for the Enumeration of Injured Cells in Stressed Microbial Population.

    PubMed

    Tsuchido, Tetsuaki

    2017-01-01

     A novel double subculture method, termed DiVSaL (Differential Viabilities between Solid and Liquid media) method, for the enumeration of injured cell population of a microorganism, which occurs after some sublethal to lethal treatment, was proposed. In this method injured cells were enumerated as the differential value between viabilities determined with two different techniques, the conventional plate counting using a solid agar medium and the growth delay analysis using a liquid medium. In the former technique, the viable cell number is obtained as colony forming unit (CFU) formed on an agar medium where sublethally injured cells are as much rescued as possible. In the latter technique, on the other hand," the integrated viability" defined by Takano and Tsuchido (1982) is introduced and is calculated from the growth delay of a stressed population, referred to unstressed one. For the growth delay analysis, in this paper, not only the original theoretical model, where the specific growth rate (and therefore the defined G10 value) does not change after the exposure to a stress treatment, but also a novel modified theory, where the parameter changes, is proposed. On the theoretical background, this DiVSaL method as a double subculture method can be used to enumerate the injured cells without selection by addition of some inhibitor or by nutritional shortage.

  15. U.S. Teen Births Hit Historic Low: CDC

    MedlinePlus

    ... medlineplus.gov/news/fullstory_166083.html U.S. Teen Births Hit Historic Low: CDC Data from 2014 also ... 2017 TUESDAY, May 30, 2017 (HealthDay News) -- Teen births continue to decline in the United States, with ...

  16. The Chelyabinsk Meteorite Hits an Anomalous Zone in the Urals

    NASA Astrophysics Data System (ADS)

    Kochemasov, G. G.

    2013-09-01

    The Chelyabinsk meteorite is "strange" because it hits an area in the Urals where anomalous events are observed: shining skies, light balls, UFOs, electrphonic bolids. The area tectonically occurs at the intersection of two fold belts: Urals and Timan.

  17. Pregnant Women Should Avoid Zika-Hit Texas Town: CDC

    MedlinePlus

    ... news/fullstory_162573.html Pregnant Women Should Avoid Zika-Hit Texas Town: CDC Advisory follows reports of ... border with Mexico, because five cases of local Zika infection have been reported there, U.S. health officials ...

  18. Superfast Cosmic Jet "Hits the Wall"

    NASA Astrophysics Data System (ADS)

    1999-01-01

    -288. The jet travelled quickly until its advance suddenly was stopped and the endpoint of the jet became brighter than the core. "This fast-moving material obviously hit something," Hjellming said. What did it it hit? "Probably a mixture of external material plus material from a previous jet ejection." Further studies of the collision could yield new information about the physics of cosmic jets. Such jets are believed to be powered by black holes into which material is being drawn. The exact mechanism by which the black hole's gravitational energy accelerates particles to nearly the speed of light is not well understood. There is even dispute about the types of particles ejected. Competing models call for either a mixture of electrons and protons or a mixture of electrons and positrons. Because protons are more than 1,800 times more massive than electrons or positrons (the positively-charged antiparticle of the electron), the electron-proton mixture would be much more massive than the electron-positron pair. Thus, an electron-proton jet is called a heavy jet and an electron-positron jet is called a light jet. A light jet would be much more easily slowed or stopped by tenuous interstellar material than a heavy jet, so the collision of XTE J1748-288's jet may indicate that it is a light jet. "There's still a lot more work to do before anyone can conclude that, but the collision offers the possibility of answering the light-heavy jet question," Hjellming said. A 1998 VLA study by John Wardle of Brandeis University and his colleagues indicated that the jet of a distant quasar is a light, electron-positron jet. Though the black holes in quasars are supermassive, usually millions of times more massive than the Sun, the physics of jet production in them is thought to be similar to the physics of jet production by smaller black holes, only a few times more massive than the sun, such as the one possibly in XTE J1748-288. The VLA is an instrument of the National Radio Astronomy

  19. iSeq: A New Double-Barcode Method for Detecting Dynamic Genetic Interactions in Yeast

    PubMed Central

    Jaffe, Mia; Sherlock, Gavin; Levy, Sasha F.

    2016-01-01

    Systematic screens for genetic interactions are a cornerstone of both network and systems biology. However, most screens have been limited to characterizing interaction networks in a single environment. Moving beyond this static view of the cell requires a major technological advance to increase the throughput and ease of replication in these assays. Here, we introduce iSeq—a platform to build large double barcode libraries and rapidly assay genetic interactions across environments. We use iSeq in yeast to measure fitness in three conditions of nearly 400 clonal strains, representing 45 possible single or double gene deletions, including multiple replicate strains per genotype. We show that iSeq fitness and interaction scores are highly reproducible for the same clonal strain across replicate cultures. However, consistent with previous work, we find that replicates with the same putative genotype have highly variable genetic interaction scores. By whole-genome sequencing 102 of our strains, we find that segregating variation and de novo mutations, including aneuploidy, occur frequently during strain construction, and can have large effects on genetic interaction scores. Additionally, we uncover several new environment-dependent genetic interactions, suggesting that barcode-based genetic interaction assays have the potential to significantly expand our knowledge of genetic interaction networks. PMID:27821633

  20. Organic double layer element driven by triboelectric nanogenerator: Study of carrier behavior by non-contact optical method

    NASA Astrophysics Data System (ADS)

    Chen, Xiangyu; Taguchi, Dai; Manaka, Takaaki; Iwamoto, Mitsumasa

    2016-02-01

    By using optical electric-field-induced second-harmonic generation (EFISHG) technique, we studied carrier behavior caused by contact electrification (CE) in an organic double-layer element. This double-layer sample was half suspended in the open air, where one electrode (anode or cathode) was connected with a Cu foil for electrification while the other electrode was floated. Results showed two distinct carrier behaviors, depending on the (anode or cathode) connections to the Cu foil, and these carrier behaviors were analyzed based on the Maxwell-Wagner model. The double-layer sample works as a simple solar cell device. The photovoltaic effect and CE process have been proved to be two paralleled effects without strong interaction with each other, while photoconductivity changing in the sample can enhance the relaxation of CE induced charges. By probing the carrier behavior in this half-suspended device, the EFISHG technique has been demonstrated to be an effective non-contact method for clarifying the CE effect on related energy harvesting devices and electronics devices. Meanwhile, the related physical analysis in this letter is also useful for elucidating the fundamental characteristic of hybrid energy system based on solar cell and triboelectric nanogenerator.

  1. 'That's OK. He's a guy': a mixed-methods study of gender double-standards for alcohol use.

    PubMed

    de Visser, Richard O; McDonnell, Elizabeth J

    2012-01-01

    Although drinking and drunkenness have traditionally been considered masculine behaviours, young women's alcohol consumption has increased in recent years. This mixed methods study was conducted to examine the extent to which young people endorse gender double-standards for alcohol use--i.e., less acceptance of drinking and drunkenness in women than men--and how these influence men's and women's alcohol consumption. A sample of 731 English university students completed an online survey of gender role attitudes, beliefs about the gendered nature of alcohol use and recent alcohol consumption. Sixteen participants were then purposively selected for individual interviews: eight women and men with the most egalitarian gender role beliefs, and eight women and men with the least egalitarian beliefs. The two sets of data revealed that although there were few sex differences in actual levels of drinking or drunkenness, gender double-standards for alcohol use persist: beer drinking, binge drinking and public drunkenness tended to be perceived as masculine, and even the most egalitarian respondents were more judgemental of women's drinking. Participants modified their drinking style so as to maintain a desired gender identity. Although gender double-standards could be a focus of interventions to encourage moderate drinking, such approaches could reinforce gender inequalities.

  2. Visualisation of the wave-front deformations caused by a phase object by the method of successive double lateral shear interferometry

    SciTech Connect

    Lyalikov, A M

    2005-03-31

    The method of moire visualisation of the wave-front deformations of a light beam propagated through a phase object is proposed. The method is based on the recording of double shear interferograms and makes it possible to obtain real-time moire pictures of the phase object with doubled sensitivity, in which the behaviour of fringes is similar to that in usual double-beam, reference-wave interferometry. The method was tested by studying the regions of thermal treatment of a polymethyl methacrylate plate. (laser applications and other topics in quantum electronics)

  3. Thomson Scattering Measurements on HIT-SI3

    NASA Astrophysics Data System (ADS)

    Everson, C. J.; Morgan, K. D.; Jarboe, T. R.

    2015-11-01

    A multi-point Thomson Scattering diagnostic has been implemented on HIT-SI3 (Helicity Injected Torus - Steady Inductive 3) to measure electron temperature. The HIT-SI3 experiment is a modification of the original HIT-SI apparatus that uses three injectors instead of two. This modification alters the configuration of magnetic fields and thus the plasma behavior in the device. The scientific aim of HIT-SI3 is to develop a deeper understanding of how injector behavior and interactions influence current drive and plasma performance in the spheromak. The Thomson Scattering system includes a 20 J (1 GW pulse) Ruby laser that provides the incident beam, and collection optics that are installed such that measurements can be taken at four spatial locations in HIT-SI3 plasmas. For each measurement point, a 3-channel polychromator is used to detect the relative level of scattering. These measurements allow for the presence of temperature gradients in the spheromak to be investigated. Preliminary HIT-SI3 temperature data are presented and can be compared to predictions from computational models. Work supported by the D.O.E.

  4. HANFORD DOUBLE SHELL TANK (DST) THERMAL & SEISMIC PROJECT BUCKLING EVALUATION METHODS & RESULTS FOR THE PRIMARY TANKS

    SciTech Connect

    MACKEY TC; JOHNSON KI; DEIBLER JE; PILLI SP; RINKER MW; KARRI NK

    2007-02-14

    This report documents a detailed buckling evaluation of the primary tanks in the Hanford double-shell waste tanks (DSTs), which is part of a comprehensive structural review for the Double-Shell Tank Integrity Project. This work also provides information on tank integrity that specifically responds to concerns raised by the Office of Environment, Safety, and Health (ES&H) Oversight (EH-22) during a review of work performed on the double-shell tank farms and the operation of the aging waste facility (AWF) primary tank ventilation system. The current buckling review focuses on the following tasks: (1) Evaluate the potential for progressive I-bolt failure and the appropriateness of the safety factors that were used for evaluating local and global buckling. The analysis will specifically answer the following questions: (a) Can the EH-22 scenario develop if the vacuum is limited to -6.6-inch water gage (w.g.) by a relief valve? (b) What is the appropriate factor of safety required to protect against buckling if the EH-22 scenario can develop? (c) What is the appropriate factor of safety required to protect against buckling if the EH-22 scenario cannot develop? (2) Develop influence functions to estimate the axial stresses in the primary tanks for all reasonable combinations of tank loads, based on detailed finite element analysis. The analysis must account for the variation in design details and operating conditions between the different DSTs. The analysis must also address the imperfection sensitivity of the primary tank to buckling. (3) Perform a detailed buckling analysis to determine the maximum allowable differential pressure for each of the DST primary tanks at the current specified limits on waste temperature, height, and specific gravity. Based on the I-bolt loads analysis and the small deformations that are predicted at the unfactored limits on vacuum and axial loads, it is very unlikely that the EH-22 scenario (i.e., progressive I-bolt failure leading to global

  5. Normalization method of highly forward-peaked scattering phase function using the double exponential formula for radiative transfer

    NASA Astrophysics Data System (ADS)

    Fujii, Hiroyuki; Okawa, Shinpei; Yamada, Yukio; Hoshi, Yoko; Watanabe, Masao

    2016-12-01

    Numerical calculation of photon migration in biological tissue using the radiative transfer equation (RTE) has attracted great interests in biomedical optics and imaging. Because biological tissue is a highly forward-peaked scattering medium, a normalization of scattering phase function in the RTE is crucial. This paper proposes a simple way of normalizing the phase function by the double exponential formula, which is heuristically modified from the original one. The proposed method is validated by the agreement between the numerical solution of the RTE with the proposed method and analytical solution of the RTE for the case of a highly forward-peaked scattering medium, while the numerical solutions with conventional normalization methods disagree with the analytical solution. This result suggests the proposed method is accurate in numerical calculation of the RTE.

  6. Investigating and optimizing charge transfer between graphene and metal by using double layer electrode and polymer-free transfer method

    NASA Astrophysics Data System (ADS)

    Huang, Kuo-You; Li, Chia-Shuo; Wen, Luo-Hong; Chou, Ang-Sheng; Ho, Mon-Shu; Wu, Chih-I.

    2017-06-01

    Achieving low contact resistance between graphene and metals is crucial to the further development of high-performance graphene field effect transistors. Increasing the number of conduction modes is the key issue in improving the contact between graphene and metals. This study characterized the work function between graphene and metal contacts using in situ thermal evaporation and ultraviolet photoelectron spectroscopy. Silver produces weak n-type doping and gold produces heavy p-type doping in graphene. The use of a polymer-free transfer method and a double electrode contact structure produced gold contacts with a resistance value of 352.8 Ω · µm, which is 2.7 times lower than that obtained using conventional methods. This method also produced silver contacts with a resistance value of 958.6 Ω · µm, which represents a 180% improvement over conventional methods.

  7. Improvement of anther culture methods for doubled haploid production in barley breeding.

    PubMed

    Hou, L; Ullrich, S E; Kleinhofs, A; Stiff, C M

    1993-04-01

    There is potential to accelerate cultivar development with a doubled haploid system for breeding line production. Anther culture methodology was evaluated for U.S.A. spring barley (Hordeum vulgare L.) breeding applications. Gelrite was found to be an acceptable replacement for ficoll in the induction medium to reduce costs while maintaining embryoid and plant production levels. Beneficial effects of 28 d cold pretreatment of donor spikes for anther culture were confirmed with Pacific Northwest USA barley genotypes. A 3 d mannitol solution pretreatment of fresh anthers was shown to be less effective for green plant production compared to 28 d cold pretreatment of donor spikes. Extended donor spike cold pretreatment from 28 to 42 d did not reduce anther culture productivity. Based on this research, anther culture techniques show promise for economical and convenient application in spring barley breeding.

  8. [Study of low density lipoproteins in hyperlipoproteinemia by the method of double immunodiffusion].

    PubMed

    Nikitina, N A; Perova, N V; Proskuriakova, T V; Suchkova, S N; Kutateladze, N V

    1977-06-01

    By way of gel double immunodiffusion a certain heterogeneity of low density lipoproteins was observed to manifest itself in an additional band of immunoprecipitation. The incidence of this additional band does not exceed 1/3 of the cases of low density lipoproteins studies in normal individuals, while in those with ischaemic heart disease the additional band is found twice-thrice as often, the highest incidence being noted in patients with ischaemic heart disease and Type IIb hyperlipoproteinemia (93% of cases). The revealed immunochemical heterogeneity of low density lipoproteins was shown to be not connected with the appearance of any new, additional antigen in their structure. Most probably it is attributable to the presence of lipoprotein particles with a quantitatively different protein and lipid composition, probably of intermediate lipoprotein metabolites in blood plasma, or conformation changes in the structure of low density lipoproteins.

  9. Fracture Toughness of Thin Plates by the Double-Torsion Test Method

    NASA Technical Reports Server (NTRS)

    Salem, Jonathan A.; Radovic, Miladin; Lara-Curzio, Edgar; Nelson, George

    2006-01-01

    Double torsion testing can produce fracture toughness values without crack length measurement that are comparable to those measured via standardized techniques such as the chevron-notch, surface-crack-in-flexure and precracked beam if the appropriate geometry is employed, and the material does not exhibit increasing crack growth resistance. Results to date indicate that 8 < W/d < 80 and L/W > 2 are required if crack length is not considered in stress intensity calculations. At L/W = 2, the normalized crack length should be 0.35 < a/L < 0.65; whereas for L/W = 3, 0.2 < a/L < 0.75 is acceptable. In addition, the load-points need to roll to reduce friction. For an alumina exhibiting increasing crack growth resistance, values corresponding to the plateau of the R-curve were measured. For very thin plates (W/d > 80) nonlinear effects were encountered.

  10. An investigation into the mechanics of double-sided incremental forming using finite element methods

    NASA Astrophysics Data System (ADS)

    Moser, Newell; Zhang, Zixuan; Ren, Huaqing; Ehmann, Kornel; Cao, Jian

    2016-10-01

    Double-Sided Incremental Forming (DSIF) is a developing sheet metal manufacturing process that has gained a lot of attention in recent years due to its inherent flexibility, low-overhead cost, and die-less nature. However, it can be challenging to define the tool gap so as to achieve a desired pressure through the sheet thickness since one must first predict sheet thinning. In this investigation, a novel part design is proposed which varies in-plane curvature as a function of depth. A finite element model for DSIF is developed and the strain histories in various regions are extracted. It was concluded that if the supporting tool loses contact with the sheet, localized necking can occur prior to part failure. Additionally, part geometry can have significant effects on the tool contact area which, consequently, affects the evolution of strain.

  11. Standardizing the double-observer survey method for estimating mountain ungulate prey of the endangered snow leopard.

    PubMed

    Suryawanshi, Kulbhushansingh R; Bhatnagar, Yash Veer; Mishra, Charudutt

    2012-07-01

    Mountain ungulates around the world have been threatened by illegal hunting, habitat modification, increased livestock grazing, disease and development. Mountain ungulates play an important functional role in grasslands as primary consumers and as prey for wild carnivores, and monitoring of their populations is important for conservation purposes. However, most of the several currently available methods of estimating wild ungulate abundance are either difficult to implement or too expensive for mountainous terrain. A rigorous method of sampling ungulate abundance in mountainous areas that can allow for some measure of sampling error is therefore much needed. To this end, we used a combination of field data and computer simulations to test the critical assumptions associated with double-observer technique based on capture-recapture theory. The technique was modified and adapted to estimate the populations of bharal (Pseudois nayaur) and ibex (Capra sibirica) at five different sites. Conducting the two double-observer surveys simultaneously led to underestimation of the population by 15%. We therefore recommend separating the surveys in space or time. The overall detection probability for the two observers was 0.74 and 0.79. Our surveys estimated mountain ungulate populations (± 95% confidence interval) of 735 (± 44), 580 (± 46), 509 (± 53), 184 (± 40) and 30 (± 14) individuals at the five sites, respectively. A detection probability of 0.75 was found to be sufficient to detect a change of 20% in populations of >420 individuals. Based on these results, we believe that this method is sufficiently precise for scientific and conservation purposes and therefore recommend the use of the double-observer approach (with the two surveys separated in time or space) for the estimation and monitoring of mountain ungulate populations.

  12. Double electrochemical covalent coupling method based on click chemistry and diazonium chemistry for the fabrication of sensitive amperometric immunosensor.

    PubMed

    Qi, Honglan; Li, Min; Zhang, Rui; Dong, Manman; Ling, Chen

    2013-08-20

    A double electrochemical covalent coupling method based on click chemistry and diazonium chemistry for the fabrication of sensitive amperometric immunosensor was developed. As a proof-of-concept, a designed alkyne functionalized human IgG was used as a capture antibody and a HRP-labeled rabbit anti-goat IgG was used as signal antibody for the determination of the anti-human IgG using the sandwich model. The immunosensor was fabricated by electrochemically grafting a phenylazide on the surface of a glassy carbon electrode, and then, by coupling the alkyne functionalized human IgG with the phenylazide group through an electro-click chemistry in the presence of Cu(II). The amperometric measurement for the determination of the anti-human IgG was performed after the fabricated immunosensor was incubated with the target anti-human IgG and then with the HRP-labeled anti-goat IgG at -0.25V in 0.10M PBS (pH 7.0) containing 0.1mM hydroquinone and 2.0mM H2O2. The results showed that the increased current was linear with the logarithm of the concentration of the anti-human IgG in the range from 1.0×10(-10)g mL(-1) to 1.0×10(-8)g mL(-1) with a detection limit of 3×10(-11)g mL(-1). Furthermore, the feasibility of the double electrochemical covalent coupling method proposed in this work for fabricating the amperometric immunosensor array was explored. This work demonstrates that the double electrochemical covalent coupling method is a promising approach for the fabrication of the immunosensor and immunosensor array.

  13. Common-mode differential-mode (CMDM) method for double-nuclear MR signal excitation and reception at ultrahigh fields.

    PubMed

    Pang, Yong; Zhang, Xiaoliang; Xie, Zhentian; Wang, Chunsheng; Vigneron, Daniel B

    2011-11-01

    Double-tuned radio-frequency (RF) coils for heteronuclear mangentic resonance (MR) require sufficient electromagnetic isolation between the two resonators operating at two Larmor frequencies and independent tuning in order to attain highly efficient signal acquisition at each frequency. In this work, a novel method for double-tuned coil design at 7T based on the concept of common-mode differential-mode (CMDM) was developed and tested. Common mode (CM) and differential mode (DM) currents exist within two coupled parallel transmission lines, e.g., microstrip lines, yielding two different current distributions. The electromagnetic (EM) fields of the CM and DM are orthogonal to each other, and thus, the two modes are intrinsically EM decoupled. The modes can be tuned independently to desired frequencies, thus satisfying the requirement of dual-frequency MR applications. To demonstrate the feasibility and efficiency of the proposed CMDM technique, CMDM surface coils and volume coils using microstrip transmission line for (1)H and (13)C MRI/MRSI were designed, constructed, and tested at 7T. Bench test results showed that the isolations between the two frequency channels of the CMDM surface coil and volume coil were better than -30 and -25 dB, respectively. High quality MR phantom images were also obtained using the CMDM coils. The performance of the CMDM technique was validated through a comparison with the conventional two-pole design method at 7T. The proposed CMDM technique can be also implemented by using other coil techniques such as lumped element method, and can be applied to designing double-tuned parallel imaging coil arrays. Furthermore, if the two resonant modes of a CMDM coil were tuned to the same frequency, the CMDM coil becomes a quadrature coil due to the intrinsic orthogonal field distribution of CM and DM.

  14. [Comparison of two types of double-lined simulated landfill leakage detection based on high voltage DC method].

    PubMed

    Yang, Ping; Nai, Chang-Xin; Dong, Lu; Wang, Qi; Wang, Yan-Wen

    2006-01-01

    Two types of double high density polyethylene (HDPE) liners landfill that clay or geogrid was added between the two HDPE liners. The general resistance of the second mode is 15% larger than the general resistance of the first mode in the primary HDPE liner detection, and 20% larger than that of the first one in the secondary HDPE liner detection. High voltage DC method can accomplish the leakage detection and location of these two types of landfill and the error of leakage location is less than 10cm when electrode space is 1m.

  15. Shock Sensitivity of a Double-Base Propellant as a Function of Size, Age, and Processing Method

    NASA Astrophysics Data System (ADS)

    Sandusky, Harold

    2015-06-01

    The shock sensitivities of a fresh and aged double-base propellant were measured with material quantities much less than that required for the conventional Large Scale Gap Test (LSGT). The Insensitive High Explosive Gap test (IHEGT) yielded the same critical initiation pressure for fresh samples using 11 g of material as the LSGT with 240 g. Results from IHEGT for the aged samples will be discussed. Challenges with different processing methods (pressing versus extrusion) owing to the limited available material and how these were overcome will also be addressed. These results demonstrate how small scale tests can mimic results in larger scale tests upon proper consideration of shock, detonation, and material science.

  16. Potential of a spectroscopic measurement method using adding-doubling to retrieve the bulk optical properties of dense microalgal media.

    PubMed

    Bellini, Sarah; Bendoula, Ryad; Latrille, Eric; Roger, Jean-Michel

    2014-01-01

    In the context of algal mass cultivation, current techniques used for the characterization of algal cells require time-consuming sample preparation and a large amount of costly, standard instrumentation. As the physical and chemical properties of the algal cells strongly affect their optical properties, the optical characterization is seen as a promising method to provide an early diagnosis in the context of mass cultivation monitoring. This article explores the potential of a spectroscopic measurement method coupled with the inversion of the radiative transfer theory for the retrieval of the bulk optical properties of dense algal samples. Total transmittance and total reflectance measurements were performed over the 380-1020 nm range on dense algal samples with a double integrating sphere setup. The bulk absorption and scattering coefficients were thus extracted over the 380-1020 nm range by inverting the radiative transfer theory using inverse-adding-doubling computations. The experimental results are presented and discussed; the configuration of the optical setup remains a critical point. The absorption coefficients obtained for the four samples of this study appear not to be more informative about pigment composition than would be classical methods in analytical spectroscopy; however, there is a real added value in measuring the reduced scattering coefficient, as it appears to be strongly correlated to the size distribution of the algal cells.

  17. [Effects of different tillage methods on photosynthetic characteristics, dry matter production and economic benefit of double cropping soybean].

    PubMed

    Tang, Jiang-hua; Su, Li-li; Li, Ya-jie; Xu, Wen-xiu; Peng, Jiang-long

    2016-01-01

    In order to explore suitable mode of high yield cultivation of double cropping soybean after wheat under drip irrigation in northern Xinjiang, field trials were set in 2013-2014 to investigate physiological indices and agronomic traits of double cropping soybean under different tillage methods under drip irrigation. The results showed that leaf area index (LAI), chlorophyll content (SPAD), leaf net photosynthetic rate (Pn), transpiration rate (Tr) and stomatal conductance (g(s)) during the determination period under different tillage methods were in the order of tillage plus film covering (TP)> tillage (T)> rotary tillage (RT) > no-tillage (NT) , and the concentration of intercellular CO₂(Ci) was the opposite. LAI, SPAD, Pn, Tr, and g(s) of TP were higher than that with NT by 55.0%, 9.1%, 41.8%, 37.5% and 56.4%, respectively, and Ci was decreased by 22.1%. TP enhanced the photosynthetic efficiency of soybean and improved the ability of CO₂assimilation, consequently leading to the increase of soybean yield under TP compared to NT. The plant dry matter accumulation of TP treatment was improved greatly, with the pod number and seeds number per plant, 100-seed mass and yield of quadric sowing soybean being increased by 50.3%, 48.1%, 11.8% and 20.8% compared with that under NT, and the differences were significant. Therefore, the plastic film mulching combined with tillage under drip irrigation technology was suitable for double cropping soybean after wheat in northern Xinjiang under this experimental condition.

  18. Surface Magnetics on the HIT-SI Experiment

    NASA Astrophysics Data System (ADS)

    Wrobel, J. S.; Jarboe, T. R.; Nelson, B. A.; Smith, R. J.; Stewart, B. T.

    2008-11-01

    An array of 96 surface magnetic probes sensitive to the poloidal and toroidal B field are embedded in the HIT-SI spheromak equilibrium flux conserver, a 12.7mm thick chromium copper alloy shell with an L/R time of 100ms. An extensive calibration campaign has been completed to correct for the frequency dependent attenuation of the magnetic field by the shell and provide plasma edge field measurements over a 10Hz-200kHz bandwidth. The system is expected to provide several important results: 1) A measurement of the non-Taylor part of the equilibrium which may reveal details of the small scale, high frequency magnetic relaxation process. 2) A measurement of the MHD mode amplitudes and evolution in the equilibrium region. 3) Provide insight into injector effects which are important for future injector designs. Comparison of experimental vector field results to computational simulations will explore the dominant physics involved in steady inductive helicity injection current drive. Analysis, progress and methods will be presented.

  19. Double-salting out assisted liquid-liquid extraction (SALLE) HPLC method for estimation of temozolomide from biological samples.

    PubMed

    Jain, Darshana; Athawale, Rajani; Bajaj, Amrita; Shrikhande, Shruti

    2014-11-01

    The role of temozolomide (TMZ) in treatment of high grade gliomas, melanomas and other malignancies is being defined by the current clinical developmental trials. Temozolomide belongs to the group of alkylating agents and is prescribed to patients suffering from most aggressive forms of brain tumors. The estimation techniques for temozolomide from the extracted plasma or biological samples includes high-performance liquid chromatography with UV detection (HPLC-UV), micellar electrokinetic capillary chromatography (MKEC) and liquid chromatography coupled to mass spectroscopy (LC-MS). These methods suffer from disadvantages like low resolution, low sensitivity, low recovery or cost involvement. An analytical method possessing capacity to estimate low quantities of TMZ in plasma samples with high extraction efficiency (%) and high resolution with cost effectiveness needs to be developed. Cost effective, robust and low plasma component interfering HPLC method using salting out liquid-liquid extraction (SALLE) technique was developed and validated for estimation of drug from plasma samples. The extraction efficiency (%) with conventional LLE technique with methanol, ethyl acetate, dichloromethane and acetonitrile was found to be 5.99±2.45, 45.39±4.56, 46.04±1.14 and 46.23±3.67 respectively. Extraction efficiency (%) improved with SALLE where sodium chloride was used as an electrolyte and was found to be 6.80±5.56, 52.01±3.13, 62.69±2.11 and 69.20±1.18 with methanol, ethyl acetate, dichloromethane and acetonitrile as organic solvent. Upon utilization of two salts for extraction (double salting liquid-liquid extraction) the extraction efficiency (%) was further improved and was twice of LLE. It was found that double salting liquid-liquid extraction technique yielded extraction efficiency (%) of 11.71±5.66, 55.62±3.44, 77.28±2.89 and 87.75±0.89. Hence a method based on double SALLE was developed for quantification of TMZ demonstrating linearity in the range of

  20. [Trimetazidine versus betahistine in Ménière's disease. A double blind method].

    PubMed

    Martini, A; De Domenico, F

    1990-01-01

    The efficacy and acceptability of trimetazidine (60 mg daily) in the treatment of Meniere's disease were compared with those of betahistine (36 mg daily) during a double-blind study spanning two months. Enrolled in the study were 45 patients (33 treated with trimetazidine, 23 with betahistine) presenting cochlear symptoms (vertigo, tinnitus, hearing loss) compatible with a diagnosis of Meniere's disease. Five patients dropped out of the study (3 in the trimetazidine group did not comply with the therapy and 2 in the betahistine group complained of poor response to the treatment) and were not taken into account in the final analysis, which therefore bore on 40 patients (19 receiving trimetazidine and 21 receiving betahistine). Trimetazidine was found to be significantly more effective than betahistine as far as the overall evolution of the ENT disease was concerned, yielding 79% and 57% improvement rates in each group, respectively (p = 0.027). Complete disappearance of the dizziness attacks was noted in 10 patients out of 19 in the trimetazidine group, versus 5/21 patients in the betahistine group (p = 0.06). There was no statistically significant difference between both treatments, as assessed from other clinical or audiometric criteria. Clinical acceptability was equally excellent in both treatment groups.

  1. A double-index method to classify Kuroshio intrusion paths in the Luzon Strait

    NASA Astrophysics Data System (ADS)

    Huang, Zhida; Liu, Hailong; Hu, Jianyu; Lin, Pengfei

    2016-06-01

    A double index (DI), which is made up of two sub-indices, is proposed to describe the spatial patterns of the Kuroshio intrusion and mesoscale eddies west to the Luzon Strait, based on satellite altimeter data. The area-integrated negative and positive geostrophic vorticities are defined as the Kuroshio warm eddy index (KWI) and the Kuroshio cold eddy index (KCI), respectively. Three typical spatial patterns are identified by the DI: the Kuroshio warm eddy path (KWEP), the Kuroshio cold eddy path (KCEP), and the leaking path. The primary features of the DI and three patterns are further investigated and compared with previous indices. The effects of the integrated area and the algorithm of the integration are investigated in detail. In general, the DI can overcome the problem of previously used indices in which the positive and negative geostrophic vorticities cancel each other out. Thus, the proportions of missing and misjudged events are greatly reduced using the DI. The DI, as compared with previously used indices, can better distinguish the paths of the Kuroshio intrusion and can be used for further research.

  2. Investigation of Crack Growth Process in Dense Hydroxyapatite Using the Double Torsion Method

    NASA Astrophysics Data System (ADS)

    Benaqqa, C.; Chevalier, J.; Saâdaoui, M.; Fantozzi, G.

    In this work, double torsion tests were performed to investigate slow crack growth behavior of dense hydroxyapatite materials. Crack rate, V, versus stress intensity factor, K I , laws were obtained for different environments and processing conditions. Stress assisted corrosion by water molecules in oxide ceramics is generally responsible for slow crack growth. The different propagation stages obtained here could be analyzed in relation to this process. The presence of a threshold defining a safety range of use was also observed. Hydroxyapatite ceramics appear to be very sensitive to slow crack growth, crack propagation occurring even at very low K I . This can be explained by the fact that their contain hydroxyl groups (HAP: Ca10(PO4)6(OH)2), favoring water adsorption on the crack surface and thus a strong decrease of surface energy in the presence of water. This study demonstrates that processing conditions must be carefully controlled, specially sintering temperature, which plays a key role on V-K I laws. Sintering at 50°C above or below the optimal temperature, for example, may shift the V-K I law towards very low stress intensity factors. The influence of ageing is finally discussed.

  3. Variable-cell double-ended surface walking method for fast transition state location of solid phase transitions.

    PubMed

    Zhang, Xiao-Jie; Liu, Zhi-Pan

    2015-10-13

    To identify the low energy pathway for solid-to-solid phase transition has been a great challenge in physics and material science. This work develops a new theoretical method, namely, variable-cell double-ended surface walking (VC-DESW) to locate the transition state (TS) and deduce the pathway in solid phase transition. Inherited from the DESW method ( J. Chem. Theory Comput. 2013 , 9 , 5745 ) for molecular systems, the VC-DESW method implements an efficient mechanism to couple the lattice and atom degrees of freedom. The method features with fast pseudopathway building and accurate TS location for solid phase transition systems without requiring expensive Hessian computation and iterative pathway optimization. A generalized coordinate, consisting of the lattice vectors and the scaled atomic coordinates, is designed for describing the crystal potential energy surface (PES), which is able to capture the anisotropic behavior in phase transition. By comparing with the existing method for solid phase transition in different systems, we show that the VC-DESW method can be much more efficient for finding the TS in crystal phase transition. With the combination of the recently developed unbiased stochastic surface walking pathway sampling method, the VC-DESW is further utilized to resolve the lowest energy pathway of SiO2 α-quartz to quartz-II phase transition from many likely reaction pathways. These new methods provide a powerful platform for understanding and predicting the solid phase transition mechanism and kinetics.

  4. Double-radionuclide autoradiographic method using N-isopropyl-iodoamphetamine for sequential measurements of local cerebral blood flow

    SciTech Connect

    Obrenovitch, T.P.; Clayton, C.B.; Strong, A.J.

    1987-06-01

    A double-radionuclide autoradiographic method has been assessed for sequential determinations of local CBF (LCBF). It is based on two successive intravascular injections of N-isopropyl-p-iodoamphetamine (IMP) labelled with different radionuclides, whose concentrations can later be differentiated in the same tissue section using double-radionuclide autoradiography. Previous studies suggested that the distribution of IMP, up to 30 min after its administration, still represents LCBFs. Our data indicate that, provided the tracer is injected directly into the left ventricle, there is little back diffusion from normal brain to blood under physiological conditions for at least 35 min following the tracer injection and an injection of unlabelled IMP, in a dose larger than that used for blood flow determination, does not displace any labelled IMP previously taken up by the brain, nor does it displace any labelled IMP previously accumulated in the lung that would lead to secondary brain uptake. On the basis of these results, we conclude that sequential autoradiographic determinations of LCBF using IMP labelled with different radionuclides is possible. This is a promising experimental method for the simultaneous investigation of changes in LCBF in several CNS structures.

  5. Comparison of retention forces with various fabrication methods and materials in double crowns.

    PubMed

    Çelik Güven, Melahat; Tuna, Meral; Bozdağ, Ergun; Öztürk, Gizem Nur; Bayraktar, Gulsen

    2017-08-01

    The purpose of this study was to analyze the retention force changes and wear behaviours of double-crown systems over long-term use. Ten groups, each consisting of six samples, were evaluated. Specifically, casting gold alloy primary crown - casting gold alloy secondary crown (AA), laser sintering primary crown - laser sintering secondary crown (LL), casting Cr alloy primary crown - casting Cr alloy secondary crown, (CC) zirconia primary crown - electroformed secondary crown (ZA), and CAD/CAM titanium alloy primary crown - CAD/CAM titanium alloy secondary crown (TT) groups were evaluated at cone angles of 4° and 6°. The samples were subjected to 5,000 insertion-separation cycles in artificial saliva, and the retention forces were measured every 500 cycles. The wear levels were analyzed via SEM at the beginning and end of the 5,000 cycles. In all samples, the retention forces increased when the conus angle decreased. The highest initial and final retention force values were found in the LL-4° group (32.89 N-32.65 N), and the lowest retention force values were found in the ZA6° group (5.41 N-6.27 N). The ZA groups' samples showed the least change in the retention force, and no wear was observed. In the other groups, wear was observed mostly in the primary crowns. More predictable, clinically relevant, and less excursive retention forces can be observed in the ZA groups. The retention force values of the LL groups were statically similar to those of the other groups, except the ZA groups.

  6. A new method to efficiently induce a site-specific double-strand break in the fission yeast Schizosaccharomyces pombe.

    PubMed

    Sunder, Sham; Greeson-Lott, Nikole T; Runge, Kurt W; Sanders, Steven L

    2012-07-01

    Double-strand DNA breaks are a serious threat to cellular viability and yeast systems have proved invaluable in helping to understand how these potentially toxic lesions are sensed and repaired. An important method to study the processing of DNA breaks in the budding yeast Saccharomyces cerevisiae is to introduce a unique double-strand break into the genome by regulating the expression of the site-specific HO endonuclease with a galactose inducible promoter. Variations of the HO site-specific DSB assay have been adapted to many organisms, but the methodology has seen only limited use in the fission yeast Schizosaccharomyces pombe because of the lack of a promoter capable of inducing endonuclease expression on a relatively short time scale (~1 h). We have overcome this limitation by developing a new assay in which expression of the homing endonuclease I-PpoI is tightly regulated with a tetracycline-inducible promoter. We show that induction of the I-PpoI endonuclease produces rapid cutting of a defined cleavage site (> 80% after 1 h), efficient cell cycle arrest and significant accumulation of the checkpoint protein Crb2 at break-adjacent regions in a manner that is analogous to published findings with DSBs produced by an acute exposure to ionizing irradiation. This assay provides an important new tool for the fission yeast community and, because many aspects of mammalian chromatin organization have been well-conserved in Sz. pombe but not in S. cerevisiae, also offers an attractive system to decipher the role of chromatin structure in modulating the repair of double-stranded DNA breaks. Copyright © 2012 John Wiley & Sons, Ltd.

  7. Spiraling between qualitative and quantitative data on women's health behaviors: a double helix model for mixed methods.

    PubMed

    Mendlinger, Sheryl; Cwikel, Julie

    2008-02-01

    A double helix spiral model is presented which demonstrates how to combine qualitative and quantitative methods of inquiry in an interactive fashion over time. Using findings on women's health behaviors (e.g., menstruation, breast-feeding, coping strategies), we show how qualitative and quantitative methods highlight the theory of knowledge acquisition in women's health decisions. A rich data set of 48 semistructured, in-depth ethnographic interviews with mother-daughter dyads from six ethnic groups (Israeli, European, North African, Former Soviet Union [FSU], American/Canadian, and Ethiopian), plus seven focus groups, provided the qualitative sources for analysis. This data set formed the basis of research questions used in a quantitative telephone survey of 302 Israeli women from the ages of 25 to 42 from four ethnic groups. We employed multiple cycles of data analysis from both data sets to produce a more detailed and multidimensional picture of women's health behavior decisions through a spiraling process.

  8. Condylar position control during maxillary surgery: the condylar positioning appliance and three-dimensional double splint method.

    PubMed

    Schwestka, R; Engelke, D; Kubein-Meesenburg, D

    1990-01-01

    A new method for positioning the maxilla and condyle after Le Fort I osteotomy maintains the patient's vertical dimension (ie, the relation of the mandible to the skull above the osteotomy plane) in the preoperative and postoperative positions during both cast surgery and actual surgery. During surgery the condylar positioning appliance is fixed to the anterolateral zygoma and the lateral cortex of the mandibular ramus bilaterally to orient the mandible in centric relation. The condylar positioning appliance is used with the three-dimensional double splint method. Two prefabricated splints enable three-dimensional positioning of the maxilla in the fixed mandibular position during surgery. Postoperatively, the mandible can be rotated into the new centric occlusion.

  9. Ensemble density functional theory method correctly describes bond dissociation, excited state electron transfer, and double excitations

    SciTech Connect

    Filatov, Michael; Huix-Rotllant, Miquel; Burghardt, Irene

    2015-05-14

    State-averaged (SA) variants of the spin-restricted ensemble-referenced Kohn-Sham (REKS) method, SA-REKS and state-interaction (SI)-SA-REKS, implement ensemble density functional theory for variationally obtaining excitation energies of molecular systems. In this work, the currently existing version of the SA-REKS method, which included only one excited state into the ensemble averaging, is extended by adding more excited states to the averaged energy functional. A general strategy for extension of the REKS-type methods to larger ensembles of ground and excited states is outlined and implemented in extended versions of the SA-REKS and SI-SA-REKS methods. The newly developed methods are tested in the calculation of several excited states of ground-state multi-reference systems, such as dissociating hydrogen molecule, and excited states of donor–acceptor molecular systems. For hydrogen molecule, the new method correctly reproduces the distance dependence of the lowest excited state energies and describes an avoided crossing between the doubly excited and singly excited states. For bithiophene–perylenediimide stacked complex, the SI-SA-REKS method correctly describes crossing between the locally excited state and the charge transfer excited state and yields vertical excitation energies in good agreement with the ab initio wavefunction methods.

  10. Interfacial width in polymer bilayer films prepared by double-spin-coating and flotation methods.

    PubMed

    Fujii, Yoshihisa; Atarashi, Hironori; Hino, Masahiro; Nagamura, Toshihiko; Tanaka, Keiji

    2009-09-01

    A spin-coating method with the aid of selective solvents has been used to construct multilayer structures for organic devices under the assumption that the solvents do not invade a preformed structure. To confirm the assumption, we examined the interfacial width (lambda(i)) of model polymer bilayers, composed of polystyrene and perdeuterated poly(methyl methacrylate), prepared by spin-coating and flotation methods. Neutron reflectivity measurements revealed that the lambda(i) value was larger for the spin-coating method than for the flotation method. These results cast doubt on the validity of the assumption. This knowledge should be kept in mind when this method is applied to construct multilayer structures.

  11. Improved curveball hitting through the enhancement of visual cues.

    PubMed Central

    Osborne, K; Rudrud, E; Zezoney, F

    1990-01-01

    This study investigated the effectiveness of using visual cues to highlight the seams of baseballs to improve the hitting of curveballs. Five undergraduate varsity baseball team candidates served as subjects. Behavior change was assessed through an alternating treatments design involving unmarked balls and two treatment conditions that included baseballs with 1/4-in. and 1/8-in. orange stripes marking the seams of the baseballs. Results indicated that subjects hit a greater percentage of marked than unmarked balls. These results suggest that the addition of visual cues may be a significant and beneficial technique to enhance hitting performance. Further research is suggested regarding the training procedures, effect of feedback, rate of fading cues, generalization to live pitching, and generalization to other types of pitches. PMID:2249972

  12. MSHAM: a multi-hit sample and hold multiplexer

    SciTech Connect

    Bernstein, D.

    1980-10-01

    The MSHAM is a single-width CAMAC module intended to be used for dE/dx or Z-position measurements, with a density of 16 analog channels. It is designed to record up to four hits/event per channel but the design can be easily adapted to eight hits. The charge collection time interval allowed per hit is externally controlled in the range of 50 to 500 ns, according to the requirements of the experiment. Besides the electrical performance of the MSHAM, i.e., linearity, noise, cross-talk, etc., the goal was to design mutli-function circuits and high density packaging in order to achieve low cost per channel.

  13. Improved curveball hitting through the enhancement of visual cues.

    PubMed

    Osborne, K; Rudrud, E; Zezoney, F

    1990-01-01

    This study investigated the effectiveness of using visual cues to highlight the seams of baseballs to improve the hitting of curveballs. Five undergraduate varsity baseball team candidates served as subjects. Behavior change was assessed through an alternating treatments design involving unmarked balls and two treatment conditions that included baseballs with 1/4-in. and 1/8-in. orange stripes marking the seams of the baseballs. Results indicated that subjects hit a greater percentage of marked than unmarked balls. These results suggest that the addition of visual cues may be a significant and beneficial technique to enhance hitting performance. Further research is suggested regarding the training procedures, effect of feedback, rate of fading cues, generalization to live pitching, and generalization to other types of pitches.

  14. Estimating residual fault hitting rates by recapture sampling

    NASA Technical Reports Server (NTRS)

    Lee, Larry; Gupta, Rajan

    1988-01-01

    For the recapture debugging design introduced by Nayak (1988) the problem of estimating the hitting rates of the faults remaining in the system is considered. In the context of a conditional likelihood, moment estimators are derived and are shown to be asymptotically normal and fully efficient. Fixed sample properties of the moment estimators are compared, through simulation, with those of the conditional maximum likelihood estimators. Properties of the conditional model are investigated such as the asymptotic distribution of linear functions of the fault hitting frequencies and a representation of the full data vector in terms of a sequence of independent random vectors. It is assumed that the residual hitting rates follow a log linear rate model and that the testing process is truncated when the gaps between the detection of new errors exceed a fixed amount of time.

  15. The ray trace method on studying double-cladding optical fiber

    NASA Astrophysics Data System (ADS)

    Wei, Yan; Fei, Yuemu

    2005-01-01

    In this paper, the pump absorption efficiency and the optimum length of DCOFs with several kinds of inner cladding shapes have been studied through the ray trace method. The DCOFs with circular, rectangular, triangular, hexagonal inner cladding have been studied in this paper. Expect for the DCOF with circular inner cladding. The maximum pump absorption efficiency of the DCOFs above exceed 0.9. It is found that the triangle shape has the highest absorption and there is only little difference among the polygon DCOF. The ray trace method is a more simple and quick method and it is competent for DCOFs with more kinds of inner cladding.

  16. Layered double hydroxide/polyethylene terephthalate nanocomposites. Influence of the intercalated LDH anion and the type of polymerization heating method

    SciTech Connect

    Herrero, M.; Martinez-Gallegos, S.; Labajos, F.M.; Rives, V.

    2011-11-15

    Conventional and microwave heating routes have been used to prepare PET-LDH (polyethylene terephthalate-layered double hydroxide) composites with 1-10 wt% LDH by in situ polymerization. To enhance the compatibility between PET and the LDH, terephthalate or dodecyl sulphate had been previously intercalated in the LDH. PXRD and TEM were used to detect the degree of dispersion of the filler and the type of the polymeric composites obtained, and FTIR spectroscopy confirmed that the polymerization process had taken place. The thermal stability of these composites, as studied by thermogravimetric analysis, was enhanced when the microwave heating method was applied. Dodecyl sulphate was more effective than terephthalate to exfoliate the samples, which only occurred for the terephthalate ones under microwave irradiation. - Graphical abstract: Conventional and microwave heating routes were used to prepare PET-LDH (polyethylene terephthalate-layered double hydroxide) composites with 1-10 wt% LDH by in situ polymerization. To enhance the compatibility between PET and the LDH, terephthalate or dodecyl sulphate was previously intercalated into the LDH. The microwave process improves the dispersion and the thermal stability of nanocomposites due to the interaction of the microwave radiation and the dipolar properties of EG and the homogeneous heating. Highlights: > LDH-PET compatibility is enhanced by preintercalation of organic anions. > Dodecylsulphate performance is much better than that of terephthalate. > Microwave heating improves the thermal stability of the composites. > Microwave heating improves as well the dispersion of the inorganic phase.

  17. Rapid recovery of polycrystalline silicon from kerf loss slurry using double-layer organic solvent sedimentation method

    NASA Astrophysics Data System (ADS)

    Xing, Peng-fei; Guo, Jing; Zhuang, Yan-xin; Li, Feng; Tu, Gan-feng

    2013-10-01

    The rapid development of photovoltaic (PV) industries has led to a shortage of silicon feedstock. However, more than 40% silicon goes into slurry wastes due to the kerf loss in the wafer slicing process. To effectively recycle polycrystalline silicon from the kerf loss slurry, an innovative double-layer organic solvent sedimentation process was presented in the paper. The sedimentation velocities of Si and SiC particles in some organic solvents were investigated. Considering the polarity, viscosity, and density of solvents, the chloroepoxy propane and carbon tetrachloride were selected to separate Si and SiC particles. It is found that Si and SiC particles in the slurry waste can be successfully separated by the double-layer organic solvent sedimentation method, which can greatly reduce the sedimentation time and improve the purity of obtained Si-rich and SiC-rich powders. The obtained Si-rich powders consist of 95.04% Si, and the cast Si ingot has 99.06% Si.

  18. Variation in number of hits for complex searches in Google Scholar

    PubMed Central

    Bramer, Wichor Matthijs

    2016-01-01

    Objective Google Scholar is often used to search for medical literature. Numbers of results reported by Google Scholar outperform the numbers reported by traditional databases. How reliable are these numbers? Why are often not all available 1,000 references shown? Methods For several complex search strategies used in systematic review projects, the number of citations and the total number of versions were calculated. Several search strategies were followed over a two-year period, registering fluctuations in reported search results. Results Changes in numbers of reported search results varied enormously between search strategies and dates. Theories for calculations of the reported and shown number of hits were not proved. Conclusions The number of hits reported in Google Scholar is an unreliable measure. Therefore, its repeatability is problematic, at least when equal results are needed. PMID:27076802

  19. Sleeping beauties in psychology: comparisons of "hits" and "missed signals" in psychological journals.

    PubMed

    Lange, Lydia L

    2005-05-01

    Scientific publications tend to be forgotten quickly. A few works, however, are still cited 100 years and more after their publication. The author used bibliometric methods to compare "hits" (works noticed by the scientific community soon after their publication) with "missed signals" (works that went unnoticed until much later) by investigating 2 psychological journals founded in the 1890s: Zeitschrift für Psychologie and Psychological Review. All articles that were published in either of these journals up to 1920 and cited more than 25 times in the Web of Science up to the year 2000 were considered for inclusion in the analysis. It emerged that hits corresponded more closely to the focus of scientific attention at the time of the publications than missed signals.

  20. Interval Throwing and Hitting Programs in Baseball: Biomechanics and Rehabilitation.

    PubMed

    Chang, Edward S; Bishop, Meghan E; Baker, Dylan; West, Robin V

    2016-01-01

    Baseball injuries from throwing and hitting generally occur as a consequence of the repetitive and high-energy motions inherent to the sport. Biomechanical studies have contributed to understanding the pathomechanics leading to injury and to the development of rehabilitation programs. Interval-based throwing and hitting programs are designed to return an athlete to competition through a gradual progression of sport-specific exercises. Proper warm-up and strict adherence to the program allows the athlete to return as quickly and safely as possible.

  1. One-hit models for virus inactivation studies.

    PubMed

    Kundi, M

    1999-04-01

    All biologicals whose production involves materials of human or animal origin are at risk of viral contamination. Testing the capacity of the production processes to remove or inactivate viruses is an essential step in establishing the safety of biological products. The one-hit model which is essentially based on the assumption that the assay will show a positive reaction if and only if there is at least one infectious particle in a small sample drawn from the material, is often used as a basis for the estimation of the number of infectious particles per unit volume, or equivalently, to estimate the ID50 (the dose which results in 50% positive reactions). Due to the availability of computers it is no longer necessary to use inadequate and biased methods like Spearman-Kärber to estimate the ID50. Depending on the details of the experiment the average bias of Spearman Karber ID50 estimates is 10-30%. Maximum likelihood estimation procedures of the parameters, the computation of ID50, reduction factors, and their confidence limits are presented. Furthermore, hints for the design of the experiments are given. The incorporation of kinetics models is also discussed. Although the method represents the state of the art in the biostatistical literature, the problem of random variations of doses has not been addressed appropriately. Based on 36 000 simulated experiments it is shown that the parameters of the model are robust with respect to random variation of doses. Designs using 10-fold dilution series, however, are generally less appropriate and also more affected by dose variability.

  2. A PCR-Based Method to Construct Lentiviral Vector Expressing Double Tough Decoy for miRNA Inhibition

    PubMed Central

    Luo, Lan; Liu, Nian; Kang, Kang; Qu, Junle; Peng, Wenda; Gou, Deming

    2015-01-01

    DNA vector-encoded Tough Decoy (TuD) miRNA inhibitor is attracting increased attention due to its high efficiency in miRNA suppression. The current methods used to construct TuD vectors are based on synthesizing long oligonucleotides (~90 mer), which have been costly and problematic because of mutations during synthesis. In this study, we report a PCR-based method for the generation of double Tough Decoy (dTuD) vector in which only two sets of shorter oligonucleotides (< 60 mer) were used. Different approaches were employed to test the inhibitory potency of dTuDs. We demonstrated that dTuD is the most efficient method in miRNA inhibition in vitro and in vivo. Using this method, a mini dTuD library against 88 human miRNAs was constructed and used for a high-throughput screening (HTS) of AP-1 pathway-related miRNAs. Seven miRNAs (miR-18b-5p, -101-3p, -148b-3p, -130b-3p, -186-3p, -187-3p and -1324) were identified as candidates involved in AP-1 pathway regulation. This novel method allows for an accurate and cost-effective generation of dTuD miRNA inhibitor, providing a powerful tool for efficient miRNA suppression in vitro and in vivo. PMID:26624995

  3. A modified fluorimetric neutral filter elution method for analyzing radiation-induced double strand break and repair.

    PubMed

    Goutham, Venkatesh H; Kamalesh, Mumbrekar D; Guruprasad, Parashiva K; Vadhiraja, Manjunath B; Satyamoorthy, Kapaettu; Rao Bola Satish, Sadashiva

    2011-07-15

    Neutral filter elution assay is one of the methods used for detection of DNA double strand breaks (DSBs). However, it is laborious, expensive, and hazardous (radiolabeled precursors for DSB detection and scintillation counter for quantification), making it a less preferred method for DSB detection. In the present study, an attempt was made to improve the existing neutral filter elution assay by making use of fluorescent dye (PicoGreen) and microfiltration assembly for eluting the fragmented DNA, thereby reducing the cost and time required for the assay. We studied the effect of dye dilution, pH conditions, and cell number as a part of method standardization. X-ray dose-response and repair kinetics in lymphocytes as well as cell lines were studied for validating the sensitivity of the assay. A linear dose-response relationship for DSBs was observed at a cell number of 4×10(5)cells, a dye dilution of 500-fold, and at pH 10. Repair kinetics revealed a time-dependent repair of DSBs up to 360 min of posttreatment, indicating its usefulness in DSB repair studies. In conclusion, the present modified method is more efficient (in terms of cell number), cost effective, less time-consuming, and less hazardous compared to the existing method. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. A method for polycrystalline silicon delineation applicable to a double-diffused MOS transistor

    NASA Technical Reports Server (NTRS)

    Halsor, J. L.; Lin, H. C.

    1974-01-01

    Method is simple and eliminates requirement for unreliable special etchants. Structure is graded in resistivity to prevent punch-through and has very narrow channel length to increase frequency response. Contacts are on top to permit planar integrated circuit structure. Polycrystalline shield will prevent creation of inversion layer in isolated region.

  5. Osteosynthesis with Rush's double nail by the "Eiffel Tower" method in pseudarthrosis impacted in good position and retarded union.

    PubMed

    Zinghi, G F; Lanfranchi, R

    1980-04-01

    The "Eiffel Tower" method of nailing has not attracted the interest in Italy that it deserves, both because its utilisaton in fractures is difficult when closed reduction of the fragments is difficult, and because the attention of surgeons has been progressively directed towards osteosynthesis by open reduction. Our experience over many years, however, has convinced us that, in the diaphysis, only the intramedullary nail can provide the quick recovery that is not always forthcoming in the case of plating. We need only think of comminuted fractures, where the possible necrosis of one or more fragments demands a certain amount of prudence in allowing direct weight bearing. Therefore, in adopting the double Rush system, we extended its application to the intramedullary osteosynthesis of metaphyseal fractures. It was a short step from this to the surgical treatment of pseudarthrosis impacted in good position or retarded union, the results of which were encouraging, as demonstrated by the eighty-one cases reported in this paper.

  6. Sorting of Double-Walled Carbon Nanotubes According to Their Outer Wall Electronic Type via a Gel Permeation Method.

    PubMed

    Moore, Katherine E; Pfohl, Moritz; Tune, Daniel D; Hennrich, Frank; Dehm, Simone; Chakradhanula, Venkata Sai K; Kübel, Christian; Krupke, Ralph; Flavel, Benjamin S

    2015-04-28

    In this work, we demonstrate the application of the gel permeation technique to the sorting of double-walled carbon nanotubes (DWCNTs) according to their outer wall electronic type. Our method uses Sephacryl S-200 gel and yields sorted fractions of DWCNTs with impurities removed and highly enriched in nanotubes with either metallic (M) or semiconducting (S) outer walls. The prepared fractions are fully characterized using optical absorption spectroscopy, transmission electron microscopy, and atomic force microscopy, and the entire procedure is monitored in real time using process Raman analysis. The sorted DWCNTs are then integrated into single nanotube field effect transistors, allowing detailed electronic measurement of the transconductance properties of the four unique inner@outer wall combinations of S@S, S@M, M@S, and M@M.

  7. Hyaluronic acid as an internal phase additive to obtain ofloxacin/PLGA microsphere by double emulsion method.

    PubMed

    Wu, Gang; Chen, Long; Li, Hong; Wang, Ying-jun

    2014-01-01

    Hyaluronic acid (HA) was used as an internal phase additive to improve the loading efficiency of ofloxacin, a hydrophilic drug encapsulated by hydrophobic polylactic-co-glycolic acid (PLGA) materials, through a double emulsion (water-in-oil-in-water) solvent extraction/evaporation method. Results from laser distribution analysis show that polyelectrolyte additives have low impact on the average particle size and distribution of the microspheres. The negatively charged HA increases the drug loading efficiency as well as the amount of HA in microspheres. Burst release can be observed in the groups with the polyelectrolyte additives. The release rate decreases with the amount of HA inside the microspheres in all negatively charged polyelectrolyte-added microsphere groups.

  8. A Two-Step Double Filter Method to Extract Open Water Surfaces from Landsat ETM+ Imagery

    NASA Astrophysics Data System (ADS)

    Wang, Haijing; Kinzelbach, Wolfgang

    2010-05-01

    In arid and semi-arid areas, lakes and temporal ponds play a significant role in agriculture and livelihood of local communities as well as in ecology. Monitoring the changes of these open water bodies allows to draw conclusions on water use as well as climatic impacts and can assist in the formulation of a sustainable resource management strategy. The simultaneous monitoring of larger numbers of water bodies with respect to their stage and area is feasible with the aid of remote sensing. Here the monitoring of lake surface areas is discussed. Landsat TM and ETM+ images provide a medium resolution of 30m, and offer an easily available data source to monitor the long term changes of water surfaces in arid and semi-arid regions. In the past great effort was put into developing simple indices to extract water surfaces from satellite images. However, there is a common problem in achieving accurate results with these indices: How to select a threshold value for water pixels without introducing excessive subjective judgment. The threshold value would also have to vary with location, land features and seasons, allowing for inherent uncertainty. A new method was developed using Landsat ETM+ imaginary (30 meter resolution) to extract open water surfaces. This method uses the Normalized Difference of Vegetation Index (NDVI) as the basis for an objective way of selecting threshold values of Modified Normalized Difference of Water Index (MNDWI) and Stress Degree Days (SDD), which were used as a combined filter to extract open water surfaces. We choose two study areas to verify the method. One study area is in Northeast China, where bigger lakes, smaller muddy ponds and wetlands are interspersed with agricultural land and salt crusts. The other one is Kafue Flats in Zambia, where seasonal floods of the Zambezi River create seasonal wetlands in addition to the more permanent water ponds and river channels. For both sites digital globe images of 0.5 meter resolution are available

  9. 2D double interaction method for modeling small particles contaminating microstructures located on substrates

    NASA Astrophysics Data System (ADS)

    Albella, P.; Moreno, F.; Saiz, J. M.; González, F.

    2007-07-01

    An interaction model developed in previous research [de la Peña JL, González F, Saiz JM, Moreno F, Valle PJ. Sizing particles on substrates. A general method for oblique incidence. J Appl Phys 1999; 85:432] is extended to the study of two-scaled systems consisting of particles located on larger structures. Far-field scattering patterns produced by these systems can be obtained by coherent addition of different electromagnetic contributions, each one obtained from an independent isolated particle calculation. Results are performed on a 2D scheme, where they can be easily compared with those given by an exact method. This analysis shows some features of the scattering patterns that can be obtained with high reliability. Research on this kind of systems can be applied to 3D situations like particle substrate contamination and particle particle contamination.

  10. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    DOEpatents

    Gray, Joe W.; Pinkel, Daniel

    1991-01-01

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. Probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations.

  11. Double sweep preconditioner for optimized Schwarz methods applied to the Helmholtz problem

    SciTech Connect

    Vion, A. Geuzaine, C.

    2014-06-01

    This paper presents a preconditioner for non-overlapping Schwarz methods applied to the Helmholtz problem. Starting from a simple analytic example, we show how such a preconditioner can be designed by approximating the inverse of the iteration operator for a layered partitioning of the domain. The preconditioner works by propagating information globally by concurrently sweeping in both directions over the subdomains, and can be interpreted as a coarse grid for the domain decomposition method. The resulting algorithm is shown to converge very fast, independently of the number of subdomains and frequency. The preconditioner has the advantage that, like the original Schwarz algorithm, it can be implemented as a matrix-free routine, with no additional preprocessing.

  12. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    DOEpatents

    Gray, J.W.; Pinkel, D.

    1991-07-02

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  13. An efficient method to determine double Gaussian fluence parameters in the eclipse™ proton pencil beam model.

    PubMed

    Shen, Jiajian; Liu, Wei; Stoker, Joshua; Ding, Xiaoning; Anand, Aman; Hu, Yanle; Herman, Michael G; Bues, Martin

    2016-12-01

    To find an efficient method to configure the proton fluence for a commercial proton pencil beam scanning (PBS) treatment planning system (TPS). An in-water dose kernel was developed to mimic the dose kernel of the pencil beam convolution superposition algorithm, which is part of the commercial proton beam therapy planning software, eclipse™ (Varian Medical Systems, Palo Alto, CA). The field size factor (FSF) was calculated based on the spot profile reconstructed by the in-house dose kernel. The workflow of using FSFs to find the desirable proton fluence is presented. The in-house derived spot profile and FSF were validated by a direct comparison with those calculated by the eclipse TPS. The validation included 420 comparisons of the FSFs from 14 proton energies, various field sizes from 2 to 20 cm and various depths from 20% to 80% of proton range. The relative in-water lateral profiles between the in-house calculation and the eclipse TPS agree very well even at the level of 10(-4). The FSFs between the in-house calculation and the eclipse TPS also agree well. The maximum deviation is within 0.5%, and the standard deviation is less than 0.1%. The authors' method significantly reduced the time to find the desirable proton fluences of the clinical energies. The method is extensively validated and can be applied to any proton centers using PBS and the eclipse TPS.

  14. Double-layer clustering method to predict protein complexes based on power-law distribution and protein sublocalization.

    PubMed

    Peng, Xiaoqing; Wang, Jianxin; Huan, Jun; Wu, Fang-Xiang

    2016-04-21

    Identifying protein complexes from Protein-protein Interaction Networks (PINs) is fundamental for understanding protein functions and activities in cell. Based on the assumption that protein complexes are highly connected areas in PINs, many algorithms were proposed to identify protein complexes from PINs. However, most of these approaches neglected that not all proteins in complexes are highly connected, and proteins in PINs with different topological properties may form protein complexes in different ways and should be treated differently. In this paper, we proposed a double-layer clustering method based on the power-law distribution (PLCluster). To calculate the centrality scores of nodes, we proposed a Dense-Spread Centrality method. The centrality scores calculated by Dense-Spread Centrality method follow a power-law distribution. Based on the power-law distribution of the centrality scores, PLCluster divides the nodes into two categories: the nodes with very high centrality scores and the nodes with lower centrality scores. Then different strategies are applied to nodes in different categories for detecting protein complexes from the PIN, respectively. Furthermore, the predicted protein complexes, which are inconsistent with the fact that all proteins in a protein complex should be in the same subcellular compartment, are filtered out. Compared with other nine existing methods on a high reliable yeast PIN, PLCluster shows great advantages in terms of the number of known complexes that are identified, Sensitivity, Specificity, f-measure and the number of perfect matches. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Estimation of the effective phase function of bulk diffusing materials with the inverse adding-doubling method.

    PubMed

    Leyre, Sven; Meuret, Youri; Durinck, Guy; Hofkens, Johan; Deconinck, Geert; Hanselaer, Peter

    2014-04-01

    The accuracy of optical simulations including bulk diffusors is heavily dependent on the accuracy of the bulk scattering properties. If no knowledge on the physical scattering effects is available, an iterative procedure is usually used to obtain the scattering properties, such as the inverse Monte Carlo method or the inverse adding-doubling (AD) method. In these methods, a predefined phase function with one free parameter is usually used to limit the number of free parameters. In this work, three predefined phase functions (Henyey-Greenstein, two-term Henyey-Greenstein, and Gegenbauer kernel (GK) phase function) are implemented in the inverse AD method to determine the optical properties of two strongly diffusing materials: low-density polyethylene and TiO₂ particles. Using the presented approach, an estimation of the effective phase function was made. It was found that the use of the GK phase function resulted in the best agreement between calculated and experimental transmittance, reflectance, and scattered radiant intensity distribution for the LDPE sample. For the TiO₂ sample, a good agreement was obtained with both the two-term Henyey-Greenstein and the GK phase function.

  16. Dealing with Hitting and Aggression in the Classroom.

    ERIC Educational Resources Information Center

    Saifer, Steffen

    1996-01-01

    Notes that while hitting-aggressive behavior is probably the greatest single behavior concern of teachers, children can be taught appropriate behavior for the classroom. Offers tips for dealing with: roughhousing; existing problems; grabbing toys; and war games, guns, or violent play. Suggests allowing children the choice of an alternative…

  17. Appreciating an Old Favorite: Sousa's All-Time Hit

    ERIC Educational Resources Information Center

    Van Outryve, Karen

    2006-01-01

    In this article, the author presents John Philip Sousa's all time hit, "The Stars and Stripes Forever". It is one of the most recognizable pieces of American music. Wherever John Philip Sousa and his band appeared, this march was likely to be played. According to American poet and educator Eli Siegel (1902-78), who first articulated the…

  18. Coordination of hitting movement revealed in baseball tee-batting.

    PubMed

    Katsumata, Hiromu; Himi, Keita; Ino, Tenpei; Ogawa, Kyohei; Matsumoto, Takehiro

    2017-12-01

    Baseball batters must react to pitches delivered to different locations within the strike zone by modulating their movements. In tee-batting practice, such batters place a ball on a tee stand at a location, where they intend to hit the ball, assuming a particular pitch's trajectory. In the present study, we analysed three-dimensional movements in tee-batting to identify characteristics of the batters' intended impact locations across the strike zone, thereby investigating spatiotemporal features of movement modulation. More specifically, 10 experienced baseball batters performed tee-batting at their preferred impact locations at nine different heights and courses within the strike zone. The distribution of impact locations showed regularity, i.e., the location shifted forward for balls placed high and inside, while it shifted backward for balls placed low and outside. Furthermore, trunk and arm movements showed systematic modulation as the impact locations changed. The duration of bat movement was also location dependent, i.e., hitting the inside ball took more time than hitting the outside ball. Our results indicate that even though movements among body segments were properly coordinated to adjust the bat swing for different impact locations, fine timing adjustments were also required to hit the ball at those preferred impact locations and therefore properly react to differences in flight paths.

  19. Appreciating an Old Favorite: Sousa's All-Time Hit

    ERIC Educational Resources Information Center

    Van Outryve, Karen

    2006-01-01

    In this article, the author presents John Philip Sousa's all time hit, "The Stars and Stripes Forever". It is one of the most recognizable pieces of American music. Wherever John Philip Sousa and his band appeared, this march was likely to be played. According to American poet and educator Eli Siegel (1902-78), who first articulated the…

  20. Madoff Debacle Hits Colleges and Raises Questions about Trustee Conflicts

    ERIC Educational Resources Information Center

    Fain, Paul

    2009-01-01

    Several colleges and universities lost millions in the alleged $50-billion Ponzi scheme run by the Wall Street trader Bernard L. Madoff. The losses include institutions' endowment holdings in hedge funds that were invested with Madoff as well as hits taken by supporting foundations and donors. Several foundations that have been active in higher…

  1. 42 CFR 495.342 - Annual HIT IAPD requirements.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... (CONTINUED) STANDARDS AND CERTIFICATION STANDARDS FOR THE ELECTRONIC HEALTH RECORD TECHNOLOGY INCENTIVE...: (a) A reference to the approved HIT PAPD/IAPD and all approved changes. (b) A project activity status which reports the status of the past year's major project tasks and milestones, addressing the degree of...

  2. Novel measurement method of heat and light detection for neutrinoless double beta decay

    NASA Astrophysics Data System (ADS)

    Kim, G. B.; Choi, J. H.; Jo, H. S.; Kang, C. S.; Kim, H. L.; Kim, I.; Kim, S. R.; Kim, Y. H.; Lee, C.; Lee, H. J.; Lee, M. K.; Li, J.; Oh, S. Y.; So, J. H.

    2017-05-01

    We developed a cryogenic phonon-scintillation detector to search for 0νββ decay of 100Mo. The detector module, a proto-type setup of the AMoRE experiment, has a scintillating 40Ca100MoO4 absorber composed of 100Mo-enriched and 48Ca-depleted elements. This new detection method employs metallic magnetic calorimeters (MMCs) as the sensor technology for simultaneous detection of heat and light signals. It is designed to have high energy and timing resolutions to increase sensitivity to probe the rare event. The detector, which is composed of a 200 g 40Ca100MoO4 crystal and phonon/photon sensors, showed an energy resolution of 8.7 keV FWHM at 2.6 MeV, with a weak temperature dependence in the range of 10-40 mK. Using rise-time and mean-time parameters and light/heat ratios, the proposed method showed a strong capability of rejecting alpha-induced events from electron events with as good as 20σ separation. Moreover, we discussed how the signal rise-time improves the rejection efficiency for random coincidence signals.

  3. Protein-Protein Interaction Inhibition (2P2I)-Oriented Chemical Library Accelerates Hit Discovery.

    PubMed

    Milhas, Sabine; Raux, Brigitt; Betzi, Stéphane; Derviaux, Carine; Roche, Philippe; Restouin, Audrey; Basse, Marie-Jeanne; Rebuffet, Etienne; Lugari, Adrien; Badol, Marion; Kashyap, Rudra; Lissitzky, Jean-Claude; Eydoux, Cécilia; Hamon, Véronique; Gourdel, Marie-Edith; Combes, Sébastien; Zimmermann, Pascale; Aurrand-Lions, Michel; Roux, Thomas; Rogers, Catherine; Müller, Susanne; Knapp, Stefan; Trinquet, Eric; Collette, Yves; Guillemot, Jean-Claude; Morelli, Xavier

    2016-08-19

    Protein-protein interactions (PPIs) represent an enormous source of opportunity for therapeutic intervention. We and others have recently pinpointed key rules that will help in identifying the next generation of innovative drugs to tackle this challenging class of targets within the next decade. We used these rules to design an oriented chemical library corresponding to a set of diverse "PPI-like" modulators with cores identified as privileged structures in therapeutics. In this work, we purchased the resulting 1664 structurally diverse compounds and evaluated them on a series of representative protein-protein interfaces with distinct "druggability" potential using homogeneous time-resolved fluorescence (HTRF) technology. For certain PPI classes, analysis of the hit rates revealed up to 100 enrichment factors compared with nonoriented chemical libraries. This observation correlates with the predicted "druggability" of the targets. A specific focus on selectivity profiles, the three-dimensional (3D) molecular modes of action resolved by X-ray crystallography, and the biological activities of identified hits targeting the well-defined "druggable" bromodomains of the bromo and extraterminal (BET) family are presented as a proof-of-concept. Overall, our present study illustrates the potency of machine learning-based oriented chemical libraries to accelerate the identification of hits targeting PPIs. A generalization of this method to a larger set of compounds will accelerate the discovery of original and potent probes for this challenging class of targets.

  4. Engineering and Design of the Steady Inductive Helicity Injected Torus (HIT--SI)

    NASA Astrophysics Data System (ADS)

    Sieck, P. E.; Jarboe, T. R.; Nelson, B. A.; Rogers, J. A.; Shumlak, U.

    1999-11-01

    HIT/SIHI/>Steady Inductive Helicity Injection (SIHI) is an inductive helicity injection method that injects helicity at a nearly constant rate, without open field lines, and without removing any helicity or magnetic energy from the plasma.(T.R. Jarboe, Fusion Technology, 36) (1), p. 85, 1999 SIHI directly produces a rotating magnetic field structure, and in the frame of the rotating field the current profile is nearly time independent. The Steady Inductive Helicity Injected Torus (HIT--SI) is a spheromak designed to implement SIHI so that the current profile in the rotating frame is optimized. The geometry of HIT--SI will be presented, including the manufacturing techniques and metallurgical processes planned for construction of the close-fitting flux conserver. The flux conserver is made of aged chromium copper with 80% the conductivity of pure copper. The detailed electrical insulation requirements in the helicity injector design lead to a complex o-ring seal and a plasma-sprayed alumina insulation coating. This has prompted the construction of an o-ring prototype test fixture having the main features of the o-ring design and the alumina coating. The design and evaluation of this fixture will also be presented with vacuum and voltage test results.

  5. HitWalker2: visual analytics for precision medicine and beyond.

    PubMed

    Bottomly, Daniel; McWeeney, Shannon K; Wilmot, Beth

    2016-04-15

    The lack of visualization frameworks to guide interpretation and facilitate discovery is a potential bottleneck for precision medicine, systems genetics and other studies. To address this we have developed an interactive, reproducible, web-based prioritization approach that builds on our earlier work. HitWalker2 is highly flexible and can utilize many data types and prioritization methods based upon available data and desired questions, allowing it to be utilized in a diverse range of studies such as cancer, infectious disease and psychiatric disorders. Source code is freely available at https://github.com/biodev/HitWalker2 and implemented using Python/Django, Neo4j and Javascript (D3.js and jQuery). We support major open source browsers (e.g. Firefox and Chromium/Chrome). wilmotb@ohsu.edu Supplementary data are available at Bioinformatics online. Additional information/instructions are available at https://github.com/biodev/HitWalker2/wiki. © The Author 2015. Published by Oxford University Press.

  6. Hit Identification and Optimization in Virtual Screening: Practical Recommendations Based Upon a Critical Literature Analysis

    PubMed Central

    Zhu, Tian; Cao, Shuyi; Su, Pin-Chih; Patel, Ram; Shah, Darshan; Chokshi, Heta B.; Szukala, Richard; Johnson, Michael E.; Hevener, Kirk E.

    2013-01-01

    A critical analysis of virtual screening results published between 2007 and 2011 was performed. The activity of reported hit compounds from over 400 studies was compared to their hit identification criteria. Hit rates and ligand efficiencies were calculated to assist in these analyses and the results were compared with factors such as the size of the virtual library and the number of compounds tested. A series of promiscuity, drug-like, and ADMET filters were applied to the reported hits to assess the quality of compounds reported and a careful analysis of a subset of the studies which presented hit optimization was performed. This data allowed us to make several practical recommendations with respect to selection of compounds for experimental testing, defining hit identification criteria, and general virtual screening hit criteria to allow for realistic hit optimization. A key recommendation is the use of size-targeted ligand efficiency values as hit identification criteria. PMID:23688234

  7. Hit identification and optimization in virtual screening: practical recommendations based on a critical literature analysis.

    PubMed

    Zhu, Tian; Cao, Shuyi; Su, Pin-Chih; Patel, Ram; Shah, Darshan; Chokshi, Heta B; Szukala, Richard; Johnson, Michael E; Hevener, Kirk E

    2013-09-12

    A critical analysis of virtual screening results published between 2007 and 2011 was performed. The activity of reported hit compounds from over 400 studies was compared to their hit identification criteria. Hit rates and ligand efficiencies were calculated to assist in these analyses, and the results were compared with factors such as the size of the virtual library and the number of compounds tested. A series of promiscuity, druglike, and ADMET filters were applied to the reported hits to assess the quality of compounds reported, and a careful analysis of a subset of the studies that presented hit optimization was performed. These data allowed us to make several practical recommendations with respect to selection of compounds for experimental testing, definition of hit identification criteria, and general virtual screening hit criteria to allow for realistic hit optimization. A key recommendation is the use of size-targeted ligand efficiency values as hit identification criteria.

  8. Drift chamber electronics with multi-hit capability for time and current division measurements

    NASA Astrophysics Data System (ADS)

    Manarin, A.; Pregernig, L.; Rabany, M.; Saban, R.; Vismara, G.

    1983-11-01

    Drift chambers have been installed for luminosity measurements in intersection 5 of the SPS accelerator working in p overlinep colliding mode. The required electronics is described. The system is able to process up to 16 hits per wire with a double pulse resolution of 40 ns; drift time and current division, with 1.25 ns and 1.6% resolution respectively, are recorded. Transconductance preamplifiers and discriminators are directly mounted on the chamber; 160 m of twisted-pair cable bring the signals to the digitizer unit. Coarse time is measured using RAM techniques, while fine time is obtained by means of a microstrip delay associated with a 100 K ECL priority encoder. Current division used a single 50 MHz Flash ADC which allows 26 dB dynamic range with 6 bit resolution. First operational results are reported.

  9. A comparison of age level on baseball hitting kinematics.

    PubMed

    Escamilla, Rafael F; Fleisig, Glenn S; DeRenne, Coop; Taylor, Marcus K; Moorman, Claude T; Imamura, Rodney; Barakatt, Edward; Andrews, James R

    2009-08-01

    We propose that learning proper hitting kinematics should be encouraged at a young age during youth baseball because this may help reinforce proper hitting kinematics as a player progresses to higher levels of baseball in their adult years. To enhance our understanding between youth and adult baseball hitting, kinematic and temporal analyses of baseball hitting were evaluated with a high-speed motion analysis system between 12 skilled youth and 12 skilled adult baseball players. There were only a small number of temporal differences between youth and adult hitters, with adult hitters taking significantly greater time than youth hitters during the stride phase and during the swing. Compared with youth hitters, adult hitters a) had significantly greater (p < .01) lead knee flexion when the hands started to move forward; b) flexed the lead knee over a greater range of motion during the transition phase (31 degrees versus 13 degrees); c) extended the lead knee over a greater range of motion during the bat acceleration phase (59 degrees versus 32 degrees); d) maintained a more open pelvis position at lead foot off ground; and e) maintained a more open upper torso position when the hands started to move forward and a more closed upper torso position at bat-ball contact. Moreover, adult hitters had greater peak upper torso angular velocity (857 degrees/s versus 717 degrees/s), peak left elbow extension angular velocity (752 degrees/s versus 598 degrees/s), peak left knee extension angular velocity (386 degrees/s versus 303 degrees/s), and bat linear velocity at bat-ball contact (30 m/s versus 25 m/s). The numerous differences in kinematic and temporal parameters between youth and adult hitters suggest that hitting mechanics are different between these two groups.

  10. [The Research on Measurement System and Method of Tissue Optical Parameters with Wide Spectra Based on Double-Integrating-Spheres].

    PubMed

    Han, Lei; Li, Chen-xi; Sun, Cheng-tao; Jiang, Jing-ying; Zhao, Hui-juan; Xu, Ke-xin

    2016-02-01

    The measurement of tissue optical parameters is the focusing research content of Biomedical Photonics. The optical properties of human tissue are closely related to the physiological and pathological state. In recent years, the tissue imaging diagnosis and non-invasive detection of componentsbecome the hot research topics, applying the tissue optical properties especially the absorption and scattering properties. These provide the basis for the study of optical imaging and the spectrum detection of body composition etc. The Double-Integrating-Spheres (DIS) method can measure the absorption coefficient, scattering coefficient and so on in vitro tissuesimultaneously. It has the advantages of accurate, rapid, large applicable scope. The method applya standard method for measuring the optical parameters. This paper build the wide spectrum measurement system of optical parameters based on DIS and super continuum lasers. Then we analyze the transfer function, error sources and the best measuring conditions of the system. Finally we establish the correction forward model based on BP-MCML and the inverse algorithm of the optical parameters based on L-M algorithm. The optical parameters of intralipid solution in the wavelength range of 1,100~1,400 nm are measured. The experiment results show that the improved inverse algorithm is accurate. The multiple measurements standard deviation is within 3%. Compared the results of scattering coefficient and absorption coefficient at different wavelengths to the results of other research groups, the deviation is less than 3.4%.

  11. Rapid Method for the Determination of 5-Hydroxymethylfurfural and Levulinic Acid Using a Double-Wavelength UV Spectroscopy

    PubMed Central

    Xue, Guoxin

    2013-01-01

    This study reports on a rapid method for the determination of levulinic acid (LA) and 5-hydroxymethylfurfural (HMF) in acid hydrolyze system of glucose based on UV spectroscopy. It was found that HMF and LA have a maximum absorption at the wavelengths of 284 nm and 266 nm, respectively, in a water medium, and the absorptions of HMF and LA at 284 nm and 266 nm follow Beer's law very well. However, it was found that a major spectral interference species will arise in the quantification of HMF and LA; nonetheless, this interference can be eliminated through the absorption treatment of charcoal. Therefore, both HMF and LA can be quantified with a double-wavelength technique. The repeatability of the method had a relative standard deviation of less than 4.47% for HMF and 2.25% for LA; the limit of quantification (LOQ) was 0.017 mmol/L for HMF and 4.68 mmol/L for LA, and the recovery ranged from 88% to 116% for HMF and from 94% to 105% for LA. The present method is simple, rapid, and accurate. It is suitable to use in the research of the preparation of HMF and LA in biorefinery area. PMID:24228006

  12. Accuracy of effective dose estimation in personal dosimetry: a comparison between single-badge and double-badge methods and the MOSFET method.

    PubMed

    Januzis, Natalie; Belley, Matthew D; Nguyen, Giao; Toncheva, Greta; Lowry, Carolyn; Miller, Michael J; Smith, Tony P; Yoshizumi, Terry T

    2014-05-01

    The purpose of this study was three-fold: (1) to measure the transmission properties of various lead shielding materials, (2) to benchmark the accuracy of commercial film badge readings, and (3) to compare the accuracy of effective dose (ED) conversion factors (CF) of the U.S. Nuclear Regulatory Commission methods to the MOSFET method. The transmission properties of lead aprons and the accuracy of film badges were studied using an ion chamber and monitor. ED was determined using an adult male anthropomorphic phantom that was loaded with 20 diagnostic MOSFET detectors and scanned with a whole body CT protocol at 80, 100, and 120 kVp. One commercial film badge was placed at the collar and one at the waist. Individual organ doses and waist badge readings were corrected for lead apron attenuation. ED was computed using ICRP 103 tissue weighting factors, and ED CFs were calculated by taking the ratio of ED and badge reading. The measured single badge CFs were 0.01 (±14.9%), 0.02 (±9.49%), and 0.04 (±15.7%) for 80, 100, and 120 kVp, respectively. Current regulatory ED CF for the single badge method is 0.3; for the double-badge system, they are 0.04 (collar) and 1.5 (under lead apron at the waist). The double-badge system provides a better coefficient for the collar at 0.04; however, exposure readings under the apron are usually negligible to zero. Based on these findings, the authors recommend the use of ED CF of 0.01 for the single badge system from 80 kVp (effective energy 50.4 keV) data.

  13. Rapid double-dye-layer coating for dye-sensitized solar cells using a new method.

    PubMed

    Jung, Cho-long; Han, Chi-Hwan; Moon, Doo Kyung; Jun, Yongseok

    2014-10-01

    Intensive research with the specific aim of developing inexpensive renewable energy sources is currently being undertaken. In dye-sensitized solar cell (DSSC) production, the most time-consuming process is coating the dye on working electrodes: absorption of ruthenium-based dyes [e.g., N719=bis(trtrabutylammonium)-cis-di(thiocyanato)-N,N'-bis(4-carboxylato-4'-carboxylic acid-2,2'-bipyridine) ruthenium(II)] on a photoanode takes a long time. We report a simple dye-coating method using a mixed solvent of ethylene glycol (EG) and glycerol (Gly). According to our experiments, dye-coating time can be reduced to 5 min from several hours. Maximum performance was obtained with an EG/Gly ratio of 1:1. This mixture of solvents gave a performance of 9.1%. Furthermore, the viscous solvent system could control coating depth; positioning dye coatings to a specific depth was rapid and facile. A cell containing two different dyes (N719+black dye) had an efficiency of 9.4%.

  14. Method and system including a double rotary kiln pyrolysis or gasification of waste material

    DOEpatents

    McIntosh, Michael J.; Arzoumanidis, Gregory G.

    1997-01-01

    A method of destructively distilling an organic material in particulate form wherein the particulates are introduced through an inlet into one end of an inner rotating kiln ganged to and coaxial with an outer rotating kiln. The inner and outer kilns define a cylindrical annular space with the inlet being positioned in registry with the axis of rotation of the ganged kilns. During operation, the temperature of the wall of the inner rotary kiln at the inlet is not less than about 500.degree. C. to heat the particulate material to a temperature in the range of from about 200.degree. C. to about 900.degree. C. in a pyrolyzing atmosphere to reduce the particulate material as it moves from the one end toward the other end. The reduced particulates including char are transferred to the annular space between the inner and the outer rotating kilns near the other end of the inner rotating kiln and moved longitudinally in the annular space from near the other end toward the one end in the presence of oxygen to combust the char at an elevated temperature to produce a waste material including ash. Also, heat is provided which is transferred to the inner kiln. The waste material including ash leaves the outer rotating kiln near the one end and the pyrolysis vapor leaves through the particulate material inlet.

  15. Method and system including a double rotary kiln pyrolysis or gasification of waste material

    DOEpatents

    McIntosh, M.J.; Arzoumanidis, G.G.

    1997-09-02

    A method is described for destructively distilling an organic material in particulate form wherein the particulates are introduced through an inlet into one end of an inner rotating kiln ganged to and coaxial with an outer rotating kiln. The inner and outer kilns define a cylindrical annular space with the inlet being positioned in registry with the axis of rotation of the ganged kilns. During operation, the temperature of the wall of the inner rotary kiln at the inlet is not less than about 500 C to heat the particulate material to a temperature in the range of from about 200 C to about 900 C in a pyrolyzing atmosphere to reduce the particulate material as it moves from the one end toward the other end. The reduced particulates including char are transferred to the annular space between the inner and the outer rotating kilns near the other end of the inner rotating kiln and moved longitudinally in the annular space from near the other end toward the one end in the presence of oxygen to combust the char at an elevated temperature to produce a waste material including ash. Also, heat is provided which is transferred to the inner kiln. The waste material including ash leaves the outer rotating kiln near the one end and the pyrolysis vapor leaves through the particulate material inlet. 5 figs.

  16. A method and system including a double rotary kiln pyrolysis or gasification of waste material

    SciTech Connect

    McIntosh, M.J.; Arzoumanidis, G.G.

    1995-12-31

    A method is described for destructively distilling an organic material in particulate form wherein the particulates are introduced through an inlet into one end of an inner rotating kiln ganged to and coaxial with an outer rotating kiln. The inner and outer kilns define a cylindrical annular space with the inlet being positioned in registry with the axis of rotation of the ganged kilns. During operation, the temperature of the wall of the inner rotary kiln at the inlet is not less than about 500 C to heat the particulate material to a temperature in the range of from about 200 C to about 900 C in a pyrolyzing atmosphere to reduce the particulate material as it moves from the one end toward the other end. The reduced particulates including char are transferred to the annular space between the inner and the outer rotating kilns near the other end of the inner rotating kiln and moved longitudinally in the annular space from near the other end toward the one end in the presence of oxygen to combust the char at an elevated temperature to produce a waste material including ash. Also, heat is provided which is transferred to the inner kiln. The waste material including ash leaves the outer rotating kiln near the one end and the pyrolysis vapor leaves through the particulate material inlet.

  17. Immunohistochemical/histochemical double staining method in the study of the columnar metaplasia of the oesophagus.

    PubMed

    Cabibi, D; Giannone, A G; Mascarella, C; Guarnotta, C; Castiglia, M; Pantuso, G; Fiorentino, E

    2014-03-05

    Intestinal metaplasia in Barrett's oesophagus (BO) represents an important risk factor for oesophageal adenocarcinoma. Instead, few and controversial data are reported about the progression risk of columnar-lined oesophagus without intestinal metaplasia (CLO), posing an issue about its clinical management. The aim was to evaluate if some immunophenotypic changes were present in CLO independently of the presence of the goblet cells. We studied a series of oesophageal biopsies from patients with endoscopic finding of columnar metaplasia, by performing some immunohistochemical stainings (CK7, p53, AuroraA) combined with histochemistry (Alcian-blue and Alcian/PAS), with the aim of simultaneously assess the histochemical features in cells that shows an aberrant expression of such antigens. We evidenced a cytoplasmic expression of CK7 and a nuclear expression of Aurora A and p53,  both in goblet cells of BO and in non-goblet cells of CLO, some of which showing mild dysplasia. These findings suggest that some immunophenotypic changes are present in CLO and they can precede the appearance of the goblet cells or can be present independently of them, confirming the conception of BO as the condition characterized by any extention of columnar epithelium. This is the first study in which a combined immunohistochemical/histochemical method has been applied to Barrett pathology.

  18. Method and system including a double rotary kiln pyrolysis or gasification of waste material

    SciTech Connect

    McIntosh, M.J.; Arzoumanidis, G.G.

    1997-09-02

    A method is described for destructively distilling an organic material in particulate form wherein the particulates are introduced through an inlet into one end of an inner rotating kiln ganged to and coaxial with an outer rotating kiln. The inner and outer kilns define a cylindrical annular space with the inlet being positioned in registry with the axis of rotation of the ganged kilns. During operation, the temperature of the wall of the inner rotary kiln at the inlet is not less than about 500 C to heat the particulate material to a temperature in the range of from about 200 C to about 900 C in a pyrolyzing atmosphere to reduce the particulate material as it moves from the one end toward the other end. The reduced particulates including char are transferred to the annular space between the inner and the outer rotating kilns near the other end of the inner rotating kiln and moved longitudinally in the annular space from near the other end toward the one end in the presence of oxygen to combust the char at an elevated temperature to produce a waste material including ash. Also, heat is provided which is transferred to the inner kiln. The waste material including ash leaves the outer rotating kiln near the one end and the pyrolysis vapor leaves through the particulate material inlet. 5 figs.

  19. Method and apparatus for controlling crossflow in a double collector main coke oven battery

    SciTech Connect

    Bauer, E.G.

    1986-07-08

    A method is described of controlling the crossflow of gases given off by a coal mass during the production of coke in a coke oven having a coke side collector main and a pusher side collector main comprising the steps of: (a) determining the temperature difference between the temperature in the coke side standpipe and the temperature in the pusher side standpipe, (b) determining the temperature difference between the temperature in the freespace adjacent the coke side of the coke oven and the temperature in the freespace adjacent the pusher side of the coke oven, (c) determining the temperature difference between the temperature of the heating wall of the coke oven adjacent the coke side of the coke oven and the temperature of the heating wall of the coke oven adjacent the pusher side of the coke oven, and (d) opening the coke side standpipe control valve and gooseneck damper and the pusher side standpipe control valve and gooseneck damper, if they are not in the open position, if the temperature difference of step (b) is substantially the same as the temperature difference of step (c) and the temperature difference of step (a) is greater than about 50/sup 0/F in order to control crossflow.

  20. Relationships between Parents' Use of Corporal Punishment and Their Children's Endorsement of Spanking and Hitting Other Children

    ERIC Educational Resources Information Center

    Simons, Dominique A.; Wurtele, Sandy K.

    2010-01-01

    Objectives: To explore the intergenerational cycle of violence, the present study examined the relationship between parental approval and children's approval of corporal punishment (CP) and the subsequent relationship between children's CP experience and preference for hitting to resolve interpersonal conflict. Method: Participants consisted of…

  1. Near-optimal alternative generation using modified hit-and-run sampling for non-linear, non-convex problems

    NASA Astrophysics Data System (ADS)

    Rosenberg, D. E.; Alafifi, A.

    2016-12-01

    Water resources systems analysis often focuses on finding optimal solutions. Yet an optimal solution is optimal only for the modelled issues and managers often seek near-optimal alternatives that address un-modelled objectives, preferences, limits, uncertainties, and other issues. Early on, Modelling to Generate Alternatives (MGA) formalized near-optimal as the region comprising the original problem constraints plus a new constraint that allowed performance within a specified tolerance of the optimal objective function value. MGA identified a few maximally-different alternatives from the near-optimal region. Subsequent work applied Markov Chain Monte Carlo (MCMC) sampling to generate a larger number of alternatives that span the near-optimal region of linear problems or select portions for non-linear problems. We extend the MCMC Hit-And-Run method to generate alternatives that span the full extent of the near-optimal region for non-linear, non-convex problems. First, start at a feasible hit point within the near-optimal region, then run a random distance in a random direction to a new hit point. Next, repeat until generating the desired number of alternatives. The key step at each iterate is to run a random distance along the line in the specified direction to a new hit point. If linear equity constraints exist, we construct an orthogonal basis and use a null space transformation to confine hits and runs to a lower-dimensional space. Linear inequity constraints define the convex bounds on the line that runs through the current hit point in the specified direction. We then use slice sampling to identify a new hit point along the line within bounds defined by the non-linear inequity constraints. This technique is computationally efficient compared to prior near-optimal alternative generation techniques such MGA, MCMC Metropolis-Hastings, evolutionary, or firefly algorithms because search at each iteration is confined to the hit line, the algorithm can move in one

  2. A Novel Method for Characterizing Fatigue Delamination Growth Under Mode I Using the Double Cantilever Beam Specimen

    NASA Technical Reports Server (NTRS)

    Carvalho, Nelson; Murri, G.

    2014-01-01

    A novel method is proposed to obtain Mode I delamination growth rate from a Double Cantilever Beam (DCB) specimen. In the proposed method, Unidirectional (UD) DCB specimens are tested in fatigue at different initial maximum energy release rates levels. The growth rate data obtained in the first increments of crack growth at each maximum energy release rate level are used to generate a Paris Law equation, which characterizes delamination growth rate without fiber-bridging, and can also be used to determine a delamination onset curve. The remaining delamination growth rate data from each test are used to determine a modified Paris law, which characterizes the delamination growth rate in a DCB specimen, explicitly accounting for fiber-bridging. The proposed expression captures well the scatter in experimental data obtained using the DCB specimens, suggesting its adequacy. The Paris Law characterizing delamination growth rate without fiber-bridging predicts higher delamination growth rates for the same maximum energy release rate applied, leading to a conservative estimate for delamination growth. This is particularly relevant, since in generic ply interfaces, fiber-bridging is less predominant than in UD DCB specimens. Failing to account for fiber-bridging in UD DCB specimens may underestimate the delamination growth rate, yielding non-conservative predictions.

  3. Electrical properties Sr2FeTiO6 double perovskite material synthesized by sol-gel method

    NASA Astrophysics Data System (ADS)

    Masta, N.; Triyono, D.; Laysandra, H.

    2017-07-01

    The structure and electrical properties of double perovskite Sr2FeTiO6 have been studied. Sr2FeTiO6 were prepared by sol-gel method results in powder form. Then, the powder was pressed and sintered at 1100 °C to form pellet. The structural features of the systems have been studied using X-Ray Diffraction (XRD), Scanning Electron Micrograph (SEM) and Energy Dispersive Spectroscopy (EDS). Through XRD characterization, the structure of the compound is single phase cubic Perovskite (space group Pm3m) with lattice parameter a = 3,899 Å and crystallite size is 26 nm. The electrical properties of the material, as functions of temperature (293 K - 523 K) and frequency (100 Hz - 1 MHz), were examined by Impedance Spectroscopy method using RLC meter. The imaginary of impedance (Zim) data shows the peaks which indicates the presence of relaxation process in this sample. Activation energy for relaxation process which is evaluated by Arrhenius Law indicates the type of charge carrier is p-type polaron.

  4. An improved method for constructing and selectively silanizing double-barreled, neutral liquid-carrier, ion-selective microelectrodes

    PubMed Central

    Deveau, Jason S.T.; Grodzinski, Bernard

    2005-01-01

    We describe an improved, efficient and reliable method for the vapour-phase silanization of multi-barreled, ion-selective microelectrodes of which the silanized barrel(s) are to be filled with neutral liquid ion-exchanger (LIX). The technique employs a metal manifold to exclusively and simultaneously deliver dimethyldichlorosilane to only the ion-selective barrels of several multi-barreled microelectrodes. Compared to previously published methods the technique requires fewer procedural steps, less handling of individual microelectrodes, improved reproducibility of silanization of the selected microelectrode barrels and employs standard borosilicate tubing rather than the less-conventional theta-type glass. The electrodes remain stable for up to 3 weeks after the silanization procedure. The efficacy of a double-barreled electrode containing a proton ionophore in the ion-selective barrel is demonstrated in situ in the leaf apoplasm of pea (Pisum) and sunflower (Helianthus). Individual leaves were penetrated to depth of ~150 μm through the abaxial surface. Microelectrode readings remained stable after multiple impalements without the need for a stabilizing PVC matrix. PMID:16136222

  5. How the method of synthesis governs the local and global structure of zinc aluminum layered double hydroxides

    SciTech Connect

    Pushparaj, Suraj Shiv Charan; Forano, Claude; Prevot, Vanessa; Lipton, Andrew S.; Rees, Gregory; Hanna, John V.; Nielsen, Ulla Gro

    2015-11-10

    A series of zinc aluminum layered double hydroxides (ZnAl LDHs), [Zn1-xAlx (OH)2Ax,nH2O with A = NO3-, Cl- or CO3] were prepared by the urea and co-precipitation synthesis methods, which allowed for a detailed investigation on how synthesis parameters such as pH, metal ion concentration and post synthesis treatment influence the local and global structure of the LDH product. Information about sample composition, purity, defects and other structural aspects of the LDH products were obtained from powder X-ray diffraction, transmission electron microscopy, micro-Raman, and elemental analysis, as well as solid state 1H, 27Al and 67Zn NMR spectroscopy. Our results show that the urea method results in LDHs, which on the global scale are highly crystalline LDHs, whereas solid state NMR shows the different local environments indicating local disorder most likely linked to the presence of Al-rich phases. However, these Alrich phases are not detected by global range techniques, as they either defects within the LDH particles or separate phase(s) associated with LDHs. In contrast, samples prepared by coprecipitation especially synthesized under careful pH control and subsequently hydrothermal treated have high local order and good crystallinity (particle size). Our results show that both molecular level and macroscopic techniques are needed to assess the composition of LDHs, as the conventional PXRD and TEM analysis of LDHs failed to identify the many structural defects and/or amorphous phases.

  6. Reprint of: Development of methods for avian oil toxicity studies using the double crested cormorant (Phalacrocorax auritus).

    PubMed

    Cunningham, Fred; Dean, Karen; Hanson-Dorr, Katie; Harr, Kendal; Healy, Kate; Horak, Katherine; Link, Jane; Shriner, Susan; Bursian, Steven; Dorr, Brian

    2017-05-29

    Oral and external dosing methods replicating field exposure were developed using the double crested cormorant (DCCO) to test the toxicity of artificially weathered Deepwater Horizon Mississippi Canyon 252 oil. The majority of previous oil dosing studies conducted on wild-caught birds used gavage methods to dose birds with oil and determine toxicity. However, rapid gut transit time of gavaged oil likely reduces oil absorption. In the present studies, dosing relied on injection of oil into live feeder fish for oral dosing of these piscivorous birds, or applying oil to body contour feathers resulting in transdermal oil exposure and oral exposure through preening. Both oral and external oil dosing studies identified oil-related toxicity endpoints associated with oxidative stress such as hemolytic anemia, liver and kidney damage, and immuno-modulation or compromise. External oil application allowed for controlled study of thermoregulatory stress as well. Infrared thermal images indicated significantly greater surface temperatures and heat loss in treated birds following external oil applications; however, measurements collected by coelomically implanted temperature transmitters showed that internal body temperatures were stable over the course of the study period. Birds exposed to oil externally consumed more fish than control birds, indicating metabolic compensation for thermal stress. Conversely, birds orally dosed with oil experienced hypothermia and consumed less fish compared to control birds. Published by Elsevier Inc.

  7. The Double Solid Reactant Method for modeling the release of trace elements from dissolving solid phases: I. Outline and limitations

    NASA Astrophysics Data System (ADS)

    Accornero, Marina; Marini, Luigi

    2008-10-01

    A Double Solid Reactant Method was elaborated from a suggestion of Marini (Geological sequestration of carbon dioxide: Thermodynamics, kinetics, and reaction path modeling. Developments in Geochemistry, Elsevier, Amsterdam, 2007) to simulate the release of trace elements during the progressive dissolution of solid phases. The method is based on the definition, for each dissolving solid, of both an entity whose thermodynamic and kinetic properties are known (either a pure mineral or a solid mixture) and a special reactant, that is, a material of known stoichiometry and unknown thermodynamic and kinetic properties. The special reactant is utilised to take into account the concentrations of trace elements in the dissolving solid phase. In this communication, the influence of several trace elements on the Δ G f o, Δ G r o and log K of the minerals considered by Lelli et al. (Environ Geol, 2007) and Accornero and Marini (Geobasi, 2007a; Proceedings of IMWA symposium, Cagliari, 27 31 May 2007b) was evaluated assuming ideal mixing in the solid state. These effects were found to be negligible for albite and the leucite latitic glass, limited for muscovites and chlorites, and slightly more important for apatites. These influences become progressively higher with increasing concentration of trace elements in these minerals. Based on these deviations in thermodynamic parameters, special reactants should not include oxide components with molar fractions higher than 0.003.

  8. Analytical model for random dopant fluctuation in double-gate MOSFET in the subthreshold region using macroscopic modeling method

    NASA Astrophysics Data System (ADS)

    Shin, Yong Hyeon; Yun, Ilgu

    2016-12-01

    An analytical model is proposed for the random dopant fluctuation (RDF) in a symmetric double-gate metal-oxidesemiconductor field-effect-transistor (DG MOSFET) in the subthreshold region. Unintended impurity dopants cannot be absolutely prevented during the device fabrication; hence, it is important to analytically model the fluctuations in the electrical characteristics caused by these impurity dopants. Therefore, a macroscopic modeling method is applied to represent the impurity dopants in DG MOSFETs. With this method, the two-dimensional (2D) Poisson equation is separated into a basic analytical DG MOSFET model with channel doping concentration NA and an impurity-dopant-related term with local doping concentration NRD confined in a specific rectangular area. To solve the second term, the manually solvable 2D Green's function for DG MOSFETs is used. Through calculation of the channel potential (ϕ(x, y)), the variations in the drive current (IDS) and threshold voltage (Vth) are extracted from the analytical model. All results from the analytical model for an impurity dopant in a DG MOSFET are examined by comparisons with the commercially available 2D numerical simulation results, with respect to various oxide thicknesses (tox), channel lengths (L), and location of impurity dopants.

  9. Hierarchical, Job Content, and Double Plateaus: A Mixed-Method Study of Stress, Depression and Coping Responses

    ERIC Educational Resources Information Center

    McCleese, Carrie S.; Eby, Lillian T.; Scharlau, Elizabeth A.; Hoffman, Bethany H.

    2007-01-01

    Hierarchically, job content, and double plateaued employees from a variety of industries were surveyed regarding their experiences. Plateau-specific stress was higher than the stress experienced by the general population. Plateaued employees also reported more depression than the general population. Double plateaued employees reported higher…

  10. A fusion of the closed-shell coupled cluster singles and doubles method and valence-bond theory for bond breaking.

    PubMed

    Small, David W; Head-Gordon, Martin

    2012-09-21

    Closed-shell coupled cluster singles and doubles (CCSD) is among the most important of electronic-structure methods. However, it fails qualitatively when applied to molecular systems with more than two strongly correlated electrons, such as those with stretched or broken covalent bonds. We show that it is possible to modify the doubles amplitudes to obtain a closed-shell CCSD method that retains the computational cost and desirable features of standard closed-shell CCSD, e.g., correct spin symmetry, size extensivity, orbital invariance, etc., but produces greatly improved energies upon bond dissociation of multiple electron pairs; indeed, under certain conditions the dissociation energies are exact.

  11. Double calibration: an accurate, reliable and easy-to-use method for 3D scapular motion analysis.

    PubMed

    Brochard, Sylvain; Lempereur, Mathieu; Rémy-Néris, Olivier

    2011-02-24

    The most recent non-invasive methods for the recording of scapular motion are based on an acromion marker (AM) set and a single calibration (SC) of the scapula in a resting position. However, this method fails to accurately measure scapular kinematics above 90° of arm elevation, due to soft tissue artifacts of the skin and muscles covering the acromion. The aim of this study was to evaluate the accuracy, and inter-trial and inter-session repeatability of a double calibration method (DC) in comparison with SC. The SC and DC data were measured with an optoelectronic system during arm flexion and abduction at different angles of elevation (0-180°). They were compared with palpation of the scapula using a scapula locator. DC data was not significantly different from palpation for 5/6 axes of rotation tested (Y, X, and Z in abduction and flexion), where as SC showed significant differences for 5/6 axes. The root mean square errors ranged from 2.96° to 4.48° for DC and from 6° to 9.19° for SC. The inter-trial repeatability was good to excellent for SC and DC. The inter-session repeatability was moderate to excellent for SC and moderate to good for DC. Coupling AM and DC is an easy-to-use method, which yields accurate and reliable measurements of scapular kinematics for the complete range of arm motion. It can be applied to the measurement of shoulder motion in many fields (sports, orthopaedics, and rehabilitation), especially when large ranges of arm motion are required.

  12. Reconstruction of the esophagojejunostomy by double stapling method using EEA™ OrVil™ in laparoscopic total gastrectomy and proximal gastrectomy

    PubMed Central

    2011-01-01

    Here we report the method of anastomosis based on double stapling technique (hereinafter, DST) using a trans-oral anvil delivery system (EEATM OrVilTM) for reconstructing the esophagus and lifted jejunum following laparoscopic total gastrectomy or proximal gastric resection. As a basic technique, laparoscopic total gastrectomy employed Roux-en-Y reconstruction, laparoscopic proximal gastrectomy employed double tract reconstruction, and end-to-side anastomosis was used for the cut-off stump of the esophagus and lifted jejunum. We used EEATM OrVilTM as a device that permitted mechanical purse-string suture similarly to conventional EEA, and endo-Surgitie. After the gastric lymph node dissection, the esophagus was cut off using an automated stapler. EEATM OrVilTM was orally and slowly inserted from the valve tip, and a small hole was created at the tip of the obliquely cut-off stump with scissors to let the valve tip pass through. Yarn was cut to disconnect the anvil from a tube and the anvil head was retained in the esophagus. The end-Surgitie was inserted at the right subcostal margin, and after the looped-shaped thread was wrapped around the esophageal stump opening, assisting Maryland forceps inserted at the left subcostal and left abdomen were used to grasp the left and right esophageal stump. The surgeon inserted anvil grasping forceps into the right abdomen, and after grasping the esophagus with the forceps, tightened the end Surgitie, thereby completing the purse-string suture on the esophageal stump. The main unit of the automated stapler was inserted from the cut-off stump of the lifted jejunum, and a trocar was made to pass through. To prevent dropout of the small intestines from the automated stapler, the automated stapler and the lifted jejunum were fastened with silk thread, the abdomen was again inflated, and the lifted jejunum was led into the abdominal cavity. When it was confirmed that the automated stapler and center rod were made completely linear

  13. Emissions of CH4 and CO2 from double rice cropping systems under varying tillage and seeding methods

    NASA Astrophysics Data System (ADS)

    Li, Chengfang; Zhang, Zhisheng; Guo, Lijin; Cai, Mingli; Cao, Cougui

    2013-12-01

    A two-year field experiment was conducted to investigate the effects of different tillage (no-tillage [NT] and conventional tillage [CT]) and seeding methods (transplanting seedlings [TPS] and throwing of seedlings [ST]) on methane (CH4) and carbon dioxide (CO2) emissions from double rice cropping systems in central China. The CH4 and CO2 fluxes for early rice ranged from -2.52 mg m-2 h-1 to 125.0 mg m-2 h-1 and from 99.3 mg m-2 h-1 to 1463.6 mg m-2 h-1, respectively, whereas the fluxes for late rice varied from -7.22 mg m-2 h-1 to 242.3 mg m-2 h-1 and from 180.6 mg m-2 h-1 to 2219.0 mg m-2 h-1, respectively. Compared with NT, CT significantly increased (P < 0.05) the CH4 and CO2 emissions, where the seasonal total CH4 emissions from the CT treatment were 1.75-2.10 times of those from the NT treatment for early rice and 1.64-1.79 times for late rice. Moreover, compared with the CT treatment, the NT treatment significantly reduced seasonal total CO2 emissions by 19%-33% for early rice (P < 0.05) and by 27%-31% for late rice (P < 0.05). The seeding methods significantly affected CH4 and CO2 emissions. Compared with TPS, ST significantly decreased seasonal total CH4 and CO2 emissions by 15%-40% (P < 0.05) and 19%-33% (P < 0.05) for early rice, and by 38%-47% (P < 0.05) and 19%-22% (P < 0.05) for late rice, respectively. These results may be attributed to reduced root growth and aboveground biomass. Therefore, simplified cultivation technologies are effective for reducing carbon emissions from double rice cropping systems in central China, and the combination of NT with ST can more effectively decrease carbon emissions.

  14. Maximal Aerobic Frequency of Ball Hitting: A New Training Load Parameter in Tennis.

    PubMed

    Baiget, Ernest; Iglesias, Xavier; Rodríguez, Ferran A

    2017-01-01

    Baiget, E, Iglesias, X, and Rodríguez, FA. Maximal aerobic frequency of ball hitting: a new training load parameter in tennis. J Strength Cond Res 31(1): 106-114, 2017-This study aimed (a) to evaluate a new training load parameter in tennis based on the ball-hitting frequency (Ballf) at V[Combining Dot Above]O2max occurs (maximal aerobic frequency of ball hitting, MAF) and (b) to assess the accuracy of a specific endurance tennis test (SET-Test) for predicting MAF. Thirty-five male competitive tennis players performed the SET-Test and selected physiological and performance parameters at maximal workload (MAX), and last completed stage (LS) and MAF were compared. Performance parameters (Ballf, time, stage, and hits per test) at LS were higher than at MAF (20.2 ± 1.7 vs. 18.1 ± 1.5 shots·min, 6.6 ± 0.8 vs. 5.6 ± 0.8 stages, and 189 ± 33 vs. 147 ± 27 hits; p < 0.001), and highly correlated (r = 0.72-0.77; p < 0.001). The mean difference between Ballf and stage at MAF and LS were 2.1 ± 1.1 shots·min and 1.1 ± 0.6 stages, respectively. The main physiological parameters (heart rate, V[Combining Dot Above]O2, and V[Combining Dot Above]CO2 at LS) were higher than at MAF (191 ± 9 vs. 186 ± 8 beats·min, 55.5 ± 5.9 vs. 55.0 ± 6.0 ml·kg·min and 4,724 ± 880 vs. 4,253 ± 739 ml·min; p < 0.005), and were very strongly correlated (r = 0.93-0.99; p < 0.001). We conclude that MAF can be used as a practical performance parameter to prescribe tennis-specific training, and that the SET-Test is a valid method for assessing MAF. Gas exchange measurements not being available, as a rule of thumb, most players reach their MAF at ∼1 stage (95% confidence interval: 0.9-1.2) and ∼2 shots·min (95% confidence interval: 1.7-2.5) less than their completed LS. A model for specific on-court training protocols for optimizing aerobic fitness in competitive tennis player is proposed.

  15. Evidence of closed flux during CHI formation of a spherical tokamak in the HIT-II experiment

    NASA Astrophysics Data System (ADS)

    Hamp, W. T.; Jarboe, T. R.; Raman, R.; Redd, A. J.; Nelson, B. A.; O'Neill, R. G.; Smith, R. J.

    2007-11-01

    The Helicity Injected Torus - II (HIT-II) experiment has demonstrated current drive by transformer action (OH), Coaxial Helicity Injection (CHI) and combinations of both. The electron temperature and density profiles of plasmas in HIT-II are measured by multi-point Thomson scattering (MPTS), and magnetic equilibria are reconstructed with EFIT. Internal probing of relaxed CHI discharges shows significant poloidal flux amplification. EFIT reconstructions of relaxed CHI discharges indicate significant closed flux, and poloidal flux increase in time. CHI initiated OH plasmas generate closed flux during the purely CHI startup. Temperature profiles of purely CHI plasmas do not match open flux models. When CHI is added to an ohmic plasma, the edge temperature drops by 75%, and the edge density doubles, while the core plasma properties remain similar to OH only discharges, indicating a transport barrier. The simplest explanation of the data is the formation and sustainment of closed flux during CHI current drive. The limitations on HIT-II CHI discharges are discussed, suggesting refinements to future experiments.

  16. Risk factors for technical failure of endoscopic double self-expandable metallic stent placement by partial stent-in-stent method.

    PubMed

    Kawakubo, Kazumichi; Kawakami, Hiroshi; Toyokawa, Yoshihide; Otani, Koichi; Kuwatani, Masaki; Abe, Yoko; Kawahata, Shuhei; Kubo, Kimitoshi; Kubota, Yoshimasa; Sakamoto, Naoya

    2015-01-01

    Endoscopic double self-expandable metallic stent (SEMS) placement by the partial stent-in-stent (PSIS) method has been reported to be useful for the management of unresectable hilar malignant biliary obstruction. However, it is technically challenging, and the optimal SEMS for the procedure remains unknown. The aim of this study was to identify the risk factors for technical failure of endoscopic double SEMS placement for unresectable malignant hilar biliary obstruction (MHBO). Between December 2009 and May 2013, 50 consecutive patients with MHBO underwent endoscopic double SEMS placement by the PSIS method. We retrospectively evaluated the rate of successful double SEMS placement and identified the risk factors for technical failure. The technical success rate for double SEMS placement was 82.0% (95% confidence interval [CI]: 69.2-90.2). On univariate analysis, the rate of technical failure was high in patients with metastatic disease and unilateral placement. Multivariate analysis revealed that metastatic disease was a significant risk factor for technical failure (odds ratio: 9.63, 95% CI: 1.11-105.5). The subgroup analysis after double guidewire insertion showed that the rate of technical success was higher in the laser-cut type SEMS with a large mesh and thick delivery system than in the braided type SEMS with a small mesh and thick delivery system. Metastatic disease was a significant risk factor for technical failure of double SEMS placement for unresectable MHBO. The laser-cut type SEMS with a large mesh and thin delivery system might be preferable for the PSIS procedure. © 2014 Japanese Society of Hepato-Biliary-Pancreatic Surgery.

  17. Transient coaxial helicity injection for solenoid-free plasma startup in HIT-II

    SciTech Connect

    Raman, R.; Jarboe, T. R; Hamp, W. T.; Redd, A. J.; Nelson, B. A.; O'Neill, R. G.; Sieck, P. E.; Smith, R. J.

    2007-02-15

    The favorable properties of the spherical torus (ST) arise from its very small aspect ratio. Methods for initiating the plasma current without relying on induction from a central solenoid are essential for the viability of the ST concept. In steady state tokamaks, the central solenoid can be dispensed with if suitable methods for initiating the plasma current are on hand. Coaxial helicity injection (CHI) is a promising candidate for solenoid-free plasma current startup in STs and tokamaks. Experiments on the Helicity Injected Torus (HIT-II) machine at the University of Washington [T. R. Jarboe, Fusion Technol. 15, 7 (1989)] have demonstrated the capability of a new method, referred to as transient CHI, to produce a high quality closed-flux equilibrium that has been successfully coupled to induction demonstrating that this new plasma current startup method is compatible with the conventional inductive method. This paper presents physics requirements for implementing this method in STs and tokamaks and supporting experimental results from the HIT-II device.

  18. A memory model for internet hits after media exposure

    NASA Astrophysics Data System (ADS)

    Chessa, Antonio G.; Murre, Jaap M. J.

    2004-02-01

    We present a cognitive model, based on the mathematical theory of point processes, which extends the results of two studies by Johansen (Physica A 276 (2000) 338; Physica A 296 (2001) 539) on download relaxation dynamics. Responses from subjects are considered as single events, which are received from original listeners or readers and from a network of social contacts, through which a message may propagate further. We collected data on the number of daily visits at our web site after a radio interview with the second author, in which the name of the web site was mentioned. A model based on an exponential hit time distribution and a homogeneous point process for regular visitors fits our data and Johansen's very well and is superior to both the power law and the logarithmic function. The fits suggest that hit data from different sources share the same cognitive mechanism, which are controlled merely by the encoding and retrieval of the target information memorised.

  19. UN study reports Asian economic crisis has hit women's health.

    PubMed

    Ciment, J

    1999-02-13

    A UN Population Fund report, "Southeast Asian Populations in Crisis," revealed that the economic crisis in Southeastern Asia has had a disproportionately adverse effect on the health of women and girls. This has occurred because the industries employing women have been hardest hit and because governments have reduced spending on health care and female education. Thailand, for example, has reduced its AIDS budget by 25% even as increasing numbers of women are pushed into the sex trade by economic necessity. Reproductive health services for adolescents have been hit just as shrinking family budgets are forcing adolescents to drop out of school. The report's authors are calling for a more detailed look at the situation.

  20. A support vector machines approach for virtual screening of active compounds of single and multiple mechanisms from large libraries at an improved hit-rate and enrichment factor.

    PubMed

    Han, L Y; Ma, X H; Lin, H H; Jia, J; Zhu, F; Xue, Y; Li, Z R; Cao, Z W; Ji, Z L; Chen, Y Z

    2008-06-01

    Support vector machines (SVM) and other machine-learning (ML) methods have been explored as ligand-based virtual screening (VS) tools for facilitating lead discovery. While exhibiting good hit selection performance, in screening large compound libraries, these methods tend to produce lower hit-rate than those of the best performing VS tools, partly because their training-sets contain limited spectrum of inactive compounds. We tested whether the performance of SVM can be improved by using training-sets of diverse inactive compounds. In retrospective database screening of active compounds of single mechanism (HIV protease inhibitors, DHFR inhibitors, dopamine antagonists) and multiple mechanisms (CNS active agents) from large libraries of 2.986 million compounds, the yields, hit-rates, and enrichment factors of our SVM models are 52.4-78.0%, 4.7-73.8%, and 214-10,543, respectively, compared to those of 62-95%, 0.65-35%, and 20-1200 by structure-based VS and 55-81%, 0.2-0.7%, and 110-795 by other ligand-based VS tools in screening libraries of >or=1 million compounds. The hit-rates are comparable and the enrichment factors are substantially better than the best results of other VS tools. 24.3-87.6% of the predicted hits are outside the known hit families. SVM appears to be potentially useful for facilitating lead discovery in VS of large compound libraries.

  1. Repeat Head Hits May Not Put NFL Players at Risk of Motor Problems

    MedlinePlus

    ... https://medlineplus.gov/news/fullstory_163670.html Repeat Head Hits May Not Put NFL Players at Risk ... 19, 2017 (HealthDay News) -- Repeated hits to the head may not doom NFL players to suffer movement ...

  2. 77 FR 66617 - HIT Policy and Standards Committees; Workgroup Application Database

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-11-06

    ... HUMAN SERVICES HIT Policy and Standards Committees; Workgroup Application Database AGENCY: Office of the... Application Database. The Office of the National Coordinator (ONC) has launched a new Health Information Technology Federal Advisory Committee Workgroup Application Database. Name of Committees: HIT...

  3. Gemcitabine induced cardiomyopathy: a case of multiple hit cardiotoxicity.

    PubMed

    Mohebali, Donya; Matos, Jason; Chang, James Ducksoon

    2017-02-01

    Gemcitabine is a commonly used antineoplastic agent used to treat a variety of cancers with rarely reported cardiac side effects. We describe a case of a 67-year-old woman with follicular lymphoma who experienced a rarely reported side effect of gemcitabine: cardiomyopathy. This case highlights a multiple hit mechanism of myocyte damage that may occur following the use of multiple cardio-toxic agents despite their administration in doses not associated with cardiotoxicity.

  4. The Effects of Pain Cues on Hitting Behavior.

    ERIC Educational Resources Information Center

    Dubanoski, Richard A.; Kong, Colleen

    This study investigates the effects of pain and non-pain consequences on groups of 22 high- and 22 low-aggression boys, as determined by a peer rating scale. The boys, who had a mean age of 10 years, 8 months, were instructed to hit a punching apparatus. Through earphones, half of each group heard pain cues, i.e., "ouch", while the other half…

  5. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    PubMed

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

    2017-07-19

    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  6. Homoclinic behaviors and chaotic motions of double layered viscoelastic nanoplates based on nonlocal theory and extended Melnikov method

    SciTech Connect

    Wang, Yu; Wang, Yi-Ze; Li, Feng-Ming

    2015-06-15

    The nonlinear dynamical equations are established for the double layered viscoelastic nanoplates (DLNP) subjected to in-plane excitation based on the nonlocal theory and von Kármán large deformation theory. The extended high dimensional homoclinic Melnikov method is employed to study the homoclinic phenomena and chaotic motions for the parametrically excited DLNP system. The criteria for the homoclinic transverse intersection for both the asynchronous and synchronous buckling cases are proposed. Lyapunov exponents and phase portraits are obtained to verify the Melnikov-type analysis. The influences of structural parameters on the transverse homoclinic orbits and homoclinic bifurcation sets are discussed for the two buckling cases. Some novel phenomena are observed in the investigation. It should be noticed that the nonlocal effect on the homoclinic behaviors and chaotic motions is quite remarkable. Hence, the small scale effect should be taken into account for homoclinic and chaotic analysis for nanostructures. It is significant that the nonlocal effect on the homoclinic phenomena for the asynchronous buckling case is quite different from that for the synchronous buckling case. Moreover, due to the van der Walls interaction between the layers, the nonlocal effect on the homoclinic behaviors and chaotic motions for high order mode is rather tiny under the asynchronous buckling condition.

  7. Self-consistent double-hybrid density-functional theory using the optimized-effective-potential method

    NASA Astrophysics Data System (ADS)

    Śmiga, Szymon; Franck, Odile; Mussard, Bastien; Buksztel, Adam; Grabowski, Ireneusz; Luppi, Eleonora; Toulouse, Julien

    2016-10-01

    We introduce an orbital-optimized double-hybrid (DH) scheme using the optimized-effective-potential (OEP) method. The orbitals are optimized using a local potential corresponding to the complete exchange-correlation energy expression including the second-order Møller-Plesset correlation contribution. We have implemented a one-parameter version of this OEP-based self-consistent DH scheme using the BLYP density-functional approximation and compared it to the corresponding non-self-consistent DH scheme for calculations on a few closed-shell atoms and molecules. While the OEP-based self-consistency does not provide any improvement for the calculations of ground-state total energies and ionization potentials, it does improve the accuracy of electron affinities and restores the meaning of the LUMO orbital energy as being connected to a neutral excitation energy. Moreover, the OEP-based self-consistent DH scheme provides reasonably accurate exchange-correlation potentials and correlated densities.

  8. Studies of interaction between terbium(III)-deferasirox and double helix DNA by spectral and electrochemical methods.

    PubMed

    Shaghaghi, Masoomeh; Dehghan, Gholamreza; Jouyban, Abolghasem; Sistani, Parisa; Arvin, Mitra

    2014-01-01

    DNA binding studies of terbium(III)-deferasirox (Tb3+-DFX) complex were monitored to understand the reaction mechanism and introduce a new probe for the assay of DNA. In the present work, UV absorption spectrophotometry, fluorescence spectroscopy, circular dichroism (CD), cyclic voltammetry (CV) and viscosity measurement were employed to study the interactions of Tb3+-DFX with calf thymus DNA (ctDNA). The binding of Tb3+-DFX complex to ctDNA showed a hyperchromic effect in the absorption spectra and the increase in fluorescence quenching effect (amount) of Tb3+-DFX complex in the presence of ctDNA. The binding constants (Kb) for the complex with ctDNA were estimated to be 1.8×10(4) M(-1) through UV absorption spectrophotometry and fluorescence spectroscopy. Upon addition of the complex, clear decreases were observed in the viscosity of ctDNA. The CD spectra indicated that there are certain detectable conformational changes in the DNA double helix when the complex was added. The CV method showed that both anodic and cathodic peak potentials of Tb3+-DFX complex showed negative shifts on the addition of the ctDNA. Further, competitive methylene blue binding studies with fluorescence spectroscopy have shown that the complex can bind to ctDNA through nonintercalative mode. The experimental results suggest that Tb3+-DFX complex binds to DNA via groove binding and/or electrostatic binding mode. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Electrode Mass Balancing as an Inexpensive and Simple Method to Increase the Capacitance of Electric Double-Layer Capacitors.

    PubMed

    Andres, Britta; Engström, Ann-Christine; Blomquist, Nicklas; Forsberg, Sven; Dahlström, Christina; Olin, Håkan

    Symmetric electric double-layer capacitors (EDLCs) have equal masses of the same active material in both electrodes. However, having equal electrode masses may prevent the EDLC to have the largest possible specific capacitance if the sizes of the hydrated anions and cations in the electrolyte differ because the electrodes and the electrolyte may not be completely utilized. Here we demonstrate how this issue can be resolved by mass balancing. If the electrode masses are adjusted according to the size of the ions, one can easily increase an EDLC's specific capacitance. To that end, we performed galvanostatic cycling to measure the capacitances of symmetric EDLCs with different electrode mass ratios using four aqueous electrolytes- Na2SO4, H2SO4, NaOH, and KOH (all with a concentration of 1 M)-and compared these to the theoretical optimal electrode mass ratio that we calculated using the sizes of the hydrated ions. Both the theoretical and experimental values revealed lower-than-1 optimal electrode ratios for all electrolytes except KOH. The largest increase in capacitance was obtained for EDLCs with NaOH as electrolyte. Specifically, we demonstrate an increase of the specific capacitance by 8.6% by adjusting the electrode mass ratio from 1 to 0.86. Our findings demonstrate that electrode mass balancing is a simple and inexpensive method to increase the capacitance of EDLCs. Furthermore, our results imply that one can reduce the amount of unused material in EDLCs and thus decrease their weight, volume and cost.

  10. Effective progression of nuclear magnetic resonance-detected fragment hits.

    PubMed

    Eaton, Hugh L; Wyss, Daniel F

    2011-01-01

    Fragment-based drug discovery (FBDD) has become increasingly popular over the last decade as an alternate lead generation tool to HTS approaches. Several compounds have now progressed into the clinic which originated from a fragment-based approach, demonstrating the utility of this emerging field. While fragment hit identification has become much more routine and may involve different screening approaches, the efficient progression of fragment hits into quality lead series may still present a major bottleneck for the broadly successful application of FBDD. In our laboratory, we have extensive experience in fragment-based NMR screening (SbN) and the subsequent iterative progression of fragment hits using structure-assisted chemistry. To maximize impact, we have applied this approach strategically to early- and high-priority targets, and those struggling for leads. Its application has yielded a clinical candidate for BACE1 and lead series in about one third of the SbN/FBDD projects. In this chapter, we will give an overview of our strategy and focus our discussion on NMR-based FBDD approaches.

  11. Quantum algorithms for Gibbs sampling and hitting-time estimation

    DOE PAGES

    Chowdhury, Anirban Narayan; Somma, Rolando D.

    2017-02-01

    In this paper, we present quantum algorithms for solving two problems regarding stochastic processes. The first algorithm prepares the thermal Gibbs state of a quantum system and runs in time almost linear in √Nβ/Ζ and polynomial in log(1/ϵ), where N is the Hilbert space dimension, β is the inverse temperature, Ζ is the partition function, and ϵ is the desired precision of the output state. Our quantum algorithm exponentially improves the dependence on 1/ϵ and quadratically improves the dependence on β of known quantum algorithms for this problem. The second algorithm estimates the hitting time of a Markov chain. Formore » a sparse stochastic matrix Ρ, it runs in time almost linear in 1/(ϵΔ3/2), where ϵ is the absolute precision in the estimation and Δ is a parameter determined by Ρ, and whose inverse is an upper bound of the hitting time. Our quantum algorithm quadratically improves the dependence on 1/ϵ and 1/Δ of the analog classical algorithm for hitting-time estimation. Finally, both algorithms use tools recently developed in the context of Hamiltonian simulation, spectral gap amplification, and solving linear systems of equations.« less

  12. COPD: A stepwise or a hit hard approach?

    PubMed

    Ferreira, A J; Reis, A; Marçal, N; Pinto, P; Bárbara, C

    2016-01-01

    Current guidelines differ slightly on the recommendations for treatment of Chronic Obstructive Pulmonary Disease (COPD) patients, and although there are some undisputed recommendations, there is still debate regarding the management of COPD. One of the hindrances to deciding which therapeutic approach to choose is late diagnosis or misdiagnosis of COPD. After a proper diagnosis is achieved and severity assessed, the choice between a stepwise or "hit hard" approach has to be made. For GOLD A patients the stepwise approach is recommended, whilst for B, C and D patients this remains debatable. Moreover, in patients for whom inhaled corticosteroids (ICS) are recommended, a step-up or "hit hard" approach with triple therapy will depend on the patient's characteristics and, for patients who are being over-treated with ICS, ICS withdrawal should be performed, in order to optimize therapy and reduce excessive medications. This paper discusses and proposes stepwise, "hit hard", step-up and ICS withdrawal therapeutic approaches for COPD patients based on their GOLD group. We conclude that all approaches have benefits, and only a careful patient selection will determine which approach is better, and which patients will benefit the most from each approach.

  13. Job-based health insurance in 2001: inflation hits double digits, managed care retreats.

    PubMed

    Gabel, J; Levitt, L; Pickreign, J; Whitmore, H; Holve, E; Rowland, D; Dhont, K; Hawkins, S

    2001-01-01

    Drawing on the results of a national survey of 1,907 firms with three or more workers, this paper reports on several facets of job-based health insurance, including the cost to employers and workers; plan offerings and enrollments; patient cost sharing and benefits; eligibility, coverage, and take-up rates; and results from questions about employers' knowledge of market trends and health policy initiatives. Premiums increased 11 percent from spring 2000 to spring 2001, and the percentage of Americans in health maintenance organizations (HMOs) fell six percentage points to its lowest level since 1993, while preferred provider organization (PPO) enrollment rose to 48 percent. Despite premium increases, the percentage of firms offering coverage remained statistically unchanged, and a relatively strong labor market has continued to shield workers from the higher cost of coverage.

  14. Thrombospondin 1 Wages a Double Hit Against Cancer | Center for Cancer Research

    Cancer.gov

    Cancer is the result of a complex series of molecular steps that promote uncontrolled growth and erode the body’s ability to fight the resulting tumor. Generating a more complete picture of these molecular events should help identify strategies to prevent and treat the disease.

  15. Concomitant achondroplasia and Chiari II malformation: A double-hit at the cervicomedullary junction

    PubMed Central

    Awad, Al-Wala; Aleck, Kyrieckos A; Bhardwaj, Ratan D

    2014-01-01

    We report the first case of a neonate with concurrent Chiari II malformation and achondroplasia. Although rare, both these conditions contribute to several deleterious anatomical changes at the cervicomedullary junction and thus predispose to acute hydrocephalus. Although our patient was initially asymptomatic, hydrocephalus ensued several weeks after birth and required cerebral spinal fluid diversion. We discuss the potential links between the two conditions, the pathophysiology, and the important clinical implications for the management of the increased risk of hydrocephalus. PMID:25405196

  16. [Clinical features in DLBCL and translocation BCL2/c-MYC "double hit" lymphoma].

    PubMed

    Škunca, Željka; Domimis, Mara; Plninc-Peraica, Ana; Jakšić, Branimir

    2014-06-01

    Diffuse large B-cell lymphoma (DLBCL) is classified as lymphoma and various entities using the gene expression of proteins are classified into three groups. The aim of this study was to clarify the clinical, biological, immunophenotypic and cytogenetic features of DLBCL with translocation t (14; 18) and 8q24/c-MYC. Eleven DLBCL patients with dual translation were monitored during the 2000-2009 period. The characteristics of these patients included morphological, immunohistochemical and cytogenetic analysis. Study results showed that all patients had aggressive characteristics, presence of B symptoms (64%), general patient condition according to ECOG scale ≥ 2 (55%), elevated serum lactate dehydrogenase activity (73%), clinical stage III and IV (82%), extranodal involvement of the disease (73%), and IPI ≥ 2 (73%). Partial remission was achieved in 73% of all patients and all patients (73%) died within a short time. Patients were treated with CHOP and similar protocols (COP, CVP, CNOP), with the addition of MabThera. Immunophenotyping was performed and determined expression of the CD20, CD3, CD10, BCL6 and MUM1 markers. The cytogenetic analysis/fluorescence in situ hybridization revealed complex karyotype changes. Thus, we analyzed the presence of BCL2, BCL6 and c-MYC genes and found eight patients to have BCL2 and c-MYC translocation genes, while three had translocation of the BCL6 and c-MYC genes. Despite appropriate therapy, the patient prognosis is poor. The median survival in these patients was 1.85 years. DLBCL with BCL2 and c-MYC rearrangement of the subgroups of lymphoma is associated with very poor survival. The presence of these two translocations has an aggressive clinical course.

  17. Searching for Dual AGNs in Galaxy Mergers: Understanding Double-Peaked [O III] and Ultra Hard X-rays as Selection Method

    NASA Astrophysics Data System (ADS)

    McGurk, Rosalie C.; Max, Claire E.; Medling, Anne; Shields, Gregory A.

    2015-01-01

    When galaxies merge, gas accretes onto both central supermassive black holes. Thus, one expects to see close pairs of active galactic nuclei (AGNs), or dual AGNs, in a fraction of galaxy mergers. However, finding them remains a challenge. The presence of double-peaked [O III] or of ultra hard X-rays have been proposed as techniques to select dual AGNs efficiently. We studied a sample of double-peaked narrow [O III] emitting AGNs from SDSS DR7. By obtaining new and archival high spatial resolution images taken with the Keck 2 Laser Guide Star Adaptive Optics system and the near-infrared (IR) camera NIRC2, we showed that 30% of double-peaked [O III] emission line SDSS AGNs have two spatial components within a 3' radius. However, spatially resolved spectroscopy or X-ray observations are needed to confirm these galaxy pairs as systems containing two AGNs. We followed up these spatially-double candidate dual AGNs with integral field spectroscopy from Keck OSIRIS and Gemini GMOS and with long-slit spectroscopy from Keck NIRSPEC and Shane Kast Double Spectrograph. We find double-peaked emitters are caused sometimes by dual AGN and sometimes by outflows or narrow line kinematics. We also performed Chandra X-ray ACIS-S observations on 12 double-peaked candidate dual AGNs. Using our observations and 8 archival observations, we compare the distribution of X-ray photons to our spatially double near-IR images, measure X-ray luminosities and hardness ratios, and estimate column densities. By assessing what fraction of double-peaked emission line SDSS AGNs are true dual AGNs, we can better determine whether double-peaked [O III] is an efficient dual AGN indicator and constrain the statistics of dual AGNs. A second technique to find dual AGN is the detection of ultra hard X-rays by the Swift Burst Alert Telescope. We use CARMA observations to measure and map the CO(1-0) present in nearby ultra-hard X-ray Active Galactic Nuclei (AGNs) merging with either a quiescent companion

  18. Teachers' Perspectives on Hitting Back in School: Between Inexcusable Violence and Self-Defense

    ERIC Educational Resources Information Center

    Fleischmann, Amos

    2015-01-01

    Israeli schools expressly forbid a student to hit back after being attacked. In semistructured interviews, 71 Israeli educators were asked for their views on the hitting-back tactic. The interviews compared their attitude toward hitting back as teachers with their take on the matter as parents. The results, analyzed using grounded theory, show…

  19. Teachers' Perspectives on Hitting Back in School: Between Inexcusable Violence and Self-Defense

    ERIC Educational Resources Information Center

    Fleischmann, Amos

    2015-01-01

    Israeli schools expressly forbid a student to hit back after being attacked. In semistructured interviews, 71 Israeli educators were asked for their views on the hitting-back tactic. The interviews compared their attitude toward hitting back as teachers with their take on the matter as parents. The results, analyzed using grounded theory, show…

  20. A double-lyophilization method for the preparation of CS/GO-COOH scaffold and its application in blood detoxification.

    PubMed

    Zhou, Gang; Wang, Lei; Li, Jianchao; Tai, Jun; Su, Haisheng; Zhang, Jing; Xi, Yuan; Fan, Yubo

    2016-10-10

    The accumulation of uremic toxins in blood might induce chronic renal failure (CRF). The incidence of CRF was as high as 10%. The traditional therapy for CRF was hemodialysis, which was more effective to remove small molecules, such as urea and creatinine. However, this detoxification method ignored the tissue functional adaption due to the retention of macromolecule uremic toxins. To solve this problem, this paper developed a new kind of chitosan/carboxyl graphite oxide (CS/GO-COOH) scaffold via a double-lyophilization method. Then, this synthetic scaffold was characterized by Fourier transform infrared spectroscopy, scanning electron microscope, hydrophilic test, mechanical property, and in vitro detoxification test. Covalent bonding and hydrogen bonding were formed, indicating the strong interactions between CS and GO-COOH. There were interconnected networks in the synthesized scaffold. The mechanical test suggested that the GO-2500 scaffold had excellent mechanical strength, which was 7.41 ± 0.82 MPa with 25% shrink. What is more, GO-2500 could totally rebound within 1s, after compressed to 90% shrink. The rates of GO-2500 were 1587 ± 60 and 246 ± 10% according to the water uptake and retention data, respectively. Furthermore, the detoxification of GO-2500 to urea, creatinine, VB12, and β2-m were 67.59 ± 2.31, 39.67 ± 2.95, 31.51 ± 2.62, and 83.82 ± 7.76 mg/g, respectively. The resulting CS/GO-COOH scaffold held great potential for the detoxification of uremic toxins.

  1. Simple phase-shifting method in Jamin double-shearing interferometer for testing of diffraction-limited wavefront

    NASA Astrophysics Data System (ADS)

    Wang, Lijuan; Liu, Liren; Luan, Zhu; Sun, Jianfeng; Zhou, Yu

    2011-09-01

    In the inter-satellite laser communication, the diffraction-limit wavefront is required. To test the wavefront, we have developed a Jamin double-shearing interferometer. The interferometer is consists of two Jamin plates to form lateral shearing and four wedge plates to divide the aperture. The laser beam to be test is incident on the first Jamin plate and gives rise to two beams. One is reflected from the front surface of the first Jamin plate, then passes two wedge plates and is reflected from the rear surface of the second Jamin plate. The other is reflected from the rear surface of the first Jamin plate, then passes other two wedge plates and is reflected from the front surface of the second Jamin plate. The two beams are recombined to form the interferogram. For the interferometer, simple phase-shifting method to improve the measurement accuracy of the wavefront by moving four wedge plates is proposed in this paper. When the wedge plates are moved along its surface or in the incidence direction of the interferometer, the optical path difference of two interferometric beams is changed to form phase shift. The added optical path difference introduced by the movement of wedge plates is liner function of displacement, thus the phase-shifting amount is easy to be control. Wedge plates can be moved in four steps with interval of quarter wavelength and the phase can be unwrapped using the four-step phase-shifting algorithm. In experiments, phase-shifting interferograms are obtained. The usefulness of the phase-shifting methods is verified.

  2. A new BOD estimation method employing a double-mediator system by ferricyanide and menadione using the eukaryote Saccharomyces cerevisiae.

    PubMed

    Nakamura, Hideaki; Suzuki, Kyota; Ishikuro, Hiroaki; Kinoshita, Shintaro; Koizumi, Rui; Okuma, Seisaku; Gotoh, Masao; Karube, Isao

    2007-04-15

    A new biochemical oxygen demand (BOD) sensing method employing a double-mediator (DM) system coupled with ferricyanide and a lipophilic mediator, menadione and the eukaryote Saccharomyces cerevisiae has been developed. In this study, a stirred micro-batch-type microbial sensor with a 560muL volume and a two-electrode system was used. The chronamperometric response of this sensor had a linear response between 1muM and 10mM hexacyanoferrate(II) (r(2)=0.9995, 14 points, n=3, average of relative standard deviation and R.S.D.(av)=1.3%). Next, the optimum conditions for BOD estimation by the DM system (BOD(DM)) were investigated and the findings revealed that the concentration of ethanol, used to dissolve menadione, influenced the sensor response and a relationship between the sensor output and glucose glutamic acid concentration was obtained over a range of 6.6-220mgO(2)L(-1) (five points, n=3, R.S.D.(av) 6.6%) when using a reaction mixture incubated for 15min. Subsequently, the characterization of this sensor was studied. The sensor responses to 14 pure organic substances were compared with the conventional BOD(5) method and other biosensor methods. Similar results with the BOD biosensor system using Trichosporon cutaneum were obtained. In addition, the influence of chloride ion, artificial seawater and heavy metal ions on the sensor response was investigated. A slight influence of 20.0gL(-1) chloride ion and artificial seawater (18.4gL(-1) Cl(-)) was observed. Thus, the possibility of BOD determination for seawater was suggested in this study. In addition, no influence of the heavy metal ions (1.0mgL(-1) Fe(3+), Cu(2+), Mn(2+), Cr(3+) and Zn(2+)) was observed. Real sample measurements using both river water and seawater were performed and compared with those obtained from the BOD(5) method. Finally, stable responses were obtained for 14 days when the yeast suspension was stored at 4 degrees C (response reduction, 93%; R.S.D. for 6 testing days, 9.1%).

  3. Video observation in HIT development: lessons learned on benefits and challenges

    PubMed Central

    2012-01-01

    Background Experience shows that the precondition for the development of successful health information technologies is a thorough insight into clinical work practice. In contemporary clinical work practice, clinical work and health information technology are integrated, and part of the practice is tacit. When work practice becomes routine, it slips to the background of the conscious awareness and becomes difficult to recognize without the context to support recall. This means that it is difficult to capture with traditional ethnographic research methods or in usability laboratories or clinical set ups. Observation by the use of the video technique within healthcare settings has proven to be capable of providing a thorough insight into the complex clinical work practice and its context - including parts of the tacit practice. The objective of this paper is 1) to argue for the video observation technique to inform and improve health-information-technology development and 2) to share insights and lessons learned on benefits and challenges when using the video observation technique within healthcare settings. Methods A multiple case study including nine case studies conducted by DaCHI researchers 2004–2011 using audio-visual, non-participant video observation for data collection within different healthcare settings. Results In HIT development, video observation is beneficial for 1) informing and improving system design 2) studying changes in work practice 3) identifying new potentials and 4) documenting current work practices. Conclusions The video observation technique used within healthcare settings is superior to other ethnographic research methods when it comes to disclosing the complexity in clinical work practice. The insights gained are far more realistic compared to traditional ethnographic studies or usability studies and studies in clinical set ups. Besides, the data generated through video recordings provide a solid basis for dialog between the health care

  4. A Double-Coil TMS Method to Assess Corticospinal Excitability Changes at a Near-Simultaneous Time in the Two Hands during Movement Preparation.

    PubMed

    Wilhelm, Emmanuelle; Quoilin, Caroline; Petitjean, Charlotte; Duque, Julie

    2016-01-01

    Many previous transcranial magnetic stimulation (TMS) studies have investigated corticospinal excitability changes occurring when choosing which hand to use for an action, one of the most frequent decision people make in daily life. So far, these studies have applied single-pulse TMS eliciting motor-evoked potential (MEP) in one hand when this hand is either selected or non-selected. Using such method, hand choices were shown to entail the operation of two inhibitory mechanisms, suppressing MEPs in the targeted hand either when it is non-selected (competition resolution, CR) or selected (impulse control, IC). However, an important limitation of this "Single-Coil" method is that MEPs are elicited in selected and non-selected conditions during separate trials and thus those two settings may not be completely comparable. Moreover, a more important problem is that MEPs are computed in relation to the movement of different hands. The goal of the present study was to test a "Double-Coil" method to evaluate IC and CR preceding the same hand responses by applying Double-Coil TMS over the two primary motor cortices (M1) at a near-simultaneous time (1 ms inter-pulse interval). MEPs were obtained in the left (MEPLEFT) and right (MEPRIGHT) hands while subjects chose between left and right hand key-presses in blocks using a Single-Coil or a Double-Coil method; in the latter blocks, TMS was either applied over left M1 first (TMSLRM1 group, n = 12) or right M1 first (TMSRLM1 group, n = 12). MEPLEFT were suppressed preceding both left (IC) and right (CR) hand responses whereas MEPRIGHT were only suppressed preceding left (CR) but not right (IC) hand responses. This result was observed regardless of whether Single-Coil or Double-Coil TMS was applied in the two subject groups. However, in the TMSLRM1 group, the MEP suppression was attenuated in Double-Coil compared to Single-Coil blocks for both IC and CR, when probed with MEPLEFT (elicited by the second pulse). Although Double

  5. HIT and brain reward function: A case of mistaken identity (theory).

    PubMed

    Wright, Cory; Colombo, Matteo; Beard, Alexander

    2017-08-01

    This paper employs a case study from the history of neuroscience-brain reward function-to scrutinize the inductive argument for the so-called 'Heuristic Identity Theory' (HIT). The case fails to support HIT, illustrating why other case studies previously thought to provide empirical support for HIT also fold under scrutiny. After distinguishing two different ways of understanding the types of identity claims presupposed by HIT and considering other conceptual problems, we conclude that HIT is not an alternative to the traditional identity theory so much as a relabeling of previously discussed strategies for mechanistic discovery. Copyright © 2017. Published by Elsevier Ltd.

  6. Electrode Mass Balancing as an Inexpensive and Simple Method to Increase the Capacitance of Electric Double-Layer Capacitors

    PubMed Central

    Andres, Britta; Engström, Ann-Christine; Blomquist, Nicklas; Forsberg, Sven; Dahlström, Christina; Olin, Håkan

    2016-01-01

    Symmetric electric double-layer capacitors (EDLCs) have equal masses of the same active material in both electrodes. However, having equal electrode masses may prevent the EDLC to have the largest possible specific capacitance if the sizes of the hydrated anions and cations in the electrolyte differ because the electrodes and the electrolyte may not be completely utilized. Here we demonstrate how this issue can be resolved by mass balancing. If the electrode masses are adjusted according to the size of the ions, one can easily increase an EDLC’s specific capacitance. To that end, we performed galvanostatic cycling to measure the capacitances of symmetric EDLCs with different electrode mass ratios using four aqueous electrolytes— Na2SO4, H2SO4, NaOH, and KOH (all with a concentration of 1 M)—and compared these to the theoretical optimal electrode mass ratio that we calculated using the sizes of the hydrated ions. Both the theoretical and experimental values revealed lower-than-1 optimal electrode ratios for all electrolytes except KOH. The largest increase in capacitance was obtained for EDLCs with NaOH as electrolyte. Specifically, we demonstrate an increase of the specific capacitance by 8.6% by adjusting the electrode mass ratio from 1 to 0.86. Our findings demonstrate that electrode mass balancing is a simple and inexpensive method to increase the capacitance of EDLCs. Furthermore, our results imply that one can reduce the amount of unused material in EDLCs and thus decrease their weight, volume and cost. PMID:27658253

  7. A new virus discovered by immunocapture of double-stranded RNA, a rapid method for virus enrichment in metagenomic studies.

    PubMed

    Blouin, Arnaud G; Ross, Howard A; Hobson-Peters, Jody; O'Brien, Caitlin A; Warren, Ben; MacDiarmid, Robin

    2016-09-01

    Next-generation sequencing technologies enable the rapid identification of viral infection of diseased organisms. However, despite a consistent decrease in sequencing costs, it is difficult to justify their use in large-scale surveys without a virus sequence enrichment technique. As the majority of plant viruses have an RNA genome, a common approach is to extract the double-stranded RNA (dsRNA) replicative form, to enrich the replicating virus genetic material over the host background. The traditional dsRNA extraction is time-consuming and labour-intensive. We present an alternative method to enrich dsRNA from plant extracts using anti-dsRNA monoclonal antibodies in a pull-down assay. The extracted dsRNA can be amplified by reverse transcriptase-polymerase chain reaction and sequenced by next-generation sequencing. In our study, we have selected three distinct plant hosts: Māori potato (Solanum tuberosum), rengarenga (Arthropodium cirratum) and broadleaved dock (Rumex obtusifolius) representing a cultivated crop, a New Zealand-native ornamental plant and a weed, respectively. Of the sequence data obtained, 31-74% of the reads were of viral origin, and we identified five viruses including Potato virus Y and Potato virus S in potato; Turnip mosaic virus in rengarenga (a new host record); and in the dock sample Cherry leaf roll virus and a novel virus belonging to the genus Macluravirus. We believe that this new assay represents a significant opportunity to upscale virus ecology studies from environmental, primary industry and/or medical samples.

  8. Micro-Shuttle Lifting of the Neck: A Percutaneous Loop Suspension Method Using a Novel Double-Ended Needle.

    PubMed

    Tiryaki, Kemal Tunc; Aksungur, Esin; Grotting, James C

    2016-06-01

    Most younger patients expect to be able to achieve significant improvements and lift to their neck, yet they don't want to undergo extensive surgery. They are now able to do that and restore their youthful appearance thanks to new concepts the techniques through volume redistribution. The authors' goal was to achieve results that are comparable to a necklift and durable through minimally invasive surgery, utilizing punctures instead of incisions. The concept of micro-shuttle lifting creates a percutaneous hammock to achieve the lifting of all different planes of the neck at once. This is accomplished by putting nonabsorbable sutures on nonundermined platsyma through the use of a double-ended (micro-shuttle) needle and anchoring it to fixed thread loops around the ears. Mitigation of gravitational force is accomplished through the loop suspensions, to obtain effective skin redraping over the suture-created internal splint. This combined technique for the neck was applied in 221 selected patients between December 2005 and May 2014, with follow-up ranging from 8 months to 7 years. The mean age of the patients was 42.5 years. Outcomes were satisfactory in all but 12 cases, of which 7 found the result inadequate. The operation time for the neck was less than 40 minutes under local anesthesia or local anesthesia with sedation, and the recovery time was 5-7 days. The sustainability of this percutaneous procedure does not rely on the suspensions, but rather on the skin redraping in the new position in a similar manner to orthopedic fracture treatment. In selected patients, this safe and simple percutaneous necklifting method can be quickly and easily performed under local anesthesia with long-term durability, low morbidity, and a high patient satisfaction rate. LEVEL OF EVIDENCE 4: Therapeutic. © 2016 The American Society for Aesthetic Plastic Surgery, Inc. Reprints and permission: journals.permissions@oup.com.

  9. Structure and geometry of the Aksay restraining double bend along the Altyn Tagh Fault, northern Tibet, imaged using magnetotelluric method

    NASA Astrophysics Data System (ADS)

    Xiao, Qibin; Yu, Guo; Liu-Zeng, Jing; Oskin, Michael E.; Shao, Guihang

    2017-05-01

    Large restraining bends along active strike-slip faults locally enhance the accumulation of clamping tectonic normal stresses that may limit the size of major earthquakes. In such settings, uncertain fault geometry at depth limits understanding of how effectively a bend arrests earthquake ruptures. Here we demonstrate fault imaging within a major restraining bend along the Altyn Tagh Fault of western China using the magnetotelluric (MT) method. The new MT data were collected along two profiles across the Aksay restraining double bend, which is bounded by two subparallel strands of the Altyn Tagh Fault: Northern (NATF) and Southern (SATF). Both two-dimensional (2-D) and three-dimensional (3-D) inversion models show that the Aksay bend may be the center of a positive flower structure, imaged as a high-resistivity body extending to an 40 km depth and bounded by subvertical resistivity discontinuities corresponding to the NATF and SATF. In the western section of the Aksay bend, both the NATF and SATF show similar low-resistivity structure, whereas in the eastern part of the bend, the low-resistivity anomaly below the SATF is wider and more prominent than that below the NATF. This observation indicates that the SATF shear zone may be wider and host more fluid than the NATF, lending structural support to the contention that fault slip at depth is asymmetrically focused on the SATF, even though surface slip is focused on the NATF. A south dipping, low-resistivity interface branching upward from the SATF toward the NATF indicates a fault link between these strands at depth.

  10. Video observation in HIT development: lessons learned on benefits and challenges.

    PubMed

    Høstgaard, Anna Marie; Bertelsen, Pernille

    2012-08-22

    Experience shows that the precondition for the development of successful health information technologies is a thorough insight into clinical work practice. In contemporary clinical work practice, clinical work and health information technology are integrated, and part of the practice is tacit. When work practice becomes routine, it slips to the background of the conscious awareness and becomes difficult to recognize without the context to support recall. This means that it is difficult to capture with traditional ethnographic research methods or in usability laboratories or clinical set ups. Observation by the use of the video technique within healthcare settings has proven to be capable of providing a thorough insight into the complex clinical work practice and its context - including parts of the tacit practice. The objective of this paper is 1) to argue for the video observation technique to inform and improve health-information-technology development and 2) to share insights and lessons learned on benefits and challenges when using the video observation technique within healthcare settings. A multiple case study including nine case studies conducted by DaCHI researchers 2004-2011 using audio-visual, non-participant video observation for data collection within different healthcare settings. In HIT development, video observation is beneficial for 1) informing and improving system design 2) studying changes in work practice 3) identifying new potentials and 4) documenting current work practices. The video observation technique used within healthcare settings is superior to other ethnographic research methods when it comes to disclosing the complexity in clinical work practice. The insights gained are far more realistic compared to traditional ethnographic studies or usability studies and studies in clinical set ups. Besides, the data generated through video recordings provide a solid basis for dialog between the health care professionals involved. The most

  11. Estimated Radiation on Mars, Hits per Cell Nucleus

    NASA Technical Reports Server (NTRS)

    2002-01-01

    This global map of Mars shows estimates for amounts of high-energy-particle cosmic radiation reaching the surface, a serious health concern for any future human exploration of the planet.

    The estimates are based on cosmic-radiation measurements made on the way to Mars by the Mars radiation environment experiment, an instrument on NASA's 2001 Mars Odyssey spacecraft, plus information about Mars' surface elevations from the laser altimeter instrument on NASA's Mars Global Surveyor. The areas of Mars expected to have least radiation are where elevation is lowest, because those areas have more atmosphere above them to block out some of the radiation. Earth's thick atmosphere shields us from most cosmic radiation, but Mars has a much thinner atmosphere than Earth does.

    Colors in the map refer to the estimated average number of times per year each cell nucleus in a human there would be hit by a high-energy cosmic ray particle. The range is generally from two hits (color-coded green), a moderate risk level, to eight hits (coded red), a high risk level.

    NASA's Jet Propulsion Laboratory, Pasadena, Calif. manages the 2001 Mars Odyssey and Mars Global Surveyor missions for NASA's Office of Space Science, Washington D.C. The Mars radiation environment experiment was developed by NASA's Johnson Space Center. Lockheed Martin Astronautics, Denver, is the prime contractor for Odyssey, and developed and built the orbiter. Mission operations are conducted jointly from Lockheed Martin and from JPL, a division of the California Institute of Technology in Pasadena.

  12. From fatty liver to fibrosis: a tale of "second hit".

    PubMed

    Basaranoglu, Metin; Basaranoglu, Gökcen; Sentürk, Hakan

    2013-02-28

    Although much is known about how fat accumulates in the liver, much remains unknown about how this causes sustained hepatocellular injury. The consequences of injury are recognized as nonalcoholic steatohepatitis (NASH) and progressive fibrosis. The accumulation of fat within the hepatocytes sensitizes the liver to injury from a variety of causes and the regenerative capacity of a fatty liver is impaired. An additional stressor is sometimes referred to as a "second hit" in a paradigm that identifies the accumulation of fat as the "first hit". Possible candidates for the second hit include increased oxidative stress, lipid peroxidation and release of toxic products such as malondialdehyde and 4-hydroxynonenal, decreased antioxidants, adipocytokines, transforming growth factor (TGF)-β, Fas ligand, mitochondrial dysfunction, fatty acid oxidation by CYPs (CYP 2E1, 4A10 and 4A14), and peroxisomes, excess iron, small intestinal bacterial overgrowth, and the generation of gut-derived toxins such as lipopolysaccharide and ethanol. Oxidative stress is one of the most popular proposed mechanisms of hepatocellular injury. Previous studies have specifically observed increased plasma and tissue levels of oxidative stress markers and lipid peroxidation products, with reduced hepatic and plasma levels of antioxidants. There is also some indirect evidence of the benefit of antioxidants such as vitamin E, S-adenosylmethionine, betaine, phlebotomy to remove iron, and N-acetylcysteine in NASH. However, a causal relationship or a pathogenic link between NASH and oxidative stress has not been established so far. A number of sources of increased reactive oxygen species production have been established in NASH that include proinflammatory cytokines such as tumor necrosis factor (TNF)-α, iron overload, overburdened and dysfunctional mitochondria, CYPs, and peroxisomes. Briefly, the pathogenesis of NASH is multifactorial and excess intracellular fatty acids, oxidant stress, ATP depletion

  13. Hit-and-Run” Transformation by Adenovirus Oncogenes

    PubMed Central

    Nevels, Michael; Täuber, Birgitt; Spruss, Thilo; Wolf, Hans; Dobner, Thomas

    2001-01-01

    According to classical concepts of viral oncogenesis, the persistence of virus-specific oncogenes is required to maintain the transformed cellular phenotype. In contrast, the “hit-and-run” hypothesis claims that viruses can mediate cellular transformation through an initial “hit,” while maintenance of the transformed state is compatible with the loss (“run”) of viral molecules. It is well established that the adenovirus E1A and E1B gene products can cooperatively transform primary human and rodent cells to a tumorigenic phenotype and that these cells permanently express the viral oncogenes. Additionally, recent studies have shown that the adenovirus E4 region encodes two novel oncoproteins, the products of E4orf6 and E4orf3, which cooperate with the viral E1A proteins to transform primary rat cells in an E1B-like fashion. Unexpectedly, however, cells transformed by E1A and either E4orf6 or E4orf3 fail to express the viral E4 gene products, and only a subset contain E1A proteins. In fact, the majority of these cells lack E4- and E1A-specific DNA sequences, indicating that transformation occurred through a hit-and-run mechanism. We provide evidence that the unusual transforming activities of the adenoviral oncoproteins may be due to their mutagenic potential. Our results strongly support the possibility that even tumors that lack any detectable virus-specific molecules can be of viral origin, which could have a significant impact on the use of adenoviral vectors for gene therapy. PMID:11238835

  14. Estimated Radiation on Mars, Hits per Cell Nucleus

    NASA Technical Reports Server (NTRS)

    2002-01-01

    This global map of Mars shows estimates for amounts of high-energy-particle cosmic radiation reaching the surface, a serious health concern for any future human exploration of the planet.

    The estimates are based on cosmic-radiation measurements made on the way to Mars by the Mars radiation environment experiment, an instrument on NASA's 2001 Mars Odyssey spacecraft, plus information about Mars' surface elevations from the laser altimeter instrument on NASA's Mars Global Surveyor. The areas of Mars expected to have least radiation are where elevation is lowest, because those areas have more atmosphere above them to block out some of the radiation. Earth's thick atmosphere shields us from most cosmic radiation, but Mars has a much thinner atmosphere than Earth does.

    Colors in the map refer to the estimated average number of times per year each cell nucleus in a human there would be hit by a high-energy cosmic ray particle. The range is generally from two hits (color-coded green), a moderate risk level, to eight hits (coded red), a high risk level.

    NASA's Jet Propulsion Laboratory, Pasadena, Calif. manages the 2001 Mars Odyssey and Mars Global Surveyor missions for NASA's Office of Space Science, Washington D.C. The Mars radiation environment experiment was developed by NASA's Johnson Space Center. Lockheed Martin Astronautics, Denver, is the prime contractor for Odyssey, and developed and built the orbiter. Mission operations are conducted jointly from Lockheed Martin and from JPL, a division of the California Institute of Technology in Pasadena.

  15. [Mg/Al layered double hydroxides prepared by microwave-assisted co-precipitation method for the removal of bromate].

    PubMed

    Zhong, Qiong; Li, Huan

    2014-04-01

    In this paper, Mg/Al layered double hydroxides (Mg/Al LDHs) were prepared by the microwave-assisted co-precipitation method and the conventional co-precipitation method. The samples were labeled as Mg/Al LDHs-MW and Mg/Al LDHs-H, respectively. Mg/Al LDHs were characterized by X-ray diffractometer (XRD), Brunauer-Emmett-Teller (BET), scanning electron microscopy (SEM) and Fourier transform infrared (FT-IR). The results showed that the application of microwave in the preparation process promoted the formation of smaller pore diameter and higher crystallinity particles. The pore size and particle size of Mg/Al LDHs-MW were 41.13 nm and 427.08 nm, respectively. Batch experiments were investigated to evaluate the effect of dosage, initial pH and regeneration frequencies for bromate removal. The conclusion showed that the process of bromate removal on Mg/Al LDHs could be described by the pseudo-second kinetic model. The Langmuir isotherm well described the experimental data, and the Mg/Al LDHs-MW has a stronger adsorption capacity while the maximum adsorption capacity (q(0)) of Mg/Al LDHs-MW for bromate was 321.26 microg x g(-1) which was larger than the q(0) (288.74 microg x g(-1)) of Mg/Al LDHs-H. For the continuous fixed-bed column, model simulations using the Thomas model showed that the experimental data obtained at three different columns packed with Mg/Al LDHs-MW were able to predict breakthrough curves. Simulating the maximum adsorption capacity of adsorption column for bromate removal was 288.81 microg x g(-1). When the bed depth was 10 cm, inlet concentration was 800 microg x L(-1) and flow rate was 4.0 mL x min, the correlation coefficient of model was 0.92, indicating that the experimental data was described well by the Thomas model.

  16. [Comparison of two shaping methods for double-lumen endotracheal tube intubation by Shikani optical stylet laryngoscope].

    PubMed

    Xu, T; Li, M; Xu, M; Guo, X Y

    2016-12-18

    To compare the efficacy and safety of two different shaping methods for double-lumen endotracheal tube (DLT).DLT was shaped with the rod of a Shikani optical stylet (SOS) with the tracheal orifice aligned with the convex aspect of the distal curvature or the concave aspect of the distal curvature. Patients scheduled for elective thoracic surgery and required intubation with a left-sided DLT were enrolled in this study. They were randomized into two groups. They were intubated with a DLT, which was shaped with the rod of a SOS with its tracheal orifice aligned with the convex aspect of the distal curvature (group T) or the concave aspect of the distal curvature (group U). Time for SOS manipulation, intubation attempts, intubation resistance score, malposition of bronchial intubation, time for fiberoptic bronchoscope (FOB) identification of bronchial placement, total intubation time and oral mucosal or dental injury were recorded. Hoarseness and throat sore of the patients were evaluated 1 hour and 24 hours after surgery. A total of 136 patients completed the study, with 68 in each group. Time for SOS manipulation was significantly shorter in group U [(35.1±6.1) s vs. 39.6±11.8) s, P=0.007]. First attempt success rate did not differ between the groups (92.6% vs.88.2%, P=0.561). Intubation resistance score was significantly lower in group U. Group T had fewer patients who suffered malposition of bronchial intubation than group U (4 vs.13, P=0.020) and cost less time for FOB identification of bronchial placement [(44.1±20.9) s vs.(53.6±29.2) s, P=0.032]. Total intubation time and the incidence of oral mucosal or dental injury did not differ between the groups. The severity and incidence of hoarseness were lower in group U than in group T 1 hour after surgery. The severity and incidence of sore throat were lower in group U than in group T 1 hour and 24 hours postoperatively. When lacing a left-sided DLT using a SOS, shaping the DLT with the tracheal orifice aligned

  17. Mapping of change in cerebral glucose utilization using fluorine-18 fluorodeoxyglucose double injection and the constrained weighted-integration method

    SciTech Connect

    Murase, K. |; Kuwabara, Hiroto; Yasuhara, Yoshifumi; Evans, A.C.; Gjedde, A.

    1996-12-01

    The authors developed a method for mapping the change in cerebral glucose utilization at two different physiological states using [{sup 18}F]fluorodeoxyglucose (FDG) double injection and the constrained weighted-integration method. They studied young normal subjects without (baseline-baseline group, n = 5) and with (baseline-stimulation group, n = 5) vibrotactile stimulation of the fingertips of the right hand. Dynamic scans were performed using positron emission tomography (PET) following an initial dose (the first session, 0--30 min) and an additional dose (the second session, 30--60 min). The parametric images of the net clearance of FDG from blood to brain (K*), unidirectional blood-to-brain clearance (K*{sub 1}) and cerebral metabolic rate of glucose (CMR{sub glc}) of the two sessions were generated. The averaged subtraction (second minus first session) and t-statistic images were generated, which were rendered into Talairach`s sterotaxic coordinates and merged with the averaged magnetic resonance imaging (MRI) image. In the baseline-baseline group, regional K*, K*{sub 1}, and CMR{sub glc} in the first and second sessions were strongly correlated (r{sup 2} = 0.953, 0.935, and 0.951, respectively, n = 340). In the baseline-stimulation group, significant increases in these estimates were obtained in the contralateral primary somatosensory cortex (SI) (from 3.43 {+-} 0.78 to 4.02 {+-} 1.01 ml/100 g/min for K*, 7.85 {+-} 1.88 to 9.09 {+-} 1.71 ml/100 g/min for K*{sub 1}, and 28.0 {+-} 5.9 to 32.3 {+-} 5.5 {micro}mol/100 g/min for CMR{sub glc}), while there were no significant changes in the ipsilateral SI (from 3.45 {+-} 0.84 to 3.39 {+-} 0.72 ml/100 g/min for K*, 8.17 {+-} 2.33 to 8.37 {+-} 1.75 ml/100 g/min for K*{sub 1}, and 29.5 {+-} 8.1 to 29.1 {+-} 8.2 {micro}mol/100 g/min for CMR{sub glc}). Significant increases in K* and CMR{sub glc} in the contralateral SI were clearly demonstrated in the t-statistic image.

  18. CEBPA-double-mutated acute myeloid leukemia displays a unique phenotypic profile: a reliable screening method and insight into biological features.

    PubMed

    Mannelli, Francesco; Ponziani, Vanessa; Bencini, Sara; Bonetti, Maria Ida; Benelli, Matteo; Cutini, Ilaria; Gianfaldoni, Giacomo; Scappini, Barbara; Pancani, Fabiana; Piccini, Matteo; Rondelli, Tommaso; Caporale, Roberto; Gelli, Anna Maria Grazia; Peruzzi, Benedetta; Chiarini, Marco; Borlenghi, Erika; Spinelli, Orietta; Giupponi, Damiano; Zanghì, Pamela; Bassan, Renato; Rambaldi, Alessandro; Rossi, Giuseppe; Bosi, Alberto

    2017-03-01

    Mutations in CCAAT/enhancer binding protein α (CEBPA) occur in 5-10% of cases of acute myeloid leukemia. CEBPA-double-mutated cases usually bear biallelic N- and C-terminal mutations and are associated with a favorable clinical outcome. Identification of CEBPA mutants is challenging because of the variety of mutations, intrinsic characteristics of the gene and technical issues. Several screening methods (fragment-length analysis, gene expression array) have been proposed especially for large-scale clinical use; although efficient, they are limited by specific concerns. We investigated the phenotypic profile of blast and maturing bone marrow cell compartments at diagnosis in 251 cases of acute myeloid leukemia. In this cohort, 16 (6.4%) patients had two CEBPA mutations, whereas ten (4.0%) had a single mutation. First, we highlighted that the CEBPA-double-mutated subset displays recurrent phenotypic abnormalities in all cell compartments. By mutational analysis after cell sorting, we demonstrated that this common phenotypic signature depends on CEBPA-double-mutated multi-lineage involvement. From a multidimensional study of phenotypic data, we developed a classifier including ten core and widely available parameters. The selected markers on blasts (CD34, CD117, CD7, CD15, CD65), neutrophil (SSC, CD64), monocytic (CD14, CD64) and erythroid (CD117) compartments were able to cluster CEBPA-double-mutated cases. In a validation set of 259 AML cases from three independent centers, our classifier showed excellent performance with 100% specificity and 100% sensitivity. We have, therefore, established a reliable screening method, based upon multidimensional analysis of widely available phenotypic parameters. This method provides early results and is suitable for large-scale detection of CEBPA-double-mutated status, allowing gene sequencing to be focused in selected cases. Copyright© Ferrata Storti Foundation.

  19. CEBPA–double-mutated acute myeloid leukemia displays a unique phenotypic profile: a reliable screening method and insight into biological features

    PubMed Central

    Mannelli, Francesco; Ponziani, Vanessa; Bencini, Sara; Bonetti, Maria Ida; Benelli, Matteo; Cutini, Ilaria; Gianfaldoni, Giacomo; Scappini, Barbara; Pancani, Fabiana; Piccini, Matteo; Rondelli, Tommaso; Caporale, Roberto; Gelli, Anna Maria Grazia; Peruzzi, Benedetta; Chiarini, Marco; Borlenghi, Erika; Spinelli, Orietta; Giupponi, Damiano; Zanghì, Pamela; Bassan, Renato; Rambaldi, Alessandro; Rossi, Giuseppe; Bosi, Alberto

    2017-01-01

    Mutations in CCAAT/enhancer binding protein α (CEBPA) occur in 5–10% of cases of acute myeloid leukemia. CEBPA-double-mutated cases usually bear biallelic N- and C-terminal mutations and are associated with a favorable clinical outcome. Identification of CEBPA mutants is challenging because of the variety of mutations, intrinsic characteristics of the gene and technical issues. Several screening methods (fragment-length analysis, gene expression array) have been proposed especially for large-scale clinical use; although efficient, they are limited by specific concerns. We investigated the phenotypic profile of blast and maturing bone marrow cell compartments at diagnosis in 251 cases of acute myeloid leukemia. In this cohort, 16 (6.4%) patients had two CEBPA mutations, whereas ten (4.0%) had a single mutation. First, we highlighted that the CEBPA-double-mutated subset displays recurrent phenotypic abnormalities in all cell compartments. By mutational analysis after cell sorting, we demonstrated that this common phenotypic signature depends on CEBPA-double-mutated multi-lineage involvement. From a multidimensional study of phenotypic data, we developed a classifier including ten core and widely available parameters. The selected markers on blasts (CD34, CD117, CD7, CD15, CD65), neutrophil (SSC, CD64), monocytic (CD14, CD64) and erythroid (CD117) compartments were able to cluster CEBPA-double-mutated cases. In a validation set of 259 AML cases from three independent centers, our classifier showed excellent performance with 100% specificity and 100% sensitivity. We have, therefore, established a reliable screening method, based upon multidimensional analysis of widely available phenotypic parameters. This method provides early results and is suitable for large-scale detection of CEBPA-double-mutated status, allowing gene sequencing to be focused in selected cases. PMID:28250006

  20. HitPredict version 4: comprehensive reliability scoring of physical protein-protein interactions from more than 100 species.

    PubMed

    López, Yosvany; Nakai, Kenta; Patil, Ashwini

    2015-01-01

    HitPredict is a consolidated resource of experimentally identified, physical protein-protein interactions with confidence scores to indicate their reliability. The study of genes and their inter-relationships using methods such as network and pathway analysis requires high quality protein-protein interaction information. Extracting reliable interactions from most of the existing databases is challenging because they either contain only a subset of the available interactions, or a mixture of physical, genetic and predicted interactions. Automated integration of interactions is further complicated by varying levels of accuracy of database content and lack of adherence to standard formats. To address these issues, the latest version of HitPredict provides a manually curated dataset of 398 696 physical associations between 70 808 proteins from 105 species. Manual confirmation was used to resolve all issues encountered during data integration. For improved reliability assessment, this version combines a new score derived from the experimental information of the interactions with the original score based on the features of the interacting proteins. The combined interaction score performs better than either of the individual scores in HitPredict as well as the reliability score of another similar database. HitPredict provides a web interface to search proteins and visualize their interactions, and the data can be downloaded for offline analysis. Data usability has been enhanced by mapping protein identifiers across multiple reference databases. Thus, the latest version of HitPredict provides a significantly larger, more reliable and usable dataset of protein-protein interactions from several species for the study of gene groups. Database URL: http://hintdb.hgc.jp/htp. © The Author(s) 2015. Published by Oxford University Press.

  1. Hit efficiency study of CMS prototype forward pixel detectors

    SciTech Connect

    Kim, Dongwook; /Johns Hopkins U.

    2006-01-01

    In this paper the author describes the measurement of the hit efficiency of a prototype pixel device for the CMS forward pixel detector. These pixel detectors were FM type sensors with PSI46V1 chip readout. The data were taken with the 120 GeV proton beam at Fermilab during the period of December 2004 to February 2005. The detectors proved to be highly efficient (99.27 {+-} 0.02%). The inefficiency was primarily located near the corners of the individual pixels.

  2. Dynamic stereoacuity: a test for hitting a baseball?

    PubMed

    Solomon, H; Zinn, W J; Vacroux, A

    1988-07-01

    Vision is a critical ingredient in professional sports such as baseball. It would, therefore, be logical to assume that vision testing should be able to discriminate between good and bad performance. Past attempts to establish this vision/performance relationship have not been successful. We believe the fault is anchored in the fact that all routine vision testing is static and unable to measure motion parameters. Using an instrument of our design to test dynamic stereoacuity, we have been able to detect subtle differences among individuals. The data show a segregation between major league hitters and pitchers. Such information could be used as one clue to predict hitting performance.

  3. Microwave-assisted melt reaction method for the intercalation of carboxylic acid anions into layered double hydroxides.

    PubMed

    Rosa, Roberto; Leonelli, Cristina; Villa, Carla; Priarone, Giulia

    2013-01-01

    Carboxylic acid anions intercalated layered double hydroxides are currently gaining increasing interest due to their potential applications in pharmaceutical field for controlled drug release in novel tunable drug delivery systems. In this work different aliphatic carboxylic acid anions were intercalated into the interlayers of commercial as well as synthetically prepared layered double hydroxides, through a novel microwave mediated melt reaction approach. The volumetric nature of microwave dielectric heating was exploited in order to rapidly heat the intimate mixture of the lamellar inorganic precursor and the appropriate organic acid, at the melting temperature of the particular mono- or dicarboxylic acid used, reaching the intercalation in approximately two hours treatment.

  4. HITS-CLIP: panoramic views of protein-RNA regulation in living cells

    PubMed Central

    Darnell, Robert B.

    2011-01-01

    The study of gene regulation in cells has recently begun to shift from a period dominated by the study of transcription factor-DNA interactions to a new focus on RNA regulation. This was sparked by the still-emerging recognition of the central role for RNA in cellular complexity emanating from the RNA World hypothesis, and has been facilitated by technologic advances, in particular high throughput RNA sequencing and crosslinking methods (RNA-Seq, CLIP, and HITS-CLIP). This article will place these advances in context, and, focusing on CLIP, will explain the method, what it can be used for, and how to approach using it. Examples of the successes, limitations and future of the technique will be discussed. Crosslinking immunoprecipitation (CLIP), coupled with high throughput sequencing (HITS-CLIP), has caught the attention of the RNA community as a means of achieving a new depth of understanding about how protein-RNA complexes interactions regulate gene expression in living cells1–4. This review will describe the context in which CLIP was developed, and provide an up-to-date review of its uses in developing genome-wide maps of RNA-protein interactions and, more recently, microRNA (miRNA) binding sites. The uses, limitations, and future of CLIP will be discussed. PMID:21935890

  5. 3D MHD Simulations of Injector Coupling and Current Drive in HIT-SI

    NASA Astrophysics Data System (ADS)

    Hansen, Chris; Marklin, George; Jarboe, Thomas

    2013-10-01

    A new non-linear reduced MHD code has been developed using the PSI-TET framework, which is capable of modeling the full HIT-SI geometry with consistent boundary conditions for the insulator coated flux conserver. The PSI-TET framework provides general mechanics supporting the development of multi-physics simulation using high order finite methods with a tetrahedral spatial discretization. Using these capabilities an implementation of reduced Hall-MHD was developed where temperature and density are assumed to be uniform and constant, reducing the full MHD equations to the momentum and induction equations. A Nedelec vector basis set is used for the magnetic field, which preserves the divergence free property of the induction equation, and a scalar Lagrange basis is used for each component of the velocity. The equation system is advanced using a time centered implicit scheme, which is solved using a multi-grid preconditioned Newton-Krylov method. Results will be presented focusing on internal injector dynamics and coupling to the Spheromak region. Comparison between this code and experimental data as well as existing NIMROD simulations of HIT-SI, which model the injector operation with boundary conditions on an axisymmetric grid, will also be shown. Work supported by DOE.

  6. Enrichment of virtual hits by progressive shape-matching and docking.

    PubMed

    Choi, Jiwon; He, Ningning; Kim, Nayoung; Yoon, Sukjoon

    2012-02-01

    The main applications of virtual chemical screening include the selection of a minimal receptor-relevant subset of a chemical library with a maximal chemical diversity. We have previously reported that the combination of ligand-centric and receptor-centric virtual screening methods may provide a compromise between computational time and accuracy during the hit enrichment process. In the present work, we propose a "progressive distributed docking" method that improves the virtual screening process using an iterative combination of shape-matching and docking steps. Known ligands with low docking scores were used as initial 3D templates for the shape comparisons with the chemical library. Next, new compounds with good template shape matches and low receptor docking scores were selected for the next round of shape searching and docking. The present iterative virtual screening process was tested for enriching peroxisome proliferator-activated receptor and phosphoinositide 3-kinase relevant compounds from a selected subset of the chemical libraries. It was demonstrated that the iterative combination improved the lead-hopping practice by improving the chemical diversity in the selected list of virtual hits.

  7. Improving the hit-to-lead process: data-driven assessment of drug-like and lead-like screening hits.

    PubMed

    Wunberg, Tobias; Hendrix, Martin; Hillisch, Alexander; Lobell, Mario; Meier, Heinrich; Schmeck, Carsten; Wild, Hanno; Hinzen, Berthold

    2006-02-01

    Drug-like and lead-like hits derived from HTS campaigns provide good starting points for lead optimization. However, too strong emphasis on potency as hit-selection parameter might hamper the success of such projects. A detailed absorption, distribution, metabolism, excretion and toxicology (ADME-Tox) profiling is needed to help identify hits with a minimum number of (known) liabilities. This is particularly true for drug-like hits. Herein, we describe how to break down large numbers of screening hits and we provide a comprehensive overview of the strengths and weaknesses for each structural class. The overall profile (e.g. ligand efficiency, selectivity and ADME-Tox) is the distinctive feature that will define the priority for follow-up.

  8. Combustion method for assay of biological materials labeled with carbon-14 or tritium, or double-labeled

    NASA Technical Reports Server (NTRS)

    Huebner, L. G.; Kisieleski, W. E.

    1969-01-01

    Dry catalytic combustion at high temperatures is used for assaying biological materials labeled carbon-14 and tritium, or double-labeled. A modified oxygen-flask technique is combined with standard vacuum-line techniques and includes convenience of direct in-vial collection of final combustion products, giving quantitative recovery of tritium and carbon-14.

  9. The use of the adding-doubling method for the optical optimization of planar luminescent down shifting layers for solar cells.

    PubMed

    Leyre, Sven; Cappelle, Jan; Durinck, Guy; Abass, Aimi; Hofkens, Johan; Deconinck, Geert; Hanselaer, Peter

    2014-05-05

    To enhance the efficiency of solar cells, a luminescent down shifting layer can be applied in order to adapt the solar spectrum to the spectral internal quantum efficiency of the semiconductor. Optimization of such luminescent down shifting layers benefits from quick and direct evaluation methods. In this paper, the potential of the adding-doubling method is investigated to simulate the optical behavior of an encapsulated solar cell including a planar luminescent down shifting layer. The results of the adding-doubling method are compared with traditional Monte Carlo ray tracing simulations. The average relative deviation is found to be less than 1.5% for the absorptance in the active layer and the reflectance from the encapsulated cell, while the computation time can be decreased with a factor 52. Furthermore, the adding-doubling method is adopted to investigate the suitability of the SrB4O7:5%Sm2 + ,5%Eu2 + phosphor as a luminescent down shifting material in combination with a Copper Indium Gallium Selenide solar cell. A maximum increase of 9.0% in the short-circuit current can be expected if precautions are taken to reduce the scattering by matching the refractive index of host material to the phosphor particles. To be useful as luminescent down shifting material, the minimal value of the quantum yield of the phosphor is determined to be 0.64.

  10. A Hit or Miss History of Statistics at Sandia

    SciTech Connect

    Diegert, Kathleen V.

    1999-08-04

    The Statistics and Human Factors Department at SNL has evolved as the Labs' mission has evolved from engineering designs for the non-nuclear parts of nuclear weapons, including the safety and security components, to a multi-program lab focusing on national security. Twenty years ago their client base was the engineers, scientists, and managers of the nuclear weapon stockpile program, at Sandia and other facilities within the DOE complex. Client relationships developed over years of association. Components and systems were assigned to statisticians so that they could develop a knowledge base in that area. Because of the many different component types and system designs in the stockpile, they typically juggled five or six statistical projects at a time. project participation other than statistical consulting was limited. They rarely had the time to lead project teams, and any skills or inclinations in that direction were often undeveloped. This paper describes a (hit-or-miss) selection of some early and recent efforts. This paper also presents their self-assessment metrics and their external assessment metrics. These metrics were selected to track the business aspects of the department; they are systematic (not hit-or-miss). These two types of histories should allow them to judge whether we're doing the right things, and also doing things right.

  11. Modifications to the HIT-SI Flux Conserver

    NASA Astrophysics Data System (ADS)

    Sieck, P. E.

    2005-10-01

    Operation of the HIT-SI helicity injectors leads to a family of field lines that are not driven directly by the injector voltage. These fields are analogous to the closed toroidal fields inside the current sheet of a "bubble-burst" coaxial gun, but the asymmetric injector geometry on HIT-SI allows these field lines to exit the flux conserver through the midplane diagnostic gap. Furthermore, as relaxation activity arises in the vessel, toroidal modes can push field into this gap. Open field lines are helicity-dissipatingfootnotetextT. R. Jarboe and B. Alper, Phys. Fluids 30 (4), p. 1177, 1987 and should be avoided. A copper strap has been installed across the diagnostic gap. This modification makes the flux conserver more complete, reducing the quantity of helicity-dissipating flux. The effect of the strap on the magnetic structure of the plasma will be shown. The strap will be replaced with localized current-carrying bridges to restore diagnostic access through the gap. A design for these bridges will be presented.

  12. Applying the new HIT results to tokamak and solar plasmas

    NASA Astrophysics Data System (ADS)

    Jarboe, Thomas; Sutherland, Derek; Hossack, Aaron; Nelson, Brian; Morgan, Kyle; Chris, Hansen; Benedett, Thomas; Everson, Chris; Penna, James

    2016-10-01

    Understanding sustainment of stable equilibria with helicity injection in HIT-SI has led to a simple picture of several tokamak features. Perturbations cause a viscous-like force on the current that flattens the λ profile, which sustains and stabilizes the equilibrium. An explanation of the mechanism is based on two properties of stable, ideal, two-fluid, magnetized plasma. First, the electron fluid is frozen to magnetic fields and, therefore, current flow is also magnetic field flow. Second, for a stable equilibrium the structure perpendicular to the flux surface resists deformation. Thus toroidal current is from electrons frozen in nested, rotating resilient flux surfaces. Only symmetric flux surfaces allow free differential current flow. Perturbations cause interference of the flux surfaces. Thus, perturbations cause forces that oppose differential electron rotation and forced differential flow produces a symmetrizing force against perturbations and instability. This mechanism can explain the level of field error that spoils tokamak performance and the rate of poloidal flux loss in argon-induced disruptions in DIII-D. This new understanding has led to an explanation of the source of the solar magnetic fields and the power source for the chromosphere, solar wind and corona. Please place in spheromak and FRC section with other HIT posters.

  13. Thermodynamic criteria for high hit rate antisense oligonucleotide design

    PubMed Central

    Matveeva, O. V.; Mathews, D. H.; Tsodikov, A. D.; Shabalina, S. A.; Gesteland, R. F.; Atkins, J. F.; Freier, S. M.

    2003-01-01

    Antisense oligonucleotides are used for therapeutic applications and in functional genomic studies. In practice, however, many of the oligonucleotides complementary to an mRNA have little or no antisense activity. Theoretical strategies to improve the ‘hit rate’ in antisense screens will reduce the cost of discovery and may lead to identification of antisense oligonucleotides with increased potency. Statistical analysis performed on data collected from more than 1000 experiments with phosphorothioate-modified oligonucleotides revealed that the oligo-probes, which form stable duplexes with RNA (ΔGo37 ≤ –30 kcal/mol) and have small self-interaction potential, are more frequently efficient than molecules that form less stable oligonucleotide–RNA hybrids or more stable self-structures. To achieve optimal statistical preference, the values for self-interaction should be (ΔGo37) ≥ –8 kcal/mol for inter-oligonucleotide pairing and (ΔGo37) ≥ –1.1 kcal/mol for intra-molecular pairing. Selection of oligonucleotides with these thermodynamic values in the analyzed experiments would have increased the ‘hit rate’ by as much as 6-fold. PMID:12930948

  14. Comparison of inguinal hernia repairs performed with lichtenstein, rutkow-robbins, and gilbert double layer graft methods.

    PubMed

    Karaca, A Serdar; Ersoy, Omer Faik; Ozkan, Namik; Yerdel, Mehmet Ali

    2015-02-01

    Tension-free repairs are performed commonly in inguinal hernia operations. The objective of the present study is to compare the outcomes of three different tension-free repair methods known as Lichtenstein, Rutkow-Robbins, and Gilbert double layer. One-hundred and fifty patients diagnosed with inguinal hernia were randomly split into three groups. The comparisons across groups were carried out in terms of operation length, postoperative pain, femoral vein flow velocity, early and late complications, recurrence rates, length of hospital stay, time required to return to work, and cost analysis. No difference was found between the groups regarding age, gender, type and classification of hernia, postoperative pain, and late complications (p > 0.05). Operation length was 53.70 ± 12.32 min in the Lichtenstein group, 44.29 ± 12.37 min in the Rutkow-Robbins group, and 45.21 ± 14.36 min in the Gilbert group (p < 0.05). Mean preoperative and postoperative femoral vein flow velocity values were 13.88 ± 2.237 and 13.42 ± 2.239 cm/s for Lichtenstein group, 12.64 ± 2.98 and 12.16 ± 2.736 cm/s for Rutkow-Robbins group, and 16.02 ± 3.19 and 15.52 ± 3.358 cm/s for the Gilbert group, respectively. Statistical difference was found between all the groups (p < 0.001). However, no difference was determined between the groups regarding the decrease rates (p = 0.977). Among early complications, hematoma was observed in one (2 %) patient of Lichtenstein group, five (10 %) patients of Rutkow-Robbins group, and three (6 %) patients of Gilbert group (p = 0.033). Cost analysis produced the following results for Lichtenstein, Rutkow-Robbins, and Gilbert groups: US $157.94 ± 50.05, $481.57 ± 11.32, and $501.51 ± 73.59, respectively (p < 0.001). Lichtenstein operation was found to be more advantageous compared with the other techniques in terms of cost analysis as well as having unaffected femoral blood

  15. [Diagnosis and treatment of heparin-induced thrombocytopenia (HIT) based on its atypical immunological features].

    PubMed

    Miyata, Shigeki; Maeda, Takuma

    2016-03-01

    Heparin-induced thrombocytopenia (HIT) is a prothrombotic side effect of heparin therapy caused by HIT antibodies, i.e., anti-platelet factor 4 (PF4)/heparin IgG with platelet-activating properties. For serological diagnosis, antigen immunoassays are commonly used worldwide. However, such assays do not indicate their platelet-activating properties, leading to low specificity for the HIT diagnosis. Therefore, over-diagnosis is currently the most serious problem associated with HIT. The detection of platelet-activating antibodies using a washed platelet activation assay is crucial for appropriate HIT diagnosis. Recent advances in our understanding of the pathogenesis of HIT include it having several clinical features atypical for an immune-mediated disease. Heparin-naïve patients can develop IgG antibodies as early as day 4, as in a secondary immune response. Evidence for an anamnestic response on heparin re-exposure is lacking. In addition, HIT antibodies are relatively short-lived, unlike those in a secondary immune response. These lines of evidence suggest that the mechanisms underlying HIT antibody formation may be compatible with a non-T cell-dependent immune reaction. These atypical clinical and serological features should be carefully considered while endeavoring to accurately diagnose HIT, which leads to appropriate therapies such as immediate administration of an alternative anticoagulant to prevent thromboembolic events and re-administration of heparin during surgery involving cardiopulmonary bypass when HIT antibodies are no longer detectable.

  16. Generalized amplitude-phase retrieval algorithm attack on 'double images encryption method with resistance against the special attack based on an asymmetric algorithm'

    NASA Astrophysics Data System (ADS)

    Zhang, Chenggong; He, Wenqi; Cai, Zewei; Peng, Xiang

    2016-09-01

    A generalized amplitude-phase retrieval algorithm (GAPRA) attack on `double images encryption method with resistance against the special attack based on an asymmetric algorithm' (DIEM) is presented in this paper. The analysis shows that the DIEM is a cascaded cryptosystem, which consist of a joint transform correlator architecture and a phasetruncated Fourier transform scheme. A GAPRA attack is proposed and the potential risk of the cascaded cryptosystems is discussed. By using our method, an attacker could crack high-quality results of the plaintexts. A set of simulation results demonstrate the validity and feasibility of the proposed method.

  17. ELECTROMAGNETISM, OPTICS, ACOUSTICS, HEAT TRANSFER, CLASSICAL MECHANICS, AND FLUID DYNAMICS: Double Symplectic Eigenfunction Expansion Method of Free Vibration of Rectangular Thin Plates

    NASA Astrophysics Data System (ADS)

    Wang, Hua; Alatancang; Huang, Jun-Jie

    2009-12-01

    The free vibration problem of rectangular thin plates is rewritten as a new upper triangular matrix differential system. For the associated operator matrix, we find that the two diagonal block operators are Hamiltonian. Moreover, the existence and completeness of normed symplectic orthogonal eigenfunction systems of these two block operators are demonstrated. Based on the completeness, the general solution of the free vibration of rectangular thin plates is given by double symplectic eigenfunction expansion method.

  18. Monitoring Hitting Load in Tennis Using Inertial Sensors and Machine Learning.

    PubMed

    Whiteside, David; Cant, Olivia; Connolly, Molly; Reid, Machar

    2017-02-09

    Quantifying external workload is fundamental to training prescription in sport. In tennis, global positioning data are imprecise and fail to capture hitting loads. The current gold standard (manual notation) is time intensive and often not possible given players' heavy travel schedules. The aim of this study was to develop an automated stroke classification system to help quantify hitting load in tennis. 18 athletes wore an inertial measurement unit (IMU) on their wrist during 66 video-recorded training sessions. Video footage was manually notated such that known shot type (serve, rally forehand, slice forehand, forehand volley, rally backhand, slice backhand, backhand volley, smash or false positive) was associated with the corresponding IMU data for 28,582 shots. Six types of machine learning models were then constructed to classify true shot type from the IMU signals. Across 10-fold cross-validation, a cubic kernel support vector machine classified binned shots (overhead, forehand or backhand) with an accuracy of 97.4%. A second cubic kernel support vector machine achieved 93.2% accuracy when classifying all 9 shot types. With a view to monitoring external load, the combination of miniature inertial sensors and machine learning can offer a practical and automated method for quantifying shot counts and for discriminating shot types in elite tennis players.

  19. Utility of Redundant Combinatorial Libraries in Distinguishing High and Low Quality Screening Hits

    PubMed Central

    2014-01-01

    Large one-bead one-compound (OBOC) combinatorial libraries can be constructed relatively easily by solid-phase split and pool synthesis. The use of resins with hydrophilic surfaces, such as TentaGel, allows the beads to be used directly in screens for compounds that bind selectively to labeled proteins, nucleic acids, or other biomolecules. However, we have found that this method, while useful, has a high false positive rate. In other words, beads that are scored as hits often display compounds that prove to be poor ligands for the target of interest when they are resynthesized and carried through validation trials. This results in a significant waste of time and resources in cases where putative hits cannot be validated without resynthesis. Here, we report that this problem can be largely eliminated through the use of redundant OBOC libraries, where more than one bead displaying the same compound is present in the screen. We show that compounds isolated more than once are likely to be high quality ligands for the target of interest, whereas compounds isolated only once have a much higher likelihood of being poor ligands. While the use of redundant libraries does limit the number of unique compounds that can be screened at one time in this format, the overall savings in time, effort, and materials makes this a more efficient route to the isolation of useful ligands for biomolecules. PMID:24749624

  20. Double checking: a second look

    PubMed Central

    Chreim, Samia; Forster, Alan

    2015-01-01

    Abstract Rationale, aims and objectives Double checking is a standard practice in many areas of health care, notwithstanding the lack of evidence supporting its efficacy. We ask in this study: ‘How do front line practitioners conceptualize double checking? What are the weaknesses of double checking? What alternate views of double checking could render it a more robust process?’ Method This is part of a larger qualitative study based on 85 semi‐structured interviews of health care practitioners in general internal medicine and obstetrics and neonatology; thematic analysis of the transcribed interviews was undertaken. Inductive and deductive themes are reported. Results Weaknesses in the double checking process include inconsistent conceptualization of double checking, double (or more) checking as a costly and time‐consuming procedure, double checking trusted as an accepted and stand‐alone process, and double checking as preventing reporting of near misses. Alternate views of double checking that would render it a more robust process include recognizing that double checking requires training and a dedicated environment, Introducing automated double checking, and expanding double checking beyond error detection. These results are linked with the concepts of collective efficiency thoroughness trade off (ETTO), an in‐family approach, and resilience. Conclusion(s) Double checking deserves more questioning, as there are limitations to the process. Practitioners could view double checking through alternate lenses, and thus help strengthen this ubiquitous practice that is rarely challenged. PMID:26568537

  1. Technology Review of Nondestructive Methods for Examination of Water Intrusion Areas on Hanford’s Double-Shell Waste Tanks

    SciTech Connect

    Watkins, Michael L.; Pardini, Allan F.

    2008-05-09

    Under a contract with CH2M Hill Hanford Group, Inc., PNNL has performed a review of the NDE technology and methods for examination of the concrete dome structure of Hanford’s double-shell tanks. The objective was to provide a matrix of methodologies that could be evaluated based on applicability, ease of deployment, and results that could provide information that could be used in the ongoing structural analysis of the tank dome. PNNL performed a technology evaluation with the objective of providing a critical literature review for all applicable technologies based on constraints provided by CH2M HILL. These constraints were not mandatory, but were desired. These constraints included performing the evaluation without removing any soil from the top of the tank, or if necessary, requesting that the hole diameter needed to gain access to evaluate the top of the tank structure to be no greater than approximately 12-in. in diameter. PNNL did not address the details of statistical sampling requirements as they depend on an unspecified risk tolerance. PNNL considered these during the technology evaluation and have reported the results in the remainder of this document. Many of the basic approaches to concrete inspection that were reviewed in previous efforts are still in use. These include electromagnetic, acoustic, radiographic, etc. The primary improvements in these tools have focused on providing quantitative image reconstruction, thus providing inspectors and analysts with three-dimensional data sets that allow for operator visualization of relevant abnormalities and analytical integration into structural performance models. Available instruments, such as radar used for bridge deck inspections, rely on post-processing algorithms and do not provide real-time visualization. Commercially available equipment only provides qualitative indications of relative concrete damage. It cannot be used as direct input for structural analysis to assess fitness for use and if

  2. Antibodies associated with heparin-induced thrombocytopenia (HIT) inhibit activated protein C generation: new insights into the prothrombotic nature of HIT

    PubMed Central

    Krishnaswamy, Sriram; Rauova, Lubica; Zhai, Li; Hayes, Vincent; Amirikian, Karine; Esko, Jeffrey D.; Bougie, Daniel W.; Aster, Richard H.; Cines, Douglas B.; Poncz, Mortimer

    2011-01-01

    Heparin-induced thrombocytopenia (HIT) is caused by antibodies that recognize complexes between platelet factor 4 (PF4) and heparin or glycosaminoglycan side chains. These antibodies can lead to a limb- and life-threatening prothrombotic state. We now show that HIT antibodies are able to inhibit generation of activated protein C (aPC) by thrombin/thrombomodulin (IIa/TM) in the presence of PF4. Tetrameric PF4 potentiates aPC generation by formation of complexes with chondroitin sulfate (CS) on TM. Formation of these complexes occurs at a specific molar ratio of PF4 to glycosaminoglycan. This observation and the finding that the effect of heparin on aPC generation depends on the concentration of PF4 suggest similarity between PF4/CS complexes and those that bind HIT antibodies. HIT antibodies reduced the ability of PF4 to augment aPC formation. Cationic protamine sulfate, which forms similar complexes with heparin, also enhanced aPC generation, but its activity was not blocked by HIT antibodies. Our studies provide evidence that complexes formed between PF4 and TM's CS may play a physiologic role in potentiating aPC generation. Recognition of these complexes by HIT antibodies reverses the PF4-dependent enhancement in aPC generation and may contribute to the prothrombotic nature of HIT. PMID:21772054

  3. Inflammation and the Two-Hit Hypothesis of Schizophrenia

    PubMed Central

    Feigenson, Keith A.; Kusnecov, Alex W.; Silverstein, Steven M.

    2014-01-01

    The high societal and individual cost of schizophrenia necessitates finding better, more effective treatment, diagnosis, and prevention strategies. One of the obstacles in this endeavor is the diverse set of etiologies that comprises schizophrenia. A substantial body of evidence has grown over the last few decades to suggest that schizophrenia is a heterogeneous syndrome with overlapping symptoms and etiologies. At the same time, an increasing number of clinical, epidemiological, and experimental studies have shown links between schizophrenia and inflammatory conditions. In this review, we analyze the literature on inflammation and schizophrenia, with a particular focus on comorbidity, biomarkers, and environmental insults. We then identify several mechanisms by which inflammation could influence the development of schizophrenia via the two-hit hypothesis. Lastly, we note the relevance of these findings to clinical applications in the diagnosis, prevention, and treatment of schizophrenia. PMID:24247023

  4. New Hits as Antagonists of GPR103 Identified by HTS

    PubMed Central

    2014-01-01

    Preclinical data indicate that GPR103 receptor and its endogenous neuropeptides QRFP26 and QRFP43 are involved in appetite regulation. A high throughput screening (HTS) for small molecule GPR103 antagonists was performed with the clinical goal to target weight management by modulation of appetite. A high hit rate from the HTS and initial low confirmation with respect to functional versus affinity data challenged us to revise the established screening cascade. To secure high quality data while increasing throughput, the binding assay was optimized on quality to run at single concentration. This strategy enabled evaluation of a larger fraction of chemical clusters and singletons delivering 17 new compound classes for GPR103 antagonism. Representative compounds from three clusters are presented. One of the identified clusters was further investigated, and an initial structure–activity relationship study is reported. The most potent compound identified had a pIC50 of 7.9 with an improved ligand lipophilic efficiency. PMID:24900874

  5. Pathomechanisms Underlying X-Adrenoleukodystrophy: A Three-Hit Hypothesis

    PubMed Central

    Singh, Inderjit; Pujol, Aurora

    2011-01-01

    X-adrenoleukodystrophy (X-ALD) is a complex disease where inactivation of ABCD1 gene results in clinically diverse phenotypes, the fatal disorder of cerebral ALD (cALD) or a milder disorder of adrenomyeloneuropathy (AMN). Loss of ABCD1 function results in defective beta oxidation of very long chain fatty acids (VLCFA) resulting in excessive accumulation of VLCFA, the biochemical “hall mark” of X-ALD. At present, the ABCD1-mediated mechanisms that determine the different phenotype of X-ALD are not well understood. The studies reviewed here suggest for a “three-hit hypothesis” for neuropathology of cALD. An improved understanding of the molecular mechanisms associated with these three phases of cALD disease should facilitate the development of effective pharmacological therapeutics for X-ALD. PMID:20626745

  6. Building markets: Most recycling markets hit bottom in 1993

    SciTech Connect

    Not Available

    1994-04-01

    For most recycling markets, 1993 was the year prices hit bottom. However, in the final weeks of 1993, recyclers saw slight, but much appreciated, price increases for most commodities. Overall in 1993, glass, plastics, and steel markets remained relatively stable, with some price fluctuations, while markets for paper and aluminum weakened. The paper recycling industry suffered from weak but volatile markets for all grades of secondary fiber, despite and explosion of new deinking facilities, and a host of voluntary recycled-content purchasing agreements. In a move that some recyclers say may be a needed shot in the arm for paper markets, Clinton signed an Executive Order in October 1993 requiring federal agencies to purchase printing and writing paper containing 20% post-consumer material by the end of 1994 and 30% post-consumer content by the end of 1998. Many recyclers are hoping that this will serve as a model for state and local governments.

  7. Imidazolopiperazines: hit to lead optimization of new antimalarial agents.

    PubMed

    Wu, Tao; Nagle, Advait; Kuhen, Kelli; Gagaring, Kerstin; Borboa, Rachel; Francek, Caroline; Chen, Zhong; Plouffe, David; Goh, Anne; Lakshminarayana, Suresh B; Wu, Jeanette; Ang, Hui Qing; Zeng, Peiting; Kang, Min Low; Tan, William; Tan, Maria; Ye, Nicole; Lin, Xuena; Caldwell, Christopher; Ek, Jared; Skolnik, Suzanne; Liu, Fenghua; Wang, Jianling; Chang, Jonathan; Li, Chun; Hollenbeck, Thomas; Tuntland, Tove; Isbell, John; Fischli, Christoph; Brun, Reto; Rottmann, Matthias; Dartois, Veronique; Keller, Thomas; Diagana, Thierry; Winzeler, Elizabeth; Glynne, Richard; Tully, David C; Chatterjee, Arnab K

    2011-07-28

    Starting from a hit series from a GNF compound library collection and based on a cell-based proliferation assay of Plasmodium falciparum, a novel imidazolopiperazine scaffold was optimized. SAR for this series of compounds is discussed, focusing on optimization of cellular potency against wild-type and drug resistant parasites and improvement of physiochemical and pharmacokinetic properties. The lead compounds in this series showed good potencies in vitro and decent oral exposure levels in vivo. In a Plasmodium berghei mouse infection model, one lead compound lowered the parasitemia level by 99.4% after administration of 100 mg/kg single oral dose and prolonged mice survival by an average of 17.0 days. The lead compounds were also well-tolerated in the preliminary in vitro toxicity studies and represents an interesting lead for drug development.

  8. More hurricanes to hit western Europe due to global warming

    NASA Astrophysics Data System (ADS)

    Haarsma, Reindert J.; Hazeleger, Wilco; Severijns, Camiel; Vries, Hylke; Sterl, Andreas; Bintanja, Richard; Oldenborgh, Geert Jan; Brink, Henk W.

    2013-05-01

    We use a very high resolution global climate model (~25 km grid size) with prescribed sea surface temperatures to show that greenhouse warming enhances the occurrence of hurricane-force (> 32.6 m s-1) storms over western Europe during early autumn (August-October), the majority of which originate as a tropical cyclone. The rise in Atlantic tropical sea surface temperatures extends eastward the breeding ground of tropical cyclones, yielding more frequent and intense hurricanes following pathways directed toward Europe. En route they transform into extratropical depressions and reintensify after merging with the midlatitude baroclinic unstable flow. Our model simulations clearly show that future tropical cyclones are more prone to hit western Europe, and do so earlier in the season, thereby increasing the frequency and impact of hurricane force winds.

  9. Quantization of Random Walks: Search Algorithms and Hitting Time

    NASA Astrophysics Data System (ADS)

    Santha, Miklos

    Many classical search problems can be cast in the following abstract framework: Given a finite set X and a subset M ⊆ X of marked elements, detect if M is empty or not, or find an element in M if there is any. When M is not empty, a naive approach to the finding problem is to repeatedly pick a uniformly random element of X until a marked element is sampled. A more sophisticated approach might use a Markov chain, that is a random walk on the state space X in order to generate the samples. In that case the resources spent for previous steps are often reused to generate the next sample. Random walks also model spatial search in physical regions where the possible moves are expressed by the edges of some specific graph. The hitting time of a Markov chain is the number of steps necessary to reach a marked element, starting from the stationary distribution of the chain.

  10. Inflammation and the two-hit hypothesis of schizophrenia.

    PubMed

    Feigenson, Keith A; Kusnecov, Alex W; Silverstein, Steven M

    2014-01-01

    The high societal and individual cost of schizophrenia necessitates finding better, more effective treatment, diagnosis, and prevention strategies. One of the obstacles in this endeavor is the diverse set of etiologies that comprises schizophrenia. A substantial body of evidence has grown over the last few decades to suggest that schizophrenia is a heterogeneous syndrome with overlapping symptoms and etiologies. At the same time, an increasing number of clinical, epidemiological, and experimental studies have shown links between schizophrenia and inflammatory conditions. In this review, we analyze the literature on inflammation and schizophrenia, with a particular focus on comorbidity, biomarkers, and environmental insults. We then identify several mechanisms by which inflammation could influence the development of schizophrenia via the two-hit hypothesis. Lastly, we note the relevance of these findings to clinical applications in the diagnosis, prevention, and treatment of schizophrenia. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. Ozone hits low levels over Antarctica, U. S

    SciTech Connect

    Zurer, P.

    1993-10-04

    This year's Antarctic ozone hole is as deep as any ever observed and is approaching the record geographical extent of 1992, according to preliminary satellite data. In addition, both groundbased and satellite observations indicate that ozone concentrations over the U.S. hit record lows earlier this year. For more than a decade, almost all the ozone at certain altitudes over Antarctica has been destroyed as the Sun returns to the polar region in September. This dramatic photochemical depletion, catalyzed by chlorine and bromine from man-made compounds, reaches its nadir in early October. Ozone levels return to near normal later in the season, when the circular pattern of winds that isolates air over Antarctica breaks down, and ozone-rich air pours in from the north.

  12. Revisiting methods to characterize bioelectrochemical systems: The influence of uncompensated resistance (iRu-drop), double layer capacitance, and junction potential

    NASA Astrophysics Data System (ADS)

    Madjarov, J.; Popat, S. C.; Erben, J.; Götze, A.; Zengerle, R.; Kerzenmacher, S.

    2017-07-01

    Bioelectrochemical systems (BES) are characterized with methods derived from the electrochemistry field, for e.g. linear sweep voltammetry (LSV), cyclic voltammetry (CV), and chronoamperometry. The limitations of electrochemical measurements are well known and described, but there are new challenges when these are applied to biological systems. For instance, the electrolyte conditions are predefined by the application involving the use of low conductivities, leading to an increase of two error sources: the iRu-drop and junction potential. Furthermore, the use of electrodes with high surface areas and thus high double layer capacitance lead to capacitive currents that superimpose the biocatalytic current of interest. Even though these problems have often been mentioned in the bioelectrochemistry field, they are seldom considered and reported in publications. The scope of this work is to present and discuss methods to quantify the Ru and double layer capacitance, and to demonstrate their significant influence on the recording of polarization curves. In a typical BES setup, it is exemplarily shown that due to iRu-drop measured potentials can deviate by more than 200 mV from the actual potential. Similarly, more than 40% of a recorded electrode current can originate from the electrode material's double layer capacitance.

  13. Anxiety vulnerability in women: a two-hit hypothesis.

    PubMed

    Catuzzi, Jennifer E; Beck, Kevin D

    2014-09-01

    Females are twice as likely to develop an anxiety disorder compared to males, and thus, are believed to possess an innate vulnerability that increases their susceptibility to develop an anxiety disorder. However, studies using aversive learning paradigms to model anxiety disorders in humans and animals have revealed contradictory results. While females exhibit the ability to rapidly acquire stimulus-response associations, which may result from a greater attentional bias towards threat, females are also capable to readily extinguish these associations. Thus, there is little evidence to suggest that the female sex represents a vulnerability factor of anxiety, per se. However, if females are to possess a second vulnerability factor that increases the inflexibility of stimulus-response associations, then an anxiety disorder may be more likely to develop. Behavioral inhibition (BI) is a vulnerability factor associated with the formation of inflexible stimulus-response associations. In this "two hit" model of anxiety vulnerability, females possessing a BI temperament will rapidly acquire stimulus-response associations that are resistant to extinction, resulting in the development of an anxiety disorder. In this review we explore evidence for a "two-hit" hypothesis underlying anxiety vulnerability in females. We explore the literature for evidence of a sex difference in attentional bias towards threat that may lead to the facilitated acquisition of stimulus-response associations in females. We also provide evidence that BI is associated with inflexible stimulus-response association formation. We conclude with data generated from our laboratory that highlights the additive effect of the female sex and behavioral inhibition vulnerabilities using a model behavior for anxiety disorder-susceptibility, active avoidance.

  14. A Facile Method to Prepare Double-Layer Isoporous Hollow Fiber Membrane by In Situ Hydrogen Bond Formation in the Spinning Line.

    PubMed

    Noor, Nazia; Koll, Joachim; Radjabian, Maryam; Abetz, Clarissa; Abetz, Volker

    2016-03-01

    A double-layer hollow fiber is fabricated where an isoporous surface of polystyrene-block-poly(4-vinylpyridine) is fixed on a support layer by co-extrusion. Due to the sulfonation of the support layer material, delamination of the two layers is suppressed without increasing the number of subsequent processing steps for isoporous composite membrane formation. Electron microscope-energy-dispersive X-ray spectroscopy images unveil the existence of a high sulfur concentration in the interfacial region by which in-process H-bond formation between the layers is evidenced. For the very first time, our study reports a facile method to fabricate a sturdy isoporous double-layer hollow fiber.

  15. Application of a method for calculating coal quantity feed into boiler for double inlet and outlet ball mill in the coordinated control system

    NASA Astrophysics Data System (ADS)

    Chen, Houtao; Wang, Xihui; Wang, Zhijie; Peng, Liang

    2017-05-01

    Accuracy of the measurement of coal quantity feed into the boiler furnace has great influence on the combustion and coordinated control of power plant. According to the characteristics of double inlet and outlet mill pulverizing system, the method of calculating the amount of coal into furnace using the correlated variable was presented. On this basis, the coordinated control system was designed. Running results show that the method of calculating the fuel quantity accurately and effectively guarantee the stability of coordinated control system. It has a high adjustment quality.

  16. 76 FR 14975 - HIT Standards Committee's Workgroup Meetings; Notice of Meetings

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-18

    ... access only. Name of Committees: HIT Standards Committee's Workgroups: Clinical Operations, Vocabulary... specific subject matter, e.g., clinical operations vocabulary standards, clinical quality,...

  17. 76 FR 46297 - HIT Standards Committee's Workgroup Meetings; Notice of Meetings

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-02

    ... access only. Name of Committees: HIT Standards Committee's Workgroups: Clinical Operations, Vocabulary... issues related to their specific subject matter, e.g., clinical operations vocabulary standards,...

  18. Reliability and Validity of the Persian HIT-6 Questionnaire in Migraine and Tension-type Headache.

    PubMed

    Zandifar, Alireza; Banihashemi, Mahboobeh; Haghdoost, Faraidoon; Masjedi, Samaneh S; Manouchehri, Navid; Asgari, Fatemeh; Najafi, Mohammad R; Ghorbani, Abbas; Zandifar, Samaneh; Saadatnia, Mohammad; White, Michelle K

    2014-09-01

    Headache Impact Test (HIT-6) measures the impact headaches in a 1-month period. We validated the Persian translation of HIT-6, compared the HIT-6 psychometric analysis between migraine and tension-type headache (TTH) patients, and evaluated the capability of HIT-6 to differentiate between TTH, chronic migraine, and episodic migraine. Qualified participants, including 274 patients diagnosed with migraine or TTH, were required to complete HIT-6, SF-36v2, and a symptoms questionnaire on their first visit. At 3 and 8 weeks from first visit, participants completed HIT-6. Internal consistency (Cronbach's α) and test-retest reproducibility (Pearson's correlation coefficient) were used to assess reliability. Convergent validity was also assessed. Tension-type headache, episodic, and chronic migraines included 24.5%, 61.9%, and 13.6% of the participants, respectively. Internal consistency among all patients, TTH, and migraine in the first visit were 0.74, 0.77, and 0.73, respectively. Test-retest reliability for HIT-6 between visit 1 and 2 showed a moderate level of correlation (r = 0.50). Convergent validity and also item total correlation were acceptable. There was no significant difference in HIT-6 total score between TTH and migraine. Persian HIT-6 is a valid and reliable questionnaire for the evaluation of headache. However, it cannot differentiate between chronic migraine, episodic migraine, and TTH in Iranian population. © 2013 World Institute of Pain.

  19. Validation of the Impact of Health Information Technology (I-HIT) Scale: an international collaborative.

    PubMed

    Dykes, Patricia C; Hurley, Ann C; Brown, Suzanne; Carr, Robyn; Cashen, Margaret; Collins, Rita; Cook, Robyn; Currie, Leanne; Docherty, Charles; Ensio, Anneli; Foster, Joanne; Hardiker, Nicholas R; Honey, Michelle L L; Killalea, Rosaleen; Murphy, Judy; Saranto, Kaija; Sensmeier, Joyce; Weaver, Charlotte

    2009-01-01

    In 2005, the Healthcare Information Management Systems Society (HIMSS) Nursing Informatics Community developed a survey to measure the impact of health information technology (HIT), the I-HIT Scale, on the role of nurses and interdisciplinary communication in hospital settings. In 2007, nursing informatics colleagues from Australia, England, Finland, Ireland, New Zealand, Scotland and the United States formed a research collaborative to validate the I-HIT across countries. All teams have completed construct and face validation in their countries. Five out of six teams have initiated reliability testing by practicing nurses. This paper reports the international collaborative's validation of the I-HIT Scale completed to date.

  20. Validation of a rapid DNA process with the RapidHIT(®) ID system using GlobalFiler(®) Express chemistry, a platform optimized for decentralized testing environments.

    PubMed

    Salceda, Susana; Barican, Arnaldo; Buscaino, Jacklyn; Goldman, Bruce; Klevenberg, Jim; Kuhn, Melissa; Lehto, Dennis; Lin, Frank; Nguyen, Phong; Park, Charles; Pearson, Francesca; Pittaro, Rick; Salodkar, Sayali; Schueren, Robert; Smith, Corey; Troup, Charles; Tsou, Dean; Vangbo, Mattias; Wunderle, Justus; King, David

    2017-05-01

    The RapidHIT(®) ID is a fully automated sample-to-answer system for short tandem repeat (STR)-based human identification. The RapidHIT ID has been optimized for use in decentralized environments and processes presumed single source DNA samples, generating Combined DNA Index System (CODIS)-compatible DNA profiles in less than 90min. The system is easy to use, requiring less than one minute of hands-on time. Profiles are reviewed using centralized linking software, RapidLINK™ (IntegenX, Pleasanton, CA), a software tool designed to collate DNA profiles from single or multiple RapidHIT ID systems at different geographic locations. The RapidHIT ID has been designed to employ GlobalFiler(®) Express and AmpFLSTR(®) NGMSElect™, Thermo Fisher Scientific (Waltham, MA) STR chemistries. The Developmental Validation studies were performed using GlobalFiler(®) Express with single source reference samples according to Scientific Working Group for DNA Analysis Methods guidelines. These results show that multiple RapidHIT ID systems networked with RapidLINK software form a highly reliable system for wide-scale deployment in locations such as police booking stations and border crossings enabling real-time testing of arrestees, potential human trafficking victims, and other instances where rapid turnaround is essential.