Sample records for double label single

  1. Double-labeled donor probe can enhance the signal of fluorescence resonance energy transfer (FRET) in detection of nucleic acid hybridization

    PubMed Central

    Okamura, Yukio; Kondo, Satoshi; Sase, Ichiro; Suga, Takayuki; Mise, Kazuyuki; Furusawa, Iwao; Kawakami, Shigeki; Watanabe, Yuichiro

    2000-01-01

    A set of fluorescently-labeled DNA probes that hybridize with the target RNA and produce fluorescence resonance energy transfer (FRET) signals can be utilized for the detection of specific RNA. We have developed probe sets to detect and discriminate single-strand RNA molecules of plant viral genome, and sought a method to improve the FRET signals to handle in vivo applications. Consequently, we found that a double-labeled donor probe labeled with Bodipy dye yielded a remarkable increase in fluorescence intensity compared to a single-labeled donor probe used in an ordinary FRET. This double-labeled donor system can be easily applied to improve various FRET probes since the dependence upon sequence and label position in enhancement is not as strict. Furthermore this method could be applied to other nucleic acid substances, such as oligo RNA and phosphorothioate oligonucleotides (S-oligos) to enhance FRET signal. Although the double-labeled donor probes labeled with a variety of fluorophores had unexpected properties (strange UV-visible absorption spectra, decrease of intensity and decay of donor fluorescence) compared with single-labeled ones, they had no relation to FRET enhancement. This signal amplification mechanism cannot be explained simply based on our current results and knowledge of FRET. Yet it is possible to utilize this double-labeled donor system in various applications of FRET as a simple signal-enhancement method. PMID:11121494

  2. Double-labelling immunohistochemistry for MGMT and a “cocktail” of non-tumourous elements is a reliable, quick and easy technique for inferring methylation status in glioblastomas and other primary brain tumours

    PubMed Central

    2013-01-01

    Background Our aim was to develop a new protocol for MGMT immunohistochemistry with good agreement between observers and good correlation with molecular genetic tests of tumour methylation. We examined 40 primary brain tumours (30 glioblastomas and 10 oligodendroglial tumours) with our new technique, namely double-labelling immunohistochemistry for MGMT and a "cocktail" of non-tumour antigens (CD34, CD45 and CD68). We compared the results with single-labelling immunohistochemistry for MGMT and methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA, a recognised molecular genetic technique which we applied as the gold-standard for the methylation status). Results Double-labelling immunohistochemistry for MGMT produced a visual separation of tumourous and non-tumourous elements on the same histological slide, making it quick and easy to determine whether tumour cell nuclei were MGMT-positive or MGMT-negative (and thereby infer the methylation status of the tumour). We found good agreement between observers (kappa 0.76) and within observer (kappa 0.84). Furthermore, double-labelling showed good specificity (80%), sensitivity (73.33%), positive predictive value (PPV, 83.33%) and negative predictive value (NPV, 68.75%) compared to MS-MLPA. Double-labelling was quicker and easier to assess than single-labelling and it outperformed quantitative computerised image analysis of MGMT single-labelling in terms of sensitivity, specificity, PPV and NPV. Conclusions Double-labelling immunohistochemistry for MGMT and a cocktail of non-tumourous elements provides a "one look" method for determining whether tumour cell nuclei are MGMT-positive or MGMT-negative. This can be used to infer the methylation status of the tumour. There is good observer agreement and good specificity, sensitivity, PPV and NPV compared to a molecular gold-standard. PMID:24252243

  3. Double-labelling immunohistochemistry for MGMT and a "cocktail" of non-tumourous elements is a reliable, quick and easy technique for inferring methylation status in glioblastomas and other primary brain tumours.

    PubMed

    Burke, Elinor; Grobler, Mariana; Elderfield, Kay; Bond, Frances; Crocker, Matthew; Taylor, Rohan; Bridges, Leslie R

    2013-06-10

    Our aim was to develop a new protocol for MGMT immunohistochemistry with good agreement between observers and good correlation with molecular genetic tests of tumour methylation. We examined 40 primary brain tumours (30 glioblastomas and 10 oligodendroglial tumours) with our new technique, namely double-labelling immunohistochemistry for MGMT and a "cocktail" of non-tumour antigens (CD34, CD45 and CD68). We compared the results with single-labelling immunohistochemistry for MGMT and methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA, a recognised molecular genetic technique which we applied as the gold-standard for the methylation status). Double-labelling immunohistochemistry for MGMT produced a visual separation of tumourous and non-tumourous elements on the same histological slide, making it quick and easy to determine whether tumour cell nuclei were MGMT-positive or MGMT-negative (and thereby infer the methylation status of the tumour). We found good agreement between observers (kappa 0.76) and within observer (kappa 0.84). Furthermore, double-labelling showed good specificity (80%), sensitivity (73.33%), positive predictive value (PPV, 83.33%) and negative predictive value (NPV, 68.75%) compared to MS-MLPA. Double-labelling was quicker and easier to assess than single-labelling and it outperformed quantitative computerised image analysis of MGMT single-labelling in terms of sensitivity, specificity, PPV and NPV. Double-labelling immunohistochemistry for MGMT and a cocktail of non-tumourous elements provides a "one look" method for determining whether tumour cell nuclei are MGMT-positive or MGMT-negative. This can be used to infer the methylation status of the tumour. There is good observer agreement and good specificity, sensitivity, PPV and NPV compared to a molecular gold-standard.

  4. Peripheral territory and neuropeptides of the trigeminal ganglion neurons centrally projecting through the oculomotor nerve demonstrated by fluorescent retrograde double-labeling combined with immunocytochemistry.

    PubMed

    Bortolami, R; Calzà, L; Lucchi, M L; Giardino, L; Callegari, E; Manni, E; Pettorossi, V E; Barazzoni, A M; Lalatta Costerbosa, G

    1991-04-26

    The peripheral territories of sheep trigeminal neurons which send their central process to the brainstem through the oculomotor nerve were investigated by the use of fluorescent tracers in double-labeling experiments. For this purpose Diamidino yellow (DY) injection into the oculomotor nerve was combined with Fast blue (FB) injection either into the extraocular muscles (EOMs), or the cornea, or the superior eyelid. Double-labeled DY + FB cells were found in the ophthalmic region of the trigeminal ganglion in addition to single-labeled DY or FB cells. The DY and DY + FB-labeled trigeminal cells were analysed immunocytochemically for their content of substance P (SP)-, calcitonin gene-related peptide (CGRP)-, and cholecystokinin-8 (CCK-8)-like. All single-labeled DY cells showed SP-, CGRP- or CCK-8-like immunoreactivity. Double-labeled DY + FB neurons innervating the EOMs were immunoreactive for each of the three peptides, whereas double-labeled neurons supplying the cornea were only CGRP-like positive. The findings suggest that, in the sheep, trigeminal neurons which send their process centrally through the oculomotor nerve supply the EOMs, the cornea, and the superior eyelid and contain neuropeptides which are usually associated with pain sensation.

  5. Double-label immunofluorescence method for simultaneous detection of adenovirus and herpes simplex virus from the eye.

    PubMed

    Walpita, P; Darougar, S

    1989-07-01

    The development and application of a double-label immunofluorescence method which has the potential to screen for single or dual infections from any site, in single shell vial cultures, is described. In this study, a total of 1,141 ocular specimens were inoculated in shell vials, centrifuged at 15,000 X g for 1 h, incubated at 37 degrees C for 48 h, and fixed in methanol at room temperature for 15 min. The virus inclusions were detected by staining with a double-label indirect immunofluorescence procedure using mixtures of appropriate first antibodies, followed by fluorescein- and rhodamine-conjugated second antibodies. Each specimen was also inoculated in parallel by the conventional virus isolation method. The sensitivity and specificity of the double-label shell vial procedure were comparable to those with the conventional method, and the former test took only 48 h to complete. The test offers a rapid and simple single-vial procedure which allows for individual or simultaneous detection of multiple pathogens. It results in savings in time and cost over the conventional virus isolation method and other shell vial procedures.

  6. Detecting RNA/DNA hybridization using double-labeled donor probes with enhanced fluorescence resonance energy transfer signals.

    PubMed

    Okamura, Yukio; Watanabe, Yuichiro

    2006-01-01

    Fluorescence resonance energy transfer (FRET) occurs when two fluorophores are in close proximity, and the emission energy of a donor fluorophore is transferred to excite an acceptor fluorophore. Using such fluorescently labeled oligonucleotides as FRET probes, makes possible specific detection of RNA molecules even if similar sequences are present in the environment. A higher ratio of signal to background fluorescence is required for more sensitive probe detection. We found that double-labeled donor probes labeled with BODIPY dye resulted in a remarkable increase in fluorescence intensity compared to single-labeled donor probes used in conventional FRET. Application of this double-labeled donor system can improve a variety of FRET techniques.

  7. Current-voltage characteristics of double stranded versus single stranded DNA molecules

    NASA Astrophysics Data System (ADS)

    Hartzell, B.; Chen, Hong; Heremans, J. J.; McCord, B.; Soghomonian, V.

    2004-03-01

    Investigation of DNA conductivity has focused on the native, duplex structure, with controversial results. Here, we present the influence of the double-helical structure on charge transport through lambda DNA molecules. The current-voltage (I-V) characteristics of both disulfide-labeled double stranded DNA (dsDNA) and disulfide-labeled single stranded DNA (ssDNA) were measured. The ssDNA was formed from the dsDNA using two different methods for comparison purposes: a thermal/chemical denaturation and enzymatic digestion utilizing lambda exonuclease. Resulting I-V characteristics of both the double stranded and single stranded samples were close-to-linear when measured at room temperature. However, the ssDNA samples consistently gave conductivity values about two orders of magnitude smaller in amplitude. Our results suggest an integral relationship between the native structure of DNA with its stacked base pairs and the molecule's ability to support charge transport.(NSF NIRT 0103034)

  8. Visualizing repetitive diffusion activity of double-strand RNA binding proteins by single molecule fluorescence assays.

    PubMed

    Koh, Hye Ran; Wang, Xinlei; Myong, Sua

    2016-08-01

    TRBP, one of double strand RNA binding proteins (dsRBPs), is an essential cofactor of Dicer in the RNA interference pathway. Previously we reported that TRBP exhibits repetitive diffusion activity on double strand (ds)RNA in an ATP independent manner. In the TRBP-Dicer complex, the diffusion mobility of TRBP facilitates Dicer-mediated RNA cleavage. Such repetitive diffusion of dsRBPs on a nucleic acid at the nanometer scale can be appropriately captured by several single molecule detection techniques. Here, we provide a step-by-step guide to four different single molecule fluorescence assays by which the diffusion activity of dsRBPs on dsRNA can be detected. One color assay, termed protein induced fluorescence enhancement enables detection of unlabeled protein binding and diffusion on a singly labeled RNA. Two-color Fluorescence Resonance Energy Transfer (FRET) in which labeled dsRBPs is applied to labeled RNA, allows for probing the motion of protein along the RNA axis. Three color FRET reports on the diffusion movement of dsRBPs from one to the other end of RNA. The single molecule pull down assay provides an opportunity to collect dsRBPs from mammalian cells and examine the protein-RNA interaction at single molecule platform. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Palladium-catalyzed double carbonylation using near stoichiometric carbon monoxide: expedient access to substituted 13C2-labeled phenethylamines.

    PubMed

    Nielsen, Dennis U; Neumann, Karoline; Taaning, Rolf H; Lindhardt, Anders T; Modvig, Amalie; Skrydstrup, Troels

    2012-07-20

    A novel and general approach for (13)C(2)- and (2)H-labeled phenethylamine derivatives has been developed, based on a highly convergent single-step assembly of the carbon skeleton. The efficient incorporation of two carbon-13 isotopes into phenethylamines was accomplished using a palladium-catalyzed double carbonylation of aryl iodides with near stoichiometric carbon monoxide.

  10. High-Throughput Particle Uptake Analysis by Imaging Flow Cytometry

    PubMed Central

    Smirnov, Asya; Solga, Michael D.; Lannigan, Joanne; Criss, Alison K.

    2017-01-01

    Quantifying the efficiency of particle uptake by host cells is important in fields including infectious diseases, autoimmunity, cancer, developmental biology, and drug delivery. Here we present a protocol for high-throughput analysis of particle uptake using imaging flow cytometry, using the bacterium Neisseria gonorrhoeae attached and internalized to neutrophils as an example. Cells are exposed to fluorescently labeled bacteria, fixed, and stained with a bacteria-specific antibody of a different fluorophore. Thus in the absence of a permeabilizing agent, extracellular bacteria are double-labeled with two fluorophores while intracellular bacteria remain single-labeled. A spot count algorithm is used to determine the number of single- and double-labeled bacteria in individual cells, to calculate the percent of cells associated with bacteria, percent of cells with internalized bacteria, and percent of cell-associated bacteria that are internalized. These analyses quantify bacterial association and internalization across thousands of cells and can be applied to diverse experimental systems. PMID:28369762

  11. Digoxigenylated wheat germ agglutinin visualized with alkaline phosphatase-labeled anti-digoxigenin antibodies--a new, sensitive technique with the potential for single and double tracing of neuronal connections.

    PubMed

    Veh, R W

    1991-01-02

    For double tracing experiments, wheat germ agglutinin (WGA) molecules labeled with two different haptens are desirable. In the present report the suitability of digoxigenylated WGA (DIG-WGA) for retrograde tracing was investigated. For this purpose the new tracer was pressure injected into rat brains and the transported DIG-WGA visualized via its digoxigenyl group with an alkaline phosphatase linked anti DIG antibody in permanently stained sections of high quality. With fixatives containing 2.5% glutaraldehyde only few positive cells were found. However, at milder fixation conditions (4% paraformaldehyde, 0.05% glutaraldehyde 0.2% picric acid, 30 min) retrogradely labeled cells were detected with a sensitivity comparable to tetramethylbenzidine protocols for conventional WGA-HRP (horseradish peroxidase) tracing. Preliminary experiments suggest excellent suitability for double labeling.

  12. Photoreceptors in a primitive mammal, the South American opossum, Didelphis marsupialis aurita: characterization with anti-opsin immunolabeling.

    PubMed

    Ahnelt, P K; Hokoç, J N; Röhlich, P

    1995-01-01

    The retinas of placental mammals appear to lack the large number and morphological diversity of cone subtypes found in diurnal reptiles. We have now studied the photoreceptor layer of a South American marsupial (Didelphis marsupialis aurita) by peanut agglutinin labeling of the cone sheath and by labeling of cone outer segments with monoclonal anti-visual pigment antibodies that have been proven to consistently label middle-to-long wavelength (COS-1) and short-wavelength (OS-2) cone subpopulations in placental mammals. Besides a dominant rod population (max. = 400,000/mm2) four subtypes of cones (max. = 3000/mm2) were identified. The outer segments of three cone subtypes were labeled by COS-1: a double cone with a principal cone containing a colorless oil droplet, a single cone with oil droplet, and another single cone. A second group of single cones lacking oil droplets was labeled by OS-2 antibody. The topography of these cone subtypes showed striking anisotropies. The COS-1 labeled single cones without oil droplets were found all over the retina and constituted the dominant population in the area centralis located in the temporal quadrant of the upper, tapetal hemisphere. The population of OS-2 labeled cones was also ubiquitous although slightly higher in the upper hemisphere (200/mm2). The COS-1 labeled cones bearing an oil droplet, including the principal member of double cones, were concentrated (800/mm2) in the inferior, non-tapetal half of the retina. The two spectral types of single cones resemble those of dichromatic photopic systems in most placental mammals. The additional set of COS-1 labeled cones is a distinct marsupial feature. The presence of oil droplets in this cone subpopulation, its absence in the area centralis, and the correlation with the non-tapetal inferior hemisphere suggest a functional specialization, possibly for mesopic conditions. Thus, sauropsid features have been retained but probably with a modified function.

  13. Assimilate partitioning in avocado, Persea americana

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Finazzo, S.; Davenport, T.L.

    1986-04-01

    Assimilate partitioning is being studied in avocado, Persea americana cv. Millborrow in relation to fruit set. Single leaves on girdled branches of 10 year old trees were radiolabeled for 1 hr with 13..mu..Ci of /sup 14/CO/sub 2/. The source leaves were sampled during the experiment to measure translocation rates. At harvest the sink tissues were dissected and the incorporated radioactivity was measured. The translocation of /sup 14/C-labelled compounds to other leaves was minimal. Incorporation of label into fruitlets varied with the tissue and the stage of development. Sink (fruitlets) nearest to the labelled leaf and sharing the same phyllotaxy incorporatedmore » the most /sup 14/C. Source leaves for single non-abscising fruitlets retained 3X more /sup 14/C-labelled compounds than did source leaves for 2 or more fruitlets at 31 hrs. post-labelling. Export of label decreased appreciably when fruitlets abscised. If fruitlets abscised within 4 days of labeling then the translocation pattern was similar to the pattern for single fruitlets. If the fruitlet abscised later, the translocation pattern was intermediate between the single and double fruitlet pattern.« less

  14. A novel single fluorophore-labeled double-stranded oligonucleotide probe for fluorescence-enhanced nucleic acid detection based on the inherent quenching ability of deoxyguanosine bases and competitive strand-displacement reaction.

    PubMed

    Zhang, Yingwei; Tian, Jingqi; Li, Hailong; Wang, Lei; Sun, Xuping

    2012-01-01

    We develop a novel single fluorophore-labeled double-stranded oligonucleotide (OND) probe for rapid, nanostructure-free, fluorescence-enhanced nucleic acid detection for the first time. We further demonstrate such probe is able to well discriminate single-base mutation in nucleic acid. The design takes advantage of an inherent quenching ability of guanine bases. The short strand of the probe is designed with an end-labeled fluorophore that is placed adjacent to two guanines as the quencher located on the long opposite strand, resulting in great quenching of dye fluorescence. In the presence of a target complementary to the long strand of the probe, a competitive strand-displacement reaction occurs and the long strand forms a more stable duplex with the target, resulting in the two strands of the probe being separated from each other. As a consequence of this displacement, the fluorophore and the quencher are no longer in close proximity and dye fluorescence increases, signaling the presence of target.

  15. Forkhead box-P3+ regulatory T cells and toll-like receptor 2 co-expression in oral squamous cell carcinoma.

    PubMed

    Hussaini, H M; Parachuru, V P B; Seymour, G J; Rich, A M

    2017-04-01

    The function of forkhead box-P3 (FoxP3) regulatory T cells (Treg) and toll-like receptor (TLR)2 protein in the oral cancer microenvironment is not fully understood, but evidence from other malignancies suggests it is likely they are involved with tumour development and progression. The aim of this study was to investigate the distribution of FoxP3 + cells, TLR2 + cells and double-labelled FoxP3 + TLR2 + immune cells in oral squamous cell carcinoma (OSCC), using immunohistochemistry (IHC) and immunofluorescence (IF). 25 archival cases of OSCC were immunostained with anti-FoxP3 and anti-TLR2 antibodies. Inflamed hyperplastic oral mucosal tissues were used as controls. The proportion of single-labelled, double-labelled and negative cells was determined. A higher frequency of double-labelled FoxP3 + TLR2 + Tregs was observed within the immune cells of OSCC compared to inflamed controls using IHC (p<0.05). Cell-to-cell contact between single-stained TLR2 + cells and FoxP3 + cells was noted. Double IF studies validated demonstration of co-expression of FoxP3 + /TLR2 + immune cells in OSCC. The presence of FoxP3 + TLR2 + cells within the OSCC microenvironment may represent a dendritic cell-dependent pathway capable of inhibiting Treg suppressive activity, potentially enhancing the anti-tumour response. Modulation of TLR2-Treg interactions should be further explored to determine if they have a role in the therapeutic management of OSCC. Copyright © 2017 Elsevier GmbH. All rights reserved.

  16. Electron Paramagnetic Resonance of a Single NV Nanodiamond Attached to an Individual Biomolecule

    NASA Astrophysics Data System (ADS)

    Teeling-Smith, Richelle M.; Jung, Young Woo; Scozzaro, Nicolas; Cardellino, Jeremy; Rampersaud, Isaac; North, Justin A.; Šimon, Marek; Bhallamudi, Vidya P.; Rampersaud, Arfaan; Johnston-Halperin, Ezekiel; Poirier, Michael G.; Hammel, P. Chris

    2016-05-01

    A key limitation of electron paramagnetic resonance (EPR), an established and powerful tool for studying atomic-scale biomolecular structure and dynamics is its poor sensitivity, samples containing in excess of 10^12 labeled biomolecules are required in typical experiments. In contrast, single molecule measurements provide improved insights into heterogeneous behaviors that can be masked by ensemble measurements and are often essential for illuminating the molecular mechanisms behind the function of a biomolecule. We report EPR measurements of a single labeled biomolecule that merge these two powerful techniques. We selectively label an individual double-stranded DNA molecule with a single nanodiamond containing nitrogen-vacancy (NV) centers, and optically detect the paramagnetic resonance of NV spins in the nanodiamond probe. Analysis of the spectrum reveals that the nanodiamond probe has complete rotational freedom and that the characteristic time scale for reorientation of the nanodiamond probe is slow compared to the transverse spin relaxation time. This demonstration of EPR spectroscopy of a single nanodiamond labeled DNA provides the foundation for the development of single molecule magnetic resonance studies of complex biomolecular systems.

  17. Visualization of macrophage recruitment in head and neck carcinoma model using fluorine-19 magnetic resonance imaging.

    PubMed

    Khurana, Aman; Chapelin, Fanny; Xu, Hongyan; Acevedo, Joseph R; Molinolo, Alfred; Nguyen, Quyen; Ahrens, Eric T

    2018-04-01

    To evaluate the role of infiltrating macrophages in murine models of single and double mutation head and neck tumors using a novel fluorine-19 ( 19 F) MRI technology. Tumor cell lines single-hit/SCC4 or double-hit/Cal27, with mutations of TP53 and TP53 & FHIT, respectively, were injected bilaterally into the flanks of (n = 10) female mice. With tumors established, perfluorocarbon nanoemulsion was injected intravenously, which labels in situ predominantly monocytes and macrophages. Longitudinal spin density-weighted 19 F MRI data enabled quantification of the macrophage burden in tumor and surrounding tissue. The average number of 19 F atoms within the tumors was twice as high in the Cal27 group compared with SCC4 (3.9 × 10 19 and 2.0 × 10 19 19 F/tumor, respectively; P = 0.0034) two days after contrast injection, signifying increased tumor-associated macrophages in double-hit tumors. The difference was still significant 10 days after injection. Histology stains correlated with in vivo results, exhibiting numerous perfluorocarbon-labeled macrophages in double-hit tumors and to a lesser extent in single-hit tumors. This study helps to establish 19 F MRI as a method for quantifying immune cells in the tumor microenvironment, allowing distinction between double and single-hit head and neck tumors. This technique would be extremely valuable in the clinic for pretreatment planning, prognostics, and post-treatment surveillance. Magn Reson Med 79:1972-1980, 2018. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.

  18. A simple procedure for parallel sequence analysis of both strands of 5'-labeled DNA.

    PubMed

    Razvi, F; Gargiulo, G; Worcel, A

    1983-08-01

    Ligation of a 5'-labeled DNA restriction fragment results in a circular DNA molecule carrying the two 32Ps at the reformed restriction site. Double digestions of the circular DNA with the original enzyme and a second restriction enzyme cleavage near the labeled site allows direct chemical sequencing of one 5'-labeled DNA strand. Similar double digestions, using an isoschizomer that cleaves differently at the 32P-labeled site, allows direct sequencing of the now 3'-labeled complementary DNA strand. It is possible to directly sequence both strands of cloned DNA inserts by using the above protocol and a multiple cloning site vector that provides the necessary restriction sites. The simultaneous and parallel visualization of both DNA strands eliminates sequence ambiguities. In addition, the labeled circular molecules are particularly useful for single-hit DNA cleavage studies and DNA footprint analysis. As an example, we show here an analysis of the micrococcal nuclease-induced breaks on the two strands of the somatic 5S RNA gene of Xenopus borealis, which suggests that the enzyme may recognize and cleave small AT-containing palindromes along the DNA helix.

  19. Frequency of glove perforation and the protective effect of double gloves in gynecological surgery.

    PubMed

    Murta, Eddie F C; Silva, Cléber S; Júnior, Odilon R A

    2003-06-01

    The purposes of this prospective study were to verify the frequency of glove perforation during gynecological operations and to evaluate the efficacy of double gloving in preventing damage to the inner glove. From May 2000 to May 2001, three house staff and 12 residents were asked to place their used gloves in bags labeled with the following information: procedure performed, presence of a recognized glove perforation, and role in operating team (surgeon, first or second assistant, and instrumentalist). All glove sets were tested using the method of water pression. Damaged gloves were excluded from that analysis. In all, 35 and 51 operations were utilized with single and double gloves, respectively. There were 240 single gloves and 792 double gloves tested. Perforation occurred in 10.4% of the single gloves and 9.8% of the outer double gloves. There were no cases of perforation in the inner double gloves. In cases of operating time that lasted more than 2 h, 56% of the surgeries that used single gloves had perforation vs 58.5% of the double gloves. The first assistant had the major risk for glove perforation with the use of single or double gloves. The indicator finger of the non-dominant hand was the major risk for perforation. In conclusion, we recommend double gloving in all gynecological surgery to reduce the risk of contracting blood-borne diseases.

  20. Construction and Analysis of High-Ethanol-Producing Fusants with Co-Fermentation Ability through Protoplast Fusion and Double Labeling Technology

    PubMed Central

    Ge, Jingping; Zhao, Jingwen; Zhang, Luyan; Zhang, Mengyun; Ping, Wenxiang

    2014-01-01

    Double labeling of resistance markers and report genes can be used to breed engineered Saccharomyces cerevisiae strains that can assimilate xylose and glucose as a mixed carbon source for ethanol fermentation and increased ethanol production. In this study Saccharomyces cerevisiae W5 and Candida shehatae 20335 were used as parent strains to conduct protoplast fusion and the resulting fusants were screened by double labeling. High performance liquid chromatography (HPLC) was used to assess the ethanol yield following the fermentation of xylose and glucose, as both single and mixed carbon sources, by the fusants. Interestingly, one fusant (ZLYRHZ7) was demonstrated to have an excellent fermentation performance, with an ethanol yield using the mixed carbon source of 0.424 g g−1, which compares with 0.240 g g−1 (W5) and 0.353 g g−1 (20335) for the parent strains. This indicates an improvement in the ethanol yield of 43.4% and 16.7%, respectively. PMID:25268957

  1. Collateral projections of nucleus raphe dorsalis neurones to the caudate-putamen and region around the nucleus raphe magnus and nucleus reticularis gigantocellularis pars alpha in the rat.

    PubMed

    Li, Y Q; Kaneko, T; Mizuno, N

    2001-02-16

    It was examined whether or not the nucleus raphe dorsalis (RD) neurons projecting to the caudate-putamen (CPu) might also project to the motor-controlling region around the nucleus raphe magnus (NRM) and nucleus reticularis gigantocellularis pars alpha (Gia) in the rat. Single RD neurons projecting to the CPu and NRM/Gia by way of axon collaterals were identified by the retrograde double-labeling method with fluorescent dyes, Fast Blue and Diamidino Yellow, which were injected respectively into the CPu and NRM/Gia. Then, serotonin (5-HT)-like immunoreactivity of the double-labeled RD neurons was examined immunohistochemically; approximately 60% of the double-labeled RD neurons showed 5-HT-like immunoreactivity. The results indicated that some of serotonergic and non-serotonergic RD neurons might control motor functions simultaneously at the levels of the CPu and NRM/Gia by way of axon collaterals.

  2. Construction and analysis of high-ethanol-producing fusants with co-fermentation ability through protoplast fusion and double labeling technology.

    PubMed

    Ge, Jingping; Zhao, Jingwen; Zhang, Luyan; Zhang, Mengyun; Ping, Wenxiang

    2014-01-01

    Double labeling of resistance markers and report genes can be used to breed engineered Saccharomyces cerevisiae strains that can assimilate xylose and glucose as a mixed carbon source for ethanol fermentation and increased ethanol production. In this study Saccharomyces cerevisiae W5 and Candida shehatae 20335 were used as parent strains to conduct protoplast fusion and the resulting fusants were screened by double labeling. High performance liquid chromatography (HPLC) was used to assess the ethanol yield following the fermentation of xylose and glucose, as both single and mixed carbon sources, by the fusants. Interestingly, one fusant (ZLYRHZ7) was demonstrated to have an excellent fermentation performance, with an ethanol yield using the mixed carbon source of 0.424 g g-1, which compares with 0.240 g g-1 (W5) and 0.353 g g-1 (20335) for the parent strains. This indicates an improvement in the ethanol yield of 43.4% and 16.7%, respectively.

  3. Three-Dimensional Conformation of Folded Polymers in Single Crystals

    NASA Astrophysics Data System (ADS)

    Hong, You-lee; Yuan, Shichen; Li, Zhen; Ke, Yutian; Nozaki, Koji; Miyoshi, Toshikazu

    2015-10-01

    The chain-folding mechanism and structure of semicrystalline polymers have long been controversial. Solid-state NMR was applied to determine the chain trajectory of 13C CH3 -labeled isotactic poly(1-butene) (i PB 1 ) in form III chiral single crystals blended with nonlabeled i PB 1 crystallized in dilute solutions under low supercooling. An advanced 13C - 13C double-quantum NMR technique probing the spatial proximity pattern of labeled 13C nuclei revealed that the chains adopt a three-dimensional (3D) conformation in single crystals. The determined results indicate a two-step crystallization process of (i) cluster formation via self-folding in the precrystallization stage and (ii) deposition of the nanoclusters as a building block at the growth front in single crystals.

  4. Brief review of published alprazolam clinical studies

    PubMed Central

    Straw, R. N.

    1985-01-01

    1 The clinical efficacy of alprazolam has been evaluated in both anxiety states and depressive disorders. In anxiety neurosis, studies have been conducted vs placebo and/or other benzodiazepine tranquilizers. Reports, to date, with regard to panic/phobia disorders have been limited to open-label studies and a single report from a placebo-controlled study. In depression, both open-label and double-blind studies (vs tricyclic antidepressants) have been published. PMID:2859879

  5. Multiple-labelling immunoEM using different sizes of colloidal gold: alternative approaches to test for differential distribution and colocalization in subcellular structures.

    PubMed

    Mayhew, Terry M; Lucocq, John M

    2011-03-01

    Various methods for quantifying cellular immunogold labelling on transmission electron microscope thin sections are currently available. All rely on sound random sampling principles and are applicable to single immunolabelling across compartments within a given cell type or between different experimental groups of cells. Although methods are also available to test for colocalization in double/triple immunogold labelling studies, so far, these have relied on making multiple measurements of gold particle densities in defined areas or of inter-particle nearest neighbour distances. Here, we present alternative two-step approaches to codistribution and colocalization assessment that merely require raw counts of gold particles in distinct cellular compartments. For assessing codistribution over aggregate compartments, initial statistical evaluation involves combining contingency table and chi-squared analyses to provide predicted gold particle distributions. The observed and predicted distributions allow testing of the appropriate null hypothesis, namely, that there is no difference in the distribution patterns of proteins labelled by different sizes of gold particle. In short, the null hypothesis is that of colocalization. The approach for assessing colabelling recognises that, on thin sections, a compartment is made up of a set of sectional images (profiles) of cognate structures. The approach involves identifying two groups of compartmental profiles that are unlabelled and labelled for one gold marker size. The proportions in each group that are also labelled for the second gold marker size are then compared. Statistical analysis now uses a 2 × 2 contingency table combined with the Fisher exact probability test. Having identified double labelling, the profiles can be analysed further in order to identify characteristic features that might account for the double labelling. In each case, the approach is illustrated using synthetic and/or experimental datasets and can be refined to correct observed labelling patterns to specific labelling patterns. These simple and efficient approaches should be of more immediate utility to those interested in codistribution and colocalization in multiple immunogold labelling investigations.

  6. Efficient enzymatic synthesis and dual-colour fluorescent labelling of DNA probes using long chain azido-dUTP and BCN dyes

    PubMed Central

    Ren, Xiaomei; El-Sagheer, Afaf H.; Brown, Tom

    2016-01-01

    A sterically undemanding azide analogue of dTTP (AHP dUTP) with an alkyl chain and ethynyl attachment to the nucleobase was designed and incorporated into DNA by primer extension, reverse transcription and polymerase chain reaction (PCR). An azide-modified 523 bp PCR amplicon with all 335 thymidines replaced by AHP dU was shown to be a perfect copy of the template from which it was amplified. Replacement of thymidine with AHP dU increases duplex stability, accounting in part for the high incorporation efficiency of the azide-modified triphosphate. Single-stranded azide-labelled DNA was conveniently prepared from PCR products by λ-exonuclease digestion and streptavidin magnetic bead isolation. Efficient fluorescent labelling of single and double-stranded DNA was carried out using dyes functionalized with bicyclo[6.1.0]non-4-yne (BCN) via the strain-promoted alkyne-azide cycloaddition (SPAAC) reaction. This revealed that the degree of labelling must be carefully controlled to achieve optimum fluorescence and avoid fluorescence quenching. Dual-coloured probes were obtained in a single tube fluorescent labelling reaction; and varying the ratios of the two dyes provides a simple method to prepare DNA probes with unique fluorescent signatures. AHP dUTP is a versatile clickable nucleotide with potentially wide applications in biology and nanotechnology including single molecule studies and synthesis of modified aptamer libraries via SELEX. PMID:26819406

  7. A new class of homogeneous nucleic acid probes based on specific displacement hybridization

    PubMed Central

    Li, Qingge; Luan, Guoyan; Guo, Qiuping; Liang, Jixuan

    2002-01-01

    We have developed a new class of probes for homogeneous nucleic acid detection based on the proposed displacement hybridization. Our probes consist of two complementary oligodeoxyribonucleotides of different length labeled with a fluorophore and a quencher in close proximity in the duplex. The probes on their own are quenched, but they become fluorescent upon displacement hybridization with the target. These probes display complete discrimination between a perfectly matched target and single nucleotide mismatch targets. A comparison of double-stranded probes with corresponding linear probes confirms that the presence of the complementary strand significantly enhances their specificity. Using four such probes labeled with different color fluorophores, each designed to recognize a different target, we have demonstrated that multiple targets can be distinguished in the same solution, even if they differ from one another by as little as a single nucleotide. Double-stranded probes were used in real-time nucleic acid amplifications as either probes or as primers. In addition to its extreme specificity and flexibility, the new class of probes is simple to design and synthesize, has low cost and high sensitivity and is accessible to a wide range of labels. This class of probes should find applications in a variety of areas wherever high specificity of nucleic acid hybridization is relevant. PMID:11788731

  8. Label-free and high-sensitive detection for genetic point mutation based on hyperspectral interferometry

    NASA Astrophysics Data System (ADS)

    Fu, Rongxin; Li, Qi; Zhang, Junqi; Wang, Ruliang; Lin, Xue; Xue, Ning; Su, Ya; Jiang, Kai; Huang, Guoliang

    2016-10-01

    Label free point mutation detection is particularly momentous in the area of biomedical research and clinical diagnosis since gene mutations naturally occur and bring about highly fatal diseases. In this paper, a label free and high sensitive approach is proposed for point mutation detection based on hyperspectral interferometry. A hybridization strategy is designed to discriminate a single-base substitution with sequence-specific DNA ligase. Double-strand structures will take place only if added oligonucleotides are perfectly paired to the probe sequence. The proposed approach takes full use of the inherent conformation of double-strand DNA molecules on the substrate and a spectrum analysis method is established to point out the sub-nanoscale thickness variation, which benefits to high sensitive mutation detection. The limit of detection reach 4pg/mm2 according to the experimental result. A lung cancer gene point mutation was demonstrated, proving the high selectivity and multiplex analysis capability of the proposed biosensor.

  9. An open-label six-month extension study to investigate the safety and efficacy of an extract of Artemisia annua for managing pain, stiffness and functional limitation associated with osteoarthritis of the hip and knee.

    PubMed

    Hunt, Sheena; Stebbings, Simon; McNamara, Debra

    2016-10-28

    This six-month single-centre open-label extension study, conducted at the University of Otago, Dunedin, follows from a previously published 12-week pilot double-blind randomised placebo-controlled study of dietary supplement, Arthrem® (ART) in patients with osteoarthritis (OA) of the hip or knee. The pilot double-blind study showed that treatment with ART 150 mg twice-daily was associated with clinically relevant pain reduction. The extension study aims were to assess longer-term safety and efficacy during six months' treatment following the pilot trial. Patients who completed the pilot double-blind study had the option to continue on open-label treatment with ART for a further six months. Safety was assessed by adverse event monitoring and laboratory tests at three and six months. Efficacy was assessed at three and six months using the Western Ontario and McMaster Universities Osteoarthritis Index (WOMAC®). Thirty-four patients entered the optional extension and 28 completed six months' treatment. ART was well tolerated when taken for up to nine months. Improvements in WOMAC® efficacy parameters reported in the double-blind phase of the study were maintained over six months. ART appears to be a safe and effective alternative for managing the symptoms of OA over an extended period.

  10. Electron microscopic visualization of complementary labeled DNA with platinum-containing guanine derivative.

    PubMed

    Loukanov, Alexandre; Filipov, Chavdar; Mladenova, Polina; Toshev, Svetlin; Emin, Saim

    2016-04-01

    The object of the present report is to provide a method for a visualization of DNA in TEM by complementary labeling of cytosine with guanine derivative, which contains platinum as contrast-enhanced heavy element. The stretched single-chain DNA was obtained by modifying double-stranded DNA. The labeling method comprises the following steps: (i) stretching and adsorption of DNA on the support film of an electron microscope grid (the hydrophobic carbon film holding negative charged DNA); (ii) complementary labeling of the cytosine bases from the stretched single-stranded DNA pieces on the support film with platinum containing guanine derivative to form base-specific hydrogen bond; and (iii) producing a magnified image of the base-specific labeled DNA. Stretched single-stranded DNA on a support film is obtained by a rapid elongation of DNA pieces on the surface between air and aqueous buffer solution. The attached platinum-containing guanine derivative serves as a high-dense marker and it can be discriminated from the surrounding background of support carbon film and visualized by use of conventional TEM observation at 100 kV accelerated voltage. This method allows examination of specific nucleic macromolecules through atom-by-atom analysis and it is promising way toward future DNA-sequencing or molecular diagnostics of nucleic acids by electron microscopic observation. © 2016 Wiley Periodicals, Inc.

  11. Double nanohole optical tweezers visualize protein p53 suppressing unzipping of single DNA-hairpins

    PubMed Central

    Kotnala, Abhay; Gordon, Reuven

    2014-01-01

    Here we report on the use of double-nanohole (DNH) optical tweezers as a label-free and free-solution single-molecule probe for protein–DNA interactions. Using this approach, we demonstrate the unzipping of individual 10 base pair DNA-hairpins, and quantify how tumor suppressor p53 protein delays the unzipping. From the Arrhenius behavior, we find the energy barrier to unzipping introduced by p53 to be 2 × 10−20 J, whereas cys135ser mutant p53 does not show suppression of unzipping, which gives clues to its functional inability to suppress tumor growth. This transformative approach to single molecule analysis allows for ultra-sensitive detection and quantification of protein–DNA interactions to revolutionize the fight against genetic diseases. PMID:24940547

  12. Segregation of feedforward and feedback projections in mouse visual cortex

    PubMed Central

    Berezovskii, Vladimir K.; Nassi, Jonathan J.; Born, Richard T.

    2011-01-01

    Hierarchical organization is a common feature of mammalian neocortex. Neurons that send their axons from lower to higher areas of the hierarchy are referred to as “feedforward” (FF) neurons, whereas those projecting in the opposite direction are called “feedback” (FB) neurons. Anatomical, functional and theoretical studies suggest that these different classes of projections play fundamentally different roles in perception. In primates, laminar differences in projection patterns often distinguish the two projection streams. In rodents, however, these differences are less clear, despite an established hierarchy of visual areas. Thus the rodent provides a strong test of the hypothesis that FF and FB neurons form distinct populations. We tested this hypothesis by injecting retrograde tracers into two different hierarchical levels of mouse visual cortex (areas 17 and AL) and then determining the relative proportions of double-labeled FB and FF neurons in an area intermediate to them (LM). Despite finding singly labeled neurons densely intermingled with no laminar segregation, we found few double-labeled neurons (~5% of each singly labeled population). We also examined the development of FF and FB connections. FF connections were present at the earliest time-point we examined (postnatal day two, P2), while FB connections were not detectable until P11. Our findings indicate that, even in cortices without laminar segregation of FF and FB neurons, the two projection systems are largely distinct at the neuronal level and also differ with respect to the timing of their outgrowth. PMID:21618232

  13. Ectopic transgene expression in the retina of four transgenic mouse lines

    PubMed Central

    Gábriel, Robert; Erdélyi, Ferenc; Szabó, Gábor; Lawrence, J. Josh

    2017-01-01

    Retinal expression of transgenes was examined in four mouse lines. Two constructs were driven by the choline acetyltransferase (ChAT) promoter: green fluorescent protein conjugated to tau protein (tau-GFP) or cytosolic yellow fluorescent protein (YFP) generated through CRE recombinase-induced expression of Rosa26 (ChAT-CRE/ Rosa26YFP). Two other constructs targeted inhibitory interneurons: GABAergic horizontal and amacrine cells identified by glutamic acid decarboxylase (GAD65-GFP) or parvalbumin (PV) cells (PV-CRE/Rosa26YFP). Animals were transcardially perfused and retinal sections prepared. Antibodies against PV, calretinin (CALR), calbindin (CALB), and tyrosine hydroxylase (TH) were used to counterstain transgene-expressing cells. In PVxRosa and ChAT-tauGFP constructs, staining appeared in vertically oriented row of processes resembling Müller cells. In the ChATxRosa construct, populations of amacrine cells and neurons in the ganglion cell layer were labeled. Some cones also exhibited GFP fluorescence. CALR, PV and TH were found in none of these cells. Occasionally, we found GFP/ CALR and GFP/PV double-stained cells in the ganglion cell layer (GCL). In the GAD65-GFP construct, all layers of the neuroretina were labeled, except photoreceptors. Not all horizontal cells expressed GFP. We did not find GFP/TH double-labeled cells and GFP was rarely present in CALR-and CALB-containing cells. Many PV-positive neurons were also labeled for GFP, including small diameter amacrines. In the GCL, single labeling for GFP and PV was ascertained, as well as several CALR/PV double-stained neurons. In the GCL, cells triple labeled with GFP/CALR/ CALB were sparse. In conclusion, only one of the four transgenic constructs exhibited an expression pattern consistent with endogenous retinal protein expression, while the others strongly suggested ectopic gene expression. PMID:26563404

  14. Coexistence of immune-neuro-endocrine substances in the rat central neurons.

    PubMed

    Zhu, C; Liu, Q; Wei, Y; Ma, C; Hao, J; Yan, P

    1999-01-01

    To investigate the expression of interleukin-2 (IL-2), metabotropic glutamate receptor subunit 1 (mGluR1) and estrogen receptor (ER) in neurons of the rat central nervous system (CNS) and identify the coexistence possibility of these immune-neuro-endocrine substances in the central neurons, the tri-labeling immunocytochemical technique with different species-specific primary antibodies (goat anti-IL-2 antibody, rabbit anti-mGluR1 antibody and mouse anti-ER antibody) were used to incubate two serial neighbor sections (one for demonstrating IL-2, another for mGluR1 and ER) of the cerebral cortex, medulla oblongata and spinal cord. There were IL-2-, mGluR1- and ER-immunoreactivity (IR)-positive labeled neurons in the above-mentioned central areas. The IL-2-IR production showed brown color, located in the cytoplasm; In the neighbor serial section, the mGluR1-IR, production showed blue-black color, located on the cell membrane; the ER-IR production also showed brown color, located in the cytoplasm and nuclei. There were mGluR1/ER double-labeled cells in the same section, which accounted for about 50%-60% of the total single and double labeled neurons. It was identified by projection check of serial neighbor sections that had mGluR1/ER/IL-2 tri-labeled cells, which accounted for about 30% of total mGluR1/ER double-labeled neurons. The results indicate that mGluR1, ER and Il-2 can coexist in the same rat central neurons, therefore, providing morphological basis for the theory about immune-neuro-endocrine network at the cellular level for the first time.

  15. Method for producing labeled single-stranded nucleic acid probes

    DOEpatents

    Dunn, John J.; Quesada, Mark A.; Randesi, Matthew

    1999-10-19

    Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector, the cloning vector having an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe.

  16. Ultrastructural localization of the C-terminus of the 43-kd dystrophin-associated glycoprotein and its relation to dystrophin in normal murine skeletal myofiber.

    PubMed Central

    Wakayama, Y.; Shibuya, S.; Takeda, A.; Jimi, T.; Nakamura, Y.; Oniki, H.

    1995-01-01

    We used single and double immunogold labeling electron microscopy to investigate ultrastructural localization of the C terminus of the 43-kd dystrophin-associated glycoprotein (43-DAG) and its relationship to dystrophin in normal murine skeletal myofibers. Single immunolabeling localized the antibody against the C terminus of 43-DAG to the inside surface of the muscle plasma membrane and the sarcoplasmic side of plasma membrane invaginations. Double immunolabeling co-localized antibodies against dystrophin and the C terminus of 43-DAG to the same site noted in the single immunolabeling localization of 43-DAG. In particular, dystrophin and the C-terminal 43-DAG antibody signals were often observed as doublets separated by less than 30 nm. We compared these results with those obtained from double immunogold labeling with anti-dystrophin and anti-beta-spectrin, as well as anti-C-terminal 43-DAG and anti-beta-spectrin antibodies. The antibodies against dystrophin and beta-spectrin, or beta-spectrin and 43-DAG, also co-localized to similar sites in skeletal muscle fibers. Signals of doublet formations were noted but their frequency was significantly lower than the doublet frequency of antidystrophin and anti-43-DAG antibodies. The results support the presence of dystrophin and 43-DAG linkage at the inside surface of the murine skeletal muscle plasma membrane. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:7856727

  17. Replication labeling patterns and chromosome territories typical of mammalian nuclei are conserved in the early metazoan Hydra.

    PubMed

    Alexandrova, Olga; Solovei, Irina; Cremer, Thomas; David, Charles N

    2003-12-01

    To investigate the evolutionary conservation of higher order nuclear architecture previously described for mammalian cells we have analyzed the nuclear architecture of the simple polyp Hydra. These diploblastic organisms have large nuclei (8-10 microm) containing about 3x10(9) bp of DNA organized in 15 chromosome pairs. They belong to the earliest metazoan phylum and are separated from mammals by at least 600 million years. Single and double pulse labeling with halogenated nucleotides (bromodeoxyuridine, iododeoxyuridine and chlorodeoxyuridine) revealed striking similarities to the known sequence of replication labeling patterns in mammalian nuclei. These patterns reflect a persistent nuclear arrangement of early, mid-, and late replicating chromatin foci that could be identified during all stages of interphase over at least 5-10 cell generations. Segregation of labeled chromatids led after several cell divisions to nuclei with single or a few labeled chromosome territories. In such nuclei distinct clusters of labeled chromatin foci were separated by extended nuclear areas with non-labeled chromatin, which is typical of a territorial arrangement of interphase chromosomes. Our results indicate the conservation of fundamental features of higher order chromatin arrangements throughout the evolution of metazoan animals and suggest the existence of conserved mechanism(s) controlling this architecture.

  18. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    DOEpatents

    Gray, Joe W.; Pinkel, Daniel

    1991-01-01

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. Probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations.

  19. Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries.

    PubMed

    Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-Ting; Gulari, Erdogan; Rouillard, Jean-Marie

    2015-06-01

    Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection-based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization.

  20. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    DOEpatents

    Gray, J.W.; Pinkel, D.

    1991-07-02

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  1. Apoptotic mechanisms after repeated noise trauma in the mouse medial geniculate body and primary auditory cortex.

    PubMed

    Fröhlich, Felix; Ernst, Arne; Strübing, Ira; Basta, Dietmar; Gröschel, Moritz

    2017-12-01

    A correlation between noise-induced apoptosis and cell loss has previously been shown after a single noise exposure in the cochlear nucleus, inferior colliculus, medial geniculate body (MGB) and primary auditory cortex (AI). However, repeated noise exposure is the most common situation in humans and a major risk factor for the induction of noise-induced hearing loss (NIHL). The present investigation measured cell death pathways using terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) in the dorsal, medial and ventral MGB (dMGB, mMGB and vMGB) and six layers of the AI (AI-1 to AI-6) in mice (NMRI strain) after a second noise exposure (double-exposure group). Therefore, a single noise exposure group has been investigated 7 (7-day-group-single) or 14 days (14-day-group-single) after noise exposure (3 h, 5-20 kHz, 115 dB SPL peak-to-peak). The double-exposure group received the same noise trauma for a second time 7 days after the initial exposure and was either TUNEL-stained immediately (7-day-group-double) or 1 week later (14-day-group-double) and data were compared to the corresponding single-trauma group as well as to an unexposed control group. It was shown that TUNEL increased immediately after the second noise exposure in AI-3 and stayed upregulated in the 14-day-group-double. A significant increase in TUNEL was also seen in the 14-day-group-double in vMGB, mMGB and AI-1. The present results show for the first time the influence of a repeated noise trauma on cell death mechanisms in thalamic and cortical structures and might contribute to the understanding of pathophysiological findings and psychoacoustic phenomena accompanying NIHL.

  2. Construction, expression, purification and biotin labeling of a single recombinant multi-epitope antigen for double-antigen sandwich ELISA to detect hepatitis C virus antibody.

    PubMed

    He, Jing; Xiu, Bingshui; Wang, Guohua; Chen, Kun; Feng, Xiaoyan; Song, Xiaoguo; Zhu, Cuixia; Yang, Xiqin; Bai, Guanzhong; Ling, Shigan; Zhang, Heqiu

    2011-08-01

    Based on B cell epitope predictions, a recombinant antigen with multiple epitopes from four Hepatitis C Virus fragments (C, NS3, NS4 and NS5) were engineered. The recombinant gene was then highly expressed in E. coli. The non-modified and C-terminal-modified recombinant proteins were used for coating and biotin labeling, respectively, to establish the double-antigen sandwich ELISA. Ten positive reference samples confirmed by the CHIRON RIBA HCV 3.0 SIA kit were detected positive, Forty one plasma samples were positive among samples from 441 volunteers, which indicated that the recombinant antigen could readily react well with plasma HCV antibody. As critical reagents of double-antigen sandwich ELISA, the recombinant multi-epitope antigen and the C-terminal-modified and biotin-conjugated antigen show good antigenicity. In this study, we provide a simple approach to produce multiple epitopes within one recombinant protein in order to avoid the costly expression of less-effective pools of multiple proteins, which is the conventional strategy of diagnostic antigen production for HCV antibody detection.

  3. Vestibular efferent neurons project to the flocculus

    NASA Technical Reports Server (NTRS)

    Shinder, M. E.; Purcell, I. M.; Kaufman, G. D.; Perachio, A. A.

    2001-01-01

    A bilateral projection from the vestibular efferent neurons, located dorsal to the genu of the facial nerve, to the cerebellar flocculus and ventral paraflocculus was demonstrated. Efferent neurons were double-labeled by the unilateral injections of separate retrograde tracers into the labyrinth and into the floccular and ventral parafloccular lobules. Efferent neurons were found with double retrograde tracer labeling both ipsilateral and contralateral to the sites of injection. No double labeling was found when using a fluorescent tracer with non-fluorescent tracers such as horseradish peroxidase (HRP) or biotinylated dextran amine (BDA), but large percentages of efferent neurons were found to be double labeled when using two fluorescent substances including: fluorogold, microruby dextran amine, or rhodamine labeled latex beads. These data suggest a potential role for vestibular efferent neurons in modulating the dynamics of the vestibulo-ocular reflex (VOR) during normal and adaptive conditions.

  4. Axonal ramification of neurons in the nucleus reticularis tegmenti pontis projecting to the paramedian lobule in the rabbit cerebellum.

    PubMed

    Bukowska, Dorota; Mierzejewska-Krzyzowska, Barbara; Zguczyński, Leszek

    2005-01-01

    Projections of the nucleus reticularis tegmenti pontis (NRTP) to the cerebellar paramedian lobule were examined in the rabbit by means of the double fluorescent retrograde tract-tracing method. The rabbit NRTP is composed of a medial, large part comprising zones A (dorsomedial), B (central) and C (lateral), and of a lateral, small part (the processus tegmentosus lateralis; PTL). Following unilateral injections of Fast Blue (FB) into the rostral part of the paramedian lobule (rPML) and of Diamidino Yellow (DY) into the caudal part (cPML), known to receive spinal inputs from forelimb and hindlimb, respectively, substantial numbers of single labeled neurons were found in all bilateral NRTP divisions, apart from the zone C. Most projection neurons to the PML were located in the medial and medioventral regions of the zone B. Smaller numbers of projection neurons were located in the PTL, zone A and outside the zone B among fibers of the medial lemniscus. The pattern of FB and DY labeling suggested that neurons projecting to the rPML and cPML originated in common rather than separate regions within the NRTP. In addition, a small percentage (mean 1.3%) of double FB+DY labeled neurons were detected with a clear contralateral preponderance, among single labeled FB or DY cells. In spite of the rarity, all the NRTP neurons giving rise to intralobular collateral projections can be regarded as potential sources of simultaneous modulating influences upon two functional different forelimb (rPML) and hindlimb (cPML) regions. The findings have been discussed in relation to earlier studies in other species and commented on with respect to the possible functional meaning of these projections.

  5. In Vitro Product of a Ribonucleic Acid Polymerase Induced by Influenza Virus

    PubMed Central

    Mahy, B. W. J.; Bromley, P. A.

    1970-01-01

    The ribonucleic acid (RNA)-dependent RNA polymerase induced in the microsomal fraction of cells infected with influenza virus synthesized a mixture of single-and double-stranded RNA in vitro. The single-stranded RNA sedimented mainly in the 8S region on sucrose density gradients, with a smaller proportion of the RNA sedimenting at 18S. This sedimentation pattern corresponds closely to that of incomplete influenza virus RNA. The double-stranded RNA formed in vitro sedimented at 11S, but molecules which may be replicative intermediate, sedimenting at 14 to 20S, were also detected in the in vitro reaction product. Similar species of RNA were detected in vivo by pulse-labeling infected cells at the time of polymerase harvest, but the proportion of each RNA species was different, most of the RNA being single-stranded and sedimenting in the 18S region. An 11S double-stranded RNA was also synthesized in vivo. Pulse chase analysis of the double-stranded RNA synthesized in vitro showed that most is stable, and only a small proportion turns over during the reaction. A proportion of the RNA formed in vitro could be annealed to RNA formed in infected cells and to RNA extracted from purified virus. PMID:5480408

  6. Efficacy and safety of teneligliptin add-on to insulin monotherapy in Japanese patients with type 2 diabetes mellitus: a 16-week, randomized, double-blind, placebo-controlled trial with an open-label period.

    PubMed

    Kadowaki, Takashi; Kondo, Kazuoki; Sasaki, Noriyuki; Miyayama, Kyoko; Yokota, Shoko; Terata, Ryuji; Gouda, Maki

    2017-09-01

    To assess the efficacy and safety of teneligliptin as add-on to insulin monotherapy in patients with type 2 diabetes mellitus (T2DM). In a 16-week, double-blind period, 148 Japanese T2DM patients with inadequate glycemic control with insulin and diet/exercise therapies were randomized to placebo or teneligliptin 20 mg. In a subsequent 36-week, open-label period, all patients received teneligliptin once daily. The primary outcome measure was change in HbA1c at the end of the double-blind period. The difference between placebo and teneligliptin in change in HbA1c in the double-blind period (least squares mean ± SE) was -0.80% ± 0.11%; teneligliptin was superior (ANCOVA, P < 0.001). The HbA1c-lowering effect of teneligliptin was maintained throughout the open-label period. The incidence of adverse events was 53.5% with placebo and 44.2% with teneligliptin in the double-blind period, 66.7% in the placebo/teneligliptin group in the open-label period, and 77.9% in the teneligliptin/teneligliptin group over both double-blind/open-label periods. The incidence of hypoglycemic symptoms was 11.1% in the placebo/teneligliptin group in the open-label period and 27.3% in the teneligliptin/teneligliptin group over both double-blind/open-label periods. Teneligliptin was effective and well tolerated in Japanese T2DM patients with inadequate glycemic control. NCT02081599.

  7. Double-quantum homonuclear rotary resonance: Efficient dipolar recovery in magic-angle spinning nuclear magnetic resonance

    NASA Astrophysics Data System (ADS)

    Nielsen, N. C.; Bildsøe, H.; Jakobsen, H. J.; Levitt, M. H.

    1994-08-01

    We describe an efficient method for the recovery of homonuclear dipole-dipole interactions in magic-angle spinning NMR. Double-quantum homonuclear rotary resonance (2Q-HORROR) is established by fulfilling the condition ωr=2ω1, where ωr is the sample rotation frequency and ω1 is the nutation frequency around an applied resonant radio frequency (rf) field. This resonance can be used for double-quantum filtering and measurement of homonuclear dipolar interactions in the presence of magic-angle spinning. The spin dynamics depend only weakly on crystallite orientation allowing good performance for powder samples. Chemical shift effects are suppressed to zeroth order. The method is demonstrated for singly and doubly 13C labeled L-alanine.

  8. Hyperplex-MRM: a hybrid multiple reaction monitoring method using mTRAQ/iTRAQ labeling for multiplex absolute quantification of human colorectal cancer biomarker.

    PubMed

    Yin, Hong-Rui; Zhang, Lei; Xie, Li-Qi; Huang, Li-Yong; Xu, Ye; Cai, San-Jun; Yang, Peng-Yuan; Lu, Hao-Jie

    2013-09-06

    Novel biomarker verification assays are urgently required to improve the efficiency of biomarker development. Benefitting from lower development costs, multiple reaction monitoring (MRM) has been used for biomarker verification as an alternative to immunoassay. However, in general MRM analysis, only one sample can be quantified in a single experiment, which restricts its application. Here, a Hyperplex-MRM quantification approach, which combined mTRAQ for absolute quantification and iTRAQ for relative quantification, was developed to increase the throughput of biomarker verification. In this strategy, equal amounts of internal standard peptides were labeled with mTRAQ reagents Δ0 and Δ8, respectively, as double references, while 4-plex iTRAQ reagents were used to label four different samples as an alternative to mTRAQ Δ4. From the MRM trace and MS/MS spectrum, total amounts and relative ratios of target proteins/peptides of four samples could be acquired simultaneously. Accordingly, absolute amounts of target proteins/peptides in four different samples could be achieved in a single run. In addition, double references were used to increase the reliability of the quantification results. Using this approach, three biomarker candidates, ademosylhomocysteinase (AHCY), cathepsin D (CTSD), and lysozyme C (LYZ), were successfully quantified in colorectal cancer (CRC) tissue specimens of different stages with high accuracy, sensitivity, and reproducibility. To summarize, we demonstrated a promising quantification method for high-throughput verification of biomarker candidates.

  9. Double-gated myocardial ASL perfusion imaging is robust to heart rate variation.

    PubMed

    Do, Hung Phi; Yoon, Andrew J; Fong, Michael W; Saremi, Farhood; Barr, Mark L; Nayak, Krishna S

    2017-05-01

    Cardiac motion is a dominant source of physiological noise (PN) in myocardial arterial spin labeled (ASL) perfusion imaging. This study investigates the sensitivity to heart rate variation (HRV) of double-gated myocardial ASL compared with the more widely used single-gated method. Double-gating and single-gating were performed on 10 healthy volunteers (n = 10, 3F/7M; age, 23-34 years) and eight heart transplant recipients (n = 8, 1F/7M; age, 26-76 years) at rest in the randomized order. Myocardial blood flow (MBF), PN, temporal signal-to-noise ratio (SNR), and HRV were measured. HRV ranged from 0.2 to 7.8 bpm. Double-gating PN did not depend on HRV, while single-gating PN increased with HRV. Over all subjects, double-gating provided a significant reduction in global PN (from 0.20 ± 0.15 to 0.11 ± 0.03 mL/g/min; P = 0.01) and per-segment PN (from 0.33 ± 0.23 to 0.21 ± 0.12 mL/g/min; P < 0.001), with significant increases in global temporal SNR (from 11 ± 8 to 18 ± 8; P = 0.02) and per-segment temporal SNR (from 7 ± 4 to 11 ± 12; P < 0.001) without significant difference in measured MBF. Single-gated myocardial ASL suffers from reduced temporal SNR, while double-gated myocardial ASL provides consistent temporal SNR independent of HRV. Magn Reson Med 77:1975-1980, 2017. © 2016 International Society for Magnetic Resonance in Medicine. © 2016 International Society for Magnetic Resonance in Medicine.

  10. Combustion method for assay of biological materials labeled with carbon-14 or tritium, or double-labeled

    NASA Technical Reports Server (NTRS)

    Huebner, L. G.; Kisieleski, W. E.

    1969-01-01

    Dry catalytic combustion at high temperatures is used for assaying biological materials labeled carbon-14 and tritium, or double-labeled. A modified oxygen-flask technique is combined with standard vacuum-line techniques and includes convenience of direct in-vial collection of final combustion products, giving quantitative recovery of tritium and carbon-14.

  11. Fluorescence correlation spectroscopy analysis for accurate determination of proportion of doubly labeled DNA in fluorescent DNA pool for quantitative biochemical assays.

    PubMed

    Hou, Sen; Sun, Lili; Wieczorek, Stefan A; Kalwarczyk, Tomasz; Kaminski, Tomasz S; Holyst, Robert

    2014-01-15

    Fluorescent double-stranded DNA (dsDNA) molecules labeled at both ends are commonly produced by annealing of complementary single-stranded DNA (ssDNA) molecules, labeled with fluorescent dyes at the same (3' or 5') end. Because the labeling efficiency of ssDNA is smaller than 100%, the resulting dsDNA have two, one or are without a dye. Existing methods are insufficient to measure the percentage of the doubly-labeled dsDNA component in the fluorescent DNA sample and it is even difficult to distinguish the doubly-labeled DNA component from the singly-labeled component. Accurate measurement of the percentage of such doubly labeled dsDNA component is a critical prerequisite for quantitative biochemical measurements, which has puzzled scientists for decades. We established a fluorescence correlation spectroscopy (FCS) system to measure the percentage of doubly labeled dsDNA (PDL) in the total fluorescent dsDNA pool. The method is based on comparative analysis of the given sample and a reference dsDNA sample prepared by adding certain amount of unlabeled ssDNA into the original ssDNA solution. From FCS autocorrelation functions, we obtain the number of fluorescent dsDNA molecules in the focal volume of the confocal microscope and PDL. We also calculate the labeling efficiency of ssDNA. The method requires minimal amount of material. The samples have the concentration of DNA in the nano-molar/L range and the volume of tens of microliters. We verify our method by using restriction enzyme Hind III to cleave the fluorescent dsDNA. The kinetics of the reaction depends strongly on PDL, a critical parameter for quantitative biochemical measurements. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets.

    PubMed

    Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard

    2007-10-30

    We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 x 10(8) bound targets per cm(2) sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format.

  13. Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets

    PubMed Central

    Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard

    2007-01-01

    We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 × 108 bound targets per cm2 sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format. PMID:17951434

  14. Modulation of the Pyrococcus abyssi NucS Endonuclease Activity by Replication Clamp at Functional and Structural Levels*

    PubMed Central

    Creze, Christophe; Ligabue, Alessio; Laurent, Sébastien; Lestini, Roxane; Laptenok, Sergey P.; Khun, Joelle; Vos, Marten H.; Czjzek, Mirjam; Myllykallio, Hannu; Flament, Didier

    2012-01-01

    Pyrococcus abyssi NucS is the founding member of a new family of structure-specific DNA endonucleases that interact with the replication clamp proliferating cell nuclear antigen (PCNA). Using a combination of small angle x-ray scattering and surface plasmon resonance analyses, we demonstrate the formation of a stable complex in solution, in which one molecule of the PabNucS homodimer binds to the outside surface of the PabPCNA homotrimer. Using fluorescent labels, PCNA is shown to increase the binding affinity of NucS toward single-strand/double-strand junctions on 5′ and 3′ flaps, as well as to modulate the cleavage specificity on the branched DNA structures. Our results indicate that the presence of a single major contact between the PabNucS and PabPCNA proteins, together with the complex-induced DNA bending, facilitate conformational flexibility required for specific cleavage at the single-strand/double-strand DNA junction. PMID:22431731

  15. Modulation of the Pyrococcus abyssi NucS endonuclease activity by replication clamp at functional and structural levels.

    PubMed

    Creze, Christophe; Ligabue, Alessio; Laurent, Sébastien; Lestini, Roxane; Laptenok, Sergey P; Khun, Joelle; Vos, Marten H; Czjzek, Mirjam; Myllykallio, Hannu; Flament, Didier

    2012-05-04

    Pyrococcus abyssi NucS is the founding member of a new family of structure-specific DNA endonucleases that interact with the replication clamp proliferating cell nuclear antigen (PCNA). Using a combination of small angle x-ray scattering and surface plasmon resonance analyses, we demonstrate the formation of a stable complex in solution, in which one molecule of the PabNucS homodimer binds to the outside surface of the PabPCNA homotrimer. Using fluorescent labels, PCNA is shown to increase the binding affinity of NucS toward single-strand/double-strand junctions on 5' and 3' flaps, as well as to modulate the cleavage specificity on the branched DNA structures. Our results indicate that the presence of a single major contact between the PabNucS and PabPCNA proteins, together with the complex-induced DNA bending, facilitate conformational flexibility required for specific cleavage at the single-strand/double-strand DNA junction.

  16. An electrochemical sensing platform based on local repression of electrolyte diffusion for single-step, reagentless, sensitive detection of a sequence-specific DNA-binding protein.

    PubMed

    Zhang, Yun; Liu, Fang; Nie, Jinfang; Jiang, Fuyang; Zhou, Caibin; Yang, Jiani; Fan, Jinlong; Li, Jianping

    2014-05-07

    In this paper, we report for the first time an electrochemical biosensor for single-step, reagentless, and picomolar detection of a sequence-specific DNA-binding protein using a double-stranded, electrode-bound DNA probe terminally modified with a redox active label close to the electrode surface. This new methodology is based upon local repression of electrolyte diffusion associated with protein-DNA binding that leads to reduction of the electrochemical response of the label. In the proof-of-concept study, the resulting electrochemical biosensor was quantitatively sensitive to the concentrations of the TATA binding protein (TBP, a model analyte) ranging from 40 pM to 25.4 nM with an estimated detection limit of ∼10.6 pM (∼80 to 400-fold improvement on the detection limit over previous electrochemical analytical systems).

  17. 48-spot single-molecule FRET setup with periodic acceptor excitation

    NASA Astrophysics Data System (ADS)

    Ingargiola, Antonino; Segal, Maya; Gulinatti, Angelo; Rech, Ivan; Labanca, Ivan; Maccagnani, Piera; Ghioni, Massimo; Weiss, Shimon; Michalet, Xavier

    2018-03-01

    Single-molecule Förster resonance energy transfer (smFRET) allows measuring distances between donor and acceptor fluorophores on the 3-10 nm range. Solution-based smFRET allows measurement of binding-unbinding events or conformational changes of dye-labeled biomolecules without ensemble averaging and free from surface perturbations. When employing dual (or multi) laser excitation, smFRET allows resolving the number of fluorescent labels on each molecule, greatly enhancing the ability to study heterogeneous samples. A major drawback to solution-based smFRET is the low throughput, which renders repetitive measurements expensive and hinders the ability to study kinetic phenomena in real-time. Here we demonstrate a high-throughput smFRET system that multiplexes acquisition by using 48 excitation spots and two 48-pixel single-photon avalanche diode array detectors. The system employs two excitation lasers allowing separation of species with one or two active fluorophores. The performance of the system is demonstrated on a set of doubly labeled double-stranded DNA oligonucleotides with different distances between donor and acceptor dyes along the DNA duplex. We show that the acquisition time for accurate subpopulation identification is reduced from several minutes to seconds, opening the way to high-throughput screening applications and real-time kinetics studies of enzymatic reactions such as DNA transcription by bacterial RNA polymerase.

  18. Method for introducing unidirectional nested deletions

    DOEpatents

    Dunn, J.J.; Quesada, M.A.; Randesi, M.

    1999-07-27

    Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector. The cloning vector has an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe. 1 fig.

  19. Method for introducing unidirectional nested deletions

    DOEpatents

    Dunn, John J.; Quesada, Mark A.; Randesi, Matthew

    1999-07-27

    Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector, the cloning vector having an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe.

  20. In vivo measurement of the potential doubling time by flowcytometry in oropharyngeal cancer treated by conventional radiotherapy.

    PubMed

    Bourhis, J; Wilson, G; Wibault, P; Bosq, J; Chavaudra, N; Janot, F; Luboinski, B; Eschwege, F; Malaise, E P

    1993-08-01

    Experimental and clinical studies suggest that the pre-treatment potential doubling time could be predictive of tumor control in patients treated by conventional radiotherapy and could help to identify the rapidly growing tumors for which accelerated radiotherapy is required. To test this hypothesis, we studied prospectively 48 patients with a squamous cell carcinoma of the oropharynx and treated by conventional radiotherapy (70 Gy/7 weeks). The duration of S phase, the labeling index and the potential doubling time were obtained by flowcytometry measurements of a tumor biopsy obtained after injection of 200 mg bromodeoxyuridine to the patient. Three parameters were significantly associated with an increased risk of relapse namely the tumors size (T4; p < 0.01), the nodal status (> or = N2; p < 0.05) and the site of the primary within the oropharynx (p = 0.08). The S phase, labeling index, DNA index and potential doubling time were not significantly associated with an increased risk of relapse. However when considering only the T2 subgroup of patients, high labeling indexes and short potential doubling time were associated with an increased risk of relapse: the mean pre-treatment potential doubling time of the tumors which relapsed was 3.21 versus 5.5 days when there was no evidence of local relapse (p < 0.05). The mean labeling index for the group of tumors associated with a tumor recurrence was 11.7% compared to 7.3% when there was no evidence of relapse (p = 0.02). Factors other than proliferation play a role in determining the outcome of oropharyngeal cancers treated by conventional radiotherapy. However there was a significant correlation between short potential doubling time, high labeling index and tumor recurrence in the T2 subgroup of patients. The finding of significance for potential doubling time and labeling index in the T2 subset of tumors may be a reflexion of the more homogeneous nature of these tumors with regard to prognostic variables.

  1. A two-color fluorogenic carbene complex for tagging olefins via metathesis reaction

    NASA Astrophysics Data System (ADS)

    Wirtz, Marcel; Grüter, Andreas; Heib, Florian; Huch, Volker; Zapp, Josef; Herten, Dirk-Peter; Schmitt, Michael; Jung, Gregor

    2015-12-01

    We describe a fluorogenic ruthenium (II) carbene complex in which the chromophore is directly connected to the metal center. The compound introduces a boron dipyrromethene (BODIPY) moiety into target double bonds by metathesis. Tagging of terminal double bonds is demonstrated on immobilized styrene units on a glass surface. We also show that two compounds with distinguishable fluorescence properties are formed in the model reaction with styrene. The outcome of the metathesis reaction is characterized by 19F-NMR, optical spectroscopy, and, finally, single-molecule trajectories. This labeling scheme, in our perception, is of particular interest in the fields of interfacial science and biorthogonal ligation in combination with super-resolution imaging.

  2. Double activity imaging reveals distinct cellular targets of haloperidol, clozapine and dopamine D(3) receptor selective RGH-1756.

    PubMed

    Kovács, K J; Csejtei, M; Laszlovszky, I

    2001-03-01

    Acute administration of typical (haloperidol) and atypical (clozapine) antipsychotics results in distinct and overlapping regions of immediate-early gene expression in the rat brain. RGH-1756 is a recently developed atypical antipsychotic with high affinity to dopamine D(3) receptors that results in a unique pattern of c-Fos induction. A single injection of either antipsychotic results in c-fos mRNA expression that peaks around 30 min after drug administration, while the maximum of c-Fos protein induction is seen 2 h after challenge. The transient and distinct temporal inducibility of c-fos mRNA and c-Fos protein was exploited to reveal and compare cellular targets of different antipsychotic drugs by concomitant localization of c-fos mRNA and c-Fos immunoreactivity in brain sections of rats that were timely challenged with two different antipsychotics. Double activity imaging revealed that haloperidol, clozapine and RGH-1756 share cellular targets in the nucleus accumbens, where 40% of all labeled neurons displayed both c-fos mRNA and c-Fos protein. Haloperidol activates cells in the caudate putamen, while clozapine-responsive, single labeled neurons were dominant in the prefrontal cortex and major island of Calleja. RGH-1756 targets haloperidol-sensitive cells in the caudate putamen, but cells that are activated by clozapine and RGH-1756 in the major island of Calleja are different.

  3. SSB-1 of the yeast Saccharomyces cerevisiae is a nucleolar-specific, silver-binding protein that is associated with the snR10 and snR11 small nuclear RNAs

    PubMed Central

    1990-01-01

    SSB-1, the yeast single-strand RNA-binding protein, is demonstrated to be a yeast nucleolar-specific, silver-binding protein. In double-label immunofluorescence microscopy experiments antibodies to two other nucleolar proteins, RNA Pol I 190-kD and fibrillarin, were used to reveal the site of rRNA transcription; i.e., the fibrillar region of the nucleolus. SSB-1 colocalized with fibrillarin in a double-label immunofluorescence mapping experiment to the yeast nucleolus. SSB-1 is located, though, over a wider region of the nucleolus than the transcription site marker. Immunoprecipitations of yeast cell extracts with the SSB-1 antibody reveal that in 150 mM NaCl SSB-1 is bound to two small nuclear RNAs (snRNAs). These yeast snRNAs are snR10 and snR11, with snR10 being predominant. Since snR10 has been implicated in pre-rRNA processing, the association of SSB-1 and snR10 into a nucleolar snRNP particle indicates SSB-1 involvement in rRNA processing as well. Also, another yeast protein, SSB-36-kD, isolated by single- strand DNA chromatography, is shown to bind silver under the conditions used for nucleolar-specific staining. It is, most likely, another yeast nucleolar protein. PMID:2121740

  4. Kinetic Characterization of Nonmuscle Myosin IIB at the Single Molecule Level*

    PubMed Central

    Nagy, Attila; Takagi, Yasuharu; Billington, Neil; Sun, Sara A.; Hong, Davin K. T.; Homsher, Earl; Wang, Aibing; Sellers, James R.

    2013-01-01

    Nonmuscle myosin IIB (NMIIB) is a cytoplasmic myosin, which plays an important role in cell motility by maintaining cortical tension. It forms bipolar thick filaments with ∼14 myosin molecule dimers on each side of the bare zone. Our previous studies showed that the NMIIB is a moderately high duty ratio (∼20–25%) motor. The ADP release step (∼0.35 s−1) of NMIIB is only ∼3 times faster than the rate-limiting phosphate release (0.13 ± 0.01 s−1). The aim of this study was to relate the known in vitro kinetic parameters to the results of single molecule experiments and to compare the kinetic and mechanical properties of single- and double-headed myosin fragments and nonmuscle IIB thick filaments. Examination of the kinetics of NMIIB interaction with actin at the single molecule level was accomplished using total internal reflection fluorescence (TIRF) with fluorescence imaging with 1-nm accuracy (FIONA) and dual-beam optical trapping. At a physiological ATP concentration (1 mm), the rate of detachment of the single-headed and double-headed molecules was similar (∼0.4 s−1). Using optical tweezers we found that the power stroke sizes of single- and double-headed heavy meromyosin (HMM) were each ∼6 nm. No signs of processive stepping at the single molecule level were observed in the case of NMIIB-HMM in optical tweezers or TIRF/in vitro motility experiments. In contrast, robust motility of individual fluorescently labeled thick filaments of full-length NMIIB was observed on actin filaments. Our results are in good agreement with the previous steady-state and transient kinetic studies and show that the individual nonprocessive nonmuscle myosin IIB molecules form a highly processive unit when polymerized into filaments. PMID:23148220

  5. Organic Compounds Produced by Photolysis of Realistic Interstellar and Cometary Ice Analogs Containing Methanol

    NASA Technical Reports Server (NTRS)

    Bernstein, Max P.; Sandford, Scott A.; Allamandola, Louis J.; Chang, Sherwood; Scharberg, Maureen A.

    1995-01-01

    The InfraRed (IR) spectra of UltraViolet (UV) and thermally processed, methanol-containing interstellar / cometary ice analogs at temperatures from 12 to 300 K are presented. Infrared spectroscopy, H-1 and C-13 Nuclear Magnetic Resonance (NMR) spectroscopy, and gas chromatography-mass spectrometry indicate that CO (carbon monoxide), CO2 (carbon dioxide), CH4 (methane), HCO (the formyl radical), H2CO (formaldehyde), CH3CH2OH (ethanol), HC([double bond]O)NH2 (formamide), CH3C([double bond]O)NH2 (acetamide), and R[single bond]C[triple bond]N (nitriles) are formed. In addition, the organic materials remaining after photolyzed ice analogs have been warmed to room temperature contain (in rough order of decreasing abundance), (1) hexamethylenetetramine (HMT, C6H12N4), (2) ethers, alcohols, and compounds related to PolyOxyMethylene (POM, ([single bond]CH2O[single bond](sub n)), and (3) ketones (R[single bond]C([double bond]O)[single bond]R') and amides (H2NC([double bond]O)[single bond]R). Most of the carbon in these residues is thought to come from the methanol in the original ice. Deuterium and C-13 isotopic labeling demonstrates that methanol is definitely the source of carbon in HMT. High concentrations of HMT in interstellar and cometary ices could have important astrophysical consequences. The ultraviolet photolysis of HMT frozen in H2O ice readily produces the 'XCN' band observed in the spectra of protostellar objects and laboratory ices, as well as other nitriles. Thus, HMT may be a precursor of XCN and a source of CN in comets and the interstellar medium. Also, HMT is known to hydrolyze under acidic conditions to yield ammonia, formaldehyde, and amino acids. Thus, HMT may be a significant source of prebiogenic compounds on asteroidal parent bodies. A potential mechanism for the radiative formation of HMT in cosmic ices is outlined.

  6. DNA with Parallel Strand Orientation: A Nanometer Distance Study with Spin Labels in the Watson-Crick and the Reverse Watson-Crick Double Helix.

    PubMed

    Wunnicke, Dorith; Ding, Ping; Yang, Haozhe; Seela, Frank; Steinhoff, Heinz-Jürgen

    2015-10-29

    Parallel-stranded (ps) DNA characterized by its sugar-phosphate backbones pointing in the same direction represents an alternative pairing system to antiparallel-stranded (aps) DNA with the potential to inhibit transcription and translation. 25-mer oligonucleotides were selected containing only dA·dT base pairs to compare spin-labeled nucleobase distances over a range of 10 or 15 base pairs in ps DNA with those in aps DNA. By means of the copper(I)-catalyzed Huisgen-Meldal-Sharpless alkyne-azide cycloaddition, the spin label 4-azido-2,2,6,6-tetramethylpiperidine-1-oxyl was clicked to 7-ethynyl-7-deaza-2'-deoxyadenosine or 5-ethynyl-2'-deoxyuridine to yield 25-mer oligonucleotides incorporating two spin labels. The interspin distances between spin labeled residues were determined by pulse EPR spectroscopy. The results reveal that in ps DNA these distances are between 5 and 10% longer than in aps DNA when the labeled DNA segment is located near the center of the double helix. The interspin distance in ps DNA becomes shorter compared with aps DNA when one of the spin labels occupies a position near the end of the double helix.

  7. Purification and general properties of the DNA-binding protein (P16) from rat liver mitochondria.

    PubMed

    Pavco, P A; Van Tuyle, G C

    1985-01-01

    The mitochondrial DNA-binding protein P16 was isolated from rat liver mitochondrial lysates by affinity chromatography on single strand DNA agarose and separated from DNA in the preparation by alkaline CsCl isopycnic gradients. The top fraction of the gradients contained a single polypeptide species (Mr approximately equal to 15,200) based upon SDS PAGE. Digestion of single strand DNA-bound P16 with proteinase K produced a protease-insensitive, DNA-binding fragment (Mr approximately equal to 6,000) that has been purified by essentially the same procedures used for intact P16. The partial amino acid compositions for P16 and the DNA-binding fragment were obtained by conventional methods. Analysis of subcellular fractions revealed that nearly all of the cellular P16 was located in the mitochondria and that only trace amounts of protein of comparable electrophoretic mobility could be isolated from the nuclear or cytoplasmic fractions. The labeling of P16 with [35S]methionine in primary rat hepatocyte cultures was inhibited by more than 90% by the cytoplasmic translation inhibitor cycloheximide, but unaffected by the mitochondrial-specific agent chloramphenicol. These results indicate that P16 is synthesized on cytoplasmic ribosomes and imported into the mitochondria. The addition of purified P16 to deproteinized mitochondrial DNA resulted in the complete protection of the labeled nascent strands of displacement loops against branch migrational loss during cleavage of parental DNA with SstI, thus providing strong evidence that P16 is the single entity required for this in vitro function. Incubation of P16 with single strand phi X174 DNA, double strand (RF) phi X174 DNA, or Escherichia coli ribosomal RNA and subsequent analysis of the nucleic acid species for bound protein indicated a strong preference of P16 for single strand DNA and no detectable affinity for RNA or double strand DNA. Examination of P16-single strand phi X174 DNA complexes by direct electron microscopy revealed thickened, irregular fibers characteristic of protein-associated single strand DNA.

  8. On cordial labeling of double duplication for some families of graph

    NASA Astrophysics Data System (ADS)

    Shobana, L.; Remigius Perpetua Mary, F.

    2018-04-01

    Let G (V, E) be a simple undirected graph where V,E are its vertex set and edge set respectively. Consider a labeling where f bea function from the vertices of G to {0, 1} and for each edge xy assign the label|f(x)-f(y)|. Then f is called cordial of G if the number of vertices labeled 0 and the number of vertices labeled 1 differs by at most 1 and the number of edges labeled 0 and the number of edges labeled 1 differs by at most 1. In this paper we proved the existence of cordial labeling for double duplication of path graph Pn: n≥2, cycle graph Cn: n≥3 except for n≡2 (mod 4), wheel graph Wn:n≥5 except for n≥3 (mod 4), flower graph Fn: n≥5 and bistar graph Bm,n: m,n≥2.

  9. Root interaction between Bromud tectorum and Poa pratensis: a three-dimensional analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bookman, P.A.; Mack, R.N.

    1982-06-01

    The spatial distribution of roots of two alien grasses, Bromus tectorum and Poa pratensis, grown singly and in a mixture, was examined using a double-labelling radioisotope technique. Interactions between the root systems of these plants led to a restricted B. tectorum rooting volume in P. pratensis neighborhoods greater than or equal to30-d-old. The roots of B. tectorum failed to develop laterally. The altered B. tectorum root systems may contribute to its inability to persist in established P. pratensis swards.

  10. CW dipolar broadening EPR spectroscopy and mechanically aligned bilayers used to measure distance and relative orientation between two TOAC spin labels on an antimicrobial peptide

    NASA Astrophysics Data System (ADS)

    Sahu, Indra D.; Hustedt, Eric J.; Ghimire, Harishchandra; Inbaraj, Johnson J.; McCarrick, Robert M.; Lorigan, Gary A.

    2014-12-01

    An EPR membrane alignment technique was applied to measure distance and relative orientations between two spin labels on a protein oriented along the surface of the membrane. Previously we demonstrated an EPR membrane alignment technique for measuring distances and relative orientations between two spin labels using a dual TOAC-labeled integral transmembrane peptide (M2δ segment of Acetylcholine receptor) as a test system. In this study we further utilized this technique and successfully measured the distance and relative orientations between two spin labels on a membrane peripheral peptide (antimicrobial peptide magainin-2). The TOAC-labeled magainin-2 peptides were mechanically aligned using DMPC lipids on a planar quartz support, and CW-EPR spectra were recorded at specific orientations. Global analysis in combination with rigorous spectral simulation was used to simultaneously analyze data from two different sample orientations for both single- and double-labeled peptides. We measured an internitroxide distance of 15.3 Å from a dual TOAC-labeled magainin-2 peptide at positions 8 and 14 that closely matches with the 13.3 Å distance obtained from a model of the labeled magainin peptide. In addition, the angles determining the relative orientations of the two nitroxides have been determined, and the results compare favorably with molecular modeling. This study demonstrates the utility of the technique for proteins oriented along the surface of the membrane in addition to the previous results for proteins situated within the membrane bilayer.

  11. Fluorescence In situ Hybridization: Cell-Based Genetic Diagnostic and Research Applications.

    PubMed

    Cui, Chenghua; Shu, Wei; Li, Peining

    2016-01-01

    Fluorescence in situ hybridization (FISH) is a macromolecule recognition technology based on the complementary nature of DNA or DNA/RNA double strands. Selected DNA strands incorporated with fluorophore-coupled nucleotides can be used as probes to hybridize onto the complementary sequences in tested cells and tissues and then visualized through a fluorescence microscope or an imaging system. This technology was initially developed as a physical mapping tool to delineate genes within chromosomes. Its high analytical resolution to a single gene level and high sensitivity and specificity enabled an immediate application for genetic diagnosis of constitutional common aneuploidies, microdeletion/microduplication syndromes, and subtelomeric rearrangements. FISH tests using panels of gene-specific probes for somatic recurrent losses, gains, and translocations have been routinely applied for hematologic and solid tumors and are one of the fastest-growing areas in cancer diagnosis. FISH has also been used to detect infectious microbias and parasites like malaria in human blood cells. Recent advances in FISH technology involve various methods for improving probe labeling efficiency and the use of super resolution imaging systems for direct visualization of intra-nuclear chromosomal organization and profiling of RNA transcription in single cells. Cas9-mediated FISH (CASFISH) allowed in situ labeling of repetitive sequences and single-copy sequences without the disruption of nuclear genomic organization in fixed or living cells. Using oligopaint-FISH and super-resolution imaging enabled in situ visualization of chromosome haplotypes from differentially specified single-nucleotide polymorphism loci. Single molecule RNA FISH (smRNA-FISH) using combinatorial labeling or sequential barcoding by multiple round of hybridization were applied to measure mRNA expression of multiple genes within single cells. Research applications of these single molecule single cells DNA and RNA FISH techniques have visualized intra-nuclear genomic structure and sub-cellular transcriptional dynamics of many genes and revealed their functions in various biological processes.

  12. Spontaneous regeneration of the corticospinal tract after transection in young rats: a key role of reactive astrocytes in making favorable and unfavorable conditions for regeneration.

    PubMed

    Iseda, T; Nishio, T; Kawaguchi, S; Yamanoto, M; Kawasaki, T; Wakisaka, S

    2004-01-01

    We demonstrated the occurrence of marked regeneration of the corticospinal tract (CST) after a single transection and failure of regeneration after a repeated transection in young rats. To provide convincing evidence for the complete transection and regeneration we used retrograde neuronal double labeling. Double-labeled neurons that took up the first tracer from the transection site and the second tracer from the injection site caudal to the transection site were observed in the sensorimotor cortex. The anterograde tracing method revealed various patterns of regeneration. In the most successful cases the vast majority of regenerated fibers descended in the normal tract and terminated normally whereas a trace amount of fibers coursed aberrantly. In the less successful cases fibers descended partly normally and partly aberrantly or totally aberrantly. To clarify the role of astrocytes in determining the success or failure of regeneration we compared expression of glial fibrillary acidic protein (GFAP), vimentin and neurofilament (NF) immunoreactivity (IR) in the lesion between single and repeated transections. In either transection, astrocytes disappeared from the CST near the lesion site as early as 3 h after lesioning. However, by 24 h after a single transection, immature astrocytes coexpressing GFAP- and vimentin-IR appeared in the former astrocyte-free area and NF-positive axons crossed the lesion. By contrast, after a repeated transection the astrocyte-free area spread and NF-positive axons never crossed the lesion. It appears likely that the major sign, and possibly cause of failure of regeneration is the prolonged disappearance of astrocytes in the lesioned tract area. Copyright 2004 IBRO

  13. Localization of visual pigment antigens to photoreceptor cells with different oil droplets in the chicken retina.

    PubMed

    Szél, A; Röhlich, P

    1985-01-01

    Frozen semithin sections and unembedded retinal pieces were investigated by immunocytochemistry using two antibodies produced against visual pigments in our laboratory. One was a polyclonal serum (AO) raised against bovine rhodopsin, while the other one was a monoclonal antibody (COS-1) produced against an epitope present in a cone visual pigment. AO stained, as expected, rod outer segments; in addition it also recognized a single cone characterized by a deep yellow oil droplet as well as another single cone with a yellowish green oil droplet. In contrast, COS-1 labelled both members of the double cones; the principal member having a yellowish-green oil droplet and the accessory member. COS-1 also stained a single cone type exhibiting a large red oil droplet.

  14. A DNA microarray-based assay to detect dual infection with two dengue virus serotypes.

    PubMed

    Díaz-Badillo, Alvaro; Muñoz, María de Lourdes; Perez-Ramirez, Gerardo; Altuzar, Victor; Burgueño, Juan; Mendoza-Alvarez, Julio G; Martínez-Muñoz, Jorge P; Cisneros, Alejandro; Navarrete-Espinosa, Joel; Sanchez-Sinencio, Feliciano

    2014-04-25

    Here; we have described and tested a microarray based-method for the screening of dengue virus (DENV) serotypes. This DNA microarray assay is specific and sensitive and can detect dual infections with two dengue virus serotypes and single-serotype infections. Other methodologies may underestimate samples containing more than one serotype. This technology can be used to discriminate between the four DENV serotypes. Single-stranded DNA targets were covalently attached to glass slides and hybridised with specific labelled probes. DENV isolates and dengue samples were used to evaluate microarray performance. Our results demonstrate that the probes hybridized specifically to DENV serotypes; with no detection of unspecific signals. This finding provides evidence that specific probes can effectively identify single and double infections in DENV samples.

  15. A DNA Microarray-Based Assay to Detect Dual Infection with Two Dengue Virus Serotypes

    PubMed Central

    Díaz-Badillo, Alvaro; de Lourdes Muñoz, María; Perez-Ramirez, Gerardo; Altuzar, Victor; Burgueño, Juan; Mendoza-Alvarez, Julio G.; Martínez-Muñoz, Jorge P.; Cisneros, Alejandro; Navarrete-Espinosa, Joel; Sanchez-Sinencio, Feliciano

    2014-01-01

    Here; we have described and tested a microarray based-method for the screening of dengue virus (DENV) serotypes. This DNA microarray assay is specific and sensitive and can detect dual infections with two dengue virus serotypes and single-serotype infections. Other methodologies may underestimate samples containing more than one serotype. This technology can be used to discriminate between the four DENV serotypes. Single-stranded DNA targets were covalently attached to glass slides and hybridised with specific labelled probes. DENV isolates and dengue samples were used to evaluate microarray performance. Our results demonstrate that the probes hybridized specifically to DENV serotypes; with no detection of unspecific signals. This finding provides evidence that specific probes can effectively identify single and double infections in DENV samples. PMID:24776933

  16. Artificial plasmid labeled with 5-bromo-2'-deoxyuridine: a universal molecular system for strand break detection.

    PubMed

    Zylicz-Stachula, Agnieszka; Polska, Katarzyna; Skowron, Piotr; Rak, Janusz

    2014-07-07

    DNA strand breaks (SBs) are among the most cytotoxic forms of DNA damage, and their residual levels correlate directly with cell death. Hence, the type and amount of SBs is directly related to the efficacy of a given anticancer therapy. In this study, we describe a molecular tool that can differentiate between single (SSBs) and double (DSBs) strand breaks and also assess them quantitatively. Our method involves PCR amplification of a linear DNA fragment labeled with a sensitizing nucleotide, circularization of that fragment, and enzymatic introduction of supercoils to transform the circular relaxed form of the synthesized plasmid into a supercoiled one. After exposure of the molecule to a damaging factor, SSB and DSB levels can be easily assayed with gel electrophoresis. We applied this method to prepare an artificial plasmid labeled with 5-bromo-2'-deoxyuridine and to assay SBs photoinduced in the synthesized plasmid. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Assessment of amide I spectroscopic maps for a gas-phase peptide using IR-UV double-resonance spectroscopy and density functional theory calculations

    NASA Astrophysics Data System (ADS)

    Carr, J. K.; Zabuga, A. V.; Roy, S.; Rizzo, T. R.; Skinner, J. L.

    2014-06-01

    The spectroscopy of amide I vibrations has become a powerful tool for exploring protein structure and dynamics. To help with spectral interpretation, it is often useful to perform molecular dynamics (MD) simulations. To connect spectroscopic experiments to simulations in an efficient manner, several researchers have proposed "maps," which relate observables in classical MD simulations to quantum spectroscopic variables. It can be difficult to discern whether errors in the theoretical results (compared to experiment) arise from inaccuracies in the MD trajectories or in the maps themselves. In this work, we evaluate spectroscopic maps independently from MD simulations by comparing experimental and theoretical spectra for a single conformation of the α-helical model peptide Ac-Phe-(Ala)5-Lys-H+ in the gas phase. Conformation-specific experimental spectra are obtained for the unlabeled peptide and for several singly and doubly 13C-labeled variants using infrared-ultraviolet double-resonance spectroscopy, and these spectra are found to be well-modeled by density functional theory (DFT) calculations at the B3LYP/6-31G** level. We then compare DFT results for the deuterated and 13C18O-labeled peptide with those from spectroscopic maps developed and used previously by the Skinner group. We find that the maps are typically accurate to within a few cm-1 for both frequencies and couplings, having larger errors only for the frequencies of terminal amides.

  18. Assessment of amide I spectroscopic maps for a gas-phase peptide using IR-UV double-resonance spectroscopy and density functional theory calculations

    PubMed Central

    Carr, J. K.; Zabuga, A. V.; Roy, S.; Rizzo, T. R.; Skinner, J. L.

    2014-01-01

    The spectroscopy of amide I vibrations has become a powerful tool for exploring protein structure and dynamics. To help with spectral interpretation, it is often useful to perform molecular dynamics (MD) simulations. To connect spectroscopic experiments to simulations in an efficient manner, several researchers have proposed “maps,” which relate observables in classical MD simulations to quantum spectroscopic variables. It can be difficult to discern whether errors in the theoretical results (compared to experiment) arise from inaccuracies in the MD trajectories or in the maps themselves. In this work, we evaluate spectroscopic maps independently from MD simulations by comparing experimental and theoretical spectra for a single conformation of the α-helical model peptide Ac-Phe-(Ala)5-Lys-H+ in the gas phase. Conformation-specific experimental spectra are obtained for the unlabeled peptide and for several singly and doubly 13C-labeled variants using infrared-ultraviolet double-resonance spectroscopy, and these spectra are found to be well-modeled by density functional theory (DFT) calculations at the B3LYP/6-31G** level. We then compare DFT results for the deuterated and 13C18O-labeled peptide with those from spectroscopic maps developed and used previously by the Skinner group. We find that the maps are typically accurate to within a few cm−1 for both frequencies and couplings, having larger errors only for the frequencies of terminal amides. PMID:24929378

  19. Hypothalamic hypocretinergic/orexinergic neurons projecting to the oral pontine rapid eye movement sleep inducing site in the cat.

    PubMed

    García-García, Berta; Reinoso-Suárez, Fernando; Rodrigo-Angulo, Margarita L

    2013-05-01

    The cat ventral oral pontine reticular nucleus (vRPO) is responsible for the generation and maintenance of rapid eye movement (REM) sleep. Hypothalamic neurons containing the peptide hypocretin-1 (also called orexin-A) which will be herewith defined as orexinergic (Orx) neurons, occupy a pre-eminent place in the integration and stabilization of arousal networks as well as in the physiopathology of narcolepsy/cataplexy. In the previous investigations, low-volume and dose microinjections of hypocretin-1 in cat vRPO produced a specific and significant suppression of REM sleep. The aim of this study is to map the hypothalamic Orx neurons that project to the vRPO and suppress REM sleep generation in the cat. Five adult cats received microinjections of the retrograde tracer cholera toxin (CTb) into the vRPO. Brains were processed employing both CTb staining and antiorexin-A immunocytochemistry techniques. A large number of double-labeled neurons (Orx-CTb) intermingled with the single CTb-positive and single Orx neurons were detected in the ipsilateral lateral, perifornical, dorsal, anterior, perimammillothalamic, and posterior hypothalamic areas but were very scarce in the paraventricular, dorsomedial, ventromedial, and periventricular hypothalamic nuclei. A considerable number of double-labeled neurons were also observed in both the dorsal and the lateral hypothalamic areas in the contralateral hypothalamus. Our results suggest that the widely distributed Orx neuronal hypothalamic groups could physiologically inhibit REM sleep generation in vRPO. Copyright © 2013 Wiley Periodicals, Inc.

  20. Enhanced Androgen Signaling With Androgen Receptor Overexpression in the Osteoblast Lineage Controls Skeletal Turnover, Matrix Quality and Bone Architecture

    DTIC Science & Technology

    2006-12-01

    tg males after double-label administration. 8-week-old male AR2.3-transgenic mice were pulsed with oxytetracycline followed 7 days later with...out at the femoral diaphysis. Fluorochromes were administered in 2-month old mice by double-label injection, with oxytetracycline followed by

  1. Epoxyethylglycyl peptides as inhibitors of oligosaccharyltransferase: double-labelling of the active site.

    PubMed

    Bause, E; Wesemann, M; Bartoschek, A; Breuer, W

    1997-02-15

    Pig liver oligosaccharyltransferase (OST) is inactivated irreversibly by a hexapeptide in which threonine has been substituted by epoxyethylglycine in the Asn-Xaa-Thr glycosylation triplet. Incubation of the enzyme in the presence of Dol-PP-linked [14C]oligosaccharides and the N-3,5-dinitrobenzoylated epoxy derivative leads to the double-labelling of two subunits (48 and 66 kDa) of the oligomeric OST complex, both of which are involved in the catalytic activity. Labelling of both subunits was blocked competitively by the acceptor peptide N-benzoyl-Asu-Gly-Thr-NHCH3 and by the OST inhibitor N-benzoyl-alpha,gamma-diaminobutyric acid-Gly-Thr-NHCH3, but not by an analogue derived from the epoxy-inhibitor by replacing asparagine with glutamine. Our data clearly show that double-labelling is an active-site-directed modification, involving inhibitor glycosylation at asparagine and covalent attachment of the glycosylated inhibitor, via the epoxy group, to the enzyme. Double-labelling of OST can occur as the result of either a consecutive or a syn-catalytic reaction sequence. The latter mechanism, during the course of which OST catalyses its own 'suicide' inactivation, is more likely, as suggested by indirect experimental evidence. The syn-catalytic mechanism corresponds with our current view of the functional role of the acceptor site Thr/Ser acting as a hydrogen-bond acceptor, not a donor, during transglycosylation.

  2. Fully convolutional networks with double-label for esophageal cancer image segmentation by self-transfer learning

    NASA Astrophysics Data System (ADS)

    Xue, Di-Xiu; Zhang, Rong; Zhao, Yuan-Yuan; Xu, Jian-Ming; Wang, Ya-Lei

    2017-07-01

    Cancer recognition is the prerequisite to determine appropriate treatment. This paper focuses on the semantic segmentation task of microvascular morphological types on narrowband images to aid clinical examination of esophageal cancer. The most challenge for semantic segmentation is incomplete-labeling. Our key insight is to build fully convolutional networks (FCNs) with double-label to make pixel-wise predictions. The roi-label indicating ROIs (region of interest) is introduced as extra constraint to guild feature learning. Trained end-to-end, the FCN model with two target jointly optimizes both segmentation of sem-label (semantic label) and segmentation of roi-label within the framework of self-transfer learning based on multi-task learning theory. The learning representation ability of shared convolutional networks for sem-label is improved with support of roi-label via achieving a better understanding of information outside the ROIs. Our best FCN model gives satisfactory segmentation result with mean IU up to 77.8% (pixel accuracy > 90%). The results show that the proposed approach is able to assist clinical diagnosis to a certain extent.

  3. A double-labeling procedure for sequence analysis of picomole amounts of nonradioactive RNA fragments.

    PubMed Central

    Gupta, R C; Randerath, E; Randerath, K

    1976-01-01

    A double-labeling procedure for sequence analysis of nonradioactive polyribonucleotides is detailed, which is based on controlled endonucleolytic degradation of 3'-terminally (3H)-labeled oligonucleotide-(3') dialcohols and 5"-terminal analysis of the partial (3H)-labeled fragments following their separation according to chain length by polyethyleneimine- (PEI-)cellulose TLC and detection by fluorography. Undesired nonradioactive partial digestion products are eliminated by periodate oxidation. The 5'-termini are assayed by enzymic incorporation of (32p)-label into the isolated fragments, enzymic release of (32p)-labeled nucleoside-(5') monophosphates, two-dimensional PEI-cellulose chromatography, and autoradiography. Using this procedure, as little as 0.1 - 0.3 A260 unit of tRNA is needed to sequence all fragments in complete ribonuclease T1 and A digests, whereas radioactive derivative methods previously described by us1-4 required 4 - 6 A260 units. Images PMID:826884

  4. Quantitative nanoscale imaging of orientational order in biological filaments by polarized superresolution microscopy

    PubMed Central

    Valades Cruz, Cesar Augusto; Shaban, Haitham Ahmed; Kress, Alla; Bertaux, Nicolas; Monneret, Serge; Mavrakis, Manos; Savatier, Julien; Brasselet, Sophie

    2016-01-01

    Essential cellular functions as diverse as genome maintenance and tissue morphogenesis rely on the dynamic organization of filamentous assemblies. For example, the precise structural organization of DNA filaments has profound consequences on all DNA-mediated processes including gene expression, whereas control over the precise spatial arrangement of cytoskeletal protein filaments is key for mechanical force generation driving animal tissue morphogenesis. Polarized fluorescence is currently used to extract structural organization of fluorescently labeled biological filaments by determining the orientation of fluorescent labels, however with a strong drawback: polarized fluorescence imaging is indeed spatially limited by optical diffraction, and is thus unable to discriminate between the intrinsic orientational mobility of the fluorophore labels and the real structural disorder of the labeled biomolecules. Here, we demonstrate that quantitative single-molecule polarized detection in biological filament assemblies allows not only to correct for the rotational flexibility of the label but also to image orientational order of filaments at the nanoscale using superresolution capabilities. The method is based on polarized direct stochastic optical reconstruction microscopy, using dedicated optical scheme and image analysis to determine both molecular localization and orientation with high precision. We apply this method to double-stranded DNA in vitro and microtubules and actin stress fibers in whole cells. PMID:26831082

  5. An improved stable isotope N-terminal labeling approach with light/heavy TMPP to automate proteogenomics data validation: dN-TOP.

    PubMed

    Bertaccini, Diego; Vaca, Sebastian; Carapito, Christine; Arsène-Ploetze, Florence; Van Dorsselaer, Alain; Schaeffer-Reiss, Christine

    2013-06-07

    In silico gene prediction has proven to be prone to errors, especially regarding precise localization of start codons that spread in subsequent biological studies. Therefore, the high throughput characterization of protein N-termini is becoming an emerging challenge in the proteomics and especially proteogenomics fields. The trimethoxyphenyl phosphonium (TMPP) labeling approach (N-TOP) is an efficient N-terminomic approach that allows the characterization of both N-terminal and internal peptides in a single experiment. Due to its permanent positive charge, TMPP labeling strongly affects MS/MS fragmentation resulting in unadapted scoring of TMPP-derivatized peptide spectra by classical search engines. This behavior has led to difficulties in validating TMPP-derivatized peptide identifications with usual score filtering and thus to low/underestimated numbers of identified N-termini. We present herein a new strategy (dN-TOP) that overwhelmed the previous limitation allowing a confident and automated N-terminal peptide validation thanks to a combined labeling with light and heavy TMPP reagents. We show how this double labeling allows increasing the number of validated N-terminal peptides. This strategy represents a considerable improvement to the well-established N-TOP method with an enhanced and accelerated data processing making it now fully compatible with high-throughput proteogenomics studies.

  6. Molecular barcodes detect redundancy and contamination in hairpin-bisulfite PCR

    PubMed Central

    Miner, Brooks E.; Stöger, Reinhard J.; Burden, Alice F.; Laird, Charles D.; Hansen, R. Scott

    2004-01-01

    PCR amplification of limited amounts of DNA template carries an increased risk of product redundancy and contamination. We use molecular barcoding to label each genomic DNA template with an individual sequence tag prior to PCR amplification. In addition, we include molecular ‘batch-stamps’ that effectively label each genomic template with a sample ID and analysis date. This highly sensitive method identifies redundant and contaminant sequences and serves as a reliable method for positive identification of desired sequences; we can therefore capture accurately the genomic template diversity in the sample analyzed. Although our application described here involves the use of hairpin-bisulfite PCR for amplification of double-stranded DNA, the method can readily be adapted to single-strand PCR. Useful applications will include analyses of limited template DNA for biomedical, ancient DNA and forensic purposes. PMID:15459281

  7. Histochemistry of nerve fibres double labelled with anti-TRPV2 antibodies and sensory nerve marker AM1-43 in the dental pulp of rat molars.

    PubMed

    Nishikawa, Sumio

    2008-09-01

    AM1-43 can label sensory nerve fibres and sensory neurons. Permeation of non-selective cation channels of the nerve cell membrane is suggested to be the mechanism responsible for labelling. To identify these channels, two candidates, TRPV1 and TRPV2 were examined by immunocytochemistry in the dental pulp and trigeminal ganglion of rats injected with AM1-43. A part of AM1-43-labelled nerve fibres was also positive for anti-TRPV2 antibody but negative for anti-TRPV1 antibody in the dental pulp. In the trigeminal ganglion, a part of the neuron showed both bright AM1-43 labelling and anti-TRPV2 immunolabelling, but neurons double labelled with AM1-43 and TRPV1 were rare. These results suggest that TRPV2 channels, but not TRPV1 channels, contribute to the fluorescent labelling of AM1-43 in the dental pulp.

  8. Molybdenum disulfide (MoS2) nanoflakes as inherently electroactive labels for DNA hybridization detection

    NASA Astrophysics Data System (ADS)

    Loo, Adeline Huiling; Bonanni, Alessandra; Ambrosi, Adriano; Pumera, Martin

    2014-09-01

    The detection of specific DNA sequences plays a critical role in the areas of medical diagnostics, environmental monitoring, drug discovery and food safety. This has therefore become a strong driving force behind the ever-increasing demand for simple, cost-effective, highly sensitive and selective DNA biosensors. In this study, we report for the first time, a novel approach for the utilization of molybdenum disulfide nanoflakes, a member of the transition metal dichalcogenides family, in the detection of DNA hybridization. Herein, molybdenum disulfide nanoflakes serve as inherently electroactive labels, with the inherent oxidation peak exploited as the analytical signal. The principle of detection is based on the differential affinity of molybdenum disulfide nanoflakes towards single-stranded DNA and double-stranded DNA. The employment of transition metal dichalcogenide nanomaterials for sensing and biosensing purposes represents an upcoming research area which holds great promise. Hence, our findings are anticipated to have significant contributions towards the fabrication of future DNA biosensors.The detection of specific DNA sequences plays a critical role in the areas of medical diagnostics, environmental monitoring, drug discovery and food safety. This has therefore become a strong driving force behind the ever-increasing demand for simple, cost-effective, highly sensitive and selective DNA biosensors. In this study, we report for the first time, a novel approach for the utilization of molybdenum disulfide nanoflakes, a member of the transition metal dichalcogenides family, in the detection of DNA hybridization. Herein, molybdenum disulfide nanoflakes serve as inherently electroactive labels, with the inherent oxidation peak exploited as the analytical signal. The principle of detection is based on the differential affinity of molybdenum disulfide nanoflakes towards single-stranded DNA and double-stranded DNA. The employment of transition metal dichalcogenide nanomaterials for sensing and biosensing purposes represents an upcoming research area which holds great promise. Hence, our findings are anticipated to have significant contributions towards the fabrication of future DNA biosensors. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr03795b

  9. Intrinsically Labeled Fluorescent Oligonucleotide Probes on Quantum Dots for Transduction of Nucleic Acid Hybridization.

    PubMed

    Shahmuradyan, Anna; Krull, Ulrich J

    2016-03-15

    Quantum dots (QDs) have been widely used in chemical and biosensing due to their unique photoelectrical properties and are well suited as donors in fluorescence resonance energy transfer (FRET). Selective hybridization interactions of oligonucleotides on QDs have been determined by FRET. Typically, the QD-FRET constructs have made use of labeled targets or have implemented labeled sandwich format assays to introduce dyes in proximity to the QDs for the FRET process. The intention of this new work is to explore a method to incorporate the acceptor dye into the probe molecule. Thiazole orange (TO) derivatives are fluorescent intercalating dyes that have been used for detection of double-stranded nucleic acids. One such dye system has been reported in which single-stranded oligonucleotide probes were doubly labeled with adjacent thiazole orange derivatives. In the absence of the fully complementary (FC) oligonucleotide target, the dyes form an H-aggregate, which results in quenching of fluorescence emission due to excitonic interactions between the dyes. The hybridization of the FC target to the probe provides for dissociation of the aggregate as the dyes intercalate into the double stranded duplex, resulting in increased fluorescence. This work reports investigation of the dependence of the ratiometric signal on the type of linkage used to conjugate the dyes to the probe, the location of the dye along the length of the probe, and the distance between adjacent dye molecules. The limit of detection for 34mer and 90mer targets was found to be identical and was 10 nM (2 pmol), similar to analogous QD-FRET using labeled oligonucleotide target. The detection system could discriminate a one base pair mismatch (1BPM) target and was functional without substantial compromise of the signal in 75% serum. The 1BPM was found to reduce background signal, indicating that the structure of the mismatch affected the environment of the intercalating dyes.

  10. Effects of hydrostatic pressure on microtubule organization and nucleus changes in gynogenetically activated eggs of olive flounder (Paralichthys olivaceus).

    PubMed

    Lin, Zhengmei; Zhu, Xiangping; Zhang, Tingrong; You, Feng; Wu, Zhihao; Cao, Yuanshui

    2016-06-01

    Fluorescent double-labeled technique was used to investigate the effects of hydrostatic pressure on microtubule organization and nucleus in gynogenetically activated eggs of olive flounder (Paralichthys olivaceus). The parameter of hydrostatic pressure treatment was 600 kg/cm(2) for 6 minutes at prometaphase of the first mitosis. The data showed that nucleus and microtubule changes of the diploid control were basically similar to those of the haploid one (5 minutes behind those of the diploid control). Nuclear diameter of the haploid embryo was significantly smaller than that of the diploid one (P < 0.01). The ploidy of chromosome set could be determined basing on nuclear diameter. The results of nuclear diameter measurement and the ratio of developmentally delayed embryo showed that the chromosome set was not doubled during the second cell cycle, the first cleavage proceeded normally; but that of about 80% treated embryo was doubled during the third cell cycle, the second cleavage was inhibited. Microtubules were disassembled, and nucleation capacity of centrosome was just temporarily inhibited by pressure treatment. Centrosome renucleated microtubule, and a bipolar spindle reassembled 15 minutes after treatment, leading to occurrence of the first cleavage. During the second cell cycle, about 80% treated embryo had a single centrosome and formed a unipolar spindle in both blastomeres. After prometaphase, chromosomes spread around for about 20 minutes instead of aligning on the equatorial plane, then assembled and formed one large nucleus without anaphase separation. The second cleavage was inhibited, and the chromosome set was doubled. The data indicated that the chromosome set doubling of mitogynogenetic diploid induced by hydrostatic pressure treatment, which performed at prometaphase of the first mitosis, mainly resulted from the inhibition of the second cleavage rather than the first one. This study is the first to adapt fluorescent double-labeled technique to investigate the mechanism on chromosome set doubling of mitotic gynogenesis induction. This study will offer theoretical support for mitogynogenetic diploid induction in marine fish. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Near-field microscopy and fluorescence spectroscopy: application to chromosomes labelled with different fluorophores.

    PubMed

    Mahieu-Williame, L; Falgayrettes, P; Nativel, L; Gall-Borrut, P; Costa, L; Salehzada, T; Bisbal, C

    2010-04-01

    We have coupled a spectrophotometer with a scanning near-field optical microscope to obtain, with a single scan, simultaneously scanning near-field optical microscope fluorescence images at different wavelengths as well as topography and transmission images. Extraction of the fluorescence spectra enabled us to decompose the different wavelengths of the fluorescence signals which normally overlap. We thus obtained images of the different fluorescence emissions of acridine orange bound to single or double stranded nucleic acids in human metaphase chromosomes before and after DNAse I or RNAse A treatment. The analysis of these images allowed us to visualize some specific chromatin areas where RNA is associated with DNA showing that such a technique could be used to identify multiple components within a cell.

  12. Radioimmunotherapy of pancreatic cancer xenografts in nude mice using 90Y-labeled anti-α6β4 integrin antibody

    PubMed Central

    Aung, Winn; Tsuji, Atsushi B.; Sudo, Hitomi; Sugyo, Aya; Ukai, Yoshinori; Kouda, Katsushi; Kurosawa, Yoshikazu; Furukawa, Takako; Saga, Tsuneo

    2016-01-01

    The contribution of integrin α6β4 (α6β4) overexpression to the pancreatic cancer invasion and metastasis has been previously shown. We have reported immunotargeting of α6β4 for radionuclide-based and near-infrared fluorescence imaging in a pancreatic cancer model. In this study, we prepared yttrium-90 labeled anti-α6β4 antibody (90Y-ITGA6B4) and evaluated its radioimmunotherapeutic efficacy against pancreatic cancer xenografts in nude mice. Mice bearing xenograft tumors were randomly divided into 5 groups: (1) single administration of 90Y-ITGA6B4 (3.7MBq), (2) double administrations of 90Y-ITGA6B4 with once-weekly schedule (3.7MBq × 2), (3) single administration of unlabeled ITGA6B4, (4) double administrations of unlabeled ITGA6B4 with once-weekly schedule and (5) the untreated control. Biweekly tumor volume measurements and immunohistochemical analyses of tumors at 2 days post-administration were performed to monitor the response to treatments. To assess the toxicity, body weight was measured biweekly. Additionally, at 27 days post-administration, blood samples were collected through cardiac puncture, and hematological parameters, hepatic and renal functions were analyzed. Both 90Y-ITGA6B4 treatment groups showed reduction in tumor volumes (P < 0.04), decreased cell proliferation marker Ki-67-positive cells and increased DNA damage marker p-H2AX-positive cells, compared with the other groups. Mice treated with double administrations of 90Y-ITGA6B4, exhibited myelosuppression. There were no significant differences in hepatic and renal functions between the 2 treatment groups and the other groups. Our results suggest that 90Y-ITGA6B4 is a promising radioimmunotherapeutic agent against α6β4 overexpressing tumors. In the future studies, dose adjustment for fractionated RIT should be considered carefully in order to get the optimal effect while avoiding myelotoxicity. PMID:27246980

  13. Diffusion and imaging properties of three new lipophilic tracers, NeuroVue ™ Maroon, NeuroVue ™ Red and NeuroVue ™ Green and their use for double and triple labeling of neuronal profile.

    PubMed Central

    Fritzsch, B.; Muirhead, K.A.; Feng, Feng; D.Gray, B.; Ohlsson-Wilhelm, B. M.

    2006-01-01

    We describe here diffusion and imaging properties of three new lipophilic tracers, NeuroVue ™ Maroon (near infrared), NeuroVue ™ Red and NeuroVue ™ Green. Using pair wise comparisons between the new dyes and existing dyes (DiI, DiA, DiD, DiO, PKH2, PKH26) applied to the left and the right side of fixed spinal cord preparations, we show that NeuroVue Maroon (excitation max 647 nm) surpasses all other dyes in this study in signal to noise ratio. We also present data showing the utility of these new dyes for both double labeling and triple labeling in combination with each other or existing lipophilic tracers. Using mice bearing the PLP-eGFP transgene, we demonstrate that either NeuroVue Maroon or NeuroVue Red can readily be combined with eGFP labeling. Double labeling experiments using NeuroVue Red and eGFP allowed us to demonstrate that every fiber in the neonatal ear is surrounded by developing Schwann cells. PMID:16023922

  14. Aptamer sensor for cocaine using minor groove binder based energy transfer.

    PubMed

    Zhou, Jinwen; Ellis, Amanda V; Kobus, Hilton; Voelcker, Nicolas H

    2012-03-16

    We report on an optical aptamer sensor for cocaine detection. The cocaine sensitive fluorescein isothiocyanate (FITC)-labeled aptamer underwent a conformational change from a partial single-stranded DNA with a short hairpin to a double-stranded T-junction in the presence of the target. The DNA minor groove binder Hoechst 33342 selectively bound to the double-stranded T-junction, bringing the dye within the Förster radius of FITC, and therefore initiating minor groove binder based energy transfer (MBET), and reporting on the presence of cocaine. The sensor showed a detection limit of 0.2 μM. The sensor was also implemented on a carboxy-functionalized polydimethylsiloxane (PDMS) surface by covalently immobilizing DNA aptamers. The ability of surface-bound cocaine detection is crucial for the development of microfluidic sensors. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Randomized, Double-Blind, Placebo-Controlled Trial of Asenapine Maintenance Therapy in Adults With an Acute Manic or Mixed Episode Associated With Bipolar I Disorder.

    PubMed

    Szegedi, Armin; Durgam, Suresh; Mackle, Mary; Yu, Sung Yun; Wu, Xiao; Mathews, Maju; Landbloom, Ronald P

    2018-01-01

    The authors determined the efficacy and safety of asenapine in preventing recurrence of any mood episode in adults with bipolar I disorder. Adults with an acute manic or mixed episode per DSM-IV-TR criteria were enrolled in this randomized, placebo-controlled trial consisting of an initial 12- to 16-week open-label period and a 26-week double-blind randomized withdrawal period. The target asenapine dosage was 10 mg b.i.d. in the open-label period but could be titrated down to 5 mg b.i.d. After completing the open-label period, subjects meeting stabilization/stable-responder criteria were randomized to asenapine or placebo treatment in the double-blind period. The primary efficacy endpoint was time to recurrence of any mood event during the double-blind period. Kaplan-Meier estimation was performed, and 95% confidence intervals were determined. Safety was assessed throughout. A total of 549 subjects entered the open-label period, of whom 253 enrolled in the double-blind randomized withdrawal period (127 in the placebo group; 126 in the asenapine group). Time to recurrence of any mood episode was statistically significantly longer for asenapine- than placebo-treated subjects. In post hoc analyses, significant differences in favor of asenapine over placebo were seen in time to recurrence of manic and depressive episodes. The most common treatment-emergent adverse events were somnolence (10.0%), akathisia (7.7%), and sedation (7.7%) in the open-label period and mania (11.9% of the placebo group compared with 4.0% of the asenapine group) and bipolar I disorder (6.3% compared with 1.6%) in the double-blind period. Long-term treatment with asenapine was more effective than placebo in preventing recurrence of mood events in adults with bipolar I disorder and was generally well-tolerated.

  16. Assessment of amide I spectroscopic maps for a gas-phase peptide using IR-UV double-resonance spectroscopy and density functional theory calculations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Carr, J. K.; Roy, S.; Skinner, J. L.

    2014-06-14

    The spectroscopy of amide I vibrations has become a powerful tool for exploring protein structure and dynamics. To help with spectral interpretation, it is often useful to perform molecular dynamics (MD) simulations. To connect spectroscopic experiments to simulations in an efficient manner, several researchers have proposed “maps,” which relate observables in classical MD simulations to quantum spectroscopic variables. It can be difficult to discern whether errors in the theoretical results (compared to experiment) arise from inaccuracies in the MD trajectories or in the maps themselves. In this work, we evaluate spectroscopic maps independently from MD simulations by comparing experimental andmore » theoretical spectra for a single conformation of the α-helical model peptide Ac-Phe-(Ala){sub 5}-Lys-H{sup +} in the gas phase. Conformation-specific experimental spectra are obtained for the unlabeled peptide and for several singly and doubly {sup 13}C-labeled variants using infrared-ultraviolet double-resonance spectroscopy, and these spectra are found to be well-modeled by density functional theory (DFT) calculations at the B3LYP/6-31G** level. We then compare DFT results for the deuterated and {sup 13}C{sup 18}O-labeled peptide with those from spectroscopic maps developed and used previously by the Skinner group. We find that the maps are typically accurate to within a few cm{sup −1} for both frequencies and couplings, having larger errors only for the frequencies of terminal amides.« less

  17. Orientation sensors by defocused imaging of single gold nano-bipyramids

    NASA Astrophysics Data System (ADS)

    Zhang, Fanwei; Li, Qiang; Rao, Wenye; Hu, Hongjin; Gao, Ye; Wu, Lijun

    2018-01-01

    Optical probes for nanoscale orientation sensing have attracted much attention in the field of single-molecule detections. Noble metal especially Au nanoparticles (NPs) exhibit extraordinary plasmonic properties, great photostability, excellent biocompatibility and nontoxicity, and thereby could be alternative labels to conventional applied organic dyes or quantum dots. One type of the most interesting metallic NPs is Au nanorods (AuNRs). Its anisotropic emission accompanied with anisotropic shape is potentially applicable in orientation sensing. Recently, we resolved the 3D orientation of single AuNRs within one frame by deliberately introducing an aberration (slight shift of the dipole away from the focal plane) to the imaging system1 . This defocused imaging technique is based on the electron transition dipole approximation and the fact that the dipole radiation exhibits an angular anisotropy. Since the photoluminescence quantum yield (PLQY) can be enhanced by the "lightning rod effect" (at a sharp angled surface) and localized SPR modes, that of the single Au nano-bipyramid (AuNB) with more sharp tips or edges was found to be doubled comparing to AuNRs with a same effective size2. Here, with a 532 nm excitation, we find that the PL properties of individual AuNBs can be described by three perpendicularly-arranged dipoles (with different ratios). Their PL defocused images are bright, clear and exhibit obvious anisotropy. These properties suggest that AuNBs are excellent candidates for orientation sensing labels in single molecule detections.

  18. SIMSISH Technique Does Not Alter the Apparent Isotopic Composition of Bacterial Cells

    PubMed Central

    Chapleur, Olivier; Wu, Ting-Di; Guerquin-Kern, Jean-Luc; Mazéas, Laurent; Bouchez, Théodore

    2013-01-01

    In order to identify the function of uncultured microorganisms in their environment, the SIMSISH method, combining in situ hybridization (ISH) and nanoscale secondary ion mass spectrometry (nanoSIMS) imaging, has been proposed to determine the quantitative uptake of specific labelled substrates by uncultured microbes at the single cell level. This technique requires the hybridization of rRNA targeted halogenated DNA probes on fixed and permeabilized microorganisms. Exogenous atoms are introduced into cells and endogenous atoms removed during the experimental procedures. Consequently differences between the original and the apparent isotopic composition of cells may occur. In the present study, the influence of the experimental procedures of SIMSISH on the isotopic composition of carbon in E. coli cells was evaluated with nanoSIMS and compared to elemental analyser-isotopic ratio mass spectrometer (EA-IRMS) measurements. Our results show that fixation and hybridization have a very limited, reproducible and homogeneous influence on the isotopic composition of cells. Thereby, the SIMSISH procedure minimizes the contamination of the sample by exogenous atoms, thus providing a means to detect the phylogenetic identity and to measure precisely the carbon isotopic composition at the single cell level. This technique was successfully applied to a complex sample with double bromine – iodine labelling targeting a large group of bacteria and a specific archaea to evaluate their specific 13C uptake during labelled methanol anaerobic degradation. PMID:24204855

  19. Computer simulation of gene detection without PCR by single molecule detection

    NASA Astrophysics Data System (ADS)

    Davis, Lloyd M.; Williams, John G.; Lamb, Don T.

    1999-01-01

    Pioneer Hi-Bred is developing a low-cost method for rapid screening of DNA, for use in research on elite crop seed genetics. Unamplified genomic DNA with the requisite base sequence is simultaneously labeled by two different colored fluorescent probes, which hybridize near the selected gene. Dual-channel single molecule detection (SMD) within a flow cell, then provides a sensitive and specific assay for the gene. The technique has been demonstrated using frequency- doubled Nd:YAG laser excitation of two visible-wavelength dyes. A prototype instrument employing infrared fluorophores and laser diodes for excitation has been developed. Here, we report results from a Monte Carlo simulation of the new instrument, in which experimentally determined photophysical parameters for candidate infrared dyes are used for parametric studies of experimental operating conditions. Fluorophore photostability is found to be a key factor in determining the instrument sensitivity. Most infrared dyes have poor photostability, resulting in inefficient SMD. However, the normalized cross-correlation function of the photon signals from each of the two channels can still yield a discernable peak, provided that the concentration of dual- labeled molecules is sufficiently high. Further, for low concentrations, processing of the two photon streams with Gaussian -weighted sliding sum digital filters and selection of simultaneously occurring peaks can also provide a sensitive indicator of the presence of dual-labeled molecules, although accidental coincidences must be considered in the interpretation of results.

  20. Studies of Xenopus laevis mitochondrial DNA: D-loop mapping and characterization of DNA-binding proteins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cairns, S.S.

    1987-01-01

    In X. laevis oocytes, mitochondrial DNA accumulates to 10/sup 5/ times the somatic cell complement, and is characterized by a high frequency of a triple-stranded displacement hoop structure at the origin of replication. To map the termini of the single strands, it was necessary to correct the nucleotide sequence of the D-loop region. The revised sequence of 2458 nucleotides contains 54 discrepancies in comparison to a previously published sequence. Radiolabeling of the nascent strands of the D-loop structure either at the 5' end or at the 3' end identifies a major species with a length of 1670 nucleotides. Cleavage ofmore » the 5' labeled strands reveals two families of ends located near several matches to an element, designated CSB-1, that is conserved in this location in several vertebrate genomes. Cleavage of 3' labeled strands produced one fragment. The unique 3' end maps to about 15 nucleotides preceding the tRNA/sup Pro/ gene. A search for proteins which may bind to mtDNA in this region to regulate nucleic acid synthesis has identified three activities in lysates of X. laevis mitochondria. The DNA-binding proteins were assayed by monitoring their ability to retard the migration of labeled double- or single-stranded DNA fragments in polyacrylamide gels. The DNA binding preference was determined by competition with an excess of either ds- or ssDNA.« less

  1. Probing phospholipase a(2) with fluorescent phospholipid substrates.

    PubMed

    Wichmann, Oliver; Gelb, Michael H; Schultz, Carsten

    2007-09-03

    The Foerster resonance energy transfer-based sensor, PENN, measures intracellular phospholipase A(2) (PLA(2)) activity in living cells and small organisms. In an attempt to modify the probe for the detection of particular isoforms, we altered the sn-2 fatty acid in such a way that either one or three of the Z double bonds in arachidonic acid were present in the sensor molecule. Arachidonic-acid-mimicking fatty acids were prepared by copper-mediated coupling reactions. Probes with a single double bond in the 5-position exhibited favorable substrate properties for secretory PLA(2)s. In vitro experiments with the novel unsaturated doubly labeled phosphatidylethanolamine derivatives showed preferred cleavage of the sensor PENN2 (one double bond) by the physiologically important group V sPLA(2), while the O-methyl-derivative PMNN2 was accepted best by the isoform from hog pancreas. For experiments in living cells, we demonstrated that bioactivation via S-acetylthioethyl (SATE) groups is essential for probe performance. Surprisingly, membrane-permeant versions of the new sensors that contained double bonds, PENN2 and PENN3, were only cleaved to a minor extent in HeLa cells while the saturated form, PENN, was well accepted.

  2. Real-time monitoring of enzyme activity in a mesoporous silicon double layer

    PubMed Central

    Orosco, Manuel M.; Pacholski, Claudia; Sailor, Michael J.

    2009-01-01

    A double layer mesoporous silicon with different pore sizes functions as a nano-reactor that can isolate, filter and quantify the kinetics of enzyme reactions in real-time by optical reflectivity. This tiny reactor may be used to rapidly characterize a variety of isolated enzymes in a label-free manner. Activity of certain protease enzymes is often an indicator of disease states such as cancer1,2, stroke2, and neurodegeneracy3, and thus, there is a need for rapid assays that can characterize the kinetics and substrate specificity of enzymatic reactions. Nanostructured membranes can efficiently separate biomolecules4 but coupling a sensitive detection method remains difficult. Here we report a single mesoporous nano-reactor that can isolate and quantify in real-time the reaction products of proteases. The reactor consists of two layers of porous films electrochemically prepared from crystalline silicon. The upper layer with large pore sizes traps the protease enzymes and acts as the reactor while the lower layer with smaller pore sizes excludes the large proteins and captures the reaction products. Infiltration of the digested fragments into the lower layer produces a measurable change in optical reflectivity and this allows label-free quantification of enzyme kinetics in real-time within a volume of approximately 5 nanoliters. PMID:19350037

  3. A real-time monitoring platform of myogenesis regulators using double fluorescent labeling

    PubMed Central

    Sapoznik, Etai; Niu, Guoguang; Zhou, Yu; Prim, Peter M.; Criswell, Tracy L.

    2018-01-01

    Real-time, quantitative measurement of muscle progenitor cell (myoblast) differentiation is an important tool for skeletal muscle research and identification of drugs that support skeletal muscle regeneration. While most quantitative tools rely on sacrificial approach, we developed a double fluorescent tagging approach, which allows for dynamic monitoring of myoblast differentiation through assessment of fusion index and nuclei count. Fluorescent tagging of both the cell cytoplasm and nucleus enables monitoring of cell fusion and the formation of new myotube fibers, similar to immunostaining results. This labeling approach allowed monitoring the effects of Myf5 overexpression, TNFα, and Wnt agonist on myoblast differentiation. It also enabled testing the effects of surface coating on the fusion levels of scaffold-seeded myoblasts. The double fluorescent labeling of myoblasts is a promising technique to visualize even minor changes in myogenesis of myoblasts in order to support applications such as tissue engineering and drug screening. PMID:29444187

  4. Fluorescent vancomycin and terephthalate comodified europium-doped layered double hydroxides nanoparticles: synthesis and application for bacteria labelling

    NASA Astrophysics Data System (ADS)

    Sun, Jianchao; Fan, Hai; Wang, Nan; Ai, Shiyun

    2014-09-01

    Vancomycin (Van)- and terephthalate (TA)-comodified europium-doped layered double hydroxides (Van-TA-Eu-LDHs) nanoparticles were successfully prepared by a two-step method, in which, TA acted as a sensitizer to enhance the fluorescent property and Van was modified on the surface of LDH to act as an affinity reagent to bacteria. The obtained products were characterized by X-ray diffraction, transmission electron microscope and fluorescent spectroscopy. The results demonstrated that the prepared Van- and TA-comodified europium-doped layered double hydroxides (Van-TA-Eu-LDHs) nanoparticles with diameter of 50 nm in size showed highly efficient fluorescent property. Furthermore, due to the high affinity of Van to bacteria, the prepared Van-TA-Eu-LDHs nanoparticles showed efficient bacteria labelling by fluorescent property. The prepared nanoparticles may have wide applications in the biological fields, such as biomolecular labelling and cell imaging.

  5. On face antimagic labeling of double duplication of graphs

    NASA Astrophysics Data System (ADS)

    Shobana, L.; Kuppan, R.

    2018-04-01

    A Labeling of a plane graph G is called d-antimagic if every numbers, the set of s-sided face weights is Ws={as,as+d,as+2d,...,as+(fs-1)d} for some integers as and d (as>0,d≥0),where fs is the number of s-sided faces. We allow differentsets ws of different s.In this paper, we proved the existence of face antimagic labeling of types (1,0,0),(1,0,1),(1,1,0),(0,1,1) and (1,1,1) of double duplication of all vertices by edges of a cycle graph Cn: n≥3 and a tree of order n.

  6. Projections from the dorsal and ventral cochlear nuclei to the medial geniculate body.

    PubMed

    Schofield, Brett R; Motts, Susan D; Mellott, Jeffrey G; Foster, Nichole L

    2014-01-01

    Direct projections from the cochlear nucleus (CN) to the medial geniculate body (MG) mediate a high-speed transfer of acoustic information to the auditory thalamus. Anderson etal. (2006) used anterograde tracers to label the projection from the dorsal CN (DCN) to the MG in guinea pigs. We examined this pathway with retrograde tracers. The results confirm a pathway from the DCN, originating primarily from the deep layers. Labeled cells included a few giant cells and a larger number of small cells of unknown type. Many more labeled cells were present in the ventral CN (VCN). These cells, identifiable as multipolar (stellate) or small cells, were found throughout much of the VCN. Most of the labeled cells were located contralateral to the injection site. The CN to MG pathway bypasses the inferior colliculus (IC), where most ascending auditory information is processed. Anderson etal. (2006) hypothesized that CN-MG axons are collaterals of axons that reach the IC. We tested this hypothesis by injecting different fluorescent tracers into the MG and IC and examining the CN for double-labeled cells. After injections on the same side of the brain, double-labeled cells were found in the contralateral VCN and DCN. Most double-labeled cells were in the VCN, where they accounted for up to 37% of the cells labeled by the MG injection. We conclude that projections from the CN to the MG originate from the VCN and, less so, from the DCN. A significant proportion of the cells send a collateral projection to the IC. Presumably, the collateral projections send the same information to both the MG and the IC. The results suggest that T-stellate cells of the VCN are a major source of direct projections to the auditory thalamus.

  7. First performance evaluation of software for automatic segmentation, labeling and reformation of anatomical aligned axial images of the thoracolumbar spine at CT.

    PubMed

    Scholtz, Jan-Erik; Wichmann, Julian L; Kaup, Moritz; Fischer, Sebastian; Kerl, J Matthias; Lehnert, Thomas; Vogl, Thomas J; Bauer, Ralf W

    2015-03-01

    To evaluate software for automatic segmentation, labeling and reformation of anatomical aligned axial images of the thoracolumbar spine on CT in terms of accuracy, potential for time savings and workflow improvement. 77 patients (28 women, 49 men, mean age 65.3±14.4 years) with known or suspected spinal disorders (degenerative spine disease n=32; disc herniation n=36; traumatic vertebral fractures n=9) underwent 64-slice MDCT with thin-slab reconstruction. Time for automatic labeling of the thoracolumbar spine and reconstruction of double-angulated axial images of the pathological vertebrae was compared with manually performed reconstruction of anatomical aligned axial images. Reformatted images of both reconstruction methods were assessed by two observers regarding accuracy of symmetric depiction of anatomical structures. In 33 cases double-angulated axial images were created in 1 vertebra, in 28 cases in 2 vertebrae and in 16 cases in 3 vertebrae. Correct automatic labeling was achieved in 72 of 77 patients (93.5%). Errors could be manually corrected in 4 cases. Automatic labeling required 1min in average. In cases where anatomical aligned axial images of 1 vertebra were created, reconstructions made by hand were significantly faster (p<0.05). Automatic reconstruction was time-saving in cases of 2 and more vertebrae (p<0.05). Both reconstruction methods revealed good image quality with excellent inter-observer agreement. The evaluated software for automatic labeling and anatomically aligned, double-angulated axial image reconstruction of the thoracolumbar spine on CT is time-saving when reconstructions of 2 and more vertebrae are performed. Checking results of automatic labeling is necessary to prevent errors in labeling. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  8. Poly(o-phenylenediamine) colloid-quenched fluorescent oligonucleotide as a probe for fluorescence-enhanced nucleic acid detection.

    PubMed

    Tian, Jingqi; Li, Hailong; Luo, Yonglan; Wang, Lei; Zhang, Yingwei; Sun, Xuping

    2011-02-01

    In this Letter, we demonstrate that chemical oxidation polymerization of o-phenylenediamine (OPD) by potassium bichromate at room temperature results in the formation of submicrometer-scale poly(o-phenylenediamine) (POPD) colloids. Such colloids can absorb and quench dye-labeled single-stranded DNA (ssDNA) very effectively. In the presence of a target, a hybridization event occurs, which produces a double-stranded DNA (dsDNA) that detaches from the POPD surface, leading to recovery of dye fluorescence. With the use of an oligonucleotide (OND) sequence associated with human immunodeficiency virus (HIV) as a model system, we demonstrate the proof of concept that POPD colloid-quenched fluorescent OND can be used as a probe for fluorescence-enhanced nucleic acid detection with selectivity down to single-base mismatch.

  9. Evaluation of Drosophila metabolic labeling strategies for in vivo quantitative proteomic analyses with applications to early pupa formation and amino acid starvation.

    PubMed

    Chang, Ying-Che; Tang, Hong-Wen; Liang, Suh-Yuen; Pu, Tsung-Hsien; Meng, Tzu-Ching; Khoo, Kay-Hooi; Chen, Guang-Chao

    2013-05-03

    Although stable isotope labeling by amino acids in cell culture (SILAC)-based quantitative proteomics was first developed as a cell culture-based technique, stable isotope-labeled amino acids have since been successfully introduced in vivo into select multicellular model organisms by manipulating the feeding diets. An earlier study by others has demonstrated that heavy lysine labeled Drosophila melanogaster can be derived by feeding with an exclusive heavy lysine labeled yeast diet. In this work, we have further evaluated the use of heavy lysine and/or arginine for metabolic labeling of fruit flies, with an aim to determine its respective quantification accuracy and versatility. In vivo conversion of heavy lysine and/or heavy arginine to several nonessential amino acids was observed in labeled flies, leading to distorted isotope pattern and underestimated heavy to light ratio. These quantification defects can nonetheless be rectified at protein level using the normalization function. The only caveat is that such a normalization strategy may not be suitable for every biological application, particularly when modified peptides need to be individually quantified at peptide level. In such cases, we showed that peptide ratios calculated from the summed intensities of all isotope peaks are less affected by the heavy amino acid conversion and therefore less sequence-dependent and more reliable. Applying either the single Lys8 or double Lys6/Arg10 metabolic labeling strategy to flies, we quantitatively mapped the proteomic changes during the onset of metamorphosis and upon amino acid deprivation. The expression of a number of steroid hormone 20-hydroxyecdysone regulated proteins was found to be changed significantly during larval-pupa transition, while several subunits of the V-ATPase complex and components regulating actomyosin were up-regulated under starvation-induced autophagy conditions.

  10. Interaction of Ddc1 and RPA with single-stranded/double-stranded DNA junctions in yeast whole cell extracts: Proteolytic degradation of the large subunit of replication protein A in ddc1Δ strains.

    PubMed

    Sukhanova, Maria V; D'Herin, Claudine; Boiteux, Serge; Lavrik, Olga I

    2014-10-01

    To characterize proteins that interact with single-stranded/double-stranded (ss/ds) DNA junctions in whole cell free extracts of Saccharomyces cerevisiae, we used [(32)P]-labeled photoreactive partial DNA duplexes containing a 3'-ss/ds-junction (3'-junction) or a 5'-ss/ds-junction (5'-junction). Identification of labeled proteins was achieved by MALDI-TOF mass spectrometry peptide mass fingerprinting and genetic analysis. In wild-type extract, one of the components of the Ddc1-Rad17-Mec3 complex, Ddc1, was found to be preferentially photocrosslinked at a 3'-junction. On the other hand, RPAp70, the large subunit of the replication protein A (RPA), was the predominant crosslinking product at a 5'-junction. Interestingly, ddc1Δ extracts did not display photocrosslinking of RPAp70 at a 5'-junction. The results show that RPAp70 crosslinked to DNA with a 5'-junction is subject to limited proteolysis in ddc1Δ extracts, whereas it is stable in WT, rad17Δ, mec3Δ and mec1Δ extracts. The degradation of the RPAp70-DNA adduct in ddc1Δ extract is strongly reduced in the presence of the proteasome inhibitor MG 132. We also addressed the question of the stability of free RPA, using anti-RPA antibodies. The results show that RPAp70 is also subject to proteolysis without photocrosslinking to DNA upon incubation in ddc1Δ extract. The data point to a novel property of Ddc1, modulating the turnover of DNA binding proteins such as RPAp70 by the proteasome. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. "Retarded?" Who Still Says that? An Adapted Physical Education Perspective

    ERIC Educational Resources Information Center

    Tarr, Susan J.

    2011-01-01

    By assigning students a label from one of the 11 disability categories, schools receive money from the government to provide appropriate educational assistance to facilitate student learning (e.g., special equipment, paraprofessional support). But educators often think of this labeling as a double-edged sword: children must have the label to…

  12. Chelator-Free Labeling of Layered Double Hydroxide Nanoparticles for in Vivo PET Imaging

    NASA Astrophysics Data System (ADS)

    Shi, Sixiang; Fliss, Brianne C.; Gu, Zi; Zhu, Yian; Hong, Hao; Valdovinos, Hector F.; Hernandez, Reinier; Goel, Shreya; Luo, Haiming; Chen, Feng; Barnhart, Todd E.; Nickles, Robert J.; Xu, Zhi Ping; Cai, Weibo

    2015-11-01

    Layered double hydroxide (LDH) nanomaterial has emerged as a novel delivery agent for biomedical applications due to its unique structure and properties. However, in vivo positron emission tomography (PET) imaging with LDH nanoparticles has not been achieved. The aim of this study is to explore chelator-free labeling of LDH nanoparticles with radioisotopes for in vivo PET imaging. Bivalent cation 64Cu2+ and trivalent cation 44Sc3+ were found to readily label LDH nanoparticles with excellent labeling efficiency and stability, whereas tetravalent cation 89Zr4+ could not label LDH since it does not fit into the LDH crystal structure. PET imaging shows that prominent tumor uptake was achieved in 4T1 breast cancer with 64Cu-LDH-BSA via passive targeting alone (7.7 ± 0.1%ID/g at 16 h post-injection; n = 3). These results support that LDH is a versatile platform that can be labeled with various bivalent and trivalent radiometals without comprising the native properties, highly desirable for PET image-guided drug delivery.

  13. Single Upconversion Nanoparticle-Bacterium Cotrapping for Single-Bacterium Labeling and Analysis.

    PubMed

    Xin, Hongbao; Li, Yuchao; Xu, Dekang; Zhang, Yueli; Chen, Chia-Hung; Li, Baojun

    2017-04-01

    Detecting and analyzing pathogenic bacteria in an effective and reliable manner is crucial for the diagnosis of acute bacterial infection and initial antibiotic therapy. However, the precise labeling and analysis of bacteria at the single-bacterium level are a technical challenge but very important to reveal important details about the heterogeneity of cells and responds to environment. This study demonstrates an optical strategy for single-bacterium labeling and analysis by the cotrapping of single upconversion nanoparticles (UCNPs) and bacteria together. A single UCNP with an average size of ≈120 nm is first optically trapped. Both ends of a single bacterium are then trapped and labeled with single UCNPs emitting green light. The labeled bacterium can be flexibly moved to designated locations for further analysis. Signals from bacteria of different sizes are detected in real time for single-bacterium analysis. This cotrapping method provides a new approach for single-pathogenic-bacterium labeling, detection, and real-time analysis at the single-particle and single-bacterium level. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. An open-label study to evaluate the long-term safety and efficacy of lanadelumab for prevention of attacks in hereditary angioedema: design of the HELP study extension.

    PubMed

    Riedl, Marc A; Bernstein, Jonathan A; Craig, Timothy; Banerji, Aleena; Magerl, Markus; Cicardi, Marco; Longhurst, Hilary J; Shennak, Mustafa M; Yang, William H; Schranz, Jennifer; Baptista, Jovanna; Busse, Paula J

    2017-01-01

    Hereditary angioedema (HAE) is characterized by recurrent attacks of subcutaneous or submucosal edema. Attacks are unpredictable, debilitating, and have a significant impact on quality of life. Patients may be prescribed prophylactic therapy to prevent angioedema attacks. Current prophylactic treatments may be difficult to administer (i.e., intravenously), require frequent administrations or are not well tolerated, and breakthrough attacks may still occur frequently. Lanadelumab is a subcutaneously-administered monoclonal antibody inhibitor of plasma kallikrein in clinical development for prophylaxis of hereditary angioedema attacks. A Phase 1b study supported its efficacy in preventing attacks. A Phase 3, randomized, double-blind, placebo-controlled, parallel-arm study has been completed and an open-label extension is currently ongoing. The primary objective of the open-label extension is to evaluate the long-term safety of repeated subcutaneous administrations of lanadelumab in patients with type I/II HAE. Secondary objectives include evaluation of efficacy and time to first angioedema attack to determine outer bounds of the dosing interval. The study will also evaluate immunogenicity, pharmacokinetics/pharmacodynamics, quality of life, characteristics of breakthrough attacks, ease of self-administration, and safety/efficacy in patients who switch to lanadelumab from another prophylactic therapy. The open-label extension will enroll patients who completed the double-blind study ("rollover patients") and those who did not participate in the double-blind study ("non-rollover patients"), which includes patients who may or may not be currently using another prophylactic therapy. Rollover patients will receive a single 300 mg dose of lanadelumab on Day 0 and the second dose after the patient's first confirmed angioedema attack. Thereafter, lanadelumab will be administered every 2 weeks. Non-rollover patients will receive 300 mg lanadelumab every 2 weeks regardless of the first attack. All patients will receive their last dose on Day 350 (maximum of 26 doses), and will then undergo a 4-week follow-up. Prevention of attacks can reduce the burden of illness associated with HAE. Prophylactic therapy requires extended, repeated dosing and the results of this study will provide important data on the long-term safety and efficacy of lanadelumab, a monoclonal antibody inhibitor of plasma kallikrein for subcutaneous administration for the treatment of HAE. Trial registration NCT02741596.

  15. Distribution and ultrastructure of dopaminergic neurons in the dorsal motor nucleus of the vagus projecting to the stomach of the rat.

    PubMed

    Hayakawa, Tetsu; Takanaga, Akinori; Tanaka, Koichi; Maeda, Seishi; Seki, Makoto

    2004-04-23

    Almost all parasympathetic preganglionic motor neurons contain acetylcholine, whereas quite a few motor neurons in the dorsal motor nucleus of the vagus (DMV) contain dopamine. We determined the distribution and ultrastructure of these dopaminergic neurons with double-labeling immunohistochemistry for tyrosine hydroxylase (TH) and the retrograde tracer cholera toxin subunit b (CTb) following its injection into the stomach. A few TH-immunoreactive (TH-ir) neurons were found in the rostral half of the DMV, while a moderate number of these neurons were found in the caudal half. Most of the TH-ir neurons (78.4%) were double-labeled for CTb in the half of the DMV caudal to the area postrema, but only a few TH-ir neurons (5.5%) were double-labeled in the rostral half. About 20% of gastric motor neurons showed TH-immunoreactivity in the caudal half of the DMV, but only 0.3% were TH-ir in the rostral half. In all gastric motor neurons, 8.1% were double-labeled for TH. The ultrastructure of the TH-ir neurons in the caudal DMV was determined with immuno-gold-silver labeling. The TH-ir neurons were small (20.4 x 12.4 microm), round or oval, and contained numerous mitochondria, many free ribosomes, several Golgi apparatuses, a round nucleus and a few Nissl bodies. The average number of axosomatic terminals per section was 4.0. More than half of them contained round synaptic vesicles and made asymmetric synaptic contacts (Gray's type I). Most of the axodendritic terminals contacting TH-ir dendrites were Gray's type I (90%), but a few contained pleomorphic vesicles and made symmetric synaptic contacts (Gray's type II).

  16. Sex differences in the expression of estrogen receptor alpha within noradrenergic neurons in the sheep brain stem.

    PubMed

    Rose, J L; Hamlin, A S; Scott, C J

    2014-10-01

    In female sheep, high levels of estrogen exert a positive feedback action on gonadotropin releasing hormone (GnRH) secretion to stimulate a surge in luteinizing hormone (LH) secretion. Part of this action appears to be via brain stem noradrenergic neurons. By contrast, estrogen action in male sheep has a negative feedback action to inhibit GnRH and LH secretion. To investigate whether part of this sex difference is due to differences in estrogen action in the brain stem, we tested the hypothesis that the distribution of estrogen receptor α (ERα) within noradrenergic neurons in the brain stem differs between rams and ewes. To determine the distribution of ERα, we used double-label fluorescence immunohistochemistry for dopamine β-Hydroxylase, as a marker for noradrenergic and adrenergic cells, and ERα. In the ventrolateral medulla (A1 region), most ERα-immunoreactive (-ir) cells were located in the caudal part of the nucleus. Overall, there were more ERα-ir cells in rams than ewes, but the proportion of double-labeled cells was did not differ between sexes. Much greater numbers of ERα-ir cells were found in the nucleus of the solitary tract (A2 region), but <10% were double labeled and there were no sex differences. The majority of ERα-labeled cells in this nucleus was located in the more rostral areas. ERα-labeled cells were found in several rostral brain stem regions but none of these were double labeled and so were not quantified. Because there was no sex difference in the number of ERα-ir cells in the brain stem that were noradrenergic, the sex difference in the action of estrogen on gonadotropin secretion in sheep is unlikely to involve actions on brain stem noradrenergic cells. Crown Copyright © 2014. Published by Elsevier Inc. All rights reserved.

  17. Single-molecule studies of multi-protein machines

    NASA Astrophysics Data System (ADS)

    van Oijen, Antoine

    2010-03-01

    Advances in optical imaging and molecular manipulation techniques have made it possible to observe individual enzymes and record molecular movies that provide new insight into their dynamics and reaction mechanisms. In a biological context, most of these enzymes function in concert with other enzymes in multi-protein complexes, so an important future direction will be the utilization of single-molecule techniques to unravel the orchestration of large macromolecular assemblies. Our group is developing the single-molecule tools that will make it possible to study biochemical pathways of arbitrary complexity at the single-molecule level. I will discuss results of single-molecule experiments on the replisome, the molecular machinery that is responsible for replication of DNA. We stretch individual DNA molecules and use their elastic properties to obtain dynamic information on the proteins that unwind the double helix and copy its genetic information. Furthermore, we visualize fluorescently labeled components of the replisome and thus obtain information on stochiometry and exchange kinetics. This simultaneous observation of catalytic activity and composition allows us to gain deeper insight into the structure-function relationship of the replisome.

  18. Efficacy and safety of once-daily, extended-release hydrocodone in individuals previously receiving hydrocodone/acetaminophen combination therapy for chronic pain.

    PubMed

    Bartoli, Adrian; Michna, Edward; He, Ellie; Wen, Warren

    2015-01-01

    Hydrocodone/acetaminophen combination analgesics are frequently prescribed for chronic pain management; however, acetaminophen presents potential hepatotoxicity to patients and thus dose limitations. These opioid medications are also widely abused. Once-daily, single-entity hydrocodone (Hysingla™ ER tablets [HYD]) is a novel formulation with abuse-deterrent properties for the management of chronic pain and represents a suitable option for those patients receiving analgesics containing the same opioid analgesic, hydrocodone. This post-hoc analysis evaluated the efficacy and safety of HYD in patients whose primary pre-study analgesic was hydrocodone/acetaminophen analgesics (23-31% of the study populations). Data were analyzed from two Phase III trials, a 12-week randomized, placebo-controlled trial (RCT) and an open-label, 52-week trial. In both trials, a dose-titration period with HYD was followed by respective periods of fixed-dose double-blind (randomized controlled trial [RCT]) or open-label, flexible-dose maintenance treatment. Pain intensity was assessed using a numerical rating scale (0-10, 0 = no pain). For the RCT, primary and sensitivity analyses of pain scores used different approaches to handle missing data. Safety data for both studies were summarized. In the RCT, the mean baseline pain score was 7.3. Pain relief was greater with HYD than placebo during double-blind treatment. In the open-label, flexible-dose trial, the majority of patients were maintained on their titrated dose. Mean baseline pain score was 6.3, about 57% of patients completed the 1-year maintenance period, and mean pain scores were between 3.6 and 4.1 during the maintenance period. Use of supplemental pain medication decreased or was maintained during the maintenance treatment with HYD. Adverse events in both trials were typical of those associated with opioid analgesics. In patients whose primary pretrial analgesic was hydrocodone/acetaminophen combination tablets, single-entity HYD was effective in reducing pain intensity and in maintaining analgesia over time without need for continued dose increase. HYD's safety and tolerability profiles were similar to other opioid analgesics.

  19. A Numerical Study of the Thermal Characteristics of an Air Cavity Formed by Window Sashes in a Double Window

    NASA Astrophysics Data System (ADS)

    Kang, Jae-sik; Oh, Eun-Joo; Bae, Min-Jung; Song, Doo-Sam

    2017-12-01

    Given that the Korean government is implementing what has been termed the energy standards and labelling program for windows, window companies will be required to assign window ratings based on the experimental results of their product. Because this has added to the cost and time required for laboratory tests by window companies, the simulation system for the thermal performance of windows has been prepared to compensate for time and cost burdens. In Korea, a simulator is usually used to calculate the thermal performance of a window through WINDOW/THERM, complying with ISO 15099. For a single window, the simulation results are similar to experimental results. A double window is also calculated using the same method, but the calculation results for this type of window are unreliable. ISO 15099 should not recommend the calculation of the thermal properties of an air cavity between window sashes in a double window. This causes a difference between simulation and experimental results pertaining to the thermal performance of a double window. In this paper, the thermal properties of air cavities between window sashes in a double window are analyzed through computational fluid dynamics (CFD) simulations with the results compared to calculation results certified by ISO 15099. The surface temperature of the air cavity analyzed by CFD is compared to the experimental temperatures. These results show that an appropriate calculation method for an air cavity between window sashes in a double window should be established for reliable thermal performance results for a double window.

  20. In situ 15N labeling experiment reveals different long-term responses to ammonium and nitrate inputs in N-saturated subtropical forest

    NASA Astrophysics Data System (ADS)

    Liu, Wenjing; Yu, Longfei; Zhang, Ting; Kang, Ronghua; Zhu, Jing; Mulder, Jan; Huang, Yongmei; Duan, Lei

    2017-09-01

    Chronically elevated deposition of reactive nitrogen (N), as ammonium (NH4+) and nitrate (NO3-), in subtropical forests with monsoonal climate has caused widespread N leaching in southern China. So far, little is known about the effect of further increases in N input and changes in the relative proportion of NH4+ and NO3- on turnover rate and fate of atmogenic N. Here we report a 15N tracer experiment in Tieshanping (TSP) forest, SW China, conducted as part of a long-term N fertilization experiment, using NH4NO3 and NaNO3, where effects of a doubling of monthly N inputs were compared. In June 2012, the regular N fertilizers were replaced by their 15N-labeled forms, viz., 15NH4NO3 and Na15NO3, as a single-dose addition. Mass balances of N for the initial 1.5 years following label addition showed that for both treatments, 70% to 80% of the annual N input was leached as NO3-, both at ambient and at double N input rates. This confirms the earlier reported extreme case of N saturation at TSP. The 15N, added as Na15NO3, showed recoveries of about 74% in soil leachates, indicating that NO3- input at TSP is subject to a rapid and nearly quantitative loss through direct leaching as a mobile anion. By contrast, recoveries of 15N in soil leachates of only 33% were found if added as 15NH4NO3. Much of the 15N was immobilized in the soil and to a lesser extent in the vegetation. Thus, immobilization of fresh N input is significantly greater if added as NH4+, than as NO3-.

  1. KChIPs and Kv4 alpha subunits as integral components of A-type potassium channels in mammalian brain.

    PubMed

    Rhodes, Kenneth J; Carroll, Karen I; Sung, M Amy; Doliveira, Lisa C; Monaghan, Michael M; Burke, Sharon L; Strassle, Brian W; Buchwalder, Lynn; Menegola, Milena; Cao, Jie; An, W Frank; Trimmer, James S

    2004-09-08

    Voltage-gated potassium (Kv) channels from the Kv4, or Shal-related, gene family underlie a major component of the A-type potassium current in mammalian central neurons. We recently identified a family of calcium-binding proteins, termed KChIPs (Kv channel interacting proteins), that bind to the cytoplasmic N termini of Kv4 family alpha subunits and modulate their surface density, inactivation kinetics, and rate of recovery from inactivation (An et al., 2000). Here, we used single and double-label immunohistochemistry, together with circumscribed lesions and coimmunoprecipitation analyses, to examine the regional and subcellular distribution of KChIPs1-4 and Kv4 family alpha subunits in adult rat brain. Immunohistochemical staining using KChIP-specific monoclonal antibodies revealed that the KChIP polypeptides are concentrated in neuronal somata and dendrites where their cellular and subcellular distribution overlaps, in an isoform-specific manner, with that of Kv4.2 and Kv4.3. For example, immunoreactivity for KChIP1 and Kv4.3 is concentrated in the somata and dendrites of hippocampal, striatal, and neocortical interneurons. Immunoreactivity for KChIP2, KChIP4, and Kv4.2 is concentrated in the apical and basal dendrites of hippocampal and neocortical pyramidal cells. Double-label immunofluorescence labeling revealed that throughout the forebrain, KChIP2 and KChIP4 are frequently colocalized with Kv4.2, whereas in cortical, hippocampal, and striatal interneurons, KChIP1 is frequently colocalized with Kv4.3. Coimmunoprecipitation analyses confirmed that all KChIPs coassociate with Kv4 alpha subunits in brain membranes, indicating that KChIPs 1-4 are integral components of native A-type Kv channel complexes and are likely to play a major role as modulators of somatodendritic excitability.

  2. PCR synthesis of double stranded DNA labeled with 5-bromouridine. A step towards finding a bromonucleoside for clinical trials.

    PubMed

    Michalska, Barbara; Sobolewski, Ireneusz; Polska, Katarzyna; Zielonka, Justyna; Zylicz-Stachula, Agnieszka; Skowron, Piotr; Rak, Janusz

    2011-12-05

    Incorporation of 5-bromouridine (5BrdU) into DNA makes it sensitive to UV and ionizing radiation, which opens up a prospective route for the clinical usage of 5-bromouridine and other halonucleosides. In the present work the polymerase chain reaction (PCR) protocol, which enables a long DNA fragment (resembling DNA synthesized in the cell in the presence of halonucleosides) to be completely substituted with 5BrdU, was optimized. Using HPLC coupled to enzymatic digestion, it was demonstrated that the actual amounts of native nucleosides and 5BrdU correspond very well to those calculated from the sequence of PCR products. The synthesized DNA is photosensitive to photons of 300nm. HPLC analysis demonstrated that the photolysis of labeled PCR products leads to a significant decrease in the 5BrdU signal and the simultaneous occurrence of a uridine peak. Agarose and polyacrylamide gel electrophoresis suggest that single strand breaks and cross-links are formed as a result of UV irradiation. The PCR protocol described in the current paper may be employed for labeling DNA not only with BrdU but also with other halonucleosides. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. Retention of retinal axon collateral is responsible for induced ipsilateral retinotectal projections in adult goldfish.

    PubMed

    Sharma, S C; Tsai, C

    1991-01-01

    In normal goldfish, optic axons innervate only the contralateral optic tectum. When one eye was enucleated and the optic nerve of the other eye crushed, the regenerating optic axons innervated both optic tecta. We studied the presence of bilaterally projecting retinal ganglion cells by double retrograde cell labeling methods using Nuclear Yellow and True Blue dyes. About 10% of the retinal ganglion cells were double labeled and these cells were found throughout the retina. In addition, HRP application to the ipsilateral tectum revealed retrogradely-labeled retinal ganglion cells of all morphological types. These results suggest that induced ipsilateral projections are formed by regenerating axon collaterals and that all cell types are involved in the generation of normal mirror image typography.

  4. A fluorescent aptasensor for analysis of adenosine triphosphate based on aptamer-magnetic nanoparticles and its single-stranded complementary DNA labeled carbon dots.

    PubMed

    Saberi, Zeinab; Rezaei, Behzad; Khayamian, Taghi

    2018-06-01

    A new fluorimetric aptasensor was designed for the determination of adenosine triphosphate (ATP) based on magnetic nanoparticles (MNPs) and carbon dots (CDs). In this analytical strategy, an ATP aptamer was conjugated on MNPs and a complementary strand of the aptamer (CS) was labeled with CDs. The aptamer and its CS were hybridized to form a double helical structure. The hybridized aptamers could be used for the specific recognition of ATP in a biological complex matrix using a strong magnetic field to remove the interfering effect. In the absence of ATP, no CDs-CS could be released into the solution and this resulted in a weak fluorescence signal. In the presence of ATP, the target binds to its aptamer and causes the dissociation of the double helical structure and liberation of the CS, such that a strong fluorescence signal was generated. The increased fluorescence signal was proportional to ATP concentration. The limit of detection was estimated to be 1.0 pmol L -1 with a dynamic range of 3.0 pmol L -1 to 5.0 nmol L -1 . The specific aptasensor was applied to detect ATP in human serum samples with satisfactory results. Moreover, molecular dynamic simulation (MDS) studies were used to analyze interactions of the ATP molecule with the aptamer. Copyright © 2018 John Wiley & Sons, Ltd.

  5. A prospective randomized study for efficacy of an uncovered double bare metal stent compared to a single bare metal stent in malignant biliary obstruction.

    PubMed

    Lee, Hyun Jik; Chung, Moon Jae; Park, Jeong Yup; Park, Seung Woo; Nam, Chung Mo; Song, Si Young; Bang, Seungmin

    2017-08-01

    A biliary self-expandable metal stent (SEMS) is commonly used to relieve malignant biliary obstruction. The aim of this study was to compare the efficacy of a conventional uncovered SEMS with that of a newly developed uncovered double bare metal stent in reducing the risk of stent occlusion caused by tumor ingrowth. We performed a prospective, open-labeled, randomized trial in 71 patients at Severance Hospital, Yonsei University College of Medicine from June 2013 to June 2014. Patients with inoperable malignant biliary obstruction were included and randomized to receive an uncovered single bare metal stent (SBSs; S&G Biotech Inc.), an uncovered single bare metal stent (SBSt; Taewoong Medical), or an uncovered double bare metal stent (DBS; S&G Biotech Inc.). The mean age was 66.6 years (range, 35-83), and 42 (59.2%) were male. The mean duration of stent patency was 212 days (±152) in the DBS group (n = 24) compared with 124 days (±98) in the SBSs group (n = 23; P = 0.022 for noninferiority) and 116 days (±79) in the SBSt group (n = 24; P = 0.010 for noninferiority). There were no differences in the incidences of early and delayed complications or migration. The newly developed DBS is noninferior to the conventional uncovered SEMSs on duration of stent patency and tumor ingrowth occurred less frequently in the DBS group. This might decrease the need for reintervention and offer a better quality of life. The trial is registered with Clinicaltrials.gov no: NCT01869894.

  6. Serotonin projection patterns to the cochlear nucleus.

    PubMed

    Thompson, A M; Thompson, G C

    2001-07-13

    The cochlear nucleus is well known as an obligatory relay center for primary auditory nerve fibers. Perhaps not so well known is the neural input to the cochlear nucleus from cells containing serotonin that reside near the midline in the midbrain raphe region. Although the specific locations of the main, if not sole, sources of serotonin within the dorsal cochlear nucleus subdivision are known to be the dorsal and median raphe nuclei, sources of serotonin located within other cochlear nucleus subdivisions are not currently known. Anterograde tract tracing was used to label fibers originating from the dorsal and median raphe nuclei while fluorescence immunohistochemistry was used to simultaneously label specific serotonin fibers in cat. Biotinylated dextran amine was injected into the dorsal and median raphe nuclei and was visualized with Texas Red, while serotonin was visualized with fluorescein. Thus, double-labeled fibers were unequivocally identified as serotoninergic and originating from one of the labeled neurons within the dorsal and median raphe nuclei. Double-labeled fiber segments, typically of fine caliber with oval varicosities, were observed in many areas of the cochlear nucleus. They were found in the molecular layer of the dorsal cochlear nucleus, in the small cell cap region, and in the granule cell and external regions of the cochlear nuclei, bilaterally, of all cats. However, the density of these double-labeled fiber segments varied considerably depending upon the exact region in which they were found. Fiber segments were most dense in the dorsal cochlear nucleus (especially in the molecular layer) and the large spherical cell area of the anteroventral cochlear nucleus; they were moderately dense in the small cell cap region; and fiber segments were least dense in the octopus and multipolar cell regions of the posteroventral cochlear nucleus. Because of the presence of labeled fiber segments in subdivisions of the cochlear nucleus other than the dorsal cochlear nucleus, we concluded that the serotoninergic projection pattern to the cochlear nucleus is divergent and non-specific. Double-labeled fiber segments were also present, but sparse, in the superior olive, localized mainly in periolivary regions; this indicated that the divergence of dorsal and median raphe neurons that extends throughout regions of the cochlear nucleus also extended well beyond the cochlear nucleus to include at least the superior olivary complex as well.

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Breton, J.; Berger, G.; Nabedryk, E.

    The photoreduction of the secondary quinone acceptor Q{sub B} in reaction centers (RCs) of the photosynthetic bacteria Rhodobacter sphaeroides and Rhodopseudomonas viridis has been investigated by light-induced FTIR difference spectroscopy of RCs reconstituted with several isotopically labeled ubiquinones. The labels used were {sup 18}O on both carbonyls and {sup 13}C either uniformly or selectively at the 1- or the 4-position, i.e., on either one of the two carbonyls. The Q{sub B}{sup {minus}}/Q{sub B} spectra of RCs reconstituted with the isotopically labeled and unlabeled quinones as well as the double differences calculated form these spectra exhibit distinct isotopic shifts for amore » numer of bands attributed to vibrations of Q{sub B} and Q{sub B}{sup {minus}}. The vibrational modes of the quinone in the Q{sub B} site are compared to those of ubiquinone in vitro, leading to band assignments for the C{double_bond}O and C{double_bond}C vibrations of the neutral Q{sub B} and for the C---O and C---C of the semiquinone. The C{double_bond}O frequency of each of the carbonyls of the unlabeled quinone is revealed at 1641 cm{sup {minus}1} for both species. This demonstrates symmetrical and weak hydrogen bonding of the two C{double_bond}O groups to the protein at the Q{sub B} site. In contrast, the C{double_bond}C vibrations are not equivalent for selective labeling at C{sub 1} or at C{sub 4}, although they both contribute to the {approximately}1611-cm{sup {minus}1} band in the Q{sub B}{sup {minus}}/Q{sub B} spectra of the two species. Compared to the vibrations of isolated ubiquinone, the C{double_bond}C mode of Q{sub B} does not involve displacement of the C{sub 4} carbon atom, while the motion of C{sub 1} is not hindered. Further analysis of the spectra suggests that the protein at the binding site imposes a specific constraint on the methoxy and/or the methyl group proximal to the C{sub 4} carbonyl. 49 refs., 5 figs.« less

  8. Effects of dual-task balance training on postural performance in patients with Multiple Sclerosis: a double-blind, randomized controlled pilot trial.

    PubMed

    Monjezi, Saeideh; Negahban, Hossein; Tajali, Shirin; Yadollahpour, Nava; Majdinasab, Nastaran

    2017-02-01

    To investigate the effects of dual-task balance training on postural performance in patients with multiple sclerosis as compared with single-task balance training. Double-blind, pretest-posttest, randomized controlled pilot trial. Local Multiple Sclerosis Society. A total of 47 patients were randomly assigned to two equal groups labeled as single-task training and dual-task training groups. All patients received supervised balance training sessions, 3 times per week for 4 weeks. The patients in the single-task group performed balance activities, alone. However, patients in dual-task group practiced balance activities while simultaneously performing cognitive tasks. The 10-Meter Walk Test and Timed Up-and-Go under single-task and dual-task conditions, in addition to Activities-specific Balance Confidence, Berg Balance Scale, and Functional Gait Assessment were assessed pre-, and post intervention and also 6-weeks after the end of intervention. Only 38 patients completed the treatment plan. There was no difference in the amount of improvement seen between the two study groups. In both groups there was a significant effect of time for dual-10 Meter Walk Test (F 1, 36 =11.33, p=0.002) and dual-Timed Up-and-Go (F 1, 36 =14.27, p=0.001) but not for their single-tasks. Moreover, there was a significant effect of time for Activities-specific Balance Confidence, Berg Balance Scale, and Functional Gait Assessment ( P<0.01). This pilot study did not show more benefits from undertaking dual-task training than single-task training. A power analysis showed 71 patients per group would be needed to determine whether there was a clinically relevant difference for dual-task gait speed between the groups.

  9. Safety and immunogenicity of a Vi polysaccharide-tetanus toxoid conjugate vaccine (Typbar-TCV) in healthy infants, children, and adults in typhoid endemic areas: a multicenter, 2-cohort, open-label, double-blind, randomized controlled phase 3 study.

    PubMed

    Mohan, Vadrevu Krishna; Varanasi, Vineeth; Singh, Anit; Pasetti, Marcela F; Levine, Myron M; Venkatesan, Ramasamy; Ella, Krishna M

    2015-08-01

    Enteric fever caused by Salmonella Typhi remains a major public health problem in developing countries. Typbar-TCV is a single-dose typhoid Vi polysaccharide-tetanus toxoid conjugate vaccine for persons ≥6 months of age. Six hundred fifty-four healthy subjects aged 2-45 years enrolled in a double-blind, randomized controlled trial (RCT) received a single dose of Typbar-TCV or comparator "Vi polysaccharide" (Typbar), and 327 healthy subjects aged 6-23 months received a single dose of Typbar-TCV in an open-label trial (OLT); both received single- or multidose presentations from different lots. After 2 years, subsets in each group received a booster dose. The primary objective included analysis of geometric mean titer (GMTs) and 4-fold rise of anti-Vi serum immunoglobulin G (IgG) enzyme-linked immunosorbent assay titers over baseline (seroconversion [SCN]) 42 days after immunization. Typbar-TCV recipients in the RCT attained higher anti-Vi IgG GMTs 42 days after immunization (SCN, 97%; GMT, 1293 [95% confidence interval {CI}, 1153-1449]) than recipients of Typbar (SCN, 93%; GMT, 411 [95% CI, 359-471]) (P < .001). Typbar-TCV was highly immunogenic in the OLT (SCN, 98%; GMT, 1937 [95% CI, 1785-2103]). Two years after vaccination, anti-Vi titers remained higher in Typbar-TCV subjects (GMT, 82 [95% CI, 73-92]); and exhibited higher avidity (geometric mean avidity index [GMAI], 60%) than in Typbar recipients (GMT, 46 [95% CI, 40-53]; GMAI 46%) in the RCT (P < .001). OLT Typbar-TCV recipients achieved GMT of 48 (95% CI, 42-55) and GMAI of 57%. Typbar-TCV induced multiple IgG subclasses and strong booster responses in all ages. No serious vaccine-attributable adverse events were observed. Single-dose Typbar-TCV is well tolerated and induces robust and long-lasting serum anti-Vi IgG across age groups. CTRI/2011/08/001957, CTRI/2014/01/004341. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  10. Bootstrapping white matter segmentation, Eve++

    NASA Astrophysics Data System (ADS)

    Plassard, Andrew; Hinton, Kendra E.; Venkatraman, Vijay; Gonzalez, Christopher; Resnick, Susan M.; Landman, Bennett A.

    2015-03-01

    Multi-atlas labeling has come in wide spread use for whole brain labeling on magnetic resonance imaging. Recent challenges have shown that leading techniques are near (or at) human expert reproducibility for cortical gray matter labels. However, these approaches tend to treat white matter as essentially homogeneous (as white matter exhibits isointense signal on structural MRI). The state-of-the-art for white matter atlas is the single-subject Johns Hopkins Eve atlas. Numerous approaches have attempted to use tractography and/or orientation information to identify homologous white matter structures across subjects. Despite success with large tracts, these approaches have been plagued by difficulties in with subtle differences in course, low signal to noise, and complex structural relationships for smaller tracts. Here, we investigate use of atlas-based labeling to propagate the Eve atlas to unlabeled datasets. We evaluate single atlas labeling and multi-atlas labeling using synthetic atlases derived from the single manually labeled atlas. On 5 representative tracts for 10 subjects, we demonstrate that (1) single atlas labeling generally provides segmentations within 2mm mean surface distance, (2) morphologically constraining DTI labels within structural MRI white matter reduces variability, and (3) multi-atlas labeling did not improve accuracy. These efforts present a preliminary indication that single atlas labels with correction is reasonable, but caution should be applied. To purse multi-atlas labeling and more fully characterize overall performance, more labeled datasets would be necessary.

  11. Evaluation of Atlas-Based White Matter Segmentation with Eve.

    PubMed

    Plassard, Andrew J; Hinton, Kendra E; Venkatraman, Vijay; Gonzalez, Christopher; Resnick, Susan M; Landman, Bennett A

    2015-03-20

    Multi-atlas labeling has come in wide spread use for whole brain labeling on magnetic resonance imaging. Recent challenges have shown that leading techniques are near (or at) human expert reproducibility for cortical gray matter labels. However, these approaches tend to treat white matter as essentially homogeneous (as white matter exhibits isointense signal on structural MRI). The state-of-the-art for white matter atlas is the single-subject Johns Hopkins Eve atlas. Numerous approaches have attempted to use tractography and/or orientation information to identify homologous white matter structures across subjects. Despite success with large tracts, these approaches have been plagued by difficulties in with subtle differences in course, low signal to noise, and complex structural relationships for smaller tracts. Here, we investigate use of atlas-based labeling to propagate the Eve atlas to unlabeled datasets. We evaluate single atlas labeling and multi-atlas labeling using synthetic atlases derived from the single manually labeled atlas. On 5 representative tracts for 10 subjects, we demonstrate that (1) single atlas labeling generally provides segmentations within 2mm mean surface distance, (2) morphologically constraining DTI labels within structural MRI white matter reduces variability, and (3) multi-atlas labeling did not improve accuracy. These efforts present a preliminary indication that single atlas labels with correction is reasonable, but caution should be applied. To purse multi-atlas labeling and more fully characterize overall performance, more labeled datasets would be necessary.

  12. 76 FR 76890 - Nutrition Labeling of Single-Ingredient Products and Ground or Chopped Meat and Poultry Products...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-12-09

    .... FSIS-2005-0018] Nutrition Labeling of Single-Ingredient Products and Ground or Chopped Meat and Poultry... (FSIS) is delaying the effective date of the final regulations that require nutrition labeling of the... December 29, 2010, FSIS published the final rule, ``Nutrition Labeling of Single-Ingredient Products and...

  13. 9 CFR 317.345 - Nutrition labeling of single-ingredient, raw meat products that are not ground or chopped...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 9 Animals and Animal Products 2 2014-01-01 2014-01-01 false Nutrition labeling of single... INSPECTION AND CERTIFICATION LABELING, MARKING DEVICES, AND CONTAINERS Nutrition Labeling § 317.345 Nutrition....301. (a)(1) Nutrition information on the major cuts of single-ingredient, raw meat products identified...

  14. 9 CFR 317.345 - Nutrition labeling of single-ingredient, raw meat products that are not ground or chopped...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 9 Animals and Animal Products 2 2013-01-01 2013-01-01 false Nutrition labeling of single... INSPECTION AND CERTIFICATION LABELING, MARKING DEVICES, AND CONTAINERS Nutrition Labeling § 317.345 Nutrition....301. (a)(1) Nutrition information on the major cuts of single-ingredient, raw meat products identified...

  15. Specific DNA duplex formation at an artificial lipid bilayer: towards a new DNA biosensor technology.

    PubMed

    Werz, Emma; Korneev, Sergei; Montilla-Martinez, Malayko; Wagner, Richard; Hemmler, Roland; Walter, Claudius; Eisfeld, Jörg; Gall, Karsten; Rosemeyer, Helmut

    2012-02-01

    A novel technique is described which comprises a base-specific DNA duplex formation at a lipid bilayer-H(2) O-phase boundary layer. Two different probes of oligonucleotides both carrying a double-tailed lipid at the 5'-terminus were incorporated into stable artificial lipid bilayers separating two compartments (cis/trans-channel) of an optically transparent microfluidic sample carrier with perfusion capabilities. Both the cis- and trans-channels are filled with saline buffer. Injection of a cyanine-5-labeled target DNA sequence, which is complementary to only one of the oligonucleotide probes, into the cis-channel, followed by a thorough perfusion, leads to an immobilization of the labeled complementary oligonucleotide on the membrane as detected by single-molecule fluorescence spectroscopy and microscopy. In the case of fluorescent but non-complementary DNA sequences, no immobilized fluorescent oligonucleotide duplex could be detected on the membrane. This clearly verifies a specific duplex formation at the membrane interface. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.

  16. Measurement of Rate Constants for Homodimer Subunit Exchange Using Double Electron-Electron Resonance and Paramagnetic Relaxation Enhancements

    PubMed Central

    Yang, Yunhuang; Ramelot, Theresa A.; Ni, Shuisong; McCarrick, Robert M.; Kennedy, Michael A.

    2013-01-01

    Here, we report novel methods to measure rate constants for homodimer subunit exchange using double electron-electron resonance (DEER) electron paramagnetic resonance spectroscopy measurements and nuclear magnetic resonance spectroscopy based paramagnetic relaxation enhancement (PRE) measurements. The techniques were demonstrated using the homodimeric protein Dsy0195 from the strictly anaerobic bacterium Desulfitobacterium hafniense Y51. At specific times following mixing site-specific MTSL-labeled Dsy0195 with uniformly 15N-labeled Dsy0195, the extent of exchange was determined either by monitoring the decrease of MTSL-labeled homodimer from the decay of the DEER modulation depth or by quantifying the increase of MTSL-labeled/15N-labeled heterodimer using PREs. Repeated measurements at several time points following mixing enabled determination of the homodimer subunit dissociation rate constant, k−1;, which was 0.037 ± 0.005 min−1 derived from DEER experiments with a corresponding half-life time of 18.7 minutes. These numbers agreed with independent measurements obtained from PRE experiments. These methods can be broadly applied to protein-protein and protein-DNA complex studies. PMID:23180051

  17. Development of Low-Cost Instrumentation for Single Point Autofluorescence Lifetime Measurements.

    PubMed

    Lagarto, João; Hares, Jonathan D; Dunsby, Christopher; French, Paul M W

    2017-09-01

    Autofluorescence lifetime measurements, which can provide label-free readouts in biological tissues, contrasting e.g. different types and states of tissue matrix components and different cellular metabolites, may have significant clinical potential for diagnosis and to provide surgical guidance. However, the cost of the instrumentation typically used currently presents a barrier to wider implementation. We describe a low-cost single point time-resolved autofluorescence instrument, exploiting modulated laser diodes for excitation and FPGA-based circuitry for detection, together with a custom constant fraction discriminator. Its temporal accuracy is compared against a "gold-standard" instrument incorporating commercial TCSPC circuitry by resolving the fluorescence decays of reference fluorophores presenting single and double exponential decay profiles. To illustrate the potential to read out intrinsic contrast in tissue, we present preliminary measurements of autofluorescence lifetime measurements of biological tissues ex vivo. We believe that the lower cost of this instrument could enhance the potential of autofluorescence lifetime metrology for clinical deployment and commercial development.

  18. Direct observation of single flexible polymers using single stranded DNA†

    PubMed Central

    Brockman, Christopher; Kim, Sun Ju

    2012-01-01

    Over the last 15 years, double stranded DNA (dsDNA) has been used as a model polymeric system for nearly all single polymer dynamics studies. However, dsDNA is a semiflexible polymer with markedly different molecular properties compared to flexible chains, including synthetic organic polymers. In this work, we report a new system for single polymer studies of flexible chains based on single stranded DNA (ssDNA). We developed a method to synthesize ssDNA for fluorescence microscopy based on rolling circle replication, which generates long strands (>65 kb) of ssDNA containing “designer” sequences, thereby preventing intramolecular base pair interactions. Polymers are synthesized to contain amine-modified bases randomly distributed along the backbone, which enables uniform labelling of polymer chains with a fluorescent dye to facilitate fluorescence microscopy and imaging. Using this approach, we synthesized ssDNA chains with long contour lengths (>30 μm) and relatively low dye loading ratios (~1 dye per 100 bases). In addition, we used epifluorescence microscopy to image single ssDNA polymer molecules stretching in flow in a microfluidic device. Overall, we anticipate that ssDNA will serve as a useful model system to probe the dynamics of polymeric materials at the molecular level. PMID:22956981

  19. Are Luxury Brand Labels and “Green” Labels Costly Signals of Social Status? An Extended Replication

    PubMed Central

    2017-01-01

    Costly signaling theory provides an explanation for why humans are willing to a pay a premium for conspicuous products such as luxury brand-labeled clothing or conspicuous environmentally friendly cars. According to the theory, the extra cost of such products is a signal of social status and wealth and leads to advantages in social interactions for the signaler. A previous study found positive evidence for the case of luxury brand labels. However, an issue of this study was that some of the experiments were not conducted in a perfectly double-blind manner. I resolved this by replicating variations of the original design in a double-blind procedure. Additionally, besides the luxury label condition, I introduced a “green” label condition. Thus, the hypothesis that signaling theory is able to explain pro-environmental behavior was tested for the first time in a natural field setting. Further, I conducted experiments in both average and below-average socioeconomic neighborhoods, where, according to signaling theory, the effects of luxury signals should be even stronger. In contrast to the original study, I did not find positive effects of the luxury brand label in any of the five experiments. Nor did I find evidence for a green-signaling effect. Moreover, in poor neighborhoods a negative tendency of the luxury label actually became evident. This suggests that a signaling theory explanation of costly labels must take into account the characteristics of the observers, e.g. their social status. PMID:28170399

  20. Are Luxury Brand Labels and "Green" Labels Costly Signals of Social Status? An Extended Replication.

    PubMed

    Berger, Joël

    2017-01-01

    Costly signaling theory provides an explanation for why humans are willing to a pay a premium for conspicuous products such as luxury brand-labeled clothing or conspicuous environmentally friendly cars. According to the theory, the extra cost of such products is a signal of social status and wealth and leads to advantages in social interactions for the signaler. A previous study found positive evidence for the case of luxury brand labels. However, an issue of this study was that some of the experiments were not conducted in a perfectly double-blind manner. I resolved this by replicating variations of the original design in a double-blind procedure. Additionally, besides the luxury label condition, I introduced a "green" label condition. Thus, the hypothesis that signaling theory is able to explain pro-environmental behavior was tested for the first time in a natural field setting. Further, I conducted experiments in both average and below-average socioeconomic neighborhoods, where, according to signaling theory, the effects of luxury signals should be even stronger. In contrast to the original study, I did not find positive effects of the luxury brand label in any of the five experiments. Nor did I find evidence for a green-signaling effect. Moreover, in poor neighborhoods a negative tendency of the luxury label actually became evident. This suggests that a signaling theory explanation of costly labels must take into account the characteristics of the observers, e.g. their social status.

  1. Staphylococcus aureus Peptidoglycan Stem Packing by Rotational-Echo Double Resonance NMR Spectroscopy

    PubMed Central

    Kim, Sung Joon; Singh, Manmilan; Preobrazhenskaya, Maria; Schaefer, Jacob

    2013-01-01

    Staphylococcus aureus grown in the presence of an alanine-racemase inhibitor was labeled with D-[1-13C]alanine and L-[15N]alanine to characterize some details of the peptidoglycan tertiary structure. Rotational-echo double-resonance NMR of intact whole cells was used to measure internuclear distances between 13C and 15N of labeled amino acids incorporated in the peptidoglycan, and from those labels to 19F of a glycopeptide drug specifically bound to the peptidoglycan. The observed 13C-15N average distance of 4.1 to 4.4 Å between D- and L-alanines in nearest-neighbor peptide stems is consistent with a local, tightly packed, parallel-stem architecture for a repeating structural motif within the peptidoglycan of S. aureus. PMID:23617832

  2. Visualizing odorant receptor trafficking in living cells down to the single-molecule level

    PubMed Central

    Jacquier, V.; Prummer, M.; Segura, J.-M.; Pick, H.; Vogel, H.

    2006-01-01

    Despite the importance of trafficking for regulating G protein-coupled receptor signaling, for many members of the seven transmembrane helix protein family, such as odorant receptors, little is known about this process in live cells. Here, the complete life cycle of the human odorant receptor OR17-40 was directly monitored in living cells by ensemble and single-molecule imaging, using a double-labeling strategy. While the overall, intracellular trafficking of the receptor was visualized continuously by using a GFP tag, selective imaging of cell surface receptors was achieved by pulse-labeling an acyl carrier protein tag. We found that OR17-40 efficiently translocated to the plasma membrane only at low expression, whereas at higher biosynthesis the receptor accumulated in intracellular compartments. Receptors in the plasma membrane showed high turnover resulting from constitutive internalization along the clathrin pathway, even in the absence of ligand. Single-molecule microscopy allowed monitoring of the early, dynamic processes in odorant receptor signaling. Although mobile receptors initially diffused either freely or within domains of various sizes, binding of an agonist or an antagonist increased partitioning of receptors into small domains of ≈190 nm, which likely are precursors of clathrin-coated pits. The binding of a ligand, therefore, resulted in modulation of the continuous, constitutive internalization. After endocytosis, receptors were directed to early endosomes for recycling. This unique mechanism of continuous internalization and recycling of OR17-40 might be instrumental in allowing rapid recovery of odor perception. PMID:16980412

  3. Pilot Study of Droxidopa With Carbidopa in Adults With ADHD.

    PubMed

    Adler, Lenard A; Gorny, Stephen W

    2015-04-23

    We conducted a two-period (open-label and double-blind) pilot investigation of droxidopa, with and without carbidopa, for ADHD. Twenty adult ADHD patients received open-label droxidopa titrated from 200 to 600 mg 3 times per day (TID; Weeks 1-3), then open-label droxidopa plus carbidopa titrated from 25 or 50 mg TID (Weeks 4-6). In Weeks 7 to 8, patients were randomized to continued co-treatment or matching placebo substitution. Improvements in mean total Adult ADHD Investigator Symptom Report Scale (AISRS) scores were seen at Week 1 (p < .0001) and Week 3 (p < .0001). Improvements were maintained but not increased with carbidopa. Thirteen of 20 patients completed open-label treatment. In the double-blind period, mean total AISRS scores were similar between the co-treatment (n = 6) and placebo (n = 5) groups. No serious adverse events were reported. These preliminary findings indicate that droxidopa can improve adult ADHD symptoms. Further studies are warranted to examine the efficacy and safety of droxidopa in ADHD. © 2015 SAGE Publications.

  4. Fluorescent triplex-forming DNA oligonucleotides labeled with a thiazole orange dimer unit

    PubMed Central

    Ikeda, Shuji; Yanagisawa, Hiroyuki; Yuki, Mizue; Okamoto, Akimitsu

    2013-01-01

    Fluorescent probes for the detection of a double-stranded DNA were prepared by labeling a triplex-forming DNA oligonucleotide with a thiazole orange (TO) dimer unit. They belong to ECHO (exciton-controlled hybridization-sensitive fluorescent oligonucleotide) probes which we have previously reported. The excitonic interaction between the two TO molecules was expected to effectively suppress the background fluorescence of the probes. The applicability of the ECHO probes for the detection of double-stranded DNA was confirmed by examining the thermal stability and photophysical and kinetic properties of the DNA triplexes formed by the ECHO probes. PMID:23445822

  5. Analysis of opioid-mediated analgesia in Phase III studies of methylnaltrexone for opioid-induced constipation in patients with chronic noncancer pain

    PubMed Central

    Webster, Lynn R; Brenner, Darren M; Barrett, Andrew C; Paterson, Craig; Bortey, Enoch; Forbes, William P

    2015-01-01

    Background Subcutaneous methylnaltrexone is efficacious and well tolerated for opioid-induced constipation (OIC) but may theoretically disrupt opioid-mediated analgesia. Methods Opioid use, pain intensity, and opioid withdrawal (Objective Opioid Withdrawal Scale [OOWS] and Subjective Opiate Withdrawal Scale [SOWS] scores) were reported in a randomized, double-blind trial with an open-label extension (RCT) and an open-label trial (OLT) evaluating safety in adults with chronic noncancer pain. In the RCT, patients taking ≥50 mg of oral morphine equivalents daily with <3 rescue-free bowel movements weekly received methyl naltrexone 12 mg once daily (n=150), every other day (n=148), or placebo (n=162) for 4 weeks, followed by open-label methylnaltrexone 12 mg (as needed [prn]; n=364) for 8 weeks. In the OLT, patients (n=1,034) on stable opioid doses with OIC received methylnaltrexone 12 mg prn for up to 48 weeks. Results Minimal fluctuations of median morphine equivalent dose from baseline (BL) were observed in the RCT double-blind period (BL, 154.8–161.0 mg/d; range, 137.1–168.0 mg/d), RCT open-label period (BL, 156.3–174.6; range, 144.0–180.0) and OLT (BL, 120 mg/d; range, 117.3–121.1 mg/d). No significant change from BL in pain intensity score occurred in any group at weeks 2 or 4 (both P≥0.1) of the RCT double-blind period, and scores remained stable during the open-label period and in the OLT (mean change, −0.2 to 0.1). Changes from BL in OOWS and SOWS scores during the double-blind period were not significantly impacted by methylnaltrexone exposure at weeks 2 or 4 (P>0.05 for all). Conclusion Methylnaltrexone did not affect opioid-mediated analgesia in patients with chronic noncancer pain and OIC. PMID:26586963

  6. Methods and kits for nucleic acid analysis using fluorescence resonance energy transfer

    DOEpatents

    Kwok, Pui-Yan; Chen, Xiangning

    1999-01-01

    A method for detecting the presence of a target nucleotide or sequence of nucleotides in a nucleic acid is disclosed. The method is comprised of forming an oligonucleotide labeled with two fluorophores on the nucleic acid target site. The doubly labeled oligonucleotide is formed by addition of a singly labeled dideoxynucleoside triphosphate to a singly labeled polynucleotide or by ligation of two singly labeled polynucleotides. Detection of fluorescence resonance energy transfer upon denaturation indicates the presence of the target. Kits are also provided. The method is particularly applicable to genotyping.

  7. Einstein-Yang-Mills scattering amplitudes from scattering equations

    NASA Astrophysics Data System (ADS)

    Cachazo, Freddy; He, Song; Yuan, Ellis Ye

    2015-01-01

    We present the building blocks that can be combined to produce tree-level S-matrix elements of a variety of theories with various spins mixed in arbitrary dimensions. The new formulas for the scattering of n massless particles are given by integrals over the positions of n points on a sphere restricted to satisfy the scattering equations. As applications, we obtain all single-trace amplitudes in Einstein-Yang-Mills (EYM) theory, and generalizations to include scalars. Also in EYM but extended by a B-field and a dilaton, we present all double-trace gluon amplitudes. The building blocks are made of Pfaffians and Parke-Taylor-like factors of subsets of particle labels.

  8. A universal aptameric biosensor: Multiplexed detection of small analytes via aggregated perylene-based broad-spectrum quencher.

    PubMed

    Hu, Rong; Zhang, Xi; Xu, Qiang; Lu, Dan-Qing; Yang, Yun-Hui; Xu, Quan-Qing; Ruan, Qiong; Mo, Liu-Ting; Zhang, Xiao-Bing

    2017-06-15

    A universal aptameric system based on the taking advantage of double-stranded DNA/perylene diimide (dsDNA/PDI) as the signal probe was developed for multiplexed detection of small molecules. Aptamers are single-stranded DNA or RNA oligonucleotides which are selected in vitro by a process known as systematic evolution of ligands by exponential enrichment. In this work, we synthesized a new kind of PDI and reported this aggregated PDI could quench the double-stranded DNA (dsDNA)-labeled fluorophores with a high quenching efficiency. The quenching efficiencies on the fluorescence of FAM, TAMRA and Cy5 could reach to 98.3%±0.9%, 97.2%±0.6% and 98.1%±1.1%, respectively. This broad-spectrum quencher was then adopted to construct a multicolor biosensor via a label-free approach. A structure-switching-triggered enzymatic recycling amplification was employed for signal amplification. High quenching efficiency combined with autocatalytic target recycling amplification afforded the biosensor with high sensitivity towards small analytes. For other targets, changing the corresponding aptamer can achieve the goal. The quencher did not interfere with the catalytic activity of nuclease. The biosensor could be manipulated with similar sensitivity no matter in pre-addition or post-addition manner. Moreover, simultaneous and multiplexed analysis of several small molecules in homogeneous solution was achieved, demonstrating its potential application in the rapid screening of multiple biotargets. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. 9 CFR 381.445 - Guidelines for voluntary nutrition labeling of single-ingredient, raw products.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Guidelines for voluntary nutrition... INSPECTION REGULATIONS Nutrition Labeling § 381.445 Guidelines for voluntary nutrition labeling of single-ingredient, raw products. (a) Nutrition information on the cuts of single-ingredient, raw poultry products...

  10. 9 CFR 317.345 - Guidelines for voluntary nutrition labeling of single-ingredient, raw products.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Guidelines for voluntary nutrition... DEVICES, AND CONTAINERS Nutrition Labeling § 317.345 Guidelines for voluntary nutrition labeling of single-ingredient, raw products. (a) Nutrition information on the cuts of single-ingredient, raw meat products...

  11. New integrative modules for multicolor-protein labeling and live-cell imaging in Saccharomyces cerevisiae.

    PubMed

    Malcova, Ivana; Farkasovsky, Marian; Senohrabkova, Lenka; Vasicova, Pavla; Hasek, Jiri

    2016-05-01

    Live-imaging analysis is performed in many laboratories all over the world. Various tools have been developed to enable protein labeling either in plasmid or genomic context in live yeast cells. Here, we introduce a set of nine integrative modules for the C-terminal gene tagging that combines three fluorescent proteins (FPs)-ymTagBFP, mCherry and yTagRFP-T with three dominant selection markers: geneticin, nourseothricin and hygromycin. In addition, the construction of two episomal modules for Saccharomyces cerevisiae with photostable yTagRFP-T is also referred to. Our cassettes with orange, red and blue FPs can be combined with other fluorescent probes like green fluorescent protein to prepare double- or triple-labeled strains for multicolor live-cell imaging. Primers for PCR amplification of the cassettes were designed in such a way as to be fully compatible with the existing PCR toolbox representing over 50 various integrative modules and also with deletion cassettes either for single or repeated usage to enable a cost-effective and an easy exchange of tags. New modules can also be used for biochemical analysis since antibodies are available for all three fluorescent probes. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. Replication of tobacco mosaic virus. VII. Further characterization of single- and double-stranded virus-related RNAs from TMV-infected plants.

    PubMed

    Palukaitis, P; García-Arenal, F; Sulzinski, M A; Zaitlin, M

    1983-12-01

    The single-stranded (ss) and double-stranded (ds) RNAs produced in tobacco tissue as a result of infection by tobacco mosaic virus (TMV) have been reinvestigated. 32P-labeled probes consisting of either cDNA or viral RNA, complementary to specific regions of either the viral RNA or its negative strand, respectively, were used in "Northern" hybridization experiments. Of the 10 ssRNA bands observed, all but four appeared to be artifacts of electrophoresis. These four RNAs were found on polyribosomes and are presumed to be true mRNAs; three were identified as the well-known genomic RNA, the I2-mRNA and the coat protein mRNA, or LMC. The fourth RNA species of MW approximately 1.2 x 10(6) had not previously been specifically identified as a subgenomic RNA of TMV. The viral RNA which gave rise to the six artifactual ssRNA bands was heterogeneous in size and was shown to be encapsidated in vivo. Upon electrophoresis, these heterogeneous RNA fragments comigrated approximately with plant rRNAs also present in the extracts, generating the observed artifactual bands. Four dsRNAs were also identified. From molecular weight and hybridization analyses, they appeared to be double-stranded forms of the above four polyribosome-associated ssRNAs. Attempts to translate proteins from the denatured dsRNAs in vitro were unsuccessful. A population of low-molecular-weight, TMV-specific ssRNAs, (+) and (-) in sequence, was generated during infection; however these RNAs were believed to be breakdown products.

  13. Double-labelled in situ hybridization reveals the lack of co-localization of mRNAs for the circadian neuropeptide PDF and FMRFamide in brains of the flies Musca domestica and Drosophila melanogaster.

    PubMed

    Matsushima, Ayami; Takano, Katsuhiro; Yoshida, Taichi; Takeda, Yukimasa; Yokotani, Satoru; Shimohigashi, Yasuyuki; Shimohigashi, Miki

    2007-06-01

    Many lines of evidence have suggested that neuropeptides other than pigment-dispersing factor (PDF) are involved in regulating insect circadian rhythms, and FMRFamide-related peptides are additional candidates acting as such neuromodulators. Double-immunolabelling in insect brains with anti-crustacean beta-PDH and anti-FMRFamide antibodies had previously suggested that insect PDF and FMRFamide-like peptides may coexist in the same cells. However, it is critical for this kind of comparative investigations to use antibodies of proven specificity, to eliminate the possibility of both reciprocal cross-reactivity and the detection of unknown peptides. In the present study, we achieved the cDNA cloning of an fmrf mRNA from the housefly Musca domestica, for which co-localization of FMRFamide and PDF peptides was previously suggested. In order to examine the possible co-expression of this gene with the pdf gene, we carried out double-labelled in situ hybridization for simultaneous detection of both pdf and fmrf mRNAs in housefly, Musca brains. The results clearly indicated that they occur in distinctly different cells. This was also proven for the fruit fly Drosophila melanogaster by similar double-labelled in situ hybridization. The results thus revealed no reason to evoke the physiological release of FMRFamide and PDF peptides from the same neurons.

  14. Window Glazing Types | Efficient Windows Collaborative

    Science.gov Websites

    of glass. Single Clear Single Tint Double Glazing The following sections on high-performance double fills. Double Clear Double Tint Double High-Solar-Gain Low-E Double Medium-Solar-Gain Low-E Double Low -Solar-Gain Low-E Double High-Solar-Gain Low-E with Roomside (4th surface) Low-E Double Medium-Solar-Gain

  15. Single-photon emission computed tomography enhanced Tc-99m-pertechnetate disodium-labelled red blood cell scintigraphy in the localization of small intestine bleeding: a single-centre twelve-year study.

    PubMed

    Dolezal, Jiri; Vizda, Jaroslav; Kopacova, Marcela

    2011-01-01

    To present our experience with the detection of bleeding in the small intestine by means of scintigraphy with in vivo-labelled red blood cells (RBCs) in the period of 1998-2009. A 12-year prospective study was accomplished with 40 patients (23 men, 17 women, aged 12-91, mean 56 years) who had lower gastrointestinal bleeding (obscure-overt bleeding) and underwent scintigraphy with in vivo-labelled RBCs by means of technetium 99m. The scintigraphy was usually performed after other diagnostic tests had failed to locate the bleeding. A total of 26 patients had a positive scintigraphy with in vivo-labelled RBCs and 14 patients had negative scintigraphy. The final diagnosis was confirmed in 20 of 26 patients with a positive scintigraphy by push enteroscopy (6/20), intraoperative enteroscopy (7/20), surgery (4/20), duodenoscopy (1/20), double-balloon enteroscopy (1/20) and X-ray angiography (1/20). The correct location of the bleeding site was identified by RBC scintigraphy in 15 of 20 (75%) patients with the confirmed source. The locations of the bleeding site identified by scintigraphy and enteroscopy (push, intraoperative) and surgical investigations were highly correlated in patients with a positive scintigraphy within the first 3 h. Eleven of the 20 correctly localized studies and none of the incorrectly localized studies were positive in the dynamic phase of imaging. In 5 patients (all erroneously localized), scintigraphy was positive only at a period longer than 18 h. RBC scintigraphy is an effective imaging modality in localizing lower gastrointestinal bleeding in patients for whom other diagnostic tests have failed to locate the bleeding. RBC scintigraphy can be successful in the detection of bleeding sites in the small intestine. Copyright © 2011 S. Karger AG, Basel.

  16. Nucleic Acid-Dependent Conformational Changes in CRISPR-Cas9 Revealed by Site-Directed Spin Labeling.

    PubMed

    Vazquez Reyes, Carolina; Tangprasertchai, Narin S; Yogesha, S D; Nguyen, Richard H; Zhang, Xiaojun; Rajan, Rakhi; Qin, Peter Z

    2017-06-01

    In a type II clustered regularly interspaced short palindromic repeats (CRISPR) system, RNAs that are encoded at the CRISPR locus complex with the CRISPR-associated (Cas) protein Cas9 to form an RNA-guided nuclease that cleaves double-stranded DNAs at specific sites. In recent years, the CRISPR-Cas9 system has been successfully adapted for genome engineering in a wide range of organisms. Studies have indicated that a series of conformational changes in Cas9, coordinated by the RNA and the target DNA, direct the protein into its active conformation, yet details on these conformational changes, as well as their roles in the mechanism of function of Cas9, remain to be elucidated. Here, nucleic acid-dependent conformational changes in Streptococcus pyogenes Cas9 (SpyCas9) were investigated using the method of site-directed spin labeling (SDSL). Single nitroxide spin labels were attached, one at a time, at one of the two native cysteine residues (Cys80 and Cys574) of SpyCas9, and the spin-labeled proteins were shown to maintain their function. X-band continuous-wave electron paramagnetic resonance spectra of the nitroxide attached at Cys80 revealed conformational changes of SpyCas9 that are consistent with a large-scale domain re-arrangement upon binding to its RNA partner. The results demonstrate the use of SDSL to monitor conformational changes in CRISPR-Cas9, which will provide key information for understanding the mechanism of CRISPR function.

  17. Quantitative multi-color FRET measurements by Fourier lifetime excitation-emission matrix spectroscopy.

    PubMed

    Zhao, Ming; Huang, Run; Peng, Leilei

    2012-11-19

    Förster resonant energy transfer (FRET) is extensively used to probe macromolecular interactions and conformation changes. The established FRET lifetime analysis method measures the FRET process through its effect on the donor lifetime. In this paper we present a method that directly probes the time-resolved FRET signal with frequency domain Fourier lifetime excitation-emission matrix (FLEEM) measurements. FLEEM separates fluorescent signals by their different phonon energy pathways from excitation to emission. The FRET process generates a unique signal channel that is initiated by donor excitation but ends with acceptor emission. Time-resolved analysis of the FRET EEM channel allows direct measurements on the FRET process, unaffected by free fluorophores that might be present in the sample. Together with time-resolved analysis on non-FRET channels, i.e. donor and acceptor EEM channels, time resolved EEM analysis allows precise quantification of FRET in the presence of free fluorophores. The method is extended to three-color FRET processes, where quantification with traditional methods remains challenging because of the significantly increased complexity in the three-way FRET interactions. We demonstrate the time-resolved EEM analysis method with quantification of three-color FRET in incompletely hybridized triple-labeled DNA oligonucleotides. Quantitative measurements of the three-color FRET process in triple-labeled dsDNA are obtained in the presence of free single-labeled ssDNA and double-labeled dsDNA. The results establish a quantification method for studying multi-color FRET between multiple macromolecules in biochemical equilibrium.

  18. Quantitative multi-color FRET measurements by Fourier lifetime excitation-emission matrix spectroscopy

    PubMed Central

    Zhao, Ming; Huang, Run; Peng, Leilei

    2012-01-01

    Förster resonant energy transfer (FRET) is extensively used to probe macromolecular interactions and conformation changes. The established FRET lifetime analysis method measures the FRET process through its effect on the donor lifetime. In this paper we present a method that directly probes the time-resolved FRET signal with frequency domain Fourier lifetime excitation-emission matrix (FLEEM) measurements. FLEEM separates fluorescent signals by their different phonon energy pathways from excitation to emission. The FRET process generates a unique signal channel that is initiated by donor excitation but ends with acceptor emission. Time-resolved analysis of the FRET EEM channel allows direct measurements on the FRET process, unaffected by free fluorophores that might be present in the sample. Together with time-resolved analysis on non-FRET channels, i.e. donor and acceptor EEM channels, time resolved EEM analysis allows precise quantification of FRET in the presence of free fluorophores. The method is extended to three-color FRET processes, where quantification with traditional methods remains challenging because of the significantly increased complexity in the three-way FRET interactions. We demonstrate the time-resolved EEM analysis method with quantification of three-color FRET in incompletely hybridized triple-labeled DNA oligonucleotides. Quantitative measurements of the three-color FRET process in triple-labeled dsDNA are obtained in the presence of free single-labeled ssDNA and double-labeled dsDNA. The results establish a quantification method for studying multi-color FRET between multiple macromolecules in biochemical equilibrium. PMID:23187535

  19. Fluorescence-based strategies to investigate the structure and dynamics of aptamer-ligand complexes

    NASA Astrophysics Data System (ADS)

    Perez-Gonzalez, Cibran; Lafontaine, Daniel; Penedo, J.

    2016-08-01

    In addition to the helical nature of double-stranded DNA and RNA, single-stranded oligonucleotides can arrange themselves into tridimensional structures containing loops, bulges, internal hairpins and many other motifs. This ability has been used for more than two decades to generate oligonucleotide sequences, so-called aptamers, that can recognize certain metabolites with high affinity and specificity. More recently, this library of artificially-generated nucleic acid aptamers has been expanded by the discovery that naturally occurring RNA sequences control bacterial gene expression in response to cellular concentration of a given metabolite. The application of fluorescence methods has been pivotal to characterize in detail the structure and dynamics of these aptamer-ligand complexes in solution. This is mostly due to the intrinsic high sensitivity of fluorescence methods and also to significant improvements in solid-phase synthesis, post-synthetic labelling strategies and optical instrumentation that took place during the last decade. In this work, we provide an overview of the most widely employed fluorescence methods to investigate aptamer structure and function by describing the use of aptamers labelled with a single dye in fluorescence quenching and anisotropy assays. The use of 2-aminopurine as a fluorescent analog of adenine to monitor local changes in structure and fluorescence resonance energy transfer (FRET) to follow long-range conformational changes is also covered in detail. The last part of the review is dedicated to the application of fluorescence techniques based on single-molecule microscopy, a technique that has revolutionized our understanding of nucleic acid structure and dynamics. We finally describe the advantages of monitoring ligand-binding and conformational changes, one molecule at a time, to decipher the complexity of regulatory aptamers and summarize the emerging folding and ligand-binding models arising from the application of these single-molecule FRET microscopy techniques.

  20. Fluorescence-Based Strategies to Investigate the Structure and Dynamics of Aptamer-Ligand Complexes

    PubMed Central

    Perez-Gonzalez, Cibran; Lafontaine, Daniel A.; Penedo, J. Carlos

    2016-01-01

    In addition to the helical nature of double-stranded DNA and RNA, single-stranded oligonucleotides can arrange themselves into tridimensional structures containing loops, bulges, internal hairpins and many other motifs. This ability has been used for more than two decades to generate oligonucleotide sequences, so-called aptamers, that can recognize certain metabolites with high affinity and specificity. More recently, this library of artificially-generated nucleic acid aptamers has been expanded by the discovery that naturally occurring RNA sequences control bacterial gene expression in response to cellular concentration of a given metabolite. The application of fluorescence methods has been pivotal to characterize in detail the structure and dynamics of these aptamer-ligand complexes in solution. This is mostly due to the intrinsic high sensitivity of fluorescence methods and also to significant improvements in solid-phase synthesis, post-synthetic labeling strategies and optical instrumentation that took place during the last decade. In this work, we provide an overview of the most widely employed fluorescence methods to investigate aptamer structure and function by describing the use of aptamers labeled with a single dye in fluorescence quenching and anisotropy assays. The use of 2-aminopurine as a fluorescent analog of adenine to monitor local changes in structure and fluorescence resonance energy transfer (FRET) to follow long-range conformational changes is also covered in detail. The last part of the review is dedicated to the application of fluorescence techniques based on single-molecule microscopy, a technique that has revolutionized our understanding of nucleic acid structure and dynamics. We finally describe the advantages of monitoring ligand-binding and conformational changes, one molecule at a time, to decipher the complexity of regulatory aptamers and summarize the emerging folding and ligand-binding models arising from the application of these single-molecule FRET microscopy techniques. PMID:27536656

  1. 9 CFR 381.445 - Guidelines for voluntary nutrition labeling of single-ingredient, raw products.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 9 Animals and Animal Products 2 2012-01-01 2012-01-01 false Guidelines for voluntary nutrition... INSPECTION REGULATIONS Nutrition Labeling § 381.445 Guidelines for voluntary nutrition labeling of single... delayed until Mar. 1, 2012, at 76 FR 76890, Dec. 9, 2011. (a) Nutrition information on the cuts of single...

  2. 9 CFR 381.445 - Nutrition labeling of single-ingredient, raw poultry products that are not ground or chopped...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 9 Animals and Animal Products 2 2014-01-01 2014-01-01 false Nutrition labeling of single... INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Nutrition Labeling § 381.445 Nutrition... § 381.401. (a)(1) Nutrition information on the major cuts of single-ingredient, raw poultry products...

  3. 9 CFR 317.345 - Guidelines for voluntary nutrition labeling of single-ingredient, raw products.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 9 Animals and Animal Products 2 2012-01-01 2012-01-01 false Guidelines for voluntary nutrition... DEVICES, AND CONTAINERS Nutrition Labeling § 317.345 Guidelines for voluntary nutrition labeling of single... delayed until Mar. 1, 2012, at 76 FR 76890, Dec. 9, 2011. (a) Nutrition information on the cuts of single...

  4. 9 CFR 381.445 - Nutrition labeling of single-ingredient, raw poultry products that are not ground or chopped...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 9 Animals and Animal Products 2 2013-01-01 2013-01-01 false Nutrition labeling of single... INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Nutrition Labeling § 381.445 Nutrition... § 381.401. (a)(1) Nutrition information on the major cuts of single-ingredient, raw poultry products...

  5. Clusters of DNA damage induced by ionizing radiation: formation of short DNA fragments. II. Experimental detection

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Chatterjee, A. (Principal Investigator)

    1996-01-01

    The basic 30-nm chromatin fiber in the mammalian cell consists of an unknown (possibly helical) arrangement of nucleosomes, with about 1.2 kb of DNA per 10-nm length of fiber. Track-structure considerations suggest that interactions of single delta rays or high-LET particles with the chromatin fiber might result in the formation of multiple lesions spread over a few kilobases of DNA (see the accompanying paper: W.R. Holley and A. Chatterjee, Radiat. Res. 145, 188-199, 1996). In particular, multiple DNA double-strand breaks and single-strand breaks may form. To test this experimentally, primary human fibroblasts were labeled with [3H]thymidine and exposed at 0 degrees C to X rays or accelerated nitrogen or iron ions in the LET range of 97-440 keV/microns. DNA was isolated inside agarose plugs and subjected to agarose gel electrophoresis under conditions that allowed good separation of 0.1-2 kb size DNA. The bulk of DNA remained in the well or migrated only a small distance into the gel. It was found that DNA fragments in the expected size range were formed linearly with dose with an efficiency that increased with LET. A comparison of the yield of such fragments with the yield of total DNA double-strand breaks suggests that for the high-LET ions a substantial proportion (20-90%) of DNA double-strand breaks are accompanied within 0.1-2 kb by at least one additional DNA double-strand break. It is shown that these results are in good agreement with theoretical calculations based on treating the 30-nm chromatin fiber as the target for ionizing particles. Theoretical considerations also predict that the clusters will contain numerous single-strand breaks and base damages. It is proposed that such clusters be designated "regionally multiply damaged sites." Postirradiation incubation at 37 degrees C resulted in a decline in the number of short DNA fragments, suggesting a repair activity. The biological significance of regionally multiply damaged sites is presently unknown.

  6. Single-larger-portion-size and dual-column nutrition labeling may help consumers make more healthful food choices.

    PubMed

    Lando, Amy M; Lo, Serena C

    2013-02-01

    The Food and Drug Administration is considering changes to the Nutrition Facts label to help consumers make more healthful choices. To examine the effects of modifications to the Nutrition Facts label on foods that can be listed as having 1 or 2 servings per container, but are reasonably consumed at a single eating occasion. Participants were randomly assigned to study conditions that varied on label format, product, and nutrition profile. Data were collected via an online consumer panel. Adults aged 18 years and older were recruited from Synovate's online household panel. Data were collected during August 2011. A total of 32,897 invitations were sent for a final sample of 9,493 interviews. Participants were randomly assigned to one of 10 label formats classified into three groups: listing 2 servings per container with a single column, listing 2 servings per container with a dual column, and listing a single serving per container. Within these groups there were versions that enlarged the font size for "calories," removed "calories from fat," and changed the wording for serving size declaration. The single product task measured product healthfulness, the amount of calories and various nutrients per serving and per container, and label perceptions. The product comparison task measured ability to identify the healthier product and the product with fewer calories per container and per serving. Analysis of covariance models with Tukey-Kramer tests were used. Covariates included general label use, age, sex, level of education, and race/ethnicity. Single-serving and dual-column formats performed better and scored higher on most outcome measures. For products that contain 2 servings but are customarily consumed at a single eating occasion, using a single-serving or dual-column labeling approach may help consumers make healthier food choices. Published by Elsevier Inc.

  7. Can cell kinetic parameters predict the response of tumours to radiotherapy?

    PubMed

    McNally, N J

    1989-11-01

    Three potential predictive assays of the repopulation component in tumour response to therapy are considered. (1) The DNA index can easily be measured. It is of prognostic value for cancers of certain sites, aneuploidy being a bad prognostic indicator. It is not strictly an indicator of cell proliferation. (2) The in vitro labelling index is of predictive value in early stage operable breast cancer and in head and neck cancer. In the former a high pretreatment labelling index can identify patients who could benefit from adjuvant chemotherapy. (3) The tumour potential doubling time (Tpot) can be measured rapidly following in vivo labelling with bromodeoxyuridine or iododeoxyuridine. We have measured Tpot in over 100 solid tumours with a success rate of about 75 per cent. Nearly 50 per cent of the tumours have a pre-treatment potential doubling time of 5 days or less. These would be suitable candidates for accelerated fractionation.

  8. Single step signal group-imidazole labeling of organic phosphate groups under aqueous conditions

    DOEpatents

    Giese, Roger W.; Wang, Poguang

    1996-01-01

    Compounds and methods for single step, covalent labeling of the phosphate group of an organic substance under aqueous conditions are described. The labeling compound includes any kind of detectable signal group covalently bound to an imidazole moiety, which can be imidazole or a substituted imidazole. A preferred labeling compound has the formula ##STR1##

  9. Optimization of transversal relaxation of nitroxides for pulsed electron-electron double resonance spectroscopy in phospholipid membranes.

    PubMed

    Dastvan, Reza; Bode, Bela E; Karuppiah, Muruga Poopathi Raja; Marko, Andriy; Lyubenova, Sevdalina; Schwalbe, Harald; Prisner, Thomas F

    2010-10-28

    Pulsed electron-electron double resonance (PELDOR) spectroscopy is increasingly applied to spin-labeled membrane proteins. However, after reconstitution into liposomes, spin labels often exhibit a much faster transversal relaxation (T(m)) than in detergent micelles, thus limiting application of the method in lipid bilayers. In this study, the main reasons for enhanced transversal relaxation in phospholipid membranes were investigated systematically by use of spin-labeled derivatives of stearic acid and phosphatidylcholine as well as spin-labeled derivatives of the channel-forming peptide gramicidin A under the conditions typically employed for PELDOR distance measurements. Our results clearly show that dephasing due to instantaneous diffusion that depends on dipolar interaction among electron spins is an important contributor to the fast echo decay in cases of high local concentrations of spin labels in membranes. The main difference between spin labels in detergent micelles and membranes is their local concentration. Consequently, avoiding spin clustering and suppressing instantaneous diffusion is the key step for maximizing PELDOR sensitivity in lipid membranes. Even though proton spin diffusion is an important relaxation mechanism, only in samples of low local concentrations does deuteration of acyl chains and buffer significantly prolong T(m). In these cases, values of up to 7 μs have been achieved. Furthermore, our study revealed that membrane composition and labeling position in the membrane can also affect T(m), either by promoting the segregation of spin-labeled species or by altering their exposure to matrix protons. Effects of other experimental parameters including temperature (<50 K), presence of oxygen, and cryoprotectant type are negligible under our experimental conditions.

  10. All-atom molecular dynamics simulations of spin labelled double and single-strand DNA for EPR studies.

    PubMed

    Prior, C; Danilāne, L; Oganesyan, V S

    2018-05-16

    We report the first application of fully atomistic molecular dynamics (MD) simulations to the prediction of electron paramagnetic resonance (EPR) spectra of spin labelled DNA. Models for two structurally different DNA spin probes with either the rigid or flexible position of the nitroxide group in the base pair, employed in experimental studies previously, have been developed. By the application of the combined MD-EPR simulation methodology we aimed at the following. Firstly, to provide a test bed against a sensitive spectroscopic technique for the recently developed improved version of the parmbsc1 force field for MD modelling of DNA. The predicted EPR spectra show good agreement with the experimental ones available from the literature, thus confirming the accuracy of the currently employed DNA force fields. Secondly, to provide a quantitative interpretation of the motional contributions into the dynamics of spin probes in both duplex and single-strand DNA fragments and to analyse their perturbing effects on the local DNA structure. Finally, a combination of MD and EPR allowed us to test the validity of the application of the Model-Free (M-F) approach coupled with the partial averaging of magnetic tensors to the simulation of EPR spectra of DNA systems by comparing the resultant EPR spectra with those simulated directly from MD trajectories. The advantage of the M-F based EPR simulation approach over the direct propagation techniques is that it requires motional and order parameters that can be calculated from shorter MD trajectories. The reported MD-EPR methodology is transferable to the prediction and interpretation of EPR spectra of higher order DNA structures with novel types of spin labels.

  11. Solvent effect on FRET spectroscopic ruler

    NASA Astrophysics Data System (ADS)

    Qu, Songyuan; Liu, Chuanbo; Liu, Qiong; Wu, Wei; Du, Baoji; Wang, Jin

    2018-03-01

    A discrepancy has emerged in recent years between single-molecule Förster resonance energy transfer (smFRET) measurements and small angle X-ray scattering (SAXS) or small angle neutron scattering experiments in the study of unfolded or intrinsically disordered proteins in denaturing solutions. Despite significant advances that have been made in identifying various factors which may have contributed to the manifestation of the so-called smFRET-SAXS discrepancy, no consensus has been reached so far on its original source or eventual resolution. In this study, we investigate this problem from the perspective of the solvent effect on FRET spectroscopic ruler (SEFSR), a generic term we use to describe various solvent-dependent factors affecting the accuracy of the FRET experimental method that is known as a "spectroscopic ruler." Some factors belonging to SEFSR, such as direct dye-solvent interaction and labeling configuration, seem to have not received due attention regarding their significance in contributing to the discrepancy. We identify SEFSR by measuring a rigid segment of a double-stranded DNA in various solutions using the smFRET method and evaluate its relative importance in smFRET experiments by measuring segments of a single-stranded DNA and polyethylene glycol (PEG) in solutions. We find that SEFSR can produce non-negligible FRET-inferred interdye distance changes in various solutions, with an intensity following the Hofmeister series in ionic solutions and dependent on labeling configurations. SEFSR is found to be significant in GuHCl and urea solutions, which can fully cover the apparent expansion signal of dye-labeled PEG. Our findings suggest that SEFSR may have played an important role in contributing to the smFRET-SAXS discrepancy.

  12. Cost-Effectiveness of Double Reading versus Single Reading of Mammograms in a Breast Cancer Screening Programme

    PubMed Central

    Posso, Margarita; Carles, Misericòrdia; Rué, Montserrat; Puig, Teresa; Bonfill, Xavier

    2016-01-01

    Objectives The usual practice in breast cancer screening programmes for mammogram interpretation is to perform double reading. However, little is known about its cost-effectiveness in the context of digital mammography. Our purpose was to evaluate the cost-effectiveness of double reading versus single reading of digital mammograms in a population-based breast cancer screening programme. Methods Data from 28,636 screened women was used to establish a decision-tree model and to compare three strategies: 1) double reading; 2) double reading for women in their first participation and single reading for women in their subsequent participations; and 3) single reading. We calculated the incremental cost-effectiveness ratio (ICER), which was defined as the expected cost per one additionally detected cancer. We performed a deterministic sensitivity analysis to test the robustness of the ICER. Results The detection rate of double reading (5.17‰) was similar to that of single reading (4.78‰; P = .768). The mean cost of each detected cancer was €8,912 for double reading and €8,287 for single reading. The ICER of double reading versus single reading was €16,684. The sensitivity analysis showed variations in the ICER according to the sensitivity of reading strategies. The strategy that combines double reading in first participation with single reading in subsequent participations was ruled out due to extended dominance. Conclusions From our results, double reading appears not to be a cost-effective strategy in the context of digital mammography. Double reading would eventually be challenged in screening programmes, as single reading might entail important net savings without significantly changing the cancer detection rate. These results are not conclusive and should be confirmed in prospective studies that investigate long-term outcomes like quality adjusted life years (QALYs). PMID:27459663

  13. Double Negative Materials (DNM), Phenomena and Applications

    DTIC Science & Technology

    2009-07-01

    Nanoparticles Formed by Pairs Of Concentric Double-Negative (DNG), Single-Negative ( SNG ) and/or Double-Positive (DPS) Metamaterial Layers.” J. Appl...material RRL Rapid Research Letters SHG second-harmonic generation SNG single-negative SSR split-ring resonator A-1 Appendix A. October 2008...Pairs of Concentric Double-Negative (DNG), Single-Negative ( SNG ), and/or Double-Positive (DPS) Metamaterial Layers.” J. Appl. Phys. 97, no. 9 (May

  14. Electrochemical label-free and sensitive nanobiosensing of DNA hybridization by graphene oxide modified pencil graphite electrode.

    PubMed

    Ahour, F; Shamsi, A

    2017-09-01

    Based on the strong interaction between single-stranded DNA (ss-DNA) and graphene material, we have constructed a novel label-free electrochemical biosensor for rapid and facile detection of short sequences ss-DNA molecules related to hepatitis C virus 1a using graphene oxide modified pencil graphite electrode. The sensing mechanism is based on the superior adsorption of single-stranded DNA to GO over double stranded DNA (ds-DNA). The intrinsic guanine oxidation signal measured by differential pulse voltammetry (DPV) has been used for duplex DNA formation detection. The probe ss-DNA adsorbs onto the surface of GO via the π- π* stacking interactions leading to a strong background guanine oxidation signal. In the presence of complementary target, formation of helix which has weak binding ability to GO induced ds-DNA to release from the electrode surface and significant variation in differential pulse voltammetric response of guanine bases. The results indicated that the oxidation peak current was proportional to the concentration of complementary strand in the range of 0.1 nM-0.5 μM with a detection limit of 4.3 × 10 -11  M. The simple fabricated electrochemical biosensor has high sensitivity, good selectivity, and could be applied as a new platform for a range of target molecules in future. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Energy and traffic light labelling have no impact on parent and child fast food selection.

    PubMed

    Dodds, Pennie; Wolfenden, Luke; Chapman, Kathy; Wellard, Lyndal; Hughes, Clare; Wiggers, John

    2013-10-25

    Labelling of food from fast food restaurants at point-of-purchase has been suggested as one strategy to reduce population energy consumption and contribute to reductions in obesity prevalence. The aim of this study was to examine the effects of energy and single traffic light labelling systems on the energy content of child and adult intended food purchases. The study employed a randomised controlled trial design. English speaking parents of children aged between three and 12 years were recruited from an existing research cohort. Participants were mailed one of three hypothetical fast food menus. Menus differed in their labelling technique- either energy labels, single traffic light labels, or a no-label control. Participants then completed a telephone survey which assessed intended food purchases for both adult and child. The primary trial outcome was total energy of intended food purchase. A total of 329 participants completed the follow-up telephone interview. Eighty-two percent of the energy labelling group and 96% of the single traffic light labelling group reported noticing labelling information on their menu. There were no significant differences in total energy of intended purchases of parents, or intended purchases made by parents for children, between the menu labelling groups, or between menu labelling groups by socio-demographic subgroups. This study provided no evidence to suggest that energy labelling or single traffic light labelling alone were effective in reducing the energy of fast food items selected from hypothetical fast food menus for purchase. Additional complementary public health initiatives promoting the consumption of healthier foods identified by labelling, and which target other key drivers of menu item selection in this setting may be required. Copyright © 2013. Published by Elsevier Ltd.

  16. The effect of energy and traffic light labelling on parent and child fast food selection: a randomised controlled trial.

    PubMed

    Dodds, Pennie; Wolfenden, Luke; Chapman, Kathy; Wellard, Lyndal; Hughes, Clare; Wiggers, John

    2014-02-01

    Labelling of food from fast food restaurants at point-of-purchase has been suggested as one strategy to reduce population energy consumption and contribute to reductions in obesity prevalence. The aim of this study was to examine the effects of energy and single traffic light labelling systems on the energy content of child and adult intended food purchases. The study employed a randomised controlled trial design. English speaking parents of children aged between three and 12 years were recruited from an existing research cohort. Participants were mailed one of three hypothetical fast food menus. Menus differed in their labelling technique – either energy labels, single traffic light labels, or a no-label control. Participants then completed a telephone survey which assessed intended food purchases for both adult and child. The primary trial outcome was total energy of intended food purchase. A total of 329 participants completed the follow-up telephone interview. Eighty-two percent of the energy labelling group and 96% of the single traffic light labelling group reported noticing labelling information on their menu. There were no significant differences in total energy of intended purchases of parents, or intended purchases made by parents for children, between the menu labelling groups, or between menu labelling groups by socio-demographic subgroups. This study provided no evidence to suggest that energy labelling or single traffic light labelling alone were effective in reducing the energy of fast food items selected from hypothetical fast food menus for purchase. Additional complementary public health initiatives promoting the consumption of healthier foods identified by labelling, and which target other key drivers of menu item selection in this setting may be required.

  17. Kinetics of rapid covalent bond formation of aniline with humic acid: ESR investigations with nitroxide spin labels

    NASA Astrophysics Data System (ADS)

    Glinka, Kevin; Matthies, Michael; Theiling, Marius; Hideg, Kalman; Steinhoff, Heinz-Jürgen

    2016-04-01

    Sulfonamide antibiotics used in livestock farming are distributed to farmland by application of slurry as fertilizer. Previous work suggests rapid covalent binding of the aniline moiety to humic acids found in soil. In the current work, kinetics of this binding were measured in X-band EPR spectroscopy by incubating Leonardite humic acid (LHA) with a paramagnetic aniline spin label (anilino-NO (2,5,5-Trimethyl-2-(3-aminophenyl)pyrrolidin-1-oxyl)). Binding was detected by a pronounced broadening of the spectral lines after incubation of LHA with anilino-NO. The time evolution of the amplitude of this feature was used for determining the reaction kinetics. Single- and double-exponential models were fitted to the data obtained for modelling one or two first-order reactions. Reaction rates of 0.16 min-1 and 0.012 min-1, were found respectively. Addition of laccase peroxidase did not change the kinetics but significantly enhanced the reacting fraction of anilino-NO. This EPR-based method provides a technically simple and effective method for following rapid binding processes of a xenobiotic substance to humic acids.

  18. 5-Fluoro pyrimidines: labels to probe DNA and RNA secondary structures by 1D 19F NMR spectroscopy

    PubMed Central

    Puffer, Barbara; Kreutz, Christoph; Rieder, Ulrike; Ebert, Marc-Olivier; Konrat, Robert; Micura, Ronald

    2009-01-01

    19F NMR spectroscopy has proved to be a valuable tool to monitor functionally important conformational transitions of nucleic acids. Here, we present a systematic investigation on the application of 5-fluoro pyrimidines to probe DNA and RNA secondary structures. Oligonucleotides with the propensity to adapt secondary structure equilibria were chosen as model systems and analyzed by 1D 19F and 1H NMR spectroscopy. A comparison with the unmodified analogs revealed that the equilibrium characteristics of the bistable DNA and RNA oligonucleotides were hardly affected upon fluorine substitution at C5 of pyrimidines. This observation was in accordance with UV spectroscopic melting experiments which demonstrated that single 5-fluoro substitutions in double helices lead to comparable thermodynamic stabilities. Thus, 5-fluoro pyrimidine labeling of DNA and RNA can be reliably applied for NMR based nucleic acid secondary structure evaluation. Furthermore, we developed a facile synthetic route towards 5-fluoro cytidine phosphoramidites that enables their convenient site-specific incorporation into oligonucleotides by solid-phase synthesis. PMID:19843610

  19. 5-Fluoro pyrimidines: labels to probe DNA and RNA secondary structures by 1D 19F NMR spectroscopy.

    PubMed

    Puffer, Barbara; Kreutz, Christoph; Rieder, Ulrike; Ebert, Marc-Olivier; Konrat, Robert; Micura, Ronald

    2009-12-01

    (19)F NMR spectroscopy has proved to be a valuable tool to monitor functionally important conformational transitions of nucleic acids. Here, we present a systematic investigation on the application of 5-fluoro pyrimidines to probe DNA and RNA secondary structures. Oligonucleotides with the propensity to adapt secondary structure equilibria were chosen as model systems and analyzed by 1D (19)F and (1)H NMR spectroscopy. A comparison with the unmodified analogs revealed that the equilibrium characteristics of the bistable DNA and RNA oligonucleotides were hardly affected upon fluorine substitution at C5 of pyrimidines. This observation was in accordance with UV spectroscopic melting experiments which demonstrated that single 5-fluoro substitutions in double helices lead to comparable thermodynamic stabilities. Thus, 5-fluoro pyrimidine labeling of DNA and RNA can be reliably applied for NMR based nucleic acid secondary structure evaluation. Furthermore, we developed a facile synthetic route towards 5-fluoro cytidine phosphoramidites that enables their convenient site-specific incorporation into oligonucleotides by solid-phase synthesis.

  20. Double-row vs single-row rotator cuff repair: a review of the biomechanical evidence.

    PubMed

    Wall, Lindley B; Keener, Jay D; Brophy, Robert H

    2009-01-01

    A review of the current literature will show a difference between the biomechanical properties of double-row and single-row rotator cuff repairs. Rotator cuff tears commonly necessitate surgical repair; however, the optimal technique for repair continues to be investigated. Recently, double-row repairs have been considered an alternative to single-row repair, allowing a greater coverage area for healing and a possibly stronger repair. We reviewed the literature of all biomechanical studies comparing double-row vs single-row repair techniques. Inclusion criteria included studies using cadaveric, animal, or human models that directly compared double-row vs single-row repair techniques, written in the English language, and published in peer reviewed journals. Identified articles were reviewed to provide a comprehensive conclusion of the biomechanical strength and integrity of the repair techniques. Fifteen studies were identified and reviewed. Nine studies showed a statistically significant advantage to a double-row repair with regards to biomechanical strength, failure, and gap formation. Three studies produced results that did not show any statistical advantage. Five studies that directly compared footprint reconstruction all demonstrated that the double-row repair was superior to a single-row repair in restoring anatomy. The current literature reveals that the biomechanical properties of a double-row rotator cuff repair are superior to a single-row repair. Basic Science Study, SRH = Single vs. Double Row RCR.

  1. Label-free CMOS bio sensor with on-chip noise reduction scheme for real-time quantitative monitoring of biomolecules.

    PubMed

    Seong-Jin Kim; Euisik Yoon

    2012-06-01

    We present a label-free CMOS field-effect transistor sensing array to detect the surface potential change affected by the negative charge in DNA molecules for real-time monitoring and quantification. The proposed CMOS bio sensor includes a new sensing pixel architecture implemented with correlated double sampling for reducing offset fixed pattern noise and 1/f noise of the sensing devices. We incorporated non-surface binding detection which allows real-time continuous monitoring of DNA concentrations without immobilizing them on the sensing surface. Various concentrations of 19-bp oligonucleotides solution can be discriminated using the prototype device fabricated in 1- μm double-poly double-metal standard CMOS process. The detection limit was measured as 1.1 ng/μl with a dynamic range of 40 dB and the transient response time was measured less than 20 seconds.

  2. Biomechanical Comparison of Single- Versus Double-Row Capsulolabral Repair for Shoulder Instability: A Review.

    PubMed

    Yousif, Matthew John; Bicos, James

    2017-12-01

    The glenohumeral joint is the most commonly dislocated joint in the body. Failure rates of capsulolabral repair have been reported to be approximately 8%. Recent focus has been on restoration of the capsulolabral complex by a double-row capsulolabral repair technique in an effort to decrease redislocation rates after arthroscopic capsulolabral repair. To present a review of the biomechanical literature comparing single- versus double-row capsulolabral repairs and discuss the previous case series of double-row fixation. Narrative review. A simple review of the literature was performed by PubMed search. Only biomechanical studies comparing single- versus double-row capsulolabral repair were included for review. Only those case series and descriptive techniques with clinical results for double-row repair were included in the discussion. Biomechanical comparisons evaluating the native footprint of the labrum demonstrated significantly superior restoration of the footprint through double-row capsulolabral repair compared with single-row repair. Biomechanical comparisons of contact pressure at the repair interface, fracture displacement in bony Bankart lesion, load to failure, and decreased external rotation (suggestive of increased load to failure) were also significantly in favor of double- versus single-row repair. Recent descriptive techniques and case series of double-row fixation have demonstrated good clinical outcomes; however, no comparative clinical studies between single- and double-row repair have assessed functional outcomes. The superiority of double-row capsulolabral repair versus single-row repair remains uncertain because comparative studies assessing clinical outcomes have yet to be performed.

  3. Chromatin Collapse during Caspase-dependent Apoptotic Cell Death Requires DNA Fragmentation Factor, 40-kDa Subunit-/Caspase-activated Deoxyribonuclease-mediated 3′-OH Single-strand DNA Breaks*

    PubMed Central

    Iglesias-Guimarais, Victoria; Gil-Guiñon, Estel; Sánchez-Osuna, María; Casanelles, Elisenda; García-Belinchón, Mercè; Comella, Joan X.; Yuste, Victor J.

    2013-01-01

    Apoptotic nuclear morphology and oligonucleosomal double-strand DNA fragments (also known as DNA ladder) are considered the hallmarks of apoptotic cell death. From a classic point of view, these two processes occur concomitantly. Once activated, DNA fragmentation factor, 40-kDa subunit (DFF40)/caspase-activated DNase (CAD) endonuclease hydrolyzes the DNA into oligonucleosomal-size pieces, facilitating the chromatin package. However, the dogma that the apoptotic nuclear morphology depends on DNA fragmentation has been questioned. Here, we use different cellular models, including MEF CAD−/− cells, to unravel the mechanism by which DFF40/CAD influences chromatin condensation and nuclear collapse during apoptosis. Upon apoptotic insult, SK-N-AS cells display caspase-dependent apoptotic nuclear alterations in the absence of internucleosomal DNA degradation. The overexpression of a wild-type form of DFF40/CAD endonuclease, but not of different catalytic-null mutants, restores the cellular ability to degrade the chromatin into oligonucleosomal-length fragments. We show that apoptotic nuclear collapse requires a 3′-OH endonucleolytic activity even though the internucleosomal DNA degradation is impaired. Moreover, alkaline unwinding electrophoresis and In Situ End-Labeling (ISEL)/In Situ Nick Translation (ISNT) assays reveal that the apoptotic DNA damage observed in the DNA ladder-deficient SK-N-AS cells is characterized by the presence of single-strand nicks/breaks. Apoptotic single-strand breaks can be impaired by DFF40/CAD knockdown, abrogating nuclear collapse and disassembly. In conclusion, the highest order of chromatin compaction observed in the later steps of caspase-dependent apoptosis relies on DFF40/CAD-mediated DNA damage by generating 3′-OH ends in single-strand rather than double-strand DNA nicks/breaks. PMID:23430749

  4. A graphene-based platform for single nucleotide polymorphism (SNP) genotyping.

    PubMed

    Liu, Meng; Zhao, Huimin; Chen, Shuo; Yu, Hongtao; Zhang, Yaobin; Quan, Xie

    2011-06-15

    A facile, rapid, stable and sensitive approach for fluorescent detection of single nucleotide polymorphism (SNP) is designed based on DNA ligase reaction and π-stacking between the graphene and the nucleotide bases. In the presence of perfectly matched DNA, DNA ligase can catalyze the linkage of fluorescein amidite-labeled single-stranded DNA (ssDNA) and a phosphorylated ssDNA, and thus the formation of a stable duplex in high yield. However, the catalytic reaction cannot effectively carry out with one-base mismatched DNA target. In this case, we add graphene to the system in order to produce different quenching signals due to its different adsorption affinity for ssDNA and double-stranded DNA. Taking advantage of the unique surface property of graphene and the high discriminability of DNA ligase, the proposed protocol exhibits good performance in SNP genotyping. The results indicate that it is possible to accurately determine SNP with frequency as low as 2.6% within 40 min. Furthermore, the presented flexible strategy facilitates the development of other biosensing applications in the future. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Intersubunit distances in full-length, dimeric, bacterial phytochrome Agp1, as measured by pulsed electron-electron double resonance (PELDOR) between different spin label positions, remain unchanged upon photoconversion.

    PubMed

    Kacprzak, Sylwia; Njimona, Ibrahim; Renz, Anja; Feng, Juan; Reijerse, Edward; Lubitz, Wolfgang; Krauss, Norbert; Scheerer, Patrick; Nagano, Soshichiro; Lamparter, Tilman; Weber, Stefan

    2017-05-05

    Bacterial phytochromes are dimeric light-regulated histidine kinases that convert red light into signaling events. Light absorption by the N-terminal photosensory core module (PCM) causes the proteins to switch between two spectrally distinct forms, Pr and Pfr, thus resulting in a conformational change that modulates the C-terminal histidine kinase region. To provide further insights into structural details of photoactivation, we investigated the full-length Agp1 bacteriophytochrome from the soil bacterium Agrobacterium fabrum using a combined spectroscopic and modeling approach. We generated seven mutants suitable for spin labeling to enable application of pulsed EPR techniques. The distances between attached spin labels were measured using pulsed electron-electron double resonance spectroscopy to probe the arrangement of the subunits within the dimer. We found very good agreement of experimental and calculated distances for the histidine-kinase region when both subunits are in a parallel orientation. However, experimental distance distributions surprisingly showed only limited agreement with either parallel- or antiparallel-arranged dimer structures when spin labels were placed into the PCM region. This observation indicates that the arrangements of the PCM subunits in the full-length protein dimer in solution differ significantly from that in the PCM crystals. The pulsed electron-electron double resonance data presented here revealed either no or only minor changes of distance distributions upon Pr-to-Pfr photoconversion. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Intracerebral estrogen provision increases cytogenesis and neurogenesis in the injured zebra finch brain

    PubMed Central

    Walters, Bradley J.; Alexiades, Nikita G.; Saldanha, Colin J.

    2010-01-01

    To determine whether or not local, injury-induced aromatization and/orestrogen provision can affect cyto-or neuro-genesis following mechanical brain damage, two groups of adult male zebra finches sustained bilateral penetrating brain injuries. The first received contralateral injections of vehicle or the aromatase inhibitor fadrozole. The second group received contalateral injections of fadrozole, or fadrozole with 17β-estradiol. Subsequent to injury, birds were injected with the thymidine analog 5-Bromo-2′-deoxyuridine (BrdU). Two weeks following injury, the birds were perfused, and coronal sections were labeled using antibodies against BrdU and the neuronal proteins HuC/HuD. In a double blind fashion, BrdU positive cells and BrdU/Hu double-labeled cells in the subventricular zone (SVZ) and at the injury site (INJ) were imaged and sampled. The average numbers of cells per image were compared across brain regions and treatments using repeated measures ANOVAs and, where applicable, post-hoc, pairwise comparisons. Fadrozole administration had no detectable effect on cytogenesis or neurogenesis, however, fadrozole coupled with estradiol significantly increased both measures. The dorsal SVZ had the greatest proportion of new cells that differentiated into neurons, though the highest numbers of BrdU labeled and BrdU, Hu double-labeled cells were detected at the injury site. In the adult zebra finch brain, local estradiol provision can increase cytogenesis and neurogenesis, however, whether or not endogenous glial aromatization is sufficient to similarly affect these processes remains to be seen. PMID:20878945

  7. Single cell systems biology by super-resolution imaging and combinatorial labeling

    PubMed Central

    Lubeck, Eric; Cai, Long

    2012-01-01

    Fluorescence microscopy is a powerful quantitative tool for exploring regulatory networks in single cells. However, the number of molecular species that can be measured simultaneously is limited by the spectral separability of fluorophores. Here we demonstrate a simple but general strategy to drastically increase the capacity for multiplex detection of molecules in single cells by using optical super-resolution microscopy (SRM) and combinatorial labeling. As a proof of principle, we labeled mRNAs with unique combinations of fluorophores using Fluorescence in situ Hybridization (FISH), and resolved the sequences and combinations of fluorophores with SRM. We measured the mRNA levels of 32 genes simultaneously in single S. cerevisiae cells. These experiments demonstrate that combinatorial labeling and super-resolution imaging of single cells provides a natural approach to bring systems biology into single cells. PMID:22660740

  8. Transfer in motion discrimination learning was no greater in double training than in single training.

    PubMed

    Huang, Jinfeng; Liang, Ju; Zhou, Yifeng; Liu, Zili

    2017-06-01

    We investigated the controversy regarding double training in motion discrimination learning. We collected data from 43 participants in a motion direction discrimination learning task with either double training (i.e., training plus exposure) or single training (i.e., no exposure). By pooling these data with those in the literature, we had data in double training from 28 participants and in single training from 36 participants. We found that, in double training, the transfer along the exposed direction was less than that along the trained direction, indicating incomplete transfer. Importantly, the transfer in double training was not reliably greater than that in single training.

  9. Single Versus Double Lung Retransplantation Does Not Affect Survival Based on Previous Transplant Type.

    PubMed

    Schumer, Erin M; Rice, Jonathan D; Kistler, Amanda M; Trivedi, Jaimin R; Black, Matthew C; Bousamra, Michael; van Berkel, Victor

    2017-01-01

    Survival following retransplantation with a single lung is worse than after double lung transplant. We sought to characterize survival of patients who underwent lung retransplantation based on the type of their initial transplant, single or double. The United Network for Organ Sharing database was queried for adult patients who underwent lung retransplantation from 2005 onward. Patients were excluded if they underwent more than one retransplantation. The patient population was divided into 4 groups based on first followed by second transplant type, respectively: single then single, double then single, double then double, and single then double. Descriptive analysis and Kaplan-Meier survival analysis were performed. A p value less than 0.05 was considered significant. A total of 410 patients underwent retransplantation in the study time period. Overall mean survival for all patients who underwent retransplantation was 1,213 days. Kaplan-Meier survival analysis demonstrated no difference in graft survival between the 4 study groups (p = 0.146). There was no significant difference in graft survival between recipients of retransplant with single or double lungs when stratified by previous transplant type. These results suggest that when retransplantation is performed, single lung retransplantation should be considered, regardless of previous transplant type, in an effort to maximize organ resources. Copyright © 2017 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved.

  10. Osmium (VI) complexes of the 3', 5'-dinucleoside monophosphates, ApU and UpA.

    PubMed

    Daniel, F B; Behrman, E J

    1976-02-10

    The dinucleoside monophosphates, ApU and UpA, react with potassium osmate (VI) and 2,2'-bipyridyl to form the corresponding oxo-osmium (VI) bipyridyl sugar ester in which the osmate group is bonded to the terminal 2',3'-glycol. Osmium (VIII) tetroxide and 2,2'-bipyridyl react with the dinucleosides to form the corresponding oxo-osmium (VI) bipyridyl heterocyclic esters which result from addition of the tetroxide to the 5,6-double bond of the uracil residue. Although capable of transesterification reactions, these heterocyclic esters are exceptionally stable toward exchange reactions in solution. No apparent exchange was observed after 1 month. This reaction thus seems promising for single-site osmium labeling in polynucleotides.

  11. Purification of human alpha uterine protein.

    PubMed

    Sutcliffe, R G; Bolton, A E; Sharp, F; Nicholson, L V; MacKinnon, R

    1980-03-01

    Human alpha uterine protein (AUP) has been prepared from extracts of decudua by antibody affinity chromatography, DEAE Sepharose chromatography and by filtration through Sephadex G-150. This procedure yielded a protein fraction containing AUP, which was labelled with 125I by chloramine T. When analysed by SDS gel electrophoresis this radioiodinated protein fraction was found to contain predominantly a single species of protein which was precipitated by antibodies against AUP in antibody-antigen crossed electrophoresis. Rabbit anti-AUP precipitated 55-65% of the tracer in a double-antibody system. Sephadex G150 gel filtration of AUP obtained before and after affinity chromatography provided a molecular weight estimate of 50000. Since SDS gel electrophoresis revealed a polypeptide molecular weight of 23000-25000, it is suggested that AUP is a dimer.

  12. Efficacy and safety of a single 2 mg dose or 4 mg double dose of alteplase for 50 occluded chest ports using a unique instillation technique.

    PubMed

    Sharma, Rajinder P; Ree, Chung Ja; Ree, Alexander

    2008-01-01

    To evaluate the effectiveness and safety of a single 2 mg dose or a 4 mg double dose of alteplase for restoring function in occluded chest ports. A prospective, open-label, nonblinded study was performed on 40 enrolled patients with a total of 50 chest ports at the Henry Ford Hospital Interventional Radiology Department (Detroid, Michigan, USA). Alteplase (Cathflo Activase; Genentech, USA), a recombinant tissue plasminogen activator produced by recombinant DNA technology, was used to restore the function of 50 occluded chest ports. Occlusion was defined as the inability to withdraw blood freely from the port, or the inability to flush the port easily. A 2 mg (2 mL) dose of alteplase was injected into the port through a Huber needle, using a gentle push and pull technique, and was left to dwell for 30 min. If the port remained occluded after the initial 2 mg alteplase treatment, an additional 2 mg alteplase treatment was administered with the same dwell time of 30 min. If a port had remained occluded despite the above regimen, this outcome would have been considered a failure and the chest port would have required surgical intervention. However, all ports were successfully treated, and no surgical intervention was required. The safety end points included minor or major hemorrhages, such as intracranial hemorrhages, or sepsis. Safety end points were determined by a 24 h follow-up telephone call. Of the 50 chest ports (30 single ports and 10 double ports) treated with alteplase, 36 required 2 mg (72%) and 14 required 4 mg (28%). The efficacy end point was 100% for all chest ports treated, without any adverse events. High efficacy and safety rates of restoring function in occluded chest ports were obtained with 2 mg or 4 mg doses of alteplase. Part of this high efficacy rate may be due to the gentle push and pull technique used in the present study.

  13. Orodispersible sublingual piribedil to abort OFF episodes: a single dose placebo-controlled, randomized, double-blind, cross-over study.

    PubMed

    Rascol, Olivier; Azulay, Jean-Philippe; Blin, Olivier; Bonnet, Anne-Marie; Brefel-Courbon, Christine; Césaro, Pierre; Damier, Philippe; Debilly, Bérengère; Durif, Frank; Galitzky, Monique; Grouin, Jean-Marie; Pennaforte, Sylvie; Villafane, Gabriel; Yaici, Sadek; Agid, Yves

    2010-02-15

    S90049, a novel sublingual formulation of the non-ergoline D(2)-D(3) agonist piribedil, has a pharmacokinetic profile promising to provide rapid relief on motor signs in Parkinson's disease (PD). We assessed the efficacy and safety of S90049 in aborting OFF episodes responding to subcutaneous apomorphine in PD patients with motor fluctuations. This was a single-dose double-blind double-placebo 3 x 3 cross-over study. Optimal tested doses were determined during a previous open-label titration phase (S90049 median dose: 60 mg, apomorphine: 5 mg). Primary endpoint was the maximal change versus baseline in UPDRS motor score (Delta UPDRS III) assessed after drug administration following an overnight withdrawal of antiparkinsonian medications. Thirty patients (age: 60 +/- 8 years, PD duration: 12 +/- 6 years, UPDRS III OFF: 37 +/- 15) participated. S90049 was superior to placebo on Delta UPDRS III (-13 +/- 12 versus -7 +/- 9 respectively; estimated difference -5.2, 95% Confidence Interval (CI)[-10.4;0.05], P = 0.05). This was also true for secondary outcomes: number of patients switching from OFF to ON (17 on S90049 vs. 8 on placebo, P = 0.03), time to turn ON (P = 0.013) and duration of the ON phase (P = 0.03). In the 17 patients who switched ON on S90049, Delta UPDRS III was similar on S90049 (-21.2 +/- 10.1) and apomorphine (-23.6 +/- 14.1) (estimated difference: 4.0 95% CI [-2.9;10.9]). S90049 was well tolerated: no serious or unexpected adverse event occurred. A single dose of up to 60 mg of S90049 given sublingually was superior to placebo in improving UPDRS III and aborting a practical OFF in patients with advanced PD. Testing greater doses might improve response rate. (c) 2009 Movement Disorder Society.

  14. Methylphenidate, cognition, and epilepsy: A 1-month open-label trial.

    PubMed

    Adams, Jesse; Alipio-Jocson, Valerie; Inoyama, Katherine; Bartlett, Victoria; Sandhu, Saira; Oso, Jemima; Barry, John J; Loring, David W; Meador, Kimford J

    2017-12-01

    Cognitive difficulties are common in epilepsy. Beyond reducing seizures and adjusting antiepileptic medications, no well-validated treatment exists in adults. Methylphenidate is used effectively in children with epilepsy and attention-deficit/hyperactivity disorder, but its effects in adults have not been systematically evaluated. We hypothesized that methylphenidate can safely improve cognition in adults with epilepsy. We detail here the open-label follow-up to a double-blind, placebo-controlled, single-dose study. Thirty epilepsy patients entered a 1-month open-label methylphenidate trial after a double-blind phase. Doses were titrated according to clinical practice and patient tolerance, ranging 20-40 mg/day. Primary measures included: Conners' Continuous Performance Test (CPT), Symbol-Digit Modalities Test (SDMT), and Medical College of Georgia Memory Test (MCG). Secondary measures were: Beck Depression Inventory, 2nd Edition (BDI-II), Beck Anxiety Inventory, Apathy Evaluation Scale (AES), Stimulant Side-Effect Checklist, Adverse Events Profile, Quality of Life in Epilepsy-89 (QOLIE-89), and seizure frequency. Fourteen healthy, nonmedicated controls were tested concurrently. Twenty-eight participants with epilepsy (13 men/15 women) completed the trial. Withdrawals occurred due to anxiety (n = 1) and fatigue (n = 1). Mean age was 36.4 years (range = 20-60). Epilepsy types were: focal (n = 21), generalized (n = 6), or unclassified (n = 1). Mean epilepsy duration was 12.3 years. Mean baseline seizure frequency was 2.8/month. There were significant improvements on methylphenidate for SDMT, MCG, CPT (the ability to discriminate between targets and nontargets [d'] hits, hit reaction time standard deviation, omissions, and commissions), and QOLIE subscales (energy/fatigue, attention/concentration, memory, and language; paired t tests; p ≤ 0.002). BDI-II and additional subscales also improved, at a lower level of statistical significance. Effect sizes were moderate to large. Comparisons with untreated controls (n = 14) revealed greater improvement for epilepsy patients on omissions and commissions, with improvement trends on d' and hits. Seizure frequency did not increase with methylphenidate treatment (2.8/month vs. 2.4/month). Methylphenidate may be an effective and safe option for improving cognition and quality of life in epilepsy. Larger and longer double-blind, placebo-controlled clinical trials are needed. Wiley Periodicals, Inc. © 2017 International League Against Epilepsy.

  15. Retrograde double-labeling demonstrates convergent afferent innervation of the prostate and bladder.

    PubMed

    Lee, Sanghee; Yang, Guang; Xiang, William; Bushman, Wade

    2016-06-01

    Prostatic inflammation is a common histologic finding in men with lower urinary tract symptoms (LUTS). It has been postulated that prostatic inflammation could sensitize afferent neurons innervating the bladder and thereby produce changes in voiding behavior. In support of this, we demonstrate an anatomic basis for pelvic cross-talk involving the prostate and bladder. Retrograde labeling was performed by an application of a neuro-tracer Fast Blue (FB) to one side of either the anterior prostate (AP), dorsal lateral prostate (DLP)/ventral prostate (VP), bladder, or seminal vesicle (SV). Examination of dorsal root ganglion (DRG) neuron labeling revealed shared afferent innervation of the prostate and bladder at spinal segments of T13, L1, L2, L6, and S1. Dual labeling was performed by an application of FB and 1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyaine perchlorate (DiI) to the AP and bladder, respectively. We observed double-labeled DRG neurons at T13, L1, L2, L6, and S1--a finding that proves convergent innervation of prostate and bladder. Our observations demonstrate the potential for neural cross-talk between the prostate and bladder and support a postulated mechanism that prostatic inflammation may induce hyper-sensitization of bladder afferents and produce irritative LUTS. © 2016 Wiley Periodicals, Inc.

  16. Comparison of outcomes after single or DOUBLE-CUFF artificial urinary sphincter insertion.

    PubMed

    O'Connor, R Corey; Gerber, Glenn S; Avila, Desiderio; Chen, Andrew A; Bales, Gregory T

    2003-10-01

    To assess the effectiveness and complications associated with single and double-cuff artificial urinary sphincter (AUS) implantation for postprostatectomy stress urinary incontinence. A retrospective study of 56 men with postprostatectomy stress urinary incontinence who underwent either single (28 patients) or double (28 patients) cuff AUS placement was performed. Patients in each cohort were matched on the basis of preoperative pad use, risk factors for complications, and age. Patient selection was blinded relative to outcome. Continence, quality of life, and complications were assessed using the Incontinence Impact Questionnaire Short Form (IIQ-7), postoperative pad use, and chart review. The mean age was 67 years for each group. Daily pad use decreased from 7.7 to 1.1 in patients treated with a single-cuff AUS and from 7.8 to 0.7 in patients with a double-cuff AUS (P = 0.25). Complete continence (0 pads daily) was reported in 3 (11%) of 28 men with single-cuff and 12 (43%) of 28 men with double-cuff sphincters (P = 0.008). The IIQ-7 scores improved from 14.8 to 3.1 after single-cuff placement and from 16.3 to 2.5 after double-cuff placement (P = 0.03). With an average follow-up of 41.3 and 21.2 months for the single and double-cuff cohorts, respectively, five complications were reported in the single-cuff recipients and four in the double-cuff patients. A significantly greater rate of complete continence and improvement in the IIQ-7 were seen in men with double-cuff AUS compared with single-cuff devices. Additional study is needed to confirm the relative advantages of double-cuff insertion.

  17. Double-strand DNA-templated formation of copper nanoparticles as fluorescent probe for label-free aptamer sensor.

    PubMed

    Zhou, Zhixue; Du, Yan; Dong, Shaojun

    2011-07-01

    Double-strand DNA (dsDNA) can act as an efficient template for the formation of copper nanoparticles (Cu NPs) at low concentration of CuSO(4), and the formed Cu NPs have excellent fluorescence, whereas a single-strand DNA (ssDNA) template does not support Cu NPs' formation. This property of dsDNA-Cu NPs makes it suitable for DNA sensing. However, exploration of dsDNA-Cu NPs applied in biological analysis is still at an early stage. In this regard, we report herein for the first time a sensitive, cost-effective, and simple aptamer sensor (aptasensor) using dsDNA-Cu NPs as fluorescent probe. The design consists of a dsDNA with reporter DNA (here, aptamer) as template for the formation of Cu NPs, and the formed dsDNA-Cu NPs show high fluorescence. Using adenosine triphosphate (ATP) as a model analyte, the introduction of ATP triggers the structure switching of reporter DNA to form aptamer-ATP complex, causing the destruction of the double helix and thus no formation of the Cu NPs, resulting in low fluorescence. The preferable linear range (0.05-500 μM), sensitivity (LOD 28 nM), and simplicity for the detection of ATP indicate that dsDNA-Cu NPs may have great prospects in the field of biological analysis. We also use this novel fluorescent probe to determine ATP in 1% human serum and human adenocarcinoma HeLa cells. The dsDNA-Cu NPs probes provide recovery of 104-108% in 1% human serum and a prominent fluorescent signal is obtained in cellular ATP assay, revealing the practicality of using dsDNA-Cu NPs for the determination of ATP in real samples. Besides, this design is simply based on nucleic acid hybridization, so it can be generally applied to other aptamers for label-free detection of a broad range of analytes. Successful detection of cocaine with detection limit of 0.1 μM demonstrates its potential to be a general method.

  18. Efficacy and Safety of a Single-Dose Mebendazole 500 mg Chewable, Rapidly-Disintegrating Tablet for Ascaris lumbricoides and Trichuris trichiura Infection Treatment in Pediatric Patients: A Double-Blind, Randomized, Placebo-Controlled, Phase 3 Study.

    PubMed

    Silber, Steven A; Diro, Ermias; Workneh, Netsanet; Mekonnen, Zeleke; Levecke, Bruno; Steinmann, Peter; Umulisa, Irenee; Alemu, Hailemaryam; Baeten, Benny; Engelen, Marc; Hu, Peter; Friedman, Andrew; Baseman, Alan; Mrus, Joseph

    2017-12-01

    This randomized, double-blind, placebo-controlled study evaluated the efficacy and safety of a new chewable, rapidly-disintegrating mebendazole (MBZ) 500 mg tablet for Ascaris lumbricoides and Trichuris trichiura infection treatment. Pediatric patients (1-15 years; N = 295; from Ethiopia and Rwanda) excreting A. lumbricoides and/or T. trichiura eggs were enrolled. The study had a screening phase (3 days), a double-blind treatment phase (DBP, 19 days), and an open-label phase (OLP, 7 days). Patients received MBZ or placebo on day 1 of DBP and open-label MBZ on day 19 ± 2 after stool sample collection. Cure rates (primary endpoint), defined as species-specific egg count of 0 at the end of DBP, were significantly higher in the MBZ group than placebo for A. lumbricoides (83.7% [72/86; 95% CI: 74.2%; 90.8%] versus 11.1% [9/81; 95% CI: 5.2%; 20.1%], P < 0.001) and for T. trichiura (33.9% [42/124; 95% CI: 25.6%; 42.9%] versus 7.6% [9/119; 95% CI: 3.5%; 13.9%], P < 0.001). Egg reduction rates (secondary endpoint) were significantly higher in the MBZ group than placebo for A. lumbricoides (97.9% [95% CI: 94.4; 99.9] versus 19.2% [95% CI: -5.9; 41.5]; P < 0.001) and T. trichiura (59.7% [95% CI: 33.9; 78.8] versus 10.5% [95% CI: -16.8; 32.9]; P = 0.003). Treatment-emergent adverse events (TEAEs) in MBZ group occurred in 6.3% (9/144) of patients during DBP and 2.5% (7/278) during OLP. No deaths, serious TEAEs, or TEAEs leading to discontinuations were reported. A 500 mg chewable MBZ tablet was more efficacious than placebo for the treatment of A. lumbricoides and T. trichiura infections in pediatric patients, and no safety concerns were identified.

  19. Single step signal group-imidazole labeling of organic phosphate groups under aqueous conditions

    DOEpatents

    Giese, R.W.; Wang, P.

    1996-04-30

    Compounds and methods for single step, covalent labeling of the phosphate group of an organic substance under aqueous conditions are described. The labeling compound includes any kind of detectable signal group covalently bound to an imidazole moiety, which can be imidazole or a substituted imidazole. A preferred labeling compound has the formula shown in the accompanying diagram. 4 figs.

  20. Outcomes of the modified Brostrom procedure using suture anchors for chronic lateral ankle instability--a prospective, randomized comparison between single and double suture anchors.

    PubMed

    Cho, Byung-Ki; Kim, Yong-Min; Kim, Dong-Soo; Choi, Eui-Sung; Shon, Hyun-Chul; Park, Kyoung-Jin

    2013-01-01

    The present prospective, randomized study was conducted to compare the clinical outcomes of the modified Brostrom procedure using single and double suture anchors for chronic lateral ankle instability. A total of 50 patients were followed up for more than 2 years after undergoing the modified Brostrom procedure. Of the 50 procedures, 25 each were performed using single and double suture anchors by 1 surgeon. The Karlsson scale had improved significantly to 89.8 points and 90.6 points in the single and double anchor groups, respectively. Using the Sefton grading system, 23 cases (92%) in the single anchor group and 22 (88%) in the double anchor group achieved satisfactory results. The talar tilt angle and anterior talar translation on stress radiographs using the Telos device had improved significantly to an average of 5.7° and 4.6 mm in the single anchor group and 4.5° and 4.3 mm in the double anchor group, respectively. The double anchor technique was superior with respect to the postoperative talar tilt. The single and double suture anchor techniques produced similar clinical and functional outcomes, with the exception of talar tilt as a reference of mechanical stability. The modified Brostrom procedure using both single and double suture anchors appears to be an effective treatment method for chronic lateral ankle instability. Copyright © 2013 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.

  1. Biomechanical Comparison of Single- Versus Double-Row Capsulolabral Repair for Shoulder Instability: A Review

    PubMed Central

    Yousif, Matthew John; Bicos, James

    2017-01-01

    Background: The glenohumeral joint is the most commonly dislocated joint in the body. Failure rates of capsulolabral repair have been reported to be approximately 8%. Recent focus has been on restoration of the capsulolabral complex by a double-row capsulolabral repair technique in an effort to decrease redislocation rates after arthroscopic capsulolabral repair. Purpose: To present a review of the biomechanical literature comparing single- versus double-row capsulolabral repairs and discuss the previous case series of double-row fixation. Study Design: Narrative review. Methods: A simple review of the literature was performed by PubMed search. Only biomechanical studies comparing single- versus double-row capsulolabral repair were included for review. Only those case series and descriptive techniques with clinical results for double-row repair were included in the discussion. Results: Biomechanical comparisons evaluating the native footprint of the labrum demonstrated significantly superior restoration of the footprint through double-row capsulolabral repair compared with single-row repair. Biomechanical comparisons of contact pressure at the repair interface, fracture displacement in bony Bankart lesion, load to failure, and decreased external rotation (suggestive of increased load to failure) were also significantly in favor of double- versus single-row repair. Recent descriptive techniques and case series of double-row fixation have demonstrated good clinical outcomes; however, no comparative clinical studies between single- and double-row repair have assessed functional outcomes. Conclusion: The superiority of double-row capsulolabral repair versus single-row repair remains uncertain because comparative studies assessing clinical outcomes have yet to be performed. PMID:29230427

  2. Expression of aquaporin water channels in rat taste buds.

    PubMed

    Watson, Kristina J; Kim, Insook; Baquero, Arian F; Burks, Catherine A; Liu, Lidong; Gilbertson, Timothy A

    2007-06-01

    In order to gain insight into the molecular mechanisms that allow taste cells to respond to changes in their osmotic environment, we have used primarily immunocytochemical and molecular approaches to look for evidence of the presence of aquaporin-like water channels in taste cells. Labeling of isolated taste buds from the fungiform, foliate, and vallate papillae in rat tongue with antibodies against several of the aquaporins (AQPs) revealed the presence of AQP1, AQP2, and AQP5 in taste cells from these areas. AQP3 antibodies failed to label isolated taste buds from any of the papillae. There was an apparent difference in the regional localization of AQP labeling within the taste bud. Antibodies against AQP1 and AQP2 labeled predominantly the basolateral membrane, whereas the AQP5 label was clearly evident on both the apical and basolateral membranes of cells within the taste bud. Double labeling revealed that AQP1 and AQP2 labeled many, but not all, of the same taste cells. Similar double-labeling experiments with anti-AQP2 and anti-AQP5 clearly showed that AQP5 was expressed on or near the apical membranes whereas AQP2 was absent from this area. The presence of these 3 types of AQPs in taste buds but not in non-taste bud-containing epithelia was confirmed using reverse transcription-polymerase chain reaction. Experiments using patch clamp recording showed that the AQP inhibitor, tetraethylammonium, significantly reduced hypoosmotic-induced currents in rat taste cells. We hypothesize that the AQPs may play roles both in the water movement underlying compensatory mechanisms for changes in extracellular osmolarity and, in the case of AQP5 in particular, in the gustatory response to water.

  3. Oxytocin efficacy is modulated by dosage and oxytocin receptor genotype in young adults with high-functioning autism: a 24-week randomized clinical trial

    PubMed Central

    Kosaka, H; Okamoto, Y; Munesue, T; Yamasue, H; Inohara, K; Fujioka, T; Anme, T; Orisaka, M; Ishitobi, M; Jung, M; Fujisawa, T X; Tanaka, S; Arai, S; Asano, M; Saito, D N; Sadato, N; Tomoda, A; Omori, M; Sato, M; Okazawa, H; Higashida, H; Wada, Y

    2016-01-01

    Recent studies have suggested that long-term oxytocin administration can alleviate the symptoms of autism spectrum disorder (ASD); however, factors influencing its efficacy are still unclear. We conducted a single-center phase 2, pilot, randomized, double-blind, placebo-controlled, parallel-group, clinical trial in young adults with high-functioning ASD, to determine whether oxytocin dosage and genetic background of the oxytocin receptor affects oxytocin efficacy. This trial consisted of double-blind (12 weeks), open-label (12 weeks) and follow-up phases (8 weeks). To examine dose dependency, 60 participants were randomly assigned to high-dose (32 IU per day) or low-dose intranasal oxytocin (16 IU per day), or placebo groups during the double-blind phase. Next, we measured single-nucleotide polymorphisms (SNPs) in the oxytocin receptor gene (OXTR). In the intention-to-treat population, no outcomes were improved after oxytocin administration. However, in male participants, Clinical Global Impression-Improvement (CGI-I) scores in the high-dose group, but not the low-dose group, were significantly higher than in the placebo group. Furthermore, we examined whether oxytocin efficacy, reflected in the CGI-I scores, is influenced by estimated daily dosage and OXTR polymorphisms in male participants. We found that >21 IU per day oxytocin was more effective than ⩽21 IU per day, and that a SNP in OXTR (rs6791619) predicted CGI-I scores for ⩽21 IU per day oxytocin treatment. No severe adverse events occurred. These results suggest that efficacy of long-term oxytocin administration in young men with high-functioning ASD depends on the oxytocin dosage and genetic background of the oxytocin receptor, which contributes to the effectiveness of oxytocin treatment of ASD. PMID:27552585

  4. Oxytocin efficacy is modulated by dosage and oxytocin receptor genotype in young adults with high-functioning autism: a 24-week randomized clinical trial.

    PubMed

    Kosaka, H; Okamoto, Y; Munesue, T; Yamasue, H; Inohara, K; Fujioka, T; Anme, T; Orisaka, M; Ishitobi, M; Jung, M; Fujisawa, T X; Tanaka, S; Arai, S; Asano, M; Saito, D N; Sadato, N; Tomoda, A; Omori, M; Sato, M; Okazawa, H; Higashida, H; Wada, Y

    2016-08-23

    Recent studies have suggested that long-term oxytocin administration can alleviate the symptoms of autism spectrum disorder (ASD); however, factors influencing its efficacy are still unclear. We conducted a single-center phase 2, pilot, randomized, double-blind, placebo-controlled, parallel-group, clinical trial in young adults with high-functioning ASD, to determine whether oxytocin dosage and genetic background of the oxytocin receptor affects oxytocin efficacy. This trial consisted of double-blind (12 weeks), open-label (12 weeks) and follow-up phases (8 weeks). To examine dose dependency, 60 participants were randomly assigned to high-dose (32 IU per day) or low-dose intranasal oxytocin (16 IU per day), or placebo groups during the double-blind phase. Next, we measured single-nucleotide polymorphisms (SNPs) in the oxytocin receptor gene (OXTR). In the intention-to-treat population, no outcomes were improved after oxytocin administration. However, in male participants, Clinical Global Impression-Improvement (CGI-I) scores in the high-dose group, but not the low-dose group, were significantly higher than in the placebo group. Furthermore, we examined whether oxytocin efficacy, reflected in the CGI-I scores, is influenced by estimated daily dosage and OXTR polymorphisms in male participants. We found that >21 IU per day oxytocin was more effective than ⩽21 IU per day, and that a SNP in OXTR (rs6791619) predicted CGI-I scores for ⩽21 IU per day oxytocin treatment. No severe adverse events occurred. These results suggest that efficacy of long-term oxytocin administration in young men with high-functioning ASD depends on the oxytocin dosage and genetic background of the oxytocin receptor, which contributes to the effectiveness of oxytocin treatment of ASD.

  5. Cyclic loading of rotator cuff reconstructions: single-row repair with modified suture configurations versus double-row repair.

    PubMed

    Lorbach, Olaf; Bachelier, Felix; Vees, Jochen; Kohn, Dieter; Pape, Dietrich

    2008-08-01

    Double-row repair is suggested to have superior biomechanical properties in rotator cuff reconstruction compared with single-row repair. However, double-row rotator cuff repair is frequently compared with simple suture repair and not with modified suture configurations. Single-row rotator cuff repairs with modified suture configurations have similar failure loads and gap formations as double-row reconstructions. Controlled laboratory study. We created 1 x 2-cm defects in 48 porcine infraspinatus tendons. Reconstructions were then performed with 4 single-row repairs and 2 double-row repairs. The single-row repairs included transosseous simple sutures; double-loaded corkscrew anchors in either a double mattress or modified Mason-Allen suture repair; and the Magnum Knotless Fixation Implant with an inclined mattress. Double-row repairs were either with Bio-Corkscrew FT using modified Mason-Allen stitches or a combination of Bio-Corkscrew FT and PushLock anchors using the SutureBridge Technique. During cyclic load (10 N to 60-200 N), gap formation was measured, and finally, ultimate load to failure and type of failure were recorded. Double-row double-corkscrew anchor fixation had the highest ultimate tensile strength (398 +/- 98 N) compared to simple sutures (105 +/- 21 N; P < .0001), single-row corkscrews using a modified Mason-Allen stitch (256 +/- 73 N; P = .003) or double mattress repair (290 +/- 56 N; P = .043), the Magnum Implant (163 +/- 13 N; P < .0001), and double-row repair with PushLock and Bio-Corkscrew FT anchors (163 +/- 59 N; P < .0001). Single-row double mattress repair was superior to transosseous sutures (P < .0001), the Magnum Implant (P = .009), and double-row repair with PushLock and Bio-Corkscrew FT anchors (P = .009). Lowest gap formation was found for double-row double-corkscrew repair (3.1 +/- 0.1 mm) compared to simple sutures (8.7 +/- 0.2 mm; P < .0001), the Magnum Implant (6.2 +/- 2.2 mm; P = .002), double-row repair with PushLock and Bio-Corkscrew FT anchors (5.9 +/- 0.9 mm; P = .008), and corkscrews with modified Mason-Allen sutures (6.4 +/- 1.3 mm; P = .001). Double-row double-corkscrew anchor rotator cuff repair offered the highest failure load and smallest gap formation and provided the most secure fixation of all tested configurations. Double-loaded suture anchors using modified suture configurations achieved superior results in failure load and gap formation compared to simple suture repair and showed similar loads and gap formation with double-row repair using PushLock and Bio-Corkscrew FT anchors. Single-row repair with modified suture configurations may lead to results comparable to several double-row fixations. If double-row repair is used, modified stitches might further minimize gap formation and increase failure load.

  6. Does double-row rotator cuff repair improve functional outcome of patients compared with single-row technique? A systematic review.

    PubMed

    DeHaan, Alexander M; Axelrad, Thomas W; Kaye, Elizabeth; Silvestri, Lorenzo; Puskas, Brian; Foster, Timothy E

    2012-05-01

    The advantage of single-row versus double-row arthroscopic rotator cuff repair techniques has been a controversial issue in sports medicine and shoulder surgery. There is biomechanical evidence that double-row techniques are superior to single-row techniques; however, there is no clinical evidence that the double-row technique provides an improved functional outcome. When compared with single-row rotator cuff repair, double-row fixation, although biomechanically superior, has no clinical benefit with respect to retear rate or improved functional outcome. Systematic review. The authors reviewed prospective studies of level I or II clinical evidence that compared the efficacy of single- and double-row rotator cuff repairs. Functional outcome scores included the American Shoulder and Elbow Surgeons (ASES) shoulder scale, the Constant shoulder score, and the University of California, Los Angeles (UCLA) shoulder rating scale. Radiographic failures and complications were also analyzed. A test of heterogeneity for patient demographics was also performed to determine if there were differences in the patient profiles across the included studies. Seven studies fulfilled our inclusion criteria. The test of heterogeneity across these studies showed no differences. The functional ASES, Constant, and UCLA outcome scores revealed no difference between single- and double-row rotator cuff repairs. The total retear rate, which included both complete and partial retears, was 43.1% for the single-row repair and 27.2% for the double-row repair (P = .057), representing a trend toward higher failures in the single-row group. Through a comprehensive literature search and meta-analysis of current arthroscopic rotator cuff repairs, we found that the single-row repairs did not differ from the double-row repairs in functional outcome scores. The double-row repairs revealed a trend toward a lower radiographic proven retear rate, although the data did not reach statistical significance. There may be a concerning trend toward higher retear rates in patients undergoing a single-row repair, but further studies are required.

  7. Effect of quetiapine vs. placebo on response to two virtual public speaking exposures in individuals with social phobia.

    PubMed

    Donahue, Christopher B; Kushner, Matt G; Thuras, Paul D; Murphy, Tom G; Van Demark, Joani B; Adson, David E

    2009-04-01

    Clinical practice and open-label studies suggest that quetiapine (an atypical anti-psychotic) might improve symptoms for individuals with social anxiety disorder (SAD). The purpose of this study was to provide a rigorous test of the acute impact of a single dose of quetiapine (25mg) on SAD symptoms. Individuals with SAD (N=20) were exposed to a 4-min virtual reality (VR) public speaking challenge after having received quetiapine or placebo (double-blind) 1h earlier. A parallel VR challenge occurred 1 week later using a counter-balanced cross-over (within subject) design for the medication-placebo order between the two sessions. There was no significant drug effect for quetiapine on the primary outcome measures. However, quetiapine was associated with significantly elevated heart rate and sleepiness compared with placebo. Study findings suggest that a single dose of 25mg quetiapine is not effective in alleviating SAD symptoms in individuals with fears of public speaking.

  8. High-efficiency dual labeling of influenza virus for single-virus imaging.

    PubMed

    Liu, Shu-Lin; Tian, Zhi-Quan; Zhang, Zhi-Ling; Wu, Qiu-Mei; Zhao, Hai-Su; Ren, Bin; Pang, Dai-Wen

    2012-11-01

    Many viruses invade host cells by entering the cells and releasing their genome for replication, which are remarkable incidents for viral infection. Therefore, the viral internal and external components should be simultaneously labeled and dynamically tracked at single-virus level for further understanding viral infection mechanisms. However, most of the previously reported methods have very low labeling efficiency and require considerable time and effort, which is laborious and inconvenient for researchers. In this work, we report a general strategy to high-efficiently label viral envelope and genome for single-virus imaging with quantum dots (QDs) and Syto 82, respectively. It was found that nearly all viral envelopes could be labeled with QDs with superior stability, which makes it possible to realize global and long-term tracking of single virus in individual cells. Effectively labeling their genome with Syto 82, about 90% of QDs-labeled viruses could be used to monitor the viral genome signal, which may provide valuable information for deeply studying viral genome transport. This is very important and meaningful to investigate the viral infection mechanism. Our labeling strategy has advantage in commonality, convenience and efficiency, which is expected to be widely used in biological research. Copyright © 2012 Elsevier Ltd. All rights reserved.

  9. Ulex Europaeus Agglutinin-1 Is a Reliable Taste Bud Marker for In Situ Hybridization Analyses.

    PubMed

    Yoshimoto, Joto; Okada, Shinji; Kishi, Mikiya; Misaka, Takumi

    2016-03-01

    Taste signals are received by taste buds. To better understand the taste reception system, expression patterns of taste-related molecules are determined by in situ hybridization (ISH) analyses at the histological level. Nevertheless, even though ISH is essential for determining mRNA expression, few taste bud markers can be applied together with ISH. Ulex europaeus agglutinin-1 (UEA-1) appears to be a reliable murine taste bud marker based on immunohistochemistry (IHC) analyses. However, there is no evidence as to whether UEA-1 can be used for ISH. Thus, the present study evaluated UEA-1 using various histochemical methods, especially ISH. When lectin staining was performed after ISH procedures, UEA-1 clearly labeled taste cellular membranes and distinctly indicated boundaries between taste buds and the surrounding epithelial cells. Additionally, UEA-1 was determined as a taste bud marker not only when used in single-colored ISH but also when employed with double-labeled ISH or during simultaneous detection using IHC and ISH methods. These results suggest that UEA-1 is a useful marker when conducting analyses based on ISH methods. To clarify UEA-1 staining details, multi-fluorescent IHC (together with UEA-1 staining) was examined, resulting in more than 99% of cells being labeled by UEA-1 and overlapping with KCNQ1-expressing cells. © 2016 The Histochemical Society.

  10. Folding dynamics of a family of beta-sheet proteins

    NASA Astrophysics Data System (ADS)

    Rousseau, Denis

    2008-03-01

    Fatty acid binding proteins (FABP) consist of ten anti-parallel beta strands and two small alpha helices. The beta strands are arranged into two nearly orthogonal five-strand beta sheets that surround the interior cavity, which binds unsaturated long-chain fatty acids. In the brain isoform (BFABP), these are very important for the development of the central nervous system and neuron differentiation. Furthermore, BFABP is implicated in the pathogenesis of a variety of human diseases including cancer and neuronal degenerative disorders. In this work, site-directed spin labeling combined with EPR techniques have been used to study the folding mechanism of BFABP. In the first series of studies, we labeled the two Cys residues at position 5 and 80 in the wild type protein with an EPR spin marker; in addition, two singly labeled mutants at positions 5 and 80 in the C80A and C5A mutants, respectively, were also produced and used as controls. The changes in the distances between the two residues were examined by a pulsed EPR method, DEER (Double Electron Electron Resonance), as a function of guanidinium hydrochloride concentration. The results were compared with those from CW EPR, circular dichroism and fluorescence measurements, which provide the information regarding sidechain mobility, secondary structure and tertiary structure, respectively. The results will be discussed in the context of the folding mechanism of the family of fatty acid binding proteins.

  11. Ulex Europaeus Agglutinin-1 Is a Reliable Taste Bud Marker for In Situ Hybridization Analyses

    PubMed Central

    Yoshimoto, Joto; Okada, Shinji; Kishi, Mikiya; Misaka, Takumi

    2015-01-01

    Taste signals are received by taste buds. To better understand the taste reception system, expression patterns of taste-related molecules are determined by in situ hybridization (ISH) analyses at the histological level. Nevertheless, even though ISH is essential for determining mRNA expression, few taste bud markers can be applied together with ISH. Ulex europaeus agglutinin-1 (UEA-1) appears to be a reliable murine taste bud marker based on immunohistochemistry (IHC) analyses. However, there is no evidence as to whether UEA-1 can be used for ISH. Thus, the present study evaluated UEA-1 using various histochemical methods, especially ISH. When lectin staining was performed after ISH procedures, UEA-1 clearly labeled taste cellular membranes and distinctly indicated boundaries between taste buds and the surrounding epithelial cells. Additionally, UEA-1 was determined as a taste bud marker not only when used in single-colored ISH but also when employed with double-labeled ISH or during simultaneous detection using IHC and ISH methods. These results suggest that UEA-1 is a useful marker when conducting analyses based on ISH methods. To clarify UEA-1 staining details, multi-fluorescent IHC (together with UEA-1 staining) was examined, resulting in more than 99% of cells being labeled by UEA-1 and overlapping with KCNQ1-expressing cells. PMID:26718243

  12. A holistic food labelling strategy for preventing obesity and dental caries.

    PubMed

    Cinar, A B; Murtomaa, H

    2009-05-01

    Obesity and dental caries in childhood are among the major public health concerns described as a global pandemic because of their global distribution and severe consequences. A consensus has developed as to a recently emerging and alarming common risk factor that leads to the double burden of dental caries and obesity; energy-dense foods (sugar-coated cereals, high-sugar yogurt, soft drinks) are becoming very popular among children because of their dense marketing, cheaper price, increased supply and variety. Implementation of health-promoting and -supporting marketing strategies for healthy food can be one initial cornerstone for successful application of the common risk factor approach in prevention of obesity and dental caries, as also suggested by World Health Organization. Labelling healthy food with a 'health-friendly' logo, illustrating that the teeth and the heart are both parts of the whole body (standing side by side supporting each other as close friends), both happy and protected because of consumption of healthy food for the whole body, can promote the foods that are friendly to health of the whole body, implementing the common risk factor approach under a single theme. Labelling healthy food as 'health-friendly' based on an international consensus will provide a clear and uniform picture of what is healthy to eat and result in an international integrated programme for prevention of obesity and caries.

  13. Fos and serotonin immunoreactivity in the raphe nuclei of the cat during carbachol-induced active sleep: a double-labeling study.

    PubMed

    Yamuy, J; Sampogna, S; López-Rodríguez, F; Luppi, P H; Morales, F R; Chase, M H

    1995-07-01

    The microinjection of carbachol into the nucleus pontis oralis produces a state which is polygraphically and behaviorally similar to active sleep (rapid eye movement sleep). In the present study, using double-labeling techniques for serotonin and the protein product of c-fos (Fos), we sought to examine whether immunocytochemically identified serotonergic neurons of the raphe nuclei of the cat were activated, as indicated by their expression of c-fos, during this pharmacologically-induced behavioral state (active sleep-carbachol). Compared with control cats, which were injected with saline, active sleep-carbachol cats exhibited a significantly greater number of c-fos-expressing neurons in the raphe dorsalis, magnus and pallidus. Whereas most of the c-fos-expressing neurons in the raphe dorsalis were small, those in the raphe magnus were medium-sized and in the raphe pallidus they were small and medium-sized. The mean number of serotonergic neurons that expressed c-fos (i.e. double-labeled cells) was similar in control and active sleep-carbachol cats. These data indicate that there is an increased number of non-serotonergic, c-fos-expressing neurons in the raphe dorsalis, magnus and pallidus during the carbachol-induced state.(ABSTRACT TRUNCATED AT 250 WORDS)

  14. Effects of epidermal growth factor on bone formation and resorption in vivo

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marie, P.J.; Hott, M.; Perheentupa, J.

    1990-02-01

    The effects of mouse epidermal growth factor (EGF) on bone formation and resorption were examined in male mice. EGF administration (2-200 ng.g-1.day-1 ip for 7 days) induced a dose-dependent rise in plasma EGF levels that remained within physiological range. Histomorphometric analysis of caudal vertebrae showed that EGF (20 and 200 ng.g-1.day-1) reduced the endosteal matrix and mineral appositional rates after 5 days of treatment as measured by double (3H)proline labeling and double tetracycline labeling, respectively. This effect was transitory and was not observed after 7 days of EGF administration. EGF administered for 7 days induced a dose-dependent increase in themore » periosteal osteoblastic and tetracycline double-labeled surfaces. At high dosage (200 ng.g-1.day-1) EGF administration increased the osteoclastic surface and the number of acid phosphatase-stained osteoclasts, although plasma calcium remained normal. The results show that EGF administration at physiological doses induces distinct effects on endosteal and periosteal bone formation and that the effects are dependent on EGF dosage and duration of treatment. This study indicates that EGF at physiological dosage stimulates periosteal bone formation and increases endosteal bone resorption in the growing mouse.« less

  15. Axon collaterals projection from nucleus reticularis tegmenti pontis onto the cerebellar paramedian lobule in the rabbit: a fluorescent double labelling study.

    PubMed

    Mierzejewska-Krzyzowska, B

    1999-01-01

    Double labelling method with retrograde transport of fluorescent tracers (Fast Blue; FB and Diamidino Yellow; DY) was employed in the rabbit to investigate whether neurones of the nucleus reticularis tegmenti pontis (NRTP) give off axon collaterals to the cerebellar paramedian lobule (PML) of both sides. Following injections to various regions of the homotopic or heterotopic sublobules of the left (FB) and right (DY) PML cortex, distribution of double labelled neurones within NRTP was analyzed. NRTP of the rabbit consists of a medial principal part (the nucleus papillioformis: PLF) and smaller lateral part (the processus tegmentosus lateralis: PTL). Within PLF three subdivisions are to be distinguished: the dorsomedial part -- zone A, the main part -- zone B and the ventrolateral part -- zone C. The present study in the rabbit indicated collateral projections from neurones in some NRTP regions to the both PML. The cells of origin of these projections were located prominently through the rostrocaudal extent of zone B. Projections from zone A were sparse and those from zone C were absent. Moreover, a weak projection arose mainly from the caudal aspect of PTL. It is concluded that the rostral (e and f) and middle (c and d) sublobules are the main targets for the NRTP-PML branching projections.

  16. The Lower Extremity Biomechanics of Single- and Double-Leg Stop-Jump Tasks

    PubMed Central

    2011-01-01

    The anterior cruciate ligament (ACL) injury is a common occurrence in sports requiring stop-jump tasks. Single- and double-leg stop-jump techniques are frequently executed in sports. The higher risk of ACL injury in single-leg drop landing task compared to a double-leg drop landing task has been identified. However the injury bias between single- and double-leg landing techniques has not been investigated for stop-jump tasks. The purpose of this study was to determine the differences between single- and double-leg stop-jump tasks in knee kinetics that were influenced by the lower extremity kinematics during the landing phase. Ground reaction force, lower extremity kinematics, and knee kinetics data during the landing phase were obtained from 10 subjects performing single- and double-leg stop-jump tasks, using motion-capture system and force palates. Greater peak posterior and vertical ground reaction forces, and peak proximal tibia anterior and lateral shear forces (p < 0.05) during landing phase were observed of single-leg stop-jump. Single-leg stop-jump exhibited smaller hip and knee flexion angle, and knee flexion angular velocity at initial foot contact with the ground (p < 0.05). We found smaller peak hip and knee flexion angles (p < 0.05) during the landing phase of single-leg stop-jump. These results indicate that single-leg landing may have higher ACL injury risk than double-leg landing in stop-jump tasks that may be influenced by the lower extremity kinematics during the landing phase. Key points Non-contact ACL injuries are more likely to occur during the single-leg stop-jump task than during the double-leg stop-jump task. Single-leg stop-jump exhibited greater peak proximal tibia anterior and lateral shear forces, and peak posterior and vertical ground reaction forces during the landing phase than the double-leg stop-jump task. Single-leg stop-jump exhibited smaller hip flexion angle, knee flexion angle, and knee flexion angular velocity at initial foot contact with the ground. Single-leg stop-jump exhibited greater peak knee extension and valgus moment during the landing phase than the double-leg stop-jump task. Single-leg stop-jump extended the hip joint at initial foot contact with the ground. PMID:24149308

  17. Penetration of short fluorescence-labeled peptides into the nucleus in HeLa cells and in vitro specific interaction of the peptides with deoxyribooligonucleotides and DNA.

    PubMed

    Fedoreyeva, L I; Kireev, I I; Khavinson, V Kh; Vanyushin, B F

    2011-11-01

    Marked fluorescence in cytoplasm, nucleus, and nucleolus was observed in HeLa cells after incubation with each of several fluorescein isothiocyanate-labeled peptides (epithalon, Ala-Glu-Asp-Gly; pinealon, Glu-Asp-Arg; testagen, Lys-Glu-Asp-Gly). This means that short biologically active peptides are able to penetrate into an animal cell and its nucleus and, in principle they may interact with various components of cytoplasm and nucleus including DNA and RNA. It was established that various initial (intact) peptides differently affect the fluorescence of the 5,6-carboxyfluorescein-labeled deoxyribooligonucleotides and DNA-ethidium bromide complexes. The Stern-Volmer constants characterizing the degree of fluorescence quenching of various single- and double-stranded fluorescence-labeled deoxyribooligonucleotides with short peptides used were different depending on the peptide primary structures. This indicates the specific interaction between short biologically active peptides and nucleic acid structures. On binding to them, the peptides discriminate between different nucleotide sequences and recognize even their cytosine methylation status. Judging from corresponding constants of the fluorescence quenching, the epithalon, pinealon, and bronchogen (Ala-Glu-Asp-Leu) bind preferentially with deoxyribooligonucleotides containing CNG sequence (CNG sites are targets for cytosine DNA methylation in eukaryotes). Epithalon, testagen, and pinealon seem to preferentially bind with CAG- but bronchogen with CTG-containing sequences. The site-specific interactions of peptides with DNA can control epigenetically the cell genetic functions, and they seem to play an important role in regulation of gene activity even at the earliest stages of life origin and in evolution.

  18. Photonic-plasmonic hybrid single-molecule nanosensor measures the effect of fluorescent labels on DNA-protein dynamics

    PubMed Central

    Liang, Feng; Guo, Yuzheng; Hou, Shaocong; Quan, Qimin

    2017-01-01

    Current methods to study molecular interactions require labeling the subject molecules with fluorescent reporters. However, the effect of the fluorescent reporters on molecular dynamics has not been quantified because of a lack of alternative methods. We develop a hybrid photonic-plasmonic antenna-in-a-nanocavity single-molecule biosensor to study DNA-protein dynamics without using fluorescent labels. Our results indicate that the fluorescein and fluorescent protein labels decrease the interaction between a single DNA and a protein due to weakened electrostatic interaction. Although the study is performed on the DNA-XPA system, the conclusion has a general implication that the traditional fluorescent labeling methods might be misestimating the molecular interactions. PMID:28560341

  19. Double versus single reading of mammograms in a breast cancer screening programme: a cost-consequence analysis.

    PubMed

    Posso, Margarita C; Puig, Teresa; Quintana, Ma Jesus; Solà-Roca, Judit; Bonfill, Xavier

    2016-09-01

    To assess the costs and health-related outcomes of double versus single reading of digital mammograms in a breast cancer screening programme. Based on data from 57,157 digital screening mammograms from women aged 50-69 years, we compared costs, false-positive results, positive predictive value and cancer detection rate using four reading strategies: double reading with and without consensus and arbitration, and single reading with first reader only and second reader only. Four highly trained radiologists read the mammograms. Double reading with consensus and arbitration was 15 % (Euro 334,341) more expensive than single reading with first reader only. False-positive results were more frequent at double reading with consensus and arbitration than at single reading with first reader only (4.5 % and 4.2 %, respectively; p < 0.001). The positive predictive value (9.3 % and 9.1 %; p = 0.812) and cancer detection rate were similar for both reading strategies (4.6 and 4.2 per 1000 screens; p = 0.283). Our results suggest that changing to single reading of mammograms could produce savings in breast cancer screening. Single reading could reduce the frequency of false-positive results without changing the cancer detection rate. These results are not conclusive and cannot be generalized to other contexts with less trained radiologists. • Double reading of digital mammograms is more expensive than single reading. • Compared to single reading, double reading yields a higher proportion of false-positive results. • The cancer detection rate was similar for double and single readings. • Single reading may be a cost-effective strategy in breast cancer screening programmes.

  20. Scale-Free Compact Routing Schemes in Networks of Low Doubling Dimension

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Konjevod, Goran; Richa, Andréa W.; Xia, Donglin

    In this work, we consider compact routing schemes in networks of low doubling dimension, where the doubling dimension is the least value α such that any ball in the network can be covered by at most 2 α balls of half radius. There are two variants of routing-scheme design: (i) labeled (name-dependent) routing, in which the designer is allowed to rename the nodes so that the names (labels) can contain additional routing information, for example, topological information; and (ii) name-independent routing, which works on top of the arbitrary original node names in the network, that is, the node names aremore » independent of the routing scheme. In this article, given any constant ε ϵ (0, 1) and an n-node edge-weighted network of doubling dimension α ϵ O(loglog n), we present —a (1 + ε)-stretch labeled compact routing scheme with Γlog n-bit routing labels, O(log 2 n/loglog n)-bit packet headers, and ((1/ε) O(α) log 3 n)-bit routing information at each node; —a (9 + ε)-stretch name-independent compact routing scheme with O(log 2 n/loglog n)-bit packet headers, and ((1/ε) O(α) log 3 n)-bit routing information at each node. In addition, we prove a lower bound: any name-independent routing scheme with o(n (ε/60)2) bits of storage at each node has stretch no less than 9 - ε for any ε ϵ (0, 8). Therefore, our name-independent routing scheme achieves asymptotically optimal stretch with polylogarithmic storage at each node and packet headers. Note that both schemes are scale-free in the sense that their space requirements do not depend on the normalized diameter Δ of the network. Finally, we also present a simpler nonscale-free (9 + ε)-stretch name-independent compact routing scheme with improved space requirements if Δ is polynomial in n.« less

  1. Scale-Free Compact Routing Schemes in Networks of Low Doubling Dimension

    DOE PAGES

    Konjevod, Goran; Richa, Andréa W.; Xia, Donglin

    2016-06-15

    In this work, we consider compact routing schemes in networks of low doubling dimension, where the doubling dimension is the least value α such that any ball in the network can be covered by at most 2 α balls of half radius. There are two variants of routing-scheme design: (i) labeled (name-dependent) routing, in which the designer is allowed to rename the nodes so that the names (labels) can contain additional routing information, for example, topological information; and (ii) name-independent routing, which works on top of the arbitrary original node names in the network, that is, the node names aremore » independent of the routing scheme. In this article, given any constant ε ϵ (0, 1) and an n-node edge-weighted network of doubling dimension α ϵ O(loglog n), we present —a (1 + ε)-stretch labeled compact routing scheme with Γlog n-bit routing labels, O(log 2 n/loglog n)-bit packet headers, and ((1/ε) O(α) log 3 n)-bit routing information at each node; —a (9 + ε)-stretch name-independent compact routing scheme with O(log 2 n/loglog n)-bit packet headers, and ((1/ε) O(α) log 3 n)-bit routing information at each node. In addition, we prove a lower bound: any name-independent routing scheme with o(n (ε/60)2) bits of storage at each node has stretch no less than 9 - ε for any ε ϵ (0, 8). Therefore, our name-independent routing scheme achieves asymptotically optimal stretch with polylogarithmic storage at each node and packet headers. Note that both schemes are scale-free in the sense that their space requirements do not depend on the normalized diameter Δ of the network. Finally, we also present a simpler nonscale-free (9 + ε)-stretch name-independent compact routing scheme with improved space requirements if Δ is polynomial in n.« less

  2. Immunoelectron microscopic double labeling of alkaline phosphatase and penicillinase with colloidal gold in frozen thin sections of Bacillus licheniformis 749/C.

    PubMed Central

    Guan, T; Ghosh, A; Ghosh, B K

    1985-01-01

    The subcellular distribution of alkaline phosphatase and penicillinase was determined by double labeling frozen thin sections of Bacillus licheniformis 749/C with colloidal gold-immunoglobulin G (IgG). Antipenicillinase and anti-alkaline phosphatase antibodies were used to prepare complexes with 5- and 15-nm colloidal gold particles, respectively. The character of the labeling of membrane-bound alkaline phosphatase and penicillinase was different: the immunolabels for alkaline phosphatase (15-nm particles) were bound to a few sites at the inner surface of the plasma membrane, and the gold particles formed clusters of various sizes at the binding sites; the immunolabels for penicillinase (5-nm particles), on the other hand, were bound to the plasma membrane in a dispersed and random fashion. In the cytoplasm, immunolabels for both proteins were distributed randomly, and the character of their binding was similar. The labeling was specific: pretreating the frozen thin sections with different concentrations of anti-alkaline phosphatase or penicillinase blocked the binding of the immunolabel prepared with the same antibody. Binding could be fully blocked by pretreatment with 800 micrograms of either antibody per ml. Images PMID:3876329

  3. Stable isotope labeling-solid phase extraction-mass spectrometry analysis for profiling of thiols and aldehydes in beer.

    PubMed

    Zheng, Shu-Jian; Wang, Ya-Lan; Liu, Ping; Zhang, Zheng; Yu, Lei; Yuan, Bi-Feng; Feng, Yu-Qi

    2017-12-15

    In this study, we developed a strategy for profiling of thiols and aldehydes in beer samples by stable isotope labeling-solid phase extraction-liquid chromatography-double precursor ion scan/double neutral loss scan-mass spectrometry analysis (SIL-SPE-LC-DPIS/DNLS-MS). A pair of isotope reagents (ω-bromoacetonylquinolinium bromide, BQB; ω-bromoacetonylquinolinium-d 7 bromide, BQB-d 7 ) were used to label thiols; while for the aldehydes, a pair of isotope reagents (4-(2-(trimethylammonio) ethoxy) benzenaminium halide, 4-APC; 4-(2-(trimethylammonio) ethoxy) benzenaminium halide-d 4 , 4-APC-d 4 ) were used. The labeled thiols and aldehydes were extracted and purified with solid-phase extraction, respectively, followed by LC-MS analysis. Using the proposed SIL-SPE-LC-DPIS/DNLS-MS methods, 76 thiol and 25 aldehyde candidates were found in beer. Furthermore, we established SIL-SPE-LC-MRM-MS methods for the relative quantitation of thiols and aldehydes in different beer samples. The results showed that the contents of thiols and aldehydes are closely related to the brands and origins of beers. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Optimized RNA ISH, RNA FISH and protein-RNA double labeling (IF/FISH) in Drosophila ovaries

    PubMed Central

    Zimmerman, Sandra G; Peters, Nathaniel C; Altaras, Ariel E; Berg, Celeste A

    2014-01-01

    In situ hybridization (ISH) is a powerful technique for detecting nucleic acids in cells and tissues. Here we describe three ISH procedures that are optimized for Drosophila ovaries: whole-mount, digoxigenin-labeled RNA ISH; RNA fluorescent ISH (FISH); and protein immunofluorescence (IF)–RNA FISH double labeling (IF/FISH). Each procedure balances conflicting requirements for permeabilization, fixation and preservation of antigenicity to detect RNA and protein expression with high resolution and sensitivity. The ISH protocol uses alkaline phosphatase–conjugated digoxigenin antibodies followed by a color reaction, whereas FISH detection involves tyramide signal amplification (TSA). To simultaneously preserve antigens for protein detection and enable RNA probe penetration for IF/FISH, we perform IF before FISH and use xylenes and detergents to permeabilize the tissue rather than proteinase K, which can damage the antigens. ISH and FISH take 3 d to perform, whereas IF/FISH takes 5 d. Probe generation takes 1 or 2 d to perform. PMID:24113787

  5. 9 CFR 317.345 - Guidelines for voluntary nutrition labeling of single-ingredient, raw products.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 9 Animals and Animal Products 2 2011-01-01 2011-01-01 false Guidelines for voluntary nutrition... DEVICES, AND CONTAINERS Nutrition Labeling § 317.345 Guidelines for voluntary nutrition labeling of single-ingredient, raw products. Link to an amendment published at 75 FR 82165, Dec. 29, 2010. (a) Nutrition...

  6. 9 CFR 381.445 - Guidelines for voluntary nutrition labeling of single-ingredient, raw products.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 9 Animals and Animal Products 2 2011-01-01 2011-01-01 false Guidelines for voluntary nutrition... INSPECTION REGULATIONS Nutrition Labeling § 381.445 Guidelines for voluntary nutrition labeling of single-ingredient, raw products. Link to an amendment published at 75 FR 82166, Dec. 29, 2010. (a) Nutrition...

  7. Oxcarbazepine in migraine headache: a double-blind, randomized, placebo-controlled study.

    PubMed

    Silberstein, S; Saper, J; Berenson, F; Somogyi, M; McCague, K; D'Souza, J

    2008-02-12

    To evaluate the efficacy, safety, and tolerability of oxcarbazepine (1,200 mg/day) vs placebo as prophylactic therapy for patients with migraine headaches. This multicenter, double-blind, randomized, placebo-controlled, parallel-group trial consisted of a 4-week single-blind baseline phase and a 15-week double-blind phase consisting of a 6-week titration period, an 8-week maintenance period, and a 1-week down-titration period, after which patients could enter a 13-week open-label extension phase. During the 6-week titration period, oxcarbazepine was initiated at 150 mg/day and increased by 150 mg/day every 5 days to a maximum tolerated dose of 1,200 mg/day. The primary outcome measure was change from baseline in the number of migraine attacks during the last 28-day period of the double-blind phase. Eighty-five patients were randomized to receive oxcarbazepine and 85 to receive placebo. There was no difference between the oxcarbazepine (-1.30) and placebo groups in mean change in number of migraine attacks from baseline during the last 28 days of double-blind phase (-1.74; p = 0.2274). Adverse events were reported for 68 oxcarbazepine-treated patients (80%) and 55 placebo-treated patients (65%). The majority of adverse events were mild or moderate in severity. The most common adverse events (>or=15% of patients) in the oxcarbazepine-treated group were fatigue (20.0%), dizziness (17.6%), and nausea (16.5%); no adverse event occurred in more than 15% of the placebo-treated patients. Overall, oxcarbazepine was safe and well tolerated; however, oxcarbazepine did not show efficacy in the prophylactic treatment of migraine headaches.

  8. A biomechanical comparison of single and double-row fixation in arthroscopic rotator cuff repair.

    PubMed

    Smith, Christopher D; Alexander, Susan; Hill, Adam M; Huijsmans, Pol E; Bull, Anthony M J; Amis, Andrew A; De Beer, Joe F; Wallace, Andrew L

    2006-11-01

    The optimal method for arthroscopic rotator cuff repair is not yet known. The hypothesis of the present study was that a double-row repair would demonstrate superior static and cyclic mechanical behavior when compared with a single-row repair. The specific aims were to measure gap formation at the bone-tendon interface under static creep loading and the ultimate strength and mode of failure of both methods of repair under cyclic loading. A standardized tear of the supraspinatus tendon was created in sixteen fresh cadaveric shoulders. Arthroscopic rotator cuff repairs were performed with use of either a double-row technique (eight specimens) or a single-row technique (eight specimens) with nonabsorbable sutures that were double-loaded on a titanium suture anchor. The repairs were loaded statically for one hour, and the gap formation was measured. Cyclic loading to failure was then performed. Gap formation during static loading was significantly greater in the single-row group than in the double-row group (mean and standard deviation, 5.0 +/- 1.2 mm compared with 3.8 +/- 1.4 mm; p < 0.05). Under cyclic loading, the double-row repairs failed at a mean of 320 +/- 96.9 N whereas the single-row repairs failed at a mean of 224 +/- 147.9 N (p = 0.058). Three single-row repairs and three double-row repairs failed as a result of suture cut-through. Four single-row repairs and one double-row repair failed as a result of anchor or suture failure. The remaining five repairs did not fail, and a midsubstance tear of the tendon occurred. Although more technically demanding, the double-row technique demonstrates superior resistance to gap formation under static loading as compared with the single-row technique. A double-row reconstruction of the supraspinatus tendon insertion may provide a more reliable construct than a single-row repair and could be used as an alternative to open reconstruction for the treatment of isolated tears.

  9. Prospective randomized assessment of single versus double-gloving for general surgical procedures.

    PubMed

    Na'aya, H U; Madziga, A G; Eni, U E

    2009-01-01

    There is increased tendency towards double-gloving by general surgeons in our practice, due probably to awareness of the risk of contamination with blood or other body fluids during surgery. The aim of the study was to compare the relative frequency of glove puncture in single-glove versus double glove sets in general surgical procedures, and to determine if duration of surgery affects perforation rate. Surgeons at random do single or double gloves at their discretion, for general surgical procedures. All the gloves used by the surgeons were assessed immediately after surgery for perforation. A total of 1120 gloves were tested, of which 880 were double-glove sets and 240 single-glove sets. There was no significant difference in the overall perforation rate between single and double glove sets (18.3% versus 20%). However, only 2.3% had perforations in both the outer and inner gloves in the double glove group. Therefore, there was significantly greater risk for blood-skin exposure in the single glove sets (p < 0.01). The perforation rate was also significantly greater during procedures lasting an hour or more compared to those lasting less than an hour (p < 0.01). Double-gloving reduces the risk of blood-skin contamination in all general surgical procedures, and especially so in procedures lasting an hour or more.

  10. End-specific strategies of attachment of long double stranded DNA onto gold-coated nanofiber arrays

    NASA Astrophysics Data System (ADS)

    Peckys, Diana B.; de Jonge, Niels; Simpson, Michael L.; McKnight, Timothy E.

    2008-10-01

    We report the effective and site-specific binding of long double stranded (ds)DNA to high aspect ratio carbon nanofiber arrays. The carbon nanofibers were first coated with a thin gold layer to provide anchorage for two controllable binding methods. One method was based on the direct binding of thiol end-labeled dsDNA. The second and enhanced method used amine end-labeled dsDNA bound with crosslinkers to a carboxyl-terminated self-assembled monolayer. The bound dsDNA was first visualized with a fluorescent, dsDNA-intercalating dye. The specific binding onto the carbon nanofiber was verified by a high resolution detection method using scanning electron microscopy in combination with the binding of neutravidin-coated fluorescent microspheres to the immobilized and biotinylated dsDNA. Functional activity of thiol end-labeled dsDNA on gold-coated nanofiber arrays was verified with a transcriptional assay, whereby Chinese hamster lung cells (V79) were impaled upon the DNA-modified nanofibers and scored for transgene expression of the tethered template. Thiol end-labeled dsDNA demonstrated significantly higher expression levels than nanofibers prepared with control dsDNA that lacked a gold-binding end-label. Employing these site-specific and robust techniques of immobilization of dsDNA onto nanodevices can be of advantage for the study of DNA/protein interactions and for gene delivery applications.

  11. Single- and double-row repair for rotator cuff tears - biology and mechanics.

    PubMed

    Papalia, Rocco; Franceschi, Francesco; Vasta, Sebastiano; Zampogna, Biagio; Maffulli, Nicola; Denaro, Vincenzo

    2012-01-01

    We critically review the existing studies comparing the features of single- and double-row repair, and discuss suggestions about the surgical indications for the two repair techniques. All currently available studies comparing the biomechanical, clinical and the biological features of single and double row. Biomechanically, the double-row repair has greater performances in terms of higher initial fixation strength, greater footprint coverage, improved contact area and pressure, decreased gap formation, and higher load to failure. Results of clinical studies demonstrate no significantly better outcomes for double-row compared to single-row repair. Better results are achieved by double-row repair for larger lesions (tear size 2.5-3.5 cm). Considering the lack of statistically significant differences between the two techniques and that the double row is a high cost and a high surgical skill-dependent technique, we suggest using the double-row technique only in strictly selected patients. Copyright © 2012 S. Karger AG, Basel.

  12. Characterization of the COD removal, electricity generation, and bacterial communities in microbial fuel cells treating molasses wastewater.

    PubMed

    Lee, Yun-Yeong; Kim, Tae G; Cho, Kyung-Suk

    2016-11-09

    The chemical oxygen demand (COD) removal, electricity generation, and microbial communities were compared in 3 types of microbial fuel cells (MFCs) treating molasses wastewater. Single-chamber MFCs without and with a proton exchange membrane (PEM), and double-chamber MFC were constructed. A total of 10,000 mg L(-1) COD of molasses wastewater was continuously fed. The COD removal, electricity generation, and microbial communities in the two types of single-chamber MFCs were similar, indicating that the PEM did not enhance the reactor performance. The COD removal in the single-chamber MFCs (89-90%) was higher than that in the double-chamber MFC (50%). However, electricity generation in the double-chamber MFC was higher than that in the single-chamber MFCs. The current density (80 mA m(-2)) and power density (17 mW m(-2)) in the double-chamber MFC were 1.4- and 2.2-times higher than those in the single-chamber MFCs, respectively. The bacterial community structures in single- and double-chamber MFCs were also distinguishable. The amount of Proteobacteria in the double-chamber MFC was 2-3 times higher than those in the single-chamber MFCs. For the archaeal community, Methanothrix (96.4%) was remarkably dominant in the single-chamber MFCs, but Methanobacterium (35.1%), Methanosarcina (28.3%), and Methanothrix (16.2%) were abundant in the double-chamber MFC.

  13. Estimating bacterial production in marine waters from the simultaneous incorporation of thymidine and leucine.

    PubMed

    Chin-Leo, G; Kirchman, D L

    1988-08-01

    We examined the simultaneous incorporation of [H]thymidine and [C]leucine to obtain two independent indices of bacterial production (DNA and protein syntheses) in a single incubation. Incorporation rates of leucine estimated by the dual-label method were generally higher than those obtained by the single-label method, but the differences were small (dual/single = 1.1 +/- 0.2 [mean +/- standard deviation]) and were probably due to the presence of labeled leucyl-tRNA in the cold trichloroacetic acid-insoluble fraction. There were no significant differences in thymidine incorporation between dual- and single-label incubations (dual/ single = 1.03 +/- 0.13). Addition of the two substrates in relatively large amounts (25 nM) did not apparently increase bacterial activity during short incubations (<5 h). With the dual-label method we found that thymidine and leucine incorporation rates covaried over depth profiles of the Chesapeake Bay. Estimates of bacterial production based on thymidine and leucine differed by less than 25%. Although the need for appropriate conversion factors has not been eliminated, the dual-label approach can be used to examine the variation in bacterial production while ensuring that the observed variation in incorporation rates is due to real changes in bacterial production rather than changes in conversion factors or introduction of other artifacts.

  14. ADMAP (automatic data manipulation program)

    NASA Technical Reports Server (NTRS)

    Mann, F. I.

    1971-01-01

    Instructions are presented on the use of ADMAP, (automatic data manipulation program) an aerospace data manipulation computer program. The program was developed to aid in processing, reducing, plotting, and publishing electric propulsion trajectory data generated by the low thrust optimization program, HILTOP. The program has the option of generating SC4020 electric plots, and therefore requires the SC4020 routines to be available at excution time (even if not used). Several general routines are present, including a cubic spline interpolation routine, electric plotter dash line drawing routine, and single parameter and double parameter sorting routines. Many routines are tailored for the manipulation and plotting of electric propulsion data, including an automatic scale selection routine, an automatic curve labelling routine, and an automatic graph titling routine. Data are accepted from either punched cards or magnetic tape.

  15. The set of triple-resonance sequences with a multiple quantum coherence evolution period

    NASA Astrophysics Data System (ADS)

    Koźmiński, Wiktor; Zhukov, Igor

    2004-12-01

    The new pulse sequence building block that relies on evolution of heteronuclear multiple quantum coherences is proposed. The particular chemical shifts are obtained in multiple quadrature, using linear combinations of frequencies taken from spectra measured at different quantum levels. The pulse sequences designed in this way consist of small number of RF-pulses, are as short as possible, and could be applied for determination of coupling constants. The examples presented involve 2D correlations H NCO, H NCA, H N(CO) CA, and H(N) COCA via heteronuclear zero and double coherences, as well as 2D H NCOCA technique with simultaneous evolution of triple and three distinct single quantum coherences. Applications of the new sequences are presented for 13C, 15N-labeled ubiquitin.

  16. Multiplexed Detection of Cytokines Based on Dual Bar-Code Strategy and Single-Molecule Counting.

    PubMed

    Li, Wei; Jiang, Wei; Dai, Shuang; Wang, Lei

    2016-02-02

    Cytokines play important roles in the immune system and have been regarded as biomarkers. While single cytokine is not specific and accurate enough to meet the strict diagnosis in practice, in this work, we constructed a multiplexed detection method for cytokines based on dual bar-code strategy and single-molecule counting. Taking interferon-γ (IFN-γ) and tumor necrosis factor-α (TNF-α) as model analytes, first, the magnetic nanobead was functionalized with the second antibody and primary bar-code strands, forming a magnetic nanoprobe. Then, through the specific reaction of the second antibody and the antigen that fixed by the primary antibody, sandwich-type immunocomplex was formed on the substrate. Next, the primary bar-code strands as amplification units triggered multibranched hybridization chain reaction (mHCR), producing nicked double-stranded polymers with multiple branched arms, which were served as secondary bar-code strands. Finally, the secondary bar-code strands hybridized with the multimolecule labeled fluorescence probes, generating enhanced fluorescence signals. The numbers of fluorescence dots were counted one by one for quantification with epi-fluorescence microscope. By integrating the primary and secondary bar-code-based amplification strategy and the multimolecule labeled fluorescence probes, this method displayed an excellent sensitivity with the detection limits were both 5 fM. Unlike the typical bar-code assay that the bar-code strands should be released and identified on a microarray, this method is more direct. Moreover, because of the selective immune reaction and the dual bar-code mechanism, the resulting method could detect the two targets simultaneously. Multiple analysis in human serum was also performed, suggesting that our strategy was reliable and had a great potential application in early clinical diagnosis.

  17. Hybridization chain reaction-based colorimetric aptasensor of adenosine 5'-triphosphate on unmodified gold nanoparticles and two label-free hairpin probes.

    PubMed

    Gao, Zhuangqiang; Qiu, Zhenli; Lu, Minghua; Shu, Jian; Tang, Dianping

    2017-03-15

    This work designs a new label-free aptasensor for the colorimetric determination of small molecules (adenosine 5'-triphosphate, ATP) by using visible gold nanoparticles as the signal-generation tags, based on target-triggered hybridization chain reaction (HCR) between two hairpin DNA probes. The assay is carried out referring to the change in the color/absorbance by salt-induced aggregation of gold nanoparticles after the interaction with hairpins, gold nanoparticles and ATP. To construct such an assay system, two hairpin DNA probes with a short single-stranded DNA at the sticky end are utilized for interaction with gold nanoparticles. In the absence of target ATP, the hairpin DNA probes can prevent gold nanoparticles from the salt-induced aggregation through the interaction of the single-stranded DNA at the sticky end with gold nanoparticles. Upon target ATP introduction, the aptamer-based hairpin probe is opened to expose a new sticky end for the strand-displacement reaction with another complementary hairpin, thus resulting in the decreasing single-stranded DNA because of the consumption of hairpins. In this case, gold nanoparticles are uncovered owing to the formation of double-stranded DNA, which causes their aggregation upon addition of the salt, thereby leading to the change in the red-to-blue color. Under the optimal conditions, the HCR-based colorimetric assay presents good visible color or absorbance responses for the determination of target ATP at a concentration as low as 1.0nM. Importantly, the methodology can be further extended to quantitatively or qualitatively monitor other small molecules or biotoxins by changing the sequence of the corresponding aptamer. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Longitudinal transvaginal ultrasound evaluation of cesarean scar niche incidence and depth in the first two years after single- or double-layer uterotomy closure: a randomized controlled trial.

    PubMed

    Bamberg, Christian; Hinkson, Larry; Dudenhausen, Joachim W; Bujak, Verena; Kalache, Karim D; Henrich, Wolfgang

    2017-12-01

    Cesarean deliveries are the most common abdominal surgery procedure globally, and the optimal way to suture the hysterotomy remains a matter of debate. The aim of this study was to assess the incidence of cesarean scar niches and the depth after single- or double-layer uterine closure. We performed a randomized controlled trial in which women were allocated to three uterotomy suture techniques: continuous single-layer unlocked, continuous locked single-layer, or double-layer sutures. Transvaginal ultrasound was performed six weeks and 6-24 months after cesarean delivery [Clinicaltrials.gov (NCT02338388)]. The study included 435 women. Six weeks after delivery, the incidence of niche was not significantly different between the groups (p = 0.52): 40% for single-layer unlocked, 32% for single-layer locked and 43% for double-layer sutures. The mean ± SD niche depths were 3.0 ± 1.4 mm for single-layer unlocked, 3.6 ± 1.7 mm for single-layer locked and 3.3 ± 1.3 mm for double-layer sutures (p = 1.0). There were no significant differences (p = 0.58) in niche incidence between the three groups at the second ultrasound follow up: 30% for single-layer unlocked, 23% for single-layer locked and 29% for double-layer sutures. The mean ± SD niche depth was 3.1 ± 1.5 mm after single-layer unlocked, 2.8 ± 1.5 mm after single-layer locked and 2.5 ± 1.2 mm after double-layer sutures (p = 0.61). There was a trend (p = 0.06) for the residual myometrium thickness to be thicker after double-layer repair at the long-term follow up. The incidence of cesarean scar niche formation and the niche depth was independent of the hysterotomy closure technique. © 2017 Nordic Federation of Societies of Obstetrics and Gynecology.

  19. Acoustic Performance of 3D Printed Nanocomposite Earmuff

    PubMed Central

    Ahmadi, Saeid; Nassiri, Parvin; Ghasemi, Ismaeil; Monazzam Ep, Mohammad R.

    2016-01-01

    Introduction: Hearing protection devices are one of the primary noise reduction tools in developing countries. This study is intended to produce and apply acrylonitrile butadiene styrene (ABS)/clay nanocomposites to fabricate a laboratory single cup earmuffs and then compare it with double cup and single cup pure ABS earmuffs in terms of noise attenuation performance and comfort. In addition, the noise attenuation performance of single cup pure ABS earmuffs is compared with double cup pure ABS earmuffs. Methods: ABS/nanoclay filament was fabricated using a twin screw extruder. A three dimensional (3D) printing machine and a 3D model of earcup, designed by solid work software, were applied to print single and double cup earmuffs using ABS/nanoclay composite and pure ABS filaments. Finally, using an acoustic test fixture, objective noise attenuation test was performed on three different types of earmuffs, including with and without nano material and a secondary cup. Moreover, earmuffs weight was measured as a comfort component. Results: Insertion loss and calculated noise reduction rating (NRR) of single cup ABS/nanoclay earmuffs (NRR=19.4 dB) and double cup pure ABS earmuffs (NRR=18.93 dB) were improved in comparison with single cup pure ABS earmuffs (NRR=15.7 dB). Additionally, both single cup earmuffs were significantly lighter than double cup earmuffs. Although single cup nano and double cup earmuffs had nearly the same attenuation performance, single cup nano earmuffs were 74 gr lighter than double cup earmuffs, so with reference to comfort, single cup nano earmuffs will probably be more acceptable. Conclusions: From this survey it might be concluded that, even though single cup ABS/nanoclay earmuffs was lighter than double cup pure ABS earmuffs, it had approximately more attenuation performance in comparison with double cup pure ABS earmuffs. Consequently, users are probably more prone to wear light- weight single cup ABS/nanoclay earmuffs as a result of improved comfort. In short, ABS/nanoclay composite can be considered a good choice in products with the necessity of high acoustic performance and low weight. PMID:26234977

  20. Canakinumab: in patients with cryopyrin-associated periodic syndromes.

    PubMed

    Curran, Monique P

    2012-02-01

    Canakinumab is a recombinant, fully human, monoclonal, anti-human interleukin-1β (IL-1β) antibody that binds with high affinity and specificity to human IL-1β, preventing its interaction with IL-1 receptors. Canakinumab (150 mg in patients weighing >40 kg or 2 mg/kg in those weighing 15-40 kg) administered once every 8 weeks as a single dose via subcutaneous injection provided a rapid and sustained response in patients with cryopyrin-associated periodic syndromes (CAPS). During the initial 8-week phase of a three-part, phase III trial, a complete response to a single dose of canakinumab occurred in 97% of the 35 patients with CAPS, with 71% of responses occurring within 8 days. After 8 weeks, 31 responders entered a 24-week, randomized, double-blind, withdrawal phase; there was a significant between-group difference in this phase in that none of the canakinumab recipients relapsed compared with 81% of placebo recipients. All patients from the second phase of the trial entered a third, 16-week phase of open-label treatment with canakinumab once every 8 weeks; clinical and biochemical remission was maintained in 28 of 29 patients who completed the trial. In a 2-year, open-label, phase III trial, subcutaneous canakinumab once every 8 weeks provided sustained disease control in the majority of patients with CAPS. Canakinumab was generally well tolerated in all trials, with the predominant adverse events being mild to moderate infections that were responsive to standard treatment.

  1. Real-time and label-free ring-resonator monitoring of solid-phase recombinase polymerase amplification.

    PubMed

    Sabaté Del Río, Jonathan; Steylaerts, Tim; Henry, Olivier Y F; Bienstman, Peter; Stakenborg, Tim; Van Roy, Wim; O'Sullivan, Ciara K

    2015-11-15

    In this work we present the use of a silicon-on-insulator (SOI) chip featuring an array of 64 optical ring resonators used as refractive index sensors for real-time and label-free DNA detection. Single ring functionalisation was achieved using a click reaction after precise nanolitre spotting of specific hexynyl-terminated DNA capture probes to link to an azido-silanised chip surface. To demonstrate detectability using the ring resonators and to optimise conditions for solid-phase amplification, hybridisation between short 25-mer single stranded DNA (ssDNA) fragments and a complementary capture probe immobilised on the surface of the ring resonators was carried out and detected through the shift in the resonant wavelength. Using the optimised conditions demonstrated via the solid-phase hybridisation, a 144-bp double stranded DNA (dsDNA) was then detected directly using recombinase and polymerase proteins through on-chip target amplification and solid-phase elongation of immobilised forward primers on specific rings, at a constant temperature of 37°C and in less than 60min, achieving a limit of detection of 7.8·10(-13)M (6·10(5) copies in 50µL). The use of an automatic liquid handler injection instrument connected to an integrated resealable chip interface (RCI) allowed programmable multiple injection protocols. Air plugs between different solutions were introduced to prevent intermixing and a proportional-integral-derivative (PID) temperature controller minimised temperature based drifts. Published by Elsevier B.V.

  2. Feed-forward and feedback projections of midbrain reticular formation neurons in the cat

    PubMed Central

    Perkins, Eddie; May, Paul J.; Warren, Susan

    2014-01-01

    Gaze changes involving the eyes and head are orchestrated by brainstem gaze centers found within the superior colliculus (SC), paramedian pontine reticular formation (PPRF), and medullary reticular formation (MdRF). The mesencephalic reticular formation (MRF) also plays a role in gaze. It receives a major input from the ipsilateral SC and contains cells that fire in relation to gaze changes. Moreover, it provides a feedback projection to the SC and feed-forward projections to the PPRF and MdRF. We sought to determine whether these MRF feedback and feed-forward projections originate from the same or different neuronal populations by utilizing paired fluorescent retrograde tracers in cats. Specifically, we tested: 1. whether MRF neurons that control eye movements form a single population by injecting the SC and PPRF with different tracers, and 2. whether MRF neurons that control head movements form a single population by injecting the SC and MdRF with different tracers. In neither case were double labeled neurons observed, indicating that feedback and feed-forward projections originate from separate MRF populations. In both cases, the labeled reticulotectal and reticuloreticular neurons were distributed bilaterally in the MRF. However, neurons projecting to the MdRF were generally constrained to the medial half of the MRF, while those projecting to the PPRF, like MRF reticulotectal neurons, were spread throughout the mediolateral axis. Thus, the medial MRF may be specialized for control of head movements, with control of eye movements being more widespread in this structure. PMID:24454280

  3. Feed-forward and feedback projections of midbrain reticular formation neurons in the cat.

    PubMed

    Perkins, Eddie; May, Paul J; Warren, Susan

    2014-01-10

    Gaze changes involving the eyes and head are orchestrated by brainstem gaze centers found within the superior colliculus (SC), paramedian pontine reticular formation (PPRF), and medullary reticular formation (MdRF). The mesencephalic reticular formation (MRF) also plays a role in gaze. It receives a major input from the ipsilateral SC and contains cells that fire in relation to gaze changes. Moreover, it provides a feedback projection to the SC and feed-forward projections to the PPRF and MdRF. We sought to determine whether these MRF feedback and feed-forward projections originate from the same or different neuronal populations by utilizing paired fluorescent retrograde tracers in cats. Specifically, we tested: 1. whether MRF neurons that control eye movements form a single population by injecting the SC and PPRF with different tracers, and 2. whether MRF neurons that control head movements form a single population by injecting the SC and MdRF with different tracers. In neither case were double labeled neurons observed, indicating that feedback and feed-forward projections originate from separate MRF populations. In both cases, the labeled reticulotectal and reticuloreticular neurons were distributed bilaterally in the MRF. However, neurons projecting to the MdRF were generally constrained to the medial half of the MRF, while those projecting to the PPRF, like MRF reticulotectal neurons, were spread throughout the mediolateral axis. Thus, the medial MRF may be specialized for control of head movements, with control of eye movements being more widespread in this structure.

  4. Double-bundle anterior cruciate ligament reconstruction is superior to single-bundle reconstruction in terms of revision frequency: a study of 22,460 patients from the Swedish National Knee Ligament Register.

    PubMed

    Svantesson, Eleonor; Sundemo, David; Hamrin Senorski, Eric; Alentorn-Geli, Eduard; Musahl, Volker; Fu, Freddie H; Desai, Neel; Stålman, Anders; Samuelsson, Kristian

    2017-12-01

    Studies comparing single- and double-bundle anterior cruciate ligament (ACL) reconstructions often include a combined analysis of anatomic and non-anatomic techniques. The purpose of this study was to compare the revision rates between single- and double-bundle ACL reconstructions in the Swedish National Knee Ligament Register with regard to surgical variables as determined by the anatomic ACL reconstruction scoring checklist (AARSC). Patients from the Swedish National Knee Ligament Register who underwent either single- or double-bundle ACL reconstruction with hamstring tendon autograft during the period 2007-2014 were included. The follow-up period started with primary ACL reconstruction, and the outcome measure was set as revision surgery. An online questionnaire based on the items of the AARSC was used to determine the surgical technique implemented in the single-bundle procedures. These were organized into subgroups based on surgical variables, and the revision rates were compared with the double-bundle ACL reconstruction. Hazard ratios (HR) with 95% confidence interval (CI) was calculated and adjusted for confounders by Cox regression. A total of 22,460 patients were included in the study, of which 21,846 were single-bundle and 614 were double-bundle ACL reconstruction. Double-bundle ACL reconstruction had a revision frequency of 2.0% (n = 12) and single-bundle 3.2% (n = 689). Single-bundle reconstruction had an increased risk of revision surgery compared with double-bundle [adjusted HR 1.98 (95% CI 1.12-3.51), p = 0.019]. The subgroup analysis showed a significantly increased risk of revision surgery in patients undergoing single-bundle with anatomic technique using transportal drilling [adjusted HR 2.51 (95% CI 1.39-4.54), p = 0.002] compared with double-bundle ACL reconstruction. Utilizing a more complete anatomic technique according to the AARSC lowered the hazard rate considerably when transportal drilling was performed but still resulted in significantly increased risk of revision surgery compared with double-bundle ACL reconstruction [adjusted HR 1.87 (95% CI 1.04-3.38), p = 0.037]. Double-bundle ACL reconstruction is associated with a lower risk of revision surgery than single-bundle ACL reconstruction. Single-bundle procedures performed using transportal femoral drilling technique had significantly higher risk of revision surgery compared with double-bundle. However, a reference reconstruction with transportal drilling defined as a more complete anatomic reconstruction reduces the risk of revision surgery considerably. III.

  5. One-to-one quantum dot-labeled single long DNA probes.

    PubMed

    He, Shibin; Huang, Bi-Hai; Tan, Junjun; Luo, Qing-Ying; Lin, Yi; Li, Jun; Hu, Yong; Zhang, Lu; Yan, Shihan; Zhang, Qi; Pang, Dai-Wen; Li, Lijia

    2011-08-01

    Quantum dots (QDs) have been received most attention due to their unique properties. Constructing QDs conjugated with certain number of biomolecules is considered as one of the most important research goals in nanobiotechnology. In this study, we report polymerase chain reaction (PCR) amplification of primer oligonucleotides bound to QDs, termed as QD-based PCR. Characterization of QD-based PCR products by gel electrophoresis and atomic force microscopy showed that QD-labeled long DNA strands were synthesized and only a single long DNA strand was conjugated with a QD. The QD-based PCR products still kept fluorescence properties. Moreover, the one-to-one QD-labeled long DNA conjugates as probes could detect a single-copy gene on maize chromosomes by fluorescence in situ hybridization. Labeling a single QD to a single long DNA will make detection of small single-copy DNA fragments, quantitative detection and single molecule imaging come true by nanotechnology, and it will promote medical diagnosis and basic biological research as well as nano-material fabrication. Copyright © 2011 Elsevier Ltd. All rights reserved.

  6. Double-codified gold nanolabels for enhanced immunoanalysis.

    PubMed

    Ambrosi, Adriano; Castañeda, Maria Teresa; Killard, Anthony J; Smyth, Malcolm R; Alegret, Salvador; Merkoçi, Arben

    2007-07-15

    A novel double-codified nanolabel (DC-AuNP) based on gold nanoparticle (AuNP) modified with anti-human IgG peroxidase (HRP)-conjugated antibody is reported. It represents a simple assay that allows enhanced spectrophotometric and electrochemical detection of antigen human IgG as a model protein. The method takes advantage of two properties of the DC-AuNP label: first, the HRP label activity toward the OPD chromogen that can be related to the analyte concentration and measured spectrophotometrically; second, the intrinsic electrochemical properties of the gold nanoparticle labels that being proportional to the protein concentration can be directly quantified by stripping voltammetry. Beside these two main direct determinations of human IgG, a secondary indirect detection was also applicable to this system, exploiting the high molar absorptivity of gold colloids, by which, the color intensity of their solution was proportional to the concentration of the antigen used in the assay. Paramagnetic beads were used as supporting material to immobilize the sandwich-type immunocomplexes resulting in incubation and washing times shorter than those typically needed in classical ELISA tests by means of a rapid magnetic separation of the unbound components. A built-in magnet graphite-epoxy-composite electrode allowed a sensibly enhanced adsorption and electrochemical quantification of the specifically captured AuNPs. The used DC-AuNP label showed an excellent specificity/selectivity, as a matter of fact using a different antigen (goat IgG) a minimal nonspecific electrochemical or spectrophotometric signal was measured. The detection limits for this novel double-codified nanoparticle-based assay were 52 and 260 pg of human IgG/mL for the spectrophotometric (HRP-based) and electrochemical (AuNP-based) detections, respectively, much lower than those typically achieved by ELISA tests. The developed label and method is versatile, offers enhanced performances, and can be easily extended to other protein detection schemes as well as in DNA analysis.

  7. Neuroanatomical evidence for a role of central melanocortin-4 receptors and oxytocin in the efferent control of the rodent clitoris and vagina.

    PubMed

    Gelez, Helene; Poirier, Sarah; Facchinetti, Patricia; Allers, Kelly A; Wayman, Chris; Alexandre, Laurent; Giuliano, François

    2010-06-01

    The clitoris and the vagina are the main peripheral anatomical structures involved in physiological changes related to sexual arousal and orgasm. Their efferent control and, more particularly, the neurochemical phenotype of these descending neuronal pathways remain largely uncharacterized. To examine if brain neurons involved in the efferent control of the clitoris and the vagina possess melanocortin-4 receptor (MC4-R) and/or contain oxytocin (OT). Neurons involved in the efferent control of the vagina and clitoris were identified following visualization of pseudorabies virus (PRV) retrograde tracing. PRV was injected into the vagina and clitoris in adult rats in estrous. On the fifth day postinjection, animals were humanely sacrificed, and brains were removed and sectioned, and processed for PRV visualization. The neurochemical phenotype of PRV-positive neurons was identified using double or triple immunocytochemical labeling against PRV, MC4-R, and OT. Double and triple labeling were quantified using confocal laser scanning microscopy. Neuroanatomical brain distribution, number and percentage of double-labeled PRV/MC4-R and PRV-/OT-positive neurons, and triple PRV-/MC4-R-/OT-labeled neurons. The majority of PRV immunopositive neurons which also expressed immunoreactivity for MC4-R were located in the paraventricular and arcuate nuclei of the hypothalamus. The majority of PRV positive neurons which were immunoreactive (IR) for OT were located in the paraventricular nucleus (PVN), medial preoptic area (MPOA), and lateral hypothalamus. PRV positive neurons were more likely to be IR for MC4-R than for OT. Scattered triple-labeled PRV/MC4-R/OT neurons were detected in the MPOA and the PVN. These data strongly suggest that MC4-R and, to a less extent, OT are involved in the efferent neuronal control of the clitoris and vagina, and consequently facilitate our understanding of how the melanocortinergic pathway regulates female sexual function.

  8. Double hard scattering without double counting

    NASA Astrophysics Data System (ADS)

    Diehl, Markus; Gaunt, Jonathan R.; Schönwald, Kay

    2017-06-01

    Double parton scattering in proton-proton collisions includes kinematic regions in which two partons inside a proton originate from the perturbative splitting of a single parton. This leads to a double counting problem between single and double hard scattering. We present a solution to this problem, which allows for the definition of double parton distributions as operator matrix elements in a proton, and which can be used at higher orders in perturbation theory. We show how the evaluation of double hard scattering in this framework can provide a rough estimate for the size of the higher-order contributions to single hard scattering that are affected by double counting. In a numeric study, we identify situations in which these higher-order contributions must be explicitly calculated and included if one wants to attain an accuracy at which double hard scattering becomes relevant, and other situations where such contributions may be neglected.

  9. Determination of the Stoichiometry between α- and γ1 Subunits of the BK Channel Using LRET.

    PubMed

    Carrasquel-Ursulaez, Willy; Alvarez, Osvaldo; Bezanilla, Francisco; Latorre, Ramon

    2018-06-05

    Two families of accessory proteins, β and γ, modulate BK channel gating and pharmacology. Notably, in the absence of internal Ca 2+ , the γ1 subunit promotes a large shift of the BK conductance-voltage curve to more negative potentials. However, very little is known about how α- and γ1 subunits interact. In particular, the association stoichiometry between both subunits is unknown. Here, we propose a method to answer this question using lanthanide resonance energy transfer. The method assumes that the kinetics of lanthanide resonance energy transfer-sensitized emission of the donor double-labeled α/γ1 complex is the linear combination of the kinetics of the sensitized emission in single-labeled complexes. We used a lanthanide binding tag engineered either into the α- or the γ1 subunits to bind Tb +3 as the donor. The acceptor (BODIPY) was attached to the BK pore-blocker iberiotoxin. We determined that γ1 associates with the α-subunit with a maximal 1:1 stoichiometry. This method could be applied to determine the stoichiometry of association between proteins within heteromultimeric complexes. Copyright © 2018 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  10. Rapid measurement of plasma free fatty acid concentration and isotopic enrichment using LC/MS

    PubMed Central

    Persson, Xuan-Mai T.; Błachnio-Zabielska, Agnieszka Urszula; Jensen, Michael D.

    2010-01-01

    Measurements of plasma free fatty acids (FFA) concentration and isotopic enrichment are commonly used to evaluate FFA metabolism. Until now, gas chromatography-combustion-isotope ratio mass spectrometry (GC/C/IRMS) was the best method to measure isotopic enrichment in the methyl derivatives of 13C-labeled fatty acids. Although IRMS is excellent for analyzing enrichment, it requires time-consuming derivatization steps and is not optimal for measuring FFA concentrations. We developed a new, rapid, and reliable method for simultaneous quantification of 13C-labeled fatty acids in plasma using high-performance liquid chromatography-mass spectrometry (HPLC/MS). This method involves a very quick Dole extraction procedure and direct injection of the samples on the HPLC system. After chromatographic separation, the samples are directed to the mass spectrometer for electrospray ionization (ESI) and analysis in the negative mode using single ion monitoring. By employing equipment with two columns connected parallel to a mass spectrometer, we can double the throughput to the mass spectrometer, reducing the analysis time per sample to 5 min. Palmitate flux measured using this approach agreed well with the GC/C/IRMS method. This HPLC/MS method provides accurate and precise measures of FFA concentration and enrichment. PMID:20526002

  11. An overview of four studies of a continuous oral contraceptive (levonorgestrel 90 mcg/ethinyl estradiol 20 mcg) on premenstrual dysphoric disorder and premenstrual syndrome.

    PubMed

    Freeman, Ellen W; Halbreich, Uriel; Grubb, Gary S; Rapkin, Andrea J; Skouby, Sven O; Smith, Lynne; Mirkin, Sebastian; Constantine, Ginger D

    2012-05-01

    This article presents an overview of four studies that evaluated a continuous oral contraceptive (OC) containing levonorgestrel (90 mcg) and ethinyl estradiol (20 mcg; LNG/EE) for managing premenstrual dysphoric disorder (PMDD) and premenstrual syndrome (PMS). Three randomized, double-blind, placebo-controlled trials and one open-label, single-treatment substudy examined mean changes from baseline in the Daily Record of Severity of Problems (DRSP) or Penn Daily Symptom Rating (DSR). Improvements from baseline in mean DRSP and DSR scores were observed, but results were not consistent among the studies. Mean percent improvement of premenstrual symptoms ranged from 30% to 59% in controlled trials and 56% to 81% in an open-label substudy. A large placebo effect was also observed in the placebo-controlled studies. Continuous LNG/EE yielded a favorable safety profile. These data, although not consistent, indicate that continuous LNG/EE may reduce the symptoms of PMDD and PMS, providing an option for women who are appropriate candidates for a continuous OC as a contraceptive, the approved indication for this medication. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. DEER distance measurement between a spin label and a native FAD semiquinone in electron transfer flavoprotein.

    PubMed

    Swanson, Michael A; Kathirvelu, Velavan; Majtan, Tomas; Frerman, Frank E; Eaton, Gareth R; Eaton, Sandra S

    2009-11-11

    The human mitochondrial electron transfer flavoprotein (ETF) accepts electrons from at least 10 different flavoprotein dehydrogenases and transfers electrons to a single electron acceptor in the inner membrane. Paracoccus denitrificans ETF has the identical function, shares the same three-dimensional structure and functional domains, and exhibits the same conformational mobility. It has been proposed that the mobility of the alphaII domain permits the promiscuous behavior of ETF with respect to a variety of redox partners. Double electron-electron resonance (DEER) measurements between a spin label and an enzymatically reduced flavin adenine dinucleotide (FAD) cofactor in P. denitrificans ETF gave two distributions of distances: a major component centered at 4.2 +/- 0.1 nm and a minor component centered at 5.1 +/- 0.2 nm. Both components had widths of approximately 0.3 nm. A distance of 4.1 nm was calculated using the crystal structure of P. denitrificans ETF, which agrees with the major component obtained from the DEER measurement. The observation of a second distribution suggests that ETF, in the absence of substrate, adopts some conformations that are intermediate between the predominant free and substrate-bound states.

  13. DEER Distance Measurement Between a Spin Label and a Native FAD Semiquinone in Electron Transfer Flavoprotein

    PubMed Central

    Swanson, Michael A.; Kathirvelu, Velavan; Majtan, Tomas; Frerman, Frank E.; Eaton, Gareth R.; Eaton, Sandra S.

    2009-01-01

    The human mitochondrial electron transfer flavoprotein (ETF) accepts electrons from at least 10 different flavoprotein dehydrogenases and transfers electrons to a single electron acceptor in the inner membrane. Paracoccus denitrificans ETF has the identical function, shares the same three dimensional structure and functional domains, and exhibits the same conformational mobility. It has been proposed that the mobility of the αII domain permits the promiscuous behavior of ETF with respect to a variety of redox partners. Double electron-electron resonance (DEER) measurements between a spin label and an enzymatically reduced flavin adenine dinucleotide (FAD) cofactor in P. denitrificans ETF gave two distributions of distances: a major component centered at 4.2 ± 0.1 nm and a minor component centered at 5.1 ± 0.2 nm. Both components had widths of approximately 0.3 nm. A distance of 4.1 nm was calculated using the crystal structure of P. denitrificans ETF, which agrees with the major component obtained from the DEER measurement. The observation of a second distribution suggests that ETF, in the absence of substrate, adopts some conformations that are intermediate between the predominant free and substrate-bound states. PMID:19886689

  14. Auto-transplanted mesenchymal stromal cell fate in periodontal tissue of beagle dogs.

    PubMed

    Wei, Na; Gong, Ping; Liao, Dapeng; Yang, Xingmei; Li, Xiaoyu; Liu, Yurong; Yuan, Quan; Tan, Zhen

    2010-07-01

    Mesenchymal stromal cells (MSC) possess multilineage differentiation potential and characteristics of self-renewal. It has been reported that MSC can acquire characteristics of cells in the periodontal ligament (PDL) in vitro. Moreover, the transplantation of MSC has been shown to be a promising strategy for treating periodontal defects. However, little is known about the fate of MSC in periodontal tissue in vivo. The aim of this study was to trace the paths of MSC after transplantation into periodontal tissues in vivo. MSC labeled with bromodeoxyuridine (BrdU) were transplanted into periodontal defects of beagle dogs. Six weeks after surgery, the animals were killed and decalcified specimens were prepared. Migration and differentiation of MSC were detected by single/double immunohistochemistry and a combination of immunohistochemistry and in situ hybridization. BrdU-labeled MSC were observed distributing into periodontal tissue that included alveolar bone, PDL, cementum and blood vessels and expressing surface markers typical of osteoblasts and fibroblasts. Cumulatively, our data suggest that MSC migrate throughout periodontal tissue and differentiate into osteoblasts and fibroblasts after transplantation into periodontal defects at 6 weeks in vivo, and have the potential to regenerate periodontal tissue.

  15. Simvastatin as an Adjunct to Conventional Therapy of Non-infectious Uveitis: A Randomized, Open-Label Pilot Study.

    PubMed

    Shirinsky, Ivan V; Biryukova, Anastasia A; Shirinsky, Valery S

    2017-12-01

    Statins have been shown to reduce ocular inflammation in animal models of uveitis and to prevent development of uveitis in observational studies. There have been no experimental human studies evaluating statins' efficacy and safety in uveitis. In this study, we aimed to investigate efficacy and safety of simvastatin in patients with uveitis. For this single-center, open-label, randomized study, we enrolled patients with acute non-infectious uveitis. The patients were randomized to receive 40 mg simvastatin per day for 2 months in addition to conventional treatment or conventional treatment alone. The studied outcomes were the rate of steroid-sparing control of ocular inflammation, measures of ocular inflammation, intraocular pressure, and visual acuity. Fifty patients were enrolled in the study. Twenty-five patients were randomly assigned to receive simvastatin with conventional treatment and 25 to conventional treatment alone. Simvastatin was associated with significantly higher rates of steroid-sparing ocular inflammation control, decrease in anterior chamber inflammation, and improvement in visual acuity. The treatment was well tolerated, no serious adverse effects were observed. Our findings suggest that statins may have therapeutic potential in uveitis. These results need to be confirmed in double-blind, randomized, controlled studies.

  16. General method for labeling siRNA by click chemistry with fluorine-18 for the purpose of PET imaging.

    PubMed

    Mercier, Frédéric; Paris, Jérôme; Kaisin, Geoffroy; Thonon, David; Flagothier, Jessica; Teller, Nathalie; Lemaire, Christian; Luxen, André

    2011-01-19

    The alkyne-azide Cu(I)-catalyzed Huisgen cycloaddition, a click-type reaction, was used to label a double-stranded oligonucleotide (siRNA) with fluorine-18. An alkyne solid support CPG for the preparation of monostranded oligonucleotides functionalized with alkyne has been developed. Two complementary azide labeling agents (1-(azidomethyl)-4-[(18)F]fluorobenzene) and 1-azido-4-(3-[(18)F]fluoropropoxy)benzene have been produced with 41% and 35% radiochemical yields (decay-corrected), respectively. After annealing with the complementary strand, the siRNA was directly labeled by click chemistry with [(18)F]fluoroazide to produce the [(18)F]-radiolabeled siRNA with excellent radiochemical yield and purity.

  17. Macrocyclic polyaminocarboxylates for stable radiometal antibody conjugates for therapy, SPECT and PET imaging

    DOEpatents

    Mease, R.C.; Mausner, L.F.; Srivastava, S.C.

    1997-06-17

    A simple method for the synthesis of 1,4,7, 10-tetraazacyclododecane N,N{prime}N{double_prime},N{prime}{double_prime}-tetraacetic acid and 1,4,8,11-tetraazacyclotetradecane N,N{prime},N{double_prime},N{prime}{double_prime}-tetraacetic acid involves cyanomethylating 1,4,7,10-tetraazacyclododecane or 1,4,8,11-tetraazacyclotetradecane to form a tetranitrile and hydrolyzing the tetranitrile. These macrocyclic compounds are functionalized through one of the carboxylates and then conjugated to various biological molecules including monoclonal antibodies. The resulting conjugated molecules are labeled with radiometals for SPECT and PET imaging and for radiotherapy. 4 figs.

  18. Frequency and Voltage Dependence of the Dielectrophoretic Trapping of Short Lengths of DNA and dCTP in a Nanopipette

    PubMed Central

    Ying, Liming; White, Samuel S.; Bruckbauer, Andreas; Meadows, Lisa; Korchev, Yuri E.; Klenerman, David

    2004-01-01

    The study of the properties of DNA under high electric fields is of both fundamental and practical interest. We have exploited the high electric fields produced locally in the tip of a nanopipette to probe the motion of double- and single-stranded 40-mer DNA, a 1-kb single-stranded DNA, and a single-nucleotide triphosphate (dCTP) just inside and outside the pipette tip at different frequencies and amplitudes of applied voltages. We used dual laser excitation and dual color detection to simultaneously follow two fluorophore-labeled DNA sequences with millisecond time resolution, significantly faster than studies to date. A strong trapping effect was observed during the negative half cycle for all DNA samples and also the dCTP. This effect was maximum below 1 Hz and decreased with higher frequency. We assign this trapping to strong dielectrophoresis due to the high electric field and electric field gradient in the pipette tip. Dielectrophoresis in electrodeless tapered nanostructures has potential applications for controlled mixing and manipulation of short lengths of DNA and other biomolecules, opening new possibilities in miniaturized biological analysis. PMID:14747337

  19. Heat-transfer resistance at solid-liquid interfaces: a tool for the detection of single-nucleotide polymorphisms in DNA.

    PubMed

    van Grinsven, Bart; Vanden Bon, Natalie; Strauven, Hannelore; Grieten, Lars; Murib, Mohammed; Monroy, Kathia L Jiménez; Janssens, Stoffel D; Haenen, Ken; Schöning, Michael J; Vermeeren, Veronique; Ameloot, Marcel; Michiels, Luc; Thoelen, Ronald; De Ceuninck, Ward; Wagner, Patrick

    2012-03-27

    In this article, we report on the heat-transfer resistance at interfaces as a novel, denaturation-based method to detect single-nucleotide polymorphisms in DNA. We observed that a molecular brush of double-stranded DNA grafted onto synthetic diamond surfaces does not notably affect the heat-transfer resistance at the solid-to-liquid interface. In contrast to this, molecular brushes of single-stranded DNA cause, surprisingly, a substantially higher heat-transfer resistance and behave like a thermally insulating layer. This effect can be utilized to identify ds-DNA melting temperatures via the switching from low- to high heat-transfer resistance. The melting temperatures identified with this method for different DNA duplexes (29 base pairs without and with built-in mutations) correlate nicely with data calculated by modeling. The method is fast, label-free (without the need for fluorescent or radioactive markers), allows for repetitive measurements, and can also be extended toward array formats. Reference measurements by confocal fluorescence microscopy and impedance spectroscopy confirm that the switching of heat-transfer resistance upon denaturation is indeed related to the thermal on-chip denaturation of DNA. © 2012 American Chemical Society

  20. Augmentation in the treatment of restless legs syndrome with transdermal rotigotine.

    PubMed

    Beneš, Heike; García-Borreguero, Diego; Ferini-Strambi, Luigi; Schollmayer, Erwin; Fichtner, Andreas; Kohnen, Ralf

    2012-06-01

    To assess the risk of augmentation under treatment with the transdermally delivered dopamine agonist rotigotine for restless legs syndrome (RLS). Experts in RLS augmentation retrospectively reviewed data from two double-blind, placebo-controlled 6-month trials (745 rotigotine and 214 placebo subjects, NCT00136045 and NCT00135993) and from two open-label 1-year trials (620 rotigotine subjects, NCT00498108 and NCT00263068). All study visits were systematically evaluated applying the Max Planck Institute (MPI) criteria for the diagnosis of both augmentation and clinically relevant augmentation. MPI criteria for augmentation were met on at least one visit by 8.2% of all subjects in the double-blind trials with 12 subjects meeting the criteria for clinically relevant augmentation: 11 under rotigotine (1.5%) and one under placebo treatment. In the open-label trials, 9.7% of all subjects met the MPI criteria for augmentation and 2.9% met the criteria for clinically relevant augmentation. None of the patients treated with rotigotine for up to 1.5 years (double-blind plus open-label trial) discontinued prematurely owing to augmentation. Neither could dose-dependency or a time pattern for clinically relevant augmentation episodes be detected. Our analyses suggest that the risk for clinically relevant augmentation for the duration of up to 18 months of rotigotine treatment is low. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Simultaneous in vivo visualization and localization of solid oral dosage forms in the rat gastrointestinal tract by magnetic resonance imaging (MRI).

    PubMed

    Christmann, V; Rosenberg, J; Seega, J; Lehr, C M

    1997-08-01

    Bioavailability of orally administered drugs is much influenced by the behavior, performance and fate of the dosage form within the gastrointestinal (GI) tract. Therefore, MRI in vivo methods that allow for the simultaneous visualization of solid oral dosage forms and anatomical structures of the GI tract have been investigated. Oral contrast agents containing Gd-DTPA were used to depict the lumen of the digestive organs. Solid oral dosage forms were visualized in a rat model by a 1H-MRI double contrast technique (magnetite-labelled microtablets) and a combination of 1H- and 19F-MRI (fluorine-labelled minicapsules). Simultaneous visualization of solid oral dosage forms and the GI environment in the rat was possible using MRI. Microtablets could reproducibly be monitored in the rat stomach and in the intestines using a 1H-MRI double contrast technique. Fluorine-labelled minicapsules were detectable in the rat stomach by a combination of 1H- and 19F-MRI in vivo. The in vivo 1H-MRI double contrast technique described allows solid oral dosage forms in the rat GI tract to be depicted. Solid dosage forms can easily be labelled by incorporating trace amounts of non-toxic iron oxide (magnetite) particles. 1H-MRI is a promising tool for observing such pharmaceutical dosage forms in humans. Combined 1H- and 19F-MRI offer a means of unambiguously localizing solid oral dosage forms in more distal parts of the GI tract. Studies correlating MRI examinations with drug plasma levels could provide valuable information for the development of pharmaceutical dosage forms.

  2. Surface proteins and the formation of biofilms by Staphylococcus aureus.

    PubMed

    Kim, Sung Joon; Chang, James; Rimal, Binayak; Yang, Hao; Schaefer, Jacob

    2018-03-01

    Staphylococcus aureus biofilms pose a serious clinical threat as reservoirs for persistent infections. Despite this clinical significance, the composition and mechanism of formation of S. aureus biofilms are unknown. To address these problems, we used solid-state NMR to examine S. aureus (SA113), a strong biofilm-forming strain. We labeled whole cells and cell walls of planktonic cells, young biofilms formed for 12-24h after stationary phase, and more mature biofilms formed for up to 60h after stationary phase. All samples were labeled either by (i) [ 15 N]glycine and l-[1- 13 C]threonine, or in separate experiments, by (ii) l-[2- 13 C, 15 N]leucine. We then measured 13 C- 15 N direct bonds by C{N} rotational-echo double resonance (REDOR). The increase in peptidoglycan stems that have bridges connected to a surface protein was determined directly by a cell-wall double difference (biofilm REDOR difference minus planktonic REDOR difference). This procedure eliminates errors arising from differences in 15 N isotopic enrichments and from the routing of 13 C label from threonine degradation to glycine. For both planktonic cells and the mature biofilm, 20% of pentaglycyl bridges are not cross-linked and are potential surface-protein attachment sites. None of these sites has a surface protein attached in the planktonic cells, but one-fourth have a surface protein attached in the mature biofilm. Moreover, the leucine-label shows that the concentration of β-strands in leucine-rich regions doubles in the mature biofilm. Thus, a primary event in establishing a S. aureus biofilm is extensive decoration of the cell surface with surface proteins that are linked covalently to the cell wall and promote cell-cell adhesion. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Accumulation of dsRNA in endosomes contributes to inefficient RNA interference in the fall armyworm, Spodoptera frugiperda.

    PubMed

    Yoon, June-Sun; Gurusamy, Dhandapani; Palli, Subba Reddy

    2017-11-01

    RNA interference (RNAi) efficiency varies among insects studied. The barriers for successful RNAi include the presence of double-stranded ribonucleases (dsRNase) in the lumen and hemolymph that could potentially digest double-stranded RNA (dsRNA) and the variability in the transport of dsRNA into and within the cells. We recently showed that the dsRNAs are transported into lepidopteran cells, but they are not processed into small interference RNAs (siRNAs) because they are trapped in acidic bodies. In the current study, we focused on the identification of acidic bodies in which dsRNAs accumulate in Sf9 cells. Time-lapse imaging studies showed that dsRNAs enter Sf9 cells and accumulate in acidic bodies within 20 min after their addition to the medium. CypHer-5E-labeled dsRNA also accumulated in the midgut and fat body dissected from Spodoptera frugiperda larvae with similar patterns observed in Sf9 cells. Pharmacological inhibitor assays showed that the dsRNAs use clathrin mediated endocytosis pathway for transport into the cells. We investigated the potential dsRNA accumulation sites employing LysoTracker and double labeling experiments using the constructs to express a fusion of green fluorescence protein with early or late endosomal marker proteins and CypHer-5E-labeled dsRNA. Interestingly, CypHer-5E-labeled dsRNA accumulated predominantly in early and late endosomes. These data suggest that entrapment of internalized dsRNA in endosomes is one of the major factors contributing to inefficient RNAi response in lepidopteran insects. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Double insemination and gonadotropin-releasing hormone treatment of repeat-breeding dairy cattle.

    PubMed

    Stevenson, J S; Call, E P; Scoby, R K; Phatak, A P

    1990-07-01

    Our objective was to determine if double inseminations during the same estrous period of dairy cattle eligible for their third or fourth service (repeat breeders) would improve pregnancy rates equivalent to injections of GnRH given at the time of AI. Repeat-breeding, lactating cows from six herds (five herds in the San Joaquin Valley of central California and one herd in northeast Kansas) were assigned randomly to four treatment groups when detected in estrus: 1) single AI plus no injection, 2) single AI plus 100 micrograms GnRH at AI, 3) double AI plus no injection, or 4) double AI plus 100 micrograms of GnRH at AI. Inseminations were performed according to the a.m.-p.m. rule. The second AI for the double AI treatment was given 12 to 16 h after the first AI. Injections of GnRH were given intramuscularly immediately following the single AI or the first AI of the double AI. Pregnancy rates of cows given a single AI and hormone injection were numerically higher in all six herds than those of their herdmates given only a single AI. In five of six herds, the pregnancy rates of cows given a double AI and hormone injection were numerically higher than pregnancy rates of their herdmates given only a double AI. Overall pregnancy rates for the four treatments were 1) 112/353 (32.1%), 2) 165/406 (41.6%), 3) 119/364 (33.5%), and 4) 135/359 (37.5%). Gonadotropin-releasing hormone increased pregnancy rates of repeat breeders compared with controls given only a single AI. No further benefit beyond the single AI was accrued from the double AI treatment, with or without concurrent hormone administration.

  5. Double-Row Capsulolabral Repair Increases Load to Failure and Decreases Excessive Motion.

    PubMed

    McDonald, Lucas S; Thompson, Matthew; Altchek, David W; McGarry, Michelle H; Lee, Thay Q; Rocchi, Vanna J; Dines, Joshua S

    2016-11-01

    Using a cadaver shoulder instability model and load-testing device, we compared biomechanical characteristics of double-row and single-row capsulolabral repairs. We hypothesized a greater reduction in glenohumeral motion and translation and a higher load to failure in a mattress double-row capsulolabral repair than in a single-row repair. In 6 matched pairs of cadaveric shoulders, a capsulolabral injury was created. One shoulder was repaired with a single-row technique, and the other with a double-row mattress technique. Rotational range of motion, anterior-inferior translation, and humeral head kinematics were measured. Load-to-failure testing measured stiffness, yield load, deformation at yield load, energy absorbed at yield load, load to failure, deformation at ultimate load, and energy absorbed at ultimate load. Double-row repair significantly decreased external rotation and total range of motion compared with single-row repair. Both repairs decreased anterior-inferior translation compared with the capsulolabral-injured condition, however, no differences existed between repair types. Yield load in the single-row group was 171.3 ± 110.1 N, and in the double-row group it was 216.1 ± 83.1 N (P = .02). Ultimate load to failure in the single-row group was 224.5 ± 121.0 N, and in the double-row group it was 373.9 ± 172.0 N (P = .05). Energy absorbed at ultimate load in the single-row group was 1,745.4 ± 1,462.9 N-mm, and in the double-row group it was 4,649.8 ± 1,930.8 N-mm (P = .02). In cases of capsulolabral disruption, double-row repair techniques may result in decreased shoulder rotational range of motion and improved load-to-failure characteristics. In cases of capsulolabral disruption, repair techniques with double-row mattress repair may provide more secure fixation. Double-row capsulolabral repair decreases shoulder motion and increases load to failure, yield load, and energy absorbed at yield load more than single-row repair. Published by Elsevier Inc.

  6. 7 CFR 43.104 - Master table of single and double sampling plans.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Master table of single and double sampling plans. 43... STANDARD CONTAINER REGULATIONS STANDARDS FOR SAMPLING PLANS Sampling Plans § 43.104 Master table of single and double sampling plans. (a) In the master table, a sampling plan is selected by first determining...

  7. 7 CFR 43.104 - Master table of single and double sampling plans.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Master table of single and double sampling plans. 43... STANDARD CONTAINER REGULATIONS STANDARDS FOR SAMPLING PLANS Sampling Plans § 43.104 Master table of single and double sampling plans. (a) In the master table, a sampling plan is selected by first determining...

  8. 7 CFR 43.104 - Master table of single and double sampling plans.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Master table of single and double sampling plans. 43... STANDARD CONTAINER REGULATIONS STANDARDS FOR SAMPLING PLANS Sampling Plans § 43.104 Master table of single and double sampling plans. (a) In the master table, a sampling plan is selected by first determining...

  9. 7 CFR 43.104 - Master table of single and double sampling plans.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Master table of single and double sampling plans. 43... STANDARD CONTAINER REGULATIONS STANDARDS FOR SAMPLING PLANS Sampling Plans § 43.104 Master table of single and double sampling plans. (a) In the master table, a sampling plan is selected by first determining...

  10. A Cognitive-Ecological Approach to Elder Abuse in Five Cultures: Human Rights and Education

    ERIC Educational Resources Information Center

    Patterson, Marcus; Malley-Morrison, Kathleen

    2006-01-01

    The population of the world is aging rapidly?a development that the World Health Organization (2004) has labeled as ?a demographic revolution.? According to its statistics, there are currently 600 million people in the world over the age of 60, a figure that will double by 2025 and double again by 2050. Within this age group, the numbers of the…

  11. High-Yield Spin Labeling of Long RNAs for Electron Paramagnetic Resonance Spectroscopy.

    PubMed

    Kerzhner, Mark; Matsuoka, Hideto; Wuebben, Christine; Famulok, Michael; Schiemann, Olav

    2018-05-10

    Site-directed spin labeling is a powerful tool for investigating the conformation and dynamics of biomacromolecules such as RNA. Here we introduce a spin labeling strategy based on click chemistry in solution that, in combination with enzymatic ligation, allows highly efficient labeling of complex and long RNAs with short reaction times and suppressed RNA degradation. With this approach, a 34-nucleotide aptamer domain of the preQ1 riboswitch and an 81-nucleotide TPP riboswitch aptamer could be labeled with two labels in several positions. We then show that conformations of the preQ1 aptamer and its dynamics can be monitored in the absence and presence of Mg 2+ and a preQ1 ligand by continuous wave electron paramagnetic resonance spectroscopy at room temperature and pulsed electron-electron double resonance spectroscopy (PELDOR or DEER) in the frozen state.

  12. A double-tracer technique to characterize absorption, distribution, metabolism and excretion (ADME) of [14C]-basimglurant and absolute bioavailability after oral administration and concomitant intravenous microdose administration of [13C6]-labeled basimglurant in humans.

    PubMed

    Guerini, Elena; Schadt, Simone; Greig, Gerard; Haas, Ruth; Husser, Christophe; Zell, Manfred; Funk, Christoph; Hartung, Thomas; Gloge, Andreas; Mallalieu, Navita L

    2017-02-01

    1. The emerging technique of employing intravenous microdose administration of an isotope tracer concomitantly with an [ 14 C]-labeled oral dose was used to characterize the disposition and absolute bioavailability of a novel metabotropic glutamate 5 (mGlu5) receptor antagonist under clinical development for major depressive disorder (MDD). 2. Six healthy volunteers received a single 1 mg [ 12 C/ 14 C]-basimglurant (2.22 MBq) oral dose and a concomitant i.v. tracer dose of 100 μg of [ 13 C 6 ]-basimglurant. Concentrations of [ 12 C]-basimglurant and the stable isotope [ 13 C 6 ]-basimglurant were determined in plasma by a specific LC/MS-MS method. Total [ 14 C] radioactivity was determined in whole blood, plasma, urine and feces by liquid scintillation counting. Metabolic profiling was conducted in plasma, urine, blood cell pellet and feces samples. 3. The mean absolute bioavailability after oral administration (F) of basimglurant was ∼67% (range 45.7-77.7%). The major route of [ 14 C]-radioactivity excretion, primarily in form of metabolites, was in urine (mean recovery 73.4%), with the remainder excreted in feces (mean recovery 26.5%). The median t max for [ 12 C]-basimglurant after the oral administration was 0.71 h (range 0.58-1.00) and the mean terminal half-life was 77.2 ± 38.5 h. Terminal half-life for the [ 14 C]-basimglurant was 178 h indicating presence of metabolites with a longer terminal half-life. Five metabolites were identified with M1-Glucuronide as major and the others in trace amounts. There was minimal binding of drug to RBCs. IV pharmacokinetics was characterized with a mean ± SD CL of 11.8 ± 7.4 mL/h and a Vss of 677 ± 229 L. 4. The double-tracer technique used in this study allowed to simultaneously characterize the absolute bioavailability and disposition characteristics of the new oral molecular entity in a single study.

  13. Single-row versus double-row rotator cuff repair: techniques and outcomes.

    PubMed

    Dines, Joshua S; Bedi, Asheesh; ElAttrache, Neal S; Dines, David M

    2010-02-01

    Double-row rotator cuff repair techniques incorporate a medial and lateral row of suture anchors in the repair configuration. Biomechanical studies of double-row repair have shown increased load to failure, improved contact areas and pressures, and decreased gap formation at the healing enthesis, findings that have provided impetus for clinical studies comparing single-row with double-row repair. Clinical studies, however, have not yet demonstrated a substantial improvement over single-row repair with regard to either the degree of structural healing or functional outcomes. Although double-row repair may provide an improved mechanical environment for the healing enthesis, several confounding variables have complicated attempts to establish a definitive relationship with improved rates of healing. Appropriately powered rigorous level I studies that directly compare single-row with double-row techniques in matched tear patterns are necessary to further address these questions. These studies are needed to justify the potentially increased implant costs and surgical times associated with double-row rotator cuff repair.

  14. Analysis of Spontaneous and Nerve-Evoked Calcium Transients in Intact Extraocular Muscles in Vitro

    PubMed Central

    Feng, Cheng-Yuan; Hennig, Grant W.; Corrigan, Robert D.; Smith, Terence K.; von Bartheld, Christopher S.

    2012-01-01

    Extraocular muscles (EOMs) have unique calcium handling properties, yet little is known about the dynamics of calcium events underlying ultrafast and tonic contractions in myofibers of intact EOMs. Superior oblique EOMs of juvenile chickens were dissected with their nerve attached, maintained in oxygenated Krebs buffer, and loaded with fluo-4. Spontaneous and nerve stimulation-evoked calcium transients were recorded and, following calcium imaging, some EOMs were double-labeled with rhodamine-conjugated alpha-bungarotoxin (rhBTX) to identify EOM myofiber types. EOMs showed two main types of spontaneous calcium transients, one slow type (calcium waves with 1/2max duration of 2–12 s, velocity of 25–50 μm/s) and two fast “flash-like” types (Type 1, 30–90 ms; Type 2, 90–150 ms 1/2max duration). Single pulse nerve stimulation evoked fast calcium transients identical to the fast (Type 1) calcium transients. Calcium waves were accompanied by a local myofiber contraction that followed the calcium transient wavefront. The magnitude of calcium-wave induced myofiber contraction far exceeded those of movement induced by nerve stimulation and associated fast calcium transients. Tetrodotoxin eliminated nerve-evoked transients, but not spontaneous transients. Alpha-bungarotoxin eliminated both spontaneous and nerve-evoked fast calcium transients, but not calcium waves, and caffeine increased wave activity. Calcium waves were observed in myofibers lacking spontaneous or evoked fast transients, suggestive of multiply-innervated myofibers, and this was confirmed by double-labeling with rhBTX. We propose that the abundant spontaneous calcium transients and calcium waves with localized contractions that do not depend on innervation may contribute to intrinsic generation of tonic functions of EOMs. PMID:22579493

  15. Estimating Bacterial Production in Marine Waters from the Simultaneous Incorporation of Thymidine and Leucine

    PubMed Central

    Chin-Leo, Gerardo; Kirchman, David L.

    1988-01-01

    We examined the simultaneous incorporation of [3H]thymidine and [14C]leucine to obtain two independent indices of bacterial production (DNA and protein syntheses) in a single incubation. Incorporation rates of leucine estimated by the dual-label method were generally higher than those obtained by the single-label method, but the differences were small (dual/single = 1.1 ± 0.2 [mean ± standard deviation]) and were probably due to the presence of labeled leucyl-tRNA in the cold trichloroacetic acid-insoluble fraction. There were no significant differences in thymidine incorporation between dual- and single-label incubations (dual/ single = 1.03 ± 0.13). Addition of the two substrates in relatively large amounts (25 nM) did not apparently increase bacterial activity during short incubations (<5 h). With the dual-label method we found that thymidine and leucine incorporation rates covaried over depth profiles of the Chesapeake Bay. Estimates of bacterial production based on thymidine and leucine differed by less than 25%. Although the need for appropriate conversion factors has not been eliminated, the dual-label approach can be used to examine the variation in bacterial production while ensuring that the observed variation in incorporation rates is due to real changes in bacterial production rather than changes in conversion factors or introduction of other artifacts. PMID:16347706

  16. Single-row versus double-row capsulolabral repair: a comparative evaluation of contact pressure and surface area in the capsulolabral complex-glenoid bone interface.

    PubMed

    Kim, Doo-Sup; Yoon, Yeo-Seung; Chung, Hoi-Jeong

    2011-07-01

    Despite the attention that has been paid to restoration of the capsulolabral complex anatomic insertion onto the glenoid, studies comparing the pressurized contact area and mean interface pressure at the anatomic insertion site between a single-row repair and a double-row labral repair have been uncommon. The purpose of our study was to compare the mean interface pressure and pressurized contact area at the anatomic insertion site of the capsulolabral complex between a single-row repair and a double-row repair technique. Controlled laboratory study. Thirty fresh-frozen cadaveric shoulders (mean age, 61 ± 8 years; range, 48-71 years) were used for this study. Two types of repair were performed on each specimen: (1) a single-row repair and (2) a double-row repair. Using pressure-sensitive films, we examined the interface contact area and contact pressure. The mean interface pressure was greater for the double-row repair technique (0.29 ± 0.04 MPa) when compared with the single-row repair technique (0.21 ± 0.03 MPa) (P = .003). The mean pressurized contact area was also significantly greater for the double-row repair technique (211.8 ± 18.6 mm(2), 78.4% footprint) compared with the single-row repair technique (106.4 ± 16.8 mm(2), 39.4% footprint) (P = .001). The double-row repair has significantly greater mean interface pressure and pressurized contact area at the insertion site of the capsulolabral complex than the single-row repair. The double-row repair may be advantageous compared with the single-row repair in restoring the native footprint area of the capsulolabral complex.

  17. Single versus double-row repair of the rotator cuff: does double-row repair with improved anatomical and biomechanical characteristics lead to better clinical outcome?

    PubMed

    Pauly, Stephan; Gerhardt, Christian; Chen, Jianhai; Scheibel, Markus

    2010-12-01

    Several techniques for arthroscopic repair of rotator cuff defects have been introduced over the past years. Besides established techniques such as single-row repairs, new techniques such as double-row reconstructions have gained increasing interest. The present article therefore provides an overview of the currently available literature on both repair techniques with respect to several anatomical, biomechanical, clinical and structural endpoints. Systematic literature review of biomechanical, clinical and radiographic studies investigating or comparing single- and double-row techniques. These results were evaluated and compared to provide an overview on benefits and drawbacks of the respective repair type. Reconstructions of the tendon-to-bone unit for full-thickness tears in either single- or double-row technique differ with respect to several endpoints. Double-row repair techniques provide more anatomical reconstructions of the footprint and superior initial biomechanical characteristics when compared to single-row repair. With regard to clinical results, no significant differences were found while radiological data suggest a better structural tendon integrity following double-row fixation. Presently published clinical studies cannot emphasize a clearly superior technique at this time. Available biomechanical studies are in favour of double-row repair. Radiographic studies suggest a beneficial effect of double-row reconstruction on structural integrity of the reattached tendon or reduced recurrent defect rates, respectively.

  18. A Prospective Randomized Clinical Trial of Single vs. Double Layer Closure of Hysterotomy at the Time of Cesarean Delivery: The Effect on Uterine Scar Thickness.

    PubMed

    Bamberg, Christian; Dudenhausen, Joachim W; Bujak, Verena; Rodekamp, Elke; Brauer, Martin; Hinkson, Larry; Kalache, Karim; Henrich, Wolfgang

    2018-06-01

     We undertook a randomized clinical trial to examine the outcome of a single vs. a double layer uterine closure using ultrasound to assess uterine scar thickness.  Participating women were allocated to one of three uterotomy suture techniques: continuous single layer unlocked suturing, continuous locked single layer suturing, or double layer suturing. Transvaginal ultrasound of uterine scar thickness was performed 6 weeks and 6 - 24 months after Cesarean delivery. Sonographers were blinded to the closure technique.  An "intent-to-treat" and "as treated" ANOVA analysis included 435 patients (n = 149 single layer unlocked suturing, n = 157 single layer locked suturing, and n = 129 double layer suturing). 6 weeks postpartum, the median scar thickness did not differ among the three groups: 10.0 (8.5 - 12.3 mm) single layer unlocked vs. 10.1 (8.2 - 12.7 mm) single layer locked vs. 10.8 (8.1 - 12.8 mm) double layer; (p = 0.84). At the time of the second follow-up, the uterine scar was not significantly (p = 0.06) thicker if the uterus had been closed with a double layer closure 7.3 (5.7 - 9.1 mm), compared to single layer unlocked 6.4 (5.0 - 8.8 mm) or locked suturing techniques 6.8 (5.2 - 8.7 mm). Women who underwent primary or elective Cesarean delivery showed a significantly (p = 0.03, p = 0.02, "as treated") increased median scar thickness after double layer closure vs. single layer unlocked suture.  A double layer closure of the hysterotomy is associated with a thicker myometrium scar only in primary or elective Cesarean delivery patients. © Georg Thieme Verlag KG Stuttgart · New York.

  19. Aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe.

    PubMed

    Lu, Ying; Li, Xianchan; Zhang, Limin; Yu, Ping; Su, Lei; Mao, Lanqun

    2008-03-15

    This study describes a facile and general strategy for the development of aptamer-based electrochemical sensors with a high specificity toward the targets and a ready regeneration feature. Very different from the existing strategies for the development of electrochemical aptasensors with the aptamers as the probes, the strategy proposed here is essentially based on the utilization of the aptamer-complementary DNA (cDNA) oligonucleotides as the probes for electrochemical sensing. In this context, the sequences at both ends of the cDNA are tailor-made to be complementary and both the redox moiety (i.e., ferrocene in this study) and thiol group are labeled onto the cDNA. The labeled cDNA are hybridized with their respective aptamers (i.e., ATP- and thrombin-binding aptamers in this study) to form double-stranded DNA (ds-DNA) and the electrochemical aptasensors are prepared by self-assembling the labeled ds-DNA onto Au electrodes. Upon target binding, the aptamers confined onto electrode surface dissociate from their respective cDNA oligonucleotides into the solution and the single-stranded cDNA could thus tend to form a hairpin structure through the hybridization of the complementary sequences at both its ends. Such a conformational change of the cDNA resulting from the target binding-induced dissociation of the aptamers essentially leads to the change in the voltammetric signal of the redox moiety labeled onto the cDNA and thus constitutes the mechanism for the electrochemical aptasensors for specific target sensing. The aptasensors demonstrated here with the cDNA as the probe are readily regenerated and show good responses toward the targets. This study may offer a new and relatively general approach to electrochemical aptasensors with good analytical properties and potential applications.

  20. Substance P immunoreactivity exhibits frequent colocalization with kisspeptin and neurokinin B in the human infundibular region.

    PubMed

    Hrabovszky, Erik; Borsay, Beáta Á; Rácz, Kálmán; Herczeg, László; Ciofi, Philippe; Bloom, Stephen R; Ghatei, Mohammad A; Dhillo, Waljit S; Liposits, Zsolt

    2013-01-01

    Neurons synthesizing neurokinin B (NKB) and kisspeptin (KP) in the hypothalamic arcuate nucleus represent important upstream regulators of pulsatile gonadotropin-releasing hormone (GnRH) neurosecretion. In search of neuropeptides co-expressed in analogous neurons of the human infundibular nucleus (Inf), we have carried out immunohistochemical studies of the tachykinin peptide Substance P (SP) in autopsy samples from men (21-78 years) and postmenopausal (53-83 years) women. Significantly higher numbers of SP-immunoreactive (IR) neurons and darker labeling were observed in the Inf of postmenopausal women than in age-matched men. Triple-immunofluorescent studies localized SP immunoreactivity to considerable subsets of KP-IR and NKB-IR axons and perikarya in the infundibular region. In postmenopausal women, 25.1% of NKB-IR and 30.6% of KP-IR perikarya contained SP and 16.5% of all immunolabeled cell bodies were triple-labeled. Triple-, double- and single-labeled SP-IR axons innervated densely the portal capillaries of the infundibular stalk. In quadruple-labeled sections, these axons formed occasional contacts with GnRH-IR axons. Presence of SP in NKB and KP neurons increases the functional complexity of the putative pulse generator network. First, it is possible that SP modulates the effects of KP and NKB in axo-somatic and axo-dendritic afferents to GnRH neurons. Intrinsic SP may also affect the activity and/or neuropeptide release of NKB and KP neurons via autocrine/paracrine actions. In the infundibular stalk, SP may influence the KP and NKB secretory output via additional autocrine/paracrine mechanisms or regulate GnRH neurosecretion directly. Finally, possible co-release of SP with KP and NKB into the portal circulation could underlie further actions on adenohypophysial gonadotrophs.

  1. Single-neuron labeling with inducible cre-mediated knockout in transgenic mice

    PubMed Central

    Young, Paul; Qiu, Li; Wang, Dongqing; Zhao, Shengli; Gross, James; Feng, Guoping

    2011-01-01

    To facilitate functional analysis of neuronal connectivity in a mammalian nervous system tightly packed with billions of cells, we developed a new technique that allows inducible genetic manipulations within fluorescently labeled single neurons in mice. We term this technique SLICK for Single-neuron Labeling with Inducible Cre-mediated Knockout. SLICK is achieved by co-expressing a drug-inducible form of cre recombinase and a fluorescent protein within the same small subsets of neurons. Thus, SLICK combines the powerful cre recombinase system for conditional genetic manipulation and the fluorescent labeling of single neurons for imaging. We demonstrate efficient inducible genetic manipulation in several types of neurons using SLICK. Furthermore, we apply SLICK to eliminate synaptic transmission in a small subset of neuromuscular junctions. Our results provide evidence for the long-term stability of inactive neuromuscular synapses in adult animals. More broadly, these studies demonstrate a cre-LoxP compatible system for dissecting gene functions in single identifiable neurons. PMID:18454144

  2. A comparative clinical evaluation of arthroscopic single-row versus double-row supraspinatus tendon repair.

    PubMed

    Buess, Eduard; Waibl, Bernhard; Vogel, Roger; Seidner, Robert

    2009-10-01

    Cadaveric studies and commercial pressure have initiated a strong trend towards double-row repair in arthroscopic cuff surgery. The objective of this study was to evaluate if the biomechanical advantages of a double-row supraspinatus tendon repair would result in superior clinical outcome and higher abduction strength. A retrospective study of two groups of 32 single-row and 33 double-row repairs of small to medium cuff tears was performed. The Simple Shoulder Test (SST) and a visual analog scale for pain were used to evaluate the outcome. The participation rate was 100%. A subset of patients was further investigated with the Constant Score (CS) including electronic strength measurement. The double-row repair patients had significantly more (p = 0.01) yes answers in the SST than the single-row group, and pain reduction was slightly better (p = 0.03). No difference was found for the relative CS (p = 0.86) and abduction strength (p = 0.74). Patient satisfaction was 100% for double-row and 97% for single-row repair. Single- and double-row repairs both achieved excellent clinical results. Evidence of superiority of double-row repair is still scarce and has to be balanced against the added complexity of the procedure and higher costs.

  3. Comparing five front-of-pack nutrition labels' influence on consumers' perceptions and purchase intentions.

    PubMed

    Gorski Findling, Mary T; Werth, Paul M; Musicus, Aviva A; Bragg, Marie A; Graham, Dan J; Elbel, Brian; Roberto, Christina A

    2018-01-01

    In 2011, a National Academy of Medicine report recommended that packaged food in the U.S. display a uniform front-of-package nutrition label, using a system such as a 0-3 star ranking. Few studies have directly compared this to other labels to determine which best informs consumers and encourages healthier purchases. In 2013, we randomized adult participants (N=1247) in an Internet-based survey to one of six conditions: no label control; single traffic light; multiple traffic light; Facts Up Front; NuVal; or 0-3 star ranking. We compared groups on purchase intentions and accuracy of participants' interpretation of food labels. There were no differences in the nutritional quality of hypothetical shopping baskets across conditions (p=0.845). All labels improved consumers' abilities to judge the nutritional quality of foods relative to no label, but the best designs varied by outcomes. NuVal and multiple traffic light labels led to the greatest accuracy identifying the healthier of two products (p<0.001), while the multiple traffic light also led to the most accurate estimates of saturated fat, sugar, and sodium (p<0.001). The single traffic light outperformed other labels when participants compared nutrient levels between similar products (p<0.03). Single/multiple traffic light and Facts Up Front labels led to the most accurate calories per serving estimations (p<0.001). Although front-of-package labels helped participants more accurately assess products' nutrition information relative to no label, no conditions shifted adults' purchase intentions. Results did not point to a clearly superior label design, but they suggest that a 3-star label might not be best for educating consumers. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Immunocytochemical localization of calretinin in the superficial layers of the cat superior colliculus.

    PubMed

    Hong, Soo-Kyung; Kim, Jee-Young; Jeon, Chang-Jin

    2002-11-01

    We localized calretinin-immunoreactive (IR) fibers and cells in the superior colliculus (SC) of the cat and studied the distribution and effect of enucleation on the distribution of this protein. Calretinin was localized with antibody immunocytochemistry. A dense plexus of anti-calretinin-IR fibers was found within the upper part of the superficial gray layer. Almost all of the labeled fibers were small diameter fibers with few varicosities. Monocular enucleation produced an almost complete reduction of calretinin-IR fibers in the SC contralateral to the enucleation. Furthermore, many calretinin-IR cells appeared in the contralateral SC. The newly appeared cells had small- to medium-sized vertical fusiform, oval or round, or stellate cell bodies. Two-color immunofluorescence revealed that no cells in the superficial layers expressed both calretinin and GABA. Many retinal ganglion cells were labeled after injections of retrograde axonal transport horseradish peroxidase (HRP) in the superficial layers. However, no large cells were double-labeled with calretinin and HRP. More than 95% of the double-labeled cells were small cells (<15 microm). Based on the retinal ganglion cell size, we believe that the vast majority of calretinin-IR retinocollicular fibers in cat SC are small gamma type cells that have W type physiologies.

  5. Connexin composition in apposed gap junction hemiplaques revealed by matched double-replica freeze-fracture replica immunogold labeling.

    PubMed

    Rash, John E; Kamasawa, Naomi; Davidson, Kimberly G V; Yasumura, Thomas; Pereda, Alberto E; Nagy, James I

    2012-06-01

    Despite the combination of light-microscopic immunocytochemistry, histochemical mRNA detection techniques and protein reporter systems, progress in identifying the protein composition of neuronal versus glial gap junctions, determination of the differential localization of their constituent connexin proteins in two apposing membranes and understanding human neurological diseases caused by connexin mutations has been problematic due to ambiguities introduced in the cellular and subcellular assignment of connexins. Misassignments occurred primarily because membranes and their constituent proteins are below the limit of resolution of light microscopic imaging techniques. Currently, only serial thin-section transmission electron microscopy and freeze-fracture replica immunogold labeling have sufficient resolution to assign connexin proteins to either or both sides of gap junction plaques. However, freeze-fracture replica immunogold labeling has been limited because conventional freeze fracturing allows retrieval of only one of the two membrane fracture faces within a gap junction, making it difficult to identify connexin coupling partners in hemiplaques removed by fracturing. We now summarize progress in ascertaining the connexin composition of two coupled hemiplaques using matched double-replicas that are labeled simultaneously for multiple connexins. This approach allows unambiguous identification of connexins and determination of the membrane "sidedness" and the identities of connexin coupling partners in homotypic and heterotypic gap junctions of vertebrate neurons.

  6. 9 CFR 381.443 - Significant participation for voluntary nutrition labeling.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... voluntary nutrition labeling. 381.443 Section 381.443 Animals and Animal Products FOOD SAFETY AND INSPECTION... Nutrition Labeling § 381.443 Significant participation for voluntary nutrition labeling. (a) In evaluating significant participation for voluntary nutrition labeling, FSIS will consider only the major cuts of single...

  7. 9 CFR 317.343 - Significant participation for voluntary nutrition labeling.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... voluntary nutrition labeling. 317.343 Section 317.343 Animals and Animal Products FOOD SAFETY AND INSPECTION... Nutrition Labeling § 317.343 Significant participation for voluntary nutrition labeling. (a) In evaluating significant participation for voluntary nutrition labeling, FSIS will consider only the major cuts of single...

  8. Effect of single- and double-row rotator cuff repair at the tendon-to-bone interface: preliminary results using an in vivo sheep model.

    PubMed

    Baums, M H; Schminke, B; Posmyk, A; Miosge, N; Klinger, H-M; Lakemeier, S

    2015-01-01

    The clinical superiority of the double-row technique is still a subject of controversial debate in rotator cuff repair. We hypothesised that the expression of different collagen types will differ between double-row and single-row rotator cuff repair indicating a faster healing response by the double-row technique. Twenty-four mature female sheep were randomly assembled to two different groups in which a surgically created acute infraspinatus tendon tear was fixed using either a modified single- or double-row repair technique. Shoulder joints from female sheep cadavers of identical age, bone maturity, and weight served as untreated control cluster. Expression of type I, II, and III collagen was observed in the tendon-to-bone junction along with recovering changes in the fibrocartilage zone after immunohistological tissue staining at 1, 2, 3, 6, 12, and 26 weeks postoperatively. Expression of type III collagen remained positive until 6 weeks after surgery in the double-row group, whereas it was detectable for 12 weeks in the single-row group. In both groups, type I collagen expression increased after 12 weeks. Type II collagen expression was increased after 12 weeks in the double-row versus single-row group. Clusters of chondrocytes were only visible between week 6 and 12 in the double-row group. The study demonstrates differences regarding the expression of type I and type III collagen in the tendon-to-bone junction following double-row rotator cuff repair compared to single-row repair. The healing response in this acute repair model is faster in the double-row group during the investigated healing period.

  9. Repeat Rifaximin for Irritable Bowel Syndrome: No Clinically Significant Changes in Stool Microbial Antibiotic Sensitivity.

    PubMed

    Pimentel, M; Cash, B D; Lembo, A; Wolf, R A; Israel, R J; Schoenfeld, P

    2017-09-01

    Rifaximin has demonstrated efficacy and safety for diarrhea-predominant irritable bowel syndrome (IBS-D). To determine the rifaximin repeat treatment effect on fecal bacterial antibiotic susceptibility. Patients with IBS in Trial 3 (TARGET 3) study who responded to open-label rifaximin 550 mg three times daily for 2 weeks, with symptom recurrence within 18 weeks, were randomized to double-blind treatment: two 2-week repeat courses of rifaximin or placebo, separated by 10 weeks. Prospective stool sample collection occurred before and after open-label rifaximin, before and after the first repeat course, and at the end of the study. Susceptibility testing was performed with 11 antibiotics, including rifaximin and rifampin, using broth microdilution or agar dilution methods. Of 103 patients receiving open-label rifaximin, 73 received double-blind rifaximin (n = 37) or placebo (n = 36). A total of 1429 bacterial and yeast isolates were identified, of which Bacteroidaceae (36.7%) and Enterobacteriaceae (33.9%) were the most common. In the double-blind phase, Clostridium difficile was highly susceptible to rifaximin [minimum inhibitory concentration (MIC) range 0.008-1 µg/mL] and rifampin (MIC range 0.004-0.25 µg/mL). Following double-blind rifaximin treatment, Staphylococcus isolates remained susceptible to rifaximin at all visits (MIC 50 range ≤0.06-32 µg/mL). Rifaximin exposure was not associated with long-term cross-resistance of Bacteroidaceae, Enterobacteriaceae, and Enterococcaceae to rifampin or nonrifamycin antibiotics tested. In this study, short-term repeat treatment with rifaximin has no apparent long-term effect on stool microbial susceptibility to rifaximin, rifampin, and nonrifamycin antibiotics. CLINICALTRIALS. NCT01543178.

  10. Double-Resonance Facilitated Decomposion of Emission Spectra

    NASA Astrophysics Data System (ADS)

    Kato, Ryota; Ishikawa, Haruki

    2016-06-01

    Emission spectra provide us with rich information about the excited-state processes such as proton-transfer, charge-transfer and so on. In the cases that more than one excited states are involved, emission spectra from different excited states sometimes overlap and a decomposition of the overlapped spectra is desired. One of the methods to perform a decomposition is a time-resolved fluorescence technique. It uses a difference in time evolutions of components involved. However, in the gas-phase, a concentration of the sample is frequently too small to carry out this method. On the other hand, double-resonance technique is a very powerful tool to discriminate or identify a common species in the spectra in the gas-phase. Thus, in the present study, we applied the double-resonance technique to resolve the overlapped emission spectra. When transient IR absorption spectra of the excited state are available, we can label the population of the certain species by the IR excitation with a proper selection of the IR wavenumbers. Thus, we can obtain the emission spectra of labeled species by subtracting the emission spectra with IR labeling from that without IR. In the present study, we chose the charge-transfer emission spectra of cyanophenyldisilane (CPDS) as a test system. One of us reported that two charge-transfer (CT) states are involved in the intramolecular charge-transfer (ICT) process of CPDS-water cluster and recorded the transient IR spectra. As expected, we have succeeded in resolving the CT emission spectra of CPDS-water cluster by the double resonance facilitated decomposion technique. In the present paper, we will report the details of the experimental scheme and the results of the decomposition of the emission spectra. H. Ishikawa, et al., Chem. Phys. Phys. Chem., 9, 117 (2007).

  11. A comparison of muscular activity during single and double mouse clicks.

    PubMed

    Thorn, Stefan; Forsman, Mikael; Hallbeck, Susan

    2005-05-01

    Work-related musculoskeletal disorders (WMSDs) in the neck/shoulder region and the upper extremities are a common problem among computer workers. Occurrences of motor unit (MU) double discharges with very short inter-firing intervals (doublets) have been hypothesised as a potential additional risk for overuse of already exhausted fibres during long-term stereotyped activity. Doublets are reported to be present during double-click mouse work tasks. A few comparative studies have been carried out on overall muscle activities for short-term tasks with single types of actions, but none on occurrences of doublets during double versus single clicks. The main purpose of this study was to compare muscle activity levels of single and double mouse clicks during a long-term combined mouse/keyboard work task. Four muscles were studied: left and right upper trapezius, right extensor digitorum communis (EDC) and right flexor carpi ulnaris. Additionally, MU activity was analysed through intramuscular electromyography in the EDC muscle for a selection of subjects. The results indicate that double clicking produces neither higher median or 90th percentile levels in the trapezius and EDC muscles, nor a higher disposition for MU doublets, than does single clicking. Especially for the 90th percentile levels, the indications are rather the opposite (in the EDC significantly higher during single clicks in 8 of 11 subjects, P < 0.05). Although it cannot be concluded from the present study that double clicks are harmless, there were no signs that double clicks during computer work generally constitute a larger risk factor for WMSDs than do single clicks.

  12. Exploratory Decision-Tree Modeling of Data from the Randomized REACTT Trial of Tadalafil Versus Placebo to Predict Recovery of Erectile Function After Bilateral Nerve-Sparing Radical Prostatectomy.

    PubMed

    Montorsi, Francesco; Oelke, Matthias; Henneges, Carsten; Brock, Gerald; Salonia, Andrea; d'Anzeo, Gianluca; Rossi, Andrea; Mulhall, John P; Büttner, Hartwig

    2016-09-01

    Understanding predictors for the recovery of erectile function (EF) after nerve-sparing radical prostatectomy (nsRP) might help clinicians and patients in preoperative counseling and expectation management of EF rehabilitation strategies. To describe the effect of potential predictors on EF recovery after nsRP by post hoc decision-tree modeling of data from A Study of Tadalafil After Radical Prostatectomy (REACTT). Randomized double-blind double-dummy placebo-controlled trial in 423 men aged <68 yr with adenocarcinoma of the prostate (Gleason ≤7, normal preoperative EF) who underwent nsRP at 50 centers from nine European countries and Canada. Postsurgery 1:1:1 randomization to 9-mo double-blind treatment with tadalafil 5mg once a day (OaD), tadalafil 20mg on demand, or placebo, followed by a 6-wk drug-free-washout, and a 3-mo open-label tadalafil OaD treatment. Three decision-tree models, using the International Index of Erectile Function-Erectile Function (IIEF-EF) domain score at the end of double-blind treatment, washout, and open-label treatment as response variable. Each model evaluated the association between potential predictors: presurgery IIEF domain and IIEF single-item scores, surgical approach, nerve-sparing score (NSS), and postsurgery randomized treatment group. The first decision-tree model (n=422, intention-to-treat population) identified high presurgery sexual desire (IIEF item 12: ≥3.5 and <3.5) as the key predictor for IIEF-EF at the end of double-blind treatment (mean IIEF-EF: 14.9 and 11.1), followed by high confidence to get and maintain an erection (IIEF item 15: ≥3.5 and <3.5; IIEF-EF: 15.4 and 7.1). For patients meeting these criteria, additional non-IIEF-related predictors included robot-assisted laparoscopic surgery (yes or no; IIEF-EF: 19.3 and 12.6), quality of nerve sparing (NSS: <2.5 and ≥2.5; IIEF-EF: 14.3 and 10.5), and treatment with tadalafil OaD (yes and no; IIEF-EF: 17.6 and 14.3). Additional analyses after washout and open-label treatment identified high presurgery intercourse satisfaction as the key predictor. Exploratory decision-tree analyses identified high presurgery sexual desire, confidence, and intercourse satisfaction as key predictors for EF recovery. Patients meeting these criteria might benefit the most from conserving surgery and early postsurgery EF rehabilitation. Strategies for improving EF after surgery should be discussed preoperatively with all patients; this information may support expectation management for functional recovery on an individual patient level. Understanding how patient characteristics and different treatment options affect the recovery of erectile function (EF) after radical surgery for prostate cancer might help physicians select the optimal treatment for their patients. This analysis of data from a clinical trial suggested that high presurgery sexual desire, sexual confidence, and intercourse satisfaction are key factors predicting EF recovery. Patients meeting these criteria might benefit the most from conserving surgery (robot-assisted surgery, perfect nerve sparing) and postsurgery medical rehabilitation of EF. ClinicalTrials.gov, NCT01026818. Copyright © 2016. Published by Elsevier B.V.

  13. Formation of template-switching artifacts by linear amplification.

    PubMed

    Chakravarti, Dhrubajyoti; Mailander, Paula C

    2008-07-01

    Linear amplification is a method of synthesizing single-stranded DNA from either a single-stranded DNA or one strand of a double-stranded DNA. In this protocol, molecules of a single primer DNA are extended by multiple rounds of DNA synthesis at high temperature using thermostable DNA polymerases. Although linear amplification generates the intended full-length single-stranded product, it is more efficient over single-stranded templates than double-stranded templates. We analyzed linear amplification over single- or double-stranded mouse H-ras DNA (exon 1-2 region). The single-stranded H-ras template yielded only the intended product. However, when the double-stranded template was used, additional artifact products were observed. Increasing the concentration of the double-stranded template produced relatively higher amounts of these artifact products. One of the artifact DNA bands could be mapped and analyzed by sequencing. It contained three template-switching products. These DNAs were formed by incomplete DNA strand extension over the template strand, followed by switching to the complementary strand at a specific Ade nucleotide within a putative hairpin sequence, from which DNA synthesis continued over the complementary strand.

  14. Double labeling of human leukemic cells using /sup 3/H-cytarabine and monoclonal antibody against bromodeoxyuridine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Raza, A.; Preisler, H.D.

    A new technique using immunofluorescence and autoradiography is described, in which the DNA of cells in S phase are labeled with two different probes. This method makes it possible to study the relationship between DNA synthesis and the uptake and/or incorporation of chemotherapeutic agents into normal or neoplastic cells. An example is provided in which the incorporation of /sup 3/H-cytarabine into DNA is demonstrated to occur only in cells which were synthesizing DNA during exposure to /sup 3/H-cytarabine. Other radioactively labeled probes can be used as well.

  15. Enzymatic production of single-molecule FISH and RNA capture probes.

    PubMed

    Gaspar, Imre; Wippich, Frank; Ephrussi, Anne

    2017-10-01

    Arrays of singly labeled short oligonucleotides that hybridize to a specific target revolutionized RNA biology, enabling quantitative, single-molecule microscopy analysis and high-efficiency RNA/RNP capture. Here, we describe a simple and efficient method that allows flexible functionalization of inexpensive DNA oligonucleotides by different fluorescent dyes or biotin using terminal deoxynucleotidyl transferase and custom-made functional group conjugated dideoxy-UTP. We show that (i) all steps of the oligonucleotide labeling-including conjugation, enzymatic synthesis, and product purification-can be performed in a standard biology laboratory, (ii) the process yields >90%, often >95% labeled product with minimal carryover of impurities, and (iii) the oligonucleotides can be labeled with different dyes or biotin, allowing single-molecule FISH, RNA affinity purification, and Northern blot analysis to be performed. © 2017 Gaspar et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  16. Single Cell Fluorescence Imaging Using Metal Plasmon-Coupled Probe

    PubMed Central

    Zhang, Jian; Fu, Yi; Lakowicz, Joseph R.

    2009-01-01

    This work constitutes the first fluorescent imaging of cells using metal plasmon-coupled probes (PCPs) at single cell resolution. N-(2-Mercapto-propionyl)glycine-coated silver nanoparticles were synthesized by reduction of silver nitrate using sodium borohyride and then succinimidylated via ligand exchange. Alexa Fluor 647-labeled concanavalin A (con A) was chemically bound to the silver particles to make the fluorescent metal plasmon-coupled probes. The fluorescence images were collected using a scanning confocal microscopy. The fluorescence intensity was observed to enhance 7-fold when binding the labeled con A on a single silver particle. PCPs were conjugated on HEK 293 A cells. Imaging results demonstrate that cells labeled by PCPs were 20-fold brighter than those by free labeled con A. PMID:17375898

  17. Synthesis of double-stranded RNA in a virus-enriched fraction from Agaricus bisporus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sriskantha, A.; Wach, P.; Schlagnhaufer, B.

    Partially purified virus preparations from sporophores of Agaricus bisporus affected with LaFrance disease had up to a 15-fold-higher RNA-dependent RNA polymerase activity than did comparable preparations from health sporophores. Enzyme activity was dependent upon the presence of Mg/sup 2 +/ and the four nucleoside triphosphates and was insensitive to actinomycin D, ..cap alpha..-amanitin, and rifampin. The /sup 3/H-labeled enzyme reaction products were double-stranded RNA (dsRNA) as indicated by CF-11 cellulose column chromatography and by their ionic-strength-dependent sensitivity to hydrolysis by RNase A. The principal dsRNA products had estimated molecular weights of 4.3 /times/ 10/sup 6/ and 1.4 /times/ 10/sup 6/.more » Cs/sub 2/SO/sub 4/ equilibrium centrifugation of the virus preparation resolved a single peak of RNA polymerase activity that banded with a 35-nm spherical virus particle containing dsRNAs with molecular weights of 4.3 /times/ 10/sup 6/ and 1.4 /times/ 10/sup 6/. The data suggest that the RNA-dependent RNA polymerase associated with the 35-nm spherical virus is a replicase which catalyzes the synthesis of the genomic dsRNAs.« less

  18. Size-dependent cell separation and enrichment using double spiral microchannels

    NASA Astrophysics Data System (ADS)

    Hu, Guoqing; Liu, Chao; Sun, Jiashu; Jiang, Xingyu

    2012-11-01

    Much attention has been directed toward microfluidic technologies that can help improve circulating tumor cells (CTCs) separation from the blood sample. In the present work, we develop a double spiral microfluidic platform with one inlet and three outlets that allows for passive, label-free tumor cell enrichment with high throughput and efficiency, inspired by the single spiral cell sorter. The curved channel induces a Dean drag force acting on cells to compete with the inertial lift, resulting in large tumor cells to be focused and deflected into the middle outlet while small hematologic cells are removed from the inner outlet. We continuously isolated and enriched the rare tumor cells (MCF-7 and Hela cells) from diluted whole blood using the same geometry. At a spike ratio of 100 tumor cells per million hematologic cells, 92.28% of blood cells and 96.77% of tumor cells were collected at the inner and middle outlet, respectively, at the throughput of 33.3 million cells per minute. A numerical model is developed to simulate the Dean flows inside the curved geometry and to track the particle/cell trajectories, which is validated against the experimental observations and serves as a theoretical foundation in optimizing the operating conditions.

  19. Strand displacement activated peroxidase activity of hemin for fluorescent DNA sensing.

    PubMed

    Wang, Quanbo; Xu, Nan; Gui, Zhen; Lei, Jianping; Ju, Huangxian; Yan, Feng

    2015-10-07

    To efficiently regulate the catalytic activity of the peroxidase mimic hemin, this work designs a double-stranded DNA probe containing an intermolecular dimer of hemin, whose peroxidase activity can be activated by a DNA strand displacement reaction. The double-stranded probe is prepared by annealing two strands of hemin labelled DNA oligonucleotides. Using the fluorescent oxidation product of tyramine by H2O2 as a tracing molecule, the low peroxidase activity of the hemin dimer ensures a low fluorescence background. The strand displacement reaction of the target DNA dissociates the hemin dimer and thus significantly increases the catalytic activity of hemin to produce a large amount of dityramine for fluorescence signal readout. Based on the strand displacement regulated peroxidase activity, a simple and sensitive homogeneous fluorescent DNA sensing method is proposed. The detection can conveniently be carried out in a 96-well plate within 20 min with a detection limit of 0.18 nM. This method shows high specificity, which can effectively distinguish single-base mismatched DNA from perfectly matched target DNA. The DNA strand displacement regulated catalytic activity of hemin has promising application in the determination of various DNA analytes.

  20. A retrospective comparative study of arthroscopic fixation in acute Rockwood type IV acromioclavicular joint dislocation: single versus double paired Endobutton technique.

    PubMed

    Xu, Jian; Liu, Haifeng; Lu, Wei; Li, Dingfu; Zhu, Weimin; Ouyang, Kan; Wu, Bing; Peng, Liangquan; Wang, Daping

    2018-05-24

    Rockwood type IV acromioclavicular joint (ACJ) dislocation is a trauma usually needs surgical treatment. Paired EndoButton technique (PET) is used in treating such condition. However, the effect of using different types of PET (single versus double PET) for fixation remains controversial. This study aims to evaluate and compare the efficacy of single and double PET and to provide a suitable option for the surgeons. We retrospectively reviewed the charts of patients with acute Rockwood type IV ACJ dislocation who had undergone arthroscopic fixation using single or double PET fixation between March 2009 and March 2015. Seventy-eight consecutive patients identified from chart review were picked and were divided into the single and double PET group with 39 cases in each group. The indexes of visual analog scale score (VAS) for pain, the radiographs of the affected shoulder at different time points of the follow-up, the time of return to activities and sports, the constant functional score, and the Karlsson acromioclavicular joint (ACJ) score, were assessed in a minimum of 2 years postoperation. The average coracoclavicular (CC) and acromioclavicular (AC) distances of the affected joints in the double PET group were significantly smaller than those of the single PET group 2 years postoperation (P < 0.05). The average AC and CC distances in the healthy shoulder joints were significantly smaller than those of the affected joints in the single PET group (P < 0.05); however, these values were not significantly different from those of the affected joints in the double PET group (P > 0.05). The mean VAS pain score was not significantly different, while significant difference was found for the number and times of cases return to activities and sports, constant functional score, and Karlsson ACJ score (P < 0.05) between the two groups. Therefore, the double PET group has better outcome than the single PET group. Complications including redislocation, button slippage, erosion, or AC joint instability occurred in the single PET group, while the complication in the double PET group was rare. Compared with the single PET, the double PET group achieved better outcome with less complications in arthroscopically treating acute Rockwood type IV ACJ dislocation.

  1. 9 CFR 317.343 - Significant participation for voluntary nutrition labeling.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... voluntary nutrition labeling. 317.343 Section 317.343 Animals and Animal Products FOOD SAFETY AND INSPECTION... Nutrition Labeling § 317.343 Significant participation for voluntary nutrition labeling. Link to an... nutrition labeling, FSIS will consider only the major cuts of single-ingredient, raw meat products, as...

  2. 9 CFR 381.443 - Significant participation for voluntary nutrition labeling.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... voluntary nutrition labeling. 381.443 Section 381.443 Animals and Animal Products FOOD SAFETY AND INSPECTION... Nutrition Labeling § 381.443 Significant participation for voluntary nutrition labeling. Link to an... nutrition labeling, FSIS will consider only the major cuts of single-ingredient, raw poultry products, as...

  3. A universal procedure for primer labelling of amplicons.

    PubMed Central

    Neilan, B A; Wilton, A N; Jacobs, D

    1997-01-01

    Detection and visualisation of nucleic acids is integral to genome analyses. Exponential amplification procedures have provided the means for the manipulation of nucleic acid sequences, which were otherwise inaccessible. We describe the development and application of a universal method for the labelling of any PCR product using a single end-labelled primer. Amplification was performed in a single reaction with the resulting amplicon labelled to a high specific activity. The method was adapted to a wide range of PCRs and significantly reduced the expense of such analyses. PMID:9207046

  4. Label-Free Fluorescent DNA Dendrimers for microRNA Detection Based On Nonlinear Hybridization Chain Reaction-Mediated Multiple G-Quadruplex with Low Background Signal.

    PubMed

    Xue, Qingwang; Liu, Chunxue; Li, Xia; Dai, Li; Wang, Huaisheng

    2018-04-18

    Various fluorescent sensing systems for miRNA detection have been developed, but they mostly contain enzymatic amplification reactions and label procedures. The strict reaction conditions of tool enzymes and the high cost of labeling limit their potential applications, especially in complex biological matrices. Here, we have addressed the difficult problems and report a strategy for label-free fluorescent DNA dendrimers based on enzyme-free nonlinear hybridization chain reaction (HCR)-mediated multiple G-quadruplex for simple, sensitive, and selective detection of miRNAs with low-background signal. In the strategy, a split G-quadruplex (3:1) sequence is ingeniously designed at both ends of two double-stranded DNAs, which is exploited as building blocks for nonlinear HCR assembly, thereby acquiring a low background signal. A hairpin switch probe (HSP) was employed as recognition and transduction element. Upon sensing the target miRNA, the nonlinear HCR assembly of two blocks (blocks-A and blocks-B) was initiated with the help of two single-stranded DNA assistants, resulting in chain-branching growth of DNA dendrimers with multiple G-quadruplex incorporation. With the zinc(II)-protoporphyrin IX (ZnPPIX) selectively intercalated into the multiple G-quadruplexes, fluorescent DNA dendrimers were obtained, leading to an exponential fluorescence intensity increase. Benefiting from excellent performances of nonlinear HCR and low background signal, this strategy possesses the characteristics of a simplified reaction operation process, as well as high sensitivity. Moreover, the proposed fluorescent sensing strategy also shows preferable selectivity, and can be implemented without modified DNA blocks. Importantly, the strategy has also been tested for miRNA quantification with high confidence in breast cancer cells. Thus, this proposed strategy for label-free fluorescent DNA dendrimers based on a nonlinear HCR-mediated multiple G-quadruplex will be turned into an alternative approach for simple, sensitive, and selective miRNA quantification.

  5. Use of ChAd3-EBO-Z Ebola virus vaccine in Malian and US adults, and boosting of Malian adults with MVA-BN-Filo: a phase 1, single-blind, randomised trial, a phase 1b, open-label and double-blind, dose-escalation trial, and a nested, randomised, double-blind, placebo-controlled trial.

    PubMed

    Tapia, Milagritos D; Sow, Samba O; Lyke, Kirsten E; Haidara, Fadima Cheick; Diallo, Fatoumata; Doumbia, Moussa; Traore, Awa; Coulibaly, Flanon; Kodio, Mamoudou; Onwuchekwa, Uma; Sztein, Marcelo B; Wahid, Rezwanul; Campbell, James D; Kieny, Marie-Paule; Moorthy, Vasee; Imoukhuede, Egeruan B; Rampling, Tommy; Roman, Francois; De Ryck, Iris; Bellamy, Abbie R; Dally, Len; Mbaya, Olivier Tshiani; Ploquin, Aurélie; Zhou, Yan; Stanley, Daphne A; Bailer, Robert; Koup, Richard A; Roederer, Mario; Ledgerwood, Julie; Hill, Adrian V S; Ballou, W Ripley; Sullivan, Nancy; Graham, Barney; Levine, Myron M

    2016-01-01

    The 2014 west African Zaire Ebola virus epidemic prompted worldwide partners to accelerate clinical development of replication-defective chimpanzee adenovirus 3 vector vaccine expressing Zaire Ebola virus glycoprotein (ChAd3-EBO-Z). We aimed to investigate the safety, tolerability, and immunogenicity of ChAd3-EBO-Z in Malian and US adults, and assess the effect of boosting of Malians with modified vaccinia Ankara expressing Zaire Ebola virus glycoprotein and other filovirus antigens (MVA-BN-Filo). In the phase 1, single-blind, randomised trial of ChAd3-EBO-Z in the USA, we recruited adults aged 18-65 years from the University of Maryland medical community and the Baltimore community. In the phase 1b, open-label and double-blind, dose-escalation trial of ChAd3-EBO-Z in Mali, we recruited adults 18-50 years of age from six hospitals and health centres in Bamako (Mali), some of whom were also eligible for a nested, randomised, double-blind, placebo-controlled trial of MVA-BN-Filo. For randomised segments of the Malian trial and for the US trial, we randomly allocated participants (1:1; block size of six [Malian] or four [US]; ARB produced computer-generated randomisation lists; clinical staff did randomisation) to different single doses of intramuscular immunisation with ChAd3-EBO-Z: Malians received 1 × 10(10) viral particle units (pu), 2·5 × 10(10) pu, 5 × 10(10) pu, or 1 × 10(11) pu; US participants received 1 × 10(10) pu or 1 × 10(11) pu. We randomly allocated Malians in the nested trial (1:1) to receive a single dose of 2 × 10(8) plaque-forming units of MVA-BN-Filo or saline placebo. In the double-blind segments of the Malian trial, investigators, clinical staff, participants, and immunology laboratory staff were masked, but the study pharmacist (MK), vaccine administrator, and study statistician (ARB) were unmasked. In the US trial, investigators were not masked, but participants were. Analyses were per protocol. The primary outcome was safety, measured with occurrence of adverse events for 7 days after vaccination. Both trials are registered with ClinicalTrials.gov, numbers NCT02231866 (US) and NCT02267109 (Malian). Between Oct 8, 2014, and Feb 16, 2015, we randomly allocated 91 participants in Mali (ten [11%] to 1 × 10(10) pu, 35 [38%] to 2·5 × 10(10) pu, 35 [38%] to 5 × 10(10) pu, and 11 [12%] to 1 × 10(11) pu) and 20 in the USA (ten [50%] to 1 × 10(10) pu and ten [50%] to 1 × 10(11) pu), and boosted 52 Malians with MVA-BN-Filo (27 [52%]) or saline (25 [48%]). We identified no safety concerns with either vaccine: seven (8%) of 91 participants in Mali (five [5%] received 5 × 10(10) and two [2%] received 1 × 10(11) pu) and four (20%) of 20 in the USA (all received 1 × 10(11) pu) given ChAd3-EBO-Z had fever lasting for less than 24 h, and 15 (56%) of 27 Malians boosted with MVA-BN-Filo had injection-site pain or tenderness. 1 × 10(11) pu single-dose ChAd3-EBO-Z could suffice for phase 3 efficacy trials of ring-vaccination containment needing short-term, high-level protection to interrupt transmission. MVA-BN-Filo boosting, although a complex regimen, could confer long-lived protection if needed (eg, for health-care workers). Wellcome Trust, Medical Research Council UK, Department for International Development UK, National Cancer Institute, Frederick National Laboratory for Cancer Research, Federal Funds from National Institute of Allergy and Infectious Diseases. Copyright © 2016 Tapia et al. Open Access article distributed under the terms of CC BY. Published by Elsevier Ltd.. All rights reserved.

  6. Interference experiment with asymmetric double slit by using 1.2-MV field emission transmission electron microscope.

    PubMed

    Harada, Ken; Akashi, Tetsuya; Niitsu, Kodai; Shimada, Keiko; Ono, Yoshimasa A; Shindo, Daisuke; Shinada, Hiroyuki; Mori, Shigeo

    2018-01-17

    Advanced electron microscopy technologies have made it possible to perform precise double-slit interference experiments. We used a 1.2-MV field emission electron microscope providing coherent electron waves and a direct detection camera system enabling single-electron detections at a sub-second exposure time. We developed a method to perform the interference experiment by using an asymmetric double-slit fabricated by a focused ion beam instrument and by operating the microscope under a "pre-Fraunhofer" condition, different from the Fraunhofer condition of conventional double-slit experiments. Here, pre-Fraunhofer condition means that each single-slit observation was performed under the Fraunhofer condition, while the double-slit observations were performed under the Fresnel condition. The interference experiments with each single slit and with the asymmetric double slit were carried out under two different electron dose conditions: high-dose for calculation of electron probability distribution and low-dose for each single electron distribution. Finally, we exemplified the distribution of single electrons by color-coding according to the above three types of experiments as a composite image.

  7. Efficacy and safety of a single 2 mg dose or 4 mg double dose of alteplase for 50 occluded chest ports using a unique instillation technique

    PubMed Central

    Sharma, Rajinder P; Ree, Chung Ja; Ree, Alexander

    2008-01-01

    PURPOSE: To evaluate the effectiveness and safety of a single 2 mg dose or a 4 mg double dose of alteplase for restoring function in occluded chest ports. METHODS: A prospective, open-label, nonblinded study was performed on 40 enrolled patients with a total of 50 chest ports at the Henry Ford Hospital Interventional Radiology Department (Detroid, Michigan, USA). Alteplase (Cathflo Activase; Genentech, USA), a recombinant tissue plasminogen activator produced by recombinant DNA technology, was used to restore the function of 50 occluded chest ports. Occlusion was defined as the inability to withdraw blood freely from the port, or the inability to flush the port easily. A 2 mg (2 mL) dose of alteplase was injected into the port through a Huber needle, using a gentle push and pull technique, and was left to dwell for 30 min. If the port remained occluded after the initial 2 mg alteplase treatment, an additional 2 mg alteplase treatment was administered with the same dwell time of 30 min. If a port had remained occluded despite the above regimen, this outcome would have been considered a failure and the chest port would have required surgical intervention. However, all ports were successfully treated, and no surgical intervention was required. The safety end points included minor or major hemorrhages, such as intracranial hemorrhages, or sepsis. Safety end points were determined by a 24 h follow-up telephone call. RESULTS: Of the 50 chest ports (30 single ports and 10 double ports) treated with alteplase, 36 required 2 mg (72%) and 14 required 4 mg (28%). The efficacy end point was 100% for all chest ports treated, without any adverse events. CONCLUSION: High efficacy and safety rates of restoring function in occluded chest ports were obtained with 2 mg or 4 mg doses of alteplase. Part of this high efficacy rate may be due to the gentle push and pull technique used in the present study. PMID:22477414

  8. Methylphenidate, cognition, and epilepsy: A double-blind, placebo-controlled, single-dose study.

    PubMed

    Adams, Jesse; Alipio-Jocson, Valerie; Inoyama, Katherine; Bartlett, Victoria; Sandhu, Saira; Oso, Jemima; Barry, John J; Loring, David W; Meador, Kimford

    2017-01-31

    To evaluate the potential efficacy of immediate-release methylphenidate (MPH) for treating cognitive deficits in epilepsy. This was a double-blind, randomized, single-dose, 3-period crossover study in patients with epilepsy and chronic cognitive complaints comparing the effects of placebo and MPH 10 and 20 mg given 1 week apart. Cognitive outcome was evaluated on the basis of an omnibus z score calculated from performance on the Conners Continuous Performance Test 3 (ability to discriminate between target and nontarget stimuli [d'] and hit reaction time standard deviation), Symbol-Digit Modalities Test, and Medical College of Georgia Paragraph Memory Test. Adverse events and seizure frequency were monitored. An open-label follow-up is reported elsewhere. Thirty-five adult patients with epilepsy participated, of whom 31 finished. Demographics included the following: mean age = 35.3 years (range 20-62 years), 13 men and 18 women, and baseline seizure frequency of 2.8 per month. Epilepsy types were focal (n = 24), generalized (n = 6), or unclassified (n = 1). Mean epilepsy duration was 12.5 years. A statistically significant performance benefit was present at both 10-mg (p = 0.030) and 20-mg (p = 0.034) MPH doses. No seizures were associated with either MPH dose. Adverse effects leading to withdrawal included cognitive "fogginess" (n = 1 on 20 mg), anxiety/agitation (n = 1 on 10 mg), and tachycardia (n = 1). One participant was lost to follow-up after one 20-mg dose without side effect. This single-dose study suggests that MPH may be effective in ameliorating some cognitive deficits in patients with epilepsy. Additional studies are required. NCT02178995. This study provides Class II evidence that single doses of MPH improve cognitive performance on some measures of attention and processing speed in patients with epilepsy and cognitive complaints. © 2016 American Academy of Neurology.

  9. Millimeter-wave optical double resonance schemes for rapid assignment of perturbed spectra, with applications to the C{sup ~} {sup 1}B{sub 2} state of SO{sub 2}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Park, G. Barratt, E-mail: barratt@mit.edu, E-mail: barratt.park@gmail.com; Womack, Caroline C.; Jiang, Jun

    2015-04-14

    Millimeter-wave detected, millimeter-wave optical double resonance (mmODR) spectroscopy is a powerful tool for the analysis of dense, complicated regions in the optical spectra of small molecules. The availability of cavity-free microwave and millimeter wave spectrometers with frequency-agile generation and detection of radiation (required for chirped-pulse Fourier-transform spectroscopy) opens up new schemes for double resonance experiments. We demonstrate a multiplexed population labeling scheme for rapid acquisition of double resonance spectra, probing multiple rotational transitions simultaneously. We also demonstrate a millimeter-wave implementation of the coherence-converted population transfer scheme for background-free mmODR, which provides a ∼10-fold sensitivity improvement over the population labeling scheme.more » We analyze perturbations in the C{sup ~} state of SO{sub 2}, and we rotationally assign a b{sub 2} vibrational level at 45 328 cm{sup −1} that borrows intensity via a c-axis Coriolis interaction. We also demonstrate the effectiveness of our multiplexed mmODR scheme for rapid acquisition and assignment of three predissociated vibrational levels of the C{sup ~} state of SO{sub 2} between 46 800 and 47 650 cm{sup −1}.« less

  10. High-bandwidth detection of short DNA in nanopipettes.

    PubMed

    Fraccari, Raquel L; Carminati, Marco; Piantanida, Giacomo; Leontidou, Tina; Ferrari, Giorgio; Albrecht, Tim

    2016-12-12

    Glass or quartz nanopipettes have found increasing use as tools for studying the biophysical properties of DNA and proteins, and as sensor devices. The ease of fabrication, favourable wetting properties and low capacitance are some of the inherent advantages, for example compared to more conventional, silicon-based nanopore chips. Recently, we have demonstrated high-bandwidth detection of double-stranded (ds) DNA with microsecond time resolution in nanopipettes, using custom-designed electronics. The electronics design has now been refined to include more sophisticated control features, such as integrated bias reversal and other features. Here, we exploit these capabilities and probe the translocation of short dsDNA in the 100 bp range, in different electrolytes. Single-stranded (ss) DNA of similar length are in use as capture probes, so label-free detection of their ds counterparts could therefore be of relevance in disease diagnostics.

  11. Synthesis of macrocyclic polyaminocarboxylates and their use for preparing stable radiometal antibody immunoconjugates for therapy, SPECT and PET imaging

    DOEpatents

    Mease, R.C.; Mausner, L.F.; Srivastava, S.C.

    1995-06-27

    A simple method for the synthesis of 1,4,7,10-tetraazacyclododecane N,N{prime}N{double_prime},N{prime}{double_prime}-tetraacetic acid and 1,4,8,11-tetraazacyclotetradecane N,N{prime},N{double_prime},N{prime}{double_prime}-tetraacetic acid involves cyanomethylating 1,4,7,10-tetraazacyclododecane or 1,4,8,11-tetraazacyclotetradecane to form a tetranitrile and hydrolyzing the tetranitrile. These macrocyclic compounds are functionalized through one of the carboxylates and then conjugated to various biological molecules including monoclonal antibodies. The resulting conjugated molecules are labeled with radiometals for SPECT and PET imaging and for radiotherapy. 4 figs.

  12. Incidence of retear with double-row versus single-row rotator cuff repair.

    PubMed

    Shen, Chong; Tang, Zhi-Hong; Hu, Jun-Zu; Zou, Guo-Yao; Xiao, Rong-Chi

    2014-11-01

    Rotator cuff tears have a high recurrence rate, even after arthroscopic rotator cuff repair. Although some biomechanical evidence suggests the superiority of the double-row vs the single-row technique, clinical findings regarding these methods have been controversial. The purpose of this study was to determine whether the double-row repair method results in a lower incidence of recurrent tearing compared with the single-row method. Electronic databases were systematically searched to identify reports of randomized, controlled trials (RCTs) comparing single-row with double-row rotator cuff repair. The primary outcome assessed was retear of the repaired cuff. Secondary outcome measures were the American Shoulder and Elbow Surgeons (ASES) shoulder score, the Constant shoulder score, and the University of California, Los Angeles (UCLA) score. Heterogeneity between the included studies was assessed. Six studies involving 428 patients were included in the review. Compared with single-row repair, double-row repair demonstrated a lower retear incidence (risk ratio [RR]=1.71 [95% confidence interval (CI), 1.18-2.49]; P=.005; I(2)=0%) and a reduced incidence of partial-thickness retears (RR=2.16 [95% CI, 1.26-3.71]; P=.005; I(2)=26%). Functional ASES, Constant, and UCLA scores showed no difference between single- and double-row cuff repairs. Use of the double-row technique decreased the incidence of retears, especially partial-thickness retears, compared with the single-row technique. The functional outcome was not significantly different between the 2 techniques. To improve the structural outcome of the repaired rotator cuff, surgeons should use the double-row technique. However, further long-term RCTs on this topic are needed. Copyright 2014, SLACK Incorporated.

  13. Solution-processed zinc oxide nanoparticles/single-walled carbon nanotubes hybrid thin-film transistors

    NASA Astrophysics Data System (ADS)

    Liu, Fangmei; Sun, Jia; Qian, Chuan; Hu, Xiaotao; Wu, Han; Huang, Yulan; Yang, Junliang

    2016-09-01

    Solution-processed thin-film transistors (TFTs) are the essential building blocks for manufacturing the low-cost and large-area consumptive electronics. Herein, solution-processed TFTs based on the composites of zinc oxide (ZnO) nanoparticles and single-walled carbon nanotubes (SWCNTs) were fabricated by the methods of spin-coating and doctor-blading. Through controlling the weight of SWCNTs, the ZnO/SWCNTs TFTs fabricated by spin-coating demonstrated a field-effect mobility of 4.7 cm2/Vs and a low threshold voltage of 0.8 V, while the TFTs devices fabricated by doctor-blading technique showed reasonable electrical performance with a mobility of 0.22 cm2/Vs. Furthermore, the ion-gel was used as an efficient electrochemical gate dielectric because of its large electric double-layer capacitance. The operating voltage of all the TFTs devices is as low as 4.0 V. The research suggests that ZnO/SWCNTs TFTs have the potential applications in low-cost, large-area and flexible consumptive electronics, such as chemical-biological sensors and smart label.

  14. Nanostructured gold microelectrodes for SERS and EIS measurements by incorporating ZnO nanorod growth with electroplating

    PubMed Central

    Zong, Xianli; Zhu, Rong; Guo, Xiaoliang

    2015-01-01

    In this paper, a fine gold nanostructure synthesized on selective planar microelectrodes in micro-chip is realized by using an advanced hybrid fabrication approach incorporating growth of nanorods (NRs) with gold electroplating. By this developed nanostructure, integration of in-situ surface-enhanced Raman spectroscopy (SERS) detection with electrochemical impedance spectroscopy (EIS) measurement for label-free, nondestructive, real-time and rapid monitoring on a single cell has been achieved. Moreover, parameters of Au nanostructures such as size of nanoholes/nanogaps can be controllably adjusted in the fabrication. We have demonstrated a SERS enhancement factor of up to ~2.24 × 106 and double-layer impedance decrease ratio of 90% ~ 95% at low frequency range below 200 kHz by using nanostructured microelectrodes. SERS detection and in-situ EIS measurement of a trapped single cell by using planar microelectrodes are realized to demonstrate the compatibility, multi-functions, high-sensitivity and simplicity of the micro-chip system. This dual function platform integrating SERS and EIS is of great significance in biological, biochemical and biomedical applications. PMID:26558325

  15. Production of isotopically labeled standards from a uniformly labeled precursor for quantitative volatile metabolomic studies.

    PubMed

    Gómez-Cortés, Pilar; Brenna, J Thomas; Sacks, Gavin L

    2012-06-19

    Optimal accuracy and precision in small-molecule profiling by mass spectrometry generally requires isotopically labeled standards chemically representative of all compounds of interest. However, preparation of mixed standards from commercially available pure compounds is often prohibitively expensive and time-consuming, and many labeled compounds are not available in pure form. We used a single-prototype uniformly labeled [U-(13)C]compound to generate [U-(13)C]-labeled volatile standards for use in subsequent experimental profiling studies. [U-(13)C]-α-Linolenic acid (18:3n-3, ALA) was thermally oxidized to produce labeled lipid degradation volatiles which were subsequently characterized qualitatively and quantitatively. Twenty-five [U-(13)C]-labeled volatiles were identified by headspace solid-phase microextraction-gas chromatography/time-of-flight mass spectrometry (HS-SPME-GC/TOF-MS) by comparison of spectra with unlabeled volatiles. Labeled volatiles were quantified by a reverse isotope dilution procedure. Using the [U-(13)C]-labeled standards, limits of detection comparable to or better than those of previous HS-SPME reports were achieved, 0.010-1.04 ng/g. The performance of the [U-(13)C]-labeled volatile standards was evaluated using a commodity soybean oil (CSO) oxidized at 60 °C from 0 to 15 d. Relative responses of n-decane, an unlabeled internal standard otherwise absent from the mixture, and [U-(13)C]-labeled oxidation products changed by up to 8-fold as the CSO matrix was oxidized, demonstrating that reliance on a single standard in volatile profiling studies yields inaccurate results due to changing matrix effects. The [U-(13)C]-labeled standard mixture was used to quantify 25 volatiles in oxidized CSO and low-ALA soybean oil with an average relative standard deviation of 8.5%. Extension of this approach to other labeled substrates, e.g., [U-(13)C]-labeled sugars and amino acids, for profiling studies should be feasible and can dramatically improve quantitative results compared to use of a single standard.

  16. Comparison of chain sampling plans with single and double sampling plans

    NASA Technical Reports Server (NTRS)

    Stephens, K. S.; Dodge, H. F.

    1976-01-01

    The efficiency of chain sampling is examined through matching of operating characteristics (OC) curves of chain sampling plans (ChSP) with single and double sampling plans. In particular, the operating characteristics of some ChSP-0, 3 and 1, 3 as well as ChSP-0, 4 and 1, 4 are presented, where the number pairs represent the first and the second cumulative acceptance numbers. The fact that the ChSP procedure uses cumulative results from two or more samples and that the parameters can be varied to produce a wide variety of operating characteristics raises the question whether it may be possible for such plans to provide a given protection with less inspection than with single or double sampling plans. The operating ratio values reported illustrate the possibilities of matching single and double sampling plans with ChSP. It is shown that chain sampling plans provide improved efficiency over single and double sampling plans having substantially the same operating characteristics.

  17. Giant plasmon excitation in single and double ionization of C60 by fast highly charged Si and O ions

    NASA Astrophysics Data System (ADS)

    Kelkar, A. H.; Kadhane, U.; Misra, D.; Tribedi, L. C.

    2007-09-01

    Se have investigated single and double ionization of C60 molecule in collisions with 2.33 MeV/u Siq+ (q=6-14) and 3.125 MeV/u Oq+ (q=5-8) projectiles. The projectile charge state dependence of the single and double ionization yields of C60 are then compared to those for an ion-atom collision system using Ne gas as a target. A large difference between the gas and the cluster target behaviour was partially explained in terms of a model based on collective excitation namely the giant dipole plasmon resonance (GDPR). The qualitative agreement between the data and GDPR model prediction for single and double ionization signifies the importance of single and double plasmon excitations in the ionization process. A large deviation of the GDPR model for triple and quadruple ionization from the experimental data imply the importance of the other low impact parameter processes such as evaporation, fragmentation and a possible solid-like dynamical screening.

  18. Efficacy and safety of saxagliptin in combination with insulin in Japanese patients with type 2 diabetes mellitus: a 16-week double-blind randomized controlled trial with a 36-week open-label extension.

    PubMed

    Kadowaki, Takashi; Muto, Satsuki; Ouchi, Yoshiumi; Shimazaki, Ryutaro; Seino, Yutaka

    2017-12-01

    We examined the efficacy and safety of saxagliptin as an add-on to insulin in Japanese patients with type 2 diabetes mellitus. We randomized 240 patients with type 2 diabetes mellitus on insulin monotherapy to 5-mg saxagliptin or placebo as add-on therapy for a 16-week, double-blind period. All patients received 5-mg saxagliptin and insulin for an additional 36 weeks (open-label extension). Change in hemoglobin A1c (HbA1c) at Week 16 was the main endpoint. At Week 16, the adjusted change in HbA1c from baseline increased by 0.51% with placebo and decreased by 0.40% with saxagliptin (difference -0.92% [95% confidence interval -1.07%, -0.76%; p < 0.001]). In patients receiving saxagliptin, reductions in HbA1c at Week 16 were maintained to Week 52, while switching from placebo to saxagliptin resulted in a similar reduction in HbA1c. The incidence of hypoglycemia was not markedly increased with saxagliptin versus placebo in the double-blind period and did not increase substantially during the open-label extension period. The efficacy and safety of saxagliptin was similar between the elderly and non-elderly patient groups. Adding saxagliptin to ongoing insulin therapy improved glycemic control and was well tolerated in Japanese patients with type 2 diabetes.

  19. Maintenance N-acetyl cysteine treatment for bipolar disorder: a double-blind randomized placebo controlled trial.

    PubMed

    Berk, Michael; Dean, Olivia M; Cotton, Sue M; Gama, Clarissa S; Kapczinski, Flavio; Fernandes, Brisa; Kohlmann, Kristy; Jeavons, Susan; Hewitt, Karen; Moss, Kirsteen; Allwang, Christine; Schapkaitz, Ian; Cobb, Heidi; Bush, Ashley I; Dodd, Seetal; Malhi, Gin S

    2012-08-14

    N-acetyl cysteine (NAC) is a glutathione precursor that has been shown to have antidepressant efficacy in a placebo-controlled trial. The current study aimed to investigate the maintenance effects of NAC following eight weeks of open-label treatment for bipolar disorder. The efficacy of a double blind randomized placebo controlled trial of 2 g/day NAC as adjunct maintenance treatment for bipolar disorder was examined. Participants (n = 149) had a Montgomery Asberg Depression Rating Score of ≥12 at trial entry and, after eight weeks of open-label NAC treatment, were randomized to adjunctive NAC or placebo, in addition to treatment as usual. Participants (primarily outpatients) were recruited through public and private services and through newspaper advertisements. Time to intervention for a mood episode was the primary endpoint of the study, and changes in mood symptoms, functionality and quality of life measures were secondary outcomes. There was a substantial decrease in symptoms during the eight-week open-label NAC treatment phase. During the subsequent double-blind phase, there was minimal further change in outcome measures with scores remaining low. Consequently, from this low plateau, between-group differences did not emerge on recurrence, clinical functioning or quality of life measures. There were no significant between-group differences in recurrence or symptomatic outcomes during the maintenance phase of the trial; however, these findings may be confounded by limitations. The trial was registered with the Australian New Zealand Clinical Trials Registry (ACTRN12607000074493).

  20. A double-blind, placebo-controlled study of risperidone in adults with autistic disorder and other pervasive developmental disorders.

    PubMed

    McDougle, C J; Holmes, J P; Carlson, D C; Pelton, G H; Cohen, D J; Price, L H

    1998-07-01

    Neurobiological research has implicated the dopamine and serotonin systems in the pathogenesis of autism. Open-label reports suggest that the serotonin2A-dopamine D2 antagonist risperidone may be safe and effective in reducing the interfering symptoms of patients with autism. Thirty-one adults (age [mean+/-SD], 28.1+/-7.3 years) with autistic disorder (n=17) or pervasive developmental disorder not otherwise specified (n=14) participated in a 12-week double-blind, placebo-controlled trial of risperidone. Patients treated with placebo subsequently received a 12-week open-label trial of risperidone. For persons completing the study, 8 (57%) of 14 patients treated with risperidone were categorized as responders (daily dose [mean+/-SD], 2.9+/-1.4 mg) compared with none of 16 in the placebo group (P<.002). Risperidone was superior to placebo in reducing repetitive behavior (P<.001), aggression (P<.001), anxiety or nervousness (P<.02), depression (P<.03), irritability (P<.01), and the overall behavioral symptoms of autism (P<.02). Objective, measurable change in social behavior and language did not occur. Nine (60%) of 15 patients who received treatment with open-label risperidone following the double-blind placebo phase responded. Other than mild, transient sedation, risperidone was well tolerated, with no evidence of extrapyramidal effects, cardiac events, or seizures. Risperidone is more effective than placebo in the short-term treatment of symptoms of autism in adults.

  1. A label-free colorimetric isothermal cascade amplification for the detection of disease-related nucleic acids based on double-hairpin molecular beacon.

    PubMed

    Wu, Dong; Xu, Huo; Shi, Haimei; Li, Weihong; Sun, Mengze; Wu, Zai-Sheng

    2017-03-08

    K-Ras mutations at codon 12 play an important role in an early step of carcinogenesis. Here, a label-free colorimetric isothermal cascade amplification for ultrasensitive and specific detection of K-Ras point mutation is developed based on a double-hairpin molecular beacon (DHMB). The biosensor consists of DHMB probe and a primer-incorporated polymerization template (PPT) designed partly complementary to DHMB. In the presence of polymerase, target DNA is designed to trigger strand displacement amplification (SDA) via promote the hybridization of PPT with DHMB and subsequently initiates cascade amplification process with the help of the nicking endonuclease. During the hybridization and enzymatic reaction, G-quadruplex/hemin DNAzymes are generated, catalyzing the oxidation of ABTS 2- by H 2 O 2 in the presence of hemin. Utilizing the proposed facile colorimetric scheme, the target DNA can be quantified down to 4 pM with the dynamic response range of 5 orders of magnitude, indicating the substantially improved detection capability. Even more strikingly, point mutation in K-ras gene can be readily observed by the naked eye without the need for the labeling or expensive equipment. Given the high-performance for K-Ras analysis, the enhanced signal transduction capability associated with double-hairpin structure of DHMB provides a novel rout to screen biomarkers, and the descripted colorimetric biosensor seems to hold great promise for diagnostic applications of genetic diseases. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. An ex vivo mechanical evaluation of single versus double semitubular plate fixation of a transverse distal-third scapular osteotomy in the dog.

    PubMed

    Mair, Jacqueline J; Belkoff, Stephen M; Boudrieau, Randy J

    2003-01-01

    To compare single versus double semitubular plate fixation for scapular body fractures. Ex vivo mechanical study. Eighteen paired cadaveric canine scapulae. Transverse scapular body osteotomies were created in the distal third of 18 pairs of scapulae. One scapula of each pair was repaired with a single plate, whereas the contralateral scapula was repaired with 2 plates. Initial strength and stiffness of the constructs were measured in 10 pairs of scapulae. Eight pairs of scapulae underwent cyclic loading and then were subjected to failure testing. Double-plate fixation was significantly stronger (3,899 +/- 632 N) but not stiffer (614 +/- 130 N/mm) than the single-plate fixation (3,238 +/- 935 N and 537 +/- 202 N/mm, respectively). Cyclic loading variables were not significantly different between the 2 methods of fixation. After cyclic loading, double-plate fixation was significantly stronger (2,916 +/- 618 N) than single-plate fixation (2,347 +/- 495 N). There was no significant difference (P =.11) in stiffness between double- versus single-plate fixations: 734 +/- 247 N/mm and 595 +/- 139 N/mm, respectively. Double-plate fixation was generally stronger and stiffer than single-plate fixation. Because all constructs failed at loads that greatly exceeded those estimated to occur clinically, any difference between the 2 methods of fixation probably is not clinically relevant. Single-plate fixation may be of sufficient strength for fixation of scapular body fractures. Copyright 2003 by The American College of Veterinary Surgeons

  3. 16 CFR 303.29 - Labeling of pairs or products containing two or more units.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... handled as a single product or ensemble and are sold and delivered to the ultimate consumer as a single product or ensemble, the required information may be set out on a single label in such a manner as to... other textile fiber products are marketed or handled in pairs or ensembles of the same fiber content...

  4. 16 CFR 300.12 - Labeling of pairs or products containing two or more units.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... handled as a single product or ensemble and are sold and delivered to the ultimate consumer as a single product or ensemble, the required information may be set out on a single label in such a manner as to... other wool products are marketed or handled in pairs or ensembles of the same fiber content, only one...

  5. 16 CFR 303.29 - Labeling of pairs or products containing two or more units.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... handled as a single product or ensemble and are sold and delivered to the ultimate consumer as a single product or ensemble, the required information may be set out on a single label in such a manner as to... other textile fiber products are marketed or handled in pairs or ensembles of the same fiber content...

  6. 16 CFR 300.12 - Labeling of pairs or products containing two or more units.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... handled as a single product or ensemble and are sold and delivered to the ultimate consumer as a single product or ensemble, the required information may be set out on a single label in such a manner as to... other wool products are marketed or handled in pairs or ensembles of the same fiber content, only one...

  7. 16 CFR 303.29 - Labeling of pairs or products containing two or more units.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... handled as a single product or ensemble and are sold and delivered to the ultimate consumer as a single product or ensemble, the required information may be set out on a single label in such a manner as to... other textile fiber products are marketed or handled in pairs or ensembles of the same fiber content...

  8. 16 CFR 300.12 - Labeling of pairs or products containing two or more units.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... handled as a single product or ensemble and are sold and delivered to the ultimate consumer as a single product or ensemble, the required information may be set out on a single label in such a manner as to... other wool products are marketed or handled in pairs or ensembles of the same fiber content, only one...

  9. 16 CFR 300.12 - Labeling of pairs or products containing two or more units.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... handled as a single product or ensemble and are sold and delivered to the ultimate consumer as a single product or ensemble, the required information may be set out on a single label in such a manner as to... other wool products are marketed or handled in pairs or ensembles of the same fiber content, only one...

  10. 16 CFR 303.29 - Labeling of pairs or products containing two or more units.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... handled as a single product or ensemble and are sold and delivered to the ultimate consumer as a single product or ensemble, the required information may be set out on a single label in such a manner as to... other textile fiber products are marketed or handled in pairs or ensembles of the same fiber content...

  11. 16 CFR 300.12 - Labeling of pairs or products containing two or more units.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... handled as a single product or ensemble and are sold and delivered to the ultimate consumer as a single product or ensemble, the required information may be set out on a single label in such a manner as to... other wool products are marketed or handled in pairs or ensembles of the same fiber content, only one...

  12. 16 CFR 303.29 - Labeling of pairs or products containing two or more units.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... handled as a single product or ensemble and are sold and delivered to the ultimate consumer as a single product or ensemble, the required information may be set out on a single label in such a manner as to... other textile fiber products are marketed or handled in pairs or ensembles of the same fiber content...

  13. Comparison of Single-Stick and Double-Stick Techniques for Percutaneous Nephrostomy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Funaki, Brian, E-mail: bfunaki@midway.uchicago.edu; Vatakencherry, Geogi

    2004-01-15

    We compared single- and double-stick techniques of percutaneous nephrostomy insertion by retrospectively reviewing 140 percutaneous nephrostomy procedures in 101 patients. All procedures were performed by residents or fellows with direct attending supervision. Either the single-stick or double-stick technique was used based solely on personal attending preference. There were no significant differences in groups in terms of age, sex, or degree of hydronephrosis. In the single-stick technique, the kidney was punctured with sonographic guidance and the tract was serially dilated to accept an 8.5 Fr. nephrostomy catheter. In the double-stick technique, the kidney was punctured with sonographic guidance and a mixturemore » of air and contrast were injected into the collecting system. The affected side was then elevated and a posterior calyx was punctured using fluoroscopic guidance. Both groups were compared in terms of complications and early tube dysfunction using the chi-squared test. All procedures were successful without immediate complications. Bleeding requiring transfusion occurred in 4.7% (4/86) procedures in the single stick group and 3.7% (2/54) in the double stick group (p-value not significant). None of these patients required further interventions for bleeding. Tube dysfunction leading to premature tube exchange occurred in 3.5% (3/86) of catheters in the single stick group and 3.7% (2/54) of catheters in the double- stick group (p-value not significant). We found no significant difference between the single and double- stick methods of percutaneous nephrostomy in terms of success rates, complications, or tube function. We believe that the single-stick method should be adopted as the insertion technique of choice.« less

  14. Micromachined quartz crystal resonator arrays for bioanalytical applications

    NASA Astrophysics Data System (ADS)

    Kao, Ping

    This work presents the design, fabrication and investigation of high frequency quartz crystal resonator arrays and their application for analyzing interfacial layers and sensing purposes. An 8-pixel micromachined quartz crystal resonator array with a fundamental resonance frequency of ˜66 MHz has been fabricated, tested and used in this work. One dimensional model for the characterization of resonator behavior for single or multiple viscoelastic layers under liquid ambient are developed by continuum mechanics approach as well as using an equivalent electrical admittance analysis approach. The investigation of thin interfacial layer between solid (electrode) and liquid phases are reported in terms of the improved resolution of viscoelasitc characteristics of adsorbed layer arising from the use of high frequency resonators. Analyzed layers include globular proteins layer under phosphate buffer solution (PBS) with molecular weights spanning three orders of magnitude, multilayers of avidin and biotin labeled bovine albumin under PBS and diffuse double layer induced by DC bias under 0.5 M sulfuric acid solution. The second half of the dissertation focuses on biosensing applications of quartz resonator arrays. The selective functionalization of 3,3'-Dithiobis (sulfosuccinimidylpropionate) (DTSSP) by physical masking method was first used for specifically detecting avidin molecules. The selective immobilization of thiol modified single stranded DNA probes via electrochemical methods was used for the specific detection of Respiratory Syncytial Virus (RSV) G-gene. The work demonstrates that micromachined quartz crystal resonator arrays could be a powerful analytical tool of investigating interfacial region and can be readily configured as biosenors that can be used for label-free, quantitative assays using extremely small volumes of analytes.

  15. Therapy-related longitudinal brain perfusion changes in patients with chronic pelvic pain syndrome.

    PubMed

    Weisstanner, Christian; Mordasini, Livio; Thalmann, George N; Verma, Rajeev K; Rummel, Christian; Federspiel, Andrea; Kessler, Thomas M; Wiest, Roland

    2017-08-03

    The imaging method most frequently employed to identify brain areas involved in neuronal processing of nociception and brain pain perception is blood oxygenation level-dependent (BOLD) magnetic resonance imaging (MRI). Arterial spin labelling (ASL), in contrast, offers advantages when slow varying changes in brain function are investigated. Chronic pelvic pain syndrome (CPPS) is a disorder of, mostly, young males that leads to altered pain perceptions in structures related to the pelvis. We aimed to investigate the potential of ASL to monitor longitudinal cranial blood flow (CBF) changes in patients with CPPS. In a randomised, placebo-controlled, double-blind single centre trial, we investigated treatment effects in CPPS after 12 weeks in patients that underwent sono-electro-magnetic therapy vs placebo. We investigated changes of CBF related to treatment outcome using pseudo-continuous arterial spin labelling (pCASL)-MRI. We observed CBF downregulation in the prefrontal cortex and anterior cingulate cortex and upregulation in the dorsolateral prefrontal cortex in responders. Nonresponders presented with CBF upregulation in the hippocampus. In patients with a history of CPPS of less than 12 months, there were significant correlations between longitudinal CBF changes and the Chronic Prostatitis Symptom Index pain subscore within the joint clusters anterior cingulate cortex and left anterior prefrontal cortex in responders, and the right hippocampus in nonresponders. We demonstrated therapy-related and stimulus-free longitudinal CBF changes in core areas of the pain matrix using ASL. ASL may act as a complementary noninvasive method to functional MRI and single-photon emission computed tomography / positron emission tomography, especially in the longitudinal assessment of pain response in clinical trials.

  16. Label-Free Detection of Sequence-Specific DNA Based on Fluorescent Silver Nanoclusters-Assisted Surface Plasmon-Enhanced Energy Transfer.

    PubMed

    Ma, Jin-Liang; Yin, Bin-Cheng; Le, Huynh-Nhu; Ye, Bang-Ce

    2015-06-17

    We have developed a label-free method for sequence-specific DNA detection based on surface plasmon enhanced energy transfer (SPEET) process between fluorescent DNA/AgNC string and gold nanoparticles (AuNPs). DNA/AgNC string, prepared by a single-stranded DNA template encoded two emitter-nucleation sequences at its termini and an oligo spacer in the middle, was rationally designed to produce bright fluorescence emission. The proposed method takes advantage of two strategies. The first one is the difference in binding properties of single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) toward AuNPs. The second one is SPEET process between fluorescent DNA/AgNC string and AuNPs, in which fluorescent DNA/AgNC string can be spontaneously adsorbed onto the surface of AuNPs and correspondingly AuNPs serve as "nanoquencher" to quench the fluorescence of DNA/AgNC string. In the presence of target DNA, the sensing probe hybridized with target DNA to form duplex DNA, leading to a salt-induced AuNP aggregation and subsequently weakened SPEET process between fluorescent DNA/AgNC string and AuNPs. A red-to-blue color change of AuNPs and a concomitant fluorescence increase were clearly observed in the sensing system, which had a concentration dependent manner with specific DNA. The proposed method achieved a detection limit of ∼2.5 nM, offering the following merits of simple design, convenient operation, and low experimental cost because of no chemical modification, organic dye, enzymatic reaction, or separation procedure involved.

  17. How securely is the testicular artery occluded in the spermatic cord by using a ligature?

    PubMed

    Rijkenhuizen, A B M; Sommerauer, S; Fasching, M; Velde, K; Peham, C

    2013-09-01

    There are no studies on the ideal ligature technique for the spermatic cord. To compare the maximal resistance pressure in the testicular artery and the maximal tensile forces to produce failure of 2 different ligature techniques used for ligation of the equine spermatic cord. The capabilities of 2 types of ligatures, single knot loop and double knot loop, were assessed using a pressure-resistance test in testicular arteries and with an in vitro mechanical evaluation of the tensile strength by single cycle-to-failure testing. In the pressure-resistance test, the mean ± s.d. peak force at failure of the single knot loop was 354.4 ± 91.7 mmHg and for the double knot loop 303.2 ± 62.0 mmHg. There was no significant difference between the maximal load to failure of the single knot loop and double knot loop technique. The pressure needed for rupture was significantly higher (P = 0.001) than for leakage. The maximal tensile force at failure of the single knot loop was significantly higher than the double knot loop (P = 0.028). There was no significant difference in load elongation properties to failure between the single knot loop and double knot loop. Although no significant differences were obtained in the pressure-resistance test, the single knot loop sustained significantly greater load to failure than the double knot loop in single cycle-to-failure testing. Based on these findings, it would appear that the performance of the single knot loop should be superior to the double knot loop. Both ligature techniques are able to withstand the normal physiological intravascular pressure. The single knot loop has the greater breaking strength of the 2 ligatures tested and is less time consuming to perform and may therefore have advantages during equine castration. © 2012 EVJ Ltd.

  18. Strategic Decision-Making Learning from Label Distributions: An Approach for Facial Age Estimation.

    PubMed

    Zhao, Wei; Wang, Han

    2016-06-28

    Nowadays, label distribution learning is among the state-of-the-art methodologies in facial age estimation. It takes the age of each facial image instance as a label distribution with a series of age labels rather than the single chronological age label that is commonly used. However, this methodology is deficient in its simple decision-making criterion: the final predicted age is only selected at the one with maximum description degree. In many cases, different age labels may have very similar description degrees. Consequently, blindly deciding the estimated age by virtue of the highest description degree would miss or neglect other valuable age labels that may contribute a lot to the final predicted age. In this paper, we propose a strategic decision-making label distribution learning algorithm (SDM-LDL) with a series of strategies specialized for different types of age label distribution. Experimental results from the most popular aging face database, FG-NET, show the superiority and validity of all the proposed strategic decision-making learning algorithms over the existing label distribution learning and other single-label learning algorithms for facial age estimation. The inner properties of SDM-LDL are further explored with more advantages.

  19. Strategic Decision-Making Learning from Label Distributions: An Approach for Facial Age Estimation

    PubMed Central

    Zhao, Wei; Wang, Han

    2016-01-01

    Nowadays, label distribution learning is among the state-of-the-art methodologies in facial age estimation. It takes the age of each facial image instance as a label distribution with a series of age labels rather than the single chronological age label that is commonly used. However, this methodology is deficient in its simple decision-making criterion: the final predicted age is only selected at the one with maximum description degree. In many cases, different age labels may have very similar description degrees. Consequently, blindly deciding the estimated age by virtue of the highest description degree would miss or neglect other valuable age labels that may contribute a lot to the final predicted age. In this paper, we propose a strategic decision-making label distribution learning algorithm (SDM-LDL) with a series of strategies specialized for different types of age label distribution. Experimental results from the most popular aging face database, FG-NET, show the superiority and validity of all the proposed strategic decision-making learning algorithms over the existing label distribution learning and other single-label learning algorithms for facial age estimation. The inner properties of SDM-LDL are further explored with more advantages. PMID:27367691

  20. Triple-Loaded Single-Row Versus Suture-Bridge Double-Row Rotator Cuff Tendon Repair With Platelet-Rich Plasma Fibrin Membrane: A Randomized Controlled Trial.

    PubMed

    Barber, F Alan

    2016-05-01

    To compare the structural healing and clinical outcomes of triple-loaded single-row with suture-bridging double-row repairs of full-thickness rotator cuff tendons when both repair constructs are augmented with platelet-rich plasma fibrin membrane. A prospective, randomized, consecutive series of patients diagnosed with full-thickness rotator cuff tears no greater than 3 cm in anteroposterior length were treated with a triple-loaded single-row (20) or suture-bridging double-row (20) repair augmented with platelet-rich plasma fibrin membrane. The primary outcome measure was cuff integrity by magnetic resonance imaging (MRI) at 12 months postoperatively. Secondary clinical outcome measures were American Shoulder and Elbow Surgeons, Rowe, Simple Shoulder Test, Constant, and Single Assessment Numeric Evaluation scores. The mean MRI interval was 12.6 months (range, 12-17 months). A total of 3 of 20 single-row repairs and 3 of 20 double-row repairs (15%) had tears at follow-up MRI. The single-row group had re-tears in 1 single tendon repair and 2 double tendon repairs. All 3 tears failed at the original attachment site (Cho type 1). In the double-row group, re-tears were found in 3 double tendon repairs. All 3 tears failed medial to the medial row near the musculotendinous junction (Cho type 2). All clinical outcome measures were significantly improved from the preoperative level (P < .0001), but there was no statistical difference between groups postoperatively. There is no MRI difference in rotator cuff tendon re-tear rate at 12 months postsurgery between a triple-loaded single-row repair or a suture-bridging double-row repair when both are augmented with platelet-rich plasma fibrin membrane. No difference could be demonstrated between these repairs on clinical outcome scores. I, Prospective randomized study. Copyright © 2016 Arthroscopy Association of North America. All rights reserved.

  1. Modelling the balance between quiescence and cell death in normal and tumour cell populations.

    PubMed

    Spinelli, Lorenzo; Torricelli, Alessandro; Ubezio, Paolo; Basse, Britta

    2006-08-01

    When considering either human adult tissues (in vivo) or cell cultures (in vitro), cell number is regulated by the relationship between quiescent cells, proliferating cells, cell death and other controls of cell cycle duration. By formulating a mathematical description we see that even small alterations of this relationship may cause a non-growing population to start growing with doubling times characteristic of human tumours. Our model consists of two age structured partial differential equations for the proliferating and quiescent cell compartments. Model parameters are death rates from and transition rates between these compartments. The partial differential equations can be solved for the steady-age distributions, giving the distribution of the cells through the cell cycle, dependent on specific model parameter values. Appropriate formulas can then be derived for various population characteristic quantities such as labelling index, proliferation fraction, doubling time and potential doubling time of the cell population. Such characteristic quantities can be estimated experimentally, although with decreasing precision from in vitro, to in vivo experimental systems and to the clinic. The model can be used to investigate the effects of a single alteration of either quiescence or cell death control on the growth of the whole population and the non-trivial dependence of the doubling time and other observable quantities on particular underlying cell cycle scenarios of death and quiescence. The model indicates that tumour evolution in vivo is a sequence of steady-states, each characterised by particular death and quiescence rate functions. We suggest that a key passage of carcinogenesis is a loss of the communication between quiescence, death and cell cycle machineries, causing a defect in their precise, cell cycle dependent relationship.

  2. Meta-analysis of Clinical and Radiographic Outcomes After Arthroscopic Single-Row Versus Double-Row Rotator Cuff Repair

    PubMed Central

    Perser, Karen; Godfrey, David; Bisson, Leslie

    2011-01-01

    Context: Double-row rotator cuff repair methods have improved biomechanical performance when compared with single-row repairs. Objective: To review clinical outcomes of single-row versus double-row rotator cuff repair with the hypothesis that double-row rotator cuff repair will result in better clinical and radiographic outcomes. Data Sources: Published literature from January 1980 to April 2010. Key terms included rotator cuff, prospective studies, outcomes, and suture techniques. Study Selection: The literature was systematically searched, and 5 level I and II studies were found comparing clinical outcomes of single-row and double-row rotator cuff repair. Coleman methodology scores were calculated for each article. Data Extraction: Meta-analysis was performed, with treatment effect between single row and double row for clinical outcomes and with odds ratios for radiographic results. The sample size necessary to detect a given difference in clinical outcome between the 2 methods was calculated. Results: Three level I studies had Coleman scores of 80, 74, and 81, and two level II studies had scores of 78 and 73. There were 156 patients with single-row repairs and 147 patients with double-row repairs, both with an average follow-up of 23 months (range, 12-40 months). Double-row repairs resulted in a greater treatment effect for each validated outcome measure in 4 studies, but the differences were not clinically or statistically significant (range, 0.4-2.2 points; 95% confidence interval, –0.19, 4.68 points). Double-row repairs had better radiographic results, but the differences were also not statistically significant (P = 0.13). Two studies had adequate power to detect a 10-point difference between repair methods using the Constant score, and 1 study had power to detect a 5-point difference using the UCLA (University of California, Los Angeles) score. Conclusions: Double-row rotator cuff repair does not show a statistically significant improvement in clinical outcome or radiographic healing with short-term follow-up. PMID:23016017

  3. Meta-analysis of Clinical and Radiographic Outcomes After Arthroscopic Single-Row Versus Double-Row Rotator Cuff Repair.

    PubMed

    Perser, Karen; Godfrey, David; Bisson, Leslie

    2011-05-01

    Double-row rotator cuff repair methods have improved biomechanical performance when compared with single-row repairs. To review clinical outcomes of single-row versus double-row rotator cuff repair with the hypothesis that double-row rotator cuff repair will result in better clinical and radiographic outcomes. Published literature from January 1980 to April 2010. Key terms included rotator cuff, prospective studies, outcomes, and suture techniques. The literature was systematically searched, and 5 level I and II studies were found comparing clinical outcomes of single-row and double-row rotator cuff repair. Coleman methodology scores were calculated for each article. Meta-analysis was performed, with treatment effect between single row and double row for clinical outcomes and with odds ratios for radiographic results. The sample size necessary to detect a given difference in clinical outcome between the 2 methods was calculated. Three level I studies had Coleman scores of 80, 74, and 81, and two level II studies had scores of 78 and 73. There were 156 patients with single-row repairs and 147 patients with double-row repairs, both with an average follow-up of 23 months (range, 12-40 months). Double-row repairs resulted in a greater treatment effect for each validated outcome measure in 4 studies, but the differences were not clinically or statistically significant (range, 0.4-2.2 points; 95% confidence interval, -0.19, 4.68 points). Double-row repairs had better radiographic results, but the differences were also not statistically significant (P = 0.13). Two studies had adequate power to detect a 10-point difference between repair methods using the Constant score, and 1 study had power to detect a 5-point difference using the UCLA (University of California, Los Angeles) score. Double-row rotator cuff repair does not show a statistically significant improvement in clinical outcome or radiographic healing with short-term follow-up.

  4. Costs of achieving live birth from assisted reproductive technology: a comparison of sequential single and double embryo transfer approaches.

    PubMed

    Crawford, Sara; Boulet, Sheree L; Mneimneh, Allison S; Perkins, Kiran M; Jamieson, Denise J; Zhang, Yujia; Kissin, Dmitry M

    2016-02-01

    To assess treatment and pregnancy/infant-associated medical costs and birth outcomes for assisted reproductive technology (ART) cycles in a subset of patients using elective double embryo (ET) and to project the difference in costs and outcomes had the cycles instead been sequential single ETs (fresh followed by frozen if the fresh ET did not result in live birth). Retrospective cohort study using 2012 and 2013 data from the National ART Surveillance System. Infertility treatment centers. Fresh, autologous double ETs performed in 2012 among ART patients younger than 35 years of age with no prior ART use who cryopreserved at least one embryo. Sequential single and double ETs. Actual live birth rates and estimated ART treatment and pregnancy/infant-associated medical costs for double ET cycles started in 2012 and projected ART treatment and pregnancy/infant-associated medical costs if the double ET cycles had been performed as sequential single ETs. The estimated total ART treatment and pregnancy/infant-associated medical costs were $580.9 million for 10,001 double ETs started in 2012. If performed as sequential single ETs, estimated costs would have decreased by $195.0 million to $386.0 million, and live birth rates would have increased from 57.7%-68.0%. Sequential single ETs, when clinically appropriate, can reduce total ART treatment and pregnancy/infant-associated medical costs by reducing multiple births without lowering live birth rates. Published by Elsevier Inc.

  5. Double aortic arch

    MedlinePlus

    Aortic arch anomaly; Double arch; Congenital heart defect - double aortic arch; Birth defect heart - double aortic arch ... aorta is a single arch that leaves the heart and moves leftward. In double aortic arch, some ...

  6. Labeling of lectin receptors during the cell cycle.

    PubMed

    Garrido, J

    1976-12-01

    Labeling of lectin receptors during the cell cycle. (Localizabión de receptores para lectinas durante el ciclo celular). Arch. Biol. Med. Exper. 10: 100-104, 1976. The topographic distribution of specific cell surface receptors for concanavalin A and wheat germ agglutinin was studied by ultrastructural labeling in the course of the cell cycle. C12TSV5 cells were synchronized by double thymidine block or mechanical selection (shakeoff). They were labeled by means of lectin-peroxidase techniques while in G1 S, G2 and M phases of the cycle. The results obtained were similar for both lectins employed. Interphase cells (G1 S, G2) present a stlihtly discontinous labeling pattern that is similar to the one observed on unsynchronized cells of the same line. Cells in mitosis, on the contrary, present a highly discontinous distribution of reaction product. This pattern disappears after the cells enters G1 and is not present on mitotic cells fixed in aldehyde prior to labeling.

  7. Repeat treatment with rifaximin improves irritable bowel syndrome-related quality of life: a secondary analysis of a randomized, double-blind, placebo-controlled trial.

    PubMed

    Cash, Brooks D; Pimentel, Mark; Rao, Satish S C; Weinstock, Leonard; Chang, Lin; Heimanson, Zeev; Lembo, Anthony

    2017-09-01

    Diarrhea-predominant irritable bowel syndrome (IBS-D) impairs patient quality of life (QOL). Rifaximin is an oral, nonsystemic antibiotic indicated for IBS-D. The objective of this secondary analysis was to evaluate rifaximin retreatment on IBS-related QOL in patients with IBS-D. Patients received open-label rifaximin 550 mg three times daily for 2 weeks. Clinical responders [simultaneously meeting weekly response criteria for abdominal pain (⩾30% improvement from baseline in mean weekly pain score) and stool consistency (⩾50% decrease from baseline in number of days/week with Bristol Stool Scale (BSS) type 6 or 7 stools) during ⩾2 of first 4 weeks posttreatment] who relapsed during an up to 18-week treatment-free observation phase were randomly assigned to receive two 2-week courses of double-blind rifaximin or placebo, separated by 10 weeks. A validated 34-item IBS-QOL questionnaire examined patient responses in 8 domains. The 2579 patients receiving open-label rifaximin experienced a mean improvement from baseline in IBS-QOL overall score of 54.9%. Responders to open-label rifaximin ( n = 1074 of 2438 evaluable; 44.1%) had significantly greater improvement from baseline in IBS-QOL overall and all eight subdomain scores, including dysphoria, food avoidance, interference with activity, body image, and sexual function versus nonresponders at 4 weeks posttreatment ( n = 1364; p < 0.001 for all comparisons). A significantly greater percentage of responders to open-label rifaximin achieved the minimally clinically important difference (MCID; ⩾14-point improvement from baseline) in the overall IBS-QOL score versus nonresponders [ n = 561 (52.2%) versus n = 287 (21.0%); p < 0.0001]. Among 636 patients with IBS-D relapse, the MCID in the overall IBS-QOL score was achieved by a significantly greater percentage of patients receiving double-blind rifaximin versus placebo (38.6% versus 29.6%, respectively; p = 0.009). Open-label and blinded retreatment with a short course (2 weeks) of rifaximin improved IBS-QOL in patients with IBS-D [ClinicalTrials.gov identifier: NCT01543178].

  8. Dual-circuit, multiple-effect refrigeration system and method

    DOEpatents

    DeVault, Robert C.

    1995-01-01

    A dual circuit absorption refrigeration system comprising a high temperature single-effect refrigeration loop and a lower temperature double-effect refrigeration loop separate from one another and provided with a double-condenser coupling therebetween. The high temperature condenser of the single-effect refrigeration loop is double coupled to both of the generators in the double-effect refrigeration loop to improve internal heat recovery and a heat and mass transfer additive such as 2-ethyl-1-hexanol is used in the lower temperature double-effect refrigeration loop to improve the performance of the absorber in the double-effect refrigeration loop.

  9. Risk of Revision Was Not Reduced by a Double-bundle ACL Reconstruction Technique: Results From the Scandinavian Registers.

    PubMed

    Aga, Cathrine; Kartus, Jüri-Tomas; Lind, Martin; Lygre, Stein Håkon Låstad; Granan, Lars-Petter; Engebretsen, Lars

    2017-10-01

    Double-bundle anterior cruciate ligament (ACL) reconstruction has demonstrated improved biomechanical properties and moderately better objective outcomes compared with single-bundle reconstructions. This could make an impact on the rerupture rate and reduce the risk of revisions in patients undergoing double-bundle ACL reconstruction compared with patients reconstructed with a traditional single-bundle technique. The National Knee Ligament Registers in Scandinavia provide information that can be used to evaluate the revision outcome after ACL reconstructions. The purposes of the study were (1) to compare the risk of revision between double-bundle and single-bundle reconstructions, reconstructed with autologous hamstring tendon grafts; (2) to compare the risk of revision between double-bundle hamstring tendon and single-bundle bone-patellar tendon-bone autografts; and (3) to compare the hazard ratios for the same two research questions after Cox regression analysis was performed. Data collection of primary ACL reconstructions from the National Knee Ligament Registers in Denmark, Norway, and Sweden from July 1, 2005, to December 31, 2014, was retrospectively analyzed. A total of 60,775 patients were included in the study; 994 patients were reconstructed with double-bundle hamstring tendon grafts, 51,991 with single-bundle hamstring tendon grafts, and 7790 with single-bundle bone-patellar tendon-bone grafts. The double-bundle ACL-reconstructed patients were compared with the two other groups. The risk of revision for each research question was detected by the risk ratio, hazard ratio, and the corresponding 95% confidence intervals. Kaplan-Meier analysis was used to estimate survival at 1, 2, and 5 years for the three different groups. Furthermore, a Cox proportional hazard regression model was applied and the hazard ratios were adjusted for country, age, sex, meniscal or chondral injury, and utilized fixation devices on the femoral and tibial sides. There were no differences in the crude risk of revision between the patients undergoing the double-bundle technique and the two other groups. A total of 3.7% patients were revised in the double-bundle group (37 of 994 patients) versus 3.8% in the single-bundle hamstring tendon group (1952 of 51,991; risk ratio, 1.01; 95% confidence interval (CI), 0.73-1.39; p = 0.96), and 2.8% of the patients were revised in the bone-patellar tendon-bone group (219 of the 7790 bone-patellar tendon-bone patients; risk ratio, 0.76; 95% CI, 0.54-1.06; p = 0.11). Cox regression analysis with adjustment for country, age, sex, menisci or cartilage injury, and utilized fixation device on the femoral and tibial sides, did not reveal any further difference in the risk of revision between the single-bundle hamstring tendon and double-bundle hamstring tendon groups (hazard ratio, 1.18; 95% CI, 0.85-1.62; p = 0.33), but the adjusted hazard ratio showed a lower risk of revision in the single-bundle bone-patellar tendon-bone group compared with the double-bundle group (hazard ratio, 0.62; 95% CI, 0.43-0.90; p = 0.01). Comparisons of the graft revision rates reported separately for each country revealed that double-bundle hamstring tendon reconstructions in Sweden had a lower hazard ratio compared with the single-bundle hamstring tendon reconstructions (hazard ratio, 1.00 versus 1.89; 95% CI, 1.09-3.29; p = 0.02). Survival at 5 years after index surgery was 96.0% for the double-bundle group, 95.4% for the single-bundle hamstring tendon group, and 97.0% for the single-bundle bone-patellar tendon-bone group. Based on the data from all three national registers, the risk of revision was not influenced by the reconstruction technique in terms of using single- or double-bundle hamstring tendons, although national differences in survival existed. Using bone-patellar tendon-bone grafts lowered the risk of revision compared with double-bundle hamstring tendon grafts. These findings should be considered when deciding what reconstruction technique to use in ACL-deficient knees. Future studies identifying the reasons for graft rerupture in single- and double-bundle reconstructions would be of interest to understand the findings of the present study. Level III, therapeutic study.

  10. Label inspection of approximate cylinder based on adverse cylinder panorama

    NASA Astrophysics Data System (ADS)

    Lin, Jianping; Liao, Qingmin; He, Bei; Shi, Chenbo

    2013-12-01

    This paper presents a machine vision system for automated label inspection, with the goal to reduce labor cost and ensure consistent product quality. Firstly, the images captured from each single-camera are distorted, since the inspection object is approximate cylindrical. Therefore, this paper proposes an algorithm based on adverse cylinder projection, where label images are rectified by distortion compensation. Secondly, to overcome the limited field of viewing for each single-camera, our method novelly combines images of all single-cameras and build a panorama for label inspection. Thirdly, considering the shake of production lines and error of electronic signal, we design the real-time image registration to calculate offsets between the template and inspected images. Experimental results demonstrate that our system is accurate, real-time and can be applied for numerous real- time inspections of approximate cylinders.

  11. Single-molecule imaging at high fluorophore concentrations by local activation of dye

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Geertsema, Hylkje J.; Mangel, Walter F.; Schulte, Aartje C.

    Single-molecule fluorescence microscopy is a powerful approach to observe biomolecular interactions with high spatial and temporal resolution. Detecting fluorescent signals from individual, labeled proteins above high levels of background fluorescence remains challenging, however. For this reason, the concentrations of labeled proteins in in vitro assays are often kept low compared to their in vivo concentrations. Here, we present a new fluorescence imaging technique by which single fluorescent molecules can be observed in real time at high, physiologically relevant concentrations. The technique requires a protein and its macromolecular substrate to be labeled each with a different fluorophore. Then, making use ofmore » short-distance energy-transfer mechanisms, the fluorescence from only those proteins bound to their substrate are selectively activated. This approach is demonstrated by labeling a DNA substrate with an intercalating stain, exciting the stain, and using energy transfer from the stain to activate the fluorescence of only those labeled DNA-binding proteins bound to the DNA. Such an experimental design allowed us to observe the sequence-independent interaction of Cy5-labeled interferon-inducible protein 16 (IFI16) with DNA and the sliding via one-dimensional diffusion of Cy5-labeled adenovirus protease (pVIc-AVP) on DNA in the presence of a background of hundreds of nM Cy5 fluorophore.« less

  12. Single-molecule imaging at high fluorophore concentrations by local activation of dye

    DOE PAGES

    Geertsema, Hylkje J.; Mangel, Walter F.; Schulte, Aartje C.; ...

    2015-02-17

    Single-molecule fluorescence microscopy is a powerful approach to observe biomolecular interactions with high spatial and temporal resolution. Detecting fluorescent signals from individual, labeled proteins above high levels of background fluorescence remains challenging, however. For this reason, the concentrations of labeled proteins in in vitro assays are often kept low compared to their in vivo concentrations. Here, we present a new fluorescence imaging technique by which single fluorescent molecules can be observed in real time at high, physiologically relevant concentrations. The technique requires a protein and its macromolecular substrate to be labeled each with a different fluorophore. Then, making use ofmore » short-distance energy-transfer mechanisms, the fluorescence from only those proteins bound to their substrate are selectively activated. This approach is demonstrated by labeling a DNA substrate with an intercalating stain, exciting the stain, and using energy transfer from the stain to activate the fluorescence of only those labeled DNA-binding proteins bound to the DNA. Such an experimental design allowed us to observe the sequence-independent interaction of Cy5-labeled interferon-inducible protein 16 (IFI16) with DNA and the sliding via one-dimensional diffusion of Cy5-labeled adenovirus protease (pVIc-AVP) on DNA in the presence of a background of hundreds of nM Cy5 fluorophore.« less

  13. Efficacy and safety of extended- versus immediate-release pramipexole in Japanese patients with advanced and L-dopa-undertreated Parkinson disease: a double-blind, randomized trial.

    PubMed

    Mizuno, Yoshikuni; Yamamoto, Mitsutoshi; Kuno, Sadako; Hasegawa, Kazuko; Hattori, Nobutaka; Kagimura, Tatsuro; Sarashina, Akiko; Rascol, Olivier; Schapira, Anthony H V; Barone, Paolo; Hauser, Robert A; Poewe, Werner

    2012-01-01

    To compare the efficacy, safety, tolerability, and trough plasma levels of pramipexole extended-release (ER) and pramipexole immediate-release (IR), and to assess the effects of overnight switching from an IR to an ER formulation, in L-dopa-treated patients with Parkinson disease (PD). After a 1- to 4-week screening/enrollment, 112 patients who had exhibited L-dopa-related problems or were receiving suboptimal L-dopa dosage were randomized in double-blind, double-dummy, 1:1 fashion to pramipexole ER once daily or pramipexole IR 2 to 3 times daily for 12 weeks, both titrated to a maximum daily dose of 4.5 mg. Successful completers of double-blind treatment were switched to open-label pramipexole ER, beginning with a 4-week dose-adjustment phase. Among the double-blind treatment patients (n = 56 in each group), Unified Parkinson's Disease Rating Scale Parts II+III total scores decreased significantly from baseline and to a similar degree with pramipexole ER and IR formulations. In each group, 47 double-blind patients (83.9%) reported adverse events (AEs), requiring withdrawal of 3 ER patients (5.4%) and 2 IR patients (3.6%). Trough plasma levels at steady state (at the same doses and dose-normalized concentrations) were also similar with both formulations. Among open-label treatment patients (n = 53 from IR to ER), 83% were successfully switched (no worsening of PD symptoms) to pramipexole ER. In L-dopa-treated patients, pramipexole ER and pramipexole IR demonstrated similar efficacy, safety, tolerability, and trough plasma levels. Patients can be safely switched overnight from pramipexole IR to pramipexole ER with no impact on efficacy.

  14. Demonstration of Single-Barium-Ion Sensitivity for Neutrinoless Double-Beta Decay Using Single-Molecule Fluorescence Imaging.

    PubMed

    McDonald, A D; Jones, B J P; Nygren, D R; Adams, C; Álvarez, V; Azevedo, C D R; Benlloch-Rodríguez, J M; Borges, F I G M; Botas, A; Cárcel, S; Carrión, J V; Cebrián, S; Conde, C A N; Díaz, J; Diesburg, M; Escada, J; Esteve, R; Felkai, R; Fernandes, L M P; Ferrario, P; Ferreira, A L; Freitas, E D C; Goldschmidt, A; Gómez-Cadenas, J J; González-Díaz, D; Gutiérrez, R M; Guenette, R; Hafidi, K; Hauptman, J; Henriques, C A O; Hernandez, A I; Hernando Morata, J A; Herrero, V; Johnston, S; Labarga, L; Laing, A; Lebrun, P; Liubarsky, I; López-March, N; Losada, M; Martín-Albo, J; Martínez-Lema, G; Martínez, A; Monrabal, F; Monteiro, C M B; Mora, F J; Moutinho, L M; Muñoz Vidal, J; Musti, M; Nebot-Guinot, M; Novella, P; Palmeiro, B; Para, A; Pérez, J; Querol, M; Repond, J; Renner, J; Riordan, S; Ripoll, L; Rodríguez, J; Rogers, L; Santos, F P; Dos Santos, J M F; Simón, A; Sofka, C; Sorel, M; Stiegler, T; Toledo, J F; Torrent, J; Tsamalaidze, Z; Veloso, J F C A; Webb, R; White, J T; Yahlali, N

    2018-03-30

    A new method to tag the barium daughter in the double-beta decay of ^{136}Xe is reported. Using the technique of single molecule fluorescent imaging (SMFI), individual barium dication (Ba^{++}) resolution at a transparent scanning surface is demonstrated. A single-step photobleach confirms the single ion interpretation. Individual ions are localized with superresolution (∼2  nm), and detected with a statistical significance of 12.9σ over backgrounds. This lays the foundation for a new and potentially background-free neutrinoless double-beta decay technology, based on SMFI coupled to high pressure xenon gas time projection chambers.

  15. Demonstration of Single-Barium-Ion Sensitivity for Neutrinoless Double-Beta Decay Using Single-Molecule Fluorescence Imaging

    NASA Astrophysics Data System (ADS)

    McDonald, A. D.; Jones, B. J. P.; Nygren, D. R.; Adams, C.; Álvarez, V.; Azevedo, C. D. R.; Benlloch-Rodríguez, J. M.; Borges, F. I. G. M.; Botas, A.; Cárcel, S.; Carrión, J. V.; Cebrián, S.; Conde, C. A. N.; Díaz, J.; Diesburg, M.; Escada, J.; Esteve, R.; Felkai, R.; Fernandes, L. M. P.; Ferrario, P.; Ferreira, A. L.; Freitas, E. D. C.; Goldschmidt, A.; Gómez-Cadenas, J. J.; González-Díaz, D.; Gutiérrez, R. M.; Guenette, R.; Hafidi, K.; Hauptman, J.; Henriques, C. A. O.; Hernandez, A. I.; Hernando Morata, J. A.; Herrero, V.; Johnston, S.; Labarga, L.; Laing, A.; Lebrun, P.; Liubarsky, I.; López-March, N.; Losada, M.; Martín-Albo, J.; Martínez-Lema, G.; Martínez, A.; Monrabal, F.; Monteiro, C. M. B.; Mora, F. J.; Moutinho, L. M.; Muñoz Vidal, J.; Musti, M.; Nebot-Guinot, M.; Novella, P.; Palmeiro, B.; Para, A.; Pérez, J.; Querol, M.; Repond, J.; Renner, J.; Riordan, S.; Ripoll, L.; Rodríguez, J.; Rogers, L.; Santos, F. P.; dos Santos, J. M. F.; Simón, A.; Sofka, C.; Sorel, M.; Stiegler, T.; Toledo, J. F.; Torrent, J.; Tsamalaidze, Z.; Veloso, J. F. C. A.; Webb, R.; White, J. T.; Yahlali, N.; NEXT Collaboration

    2018-03-01

    A new method to tag the barium daughter in the double-beta decay of Xe 136 is reported. Using the technique of single molecule fluorescent imaging (SMFI), individual barium dication (Ba++ ) resolution at a transparent scanning surface is demonstrated. A single-step photobleach confirms the single ion interpretation. Individual ions are localized with superresolution (˜2 nm ), and detected with a statistical significance of 12.9 σ over backgrounds. This lays the foundation for a new and potentially background-free neutrinoless double-beta decay technology, based on SMFI coupled to high pressure xenon gas time projection chambers.

  16. Beam current enhancement of microwave plasma ion source utilizing double-port rectangular cavity resonator

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Yuna; Park, Yeong-Shin; Jo, Jong-Gab

    2012-02-15

    Microwave plasma ion source with rectangular cavity resonator has been examined to improve ion beam current by changing wave launcher type from single-port to double-port. The cavity resonators with double-port and single-port wave launchers are designed to get resonance effect at TE-103 mode and TE-102 mode, respectively. In order to confirm that the cavities are acting as resonator, the microwave power for breakdown is measured and compared with the E-field strength estimated from the HFSS (High Frequency Structure Simulator) simulation. Langmuir probe measurements show that double-port cavity enhances central density of plasma ion source by modifying non-uniform plasma density profilemore » of the single-port cavity. Correspondingly, beam current from the plasma ion source utilizing the double-port resonator is measured to be higher than that utilizing single-port resonator. Moreover, the enhancement in plasma density and ion beam current utilizing the double-port resonator is more pronounced as higher microwave power applied to the plasma ion source. Therefore, the rectangular cavity resonator utilizing the double-port is expected to enhance the performance of plasma ion source in terms of ion beam extraction.« less

  17. Beam current enhancement of microwave plasma ion source utilizing double-port rectangular cavity resonator.

    PubMed

    Lee, Yuna; Park, Yeong-Shin; Jo, Jong-Gab; Yang, J J; Hwang, Y S

    2012-02-01

    Microwave plasma ion source with rectangular cavity resonator has been examined to improve ion beam current by changing wave launcher type from single-port to double-port. The cavity resonators with double-port and single-port wave launchers are designed to get resonance effect at TE-103 mode and TE-102 mode, respectively. In order to confirm that the cavities are acting as resonator, the microwave power for breakdown is measured and compared with the E-field strength estimated from the HFSS (High Frequency Structure Simulator) simulation. Langmuir probe measurements show that double-port cavity enhances central density of plasma ion source by modifying non-uniform plasma density profile of the single-port cavity. Correspondingly, beam current from the plasma ion source utilizing the double-port resonator is measured to be higher than that utilizing single-port resonator. Moreover, the enhancement in plasma density and ion beam current utilizing the double-port resonator is more pronounced as higher microwave power applied to the plasma ion source. Therefore, the rectangular cavity resonator utilizing the double-port is expected to enhance the performance of plasma ion source in terms of ion beam extraction.

  18. Corpus luteum function following single and double ovulation during estrous cycle in Sanjabi ewes.

    PubMed

    Shabankareh, H Karami; Habibizad, J; Torki, M

    2009-09-01

    This study compared the effect of double and single ovulation on serum progesterone concentrations and luteal characteristics in Sanjabi ewes at different days of the estrous cycle. The estrous cycles of 197 Sanjabi ewes were synchronized by a 12-day treatment with intravaginal sponges (Chronogest). Estrus was detected in 144 ewes 27-39 h after sponge removal. Daily blood samples were taken every morning and analyzed for serum progesterone (P4). Ewes were then transported to a local abattoir, where nine ewes were slaughtered on each experimental day (days 1-16 after estrus) for ovary collection. The ovarian follicles were measured and categorized by size (very small <2mm; small 2-3.5mm; medium 3.5-5mm; large >5mm). On each slaughter day, the number of corpora lutea per ewe was classified as single and double ovulation. The results show that the effect of dominant follicles was less during the mid-luteal phase. Ovulation rate of right, left and both ovaries were (54.9%), (23.6%) and (21.5%), respectively. The incidence of double ovulations was 40.2%. In the case of ewes exhibiting double ovulation, 46.6% occurred unilateral (ewes exhibited both ovulations on the right ovary); whereas 53.4% occurred bilateral (ewes exhibited ovulations on the right and left ovaries). Unilateral double ovulation was not observed in the left ovary. The right ovary appeared to play a significantly greater role in ewes showing single and double ovulations than the left ovary (P<0.05). Serum progesterone concentration showed minimum and maximum levels of 0.29+/-0.15 and 5.51+/-0.75 ng/ml on days 16 and 11 post-estrous, respectively (P<0.001). The mean volume of individual corpus lutea in ewes with single ovulations was significantly higher than in ewes with double ovulations (P<0.01). However, the total volume of corpus lutea in ewes with single ovulation was significantly lower than in ewes with double ovulations in some days of estrous cycle (P<0.01). The serum progesterone concentration was significantly higher in double than single ovulating animals on days 1-16 of the estrous cycle (P<0.001). These results indicated a relatively high incidence of double ovulation in ewes associated with increasing total luteal volume and high circulating concentrations of progesterone.

  19. The oxygen enhancement ratio for single- and double-strand breaks induced by tritium incorporated in DNA of cultured human T1 cells. Impact of the transmutation effect.

    PubMed

    Tisljar-Lentulis, G; Henneberg, P; Feinendegen, L E; Commerford, S L

    1983-04-01

    The effect of oxygen, expressed as the oxygen enhancement ratio (OER), on the number of single-strand breaks (SSB) and double-strand breaks (DSB) induced in DNA by the radioactive decay of tritium was measured in human T1 cells whose DNA had been labeled with tritium at carbon atom number 6 of thymidine. Decays were accumulated in vivo under aerobic conditions at 0-1 degrees C and at -196 degrees C and in a nitrogen atmosphere at 0-1 degrees C. The number of SSB and DSB produced was analyzed by sucrose gradient centrifugation. For each tritium decay there were 0.25 DSB in cells exposed to air at 0-1 degrees C and 0.07 in cells kept under nitrogen, indicating an OER of 3.6, a value expected for such low-LET radiation. However, for each tritium decay there were 1.25 SSB in cells exposed to air at 0-1 degrees C and 0.76 in cells kept under nitrogen indicating an OER of only 1.7. The corresponding values for 60Co gamma radiation, expressed as SSB per 100 eV absorbed energy, were 4.5 and 1.0, giving an OER of 4.5. The low OER value found for SSB induced by tritium decay can be explained if 31% of the total SSB produced in air result from transmutation by a mechanism which does not produce DSB and is unaffected by oxygen.

  20. Cellular internalization of LiNbO3 nanocrystals for second harmonic imaging and the effects on stem cell differentiation

    NASA Astrophysics Data System (ADS)

    Li, Jianhua; Qiu, Jichuan; Guo, Weibo; Wang, Shu; Ma, Baojin; Mou, Xiaoning; Tanes, Michael; Jiang, Huaidong; Liu, Hong

    2016-03-01

    Second harmonic generation (SHG) nanocrystals have recently been reported to label cancer cells and other functional cell lines due to their unique double-frequency property. In this paper, we report for the first time the use of lithium niobate (LiNbO3, LN) nanocrystals as SHG labels for imaging stem cells. Rat mesenchymal stem cells (rMSCs) were labeled with LN nanocrystals in order to study the cellular internalization of the nanocrystals and the influence on stem cell differentiation. The results showed that LN nanocrystals were endocytosed by the rMSCs and the distribution of the internalized nanoparticles demonstrated a high consistency with the orientation of the actin filaments. Besides, LN-labeled rMSCs showed a concentration-dependent viability. Most importantly, rMSCs labeled with 50 μg per mL of LN nanocrystals retained their ability to differentiate into both osteogenic and adipogenic lineages. The results prove that LN nanocrystals can be used as a cytocompatible, near-infrared (NIR) light driven cell label for long-term imaging, without hindering stem cell differentiation. This work will promote the use of LN nanocrystals to broader applications like deep-tissue tracking, remote drug delivery and stem cell therapy.Second harmonic generation (SHG) nanocrystals have recently been reported to label cancer cells and other functional cell lines due to their unique double-frequency property. In this paper, we report for the first time the use of lithium niobate (LiNbO3, LN) nanocrystals as SHG labels for imaging stem cells. Rat mesenchymal stem cells (rMSCs) were labeled with LN nanocrystals in order to study the cellular internalization of the nanocrystals and the influence on stem cell differentiation. The results showed that LN nanocrystals were endocytosed by the rMSCs and the distribution of the internalized nanoparticles demonstrated a high consistency with the orientation of the actin filaments. Besides, LN-labeled rMSCs showed a concentration-dependent viability. Most importantly, rMSCs labeled with 50 μg per mL of LN nanocrystals retained their ability to differentiate into both osteogenic and adipogenic lineages. The results prove that LN nanocrystals can be used as a cytocompatible, near-infrared (NIR) light driven cell label for long-term imaging, without hindering stem cell differentiation. This work will promote the use of LN nanocrystals to broader applications like deep-tissue tracking, remote drug delivery and stem cell therapy. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr00785f

  1. The effect of black tea and caffeine on regional cerebral blood flow measured with arterial spin labeling

    PubMed Central

    Vidyasagar, Rishma; Greyling, Arno; Draijer, Richard; Corfield, Douglas R; Parkes, Laura M

    2013-01-01

    Black tea consumption has been shown to improve peripheral vascular function. Its effect on brain vasculature is unknown, though tea contains small amounts of caffeine, a psychoactive substance known to influence cerebral blood flow (CBF). We investigated the effects on CBF due to the intake of tea components in 20 healthy men in a double-blinded, randomized, placebo-controlled study. On separate days, subjects received a single dose of 184 mg caffeine (equivalent to one strong espresso coffee), 2,820 mg black tea solids containing 184 mg caffeine (equivalent to 6 cups of tea), 2,820 mg decaffeinated black tea solids, or placebo. The CBF and cerebrovascular reactivity (CVR) to hypercapnia were measured with arterial spin labeled magnetic resonance imaging (MRI) before and 2 hours after administration. We found a significant global reduction with caffeine (20%) and tea (21%) in gray matter CBF, with no effect of decaffeinated tea, suggesting that only caffeine influences CBF acutely. Voxelwise analysis revealed the effect of caffeine to be regionally specific. None of the interventions had an effect on CVR. Additional research is required to conclude on the physiologic relevance of these findings and the chronic effects of caffeine and tea intake on CBF. PMID:23486295

  2. Determining Protease Activity In Vivo by Fluorescence Cross-Correlation Analysis

    PubMed Central

    Kohl, Tobias; Haustein, Elke; Schwille, Petra

    2005-01-01

    To date, most biochemical approaches to unravel protein function have focused on purified proteins in vitro. Whereas they analyze enzyme performance under assay conditions, they do not necessarily tell us what is relevant within a living cell. Ideally, cellular functions should be examined in situ. In particular, association/dissociation reactions are ubiquitous, but so far there is no standard technique permitting online analysis of these processes in vivo. Featuring single-molecule sensitivity combined with intrinsic averaging, fluorescence correlation spectroscopy is a minimally invasive technique ideally suited to monitor proteins. Moreover, endogenous fluorescence-based assays can be established by genetically encoding fusions of autofluorescent proteins and cellular proteins, thus avoiding the disadvantages of in vitro protein labeling and subsequent delivery to cells. Here, we present an in vivo protease assay as a model system: Green and red autofluorescent proteins were connected by Caspase-3- sensitive and insensitive protein linkers to create double-labeled protease substrates. Then, dual-color fluorescence cross-correlation spectroscopy was employed to study the protease reaction in situ. Allowing assessment of multiple dynamic parameters simultaneously, this method provided internal calibration and improved experimental resolution for quantifying protein stability. This approach, which is easily extended to reversible protein-protein interactions, seems very promising for elucidating intracellular protein functions. PMID:16055538

  3. The organization of orientation selectivity throughout macaque visual cortex.

    PubMed

    Vanduffel, Wim; Tootell, Roger B H; Schoups, Aniek A; Orban, Guy A

    2002-06-01

    A double-label deoxyglucose technique was used to study orientation columns throughout visual cortex in awake behaving macaques. Four macaques were trained to fixate while contrastreversing, stationary gratings or one-dimensional noise of a single orientation or an orthogonal orientation were presented, during uptake of [14C]deoxyglucose ([14C]DG) or [3H]DG, respectively. The two orthogonal stimulus orientations produced DG-labeled columns that were maximally separated in the two isotope maps (inter-digitated) in four areas: V1, V2, V3 and VP. The topographic change from interdigitated to overlapping columns occurred abruptly rather than gradually, at corresponding cortical area borders (e.g. VP and V4v, respectively). In addition, the data suggest that orientation column topography systematically changes with retinotopic eccentricity. In V1, the orientation columns systematically avoided the cytochrome oxidase blobs in the parafoveal representation, but converged closer to the blobs in the foveal representation. A control experiment indicated that this was unlikely to reflect eccentricity-dependent differences in cortical spatial frequency sensitivity. A similar eccentricity-dependent change in the topography of orientation columns occurred in V2. In parafoveal but not foveal visual field representations of V2, the orientation columns were centered on the thick cytochrome oxidase stripes, extended into the adjacent interstripe region, but were virtually absent in the thin stripes.

  4. Comparing the Properties of Electrochemical-Based DNA Sensors Employing Different Redox Tags

    PubMed Central

    Kang, Di; Zuo, Xiaolei; Yang, Renqiang; Xia, Fan; Plaxco, Kevin W.; White, Ryan J.

    2009-01-01

    Many electrochemical biosensor approaches developed in recent years utilize redox labeled (most commonly methylene blue or ferrocene) oligonucleotide probes site-specifically attached to an interrogating electrode. Sensors in this class have been reported employing a range of probe architectures, including single- and double-stranded DNA, more complex DNA structures, DNA and RNA aptamers and, most recently, DNA-small molecule chimeras. Signaling in this class of sensors is generally predicated on binding-induced changes in the efficiency with which the covalently attached redox label transfers electrons with the interrogating electrode. Here we have investigated how the properties of the redox tag affect the performance of such sensors. Specifically, we compare the differences in signaling and stability of electrochemical DNA sensors (E-DNA sensors) fabricated using either ferrocene or methylene blue as the signaling redox moiety. We find that while both tags support efficient E-DNA signaling, ferrocene produces slightly improved signal gain and target affinity. These small advantages, however, come at a potentially significant price: the ferrocene-based sensors are far less stable than their methylene blue counterparts, particularly with regards to stability to long-term storage, repeated electrochemical interrogations, repeated sensing/regeneration iterations, and employment in complex sample matrices such as blood serum. PMID:19810694

  5. Real-time imaging of microparticles and living cells with CMOS nanocapacitor arrays

    NASA Astrophysics Data System (ADS)

    Laborde, C.; Pittino, F.; Verhoeven, H. A.; Lemay, S. G.; Selmi, L.; Jongsma, M. A.; Widdershoven, F. P.

    2015-09-01

    Platforms that offer massively parallel, label-free biosensing can, in principle, be created by combining all-electrical detection with low-cost integrated circuits. Examples include field-effect transistor arrays, which are used for mapping neuronal signals and sequencing DNA. Despite these successes, however, bioelectronics has so far failed to deliver a broadly applicable biosensing platform. This is due, in part, to the fact that d.c. or low-frequency signals cannot be used to probe beyond the electrical double layer formed by screening salt ions, which means that under physiological conditions the sensing of a target analyte located even a short distance from the sensor (∼1 nm) is severely hampered. Here, we show that high-frequency impedance spectroscopy can be used to detect and image microparticles and living cells under physiological salt conditions. Our assay employs a large-scale, high-density array of nanoelectrodes integrated with CMOS electronics on a single chip and the sensor response depends on the electrical properties of the analyte, allowing impedance-based fingerprinting. With our platform, we image the dynamic attachment and micromotion of BEAS, THP1 and MCF7 cancer cell lines in real time at submicrometre resolution in growth medium, demonstrating the potential of the platform for label/tracer-free high-throughput screening of anti-tumour drug candidates.

  6. Single Versus Double Ureteral Stent Placement After Laser Endoureterotomy for the Management of Benign Ureteral Strictures: A Randomized Clinical Trial.

    PubMed

    Ibrahim, Hamdy M; Mohyelden, Khaled; Abdel-Bary, Ahmed; Al-Kandari, Ahmed M

    2015-10-01

    Endoureterotomy is a viable option for treating patients with benign ureteral stricture. We compared the efficacy and safety of double versus single ureteral stent placement after laser endoureterotomy. This study included 55 patients with benign ureteral strictures; all patients underwent retrograde laser endoureterotomy. Patients were randomized either to single or double ureteral stents. Single stents were placed in 27 ureters while double stents were placed in 28 ureters. The stent diameter used was 7 F, and stents were indwelling for 8 weeks. Imaging was performed 1 month after stent removal and repeated regularly every 3 months. Clinical characteristics, operative results, and functional outcomes were compared for strictures managed in both groups. Success was evaluated both subjectively and objectively. Fifty-five patients with a mean age of 46 (16-75) years had benign ureteral strictures; the mean stricture length was 1.92 (1-3) cm. The mean follow-up was 25.7 (9-42) months. The overall success rate was 67.3% (37 patients) with no radiologic evidence of obstruction, 6 (10.9%) patients showed symptomatic improvement while 12 (21.8%) patients underwent surgical reconstruction. Success was significantly higher for ureteral strictures (>1.5 cm) managed with double stent placement (82.4%), compared with single stent placement (38.9%) with a P value of 0.009. Double stent placement of the ureter after laser endoureterotomy achieved a higher success rate compared with single stent placement in cases of benign ureteral strictures. Although ureteral strictures (≤1.5 cm) achieved better outcome after laser endoureterotomy, strictures (>1.5 cm) favored better with double stent versus single stent placement.

  7. Espresso coffees, caffeine and chlorogenic acid intake: potential health implications.

    PubMed

    Crozier, Thomas W M; Stalmach, Angelique; Lean, Michael E J; Crozier, Alan

    2012-01-01

    HPLC analysis of 20 commercial espresso coffees revealed 6-fold differences in caffeine levels, a 17-fold range of caffeoylquinic acid contents, and 4-fold differences in the caffeoylquinic acid : caffeine ratio. These variations reflect differences in batch-to-batch bean composition, possible blending of arabica with robusta beans, as well as roasting and grinding procedures, but the predominant factor is likely to be the amount of beans used in the coffee-making/barista processes. The most caffeine in a single espresso was 322 mg and a further three contained >200 mg, exceeding the 200 mg day(-1) upper limit recommended during pregnancy by the UK Food Standards Agency. This snap-shot of high-street expresso coffees suggests the published assumption that a cup of strong coffee contains 50 mg caffeine may be misleading. Consumers at risk of toxicity, including pregnant women, children and those with liver disease, may unknowingly ingest excessive caffeine from a single cup of espresso coffee. As many coffee houses prepare larger volume coffees, such as Latte and Cappuccino, by dilution of a single or double shot of expresso, further study on these products is warranted. New data are needed to provide informative labelling, with attention to bean variety, preparation, and barista methods.

  8. Gold nano particle decorated graphene core first generation PAMAM dendrimer for label free electrochemical DNA hybridization sensing.

    PubMed

    Jayakumar, K; Rajesh, R; Dharuman, V; Venkatasan, R; Hahn, J H; Pandian, S Karutha

    2012-01-15

    A novel first generation (G1) poly(amidoamine) dendrimer (PAMAM) with graphene core (GG1PAMAM) was synthesized for the first time. Single layer of GG1PAMAM was immobilized covalently on mercaptopropionic acid (MPA) monolayer on Au transducer. This allows cost effective and easy deposition of single layer graphene on the Au transducer surface than the advanced vacuum techniques used in the literature. Au nano particles (17.5 nm) then decorated the GG1PAMAM and used for electrochemical DNA hybridization sensing. The sensor discriminates selectively and sensitively the complementary double stranded DNA (dsDNA, hybridized), non-complementary DNA (ssDNA, un-hybridized) and single nucleotide polymorphism (SNP) surfaces. Interactions of the MPA, GG1PAMAM and the Au nano particles were characterized by Ultra Violet (UV), Fourier Transform Infrared (FTIR), Raman spectroscopy (RS), Thermo gravimetric analysis (TGA), Scanning Electron Microscopy (SEM), Atomic Force Microscopy (AFM), Cyclic Voltmetric (CV), Impedance spectroscopy (IS) and Differntial Pulse Voltammetry (DPV) techniques. The sensor showed linear range 1×10(-6) to 1×10(-12) M with lowest detection limit 1 pM which is 1000 times lower than G1PAMAM without graphene core. Copyright © 2011 Elsevier B.V. All rights reserved.

  9. Towards assessing corticospinal excitability bilaterally: Validation of a double-coil TMS method.

    PubMed

    Grandjean, Julien; Derosiere, Gerard; Vassiliadis, Pierre; Quemener, Louise; Wilde, Ysaline de; Duque, Julie

    2018-01-01

    For several decades, Transcranial magnetic stimulation (TMS) has been used to monitor corticospinal excitability (CSE) changes in various contexts. Habitually, single-coil TMS is applied over one primary motor cortex (M1), eliciting motor-evoked potentials (MEPs) in a contralateral limb muscle, usually a hand effector. However, in many situations, it would be useful to obtain MEPs in both hands simultaneously, to track CSE bilaterally. Such an approach requires stimulating both M1 concurrently while avoiding interference between the two descending stimuli. We examined MEPs obtained at rest using a double-coil TMS approach where the two M1 are stimulated with a 1ms inter-pulse interval (double-coil 1ms ). MEPs were acquired using double-coil 1ms (MEP double ) or single-coil (MEP single ) TMS, at five different intensities of stimulation (100, 115, 130, 145 or 160% of the resting motor threshold, rMT). Given the 1ms inter-pulse interval in double-coil 1ms trials, MEP double were either evoked by a 1st (MEP double-1 ) or a 2nd (MEP double-2 ) TMS pulse. All MEP TYPE (MEP TYPE =MEP single , MEP double-1 and MEP double-2 ) were equivalent, regardless of the hand within which they were elicited, the intensity of stimulation or the pulse order. This method allows one to observe state-related CSE changes for the two hands simultaneously on a trial-by-trial basis. These results infer the absence of any neural interactions between the two cortico-spinal volleys with double-coil 1ms TMS. Hence, this technique can be reliably used to assess CSE bilaterally, opening new research perspectives for scientists interested in physiological markers of activity in the motor output system. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Efficacy and safety of luseogliflozin added to insulin therapy in Japanese patients with type 2 diabetes: a multicenter, 52-week, clinical study with a 16-week, double-blind period and a 36-week, open-label period.

    PubMed

    Seino, Yutaka; Sasaki, Takashi; Fukatsu, Atsushi; Imazeki, Hisae; Ochiai, Hidekazu; Sakai, Soichi

    2018-06-01

    To evaluate the efficacy and safety of luseogliflozin in Japanese patients with type 2 diabetes (T2D) inadequately controlled with insulin monotherapy. This 52-week multicenter study entailed a 16-week, double-blind period followed by a 36-week, open-label period. Patients were randomized to receive either luseogliflozin 2.5 mg (n = 159) or placebo (n = 74) during the double-blind period. All patients who entered the open-label period received luseogliflozin. Major efficacy endpoints included the changes from baseline in HbA1c, fasting plasma glucose (FPG), postprandial plasma glucose (PPG) and bodyweight. Safety assessments included adverse events, laboratory tests and vital signs. In the double-blind period, luseogliflozin significantly decreased HbA1c (-1.18%), FPG (-42.4 mg/dL), 2 hour PPG (-68.7 mg/dL) and bodyweight (-1.27 kg) compared with placebo (all p < .001); these reductions were maintained over 52 weeks. The changes from baseline at Week 52 were -1.00%, -35.1 mg/dL, -68.8 mg/dL and -1.81 kg, respectively (all p < .001). In the placebo group, favorable glycemic control and bodyweight reduction were also observed after switching to luseogliflozin. Most adverse events were mild in severity. During the double-blind period, the incidences of hypoglycemia were 20.8% and 13.5% in the luseogliflozin and placebo groups, respectively. During the 52 weeks of luseogliflozin treatment, the frequency of hypoglycemia was 33.3%, but no serious hypoglycemia occurred. The safety profile other than hypoglycemia was also acceptable. There were no new safety concerns about luseogliflozin added to insulin. Luseogliflozin added to insulin therapy significantly improved glycemic control with bodyweight reduction and was well tolerated in Japanese patients with T2D. Japan Pharmaceutical Information Center (JapicCTI-142582).

  11. Three-dimensional evaluation of cyclic displacement in single-row and double-row rotator cuff reconstructions under static external rotation.

    PubMed

    Lorbach, Olaf; Kieb, Matthias; Raber, Florian; Busch, Lüder C; Kohn, Dieter M; Pape, Dietrich

    2013-01-01

    The double-row suture bridge repair was recently introduced and has demonstrated superior biomechanical results and higher yield load compared with the traditional double-row technique. It therefore seemed reasonable to compare this second generation of double-row constructs to the modified single-row double mattress reconstruction. The repair technique, initial tear size, and tendon subregion will have a significant effect on 3-dimensional (3D) cyclic displacement under additional static external rotation of a modified single-row compared with a double-row rotator cuff repair. Controlled laboratory study. Rotator cuff tears (small to medium: 25 mm; medium to large: 35 mm) were created in 24 human cadaveric shoulders. Rotator cuff repairs were performed as modified single-row or double-row repairs, and cyclic loading (10-60 N, 10-100 N) was applied under 20° of external rotation. Radiostereometric analysis was used to calculate cyclic displacement in the anteroposterior (x), craniocaudal (y), and mediolateral (z) planes with a focus on the repair constructs and the initial tear size. Moreover, differences in cyclic displacement of the anterior compared with the posterior tendon subregions were calculated. Significantly lower cyclic displacement was seen in small to medium tears for the single-row compared with double-row repair at 60 and 100 N in the x plane (P = .001) and y plane (P = .001). The results were similar in medium to large tears at 100 N in the x plane (P = .004). Comparison of 25-mm versus 35-mm tears did not show any statistically significant differences for the single-row repairs. In the double-row repairs, lower gap formation was found for the 35-mm tears (P ≤ .05). Comparison of the anterior versus posterior tendon subregions revealed a trend toward higher anterior gap formation, although this was statistically not significant. The tested single-row reconstruction achieved superior results in 3D cyclic displacement to the tested double-row repair. Extension of the initial rupture size did not have a negative effect on the biomechanical results of the tested constructs. Single-row repairs with modified suture configurations provide comparable biomechanical strength to double-row repairs. Furthermore, as increased gap formation in the early postoperative period might lead to failure of the construct, a strong anterior fixation and restricted external rotation protocol might be considered in rotator cuff repairs to avoid this problem.

  12. Biomechanical advantages of triple-loaded suture anchors compared with double-row rotator cuff repairs.

    PubMed

    Barber, F Alan; Herbert, Morley A; Schroeder, F Alexander; Aziz-Jacobo, Jorge; Mays, Matthew M; Rapley, Jay H

    2010-03-01

    To evaluate the strength and suture-tendon interface security of various suture anchors triply and doubly loaded with ultrahigh-molecular weight polyethylene-containing sutures and to evaluate the relative effectiveness of placing these anchors in a single-row or double-row arrangement by cyclic loading and then destructive testing. The infraspinatus muscle was reattached to the original humeral footprint by use of 1 of 5 different repair patterns in 40 bovine shoulders. Two single-row repairs and three double-row repairs were tested. High-strength sutures were used for all repairs. Five groups were studied: group 1, 2 triple-loaded screw suture anchors in a single row with simple stitches; group 2, 2 triple-loaded screw anchors in a single row with simple stitches over a fourth suture passed perpendicularly ("rip-stop" stitch); group 3, 2 medial and 2 lateral screw anchors with a single vertical mattress stitch passed from the medial anchors and 2 simple stitches passed from the lateral anchors; group 4, 2 medial double-loaded screw anchors tied in 2 mattress stitches and 2 push-in lateral anchors capturing the medial sutures in a "crisscross" spanning stitch; and group 5, 2 medial double-loaded screw anchors tied in 2 mattress stitches and 2 push-in lateral anchors creating a "suture-bridge" stitch. The specimens were cycled between 10 and 180 N at 1.0 Hz for 3,500 cycles or until failure. Endpoints were cyclic loading displacement (5 and 10 mm), total displacement, and ultimate failure load. A single row of triply loaded anchors was more resistant to stretching to a 5- and 10-mm gap than the double-row repairs with or without the addition of a rip-stop suture (P < .05). The addition of a rip-stop stitch made the repair more resistant to gap formation than a double row repair (P < .05). The crisscross double row created by 2 medial double-loaded suture anchors and 2 lateral push-in anchors stretched more than any other group (P < .05). Double-row repairs with either crossing sutures or 4 separate anchor points were more likely to fail (5- or 10-mm gap) than a single-row repair loaded with 3 simple sutures. The triple-loaded anchors with ultrahigh-molecular weight polyethylene-containing sutures placed in a single row were more resistant to stretching than the double-row groups. Copyright 2010 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.

  13. Visual performance on detection tasks with double-targets of the same and different difficulty.

    PubMed

    Chan, Alan H S; Courtney, Alan J; Ma, C W

    2002-10-20

    This paper reports a study of measurement of horizontal visual sensitivity limits for 16 subjects in single-target and double-targets detection tasks. Two phases of tests were conducted in the double-targets task; targets of the same difficulty were tested in phase one while targets of different difficulty were tested in phase two. The range of sensitivity for the double-targets test was found to be smaller than that for single-target in both the same and different target difficulty cases. The presence of another target was found to affect performance to a marked degree. Interference effect of the difficult target on detection of the easy one was greater than that of the easy one on the detection of the difficult one. Performance decrement was noted when correct percentage detection was plotted against eccentricity of target in both the single-target and double-targets tests. Nevertheless, the non-significant correlation found between the performance for the two tasks demonstrated that it was impossible to predict quantitatively ability for detection of double targets from the data for single targets. This indicated probable problems in generalizing data for single target visual lobes to those for multiple targets. Also lobe area values obtained from measurements using a single-target task cannot be applied in a mathematical model for situations with multiple occurrences of targets.

  14. Single-row versus double-row arthroscopic rotator cuff repair in small- to medium-sized tears.

    PubMed

    Aydin, Nuri; Kocaoglu, Baris; Guven, Osman

    2010-07-01

    Double-row rotator cuff repair leads to superior cuff integrity and clinical results compared with single-row repair. The study enrolled 68 patients with a full-thickness rotator cuff tear who were divided into 2 groups of 34 patients according to repair technique. The patients were followed-up for at least 2 years. The results were evaluated by Constant score. Despite the biomechanical studies and cadaver studies that proved the superiority of double-row fixation over single-row fixation, our clinical results show no difference in functional outcome between the two methods. It is evident that double-row repair is more technically demanding, expensive, and time-consuming than single-row repair, without providing a significant improvement in clinical results. Comparison between groups did not show significant differences. At the final follow-up, the Constant score was 82.2 in the single-row group and 78.8 in the double-row group. Functional outcome was improved in both groups after surgery, but the difference between the 2 groups was not significant. At long-term follow-up, arthroscopic rotator cuff repair with the double-row technique showed no significant difference in clinical outcome compared with single-row repair in small to medium tears. 2010 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Mosby, Inc. All rights reserved.

  15. Time-resolved double-slit interference pattern measurement with entangled photons

    PubMed Central

    Kolenderski, Piotr; Scarcella, Carmelo; Johnsen, Kelsey D.; Hamel, Deny R.; Holloway, Catherine; Shalm, Lynden K.; Tisa, Simone; Tosi, Alberto; Resch, Kevin J.; Jennewein, Thomas

    2014-01-01

    The double-slit experiment strikingly demonstrates the wave-particle duality of quantum objects. In this famous experiment, particles pass one-by-one through a pair of slits and are detected on a distant screen. A distinct wave-like pattern emerges after many discrete particle impacts as if each particle is passing through both slits and interfering with itself. Here we present a temporally- and spatially-resolved measurement of the double-slit interference pattern using single photons. We send single photons through a birefringent double-slit apparatus and use a linear array of single-photon detectors to observe the developing interference pattern. The analysis of the buildup allows us to compare quantum mechanics and the corpuscular model, which aims to explain the mystery of single-particle interference. Finally, we send one photon from an entangled pair through our double-slit setup and show the dependence of the resulting interference pattern on the twin photon's measured state. Our results provide new insight into the dynamics of the buildup process in the double-slit experiment, and can be used as a valuable resource in quantum information applications. PMID:24770360

  16. The transition mechanism from a symmetric single period discharge to a period-doubling discharge in atmospheric helium dielectric-barrier discharge

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Dingzong; Wang, Yanhui; Wang, Dezhen

    2013-06-15

    Period-doubling and chaos phenomenon have been frequently observed in atmospheric-pressure dielectric-barrier discharges. However, how a normal single period discharge bifurcates into period-doubling state is still unclear. In this paper, by changing the driving frequency, we study numerically the transition mechanisms from a normal single period discharge to a period-doubling state using a one-dimensional self-consistent fluid model. The results show that before a discharge bifurcates into a period-doubling state, it first deviates from its normal operation and transforms into an asymmetric single period discharge mode. Then the weaker discharge in this asymmetric discharge will be enhanced gradually with increasing of themore » frequency until it makes the subsequent discharge weaken and results in the discharge entering a period-doubling state. In the whole transition process, the spatial distribution of the charged particle density and the electric field plays a definitive role. The conclusions are further confirmed by changing the gap width and the amplitude of the applied voltage.« less

  17. Single-organelle tracking by two-photon conversion

    NASA Astrophysics Data System (ADS)

    Watanabe, Wataru; Shimada, Tomoko; Matsunaga, Sachihiro; Kurihara, Daisuke; Fukui, Kiichi; Shin-Ichi Arimura, Shin-Ichi; Tsutsumi, Nobuhiro; Isobe, Keisuke; Itoh, Kazuyoshi

    2007-03-01

    Spatial and temporal information about intracellular objects and their dynamics within a living cell are essential for dynamic analysis of such objects in cell biology. A specific intracellular object can be discriminated by photoactivatable fluorescent proteins that exhibit pronounced light-induced spectral changes. Here, we report on selective labeling and tracking of a single organelle by using two-photon conversion of a photoconvertible fluorescent protein with near-infrared femtosecond laser pulses. We performed selective labeling of a single mitochondrion in a living tobacco BY-2 cell using two-photon photoconversion of Kaede. Using this technique, we demonstrated that, in plants, the directed movement of individual mitochondria along the cytoskeletons was mediated by actin filaments, whereas microtubules were not required for the movement of mitochondria. This single-organelle labeling technique enabled us to track the dynamics of a single organelle, revealing the mechanisms involved in organelle dynamics. The technique has potential application in direct tracking of selective cellular and intracellular structures.

  18. A post-labeling strategy based on dye-induced peeling of the aptamer off single-walled carbon nanotubes for electrochemical aptasensing.

    PubMed

    Fu, Yingchun; Wang, Ting; Bu, Lijuan; Xie, Qingji; Li, Penghao; Chen, Jinhua; Yao, Shouzhuo

    2011-03-07

    A simple and efficient post-labeling strategy based on dye-induced peeling of the aptamer molecules off single-walled carbon nanotubes was developed for electrochemical aptasensing of thrombin with a detection limit down to 3 pM.

  19. The occurrence of double strand DNA breaks is not the sole condition for meiotic crossing over in Drosophila melanogaster.

    PubMed

    Portin, P; Rantanen, M

    2000-01-01

    Analysis of the interchromosomal effects of In(2L + 2R)Cy, In(3L + 3R)LVM and their joint effect on the frequencies of single and double crossovers in the cv-v-f region of the X chromosome as well as interference showed that both inversions, occurring separately, increased the frequency of single as well as double crossovers and the coefficient of coincidence. However, when the inversions occurred together the frequencies of single crossovers no longer increased, but the frequency of double crossovers, as well as the coefficient of coincidence did increase. These results indicate firstly that the interchromosomal effects influence some precondition of exchange, but that this precondition is not an occurrence of double strand DNA breaks. Thus, the occurrence of double strand DNA breaks is not the sole condition for crossing over in Drosophila melanogaster.

  20. Genome-Wide Profiling of DNA Double-Strand Breaks by the BLESS and BLISS Methods.

    PubMed

    Mirzazadeh, Reza; Kallas, Tomasz; Bienko, Magda; Crosetto, Nicola

    2018-01-01

    DNA double-strand breaks (DSBs) are major DNA lesions that are constantly formed during physiological processes such as DNA replication, transcription, and recombination, or as a result of exogenous agents such as ionizing radiation, radiomimetic drugs, and genome editing nucleases. Unrepaired DSBs threaten genomic stability by leading to the formation of potentially oncogenic rearrangements such as translocations. In past few years, several methods based on next-generation sequencing (NGS) have been developed to study the genome-wide distribution of DSBs or their conversion to translocation events. We developed Breaks Labeling, Enrichment on Streptavidin, and Sequencing (BLESS), which was the first method for direct labeling of DSBs in situ followed by their genome-wide mapping at nucleotide resolution (Crosetto et al., Nat Methods 10:361-365, 2013). Recently, we have further expanded the quantitative nature, applicability, and scalability of BLESS by developing Breaks Labeling In Situ and Sequencing (BLISS) (Yan et al., Nat Commun 8:15058, 2017). Here, we first present an overview of existing methods for genome-wide localization of DSBs, and then focus on the BLESS and BLISS methods, discussing different assay design options depending on the sample type and application.

  1. Label-free as-grown double wall carbon nanotubes bundles for Salmonella typhimurium immunoassay.

    PubMed

    Punbusayakul, Niramol; Talapatra, Saikat; Ajayan, Pulickel M; Surareungchai, Werasak

    2013-01-01

    A label-free immunosensor from as-grown double wall carbon nanotubes (DW) bundles was developed for detecting Salmonella typhimurium. The immunosensor was fabricated by using the as-grown DW bundles as an electrode material with an anti-Salmonella impregnated on the surface. The immunosensor was electrochemically characterized by cyclic voltammetry. The working potential (100, 200, 300 and 400 mV vs. Ag/AgCl) and the anti-Salmonella concentration (10, 25, 50, 75, and 100 μg/mL) at the electrode were subsequently optimized. Then, chronoamperometry was used with the optimum potential of 100 mV vs. Ag/AgCl) and the optimum impregnated anti-Salmonella of 10 μg/mL to detect S. typhimurium cells (0-10(9) CFU/mL). The DW immunosensor exhibited a detection range of 10(2) to 10(7) CFU/mL for the bacteria with a limit of detection of 8.9 CFU/mL according to the IUPAC recommendation. The electrode also showed specificity to S. typhimurium but no current response to Escherichia coli. These findings suggest that the use of a label-free DW immunosensor is promising for detecting S. typhimurium.

  2. Bias stress instability of double-gate a-IGZO TFTs on polyimide substrate

    NASA Astrophysics Data System (ADS)

    Cho, Won-Ju; Ahn, Min-Ju

    2017-09-01

    In this study, flexible double-gate thin-film transistor (TFT)-based amorphous indium-galliumzinc- oxide (a-IGZO) was fabricated on a polyimide substrate. Double-gate operation with connected front and back gates was compared with a single-gate operation. As a result, the double-gate a- IGZO TFT exhibited enhanced electrical characteristics as well as improved long-term reliability. Under positive- and negative-bias temperature stress, the threshold voltage shift of the double-gate operation was much smaller than that of the single-gate operation.

  3. Single-Versus Double-Row Arthroscopic Rotator Cuff Repair in Massive Tears

    PubMed Central

    Wang, EnZhi; Wang, Liang; Gao, Peng; Li, ZhongJi; Zhou, Xiao; Wang, SongGang

    2015-01-01

    Background It is a challenge for orthopaedic surgeons to treat massive rotator cuff tears. The optimal management of massive rotator cuff tears remains controversial. Therefore, the goal of this study was to compare arthroscopic single- versus double-row rotator cuff repair with a larger sample size. Material/Methods Of the subjects with massive rotator cuff tears, 146 were treated using single-row repair, and 102 were treated using double-row repair. Pre- and postoperative functional outcomes and radiographic images were collected. The clinical outcomes were evaluated for a minimum of 2 years. Results No significant differences were shown between the groups in terms of functional outcomes. Regarding the integrity of the tendon, a lower rate of post-treatment retear was observed in patients who underwent double-row repair compared with single-row repair. Conclusions The results suggest that double-row repair is relatively superior in shoulder ROM and the strength of tendon compared with single-row repair. Future studies involving more patients in better-designed randomized controlled trials will be required. PMID:26017641

  4. Method for rapid base sequencing in DNA and RNA with two base labeling

    DOEpatents

    Jett, J.H.; Keller, R.A.; Martin, J.C.; Posner, R.G.; Marrone, B.L.; Hammond, M.L.; Simpson, D.J.

    1995-04-11

    A method is described for rapid-base sequencing in DNA and RNA with two-base labeling and employing fluorescent detection of single molecules at two wavelengths. Bases modified to accept fluorescent labels are used to replicate a single DNA or RNA strand to be sequenced. The bases are then sequentially cleaved from the replicated strand, excited with a chosen spectrum of electromagnetic radiation, and the fluorescence from individual, tagged bases detected in the order of cleavage from the strand. 4 figures.

  5. Method for rapid base sequencing in DNA and RNA with two base labeling

    DOEpatents

    Jett, James H.; Keller, Richard A.; Martin, John C.; Posner, Richard G.; Marrone, Babetta L.; Hammond, Mark L.; Simpson, Daniel J.

    1995-01-01

    Method for rapid-base sequencing in DNA and RNA with two-base labeling and employing fluorescent detection of single molecules at two wavelengths. Bases modified to accept fluorescent labels are used to replicate a single DNA or RNA strand to be sequenced. The bases are then sequentially cleaved from the replicated strand, excited with a chosen spectrum of electromagnetic radiation, and the fluorescence from individual, tagged bases detected in the order of cleavage from the strand.

  6. Functional and structural outcomes of single-row versus double-row versus combined double-row and suture-bridge repair for rotator cuff tears.

    PubMed

    Mihata, Teruhisa; Watanabe, Chisato; Fukunishi, Kunimoto; Ohue, Mutsumi; Tsujimura, Tomoyuki; Fujiwara, Kenta; Kinoshita, Mitsuo

    2011-10-01

    Although previous biomechanical research has demonstrated the superiority of the suture-bridge rotator cuff repair over double-row repair from a mechanical point of view, no articles have described the structural and functional outcomes of this type of procedure. The structural and functional outcomes after arthroscopic rotator cuff repair may be different between the single-row, double-row, and combined double-row and suture-bridge (compression double-row) techniques. Cohort study; Level of evidence, 3. There were 206 shoulders in 201 patients with full-thickness rotator cuff tears that underwent arthroscopic rotator cuff repair. Eleven patients were lost to follow-up. Sixty-five shoulders were repaired using the single-row, 23 shoulders using the double-row, and 107 shoulders using the compression double-row techniques. Clinical outcomes were evaluated at an average of 38.5 months (range, 24-74 months) after rotator cuff repair. Postoperative cuff integrity was determined using Sugaya's classification of magnetic resonance imaging (MRI). The retear rates after arthroscopic rotator cuff repair were 10.8%, 26.1%, and 4.7%, respectively, for the single-row, double-row, and compression double-row techniques. In the subcategory of large and massive rotator cuff tears, the retear rate in the compression double-row group (3 of 40 shoulders, 7.5%) was significantly less than those in the single-row group (5 of 8 shoulders, 62.5%, P < .001) and the double-row group (5 of 12 shoulders, 41.7%, P < .01). Postoperative clinical outcomes in patients with a retear were significantly lower than those in patients without a retear for all 3 techniques. The additional suture bridges decreased the retear rate for large and massive tears. The combination of the double-row and suture-bridge techniques, which had the lowest rate of postoperative retear, is an effective option for arthroscopic repair of the rotator cuff tendons because the postoperative functional outcome in patients with a retear is inferior to that without retear.

  7. Determination and analysis of site-specific 125I decay-induced DNA double-strand break end-group structures.

    PubMed

    Datta, Kamal; Weinfeld, Michael; Neumann, Ronald D; Winters, Thomas A

    2007-02-01

    End groups contribute to the structural complexity of radiation-induced DNA double-strand breaks (DSBs). As such, end-group structures may affect a cell's ability to repair DSBs. The 3'-end groups of strand breaks caused by gamma radiation, or oxidative processes, under oxygenated aqueous conditions have been shown to be distributed primarily between 3'-phosphoglycolate and 3'-phosphate, with 5'-phosphate ends in both cases. In this study, end groups of the high-LET-like DSBs caused by 125I decay were investigated. Site-specific DNA double-strand breaks were produced in plasmid pTC27 in the presence or absence of 2 M DMSO by 125I-labeled triplex-forming oligonucleotide targeting. End-group structure was assessed enzymatically as a function of the DSB end to serve as a substrate for ligation and various forms of end labeling. Using this approach, we have demonstrated 3'-hydroxyl (3'-OH) and 3'-phosphate (3'-P) end groups and 5'-ends (> or = 42%) terminated by phosphate. A 32P postlabeling assay failed to detect 3'-phosphoglycolate in a restriction fragment terminated by the 125I-induced DNA double-strand break, and this is likely due to restricted oxygen diffusion during irradiation as a frozen aqueous solution. Even so, end-group structure and relative distribution varied as a function of the free radical scavenging capacity of the irradiation buffer.

  8. Optimal Tikhonov regularization for DEER spectroscopy

    NASA Astrophysics Data System (ADS)

    Edwards, Thomas H.; Stoll, Stefan

    2018-03-01

    Tikhonov regularization is the most commonly used method for extracting distance distributions from experimental double electron-electron resonance (DEER) spectroscopy data. This method requires the selection of a regularization parameter, α , and a regularization operator, L. We analyze the performance of a large set of α selection methods and several regularization operators, using a test set of over half a million synthetic noisy DEER traces. These are generated from distance distributions obtained from in silico double labeling of a protein crystal structure of T4 lysozyme with the spin label MTSSL. We compare the methods and operators based on their ability to recover the model distance distributions from the noisy time traces. The results indicate that several α selection methods perform quite well, among them the Akaike information criterion and the generalized cross validation method with either the first- or second-derivative operator. They perform significantly better than currently utilized L-curve methods.

  9. Molecular imaging needles: dual-modality optical coherence tomography and fluorescence imaging of labeled antibodies deep in tissue

    PubMed Central

    Scolaro, Loretta; Lorenser, Dirk; Madore, Wendy-Julie; Kirk, Rodney W.; Kramer, Anne S.; Yeoh, George C.; Godbout, Nicolas; Sampson, David D.; Boudoux, Caroline; McLaughlin, Robert A.

    2015-01-01

    Molecular imaging using optical techniques provides insight into disease at the cellular level. In this paper, we report on a novel dual-modality probe capable of performing molecular imaging by combining simultaneous three-dimensional optical coherence tomography (OCT) and two-dimensional fluorescence imaging in a hypodermic needle. The probe, referred to as a molecular imaging (MI) needle, may be inserted tens of millimeters into tissue. The MI needle utilizes double-clad fiber to carry both imaging modalities, and is interfaced to a 1310-nm OCT system and a fluorescence imaging subsystem using an asymmetrical double-clad fiber coupler customized to achieve high fluorescence collection efficiency. We present, to the best of our knowledge, the first dual-modality OCT and fluorescence needle probe with sufficient sensitivity to image fluorescently labeled antibodies. Such probes enable high-resolution molecular imaging deep within tissue. PMID:26137379

  10. The significance of calcified fibrocartilage on the cortical endplate of the translational sheep spine model.

    PubMed

    Sinclair, Sarina K; Bell, Spencer; Epperson, Richard Tyler; Bloebaum, Roy D

    2013-05-01

    To gain an understanding of the vertebral cortical endplate and factors that may affect the ability to achieve skeletal attachment to intervertebral implants and fusion, this study aimed to characterize the hypermineralized tissue on the cortical endplate of the vertebral body on a commonly used animal model. Skeletally mature sheep were injected with tetracycline prior to euthanasia and the C2-C3, T5-T6, and L2-L3 spinal motion segments were excised and prepared. Vertebral tissues were imaged using backscatter electron (BSE) imaging, histology, and tetracycline labeling was used to assess bone remodeling within different tissue layers. It was determined that the hypermineralized tissue layer was calcified fibrocartilage (CFC). No tetracycline labels were identified in the CFC layer, in contrast to single and double labels that were present in the underlying bone, indicating the CFC present on the cortical endplate was not being actively remodeled. The average thickness of the CFC layer was 146.3 ± 70.53 µm in the cervical region, 98.2 ± 40.29 µm in the thoracic region, and 150.89 ± 69.25 µm in the lumbar region. This difference in thickness may be attributed to the regional biomechanical properties of the spine. Results from this investigation indicate the presence of a nonremodeling tissue on the cortical endplate of the vertebral body in sheep spines, which attaches the intervertebral disc to the vertebrae. This tissue, if not removed, would likely prevent successful bony attachment to an intervertebral device in spinal fusion studies and total disc replacement surgeries. Copyright © 2013 Wiley Periodicals, Inc.

  11. DNA-stabilized silver nanoclusters and carbon nanoparticles oxide: A sensitive platform for label-free fluorescence turn-on detection of HIV-DNA sequences.

    PubMed

    Ye, Yu-Dan; Xia, Li; Xu, Dang-Dang; Xing, Xiao-Jing; Pang, Dai-Wen; Tang, Hong-Wu

    2016-11-15

    Based on the remarkable difference between the interactions of carbon nanoparticles (CNPs) oxide with single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA), and the fact that fluorescence of DNA-stabilized silver nanoclusters (AgNCs) can be quenched by CNPs oxide, DNA-functionalized AgNCs were applied as label-free fluorescence probes and a novel fluorescence resonance energy transfer (FRET) sensor was successfully constructed for the detection of human immunodeficiency virus (HIV) DNA sequences. CNPs oxide were prepared with the oxidation of candle soot, hence it is simple, time-saving and low-cost. The strategy of dual AgNCs probes was applied to improve the detection sensitivity by using dual- probe capturing the same target DNA in a sandwich mode and as the fluorescence donor, and using CNPs oxide as the acceptor. In the presence of target DNA, a dsDNA hybrid forms, leading to the desorption of the ssDNA-AgNCs probes from CNPs oxide, and the recovering of fluorescence of the AgNCs in a HIV-DNA concentration-dependent manner. The results show that HIV-DNA can be detected in the range of 1-50nM with a detection limit of 0.40nM in aqueous buffer. The method is simple, rapid and sensitive with no need of labeled fluorescent probes, and moreover, the design of fluorescent dual-probe makes full use of the excellent fluorescence property of AgNCs and further improves the detection sensitivity. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Simply amplified electrochemical aptasensor of ochratoxin A based on exonuclease-catalyzed target recycling.

    PubMed

    Tong, Ping; Zhang, Lan; Xu, Jing-Juan; Chen, Hong-Yuan

    2011-11-15

    A new "signal-on" aptasensor for ultrasensitive detection of Ochratoxin A (OTA) in wheat starch was developed based on exonuclease-catalyzed target recycling. To construct the aptasensor, a ferrocene (Fc) labeled probe DNA (S1) was immobilized on a gold electrode (GE) via Au-S bonding for the following hybridization with the complementary OTA aptamer, with the labeled Fc on S1 far from the GE surface. In the presence of analyte OTA, the formation of aptamer-OTA complex would result in not only the dissociation of aptamer from the double-strand DNA but also the transformation of the probe DNA into a hairpin structure. Subsequently, the OTA could be liberated from the aptamer-OTA complex for analyte recycling due to the employment of exonuclease, which is a single-stranded DNA specific exonuclease to selectively digest the appointed DNA (aptamer). Owing to the labeled Fc in close proximity to the electrode surface caused by the formation of the hairpin DNA and to the analyte recycling, differential pulse voltammetry (DPV) signal could be produced with enhanced signal amplification. Based on this strategy, an ultrasensitive aptasensor for the detection of OTA could be exhibited with a wide linear range of 0.005-10.0ngmL(-1) with a low detection limit (LOD) of 1.0pgmL(-1) OTA (at 3σ). The fabricated biosensor was then applied for the measurement of OTA in real wheat starch sample and validated by ELISA method. Copyright © 2011 Elsevier B.V. All rights reserved.

  13. Label-Free Sensitive Detection of DNA Methyltransferase by Target-Induced Hyperbranched Amplification with Zero Background Signal.

    PubMed

    Zhang, Yan; Wang, Xin-Yan; Zhang, Qianyi; Zhang, Chun-Yang

    2017-11-21

    DNA methyltransferases (MTases) may specifically recognize the short palindromic sequences and transfer a methyl group from S-adenosyl-l-methionine to target cytosine/adenine. The aberrant DNA methylation is linked to the abnormal DNA MTase activity, and some DNA MTases have become promising targets of anticancer/antimicrobial drugs. However, the reported DNA MTase assays often involve laborious operation, expensive instruments, and radio-labeled substrates. Here, we develop a simple and label-free fluorescent method to sensitively detect DNA adenine methyltransferase (Dam) on the basis of terminal deoxynucleotidyl transferase (TdT)-activated Endonuclease IV (Endo IV)-assisted hyperbranched amplification. We design a hairpin probe with a palindromic sequence in the stem as the substrate and a NH 2 -modified 3' end for the prevention of nonspecific amplification. The substrate may be methylated by Dam and subsequently cleaved by DpnI, producing three single-stranded DNAs, two of which with 3'-OH termini may be amplified by hyperbranched amplification to generate a distinct fluorescence signal. Because high exactitude of TdT enables the amplification only in the presence of free 3'-OH termini and Endo IV only hydrolyzes the intact apurinic/apyrimidinic sites in double-stranded DNAs, zero background signal can be achieved. This method exhibits excellent selectivity and high sensitivity with a limit of detection of 0.003 U/mL for pure Dam and 9.61 × 10 -6 mg/mL for Dam in E. coli cells. Moreover, it can be used to screen the Dam inhibitors, holding great potentials in disease diagnosis and drug development.

  14. Exploratory Decision-Tree Modeling of Data from the Randomized REACTT Trial of Tadalafil Versus Placebo to Predict Recovery of Erectile Function After Bilateral Nerve-Sparing Radical Prostatectomy

    PubMed Central

    Montorsi, Francesco; Oelke, Matthias; Henneges, Carsten; Brock, Gerald; Salonia, Andrea; d’Anzeo, Gianluca; Rossi, Andrea; Mulhall, John P.; Büttner, Hartwig

    2017-01-01

    Background Understanding predictors for the recovery of erectile function (EF) after nerve-sparing radical prostatectomy (nsRP) might help clinicians and patients in preoperative counseling and expectation management of EF rehabilitation strategies. Objective To describe the effect of potential predictors on EF recovery after nsRP by post hoc decision-tree modeling of data from A Study of Tadalafil After Radical Prostatectomy (REACTT). Design, setting, and participants Randomized double-blind double-dummy placebo-controlled trial in 423 men aged <68 yr with adenocarcinoma of the prostate (Gleason ≤7, normal preoperative EF) who underwent nsRP at 50 centers from nine European countries and Canada. Intervention Postsurgery 1:1:1 randomization to 9-mo double-blind treatment with tadalafil 5 mg once a day (OaD), tadalafil 20 mg on demand, or placebo, followed by a 6-wk drug-free-washout, and a 3-mo open-label tadalafil OaD treatment. Outcome measurements and statistical analysis Three decision-tree models, using the International Index of Erectile Function-Erectile Function (IIEF-EF) domain score at the end of double-blind treatment, washout, and open-label treatment as response variable. Each model evaluated the association between potential predictors: presurgery IIEF domain and IIEF single-item scores, surgical approach, nerve-sparing score (NSS), and postsurgery randomized treatment group. Results and limitations The first decision-tree model (n = 422, intention-to-treat population) identified high presurgery sexual desire (IIEF item 12: ≥3.5 and <3.5) as the key predictor for IIEF-EF at the end of double-blind treatment (mean IIEF-EF: 14.9 and 11.1), followed by high confidence to get and maintain an erection (IIEF item 15: ≥3.5 and <3.5; IIEF-EF: 15.4 and 7.1). For patients meeting these criteria, additional non-IIEF–related predictors included robot-assisted laparoscopic surgery (yes or no; IIEF-EF: 19.3 and 12.6), quality of nerve sparing (NSS: <2.5 and ≥2.5; IIEF-EF: 14.3 and 10.5), and treatment with tadalafil OaD (yes and no; IIEF-EF: 17.6 and 14.3). Additional analyses after washout and open-label treatment identified high presurgery intercourse satisfaction as the key predictor. Conclusions Exploratory decision-tree analyses identified high presurgery sexual desire, confidence, and intercourse satisfaction as key predictors for EF recovery. Patients meeting these criteria might benefit the most from conserving surgery and early postsurgery EF rehabilitation. Strategies for improving EF after surgery should be discussed preoperatively with all patients; this information may support expectation management for functional recovery on an individual patient level. Patient summary Understanding how patient characteristics and different treatment options affect the recovery of erectile function (EF) after radical surgery for prostate cancer might help physicians select the optimal treatment for their patients. This analysis of data from a clinical trial suggested that high presurgery sexual desire, sexual confidence, and intercourse satisfaction are key factors predicting EF recovery. Patients meeting these criteria might benefit the most from conserving surgery (robot-assisted surgery, perfect nerve sparing) and postsurgery medical rehabilitation of EF. Trial registration ClinicalTrials.gov, NCT01026818 PMID:26947602

  15. Occurrence and Nature of Double Alleles in Variable-Number Tandem-Repeat Patterns of More than 8,000 Mycobacterium tuberculosis Complex Isolates in The Netherlands

    PubMed Central

    Kamst, Miranda; van Hunen, Rianne; de Zwaan, Carolina Catherina; Mulder, Arnout; Supply, Philip; Anthony, Richard; van der Hoek, Wim; van Soolingen, Dick

    2017-01-01

    ABSTRACT Since 2004, variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates has been applied on a structural basis in The Netherlands to study the epidemiology of tuberculosis (TB). Although this technique is faster and technically less demanding than the previously used restriction fragment length polymorphism (RFLP) typing, reproducibility remains a concern. In the period from 2004 to 2015, 8,532 isolates were subjected to VNTR typing in The Netherlands, with 186 (2.2%) of these exhibiting double alleles at one locus. Double alleles were most common in loci 4052 and 2163b. The variables significantly associated with double alleles were urban living (odds ratio [OR], 1.503; 95% confidence interval [CI], 1.084 to 2.084; P = 0.014) and pulmonary TB (OR, 1.703; 95% CI, 1.216 to 2.386; P = 0.002). Single-colony cultures of double-allele strains were produced and revealed single-allele profiles; a maximum of five single nucleotide polymorphisms (SNPs) was observed between the single- and double-allele isolates from the same patient when whole-genome sequencing (WGS) was applied. This indicates the presence of two bacterial populations with slightly different VNTR profiles in the parental population, related to genetic drift. This observation is confirmed by the fact that secondary cases from TB source cases with double-allele isolates sometimes display only one of the two alleles present in the source case. Double alleles occur at a frequency of 2.2% in VNTR patterns in The Netherlands. They are caused by biological variation rather than by technical aberrations and can be transmitted either as single- or double-allele variants. PMID:29142049

  16. Biomechanical and magnetic resonance imaging evaluation of a single- and double-row rotator cuff repair in an in vivo sheep model.

    PubMed

    Baums, Mike H; Spahn, Gunter; Buchhorn, Gottfried H; Schultz, Wolfgang; Hofmann, Lars; Klinger, Hans-Michael

    2012-06-01

    To investigate the biomechanical and magnetic resonance imaging (MRI)-derived morphologic changes between single- and double-row rotator cuff repair at different time points after fixation. Eighteen mature female sheep were randomly assigned to either a single-row treatment group using arthroscopic Mason-Allen stitches or a double-row treatment group using a combination of arthroscopic Mason-Allen and mattress stitches. Each group was analyzed at 1 of 3 survival points (6 weeks, 12 weeks, and 26 weeks). We evaluated the integrity of the cuff repair using MRI and biomechanical properties using a mechanical testing machine. The mean load to failure was significantly higher in the double-row group compared with the single-row group at 6 and 12 weeks (P = .018 and P = .002, respectively). At 26 weeks, the differences were not statistically significant (P = .080). However, the double-row group achieved a mean load to failure similar to that of a healthy infraspinatus tendon, whereas the single-row group reached only 70% of the load of a healthy infraspinatus tendon. No significant morphologic differences were observed based on the MRI results. This study confirms that in an acute repair model, double-row repair may enhance the speed of mechanical recovery of the tendon-bone complex when compared with single-row repair in the early postoperative period. Double-row rotator cuff repair enables higher mechanical strength that is especially sustained during the early recovery period and may therefore improve clinical outcome. Crown Copyright © 2012. Published by Elsevier Inc. All rights reserved.

  17. DNA hybridization sensor based on pentacene thin film transistor.

    PubMed

    Kim, Jung-Min; Jha, Sandeep Kumar; Chand, Rohit; Lee, Dong-Hoon; Kim, Yong-Sang

    2011-01-15

    A DNA hybridization sensor using pentacene thin film transistors (TFTs) is an excellent candidate for disposable sensor applications due to their low-cost fabrication process and fast detection. We fabricated pentacene TFTs on glass substrate for the sensing of DNA hybridization. The ss-DNA (polyA/polyT) or ds-DNA (polyA/polyT hybrid) were immobilized directly on the surface of the pentacene, producing a dramatic change in the electrical properties of the devices. The electrical characteristics of devices were studied as a function of DNA immobilization, single-stranded vs. double-stranded DNA, DNA length and concentration. The TFT device was further tested for detection of λ-phage genomic DNA using probe hybridization. Based on these results, we propose that a "label-free" detection technique for DNA hybridization is possible through direct measurement of electrical properties of DNA-immobilized pentacene TFTs. Copyright © 2010 Elsevier B.V. All rights reserved.

  18. Pre- and post-head processing for single- and double-scrambled sentences of a head-final language as measured by the eye tracking method.

    PubMed

    Tamaoka, Katsuo; Asano, Michiko; Miyaoka, Yayoi; Yokosawa, Kazuhiko

    2014-04-01

    Using the eye-tracking method, the present study depicted pre- and post-head processing for simple scrambled sentences of head-final languages. Three versions of simple Japanese active sentences with ditransitive verbs were used: namely, (1) SO₁O₂V canonical, (2) SO₂O₁V single-scrambled, and (3) O₁O₂SV double-scrambled order. First pass reading times indicated that the third noun phrase just before the verb in both single- and double-scrambled sentences required longer reading times compared to canonical sentences. Re-reading times (the sum of all fixations minus the first pass reading) showed that all noun phrases including the crucial phrase before the verb in double-scrambled sentences required longer re-reading times than those required for single-scrambled sentences; single-scrambled sentences had no difference from canonical ones. Therefore, a single filler-gap dependency can be resolved in pre-head anticipatory processing whereas two filler-gap dependencies require much greater cognitive loading than a single case. These two dependencies can be resolved in post-head processing using verb agreement information.

  19. A coupled-cluster study of photodetachment cross sections of closed-shell anions

    NASA Astrophysics Data System (ADS)

    Cukras, Janusz; Decleva, Piero; Coriani, Sonia

    2014-11-01

    We investigate the performance of Stieltjes Imaging applied to Lanczos pseudo-spectra generated at the coupled cluster singles and doubles, coupled cluster singles and approximate iterative doubles and coupled cluster singles levels of theory in modeling the photodetachment cross sections of the closed shell anions H-, Li-, Na-, F-, Cl-, and OH-. The accurate description of double excitations is found to play a much more important role than in the case of photoionization of neutral species.

  20. A coupled-cluster study of photodetachment cross sections of closed-shell anions.

    PubMed

    Cukras, Janusz; Decleva, Piero; Coriani, Sonia

    2014-11-07

    We investigate the performance of Stieltjes Imaging applied to Lanczos pseudo-spectra generated at the coupled cluster singles and doubles, coupled cluster singles and approximate iterative doubles and coupled cluster singles levels of theory in modeling the photodetachment cross sections of the closed shell anions H(-), Li(-), Na(-), F(-), Cl(-), and OH(-). The accurate description of double excitations is found to play a much more important role than in the case of photoionization of neutral species.

  1. Demonstration of Single-Barium-Ion Sensitivity for Neutrinoless Double-Beta Decay Using Single-Molecule Fluorescence Imaging

    DOE PAGES

    McDonald, A. D.; Jones, B. J. P.; Nygren, D. R.; ...

    2018-03-26

    A new method to tag the barium daughter in the double beta decay ofmore » $$^{136}$$Xe is reported. Using the technique of single molecule fluorescent imaging (SMFI), individual barium dication (Ba$$^{++}$$) resolution at a transparent scanning surface has been demonstrated. A single-step photo-bleach confirms the single ion interpretation. Individual ions are localized with super-resolution ($$\\sim$$2~nm), and detected with a statistical significance of 12.9~$$\\sigma$$ over backgrounds. This lays the foundation for a new and potentially background-free neutrinoless double beta decay technology, based on SMFI coupled to high pressure xenon gas time projection chambers.« less

  2. Effect of multiple plasmon excitation on single, double and multiple ionizations of C60 in collisions with fast highly charged Si ions

    NASA Astrophysics Data System (ADS)

    Kelkar, A. H.; Kadhane, U.; Misra, D.; Kumar, A.; Tribedi, L. C.

    2007-06-01

    We have investigated the single and multiple ionizations of the C60 molecule in collisions with fast Siq+ projectiles for various projectile charge states (q) between q = 6 and 14. The q-dependence of the ionization cross sections and their ratios is compared with the giant dipole plasmon resonance (GDPR) model. The excellent qualitative agreement with the model in case of single and double ionizations and also a reasonable agreement with the triple (and to some extent with quadruple) ionization (without evaporation) yields signify dominant contributions of the single-, double- and triple-plasmon excitations on the single- and multiple-ionization process.

  3. Effects of an oral contraceptive (norgestimate/ethinyl estradiol) on bone mineral density in women with hypothalamic amenorrhea and osteopenia: an open-label extension of a double-blind, placebo-controlled study.

    PubMed

    Warren, Michelle P; Miller, K K; Olson, W H; Grinspoon, S K; Friedman, A J

    2005-09-01

    The effects of long-term triphasic oral contraceptive administration on bone mineral density (BMD) were investigated in premenopausal women with hypothalamic amenorrhea (HA) and osteopenia. After completing three 28-day cycles in the double-blind phase of a placebo-controlled trial, women (mean age, 26.7 years) who received norgestimate 180-250 microg/ethinyl estradiol 35 microg (NGM/EE, n = 15) or placebo (n = 12) in the double-blind phase were to receive open-label NGM/EE for 10 additional cycles. For subjects completing > or =10 NGM/EE treatment cycles, mean posteroanterior total lumbar spine BMD (L1-L4) increased from 0.881+/-0.0624 g/cm2 at baseline (last visit prior to NGM/EE) to 0.894+/-0.0654 g/cm2 at final visit (p = .043); no significant changes in hip BMD occurred. Decreases in N-telopeptide, osteocalcin, procollagen type I propeptide and bone-specific alkaline phosphatase levels indicated effects on bone metabolism. Long-term administration of triphasic NGM/EE to osteopenic women with HA may increase total lumbar spine BMD.

  4. Effects of Maternal Behavior Induction and Pup Exposure on Neurogenesis in Adult, Virgin Female Rats

    PubMed Central

    Furuta, Miyako; Bridges, Robert S.

    2009-01-01

    The states of pregnancy and lactation bring about a range of physiological and behavioral changes in the adult mammal that prepare the mother to care for her young. Cell proliferation increases in the subventricular zone (SVZ) of the female rodent brain during both pregnancy and lactation when compared to that in cycling, diestrous females. In the present study, the effects of maternal behavior induction and pup exposure on neurogenesis in nulliparous rats were examined in order to determine whether maternal behavior itself, independent of pregnancy and lactation, might affect neurogenesis. Adult, nulliparous, Sprague-Dawley, female rats were exposed daily to foster young in order to induce maternal behavior. Following the induction of maternal behavior each maternal subject plus females that were exposed to pups for a comparable number of test days, but did not display maternal behavior, and subjects that had received no pup exposure were injected with bromodeoxyuridine (BrdU, 90 mg/kg, i.v.). Brain sections were double-labeled for BrdU and the neural marker, NeuN, to examine the proliferating cell population. Increases in the number of double-labeled cells were found in the maternal virgin brain when compared with the number of double-labeled cells present in non-maternal, pup-exposed nulliparous rats and in females not exposed to young. No changes were evident in the dentate gyrus of the hippocampus as a function of maternal behavior. These data indicate that in nulliparous female rats maternal behavior itself is associated with the stimulation of neurogenesis in the SVZ. PMID:19712726

  5. Maintenance N-acetyl cysteine treatment for bipolar disorder: A double-blind randomized placebo controlled trial

    PubMed Central

    2012-01-01

    Background N-acetyl cysteine (NAC) is a glutathione precursor that has been shown to have antidepressant efficacy in a placebo-controlled trial. The current study aimed to investigate the maintenance effects of NAC following eight weeks of open-label treatment for bipolar disorder. Method The efficacy of a double blind randomized placebo controlled trial of 2 g/day NAC as adjunct maintenance treatment for bipolar disorder was examined. Participants (n = 149) had a Montgomery Asberg Depression Rating Score of ≥12 at trial entry and, after eight weeks of open-label NAC treatment, were randomized to adjunctive NAC or placebo, in addition to treatment as usual. Participants (primarily outpatients) were recruited through public and private services and through newspaper advertisements. Time to intervention for a mood episode was the primary endpoint of the study, and changes in mood symptoms, functionality and quality of life measures were secondary outcomes. Results There was a substantial decrease in symptoms during the eight-week open-label NAC treatment phase. During the subsequent double-blind phase, there was minimal further change in outcome measures with scores remaining low. Consequently, from this low plateau, between-group differences did not emerge on recurrence, clinical functioning or quality of life measures. Conclusions There were no significant between-group differences in recurrence or symptomatic outcomes during the maintenance phase of the trial; however, these findings may be confounded by limitations. Trial Registration The trial was registered with the Australian New Zealand Clinical Trials Registry (ACTRN12607000074493). PMID:22891797

  6. Labeling single cell for in-vivo study of cell fate mapping and lineage tracing

    NASA Astrophysics Data System (ADS)

    He, Sicong; Xu, Jin; Wu, Yi; Tian, Ye; Sun, Qiqi; Wen, Zilong; Qu, Jianan Y.

    2018-02-01

    Cell fate mapping and lineage tracing are significant ways to understanding the developmental origins of biological tissues. It requires labeling individual cells and tracing the development of their progeny. We develop an infrared laser-evoked gene operator heat-shock microscope system to achieve single-cell labeling in zebrafish. With a fluorescent thermometry technique, we measure the temperature increase in zebrafish tissues induced by infrared laser and identify the optimal heat shock conditions for single-cell gene induction in different types of zebrafish cells. We use this technique to study the fate mapping of T lymphocytes and discover the distinct waves of lymphopoiesis during the zebrafish development.

  7. Opicapone as Adjunct to Levodopa Therapy in Patients With Parkinson Disease and Motor Fluctuations: A Randomized Clinical Trial.

    PubMed

    Lees, Andrew J; Ferreira, Joaquim; Rascol, Olivier; Poewe, Werner; Rocha, José-Francisco; McCrory, Michelle; Soares-da-Silva, Patricio

    2017-02-01

    Catechol O-methyltransferase (COMT) inhibitors are an established treatment for end-of-dose motor fluctuations associated with levodopa therapy in patients with Parkinson disease (PD). Current COMT inhibitors carry a high risk for toxic effects to hepatic cells or show moderate improvement. Opicapone was designed to be effective without the adverse effects. To evaluate the efficacy and safety of 25- and 50-mg/d dosages of opicapone compared with placebo as adjunct to levodopa therapy in patients with PD experiencing end-of-dose motor fluctuations. This phase 3 international, multicenter outpatient study evaluated a 25- and a 50-mg/d dosage of opicapone in a randomized, double-blind, 14- to 15-week, placebo-controlled clinical trial, followed by a 1-year open-label phase during which all patients received active treatment with opicapone. Patients with PD who experienced signs of end-of-dose deterioration and had a mean total awake off-time (state of akinesia or decreased mobility) of at least 1.5 hours, not including morning akinesia, were enrolled. Data were collected from March 18, 2011, through June 25, 2013. Data from the evaluable population were analyzed from July 31, 2013, to July 31, 2014. The primary efficacy outcome of the double-blind phase was the change from baseline in absolute off-time vs placebo based on patient diaries. The open-label phase focused on maintenance of treatment effect in off-time. A total of 427 patients (258 men [60.4%] and 169 women [39.6%]; mean [SD] age, 63.1 [8.8] years) were randomized to a 25-mg/d (n = 129) or a 50-mg/d (n = 154) dosage of opicapone or to placebo (n = 144). Of these, 376 patients completed the double-blind phase and entered the open-label phase, of whom 286 completed 1 year of open-label treatment. At the end of the double-blind phase, the least squares mean change (SE) in off-time was -64.5 (14.4) minutes for the placebo group, -101.7 (14.9) minutes for the 25-mg/d opicapone group, and -118.8 (13.8) minutes for the 50-mg/d opicapone group. The adjusted treatment difference vs placebo was significant for the 50-mg/d opicapone group (treatment effect, -54.3 [95% CI, -96.2 to -12.4] minutes; P = .008), but not for the 25-mg/d opicapone group (treatment effect, -37.2 [95% CI, -80.8 to 6.4] minutes; P = .11). The off-time reduction was sustained throughout the open-label phase (-126.3 minutes at 1-year open-label end point). The most common adverse events in the opicapone vs placebo groups were dyskinesia, constipation, and dry mouth. Fifty-one patients (11.9%) discontinued from the study during the double-blind phase. Treatment with a 50-mg once-daily dose of opicapone was associated with a significant reduction in mean daily off-time in levodopa-treated patients with PD and motor fluctuations, and this effect is maintained for at least 1 year. Opicapone was safe and well tolerated. clinicaltrials.gov Identifier: NCT01227655.

  8. Efficacy, safety and tolerability of ongoing statin plus ezetimibe versus doubling the ongoing statin dose in hypercholesterolemic Taiwanese patients: an open-label, randomized clinical trial

    PubMed Central

    2012-01-01

    Background Reducing low-density lipoprotein cholesterol (LDL-C) is associated with reduced risk for major coronary events. Despite statin efficacy, a considerable proportion of statin-treated hypercholesterolemic patients fail to reach therapeutic LDL-C targets as defined by guidelines. This study compared the efficacy of ezetimibe added to ongoing statins with doubling the dose of ongoing statin in a population of Taiwanese patients with hypercholesterolemia. Methods This was a randomized, open-label, parallel-group comparison study of ezetimibe 10 mg added to ongoing statin compared with doubling the dose of ongoing statin. Adult Taiwanese hypercholesterolemic patients not at optimal LDL-C levels with previous statin treatment were randomized (N = 83) to ongoing statin + ezetimibe (simvastatin, atorvastatin or pravastatin + ezetimibe at doses of 20/10, 10/10 or 20/10 mg) or doubling the dose of ongoing statin (simvastatin 40 mg, atorvastatin 20 mg or pravastatin 40 mg) for 8 weeks. Percent change in total cholesterol, LDL-C, high-density lipoprotein cholesterol (HDL-C) and triglycerides, and specified safety parameters were assessed at 4 and 8 weeks. Results At 8 weeks, patients treated with statin + ezetimibe experienced significantly greater reductions compared with doubling the statin dose in LDL-C (26.2% vs 17.9%, p = 0.0026) and total cholesterol (20.8% vs 12.2%, p = 0.0003). Percentage of patients achieving treatment goal was greater for statin + ezetimibe (58.6%) vs doubling statin (41.2%), but the difference was not statistically significant (p = 0.1675). The safety and tolerability profiles were similar between treatments. Conclusion Ezetimibe added to ongoing statin therapy resulted in significantly greater lipid-lowering compared with doubling the dose of statin in Taiwanese patients with hypercholesterolemia. Studies to assess clinical outcome benefit are ongoing. Trial registration Registered at ClinicalTrials.gov: NCT00652327 PMID:22621316

  9. Labeling viral envelope lipids with quantum dots by harnessing the biotinylated lipid-self-inserted cellular membrane.

    PubMed

    Lv, Cheng; Lin, Yi; Liu, An-An; Hong, Zheng-Yuan; Wen, Li; Zhang, Zhenfeng; Zhang, Zhi-Ling; Wang, Hanzhong; Pang, Dai-Wen

    2016-11-01

    Highly efficient labeling of viruses with quantum dots (QDs) is the prerequisite for the long-term tracking of virus invasion at the single virus level to reveal mechanisms of virus infection. As one of the structural components of viruses, viral envelope lipids are hard to be labeled with QDs due to the lack of efficient methods to modify viral envelope lipids. Moreover, it is still a challenge to maintain the intactness and infectivity of labeled viruses. Herein, a mild method has been developed to label viral envelope lipids with QDs by harnessing the biotinylated lipid-self-inserted cellular membrane. Biotinylated lipids can spontaneously insert in cellular membranes of host cells during culture and then be naturally assembled on progeny Pseudorabies virus (PrV) via propagation. The biotinylated PrV can be labeled with streptavidin-conjugated QDs, with a labeling efficiency of ∼90%. Such a strategy to label lipids with QDs can retain the intactness and infectivity of labeled viruses to the largest extent, facilitating the study of mechanisms of virus infection at the single virus level. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Visualizing long-term single-molecule dynamics in vivo by stochastic protein labeling.

    PubMed

    Liu, Hui; Dong, Peng; Ioannou, Maria S; Li, Li; Shea, Jamien; Pasolli, H Amalia; Grimm, Jonathan B; Rivlin, Patricia K; Lavis, Luke D; Koyama, Minoru; Liu, Zhe

    2018-01-09

    Our ability to unambiguously image and track individual molecules in live cells is limited by packing of multiple copies of labeled molecules within the resolution limit. Here we devise a universal genetic strategy to precisely control copy number of fluorescently labeled molecules in a cell. This system has a dynamic range of ∼10,000-fold, enabling sparse labeling of proteins expressed at different abundance levels. Combined with photostable labels, this system extends the duration of automated single-molecule tracking by two orders of magnitude. We demonstrate long-term imaging of synaptic vesicle dynamics in cultured neurons as well as in intact zebrafish. We found axon initial segment utilizes a "waterfall" mechanism gating synaptic vesicle transport polarity by promoting anterograde transport processivity. Long-time observation also reveals that transcription factor hops between clustered binding sites in spatially restricted subnuclear regions, suggesting that topological structures in the nucleus shape local gene activities by a sequestering mechanism. This strategy thus greatly expands the spatiotemporal length scales of live-cell single-molecule measurements, enabling new experiments to quantitatively understand complex control of molecular dynamics in vivo.

  11. Hazardous Material Packaging and Transportation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hypes, Philip A.

    2016-02-04

    This is a student training course. Some course objectives are to: recognize and use standard international and US customary units to describe activities and exposure rates associated with radioactive material; determine whether a quantity of a single radionuclide meets the definition of a class 7 (radioactive) material; determine, for a given single radionuclide, the shipping quantity activity limits per 49 Code of Federal Regulations (CFR) 173.435; determine the appropriate radioactive material hazard class proper shipping name for a given material; determine when a single radionuclide meets the DOT definition of a hazardous substance; determine the appropriate packaging required for amore » given radioactive material; identify the markings to be placed on a package of radioactive material; determine the label(s) to apply to a given radioactive material package; identify the entry requirements for radioactive material labels; determine the proper placement for radioactive material label(s); identify the shipping paper entry requirements for radioactive material; select the appropriate placards for a given radioactive material shipment or vehicle load; and identify allowable transport limits and unacceptable transport conditions for radioactive material.« less

  12. Liver nuclear DNA synthesis in mice following carbon tetrachloride administration or partial hepatectomy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gans, J.H.; Korson, R.

    1984-02-01

    Long-term, continuous (twice per week) administration of CCl/sub 4/ to male mice resulted in a high incidence of liver nodules which appear to be resistant to the necrotizing effects of CCl/sub 4/ but showed no features of malignant neoplasia. Liver nuclear DNA synthesis was compared in mice given CCl/sub 4/ and in mice subjected to partial hepatectomy (PH). Mice were given by gavage corn oil or CCl/sub 4/ in corn oil for periods of 2 to 25 weeks and several mice were subjected to PH after 12 and 25 weeks of corn oil treatment. Mice were given (/sup 3/H)TdR duringmore » liver regeneration and newly synthesized liver nuclear DNA was isolated and separated by BND-cellulose chromatography. Greater than 85% of the labeled DNA from PH mice eluted from BND-cellulose columns as double-stranded (ds) DNA with single-stranded (ss) regions or ends and less than 15% as ds DNA. When mice were treated with CCl/sub 4/ for 8 weeks or longer a significantly greater portion of liver nuclear DNA eluted as ds DNA. Administration of HU and 5-FU with (/sup 3/H)TdR decreased (/sup 3/H)TdR incorporation into DNA to low levels incompatible with unscheduled DNA synthesis. Single doses of CCl/sub 4/ given to mice treated with corn oil for 2 to 12 weeks provided newly synthesized DNA which was primarily (>80%) ds DNA with ss regions or ends, but after 25 weeks of corn oil administration, a single dose of CCl/sub 4/ resulted in newly synthesized DNA with a greater proportion of ds DNA. The high labeling of ds DNA in mice treated with CCl/sub 4/ may have resulted from an alternate pathway of DNA synthesis catalyzed by the enzymes or enzyme complexes associated with semiconservative DNA synthesis or from proliferation of nonparenchymal cells with a rapid turn-over rate.« less

  13. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    PubMed

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

    2017-07-19

    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  14. Differential pH-dependent cellular uptake pathways among foamy viruses elucidated using dual-colored fluorescent particles

    PubMed Central

    2012-01-01

    Background It is thought that foamy viruses (FVs) enter host cells via endocytosis because all FV glycoproteins examined display pH-dependent fusion activities. Only the prototype FV (PFV) glycoprotein has also significant fusion activity at neutral pH, suggesting that its uptake mechanism may deviate from other FVs. To gain new insights into the uptake processes of FV in individual live host cells, we developed fluorescently labeled infectious FVs. Results N-terminal tagging of the FV envelope leader peptide domain with a fluorescent protein resulted in efficient incorporation of the fluorescently labeled glycoprotein into secreted virions without interfering with their infectivity. Double-tagged viruses consisting of an eGFP-tagged PFV capsid (Gag-eGFP) and mCherry-tagged Env (Ch-Env) from either PFV or macaque simian FV (SFVmac) were observed during early stages of the infection pathway. PFV Env, but not SFVmac Env, containing particles induced strong syncytia formation on target cells. Both virus types showed trafficking of double-tagged virions towards the cell center. Upon fusion and subsequent capsid release into the cytosol, accumulation of naked capsid proteins was observed within four hours in the perinuclear region, presumably representing the centrosomes. Interestingly, virions harboring fusion-defective glycoproteins still promoted virus attachment and uptake, but failed to show syncytia formation and perinuclear capsid accumulation. Biochemical and initial imaging analysis indicated that productive fusion events occur predominantly within 4–6 h after virus attachment. Non-fused or non-fusogenic viruses are rapidly cleared from the cells by putative lysosomal degradation. Quantitative monitoring of the fraction of individual viruses containing both Env and capsid signals as a function of time demonstrated that PFV virions fused within the first few minutes, whereas fusion of SFVmac virions was less pronounced and observed over the entire 90 minutes measured. Conclusions The characterized double-labeled FVs described here provide new mechanistic insights into FV early entry steps, demonstrating that productive viral fusion occurs early after target cell attachment and uptake. The analysis highlights apparent differences in the uptake pathways of individual FV species. Furthermore, the infectious double-labeled FVs promise to provide important tools for future detailed analyses on individual FV fusion events in real time using advanced imaging techniques. PMID:22935135

  15. Double lung transplants have significantly improved survival compared with single lung transplants in high lung allocation score patients.

    PubMed

    Black, Matthew C; Trivedi, Jaimin; Schumer, Erin M; Bousamra, Michael; van Berkel, Victor

    2014-11-01

    Historically, double lung transplantation survival rates are higher than those of single lung transplantation, but in critically ill patients a single lung transplant, with less associated operative morbidity, could afford a better outcome. This article evaluates how survival is affected in patients who have a high lung allocation score (LAS) and receive a single versus a double lung transplant. The UNOS Thoracic Transplant Database for lung transplants from January 2005 to June 2012 was used for analysis. Propensity matching was used to minimize differences between the high and low LAS groups and between single and double lung transplants in the high LAS group. Within this database, there were 8,778 patients, of whom 8,050 had an LAS less than 75 and 728 had an LAS greater than or equal to 75. Kaplan-Meier survival curves stratified by high and low LAS, and by single versus double lung transplants, showed a marked decrease in survival (p<0.001) in those with a high LAS who received a single lung transplant when compared with those with a high LAS who received a double lung transplant. This was a much greater difference in survival than was present in the low LAS patient population. Despite a higher operative morbidity, patients who had a high LAS did substantially better in terms of survival if two lungs were transplanted rather than only one, with a larger difference in survival than for patients with a lower LAS. Copyright © 2014 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved.

  16. Social Context and Musical Content of Rap Music, 1979-1995

    ERIC Educational Resources Information Center

    Lena, Jennifer C.

    2006-01-01

    There is a link between the context of production and the content of rap music singles. This research finds that when independent labels owned most of the charted singles, lyrics emphasized features of the local environment and hostility to corporate music production and values. In contrast, the major-label dominated market featured lyrics…

  17. Axonal transport studied in a single vertebrate neuron: the giant electromotor neuron of the electric catfish, Malapterurus electricus.

    PubMed

    Zimmermann, H; Tashiro, T; Komiya, Y; Kurokawa, M

    1989-02-01

    Axonal transport was studied using a single vertebrate neuron, the giant electromotor neuron of the electric catfish, Malapterurus electricus. The electric organs of this strongly electric fish are innervated by two neurons whose axons form one electric nerve each. After injection of [35S]methionine into the spinal cord at the level of the two perikarya radioactively labelled material is exported by fast flow as a small wave with a velocity of 5.8 mm/h and a somal release time of 91 min (29 degrees C). Slow flow investigated between 15 and 39 days had a velocity of 1.36 mm/d at 29 degrees C. Analysis of radiolabelled proteins by polyacrylamide gel electrophoresis revealed different patterns of labelling between slow and fast flow. The relative molecular mass of the two major proteins labelled on slow flow correspond to actin and tubulin. Labelled proteins of higher relative molecular mass may correspond to neurofilament proteins. Our results suggest that this vertebrate single-neuron and single-axon system can be used successfully for axonal transport studies.

  18. Label-Free Optofluidic Nanobiosensor Enables Real-Time Analysis of Single-Cell Cytokine Secretion.

    PubMed

    Li, Xiaokang; Soler, Maria; Szydzik, Crispin; Khoshmanesh, Khashayar; Schmidt, Julien; Coukos, George; Mitchell, Arnan; Altug, Hatice

    2018-06-01

    Single-cell analysis of cytokine secretion is essential to understand the heterogeneity of cellular functionalities and develop novel therapies for multiple diseases. Unraveling the dynamic secretion process at single-cell resolution reveals the real-time functional status of individual cells. Fluorescent and colorimetric-based methodologies require tedious molecular labeling that brings inevitable interferences with cell integrity and compromises the temporal resolution. An innovative label-free optofluidic nanoplasmonic biosensor is introduced for single-cell analysis in real time. The nanobiosensor incorporates a novel design of a multifunctional microfluidic system with small volume microchamber and regulation channels for reliable monitoring of cytokine secretion from individual cells for hours. Different interleukin-2 secretion profiles are detected and distinguished from single lymphoma cells. The sensor configuration combined with optical spectroscopic imaging further allows us to determine the spatial single-cell secretion fingerprints in real time. This new biosensor system is anticipated to be a powerful tool to characterize single-cell signaling for basic and clinical research. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Chloroformate derivatization for tracing the fate of Amino acids in cells and tissues by multiple stable isotope resolved metabolomics (mSIRM).

    PubMed

    Yang, Ye; Fan, Teresa W-M; Lane, Andrew N; Higashi, Richard M

    2017-07-11

    Amino acids have crucial roles in central metabolism, both anabolic and catabolic. To elucidate these roles, steady-state concentrations of amino acids alone are insufficient, as each amino acid participates in multiple pathways and functions in a complex network, which can also be compartmentalized. Stable Isotope-Resolved Metabolomics (SIRM) is an approach that uses atom-resolved tracking of metabolites through biochemical transformations in cells, tissues, or whole organisms. Using different elemental stable isotopes to label multiple metabolite precursors makes it possible to resolve simultaneously the utilization of these precursors in a single experiment. Conversely, a single precursor labeled with two (or more) different elemental isotopes can trace the allocation of e.g. C and N atoms through the network. Such dual-label experiments however challenge the resolution of conventional mass spectrometers, which must distinguish the neutron mass differences among different elemental isotopes. This requires ultrahigh resolution Fourier transform mass spectrometry (UHR-FTMS). When combined with direct infusion nano-electrospray ion source (nano-ESI), UHR-FTMS can provide rapid, global, and quantitative analysis of all possible mass isotopologues of metabolites. Unfortunately, very low mass polar metabolites such as amino acids can be difficult to analyze by current models of UHR-FTMS, plus the high salt content present in typical cell or tissue polar extracts may cause unacceptable ion suppression for sources such as nano-ESI. Here we describe a modified method of ethyl chloroformate (ECF) derivatization of amino acids to enable rapid quantitative analysis of stable isotope labeled amino acids using nano-ESI UHR-FTMS. This method showed excellent linearity with quantifiable limits in the low nanomolar range represented in microgram quantities of biological specimens, which results in extracts with total analyte abundances in the low to sub-femtomole range. We have applied this method to profile amino acids and their labeling patterns in 13 C and 2 H doubly labeled PC9 cell extracts, cancerous and non-cancerous tissue extracts from a lung cancer patient and their protein hydrolysates as well as plasma extracts from mice fed with a liquid diet containing 13 C 6 -glucose (Glc). The multi-element isotopologue distributions provided key insights into amino acid metabolism and intracellular pools in human lung cancer tissues in high detail. The 13 C labeling of Asp and Glu revealed de novo synthesis of these amino acids from 13 C 6 -Glc via the Krebs cycle, specifically the elevated level of 13 C 3 -labeled Asp and Glu in cancerous versus non-cancerous lung tissues was consistent with enhanced pyruvate carboxylation. In addition, tracking the fate of double tracers, ( 13 C 6 -Glc +  2 H 2 -Gly or 13 C 6 -Glc +  2 H 3 -Ser) in PC9 cells clearly resolved pools of Ser and Gly synthesized de novo from 13 C 6 -Glc ( 13 C 3 -Ser and 13 C 2 -Gly) versus Ser and Gly derived from external sources ( 2 H 3 -Ser, 2 H 2 -Gly). Moreover the complex 2 H labeling patterns of the latter were results of Ser and Gly exchange through active Ser-Gly one-carbon metabolic pathway in PC9 cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Safety, Tolerability, and Pharmacokinetic Properties of Intravenous Delafloxacin After Single and Multiple Doses in Healthy Volunteers.

    PubMed

    Hoover, Randall; Hunt, Thomas; Benedict, Michael; Paulson, Susan K; Lawrence, Laura; Cammarata, Sue; Sun, Eugene

    2016-01-01

    The objective of this report was to determine the pharmacokinetic properties, safety, and tolerability of single and multiple doses of intravenous delafloxacin. In addition, the absolute bioavailability (BA) of the 450-mg tablet formulation of delafloxacin was determined. Three clinical trials are summarized. The first study was a randomized, double-blind, placebo-controlled, single- (300, 450, 600, 750, 900, and 1200 mg) ascending-dose study of IV delafloxacin in 62 (52 active, 10 placebo) healthy volunteers. The second study was a randomized, double-blind, placebo-controlled study of IV delafloxacin (300 mg) given as a single dose on day 1, followed by twice-daily dosing on days 2 through 14; 12 (8 active, 4 placebo) healthy volunteers were enrolled. The third study was an open-label, randomized, 2-period, 2-sequence crossover study in which 56 healthy volunteers were randomly assigned to 1 of 2 sequences of a single oral dose of delafloxacin (450-mg tablet) or IV delafloxacin (300 mg). Serial blood samples were collected, and plasma pharmacokinetic parameters of delafloxacin were calculated. Delafloxacin Cmax values increased proportionally with increasing single IV dose for the dose range of 300 to 1200 mg, whereas the AUC values increased more than proportionally to dose for the same dose range. The mean terminal half-life of delafloxacin was approximately 12 hours (ranging from 8 to 17 hours). The volume of distribution (Vd) at steady state was approximately 35 L, which is similar to the volume of total body water. There was minimal accumulation of delafloxacin after twice-daily IV administration of 300 mg with an accumulation ratio of 1.09. The delafloxacin total exposure after a single 1-hour IV infusion of 300 mg and a single oral dose of a 450-mg tablet were equivalent with geometric least square mean ratio (90% CI) of 0.8768 (0.8356-0.9200) for AUC0-∞ and 0.8445 (0.8090-0.8815) for AUC0-t, respectively. The Cmax values of delafloxacin were not equivalent for the 2 formulations with a ratio (90% CI) of 0.5516 (0.5150-0.5908), respectively. The mean absolute bioavailability of delafloxacin was 58.8%. Delafloxacin was well tolerated in healthy volunteers after single and multiple IV doses. The total systemic exposure to IV (300 mg) and oral (450 mg) delafloxacin is comparable, supporting that a switch between the 2 formulations is appropriate. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Double-layer versus single-layer bone-patellar tendon-bone anterior cruciate ligament reconstruction: a prospective randomized study with 3-year follow-up.

    PubMed

    Mei, Xiaoliang; Zhang, Zhenxiang; Yang, Jingwen

    2016-12-01

    To evaluate the clinical results of a randomized controlled trial of single-layer versus double-layer bone-patellar tendon-bone (BPTB) anterior cruciate ligament (ACL) reconstruction. Fifty-eight subjects who underwent primary ACL reconstruction with a BPTB allograft were prospectively randomized into two groups: single-layer reconstruction (n = 31) and double-layer reconstruction (n = 27). The following evaluation methods were used: clinical examination, KT-1000 arthrometer measurement, muscle strength, Tegner activity score, Lysholm score, subjective rating scale regarding patient satisfaction and sports performance level, graft retear, contralateral ACL tear, and additional meniscus surgery. Forty-eight subjects (24 in single-layer group and 24 in double-layer group) who were followed up for 3 years were evaluated. Preoperatively, there were no differences between the groups. At 3-year follow-up, the Lachman and pivot-shift test results were better in the double-layer group (P = 0.019 and P < 0.0001, respectively). KT measurements were better in the double-layer group (mean 2.9 versus 1.5 mm; P = 0.0025). The Tegner score was also better in the double-layer group (P = 0.024). There were no significant differences in range of motion, muscle strength, Lysholm score, subjective rating scale, graft retear, and secondary meniscal tear. In ACL reconstruction, double-layer BPTB reconstruction was significantly better than single-layer reconstruction regarding anterior and rotational stability at 3-year follow-up. The results of KT measurements and the Lachman and pivot-shift tests were significantly better in the double-layer group, whereas there was no difference in the anterior drawer test results. The Tegner score was also better in the double-layer group; however, there were no differences in the other subjective findings.

  2. Multi-Isotope Secondary Ion Mass Spectrometry Combining Heavy Water 2H with 15N Labeling As Complementary Tracers for Metabolic Heterogeneity at the Single-Cell Level

    NASA Astrophysics Data System (ADS)

    Kopf, S.; McGlynn, S.; Cowley, E.; Green, A.; Newman, D. K.; Orphan, V. J.

    2014-12-01

    Metabolic rates of microbial communities constitute a key physiological parameter for understanding the in situ growth constraints for life in any environment. Isotope labeling techniques provide a powerful approach for measuring such biological activity, due to the use of isotopically enriched substrate tracers whose incorporation into biological materials can be detected with high sensitivity by isotope-ratio mass spectrometry. Nano-meter scale secondary ion mass spectrometry (NanoSIMS) combined with stable isotope labeling provides a unique tool for studying the spatiometabolic activity of microbial populations at the single cell level in order to assess both community structure and population diversity. However, assessing the distribution and range of microbial activity in complex environmental systems with slow-growing organisms, diverse carbon and nitrogen sources, or heterotrophic subpopulations poses a tremendous technical challenge because the introduction of isotopically labeled substrates frequently changes the nutrient availability and can inflate or bias measures of activity. Here, we present the use of hydrogen isotope labeling with deuterated water as an important new addition to the isotopic toolkit and apply it for the determination of single cell microbial activities by NanoSIMS imaging. This tool provides a labeling technique that minimally alters any aquatic chemical environment, can be administered with strong labels even in minimal addition (natural background is very low), is an equally universal substrate for all forms of life even in complex, carbon and nitrogen saturated systems, and can be combined with other isotopic tracers. The combination of heavy water labeling with the most commonly used NanoSIMS tracer, 15N, is technically challenging but opens up a powerful new set of multi-tracer experiments for the study of microbial activity in complex communities. We present the first truly simultaneous single cell triple isotope system measurements of 2H/1H, 13C/12C and 15N/14N and apply it to study of microbial metabolic heterogeneity and nitrogen metabolism in a continuous culture case study. Our data provide insight into both the diversity of microbial activity rates, as well as patterns of ammonium utilization at the single cell level.

  3. Enhanced labeling density and whole-cell 3D dSTORM imaging by repetitive labeling of target proteins.

    PubMed

    Venkataramani, Varun; Kardorff, Markus; Herrmannsdörfer, Frank; Wieneke, Ralph; Klein, Alina; Tampé, Robert; Heilemann, Mike; Kuner, Thomas

    2018-04-03

    With continuing advances in the resolving power of super-resolution microscopy, the inefficient labeling of proteins with suitable fluorophores becomes a limiting factor. For example, the low labeling density achieved with antibodies or small molecule tags limits attempts to reveal local protein nano-architecture of cellular compartments. On the other hand, high laser intensities cause photobleaching within and nearby an imaged region, thereby further reducing labeling density and impairing multi-plane whole-cell 3D super-resolution imaging. Here, we show that both labeling density and photobleaching can be addressed by repetitive application of trisNTA-fluorophore conjugates reversibly binding to a histidine-tagged protein by a novel approach called single-epitope repetitive imaging (SERI). For single-plane super-resolution microscopy, we demonstrate that, after multiple rounds of labeling and imaging, the signal density is increased. Using the same approach of repetitive imaging, washing and re-labeling, we demonstrate whole-cell 3D super-resolution imaging compensated for photobleaching above or below the imaging plane. This proof-of-principle study demonstrates that repetitive labeling of histidine-tagged proteins provides a versatile solution to break the 'labeling barrier' and to bypass photobleaching in multi-plane, whole-cell 3D experiments.

  4. Comparative study of single lateral locked plating versus double plating in type C bicondylar tibial plateau fractures.

    PubMed

    Neogi, Devdatta Suhas; Trikha, Vivek; Mishra, Kaushal Kant; Bandekar, Shivanand M; Yadav, Chandra Shekhar

    2015-01-01

    Bicondylar tibial plateau fractures are complex injuries and treatment is challenging. Ideal method is still controversial with risk of unsatisfactory results if not treated properly. Many different techniques of internal and external fixation are used. This study compares the clinical results in single locked plating versus dual plating (DP) using two incision approaches. Our hypothesis was that DP leads to less collapse and change in alignment at final followup compared with single plating. 61 cases of Type C tibial plateau fractures operated between January 2007 and June 2011 were included in this prospective study. All cases were operated either by single lateral locked plate by anterolateral approach or double plating through double incision. All cases were followed for a minimum of 24 months radiologically and clinically. The statistical analysis was performed using software SPSS 10.0 to analyze the data. Twenty nine patients in a single lateral locked plate and 32 patients in a double plating group were followed for minimum 2 years. All fractures healed, however there was a significant incidence of malalignment in the single lateral plating group. Though there was a significant increase in soft tissue issues with the double plating group; however, there was only 3.12% incidence of deep infection. There was no significant difference in Hospital for special surgery score at 2 years followup. Double plating through two incisions resulted in a better limb alignment and joint reduction with an acceptable soft tissue complication rate.

  5. Identification of the formation of metal-vinylidene interfacial bonds of alkyne-capped platinum nanoparticles by isotopic labeling.

    PubMed

    Hu, Peiguang; Chen, Limei; Deming, Christopher P; Bonny, Lewis W; Lee, Hsiau-Wei; Chen, Shaowei

    2016-10-07

    Stable platinum nanoparticles were prepared by the self-assembly of 1-dodecyne and dodec-1-deuteroyne onto bare platinum colloid surfaces. The nanoparticles exhibited consistent core size and optical properties. FTIR and NMR measurements confirmed the formation of Pt-vinylidene (Pt[double bond, length as m-dash]C[double bond, length as m-dash]CH-) interfacial linkages rather than Pt-acetylide (Pt-C[triple bond, length as m-dash]C-) and platinum-hydride (Pt-H) bonds.

  6. A dopaminergic projection to the rat mammillary nuclei demonstrated by retrograde transport of wheat germ agglutinin-horseradish peroxidase and tyrosine hydroxylase immunohistochemistry

    NASA Technical Reports Server (NTRS)

    Gonzalo-Ruiz, A.; Alonso, A.; Sanz, J. M.; Llinas, R. R.

    1992-01-01

    The presence and distribution of dopaminergic neurons and terminals in the hypothalamus of the rat were studied by tyrosine hydroxylase (TH) immunohistochemistry. Strongly labelled TH-immunoreactive neurons were seen in the dorsomedial hypothalamic nucleus, periventricular region, zona incerta, arcuate nucleus, and supramammillary nucleus. A few TH-positive neurons were also identified in the dorsal and ventral premammillary nucleus, as well as the lateral hypothalamic area. TH-immunoreactive fibres and terminals were unevenly distributed in the mammillary nuclei; small, weakly labelled terminals were scattered in the medial mammillary nucleus, while large, strongly labelled, varicose terminals were densely concentrated in the internal part of the lateral mammillary nucleus. A few dorsoventrally oriented TH-positive axon bundles were also identified in the lateral mammillary nucleus. A dopaminergic projection to the mammillary nuclei from the supramammillary nucleus and lateral hypothalamic area was identified by double labelling with retrograde transport of wheat germ agglutinin-horseradish peroxidase and TH-immunohistochemistry. The lateral mammillary nucleus receives a weak dopaminergic projection from the medial, and stronger projections from the lateral, caudal supramammillary nucleus. The double-labelled neurons in the lateral supramammillary nucleus appear to encapsulate the caudal end of the mammillary nuclei. The medial mammillary nucleus receives a very light dopaminergic projection from the caudal lateral hypothalamic area. These results suggest that the supramammillary nucleus is the principal source of the dopaminergic input to the mammillary nuclei, establishing a local TH-pathway in the mammillary complex. The supramammillary cell groups are able to modulate the limbic system through its dopaminergic input to the mammillary nuclei as well as through its extensive dopaminergic projection to the lateral septal nucleus.

  7. Electron transfer flavoprotein domain II orientation monitored using double electron-electron resonance between an enzymatically reduced, native FAD cofactor, and spin labels

    PubMed Central

    Swanson, Michael A; Kathirvelu, Velavan; Majtan, Tomas; Frerman, Frank E; Eaton, Gareth R; Eaton, Sandra S

    2011-01-01

    Human electron transfer flavoprotein (ETF) is a soluble mitochondrial heterodimeric flavoprotein that links fatty acid β-oxidation to the main respiratory chain. The crystal structure of human ETF bound to medium chain acyl-CoA dehydrogenase indicates that the flavin adenine dinucleotide (FAD) domain (αII) is mobile, which permits more rapid electron transfer with donors and acceptors by providing closer access to the flavin and allows ETF to accept electrons from at least 10 different flavoprotein dehydrogenases. Sequence homology is high and low-angle X-ray scattering is identical for Paracoccus denitrificans (P. denitrificans) and human ETF. To characterize the orientations of the αII domain of P. denitrificans ETF, distances between enzymatically reduced FAD and spin labels in the three structural domains were measured by double electron-electron resonance (DEER) at X- and Q-bands. An FAD to spin label distance of 2.8 ± 0.15 nm for the label in the FAD-containing αII domain (A210C) agreed with estimates from the crystal structure (3.0 nm), molecular dynamics simulations (2.7 nm), and rotamer library analysis (2.8 nm). Distances between the reduced FAD and labels in αI (A43C) were between 4.0 and 4.5 ± 0.35 nm and for βIII (A111C) the distance was 4.3 ± 0.15 nm. These values were intermediate between estimates from the crystal structure of P. denitrificans ETF and a homology model based on substrate-bound human ETF. These distances suggest that the αII domain adopts orientations in solution that are intermediate between those which are observed in the crystal structures of free ETF (closed) and ETF bound to a dehydrogenase (open). PMID:21308847

  8. Time-resolved delayed luminescence image microscopy using an europium ion chelate complex.

    PubMed Central

    Marriott, G.; Heidecker, M.; Diamandis, E. P.; Yan-Marriott, Y.

    1994-01-01

    Improvements and extended applications of time-resolved delayed luminescence imaging microscopy (TR-DLIM) in cell biology are described. The emission properties of europium ion complexed to a fluorescent chelating group capable of labeling proteins are exploited to provide high contrast images of biotin labeled ligands through detection of the delayed emission. The streptavidin-based macromolecular complex (SBMC) employs streptavidin cross-linked to thyroglobulin multiply labeled with the europium-fluorescent chelate. The fluorescent chelate is efficiently excited with 340-nm light, after which it sensitizes europium ion emission at 612 nm hundreds of microseconds later. The SBMC complex has a high quantum yield orders of magnitude higher than that of eosin, a commonly used delayed luminescent probe, and can be readily seen by the naked eye, even in specimens double-labeled with prompt fluorescent probes. Unlike triplet-state phosphorescent probes, sensitized europium ion emission is insensitive to photobleaching and quenching by molecular oxygen; these properties have been exploited to obtain delayed luminescence images of living cells in aerated medium thus complementing imaging studies using prompt fluorescent probes. Since TR-DLIM has the unique property of rejecting enormous signals that originate from scattered light, autofluorescence, and prompt fluorescence it has been possible to resolve double emission images of living amoeba cells containing an intensely stained lucifer yellow in pinocytosed vesicles and membrane surface-bound SBMC-labeled biotinylated concanavalin A. Images of fixed cells represented in terms of the time decay of the sensitized emission show the lifetime of the europium ion emission is sensitive to the environment in which it is found. Through the coupling of SBMC to streptavidin,a plethora of biotin-based tracer molecules are available for immunocytochemical studies. Images FIGURE 1 FIGURE 2 FIGURE 3 FIGURE 4 FIGURE 5 FIGURE 6 FIGURE 7 PMID:7811952

  9. Simulation of double-pass stimulated Raman backscattering

    NASA Astrophysics Data System (ADS)

    Wu, Z.; Chen, Q.; Morozov, A.; Suckewer, S.

    2018-04-01

    Experiments on Stimulated Raman Backscattering (SRBS) in plasma have demonstrated significantly higher energy conversion in a double-pass amplifier where the laser pulses go through the plasma twice compared with a single-pass amplifier with double the plasma length of a single pass. In this paper, the improvement in understanding recent experimental results is presented by considering quite in detail the effects of plasma heating on the modeling of SRBS. Our simulation results show that the low efficiency of single-pass amplifiers can be attributed to Landau damping and the frequency shift of Langmuir waves. In double-pass amplifiers, these issues can be avoided, to some degree, because pump-induced heating could be reduced, while the plasma cools down between the passes. Therefore, double-pass amplifiers yield considerably enhanced energy transfer from the pump to the seed, hence the output pulse intensity.

  10. Phospholipid bilayer relaxation dynamics as revealed by the pulsed electron-electron double resonance of spin labels

    NASA Astrophysics Data System (ADS)

    Syryamina, V. N.; Dzuba, S. A.

    2012-10-01

    Electron paramagnetic resonance (EPR) spectroscopy in the form of pulsed electron-electron double resonance (ELDOR) was applied to 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) phospholipid bilayers containing lipids that were spin-labeled at different carbon positions along the lipid acyl chain. Pulsed ELDOR detects motionally induced spin flips of nitrogen nuclei in the nitroxide spin labels, which manifests itself as magnetization transfer (MT) in the nitroxide EPR spectrum. The MT effect was observed over a wide temperature range (100-225 K) on a microsecond time scale. In line with a previous study on molecular glasses [N. P. Isaev and S. A. Dzuba, J. Chem. Phys. 135, 094508 (2011), 10.1063/1.3633241], the motions that induce MT effect were suggested to have the same nature as those in dielectric secondary (β) Johari-Goldstein fast relaxation. The results were compared with literature dielectric relaxation data for POPC bilayers, revealing some common features. Molecular motions resulting in MT are faster for deeper spin labels in the membrane interior. The addition of cholesterol to the bilayer suppresses the lipid motions near the steroid nucleus and accelerates the lipid motions beyond the steroid nucleus, in the bilayer interior. This finding was attributed to the lipid acyl chains being more ordered near the steroid nucleus and less ordered in the bilayer interior. The motions are absent in dry lipids, indicating that the motions are determined by intermolecular interactions in the bilayer.

  11. Comparison of a single-view and a double-view aerosol optical depth retrieval algorithm

    NASA Astrophysics Data System (ADS)

    Henderson, Bradley G.; Chylek, Petr

    2003-11-01

    We compare the results of a single-view and a double-view aerosol optical depth (AOD) retrieval algorithm applied to image pairs acquired over NASA Stennis Space Center, Mississippi. The image data were acquired by the Department of Energy's (DOE) Multispectral Thermal Imager (MTI), a pushbroom satellite imager with 15 bands from the visible to the thermal infrared. MTI has the ability to acquire imagery in pairs in which the first image is a near-nadir view and the second image is off-nadir with a zenith angle of approximately 60°. A total of 15 image pairs were used in the analysis. For a given image pair, AOD retrieval is performed twice---once using a single-view algorithm applied to the near-nadir image, then again using a double-view algorithm. Errors for both retrievals are computed by comparing the results to AERONET AOD measurements obtained at the same time and place. The single-view algorithm showed an RMS error about the mean of 0.076 in AOD units, whereas the double-view algorithm showed a modest improvement with an RMS error of 0.06. The single-view errors show a positive bias which is presumed to be a result of the empirical relationship used to determine ground reflectance in the visible. A plot of AOD error of the double-view algorithm versus time shows a noticeable trend which is interpreted to be a calibration drift. When this trend is removed, the RMS error of the double-view algorithm drops to 0.030. The single-view algorithm qualitatively appears to perform better during the spring and summer whereas the double-view algorithm seems to be less sensitive to season.

  12. Single-row versus double-row repair of the distal Achilles tendon: a biomechanical comparison.

    PubMed

    Pilson, Holly; Brown, Philip; Stitzel, Joel; Scott, Aaron

    2012-01-01

    Surgery for recalcitrant insertional Achilles tendinopathy often consists of partial or total release of the insertion site, debridement of the diseased portion of the tendon, calcaneal ostectomy, and reattachment of the Achilles to the calcaneus. Although single-row and double-row techniques exist for repair of the detached Achilles tendon, biomechanical data are lacking to support one technique over the other. Based on data extrapolated from the study of rotator cuff repairs, we hypothesized that a double-row construct would provide superior fixation strength over a single-row repair. Eighteen human cadaveric Achilles tendons (9 matched pairs) with attached calcanei were repaired with single-row or double-row techniques. Specimens were mounted in a servohydraulic materials testing machine, subjected to a preconditioning cycle, and loaded to failure. Failure was defined as suture breakage or pullout, midsubstance tendon rupture, or anchor pullout. Among the failures were 12 suture failures, 5 proximal-row anchor failures, and 1 distal-row anchor failure. No midsubstance tendon ruptures or testing apparatus failures were observed. There were no statistically significant differences in the peak load to failure between the single-row and double-row repairs (p = .46). Similarly, no significant differences were observed with regards to mean energy expenditure to failure (p = .069). The present study demonstrated no biomechanical advantages of the double-row repair over a single-row repair. Despite the lack of a clear biomechanical advantage, there may exist clinical advantages of a double-row repair, such as reduction in knot prominence and restoration of the Achilles footprint. Copyright © 2012 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.

  13. In vitro labeling strategies for in cellulo fluorescence microscopy of single ribonucleoprotein machines.

    PubMed

    Custer, Thomas C; Walter, Nils G

    2017-07-01

    RNA plays a fundamental, ubiquitous role as either substrate or functional component of many large cellular complexes-"molecular machines"-used to maintain and control the readout of genetic information, a functional landscape that we are only beginning to understand. The cellular mechanisms for the spatiotemporal organization of the plethora of RNAs involved in gene expression are particularly poorly understood. Intracellular single-molecule fluorescence microscopy provides a powerful emerging tool for probing the pertinent mechanistic parameters that govern cellular RNA functions, including those of protein coding messenger RNAs (mRNAs). Progress has been hampered, however, by the scarcity of efficient high-yield methods to fluorescently label RNA molecules without the need to drastically increase their molecular weight through artificial appendages that may result in altered behavior. Herein, we employ T7 RNA polymerase to body label an RNA with a cyanine dye, as well as yeast poly(A) polymerase to strategically place multiple 2'-azido-modifications for subsequent fluorophore labeling either between the body and tail or randomly throughout the tail. Using a combination of biochemical and single-molecule fluorescence microscopy approaches, we demonstrate that both yeast poly(A) polymerase labeling strategies result in fully functional mRNA, whereas protein coding is severely diminished in the case of body labeling. © 2016 The Protein Society.

  14. Topological events in single molecules of E. coli DNA confined in nanochannels

    PubMed Central

    Reifenberger, Jeffrey G.; Dorfman, Kevin D.; Cao, Han

    2015-01-01

    We present experimental data concerning potential topological events such as folds, internal backfolds, and/or knots within long molecules of double-stranded DNA when they are stretched by confinement in a nanochannel. Genomic DNA from E. coli was labeled near the ‘GCTCTTC’ sequence with a fluorescently labeled dUTP analog and stained with the DNA intercalator YOYO. Individual long molecules of DNA were then linearized and imaged using methods based on the NanoChannel Array technology (Irys® System) available from BioNano Genomics. Data were collected on 189,153 molecules of length greater than 50 kilobases. A custom code was developed to search for abnormal intensity spikes in the YOYO backbone profile along the length of individual molecules. By correlating the YOYO intensity spikes with the aligned barcode pattern to the reference, we were able to correlate the bright intensity regions of YOYO with abnormal stretching in the molecule, which suggests these events were either a knot or a region of internal backfolding within the DNA. We interpret the results of our experiments involving molecules exceeding 50 kilobases in the context of existing simulation data for relatively short DNA, typically several kilobases. The frequency of these events is lower than the predictions from simulations, while the size of the events is larger than simulation predictions and often exceeds the molecular weight of the simulated molecules. We also identified DNA molecules that exhibit large, single folds as they enter the nanochannels. Overall, topological events occur at a low frequency (~7% of all molecules) and pose an easily surmountable obstacle for the practice of genome mapping in nanochannels. PMID:25991508

  15. Biomarkers for radiation pneumonitis using non-invasive molecular imaging

    PubMed Central

    Medhora, Meetha; Haworth, Steven; Liu, Yu; Narayanan, Jayashree; Gao, Feng; Zhao, Ming; Audi, Said; Jacobs, Elizabeth R.; Fish, Brian L.; Clough, Anne V.

    2016-01-01

    Rationale Our goal is to develop minimally-invasive biomarkers for predicting radiation-induced lung injury before symptoms develop. Currently there are no biomarkers that can predict radiation pneumonitis. Radiation damage to the whole lung is a serious risk in nuclear accidents or in case of radiological terrorism. Our previous studies have shown a single dose of 15 Gy X-rays to the thorax causes severe pneumonitis in rats by 6–8 weeks. We have also developed a mitigator for radiation pneumonitis and fibrosis that can be started as late as 5 weeks after radiation. Methods We used two functional single photon emission computed tomography (SPECT) probes in vivo in irradiated rat lungs. Regional pulmonary perfusion was measured by injection of technetium labeled macroaggregated albumin (99mTc-MAA). Perfused volume was determined by comparing the volume of distribution of 99mTc-MAA to the anatomical lung volume obtained by micro-CT. A second probe, technetium labeled duramycin that binds to apoptotic cells, was used to measure pulmonary cell death in the same rat model. Results Perfused volume of lung was decreased by ~25% at 1, 2 and 3 weeks after 15 Gy and 99mTc-duramycin uptake was more than doubled at 2 and 3 weeks. There was no change in body weight, breathing rate or lung histology between irradiated and non-irradiated rats at these times. Pulmonary vascular resistance and vascular permeability measured in isolated perfused lungs ex vivo increased at 2 weeks after 15 Gy. Principal conclusions Our results suggest the potential for SPECT biomarkers for predicting radiation injury to the lungs before substantial functional or histological damage is observed. Early prediction of radiation pneumonitis will benefit those receiving radiation in the context of therapy, accidents or terrorism in time to initiate mitigation. PMID:27033892

  16. Virus-Specific RNA Synthesis in Cells Infected by Infectious Pancreatic Necrosis Virus

    PubMed Central

    Somogyi, Paul; Dobos, Peter

    1980-01-01

    Pulse-labeling experiments with [3H]uridine revealed that the rate of infections pancreatic necrosis virus-specific RNA synthesis was maximal at 8 to 10 h after infection and was completely diminished by 12 to 14 h. Three forms of RNA intermediates were detected: (i) a putative transcription intermediate (TRI) which comigrated in acrylamide gels with virion double-stranded RNA (dsRNA) after RNase treatment; (ii) a 24S genome length mRNA which could be resolved into two bands by polyacrylamide gel electrophoresis; and (iii) a 14S dsRNA component indistinguishable from virion RNA by gradient centrifugation and gel electrophoresis. The TRI (i) was LiCl precipitable; (ii) sedimented slightly faster and broader (14 to 16S) than the 14S virion dsRNA; (iii) had a lower electrophoretic mobility in acrylamide gels than dsRNA, barely entering acrylamide gels as a heterogenous component; (iv) yielded genome-sized pieces of dsRNA after RNase digestion; and (v) was the most abundant RNA form early in the infectious cycle. The 24S single-stranded RNA was thought to be the viral mRNA since it: (i) became labeled during short pulses; (ii) was found in the polysomal fraction of infected cells; and (iii) hybridized to denatured viral RNA, forming two segments of RNase-resistant RNA that comigrated with virion dsRNA in gels. The 24S mRNA component was formed before the synthesis of dsRNA, and radioactivity could be chased from 24S single-stranded RNA to dsRNA, indicating that 24S RNA may serve as template for the synthesis of complementary strands to form dsRNA. Similar to reovirus, infectious pancreatic necrosis viral 24S mRNA contained no polyadenylic acid tracts. Images PMID:16789184

  17. Exon skipping of AGAMOUS homolog PrseAG in developing double flowers of Prunus lannesiana (Rosaceae).

    PubMed

    Liu, Zhixiong; Zhang, Dandan; Liu, Di; Li, Fenglan; Lu, Hai

    2013-02-01

    KEY MESSAGE : Two transcript isoforms of AGAMOUS homologs, from single and double flower Prunus lannesiana, respectively, showed different functions. The Arabidopsis floral homeotic C function gene AGAMOUS (AG) confers stamen and carpel identity. Loss of AG function results in homeotic conversions of stamens into petals and formation of double flowers. In order to present a molecular dissection of a double-flower cultivar in Prunus lannesiana (Rosaceae), we isolated and identified a single-copy gene, AG homolog from two genetically cognate P. lannesiana bearing single and double flowers, respectively. Sequence analysis revealed that the AG homolog, prseag-1, from double flowers showed a 170-bp exon skipping as compared to PrseAG (Prunus serrulata AGAMOUS) from the single flowers. Genomic DNA sequence revealed that abnormal splicing resulted in mutant prseag-1 protein with the C-terminal AG motifs I and II deletions. In addition, protein sequence alignment and phylogenetic analyses revealed that the PrseAG was grouped into the euAG lineage. A semi-quantitative PCR analysis showed that the expression of PrseAG was restricted to reproductive organs of stamens and carpels in single flowers of P. lannesiana 'speciosa', while the prseag-1 mRNA was highly transcribed throughout the petals, stamens, and carpels in double flowers from 'Albo-rosea'. The transgenic Arabidopsis containing 35S::PrseAG displayed extremely early flowering, bigger stamens and carpels and homeotic conversion of petals into staminoid organs, but ectopic expression of prseag-1 could not mimic the phenotypic ectopic expression of PrseAG in Arabidopsis. In general, this study provides evidences to show that double flower 'Albo-rosea' is a putative C functional ag mutant in P. lannesiana.

  18. Biological characterization of adult MYC-translocation-positive mature B-cell lymphomas other than molecular Burkitt lymphoma.

    PubMed

    Aukema, Sietse M; Kreuz, Markus; Kohler, Christian W; Rosolowski, Maciej; Hasenclever, Dirk; Hummel, Michael; Küppers, Ralf; Lenze, Dido; Ott, German; Pott, Christiane; Richter, Julia; Rosenwald, Andreas; Szczepanowski, Monika; Schwaenen, Carsten; Stein, Harald; Trautmann, Heiko; Wessendorf, Swen; Trümper, Lorenz; Loeffler, Markus; Spang, Rainer; Kluin, Philip M; Klapper, Wolfram; Siebert, Reiner

    2014-04-01

    Chromosomal translocations affecting the MYC oncogene are the biological hallmark of Burkitt lymphomas but also occur in a subset of other mature B-cell lymphomas. If accompanied by a chromosomal break targeting the BCL2 and/or BCL6 oncogene these MYC translocation-positive (MYC(+)) lymphomas are called double-hit lymphomas, otherwise the term single-hit lymphomas is applied. In order to characterize the biological features of these MYC(+) lymphomas other than Burkitt lymphoma we explored, after exclusion of molecular Burkitt lymphoma as defined by gene expression profiling, the molecular, pathological and clinical aspects of 80 MYC-translocation-positive lymphomas (31 single-hit, 46 double-hit and 3 MYC(+)-lymphomas with unknown BCL6 status). Comparison of single-hit and double-hit lymphomas revealed no difference in MYC partner (IG/non-IG), genomic complexity, MYC expression or gene expression profile. Double-hit lymphomas more frequently showed a germinal center B-cell-like gene expression profile and had higher IGH and MYC mutation frequencies. Gene expression profiling revealed 130 differentially expressed genes between BCL6(+)/MYC(+) and BCL2(+)/MYC(+) double-hit lymphomas. BCL2(+)/MYC(+) double-hit lymphomas more frequently showed a germinal center B-like gene expression profile. Analysis of all lymphomas according to MYC partner (IG/non-IG) revealed no substantial differences. In this series of lymphomas, in which immunochemotherapy was administered in only a minority of cases, single-hit and double-hit lymphomas had a similar poor outcome in contrast to the outcome of molecular Burkitt lymphoma and lymphomas without the MYC break. Our data suggest that, after excluding molecular Burkitt lymphoma and pediatric cases, MYC(+) lymphomas are biologically quite homogeneous with single-hit and double-hit lymphomas as well as IG-MYC and non-IG-MYC(+) lymphomas sharing various molecular characteristics.

  19. Developments in label-free microfluidic methods for single-cell analysis and sorting.

    PubMed

    Carey, Thomas R; Cotner, Kristen L; Li, Brian; Sohn, Lydia L

    2018-04-24

    Advancements in microfluidic technologies have led to the development of many new tools for both the characterization and sorting of single cells without the need for exogenous labels. Label-free microfluidics reduce the preparation time, reagents needed, and cost of conventional methods based on fluorescent or magnetic labels. Furthermore, these devices enable analysis of cell properties such as mechanical phenotype and dielectric parameters that cannot be characterized with traditional labels. Some of the most promising technologies for current and future development toward label-free, single-cell analysis and sorting include electronic sensors such as Coulter counters and electrical impedance cytometry; deformation analysis using optical traps and deformation cytometry; hydrodynamic sorting such as deterministic lateral displacement, inertial focusing, and microvortex trapping; and acoustic sorting using traveling or standing surface acoustic waves. These label-free microfluidic methods have been used to screen, sort, and analyze cells for a wide range of biomedical and clinical applications, including cell cycle monitoring, rapid complete blood counts, cancer diagnosis, metastatic progression monitoring, HIV and parasite detection, circulating tumor cell isolation, and point-of-care diagnostics. Because of the versatility of label-free methods for characterization and sorting, the low-cost nature of microfluidics, and the rapid prototyping capabilities of modern microfabrication, we expect this class of technology to continue to be an area of high research interest going forward. New developments in this field will contribute to the ongoing paradigm shift in cell analysis and sorting technologies toward label-free microfluidic devices, enabling new capabilities in biomedical research tools as well as clinical diagnostics. This article is categorized under: Diagnostic Tools > Biosensing Diagnostic Tools > Diagnostic Nanodevices. © 2018 Wiley Periodicals, Inc.

  20. Using a Double-Coil TMS Protocol to Assess Preparatory Inhibition Bilaterally.

    PubMed

    Vassiliadis, Pierre; Grandjean, Julien; Derosiere, Gerard; de Wilde, Ysaline; Quemener, Louise; Duque, Julie

    2018-01-01

    Transcranial magnetic stimulation (TMS) applied over the primary motor cortex (M1), elicits motor-evoked potentials (MEPs) in contralateral limb muscles which are valuable indicators of corticospinal excitability (CSE) at the time of stimulation. So far, most studies have used single-coil TMS over one M1, yielding MEPs in muscles of a single limb-usually the hand. However, tracking CSE in the two hands simultaneously would be useful in many contexts. We recently showed that, in the resting state, double-coil stimulation of the two M1 with a 1 ms inter-pulse interval (double-coil 1 ms TMS) elicits MEPs in both hands that are comparable to MEPs obtained using single-coil TMS. To further evaluate this new technique, we considered the MEPs elicited by double-coil 1 ms TMS in an instructed-delay choice reaction time task where a prepared response has to be withheld until an imperative signal is displayed. Single-coil TMS studies have repetitively shown that in this type of task, the motor system is transiently inhibited during the delay period, as evident from the broad suppression of MEP amplitudes. Here, we aimed at investigating whether a comparable inhibitory effect can be observed with MEPs elicited using double-coil 1 ms TMS. To do so, we compared the amplitude as well as the coefficient of variation (CV) of MEPs produced by double-coil 1 ms or single-coil TMS during action preparation. We observed that MEPs were suppressed (smaller amplitude) and often less variable (smaller CV) during the delay period compared to baseline. Importantly, these effects were equivalent whether single-coil or double-coil 1 ms TMS was used. This suggests that double-coil 1 ms TMS is a reliable tool to assess CSE, not only when subjects are at rest, but also when they are involved in a task, opening new research horizons for scientists interested in the corticospinal correlates of human behavior.

  1. Using a Double-Coil TMS Protocol to Assess Preparatory Inhibition Bilaterally

    PubMed Central

    Vassiliadis, Pierre; Grandjean, Julien; Derosiere, Gerard; de Wilde, Ysaline; Quemener, Louise; Duque, Julie

    2018-01-01

    Transcranial magnetic stimulation (TMS) applied over the primary motor cortex (M1), elicits motor-evoked potentials (MEPs) in contralateral limb muscles which are valuable indicators of corticospinal excitability (CSE) at the time of stimulation. So far, most studies have used single-coil TMS over one M1, yielding MEPs in muscles of a single limb—usually the hand. However, tracking CSE in the two hands simultaneously would be useful in many contexts. We recently showed that, in the resting state, double-coil stimulation of the two M1 with a 1 ms inter-pulse interval (double-coil1 ms TMS) elicits MEPs in both hands that are comparable to MEPs obtained using single-coil TMS. To further evaluate this new technique, we considered the MEPs elicited by double-coil1 ms TMS in an instructed-delay choice reaction time task where a prepared response has to be withheld until an imperative signal is displayed. Single-coil TMS studies have repetitively shown that in this type of task, the motor system is transiently inhibited during the delay period, as evident from the broad suppression of MEP amplitudes. Here, we aimed at investigating whether a comparable inhibitory effect can be observed with MEPs elicited using double-coil1 ms TMS. To do so, we compared the amplitude as well as the coefficient of variation (CV) of MEPs produced by double-coil1 ms or single-coil TMS during action preparation. We observed that MEPs were suppressed (smaller amplitude) and often less variable (smaller CV) during the delay period compared to baseline. Importantly, these effects were equivalent whether single-coil or double-coil1 ms TMS was used. This suggests that double-coil1 ms TMS is a reliable tool to assess CSE, not only when subjects are at rest, but also when they are involved in a task, opening new research horizons for scientists interested in the corticospinal correlates of human behavior. PMID:29568258

  2. Magnetic resonance imaging of single co-labeled mesenchymal stromal cells after intracardial injection in mice.

    PubMed

    Salamon, J; Wicklein, D; Didié, M; Lange, C; Schumacher, U; Adam, G; Peldschus, K

    2014-04-01

    The aim of this study was to establish co-labeling of mesenchymal stromal cells (MSC) for the detection of single MSC in-vivo by MRI and histological validation. Mouse MSC were co-labeled with fluorescent iron oxide micro-particles and carboxyfluorescein succinimidyl ester (CFSE). The cellular iron content was determined by atomic absorption spectrometry. Cell proliferation and expression of characteristic surface markers were determined by flow cytometry. The chondrogenic differentiation capacity was assessed. Different amounts of cells (n1 = 5000, n2 = 15 000, n3 = 50 000) were injected into the left heart ventricle of 12 mice. The animals underwent sequential MRI on a clinical 3.0 T scanner (Intera, Philips Medical Systems, Best, The Netherlands). For histological validation cryosections were examined by fluorescent microscopy. Magnetic and fluorescent labeling of MSC was established (mean cellular iron content 23.6 ± 3 pg). Flow cytometry showed similar cell proliferation and receptor expression of labeled and unlabeled MSC. Chondrogenic differentiation of labeled MSC was verified. After cell injection MRI revealed multiple signal voids in the brain and fewer signal voids in the kidneys. In the brain, an average of 4.6 ± 1.2 (n1), 9.0 ± 3.6 (n2) and 25.0 ± 1.0 (n3) signal voids were detected per MRI slice. An average of 8.7 ± 3.1 (n1), 22.0 ± 6.1 (n2) and 89.8 ± 6.5 (n3) labeled cells per corresponding stack of adjacent cryosections could be detected in the brain. Statistical correlation of the numbers of MRI signal voids in the brain and single MSC found by histology revealed a correlation coefficient of r = 0.91. The study demonstrates efficient magnetic and fluorescent co-labeling of MSC and their detection on a single cell level in mice by in-vivo MRI and histology. The described techniques may broaden the methods for in-vivo tracking of MSC. • Detection of single magnetically labeled MSC in-vivo using a clinical 3.0 T MRI is possible.• Fluorescent and magnetic co-labeling does not affect cell vitality.• The number of cells detected by MRI and histology has a high correlation. © Georg Thieme Verlag KG Stuttgart · New York.

  3. The sodium glucose cotransporter 2 inhibitor empagliflozin does not prolong QT interval in a thorough QT (TQT) study

    PubMed Central

    2013-01-01

    Background Empagliflozin is a potent, selective sodium glucose cotransporter 2 (SGLT2) inhibitor in development as an oral antidiabetic treatment. This QT interval study assessed potential effects of empagliflozin on ventricular repolarisation and other electrocardiogram (ECG) parameters. Methods A randomised, placebo-controlled, single-dose, double-blind, five-period crossover study incorporating a novel double-placebo period design to reduce sample size, while maintaining full statistical power. Treatments: single empagliflozin doses of 25 mg (therapeutic) and 200 mg (supratherapeutic), matching placebo and open-label moxifloxacin 400 mg (positive control). Triplicate 12-lead ECGs of 10 second duration were recorded at baseline and during the first 24 hours after dosing. The primary endpoint was mean change from baseline (MCfB) in the population heart rate-corrected QT interval (QTcN) between 1–4 hours after dosing. Results Thirty volunteers (16 male, 14 female, mean [range] age: 34.5 [18–52] years) were randomised. The placebo-corrected MCfB in QTcN 1–4 hours after dosing was 0.6 (90% CI: -0.7, 1.9) ms and -0.2 (-1.4, 0.9) ms for empagliflozin 25 mg and 200 mg, respectively, below the ICH E14 defined threshold of regulatory concern 10 ms. Assay sensitivity was confirmed by a placebo-corrected MCfB in QTcN 2–4 hours post-dose of 12.4 (10.7, 14.1) ms with moxifloxacin 400 mg. Empagliflozin tolerability was good for all volunteers; 23.3% experienced adverse events (AEs) with empagliflozin and 27.6% with placebo. The most frequent AE was nasopharyngitis. Conclusions/interpretation Single doses of empagliflozin 25 mg and 200 mg were not associated with QTcN prolongation and were well tolerated in healthy volunteers. Trial registration ClinicalTrials.gov: NCT01195675 PMID:23617452

  4. Label-free fluorescence strategy for sensitive microRNA detection based on isothermal exponential amplification and graphene oxide.

    PubMed

    Li, Wei; Hou, Ting; Wu, Min; Li, Feng

    2016-01-01

    MicroRNAs (miRNAs) play an important role in many biological processes, and have been regarded as potential targets and biomarkers in cancer diagnosis and therapy. Also, to meet the big challenge imposed by the characteristics of miRNAs, such as small size and vulnerability to enzymatic digestion, it is of great importance to develop accurate, sensitive and simple miRNA assays. Herein, we developed a label-free fluorescence strategy for sensitive miRNA detection by combining isothermal exponential amplification and the unique features of SYBR Green I (SG) and graphene oxide (GO), in which SG gives significantly enhanced fluorescence upon intercalation into double-stranded DNAs (dsDNAs), and GO selectively adsorbs miRNA, single-stranded DNA and SG, to protect miRNA from enzymatic digestion, and to quench the fluorescence of the adsorbed SG. In the presence of the target miRNA, the ingeniously designed hairpin probe (HP) is unfolded and the subsequent polymerization and strand displacement reaction takes place to initiate the target recycling process. The newly formed dsDNAs are then recognized and cleaved by the nicking enzyme, generating new DNA triggers with the same sequence as the target miRNA, which hybridize with intact HPs to initiate new extension reactions. As a result, the circular exponential amplification for target miRNA is achieved and large amount of dsDNAs are formed to generate significantly enhanced fluorescence upon the intercalation of SG. Thus sensitive and selective fluorescence miRNA detection is realized, and the detection limit of 3 fM is obtained. Besides, this method exhibits additional advantages of simplicity and low cost, since expensive and tedious labeling process is avoided. Therefore, the as-proposed label-free fluorescence strategy has great potential in the applications in miRNA-related clinical practices and biochemical researches. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forwardmore » or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource-limited environments.« less

  6. Progressive multi-atlas label fusion by dictionary evolution.

    PubMed

    Song, Yantao; Wu, Guorong; Bahrami, Khosro; Sun, Quansen; Shen, Dinggang

    2017-02-01

    Accurate segmentation of anatomical structures in medical images is important in recent imaging based studies. In the past years, multi-atlas patch-based label fusion methods have achieved a great success in medical image segmentation. In these methods, the appearance of each input image patch is first represented by an atlas patch dictionary (in the image domain), and then the latent label of the input image patch is predicted by applying the estimated representation coefficients to the corresponding anatomical labels of the atlas patches in the atlas label dictionary (in the label domain). However, due to the generally large gap between the patch appearance in the image domain and the patch structure in the label domain, the estimated (patch) representation coefficients from the image domain may not be optimal for the final label fusion, thus reducing the labeling accuracy. To address this issue, we propose a novel label fusion framework to seek for the suitable label fusion weights by progressively constructing a dynamic dictionary in a layer-by-layer manner, where the intermediate dictionaries act as a sequence of guidance to steer the transition of (patch) representation coefficients from the image domain to the label domain. Our proposed multi-layer label fusion framework is flexible enough to be applied to the existing labeling methods for improving their label fusion performance, i.e., by extending their single-layer static dictionary to the multi-layer dynamic dictionary. The experimental results show that our proposed progressive label fusion method achieves more accurate hippocampal segmentation results for the ADNI dataset, compared to the counterpart methods using only the single-layer static dictionary. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Biomechanical comparison of double-row versus transtendon single-row suture anchor technique for repair of the grade III partial articular-sided rotator cuff tears.

    PubMed

    Zhang, Chun-Gang; Zhao, De-Wei; Wang, Wei-Ming; Ren, Ming-Fa; Li, Rui-Xin; Yang, Sheng; Liu, Yu-Peng

    2010-11-01

    For partial-thickness tears of the rotator cuff, double-row fixation and transtendon single-row fixation restore insertion site anatomy, with excellent results. We compared the biomechanical properties of double-row and transtendon single-row suture anchor techniques for repair of grade III partial articular-sided rotator cuff tears. In 10 matched pairs of fresh-frozen sheep shoulders, the infraspinatus tendon from 1 shoulder was repaired with a double-row suture anchor technique. This comprised placement of 2 medial anchors with horizontal mattress sutures at an angle of ≤ 45° into the medial margin of the infraspinatus footprint, just lateral to the articular surface, and 2 lateral anchors with horizontal mattress sutures. Standardized, 50% partial, articular-sided infraspinatus lesions were created in the contralateral shoulder. The infraspinatus tendon from the contralateral shoulder was repaired using two anchors with transtendon single-row mattress sutures. Each specimen underwent cyclic loading from 10 to 100 N for 50 cycles, followed by tensile testing to failure. Gap formation and strain over the footprint area were measured using a motion capture system; stiffness and failure load were determined from testing data. Gap formation for the transtendon single-row repair was significantly smaller (P < 0.05) when compared with the double-row repair for the first cycle ((1.74 ± 0.38) mm vs. (2.86 ± 0.46) mm, respectively) and the last cycle ((3.77 ± 0.45) mm vs. (5.89 ± 0.61) mm, respectively). The strain over the footprint area for the transtendon single-row repair was significantly smaller (P < 0.05) when compared with the double-row repair. Also, it had a higher mean ultimate tensile load and stiffness. For grade III partial articular-sided rotator cuff tears, transtendon single-row fixation exhibited superior biomechanical properties when compared with double-row fixation.

  8. Cisplatin enhances the formation of DNA single- and double-strand breaks by hydrated electrons and hydroxyl radicals.

    PubMed

    Rezaee, Mohammad; Sanche, Léon; Hunting, Darel J

    2013-03-01

    The synergistic interaction of cisplatin with ionizing radiation is the clinical rationale for the treatment of several cancers including head and neck, cervical and lung cancer. The underlying molecular mechanism of the synergy has not yet been identified, although both DNA damage and repair processes are likely involved. Here, we investigate the indirect effect of γ rays on strand break formation in a supercoiled plasmid DNA (pGEM-3Zf-) covalently modified by cisplatin. The yields of single- and double-strand breaks were determined by irradiation of DNA and cisplatin/DNA samples with (60)Co γ rays under four different scavenging conditions to examine the involvement of hydrated electrons and hydroxyl radicals in inducing the DNA damage. At 5 mM tris in an N2 atmosphere, the presence of an average of two cisplatins per plasmid increased the yields of single- and double-strand breaks by factors of 1.9 and 2.2, respectively, relative to the irradiated unmodified DNA samples. Given that each plasmid of 3,200 base pairs contained an average of two cisplatins, this represents an increase in radiosensitivity of 3,200-fold on a per base pair basis. When hydrated electrons were scavenged by saturating the samples with N2O, these enhancement factors decreased to 1.5 and 1.2, respectively, for single- and double-strand breaks. When hydroxyl radicals were scavenged using 200 mM tris, the respective enhancement factors were 1.2 and 1.6 for single- and double-strand breaks, respectively. Furthermore, no enhancement in DNA damage by cisplatin was observed after scavenging both hydroxyl radicals and hydrated electrons. These findings show that hydrated electrons can induce both single- and double-strand breaks in the platinated DNA, but not in unmodified DNA. In addition, cisplatin modification is clearly an extremely efficient means of increasing the formation of both single- and double-strand breaks by the hydrated electrons and hydroxyl radicals created by ionizing radiation.

  9. DNA damage induced by ascorbate in the presence of Cu2+.

    PubMed

    Kobayashi, S; Ueda, K; Morita, J; Sakai, H; Komano, T

    1988-01-25

    DNA damage induced by ascorbate in the presence of Cu2+ was investigated by use of bacteriophage phi X174 double-stranded supercoiled DNA and linear restriction fragments as substrates. Single-strand cleavage was induced when supercoiled DNA was incubated with 5 microM-10 mM ascorbate and 50 microM Cu2+ at 37 degrees C for 10 min. The induced DNA damage was analyzed by sequencing of fragments singly labeled at their 5'- or 3'-end. DNA was cleaved directly and almost uniformly at every nucleotide by ascorbate and Cu2+. Piperidine treatment after the reaction showed that ascorbate and Cu2+ induced another kind of DNA damage different from the direct cleavage. The damage proceeded to DNA cleavage by piperidine treatment and was sequence-specific rather than random. These results indicate that ascorbate induces two classes of DNA damage in the presence of Cu2+, one being direct strand cleavage, probably via damage to the DNA backbone, and the other being a base modification labile to alkali treatment. These two classes of DNA damage were inhibited by potassium iodide, catalase and metal chelaters, suggesting the involvement of radicals generated from ascorbate hydroperoxide.

  10. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.

    PubMed

    Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V

    2017-02-15

    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Comparison between single-row and double-row rotator cuff repair: a biomechanical study.

    PubMed

    Milano, Giuseppe; Grasso, Andrea; Zarelli, Donatella; Deriu, Laura; Cillo, Mario; Fabbriciani, Carlo

    2008-01-01

    The aim of this study was to compare the mechanical behavior under cyclic loading test of single-row and double-row rotator cuff repair with suture anchors in an ex-vivo animal model. For the present study, 50 fresh porcine shoulders were used. On each shoulder, a crescent-shaped full-thickness tear of the infraspinatus was performed. Width of the tendon tear was 2 cm. The lesion was repaired using metal suture anchors. Shoulders were divided in four groups, according the type of repair: single-row tension-free repair (Group 1); single-row tension repair (Group 2); double-row tension-free repair (Group 3); double-row tension repair (Group 4); and a control group. Specimens were subjected to a cyclic loading test. Number of cycles at 5 mm of elongation and at failure, and total elongation were calculated. Single-row tension repair showed significantly poorest results for all the variables considered, when compared with the other groups. Regarding the mean number of cycles at 5 mm of elongation and at failure, there was a nonsignificant difference between Groups 3 and 4, and both of them were significantly greater than Group 1. For mean total elongation, the difference between Groups 1, 3, and 4 was not significant, but all of them were significantly lower than the control group. A single-row repair is particularly weak when performed under tension. Double-row repair is significantly more resistant to cyclic displacement than single-row repair in both tension-free and tension repair. Double-row repair technique can be primarily considered for large, unstable rotator cuff tears to improve mechanical strength of primary fixation of tendons to bone.

  12. Outcomes of single-row and double-row arthroscopic rotator cuff repair: a systematic review.

    PubMed

    Saridakis, Paul; Jones, Grant

    2010-03-01

    Arthroscopic rotator cuff repair is a common procedure that is gaining wide acceptance among orthopaedic surgeons because it is less invasive than open repair techniques. However, there is little consensus on whether to employ single-row or double-row fixation. The purpose of the present study was to systematically review the English-language literature to see if there is a difference between single-row and double-row fixation techniques in terms of clinical outcomes and radiographic healing. PubMed, the Cochrane Central Register of Controlled Trials, and EMBASE were reviewed with the terms "arthroscopic rotator cuff," "single row repair," and "double row repair." The inclusion criteria were a level of evidence of III (or better), an in vivo human clinical study on arthroscopic rotator cuff repair, and direct comparison of single-row and double-row fixation. Excluded were technique reports, review articles, biomechanical studies, and studies with no direct comparison of arthroscopic rotator cuff repair techniques. On the basis of these criteria, ten articles were found, and a review of the full-text articles identified six articles for final review. Data regarding demographic characteristics, rotator cuff pathology, surgical techniques, biases, sample sizes, postoperative rehabilitation regimens, American Shoulder and Elbow Surgeons scores, University of California at Los Angeles scores, Constant scores, and the prevalence of recurrent defects noted on radiographic studies were extracted. Confidence intervals were then calculated for the American Shoulder and Elbow Surgeons, University of California at Los Angeles, and Constant scores. Quality appraisal was performed by the two authors to identify biases. There was no significant difference between the single-row and double-row groups within each study in terms of postoperative clinical outcomes. However, one study divided each of the groups into patients with small-to-medium tears (< 3 cm in length) and those with large-to-massive tears (> or = 3 cm in length), and the authors noted that patients with large to massive tears who had double-row fixation performed better in terms of the American Shoulder and Elbow Surgeons scores and Constant scores in comparison with those who had single-row fixation. Two studies demonstrated a significant difference in terms of structural healing of the rotator cuff tendons after surgery, with the double-row method having superior results. There was an overlap in the confidence intervals between the single-row and double-row groups for all of the studies and the American Shoulder and Elbow Surgeons, Constant, and University of California at Los Angeles scoring systems utilized in the studies, indicating that there was no difference in these scores between single-row and double-row fixation. Potential biases included selection, performance, detection, and attrition biases; each study had at least one bias. Two studies had potentially inadequate power to detect differences between the two techniques. There appears to be a benefit of structural healing when an arthroscopic rotator cuff repair is performed with double-row fixation as opposed to single-row fixation. However, there is little evidence to support any functional differences between the two techniques, except, possibly, for patients with large or massive rotator cuff tears (> or = 3 cm). A risk-reward analysis of a patient's age, functional demands, and other quality-of-life issues should be considered before deciding which surgical method to employ. Double-row fixation may result in improved structural healing at the site of rotator cuff repair in some patients, depending on the size of the tear.

  13. Optofluidic wavelength division multiplexing for single-virus detection

    PubMed Central

    Ozcelik, Damla; Parks, Joshua W.; Wall, Thomas A.; Stott, Matthew A.; Cai, Hong; Parks, Joseph W.; Hawkins, Aaron R.; Schmidt, Holger

    2015-01-01

    Optical waveguides simultaneously transport light at different colors, forming the basis of fiber-optic telecommunication networks that shuttle data in dozens of spectrally separated channels. Here, we reimagine this wavelength division multiplexing (WDM) paradigm in a novel context––the differentiated detection and identification of single influenza viruses on a chip. We use a single multimode interference (MMI) waveguide to create wavelength-dependent spot patterns across the entire visible spectrum and enable multiplexed single biomolecule detection on an optofluidic chip. Each target is identified by its time-dependent fluorescence signal without the need for spectral demultiplexing upon detection. We demonstrate detection of individual fluorescently labeled virus particles of three influenza A subtypes in two implementations: labeling of each virus using three different colors and two-color combinatorial labeling. By extending combinatorial multiplexing to three or more colors, MMI-based WDM provides the multiplexing power required for differentiated clinical tests and the growing field of personalized medicine. PMID:26438840

  14. Synthesis of polycyclic molecules by double C(sp2)-H/C(sp3)-H arylations with a single palladium catalyst.

    PubMed

    Pierre, Cathleen; Baudoin, Olivier

    2011-04-01

    Polycyclic molecules were obtained in good yields by double C(sp(2))-H/C(sp(3))-H arylations mediated by a single palladium/phosphine catalyst. Both double intermolecular/intramolecular and intramolecular/intramolecular C-C couplings were performed successfully, which indicates that this concept has a broad applicability for the rapid construction of molecular complexity.

  15. Single- versus Double-Scoring of Trend Responses in Trend Score Equating with Constructed-Response Tests. Research Report. ETS RR-10-12

    ERIC Educational Resources Information Center

    Tan, Xuan; Ricker, Kathryn L.; Puhan, Gautam

    2010-01-01

    This study examines the differences in equating outcomes between two trend score equating designs resulting from two different scoring strategies for trend scoring when operational constructed-response (CR) items are double-scored--the single group (SG) design, where each trend CR item is double-scored, and the nonequivalent groups with anchor…

  16. Contribution of double scattering to structural coloration in quasiordered nanostructures of bird feathers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Noh, Heeso; Liew, Seng Fatt; Saranathan, Vinodkumar

    2010-07-28

    We measured the polarization- and angle-resolved optical scattering and reflection spectra of the quasiordered nanostructures in the bird feather barbs. In addition to the primary peak that originates from single scattering, we observed a secondary peak which exhibits depolarization and distinct angular dispersion. We explained the secondary peak in terms of double scattering, i.e., light is scattered successively twice by the structure. The two sequential single-scattering events are considered uncorrelated. Using the Fourier power spectra of the nanostructures obtained from the small-angle x-ray scattering experiment, we calculated the double scattering of light in various directions. The double-scattering spectrum is broadermore » than the single-scattering spectrum, and it splits into two subpeaks at larger scattering angle. The good agreement between the simulation results and the experimental data confirms that double scattering of light makes a significant contribution to the structural color.« less

  17. A high power, continuous-wave, single-frequency fiber amplifier at 1091 nm and frequency doubling to 545.5 nm

    NASA Astrophysics Data System (ADS)

    Stappel, M.; Steinborn, R.; Kolbe, D.; Walz, J.

    2013-07-01

    We present a high power single-frequency ytterbium fiber amplifier system with an output power of 30 W at 1091 nm. The amplifier system consists of two stages, a preamplifier stage in which amplified spontaneous emission is efficiently suppressed (>40 dB) and a high power amplifier with an efficiency of 52%. Two different approaches to frequency doubling are compared. We achieve 8.6 W at 545.5 nm by single-pass frequency doubling in a MgO-doped periodically poled stoichiometric LiTaO3 crystal and up to 19.3 W at 545.5 nm by frequency doubling with a lithium-triborate crystal in an external enhancement cavity.

  18. Depressive symptoms in epilepsy: prevalence, impact, aetiology, biological correlates and effect of treatment with antiepileptic drugs.

    PubMed

    Miller, J Mitchell; Kustra, Robert P; Vuong, Alain; Hammer, Anne E; Messenheimer, John A

    2008-01-01

    Occurring in up to 80% of patients with epilepsy, depression in epilepsy may manifest as (i) major depressive disorder, meeting Diagnostic and Statistical Manual, 4th edition (DSM-IV) diagnostic criteria; (ii) atypical depression or dysthymia; or (iii) a dysthymic-like disorder with intermittent symptoms that can be milder than those of major depression. Depressive symptoms impair patients' health-related quality of life and may affect the clinical course of epilepsy. Depressive symptoms in epilepsy have been attributed to several causes, including endocrine and/or metabolic effects of seizures; the psychological response to epilepsy and its associated mental, physical and social challenges; common pathogenic mechanisms between depression and epilepsy; and the adverse effects of certain antiepileptic drugs (AEDs), particularly GABAergic agents, such as vigabatrin, tiagabine, topiramate and phenobarbital. Whereas some AEDs impair mood, others appear to improve aspects of mood or are mood neutral. Demonstrable antidepressant efficacy of AEDs used to manage seizures could have a significant impact on the care of patients with epilepsy. The AED lamotrigine has been demonstrated to be effective in the treatment of depressive symptoms in patients with epilepsy. In randomized, double-blind, clinical trials in patients with epilepsy, depressive symptoms improved more with lamotrigine monotherapy than valproate monotherapy and more with lamotrigine adjunctive therapy than placebo. Results of open-label studies of lamotrigine monotherapy and adjunctive therapy are consistent with the results of double-blind clinical trials. Lamotrigine-associated improvement in depressive symptoms is independent of its anticonvulsant efficacy. In prospective assessments, gabapentin, levetiracetam and oxcarbazepine each exhibited potentially beneficial effects on depressive symptoms in patients with epilepsy. However, evidence for the efficacy of gabapentin, levetiracetam and oxcarbazepine in the treatment of depressive symptoms in epilepsy is inconclusive at present because the effects of each agent have only been reported in single studies of an open-label design and with small sample sizes.

  19. Tocotrienol Treatment in Familial Dysautonomia: Open-Label Pilot Study.

    PubMed

    Cheishvili, David; Maayan, Channa; Holzer, Naama; Tsenter, Jeanna; Lax, Elad; Petropoulos, Sophie; Razin, Aharon

    2016-07-01

    Familial dysautonomia (FD) is an autosomal recessive congenital neuropathy, primarily presented in Ashkenazi Jews. The most common mutation in FD patients results from a single base pair substitution of an intronic splice site in the IKBKAP gene which disrupts normal mRNA splicing and leads to tissue-specific reduction of IKBKAP protein (IKAP). To date, treatment of FD patients remains preventative, symptomatic and supportive. Based on previous in vitro evidence that tocotrienols, members of the vitamin E family, upregulate transcription of the IKBKAP gene, we aimed to investigate whether a similar effects was observed in vivo. In the current study, we assessed the effects of tocotrienol treatment on FD patients' symptoms and IKBKAP expression in white blood cells. The initial daily doses of 50 or 100 mg tocotrienol, doubled after 3 months, was administered to 32 FD patients. Twenty-eight FD patients completed the 6-month study. The first 3 months of tocotrienol treatment was associated with a significant increase in IKBKAP expression level in FD patients' blood. Despite doubling the dose after the initial 3 months of treatment, IKBKAP expression level returned to baseline by the end of the 6-month treatment. Clinical improvement was noted in the reported clinical questionnaire (with regard to dizziness, bloching, sweating, number of pneumonia, cough episodes, and walking stability), however, no significant effect was observed in any clinical measurements (weight, height, oxygen saturation, blood pressure, tear production, histamine test, vibration threshold test, nerve conduction, and heart rate variability) following Tocotrienol treatment. In conclusion, tocotrienol treatment appears significantly beneficial by clinical evaluation for some FD patients in a few clinical parameters; however it was not significant by clinical measurements. This open-label study shows the complexity of effect of tocotrienol treatment on FD patients' clinical outcomes and on IKBKAP expression level compared to in vitro results. A longitudinal study with an increased sample size is required in the future to better understand tocotrienol affect on FD patients.

  20. Real-time feedback on knee abduction moment does not improve frontal-plane knee mechanics during jump landings.

    PubMed

    Beaulieu, M L; Palmieri-Smith, R M

    2014-08-01

    Excessive knee abduction loading is a contributing factor to anterior cruciate ligament (ACL) injury risk. The purpose of this study was to determine whether a double-leg landing training program with real-time visual feedback improves frontal-plane mechanics during double- and single-leg landings. Knee abduction angles and moments and vertical ground reaction forces (GRF) of 21 recreationally active women were quantified for double- and single-leg landings before and after the training program. This program consisted of two sessions of double-leg jump landings with real-time visual feedback on knee abduction moments for the experimental group and without real-time feedback for the control group. No significant differences were found between training groups. In comparison with pre-training data, peak knee abduction moments decreased 12% post-training for both double- and single-leg landings; whereas peak vertical GRF decreased 8% post-training for double-leg landings only, irrespective of training group. Real-time feedback on knee abduction moments, therefore, did not significantly improve frontal-plane knee mechanics during landings. The effect of the training program on knee abduction moments, however, transferred from the double-leg landings (simple task) to single-leg landings (more complex task). Consequently, ACL injury prevention efforts may not need to focus on complex tasks during which injury occurs. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Rise-Time of FRET-Acceptor Fluorescence Tracks Protein Folding

    PubMed Central

    Lindhoud, Simon; Westphal, Adrie H.; van Mierlo, Carlo P. M.; Visser, Antonie J. W. G.; Borst, Jan Willem

    2014-01-01

    Uniform labeling of proteins with fluorescent donor and acceptor dyes with an equimolar ratio is paramount for accurate determination of Förster resonance energy transfer (FRET) efficiencies. In practice, however, the labeled protein population contains donor-labeled molecules that have no corresponding acceptor. These FRET-inactive donors contaminate the donor fluorescence signal, which leads to underestimation of FRET efficiencies in conventional fluorescence intensity and lifetime-based FRET experiments. Such contamination is avoided if FRET efficiencies are extracted from the rise time of acceptor fluorescence upon donor excitation. The reciprocal value of the rise time of acceptor fluorescence is equal to the decay rate of the FRET-active donor fluorescence. Here, we have determined rise times of sensitized acceptor fluorescence to study the folding of double-labeled apoflavodoxin molecules and show that this approach tracks the characteristics of apoflavodoxinʼs complex folding pathway. PMID:25535076

  2. Enhanced labeling of microalgae cellular lipids by application of an electric field generated by alternating current.

    PubMed

    Su, Li-Chien; Hsu, Yi-Hsiang; Wang, Hsiang-Yu

    2012-05-01

    An alternating current was used to generate an electric field to enhance the fluorescent labeling of microalgae cellular lipids with Nile red and LipidTOX. The decay of the fluorescence intensity of Chlorella vulgaris cells in 0 V/cm was more than 50% after 10 min, and the intensity variation was as high as 7% in 20s. At 2000 V/cm, the decay rate decreased to 1.22% per minute and the intensity fluctuation was less than 1% for LipidTOX-labeled cells. For Spirulina sp. cells at 0 V/cm, the fluorescence intensity increased by 10% after 10 min, whereas at 2000 V/cm, labeling was more rapid and fluorescence intensity doubled. These results show that applying an electric field can improve the quality of fluorescence detection by alleviating decay and fluctuation or by enhancing signal intensity. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) for detection and identification of albumin phosphylation by organophosphorus pesticides and G- and V-type nerve agents.

    PubMed

    John, Harald; Breyer, Felicitas; Thumfart, Jörg Oliver; Höchstetter, Hans; Thiermann, Horst

    2010-11-01

    Toxic organophosphorus compounds (OPC), e.g., pesticides and nerve agents (NA), are known to phosphylate distinct endogenous proteins in vivo and in vitro. OPC adducts of butyrylcholinesterase and albumin are considered to be valuable biomarkers for retrospective verification of OPC exposure. Therefore, we have detected and identified novel adducts of human serum albumin (HSA) by means of matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). Pure albumin and plasma were incubated with numerous pesticides and NA of the V- and G-type in different molar ratios. Samples were prepared either by sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by in-gel enzymatic cleavage using endoproteinase Glu-C (Glu-C) or by combining highly albumin-selective affinity extraction with ultrafiltration followed by reduction, carbamidomethylation, and enzymatic cleavage (Glu-C) prior to MALDI-TOF MS analysis. Characteristic mass shifts for phosphylation revealed tyrosine adducts at Y(411) (Y(401)KFQNALLVRY(411)TKKVPQVSTPTLVE(425)), Y(148) and Y(150) (I(142)ARRHPY(148)FY(150)APE(153), single and double labeled), and Y(161) (L(154)LFFAKRY(161)KAAFTE(167)) produced by original NA (tabun, sarin, soman, cyclosarin, VX, Chinese VX, and Russian VX) as well as by chlorpyrifos-oxon, diisopropyl fluorophosphate (DFP), paraoxon-ethyl (POE), and profenofos. MALDI-MS/MS of the single-labeled I(142)-E(153) peptide demonstrated that Y(150) was phosphylated with preference to Y(148). Aged albumin adducts were not detected. The procedure described was reproducible and feasible for detection of adducts at the most reactive Y(411)-residue (S/N ≥ 3) when at least 1% of total albumin was labeled. This was achieved by incubating plasma with molar HSA/OPC ratios ranging from approximately 1:0.03 (all G-type NA, DFP, and POE) to 1:3 (V-type NA, profenofos). Relative signal intensity of the Y(411) adduct correlated well with the spotted relative molar amount underlining the usefulness for quantitative adduct determination. In conclusion, the current analytical design exhibits potential as a verification tool for high-dose exposure.

  4. Practical cell labeling with magnetite cationic liposomes for cell manipulation.

    PubMed

    Ito, Hiroshi; Nonogaki, Yurika; Kato, Ryuji; Honda, Hiroyuki

    2010-07-01

    Personalization of the cell culture process for cell therapy is an ideal strategy to obtain maximum treatment effects. In a previous report, we proposed a strategy using a magnetic manipulation device that combined a palm-top size device and a cell-labeling method using magnetite cationic liposomes (MCLs) to enable feasible personalized cell processing. In the present study, we focused on optimizing the MCL-labeling technique with respect to cell manipulation in small devices. From detailed analysis with different cell types, 4 pg/cell of MCL-label was found to be obtained immediately after mixing with MCLs, which was sufficient for magnetic cell manipulation. The amount of label increased within 24 h depending on cell type, although in all cases it decreased along with cell doubling, indicating that the labeling potential of MCLs was limited. The role of free MCLs not involved in labeling was also investigated; MCLs' role was found to be a supportive one that maximized the manipulation performance up to 100%. We also determined optimum conditions to manipulate adherent cells by MCL labeling using the MCL dispersed in trypsin solution. Considering labeling feasibility and practical performance with 10(3)-10(5) cells for personalized cell processing, we determined that 10 microg/ml of label without incubation time (0 h incubation) was the universal MCL-labeling condition. We propose the optimum specifications for a device to be combined with this method. 2010. Published by Elsevier B.V.

  5. Single-Photon, Double Photodetachment of Nickel Phthalocyanine Tetrasulfonic Acid 4- Anions.

    PubMed

    Daly, Steven; Girod, Marion; Vojkovic, Marin; Giuliani, Alexandre; Antoine, Rodolphe; Nahon, Laurent; O'Hair, Richard A J; Dugourd, Philippe

    2016-07-07

    Single-photon, two-electron photodetachment from nickel phthalocyanine tetrasulfonic acid tetra anions, [NiPc](4-), was examined in the gas-phase using a linear ion trap coupled to the DESIRS VUV beamline of the SOLEIL Synchrotron. This system was chosen since it has a low detachment energy, known charge localization, and well-defined geometrical and electronic structures. A threshold for two-electron loss is observed at 10.2 eV, around 1 eV lower than previously observed double detachment thresholds on multiple charged protein anions. The photodetachment energy of [NiPc](4-) has been previously determined to be 3.5 eV and the photodetachment energy of [NiPc](3-•) is determined in this work to be 4.3 eV. The observed single photon double electron detachment threshold is hence 5.9 eV higher than the energy required for sequential single electron loss. Possible mechanisms are for double photodetachment are discussed. These observations pave the way toward new, exciting experiments for probing double photodetachment at relatively low energies, including correlation measurements on emitted photoelectrons.

  6. PAPER-CHROMATOGRAM MEASUREMENT OF SUBSTANCES LABELLED WITH H$sup 3$ (in German)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wenzel, M.

    1961-03-01

    Compounds labelled with H/sup 3/ can be detected with a paper chromatogram using a methane flow counter with a count yield of 1%. The yield can be estimated from the beta maximum energy. A new double counter was developed which increases the count yield to 2% and also considerably decreases the margin of error. Calibration curves with leucine and glucosamine show satisfactory linearity between measured and applied activity in the range from 4 to 50 x 10/sup -//sup 3/ mu c of H/sup 3/. (auth)

  7. Spin-locking and cross-polarization under magic-angle spinning of uniformly labeled solids.

    PubMed

    Hung, Ivan; Gan, Zhehong

    2015-07-01

    Spin-locking and cross-polarization under magic-angle spinning are investigated for uniformly (13)C and (15)N labeled solids. In particular, the interferences from chemical shift anisotropy, and (1)H heteronuclear and (13)C homonuclear dipolar couplings are identified. The physical origin of these interferences provides guidelines for selecting the best (13)C and (15)N polarization transfer rf fields. Optimal settings for both the zero- and double-quantum cross-polarization transfer mechanisms are recommended. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Biomechanical evaluation of a single-row versus double-row repair for complete subscapularis tears.

    PubMed

    Wellmann, Mathias; Wiebringhaus, Philipp; Lodde, Ina; Waizy, Hazibullah; Becher, Christoph; Raschke, Michael J; Petersen, Wolf

    2009-12-01

    The purpose of the study was to compare a single-row repair and a double-row repair technique for the specific characteristics of a complete subscapularis lesion. Ten pairs of human cadaveric shoulder human shoulder specimens were tested for stiffness and ultimate tensile strength of the intact tendons in a load to failure protocol. After a complete subscapularis tear was provoked, the specimens were assigned to two treatment groups: single-row repair (1) and a double-row repair using a "suture bridge" technique (2). After repair cyclic loading a subsequent load to failure protocol was performed to determine the ultimate tensile load, the stiffness and the elongation behaviour of the reconstructions. The intact subscapularis tendons had a mean stiffness of 115 N/mm and a mean ultimate load of 720 N. The predominant failure mode of the intact tendons was a tear at the humeral insertion site (65%). The double-row technique restored 48% of the ultimate load of the intact tendons (332 N), while the single-row technique revealed a significantly lower ultimate load of 244 N (P = 0.001). In terms of the stiffness, the double-row technique showed a mean stiffness of 81 N/mm which is significantly higher compared to the stiffness of the single-row repairs of 55 N/mm (P = 0.001). The double-row technique has been shown to be stronger and stiffer when compared to a conventional single-row repair. Therefore, this technique is recommended from a biomechanical point of view irrespectively if performed by an open or arthroscopic approach.

  9. Comparative study of single lateral locked plating versus double plating in type C bicondylar tibial plateau fractures

    PubMed Central

    Neogi, Devdatta Suhas; Trikha, Vivek; Mishra, Kaushal Kant; Bandekar, Shivanand M.; Yadav, Chandra Shekhar

    2015-01-01

    Background: Bicondylar tibial plateau fractures are complex injuries and treatment is challenging. Ideal method is still controversial with risk of unsatisfactory results if not treated properly. Many different techniques of internal and external fixation are used. This study compares the clinical results in single locked plating versus dual plating (DP) using two incision approaches. Our hypothesis was that DP leads to less collapse and change in alignment at final followup compared with single plating. Materials and Methods: 61 cases of Type C tibial plateau fractures operated between January 2007 and June 2011 were included in this prospective study. All cases were operated either by single lateral locked plate by anterolateral approach or double plating through double incision. All cases were followed for a minimum of 24 months radiologically and clinically. The statistical analysis was performed using software SPSS 10.0 to analyze the data. Results: Twenty nine patients in a single lateral locked plate and 32 patients in a double plating group were followed for minimum 2 years. All fractures healed, however there was a significant incidence of malalignment in the single lateral plating group. Though there was a significant increase in soft tissue issues with the double plating group; however, there was only 3.12% incidence of deep infection. There was no significant difference in Hospital for special surgery score at 2 years followup. Conclusion: Double plating through two incisions resulted in a better limb alignment and joint reduction with an acceptable soft tissue complication rate. PMID:26015609

  10. Single chip camera device having double sampling operation

    NASA Technical Reports Server (NTRS)

    Fossum, Eric R. (Inventor); Nixon, Robert (Inventor)

    2002-01-01

    A single chip camera device is formed on a single substrate including an image acquisition portion for control portion and the timing circuit formed on the substrate. The timing circuit also controls the photoreceptors in a double sampling mode in which are reset level is first read and then after an integration time a charged level is read.

  11. Optimal Shape of a Gamma-ray Collimator: single vs double knife edge

    NASA Astrophysics Data System (ADS)

    Metz, Albert; Hogenbirk, Alfred

    2017-09-01

    Gamma-ray collimators in nuclear waste scanners are used for selecting a narrow vertical segment in activity measurements of waste vessels. The system that is used by NRG uses tapered slit collimators of both the single and double knife edge type. The properties of these collimators were investigated by means of Monte Carlo simulations. We found that single knife edge collimators are highly preferable for a conservative estimate of the activity of the waste vessels. These collimators show much less dependence on the angle of incidence of the radiation than double knife edge collimators. This conclusion also applies to cylindrical collimators of the single knife edge type, that are generally used in medical imaging spectroscopy.

  12. Multiple ionization of C 60 in collisions with 2.33 MeV/u O-ions and giant plasmon excitation

    NASA Astrophysics Data System (ADS)

    Kelkar, A. H.; Kadhane, U.; Misra, D.; Kumar, Ajay; Tribedi, L. C.

    2007-03-01

    Single and multiple ionization of C60 in collisions with fast (v = 9.7 a.u.) Oq+ ions have been studied. Relative cross sections for production of C 601+ to C 604+ have been measured. The intensity ratios of double-to-single ionization agree very well with a model based on giant dipole plasmon resonance (GDPR). Almost linear increasing trend of the yields of single and double ionizations with projectile charge state is well reproduced by the single and double plasmon excitation mechanisms. The observed charge state independence of triple and quadruple ionization is in sharp contrast to the GDPR model.

  13. A Review of Pharmacologic Treatment for Compulsive Buying Disorder.

    PubMed

    Soares, Célia; Fernandes, Natália; Morgado, Pedro

    2016-04-01

    At present, no treatment recommendations can be made for compulsive buying disorder. Recent studies have found evidence for the efficacy of psychotherapeutic options, but less is known regarding the best pharmacologic treatment. The purpose of this review is to present and analyze the available published evidence on the pharmacological treatment of compulsive buying disorder. To achieve this, we conducted a review of studies focusing on the pharmacological treatment of compulsive buying by searching the PubMed/MEDLINE database. Selection criteria were applied, and 21 studies were identified. Pharmacological classes reported included antidepressants, mood stabilizers, opioid antagonists, second-generation antipsychotics, and N-methyl-D-aspartate receptor antagonists. We found only placebo-controlled trials for fluvoxamine; none showed effectiveness against placebo. Three open-label trials reported clinical improvement with citalopram; one was followed by a double-blind discontinuation. Escitalopram was effective in an open-label trial but did not show efficacy in the double-blind phase. Memantine was identified as effective in a pilot open-label study. Fluoxetine, bupropion, nortriptyline, clomipramine, topiramate and naltrexone were only reported to be effective in clinical cases. According to the available literature, there is no evidence to propose a specific pharmacologic agent for compulsive buying disorder. Future research is required for a better understanding of both pathogenesis and treatment of this disorder.

  14. Complications and Short-Term Explantation Rate Following Artificial Urinary Sphincter Implantation: Results from a Large Middle European Multi-Institutional Case Series.

    PubMed

    Kretschmer, Alexander; Hüsch, Tanja; Thomsen, Frauke; Kronlachner, Dominik; Obaje, Alice; Anding, Ralf; Pottek, Tobias; Rose, Achim; Olianas, Roberto; Friedl, Alexander; Hübner, Wilhelm; Homberg, Roland; Pfitzenmaier, Jesco; Grein, Ulrich; Queissert, Fabian; Naumann, Carsten Maik; Schweiger, Josef; Wotzka, Carola; Nyarangi-Dix, Joanne N; Hofmann, Torben; Seiler, Roland; Haferkamp, Axel; Bauer, Ricarda M

    2016-01-01

    Background/Aims/Objectives: To analyze perioperative complication and short-term explantation rates after perineal or penoscrotal single-cuff and double-cuff artificial urinary sphincter (AUS) implantation in a large middle European multi-institutional patient cohort. 467 male patients with stress urinary incontinence underwent implantation of a perineal single-cuff (n = 152), penoscrotal single-cuff (n = 99), or perineal double-cuff (n = 216) AUS between 2010 and 2012. Postoperative complications and 6-month explantation rates were assessed. For statistical analysis, Fisher's exact test and Kruskal-Wallis rank sum test, and a multiple logistic regression model were used (p < 0.05). Compared to perineal single-cuff AUS, penoscrotal single-cuff implantation led to significantly increased short-term explantation rates (8.6% (perineal) vs. 19.2% (penoscrotal), p = 0.019). The postoperative infection rate was significantly higher after double-cuff compared to single-cuff implantation (6.0% (single-cuff) vs. 13.9% (double-cuff), p = 0.019). The short-term explantation rate after primary double-cuff placement was 6.5% (p = 0.543 vs. perineal single-cuff). In multivariate analysis, the penoscrotal approach (p = 0.004), intraoperative complications (p = 0.005), postoperative bleeding (p = 0.011), and perioperative infection (p < 0.001) were independent risk factors for short-term explantation. Providing data from a large contemporary multi-institutional patient cohort from high-volume and low-volume institutions, our results reflect the current standard of care in middle Europe. We indicate that the penoscrotal approach is an independent risk factor for increased short-term explantation rates. © 2016 S. Karger AG, Basel.

  15. Double versus single high-dose melphalan 200 mg/m2 and autologous stem cell transplantation for multiple myeloma: a region-based study in 484 patients from the Nordic area

    PubMed Central

    Björkstrand, Bo; Klausen, Tobias W.; Remes, Kari; Gruber, Astrid; Knudsen, Lene M.; Bergmann, Olav J.; Lenhoff, Stig; Johnsen, Hans E.

    2009-01-01

    Autologous stem cell transplantation is still considered the standard of care in young patients with multiple myeloma (MM). This disease is the most common indication for high-dose therapy (HDT) supported by hematopoietic stem cell transplantation and much data support the benefit of this procedure. Results of randomized studies are in favor of tandem autologous transplantation although the effect on overall survival is unclear. Based on sequential registration trials in the Nordic area, we aimed to evaluate the outcome of conventional single or double HDT. During 1994–2000 we registered a total of 484 previously untreated patients under the age of 60 years at diagnosis who on a regional basis initially were treated with single [Trial NMSG #5/94 and #7/98 (N=383)] or double [Trial Huddinge Karolinska Turku Herlev (N=101)] high-dose melphalan (200 mg/m2) therapy supported by autologous stem cell transplantation. A complete or very good partial response was achieved by 40% of patients in the single transplant group and 60% of patients in the double transplant group (p=0.0006). The probability of surviving progression free for five years after the diagnosis was 25% (95% CL 18–32%) in the singletransplant group and 46% (95% CL 33–55%) in the double transplant group (p=0.0014). The estimated overall five-year survival rate was 60% in the single transplant group and 64% in the doubletransplant (p=0.9). In a multivariate analysis of variables, including single versus double transplantation, β2 microglobulin level, age, sex and disease stage, only β2 microglobulin level was predictive for overall survival (p>0.0001) and progression free survival (p=0.001). In accordance with these results, a 1:1 case-control matched comparison between double and single transplantation did not identify significant differences in overall and progression free survival. In this retrospective analysis up front double transplantation with melphalan (200 mg/m2) as compared to single transplantation did not seem to improve the final outcome among patients in the Nordic area. These data are in accordance with recent publications from the Bologna 96 trial indicating that a second transplant should not be recommended up front as standard care.

  16. Single-incision approach improves wound healing and bone union for treating mid-to-lower segment of tibiofibular fracture.

    PubMed

    Zhang, Yongguang; Zhuang, Yuehong; Wang, Benhai; Xu, Hao; Chen, Jinshui; Lin, Songqing

    2015-01-01

    The mid-to-lower segment of tibiofibular fractures (MLTFs) is commonly encountered in clinical practice, which is conventionally treated by the double-incision surgical approach. However, the double-incision approach frequently makes the closure of the wound extremely difficult and sometimes results in necrosis of skin around fractured sites. In the present study, our experience of using a single-incision surgical approach for treating MLTF was exhibited. From February 2005 to December 2013, the clinical outcomes of 212 patients with MLTFs who underwent either double-incision approach or single-incision approach were retrospectively evaluated and compared. Both groups were similar with respect to injury mechanism and all patients were followed up with the efficacies of treatment evaluated by Johner-Wruth criteria. The results demonstrated that the effective rate and the rate of excellent and good efficacy in the single-incision group were significantly higher than those in the double-incision group (P<0.05). In addition, the rates of skin wound healing and bone union after surgery in the single-incision group were significantly higher than those in the double-incision group (P<0.05). These findings indicate that the single-incision surgical approach, which holds the advantages of being milder in trauma, fewer in complications and better in function restoration, might be used as an alternative method for treating MLTFs.

  17. 3D 14N/1H Double Quantum/1H Single Quantum Correlation Solid-State NMR for Probing Parallel and Anti-Parallel Beta-Sheet Arrangement of Oligo-Peptides at Natural Abundance.

    PubMed

    Hong, You-Lee; Asakura, Tetsuo; Nishiyama, Yusuke

    2018-05-08

    β-sheet structure of oligo- and poly-peptides can be formed in anti-parallel (AP)- and parallel (P)-structure, which is the important feature to understand the structures. In principle, P- and AP-β-sheet structures can be identified by the presence (AP) and absence (P) of the interstrand 1HNH/1HNH correlations on a diagonal in 2D 1H double quantum (DQ)/1H single quantum (SQ) spectrum due to the different interstrand 1HNH/1HNH distances between these two arrangements. However, the 1HNH/1HNH peaks overlap to the 1HNH3+/1HNH3+ peaks, which always give cross peaks regardless of the β-sheet arrangement. The 1HNH3+/1HNH3+ peaks disturb the observation of the presence/absence of 1HNH/1HNH correlations and the assignment of 1HNH and 1HNH3+ is not always available. Here, 3D 14N/1H DQ/1H SQ correlation solid-state NMR experiments at fast magic angle spinning (70 kHz) are introduced to distinguish AP and P β-sheet structure. The 14N dimension allows the separate observation of 1HNH/1HNH peaks from 1HNH3+/1HNH3+ peaks with clear assignment of 1HNH and 1HNH3+. In addition, the high natural abundance of 1H and 14N enables 3D 14N/1H DQ/1H SQ experiments of oligo-alanines (Ala3-6) in four hours without any isotope labelling. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Class XI Myosins Move Specific Organelles in Pollen Tubes and Are Required for Normal Fertility and Pollen Tube Growth in Arabidopsis1[OPEN

    PubMed Central

    Madison, Stephanie L.; Buchanan, Matthew L.; Glass, Jeremiah D.; McClain, Tarah F.; Park, Eunsook; Nebenführ, Andreas

    2015-01-01

    Pollen tube growth is an essential aspect of plant reproduction because it is the mechanism through which nonmotile sperm cells are delivered to ovules, thus allowing fertilization to occur. A pollen tube is a single cell that only grows at the tip, and this tip growth has been shown to depend on actin filaments. It is generally assumed that myosin-driven movements along these actin filaments are required to sustain the high growth rates of pollen tubes. We tested this conjecture by examining seed set, pollen fitness, and pollen tube growth for knockout mutants of five of the six myosin XI genes expressed in pollen of Arabidopsis (Arabidopsis thaliana). Single mutants had little or no reduction in overall fertility, whereas double mutants of highly similar pollen myosins had greater defects in pollen tube growth. In particular, myo11c1 myo11c2 pollen tubes grew more slowly than wild-type pollen tubes, which resulted in reduced fitness compared with the wild type and a drastic reduction in seed set. Golgi stack and peroxisome movements were also significantly reduced, and actin filaments were less organized in myo11c1 myo11c2 pollen tubes. Interestingly, the movement of yellow fluorescent protein-RabA4d-labeled vesicles and their accumulation at pollen tube tips were not affected in the myo11c1 myo11c2 double mutant, demonstrating functional specialization among myosin isoforms. We conclude that class XI myosins are required for organelle motility, actin organization, and optimal growth of pollen tubes. PMID:26358416

  19. Civamide cream 0.075% in patients with osteoarthritis of the knee: a 12-week randomized controlled clinical trial with a longterm extension.

    PubMed

    Schnitzer, Thomas J; Pelletier, Jean-Pierre; Haselwood, Doug M; Ellison, William T; Ervin, John E; Gordon, Richard D; Lisse, Jeffrey R; Archambault, W Tad; Sampson, Allan R; Fezatte, Heidi B; Phillips, Scott B; Bernstein, Joel E

    2012-03-01

    To evaluate the safety and efficacy of civamide cream 0.075% for the treatment of osteoarthritis (OA) of the knee. We conducted a 12-week, multicenter, randomized, double-blind study with a 52-week open-label extension. Patients with OA of the knee received either civamide cream 0.075% or a lower dose of civamide cream, 0.01%, as the control. The 3 co-primary endpoints in the double-blind study were the time-weighted average (TWA) of change from baseline to Day 84 in the Western Ontario and McMaster Universities Osteoarthritis Index (WOMAC) pain subscale, the WOMAC physical function subscale, and the Subject Global Evaluation (SGE). In the 52-week open-label extension study, the Osteoarthritis Pain Score and SGE were assessed. A total of 695 patients were randomized to receive civamide cream 0.075% (n = 351) or civamide cream 0.01% (control; n = 344) in the double-blind study. Significance in favor of civamide cream 0.075% was achieved for the TWA for all 3 co-primary efficacy variables: WOMAC pain (p = 0.009), WOMAC physical function (p < 0.001), and SGE (p = 0.008); and at Day 84 for these 3 variables (p = 0.013, p < 0.001, and p = 0.049, respectively). These analyses accounted for significant baseline-by-treatment interactions. In the 52-week open-label extension, efficacy was maintained. Civamide cream 0.075% was well tolerated throughout the studies. These studies demonstrate the efficacy of civamide cream for up to 1 year of continuous use. Civamide cream, with its lack of systemic absorption, does not have the potential for serious systemic toxicity, in contrast to several other OA treatments.

  20. Impact of 6-month earlier versus postponed initiation of rotigotine on long-term outcome: post hoc analysis of patients with early Parkinson's disease with mild symptom severity.

    PubMed

    Timmermann, Lars; Asgharnejad, Mahnaz; Boroojerdi, Babak; Dohin, Elisabeth; Woltering, Franz; Elmer, Lawrence W

    2015-01-01

    Investigate impact of 6-month earlier versus postponed initiation of rotigotine in patients with early Parkinson's disease (PD) with mild symptom severity. Long-term benefit of rotigotine in early-PD has been demonstrated: SP702 (NCT00594165) and SP716 (NCT00599196) were long-term, open-label extensions of double-blind, placebo-controlled studies of 6-month maintenance; rotigotine was well tolerated for up to 6 years, and demonstrated efficacy (Unified Parkinson's Disease Rating Scale [UPDRS] II + III below baseline) for ∼ 2 years (SP702) and ∼ 4 years (SP716). Post hoc analysis of patients at Hoehn and Yahr 1-2; groups defined by treatment received in 6-month double-blind studies: 'Rotigotine-Rotigotine' received rotigotine (n = 221), 'Placebo-Rotigotine' received placebo (n = 125). At the start of open-label rotigotine maintenance, UPDRS II + III mean ± SD change from double-blind baseline was: -8.5 ± 10.6 'Rotigotine-Rotigotine', -7.7 ± 9.0 'Placebo-Rotigotine.' After this initial improvement scores gradually increased: It took ∼ 45 months for mean scores to cross baseline in 'Rotigotine-Rotigotine', and ∼ 21 months in 'Placebo-Rotigotine.' At the time mean UPDRS II + III had crossed baseline in 'Placebo-Rotigotine' (open-label week 84; ∼ 21 months), treatment difference (LS-mean) to 'Rotigotine-Rotigotine' change from baseline was -3.89 (95% CI -6.94, -0.84); p = 0.013. In this post hoc analysis, 6-month earlier initiation of rotigotine resulted in slower return to baseline mean UPDRS II + III; initiation of rotigotine in patients with minimal/no functional disability or impairment may lead to an extended benefit.

  1. The safety and tolerability of rotigotine transdermal system over a 6-year period in patients with early-stage Parkinson's disease.

    PubMed

    Giladi, Nir; Boroojerdi, Babak; Surmann, Erwin

    2013-09-01

    This open-label extension (SP716; NCT00599196) of a 6-month, double-blind, randomized study (SP513) investigated the safety and tolerability of rotigotine transdermal system over up to ~6 years in patients with Parkinson's disease (PD; early-stage PD at double-blind enrollment). Eligible patients completing the 6-month study received optimal dose open-label rotigotine (≤ 16 mg/24 h) for up to ~6 years. Adjunctive levodopa was permitted. Primary outcomes included adverse events (AEs) and extent of rotigotine exposure. Analysis of adjunctive levodopa use, dyskinesias [unified Parkinson's disease rating scale (UPDRS) IV], and efficacy (UPDRS II + III total score) were also assessed. Of 381 patients enrolled in the open-label extension, 52 % were still in the study at time of closure; 24 % withdrew because of AEs and 6 % because of lack of efficacy. Patients received rotigotine for a median duration of 1,564.5 days (~4 years, 3 months; range 5-2, 145 days). 69 % of patients started supplemental levodopa; median time to levodopa was 485 days (~1 year, 4 months). Most common AEs (% per patient-year) were somnolence (18 %), application site reactions (12 %), nausea (9 %), peripheral edema (7 %), and fall (7 %). AEs indicative of impulsive-compulsive behavior were recorded in 25 (7 %) patients. Dyskinesias were experienced by 65 (17 %) patients; the majority [47 of 65 (72 %)] reported first dyskinesia after starting levodopa. Mean UPDRS II + III total scores remained below double-blind baseline for 4 years (assessment of all patients). In conclusion, rotigotine was generally well tolerated for up to ~6 years in patients with early-stage PD. The AEs reported were in line with previous studies of rotigotine transdermal system, with typical dopaminergic side effects and application site reactions seen.

  2. Nanoscale Label-free Bioprobes to Detect Intracellular Proteins in Single Living Cells

    PubMed Central

    Hong, Wooyoung; Liang, Feng; Schaak, Diane; Loncar, Marko; Quan, Qimin

    2014-01-01

    Fluorescent labeling techniques have been widely used in live cell studies; however, the labeling processes can be laborious and challenging for use in non-transfectable cells, and labels can interfere with protein functions. While label-free biosensors have been realized by nanofabrication, a method to track intracellular protein dynamics in real-time, in situ and in living cells has not been found. Here we present the first demonstration of label-free detection of intracellular p53 protein dynamics through a nanoscale surface plasmon-polariton fiber-tip-probe (FTP). PMID:25154394

  3. Growth of the parvovirus minute virus of mice MVMp3 in EL4 lymphocytes is restricted after cell entry and before viral DNA amplification: cell-specific differences in virus uncoating in vitro.

    PubMed

    Previsani, N; Fontana, S; Hirt, B; Beard, P

    1997-10-01

    Two murine parvoviruses with genomic sequences differing only in 33 nucleotides (8 amino acids) in the region coding for the capsid proteins show different host cell specificities: MVMi grows in EL4 T lymphocytes and MVMp3 grows in A9 fibroblasts. In this study we compared the courses of infections with these two viruses in EL4 cells in order to investigate at which step(s) the infection process of MVMp3 is interrupted. The two viruses bound equally well to EL4 cells, and similar amounts of MVMi and MVMp3 input virion DNA appeared in the nuclear fractions of EL4 cells 1 h after infection. However, double-stranded replicative-form (RF) DNA of the two viruses appeared at different times, at 10 h postinfection with MVMi and at 24 h postinfection with MVMp3. The amount of MVMp3 RF DNA detected at 24 h was very small because it was produced only in a tiny subset of the population of EL4 cells that proved to be permissive for MVMp3. Replication of double-stranded viral DNA in EL4 cells was measured after transfection of purified RF DNA, cloned viral DNA, and cloned viral DNA with a mutation preventing synthesis of the capsid proteins. In each of these cases, DNA replication was comparable for MVMi and MVMp3. Production of virus particles also appeared to be similar after transfection of the two types of RF DNA into EL4 cells. Conversion of incoming 32P-labeled single-stranded MVM DNA to 32P-labeled double-stranded RF DNA was detected only after RF DNA amplification, indicating that few molecules serve as templates for viral DNA amplification. We showed that extracts of EL4 cells contain a factor which can destabilize MVMi virions but not MVMp3 by testing the sensitivity of viral DNA to DNase and by CsCl gradient analyses of viral particles. We therefore conclude that the MVMp3 life cycle is arrested after the transport of virions to the nucleus and prior to the replication of RF DNA, most likely at the stage of viral decapsidation.

  4. Interleukin 1 increases thymidine labeling index of normal tissues of mic but not the tumor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zaghloul, M.S.; Dorie, M.J.; Kallman, R.F.

    1994-07-01

    This study was conducted to investigate the action of human recombinant interleukin 1 as a radioprotector for different mouse normal cells other than bone marrow cells. Semi-continuous injections of tritiated thymidine were administered every 6 h, over 24 h to determine thymidine labeling index. Mice were injected with recombinant human interleukin 1 24 h prior to tritiated thymidine and were compared to control animals that did not receive interleukin 1. Mice were killed 1 h after the last thymidine injection. The 24 h thymidine labeling index for normal tissues and RIF-1 tumor was determined. Labeling indices were also determined 1-14more » days after a series of fractionated irradiations with or without pretreatment with a single dose of interleukin 1 administered 24 h prior to the first radiation. The thymidine labeling index of normal tissues was higher following the injection of recombinant human interleukin 1 24 h before radiolabeling. This was found in all normal tissues tested. The thymidine labeling index of RIF-1 fibrosarcoma was not affected by interleukin 1 injection. A single interleukin 1 injection 24 h before the first radiation fraction also increased the thymidine labeling indices of normal tissues after localized fractionated irradiation. The thymidine labeling index of RIF-1 tumor was not increased by interleukin 1 administration except after relatively high radiation doses (20 Gy in five fractions). The ability of interleukin 1 to enhance the thymidine labeling index declined after the first day following the completion of fractionated irradiation. Recombinant human interleukin 1 increased the 24 h thymidine labeling index in normal tissues in mice, but not in RIF-1 tumor. Fractionated irradiation could maintain the effect of a single dose of interleukin 1, administered 24 h prior to the first fraction, up to 24 h after the end of radiation. 25 refs., 3 figs., 1 tab.« less

  5. Food labeling

    MedlinePlus

    ... Spices Stores may voluntarily list nutrients for many raw foods. They may also display the nutrition information for the 20 most commonly eaten raw fruits, vegetables, and seafood. Nutrition labeling for single- ...

  6. Pion single and double charge exchange in the resonance region: Dynamical corrections

    NASA Astrophysics Data System (ADS)

    Johnson, Mikkel B.; Siciliano, E. R.

    1983-04-01

    We consider pion-nucleus elastic scattering and single- and double-charge-exchange scattering to isobaric analog states near the (3,3) resonance within an isospin invariant framework. We extend previous theories by introducing terms into the optical potential U that are quadratic in density and consistent with isospin invariance of the strong interaction. We study the sensitivity of single and double charge exchange angular distributions to parameters of the second-order potential both numerically, by integrating the Klein-Gordon equation, and analytically, by using semiclassical approximations that explicate the dependence of the exact numerical results to the parameters of U. The magnitude and shape of double charge exchange angular distributions are more sensitive to the isotensor term in U than has been hitherto appreciated. An examination of recent experimental data shows that puzzles in the shape of the 18O(π+, π-)18Ne angular distribution at 164 MeV and in the A dependence of the forward double charge exchange scattering on 18O, 26Mg, 42Ca, and 48Ca at the same energy may be resolved by adding an isotensor term in U. NUCLEAR REACTIONS Scattering theory for elastic, single-, and double-charge-exchange scattering to IAS in the region of the P33 resonance. Second-order effects on charge-exchange calculations of σ(A, θ).

  7. Clinical Efficacy and Safety of Ranibizumab Versus Dexamethasone for Central Retinal Vein Occlusion (COMRADE C): A European Label Study.

    PubMed

    Hoerauf, Hans; Feltgen, Nicolas; Weiss, Claudia; Paulus, Eva-Maria; Schmitz-Valckenberg, Steffen; Pielen, Amelie; Puri, Pankaj; Berk, Hüsnü; Eter, Nicole; Wiedemann, Peter; Lang, Gabriele E; Rehak, Matus; Wolf, Armin; Bertelmann, Thomas; Hattenbach, Lars-Olof

    2016-09-01

    To compare the efficacy and safety of the European labels of ranibizumab 0.5 mg vs dexamethasone 0.7 mg in patients with macular edema secondary to central retinal vein occlusion (CRVO). Phase IIIb, multicenter, double-masked, randomized clinical trial. Patients were randomized (1:1) to receive either monthly ranibizumab followed by pro re nata (PRN) treatment (n = 124) or 1 sustained-release dexamethasone implant followed by PRN sham injections (n = 119). Main outcomes were mean average change in best-corrected visual acuity (BCVA) from baseline to month 1 through month 6, mean change in BCVA, and adverse events (AEs). Of 243 patients, 185 (76.1%) completed the study. No difference was observed in BCVA between ranibizumab and dexamethasone at months 1 and 2. From month 3 to month 6, there was significant difference in BCVA gains in favor of ranibizumab. At month 6, mean average BCVA gain was significantly higher with ranibizumab than with dexamethasone (12.86 vs 2.96 letters; difference 9.91 letters, 95% confidence interval [6.51-13.30]; P < .0001). Mean injection number of ranibizumab was 4.52. Ocular AEs were reported in more patients in the dexamethasone than in the ranibizumab group (86.6% vs 55.6%). Using the European labels, similar efficacy was observed for ranibizumab and dexamethasone at months 1 and 2. However, ranibizumab maintained its efficacy throughout the study, whereas dexamethasone declined from month 3 onward. The main limitation of the study was that dexamethasone patients received only a single treatment during the 6-month study. In clinical practice, dexamethasone retreatment may be required earlier than 6 months. Safety findings were similar to those previously reported. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. A homogeneous and "off-on" fluorescence aptamer-based assay for chloramphenicol using vesicle quantum dot-gold colloid composite probes.

    PubMed

    Miao, Yang-Bao; Ren, Hong-Xia; Gan, Ning; Zhou, You; Cao, Yuting; Li, Tianhua; Chen, Yinji

    2016-07-27

    In this work, a novel homogeneous and signal "off-on" aptamer based fluorescence assay was successfully developed to detect chloramphenicol (CAP) residues in food based on the fluorescence resonance energy transfer (FRET). The vesicle nanotracer was prepared through labeling single stranded DNA binding protein (SSB) on limposome-CdSe/ZnS quantum dot (SSB/L-QD) complexes. It was worth mentioning that the signal tracer (SSB/L-QD) with vesicle shape, which was fabricated being encapsulated with a number of quantum dots and SSB. The nanotracer has excellent signal amplification effects. The vesicle composite probe was formed by combining aptamer labeled nano-gold (Au-Apt) and SSB/L-QD. Which based on SSB's specific affinity towards aptamer. This probe can't emit fluoresce which is in "off" state because the signal from SSB/L-QD as donor can be quenched by the Au-aptas acceptor. When CAP was added in the composite probe solution, the aptamer on the Au-Apt can be preferentially bounded with CAP then release from the composite probe, which can turn the "off" signal of SSB/L-QD tracer into "on" state. The assay indicates excellent linear response to CAP from 0.001 nM to 10 nM and detection limit down to 0.3 pM. The vesicle probes with size of 88 nm have strong signal amplification. Because a larger number of QDs can be labeled inside the double phosphorus lipid membrane. Besides, it was employed to detect CAP residues in the milk samples with results being agreed well with those from ELISA, verifying its accuracy and reliability. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. [Experimental study of glioma stem cell-mediated immune tolerance in tumor microenvironment].

    PubMed

    Xie, T; Ma, J W; Liu, B; Dong, J; Huang, Q

    2017-11-23

    Objective: To investigate the tumor microenvironment of immune tolerance induced by glioma stem cells (GSC). Methods: Human GSC SU3 cells transfected with red fluorescent protein (SU3-RFP) gene were implanted into the brain, subcutis (armpit and foot), liver and abdominal cavity of transgenic green fluorescence protein (GFP) nude mice to establish RFP(+) /GFP(+) dual fluorescence solid tumor model. The re-cultured cells derived from implanted tumor tissues, SU3-RFP cells co-cultured with peritoneal fluid of transgenic GFP nude mice and malignant ascites of tumor-bearing mice were observed by fluorescence microscopy and real-time video image tracing to analyze the microenvironment of immune tolerance mediated by RFP(+) /GFP(+) implanted tumor. Results: Dual fluorescence labeled frozen section showed that all of cells in the tumor microenvironment were GFP(+) , while the pressed tissue-patch showed that the tumor blood vessels exhibited a RFP(+) /GFP(+) double-positioning yellow. In the GFP single fluorescence labeled tumor tissue, all of cells in the microenvironment were green, including tumor edge, necrotic foci and blood vessel. Among them, CD68(+) , F4/80(+) , CD11c(+) , CD11b(+) and CD80(+) cells were observed. In the dual fluorescence labeled co-cultured cells, the phagocytosis and fusion between green host cells and red tumor cells were also observed, and these fusion cells might transfer to the malignant dendritic cells and macrophages. Conclusions: The tumor microenvironment of immune tolerance induced by GSC is not affected by the tissue types of tumor-inoculated sites, and the immune tolerance mediated by inflammatory cells is associated with the inducible malignant transformation, which may be driven by cell fusion.

  10. Dissimilar Kinetic Behavior of Electrically Manipulated Single- and Double-Stranded DNA Tethered to a Gold Surface

    PubMed Central

    Rant, Ulrich; Arinaga, Kenji; Tornow, Marc; Kim, Yong Woon; Netz, Roland R.; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard

    2006-01-01

    We report on the electrical manipulation of single- and double-stranded oligodeoxynucleotides that are end tethered to gold surfaces in electrolyte solution. The response to alternating repulsive and attractive electric surface fields is studied by time-resolved fluorescence measurements, revealing markedly distinct dynamics for the flexible single-stranded and stiff double-stranded DNA, respectively. Hydrodynamic simulations rationalize this finding and disclose two different kinetic mechanisms: stiff polymers undergo rotation around the anchoring pivot point; flexible polymers, on the other hand, are pulled onto the attracting surface segment by segment. PMID:16473909

  11. Dissimilar kinetic behavior of electrically manipulated single- and double-stranded DNA tethered to a gold surface.

    PubMed

    Rant, Ulrich; Arinaga, Kenji; Tornow, Marc; Kim, Yong Woon; Netz, Roland R; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard

    2006-05-15

    We report on the electrical manipulation of single- and double-stranded oligodeoxynucleotides that are end tethered to gold surfaces in electrolyte solution. The response to alternating repulsive and attractive electric surface fields is studied by time-resolved fluorescence measurements, revealing markedly distinct dynamics for the flexible single-stranded and stiff double-stranded DNA, respectively. Hydrodynamic simulations rationalize this finding and disclose two different kinetic mechanisms: stiff polymers undergo rotation around the anchoring pivot point; flexible polymers, on the other hand, are pulled onto the attracting surface segment by segment.

  12. SU-E-J-53: Dosimetric Evaluation at Volumetric Modulated Arc Therapy for Treatment of Prostate Cancer Using Single Or Double Arcs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Silva, D; Salmon, H; Pavan, G

    2014-06-01

    Purpose: Evaluate and compare retrospective prostate treatment plan using Volumetric Modulated Arc Therapy (RapidArc™ - Varian) technique with single or double arcs at COI Group. Methods: Ten patients with present prostate and seminal vesicle neoplasia were replanned as a target treatment volume and a prescribed dose of 78 Gy. A baseline planning, using single arc, was developed for each case reaching for the best result on PTV, in order to minimize the dose on organs at risk (OAR). Maintaining the same optimization objectives used on baseline plan, two copies for optimizing single and double arcs, have been developed. The plansmore » were performed with 10 MV photon beam energy on Eclipse software, version 11.0, making use of Trilogy linear accelerator with Millenium HD120 multileaf collimator. Comparisons on PTV have been performed, such as: maximum, minimum and mean dose, gradient dose, as well as the quantity of monitor units, treatment time and homogeneity and conformity index. OARs constrains dose have been evaluated, comparing both optimizations. Results: Regarding PTV coverage, the difference of the minimum, maximum and mean dose were 1.28%, 0.7% and 0.2% respectively higher for single arc. When analyzed the index of homogeneity found a difference of 0.99% higher when compared with double arcs. However homogeneity index was 0.97% lower on average by using single arc. The doses on the OARs, in both cases, were in compliance to the recommended limits RTOG 0415. With the use of single arc, the quantity of monitor units was 10,1% lower, as well as the Beam-On time, 41,78%, when comparing double arcs, respectively. Conclusion: Concerning the optimization of patients with present prostate and seminal vesicle neoplasia, the use of single arc reaches similar objectives, when compared to double arcs, in order to decrease the treatment time and the quantity of monitor units.« less

  13. Efficacy and Safety of Paliperidone Palmitate 3-Month Formulation for Patients with Schizophrenia: A Randomized, Multicenter, Double-Blind, Noninferiority Study

    PubMed Central

    Xu, Haiyan; Gopal, Srihari; Nuamah, Isaac; Ravenstijn, Paulien; Janik, Adam; Schotte, Alain; Hough, David; Fleischhacker, Wolfgang W.

    2016-01-01

    Background: This double-blind, parallel-group, multicenter, phase-3 study was designed to test the noninferiority of paliperidone palmitate 3-month formulation (PP3M) to the currently marketed 1-month formulation (PP1M) in patients (age 18–70 years) with schizophrenia, previously stabilized on PP1M. Methods: After screening (≤3 weeks) and a 17-week, flexible-dosed, open-label phase (PP1M: day 1 [150mg eq. deltoid], day 8 [100mg eq. deltoid.], weeks 5, 9, and 13 [50, 75, 100, or 150mg eq., deltoid/gluteal]), clinically stable patients were randomized (1:1) to PP3M (fixed-dose, 175, 263, 350, or 525mg eq. deltoid/gluteal) or PP1M (fixed-dose, 50, 75, 100, or 150mg eq. deltoid/gluteal) for a 48-week double-blind phase. Results: Overall, 1016/1429 open-label patients entered the double-blind phase (PP3M: n=504; PP1M: n=512) and 842 completed it (including patients with relapse). PP3M was noninferior to PP1M: relapse rates were similar in both groups (PP3M: n=37, 8%; PP1M: n=45, 9%; difference in relapse-free rate: 1.2% [95% CI:-2.7%; 5.1%]) based on Kaplan-Meier estimates (primary efficacy). Secondary endpoint results (changes from double-blind baseline in positive and negative symptom score total and subscale scores, Clinical Global Impression-Severity, and Personal and Social Performance scores) were consistent with primary endpoint results. No clinically relevant differences were observed in pharmacokinetic exposures between PP3M and PP1M. Both groups had similar tolerability profiles; increased weight was the most common treatment-emergent adverse event (double-blind phase; 21% each). No new safety signals were detected. Conclusion: Taken together, PP3M with its 3-month dosing interval is a unique option for relapse prevention in schizophrenia. PMID:26902950

  14. How to measure separations and angles between intra-molecular fluorescent markers

    NASA Astrophysics Data System (ADS)

    Flyvbjerg, Henrik; Mortensen, Kim I.; Sung, Jongmin; Spudich, James A.

    We demonstrate a novel, yet simple tool for the study of structure and function of biomolecules by extending two-colour co-localization microscopy to fluorescent molecules with fixed orientations and in intra-molecular proximity. From each color-separated microscope image in a time-lapse movie and using only simple means, we simultaneously determine both the relative (x,y)-separation of the fluorophores and their individual orientations in space with accuracy and precision. The positions and orientations of two domains of the same molecule are thus time-resolved. Using short double-stranded DNA molecules internally labelled with two fixed fluorophores, we demonstrate the accuracy and precision of our method using the known structure of double-stranded DNA as a benchmark, resolve 10-base-pair differences in fluorophore separations, and determine the unique 3D orientation of each DNA molecule, thereby establishing short, double-labelled DNA molecules as probes of 3D orientation of anything to which one can attach them firmly. This work was supported by a Lundbeck fellowship to K.I.M; a Stanford Bio-X fellowship to J.S. and Grants from the NIH (GM33289) to J.A.S. and the Human Frontier Science Program (GP0054/2009-C) to J.A.S. and H.F.

  15. Short-range order in the Ca sub 1-x La sub x F sub 2+x solid solution: 1:0:3 or 1:0:4 clusters

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Laval, J.P.; Abaouz, A.; Frit, B.

    1989-08-01

    The defect structure of the Ca{sub 1-x}La{sub x}F{sub 2+x} solid solution (0 {le} x {le} 0.38) has been examined at room temperature by powder neutron diffraction. Two kinds of (xxx) interstitial anions, whose respective numbers increase linearly with increasing dopant cation concentration, have been found: one labeled F{sup 0} (x {approx} 0.41) is a true interstitial; the other labeled F{sup {prime}{double prime}} (x {approx} 0.31) can be considered a relaxed normal anion. Two 1:0:n defect clusters are compatible, within the experimental errors, with these results: the 1:0:3 (1V{sub F}, OF{prime}, 3F{sup {double prime}}, 2 La{sup 3+}) and the 1:0:4 (1V{submore » F}, OF{prime}, 4F{sup {double prime}}, 3La{sup 3+}) clusters. Charge balance considerations and comparisons with the homologous Ca{sub 1-x}M{sub x}{sup IV}F{sub 2+2x} solid solutions (M{sup IV} = Th, U) allow us to think that the less dense 1:0:3 cluster is present for the whole domain of both kinds of solid solutions.« less

  16. Ratios of double to single ionization of He and Ne by strong 400-nm laser pulses using the quantitative rescattering theory

    NASA Astrophysics Data System (ADS)

    Chen, Zhangjin; Li, Xiaojin; Zatsarinny, Oleg; Bartschat, Klaus; Lin, C. D.

    2018-01-01

    We present numerical simulations of the ratio between double and single ionization of He and Ne by intense laser pulses at wavelengths of 390 and 400 nm, respectively. The yields of doubly charged ions due to nonsequential double ionization (NSDI) are obtained by employing the quantitative rescattering (QRS) model. In this model, the NSDI ionization probability is expressed as a product of the returning electron wave packet (RWP) and the total scattering cross sections for laser-free electron impact excitation and electron impact ionization of the parent ion. According to the QRS theory, the same RWP is also responsible for the emission of high-energy above-threshold ionization photoelectrons. To obtain absolute double-ionization yields, the RWP is generated by solving the time-dependent Schrödinger equation (TDSE) within a one-electron model. The same TDSE results can also be taken to obtain single-ionization yields. By using the TDSE results to calibrate single ionization and the RWP obtained from the strong-field approximation, we further simplify the calculation such that the nonuniform laser intensity distribution in the focused laser beam can be accounted for. In addition, laser-free electron impact excitation and ionization cross sections are calculated using the state-of-the-art many-electron R -matrix theory. The simulation results for double-to-single-ionization ratios are found to compare well with experimental data and support the validity of the nonsequential double-ionization mechanism for the covered intensity region.

  17. "Double-Cable" Conjugated Polymers with Linear Backbone toward High Quantum Efficiencies in Single-Component Polymer Solar Cells.

    PubMed

    Feng, Guitao; Li, Junyu; Colberts, Fallon J M; Li, Mengmeng; Zhang, Jianqi; Yang, Fan; Jin, Yingzhi; Zhang, Fengling; Janssen, René A J; Li, Cheng; Li, Weiwei

    2017-12-27

    A series of "double-cable" conjugated polymers were developed for application in efficient single-component polymer solar cells, in which high quantum efficiencies could be achieved due to the optimized nanophase separation between donor and acceptor parts. The new double-cable polymers contain electron-donating poly(benzodithiophene) (BDT) as linear conjugated backbone for hole transport and pendant electron-deficient perylene bisimide (PBI) units for electron transport, connected via a dodecyl linker. Sulfur and fluorine substituents were introduced to tune the energy levels and crystallinity of the conjugated polymers. The double-cable polymers adopt a "face-on" orientation in which the conjugated BDT backbone and the pendant PBI units have a preferential π-π stacking direction perpendicular to the substrate, favorable for interchain charge transport normal to the plane. The linear conjugated backbone acts as a scaffold for the crystallization of the PBI groups, to provide a double-cable nanophase separation of donor and acceptor phases. The optimized nanophase separation enables efficient exciton dissociation as well as charge transport as evidenced from the high-up to 80%-internal quantum efficiency for photon-to-electron conversion. In single-component organic solar cells, the double-cable polymers provide power conversion efficiency up to 4.18%. This is one of the highest performances in single-component organic solar cells. The nanophase-separated design can likely be used to achieve high-performance single-component organic solar cells.

  18. Single and double acquisition strategies for compensation of artifacts from eddy current and transient oscillation in balanced steady-state free precession.

    PubMed

    Lee, Hyun-Soo; Choi, Seung Hong; Park, Sung-Hong

    2017-07-01

    To develop single and double acquisition methods to compensate for artifacts from eddy currents and transient oscillations in balanced steady-state free precession (bSSFP) with centric phase-encoding (PE) order for magnetization-prepared bSSFP imaging. A single and four different double acquisition methods were developed and evaluated with Bloch equation simulations, phantom/in vivo experiments, and quantitative analyses. For the single acquisition method, multiple PE groups, each of which was composed of N linearly changing PE lines, were ordered in a pseudocentric manner for optimal contrast and minimal signal fluctuations. Double acquisition methods used complex averaging of two images that had opposite artifact patterns from different acquisition orders or from different numbers of dummy scans. Simulation results showed high sensitivity of eddy-current and transient-oscillation artifacts to off-resonance frequency and PE schemes. The artifacts were reduced with the PE-grouping with N values from 3 to 8, similar to or better than the conventional pairing scheme of N = 2. The proposed double acquisition methods removed the remaining artifacts significantly. The proposed methods conserved detailed structures in magnetization transfer imaging well, compared with the conventional methods. The proposed single and double acquisition methods can be useful for artifact-free magnetization-prepared bSSFP imaging with desired contrast and minimized dummy scans. Magn Reson Med 78:254-263, 2017. © 2016 International Society for Magnetic Resonance in Medicine. © 2016 International Society for Magnetic Resonance in Medicine.

  19. Don't Double Up on Acetaminophen

    MedlinePlus

    ... re at the store deciding which product to buy, check the 'Drug Facts' label of OTC cold, cough and flu ... If you’re still not sure which to buy, ask the pharmacist for advice. FDA has an ... medicines containing acetaminophen accounted for nearly half of all ...

  20. BLISS is a versatile and quantitative method for genome-wide profiling of DNA double-strand breaks.

    PubMed

    Yan, Winston X; Mirzazadeh, Reza; Garnerone, Silvano; Scott, David; Schneider, Martin W; Kallas, Tomasz; Custodio, Joaquin; Wernersson, Erik; Li, Yinqing; Gao, Linyi; Federova, Yana; Zetsche, Bernd; Zhang, Feng; Bienko, Magda; Crosetto, Nicola

    2017-05-12

    Precisely measuring the location and frequency of DNA double-strand breaks (DSBs) along the genome is instrumental to understanding genomic fragility, but current methods are limited in versatility, sensitivity or practicality. Here we present Breaks Labeling In Situ and Sequencing (BLISS), featuring the following: (1) direct labelling of DSBs in fixed cells or tissue sections on a solid surface; (2) low-input requirement by linear amplification of tagged DSBs by in vitro transcription; (3) quantification of DSBs through unique molecular identifiers; and (4) easy scalability and multiplexing. We apply BLISS to profile endogenous and exogenous DSBs in low-input samples of cancer cells, embryonic stem cells and liver tissue. We demonstrate the sensitivity of BLISS by assessing the genome-wide off-target activity of two CRISPR-associated RNA-guided endonucleases, Cas9 and Cpf1, observing that Cpf1 has higher specificity than Cas9. Our results establish BLISS as a versatile, sensitive and efficient method for genome-wide DSB mapping in many applications.

Top