DOE Office of Scientific and Technical Information (OSTI.GOV)
Noh, Heeso; Liew, Seng Fatt; Saranathan, Vinodkumar
2010-07-28
We measured the polarization- and angle-resolved optical scattering and reflection spectra of the quasiordered nanostructures in the bird feather barbs. In addition to the primary peak that originates from single scattering, we observed a secondary peak which exhibits depolarization and distinct angular dispersion. We explained the secondary peak in terms of double scattering, i.e., light is scattered successively twice by the structure. The two sequential single-scattering events are considered uncorrelated. Using the Fourier power spectra of the nanostructures obtained from the small-angle x-ray scattering experiment, we calculated the double scattering of light in various directions. The double-scattering spectrum is broadermore » than the single-scattering spectrum, and it splits into two subpeaks at larger scattering angle. The good agreement between the simulation results and the experimental data confirms that double scattering of light makes a significant contribution to the structural color.« less
Optically controlled resonant tunneling in a double-barrier diode
NASA Astrophysics Data System (ADS)
Kan, S. C.; Wu, S.; Sanders, S.; Griffel, G.; Yariv, A.
1991-03-01
The resonant tunneling effect is optically enhanced in a GaAs/GaAlAs double-barrier structure that has partial lateral current confinement. The peak current increases and the valley current decreases simultaneously when the device surface is illuminated, due to the increased conductivity of the top layer of the structure. The effect of the lateral current confinement on the current-voltage characteristic of a double-barrier resonant tunneling structure was also studied. With increased lateral current confinement, the peak and valley current decrease at a different rate such that the current peak-to-valley ratio increases up to three times. The experimental results are explained by solving the electrostatic potential distribution in the structure using a simple three-layer model.
Double scattering of light from Biophotonic Nanostructures with short-range order
DOE Office of Scientific and Technical Information (OSTI.GOV)
Noh, Heeso; Liew, Seng Fatt; Saranathan, Vinodkumar
2010-07-28
We investigate the physical mechanism for color production by isotropic nanostructures with short-range order in bird feather barbs. While the primary peak in optical scattering spectra results from constructive interference of singly-scattered light, many species exhibit secondary peaks with distinct characteristic. Our experimental and numerical studies show that these secondary peaks result from double scattering of light by the correlated structures. Without an analog in periodic or random structures, such a phenomenon is unique for short-range ordered structures, and has been widely used by nature for non-iridescent structural coloration.
NASA Astrophysics Data System (ADS)
Liu, Xin; Lazio, T. Joseph W.; Shen, Yue; Strauss, Michael A.
2018-02-01
This paper presents Very Long Baseline Array (VLBA) observations of 13 double-peaked [O III] emission-line type-2 active galactic nuclei (AGNs) at redshifts 0.06 < z < 0.41 (with a median redshift of z ∼ 0.15) identified in the Sloan Digital Sky Survey. Such double-peaked emission-line objects may result from jets or outflows from the central engine or from a dual AGN. The VLBA provides an angular resolution of ≲10 pc at the distance of many of these galaxies, sufficient to resolve the radio emission from extremely close dual AGNs and to contribute to understanding the origin of double-peaked [O III] emission lines. Of the 13 galaxies observed at 3.6 cm (8.4 GHz), we detect six at a 1σ sensitivity level of ∼0.15 mJy beam‑1, two of which show clear jet structures on scales ranging from a few milliarcseconds to tens of milliarcseconds (corresponding to a few pc to tens of pc at a median redshift of 0.15). We suggest that radio-loud, double-peaked emission-line type-2 AGNs may be indicative of jet produced structures, but a larger sample of double-peaked [O III] AGNs with high angular resolution radio observations will be required to confirm this suggestion. Based, in part, on observations made with the Very Long Baseline Array, obtained at the Long Baseline Observatory. The Long Baseline Observatory is a facility of the National Science Foundation operated under cooperative agreement by Associated Universities, Inc.
Thermal properties of spin-S Kitaev-Heisenberg model on a honeycomb lattice
NASA Astrophysics Data System (ADS)
Suzuki, Takafumi; Yamaji, Youhei
2018-05-01
Temperature (T) dependence of heat capacity C (T) in the S = 1 / 2 Kitaev honeycomb model shows a double-peak structure resulting from fractionalization of spins into two kinds of Majorana fermions. Recently it has been discussed that the double-peak structure in C (T) is also observed in magnetic ordered phases of the S = 1 / 2 Kitaev-Heisenberg (KH) model on a honeycomb lattice when the system is located in the vicinity of the Kitaev's spin liquid phase. In addition to the S = 1 / 2 spin case, similar double-peak structure has been confirmed in the KH honeycomb model for classical Heisenberg spins, where spin S is regarded as S → ∞ . We investigate spin-S dependence of C (T) for the KH honeycomb models by using thermal pure quantum state. We also perform classical Monte Carlo calculations to obtain C (T) for the classical KH model. From obtained results, we find that the origin of the high-temperature peak is different between the quantum spin case with small Ss and the classical Heisenberg spin case. Furthermore, the high-temperature peak in the quantum spin case, which is one of the clues for fractionalization of spins, disappears for S > 1 .
NASA Astrophysics Data System (ADS)
Yunfeng, Lin; Xiaoqi, Hu; Lin, Hu
2018-04-01
A composite structure design metamaterial absorber is designed and simulated. The proposed composite structure consists of a double-hole sub-structure and a double-metallic particle sub-structure. The damping constant of bulk gold layer is optimized to eliminate the adverse effects of the grain boundary and the surface scattering of thin films on the absorption property. Two absorption peaks (A1 = 58%, A2 = 23%) are achieved based on the localized surface plasmon (LSP) modes resonance. Moreover, the plasmonic hybridization phenomenon between LSP modes is found, which leads to the absorption enhancement between two absorption peaks. The proposed metamaterial absorber holds the property of wide-angle incidence.
Mesoscale influence on long-range transport — evidence from ETEX modelling and observations
NASA Astrophysics Data System (ADS)
Sørensen, Jens Havskov; Rasmussen, Alix; Ellermann, Thomas; Lyck, Erik
During the first European Tracer Experiment (ETEX) tracer gas was released from a site in Brittany, France, and subsequently observed over a range of 2000 km. Hourly measurements were taken at the National Environmental Research Institute (NERI) located at Risø, Denmark, using two measurement techniques. At this location, the observed concentration time series shows a double-peak structure occurring between two and three days after the release. By using the Danish Emergency Response Model of the Atmosphere (DERMA), which is developed at the Danish Meteorological Institute (DMI), simulations of the dispersion of the tracer gas have been performed. Using numerical weather-prediction data from the European Centre for Medium-Range Weather Forecast (ECMWF) by DERMA, the arrival time of the tracer is quite well predicted, so also is the duration of the passage of the plume, but the double-peak structure is not reproduced. However, using higher-resolution data from the DMI version of the HIgh Resolution Limited Area Model (DMI-HIRLAM), DERMA reproduces the observed structure very well. The double-peak structure is caused by the influence of a mesoscale anti-cyclonic eddy on the tracer gas plume about one day earlier.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kumara, L. S. R., E-mail: KUMARA.Rosantha@nims.go.jp; Yang, Anli; Sakata, Osami, E-mail: SAKATA.Osami@nims.go.jp
2014-07-28
The core-level and valence-band electronic structures of Li{sub x}Ni{sub 1−x}O epitaxial thin films with x = 0, 0.27, and 0.48 were studied by hard X-ray photoelectron spectroscopy. A double peak structure, consisting of a main peak and a shoulder peak, and a satellite structure were observed in the Ni 2p{sub 3/2} core-level spectra. The intensity ratio of the shoulder to main peak in this double peak structure increased with increasing lithium content in Li{sub x}Ni{sub 1−x}O. This lithium doping dependence of the Ni 2p{sub 3/2} core-level spectra was investigated using an extended cluster model, which included the Zhang–Rice (ZR) doubletmore » bound states arising from a competition between O 2p – Ni 3d hybridization and the Ni on-site Coulomb interaction. The results indicated that the change in the intensity ratio in the main peak is because of a reduction in the ZR doublet bound states from lithium substitutions. This strongly suggests that holes compensating Li doping in Li{sub x}Ni{sub 1−x}O are of primarily ZR character.« less
Memory Effect Manifested by a Boson Peak in Metallic Glass.
Luo, P; Li, Y Z; Bai, H Y; Wen, P; Wang, W H
2016-04-29
We explore the correlation between a boson peak and structural relaxation in a typical metallic glass. Consistent with enthalpy recovery, a boson peak shows a memory effect in an aging-and-scan procedure. Single-step isothermal aging produces a monotonic decrease of enthalpy and boson peak intensity; for double-step isothermal aging, both enthalpy and boson peak intensity experience, coincidently, an incipient increase to a maximum and a subsequent decrease toward the equilibrium state. Our results indicate a direct link between slow structural relaxation and fast boson peak dynamics, which presents a profound understanding of the two dynamic behaviors in glass.
Silicon-based hot electron emitting substrate with double tunneling
NASA Astrophysics Data System (ADS)
Chen, Fei; Zhan, Xinghua; Salcic, Zoran; Wong, Chee Cheong; Gao, Wei
2017-07-01
We propose a novel silicon structure, Hot Electron Emitting Substrate (HEES), which exhibits important effect of repeated tunneling at two different voltage ranges, which we refer to as double tunneling. In ambient atmosphere and room temperature, the I-V characteristic of HEES shows two current peaks during voltage sweep from 2 to 15 V. These two peaks are formed by the Fowler-Nordheim (FN) tunneling effect and tunneling diode mechanism, respectively.
Soft X-Ray Absorption Spectroscopy of High-Abrasion-Furnace Carbon Black
DOE Office of Scientific and Technical Information (OSTI.GOV)
Muramatsu, Yasuji; Harada, Ryusuke; Gullikson, Eric M.
2007-02-02
The soft x-ray absorption spectra of high-abrasion-furnace carbon black were measured to obtain local-structure/chemical-states information of the primary particles and/or crystallites. The soft x-ray absorption spectral features of carbon black represent broader {pi}* and {sigma}* peak structures compared to highly oriented pyrolytic graphite (HOPG). The subtracted spectra between the carbon black and HOPG, (carbon black) - (HOPG), show double-peak structures on both sides of the {pi}* peak. The lower-energy peak, denoted as the 'pre-peak', in the subtracted spectra and the {pi}*/{sigma}* peak intensity ratio in the absorption spectra clearly depend on the specific surface area by nitrogen adsorption (NSA). Therefore,more » it is concluded that the pre-peak intensity and the {pi}*/{sigma}* ratio reflect the local graphitic structure of carbon black.« less
NASA Astrophysics Data System (ADS)
Park, Seoung-Hwan; Ahn, Doyeol
2018-05-01
Ultraviolet light emission characteristics of lattice-matched BxAlyGa1-x-y N/AlN quantum well (QW) structures with double AlGaN delta layers were investigated theoretically. In contrast to conventional single dip-shaped QW structure where the reduction effect of the spatial separation between electron and hole wave functions is negligible, proposed double dip-shaped QW shows significant enhancement of the ultraviolet light emission intensity from a BAlGaN/AlN QW structure due to the reduced spatial separation between electron and hole wave functions. The emission peak of the double dip-shaped QW structure is expected to be about three times larger than that of the conventional rectangular AlGaN/AlN QW structure.
Periodic and rational solutions of the reduced Maxwell-Bloch equations
NASA Astrophysics Data System (ADS)
Wei, Jiao; Wang, Xin; Geng, Xianguo
2018-06-01
We investigate the reduced Maxwell-Bloch (RMB) equations which describe the propagation of short optical pulses in dielectric materials with resonant non-degenerate transitions. The general Nth-order periodic solutions are provided by means of the Darboux transformation. The Nth-order degenerate periodic and Nth-order rational solutions containing several free parameters with compact determinant representations are derived from two different limiting cases of the obtained general periodic solutions, respectively. Explicit expressions of these solutions from first to second order are presented. Typical nonlinear wave patterns for the four components of the RMB equations such as single-peak, double-peak-double-dip, double-peak and single-dip structures in the second-order rational solutions are shown. This kind of the rational solutions correspond to rogue waves in the reduced Maxwell-Bloch equations.
NASA Astrophysics Data System (ADS)
Madin, M. Sya'aer; Ahmad Hambali, N. A. M.; Shahimin, M. M.; Wahid, M. H. A.; Roshidah, N.; Azaidin, M. A. M.
2017-02-01
In this paper, double frequency spacing of multi-wavelength Brillouin Raman fiber laser utilizing eight-shaped structure in conjunction with Raman amplifier is simulated and demonstrated using Optisys software. Double frequency multiwavelength Brillouin Raman fiber laser is one of the solution for single frequency spacing channel de-multiplexing from narrow single spacing in the communication systems. The eight-shaped structure has the ability to produce lower noise and double frequency spacing. The 7 km of single mode fiber acting as a nonlinear medium for the generation of Stimulated Brillouin Scattering and Stimulated Raman Scattering. As a results, the optimum results are recorded at 1450 nm of RP power at 22 dBm and 1550 nm of BP power at 20 dBm. These parameters provide a high output peak power, gain and average OSNR. The highest peak power of Stokes 1 is recorded at 90% of coupling ratio which is 29.88 dBm. It is found that the maximum gain and average OSNR of about 1.23 dB and 63.74 dB.
Growth and characterization of high current density, high-speed InAs/AlSb resonant tunneling diodes
NASA Technical Reports Server (NTRS)
Soderstrom, J. R.; Brown, E. R.; Parker, C. D.; Mahoney, L. J.; Yao, J. Y.
1991-01-01
InAs/AlSb double-barrier resonant tunneling diodes with peak current densities up to 370,000 A/sq cm and high peak-to-valley current ratios of 3.2 at room temperature have been fabricated. The peak current density is well-explained by a stationary-state transport model with the two-band envelope function approximation. The valley current density predicted by this model is less than the experimental value by a factor that is typical of the discrepancy found in other double-barrier structures. It is concluded that threading dislocations are largely inactive in the resonant tunneling process.
Electron transport in electrically biased inverse parabolic double-barrier structure
NASA Astrophysics Data System (ADS)
M, Bati; S, Sakiroglu; I, Sokmen
2016-05-01
A theoretical study of resonant tunneling is carried out for an inverse parabolic double-barrier structure subjected to an external electric field. Tunneling transmission coefficient and density of states are analyzed by using the non-equilibrium Green’s function approach based on the finite difference method. It is found that the resonant peak of the transmission coefficient, being unity for a symmetrical case, reduces under the applied electric field and depends strongly on the variation of the structure parameters.
NASA Astrophysics Data System (ADS)
Pyak, P. E.; Usachenko, V. I.
2018-03-01
The phenomenon of pronounced peak structure(s) of longitudinal momentum distributions as well as a spike-like structure of low-energy spectra of photoelectrons emitted from laser-irradiated Ar and Ne atoms in a single ionization process is theoretically studied in the tunneling and multiphoton regimes of ionization. The problem is addressed assuming only the direct above-threshold ionization (ATI) as a physical mechanism underlying the phenomenon under consideration (viz. solely contributing to observed photoelectron momentum distributions (PMD)) and using the Coulomb-Volkov (CV) ansatz within the frame of conventional strong-field approximation (SFA) applied in the length-gauge formulation. The developed CV-SFA approach also incorporates the density functional theory essentially exploited for numerical composition of initial (laser-free) atomic state(s) constructed from atomic orbitals of Gaussian type. Our presented CV-SFA based (and laser focal-volume averaged) calculation results proved to be well reproducing both the pronounced double-peak and/or ATI-like multi-peak structure(s) experimentally observed in longitudinal PMD under conditions of tunneling and/or multiphoton regime, respectively. In addition, our CV-SFA results presented for tunneling regime also suggest and remarkably reproduce a pronounced structure observed in relevant experiments as a ‘spike-like’ enhanced maximum arising in low-energy region (around the value of about 1 eV) of photoelectron spectra. The latter consistency allows to identify and interpret these results as the so-called low-energy structure (LES) since the phenomenon proved to appear as the most prominent if the influence of Coulomb potential on photoelectron continuum states is maximally taken into account under calculations (viz. if the parameter Z in CV’s functions is put equal to 1). Moreover, the calculated LES proved to correspond (viz., established as closely related) to the mentioned double-peak structure arising in the low-momentum region ({p}| | ≤slant | 0.2| a.u.) of longitudinal PMDs calculated under condition of the tunneling regime. Thus, the phenomena under consideration can be well understood and adequately interpreted beyond the terms and/or concepts of various different alternative strong-field approaches and models (such as e.g., extensively invoked and exploited nowadays though, more sophisticated SFA-based ‘rescattering’ mechanism) compared to which, the currently applied CV-SFA model (through the same underlying physical mechanism of solely direct ATI suggested) is additionally able to provide and reveal an intimate and transparent interrelation between the phenomena of LES and double-peak structure arising in PMDs observed in the tunneling regime.
SUBSTRUCTURE WITHIN THE SSA22 PROTOCLUSTER AT z ≈ 3.09
DOE Office of Scientific and Technical Information (OSTI.GOV)
Topping, Michael W.; Shapley, Alice E.; Steidel, Charles C., E-mail: mtopping@astro.ucla.edu
We present the results of a densely sampled spectroscopic survey of the SSA22 protocluster at z ≈ 3.09. Our sample with Keck/LRIS spectroscopy includes 106 Ly α emitters (LAEs) and 40 Lyman break galaxies (LBGs) at z = 3.05–3.12. These galaxies are contained within the 9′ × 9′ region in which the protocluster was discovered, which also hosts the maximum galaxy overdensity in the SSA22 region. The redshift histogram of our spectroscopic sample reveals two distinct peaks, at z = 3.069 (blue; 43 galaxies) and z = 3.095 (red; 103 galaxies). Furthermore, objects in the blue and red peaks aremore » segregated on the sky, with galaxies in the blue peak concentrating toward the western half of the field. These results suggest that the blue and red redshift peaks represent two distinct structures in physical space. Although the double-peaked redshift histogram is traced in the same manner by LBGs and LAEs, and brighter and fainter galaxies, we find that 9 out of 10 X-ray AGNs in SSA22, and all 7 spectroscopically confirmed giant Ly α “blobs,” reside in the red peak. We combine our data set with sparsely sampled spectroscopy from the literature over a significantly wider area, finding preliminary evidence that the double-peaked structure in redshift space extends beyond the region of our dense spectroscopic sampling. In order to fully characterize the three-dimensional structure, dynamics, and evolution of large-scale structure in the SSA22 overdensity, we require the measurement of large samples of LAE and LBG redshifts over a significantly wider area, as well as detailed comparisons with cosmological simulations of massive cluster formation.« less
Hong, You-Lee; Asakura, Tetsuo; Nishiyama, Yusuke
2018-05-08
β-sheet structure of oligo- and poly-peptides can be formed in anti-parallel (AP)- and parallel (P)-structure, which is the important feature to understand the structures. In principle, P- and AP-β-sheet structures can be identified by the presence (AP) and absence (P) of the interstrand 1HNH/1HNH correlations on a diagonal in 2D 1H double quantum (DQ)/1H single quantum (SQ) spectrum due to the different interstrand 1HNH/1HNH distances between these two arrangements. However, the 1HNH/1HNH peaks overlap to the 1HNH3+/1HNH3+ peaks, which always give cross peaks regardless of the β-sheet arrangement. The 1HNH3+/1HNH3+ peaks disturb the observation of the presence/absence of 1HNH/1HNH correlations and the assignment of 1HNH and 1HNH3+ is not always available. Here, 3D 14N/1H DQ/1H SQ correlation solid-state NMR experiments at fast magic angle spinning (70 kHz) are introduced to distinguish AP and P β-sheet structure. The 14N dimension allows the separate observation of 1HNH/1HNH peaks from 1HNH3+/1HNH3+ peaks with clear assignment of 1HNH and 1HNH3+. In addition, the high natural abundance of 1H and 14N enables 3D 14N/1H DQ/1H SQ experiments of oligo-alanines (Ala3-6) in four hours without any isotope labelling. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Refraction index sensor based on phase resonances in a subwavelength structure with double period.
Skigin, Diana C; Lester, Marcelo
2016-10-01
In this paper, we numerically demonstrate a refraction index sensor based on phase resonance excitation in a subwavelength-slit structure with a double period. The sensor consists of a metal layer with subwavelength slots arranged in a bi-periodic form, separated from a high refraction index medium. Between the metallic structure and the incident medium, a dielectric waveguide is formed whose refraction index is going to be determined. Variations in the refraction index of the waveguide are detected as shifts in the peaks of transmitted intensity originated by resonant modes supported by the compound metallic structure. At normal incidence, the spectral position of these resonant peaks exhibits a linear or a quadratic dependence with the refraction index, which permits us to obtain the unknown refraction index value with a high precision for a wide range of wavelengths. Since the operating principle of the sensor is due to the morphological resonances of the slits' structure, this device can be scaled to operate in different wavelength ranges while keeping similar characteristics.
Correlation between the line width and the line flux of the double-peaked broad Hα of 3C390.3
NASA Astrophysics Data System (ADS)
Zhang, Xue-Guang
2013-03-01
In this paper, we carefully check the correlation between the line width (second moment) and the line flux of the double-peaked broad Hα of the well-known mapped active galactic nucleus (AGN) 3C390.3 in order to show some further distinctions between double-peaked emitters and normal broad-line AGN. Based on the virialization assumption MBH ∝ RBLR × V2(BLR) and the empirical relation RBLR ∝ L˜0.5, one strong negative correlation between the line width and the line flux of the double-peaked broad lines should be expected for 3C390.3, such as the negative correlation confirmed for the mapped broad-line object NGC 5548, RBLR × V2(BLR) ∝ L˜0.5 × σ2 = constant. Moreover, based on the public spectra around 1995 from the AGN WATCH project for 3C390.3, one reliable positive correlation is found between the line width and the line flux of the double-peaked broad Hα. In the context of the proposed theoretical accretion disc model for double-peaked emitters, the unexpected positive correlation can be naturally explained, due to different time delays for the inner and outer parts of the disc-like broad-line region (BLR) of 3C390.3. Moreover, the virialization assumption is checked and found to be still available for 3C390.3. However, the time-varying size of the BLR of 3C390.3 cannot be expected by the empirical relation RBLR ∝ L˜0.5. In other words, the mean size of the BLR of 3C390.3 can be estimated by the continuum luminosity (line luminosity), while the continuum emission strengthening leads to the size of BLR decreasing (not increasing) in different moments for 3C390.3. Then, we compared our results of 3C390.3 with the previous results reported in the literature for the other double-peaked emitters, and found that before to clearly correct the effects from disc physical parameters varying (such as the effects of disc precession) for long-term observed line spectra, it is not so meaningful to discuss the correlation of the line parameters of double-peaked broad lines. Furthermore, due to the probable `external' ionizing source with so far unclear structures, it is hard to give one conclusion that the positive correlation between the line width and the line flux can be found for all double-peaked emitters, even after the considerations of disc physical parameters varying. However, once one positive correlation of broad-line parameters is found, the accretion disc origination of the broad line should be considered first.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Jia; Halpern, Jules P.; Eracleous, Michael
2016-01-20
One of the proposed explanations for the broad, double-peaked Balmer emission lines observed in the spectra of some active galactic nuclei (AGNs) is that they are associated with sub-parsec supermassive black hole (SMBH) binaries. Here, we test the binary broad-line region hypothesis through several decades of monitoring of the velocity structure of double-peaked Hα emission lines in 13 low-redshift, mostly radio-loud AGNs. This is a much larger set of objects compared to an earlier test by Eracleous et al. and we use much longer time series for the three objects studied in that paper. Although systematic changes in radial velocitymore » can be traced in many of their lines, they are demonstrably not like those of a spectroscopic binary in a circular orbit. Any spectroscopic binary period must therefore be much longer than the span of the monitoring (assuming a circular orbit), which in turn would require black hole masses that exceed by 1–2 orders of magnitude the values obtained for these objects using techniques such as reverberation mapping and stellar velocity dispersion. Moreover, the response of the double-peaked Balmer line profiles to fluctuations of the ionizing continuum and the shape of the Lyα profiles are incompatible with an SMBH binary. The binary broad-line region hypothesis is therefore disfavored. Other processes evidently shape these line profiles and cause the long-term velocity variations of the double peaks.« less
The 4-Day Wave as Observed from the Upper Atmosphere Research Satellite Microwave Limb Sounder
NASA Technical Reports Server (NTRS)
Allen, D. R.; Stanford, J. L.; Elson, L. S.; Fishbein, E. F.; Froidevaux, L.; Waters, J. W.
1997-01-01
The "4-day wave" is an eastward moving quasi-nondispersive feature with period near 4 days occurring near the winter polar stratopause. This paper presents evidence of the 4-day feature in Microwave Limb Sounder (MLS) temperature, geopotential height, and ozone data from the late southern winters of 1992 and 1993. Space-time spectral analyses reveal a double-peaked temperature structure consisting of one peak near the stratopause and another in the lower mesosphere, with an out-of-phase relationship between the two peaks. This double- peaked structure is reminiscent of recent three-dimensional barotropic/baroclinic instability model predictions and is observed here for the first time. The height variation of the 4-day ozone signal is shown to compare well with a linear advective-photochemical tracer model. Negative regions of quasigeostrophic potential vorticity (PV) gradient and positive Eliassen-Palm flux divergence are shown to occur, consistent with instability dynamics playing a role in wave forcing. Spectral analyses of PV derived from MLS geopotential height fields reveal a 4-day signal peaking near the polar stratopause. The three-dimensional structure of the 4-day wave resembles the potential vorticity "charge" concept, wherein a PV anomaly in the atmosphere (analogous to an electrical charge in a dielectric material) induces a geopotential field, a vertically oriented temperature dipole, and circulation about the vertical axis.
Observation of radiative surface plasmons in metal-oxide-metal tunnel junctions
NASA Technical Reports Server (NTRS)
Donohue, J. F.; Yang, E. Y.
1986-01-01
A peak in the UV region of the spectrum of light emitted from metal-oxide-metal (MOM) tunnel junctions has been observed at room temperature. Both the amplitude and wavelength of the peak are sensitive to applied junction bias. The UV peak corresponds to the normal or radiative surface plasmon mode while a visible peak, also present in the present spectra and reported in past MOM literature, is due to the tangential or nonradiative mode. The radiative mode requires no surface roughness or gratings for photon coupling. The results show that it is possible to obtain radiative surface plasmon production followed by a direct decay into photons with MOM tunnel diodes. A MOM diode with a double anode structure is found to emit light associated only with the nonradiative mode. The thickness dependence of the UV peak, along with the experimental results of the double anode MOM diode and the ratio of the UV peak to visible peak, support the contention that the UV light emission is indeed due to the radiative surface plasmon.
Heendeniya, Ravindra G; Yu, Peiqiang
2017-03-20
Alfalfa ( Medicago sativa L.) genotypes transformed with Lc-bHLH and Lc transcription genes were developed with the intention of stimulating proanthocyanidin synthesis in the aerial parts of the plant. To our knowledge, there are no studies on the effect of single-gene and two-gene transformation on chemical functional groups and molecular structure changes in these plants. The objective of this study was to use advanced molecular spectroscopy with multivariate chemometrics to determine chemical functional group intensity and molecular structure changes in alfalfa plants when co-expressing Lc-bHLH and C1-MYB transcriptive flavanoid regulatory genes in comparison with non-transgenic (NT) and AC Grazeland (ACGL) genotypes. The results showed that compared to NT genotype, the presence of double genes ( Lc and C1 ) increased ratios of both the area and peak height of protein structural Amide I/II and the height ratio of α-helix to β-sheet. In carbohydrate-related spectral analysis, the double gene-transformed alfalfa genotypes exhibited lower peak heights at 1370, 1240, 1153, and 1020 cm -1 compared to the NT genotype. Furthermore, the effect of double gene transformation on carbohydrate molecular structure was clearly revealed in the principal component analysis of the spectra. In conclusion, single or double transformation of Lc and C1 genes resulted in changing functional groups and molecular structure related to proteins and carbohydrates compared to the NT alfalfa genotype. The current study provided molecular structural information on the transgenic alfalfa plants and provided an insight into the impact of transgenes on protein and carbohydrate properties and their molecular structure's changes.
Simulation of double stage hall thruster with double-peaked magnetic field
NASA Astrophysics Data System (ADS)
Ding, Yongjie; Li, Peng; Sun, Hezhi; Wei, Liqiu; Xu, Yu; Peng, Wuji; Su, Hongbo; Li, Hong; Yu, Daren
2017-07-01
This study adopts double permanent magnetic rings and four permanent magnetic rings to form two symmetrical magnetic peaks and two asymmetrical magnetic peaks in the channel of a Hall thruster, and uses a 2D-3V PIC-MCC model to analyze the influence of magnetic strength on the discharge characteristic and performance of Hall thrusters with an intermediate electrode and double-peaked magnetic field. As opposed to the two symmetrical magnetic peaks formed by double permanent magnetic rings, increasing the magnetic peak value deep within the channel can cause propellant ionization to occur; with the increase in the magnetic peak deep in the channel, the propellant utilization, thrust, and anode efficiency of the thruster are significantly improved. Double-peaked magnetic field can realize separate control of ionization and acceleration in a Hall thruster, and provide technical means for further improving thruster performance. Contribution to the Topical Issue "Physics of Ion Beam Sources", edited by Holger Kersten and Horst Neumann.
Goto, Tomoyo; Itoh, Toshio; Akamatsu, Takafumi; Shin, Woosuck
2015-12-15
The CO sensing properties of a micro thermoelectric gas sensor (micro-TGS) with a double AuPtPd/SnO₂ and Pt/α-Al₂O₃ catalyst were investigated. While several nanometer sized Pt and Pd particles were uniformly dispersed on SnO₂, the Au particles were aggregated as particles measuring >10 nm in diameter. In situ diffuse reflectance Fourier transform Infrared spectroscopy (DRIFT) analysis of the catalyst showed a CO adsorption peak on Pt and Pd, but no clear peak corresponding to the interaction between CO and Au was detected. Up to 200 °C, CO combustion was more temperature dependent than that of H₂, while H₂ combustion was activated by repeated exposure to H₂ gas during the periodic gas test. Selective CO sensing of the micro-TGS against H₂ was attempted using a double catalyst structure with 0.3-30 wt% Pt/α-Al₂O₃ as a counterpart combustion catalyst. The sensor output of the micro-TGS decreased with increasing Pt content in the Pt/α-Al₂O₃ catalyst, by cancelling out the combustion heat from the AuPtPd/SnO₂ catalyst. In addition, the AuPtPd/SnO₂ and 0.3 wt% Pt/α-Al₂O₃ double catalyst sensor showed good and selective CO detection. We therefore demonstrated that our micro-TGS with double catalyst structure is useful for controlling the gas selectivity of CO against H₂.
WISE J233237.05-505643.5: A Double-Peaked Broad-Lined AGN with Spiral-Shaped Radio Morphology
NASA Technical Reports Server (NTRS)
Tsai, Chao Wei; Jarrett, Thomas H.; Stern, Daniel; Emonts, Bjorn; Barrows, R. Scott; Assef, Roberto J.; Norris, Ray P.; Eisenhardt, Peter R. M.; Lonsdale, Carol; Blain, Andrew W.;
2013-01-01
We present radio continuum mapping, optical imaging and spectroscopy of the newly discovered double-peaked broad-lined AGN WISE J233237.05-505643.5 at redshift z = 0.3447. This source exhibits an FR-I and FR-II hybrid-morphology, characterized by bright core, jet, and Doppler-boosted lobe structures in ATCA continuum maps at 1.5, 5.6, and 9 GHz. Unlike most FR-II objects, W2332-5056 is hosted by a disk-like galaxy. The core has a projected 5" linear radio feature that is perpendicular to the curved primary jet, hinting at unusual and complex activity within the inner 25 kpc. The multi-epoch optical-near-IR photometric measurements indicate significant variability over a 3-20 year baseline from the AGN component. Gemini-South optical data shows an unusual double-peaked emission-line features: the centroids of the broad-lined components of H-alpha and H-beta are blueshifted with respect to the narrow lines and host galaxy by approximately 3800 km/s. We examine possible cases which involve single or double supermassive black holes in the system, and discuss required future investigations to disentangle the mystery nature of this system.
Experimental evaluation of a high performance superconducting torquer
NASA Astrophysics Data System (ADS)
Goldie, James H.; Avakian, Kevin M.; Downer, James R.; Gerver, Michael; Gondhalekar, Vijay; Johnson, Bruce G.
The high performance superconducting torquer (HPSCT) was designed to slew a large inertia in one degree of freedom with a double versine torque profile, a profile used for pointing applications which minimizes the exciting of structural resonances. The program culminated with the successful demonstration of closed loop torque control, following a desired double versine torque profile to an accuracy of approximately 1 percent of the peak torque of the profile. The targeted double versine possessed a peak torque which matches the torque capacity of the Sperry M4500 CMG (controlled moment gyro). The research provided strong evidence of the feasibility of an advanced concept CMG which would use cryoresistive control coils in conjunction with an electromagnetically suspended rotor and superconducting source coil. The cryoresistive coils interact with the superconducting solenoid to develop the desired torque and, in addition, the required suspension forces.
NASA Astrophysics Data System (ADS)
Ahia, Chinedu Christian; Tile, Ngcali; Botha, Johannes R.; Olivier, E. J.
2018-04-01
The structural and photoluminescence (PL) characterization of InGaSb quantum well (QW) structures grown on GaSb substrate (100) using atmospheric pressure Metalorganic Vapor Phase Epitaxy (MOVPE) is presented. Both structures (single and double-InGaSb QWs) were inadvertently formed during an attempt to grow capped InSb/GaSb quantum dots (QDs). In this work, 10 K PL peak energies at 735 meV and 740 meV are suggested to be emissions from the single and double QWs, respectively. These lines exhibit red shifts, accompanied by a reduction in their full-widths at half-maximum (FWHM) as the excitation power decreases. The presence of a GaSb spacer in the double QW was found to increase the strength of the PL emission, which consequently gives rise to a reduced blue-shift and broadening of the PL emission line observed for the double QW with an increase in laser power, while the low thermal activation energy for the quenching of the PL from the double QW is attributed to the existence of threading dislocations, as seen in the bright field TEM image for this sample.
Planar Lattice Instability in LA2CUO4.1 across the Superconducting Transition
NASA Astrophysics Data System (ADS)
Acosta-Alejandro, Manuel; Mustre-de Leon, Jose; Conradson, Steven
2001-03-01
The local atomic structure of La2CuO4.1 around Cu K-edge is analyzed for 10
Graphene patterns supported terahertz tunable plasmon induced transparency.
He, Xiaoyong; Liu, Feng; Lin, Fangting; Shi, Wangzhou
2018-04-16
The tunable plasmonic induced transparency has been theoretically investigated based on graphene patterns/SiO 2 /Si/polymer multilayer structure in the terahertz regime, including the effects of graphene Fermi level, structural parameters and operation frequency. The results manifest that obvious Fano peak can be observed and efficiently modulated because of the strong coupling between incident light and graphene pattern structures. As Fermi level increases, the peak amplitude of Fano resonance increases, and the resonant peak position shifts to high frequency. The amplitude modulation depth of Fano curves is about 40% on condition that the Fermi level changes in the scope of 0.2-1.0 eV. With the distance between cut wire and double semi-circular patterns increases, the peak amplitude and figure of merit increases. The results are very helpful to develop novel graphene plasmonic devices (e.g. sensors, modulators, and antenna) and find potential applications in the fields of biomedical sensing and wireless communications.
Co-evolution of payoff strategy and interaction strategy in prisoner's dilemma game
NASA Astrophysics Data System (ADS)
Zhang, Kangjie; Cheng, Hongyan
2016-11-01
Co-evolutionary dynamical models, providing a realistic paradigm for investigating complex system, have been extensively studied. In this paper, the co-evolution of payoff strategy and interaction strategy is studied. Starting with an initial Gaussian distribution of payoff strategy r with the mean u and the variance q, we focus on the final distribution of the payoff strategy. We find that final distribution of the payoff strategy may display different structures depending on parameters. In the ranges u < - 1 and u > 3, the distribution displays a single-peak structure which is symmetric about r = u. The distribution manifests itself as a double-peak structure in the range - 1 < u < 3 although a fake three-peak structure shows up in range 1 < u < 2. The explanations on the formation of different types of payoff strategy distributions are presented.
NASA Astrophysics Data System (ADS)
Liu, Yang; Gao, Bo; Gong, Min; Shi, Ruiying
2017-06-01
The influence of a GaN layer as a sub-quantum well for an AlGaN/GaN/AlGaN double barrier resonant tunneling diode (RTD) on device performance has been investigated by means of numerical simulation. The introduction of the GaN layer as the sub-quantum well turns the dominant transport mechanism of RTD from the 3D-2D model to the 2D-2D model and increases the energy difference between tunneling energy levels. It can also lower the effective height of the emitter barrier. Consequently, the peak current and peak-to-valley current difference of RTD have been increased. The optimal GaN sub-quantum well parameters are found through analyzing the electrical performance, energy band, and transmission coefficient of RTD with different widths and depths of the GaN sub-quantum well. The most pronounced electrical parameters, a peak current density of 5800 KA/cm2, a peak-to-valley current difference of 1.466 A, and a peak-to-valley current ratio of 6.35, could be achieved by designing RTD with the active region structure of GaN/Al0.2Ga0.8 N/GaN/Al0.2Ga0.8 N (3 nm/1.5 nm/1.5 nm/1.5 nm).
AC losses in (Bi,Pb) 2Sr 2Ca 2Cu 3O x tapes
NASA Astrophysics Data System (ADS)
D'Anna, G.; Indenbom, M. V.; André, M.-O.; Benoit, W.; Grivel, J.-C.; Hensel, B.; Flükiger, R.
1994-05-01
A double peak structure is observed in the AC losses of (Bi,Pb) 2Sr 2Ca 2Cu 3O x silver-sheathed tapes using a torsion-pendulum oscillator. The low-temperature peak is associated to the intragrain flux expulsion, while the high-temperature peak results from a macroscopic current path around the whole sample due to a well-coupled fraction of the grains. The flux pinning by the dislocations forming small-angle grain boundaries is suggested to control the transport current.
NASA Astrophysics Data System (ADS)
Karaaslan, Y.; Gisi, B.; Sakiroglu, S.; Kasapoglu, E.; Sari, H.; Sokmen, I.
2018-02-01
We study the influence of electric field on the electronic energy band structure, zero-temperature ballistic conductivity and optical properties of double quantum wire. System described by double-well anharmonic confinement potential is exposed to a perpendicular magnetic field and Rashba and Dresselhaus spin-orbit interactions. Numerical results show up that the combined effects of internal and external agents cause the formation of crossing, anticrossing, camel-back/anomaly structures and the lateral, downward/upward shifts in the energy dispersion. The anomalies in the energy subbands give rise to the oscillation patterns in the ballistic conductance, and the energy shifts bring about the shift in the peak positions of optical absorption coefficients and refractive index changes.
Zhang, Hongyan; Lv, Jie; Jia, Zhenhong
2018-01-01
We successfully demonstrate a porous silicon (PS) double Bragg mirror by electrochemical etching at room temperature as a deoxyribonucleic acid (DNA) label-free biosensor for detecting ammonia-oxidizing bacteria (AOB). Compared to various other one-dimension photonic crystal configurations of PS, the double Bragg mirror structure is quite easy to prepare and exhibits interesting optical properties. The width of high reflectivity stop band of the PS double Bragg mirror is about 761 nm with a sharp and deep resonance peak at 1328 nm in the reflectance spectrum, which gives a high sensitivity and distinguishability for sensing performance. The detection sensitivity of such a double Bragg mirror structure is illustrated through the investigation of AOB DNA hybridization in the PS pores. The redshifts of the reflectance spectra show a good linear relationship with both complete complementary and partial complementary DNA. The lowest detection limit for complete complementary DNA is 27.1 nM and the detection limit of the biosensor for partial complementary DNA is 35.0 nM, which provides the feasibility and effectiveness for the detection of AOB in a real environment. The PS double Bragg mirror structure is attractive for widespread biosensing applications and provides great potential for the development of optical applications.
Goto, Tomoyo; Itoh, Toshio; Akamatsu, Takafumi; Shin, Woosuck
2015-01-01
The CO sensing properties of a micro thermoelectric gas sensor (micro-TGS) with a double AuPtPd/SnO2 and Pt/α-Al2O3 catalyst were investigated. While several nanometer sized Pt and Pd particles were uniformly dispersed on SnO2, the Au particles were aggregated as particles measuring >10 nm in diameter. In situ diffuse reflectance Fourier transform Infrared spectroscopy (DRIFT) analysis of the catalyst showed a CO adsorption peak on Pt and Pd, but no clear peak corresponding to the interaction between CO and Au was detected. Up to 200 °C, CO combustion was more temperature dependent than that of H2, while H2 combustion was activated by repeated exposure to H2 gas during the periodic gas test. Selective CO sensing of the micro-TGS against H2 was attempted using a double catalyst structure with 0.3–30 wt% Pt/α-Al2O3 as a counterpart combustion catalyst. The sensor output of the micro-TGS decreased with increasing Pt content in the Pt/α-Al2O3 catalyst, by cancelling out the combustion heat from the AuPtPd/SnO2 catalyst. In addition, the AuPtPd/SnO2 and 0.3 wt% Pt/α-Al2O3 double catalyst sensor showed good and selective CO detection. We therefore demonstrated that our micro-TGS with double catalyst structure is useful for controlling the gas selectivity of CO against H2. PMID:26694397
The Nature of Double-peaked [O III] Active Galactic Nuclei
NASA Astrophysics Data System (ADS)
Fu, Hai; Yan, Lin; Myers, Adam D.; Stockton, Alan; Djorgovski, S. G.; Aldering, G.; Rich, Jeffrey A.
2012-01-01
Active galactic nuclei (AGNs) with double-peaked [O III] lines are suspected to be sub-kpc or kpc-scale binary AGNs. However, pure gas kinematics can produce the same double-peaked line profile in spatially integrated spectra. Here we combine integral-field spectroscopy and high-resolution imaging of 42 double-peaked [O III] AGNs from the Sloan Digital Sky Survey to investigate the constituents of the population. We find two binary AGNs where the line splitting is driven by the orbital motion of the merging nuclei. Such objects account for only ~2% of the double-peaked AGNs. Almost all (~98%) of the double-peaked AGNs were selected because of gas kinematics; and half of those show spatially resolved narrow-line regions that extend 4-20 kpc from the nuclei. Serendipitously, we find two spectrally unresolved binary AGNs where gas kinematics produced the double-peaked [O III] lines. The relatively frequent serendipitous discoveries indicate that only ~1% of binary AGNs would appear double-peaked in Sloan spectra and 2.2+2.5 -0.8% of all Sloan AGNs are binary AGNs. Therefore, the double-peaked sample does not offer much advantage over any other AGN samples in finding binary AGNs. The binary AGN fraction implies an elevated AGN duty cycle (8+8 -3%), suggesting galaxy interactions enhance nuclear accretion. We illustrate that integral-field spectroscopy is crucial for identifying binary AGNs: several objects previously classified as "binary AGNs" with long-slit spectra are most likely single AGNs with extended narrow-line regions (ENLRs). The formation of ENLRs driven by radiation pressure is also discussed. Some of the data presented herein were obtained at the W.M. Keck Observatory, which is operated as a scientific partnership among the California Institute of Technology, the University of California, and the National Aeronautics and Space Administration. The Observatory was made possible by the generous financial support of the W. M. Keck Foundation.
NASA Astrophysics Data System (ADS)
Rudek, Benedikt; Bennett, Daniel; Bug, Marion U.; Wang, Mingjie; Baek, Woon Yong; Buhr, Ticia; Hilgers, Gerhard; Champion, Christophe; Rabus, Hans
2016-09-01
For track structure simulations in the Bragg peak region, measured electron emission cross sections of DNA constituents are required as input for developing parameterized model functions representing the scattering probabilities. In the present work, double differential cross sections were measured for the electron emission from vapor-phase pyrimidine, tetrahydrofuran, and trimethyl phosphate that are structural analogues to the base, the sugar, and the phosphate residue of the DNA, respectively. The range of proton energies was from 75 keV to 135 keV, the angles ranged from 15° to 135°, and the electron energies were measured from 10 eV to 200 eV. Single differential and total electron emission cross sections are derived by integration over angle and electron energy and compared to the semi-empirical Hansen-Kocbach-Stolterfoht (HKS) model and a quantum mechanical calculation employing the first Born approximation with corrected boundary conditions (CB1). The CB1 provides the best prediction of double and single differential cross section, while total cross sections can be fitted with semi-empirical models. The cross sections of the three samples are proportional to their total number of valence electrons.
VLBI observations at 2.3 GHz of the compact galaxy 1934-638
NASA Technical Reports Server (NTRS)
Tzioumis, Anastasios K.; Jauncey, David L.; Preston, Robert A.; Meier, David L.; Morabito, David D.; Skjerve, Lyle; Slade, Martin A.; Nicolson, George D.; Niell, Arthur E.; Wehrle, Ann E.
1989-01-01
VLBI observations of the strong radio source 1934-638 show it to be a binary with a component separation of 42.0 + or - 0.2 mas, a position angle of 90.5 + or - 1 deg, and component sizes of about 2.5 mas. The results imply the presence of an additional elongated component aligned with, and between, the compact double components. The sources's almost equal compact double structure, peaked spectrum, low variability, small polarization, and particle-dominated radio lobes suggests that it belongs to the class of symmetric compact double sources identified by Phillips and Mutel (1980, 1981, 1982).
NASA Astrophysics Data System (ADS)
Cruzeiro, L.
2008-10-01
A new physical cause for a temperature-dependent double peak in exciton systems is put forward within a thermal equilibrium approach for the calculation of optical properties of exciton systems. Indeed, it is found that one-dimensional exciton systems with only one molecule per unit cell can have an absorption spectrum characterized by a double peak provided that the coupling between excitations in different molecules is positive. The two peaks, whose relative intensities vary with temperature, are located around the exciton band edges, being separated by an energy of approximately 4V, where V is the average coupling between nearest neighbours. For small amounts of diagonal and off-diagonal disorder, the contributions from the intermediate states in the band are also visible as intermediate structure between the two peaks, this being enhanced for systems with periodic boundary conditions. At a qualitative level, these results correlate well with experimental observations in the molecular aggregates of the thiacarbocyanine dye THIATS and in the organic crystals of acetanilide and N-methylacetamide.
NASA Astrophysics Data System (ADS)
Zhang, Danfeng; Hao, Zhifeng; Qian, Yannan; Zeng, Bi; Zhu, Haiping; Wu, Qibai; Yan, Chengjie; Chen, Muyu
2018-05-01
Nanocarbon-based materials are outstanding microwave absorbers with good dielectric properties. In this study, double-layer silicone resin flexible absorbing coatings, composed of carbon-coated nickel nanoparticles (Ni@C) and carbon nanotubes (CNTs), with low loading and a total thickness of 2 mm, were prepared. The reflection loss (RL) of the double-layer absorbing coatings has measured for frequencies between 2 and 18 GHz using the Arch reflecting testing method. The effects of the thickness and electromagnetic parameters of each layer and of the layer sequence on the absorbing properties were investigated. It is found that the measured bandwidth (RL ≤ - 10 dB) of the optimum double-layer structure in our experiment range achieves 3.70 GHz. The results indicated that the double coating structure composed of different materials has greater synergistic absorption effect on impedance matching than that of same materials with different loading. The maximum RL of S1 (5 wt% CNTs)/S3 (60 wt% Ni@C) double-layer absorbing coating composed of different materials (S1 and S3) was larger than the one achieved using either S1 or S3 alone with the same thickness. This was because double-layer coating provided a suitable matching layer and improve the interfacial impedance. It was also shown that absorbing peak value and frequency position can be adjusted by double-layer coating structure.
Transport of ion beam in an annular magnetically expanding helicon double layer thruster
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Yunchao, E-mail: yunchao.zhang@anu.edu.au; Charles, Christine; Boswell, Rod
2014-06-15
An ion beam generated by an annular double layer has been measured in a helicon thruster, which sustains a magnetised low-pressure (5.0 × 10{sup −4} Torr) argon plasma at a constant radio-frequency (13.56 MHz) power of 300 W. After the ion beam exits the annular structure, it merges into a solid centrally peaked structure in the diffusion chamber. As the annular ion beam moves towards the inner region in the diffusion chamber, a reversed-cone plasma wake (with a half opening angle of about 30°) is formed. This process is verified by measuring both the radial and axial distributions of the beam potential and beammore » current. The beam potential changes from a two-peak radial profile (maximum value ∼ 30 V, minimum value ∼ 22.5 V) to a flat (∼28 V) along the axial direction; similarly, the beam current changes from a two-peak to one-peak radial profile and the maximum value decreases by half. The inward cross-magnetic-field motion of the beam ions is caused by a divergent electric field in the source. Cross-field diffusion of electrons is also observed in the inner plume and is determined as being of non-ambipolar origin.« less
Magnetic texturing due to the partial ordering of Fe+3 and Cu+2 in NdBaCuFeO5
NASA Astrophysics Data System (ADS)
Pissas, M.
2017-06-01
The crystal and magnetic structure of the oxygen deficient double perovskite NdBaCuFeO5 was studied, using neutron powder diffraction data. The structure was refined from neutron powder diffraction data using the space groups P 4 / mmm and P 4 mm . For 2K ⩽ T ⩽TN2 = 260K three families of magnetic Bragg peaks exist. These peaks can be indexed with commensurate propagation vectors k1 =[1/2 1/2 1/2], k2 =[1/2 1/2 0] and the incommensurate k3 =[1/2 1/2 0.4]. Above TN2 only magnetic Bragg peaks originated from k1 and k2 propagation, were observed. The incommensurate magnetic structure can be attributed to a circular inclined spiral ordering as in YBaCuFeO5 compound.
NASA Astrophysics Data System (ADS)
Fajar, M. N.; Hidayat, R.; Triwikantoro; Endarko
2018-04-01
The TiO2-SnO2 thin film with single and double-layer structure has successfully synthesized on FTO (Fluorine-doped Tin Oxide) substrate using the screen printing technique. The structural, optical, and morphological properties of the film were investigated by XRD, UV-Vis, and SEM, respectively. The results showed that the single and double-layer structure of TiO2-SnO2 thin film has mixed phase with a strong formation of casseritte phase. The acid treatment effect on TiO2-SnO2 thin film decreases the peak intensity of anatase phase formation and thin film’s absorbance values. The morphological study is also revealed that the single layer TiO2-SnO2 thin film had a more porous nature and decreased particle size distribution after acid treatment, while the double-layer TiO2-SnO2 thin film Eroded due to acid treatment.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shirakashi, Ryo, E-mail: aa21150@iis.u-tokyo.ac.jp; Mischke, Miriam; Fischer, Peter
2012-11-09
Highlights: Black-Right-Pointing-Pointer Electrorotation offers a non-invasive tool for dielectric analysis of fish embryos. Black-Right-Pointing-Pointer The three-shell dielectric model matches the rotation spectra of medaka eggs. Black-Right-Pointing-Pointer The capacitance value suggests a double-membrane structure of yolk envelope. -- Abstract: The Japanese medaka fish, Oryzias latipes, has become a powerful vertebrate model organism in developmental biology and genetics. The present study explores the dielectric properties of medaka embryos during pre-hatching development by means of the electrorotation (ROT) technique. Due to their layered structure, medaka eggs exhibited up to three ROT peaks in the kHz-MHz frequency range. During development from blastula to earlymore » somite stage, ROT spectra varied only slightly. But as the embryo progressed to the late-somite stage, the ROT peaks underwent significant changes in frequency and amplitude. Using morphological data obtained by light and electron microscopy, we analyzed the ROT spectra with a three-shell dielectric model that accounted for the major embryonic compartments. The analysis yielded a very high value for the ionic conductivity of the egg shell (chorion), which was confirmed by independent osmotic experiments. A relatively low capacitance of the yolk envelope was consistent with its double-membrane structure revealed by transmission electron microscopy. Yolk-free dead eggs exhibited only one co-field ROT peak, shifted markedly to lower frequencies with respect to the corresponding peak of live embryos. The dielectric data may be useful for monitoring the development and changes in fish embryos' viability/conditions in basic research and industrial aquaculture.« less
Yu, Yifei; Luo, Linqing; Li, Bo; Guo, Linfeng; Yan, Jize; Soga, Kenichi
2015-10-01
The measured distance error caused by double peaks in the BOTDRs (Brillouin optical time domain reflectometers) system is a kind of Brillouin scattering spectrum (BSS) deformation, discussed and simulated for the first time in the paper, to the best of the authors' knowledge. Double peak, as a kind of Brillouin spectrum deformation, is important in the enhancement of spatial resolution, measurement accuracy, and crack detection. Due to the variances of the peak powers of the BSS along the fiber, the measured starting point of a step-shape frequency transition region is shifted and results in distance errors. Zero-padded short-time-Fourier-transform (STFT) can restore the transition-induced double peaks in the asymmetric and deformed BSS, thus offering more accurate and quicker measurements than the conventional Lorentz-fitting method. The recovering method based on the double-peak detection and corresponding BSS deformation can be applied to calculate the real starting point, which can improve the distance accuracy of the STFT-based BOTDR system.
Compression member response of double steel angles on truss structure with member length variation
NASA Astrophysics Data System (ADS)
Hasibuan, Purwandy; Panjaitan, Arief; Haiqal, Muhammad
2018-05-01
One type of structures that implements steel angles as its members is truss system of telecommunication tower. For this structure, reinforcements on tower legs are also needed when antennas and microwaves installation placed on the peak of tower increases in quantity. One type of reinforcement methods commonly used is by increasing areas section capacity, where tower leg consisted of single angle section will be reinforced to be double angle sections. Regarding this case, this research discussed behavior two types of double angle steel section 2L 30.30.3 that were designed identically in area section but vary in length: 103 cm and 83 cm. At the first step, compression member together with tension member was formed to be a truss system, where compression and tension member were met at the joint plate. Schematic loading was implemented by giving tension loading on the joint plate, and this loading was terminated when each specimen reached its failure. Research findings showed that implementing shorter double angle (83 cm) sections, increased compression strength of steel angle section up to 13 %. Significant deformation occurring only on the flange for both of specimens indicated that implementing double angle is effective to prevent lateral-torsional buckling.
The profile of the bending mode band in solid CO2
NASA Astrophysics Data System (ADS)
Baratta, G. A.; Palumbo, M. E.
2017-12-01
Context. Solid carbon dioxide (CO2) is one of the most abundant species detected in icy grain mantles in dense molecular clouds. Its identification is based on the comparison between astronomical and laboratory spectra. In the past 30 yr the profile of solid CO2 infrared absorption bands has been extensively studied experimentally, however, the debate on the structure (amorphous versus crystalline) of CO2 samples obtained in laboratory by the thin-film technique is still open. Aims: The aim of this work is to investigate if the presence of the double peak feature in the profile of the CO2 bending mode band is related to the crystalline or amorphous structure of the sample. Methods: We performed new laboratory experiments depositing CO2 under ultra high vacuum (UHV) conditions at 17 K. We investigated, using infrared transmission spectroscopy, the influence of various experimental parameters on the profile of the CO2 bands, namely deposition rate, sample thickness, annealing, and presence of H2O, CH3OH or CO co-deposited with CO2. Results: We found that, within experimental uncertainties, under UHV conditions the profile of the CO2 bands in pure solid samples does not depend on the deposition rate or the sample thickness in the ranges investigated. In all cases the bending mode band profile shows a double peak (at 660 and 655 cm-1). The spectra also show the Fermi resonance features that cannot be active in crystalline samples. On the other hand, when a small fraction of H2O or CH3OH is co-deposited with CO2 the double peak is not observed while it is observed when a CO2:CO mixture is considered. Furthermore, we measured the density of solid CO2 and the refractive index (at 543.5 nm) at 17 K and at 70 K: ρ(17 K)= 1.17 g cm-3, ρ(70K)= 1.49 g cm-3, n(17K)= 1.285, and n(70K)= 1.372. Conclusions: Our experimental results indicate that the presence of the double peak in the profile of the bending mode band is not an indication of a crystalline structure of the sample and they do not exclude the presence of amorphous solid CO2 in space.
NASA Astrophysics Data System (ADS)
Rosario, D. J.; Shields, G. A.; Taylor, G. B.; Salviander, S.; Smith, K. L.
2010-06-01
We report on the study of an intriguing active galaxy that was selected as a potential multiple supermassive black hole merger in the early-type host SDSS J151709.20+335324.7 (z = 0.135) from a complete search for double-peaked [O III] lines from the SDSS spectroscopic quasi-stellar object (QSO) database. Ground-based SDSS imaging reveals two blue structures on either side of the photometric center of the host galaxy, separated from each other by about 5.7 kpc. From a combination of SDSS fiber and Keck/HIRES long-slit spectroscopy, it is demonstrated that, in addition to these two features, a third distinct structure surrounds the nucleus of the host galaxy. All three structures exhibit highly ionized line emission with line ratios characteristic of Seyfert II active galactic nuclei. The analysis of spatially resolved emission-line profiles from the HIRES spectrum reveal three distinct kinematic subcomponents, one at rest and the other two moving at -350 km s-1 and 500 km s-1 with respect to the systemic velocity of the host galaxy. A comparison of imaging and spectral data confirm a strong association between the kinematic components and the spatial knots, which implies a highly disturbed and complex active region in this object. A comparative analysis of the broadband positions, colors, kinematics, and spectral properties of the knots in this system lead to two plausible explanations: (1) a multiple active galactic nucleus (AGN) produced due to a massive dry merger, or (2) a very powerful radio jet-driven outflow. Subsequent VLA radio imaging reveals a clear jet aligned with the emission-line gas, confirming the latter explanation. We use the broadband radio measurements to examine the impact of the jet on the interstellar medium of the host galaxy, and find that the energy in the radio lobes can heat a significant fraction of the gas to the virial temperature. Finally, we discuss tests that may help future surveys distinguish between jet-driven kinematics and true black-hole binaries. J1517+3353 is a remarkable laboratory for AGN feedback and warrants deeper follow-up study. In the Appendix, we present high-resolution radio imaging of a second AGN with double-peaked [O III] lines, SDSS J112939.78+605742.6, which shows a sub-arcsecond radio jet. If the double-peaked nature of the narrow lines in radio-loud AGNs are generally due to radio jet interactions, we suggest that extended radio structure should be expected in most of such systems.
Twisted rogue-wave pairs in the Sasa-Satsuma equation.
Chen, Shihua
2013-08-01
Exact explicit rogue wave solutions of the Sasa-Satsuma equation are obtained by use of a Darboux transformation. In addition to the double-peak structure and an analog of the Peregrine soliton, the rogue wave can exhibit an intriguing twisted rogue-wave pair that involves four well-defined zero-amplitude points. This exotic structure may enrich our understanding on the nature of rogue waves.
NASA Astrophysics Data System (ADS)
McGurk, Rosalie C.; Max, Claire E.; Medling, Anne; Shields, Gregory A.
2015-01-01
When galaxies merge, gas accretes onto both central supermassive black holes. Thus, one expects to see close pairs of active galactic nuclei (AGNs), or dual AGNs, in a fraction of galaxy mergers. However, finding them remains a challenge. The presence of double-peaked [O III] or of ultra hard X-rays have been proposed as techniques to select dual AGNs efficiently. We studied a sample of double-peaked narrow [O III] emitting AGNs from SDSS DR7. By obtaining new and archival high spatial resolution images taken with the Keck 2 Laser Guide Star Adaptive Optics system and the near-infrared (IR) camera NIRC2, we showed that 30% of double-peaked [O III] emission line SDSS AGNs have two spatial components within a 3' radius. However, spatially resolved spectroscopy or X-ray observations are needed to confirm these galaxy pairs as systems containing two AGNs. We followed up these spatially-double candidate dual AGNs with integral field spectroscopy from Keck OSIRIS and Gemini GMOS and with long-slit spectroscopy from Keck NIRSPEC and Shane Kast Double Spectrograph. We find double-peaked emitters are caused sometimes by dual AGN and sometimes by outflows or narrow line kinematics. We also performed Chandra X-ray ACIS-S observations on 12 double-peaked candidate dual AGNs. Using our observations and 8 archival observations, we compare the distribution of X-ray photons to our spatially double near-IR images, measure X-ray luminosities and hardness ratios, and estimate column densities. By assessing what fraction of double-peaked emission line SDSS AGNs are true dual AGNs, we can better determine whether double-peaked [O III] is an efficient dual AGN indicator and constrain the statistics of dual AGNs. A second technique to find dual AGN is the detection of ultra hard X-rays by the Swift Burst Alert Telescope. We use CARMA observations to measure and map the CO(1-0) present in nearby ultra-hard X-ray Active Galactic Nuclei (AGNs) merging with either a quiescent companion galaxy or a companion galaxy hosting a second AGN, in order to understand the role molecular gas plays in feeding this unusual population of ultra-hard X-ray AGNs and to understand ultra-hard X-rays as a dual AGN selection method.
Formation of lunar basin rings
Hodges, C.A.; Wilhelms, D.E.
1978-01-01
The origin of the multiple concentric rings that characterize lunar impact basins, and the probable depth and diameter of the transient crater have been widely debated. As an alternative to prevailing "megaterrace" hypotheses, we propose that the outer scarps or mountain rings that delineate the topographic rims of basins-the Cordilleran at Orientale, the Apennine at Imbrium, and the Altai at Nectaris-define the transient cavities, enlarged relatively little by slumping, and thus are analogous to the rim crests of craters like Copernicus; inner rings are uplifted rims of craters nested within the transient cavity. The magnitude of slumping that occurs on all scarps is insufficient to produce major inner rings from the outer. These conclusions are based largely on the observed gradational sequence in lunar central uplifts:. from simple peaks through somewhat annular clusters of peaks, peak and ring combinations and double ring basins, culminating in multiring structures that may also include peaks. In contrast, belts of slump terraces are not gradational with inner rings. Terrestrial analogs suggest two possible mechanisms for producing rings. In some cases, peaks may expand into rings as material is ejected from their cores, as apparently occurred at Gosses Bluff, Australia. A second process, differential excavation of lithologically diverse layers, has produced nested experimental craters and is, we suspect, instrumental in the formation of terrestrial ringed impact craters. Peak expansion could produce double-ring structures in homogeneous materials, but differential excavation is probably required to produce multiring and peak-in-ring configurations in large lunar impact structures. Our interpretation of the representative lunar multiring basin Orientale is consistent with formation of three rings in three layers detected seismically in part of the Moon-the Cordillera (basin-bounding) ring in the upper crust, the composite Montes Rook ring in the underlying, more coherent "heald" crust, and an innermost, 320-km ring at the crust-mantle interface. Depth-diameter ratios of 1 10to 1 15 are consistent with this interpretation and suggest that volumes of transient cavities and hence of basin ejecta may be considerably greater than commonly assumed. ?? 1978.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nakar, Ehud; Piro, Anthony L.
2014-06-20
Early observations of supernova light curves are powerful tools for shedding light on the pre-explosion structures of their progenitors and their mass-loss histories just prior to explosion. Some core-collapse supernovae that are detected during the first days after the explosion prominently show two peaks in the optical bands, including the R and I bands, where the first peak appears to be powered by the cooling of shocked surface material and the second peak is clearly powered by radioactive decay. Such light curves have been explored in detail theoretically for SN 1993J and 2011dh, where it was found that they maymore » be explained by progenitors with extended, low-mass envelopes. Here, we generalize these results. We first explore whether any double-peaked light curve of this type can be generated by a progenitor with a 'standard' density profile, such as a red supergiant or a Wolf-Rayet star. We show that a standard progenitor (1) cannot produce a double-peaked light curve in the R and I bands and (2) cannot exhibit a fast drop in the bolometric luminosity as is seen after the first peak. We then explore the signature of a progenitor with a compact core surrounded by extended, low-mass material. This may be a hydrostatic low-mass envelope or material ejected just prior to the explosion. We show that it naturally produces both of these features. We use this result to provide simple formulae to estimate (1) the mass of the extended material from the time of the first peak, (2) the extended material radius from the luminosity of the first peak, and (3) an upper limit on the core radius from the luminosity minimum between the two peaks.« less
Structural and electro-optical properties of bilayer graphyne like BN sheet
NASA Astrophysics Data System (ADS)
Behzad, Somayeh
2016-12-01
The structural, electronic and optical properties of bilayer graphyne like BN sheet (BNyne) with different stacking manners have been explored by the first-principles calculations. The stabilities of α-BNyne bilayers with different stacking manners are compared. The α-BNyne Bilayers have wide band gaps. Compared to the single α-BNyne, the numbers of energy bands are doubled due to the interlayer interactions and the band gap is reduced. The AB-I configuration has a direct band gap while the band gap becomes indirect for AA-II. The calculated ε2 (ω) of bilayer α-BNyne for (Eǁx) is similar to that of the monolayer α-BNyne, except for the small changes of peak positions and increasing of peak intensities. For (Eǁz), the first absorption peak occures at 3.86 eV, and the prominant peak of monolayer at 9.17 eV becomes broadened. These changes are related to the new transitions resulting from the band splitting.
NASA Astrophysics Data System (ADS)
Zhao, Guijuan; Wang, Lianshan; Li, Huijie; Meng, Yulin; Li, Fangzheng; Yang, Shaoyan; Wang, Zhanguo
2018-01-01
Semi-polar (11-22) InGaN multiple quantum well (MQW) green light-emitting diode (LED) structures have been realized by metal-organic chemical vapor deposition on an m-plane sapphire substrate. By introducing double GaN buffer layers, we improve the crystal quality of semi-polar (11-22) GaN significantly. The vertical alignment of the diffraction peaks in the (11-22) X-ray reciprocal space mapping indicates the fully strained MQW on the GaN layer. The photoluminescence spectra of the LED structure show stronger emission intensity along the [1-100] InGaN/GaN direction. The electroluminescence emission of the LED structure is very broad with peaks around 550 nm and 510 nm at the 100 mA current injection for samples A and B, respectively, and exhibits a significant blue-shift with increasing drive current.
A novel SOI LDMOS with substrate field plate and variable-k dielectric buried layer
NASA Astrophysics Data System (ADS)
Li, Qi; Wen, Yi; Zhang, Fabi; Li, Haiou; Xiao, Gongli; Chen, Yonghe; Fu, Tao
2018-09-01
A novel silicon-on-insulator (SOI) lateral double-diffused metal-oxide-semiconductor (LDMOS) structure has been proposed. The new structure features a substrate field plate (SFP) and a variable-k dielectric buried layer (VKBL). The SFP and VKBL improve the breakdown voltage by introducing new electric field peaks in the surface electric field distribution. Moreover, the SFP reduces the specific ON-resistance through an enhanced auxiliary depletion effect on the drift region. The simulation results indicate that compared to the conventional SOI LDMOS structure, the breakdown voltage is improved from 118 V to 221 V, the specific ON-resistance is decreased from 7.15 mΩ·cm2 to 3.81 mΩ·cm2, the peak value of surface temperature is declined by 38 K.
Lu, Ji-Yun; Liang, Da-Kai; Zhang, Xiao-Li; Zhu, Zhu
2009-12-01
Spectrum of fiber bragg grating (FBG) sensor modulated by double long period grating (LPFG) is proposed in the paper. Double LPFG consists of two LPFGS whose center wavelengths are the same and reflection spectrum of FBG sensor is located in linear range of double LPFG transmission spectrum. Based on spectral analysis of FBG and double LPFG, reflection spectrum of FBG modulated by double LPFG is obtained and studied by use of band-hider filter characteristics for double LPFG. An FBG sensor is attached on the surface of thin steel beam, which is strained by bending, and the center wavelength of FBG sensor will shift. The spectral peak of FBG sensor modulated by double LPFG is changed correspondingly, and the spectral change will lead to variation in exit light intensity from double LPFG. Experiment demonstrates that the relation of filtering light intensity from double LPFG monitored by optical power meter to center wavelength change of FBG sensor is linear and the minimum strain of material (steel beam) detected by the modulation and demodulation system is 1.05 microepsilon. This solution is used in impact monitoring of optical fibre smart structure, and FBG sensor is applied for impulse response signal monitoring induced by low-velocity impact, when impact pendulum is loaded to carbon fiber-reinforced plastics (CFP). The acquired impact response signal and fast Fourier transform of the signal detected by FBG sensor agree with the measurement results of eddy current displacement meter attached to the FBG sensor. From the results, the present method using FBG sensor is found to be effective for monitoring the impact. The research provides a practical reference in dynamic monitoring of optical fiber smart structure field.
Temperature shift of intraband absorption peak in tunnel-coupled QW structure
NASA Astrophysics Data System (ADS)
Akimov, V.; Firsov, D. A.; Duque, C. A.; Tulupenko, V.; Balagula, R. M.; Vinnichenko, M. Ya.; Vorobjev, L. E.
2017-04-01
An experimental study of the intersubband light absorption by the 100-period GaAs/Al0.25Ga0.75As double quantum well heterostructure doped with silicon is reported and interpreted. Small temperature redshift of the 1-3 intersubband absorption peak is detected. Numerical calculations of the absorption coefficient including self-consistent Hartree calculations of the bottom of the conduction band show good agreement with the observed phenomena. The temperature dependence of energy gap of the material and the depolarization shift should be accounted for to explain the shift.
Excitation mechanism of surface plasmon polaritons in a double-layer wire grid structure
NASA Astrophysics Data System (ADS)
Motogaito, Atsushi; Nakajima, Tomoyasu; Miyake, Hideto; Hiramatsu, Kazumasa
2017-12-01
We characterize the optical properties of a double-layer wire grid structure and investigate in detail the excitation mechanism of surface plasmon polaritons (SPPs). Angular spectra for the transmittance of the transverse magnetic polarized light that are obtained through the experiment reveal two peaks. In addition, simulated mapping of the transmittance and the magnetic field distribution indicate that SPPs are excited in two areas of the wire grid structures: at the interface between the Au layer and the resist layer or the glass substrate and at the interface between the Au layer and air. The experimental data are consistent with the transmittance mapping result and the distribution of the magnetic field. Accordingly, we constructed a model of SPPs propagation. We consider that SPPs excited at the interface between the Au layer and the resist layer or the glass substrate strongly contribute to the extraordinary transmission observed in the wire grid structures.
Stoggl, Thomas; Enqvist, Jonas; Muller, Erich; Holmberg, Hans-Christer
2010-01-01
In modern sprint cross-country skiing, strength and maximal speed are major determinants of performance. The aims of this study were to ascertain the anthropometric characteristics of world-class sprint skiers and to evaluate whether a specific body composition and/or body dimension characterizes a successful sprint skier. Our hypothesis was that body height and lean body mass are related to peak speed in double poling and diagonal stride. Fourteen male national and international elite skiers performed two peak speed tests in double poling and diagonal stride roller skiing on a treadmill and were analysed using dual-energy X-ray absorptiometry to determine body composition and body dimensions. Relative pole length was positively correlated with both techniques (double poling: r = 0.77, P < 0.01; diagonal stride: r = 0.60, P < 0.05) and was the only variable that was part of the multiple regression model for both double poling and diagonal stride peak speed. Body height was not correlated with any technique, whereas lean trunk mass (r = 0.75, P < 0.01), body mass index (r = 0.66, P < 0.01), total lean mass (r = 0.69, P < 0.01), and body mass (r = 0.57, P < 0.05) were positively related to double poling peak speed. Total lean mass (absolute: r = 0.58, P < 0.05; relative: r = 0.76, P < 0.001) and relative lean mass of the trunk, arms (both r = 0.72, P < 0.01), and legs (r = 0.54, P < 0.05) were positively related to diagonal stride peak speed. In conclusion, skiers should aim to achieve a body composition with a high percentage of lean mass and low fat mass. A focus on trunk mass through increased muscle mass appears to be important, especially for double poling. The use of longer poles (percent body height) seems to be advantageous for both double poling and diagonal stride peak speed, whereas body dimensions do not appear to be a predictive factor.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Afrizal,, E-mail: rizalunj04@yahoo.com; Nurdelima,; Umeir
2014-03-24
Chiral Smectic Liquid Crystal (S)-(+)-4-(2-methyl-1-butyloyloxy)phenyl 4-[1-(propenoyloxy) butiloxy] benzoate has been synthesized using method of steglich esterification at room temperature. The mesomorphic behavior of chiral smectic at 55°C that showed schlieren texture in POM analysis. Fixation of structure chiral smectic liquid crystal by means of photopolymerization of monomer (S)-(+)-4-(2-methyl-1-butyloyloxy)phenyl 4-[1-(propenoyloxy) butiloxy] benzoate under UV irradiation which called UV curing techniques. The curing process using UV 3 lamps 100 volt at 60°C for an hour. The product of photopolymerization could be seen by analysis of FTIR spectra both monomer and polymer. FTIR spectra of monomer, two peaks for ester carbonyl and C-Cmore » double bond groups appeared at 1729.09 cm-1and 3123.46 cm{sup −1}. After UV curing process, peak for the carbonyl group at 1729.09 cm{sup −1} decreased and a new peak at 1160.21 cm{sup −1} appeared due to the carbonyl group attached to a C-C bond group and then peak at 3123.46 cm{sup −1} for C-C double bond group was disappeared.« less
Shock-wave structure in a partially ionized gas
NASA Technical Reports Server (NTRS)
Lu, C. S.; Huang, A. B.
1974-01-01
The structure of a steady plane shock in a partially ionized gas has been investigated using the Boltzmann equation with a kinetic model as the governing equation and the discrete ordinate method as a tool. The effects of the electric field induced by the charge separation on the shock structure have also been studied. Although the three species of an ionized gas travel with approximately the same macroscopic velocity, the individual distribution functions are found to be very different. In a strong shock the atom distribution function may have double peaks, while the ion distribution function has only one peak. Electrons are heated up much earlier than ions and atoms in a partially ionized gas. Because the interactions of electrons with atoms and with ions are different, the ion temperature can be different from the atom temperature.
NASA Astrophysics Data System (ADS)
Shahamat, Yadollah; Vahedi, Mohammad
2017-06-01
An ultracompact double eight-shaped plasmonic structure for the realization of plasmon-induced transparency (PIT) in the terahertz (THz) region has been studied. The device consists of a semiconductor-insulator-semiconductor bus waveguide coupled to the dual-disk resonators. Indium antimonide is employed to excite SPP in the THz region. The transmission characteristics of the proposed device are simulated numerically by the finite-difference time-domain method. In addition, a theoretical analysis based on the coupled-mode theory for transmission features is presented and compared with the numerical results. Results are in good agreement. Also, the dependence of PIT frequency characteristics on the radius of the outer disk is discussed in detail. In addition, by removing one of the outer disk resonators, double-PIT peaks can be observed in the transmission spectrum, and the physical mechanism of the appeared peaks is investigated. Finally, an application of the proposed structure for distinguishing different states of DNA molecules is discussed. Results show that the maximum sensitivity with 654 GHz/RIU-1 could be obtained for a single PIT structure. The frequency shifts equal to 37 and 99 GHz could be observed for the denatured and the hybridized DNA states, respectively.
Stability of excitons in double quantum well: Through electron and holes transmission probabilities
NASA Astrophysics Data System (ADS)
Vignesh, G.; Nithiananthi, P.
2017-05-01
Stability of excitons has been analyzed using the transmission probability of its constituent particles in GaAs/Al0.3Ga0.7As Double Quantum Well (DQW) structure by varying well and barrier layer thickness. The effective mass approximation is used and anisotropy in material properties are also considered to get realistic situations. It is observed that tuning barrier layer avails many resonance peaks for the transmission and tuning well width admits maximum transmission at narrow well widths. Every saddle point of the observed transmission coefficients decides the formation, strength and transportation of excitons in DQW.
NASA Astrophysics Data System (ADS)
Martínez-Orozco, J. C.; Rodríguez-Magdaleno, K. A.; Suárez-López, J. R.; Duque, C. A.; Restrepo, R. L.
2016-04-01
In this work we present theoretical results for the electronic structure as well as for the absorption coefficient and relative refractive index change for an asymmetric double δ-doped like confining potential in the active region of a Multiple Independent Gate Field Effect Transistor (MIGFET) system. We model the potential profile as a double δ-doped like potential profile between two Schottky (parabolic) potential barriers that are just the main characteristics of the MIGFET configuration. We investigate the effect of external electromagnetic fields in this kind of quantum structures, in particular we applied a homogeneous constant electric field in the growth direction z as well as a homogeneous constant magnetic field in the x-direction. In general we conclude that by applying electromagnetic fields we can modulate the resonant peaks of the absorption coefficient as well as their energy position. Also with such probes it is possible to control the nodes and amplitude of the relative refractive index changes related to resonant intersubband optical transitions.
Spatially Resolved Imaging and Spectroscopy of Candidate Dual Active Galactic Nuclei
NASA Astrophysics Data System (ADS)
McGurk, R. C.; Max, C. E.; Medling, A. M.; Shields, G. A.; Comerford, J. M.
2015-09-01
When galaxies merge, both central supermassive black holes are immersed in a dense and chaotic environment. If there is sufficient gas in the nuclear regions, one expects to see close pairs of active galactic nuclei (AGNs), or dual AGNs, in a fraction of galaxy mergers. However, finding them remains a challenge. The presence of double-peaked [O iii] emission lines has been proposed as a technique to select dual AGNs efficiently. We studied a sample of double-peaked narrow [O iii] emitting AGNs from Sloan Digital Sky Survey (SDSS) DR7. By obtaining new and archival high spatial resolution images taken with the Keck II Laser Guide Star Adaptive Optics system and the near-infrared camera NIRC2, we show that 30% of 140 double-peaked [O iii] emission line SDSS AGNs have two spatial components within a 3″ radius. However, spatially resolved spectroscopy or X-ray observations are needed to confirm these galaxy pairs as systems containing two AGNs. We followed up three spatially double candidate dual AGNs with integral field spectroscopy from Keck OSIRIS and 10 candidates with long-slit spectroscopy from the Shane Kast Double Spectrograph at Lick Observatory. We find that the double-peaked emission lines in our sample of 12 candidates are caused by: one dual AGN (SDSS J114642.47+511029.6), one confirmed outflow and four likely outflows, two pairs of star-forming galaxies, one candidate indeterminate due to sky line interference, and three AGNs with spatially coincident double [O iii] peaks, likely due to unresolved complex narrow line kinematics, outflows, binary AGN, or small-scale jets.
ScienceCast 94: Solar Max Double Peaked
2013-03-01
Something unexpected is happening on the sun. 2013 is supposed to be the year of Solar Max, but solar activity is much lower than expected. At least one leading forecaster expects the sun to rebound with a double-peaked maximum later this year.
NASA Astrophysics Data System (ADS)
Shin, Sunhae; Rok Kim, Kyung
2016-04-01
We propose complement double-peak negative differential resistance (NDR) devices with ultrahigh peak-to-valley current ratio (PVCR) over 106 by combining tunnel diode with conventional CMOS and its compact five-state latch circuit by introducing standard ternary inverter (STI). At the “high”-state of STI, n-type NDR device (tunnel diode with nMOS) has 1st NDR characteristics with 1st peak and valley by band-to-band tunneling (BTBT) and trap-assisted tunneling (TAT), whereas p-type NDR device (tunnel diode with pMOS) has second NDR characteristics from the suppression of diode current by off-state MOSFET. The “intermediate”-state of STI permits double-peak NDR device to operate five-state latch with only four transistors, which has 33% area reduction compared with that of binary inverter and 57% bit-density reduction compared with binary latch.
NASA Astrophysics Data System (ADS)
Fan, C.; Tian, Y.; Wang, Z. Q.; Nie, J. K.; Wang, G. K.; Liu, X. S.
2017-06-01
In view of the noise feature and service environment of urban power substations, this paper explores the idea of compound impedance, fills some porous sound-absorption material in the first resonance cavity of the double-resonance sound-absorption material, and designs a new-type of composite acoustic board. We conduct some acoustic characterizations according to the standard test of impedance tube, and research on the influence of assembly order, the thickness and area density of the filling material, and back cavity on material sound-absorption performance. The results show that the new-type of acoustic board consisting of aluminum fibrous material as inner structure, micro-porous board as outer structure, and polyester-filled space between them, has good sound-absorption performance for low frequency and full frequency noise. When the thickness, area density of filling material and thickness of back cavity increase, the sound absorption coefficient curve peak will move toward low frequency.
Investigating gravity waves evidences in the Venus upper atmosphere
NASA Astrophysics Data System (ADS)
Migliorini, Alessandra; Altieri, Francesca; Shakun, Alexey; Zasova, Ludmila; Piccioni, Giuseppe; Bellucci, Giancarlo; Grassi, Davide
2014-05-01
We present a method to investigate gravity waves properties in the upper mesosphere of Venus, through the O2 nightglow observations acquired with the imaging spectrometer VIRTIS on board Venus Express. Gravity waves are important dynamical features that transport energy and momentum. They are related to the buoyancy force, which lifts air particles. Then, the vertical displacement of air particles produces density changes that cause gravity to act as restoring force. Gravity waves can manifest through fluctuations on temperature and density fields, and hence on airglow intensities. We use the O2 nightglow profiles showing double peaked structures to study the influence of gravity waves in shaping the O2 vertical profiles and infer the waves properties. In analogy to the Earth's and Mars cases, we use a well-known theory to model the O2 nightglow emissions affected by gravity waves propagation. Here we propose a statistical discussion of the gravity waves characteristics, namely vertical wavelength and wave amplitude, with respect to local time and latitude. The method is applied to about 30 profiles showing double peaked structures, and acquired with the VIRTIS/Venus Express spectrometer, during the mission period from 2006-07-05 to 2008-08-15.
Highly strained InAlP/InGaAs-based coupled double quantum wells on InP substrates
NASA Astrophysics Data System (ADS)
Gozu, Shin-ichiro; Mozume, Teruo
2018-05-01
InAlP/InGaAs based coupled double quantum wells (CDQWs) are proposed for optelectronic devices utilizing intersubband transitions. The aim of the proposed CDQW structure was to reduce the Al volume as compared with that in InGaAs/AlAsSb(AlAs/InAlAs) based CDQWs. By careful consideration of the band gap energy as well as conduction band offset and lattice constants for III–V materials, highly strained InAlP was chosen as the barrier material. With the appropriate CDQW structure and under the optimized growth conditions, proposed CDQWs exhibited clear X-ray diffraction satellite peaks, and almost identical optical absorption spectrum as compared with the InGaAs/AlAs/InAlAs CDQWs.
The Lower Extremity Biomechanics of Single- and Double-Leg Stop-Jump Tasks
2011-01-01
The anterior cruciate ligament (ACL) injury is a common occurrence in sports requiring stop-jump tasks. Single- and double-leg stop-jump techniques are frequently executed in sports. The higher risk of ACL injury in single-leg drop landing task compared to a double-leg drop landing task has been identified. However the injury bias between single- and double-leg landing techniques has not been investigated for stop-jump tasks. The purpose of this study was to determine the differences between single- and double-leg stop-jump tasks in knee kinetics that were influenced by the lower extremity kinematics during the landing phase. Ground reaction force, lower extremity kinematics, and knee kinetics data during the landing phase were obtained from 10 subjects performing single- and double-leg stop-jump tasks, using motion-capture system and force palates. Greater peak posterior and vertical ground reaction forces, and peak proximal tibia anterior and lateral shear forces (p < 0.05) during landing phase were observed of single-leg stop-jump. Single-leg stop-jump exhibited smaller hip and knee flexion angle, and knee flexion angular velocity at initial foot contact with the ground (p < 0.05). We found smaller peak hip and knee flexion angles (p < 0.05) during the landing phase of single-leg stop-jump. These results indicate that single-leg landing may have higher ACL injury risk than double-leg landing in stop-jump tasks that may be influenced by the lower extremity kinematics during the landing phase. Key points Non-contact ACL injuries are more likely to occur during the single-leg stop-jump task than during the double-leg stop-jump task. Single-leg stop-jump exhibited greater peak proximal tibia anterior and lateral shear forces, and peak posterior and vertical ground reaction forces during the landing phase than the double-leg stop-jump task. Single-leg stop-jump exhibited smaller hip flexion angle, knee flexion angle, and knee flexion angular velocity at initial foot contact with the ground. Single-leg stop-jump exhibited greater peak knee extension and valgus moment during the landing phase than the double-leg stop-jump task. Single-leg stop-jump extended the hip joint at initial foot contact with the ground. PMID:24149308
Howes, A P; Vedishcheva, N M; Samoson, A; Hanna, J V; Smith, M E; Holland, D; Dupree, R
2011-07-07
It is shown, using the important technological glass Pyrex® as an example, that 1D and 2D (11)B Double-Rotation (DOR) NMR experiments, in combination with thermodynamic modelling, are able to provide unique structural information about complex glasses. (11)B DOR NMR has been applied to Pyrex® glass in order to remove both dipolar and quadrupolar broadening of the NMR lines, leading to high resolution spectra that allow unambiguous, accurate peak fitting to be carried out, of particular importance in the case of the 3-coordinated [BO(3)] (B3) trigonal planar environments. The data obtained are of sufficient quality that they can be used to test the distributions of borate and borosilicate superstructural units predicted by the thermodynamics-based Model of Associated Solutions. The model predicts the dominant boron-containing chemical groupings in Pyrex® glass to be those associated with B(2)O(3) and sodium tetraborate (with smaller amounts of sodium triborate, sodium diborate, sodium pentaborate, danburite and reedmergnerite). Excellent agreement is found between model and experiment provided the (11)B peaks with isotropic chemical shifts of -1.4 ppm and 0.5 ppm are assigned to B4 species from borosilicate units ([B(OSi)(4)] and [B(OSi)(3)(OB)]) and borate superstructural units (mainly triborate rings with some pentaborate and diborate) respectively. The peaks with isotropic shifts of 14 ppm and 18.1 ppm are then assigned to B3 in borate superstructural units (mainly triborate and pentaborate along with connecting B3) and boroxol rings respectively. The assignments of the DOR NMR peaks, are supported by the presence of cross-peaks in (11)B spin-diffusion DOR NMR spectra which can be used to develop a structural model in which B(2)O(3)-like regions are linked, via borate and borosilicate superstructural units, to the majority silica network. Pyrex® is thus shown to have a heterogeneous structure, with distinct molecular groupings that are far removed from a random distribution of network polyhedra with only short-range order. This journal is © the Owner Societies 2011
NASA Astrophysics Data System (ADS)
Soszka, W.
1992-09-01
Energy spectra of 5 keV Ne+ and He+ ions backscattered from the cold (100) nickel surface for chosen values of the incidence angles were measured. It was found that the occurrence of the isotope structure of the so-called "single-scattering" peak as well as its position on the energy scale depend on the incidence angle and the target temperature. In comparison to the case of room temperature the "ICISS curve" (the intensity of the single-scattering peak versus the incidence angle) at low temperatures increases up to relatively large angles. The curve in its part shows some structure which is not observed at room temperatures. It has been shown [E.S. Parilis et al., Atomic Collisions in Gases and on Solid Surfaces (FAN, Tashkent, 1988) in Russian] that the doubly scattered ions can have the same energy and exit angle as the singly scattered ions and both components create the quasi-single-scattering peak. The double-scattering component depends in a complex manner on the incidence angle and the target temperature. It is shown that at low temperatures (below 80 K) the intensity of the single-scattering component decreases (a decrease of thermal cross section), and the intensity of the double-scattering component relatively increases. This determines the behaviour of the ICISS curve, which, for low temperatures and light projectiles cannot be treated as a real ICISS curve.
Active multiple plasmon-induced transparencies with detuned asymmetric multi-rectangle resonators
NASA Astrophysics Data System (ADS)
Liu, Dongdong; Wang, Jicheng; Lu, Jian
2016-11-01
The phenomenon of plasmon-induced transparency (PIT) is realized in surface plasmon polariton waveguide at the visible and near-infrared ranges. By adding one and two resonant cavities, the PIT peak(s) was (were) achieved due to destructive interference between the side-coupled rectangle cavity and the bus waveguide. The proposed structures were demonstrated by the finite element method. The simulation results showed that for three rectangle resonators system, not only can we manipulate each single PIT window, but also the double PIT windows simultaneously by adjusting one of the geometrical parameters of the system; for four rectangle resonators system, by changing the widths, the lengths and the refractive index of three cavities simultaneously, we would realize treble PIT peaks and induce an off-to-on PIT optical response. Our novel plasmonic structures and the findings pave the way for new design and engineering of highly integrated optical circuit such as nanoscale optical switching, nanosensor and wavelength-selecting nanostructure.
NASA Astrophysics Data System (ADS)
Zhong, Jin-Rong; Zeng, Xin-Yang; Zhou, Feng-He; Ran, Qi-Dong; Sun, Chang-Yu; Zhong, Rui-Qin; Yang, Lan-Ying; Chen, Guang-Jin; Koh, Carolyn A.
2016-12-01
The hydrate structure type and dissociation behavior for pure methane and methane-ethane hydrates at temperatures below the ice point and atmospheric pressure were investigated using in situ Raman spectroscopic analysis. The self-preservation effect of sI methane hydrate is significant at lower temperatures (268.15 to 270.15 K), as determined by the stable C-H region Raman peaks and AL/AS value (Ratio of total peak area corresponding to occupancies of guest molecules in large cavities to small cavities) being around 3.0. However, it was reduced at higher temperatures (271.15 K and 272.15 K), as shown from the dramatic change in Raman spectra and fluctuations in AL/AS values. The self-preservation effect for methane-ethane double hydrate is observed at temperatures lower than 271.15 K. The structure transition from sI to sII occurred during the methane-ethane hydrate decomposition process, which was clearly identified by the shift in peak positions and the change in relative peak intensities at temperatures from 269.15 K to 271.15 K. Further investigation shows that the selectivity for self-preservation of methane over ethane leads to the structure transition; this kind of selectivity increases with decreasing temperature. This work provides new insight into the kinetic behavior of hydrate dissociation below the ice point.
Experimental study on pore structure and performance of sintered porous wick
NASA Astrophysics Data System (ADS)
He, Da; Wang, Shufan; Liu, Rutie; Wang, Zhubo; Xiong, Xiang; Zou, Jianpeng
2018-02-01
Porous wicks were prepared via powder metallurgy using NH4HCO3 powders as pore-forming agent. The pore-forming agent particle size was varied to control the pore structure and equivalent pore size distribution feature of porous wick. The effect of pore-forming agent particle size on the porosity, pore structures, equivalent pore size distribution and capillary pumping performance were investigated. Results show that with the particle size of pore-forming agent decrease, the green density and the volume shrinkage of the porous wicks gradually increase and the porosity reduces slightly. There are two types of pores inside the porous wick, large-sized prefabricated pores and small-sized gap pores. With the particle size of pore-forming agent decrease, the size of the prefabricated pores becomes smaller and the distribution tends to be uniform. Gap pores and prefabricated pores inside the wick can make up different types of pore channels. The equivalent pore size of wick is closely related to the structure of pore channels. Furthermore, the equivalent pore size distribution of wick shows an obvious double-peak feature when the pore-forming agent particle size is large. With the particle size of pore-forming agent decrease, the two peaks of equivalent pore size distribution approach gradually to each other, resulting in a single-peak feature. Porous wick with single-peak feature equivalent pore size distribution possesses the better capillary pumping performances.
Sequential Double lonization: The Timing of Release
NASA Astrophysics Data System (ADS)
Pfeiffer, A.
2011-05-01
The timing of electron release in strong field double ionization poses great challenges both for conceptual definition and for conducting experimental measurement. Here we present coincidence momentum measurements of the doubly charged ion and of the two electrons arising from double ionization of Argon using elliptically (close to circularly) polarized laser pulses. Based on a semi-classical model, the ionization times are calculated from the measured electron momenta across a large intensity range. Exploiting the attoclock technique we have direct access to timings on a coarse and on a fine scale, similar to the hour and the minute hand of a clock. In our attoclock, the magnitude of the electron momenta follows the envelope of the laser pulse and gives a coarse timing for the electron releases (the hour hand), while the fine timing (the minute hand) is provided by the emission angle of the electrons. The first of our findings is that due to depletion the averaged ionization time moves towards the beginning of the pulse with increasing intensity, confirming the results of Maharjan et al., and that the ion momentum distribution projected onto the minor polarization axis shows a bifurcation from a 3-peak to a 4-peak structure. This effect can be fully understood by modeling the process semi-classically in the independent electron approximation following the simple man's model. The ionization time measurement performed with the attoclock shows that the release time of the first electron is in good agreement with the semi-classical simulation performed on the basis of Sequential Double lonization (SDI), whereas the ionization of the second electron occurs significantly earlier than predicted. This observation suggests that electron correlation and other Non-Sequential Double lonization (NSDI) mechanisms may play an important role also in the case of strong field double ionization by close-to-circularly polarized laser pulses. The timing of electron release in strong field double ionization poses great challenges both for conceptual definition and for conducting experimental measurement. Here we present coincidence momentum measurements of the doubly charged ion and of the two electrons arising from double ionization of Argon using elliptically (close to circularly) polarized laser pulses. Based on a semi-classical model, the ionization times are calculated from the measured electron momenta across a large intensity range. Exploiting the attoclock technique we have direct access to timings on a coarse and on a fine scale, similar to the hour and the minute hand of a clock. In our attoclock, the magnitude of the electron momenta follows the envelope of the laser pulse and gives a coarse timing for the electron releases (the hour hand), while the fine timing (the minute hand) is provided by the emission angle of the electrons. The first of our findings is that due to depletion the averaged ionization time moves towards the beginning of the pulse with increasing intensity, confirming the results of Maharjan et al., and that the ion momentum distribution projected onto the minor polarization axis shows a bifurcation from a 3-peak to a 4-peak structure. This effect can be fully understood by modeling the process semi-classically in the independent electron approximation following the simple man's model. The ionization time measurement performed with the attoclock shows that the release time of the first electron is in good agreement with the semi-classical simulation performed on the basis of Sequential Double lonization (SDI), whereas the ionization of the second electron occurs significantly earlier than predicted. This observation suggests that electron correlation and other Non-Sequential Double lonization (NSDI) mechanisms may play an important role also in the case of strong field double ionization by close-to-circularly polarized laser pulses. In collaboration with C. Cirelli and M. Smolarski, Physics Department, ETH Zurich, 8093 Zurich, Switzerland; R. Doerner, Institut fiir Kernphysik, Johann Wolfgang Goethe Universitat, 60438 Frankfurt am Main, Germany; and U. Keller, ETH Zurich.
A case against an X-shaped structure in the Milky Way young bulge
NASA Astrophysics Data System (ADS)
López-Corredoira, Martín
2016-09-01
Context. A number of recent papers have claimed the discovery of an X-shape structure in the bulge of our Galaxy in the population of the red clumps. Aims: We endeavor to analyze the stellar density of bulge stars in the same regions using a different stellar population that is characteristic of the young bulge (≲ 5 Gyr). Particularly, we use F0-F5 main-sequence stars with distances derived through photometric parallax. Methods: We extract these stars from extinction-corrected color-magnitude diagrams in the near-infrared of VISTA-VVV data in some bulge regions and calculate the densities along the line of sight. We take the uncertaintity in the photometric parallax and the contamination of other sources into account, and we see that these errors do not avoid the detection of a possible double peak along some lines of sight as expected for a X-shape bulge if it existed. Results: Only a single peak in the density distribution along the line of sight is observed, so apparently there is no X-shape structure for this population of stars. Nonetheless, the effects of the dispersion of absolute magnitudes in the selected population might be an alternative explanation, although in principle these effects are insufficient to explain this lack of double peak according to our calculations. Conclusions: The results of the present paper do not demonstrate that previous claims of X-shaped bulge using only red clump stars are incorrect, but there are apparently some puzzling questions if we want to maintain the validity of both the red-clump results and the results of this paper.
Polarized micro Raman spectroscopy of bilayer graphene
NASA Astrophysics Data System (ADS)
Moon, Hyerim; Yoon, Duhee; Son, Young-Woo; Cheong, Hyeonsik
2009-03-01
The frequency of Raman 2D band of the graphite depends on the excitation laser energy. This phenomenon is explained with double resonance Raman process. In polarized micro-Raman spectroscopy of single layer graphene, Raman G band (˜1586 cm-1) is isotropic, and 2D band (˜2686 cm-1) strongly depends on relative polarizations of the incident and scattered photons. This strong polarization dependence originates from inhomogeneous optical absorption and emission mediated by resonant electron-phonon interaction. In bi-layer graphene, Raman 2D band can be decomposed into four Lorenztian peaks which can be interpreted in terms of the four transition paths in the double resonance Raman process. We investigated the polarization dependence of each Lorenztian peak in the Raman 2D band of bi-layer graphene for different excitation laser energies. Strong polarization dependence of the Raman 2D band, similar to the case of single layer graphene, is observed. The excitation energy dependence of the polarized Raman scattering is analyzed in terms of the band structure of bi-layer graphene.
Wang, Bin; Wang, Xiaokai; Hua, Lin; Li, Juanjuan; Xiang, Qing
2017-04-01
Electromagnetic acoustic resonance (EMAR) is a considerable method to determine the mean grain size of the metal material with a high precision. The basic ultrasonic attenuation theory used for the mean grain size detection of EMAR is come from the single phase theory. In this paper, the EMAR testing was carried out based on the ultrasonic attenuation theory. The detection results show that the double peaks phenomenon occurs in the EMAR testing of DP590 steel plate. The dual phase structure of DP590 steel is the inducement of the double peaks phenomenon in the EMAR testing. In reaction to the phenomenon, a corrected method with EMAR was put forward to detect the mean grain size of dual phase steel. Compared with the traditional attenuation evaluation method and the uncorrected method with EMAR, the corrected method with EMAR shows great effectiveness and superiority for the mean grain size detection of DP590 steel plate. Copyright © 2016. Published by Elsevier B.V.
NASA Astrophysics Data System (ADS)
Oguri, Katsuya; Mashiko, Hiroki; Ogawa, Tatsuya; Hanada, Yasutaka; Nakano, Hidetoshi; Gotoh, Hideki
2018-04-01
We demonstrate the generation of ultrabroad bandwidth attosecond continua extending to sub-50-as duration in the extreme ultraviolet (EUV) region based on a 1.6-cycle Ti:sapphire laser pulse. The combination of the amplitude gating scheme with a sub-two-cycle driver pulse and the double optical gating scheme achieves the continuum generation with a bandwidth of 70 eV at the full width at half maximum near the peak photon energy of 140 eV, which supports a Fourier-transform-limited pulse duration as short as 32 as. The carrier-envelope-phase (CEP) dependence of the attosecond continua shows a single-peak structure originating from the half-cycle cut-off at appropriate CEP values, which strongly indicates the generation of a single burst of an isolated attosecond pulse. Our approach suggests a possibility for isolated sub-50-as pulse generation in the EUV region by compensating for the intrinsic attosecond chirp with a Zr filter.
FOUR DUAL AGN CANDIDATES OBSERVED WITH THE VLBA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gabányi, K. É.; Frey, S.; An, T.
According to hierarchical structure formation models, merging galaxies are expected to be seen in different stages of coalescence. However, there are currently no straightforward observational methods to either select or to confirm a large number of dual active galactic nucleus (AGN) candidates. Most attempts involve obtaining a better understanding of double-peaked narrow emission line sources, in order to distinguish the objects for which the emission lines originate from narrow-line kinematics or jet-driven outflows, from those which might harbor dual AGNs. We observed four such candidate sources with the Very Long Baseline Array (VLBA), at 1.5 GHz with a ∼10 masmore » angular resolution, for which the spectral profiles of AGN optical emission suggested the existence of dual AGNs. In SDSS J210449.13–000919.1 and SDSS J23044.82–093345.3 the radio structures are aligned with the optical emission features, thus the double-peaked emission lines might be the results of jet-driven outflows. In the third detected source SDSS J115523.74+150756.9, the radio structure is less extended and is oriented nearly perpendicular to the position angle derived from optical spectroscopy. The fourth source remained undetected with the VLBA, but it was imaged with the Very Large Array at arcsec resolution a few months before our observations, suggesting the existence of an extended radio structure. We did not detect two radio-emitting cores in any of the four sources, a convincing signature of duality.« less
Höhm, Sandra; Rosenfeld, Arkadi; Krüger, Jörg; Bonse, Jörn
2015-10-05
Single- and two-color double-fs-pulse experiments were performed on titanium to study the dynamics of the formation of laser-induced periodic surface structures (LIPSS). A Mach-Zehnder inter-ferometer generated polarization controlled (parallel or cross-polarized) double-pulse sequences in two configurations - either at 800 nm only, or at 400 and 800 nm wavelengths. The inter-pulse delays of the individual 50-fs pulses ranged up to some tens of picoseconds. Multiple of these single- or two-color double-fs-pulse sequences were collinearly focused by a spherical mirror to the sample surface. In both experimental configurations, the peak fluence of each individual pulse was kept below its respective ablation threshold and only the joint action of both pulses lead to the formation of LIPSS. Their resulting characteristics were analyzed by scanning electron microscopy and the periods were quantified by Fourier analyses. The LIPSS periods along with the orientation allow a clear identification of the pulse which dominates the energy coupling to the material. A plasmonic model successfully explains the delay-dependence of the LIPSS on titanium and confirms the importance of the ultrafast energy deposition stage for LIPSS formation.
Fröhlich, Felix; Ernst, Arne; Strübing, Ira; Basta, Dietmar; Gröschel, Moritz
2017-12-01
A correlation between noise-induced apoptosis and cell loss has previously been shown after a single noise exposure in the cochlear nucleus, inferior colliculus, medial geniculate body (MGB) and primary auditory cortex (AI). However, repeated noise exposure is the most common situation in humans and a major risk factor for the induction of noise-induced hearing loss (NIHL). The present investigation measured cell death pathways using terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) in the dorsal, medial and ventral MGB (dMGB, mMGB and vMGB) and six layers of the AI (AI-1 to AI-6) in mice (NMRI strain) after a second noise exposure (double-exposure group). Therefore, a single noise exposure group has been investigated 7 (7-day-group-single) or 14 days (14-day-group-single) after noise exposure (3 h, 5-20 kHz, 115 dB SPL peak-to-peak). The double-exposure group received the same noise trauma for a second time 7 days after the initial exposure and was either TUNEL-stained immediately (7-day-group-double) or 1 week later (14-day-group-double) and data were compared to the corresponding single-trauma group as well as to an unexposed control group. It was shown that TUNEL increased immediately after the second noise exposure in AI-3 and stayed upregulated in the 14-day-group-double. A significant increase in TUNEL was also seen in the 14-day-group-double in vMGB, mMGB and AI-1. The present results show for the first time the influence of a repeated noise trauma on cell death mechanisms in thalamic and cortical structures and might contribute to the understanding of pathophysiological findings and psychoacoustic phenomena accompanying NIHL.
Understanding the double peaked El Niño in coupled GCMs
NASA Astrophysics Data System (ADS)
Graham, Felicity S.; Wittenberg, Andrew T.; Brown, Jaclyn N.; Marsland, Simon J.; Holbrook, Neil J.
2017-03-01
Coupled general circulation models (CGCMs) simulate a diverse range of El Niño-Southern Oscillation behaviors. "Double peaked" El Niño events—where two separate centers of positive sea surface temperature (SST) anomalies evolve concurrently in the eastern and western equatorial Pacific—have been evidenced in Coupled Model Intercomparison Project version 5 CGCMs and are without precedent in observations. The characteristic CGCM double peaked El Niño may be mistaken for a central Pacific warming event in El Niño composites, shifted westwards due to the cold tongue bias. In results from the Australian Community Climate and Earth System Simulator coupled model, we find that the western Pacific warm peak of the double peaked El Niño event emerges due to an excessive westward extension of the climatological cold tongue, displacing the region of strong zonal SST gradients towards the west Pacific. A coincident westward shift in the zonal current anomalies reinforces the western peak in SST anomalies, leading to a zonal separation between the warming effect of zonal advection (in the west Pacific) and that of vertical advection (in the east Pacific). Meridional advection and net surface heat fluxes further drive growth of the western Pacific warm peak. Our results demonstrate that understanding historical CGCM El Niño behaviors is a necessary precursor to interpreting projections of future CGCM El Niño behaviors, such as changes in the frequency of eastern Pacific El Niño events, under global warming scenarios.
NASA Astrophysics Data System (ADS)
Bouras, I.; El, A.; Fochler, O.; Lauciello, F.; Reining, F.; Uphoff, J.; Wesp, C.; Molnar, E.; Niemi, H.; Xu, Z.; Greiner, C.
2011-01-01
Employing a microscopic transport model we investigate the evolution of high energetic jets moving through a viscous medium. For the scenario of an unstoppable jet we observe a clearly strong collective behavior for a low dissipative system η/s approx 0.005, leading to the observation of cone-like structures. Increasing the dissipation of the system to η/s approx 0.32 the Mach Cone structure vanishes. Furthermore, we investigate jet-associated particle correlations. A double-peak structure, as observed in experimental data, is even for low-dissipative systems not supported, because of the large influence of the head shock.
DOUBLE-PEAKED NARROW-LINE ACTIVE GALACTIC NUCLEI. II. THE CASE OF EQUAL PEAKS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Smith, K. L.; Shields, G. A.; Salviander, S.
Active galactic nuclei (AGNs) with double-peaked narrow lines (DPAGNs) may be caused by kiloparsec-scale binary AGNs, bipolar outflows, or rotating gaseous disks. We examine the class of DPAGNs in which the two narrow-line components have closely similar intensity as being especially likely to involve disks or jets. Two spectroscopic indicators support this likelihood. For DPAGNs from Smith et al., the 'equal-peaked' objects (EPAGNs) have [Ne V]/[O III]ratios lower than for a control sample of non-double-peaked AGNs. This is unexpected for a pair of normal AGNs in a galactic merger, but may be consistent with [O III] emission from a rotatingmore » ring with relatively little gas at small radii. Also, [O III]/H{beta} ratios of the redshifted and blueshifted systems in the EPAGN are more similar to each other than in a control sample, suggestive of a single ionizing source and inconsistent with the binary interpretation.« less
Vertical transport in graphene-hexagonal boron nitride heterostructure devices
Bruzzone, Samantha; Logoteta, Demetrio; Fiori, Gianluca; Iannaccone, Giuseppe
2015-01-01
Research in graphene-based electronics is recently focusing on devices based on vertical heterostructures of two-dimensional materials. Here we use density functional theory and multiscale simulations to investigate the tunneling properties of single- and double-barrier structures with graphene and few-layer hexagonal boron nitride (h-BN) or hexagonal boron carbon nitride (h-BC2N). We find that tunneling through a single barrier exhibit a weak dependence on energy. We also show that in double barriers separated by a graphene layer we do not observe resonant tunneling, but a significant increase of the tunneling probability with respect to a single barrier of thickness equal to the sum of the two barriers. This is due to the fact that the graphene layer acts as an effective phase randomizer, suppressing resonant tunneling and effectively letting a double-barrier structure behave as two single-barriers in series. Finally, we use multiscale simulations to reproduce a current-voltage characteristics resembling that of a resonant tunneling diode, that has been experimentally observed in single barrier structure. The peak current is obtained when there is perfect matching between the densities of states of the cathode and anode graphene regions. PMID:26415656
NASA Astrophysics Data System (ADS)
Dewaide, Lorraine; Collon, Pauline; Poulain, Amaël; Rochez, Gaëtan; Hallet, Vincent
2018-03-01
The existence of double-peaked breakthrough curves (BTC), which are the result of the transport of a dye tracer through underground lakes, is reported. Investigations were undertaken on the Furfooz karst system in southern Belgium. In this system, the River Lesse sinks partially into a swallow hole. The water follows a solitary conduit leading to an underground lake that is directly connected to a second underground lake. Double-peaked BTCs were detected in the resurgent water, downstream of this second lake. The report first describes field data (tracer tests in various hydrologic conditions) which point towards the double peak being linked to a nonlinear process that originates within the lakes. Complementary investigations within the lakes show a complex behavior of the dye tracer related to a specific hydrodynamic feature that leads to the separation of the solute plume. A conceptual model of the solute transport within the lakes is proposed. This model emphasizes the physical effect of the lakes on the dye flow-through process.
Double-spiral magnetic structure of the Fe/Cr multilayer revealed by nuclear resonance reflectivity
NASA Astrophysics Data System (ADS)
Andreeva, M. A.; Baulin, R. A.; Chumakov, A. I.; Rüffer, R.; Smirnov, G. V.; Babanov, Y. A.; Devyaterikov, D. I.; Milyaev, M. A.; Ponomarev, D. A.; Romashev, L. N.; Ustinov, V. V.
2018-01-01
We have studied the magnetization depth profiles in a [57Fe (dFe) /Cr (dCr) ]30 multilayer with ultrathin Fe layers and nominal thickness of the chromium spacers dCr≈2.0 nm using nuclear resonance scattering of synchrotron radiation. The presence of a broad pure-magnetic half-order (1/2) Bragg reflection has been detected at zero external field. The joint fit of the reflectivity curves and Mössbauer spectra of reflectivity measured near the critical angle and at the "magnetic" peak reveals that the magnetic structure of the multilayer is formed by two spirals, one in the odd and another one in the even iron layers, with the opposite signs of rotation. The double-spiral structure starts from the surface with the almost-antiferromagnetic alignment of the adjacent Fe layers. The rotation of the two spirals leads to nearly ferromagnetic alignment of the two magnetic subsystems at some depth, where the sudden turn of the magnetic vectors by ˜180∘ (spin flop) appears, and both spirals start to rotate in opposite directions. The observation of this unusual double-spiral magnetic structure suggests that the unique properties of giant magnetoresistance devices can be further tailored using ultrathin magnetic layers.
The effect of external magnetic field on the Raman peaks in manganites
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sahu, A. K., E-mail: ajitsahu@seemantaengg.ac.in; Rout, G. C.
2014-04-24
We report here a microscopic theoretical model study exhibiting the effect of external magnetic field on the Raman excitation peaks in the CMR manganite system. The Hamiltonian consists of Jahn-Teller (J-T) distortion in e{sub g} band, the double exchange interaction and the Heisenberg spin-spin interaction. Further the phonons are coupled to e{sub g} band electrons, J-T distorted e{sub g} band and the double exchange interaction. The Raman spectral intensity is calculated from the imaginary part of the phonon Green function. The spectra exhibits three peaks besides a very weak high energy peak. The magnetic field effect on these peaks aremore » reported.« less
The 640 × 512 LWIR type-II superlattice detectors operating at 110 K
NASA Astrophysics Data System (ADS)
Tan, Bi-Song; Zhang, Chuan-Jie; Zhou, Wen-Hong; Yang, Xiao-Jie; Wang, Guo-Wei; Li, Yun-Tao; Ding, Yan-Yan; Zhang, Zhou; Lei, Hua-Wei; Liu, Wei-Hua; Du, Yu; Zhang, Li-Fang; Liu, Bin; Wang, Li-Bao; Huang, Li
2018-03-01
The type-II InAs/GaSb superlattices (T2SLs)-based 640 × 512 long wavelength infrared (LWIR) Focal Plane Array (FPA) detector with15 μm pitch and 50% cut-off wavelength of 10.5 μm demonstrates a peak quantum efficiency of 38.6% and peak detectivity of 1.65 × 1011 cm Hz1/2 W-1 at 8.1 μm, high pixel operability of 99.5% and low responsivity non-uniformity of 2.69% at 80 K. The FPA exhibits clear infrared imaging at 110 K and diffusion-limited dark current densities below Tennant's 'Rule07' at temperature above 100 K, which is attributed to the efficient suppression of diffusion dark current and surface leak current by introducing M-structure barrier and double hetero-structure passivation layers.
Dual-Wavelength InGaAsSb/AlGaAsSb Quantum-Well Light-Emitting Diodes
NASA Astrophysics Data System (ADS)
Nguyen, Tien Dai; Hwang, Jehwan; Kim, Yeongho; Kim, Eui-Tae; Kim, Jun Oh; Lee, Sang Jun
2018-05-01
We have investigated the structural characteristics and the device performance of three-stack InGaAsSb/AlGaAsSb quantum-well (QW) light-emitting diodes (LEDs) grown by using molecular beam epitaxy. The QW LED structure with an 8-nm well thickness had a single peak emission wavelength of 2.06 μm at an injection current of 0.3 A at room temperature. However, the QWLEDs with three different well thicknesses of 5-, 10-, and 15-nm had double peak emission wavelengths of 1.97 and 2.1 μm at an injection current of 1.1 A, which were associated with the radiative recombination in the QW with a 5-nm well thickness and the overlapped emission from the QWs with 10- and 15-nm well thicknesses, respectively.
Muñoz-García, Ana Belén; Seijo, Luis
2011-02-10
The atomistic structure, energetics, and electronic structure of single-substitutional Ce and La defects and double-substitutional Ce-La defects in Ce,La-codoped yttrium aluminum garnet (YAG) Y(3)Al(5)O(12) have been studied by means of first-principles periodic boundary conditions density functional theory calculations. Single substitution of Y by Ce or by La produces atomistic expansions around the impurities, which are significantly smaller than the ionic radii mismatches and the overall lattice distortions are found to be confined within their second coordination spheres. In double-substitutional defects, the impurities tend to be as close as possible. La-codoping Ce:YAG provokes an anisotropic expansion around Ce defects. The Ce impurity introduces 4f occupied states in the 5.0 eV computed gap of YAG, peaking 0.25 eV above the top of the valence band, and empty 4f, 5d, and 6s states starting at 3.8 eV in the gap and spreading over the conduction band. La-codoping produces very small effects on the electronic structure of Ce:YAG, the most visible one being the decrease in covalent bonding with one of the oxygen atoms, which shifts 0.05 Å away from Ce and gets 0.04 Å closer to La in the most stable Ce-La double-substitutional defect.
A DOUBLE-PEAKED OUTBURST OF A 0535+26 OBSERVED WITH INTEGRAL, RXTE, AND SUZAKU
DOE Office of Scientific and Technical Information (OSTI.GOV)
Caballero, I.; Pottschmidt, K.; Marcu, D. M.
2013-02-20
The Be/X-ray binary A 0535+26 showed a normal (type I) outburst in 2009 August. It is the fourth in a series of normal outbursts associated with the periastron, but is unusual because it presented a double-peaked light curve. The two peaks reached a flux of {approx}450 mCrab in the 15-50 keV range. We present results of the timing and spectral analysis of INTEGRAL, RXTE, and Suzaku observations of the outburst. The energy-dependent pulse profiles and their evolution during the outburst are studied. No significant differences with respect to other normal outbursts are observed. The centroid energy of the fundamental cyclotronmore » line shows no significant variation during the outburst. A spectral hardening with increasing luminosity is observed. We conclude that the source is accreting in the sub-critical regime. We discuss possible explanations for the double-peaked outburst.« less
Hardening Mechanisms of Silicon Nanospheres: A Molecular Dynamics Study
2011-05-01
in single oxide system 111 Figure 5.9 Dislocation motion in double oxide systems 112 x Figure 5.10 Dislocation response to incremental...addressed as no single dislocation loops were ever separated and no diffraction peaks indicative of the -Sn phase were observed. The load vs. displacement...as the diamond cubic structure has angle dependent covalent bonds. Therefore, other potentials have been 20 developed that model the
NASA Astrophysics Data System (ADS)
Yang, Zhenqing; Shao, Di; Li, Juan; Tang, Lian; Shao, Changjin
2018-05-01
In this work, we designed a series of butterfly type organic dyes, named ME07-ME13 by introducing such as triphenylamine, phenothiazine, coumarin groups etc. as electron donors and further investigated their absorption spectra using density functional theory (DFT) and time-dependent DFT (TDDFT). All designed dyes cover the entire visible absorption spectrum from 300 to 800 nm. It's fascinating that ME13 molecule has two absorption peak and the molar coefficient of two absorption peaks are above 4.645 × 104 M-1·cm-1. The light absorption area of ME13 exhibits an increment of 16.5-19.1% compared to ME07-ME12. Furthermore, we performed a detailed analysis on their geometrical and electronic properties, including molecular structures, energy levels, light harvesting efficiency (LHE), driving force (ΔGinject), regeneration (ΔGregen),electron dipole moments (μnormal), intermolecular electron transfer and dye/(TiO2)38 system electron transitions. The results of calculation reveal that double coumarin donors in ME13 are promising functional groups for butterfly type organic dye sensitizers. It is expected that the design of double donors can provide a new strategy and guidance for the investigation in high efficiency dye-sensitized devices.
Double-peaked Emission Lines Due to a Radio Outflow in KISSR 1219
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kharb, P.; Vaddi, S.; Subramanian, S.
We present the results from 1.5 and 5 GHz phase-referenced VLBA and 1.5 GHz Karl G. Jansky Very Large Array (VLA) observations of the Seyfert 2 galaxy KISSR 1219, which exhibits double-peaked emission lines in its optical spectrum. The VLA and VLBA data reveal a one-sided core-jet structure at roughly the same position angles, providing evidence of an active galactic nucleus outflow. The absence of dual parsec-scale radio cores puts the binary black-hole picture in doubt for the case of KISSR 1219. The high brightness temperatures of the parsec-scale core and jet components (>10{sup 6} K) are consistent with thismore » interpretation. Doppler boosting with jet speeds of ≳0.55 c to ≳0.25 c , going from parsec to kiloparsec scales, at a jet inclination ≳50° can explain the jet one-sidedness in this Seyfert 2 galaxy. A blueshifted broad emission line component in [O iii] is also indicative of an outflow in the emission line gas at a velocity of ∼350 km s{sup −1}, while the [O i] doublet lines suggest the presence of shock-heated gas. A detailed line ratio study using the MAPPINGS III code further suggests that a shock+precursor model can explain the line ionization data well. Overall, our data suggest that the radio outflow in KISSR 1219 is pushing the emission line clouds, both ahead of the jet and in a lateral direction, giving rise to the double peak emission line spectra.« less
Resonant Tunneling in Photonic Double Quantum Well Heterostructures.
Cox, Joel D; Singh, Mahi R
2010-01-30
Here, we study the resonant photonic states of photonic double quantum well (PDQW) heterostructures composed of two different photonic crystals. The heterostructure is denoted as B/A/B/A/B, where photonic crystals A and B act as photonic wells and barriers, respectively. The resulting band structure causes photons to become confined within the wells, where they occupy discrete quantized states. We have obtained an expression for the transmission coefficient of the PDQW heterostructure using the transfer matrix method and have found that resonant states exist within the photonic wells. These resonant states occur in split pairs, due to a coupling between degenerate states shared by each of the photonic wells. It is observed that when the resonance energy lies at a bound photonic state and the two photonic quantum wells are far away from each other, resonant states appear in the transmission spectrum of the PDQW as single peaks. However, when the wells are brought closer together, coupling between bound photonic states causes an energy-splitting effect, and the transmitted states each have two peaks. Essentially, this means that the system can be switched between single and double transparent states. We have also observed that the total number of resonant states can be controlled by varying the width of the photonic wells, and the quality factor of transmitted peaks can be drastically improved by increasing the thickness of the outer photonic barriers. It is anticipated that the resonant states described here can be used to develop new types of photonic-switching devices, optical filters, and other optoelectronic devices.
A NON-PRE DOUBLE-PEAKED BURST FROM 4U 1636-536: EVIDENCE FOR BURNING FRONT PROPAGATION
NASA Technical Reports Server (NTRS)
Bhattacharyya, Sudip; Strohmayer, Tod E.
2005-01-01
We analyse Rossi X-ray Timing Explorer (RXTE) Proportional Counter Array (PCA) data of a double-peaked burst from the low mass X-ray binary (LMXB) 4U 1636-536 that shows no evidence for photospheric radius expansion (PRE). We find that the X-ray emitting area on the star increases with time as the burst progresses, even though the photosphere does not expand. We argue that this is a strong indication of thermonuclear flame spreading on the stellar surface during such bursts. We propose a model for such double-peaked bursts, based on thermonuclear flame spreading, that can qualitatively explain their essential features, as well as the rarity of these bursts.
NASA Astrophysics Data System (ADS)
Kyutt, R. T.
2017-04-01
The shape of X-ray diffraction epitaxial layers with high dislocation densities has been studied experimentally. Measurements with an X-ray diffractometer were performed in double- and triple-crystal setups with both Cu K α and Mo K α radiation. Epitaxial layers (GaN, AlN, AlGaN, ZnO, etc.) with different degrees of structural perfection grown by various methods on sapphire, silicon, and silicon carbide substrates have been examined. The layer thickness varied in the range of 0.5-30 μm. It has been found that the center part of peaks is well approximated by the Voigt function with different Lorentz fractions, while the wing intensity drops faster and may be represented by a power function (with the index that varies from one structure to another). A well-marked dependence on the ordering of dislocations was observed. The drop in intensity in the majority of structures with a regular system and regular threading dislocations was close to the theoretically predicted law Δθ-3; the intensity in films with a chaotic distribution decreased much faster. The dependence of the peak shape on the order of reflection, the diffraction geometry, and the epitaxial layer thickness was also examined.
Zhong, Jin-Rong; Zeng, Xin-Yang; Zhou, Feng-He; Ran, Qi-Dong; Sun, Chang-Yu; Zhong, Rui-Qin; Yang, Lan-Ying; Chen, Guang-Jin; Koh, Carolyn A.
2016-01-01
The hydrate structure type and dissociation behavior for pure methane and methane-ethane hydrates at temperatures below the ice point and atmospheric pressure were investigated using in situ Raman spectroscopic analysis. The self-preservation effect of sI methane hydrate is significant at lower temperatures (268.15 to 270.15 K), as determined by the stable C-H region Raman peaks and AL/AS value (Ratio of total peak area corresponding to occupancies of guest molecules in large cavities to small cavities) being around 3.0. However, it was reduced at higher temperatures (271.15 K and 272.15 K), as shown from the dramatic change in Raman spectra and fluctuations in AL/AS values. The self-preservation effect for methane-ethane double hydrate is observed at temperatures lower than 271.15 K. The structure transition from sI to sII occurred during the methane-ethane hydrate decomposition process, which was clearly identified by the shift in peak positions and the change in relative peak intensities at temperatures from 269.15 K to 271.15 K. Further investigation shows that the selectivity for self-preservation of methane over ethane leads to the structure transition; this kind of selectivity increases with decreasing temperature. This work provides new insight into the kinetic behavior of hydrate dissociation below the ice point. PMID:27941857
Zhong, Jin-Rong; Zeng, Xin-Yang; Zhou, Feng-He; Ran, Qi-Dong; Sun, Chang-Yu; Zhong, Rui-Qin; Yang, Lan-Ying; Chen, Guang-Jin; Koh, Carolyn A
2016-12-12
The hydrate structure type and dissociation behavior for pure methane and methane-ethane hydrates at temperatures below the ice point and atmospheric pressure were investigated using in situ Raman spectroscopic analysis. The self-preservation effect of sI methane hydrate is significant at lower temperatures (268.15 to 270.15 K), as determined by the stable C-H region Raman peaks and A L /A S value (Ratio of total peak area corresponding to occupancies of guest molecules in large cavities to small cavities) being around 3.0. However, it was reduced at higher temperatures (271.15 K and 272.15 K), as shown from the dramatic change in Raman spectra and fluctuations in A L /A S values. The self-preservation effect for methane-ethane double hydrate is observed at temperatures lower than 271.15 K. The structure transition from sI to sII occurred during the methane-ethane hydrate decomposition process, which was clearly identified by the shift in peak positions and the change in relative peak intensities at temperatures from 269.15 K to 271.15 K. Further investigation shows that the selectivity for self-preservation of methane over ethane leads to the structure transition; this kind of selectivity increases with decreasing temperature. This work provides new insight into the kinetic behavior of hydrate dissociation below the ice point.
Zhu, Zhihong; Li, Xia; Zeng, Yan; Sun, Wei
2010-06-15
In this paper the direct electrochemistry of double-stranded DNA (dsDNA) was investigated on ordered mesoporous carbon (OMC) modified carbon ionic liquid electrode (CILE). CILE was prepared by mixing graphite powder with 1-ethyl-3-methylimidazolium ethylsulphate ([EMIM]EtOSO(3)) and liquid paraffin. A stable OMC film was formed on the surface of CILE with the help of Nafion to get a modified electrode denoted as Nafion-OMC/CILE. Due to the specific characteristics of OMC and IL present on the electrode surface, the fabricated electrode showed good electrochemical performances to different electroactive molecules. The electrochemical responses of dsDNA were carefully investigated on this electrode with two irreversible oxidation peak appeared at +1.250 V and +0.921 V (vs. SCE), which was corresponding to the oxidation of adenine and guanine residues in dsDNA structure. The electrochemical behaviors of dsDNA were carefully investigated on the Nafion-OMC/CILE. Experimental results indicated that the electron transfer rate was promoted with the increase of the oxidation peak current and the decrease of the oxidation peak potential, which was due to the electrocatalytic ability of OMC on the electrode surface. Under the optimal conditions the oxidation peak current increased with dsDNA concentration in the range of 10.0-600.0 microg mL(-1) by differential pulse voltammetry (DPV) with the detection limit of 1.2 microg mL(-1) (3sigma). Copyright 2010 Elsevier B.V. All rights reserved.
Double peak searches for scalar and pseudoscalar resonances at the LHC
DOE Office of Scientific and Technical Information (OSTI.GOV)
Carena, Marcela; Huang, Peisi; Ismail, Ahmed
2016-12-01
Many new physics models contain a neutral scalar resonance that can be predominantly produced via gluon fusion through loops. In such a case, there could be important effects of additional particles, that in turn may hadronize before decaying and form bound states. This interesting possibility may lead to novel signatures with double peaks that can be searched for at the LHC. We study the phenomenology of double peak searches in diboson final states from loop-induced production and decay of a new neutral spin-0 resonance at the LHC. The loop-induced couplings should be mediated by particles carrying color and electroweak chargemore » that after forming bound states will induce a second peak in the diboson invariant mass spectrum near twice their mass. A second peak could be present via loop-induced couplings into gg (dijet),gamma gamma and Z gamma final states as well as in the WW and ZZ channels for the case of a pseudoscalar resonance or for scalars with suppressed tree-level coupling to gauge bosons« less
Double peak searches for scalar and pseudoscalar resonances at the LHC
DOE Office of Scientific and Technical Information (OSTI.GOV)
Carena, Marcela; Huang, Peisi; Ismail, Ahmed
2016-12-01
Many new physics models contain a neutral scalar resonance that can be predominantly produced via gluon fusion through loops. In such a case, there could be important effects of additional particles, that in turn may hadronize before decaying and form bound states. This interesting possibility may lead to novel signatures with double peaks that can be searched for at the LHC. We study the phenomenology of double peak searches in diboson final states from loop induced production and decay of a new neutral spin-0 resonance at the LHC. The loop-induced couplings should be mediated by particles carrying color and electroweak charge that after forming bound states will induce a second peak in the diboson invariant mass spectrum near twice their mass. As a result, a second peak could be present via loop-induced couplings intomore » $gg$ (dijet), $$\\gamma\\gamma$$ and $$Z\\gamma$$ final states as well as in the $WW$ and $ZZ$ channels for the case of a pseudo-scalar resonance or for scalars with suppressed tree-level coupling to gauge bosons.« less
First resonant tunneling via a light-hole ground state
NASA Astrophysics Data System (ADS)
Lampin, J. F.; Mollot, F.
1998-07-01
We report the demonstration of resonant tunneling of light-holes through an AlAs/GaAs 0.7P 0.3 double-barrier heterostructure. The tensile strain in the quantum well reverses the order of the light- and heavy-hole levels, the first light-hole level becoming the ground state. The I( V) characteristics are measured at different temperatures and compared to those of a standard AlAs/GaAs unstrained structure. The peak current density of the first light-hole resonance and its peak-to-valley current ratio are enhanced. They reach 28 A/cm 2 and 3.4 : 1 at 15 K. A negative differential resistance is observed up to 250 K.
Effect of the depolarization field on coherent optical properties in semiconductor quantum dots
NASA Astrophysics Data System (ADS)
Mitsumori, Yasuyoshi; Watanabe, Shunta; Asakura, Kenta; Seki, Keisuke; Edamatsu, Keiichi; Akahane, Kouichi; Yamamoto, Naokatsu
2018-06-01
We study the photon echo spectrum of self-assembled semiconductor quantum dots using femtosecond light pulses. The spectrum shape changes from a single-peaked to a double-peaked structure as the time delay between the two excitation pulses is increased. The spectrum change is reproduced by numerical calculations, which include the depolarization field induced by the biexciton-exciton transition as well as the conventional local-field effect for the exciton-ground-state transition in a quantum dot. Our findings suggest that various optical transitions in tightly localized systems generate a depolarization field, which renormalizes the resonant frequency with a change in the polarization itself, leading to unique optical properties.
Ma, Yan; Li, Peibo; Chen, Dawei; Fang, Tiezheng; Li, Haitian; Su, Weiwei
2006-01-13
A highly sensitive and specific electrospray ionization (ESI) liquid chromatography-tandem mass spectrometry (LC/MS/MS) method for quantitation of naringenin (NAR) and an explanation for the double peaks phenomenon was developed and validated. NAR was extracted from rat plasma and tissues along with the internal standard (IS), hesperidin, with ethyl acetate. The analytes were analyzed in the multiple-reaction-monitoring (MRM) mode as the precursor/product ion pair of m/z 273.4/151.3 for NAR and m/z 611.5/303.3 for the IS. The assay was linear over the concentration range of 5-2500 ng/mL. The lower limit quantification was 5 ng/mL, available for plasma pharmacokinetics of NAR in rats. Accuracy in within- and between-run precisions showed good reproducibility. When NAR was administered orally, only little and predominantly its glucuronidation were into circulation in the plasma. There existed double peaks phenomenon in plasma concentration-time curve leading to the relatively slow elimination of NAR in plasma. The results showed that there was a linear relationship between the AUC of total NAR and dosages. And the double peaks are mainly due to enterohepatic circulation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ge Junqiang; Hu Chen; Wang Jianmin
Recently, much attention has been paid to double-peaked narrow emission-line (NEL) galaxies, some of which are suggested to be related to merging galaxies. We make a systematic search to build the largest sample of these sources from Data Release 7 of the Sloan Digital Sky Survey (SDSS). With reasonable criteria for fluxes, FWHMs of the emission lines, and separations of the peaks, we select 3030 double-peaked NEL galaxies. In light of the existence of broad Balmer lines and the locations of the two components of double-peaked NELs distinguished by the Kauffmann et al. criteria in the Baldwin-Phillips-Terlevich diagram, we findmore » that there are 81 Type I active galactic nuclei (AGNs), 837 double Type II AGNs (2-Type II), 708 galaxies with double star-forming components (2-SF), 400 with mixed star-forming and Type II AGN components (Type II + SF), and 1004 unknown-type objects. As a by-product, a sample of galaxies (12,582) with asymmetric or top-flat profiles of emission lines is established. After visually inspecting the SDSS images of the two samples, we find 54 galaxies with dual cores. The present samples can be used to study the dynamics of merging galaxies, the triggering mechanism of black hole activity, the hierarchical growth of galaxies, and the dynamics of narrow line regions driven by outflows and a rotating disk.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chojnowski, Grzegorz, E-mail: gchojnowski@genesilico.pl; Waleń, Tomasz; University of Warsaw, Banacha 2, 02-097 Warsaw
2015-03-01
A computer program that builds crystal structure models of nucleic acid molecules is presented. Brickworx is a computer program that builds crystal structure models of nucleic acid molecules using recurrent motifs including double-stranded helices. In a first step, the program searches for electron-density peaks that may correspond to phosphate groups; it may also take into account phosphate-group positions provided by the user. Subsequently, comparing the three-dimensional patterns of the P atoms with a database of nucleic acid fragments, it finds the matching positions of the double-stranded helical motifs (A-RNA or B-DNA) in the unit cell. If the target structure ismore » RNA, the helical fragments are further extended with recurrent RNA motifs from a fragment library that contains single-stranded segments. Finally, the matched motifs are merged and refined in real space to find the most likely conformations, including a fit of the sequence to the electron-density map. The Brickworx program is available for download and as a web server at http://iimcb.genesilico.pl/brickworx.« less
Wang, Wei; Liu, Juan; Sun, Lin
2016-07-01
Protein-DNA bindings are critical to many biological processes. However, the structural mechanisms underlying these interactions are not fully understood. Here, we analyzed the residues shape (peak, flat, or valley) and the surrounding environment of double-stranded DNA-binding proteins (DSBs) and single-stranded DNA-binding proteins (SSBs) in protein-DNA interfaces. In the results, we found that the interface shapes, hydrogen bonds, and the surrounding environment present significant differences between the two kinds of proteins. Built on the investigation results, we constructed a random forest (RF) classifier to distinguish DSBs and SSBs with satisfying performance. In conclusion, we present a novel methodology to characterize protein interfaces, which will deepen our understanding of the specificity of proteins binding to ssDNA (single-stranded DNA) or dsDNA (double-stranded DNA). Proteins 2016; 84:979-989. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
NASA Astrophysics Data System (ADS)
Xia, Y.-Y.; Yuan, R.-Y.; Yang, Q.-J.; Sun, Q.; Zheng, J.; Guo, Y.
In this paper, with the three-band tight-binding model and non-equilibrium Green’s function technique, we investigate spin transport in electric-barrier-modulated Ferromagnetic/Normal/Ferromagnetic (F/N/F) monolayer (ML) zigzag MoS2 nanoribbon junction. The results demonstrate that once the double electric barriers structure emerges, the oscillations of spin conductances become violent, especially for spin-down conductance, the numbers of resonant peaks increase obviously, thus we can obtain 100% spin polarization in the low energy region. It is also found that with the intensity of the exchange field enhancement, the resonant peaks of spin-up and spin-down conductances move in the opposite direction in a certain energy region. As a consequence, the spin-down conductance can be filtered out completely. The findings here indicate that the present structure may be considered as a good candidate for spin filter.
NASA Astrophysics Data System (ADS)
Kvasil, J.; Nesterenko, V. O.; Repko, A.; Kleinig, W.; Reinhard, P.-G.
2016-12-01
The deformation-induced splitting of isoscalar giant monopole resonance (ISGMR) is systematically analyzed in a wide range of masses covering medium, rare-earth, actinide, and superheavy axial deformed nuclei. The study is performed within the fully self-consistent quasiparticle random-phase-approximation method based on the Skyrme functional. Two Skyrme forces, one with a large (SV-bas) and one with a small (SkP) nuclear incompressibility, are considered. The calculations confirm earlier results that, because of the deformation-induced E 0 -E 2 coupling, the isoscalar E 0 resonance attains a double-peak structure and significant energy upshift. Our results are compared with available analytic estimations. Unlike earlier studies, we get a smaller energy difference between the lower and upper peaks and thus a stronger E 0 -E 2 coupling. This in turn results in more pumping of E 0 strength into the lower peak and more pronounced splitting of ISGMR. We also discuss widths of the peaks and their negligible correlation with deformation.
A peculiar low-luminosity short gamma-ray burst from a double neutron star merger progenitor.
Zhang, B-B; Zhang, B; Sun, H; Lei, W-H; Gao, H; Li, Y; Shao, L; Zhao, Y; Hu, Y-D; Lü, H-J; Wu, X-F; Fan, X-L; Wang, G; Castro-Tirado, A J; Zhang, S; Yu, B-Y; Cao, Y-Y; Liang, E-W
2018-01-31
Double neutron star (DNS) merger events are promising candidates of short gamma-ray burst (sGRB) progenitors as well as high-frequency gravitational wave (GW) emitters. On August 17, 2017, such a coinciding event was detected by both the LIGO-Virgo gravitational wave detector network as GW170817 and Gamma-Ray Monitor on board NASA's Fermi Space Telescope as GRB 170817A. Here, we show that the fluence and spectral peak energy of this sGRB fall into the lower portion of the distributions of known sGRBs. Its peak isotropic luminosity is abnormally low. The estimated event rate density above this luminosity is at least [Formula: see text] Gpc -3 yr -1 , which is close to but still below the DNS merger event rate density. This event likely originates from a structured jet viewed from a large viewing angle. There are similar faint soft GRBs in the Fermi archival data, a small fraction of which might belong to this new population of nearby, low-luminosity sGRBs.
Wang, Chunhua; Liu, Chong; Shen, Lifeng; Zhao, Zhiliang; Liu, Bin; Jiang, Hongbo
2016-03-20
In this paper a delicately designed double-passing end-pumped Nd:YVO4 rod amplifier is reported that produces 10.2 W average laser output when seeded by a 6 mW Nd:YVO4 microchip laser at a repetition rate of 70 kHz with pulse duration of 90 ps. A pulse peak power of ∼1.6 MW and pulse energy of ∼143 μJ is achieved. The beam quality is well preserved by a double-passing configuration for spherical-aberration compensation. The laser-beam size in the amplifier is optimized to prevent the unwanted damage from the high pulse peak-power density. This study provides a simple and robust picosecond all-solid-state master oscillator power amplifier system with both high peak power and high beam quality, which shows great potential in the micromachining.
Transition from ideal to viscous Mach cones in a kinetic transport approach
NASA Astrophysics Data System (ADS)
Bouras, I.; El, A.; Fochler, O.; Niemi, H.; Xu, Z.; Greiner, C.
2012-04-01
Using a microscopic transport model we investigate the evolution of conical structures originating from the supersonic projectile moving through the hot matter of ultrarelativistic particles. Using different scenarios for the interaction between projectile and matter, and different transport properties of the matter, we study the formation and structure of Mach cones. Especially, a dependence of the Mach cone angle on the details and rate of the energy deposition from projectile to the matter is investigated. Furthermore, the two-particle correlations extracted from the numerical calculations are compared to an analytical approximation. We find that the propagation of a high energetic particle through the matter does not lead to the appearance of a double peak structure as observed in the ultrarelativistic heavy-ion collision experiments. The reason is the strongly forward-peaked energy and momentum deposition in the head shock region. In addition, by adjusting the cross section we investigate the influence of the viscosity to the structure of Mach cones. A clear and unavoidable smearing of the profile depending on a finite ratio of shear viscosity to entropy density is clearly visible.
Insight into the split and asymmetry of charge distribution in biased M-structure superlattice
NASA Astrophysics Data System (ADS)
Liu, Lu; Bi, Han; Zhao, Yunhao; Zhao, Xuebing; Han, Xi; Wang, Guowei; Xu, Yingqiang; Li, Yuesheng; Che, Renchao
2017-07-01
The charge distribution in real space of an insertion variant based on an InAs/GaSb superlattice for an infrared detector is illustrated by in situ electron microscopy. The localization split of positive charge can be directly observed in the InAs/GaSb/AlSb/GaSb superlattice (M-structure) rather than in the InAs/GaSb superlattice. With the applied bias increasing from 0 to 4.5 V, the double peaks of positive charge density become asymmetrical gradually, with the peak integral ratio ranging from 1.13 to 2.54. Simultaneously, the negative charges move along the direction of the negative electric field. Without inserting the AlSb layer, the charge inversion occurs in both the hole wells and the electron wells of the InAs/GaSb superlattice under high bias. Such a discrepancy between the M-structure superlattice and the traditional superlattice suggests an effective reduction of tunneling probability of the M-structure design. Our result is of great help to understand the carrier immigration mechanism of the superlattice-based infrared detector.
NASA Astrophysics Data System (ADS)
Li, G.; Arnold, L.; Miao, B.; Yan, Y.
2011-12-01
G. Li (1,2), L. Arnold (1), B. Miao (3) and Y. Yan (4) (1) Department of Physics, University of Alabama in Huntsville Huntsville, AL, 35899 (2) CSPAR, University of Alabama in Huntsville Huntsville, AL, 35899 (3) School of Earth and Space Sciences, University of Science and Technology of CHINA, Hefei, China (4) Key Laboratory of Solar Activity, National Astronomical Observatories, Chinese Academy of Science, Beijing 100012, China Current sheets is a common structure in the solar wind and is a significant source of solar wind MHD turbulence intermittency. The origin of these structure is presently unknown. Non-linear interactions of the solar wind MHD turbulence can spontaneously generate these structures. On the other hand, there are proposals that these structures may represent relic structures having solar origins. Using a technique developed in [1], we examine current sheets in the solar wind from multiple spacecraft. We identify the "single-peak" and "double-peak" events in the solar wind and discuss possible scenarios for these events and its implication of the origin of the current sheets. [1] Li, G., "Identify current-sheet-like structures in the solar wind", ApJL 672, L65, 2008.
Badyal, Rama Kumari; Chhabra, Sanjeev; Sharma, Prashant; Das, Reena
2014-01-01
Cation exchange high performance liquid chromatography (HPLC) is commonly utilized as the first method of screening for thalassemias and hemoglobinopathies worldwide. This method of diagnosis requires knowledge of the clinical background and complete blood counts as well as skill and experience in interpreting the sometimes complex results produced. An asymptomatic 27-year-old pregnant North Indian woman was found to have a highly unusual chromatographic pattern with multiple unexpected peaks during routine antenatal screening. Most concerning was a C-window peak as Hb C (HBB: c.19G>A) is rare in ethnic Asian Indian populations. Cellulose acetate electrophoresis at alkaline pH (8.6) and parental screening were performed. These revealed the correct diagnosis to be a double heterozygosity for Hb Q-India (HBA1: c.193G>C) (an uncommon asymptomatic α-globin chain variant) plus Hb D-Punjab (HBB: c.364G>C) (a β-globin chain variant that is common in this region and is asymptomatic in the heterozygous state). The unexpected C-window peak was the hybrid of the abnormal α-Q-India and β-D-Punjab globin chains. Another small peak was explained as a variant Hb A2 formed by the combination of α-Q-India and δ-globin chains. Hematopathologists should be cognizant of the complex pattern resulting from coinheritance of both α- and β-globin structural variants. Second-line testing and parental testing are invaluable in resolving unknown peaks, especially if rare or unexpected variants are being considered. Although both Hb Q-India and Hb D-Punjab are relatively common in northwestern India, to the best of our knowledge, only two recent reports describe a total of three cases of such diagnostically puzzling coinheritance.
NASA Astrophysics Data System (ADS)
Usman, Muhammad; Saba, Kiran; Han, Dong-Pyo; Muhammad, Nazeer
2018-01-01
High efficiency of green GaAlInN-based light-emitting diode (LED) has been proposed with peak emission wavelength of ∼510 nm. By introducing quaternary quantum well (QW) along with the quaternary barrier (QB) and quaternary electron blocking layer (EBL) in a single structure, an efficiency droop reduction of up to 29% has been achieved in comparison to the conventional GaN-based LED. The proposed structure has significantly reduced electrostatic field in the active region. As a result, carrier leakage has been minimized and spontaneous emission rate has been doubled.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hashimoto, J.; Tamura, M.; Fukue, T.
We report high-resolution 1.6 {mu}m polarized intensity (PI) images of the circumstellar disk around the Herbig Ae star AB Aur at a radial distance of 22 AU (0.''15) up to 554 AU (3.''85), which have been obtained by the high-contrast instrument HiCIAO with the dual-beam polarimetry. We revealed complicated and asymmetrical structures in the inner part ({approx}<140 AU) of the disk while confirming the previously reported outer (r {approx}> 200 AU) spiral structure. We have imaged a double ring structure at {approx}40 and {approx}100 AU and a ring-like gap between the two. We found a significant discrepancy of inclination anglesmore » between two rings, which may indicate that the disk of AB Aur is warped. Furthermore, we found seven dips (the typical size is {approx}45 AU or less) within two rings, as well as three prominent PI peaks at {approx}40 AU. The observed structures, including a bumpy double ring, a ring-like gap, and a warped disk in the innermost regions, provide essential information for understanding the formation mechanism of recently detected wide-orbit (r > 20 AU) planets.« less
Acharya, H; Bhowmick, Anil K
2007-01-01
Ethylene propylene diene terpolymer (EPDM)/MgAl layered double hydroxide (LDH) nanocomposites have been synthesized by solution intercalation using organically modified LDH (DS-LDH). The molecular level dispersion of LDH nanolayers has been verified by the disappearance of basal XRD peak of DS-LDH in the composites. The internal structures, of the nanocomposite with the dispersion nature of LDH particles in EPDM matrix have been studied by TEM and AFM. Thermogravimetric analysis (TGA) shows thermal stability of nanocomposites improved by ≈40 °C when 10% weight loss was selected as point of comparison. The degradation for pure EPDM is faster above 380 °C while in case of its nanocomposites, it is much slower.
Noble metal nanostructures for double plasmon resonance with tunable properties
NASA Astrophysics Data System (ADS)
Petr, M.; Kylián, O.; Kuzminova, A.; Kratochvíl, J.; Khalakhan, I.; Hanuš, J.; Biederman, H.
2017-02-01
We report and compare two vacuum-based strategies to produce Ag/Au materials characterized by double plasmon resonance peaks: magnetron sputtering and method based on the use of gas aggregation sources (GAS) of nanoparticles. It was observed that the double plasmon resonance peaks may be achieved by both of these methods and that the intensities of individual localized surface plasmon resonance peaks may be tuned by deposition conditions. However, in the case of sputter deposition it was necessary to introduce a separation dielectric interlayer in between individual Ag and Au nanoparticle films which was not the case of films prepared by GAS systems. The differences in the optical properties of sputter deposited bimetallic Ag/Au films and coatings consisted of individual Ag and Au nanoparticles produced by GAS is ascribed to the divers mechanisms of nanoparticles formation.
NASA Astrophysics Data System (ADS)
Takata, J.; Yang, H.; Cheng, K. S.
2017-12-01
AR Scorpii is an intermediate polar binary system composed of a magnetic white dwarf (WD) and an M-type star and shows nonthermal, pulsed, and highly linearly polarized emission. The radio/optical emission modulates with the WD’s spin and shows the double-peak structure in the light curves. In this paper, we discuss a possible scenario for the radiation mechanism of AR Scorpii. The magnetic interaction on the surface of the companion star produces an outflow from the companion star, the heating of the companion star surface, and the acceleration of electrons to a relativistic energy. The accelerated electrons, whose typical Lorentz factor is ∼50–100, from the companion star move along the magnetic field lines toward the WD surface. The electrons injected with the pitch angle of \\sin {θ }p,0> 0.05 are subject to the magnetic mirror effect and are trapped in the closed magnetic field line region. We find that the emission from the first magnetic mirror points mainly contributes to the observed pulsed emission and the formation of the double-peak structure in the light curve. For the inclined rotator, the pulse peak in the calculated light curve shifts the position in the spin phase, and a Fourier analysis exhibits a beat frequency feature, which are consistent with the optical/UV observations. The pulse profile also evolves with the orbital phase owing to the effect of the viewing geometry. The model also interprets the global features of the observed spectral energy distribution in radio to X-ray energy bands. We also discuss the curvature radiation and the inverse-Compton scattering process in the outer gap accelerator of the WD in AR Scorpii and the possibility of the detection by future high-energy missions.
Catching the radio flare in CTA 102. I. Light curve analysis
NASA Astrophysics Data System (ADS)
Fromm, C. M.; Perucho, M.; Ros, E.; Savolainen, T.; Lobanov, A. P.; Zensus, J. A.; Aller, M. F.; Aller, H. D.; Gurwell, M. A.; Lähteenmäki, A.
2011-07-01
Context. The blazar CTA 102 (z = 1.037) underwent a historical radio outburst in April 2006. This event offered a unique chance to study the physical properties of the jet. Aims: We used multifrequency radio and mm observations to analyze the evolution of the spectral parameters during the flare as a test of the shock-in-jet model under these extreme conditions. Methods: For the analysis of the flare we took into account that the flaring spectrum is superimposed on a quiescent spectrum. We reconstructed the latter from archival data and fitted a synchrotron self-absorbed distribution of emission. The uncertainties of the derived spectral parameters were calculated using Monte Carlo simulations. The spectral evolution is modeled by the shock-in-jet model, and the derived results are discussed in the context of a geometrical model (varying viewing angle) and shock-shock interaction Results: The evolution of the flare in the turnover frequency-turnover flux density (νm - Sm) plane shows a double peak structure. The nature of this evolution is dicussed in the frame of shock-in-jet models. We discard the generation of the double peak structure in the νm - Sm plane purely based on geometrical changes (variation of the Doppler factor). The detailed modeling of the spectral evolution favors a shock-shock interaction as a possible physical mechanism behind the deviations from the standard shock-in-jet model.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Serrano-Posada, Hugo; Centeno-Leija, Sara; Rojas-Trejo, Sonia Patricia
2015-11-26
During X-ray data collection from a multicopper oxidase (MCO) crystal, electrons and protons are mainly released into the system by the radiolysis of water molecules, leading to the X-ray-induced reduction of O 2 to 2H 2O at the trinuclear copper cluster (TNC) of the enzyme. In this work, 12 crystallographic structures of Thermus thermophilus HB27 multicopper oxidase (Tth-MCO) in holo, apo and Hg-bound forms and with different X-ray absorbed doses have been determined. In holo Tth -MCO structures with four Cu atoms, the proton-donor residue Glu451 involved in O 2 reduction was found in a double conformation: Glu451a (~7 Åmore » from the TNC) and Glu451b (~4.5 Å from the TNC). A positive peak of electron density above 3.5σ in anF o-F c map for Glu451a O ε2 indicates the presence of a carboxyl functional group at the side chain, while its significant absence in Glu451b strongly suggests a carboxylate functional group. In contrast, for apo Tth -MCO and in Hg-bound structures neither the positive peak nor double conformations were observed. Together, these observations provide the first structural evidence for a proton-relay mechanism in the MCO family and also support previous studies indicating that Asp106 does not provide protons for this mechanism. In addition, eight composite structures (Tth -MCO-C1–8) with different X-ray-absorbed doses allowed the observation of different O 2-reduction states, and a total depletion of T2Cu at doses higher than 0.2 MGy showed the high susceptibility of this Cu atom to radiation damage, highlighting the importance of taking radiation effects into account in biochemical interpretations of an MCO structure.« less
NASA Astrophysics Data System (ADS)
Titus, Jitto; Thakur, Mrinal
2006-03-01
As recently reported, the electrical conductivity of the nonconjugated polymer, poly(beta-pinene) increases by more than ten orders of magnitude upon doping with iodine [1]. The FTIR, optical absorption and EPR measurements have shown that radical cations are formed upon doping and charge-transfer involving the isolated double-bond in poly(beta-pinene). In this report, exceptionally large two-photon absorption in iodine-doped poly(beta-pinene) will be discussed. The linear absorption spectrum of medium-doped poly(beta-pinene) have peaks at about 4 eV and 3.1 eV. The first peak is due to the radical cation and the second due to the charge-transfer between the double bond and the dopant. The two-photon absorption of the medium-doped polymer has been measured at 730-860 nm using open-aperture z-scan with 150 femtosecond pulses from a Ti:Sapphire laser. A two-photon peak at about 1.5 eV with a magnitude of more than 1 cm/MW has been observed. The large magnitude of the two-photon absorption coefficient which is proportional to the imaginary part of the third order susceptibility has been attributed to the special structure of the radical cation and the confinement within a sub-nanometer dimension. [1] Vippa, Rajagopalan and Thakur, J. Poly. Sci. Part B: Poly. Phys., 43, 3695 (2005).
NASA Astrophysics Data System (ADS)
Meher Abhinav, E.; Sundararaj, Anuraj; Gopalakrishnan, Chandrasekaran; Kasmir Raja, S. V.; Chokhra, Saurabh
2017-11-01
In this work, chair like fully hydrogenated germanane (CGeH) nano-ribbon 6 nm short channel double gate field effect transistor (DG-FET) has been modeled and the impact of strain on the I-V characteristics of CGeH channel has been examined. The bond lengths, binding and formation energies of various hydrogenated geometries of buckled germanane channel were calculated using local density approximation (LDA) with Perdew-Zunger (PZ) and generalized gradient approximation (GGA) with Perdew Burke Ernzerhof (PBE) parameterization. From four various geometries, chair like structure is found to be more stable compared to boat like obtuse, stiruup structure and table like structure. The bandgap versus width, bandgap versus strain characteristics and I-V characteristics had been analyzed at room temperature using density functional theory (DFT). Using self consistent calculation it was observed that the electronic properties of nano-ribbon is independent of length and band structure, but dependent on edge type, strain [Uni-axial (ɛ xx ), bi-axial (ɛ xx = ɛ yy )] and width of the ribbon. The strain engineered hydrogenated germanane (GeH) showed wide direct bandgap (2.3 eV) which could help to build low noise electronic devices that operates at high frequencies. The observed bi-axial compression has high impact on the device transport characteristics with peak to valley ratio (PVR) of 2.14 and 380% increase in peak current compared to pristine CGeH device. The observed strain in CGeH DG-FET could facilitate in designing novel multiple-logic memory devices due to multiple negative differential resistance (NDR) regions.
NASA Astrophysics Data System (ADS)
Wierzchowski, W.; Moore, M.; Makepeace, A. P. W.; Yacoot, A.
1991-10-01
A 4 x 4 x 1.5 cu mm cuboctahedral diamond and two 0.7 mm thick slabs cut from a truncated octahedral diamond grown by the reconstitution technique were studied in different double-crystal arrangements with both conventional and synchrotron X-ray sources. The back-reflection double crystal topographs of large polished 001-plane-oriented faces intersecting different growth sectors, together with cathodoluminescence patterns, allowed identification of these sectors. A double-crystal arrangement, employing the -3 2 5 quartz reflection matching the symmetrical 004 diamond reflection in CuK(alpha 1) radiation, was used for measurement of lattice parameter differences with an accuracy of one and a half parts per million. The simultaneous investigation by means of Lang projection and section topography provided complementary information about the crystallographic defects and internal structures of growth sectors. Observation of the cuboctahedral diamond with a filter of peak transmittance at 430 nm revealed a 'Maltese cross' growth feature in the central (001) growth sector, which also affected the birefringence pattern. However, this feature only very slightly affected the double-crystal topographs.
Band structures in coupled-cluster singles-and-doubles Green's function (GFCCSD)
NASA Astrophysics Data System (ADS)
Furukawa, Yoritaka; Kosugi, Taichi; Nishi, Hirofumi; Matsushita, Yu-ichiro
2018-05-01
We demonstrate that the coupled-cluster singles-and-doubles Green's function (GFCCSD) method is a powerful and prominent tool drawing the electronic band structures and the total energies, which many theoretical techniques struggle to reproduce. We have calculated single-electron energy spectra via the GFCCSD method for various kinds of systems, ranging from ionic to covalent and van der Waals, for the first time: the one-dimensional LiH chain, one-dimensional C chain, and one-dimensional Be chain. We have found that the bandgap becomes narrower than in HF due to the correlation effect. We also show that the band structures obtained from the GFCCSD method include both quasiparticle and satellite peaks successfully. Besides, taking one-dimensional LiH as an example, we discuss the validity of restricting the active space to suppress the computational cost of the GFCCSD method. We show that the calculated results without bands that do not contribute to the chemical bonds are in good agreement with full-band calculations. With the GFCCSD method, we can calculate the total energies and spectral functions for periodic systems in an explicitly correlated manner.
Monte Carlo approach in assessing damage in higher order structures of DNA
NASA Technical Reports Server (NTRS)
Chatterjee, A.; Schmidt, J. B.; Holley, W. R.
1994-01-01
We have developed a computer monitor of nuclear DNA in the form of chromatin fibre. The fibres are modeled as a ideal solenoid consisting of twenty helical turns with six nucleosomes per turn. The chromatin model, in combination with are Monte Carlo theory of radiation damage induces by charged particles, based on general features of tack structure and stopping power theory, has been used to evaluate the influence of DNA structure on initial damage. An interesting has emerged from our calculations. Our calculated results predict the existence of strong spatial correlations in damage sites associated with the symmetries in the solenoidal model. We have calculated spectra of short fragments of double stranded DNA produced by multiple double strand breaks induced by both high and low LET radiation. The spectra exhibit peaks at multiples of approximately 85 base pairs (the nucleosome periodicity), and approximately 1000 base pairs (solenoid periodicity). Preliminary experiments to investigate the fragment distributions from irradiated DNA, made by B. Rydberg at Lawrence Berkeley Laboratory, confirm the existence of short DNA fragments and are in substantial agreement with the predictions of our theory.
Christopher, Scott A; Kim, Stanley E; Roe, Simon; Pozzi, Antonio
2016-08-01
Periprosthetic femoral fractures are a common complication associated with cementless press-fit total hip arthroplasty. The use of prophylactic cerclage wire fixation has been advocated to reduce this complication. The objective of this study was to evaluate whether a double loop cerclage wire, used as adjunctive fixation, increased the peak torsional load to failure in femora implanted with press-fit cementless stems. Peak torsional load to failure was compared between femora without adjunctive fixation and femora receiving a 1 mm double loop cerclage wire placed proximally to the lesser trochanter. Femora treated with adjunctive cerclage wire fixation failed at 20% greater peak torque (P = 0.0001). In conclusion, a double loop cerclage wire may aid in the prevention of periprosthetic fractures associated with press-fit cementless femoral stems. Copyright © 2016. Published by Elsevier Ltd.
Unusual X-ray burst profiles from 4U/MXB 1636-53
NASA Technical Reports Server (NTRS)
Sztajno, M.; Truemper, J.; Pietsch, W.; Van Paradijs, J.; Stollman, G.
1985-01-01
During a one day Exosat observation eight X-ray bursts from 4U/MXB 1636-53 are observed. Four of these were very unusual. Their peak fluxes were relatively low, and they showed a distinct double peak in their bolometric flux profiles. These new double-peaked bursts are unexplained by presently available models of X-ray bursts. It is possible that the energy release in these bursts proceeds in two 'steps'. The burst profiles are not the result of an expansion and subsequent contraction of the photosphere of the neutron star. Thus, they are very different from previously observed bursts which do show a double peak in certain energy ranges but not in their bolometric flux profiles; these are satisfactorily explained in terms of photospheric radius expansion and contraction. The anticorrelation between the apparent blackbody radius and blackbody temperature is discussed in terms of the nonPlanckian character of burst spectra and it is concluded that the model calculations reported by London, Taam, and Howard in 1984 give a reasonable first-order description of the observed apparent radius changes in X-ray bursts.
Two-Pole Caustic Model for High-Energy Lightcurves of Pulsars
NASA Technical Reports Server (NTRS)
Dyks, J.; Rudak, B.
2003-01-01
We present a new model of high-energy lightcurves from rotation powered pulsars. The key ingredient of the model is the gap region (i.e. the region where particle acceleration is taking place and high-energy photons originate) which satisfies the following assumptions: i) the gap region extends from each polar cap to the light cylinder; ii) the gap is thin and confined to the surface of last open magnetic-field lines; iii) photon emissivity is uniform within the gap region. The model lightcurves are dominated by strong peaks (either double or single) of caustic origin. Unlike in other pulsar models with caustic effects, the double peaks arise due to crossing two caustics, each of which is associated with a different magnetic pole. The generic features of the lightcurves are consistent with the observed characteristics of pulsar lightcurves: 1) the most natural (in terms of probability) shape consists of two peaks (separated by 0.4 to 0.5 in phase for large viewing angles); 2) the peaks possess well developed wings; 3) there is a bridge (inter-peak) emission component; 4) there is a non-vanishing off-pulse emission level; 5) the radio pulse occurs before the leading high-energy peak. The model is well suited for four gamma-ray pulsars - Crab, Vela, Geminga and B1951+32 - with double-peak lightcurves exhibiting the peak separation of 0.4 to 0.5 in phase. Hereby, we apply the model to the Vela pulsar. Moreover, we indicate the limitation of the model in accurate reproducing of the lightcurves with single pulses and narrowly separated (about 0.2 in phase) pulse peaks. We also discuss the optical polarization properties for the Crab pulsar in the context of the two-pole caustic model.
Ma, C Benjamin; Comerford, Lyn; Wilson, Joseph; Puttlitz, Christian M
2006-02-01
Recent studies have shown that arthroscopic rotator cuff repairs can have higher rates of failure than do open repairs. Current methods of rotator cuff repair have been limited to single-row fixation of simple and horizontal stitches, which is very different from open repairs. The objective of this study was to compare the initial cyclic loading and load-to-failure properties of double-row fixation with those of three commonly used single-row techniques. Ten paired human supraspinatus tendons were split in half, yielding four tendons per cadaver. The bone mineral content at the greater tuberosity was assessed. Four stitch configurations (two-simple, massive cuff, arthroscopic Mason-Allen, and double-row fixation) were randomized and tested on each set of tendons. Specimens were cyclically loaded between 5 and 100 N at 0.25 Hz for fifty cycles and then loaded to failure under displacement control at 1 mm/sec. Conditioning elongation, peak-to-peak elongation, ultimate tensile load, and stiffness were measured with use of a three-dimensional tracking system and compared, and the failure type (suture or anchor pull-out) was recorded. No significant differences were found among the stitches with respect to conditioning elongation. The mean peak-to-peak elongation (and standard error of the mean) was significantly lower for the massive cuff (1.1 +/- 0.1 mm) and double-row stitches (1.1 +/- 0.1 mm) than for the arthroscopic Mason-Allen stitch (1.5 +/- 0.2 mm) (p < 0.05). The ultimate tensile load was significantly higher for double-row fixation (287 +/- 24 N) than for all of the single-row fixations (p < 0.05). Additionally, the massive cuff stitch (250 +/- 21 N) was found to have a significantly higher ultimate tensile load than the two-simple (191 +/- 18 N) and arthroscopic Mason-Allen (212 +/- 21 N) stitches (p < 0.05). No significant differences in stiffness were found among the stitches. Failure mechanisms were similar for all stitches. Rotator cuff repairs in the anterior half of the greater tuberosity had a significantly lower peak-to-peak elongation and higher ultimate tensile strength than did repairs on the posterior half. In this in vitro cadaver study, double-row fixation had a significantly higher ultimate tensile load than the three types of single-row fixation stitches. Of the single-row fixations, the massive cuff stitch had cyclic and load-to-failure characteristics similar to the double-row fixation. Anterior repairs of the supraspinatus tendon had significantly stronger biomechanical behavior than posterior repairs.
NASA Astrophysics Data System (ADS)
Cho, Gookbin; Kim, Jungho
2017-09-01
We theoretically investigate the effect of conduction band non-parabolicity (NPB) on the optical gain spectrum of quantum cascade lasers (QCLs) using the effective two-band finite difference method. Based on the effective two-band model to consider the NPB effect in the multiple quantum wells (QWs), the wave functions and confined energies of electron states are calculated in two different active-region structures, which correspond to three-QW single-phonon and four-QW double-phonon resonance designs. In addition, intersubband optical dipole moments and polar-optical-phonon scattering times are calculated and compared without and with the conduction band NPB effect. Finally, the calculation results of optical gain spectra are compared in the two QCL structures having the same peak gain wavelength of 8.55 μm. The gain peaks are greatly shifted to longer wavelengths and the overall gain magnitudes are slightly reduced when the NPB effect is considered. Compared with the three-QW active-region design, the redshift of the peak gain is more prominent in the four-QW active-region design, which makes use of higher electronic states for the lasing transition.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Costamante, L.; Aharonian, F.; Khangulyan, D.
2007-07-12
An often overlooked fact is that the MeV-GeV emission from High-energy peaked BL Lacs (HBL) is basically unknown: there are only 3 objects of this type among all EGRET identified blazars with measured spectra. GLAST will be able to measure the spectrum for many of them, in particular TeV-blazars, and surprises are expected. GLAST will tell if the {gamma}-ray peak in some HBL is actually a ''double peak'', as suggested by the comparison of EGRET and HESS data in PKS 2155-304, We also remind and argue that a new class of BL Lacs could exist, where particles are shock-accelerated nearmore » the maximum possible rate, characterized by the synchrotron emission peaking in the GLAST band (100 MeV - few GeV). Such objects could easily have escaped detection or identification so far, and could now be unveiled by GLAST.« less
Structural Basis for Bc12-Regulated Mitochondrion-Dependent Apoptosis
2005-04-01
groups , double-resonance (’H/15N or 1H/ 31P) probes had square r.f. which have a considerably narrower ’IN chemical shift coils wrapped directly around...bilayers, which provides no res- B E H olution [Fig. 5(D)]. The peak near 35 ppm results from the amino groups of the lysine side-chains and the N...tissue-specific and physiological state-specific sub- 21. Huang Q, Petros AM, Virgin HW, Fesik SW, Olejniczak ET. Proc. units of the Na+, K+-ATPase. The
Experimental status of the nuclear spin scissors mode
NASA Astrophysics Data System (ADS)
Balbutsev, E. B.; Molodtsova, I. V.; Schuck, P.
2018-04-01
With the Wigner function moments (WFM) method the scissors mode of the actinides and rare earth nuclei are investigated. The unexplained experimental fact that in 232Th a double hump structure is found finds a natural explanation within WFM. It is predicted that the lower peak corresponds to an isovector spin scissors mode whereas the higher-lying states corresponds to the conventional isovector orbital scissors mode. The experimental situation is scrutinized in this respect concerning practically all results of M 1 excitations.
NASA Astrophysics Data System (ADS)
Xifang, Chen; Wenxia, Zhang; Qianjin, Wang; Jiyang, Fan
Carbon quantum dots (CQDs) have attracted great attention in the past few years due to their low cytotoxicity, exploited various synthesis methods, unexampled abundance of raw materials on earth, and robust near-infrared to near-UV luminescence. Carbon nanoparticles have applications in biological labeling, delivery of drugs and biological molecules into cells, and light emitting diodes and lasing. CQDs generally exist as nanodiamonds or graphite quantum dots according to previous research reports. In this study, we report the first synthesis of the third-allotrope CQDs through carbonization of sucrose and study their luminescence properties. These CQDs have a body-centered cubic structure and each lattice point is composed of eight atoms which form a sub-cube (so called C8 crystal structure). High-resolution transmission electron microscopy and X-ray diffraction confirm the C8 structure of the synthesized carbon nanocrystallites with an average size of 2 nm. The C8 CQDs exhibit double-band luminescence with two peaks centered at around 432 and 520 nm. The study based on the photoluminescence, UV-Vis absorption, Fourier-transform infrared, and X-ray photoelectron spectroscopies reveals that the green emission originates from the C=O related surface defect.
Moritake, Y.; Kanamori, Y.; Hane, K.
2016-01-01
We demonstrated fine emission wavelength tuning of quantum dot (QD) fluorescence by fine structural control of optical metamaterials with Fano resonance. An asymmetric-double-bar (ADB), which was composed of only two bars with slightly different bar lengths, was used to obtain Fano resonance in the optical region. By changing the short bar length of ADB structures with high dimensional accuracy in the order of 10 nm, resonant wavelengths of Fano resonance were controlled from 1296 to 1416 nm. Fluorescence of QDs embedded in a polymer layer on ADB metamaterials were modified due to coupling to Fano resonance and fine tuning from 1350 to 1376 nm was observed. Wavelength tuning of modified fluorescence was reproduced by analysis using absorption peaks of Fano resonance. Tuning range of modified fluorescence became narrow, which was interpreted by a simple Gaussian model and resulted from comparable FWHM in QD fluorescence and Fano resonant peaks. The results will help the design and fabrication of metamaterial devices with fluorophores such as light sources and biomarkers. PMID:27622503
Double Barriers and Magnetic Field in Bilayer Graphene
NASA Astrophysics Data System (ADS)
Redouani, Ilham; Jellal, Ahmed; Bahlouli, Hocine
2015-12-01
We study the transmission probability in an AB-stacked bilayer graphene of Dirac fermions scattered by a double-barrier structure in the presence of a magnetic field. We take into account the full four bands structure of the energy spectrum and use the suitable boundary conditions to determine the transmission probability. Our numerical results show that for energies higher than the interlayer coupling, four ways for transmission are possible while for energies less than the height of the barrier, Dirac fermions exhibit transmission resonances and only one transmission channel is available. We show that, for AB-stacked bilayer graphene, there is no Klein tunneling at normal incidence. We find that the transmission displays sharp peaks inside the transmission gap around the Dirac point within the barrier regions while they are absent around the Dirac point in the well region. The effect of the magnetic field, interlayer electrostatic potential, and various barrier geometry parameters on the transmission probabilities is also discussed.
Plasmons in Dimensionally Mismatched Coulomb Coupled Graphene Systems.
Badalyan, S M; Shylau, A A; Jauho, A P
2017-09-22
We calculate the plasmon dispersion relation for Coulomb coupled metallic armchair graphene nanoribbons and doped monolayer graphene. The crossing of the plasmon curves, which occurs for uncoupled 1D and 2D systems, is split by the interlayer Coulomb coupling into a lower and an upper plasmon branch. The upper branch exhibits an unusual behavior with end points at finite q. Accordingly, the structure factor shows either a single or a double peak behavior, depending on the plasmon wavelength. The new plasmon structure is relevant to recent experiments, its properties can be controlled by varying the system parameters and be used in plasmonic applications.
Crush analysis of the foam-filled bitubal circular tube under oblique impact
NASA Astrophysics Data System (ADS)
Djamaluddin, F.; Abdullah, S.; Arrifin, A. K.; Nopiah, Z. M.
2018-02-01
This paper presents crashworthiness analysis of bitubal cylindrical tubes under different impact angular. The numerical solution of double cylindrical tubes are determined by finite element analysis (FEA). Moreover, the structure was impacted by mass block as impactor respect to longitudinal direction of the tubes. The model of structure was developed by non-linear ABAQUS sofware with variations of load angle and dimensions of tube. The outcome of this study is the respons parameters such as the peak crusing force (PCF), energy absorption (EA) and specific energy absorption (SEA), thus it can be expected this tube as the great energy absorber.
The profiles of Fe K α line from the inhomogeneous accretion flow
NASA Astrophysics Data System (ADS)
Yu, Xiao-Di; Ma, Ren-Yi; Li, Ya-Ping; Zhang, Hui; Fang, Tao-Tao
2018-05-01
The clumpy disc, or inhomogeneous accretion flow, has been proposed to explain the properties of accreting black hole systems. However, the observational evidence remains to be explored. In this work, we calculate the profiles of Fe K α lines emitted from the inhomogeneous accretion flow through the ray-tracing technique, in order to find possible observable signals of the clumps. Compared with the skewed double-peaked profile of the continuous standard accretion disc, the lines show a multipeak structure when the emissivity index is not very steep. The peaks and wings are affected by the position and size of the cold clumps. When the clump is small and is located in the innermost region, due to the significant gravitational redshift, the blue wing can overlap with the red wing of the outer cold disc/clump, forming a fake peak or greatly enhancing the red peak. Given high enough resolution, it is easier to constrain the clumps around the supermassive black holes than the clumps in stellar mass black holes due to the thermal Doppler effect.
Broad ion energy distributions in helicon wave-coupled helium plasma
NASA Astrophysics Data System (ADS)
Woller, K. B.; Whyte, D. G.; Wright, G. M.
2017-05-01
Helium ion energy distributions were measured in helicon wave-coupled plasmas of the dynamics of ion implantation and sputtering of surface experiment using a retarding field energy analyzer. The shape of the energy distribution is a double-peak, characteristic of radiofrequency plasma potential modulation. The broad distribution is located within a radius of 0.8 cm, while the quartz tube of the plasma source has an inner radius of 2.2 cm. The ion energy distribution rapidly changes from a double-peak to a single peak in the radius range of 0.7-0.9 cm. The average ion energy is approximately uniform across the plasma column including the double-peak and single peak regions. The widths of the broad distribution, ΔE , in the wave-coupled mode are large compared to the time-averaged ion energy, ⟨E ⟩. On the axis (r = 0), ΔE / ⟨E ⟩ ≲ 3.4, and at a radius near the edge of the plasma column (r = 2.2 cm), ΔE / ⟨E ⟩ ˜ 1.2. The discharge parameter space is scanned to investigate the effects of the magnetic field, input power, and chamber fill pressure on the wave-coupled mode that exhibits the sharp radial variation in the ion energy distribution.
Exercise economy in skiing and running
Losnegard, Thomas; Schäfer, Daniela; Hallén, Jostein
2014-01-01
Substantial inter-individual variations in exercise economy exist even in highly trained endurance athletes. The variation is believed to be determined partly by intrinsic factors. Therefore, in the present study, we compared exercise economy in V2-skating, double poling, and uphill running. Ten highly trained male cross-country skiers (23 ± 3 years, 180 ± 6 cm, 75 ± 8 kg, VO2peak running: 76.3 ± 5.6 mL·kg−1·min−1) participated in the study. Exercise economy and VO2peak during treadmill running, ski skating (V2 technique) and double poling were compared based on correlation analysis. There was a very large correlation in exercise economy between V2-skating and double poling (r = 0.81) and large correlations between V2-skating and running (r = 0.53) and double poling and running (r = 0.58). There were trivial to moderate correlations between exercise economy and the intrinsic factors VO2peak (r = 0.00–0.23), cycle rate (r = 0.03–0.46), body mass (r = −0.09–0.46) and body height (r = 0.11–0.36). In conclusion, the inter-individual variation in exercise economy could be explained only moderately by differences in VO2peak, body mass and body height. Apparently other intrinsic factors contribute to the variation in exercise economy between highly trained subjects. PMID:24478718
Transfer matrix approach to electron transport in monolayer MoS2/MoO x heterostructures
NASA Astrophysics Data System (ADS)
Li, Gen
2018-05-01
Oxygen plasma treatment can introduce oxidation into monolayer MoS2 to transfer MoS2 into MoO x , causing the formation of MoS2/MoO x heterostructures. We find the MoS2/MoO x heterostructures have the similar geometry compared with GaAs/Ga1‑x Al x As semiconductor superlattice. Thus, We employ the established transfer matrix method to analyse the electron transport in the MoS2/MoO x heterostructures with double-well and step-well geometries. We also considere the coupling between transverse and longitudinal kinetic energy because the electron effective mass changes spatially in the MoS2/MoO x heterostructures. We find the resonant peaks show red shift with the increasing of transverse momentum, which is similar to the previous work studying the transverse-momentum-dependent transmission in GaAs/Ga1‑x Al x As double-barrier structure. We find electric field can enhance the magnitude of peaks and intensify the coupling between longitudinal and transverse momentums. Moreover, higher bias is applied to optimize resonant tunnelling condition to show negative differential effect can be observed in the MoS2/MoO x system.
Double-peaked broad line emission from the LINER nucleus of NGC 1097
NASA Technical Reports Server (NTRS)
Storchi-Bergmann, Thaisa; Baldwin, Jack A.; Wilson, Andrew S.
1993-01-01
We report the recent appearance of a very broad component in the H-alpha and H-beta emission lines of the weakly active nucleus of the Sersic-Pastoriza galaxy NGC 1097. The FWZI of the broad component is about 21,000 km/s, and its profile is double-peaked; the presence of a blue, featureless continuum in the nucleus is also suggested. The broad component was first observed in H-alpha in November 2, 1991, and confirmed 11 months later. The H-alpha profile and flux did not change in this time interval. Comparison with previously published spectral data indicates that the broad lines have only recently appeared. Together with the relatively high X-ray luminosity and the compact nuclear radio source, our results characterize the presence of a Seyfert 1 nucleus in a galaxy which had previously shown only LINER characteristics. Obscuring material along our line of sight to the nucleus appears to have recently cleared, permitting a direct view of the active nucleus. We discuss two possible structures for the broad line region, biconical outflow and an accretion disk, that could give rise to the observed profile.
Zhang, Ping; Li, Ling; Zhao, Yun; Tian, Zeyun; Qin, Yumei; Lu, Jun
2016-09-06
The fluorescent dye 8-anilino-1-naphthalenesulfonate (ANS) is a widely used fluorescent probe molecule for biochemistry analysis. This paper reported the fabrication of ANS/layered double hydroxide nanosheets (ANS/LDH)n ultrathin films (UTFs) via the layer-by-layer small anion assembly technique based on electrostatic interaction and two possible weak interactions: hydrogen-bond and induced electrostatic interactions between ANS and positive-charged LDH nanosheets. The obtained UTFs show a long-range-ordered periodic layered stacking structure and weak fluorescence in dry air or water, but it split into three narrow strong peaks in a weak polarity environment induced by the two-dimensional (2D) confinement effect of the LDH laminate; the fluorescence intensity increases with decreasing the solvent polarity, concomitant with the blue shift of the emission peaks, which show good sensoring reversibility. Meanwhile, the UTFs exhibit selective fluorescence enhancement to the bovine serum albumin (BSA)-like protein biomolecules, and the rate of fluorescence enhancement with the protein concentration is significantly different with the different protein aggregate states. The (ANS/LDH)n UTF has the potential to be a novel type of biological flourescence sensor material.
Wang, Fang; Jia, Jin-Song; Wang, Jing; Zhao, Ting; Jiang, Qian; Jiang, Hao; Zhu, Hong-Hu
2017-10-01
We aimed to compare the kinetics of white blood cell (WBC) and explore predictive factors of leukocytosis in non-high-risk acute promyelocytic leukemia (APL), with oral arsenic plus all-trans retinoic acid (ATRA) or intravenous arsenic trioxide (ATO) plus ATRA as a first-line treatment. The absolute count, doubling time and peak time of WBC were analyzed in 64 newly diagnosed non-high-risk APL patients who were treated with different induction regimens containing either oral Realgar-indigo naturalis formula (RIF) (n=35) or ATO (n=29). The end points were the dynamic changes of the WBC counts during induction. The time points started at day 1 and were selected over 3-day intervals for 28days. Among the 64 included patients, the median initial and peak WBC counts were 1.78×10 9 /L (range 0.31-9.89) and 12.16×10 9 /L (range 1.56-80.01), respectively. The incidence of differentiation syndrome was 9.38%. The dynamic changes in leukocytosis showed a single peak wave in all the patients, and the median time to peak was 10 (range 2-26) days. A higher WBC count was observed in the RIF group than in the ATO group after 10days of treatment (9.22×10 9 /L vs. 4.10×10 9 /L, p=0.015). Patients with the peak WBC count >10×10 9 /L had a shorter WBC doubling time compared to patients with a lower peak WBC (RIF group 4days vs. 7days, p=0.001; ATO group 4.5days vs. 23days, p=0.002). Univariate and multivariable analyses showed that the doubling time of WBC is an independent factor for the peak WBC count. Different kinetics of WBC proliferation were observed during induction with oral arsenic plus ATRA and ATO plus ATRA. The doubling time of WBC is an important independent factor for predicting the peak WBC count. Copyright © 2017 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Yao, Hui; Zhang, Chao; Li, Zhi-Jian; Nie, Yi-Hang; Niu, Peng-bin
2018-05-01
We theoretically investigate the thermoelectric properties in a tunneling-coupled parallel DQD-AB ring attached to one normal and one superconducting lead. The role of the intrinsic and extrinsic parameters in improving thermoelectric properties is discussed. The peak value of figure of merit near gap edges increases with the asymmetry parameter decreasing, particularly, when asymmetry parameter is less than 0.5, the figure of merit near gap edges rapidly rises. When the interdot coupling strengh is less than the superconducting gap the thermopower spectrum presents a single-platform structure. While when the interdot coupling strengh is larger than the gap, a double-platform structure appears in thermopower spectrum. Outside the gap the peak values of figure of merit might reach the order of 102. On the basis of optimizing internal parameters the thermoelectric conversion efficiency of the device can be further improved by appropriately matching the total magnetic flux and the flux difference between two subrings.
Gate-controlled quantum collimation in nanocolumn resonant tunneling transistors.
Wensorra, J; Lepsa, M I; Trellenkamp, S; Moers, J; Indlekofer, K M; Lüth, H
2009-11-18
Nanoscaled resonant tunneling transistors (RTT) based on MBE-grown GaAs/AlAs double-barrier quantum well (DBQW) structures have been fabricated by a top-down approach using electron-beam lithographic definition of the vertical nanocolumns. In the preparation process, a reproducible mask alignment accuracy of below 10 nm has been achieved and the all-around metal gate at the level of the DBQW structure has been positioned at a distance of about 20 nm relative to the semiconductor nanocolumn. Due to the specific doping profile n++/i/n++ along the transistor nanocolumn, a particular confining potential is established for devices with diameters smaller than 70 nm, which causes a collimation effect of the propagating electrons. Under these conditions, room temperature optimum performance of the nano-RTTs is achieved with peak-to-valley current ratios above 2 and a peak current swing factor of about 6 for gate voltages between -6 and +6 V. These values indicate that our nano-RTTs can be successfully used in low power fast nanoelectronic circuits.
The fundamentals of average local variance--Part I: Detecting regular patterns.
Bøcher, Peder Klith; McCloy, Keith R
2006-02-01
The method of average local variance (ALV) computes the mean of the standard deviation values derived for a 3 x 3 moving window on a successively coarsened image to produce a function of ALV versus spatial resolution. In developing ALV, the authors used approximately a doubling of the pixel size at each coarsening of the image. They hypothesized that ALV is low when the pixel size is smaller than the size of scene objects because the pixels on the object will have similar response values. When the pixel and objects are of similar size, they will tend to vary in response and the ALV values will increase. As the size of pixels increase further, more objects will be contained in a single pixel and ALV will decrease. The authors showed that various cover types produced single peak ALV functions that inexplicitly peaked when the pixel size was 1/2 to 3/4 of the object size. This paper reports on work done to explore the characteristics of the various forms of the ALV function and to understand the location of the peaks that occur in this function. The work was conducted using synthetically generated image data. The investigation showed that the hypothesis originally proposed in is not adequate. A new hypothesis is proposed that the ALV function has peak locations that are related to the geometric size of pattern structures in the scene. These structures are not always the same as scene objects. Only in cases where the size of and separation between scene objects are equal does the ALV function detect the size of the objects. In situations where the distance between scene objects are larger than their size, the ALV function has a peak at the object separation, not at the object size. This work has also shown that multiple object structures of different sizes and distances in the image provide multiple peaks in the ALV function and that some of these structures are not implicitly recognized as such from our perspective. However, the magnitude of these peaks depends on the response mix in the structures, complicating their interpretation and analysis. The analysis of the ALV Function is, thus, more complex than that generally reported in the literature.
The dynamical conductance of graphene tunnelling structures.
Zhang, Huan; Chan, K S; Lin, Zijing
2011-12-16
The dynamical conductances of graphene tunnelling structures were numerically calculated using the scattering matrix method with the interaction effect included in a phenomenological approach. The overall single-barrier dynamical conductance is capacitative. Transmission resonances in the single-barrier structure lead to dips in the capacitative imaginary part of the response. This is different from the ac responses of typical semiconductor nanostructures, where transmission resonances usually lead to inductive peaks. The features of the dips depend on the Fermi energy. When the Fermi energy is below half of the barrier height, the dips are sharper. When the Fermi energy is higher than half of the barrier height, the dips are broader. Inductive behaviours can be observed in a double-barrier structure due to the resonances formed by reflection between the two barriers.
Two-stage Energy Release Process of a Confined Flare with Double HXR Peaks
NASA Astrophysics Data System (ADS)
Ning, Hao; Chen, Yao; Wu, Zhao; Su, Yang; Tian, Hui; Li, Gang; Du, Guohui; Song, Hongqiang
2018-02-01
A complete understanding of the onset and subsequent evolution of confined flares has not been achieved. Earlier studies mainly analyzed disk events so as to reveal their magnetic topology and the cause of confinement. In this study, taking advantage of a tandem of instruments working at different wavelengths of X-rays, EUVs, and microwaves, we present dynamic details about a confined flare observed on the northwestern limb of the solar disk on 2016 July 24. The entire dynamic evolutionary process starting from its onset is consistent with a loop–loop interaction scenario. The X-ray profiles manifest an intriguing double-peak feature. From the spectral fitting, it has been found that the first peak is nonthermally dominated, while the second peak is mostly multithermal with a hot (∼10 MK) and a super-hot (∼30 MK) component. This double-peak feature is unique in that the two peaks are clearly separated by 4 minutes, and the second peak reaches up to 25–50 keV in addition, at energy bands above 3 keV, the X-ray fluxes decline significantly between the two peaks. This, together with other available imaging and spectral data, manifest a two-stage energy release process. A comprehensive analysis is carried out to investigate the nature of this two-stage process. We conclude that the second stage with the hot and super-hot sources mainly involves direct heating through a loop–loop reconnection at a relatively high altitude in the corona. The uniqueness of the event characteristics and the complete dataset make the study a nice addition to present literature on solar flares.
Lasing in circuit quantum electrodynamics with strong noise
NASA Astrophysics Data System (ADS)
Marthaler, M.; Utsumi, Y.; Golubev, D. S.
2015-05-01
We study a model which can describe a superconducting single-electron transistor or a double quantum dot coupled to a transmission-line oscillator. In both cases the degree of freedom is given by a charged particle, which couples strongly to the electromagnetic environment or phonons. We consider the case where a lasing condition is established and study the dependence of the average photon number in the resonator on the spectral function of the electromagnetic environment. We focus on three important cases: a strongly coupled environment with a small cutoff frequency, a structured environment peaked at a specific frequency, and 1 /f noise. We find that the electromagnetic environment can have a substantial impact on the photon creation. Resonance peaks are in general broadened and additional resonances can appear.
Interlayer tunneling in double-layer quantum hall pseudoferromagnets.
Balents, L; Radzihovsky, L
2001-02-26
We show that the interlayer tunneling I-V in double-layer quantum Hall states displays a rich behavior which depends on the relative magnitude of sample size, voltage length scale, current screening, disorder, and thermal lengths. For weak tunneling, we predict a negative differential conductance of a power-law shape crossing over to a sharp zero-bias peak. An in-plane magnetic field splits this zero-bias peak, leading instead to a "derivative" feature at V(B)(B(parallel)) = 2 pi Planck's over 2 pi upsilon B(parallel)d/e phi(0), which gives a direct measurement of the dispersion of the Goldstone mode corresponding to the spontaneous symmetry breaking of the double-layer Hall state.
An x-ray absorption spectroscopy study of Ni-Mn-Ga shape memory alloys.
Sathe, V G; Dubey, Aditi; Banik, Soma; Barman, S R; Olivi, L
2013-01-30
The austenite to martensite phase transition in Ni-Mn-Ga ferromagnetic shape memory alloys was studied by extended x-ray absorption fine structure (EXAFS) and x-ray absorption near-edge structure (XANES) spectroscopy. The spectra at all the three elements', namely, Mn, Ga and Ni, K-edges in several Ni-Mn-Ga samples (with both Ni and Mn excess) were analyzed at room temperature and low temperatures. The EXAFS analysis suggested a displacement of Mn and Ga atoms in opposite direction with respect to the Ni atoms when the compound transforms from the austenite phase to the martensite phase. The first coordination distances around the Mn and Ga atoms remained undisturbed on transition, while the second and subsequent shells showed dramatic changes indicating the presence of a modulated structure. The Mn rich compounds showed the presence of antisite disorder of Mn and Ga. The XANES results showed remarkable changes in the unoccupied partial density of states corresponding to Mn and Ni, while the electronic structure of Ga remained unperturbed across the martensite transition. The post-edge features in the Mn K-edge XANES spectra changed from a double peak like structure to a flat peak like structure upon phase transition. The study establishes strong correlation between the crystal structure and the unoccupied electronic structure in these shape memory alloys.
Double passing the Kitt Peak 1-m Fourier transform spectrometer
NASA Technical Reports Server (NTRS)
Jennings, D. E.; Hubbard, R.; Brault, J. W.
1985-01-01
Attention is given to a simple technique for performing the conversion of the Kitt Peak 1-m Fourier transform spectrometer's dual input/output optical configuration to a double pass configuration that improves spectral resolution by a factor of 2. The modification is made by placing a flat mirror in the output beam from each cat's eye, retroreflecting the beams back through the cat's eyes to the first beam splitter. A single detector is placed at the second input port, which then becomes the instrument's output.
NASA Astrophysics Data System (ADS)
Ren, Xueguang; Senftleben, Arne; Pflüger, Thomas; Bartschat, Klaus; Zatsarinny, Oleg; Berakdar, Jamal; Colgan, James; Pindzola, Michael S.; Bray, Igor; Fursa, Dmitry V.; Dorn, Alexander
2015-11-01
We report a combined experimental and theoretical study on the electron-impact ionization of helium at E0=70.6 eV and equal energy sharing of the two outgoing electrons (E1=E2=23 eV ), where a double-peak or dip structure in the binary region of the triple differential cross section is observed. The experimental cross sections are compared with results from convergent close-coupling (CCC), B -spline R-matrix-with-pseudostates (BSR), and time-dependent close-coupling (TDCC) calculations, as well as predictions from the dynamic screening three-Coulomb (DS3C) theory. Excellent agreement is obtained between experiment and the nonperturbative CCC, BSR, and TDCC theories, and good agreement is also found for the DS3C model. The data are further analyzed regarding contributions in particular coupling schemes for the spins of either the two outgoing electrons or one of the outgoing electrons and the 1 s electron remaining in the residual ion. While both coupling schemes can be used to explain the observed double-peak structure in the cross section, the second one allows for the isolation of the exchange contribution between the incident projectile and the target. For different observation angles of the two outgoing electrons, we interpret the results as a propensity for distinguishing these two electrons—one being more likely the incident projectile and the other one being more likely ejected from the target.
Latitudinal Variations Of The F3 Layer Observed From The SEALION Ionosonde Network
NASA Astrophysics Data System (ADS)
Uemoto, J.; Ono, T.; Maruyama, T.; Saito, S.; Iizima, M.; Kumamoto, A.
2006-12-01
[INTRODUCTION] The occurrence probability, local time, solar and magnetic activity dependences of the F3 layer have been clarified experimentally from ionosonde observations as well as model calculation, whereas some unexplained problems have remained; It has been reported that the F3 layer was frequently obrved in June solstice season at Fortaleza in Brazil (geographic latitude -4 deg, geographic longitude 322 deg, and dip latitude -5.4 deg) though in this season (local winter season), frequently occurrences of the F3 layer were not predicted from the model calculation with normal values of the E x B drift and meridional neutral wind and seasonal dependence of occurrences at Waltair (17.7 deg, 83.3 deg, 11.5 deg) shows a different tendency from that at Fortaleza. The latter problem seems to result from geographic control or differences of dip latitude between two observation locations, however, its physical mechanism has not been clarified. Then conjugate observations in a magnetic meridional plane are needed. For the purpose of clarifying the mechanism of the F3 layer in more detail, we are analyzing the ionosonde data of the South East Asian Low-latitude IOnosonde Network [SEALION] mainly provided by NiCT which consists of 4 ionosonde stations. In this study, we analyzed ionosonde data observed at Chiang Mai (CMU [18.8 deg, 98.9 deg, 13.0 deg]), Chumphon(CPN [10.7 deg, 99.4 deg, 3.3 deg]) and Kototabang (KTB [-0.2 deg, 100.3 deg, -10.0 deg]). [ANALYSIS] As a result from analyzing ionosonde data on 31st March, 2005, following dip latitudinal differences have been found; At CPN, in the vicinity of the dip equator, the F3 layer moved upward rapidly and disappeared in earlier local time, while at CMU and KTB, in the low dip latitude region, the F3 layer stayed at almost the same altitude and remained to be detectable with longer time duration. [CONCLUSION] From comparing between observation results and the model calculation, it is suggested that such a dip latitudinal difference can be explained by considering that (1) the magnetic field line at the F2 peak which moved upward by the E x B drift (corresponding to the F3 peak or subsequently ionization ledge peak) in the vicinity of the dip equator is also crossing at that in the low dip latitude region and (2) a dip latitudinal difference of field aligned plasma diffusion effects; In the vicinity of the dip equator, since plasma at the upward drifted peak altitude diffuses aligned magnetic field line to higher altitude, plasma density at upward drifted peak decreases and becomes smaller immediately than the F2 peak existing at the usual altitude, then double peak structure is observable from the ground with shorter duration time and the ionization ledge structure might be formed in earlier local time. On the other hand, in the low latitude region, since plasma are transported from the vicinity of the dip equator, plasma density at upward drifted peak altitude is retained denser than that at usual F2 peak altitude for a longer time. Then double peak structure is observable from the ground with longer duration time.
Shot noise of charge current in a quantum dot responded by rotating and oscillating magnetic fields
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhao, Hong-Kang, E-mail: zhaohonk@yahoo.com; Zou, Wei-Ke; Chen, Qiao
We have investigated the shot noise and Fano factor of the dynamic spin-polarized quantum dot under the perturbations of a rotating magnetic field (RMF), and an oscillating magnetic field (OMF) by employing the non-equilibrium Green's function approach. The shot noise is enhanced from sub-Poissonian to super-Poissonian due to the application of RMF and OMF, and it is controlled sensitively by the tilt angle θ of RMF. The magnitude of shot noise increases as the photon energy ℏω of OMF increases, and its valley eventually is reversed to peaks as the photon energy is large enough. Double-peak structure of Fano factormore » is exhibited as the frequency of OMF increases to cover a large regime. The Zeeman energy μ{sub 0}B{sub 0} acts as an effective gate bias to exhibit resonant behavior, and novel peak emerges associated with the applied OMF.« less
Gebala, Magdalena; La Mantia, Fabio; Schuhmann, Wolfgang
2013-07-22
Surface-confined immobilized redox species often do not show the expected zero peak separation in slow-scan cyclic voltammograms. This phenomenon is frequently associated to experimental drawbacks and hence neglected. However, a nonzero peak separation, which is common to many electrochemical systems with high structural flexibility, can be rationally assigned to a thermodynamic hysteresis. To study this phenomenon, a surface-confined redox species was used. Specifically, a DNA strand which is tagged with ferrocene (Fc) moieties at its 5' end and its complementary capture probe is thiolated at the 3' end was self-assembled in a monolayer at a Au electrode with the Fc moieties being located at the bottom plane of the double-stranded DNA (dsDNA). The DNA-bound Fc undergoes rapid electron transfer with the electrode surface as evaluated by fast scan cyclic voltammetry. The electron transfer is sensitive to the ion transport along the DNA strands, a phenomenon which is modulated upon specific intercalation of proflavine into surface-bound dsDNA. The electron transfer rate of the Fc(0/+) redox process is influenced by the cationic permselectivity of the DNA monolayer. In addition to the kinetic hindrance, a thermodynamic effect correlated with changes in the activity coefficients of the Fc(0/+) moieties near the gold-dsDNA interface is observed and discussed as source of the observed hysteresis causing the non-zero peak separation in the voltammograms. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Neutron scattering study on the magnetic and superconducting phases of MnP
NASA Astrophysics Data System (ADS)
Yano, Shinichiro; Lancon, Diane; Ronnow, Henrik; Hansen, Thomas; Gardner, Jason
We have performed series of neutron scattering experiments on MnP. MnP has been investigated for decades because of its rich magnetic phase diagram. The magnetic structure of MnP is ferromagnetic (FM) below TC = 291 K. It transforms into a helimagnetic structure at TS = 47 K with a propagation vector q = 0 . 117a* . Superconductivity was found in MnP under pressures of 8 GPa with a TSC around 1 K by J.-G. Cheng. Since Mn-based superconductors are rare, and the superconducting phase occurs in the vicinity of FM, new magnetic and helimagnetic phases, there is a need to understand how the magnetism evolves as one approach the superconducting state. MnP is believed to be a double helix magnetic structure at TS = 47 K. We observed new 2 δ and 3 δ satellite peaks whose intensity are 200 ~ 1000 times smaller than these of 1 δ satellite peaks on the cold triple axis spectrometer SIKA under zero magnetic fields. We also found the periods of helimagnetic structure changes as a function of temperature. If time permits, we will discuss recent experiments under pressure. However, we have complete picture of magnetic structure of this system with and without applied pressure, revealing the interplay between the magnetic and superconducting phases.
Control of fluorescence in quantum emitter and metallic nanoshell hybrids for medical applications
NASA Astrophysics Data System (ADS)
Singh, Mahi R.; Guo, Jiaohan; J. Cid, José M.; De Hoyos Martinez, Jesús E.
2017-03-01
We study the light emission from a quantum emitter and double metallic nanoshell hybrid systems. Quantum emitters act as local sources which transmit their light efficiently due to a double nanoshell near field. The double nanoshell consists of a dielectric core and two outer nanoshells. The first nanoshell is made of a metal, and the second spacer nanoshell is made of a dielectric material or human serum albumin. We have calculated the fluorescence emission for a quantum emitter-double nanoshell hybrid when it is injected in an animal or a human body. Surface plasmon polariton resonances in the double nanoshell are calculated using Maxwell's equations in the quasi-static approximation, and the fluorescence emission is evaluated using the density matrix method in the presence of dipole-dipole interactions. We have compared our theory with two fluorescence experiments in hybrid systems in which the quantum emitter is Indocyanine Green or infrared fluorescent molecules. The outer spacer nanoshell of double metallic nanoshells consists of silica and human serum albumin with variable thicknesses. Our theory explains the enhancement of fluorescence spectra in both experiments. We find that the thickness of the spacer nanoshell layer increases the enhancement when the fluorescence decreases. The enhancement of the fluorescence depends on the type of quantum emitter, spacer layer, and double nanoshell. We also found that the peak of the fluorescence spectrum can be shifted by changing the shape and the size of the nanoshell. The fluorescence spectra can be switched from one peak to two peaks by removing the degeneracy of excitonic states in the quantum emitter. Hence, using these properties, one can use these hybrids as sensing and switching devices for applications in medicine.
Investigating the development of double-peak subauroral ion drift (DSAID)
NASA Astrophysics Data System (ADS)
Horvath, Ildiko; Lovell, Brian C.
2017-04-01
This study focuses on the newly described ionospheric feature, called double-peak subauroral ion drift (DSAID), which is a subclass of the well-known single-peak SAID. Double-layer Region 2 (R2) field aligned currents (FACs) could be the main driver of DSAID. Our aim is to gain new insights into the development of DSAID during its two-stage progression. Observational results are provided by five scenarios, each demonstrating a certain progression sequence of DSAID. Results show that SAID/DSAID occurred during flux transfer events and was accompanied by flow channels (FCs) associated with dayside magnetopause (FC-2) and nightside magnetotail (FC-3) reconnections, with westward electrojet (eastward FC), and with auroral streamers (FC-4). In the premidnight magnetic local time (MLT) sector of stage 2, DSAID development was due to the short-circuiting of the reconnection-injected plasma jets during substorms or pseudobreakups. Thus, the related ring current pressure buildup enhanced the downward R2 FACs leading to double/multiple circuits forming double-layer R2 FACs. During the midnight MLT hours of stage 2, DSAID development was closely related to the westward traveling surge (WTS)/substorm current wedge (SCW). WTS/SCW-related strong upward R1 FACs closed with meriodional currents producing eastward and downward (i.e., downward R2 FAC-style) return currents enhancing the downward R2 FACs and thus leading to double/multiple circuits forming double-layer R2 FACs. Auroral streamers/FC-4 represent a substorm substructure and their occurrence with DSAID after stage 2 demonstrates that this substructure occasionally includes DSAID. Our results demonstrate also that the short-circuited system underlying SAID/DSAID acted sometimes as a current generator and sometimes as a voltage generator.
Internal friction peaks observed in explosively deformed polycrystalline Mo, Nb, and Cu
NASA Technical Reports Server (NTRS)
Rieu, G. E.; Grimes, H. H.; Romain, J. P.; Defouquet, J.
1974-01-01
Explosive deformation (50 kbar range) induced, in Cu, Mo and Nb, internal friction peaks identical to those observed after large normal deformation. The variation of the peaks with pressure for Mo and Nb lead to an explanation of these processes in terms of double kink generation in screw and edge dislocations.
Pyrolytic Decomposition Studies of AA2, A Double-Base Propellent
2001-10-01
broad HMW peaks in each pyrolys - ate, these data were analyzed by manual integration of each major or identified peak. The total percent areas in... pyroly - sis to permit the air peak to elute. NG is highly energetic and it shares a common behavior with NC. The majority of the pyrolysate (96.1
NASA Astrophysics Data System (ADS)
Csete, M.; Sipos, Á.; Szalai, A.; Mathesz, A.; Deli, M. A.; Veszelka, Sz.; Schmatulla, A.; Kőházi-Kis, A.; Osvay, K.; Marti, O.; Bor, Zs.
2007-09-01
Novel plasmonic sensor chips are prepared by generating sub-micrometer periodic patterns in the interfacial layers of bimetal-polymer films via master-grating based interference method. Poly-carbonate films spin-coated onto vacuum evaporated silver-gold bimetallic layers are irradiated by the two interfering UV beams of a Nd:YAG laser. It is proven by pulsed force mode AFM that periodic adhesion pattern corresponds to the surface relief gratings, consisting of sub-micrometer droplet arrays and continuous polymer stripes, induced by p- and s-polarized beams, respectively. The characteristic periods are the same, but more complex and larger amplitude adhesion modulation is detectable on the droplet arrays. The polar and azimuthal angle dependence of the resonance characteristic of plasmons is studied by combining the prism- and grating-coupling methods in a modified Kretschmann arrangement, illuminating the structured metal-polymer interface by a frequency doubled Nd:YAG laser through a semi-cylinder. It is proven that the grating-coupling results in double-peaked plasmon resonance curves on both of the droplet arrays and line gratings, when the grooves are rotated to an appropriate azimuthal angle, and the modulation amplitude of the structure is sufficiently large. Streptavidin seeding is performed to demonstrate that small amount of protein can be detected monitoring the shift of the secondary resonance minima. The available high concentration sensitivity is explained by the promotion of protein adherence in the structure's valleys due to the enhanced adhesion. The line-shaped polymer gratings resulting in narrow resonance peaks are utilized to demonstrate the effect of therapeutic molecules on Amyloid-Β peptide, a pathogenic factor in Alzheimer disease.
Mechanical Properties and Microstructural Evolution of Variable-Plane-Rolled Mg-3Al-1Zn Alloy
NASA Astrophysics Data System (ADS)
Zhu, Rong; Bian, Cunjian; Wu, Yanjun
2017-04-01
The microstructural evolution and mechanical properties of AZ31 magnesium alloy produced by variable-plane rolling (VPR) were investigated. Two types of weak textures were formed: basal texture in odd pass and double-peak basal texture in even pass. Dynamic recrystallization (DRX) was observed during the VPR treatment, and the nucleation of grains during DRX was dependent on the coalescence of subgrains. Three types of twins were observed in the VPR treatment: {10-12} extension twins, {10-13} contraction twins and {10-11}-{10-12} double twins. The {10-11}-{10-12} double twinning is the underlying mechanism in the formation of the double-peak texture. Tensile testing revealed improved strength without loss of ductility. The Hall-Petch relationship can be used to describe the strengths in any even pass with the same texture. The significant strengthening is ascribed to the refined grain, twin boundaries, texture hardening, and high dislocation density.
Revisiting the accuracy of peak flow meters: a double-blind study using formal methods of agreement.
Nazir, Z; Razaq, S; Mir, S; Anwar, M; Al Mawlawi, G; Sajad, M; Shehab, A; Taylor, R S
2005-05-01
There is widespread use of peak flow meters in both hospitals and general practice. Previous studies to assess peak flow meter accuracy have shown significant differences in the values obtained from different meters. However, many of these studies did not use human subjects for peak flow measurements and did not compare meters of varying usage. In this study human subjects have been used with meters of varying usage. Participants were tested using two new (meters A and C) and one old peak flow meter (meter B) in random order. The study was double-blinded. Participants were recruited from the university campus. Four hundred and nine individuals participated. The difference between peak flow means of A and B was -9.93 l/min (95% CI: -12.37 to -7.48, P<0.0001). The difference between peak flow means of B and C was 20.08 l/min (95% CI: 17.85-22.29, P<0.0001). The difference between peak flow means of A and C was 10.15 l/min (95% CI: 7.68-12.61, P<0.0001). There was a significant difference between the values obtained from the new and old peak flow meters and also between the two new peak flow meters. We conclude that there is need for caution in interchangeably using flow meters in clinical practice.
A Study of a Compound Solar Eruption with Two Consecutive Erupting Magnetic Structures
NASA Astrophysics Data System (ADS)
Dhakal, Suman K.; Chintzoglou, Georgios; Zhang, Jie
2018-06-01
We report a study of a compound solar eruption that was associated with two consecutively erupting magnetic structures and correspondingly two distinct peaks, during impulsive phase, of an M-class flare (M8.5). Simultaneous multi-viewpoint observations from SDO, GOES and STEREO-A show that this compound eruption originated from two pre-existing sigmoidal magnetic structures lying along the same polarity inversion line. Observations of the associated pre-existing filaments further show that these magnetic structures are lying one on top of the other, separated by 12 Mm in height, in a so-called “double-decker” configuration. The high-lying magnetic structure became unstable and erupted first, appearing as an expanding hot channel seen at extreme ultraviolet wavelengths. About 12 minutes later, the low-lying structure also started to erupt and moved at an even faster speed compared to the high-lying one. As a result, the two erupting structures interacted and merged with each other, appearing as a single coronal mass ejection in the outer corona. We find that the double-decker configuration is likely caused by the persistent shearing motion and flux cancellation along the source active region’s strong-gradient polarity inversion line. The successive destabilization of these two separate but closely spaced magnetic structures, possibly in the form of magnetic flux ropes, led to a compound solar eruption. The study of the compound eruption provides a unique opportunity to reveal the formation process, initiation, and evolution of complex eruptive structures in solar active regions.
High-lying single-particle modes, chaos, correlational entropy, and doubling phase transition
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stoyanov, Chavdar; Zelevinsky, Vladimir
Highly excited single-particle states in nuclei are coupled with the excitations of a more complex character, first of all with collective phononlike modes of the core. In the framework of the quasiparticle-phonon model, we consider the structure of resulting complex configurations, using the 1k{sub 17/2} orbital in {sup 209}Pb as an example. Although, on the level of one- and two-phonon admixtures, the fully chaotic Gaussian orthogonal ensemble regime is not reached, the eigenstates of the model carry a significant degree of complexity that can be quantified with the aid of correlational invariant entropy. With artificially enhanced particle-core coupling, the systemmore » undergoes the doubling phase transition with the quasiparticle strength concentrated in two repelling peaks. This phase transition is clearly detected by correlational entropy.« less
NASA Astrophysics Data System (ADS)
Gálisová, Lucia
2018-05-01
Ground-state properties of a hybrid double-tetrahedral chain, in which the localized Ising spins regularly alternate with triangular plaquettes occupied by a variable number of mobile electrons, are exactly investigated. We demonstrate that the zero-temperature phase diagram of the model involves several non-degenerate, two-fold degenerate and macroscopically degenerate chiral phases. Low-temperature dependencies of the entropy and specific heat are also examined in order to gain a deeper insight into the degeneracy of individual ground-state phases and phase transitions. It is shown that a diversity of the ground-state degeneracy manifests itself in multiple-peak structures of both thermodynamic quantities. A remarkable temperature dependencies of the specific heat with two and three Schottky-type maxima are discussed in detail.
Direct observation of double exchange in ferromagnetic La0.7Sr0.3CoO3 by broadband ellipsometry
NASA Astrophysics Data System (ADS)
Friš, P.; Munzar, D.; Caha, O.; Dubroka, A.
2018-01-01
We present results of our broadband ellipsometry measurements of the optical response of ferromagnetic La0.7Sr0.3CoO3 . Our data show that the ferromagnetic transition is accompanied by a transfer of optical spectral weight from an absorption band centered at 1.5 eV to a narrow component of the Drude-like peak. The associated reduction of the intraband kinetic energy is significantly larger than kBTc , confirming that the double exchange plays a major role in the ferromagnetism of doped cobaltites. In conjunction with results of recent theoretical studies, the temperature dependence of the Drude-like peak suggests that the double exchange is mediated by t2 g orbitals.
NASA Astrophysics Data System (ADS)
Wenderoth, S.; Bätge, J.; Härtle, R.
2016-09-01
We study sharp peaks in the conductance-voltage characteristics of a double quantum dot and a quantum dot spin valve that are located around zero bias. The peaks share similarities with a Kondo peak but can be clearly distinguished, in particular as they occur at high temperatures. The underlying physical mechanism is a strong current suppression that is quenched in bias-voltage dependent ways by exchange interactions. Our theoretical results are based on the quantum master equation methodology, including the Born-Markov approximation and a numerically exact, hierarchical scheme, which we extend here to the spin-valve case. The comparison of exact and approximate results allows us to reveal the underlying physical mechanisms, the role of first-, second- and beyond-second-order processes and the robustness of the effect.
Oster, L; Horowitz, Y S; Biderman, S; Haddad, J
2003-12-01
We demonstrate the viability of the concept of using existing molecular nanostructures in thermoluminescent solid-state materials as solid-state nanodosimeters. The concept is based on mimicking radiobiology (specifically the ionization density dependence of double strand breaks in DNA) by using the similar ionization density dependence of simultaneous electron-hole capture in spatially correlated trapping and luminescent centres pairs in the thermoluminescence of LiF:Mg,Ti. This simultaneous electron-hole capture has been shown to lead to ionization density dependence in the relative intensity of peak 5a to peak 5 similar to the ratio of double-strand breaks to single-strand breaks for low energy He ions.
Characterization of Y1-xCaxBa2Cu4O8 (x=0.0˜ 0.1) with Double Cu-O Chains by Raman Spectra
NASA Astrophysics Data System (ADS)
Kodama, Yasuharu; Tanemura, Sakae; Ikeda, Teruki
1991-08-01
Raman spectra of Y1-xCaxBa2Cu4O8 (x=0.0, 0.02, 0.05 and 0.1) ceramic samples synthesized under high oxygen pressure were investigated. Seven clear peaks assigned to Ag modes were observed for the sample with x=0. With increasing x, the peaks at 238 cm-1, 332 cm-1, 430 cm-1 and 590 cm-1 were broadened. The origin of the broadening of the peaks at 238 cm-1 and 590 cm-1 is considered to be the destruction of the double Cu-O chains due to the substitution of Ca for Y.
NASA Astrophysics Data System (ADS)
Li, Hong; Peng, Wei; Wang, Yanjie; Hu, Lingling; Liang, Yuzhang; Zhang, Xinpu; Yao, Wenjuan; Yu, Qi; Zhou, Xinlei
2011-12-01
Optical sensors based on nanoparticles induced Localized Surface Plasmon Resonance are more sensitive to real-time chemical and biological sensing, which have attracted intensive attentions in many fields. In this paper, we establish a simulation model based on nanoparticles imprinted polymer to increase sensitivity of the LSPR sensor by detecting the changes of Surface Plasmon Resonance signals. Theoretical analysis and numerical simulation of parameters effects to absorption peak and light field distribution are highlighted. Two-dimensional simulated color maps show that LSPR lead to centralization of the light energy around the gold nanoparticles, Transverse Magnetic wave and total reflection become the important factors to enhance the light field in our simulated structure. Fast Fourier Transfer analysis shows that the absorption peak of the surface plasmon resonance signal resulted from gold nanoparticles is sharper while its wavelength is bigger by comparing with silver nanoparticles; a double chain structure make the amplitude of the signals smaller, and make absorption wavelength longer; the absorption peak of enhancement resulted from nanopore arrays has smaller wavelength and weaker amplitude in contrast with nanoparticles. These simulation results of the Localized Surface Plasmon Resonance can be used as an enhanced transduction mechanism for enhancement of sensitivity in recognition and sensing of target analytes in accordance with different requirements.
Miyahara, Tomoo; Nakatsuji, Hiroshi; Sugiyama, Hiroshi
2016-11-17
The helical structures of DNA and RNA are investigated experimentally using circular dichroism (CD) spectroscopy. The signs and the shapes of the CD spectra are much different between the right- and left-handed structures as well as between DNA and RNA. The main difference lies in the sign at around 295 nm of the CD spectra: it is positive for the right-handed B-DNA and the left-handed Z-RNA but is negative for the left-handed Z-DNA and the right-handed A-RNA. We calculated the SAC-CI CD spectra of DNA and RNA using the tetramer models, which include both hydrogen-bonding and stacking interactions that are important in both DNA and RNA. The SAC-CI results reproduced the features at around 295 nm of the experimental CD spectra of each DNA and RNA, and elucidated that the strong stacking interaction between the two base pairs is the origin of the negative peaks at 295 nm of the CD spectra for both DNA and RNA. On the basis of these facts, we discuss the similarities and differences between RNA and DNA double-helical structures in the CD spectroscopy based on the ChiraSac methodology.
NASA Technical Reports Server (NTRS)
Breckinridge, J. B.; Mcalister, H. A.; Robinson, W. G.
1979-01-01
The speckle camera in regular use at Kitt Peak National Observatory since 1974 is described in detail. The design of the atmospheric dispersion compensation prisms, the use of film as a recording medium, the accuracy of double star measurements, and the next generation speckle camera are discussed. Photographs of double star speckle patterns with separations from 1.4 sec of arc to 4.7 sec of arc are shown to illustrate the quality of image formation with this camera, the effects of seeing on the patterns, and to illustrate the isoplanatic patch of the atmosphere.
Artificial stimulation of auroral electron acceleration by intense field aligned currents
NASA Technical Reports Server (NTRS)
Holmgren, G.; Bostrom, R.; Kelley, M. C.; Kintner, P. M.; Lundin, R.; Bering, E. A.; Sheldon, W. R.; Fahleson, U. V.
1979-01-01
A cesium-doped high explosion was detonated at 165 km altitude in the auroral ionosphere during quiet conditions. An Alfven wave pulse with a 200-mV/m electric field was observed, with the peak occurring 135 ms after the explosion at a distance of about 1 km. The count rate of fixed energy 2-keV electron detectors abruptly increased at 140 ms, peaked at 415 ms, and indicated a downward field-aligned beam of accelerated electrons. An anomalously high-field aligned beam of backscattered electrons was also detected. The acceleration is interpreted as due to production of an electrostatic shock or double layer between 300 and 800 km altitude. The structure was probably formed by an instability of the intense field-aligned currents in the Alfven wave launched by the charge-separation electric field due to the explosion.
Interaction of a shock wave with multiple spheres suspended in different arrangements
NASA Astrophysics Data System (ADS)
Zhang, Li-Te; Sui, Zhen-Zhen; Shi, Hong-Hui
2018-03-01
In this study, the unsteady drag force, Fd, drag coefficient, Cd, and the relevant dynamic behaviors of waves caused by the interaction between a planar incident shock wave and a multi-sphere model are investigated by using imbedded accelerometers and a high-speed Schlieren system. The shock wave is produced in a horizontal 200 mm inner diameter circular shock tube with a 2000 mm × 200 mm × 200 mm transparent test section. The time history of Cd is obtained based on band-block and low-pass Fast Fourier Transformation filtering combined with Savitzky-Golay polynomial smoothing for the measured acceleration. The effects of shock Mach number, Ms, geometry of multi-sphere model, nondimensional distance between sphere centers, H, and channel blockage are analyzed. We find that all time histories of Cd have a similar double-peak shaped main structure. It is due to wave reflection, diffraction, interference, and convergence at different positions of the spheres. The peak Fd increases, whereas the peak Cd decreases monotonically with increasing Ms. The increase of shock strength due to shock focusing by upstream spheres increases the peak Fd of downstream spheres. Both the increase in sphere number and the decrease in distance between spheres promote wave interference between neighboring spheres. As long as the wave interference times are shorter than the peak times, the peak Fd and Cd are higher compared to a single sphere.
Li, Zan; Millan, Robyn M; Hudson, Mary K
2013-12-01
[1]Previous studies on electromagnetic ion cyclotron (EMIC) waves as a possible cause of relativistic electron precipitation (REP) mainly focus on the time evolution of the trapped electron flux. However, directly measured by balloons and many satellites is the precipitating flux as well as its dependence on both time and energy. Therefore, to better understand whether pitch angle scattering by EMIC waves is an important radiation belt electron loss mechanism and whether quasi-linear theory is a sufficient theoretical treatment, we simulate the quasi-linear wave-particle interactions for a range of parameters and generate energy spectra, laying the foundation for modeling specific events that can be compared with balloon and spacecraft observations. We show that the REP energy spectrum has a peaked structure, with a lower cutoff at the minimum resonant energy. The peak moves with time toward higher energies and the spectrum flattens. The precipitating flux, on the other hand, first rapidly increases and then gradually decreases. We also show that increasing wave frequency can lead to the occurrence of a second peak. In both single- and double-peak cases, increasing wave frequency, cold plasma density or decreasing background magnetic field strength lowers the energies of the peak(s) and causes the precipitation to increase at low energies and decrease at high energies at the start of the precipitation.
Vickers, D.; Thomas, C.
2014-05-13
Observations of the scale-dependent turbulent fluxes and variances above, within and beneath a tall closed Douglas-Fir canopy in very weak winds are examined. The daytime subcanopy vertical velocity spectra exhibit a double-peak structure with peaks at time scales of 0.8 s and 51.2 s. A double-peak structure is also observed in the daytime subcanopy heat flux cospectra. The daytime momentum flux cospectra inside the canopy and in the subcanopy are characterized by a relatively large cross-wind component, likely due to the extremely light and variable winds, such that the definition of a mean wind direction, and subsequent partitioning of themore » momentum flux into along- and cross-wind components, has little physical meaning. Positive values of both momentum flux components in the subcanopy contribute to upward transfer of momentum, consistent with the observed mean wind speed profile. In the canopy at night at the smallest resolved scales, we find relatively large momentum fluxes (compared to at larger scales), and increasing vertical velocity variance with decreasing time scale, consistent with very small eddies likely generated by wake shedding from the canopy elements that transport momentum but not heat. We find unusually large values of the velocity aspect ratio within the canopy, consistent with enhanced suppression of the horizontal wind components compared to the vertical by the canopy. The flux-gradient approach for sensible heat flux is found to be valid for the subcanopy and above-canopy layers when considered separately; however, single source approaches that ignore the canopy fail because they make the heat flux appear to be counter-gradient when in fact it is aligned with the local temperature gradient in both the subcanopy and above-canopy layers. Modeled sensible heat fluxes above dark warm closed canopies are likely underestimated using typical values of the Stanton number.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vickers, D.; Thomas, C.
Observations of the scale-dependent turbulent fluxes and variances above, within and beneath a tall closed Douglas-Fir canopy in very weak winds are examined. The daytime subcanopy vertical velocity spectra exhibit a double-peak structure with peaks at time scales of 0.8 s and 51.2 s. A double-peak structure is also observed in the daytime subcanopy heat flux cospectra. The daytime momentum flux cospectra inside the canopy and in the subcanopy are characterized by a relatively large cross-wind component, likely due to the extremely light and variable winds, such that the definition of a mean wind direction, and subsequent partitioning of themore » momentum flux into along- and cross-wind components, has little physical meaning. Positive values of both momentum flux components in the subcanopy contribute to upward transfer of momentum, consistent with the observed mean wind speed profile. In the canopy at night at the smallest resolved scales, we find relatively large momentum fluxes (compared to at larger scales), and increasing vertical velocity variance with decreasing time scale, consistent with very small eddies likely generated by wake shedding from the canopy elements that transport momentum but not heat. We find unusually large values of the velocity aspect ratio within the canopy, consistent with enhanced suppression of the horizontal wind components compared to the vertical by the canopy. The flux-gradient approach for sensible heat flux is found to be valid for the subcanopy and above-canopy layers when considered separately; however, single source approaches that ignore the canopy fail because they make the heat flux appear to be counter-gradient when in fact it is aligned with the local temperature gradient in both the subcanopy and above-canopy layers. Modeled sensible heat fluxes above dark warm closed canopies are likely underestimated using typical values of the Stanton number.« less
Cellular monotectic model solidification
NASA Technical Reports Server (NTRS)
Kaukler, William F.
1987-01-01
Succinonitrile (sn) was purified to a superior level using a fractional recrystallization method. The melting point of the best twice recrystallized sn was not raised by following with double distillation. This was tested using differential scanning calorimetry. The peak shape on melting also proved that double distillation after double recrystallization did not improve the quality. Stability and phase diagrams for succinonitrile and glycerol are presented.
NASA Astrophysics Data System (ADS)
Singh, Swarnima; Sribalaji, M.; Wasekar, Nitin P.; Joshi, Srikant; Sundararajan, G.; Singh, Raghuvir; Keshri, Anup Kumar
2016-02-01
Silicon carbide (SiC) reinforced nickel-tungsten (Ni-W) coatings were successfully fabricated on steel substrate by pulse electrodeposition method (PED) and the amount of SiC was varied as 0 g/l, 2 g/l, and 5 g/l in Ni-W coating. Effect of subsequent addition of SiC on microstructures, phases and on corrosion property of the coating was investigated. Field emission scanning electron microscopy (FE-SEM) image of the surface morphology of the coating showed the transformation from the dome like structure to turtle shell like structure. X-ray diffraction (XRD) of Ni-W-5 g/l SiC showed the disappearance of (220) plane of Ni(W), peak splitting in major peak of Ni(W) and formation of distinct peak of W(Ni) solid solution. Absence of (220) plane, peak splitting and presence of W(Ni) solid solution was explained by the high resolution transmission electron microscopy (HR-TEM) images. Tafel polarization plot was used to study the corrosion property of the coatings in 0.5 M NaCl solution. Ni-W-5 g/l SiC coating was showed higher corrosion resistance (i.e. ∼21% increase in corrosion potential, Ecorr) compared to Ni-W coating. Two simultaneous phenomena have been identified for the enhanced corrosion resistance of Ni-W-5 g/l SiC coating. (a) Presence of crystallographic texture (b) formation of continuous double barrier layer of NiWO4 and SiO2.
Asymmetric quantum-well structures for AlGaN/GaN/AlGaN resonant tunneling diodes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Lin'an, E-mail: layang@xidian.edu.cn; Li, Yue; Wang, Ying
Asymmetric quantum-well (QW) structures including the asymmetric potential-barrier and the asymmetric potential-well are proposed for AlGaN/GaN/AlGaN resonant tunneling diodes (RTDs). Theoretical investigation gives that an appropriate decrease in Al composition and thickness for emitter barrier as well as an appropriate increase of both for collector barrier can evidently improve the negative-differential-resistance characteristic of RTD. Numerical simulation shows that RTD with a 1.5-nm-thick GaN well sandwiched by a 1.3-nm-thick Al{sub 0.15}Ga{sub 0.85}N emitter barrier and a 1.7-nm-thick Al{sub 0.25}Ga{sub 0.75}N collector barrier can yield the I-V characteristic having the peak current (Ip) and the peak-to-valley current ratio (PVCR) of 0.39 A andmore » 3.6, respectively, about double that of RTD with a 1.5-nm-thick Al{sub 0.2}Ga{sub 0.8}N for both barriers. It is also found that an introduction of InGaN sub-QW into the diode can change the tunneling mode and achieve higher transmission coefficient of electron. The simulation demonstrates that RTD with a 2.8-nm-thick In{sub 0.03}Ga{sub 0.97}N sub-well in front of a 2.0-nm-thick GaN main-well can exhibit the I-V characteristic having Ip and PVCR of 0.07 A and 11.6, about 7 times and double the value of RTD without sub-QW, respectively. The purpose of improving the structure of GaN-based QW is to solve apparent contradiction between the device structure and the device manufacturability of new generation RTDs for sub-millimeter and terahertz applications.« less
The binding of terbium ions to tubulin induces ring formation.
Monasterio, O; Acoria, M; Díaz, M A; Lagos, R
1993-02-01
The intrinsic fluorescence excitation and emission spectra of chicken brain tubulin showed the characteristic tryptophan fluorescence. The emission spectrum of Tb3+ in the presence of tubulin and GTP excited at 295 nm, showed four peaks, with the maxima at 490, 545, and 586 nm and a minor peak around 620 nm. Titration of tubulin with Tb3+ was followed by the increment in luminescence at 545 nm and showed a sigmoidal curve where the initial lag interval and the maximal luminescence intensity depended on tubulin concentration. The presence of Mg2+, Co2+, and Zn2+ diminished both the sigmoidicity of the curve and the maximal luminescence intensity. Titration of tubulin with Tb3+ also produced a sigmoidal increase in turbidity, which was shifted to the left with respect to the luminescence curve. The dependence of turbidity on the wavelength of the Tb(3+)-induced polymers revealed that the large structures formed were not microtubules. Electron microscopy of the aggregates induced by Tb3+ showed mainly a lattice of double rings with side-by-side contacts. These results indicate that Tb3+ induces principally double ring formation and that these rings (33 +/- 2 nm external diameter) aggregate in large-ordered arrays. The luminescence of Tb3+ seems to be induced mainly by the aggregation of rings.
Interplay between spin frustration and magnetism in the exactly solved two-leg mixed spin ladder
NASA Astrophysics Data System (ADS)
Qi, Yan; Lv, Song-Wei; Du, An; Yu, Nai-sen
2016-11-01
We study a mixed spin-(3/2, 1) ladder system with antiferromagnetic rung coupling and next-nearest-neighbor interaction. The exactly solved Ising-chain model is employed to investigate the ground-state properties and thermodynamics of the low-dimensional ladder system. Our results show that the competition between different exchange couplings brings in a large variety of ground states characterized by various values of normalized magnetization equal to 0, 1/5, 2/5, 3/5, 1. Moreover, an interesting double-peak structure is also detected in the thermal dependence of magnetic susceptibility and specific heat when the frustration comes into play. It is shown that the double-peak phenomenon at zero-field for the case of AF2 ground-state arises from the very strong antiferromagnetic rung coupling, while other cases are attributed to the excitations induced by temperature and external field around the phase boundary. Project supported by the National Natural Science Foundation of China (Grant No. 11547236), the General Project of the Education Department of Liaoning Province, China (Grant No. L2015130), the Fundamental Research Funds for the Central Universities, China (Grant Nos. DC201501065 and DCPY2016014), and the Doctoral Starting-up Foundation of Dalian Nationalities University, China.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Benitez, Erika; Cruz-Gonzalez, Irene; Martinez, Benoni
A sample of 10 nearby intermediate-type active galactic nuclei (AGNs) drawn from the Sloan Digital Sky Survey is presented. The aim of this work is to provide estimations of the black hole (BH) mass for the sample galaxies from the dynamics of the broad-line region. For this purpose, a detailed spectroscopic analysis of the objects was done. Using Baldwin-Phillips-Terlevich diagnostic diagrams, we have carefully classified the objects as true intermediate-type AGNs and found that 80%{sup +7.2%} {sub -17.3%} are composite AGNs. The BH mass estimated for the sample is within 6.54 {+-} 0.16 < log M {sub BH} < 7.81more » {+-} 0.14. Profile analysis shows that five objects (J120655.63+501737.1, J121607.08+504930.0, J141238.14+391836.5, J143031.18+524225.8, and J162952.88+242638.3) have narrow double-peaked emission lines in both the red (H{alpha}, [N II] {lambda}{lambda}6548,6583 and [S II] {lambda}{lambda}6716, 6731) and the blue (H{beta} and [O III] {lambda}{lambda}4959, 5007) regions of the spectra, with velocity differences ({Delta}V) between the double peaks within 114 km s{sup -1} < {Delta}V < 256 km s{sup -1}. Two of them, J121607.08+504930.0 and J141238.14+391836.5, are candidates for dual AGNs since their double-peaked emission lines are dominated by AGN activity. In searches of dual AGNs, type 1, type II, and intermediate-type AGNs should be carefully separated, due to the high serendipitous number of narrow double-peaked sources (50% {+-} 14.4%) found in our sample.« less
Tracer adsorption in sand-tank experiments of saltwater up-coning
NASA Astrophysics Data System (ADS)
Jakovovic, Danica; Post, Vincent E. A.; Werner, Adrian D.; Männicke, Oliver; Hutson, John L.; Simmons, Craig T.
2012-01-01
SummaryThis study aims to substantiate otherwise unresolved double-peaked plumes produced in recent saltwater up-coning experiments (see Jakovovic et al. (2011), Numerical modelling of saltwater up-coning: Comparison with experimental laboratory observations, Journal of Hydrology 402, 261-273) through additional laboratory testing and numerical modelling. Laboratory experimentation successfully reproduced the double-peaked plume demonstrating that this phenomenon was not an experimental nuance in previous experiments. Numerical modelling by Jakovovic et al. (2011) was extended by considering adsorption effects, which were needed to explain the observed up-coning double peaks of both previous and current laboratory experiments. A linear adsorption isotherm was applied in predicting dye tracer (Rhodamine WT) behaviour in the sand-tank experiments using adsorption parameters obtained experimentally. The same adsorption parameters were tested on all laboratory experiments and it was found that adsorption had insignificant effect on experiments with high pumping rates. However, low pumping rates produced pronounced spatial velocity variations within the dense salt plume beneath the pumping well, with velocities within the plume increasing from the centre of the plume towards the interface. The dye tracer was retarded relative to the salt and was transported preferentially along the higher-velocity paths (i.e. along the edges of the salt plume) towards the well forming double-peaked up-coning patterns. This illustrates the sensitive adsorptive nature of Rhodamine WT and that care should be taken when it is used in similar sand-tank experiments. Observations from this study offer insight into the separation of chemicals in natural systems due to different adsorption characteristics and under conditions of density-dependent flow.
VizieR Online Data Catalog: Double-peaked narrow lines in AGN. II. z<0.1 (Nevin+, 2016)
NASA Astrophysics Data System (ADS)
Nevin, R.; Comerford, J.; Muller-Sanchez, F.; Barrows, R.; Cooper, M.
2017-02-01
To determine the nature of 71 Type 2 AGNs with double-peaked [OIII] emission lines in SDSS that are at z<0.1 and further characterize their properties, we observe them using two complementary follow-up methods: optical long-slit spectroscopy and Jansky Very Large Array (VLA) radio observations. We use various spectrographs with similar pixel scales (Lick Kast Spectrograph; Palomar Double Spectrograph; MMT Blue Channel Spectrograph; APO Dual Imaging Spectrograph and Keck DEep Imaging Multi-Object Spectrograph. We use a 1200 lines/mm grating for all spectrographs; see table 1. In future work, we will combine our long-slit observations with the VLA data for the full sample of 71 galaxies (O. Muller-Sanchez+ 2016, in preparation). (4 data files).
Discharging dynamics in an electrolytic cell
NASA Astrophysics Data System (ADS)
Feicht, Sarah E.; Frankel, Alexandra E.; Khair, Aditya S.
2016-07-01
We analyze the dynamics of a discharging electrolytic cell comprised of a binary symmetric electrolyte between two planar, parallel blocking electrodes. When a voltage is initially applied, ions in the electrolyte migrate towards the electrodes, forming electrical double layers. After the system reaches steady state and the external current decays to zero, the applied voltage is switched off and the cell discharges, with the ions eventually returning to a uniform spatial concentration. At voltages on the order of the thermal voltage VT=kBT /q ≃25 mV, where kB is Boltzmann's constant, T is temperature, and q is the charge of a proton, experiments on surfactant-doped nonpolar fluids observe that the temporal evolution of the external current during charging and discharging is not symmetric [V. Novotny and M. A. Hopper, J. Electrochem. Soc. 126, 925 (1979), 10.1149/1.2129195; P. Kornilovitch and Y. Jeon, J. Appl. Phys. 109, 064509 (2011), 10.1063/1.3554445]. In fact, at sufficiently large voltages (several VT), the current during discharging is no longer monotonic: it displays a "reverse peak" before decaying in magnitude to zero. We analyze the dynamics of discharging by solving the Poisson-Nernst-Planck equations governing ion transport via asymptotic and numerical techniques in three regimes. First, in the "linear regime" when the applied voltage V is formally much less than VT, the charging and discharging currents are antisymmetric in time; however, the potential and charge density profiles during charging and discharging are asymmetric. The current evolution is on the R C timescale of the cell, λDL /D , where L is the width of the cell, D is the diffusivity of ions, and λD is the Debye length. Second, in the (experimentally relevant) thin-double-layer limit ɛ =λD/L ≪1 , there is a "weakly nonlinear" regime defined by VT≲V ≲VTln(1 /ɛ ) , where the bulk salt concentration is uniform; thus the R C timescale of the evolution of the current magnitude persists. However, nonlinear, voltage-dependent, capacitance of the double layer is responsible for a break in temporal antisymmetry of the charging and discharging currents. Third, the reverse peak in the discharging current develops in a "strongly nonlinear" regime V ≳VTln(1 /ɛ ) , driven by neutral salt adsorption into the double layers and consequent bulk depletion during charging. The strongly nonlinear regime features current evolution over three timescales. The current decays in magnitude on the double layer relaxation timescale, λD2/D ; then grows exponentially in time towards the reverse peak on the diffusion timescale, L2/D , indicating that the reverse peak is the results of fast diffusion of ions from the double layer layer to the bulk. Following the reverse peak, the current decays exponentially to zero on the R C timescale. Notably, the current at the reverse peak and the time of the reverse peak saturate at large voltages V ≫VTln(1 /ɛ ) . We provide semi-analytic expressions for the saturated reverse peak time and current, which can be used to infer charge carrier diffusivity and concentration from experiments.
Intervalley double resonance processes in MoS2
NASA Astrophysics Data System (ADS)
Wang, Yuanxi; Carvalho, Bruno; Malard, Leandro; Fantini, Cristiano; Crespi, Vincent; Pimenta, Marcos
Intervalley scattering plays a significant role in electronic energy dissipation in semiconductors. We investigate the intervalley scattering of monolayer and few-layer MoS2, by combining density functional theory calculations and resonant Raman spectroscopy probed by up to 20 laser excitation energies. We observe that two Raman peaks within 420-460 cm-1 are dispersive over a small range of laser energy, a clear signature of second-order processes involving intervalley scattering. Both modes involve LA and TA phonons at or near the K point. A third Raman peak at 466 cm-1 shows a strong intensity dependence on the layer number and is assigned 2LA(M). Our results invalidate previous Raman peak assignment proposals and open up a better understanding of double resonance processes in transition metal dichalcogenides.
Hayashi, Tomoyuki; Mukamel, Shaul
2006-11-21
The coherent nonlinear response of the entire amide line shapes of N-methyl acetamide to three infrared pulses is simulated using an electrostatic density functional theory map. Positive and negative cross peaks contain signatures of correlations between the fundamentals and the combination state. The amide I-A and I-III cross-peak line shapes indicate positive correlation and anticorrelation of frequency fluctuations, respectively. These can be ascribed to correlated hydrogen bonding at C[double bond]O and N-H sites. The amide I frequency is negatively correlated with the hydrogen bond on carbonyl C[double bond]O, whereas the amide A and III are negatively and positively correlated, respectively, with the hydrogen bond on amide N-H.
The effect of magnetic field on RbCl quantum pseudodot qubit
NASA Astrophysics Data System (ADS)
Xiao, Jing-Lin
2015-07-01
Under the condition of strong electron-LO-phonon coupling in a RbCl quantum pseudodot (QPD) with an applied magnetic field (MF), the eigenenergies and the eigenfunctions of the ground and the first excited states (GFES) are obtained by using a variational method of the Pekar type (VMPT). A single qubit can be realized in this two-level quantum system. The electron’s probability density oscillates in the RbCl QPD with a certain period of T0 = 7.933 fs when the electron is in the superposition state of the GFES. The results indicate that due to the presence of the asymmetrical structure in the z direction of the RbCl QPD, the electron’s probability density shows double-peak configuration, whereas there is only peak if the confinement is a symmetric structure in the x and y directions of the RbCl QPD. The oscillating period is an increasing function of the cyclotron frequency and the polaron radius, whereas it is a decreasing one of the chemical potential of the two-dimensional electron gas and the zero point of the pseudoharmonic potential (PP).
DNA biosensing with 3D printing technology.
Loo, Adeline Huiling; Chua, Chun Kiang; Pumera, Martin
2017-01-16
3D printing, an upcoming technology, has vast potential to transform conventional fabrication processes due to the numerous improvements it can offer to the current methods. To date, the employment of 3D printing technology has been examined for applications in the fields of engineering, manufacturing and biological sciences. In this study, we examined the potential of adopting 3D printing technology for a novel application, electrochemical DNA biosensing. Metal 3D printing was utilized to construct helical-shaped stainless steel electrodes which functioned as a transducing platform for the detection of DNA hybridization. The ability of electroactive methylene blue to intercalate into the double helix structure of double-stranded DNA was then exploited to monitor the DNA hybridization process, with its inherent reduction peak serving as an analytical signal. The designed biosensing approach was found to demonstrate superior selectivity against a non-complementary DNA target, with a detection range of 1-1000 nM.
A double expansion method for the frequency response of finite-length beams with periodic parameters
NASA Astrophysics Data System (ADS)
Ying, Z. G.; Ni, Y. Q.
2017-03-01
A double expansion method for the frequency response of finite-length beams with periodic distribution parameters is proposed. The vibration response of the beam with spatial periodic parameters under harmonic excitations is studied. The frequency response of the periodic beam is the function of parametric period and then can be expressed by the series with the product of periodic and non-periodic functions. The procedure of the double expansion method includes the following two main steps: first, the frequency response function and periodic parameters are expanded by using identical periodic functions based on the extension of the Floquet-Bloch theorem, and the period-parametric differential equation for the frequency response is converted into a series of linear differential equations with constant coefficients; second, the solutions to the linear differential equations are expanded by using modal functions which satisfy the boundary conditions, and the linear differential equations are converted into algebraic equations according to the Galerkin method. The expansion coefficients are obtained by solving the algebraic equations and then the frequency response function is finally determined. The proposed double expansion method can uncouple the effects of the periodic expansion and modal expansion so that the expansion terms are determined respectively. The modal number considered in the second expansion can be reduced remarkably in comparison with the direct expansion method. The proposed double expansion method can be extended and applied to the other structures with periodic distribution parameters for dynamics analysis. Numerical results on the frequency response of the finite-length periodic beam with various parametric wave numbers and wave amplitude ratios are given to illustrate the effective application of the proposed method and the new frequency response characteristics, including the parameter-excited modal resonance, doubling-peak frequency response and remarkable reduction of the maximum frequency response for certain parametric wave number and wave amplitude. The results have the potential application to structural vibration control.
NASA Astrophysics Data System (ADS)
Julian, A.; Jehl, Z.; Miyashita, N.; Okada, Y.; Guillemoles, J.-F.
2016-12-01
Energy selective electrical contacts have been proposed as a way to approach ultimate efficiencies both for thermoelectric and photovoltaic devices as they allow a reduction of the entropy production during the energy conversion process. A self-consistent numerical model based on the transfer matrix approach in the effective mass and envelope function approximation has been developed to calculate the electronic properties of double resonant tunneling barriers used as energy selective contacts in hot carrier solar cells. It is found that the application of an external electric bias significantly degrades the electronic transmission of the structure, and thus the tunneling current in the current-voltage characteristic. This is due to a symmetry breaking which can be offset using finely tuned asymmetric double resonant tunneling barriers, leading to a full recovery of the tunneling current in our model. Moreover, we model the heterostructure using electrons temperature in the emitter higher than that of the lattice, providing insights on the interpretation of experimental devices functioning in hot carrier conditions, especially regarding the previously reported shift of the resonance peak (negative differential resistance), which we interpret as related to a shift in the hot electron distribution while the maximum remains at the conduction band edge of the emitter. Finally, experimental results are presented using asymmetric structure showing significantly improved resonant properties at room temperature with very sharp negative differential resistance.
NASA Astrophysics Data System (ADS)
Hara, Toru; Kondo, Chikara; Inagaki, Takahiro; Togawa, Kazuaki; Fukami, Kenji; Nakazawa, Shingo; Hasegawa, Taichi; Morimoto, Osamu; Yoshioka, Masamichi; Maesaka, Hirokazu; Otake, Yuji; Tanaka, Hitoshi
2018-04-01
The parallel operation of multiple beam lines is an important means to expand the opportunity of user experiments at x-ray free-electron laser (XFEL) facilities. At SPring-8 Angstrom free-electron laser (SACLA), the multi-beam-line operation had been tested using two beam lines, but transverse coherent synchrotron radiation (CSR) effects at a dogleg beam transport severely limited the laser performance. To suppress the CSR effects, a new beam optics based on two double bend achromat (DBA) structures was introduced for the dogleg. After the replacement of the beam optics, high peak current bunches of more than 10 kA are now stably transported through the dogleg and the laser pulse output is increased by a factor of 2-3. In the multi-beam-line operation of SACLA, the electron beam parameters, such as the beam energy and peak current, can be adjusted independently for each beam line. Thus the laser output can be optimized and wide spectral tunability is ensured for all beam lines.
Self-organization and positioning of bacterial protein clusters
NASA Astrophysics Data System (ADS)
Murray, Seán M.; Sourjik, Victor
2017-10-01
Many cellular processes require proteins to be precisely positioned within the cell. In some cases this can be attributed to passive mechanisms such as recruitment by other proteins in the cell or by exploiting the curvature of the membrane. However, in bacteria, active self-positioning is likely to play a role in multiple processes, including the positioning of the future site of cell division and cytoplasmic protein clusters. How can such dynamic clusters be formed and positioned? Here, we present a model for the self-organization and positioning of dynamic protein clusters into regularly repeating patterns based on a phase-locked Turing pattern. A single peak in the concentration is always positioned at the midpoint of the model cell, and two peaks are positioned at the midpoint of each half. Furthermore, domain growth results in peak splitting and pattern doubling. We argue that the model may explain the regular positioning of the highly conserved structural maintenance of chromosomes complexes on the bacterial nucleoid and that it provides an attractive mechanism for the self-positioning of dynamic protein clusters in other systems.
Impact of ETO propellants on the aerothermodynamic analyses of propulsion components
NASA Technical Reports Server (NTRS)
Civinskas, K. C.; Boyle, R. J.; Mcconnaughey, H. V.
1988-01-01
The operating conditions and the propellant transport properties used in Earth-to-Orbit (ETO) applications affect the aerothermodynamic design of ETO turbomachinery in a number of ways. Some aerodynamic and heat transfer implications of the low molecular weight fluids and high Reynolds number operating conditions on future ETO turbomachinery are discussed. Using the current SSME high pressure fuel turbine as a baseline, the aerothermodynamic comparisons are made for two alternate fuel turbine geometries. The first is a revised first stage rotor blade designed to reduce peak heat transfer. This alternate design resulted in a 23 percent reduction in peak heat transfer. The second design concept was a single stage rotor to yield the same power output as the baseline two stage rotor. Since the rotor tip speed was held constant, the turbine work factor doubled. In this alternate design, the peak heat transfer remained the same as the baseline. While the efficiency of the single stage design was 3.1 points less than the baseline two stage turbine, the design was aerothermodynamically feasible, and may be structurally desirable.
[Spectroscopic analysis of the interaction of ethanol and acid phosphatase from wheat germ].
Xu, Dong-mei; Liu, Guang-shen; Wang, Li-ming; Liu, Wei-ping
2004-11-01
Conformational and activity changes of acid phosphatase from wheat germ in ethanol solutions of different concentrations were measured by fluorescence spectra and differential UV-absorption spectra. The effect of ethanol on kinetics of acid phosphatase was determined by using the double reciprocal plot. The results indicate the ethanol has a significant effect on the activity and conformation of acid phosphatase. The activity of acid phosphatase decreased linearly with increasing the concentration of ethanol. Differential UV-absorption spectra of the enzyme denatured in ethanol solutions showed two positive peaks at 213 and 234 nm, respectively. The peaks on the differential UV-absorption spectra suggested that the conformation of enzyme molecule changed from orderly structure to out-of-order crispation. The fluorescence emission peak intensity of the enzyme gradually strengthened with increasing ethanol concentration, which is in concordance with the conformational change of the microenvironments of tyrosine and tryptophan residues. The results indicate that the expression of the enzyme activity correlates with the stability and integrity of the enzyme conformation to a great degree. Ethanol is uncompetitive inhibitor of acid phosphatase.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pereyra, Pedro, E-mail: pereyrapedro@gmail.com; Mendoza-Figueroa, M. G.
Transport properties of electrons through biased double barrier semiconductor structures with finite transverse width w{sub y}, in the presence of a channel-mixing transverse electric field E{sub T} (along the y-axis), were studied. We solve the multichannel Schrödinger equation using the transfer matrix method and transport properties, like the conductance G and the transmission coefficients T{sub ij} have been evaluated as functions of the electrons' energy E and the transverse and longitudinal (bias) electric forces, f{sub T} and f{sub b}. We show that peak-suppression effects appear, due to the applied bias. Similarly, coherent interference of wave-guide states induced by the transversemore » field is obtained. We show also that the coherent interference of resonant wave-guide states gives rise to resonant conductance, which can be tuned to produce broad resonant peaks, implying operation frequencies of the order of 10 THz or larger.« less
NASA Astrophysics Data System (ADS)
Park, Wan Kyu; Hunt, C. R.; Arham, H. Z.; Lu, X.; Greene, L. H.; Xu, Z. J.; Wen, J. S.; Lin, Z. W.; Li, Q.; Gu, G.
2010-03-01
We report point-contact conductance measurements on the iron chalcogenide superconductors, Fe1+yTe1-xSex. The excess Fe atoms are known to occupy the interstitial sites in the Te-Se plane, affecting the superconductivity as well as the magnetism in this family. For a compound having nominal values of y=0 and x=0.45, a single superconducting transition is observed at 14.2 K. In the superconducting state, BTK-like double peak structures due to Andreev reflection are observed. However, the peak position of different point contacts falls to a wide voltage range, 1.5 -- 4 mV. Additional multiple humps are sometimes observed in a much higher bias voltage range, 8 -- 15 mV. Most strikingly, conductance enhancement persists well above Tc. We will present possible interpretations of these experimental observations in terms of multiband superconductivity and the interplay between superconductivity and magnetism.
First Spectroscopic Identification of Massive Young Stellar Objects in the Galactic Center
NASA Technical Reports Server (NTRS)
An, Deokkeun; Ramirez, V.; Sellgren, Kris; Arendt, Richard G.; Boogert, A. C.; Schultheis, Mathias; Stolovy, Susan R.; Cotera, Angela S.; Robitaille, Thomas P.; Smith, Howard A.
2009-01-01
We report the detection of several molecular gas-phase and ice absorption features in three photometrically-selected young stellar object (YSO) candidates in the central 280 pc of the Milky Way. Our spectra, obtained with the Infrared Spectrograph (IRS) onboard the Spitzer Space Telescope, reveal gas-phase absorption from CO2 (15.0 microns), C2H2 (13.7 microns) and HCN (14.0 microns). We attribute this absorption to warm, dense gas in massive YSOs. We also detect strong and broad 15 microns CO2 ice absorption features, with a remarkable double-peaked structure. The prominent long-wavelength peak is due to CH3OH-rich ice grains, and is similar to those found in other known massive YSOs. Our IRS observa.tions demonstra.te the youth of these objects, and provide the first spectroscopic identification of massive YSOs in the Galactic Center.
Beaulieu, M L; Palmieri-Smith, R M
2014-08-01
Excessive knee abduction loading is a contributing factor to anterior cruciate ligament (ACL) injury risk. The purpose of this study was to determine whether a double-leg landing training program with real-time visual feedback improves frontal-plane mechanics during double- and single-leg landings. Knee abduction angles and moments and vertical ground reaction forces (GRF) of 21 recreationally active women were quantified for double- and single-leg landings before and after the training program. This program consisted of two sessions of double-leg jump landings with real-time visual feedback on knee abduction moments for the experimental group and without real-time feedback for the control group. No significant differences were found between training groups. In comparison with pre-training data, peak knee abduction moments decreased 12% post-training for both double- and single-leg landings; whereas peak vertical GRF decreased 8% post-training for double-leg landings only, irrespective of training group. Real-time feedback on knee abduction moments, therefore, did not significantly improve frontal-plane knee mechanics during landings. The effect of the training program on knee abduction moments, however, transferred from the double-leg landings (simple task) to single-leg landings (more complex task). Consequently, ACL injury prevention efforts may not need to focus on complex tasks during which injury occurs. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Topyła, M; Néel, N; Kröger, J
2016-07-12
The adsorption of manganese-phthalocyanine molecules on Au(110) was investigated using a low-temperature scanning tunneling microscope. A rich variety of commensurate superstructures was observed upon increasing the molecule coverage from submonolayers to ultrathin films. All structures were associated with reconstructions of the Au(110) substrate. Molecules adsorbed in the second molecular layer exhibited negative differential conductance occurring symmetrically around zero bias voltage. A double-barrier tunneling model rationalized this observation in terms of a peaked molecular resonance at the Fermi energy together with a voltage drop across the molecular film.
Spin relaxation in quantum dots due to electron exchange with leads.
Vorontsov, A B; Vavilov, M G
2008-11-28
We calculate spin relaxation rates in lateral quantum dot systems due to electron exchange between dots and leads. Using rate equations, we develop a theoretical description of the experimentally observed electric current in the spin blockade regime of double quantum dots. A single expression fits the entire current profile and describes the structure of both the conduction peaks and the suppressed ("valley") region. Extrinsic rates calculated here have to be taken into account for accurate extraction of intrinsic relaxation rates due to the spin-orbit and hyperfine spin scattering mechanisms from spin blockade measurements.
NASA Astrophysics Data System (ADS)
Lensky, N. G.; Lensky, I. M.; Peretz, A.; Gertman, I.; Tanny, J.; Assouline, S.
2018-01-01
Partitioning between the relative effects of the radiative and aerodynamic components of the atmospheric forcing on evaporation is challenging since diurnal distributions of wind speed and solar radiation typically overlap. The Dead Sea is located about a 100 km off the Eastern Mediterranean coast, where and the Mediterranean Sea breeze front reaches it after sunset. Therefore, in the Dead Sea the peaks of solar radiation and wind speed diurnal cycles in the Dead Sea are distinctly separated in time, offering a unique opportunity to distinguish between their relative impacts on evaporation. We present mid-summer eddy covariance and meteorological measurements of evaporation rate and surface energy fluxes over the Dead Sea. The evaporation rate is characterized by a clear diurnal cycle with a daytime peak, few hours after solar radiation peak, and a nighttime peak coincident with wind speed peak. Evaporation rate is minimum during sunrise and sunset. Measurements of evaporation rate from two other water bodies that are closer to the Mediterranean coast, Eshkol Reservoir, and Lake Kinneret, present a single afternoon peak, synchronous with the sea breeze. The inland diurnal evaporation rate cycle varies with the distance from the Mediterranean coast, following the propagation of sea breeze front: near the coast, wind speed, and radiation peaks are close and consequently a single daily evaporation peak appears in the afternoon; at the Dead Sea, about a 100 km inland, the sea breeze front arrives at sunset, resulting in a diurnal evaporation cycle characterized by a distinct double peak.
NASA Astrophysics Data System (ADS)
Vilà, A.; Zhu, J.; Scrinzi, A.; Emmanouilidou, A.
2018-03-01
We study frustrated double ionization (FDI) in a strongly-driven heteronuclear molecule HeH+ and compare with H2. We compute the probability distribution of the sum of the final kinetic energies of the nuclei for strongly-driven HeH+. We find that this distribution has more than one peak for strongly-driven HeH+, a feature we do not find to be present for strongly-driven H2. Moreover, we compute the probability distribution of the principal quantum number n of FDI. We find that this distribution has several peaks for strongly-driven HeH+, while the respective distribution has one main peak and a ‘shoulder’ at lower principal quantum numbers n for strongly-driven H2. Surprisingly, we find this feature to be a clear signature of the intertwined electron-nuclear motion.
NASA Astrophysics Data System (ADS)
Ouyed, Rachid; Leahy, Denis; Koning, Nico
2016-02-01
A quark-nova (QN; the sudden transition from a neutron star into a quark star), which occurs in the second common envelope (CE) phase of a massive binary, gives excellent fits to superluminous, hydrogen-poor, supernovae (SLSNe) with double-peaked light curves, including DES13S2cmm, SN 2006oz, and LSQ14bdq (http://www.quarknova.ca/LCGallery.html). In our model, the H envelope of the less massive companion is ejected during the first CE phase, while the QN occurs deep inside the second, He-rich, CE phase after the CE has expanded in size to a radius of a few tens to a few thousands of solar radii; this yields the first peak in our model. The ensuing merging of the quark star with the CO core leads to black hole formation and accretion, explaining the second long-lasting peak. We study a sample of eight SLSNe Ic with double-humped light curves. Our model provides good fits to all of these, with a universal explosive energy of 2 × 1052 erg (which is the kinetic energy of the QN ejecta) for the first hump. The late-time emissions seen in iPTF13ehe and LSQ14bdq are fit with a shock interaction between the outgoing He-rich (I.e., second) CE and the previously ejected H-rich (I.e., first) CE.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Taddia, F.; Sollerman, J.; Fremling, C.
The aim is to study PTF11mnb, a He-poor supernova (SN) whose light curves resemble those of SN 2005bf, a peculiar double-peaked stripped-envelope (SE) SN, until the declining phase after the main peak. We investigate the mechanism powering its light curve and the nature of its progenitor star. Methods. Optical photometry and spectroscopy of PTF11mnb are presented. We compared light curves, colors and spectral properties to those of SN 2005bf and normal SE SNe. We built a bolometric light curve and modeled this light curve with the SuperNova Explosion Code (SNEC) hydrodynamical code explosion of a MESA progenitor star and semi-analyticmore » models. Results. The light curve of PTF11mnb turns out to be similar to that of SN 2005bf until ~50 d when the main (secondary) peaks occur at -18.5 mag. The early peak occurs at ~20 d and is about 1.0 mag fainter. After the main peak, the decline rate of PTF11mnb is remarkably slower than what was observed in SN 2005bf, and it traces well the 56Co decay rate. The spectra of PTF11mnb reveal a SN Ic and have no traces of He unlike in the case of SN Ib 2005bf, although they have velocities comparable to those of SN 2005bf. The whole evolution of the bolometric light curve is well reproduced by the explosion of a massive (M ej = 7.8 M ⊙ ), He-poor star characterized by a double-peaked 56 Ni distribution, a total 56 Ni mass of 0.59 M ⊙ , and an explosion energy of 2.2 × 10 51 erg. Alternatively, a normal SN Ib/c explosion (M( 56Ni) = 0.11 M ⊙ , E K = 0.2 × 10 51 erg, M ej = 1 M ⊙ ) can power the first peak while a magnetar, with a magnetic field characterized by B = 5.0 × 10 14 G, and a rotation period of P = 18.1 ms, provides energy for the main peak. The early g-band light curve can be fit with a shock-breakout cooling tail or an extended envelope model from which a radius of at least 30 R ⊙ is obtained. Conclusions. We presented a scenario where PTF11mnb was the explosion of a massive, He-poor star, characterized by a double-peaked 56Ni distribution. In this case, the ejecta mass and the absence of He imply a large ZAMS mass (~85 M ⊙) for the progenitor, which most likely was a Wolf-Rayet star, surrounded by an extended envelope formed either by a pre-SN eruption or due to a binary configuration. Alternatively, PTF11mnb could be powered by a SE SN with a less massive progenitor during the first peak and by a magnetar afterward.« less
Self-assembled indium arsenide quantum dots: Structure, formation dynamics, optical properties
NASA Astrophysics Data System (ADS)
Lee, Hao
1998-12-01
In this dissertation, we investigate the properties of InAs/GaAs quantum dots grown by molecular beam epitaxy. The structure and formation dynamics of InAs quantum dots are studied by a variety of structural characterization techniques. Correlations among the growth conditions, the structural characteristics, and the observed optical properties are explored. The most fundamental structural characteristic of the InAs quantum dots is their shape. Through detailed study of the reflection high energy electron diffraction patterns, we determined that self-assembled InAs islands possess a pyramidal shape with 136 bounding facets. Cross-sectional transmission electron microscopy images and atomic force microscopy images strongly support this model. The 136 model we proposed is the first model that is consistent with all reported shape features determined using different methods. The dynamics of coherent island formation is also studied with the goal of establishing the factors most important in determining the size, density, and the shape of self- organized InAs quantum dots. Our studies clearly demonstrate the roles that indium diffusion and desorption play in InAs island formation. An unexpected finding (from atomic force microscopy images) was that the island size distribution bifurcated during post- growth annealing. Photoluminescence spectra of the samples subjected to in-situ annealing prior to the growth of a capping layer show a distinctive double-peak feature. The power-dependence and temperature-dependence of the photoluminescence spectra reveals that the double- peak emission is associated with the ground-state transition of islands in two different size branches. These results confirm the island size bifurcation observed from atomic force microscopy images. The island size bifurcation provides a new approach to the control and manipulation of the island size distribution. Unexpected dependence of the photoluminescence line-shape on sample temperature and pump intensity was observed for samples grown at relatively high substrate temperatures. The behavior is modeled and explained in terms of competition between two overlapping transitions. The study underscores that the growth conditions can have a dramatic impact on the optical properties of the quantum dots. This dissertation includes both my previously published and unpublished authored materials.
Perez, Camilo; Chen, Hong; Matula, Thomas J; Karzova, Maria; Khokhlova, Vera A
2013-08-01
Extracorporeal shock wave therapy (ESWT) uses acoustic pulses to treat certain musculoskeletal disorders. In this paper the acoustic field of a clinical portable ESWT device (Duolith SD1) was characterized. Field mapping was performed in water for two different standoffs of the electromagnetic head (15 or 30 mm) using a fiber optic probe hydrophone. Peak positive pressures at the focus ranged from 2 to 45 MPa, while peak negative pressures ranged from -2 to -11 MPa. Pulse rise times ranged from 8 to 500 ns; shock formation did not occur for any machine settings. The maximum standard deviation in peak pressure at the focus was 1.2%, indicating that the Duolith SD1 generates stable pulses. The results compare qualitatively, but not quantitatively with manufacturer specifications. Simulations were carried out for the short standoff by matching a Khokhlov-Zabolotskaya-Kuznetzov equation to the measured field at a plane near the source, and then propagating the wave outward. The results of modeling agree well with experimental data. The model was used to analyze the spatial structure of the peak pressures. Predictions from the model suggest that a true shock wave could be obtained in water if the initial pressure output of the device were doubled.
Perez, Camilo; Chen, Hong; Matula, Thomas J.; Karzova, Maria; Khokhlova, Vera A.
2013-01-01
Extracorporeal shock wave therapy (ESWT) uses acoustic pulses to treat certain musculoskeletal disorders. In this paper the acoustic field of a clinical portable ESWT device (Duolith SD1) was characterized. Field mapping was performed in water for two different standoffs of the electromagnetic head (15 or 30 mm) using a fiber optic probe hydrophone. Peak positive pressures at the focus ranged from 2 to 45 MPa, while peak negative pressures ranged from −2 to −11 MPa. Pulse rise times ranged from 8 to 500 ns; shock formation did not occur for any machine settings. The maximum standard deviation in peak pressure at the focus was 1.2%, indicating that the Duolith SD1 generates stable pulses. The results compare qualitatively, but not quantitatively with manufacturer specifications. Simulations were carried out for the short standoff by matching a Khokhlov-Zabolotskaya-Kuznetzov equation to the measured field at a plane near the source, and then propagating the wave outward. The results of modeling agree well with experimental data. The model was used to analyze the spatial structure of the peak pressures. Predictions from the model suggest that a true shock wave could be obtained in water if the initial pressure output of the device were doubled. PMID:23927207
Raman study of the Hg0.7Cr0.3Sr2CuO4+δ superconductors
NASA Astrophysics Data System (ADS)
Lee, S.-Y.; Chang, B.-Y.; Yang, I.-S.; Gwak, J.-H.; Kim, S.-J.; Choi, J.-H.; Lee, S.-I.; Yakhmi, J. V.; Mandal, J. B.; Bandyopadhyay, B.; Ghosh, B.
1997-08-01
The local environment of the apical oxygens (OA) in the Sr-substituted mercury-based superconductor Hg0.7Cr0.3Sr2CuO4+δ is investigated using Raman spectroscopy. Raman spectra from the Sr-substituted Hg-1201 samples show broad OA A1g double peaks at 553 and 583 cm-l, which are 10 - 20 cm-1 lower than the pristine Hg-1201. The existence of, and lower shift of, the double peaks in the Raman spectra of the Sr-substituted Hg-1201 superconductors indicate changes in the environment of OA in the Sr-substituted mercury-based superconductors.
Lou, Qiong; Ye, Xiaolan; Zhou, Yingyi; Li, Hua; Song, Fenyun
2015-06-01
A method incorporating double-wavelength ultra high performance liquid chromatography with quadrupole time-of-flight mass spectrometry was developed for the investigation of the chemical fingerprint of Ganmaoling granule. The chromatographic separations were performed on an ACQUITY UPLC HSS C18 column (2.1 × 50 mm, 1.8 μm) at 30°C using gradient elution with water/formic acid (1%) and acetonitrile at a flow rate of 0.4 mL/min. A total of 11 chemical constituents of Ganmaoling granule were identified from their molecular weight, UV spectra, tandem mass spectrometry data, and retention behavior by comparing the results with those of the reference standards or literature. And 25 peaks were selected as the common peaks for fingerprint analysis to evaluate the similarities among 25 batches of Ganmaoling granule. The results of principal component analysis and orthogonal projection to latent structures discriminant analysis showed that the important chemical markers that could distinguish the different batches were revealed as 4,5-di-O-caffeoylquinic acid, 3,5-di-O-caffeoylquinic acid, and 4-O-caffeoylquinic acid. This is the first report of the ultra high performance liquid chromatography chemical fingerprint and component identification of Ganmaoling granule, which could lay a foundation for further studies of Ganmaoling granule. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Double peak sensory nerve action potentials to single stimuli in nerve conduction studies.
Leote, Joao; Pereira, Pedro; Valls-Sole, Josep
2017-05-01
In humans, sensory nerve action potentials (SNAPs) can show 2 separate deflections, i.e., double peak potentials (DPp), which necessarily means that 1 peak is delayed with respect to the other. DPps may have various origins and be due to either physical or physiological properties. We review the nature of commonly encountered DPps in clinical practice, provide the most likely interpretations for their physiological origin, and assess their reproducibility and clinical utility. We classified the DPps into 3 categories: (1) simultaneous anodal and cathodal stimulation. (2) simultaneous recording from 2 different nerves at the same site, and (3) SNAP desynchronization. Although the recording of DPps is not a standardized neurophysiological method, their study brings interesting cues about the physiology of nerve stimulation and paves the way for clinical application of such an observation. Muscle Nerve 55: 619-625, 2017. © 2016 Wiley Periodicals, Inc.
Asymmetric anode and cathode extraction structure fast recovery diode
NASA Astrophysics Data System (ADS)
Xie, Jiaqiang; Ma, Li; Gao, Yong
2018-05-01
This paper presents an asymmetric anode structure and cathode extraction fast and soft recovery diode. The device anode is partial-heavily doped and partial-lightly doped. The P+ region is introduced into the cathode. Firstly, the characteristics of the diode are simulated and analyzed. Secondly, the diode was fabricated and its characteristics were tested. The experimental results are in good agreement with the simulation results. The results show that, compared with the P–i–N diode, although the forward conduction characteristic of the diode is declined, the reverse recovery peak current is reduced by 47%, the reverse recovery time is shortened by 20% and the softness factor is doubled. In addition, the breakdown voltage is increased by 10%. Project supported by the National Natural Science Foundation of China (No. 51177133).
Lattice dynamics of the rare-earth element samarium
NASA Astrophysics Data System (ADS)
Bauder, Olga; Piekarz, Przemysław; Barla, Alessandro; Sergueev, Ilya; Rüffer, Rudolf; ŁaŻewski, Jan; Baumbach, Tilo; Parlinski, Krzysztof; Stankov, Svetoslav
2013-12-01
The lattice dynamics of samarium is determined by in situ low-temperature nuclear inelastic scattering on a single crystalline (0001)Sm film, a polycrystalline Sm foil, and by first-principles theory. The ab initio calculated phonon dispersion relations and phonon density of states for the Sm-type structure and the double hexagonal-close-packed (dhcp) lattice, characteristic for light lanthanides, are compared. The dhcp unit cell, which is a factor of 2.24 smaller in height, exhibits more pronounced vibrational anisotropy in comparison to the Sm-type structure. The analysis reveals a minor influence of the spin-orbit coupling in the Sm atom on the lattice dynamics. A broadening of the longitudinal peak, not found in the calculations, suggests the influence of electron correlations on lattice dynamics in metallic samarium.
Doyle, D A; Wallace, B A
1998-01-01
The conformation of the polypeptide antibiotic gramicidin is greatly influenced by its environment. In methanol, it exists as an equilibrium mixture of four interwound double-helical conformers that differ in their handedness, chain orientation, and alignment. Upon the addition of multivalent cationic salts, there is a shift in the equilibrium to a single conformer, which was monitored in this study by circular dichroism spectroscopy. With increasing concentrations of multivalent cations, both the magnitude of the entire spectrum and the ratio of the 229-nm to the 210-nm peak were increased. The spectral change is not related to the charge on the cation, but appears to be related to the cationic radius, with the maximum change in ellipticity occurring for cations with a radius of approximately 1 A. The effect requires the presence of an anion whose radius is greater than that of a fluoride ion, but is otherwise not a function of anion type. It is postulated that multivalent cations interact with a binding site in one of the conformers, known as species 1 (a left-handed, parallel, no stagger double helix), stabilizing a modified form of this type of structure. PMID:9675165
A double-correlation tremor-location method
NASA Astrophysics Data System (ADS)
Li, Ka Lok; Sgattoni, Giulia; Sadeghisorkhani, Hamzeh; Roberts, Roland; Gudmundsson, Olafur
2017-02-01
A double-correlation method is introduced to locate tremor sources based on stacks of complex, doubly-correlated tremor records of multiple triplets of seismographs back projected to hypothetical source locations in a geographic grid. Peaks in the resulting stack of moduli are inferred source locations. The stack of the moduli is a robust measure of energy radiated from a point source or point sources even when the velocity information is imprecise. Application to real data shows how double correlation focuses the source mapping compared to the common single correlation approach. Synthetic tests demonstrate the robustness of the method and its resolution limitations which are controlled by the station geometry, the finite frequency of the signal, the quality of the used velocity information and noise level. Both random noise and signal or noise correlated at time shifts that are inconsistent with the assumed velocity structure can be effectively suppressed. Assuming a surface wave velocity, we can constrain the source location even if the surface wave component does not dominate. The method can also in principle be used with body waves in 3-D, although this requires more data and seismographs placed near the source for depth resolution.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kryzhkov, D. I., E-mail: krizh@ipmras.ru; Yablonsky, A. N.; Morozov, S. V.
2014-11-28
In this work, a study of the photoluminescence (PL) temperature dependence in quantum well GaAs/GaAsSb and double quantum well InGaAs/GaAsSb/GaAs heterostructures grown by metalorganic chemical vapor deposition with different parameters of GaAsSb and InGaAs layers has been performed. It has been demonstrated that in double quantum well InGaAs/GaAsSb/GaAs heterostructures, a significant shift of the PL peak to a longer-wavelength region (up to 1.2 μm) and a considerable reduction in the PL thermal quenching in comparison with GaAs/GaAsSb structures can be obtained due to better localization of charge carriers in the double quantum well. For InGaAs/GaAsSb/GaAs heterostructures, an additional channel of radiativemore » recombination with participation of the excited energy states in the quantum well, competing with the main ground-state radiative transition, has been revealed.« less
NASA Astrophysics Data System (ADS)
Morasse, Bertrand; Plourde, Estéban
2017-02-01
We present a simple way to achieve and optimize hundreds of kW peak power pulsed output using a monolithic amplifier chain based on solid core double cladding fiber tightly packaged. A fiber pigtailed current driven diode is used to produce nanosecond pulses at 1064 nm. We present how to optimize the use of Fabry-Perot versus DFB type diode along with the proper wavelength locking using a fiber Bragg grating. The optimization of the two pre-amplifiers with respect to the pump wavelength and Yb inversions is presented. We explain how to manage ASE using core and cladding pumping and by using single pass and double pass amplifier. ASE rejection within the Yb fiber itself and with the use of bandpass filter is discussed. Maximizing the amplifier conversion efficiency with regards to the fiber parameters, glass matrix and signal wavelength is described in details. We present how to achieve high peak power at the power amplifier stage using large core/cladding diameter ratio highly doped Yb fibers pumped at 975 nm. The effect of pump bleaching on the effective Yb fiber length is analyzed carefully. We demonstrate that counter-pumping brings little advantage in very short length amplifier. Dealing with the self-pulsation limit of stimulated Brillouin scattering is presented with the adjustment of the seed pulsewidth and linewidth. Future prospects for doubling the output peak power are discussed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Magnusson, A. K.; LaGory, K. E.; Hayse, J. W.
2010-06-25
Flaming Gorge Dam, a hydroelectric facility operated by the Bureau of Reclamation (Reclamation), is located on the Green River in Daggett County, northeastern Utah. Until recently, and since the early 1990s, single daily peak releases or steady flows have been the operational pattern of the dam during the winter period. However, releases from Flaming Gorge Reservoir followed a double-peak pattern (two daily flow peaks) during the winters of 2006-2007 and 2008-2009. Because there is little recent long-term history of double-peaking at Flaming Gorge Dam, the potential effects of double-peaking operations on trout body condition in the dam's tailwater are notmore » known. A study plan was developed that identified research activities to evaluate potential effects from winter double-peaking operations (Hayse et al. 2009). Along with other tasks, the study plan identified the need to conduct a statistical analysis of historical trout condition and macroinvertebrate abundance to evaluate the potential effects of hydropower operations. The results from analyses based on the combined size classes of trout (85-630 mm) were presented in Magnusson et al. (2008). The results of this earlier analysis suggested possible relationships between trout condition and flow, but concern that some of the relationships resulted from size-based effects (e.g., apparent changes in condition may have been related to concomitant changes in size distribution, because small trout may have responded differently to flow than large trout) prompted additional analysis of within-size class relationships. This report presents the results of analyses of three different size classes of trout (small: 200-299 mm, medium: 300-399 mm, and large: {ge}400 mm body length). We analyzed historical data to (1) describe temporal patterns and relationships among flows, benthic macroinvertebrate abundance, and condition of brown trout (Salmo trutta) and rainbow trout (Oncorhynchus mykiss) in the tailwaters of Flaming Gorge Dam, and to (2) evaluate the relative importance of the effects of flow (i.e., flow volumes and flow variability), trout abundance (catch per unit effort [CPUE]), and benthic macroinvertebrate abundance on trout condition for different size classes of trout.« less
NASA Astrophysics Data System (ADS)
Saravanakumar, B.; Ramachandran, S. P.; Ravi, G.; Ganesh, V.; Guduru, Ramesh K.; Yuvakkumar, R.
2018-01-01
In this study, uniform iron manganese trioxide (FeMnO3) microspheres were characterized as electrode for supercapacitor applications. The microspheres were synthesized by hydrothermal method in the presence of different molar ratios of sucrose. X-ray diffraction pattern confirmed that the obtained microsphere has body-centered lattice structure of space group 1213(199). The Raman peak observed at 640 cm-1 might be attributed to the stretching mode of vibration of Mn-O bonds perpendicular to the direction of MnO6 octahedral double chains. The photoluminescence peak at the 536 nm corresponded to Fe2+ ions in FeMnO3 lattice point of body-centered cubic structure. The characteristic strong infrared (IR) bands observed at 669 cm-1 corresponded to Fe-O stretching. The electrochemical characterization of the obtained FeMnO3 products could be understood by carrying out cyclic voltammeter, electroimpedance spectra, and galvanostatic charging and discharge studies in a three-cell setup that demonstrates the exceptional specific capacitance of 773.5 F g-1 at a scan rate of 10 mV s-1 and 763.4 F g-1 at a current density of 1 A g-1.
NASA Astrophysics Data System (ADS)
Taddia, F.; Sollerman, J.; Fremling, C.; Karamehmetoglu, E.; Quimby, R. M.; Gal-Yam, A.; Yaron, O.; Kasliwal, M. M.; Kulkarni, S. R.; Nugent, P. E.; Smadja, G.; Tao, C.
2018-01-01
Aims: We study PTF11mnb, a He-poor supernova (SN) whose light curves resemble those of SN 2005bf, a peculiar double-peaked stripped-envelope (SE) SN, until the declining phase after the main peak. We investigate the mechanism powering its light curve and the nature of its progenitor star. Methods: Optical photometry and spectroscopy of PTF11mnb are presented. We compared light curves, colors and spectral properties to those of SN 2005bf and normal SE SNe. We built a bolometric light curve and modeled this light curve with the SuperNova Explosion Code (SNEC) hydrodynamical code explosion of a MESA progenitor star and semi-analytic models. Results: The light curve of PTF11mnb turns out to be similar to that of SN 2005bf until 50 d when the main (secondary) peaks occur at -18.5 mag. The early peak occurs at 20 d and is about 1.0 mag fainter. After the main peak, the decline rate of PTF11mnb is remarkably slower than what was observed in SN 2005bf, and it traces well the 56Co decay rate. The spectra of PTF11mnb reveal a SN Ic and have no traces of He unlike in the case of SN Ib 2005bf, although they have velocities comparable to those of SN 2005bf. The whole evolution of the bolometric light curve is well reproduced by the explosion of a massive (Mej = 7.8 M⊙), He-poor star characterized by a double-peaked 56Ni distribution, a total 56Ni mass of 0.59 M⊙, and an explosion energy of 2.2 × 1051 erg. Alternatively, a normal SN Ib/c explosion (M(56Ni) = 0.11 M⊙, EK = 0.2 × 1051 erg, Mej = 1 M⊙) can power the first peak while a magnetar, with a magnetic field characterized by B = 5.0 × 1014 G, and a rotation period of P = 18.1 ms, provides energy for the main peak. The early g-band light curve can be fit with a shock-breakout cooling tail or an extended envelope model from which a radius of at least 30 R⊙ is obtained. Conclusions: We presented a scenario where PTF11mnb was the explosion of a massive, He-poor star, characterized by a double-peaked 56Ni distribution. In this case, the ejecta mass and the absence of He imply a large ZAMS mass ( 85 M⊙) for the progenitor, which most likely was a Wolf-Rayet star, surrounded by an extended envelope formed either by a pre-SN eruption or due to a binary configuration. Alternatively, PTF11mnb could be powered by a SE SN with a less massive progenitor during the first peak and by a magnetar afterward. Photometric tables are only available at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/609/A106
Structural Configuration Systems Analysis for Advanced Aircraft Fuselage Concepts
NASA Technical Reports Server (NTRS)
Mukhopadhyay, Vivek; Welstead, Jason R.; Quinlan, Jesse R.; Guynn, Mark D.
2016-01-01
Structural configuration analysis of an advanced aircraft fuselage concept is investigated. This concept is characterized by a double-bubble section fuselage with rear mounted engines. Based on lessons learned from structural systems analysis of unconventional aircraft, high-fidelity finite-element models (FEM) are developed for evaluating structural performance of three double-bubble section configurations. Structural sizing and stress analysis are applied for design improvement and weight reduction. Among the three double-bubble configurations, the double-D cross-section fuselage design was found to have a relatively lower structural weight. The structural FEM weights of these three double-bubble fuselage section concepts are also compared with several cylindrical fuselage models. Since these fuselage concepts are different in size, shape and material, the fuselage structural FEM weights are normalized by the corresponding passenger floor area for a relative comparison. This structural systems analysis indicates that an advanced composite double-D section fuselage may have a relative structural weight ratio advantage over a conventional aluminum fuselage. Ten commercial and conceptual aircraft fuselage structural weight estimates, which are empirically derived from the corresponding maximum takeoff gross weight, are also presented and compared with the FEM- based estimates for possible correlation. A conceptual full vehicle FEM model with a double-D fuselage is also developed for preliminary structural analysis and weight estimation.
Super-massive binary black holes and emission lines in active galactic nuclei
NASA Astrophysics Data System (ADS)
Popović, Luka Č.
2012-02-01
It is now agreed that mergers play an essential role in the evolution of galaxies and therefore that mergers of supermassive black holes (SMBHs) must have been common. We see the consequences of past supermassive binary black holes (SMBs) in the light profiles of so-called 'core ellipticals' and a small number of SMBs have been detected. However, the evolution of SMBs is poorly understood. Theory predicts that SMBs should spend a substantial amount of time orbiting at velocities of a few thousand kilometers per second. If the SMBs are surrounded by gas observational effects might be expected from accretion onto one or both of the SMBHs. This could result in a binary Active Galactic Nucleus (AGN) system. Like a single AGN, such a system would emit a broad band electromagnetic spectrum and broad and narrow emission lines. The broad emission spectral lines emitted from AGNs are our main probe of the geometry and physics of the broad line region (BLR) close to the SMBH. There is a group of AGNs that emit very broad and complex line profiles, showing two displaced peaks, one blueshifted and one redshifted from the systemic velocity defined by the narrow lines, or a single such peak. It has been proposed that such line shapes could indicate an SMB system. We discuss here how the presence of an SMB will affect the BLRs of AGNs and what the observational consequences might be. We review previous claims of SMBs based on broad line profiles and find that they may have non-SMB explanations as a consequence of a complex BLR structure. Because of these effects it is very hard to put limits on the number of SMBs from broad line profiles. It is still possible, however, that unusual broad line profiles in combination with other observational effects (line ratios, quasi-periodical oscillations, spectropolarimetry, etc.) could be used for SMBs detection. Some narrow lines (e.g., [O III]) in some AGNs show a double-peaked profile. Such profiles can be caused by streams in the Narrow Line Region (NLR), but may also indicate the presence of a kilo-parsec scale mergers. A few objects indicated as double-peaked narrow line emitters are confirmed as kpc-scale margers, but double-peaked narrow line profiles are mostly caused by the complex NLR geometry. We briefly discuss the expected line profile of broad Fe Kα that probably originated in the accretion disk(s) around SMBs. This line may also be very complex and indicate the complex disk geometry or/and an SMB presence. Finally we consider rare configurations where a SMB system might be gravitationally lensed by a foreground galaxy, and discuss the expected line profiles in these systems.
NASA Astrophysics Data System (ADS)
Liu, L. Z.; Wu, X. L.; Li, T. H.; Xiong, S. J.; Chen, H. T.; Chu, Paul K.
2011-12-01
Nanoscale spherical, cubic, and cuboid SnO2 nanocrystals (NCs) are used to investigate morphology-dependent low-frequency Raman scattering. A double-peak structure in which the linewidths and energy separation between two subpeaks decrease with increasing sizes of cuboid NCs is observed and attributed to the surface acoustic phonon modes confined in three dimensional directions and determined by the surface/interface compositions. The decrease in energy separation is due to weaker coupling between the acoustic modes in different vibration directions. Our experimental and theoretical studies clearly disclose the morphology-dependent surface vibrational behavior in self-assembled NCs.
The Correlation Entropy as a Measure of the Complexity of High-Lying Single-Particle Modes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stoyanov, Chavdar; Zelevinsky, Vladimir; Department of Physics and Astronomy, Michigan State University, East Lansing, Michigan 48824-1321
Highly-excited single-particle states in nuclei are coupled with the excitations of a more complex character, first of all with collective phonon-like modes of the core. In the framework of the quasiparticle-phonon model we consider the structure of resulting complex configurations using the 1k17/2 orbital in 209Pb as an example. The eigenstates of the model carry significant degree of complexity that can be quantified with the aid of correlational invariant entropy. With artificially enhanced particle-core coupling, the system undergoes the doubling phase transition with the quasiparticle strength concentrated in two repelling peaks.
2012-01-06
polyacrylonitrile, -(CH2=CH- C ≡ N )- n and polybutadiene, -(CH2-CH=CH-CH2)- n . The characteristics of a given elastomer are therefore expected to depend on the...presence of the nitrile (cyano) - C ≡ N group which is known to yield a sharp peak at 2235 cm-1 in IR spectra. The presence of the line due to C = C double bond...70 and N0741-75 obtained using KBr pellet method are shown in Fig. 2. In the IR spectra of both elastomers, the nitrile (- C ≡ N ) band at 2235 cm-1 is
Automated Processing of Two-Dimensional Correlation Spectra
Sengstschmid; Sterk; Freeman
1998-04-01
An automated scheme is described which locates the centers of cross peaks in two-dimensional correlation spectra, even under conditions of severe overlap. Double-quantum-filtered correlation (DQ-COSY) spectra have been investigated, but the method is also applicable to TOCSY and NOESY spectra. The search criterion is the intrinsic symmetry (or antisymmetry) of cross-peak multiplets. An initial global search provides the preliminary information to build up a two-dimensional "chemical shift grid." All genuine cross peaks must be centered at intersections of this grid, a fact that reduces the extent of the subsequent search program enormously. The program recognizes cross peaks by examining the symmetry of signals in a test zone centered at a grid intersection. This "symmetry filter" employs a "lowest value algorithm" to discriminate against overlapping responses from adjacent multiplets. A progressive multiplet subtraction scheme provides further suppression of overlap effects. The processed two-dimensional correlation spectrum represents cross peaks as points at the chemical shift coordinates, with some indication of their relative intensities. Alternatively, the information is presented in the form of a correlation table. The authenticity of a given cross peak is judged by a set of "confidence criteria" expressed as numerical parameters. Experimental results are presented for the 400-MHz double-quantum-filtered COSY spectrum of 4-androsten-3,17-dione, a case where there is severe overlap. Copyright 1998 Academic Press.
Dissociative and double photoionization of CO2 from threshold to 90 A
NASA Technical Reports Server (NTRS)
Masuoka, T.; Samson, J. A. R.
1979-01-01
The molecular photoionization, dissociative photoionization and double photoionization cross sections for CO2 were measured from their onsets down to 90 A by using various combinations of mass spectrometers (a coincidence time-of-flight mass spectrometer and a magnetic mass spectrometer) and light sources (synchrotron radiation, and glow and spark discharge). It is concluded that the one broad peak and the three shoulders in the total adsorption cross section curve between 640 and 90 A are caused completely by dissociative ionization processes. Several peaks observed in the cross section curve for the total fragmentation CO(+)3, O(+) and C(+) are compared with those in the photoelectron spectrum reported for CO2.
Micro-Welding of Copper Plate by Frequency Doubled Diode Pumped Pulsed Nd:YAG Laser
NASA Astrophysics Data System (ADS)
Nakashiba, Shin-Ichi; Okamoto, Yasuhiro; Sakagawa, Tomokazu; Takai, Sunao; Okada, Akira
A pulsed laser of 532 nm wavelength with ms range pulse duration was newly developed by second harmonic generation of diode pumped pulsed Nd:YAG laser. High electro-optical conversion efficiency more than 13% could be achieved, and 1.5 kW peak power green laser pulse was put in optical fiber of 100 μm in diameter. In micro- welding of 1.0 mm thickness copper plate, a keyhole welding was successfully performed by 1.0 kW peak power at spot diameter less than 200 μm. The frequency doubled pulsed laser improved the processing efficiency of copper welding, and narrow and deep weld bead was stably obtained.
Abramavicius, Darius; Voronine, Dmitri V.; Mukamel, Shaul
2008-01-01
A simulation study demonstrates how the nonlinear optical response of the Fenna–Matthews–Olson photosynthetic light-harvesting complex may be explored by a sequence of laser pulses specifically designed to probe the correlated dynamics of double excitations. Cross peaks in the 2D correlation plots of the spectra reveal projections of the double-exciton wavefunctions onto a basis of direct products of single excitons. An alternative physical interpretation of these signals in terms of quasiparticle scattering is developed. PMID:18562293
[Fluorescence spectra analysis of the scrophularia soup].
Yan, Li-hua; Song, Feng; Han, Juan; Su, Jing; Qu, Fei-fei; Song, Yi-zhan; Hu, Bo-lin; Tian, Jian-guo
2008-08-01
The cold-water and boiled-water soaked scrophularia soups have been prepared. The emission and excitation spectra of each scrophularia soup under different conditions have been measured at room temperature. The pH values of the different scrophularia soups have been also detected. There are obvious differences between the cold-water soaked scrophularia soup and the boiled-water soaked scrophularia. For both soups the emission wavelength increases with the wavelength of the excitation, but the peaks of the emission spectra for cold-water and boiled-water soaked scrophularia soup are different, which are 441 and 532 nm, respectively. Excitation spectrum has double peaks in the cold-water soaked scrophularia soup while only one peak with longer wavelength in the boiled-water soaked one. The pH value changes from 5.5 to 4.1. According to the organic admixture fluorescence mechanism we analyzed the reasons of the experimental results. Through heating, the interaction in different fluorescence molecular and the energy transfer process in the same fluorescence molecular become more active, and the conjugate structures and the generation of hydrogen bonds, increase. The fluorescence measurement is of value for the scrophularia pharmacology analysis and provides an analytical method for the quality identification of scrophularia soup.
Frustrated magnetism in the double perovskite L a2LiOs O6 : A comparison with L a2LiRu O6
NASA Astrophysics Data System (ADS)
Thompson, C. M.; Marjerrison, C. A.; Sharma, A. Z.; Wiebe, C. R.; Maharaj, D. D.; Sala, G.; Flacau, R.; Hallas, A. M.; Cai, Y.; Gaulin, B. D.; Luke, G. M.; Greedan, J. E.
2016-01-01
The frustrated double perovskite L a2LiOs O6 , based on O s5 +(5 d3,t23 ) is studied using magnetization, elastic neutron scattering, heat capacity, and muon spin relaxation (μSR) techniques and compared with isostructural (P 21/n ) L a2LiRu O6 ,R u5 +(4 d3,t23 ) . While previous studies of L a2LiOs O6 showed a broad susceptibility maximum (χmax) near 40 K, heat capacity data indicate a sharp peak at 30 K, similar to L a2LiRu O6 with χmax˜30 K and a heat capacity peak at 24 K. Significant differences between the two materials are seen in powder neutron diffraction where the magnetic structure is described by k =(1 /2 1 /2 0 ) for L a2LiOs O6 , while L a2LiRu O6 has been reported with k =(000 ) , structure for face centered lattices. For the k =(1 /2 1 /2 0 ) structure, one has antiferromagnetic layers stacked antiferromagnetically, while for k =(0 0 0 ) structure, ferromagnetic layers are stacked antiferromagnetically. In spite of these differences, both can be considered as type I fcc antiferromagnetic structures. For L a2LiOs O6 , the magnetic structure is best described in terms of linear combinations of basis vectors belonging to irreducible representations Γ2 and Γ4. The combinations Γ2- Γ4 and Γ2+Γ4 could not be distinguished from refinement of the data. In all cases, the O s5 + moments lie in the y z plane with the largest component along y . The total moment is 1.81(4) μB. For L a2LiRu O6 , the R u5 + moments are reported to lie in the x z plane. In addition, while neutron diffraction, μSR and NMR data indicate a unique TN=24 K for L a2LiRu O6 , the situation for L a2LiOs O6 is more complex, with heat capacity, neutron diffraction, and μSR indicating two ordering events at 30 and 37 K, similar to the cases of cubic B a2YRu O6 and monoclinic S r2YRu O6 .
Measurement of Double-Polarization Asymmetries in the Quasielastic He → 3 ( e → , e ' d ) Process
Mihovilovic, M.; Jin, G.; Long, E.; ...
2014-12-05
We present a precise measurement of double-polarization asymmetries in the 3He(e,e'd) reaction. This particular process is a uniquely sensitive probe of hadron dynamics in 3He and the structure of the underlying electromagnetic currents. The measurements have been performed in and around quasi-elastic kinematics at Q 2=0.25(GeV/c) 2 for missing momenta up to 270MeV/c. The asymmetries are in fair agreement with the state-of-the-art calculations in terms of their functional dependencies on pm and omega, but are systematically offset. Beyond the region of the quasi-elastic peak, the discrepancies become even more pronounced. Thus, our measurements have been able to reveal deficiencies inmore » the most sophisticated calculations of the three-body nuclear system, and indicate that further refinement in the treatment of their two- and/or three-body dynamics is required.« less
Characterizations of double pulsing in neutron multiplicity and coincidence counting systems
Koehler, Katrina E.; Henzl, Vladimir; Croft, Stephen; ...
2016-06-29
Passive neutron coincidence/multiplicity counters are subject to non-ideal behavior, such as double pulsing and dead time. It has been shown in the past that double-pulsing exhibits a distinct signature in a Rossi-alpha distribution, which is not readily noticed using traditional Multiplicity Shift Register analysis. But, it has been assumed that the use of a pre-delay in shift register analysis removes any effects of double pulsing. Here, we use high-fidelity simulations accompanied by experimental measurements to study the effects of double pulsing on multiplicity rates. By exploiting the information from the double pulsing signature peak observable in the Rossi-alpha distribution, themore » double pulsing fraction can be determined. Algebraic correction factors for the multiplicity rates in terms of the double pulsing fraction have been developed. We also discuss the role of these corrections across a range of scenarios.« less
Physiological and harmonic components in neural and muscular coherence in Parkinsonian tremor.
Wang, Shouyan; Aziz, Tipu Z; Stein, John F; Bain, Peter G; Liu, Xuguang
2006-07-01
To differentiate physiological from harmonic components in coherence analysis of the tremor-related neural and muscular signals by comparing power, cross-power and coherence spectra. Influences of waveform, burst-width and additional noise on generating harmonic peaks in the power, cross-power and coherence spectra were studied using simulated signals. The local field potentials (LFPs) of the subthalamic nucleus (STN) and the EMGs of the contralateral forearm muscles in PD patients with rest tremor were analysed. (1) Waveform had significant effect on generating harmonics; (2) noise significantly decreased the coherence values in a frequency-dependent fashion; and (3) cross-spectrum showed high resistance to harmonics. Among six examples of paired LFP-EMG signals, significant coherence appeared at the tremor frequency only, both the tremor and double tremor frequencies and the double-tremor frequency only. In coherence analysis of neural and muscular signals, distortion in waveform generates significant harmonic peaks in the coherence spectra and the coherence values of both physiological and harmonic components are modulated by extra noise or non-tremor related activity. The physiological or harmonic nature of a coherence peak at the double tremor frequency may be differentiated when the coherence spectra are compared with the power and in particular the cross-power spectra.
NASA Astrophysics Data System (ADS)
Mohamadi, Maryam; Afzali, Daryoush; Esmaeili-Mahani, Saeed; Mostafavi, Ali; Torkzadeh-Mahani, Masoud
2015-09-01
Interaction of oleuropein, the major bio-phenol in olive leaf and fruit, with salmon sperm double-stranded DNA was investigated by employing electronic absorption titrations, fluorescence quenching spectroscopy, competitive fluorescence spectroscopy, thermal denaturation and voltammetric studies. Titration of oleuropein with the DNA caused a hypochromism accompanied with a red shift indicating an intercalative mode of interaction. Binding constant of 1.4 × 104 M-1 was obtained for this interaction. From the curves of fluorescence titration of oleuropein with the DNA, binding constant and binding sites were calculated to be 8.61 × 103 M-1 and 1.05, respectively. Competitive studies with ethidium bromide (a well-known DNA intercalator) showed that the bio-phenol could take the place of ethidium bromide in the DNA intercalation sites. The interaction of oleuropein with DNA was also studied electrochemically. In the presence of the DNA, the anodic and cathodic peak currents of oleuropein decreased accompanied with increases in peak-to-peak potential separation and formal potential, indicating the intercalation of oleuropein into the DNA double helix. Moreover, melting temperature of the DNA was found to increase in the presence of oleuropein, indicating the stabilization of the DNA double helix due to an intercalative interaction.
NASA Astrophysics Data System (ADS)
Sordillo, Laura A.; Sordillo, Peter P.; Budansky, Yury; Pu, Yang; Alfano, R. R.
2015-03-01
Fluorescence profiles from breast cancer and breast normal tissue samples with excitation wavelengths at 280 nm and 340 nm were obtained using the conventional LS-50 Perkin-Elmer spectrometer. Fluorescence ratios from these tissue samples, demonstrated by emission peaks at 340 nm, 440 nm and 460 nm and likely representing tryptophan and NADH, show increased relative content of tryptophan in malignant samples. Double ratio (DR) techniques were used to measure the severity of disease. The single excitation double ratio (Single-DR) method utilizes the emission intensity peaks from the spectrum acquired using a single excitation of 280 nm; while the dual excitation double ratio (dual-DR) method utilizes the emission intensity peaks from the spectra acquired using an excitation of 280 nm and 340 nm. Single-DR and dual-DR from 13 patients with breast carcinoma were compared in terms of their efficiency to distinguish high from low/intermediate tumors. Similar results were found with both methods. Results suggest that dual excitation wavelengths may be as effective as single excitation wavelength in calculating the relative content of biomolecules in breast cancer tissue, as well as for the assessment of the malignant potential of these tumors.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Yong-Xin; Gao, Fei; Liu, Jia
2014-07-28
Radial uniformity measurements of plasma density were carried out by using a floating double probe in a cylindrical (21 cm in electrode diameter) capacitive discharge reactor driven over a wide range of frequencies (27–220 MHz). At low rf power, a multiple-node structure of standing wave effect was observed at 130 MHz. The secondary density peak caused by the standing wave effect became pronounced and shifts toward the axis as the driving frequency further to increase, indicative of a much more shortened standing-wave wavelength. With increasing rf power, the secondary density peak shift toward the radial edge, namely, the standing-wave wavelength was increased,more » in good qualitative agreement with the previous theory and simulation results. At higher pressures and high frequencies, the rf power was primarily deposited at the periphery of the electrode, due to the fact that the waves were strongly damped as they propagated from the discharge edge into the center.« less
Latitude character and evolution of Gnevyshev gap
NASA Astrophysics Data System (ADS)
Pandey, K. K.; Hiremath, K. M.; Yellaiah, G.
2017-06-01
The time interval, between two highest peaks of the sunspot maximum, during which activity energy substantially absorbed is called Gnevyshev gap. In this study we focus on mysterious evolution of the Gnevyshev gap by analyzing and comparing the integrated (over the whole Sun) characteristics of magnetic field strength of sunspot groups, soft x-ray flares, filaments or prominences and polar faculae. The time latitude distribution of these solar activities from photosphere to coronal height, for the low (≤50°) and high (≥50°) latitudes, shows the way Gnevyshev gap is evolved. The presence of double peak structure is noticed in high latitude (≥50°) activity. During activity maximum the depression (or valley) appearing, in different activity processes, probably due to shifting, spreading, and transfer of energy from higher to lower latitudes with the progress of solar cycle. The morphology of successive lower latitude zones, considering it as a wave pulse, appears to be modified/scattered, by certain degree due to shifting of magnetic energy to empower higher or lower latitudes.
Understanding Large-scale Structure in the SSA22 Protocluster Region Using Cosmological Simulations
NASA Astrophysics Data System (ADS)
Topping, Michael W.; Shapley, Alice E.; Steidel, Charles C.; Naoz, Smadar; Primack, Joel R.
2018-01-01
We investigate the nature and evolution of large-scale structure within the SSA22 protocluster region at z = 3.09 using cosmological simulations. A redshift histogram constructed from current spectroscopic observations of the SSA22 protocluster reveals two separate peaks at z = 3.065 (blue) and z = 3.095 (red). Based on these data, we report updated overdensity and mass calculations for the SSA22 protocluster. We find {δ }b,{gal}=4.8+/- 1.8 and {δ }r,{gal}=9.5+/- 2.0 for the blue and red peaks, respectively, and {δ }t,{gal}=7.6+/- 1.4 for the entire region. These overdensities correspond to masses of {M}b=(0.76+/- 0.17)× {10}15{h}-1 {M}ȯ , {M}r=(2.15+/- 0.32)× {10}15{h}-1 {M}ȯ , and {M}t=(3.19+/- 0.40)× {10}15{h}-1 {M}ȯ for the red, blue, and total peaks, respectively. We use the Small MultiDark Planck (SMDPL) simulation to identify comparably massive z∼ 3 protoclusters, and uncover the underlying structure and ultimate fate of the SSA22 protocluster. For this analysis, we construct mock redshift histograms for each simulated z∼ 3 protocluster, quantitatively comparing them with the observed SSA22 data. We find that the observed double-peaked structure in the SSA22 redshift histogram corresponds not to a single coalescing cluster, but rather the proximity of a ∼ {10}15{h}-1 {M}ȯ protocluster and at least one > {10}14{h}-1 {M}ȯ cluster progenitor. Such associations in the SMDPL simulation are easily understood within the framework of hierarchical clustering of dark matter halos. We finally find that the opportunity to observe such a phenomenon is incredibly rare, with an occurrence rate of 7.4{h}3 {{{Gpc}}}-3. Based on data obtained at the W.M. Keck Observatory, which is operated as a scientific partnership among the California Institute of Technology, the University of California, and the National Aeronautics and Space Administration, and was made possible by the generous financial support of the W.M. Keck Foundation.
On double shearing in frictional materials
NASA Astrophysics Data System (ADS)
Teunissen, J. A. M.
2007-01-01
This paper evaluates the mechanical behaviour of yielding frictional geomaterials. The general Double Shearing model describes this behaviour. Non-coaxiality of stress and plastic strain increments for plane strain conditions forms an important part of this model. The model is based on a micro-mechanical and macro-mechanical formulation. The stress-dilatancy theory in the model combines the mechanical behaviour on both scales.It is shown that the general Double Shearing formulation comprises other Double Shearing models. These models differ in the relation between the mobilized friction and dilatancy and in non-coaxiality. In order to describe reversible and irreversible deformations the general Double Shearing model is extended with elasticity.The failure of soil masses is controlled by shear mechanisms. These shear mechanisms are determined by the conditions along the shear band. The shear stress ratio of a shear band depends on the orientation of the stress in the shear band. There is a difference between the peak strength and the residual strength in the shear band. While peak stress depends on strength properties only, the residual strength depends upon the yield conditions and the plastic deformation mechanisms and is generally considerably lower than the maximum strength. It is shown that non-coaxial models give non-unique solutions for the shear stress ratio on the shear band. The Double Shearing model is applied to various failure problems of soils such as the direct simple shear test, the biaxial test, infinite slopes, interfaces and for the calculation of the undrained shear strength. Copyright
Zheng, Dong; Yuan, Xiang-Ai; Ma, Haibo; Li, Xiaoxiong; Wang, Xizhang; Liu, Ziteng
2018-01-01
Cresol is a prototype molecule in understanding intermolecular interactions in material and biological systems, because it offers different binding sites with various solvents and protonation states under different pH values. It is found that the UV/Vis absorption spectra of o-cresol in aromatic solvents (benzene, toluene) are characterized by a sharp peak, unlike the broad double-peaks in 11 non-aromatic solvents. Both molecular dynamics simulations and electronic structure calculations revealed the formation of intermolecular π-complexation between o-cresol and aromatic solvents. The thermal movements of solvent and solute molecules render the conformations of o-cresol changing between trans and cis isomers. The π-interaction makes the cis configuration a dominant isomer, hence leading to the single keen-edged UV/Vis absorption peak at approximately 283 nm. The free conformation changes between trans and cis in aqueous solution rationalize the broader absorption peaks in the range of 260–280 nm. The pH dependence of the UV/Vis absorption spectra in aqueous solutions is also rationalized by different protonation states of o-cresol. The explicit solvent model with long-ranged interactions is vital to describe the effects of π-complexation and electrostatic interaction on the UV/Vis absorption spectra of o-cresol in toluene and alkaline aqueous (pH > 10.3) solutions, respectively. PMID:29657794
Zheng, Dong; Yuan, Xiang-Ai; Ma, Haibo; Li, Xiaoxiong; Wang, Xizhang; Liu, Ziteng; Ma, Jing
2018-03-01
Cresol is a prototype molecule in understanding intermolecular interactions in material and biological systems, because it offers different binding sites with various solvents and protonation states under different pH values. It is found that the UV/Vis absorption spectra of o -cresol in aromatic solvents (benzene, toluene) are characterized by a sharp peak, unlike the broad double-peaks in 11 non-aromatic solvents. Both molecular dynamics simulations and electronic structure calculations revealed the formation of intermolecular π-complexation between o -cresol and aromatic solvents. The thermal movements of solvent and solute molecules render the conformations of o -cresol changing between trans and cis isomers. The π-interaction makes the cis configuration a dominant isomer, hence leading to the single keen-edged UV/Vis absorption peak at approximately 283 nm. The free conformation changes between trans and cis in aqueous solution rationalize the broader absorption peaks in the range of 260-280 nm. The pH dependence of the UV/Vis absorption spectra in aqueous solutions is also rationalized by different protonation states of o -cresol. The explicit solvent model with long-ranged interactions is vital to describe the effects of π-complexation and electrostatic interaction on the UV/Vis absorption spectra of o -cresol in toluene and alkaline aqueous (pH > 10.3) solutions, respectively.
Energy resolution of pulsed neutron beam provided by the ANNRI beamline at the J-PARC/MLF
NASA Astrophysics Data System (ADS)
Kino, K.; Furusaka, M.; Hiraga, F.; Kamiyama, T.; Kiyanagi, Y.; Furutaka, K.; Goko, S.; Hara, K. Y.; Harada, H.; Harada, M.; Hirose, K.; Kai, T.; Kimura, A.; Kin, T.; Kitatani, F.; Koizumi, M.; Maekawa, F.; Meigo, S.; Nakamura, S.; Ooi, M.; Ohta, M.; Oshima, M.; Toh, Y.; Igashira, M.; Katabuchi, T.; Mizumoto, M.; Hori, J.
2014-02-01
We studied the energy resolution of the pulsed neutron beam of the Accurate Neutron-Nucleus Reaction Measurement Instrument (ANNRI) at the Japan Proton Accelerator Research Complex/Materials and Life Science Experimental Facility (J-PARC/MLF). A simulation in the energy region from 0.7 meV to 1 MeV was performed and measurements were made at thermal (0.76-62 meV) and epithermal energies (4.8-410 eV). The neutron energy resolution of ANNRI determined by the time-of-flight technique depends on the time structure of the neutron pulse. We obtained the neutron energy resolution as a function of the neutron energy by the simulation in the two operation modes of the neutron source: double- and single-bunch modes. In double-bunch mode, the resolution deteriorates above about 10 eV because the time structure of the neutron pulse splits into two peaks. The time structures at 13 energy points from measurements in the thermal energy region agree with those of the simulation. In the epithermal energy region, the time structures at 17 energy points were obtained from measurements and agree with those of the simulation. The FWHM values of the time structures by the simulation and measurements were found to be almost consistent. In the single-bunch mode, the energy resolution is better than about 1% between 1 meV and 10 keV at a neutron source operation of 17.5 kW. These results confirm the energy resolution of the pulsed neutron beam produced by the ANNRI beamline.
[Effects of glycerol on the spectral properties of sodium caseinate].
Li, Yan; Chang, Fen-fen; Gao, Huan-yuan; Cao, Qing; Jin, Li-e
2015-01-01
Although the immigration of water molecule, and diffusion and traversing of oxygen can be prevented by the edible film prepared through sodium caseinate, which plays a good protection role for the food, the strong hydrophilicity makes its watertightness and mechanical properties become inferior. Because the toughness and water resistance of SC films can be enhanced by glycerol (G) as an additive, it is necessary to elucidate the interaction between G and SC through the spectral characteristics such as fluorescence spectra, infrared spectra and UV spectra. The results show that the fluorescence intensity of SC decreases due to the addition of G. The binding constant obtained by the double logarithmic regression curve analysis is 1. 127 x 10(3) L . mol-1 and the number of binding sites reaches 1. 161. It indicates that the weak chemical bond is primary between G and SC molecules; From IR the absorption peaks of SC are almost the same before and after adding G. However, there is a certain difference among their absorption intensities. It reveals that the secondary structure of SC is affected, β folding length decreases, α helix, random coil structure, β angle structure increases, and the intermolecular hydrogen bond is strengthened; From UV the peptide bond structure of SC is not changed after the addition of G, but the polymer with larger molecular weight, which is formed by non-covalent bond, makes the peak intensity decrease. The research gives the mode of G and SC from the molecular level.
NASA Astrophysics Data System (ADS)
Chen, Peng; Yang, Dingming; Hu, Wenyuan; Zhang, Jing; Wu, Yadong
2017-12-01
Novel red-emitting Ba2Zn1-x-yWO6:xEu3+, yLi+ phosphors were prepared using a high-temperature solid-state method, and the crystal structure, the photoluminescence properties and the doping concentrations of Eu3+ and Li+ were investigated. The results show that these phosphors can be excited by near-ultraviolet light (250-400 nm) and co-doped Li+ can significantly enhance their PL performance. An intense red emission peak at 598 nm (5D0-7F1 transitions) was observed with an excitation wavelength of 316 nm. The CIE chromaticity coordinates of the phosphors are located in the red region, indicating that the BZW:Eu3+, Li+ phosphor holds promise as a red phosphor for near-ultraviolet excited WLEDs.
Structural sensitivity of Csbnd H vibrational band in methyl benzoate
NASA Astrophysics Data System (ADS)
Roy, Susmita; Maiti, Kiran Sankar
2018-05-01
The Csbnd H vibrational bands of methyl benzoate are studied to understand its coupling pattern with other vibrational bands of the biological molecule. This will facilitate to understand the biological structure and dynamics in spectroscopic as well as in microscopic study. Due to the congested spectroscopic pattern, near degeneracy, and strong anharmonicity of the Csbnd H stretch vibrations, assignment of the Csbnd H vibrational frequencies are often misleading. Anharmonic vibrational frequency calculation with multidimensional potential energy surface interprets the Csbnd H vibrational spectra more accurately. In this article we have presented the importance of multidimensional potential energy surface in anharmonic vibrational frequency calculation and discuss the unexpected red shift of asymmetric Csbnd H stretch vibration of methyl group. The Csbnd D stretch vibrational band which is splitted to double peaks due to the Fermi resonance is also discussed here.
Wang, Luojia; Gu, Ying; Chen, Hongyi; Zhang, Jia-Yu; Cui, Yiping; Gerardot, Brian D.; Gong, Qihuang
2013-01-01
Surface plasmons with ultrasmall optical mode volume and strong near field enhancement can be used to realize nanoscale light-matter interaction. Combining surface plasmons with the quantum system provides the possibility of nanoscale realization of important quantum optical phenomena, including the electromagnetically induced transparency (EIT), which has many applications in nonlinear quantum optics and quantum information processing. Here, using a custom-designed resonant plasmon nanocavity, we demonstrate polarized position-dependent linewidth-controllable EIT spectra at the nanoscale. We analytically obtain the double coherent population trapping conditions in a double-Λ quantum system with crossing damping, which give two transparent points in the EIT spectra. The linewidths of the three peaks are extremely sensitive to the level spacing of the excited states, the Rabi frequencies and detunings of pump fields, and the Purcell factors. In particular the linewidth of the central peak is exceptionally narrow. The hybrid system may have potential applications in ultra-compact plasmon-quantum devices. PMID:24096943
NASA Astrophysics Data System (ADS)
Datsyuk, V. V.; Izmailov, I. A.; Naumov, V. V.; Kochelap, V. A.
2016-08-01
In a nonequlibrium plasma of a gas-discharge HgBr lamp, the terminal electronic state of the HgBr(B-X) radiative transition with a peak wavelength of 502 nm remains populated for a relatively long time and is repeatedly excited to the B state in collisions with plasma electrons. This transfer of the HgBr molecules from the ground state X to the excited state B is the main mechanism of formation of the light-emitting molecules especially when the lamp is excited by double current pulses. According to our simulations, due to the electron-induced transitions between HgBr(X) and HgBr(B), the output characteristics of the DBD lamp operating in a double-pulse regime are better than those of the lamp operating in a single-pulse regime. In the considered case, the peak power is calculated to increase by a factor of about 2 and the lamp efficiency increases by about 50%.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Smith, M.; Sullivan, M.; D’Andrea, C. B.
2016-02-03
We present DES14X3taz, a new hydrogen-poor superluminous supernova (SLSN-I) discovered by the Dark Energy Survey (DES) supernova program, with additional photometric data provided by the Survey Using DECam for Superluminous Supernovae. Spectra obtained using Optical System for Imaging and low-Intermediate-Resolution Integrated Spectroscopy on the Gran Telescopio CANARIAS show DES14X3taz is an SLSN-I at z = 0.608. Multi-color photometry reveals a double-peaked light curve: a blue and relatively bright initial peak that fades rapidly prior to the slower rise of the main light curve. Our multi-color photometry allows us, for the first time, to show that the initial peak cools frommore » 22,000 to 8000 K over 15 rest-frame days, and is faster and brighter than any published core-collapse supernova, reaching 30% of the bolometric luminosity of the main peak. No physical Ni-56-powered model can fit this initial peak. We show that a shock-cooling model followed by a magnetar driving the second phase of the light curve can adequately explain the entire light curve of DES14X3taz. Models involving the shock-cooling of extended circumstellar material at a distance of similar or equal to 400 R-circle dot are preferred over the cooling of shock-heated surface layers of a stellar envelope. We compare DES14X3taz to the few double-peaked SLSN-I events in the literature. Although the rise. times and characteristics of these initial peaks differ, there exists the tantalizing possibility that they can be explained by one physical interpretation« less
Smith, M.
2016-02-03
Here, we present DES14X3taz, a new hydrogen-poor superluminous supernova (SLSN-I) discovered by the Dark Energy Survey (DES) supernova program, with additional photometric data provided by the Survey Using DECam for Superluminous Supernovae. Spectra obtained using Optical System for Imaging and low-Intermediate-Resolution Integrated Spectroscopy on the Gran Telescopio CANARIAS show DES14X3taz is an SLSN-I at z = 0.608. Multi-color photometry reveals a double-peaked light curve: a blue and relatively bright initial peak that fades rapidly prior to the slower rise of the main light curve. Our multi-color photometry allows us, for the first time, to show that the initial peak cools from 22,000more » to 8000 K over 15 rest-frame days, and is faster and brighter than any published core-collapse supernova, reaching 30% of the bolometric luminosity of the main peak. No physical (56)Ni-powered model can fit this initial peak. We show that a shock-cooling model followed by a magnetar driving the second phase of the light curve can adequately explain the entire light curve of DES14X3taz. Models involving the shock-cooling of extended circumstellar material at a distance of ≃400 R ⊙ are preferred over the cooling of shock-heated surface layers of a stellar envelope. We compare DES14X3taz to the few double-peaked SLSN-I events in the literature. Although the rise times and characteristics of these initial peaks differ, there exists the tantalizing possibility that they can be explained by one physical interpretation.« less
A preliminary objective evaluation of leprosy footwear using in-shoe pressure measurement.
Linge, K
1996-01-01
The primary function of leprosy shoes, insoles and podiatric orthoses is to provide an underfoot environment capable of distributing the inevitable vertical forces, so reducing areas of peak pressure and ideally the period through which they are applied. Many patients with Hansen's disease have both skeletal deformity and anesthetised feet and the presence of high plantar pressures is the key reason for foot ulceration. This objective investigation using in-shoe dynamic pressure measurements showed that the addition of a shank to control insole rigidity reduced the overall peak pressures under the foot. When a deep canvas shoe was used to test single- and double-thickness insoles of two different types of material it was found in each case that the double-thickness mode was advantageous overall. Microcellular rubber insoles in two types of leprosy shoe were replaced by the polymer Poron. The Poron proved to be superior to both microcellular rubbers. The peak pressure and pressure-time integral should be considered as complimentary variables when determining the efficacy of footwear.
A Study of Applying Pulsed Remote Field Eddy Current in Ferromagnetic Pipes Testing
Luo, Qingwang; Shi, Yibing; Wang, Zhigang; Zhang, Wei; Li, Yanjun
2017-01-01
Pulsed Remote Field Eddy Current Testing (PRFECT) attracts the attention in the testing of ferromagnetic pipes because of its continuous spectrum. This paper simulated the practical PRFECT of pipes by using ANSYS software and employed Least Squares Support Vector Regression (LSSVR) to extract the zero-crossing time to analyze the pipe thickness. As a result, a secondary peak is found in zero-crossing time when transmitter passed by a defect. The secondary peak will lead to wrong quantification and the localization of defects, especially when defects are found only at the transmitter location. Aiming to eliminate the secondary peaks, double sensing coils are set in the transition zone and Wiener deconvolution filter is applied. In the proposed method, position dependent response of the differential signals from the double sensing coils is calibrated by employing zero-mean normalization. The methods proposed in this paper are validated by analyzing the simulation signals and can improve the practicality of PRFECT of ferromagnetic pipes. PMID:28475141
NASA Astrophysics Data System (ADS)
Zhang, Shen; Guo, Yuyu; Li, Xingying; Wu, Xu; Li, Zhe
2018-06-01
Physicochemical properties of Pd/Al2O3-TiO2 catalysts with different amounts of TiO2 contents were investigated by XRD, nitrogen adsorption-desorption, FTIR, NH3-TPD, H2-TPR and XPS techniques. Catalysts of different compositions were tested in the ethanol oxidation reaction to study the effects of TiO2 contents. Double peaks and symmetric path phenomena were observed at certain temperatures with the increase in TiO2 contents. The symmetric peak phenomena and the diverse activity fluctuations have been ascribed to the controlling factors such as temperature and compositions. With the increase in TiO2 content, the surface area, adsorbed oxygen contents and surface acid quantity decreased gradually. The large surface area and adsorbed oxygen contents were conducive to the performance, while increased acid amounts were not beneficial for ethanol oxidation. At 150 and 175 °C, Pd/AT(X1
NASA Astrophysics Data System (ADS)
Roy, Debapriya; Biswas, Abhijit
2017-10-01
Using extensive numerical analysis we investigate effects of asymmetric sidewall spacers on various device parameters of 20-nm double gate MOSFETs associated with analog/RF applications. Our studies show that the device with underlap drain-side spacer length LED of 10 nm and source-side spacer length LES of 5 nm shows improvement in terms of the peak value of transconductance efficiency, voltage gain Av, unity-gain cut-off frequency fT and maximum frequency of oscillations fMAX by 8.6%, 51.7%, 5% and 10.3%, respectively compared to the symmetric 5 nm underlap spacer device with HfO2 spacer of dielectric constant k = 22. Additionally, a higher spacer dielectric constant increases the peak Av while decreasing both peak fT and fMAX. The detailed physical insight is exploited to design a cascode amplifier which yields an ultra-wide gain bandwidth of 2.48 THz at LED = 10 nm with a SiO2 spacer.
A Study of Applying Pulsed Remote Field Eddy Current in Ferromagnetic Pipes Testing.
Luo, Qingwang; Shi, Yibing; Wang, Zhigang; Zhang, Wei; Li, Yanjun
2017-05-05
Pulsed Remote Field Eddy Current Testing (PRFECT) attracts the attention in the testing of ferromagnetic pipes because of its continuous spectrum. This paper simulated the practical PRFECT of pipes by using ANSYS software and employed Least Squares Support Vector Regression (LSSVR) to extract the zero-crossing time to analyze the pipe thickness. As a result, a secondary peak is found in zero-crossing time when transmitter passed by a defect. The secondary peak will lead to wrong quantification and the localization of defects, especially when defects are found only at the transmitter location. Aiming to eliminate the secondary peaks, double sensing coils are set in the transition zone and Wiener deconvolution filter is applied. In the proposed method, position dependent response of the differential signals from the double sensing coils is calibrated by employing zero-mean normalization. The methods proposed in this paper are validated by analyzing the simulation signals and can improve the practicality of PRFECT of ferromagnetic pipes.
The impact law of confining pressure and plastic parameter on Dilatancy of rock
NASA Astrophysics Data System (ADS)
Wang, Bin; Zhang, Zhenjie; Zhu, Jiebing
2017-08-01
Based on cyclic loading-unloading triaxle test of marble, the double parameter dilation angle model is established considering confining pressure effect and plastic parameter. Research shows that not only the strength but also the militancy behavior is highly depended on its confining pressure and plastic parameter during process of failure. Dilation angle evolution law shows obvious nonlinear characteristic almost with a rapid increase to the peak and then decrease gradually with plastic increasing, and the peak dilation angle value is inversely proportional with confining pressure. The proposed double parameter nonlinear dilation angle model can be used to well describe the Dilatancy of rock, which helps to understand the failure mechanism of surrounding rock mass and predict the range of plastic zone.
NASA Astrophysics Data System (ADS)
Jallapuram, Raghavendra; Naydenova, Izabela; Byrne, Hugh J.; Martin, Suzanne; Howard, Robert; Toal, Vincent
2008-01-01
Investigations of polymerization rates in an acrylamide-based photopolymer are presented. The polymerization rate for acrylamide and methylenebisacrylamide was determined by monitoring the changes in the characteristic vibrational peaks at 1284 and 1607 cm-1 corresponding to the bending mode of the CH bond and CC double bonds of acrylamide and in the characteristic peak at 1629 cm-1 corresponding to the carbon-carbon double bond of methylenebisacrylamide using Raman spectroscopy. To study the dependence of the polymerization rate on intensity and to find the dependence parameter, the polymerization rate constant is measured at different intensities. A comparison with a commercially available photopolymer shows that the polymerization rate in this photopolymer is much faster.
Strong late-time circumstellar interaction in the peculiar supernova iPTF14hls
NASA Astrophysics Data System (ADS)
Andrews, Jennifer E.; Smith, Nathan
2018-06-01
We present a moderate-resolution spectrum of the peculiar Type II supernova (SN) iPTF14hls taken on day 1153 after discovery. This spectrum reveals the clear signature of shock interaction with dense circumstellar material (CSM). We suggest that this CSM interaction may be an important clue for understanding the extremely unusual photometric and spectroscopic evolution seen over the first 600 d of iPTF14hls. The late-time spectrum shows a double-peaked intermediate-width H α line indicative of expansion speeds around 1000 km s-1, with the double-peaked shape hinting at a disc-like geometry in the CSM. If the CSM were highly asymmetric, perhaps in a disc or torus that was ejected from the star 3-6 yr prior to explosion, the CSM interaction could have been overrun and hidden below the SN ejecta photosphere from a wide range of viewing angles. In that case, CSM interaction luminosity would have been thermalized well below the photosphere, potentially sustaining the high luminosity without exhibiting the traditional observational signatures of strong CSM interaction (narrow H α emission and X-rays). Variations in density structure of the CSM could account for the multiple rebrightenings of the light curve. We propose that a canonical 1 × 1051 erg explosion energy with enveloped CSM interaction as seen in some recent SNe, rather than an entirely new explosion mechanism, may be adequate to explain the peculiar evolution of iPTF14hls.
Vertically Oriented Graphene Electrochemical Double Layer Capacitor with Very Fast Dynamic Response
2013-01-01
cauliflower type of morphology (see Figure A-2c). Figure A-3. (a) The intensity of D to G peak ratio in Raman spectra and the thickness (height) of...in a random, cauliflower type of morphology (see Figure A-2c). Figure A-2. (a) The intensity of D to G peak ratio in Raman spectra and the
Diffraction-limited, 300-kW peak-power pulses from a coiled multimode fiber amplifier
NASA Astrophysics Data System (ADS)
di Teodoro, Fabio; Koplow, Jeffrey P.; Moore, Sean W.; Kliner, Dahv A. V.
2002-04-01
We report a multimode, double-clad, Yb-doped fiber amplifier that produces diffraction-limited, 0.8-ns pulses with energies of 255 μJ and peak powers in excess of 300 kW at a repetition rate of ~8 kHz. Single-transverse-mode operation was obtained by bend-loss-induced mode filtering of the gain fiber.
Simulating double-peak hydrographs from single storms over mixed-use watersheds
Yang Yang; Theodore A. Endreny; David J. Nowak
2015-01-01
Two-peak hydrographs after a single rain event are observed in watersheds and storms with distinct volumes contributing as fast and slow runoff. The authors developed a hydrograph model able to quantify these separate runoff volumes to help in estimation of runoff processes and residence times used by watershed managers. The model uses parallel application of two...
Dao, Khanh K.; Pey, Angel L.; Gjerde, Anja Underhaug; Teigen, Knut; Byeon, In-Ja L.; Døskeland, Stein O.; Gronenborn, Angela M.; Martinez, Aurora
2011-01-01
Background The regulatory subunit (R) of cAMP-dependent protein kinase (PKA) is a modular flexible protein that responds with large conformational changes to the binding of the effector cAMP. Considering its highly dynamic nature, the protein is rather stable. We studied the thermal denaturation of full-length RIα and a truncated RIα(92-381) that contains the tandem cyclic nucleotide binding (CNB) domains A and B. Methodology/Principal Findings As revealed by circular dichroism (CD) and differential scanning calorimetry, both RIα proteins contain significant residual structure in the heat-denatured state. As evidenced by CD, the predominantly α-helical spectrum at 25°C with double negative peaks at 209 and 222 nm changes to a spectrum with a single negative peak at 212–216 nm, characteristic of β-structure. A similar α→β transition occurs at higher temperature in the presence of cAMP. Thioflavin T fluorescence and atomic force microscopy studies support the notion that the structural transition is associated with cross-β-intermolecular aggregation and formation of non-fibrillar oligomers. Conclusions/Significance Thermal denaturation of RIα leads to partial loss of native packing with exposure of aggregation-prone motifs, such as the B' helices in the phosphate-binding cassettes of both CNB domains. The topology of the β-sandwiches in these domains favors inter-molecular β-aggregation, which is suppressed in the ligand-bound states of RIα under physiological conditions. Moreover, our results reveal that the CNB domains persist as structural cores through heat-denaturation. PMID:21394209
Local strain-induced band gap fluctuations and exciton localization in aged WS2 monolayers
NASA Astrophysics Data System (ADS)
Krustok, J.; Kaupmees, R.; Jaaniso, R.; Kiisk, V.; Sildos, I.; Li, B.; Gong, Y.
2017-06-01
Optical properties of aged WS2 monolayers grown by CVD method on Si/SiO2 substrates are studied using temperature dependent photoluminescence and reflectance contrast spectroscopy. Aged WS2 monolayers have a typical surface roughness about 0.5 nm and, in addition, a high density of nanoparticles (nanocaps) with the base diameter about 30 nm and average height of 7 nm. The A-exciton of aged monolayer has a peak position at 1.951 eV while in as-grown monolayer the peak is at about 24 meV higher energy at room temperature. This red-shift is explained using local tensile strain concept, where strain value of 2.1% was calculated for these nanocap regions. Strained nanocaps have lower band gap energy and excitons will funnel into these regions. At T=10K a double exciton and trion peaks were revealed. The separation between double peaks is about 20 meV and the origin of higher energy peaks is related to the optical band gap energy fluctuations caused by random distribution of local tensile strain due to increased surface roughness. In addition, a wide defect related exciton band XD was found at about 1.93 eV in all aged monolayers. It is shown that the theory of localized excitons describes well the temperature dependence of peak position and halfwidth of the A-exciton band. The possible origin of nanocaps is also discussed.
Double Density Dual Tree Discrete Wavelet Transform implementation for Degraded Image Enhancement
NASA Astrophysics Data System (ADS)
Vimala, C.; Aruna Priya, P.
2018-04-01
Wavelet transform is a main tool for image processing applications in modern existence. A Double Density Dual Tree Discrete Wavelet Transform is used and investigated for image denoising. Images are considered for the analysis and the performance is compared with discrete wavelet transform and the Double Density DWT. Peak Signal to Noise Ratio values and Root Means Square error are calculated in all the three wavelet techniques for denoised images and the performance has evaluated. The proposed techniques give the better performance when comparing other two wavelet techniques.
Biomechanical Effects of an Injury Prevention Program in Preadolescent Female Soccer Athletes
Thompson, Julie A.; Tran, Andrew A.; Gatewood, Corey T.; Shultz, Rebecca; Silder, Amy; Delp, Scott L.; Dragoo, Jason L.
2017-01-01
Background Anterior cruciate ligament (ACL) injuries are common, and children as young as 10 years of age exhibit movement patterns associated with an ACL injury risk. Prevention programs have been shown to reduce injury rates, but the mechanisms behind these programs are largely unknown. Few studies have investigated biomechanical changes after injury prevention programs in children. Purpose/Hypothesis To investigate the effects of the F-MARC 11+ injury prevention warm-up program on changes to biomechanical risk factors for an ACL injury in preadolescent female soccer players. We hypothesized that the primary ACL injury risk factor of peak knee valgus moment would improve after training. In addition, we explored other kinematic and kinetic variables associated with ACL injuries. Study Design Controlled laboratory study. Methods A total of 51 female athletes aged 10 to 12 years were recruited from soccer clubs and were placed into an intervention group (n = 28; mean [±SD] age, 11.8 ± 0.8 years) and a control group (n = 23; mean age, 11.2 ± 0.6 years). The intervention group participated in 15 in-season sessions of the F-MARC 11+ program (2 times/wk). Pre- and postseason motion capture data were collected during preplanned cutting, unanticipated cutting, double-leg jump, and single-leg jump tasks. Lower extremity joint angles and moments were estimated using OpenSim, a biomechanical modeling system. Results Athletes in the intervention group reduced their peak knee valgus moment compared with the control group during the double-leg jump (mean [±standard error of the mean] pre- to posttest change, −0.57 ± 0.27 %BW×HT vs 0.25 ± 0.25 %BW×HT, respectively; P = .034). No significant differences in the change in peak knee valgus moment were found between the groups for any other activity; however, the intervention group displayed a significant pre- to posttest increase in peak knee valgus moment during unanticipated cutting (P = .044). Additional analyses revealed an improvement in peak ankle eversion moment after training during preplanned cutting (P = .015), unanticipated cutting (P = .004), and the double-leg jump (P = .016) compared with the control group. Other secondary risk factors did not significantly improve after training, although the peak knee valgus angle improved in the control group compared with the intervention group during unanticipated cutting (P = .018). Conclusion The F-MARC 11+ program may be effective in improving some risk factors for an ACL injury during a double-leg jump in preadolescent athletes, most notably by reducing peak knee valgus moment. Clinical Relevance This study provides motivation for enhancing injury prevention programs to produce improvement in other ACL risk factors, particularly during cutting and single-leg tasks. PMID:27793803
Biomechanical Effects of an Injury Prevention Program in Preadolescent Female Soccer Athletes.
Thompson, Julie A; Tran, Andrew A; Gatewood, Corey T; Shultz, Rebecca; Silder, Amy; Delp, Scott L; Dragoo, Jason L
2017-02-01
Anterior cruciate ligament (ACL) injuries are common, and children as young as 10 years of age exhibit movement patterns associated with an ACL injury risk. Prevention programs have been shown to reduce injury rates, but the mechanisms behind these programs are largely unknown. Few studies have investigated biomechanical changes after injury prevention programs in children. Purpose/Hypothesis: To investigate the effects of the F-MARC 11+ injury prevention warm-up program on changes to biomechanical risk factors for an ACL injury in preadolescent female soccer players. We hypothesized that the primary ACL injury risk factor of peak knee valgus moment would improve after training. In addition, we explored other kinematic and kinetic variables associated with ACL injuries. Controlled laboratory study. A total of 51 female athletes aged 10 to 12 years were recruited from soccer clubs and were placed into an intervention group (n = 28; mean [±SD] age, 11.8 ± 0.8 years) and a control group (n = 23; mean age, 11.2 ± 0.6 years). The intervention group participated in 15 in-season sessions of the F-MARC 11+ program (2 times/wk). Pre- and postseason motion capture data were collected during preplanned cutting, unanticipated cutting, double-leg jump, and single-leg jump tasks. Lower extremity joint angles and moments were estimated using OpenSim, a biomechanical modeling system. Athletes in the intervention group reduced their peak knee valgus moment compared with the control group during the double-leg jump (mean [±standard error of the mean] pre- to posttest change, -0.57 ± 0.27 %BW×HT vs 0.25 ± 0.25 %BW×HT, respectively; P = .034). No significant differences in the change in peak knee valgus moment were found between the groups for any other activity; however, the intervention group displayed a significant pre- to posttest increase in peak knee valgus moment during unanticipated cutting ( P = .044). Additional analyses revealed an improvement in peak ankle eversion moment after training during preplanned cutting ( P = .015), unanticipated cutting ( P = .004), and the double-leg jump ( P = .016) compared with the control group. Other secondary risk factors did not significantly improve after training, although the peak knee valgus angle improved in the control group compared with the intervention group during unanticipated cutting ( P = .018). The F-MARC 11+ program may be effective in improving some risk factors for an ACL injury during a double-leg jump in preadolescent athletes, most notably by reducing peak knee valgus moment. This study provides motivation for enhancing injury prevention programs to produce improvement in other ACL risk factors, particularly during cutting and single-leg tasks.
NASA Astrophysics Data System (ADS)
Johnson, Robert L.; Anderson, Jason M.; Shanks, Brent H.; Fang, Xiaowen; Hong, Mei; Schmidt-Rohr, Klaus
2013-09-01
Two robust combinations of spectral editing techniques with 2D 13Csbnd 13C NMR have been developed for characterizing the aromatic components of 13C-enriched low-temperature carbon materials. One method (exchange with protonated and nonprotonated spectral editing, EXPANSE) selects cross peaks of protonated and nearby nonprotonated carbons, while the other technique, dipolar-dephased double-quantum/single-quantum (DQ/SQ) NMR, selects signals of bonded nonprotonated carbons. Both spectra are free of a diagonal ridge, which has many advantages: Cross peaks on the diagonal or of small intensity can be detected, and residual spinning sidebands or truncation artifacts associated with the diagonal ridge are avoided. In the DQ/SQ experiment, dipolar dephasing of the double-quantum coherence removes protonated-carbon signals; this approach also eliminates the need for high-power proton decoupling. The initial magnetization is generated with minimal fluctuation by combining direct polarization, cross polarization, and equilibration by 13C spin diffusion. The dipolar dephased DQ/SQ spectrum shows signals from all linkages between aromatic rings, including a distinctive peak from polycondensed aromatics. In EXPANSE NMR, signals of protonated carbons are selected in the first spectral dimension by short cross polarization combined with dipolar dephasing difference. This removes ambiguities of peak assignment to overlapping signals of nonprotonated and protonated aromatic carbons, e.g. near 125 ppm. Spin diffusion is enhanced by dipolar-assisted rotational resonance. Before detection, Csbnd H dipolar dephasing by gated decoupling is applied, which selects signals of nonprotonated carbons. Thus, only cross peaks due to magnetization originating from protonated C and ending on nearby nonprotonated C are retained. Combined with the chemical shifts deduced from the cross-peak position, this double spectral editing defines the bonding environment of aromatic, COO, and Cdbnd O carbons, which is particularly useful for identifying furan and arene rings. The Cdbnd O carbons, whose chemical shifts vary strongly (between 212 and 165 ppm) and systematically depend on their two bonding partners, show particularly informative cross peaks, given that one bonding partner is defined by the other frequency coordinate of the cross peak. The new techniques and the information content of the resulting spectra are validated on sulfuric-acid treated low-temperature carbon materials and on products of the Maillard reaction. The crucial need for spectral editing for correct peak assignment is demonstrated in an example.
NASA Astrophysics Data System (ADS)
Zhang, Shuo; Bo, Zheng; Yang, Huachao; Yang, Jinyuan; Duan, Liangping; Yan, Jianhua; Cen, Kefa
2016-12-01
Organic electrolytes are widely used in electric double-layer capacitors (EDLCs). In this work, the microstructure of planar graphene-based EDLCs with different organic solvents are investigated with molecular dynamics simulations. Results show that an increase of solvent polarity could weaken the accumulation of counter-ions nearby the electrode surface, due to the screen of electrode charges and relatively lower ionic desolvation. It thus suggests that solvents with low polarity could be preferable to yield high EDL capacitance. Meanwhile, the significant effects of the size and structure of solvent molecules are reflected by non-electrostatic molecule-electrode interactions, further influencing the adsorption of solvent molecules on electrode surface. Compared with dimethyl carbonate, γ-butyrolactone, and propylene carbonate, acetonitrile with relatively small-size and linear structure owns weak non-electrostatic interactions, which favors the easy re-orientation of solvent molecules. Moreover, the shift of solvent orientation in surface layer, from parallel orientation to perpendicular orientation relative to the electrode surface, deciphers the solvent twin-peak behavior near negative electrode. The as-obtained insights into the roles of solvent properties on the interplays among particles and electrodes elucidate the solvent influences on the microstructure and capacitive behavior of EDLCs using organic electrolytes.
8. VIEW FORWARD IN CREW'S QUARTERS (FOC'S'LE) SHOWING DOUBLE TIER ...
8. VIEW FORWARD IN CREW'S QUARTERS (FOC'S'LE) SHOWING DOUBLE TIER OF BUNKS IN THE EVELINA M. GOULART. KINGPOST IS AT CENTER OF PHOTOGRAPH WITH FORE PEAK IN BACKGROUND. A FOLDING MESS TABLE IS AT LOWER LEFT OF PHOTOGRAPH. NOTE BENCH SEAT BELOW LOWEST TIER OF BUNKS. - Auxiliary Fishing Schooner "Evelina M. Goulart", Essex Shipbuilding Museum, 66 Main Street, Essex, Essex County, MA
1993-05-14
Lent 6 I We have studied transmission in quantum waveguides in the presence of resonant cavities. This work was inspired by our previous modeling of the...conductance of resonantly- coupled quantum wire systems. We expected to find qualitatively the same phenomena as in the much studied case of double...transmission peaks does not give the location of the quasi-bound3 states, like for double-barrier resonant tunneling. In current work, we study
Electrokinetic ion breakdown in a nanochannel
NASA Astrophysics Data System (ADS)
Wang, Jun-yao; Xu, Zheng
2016-07-01
In this paper, the electrokinetic ion breakdown in a nanochannel is investigated. The Poisson-Nernst-Planck equations are employed to simulate the influence of the voltage on the concentration. Both theoretical research and experiments show that increasing the voltage can promote the ion concentration, but high voltage will break up the repulsion effect of the electric double layer and bring the concentration down. For a given micro-nanochannel, the ion concentration has a peak value corresponding with a peak voltage. Narrowing the width of a nanochannel improves the peak voltage and the peak concentration. The results will be beneficial to research the internal discipline of electrokinetic concentration.
NASA Astrophysics Data System (ADS)
Zhang, Duo; Li, Jiahua; Ding, Chunling; Yang, Xiaoxue
2012-05-01
The spontaneous emission properties of a microwave-field-driven four-level atom embedded in anisotropic double-band photonic crystals (PCs) are investigated. We discuss the influences of the band-edge positions, Rabi frequency and detuning of the microwave field on the emission spectrum. It is found that several interesting features such as spectral-line enhancement, spectral-line suppression, spectral-line overlap, and multi-peak structures can be observed in the spectra. The proposed scheme can be achieved by use of a microwave-coupled field into hyperfine levels in rubidium atom confined in a photonic crystal. These theoretical investigations may provide more degrees of freedom to manipulate the atomic spontaneous emission.
Magnetization process and low-temperature thermodynamics of a spin-1/2 Heisenberg octahedral chain
NASA Astrophysics Data System (ADS)
Strečka, Jozef; Richter, Johannes; Derzhko, Oleg; Verkholyak, Taras; Karľová, Katarína
2018-05-01
Low-temperature magnetization curves and thermodynamics of a spin-1/2 Heisenberg octahedral chain with the intra-plaquette and monomer-plaquette interactions are examined within a two-component lattice-gas model of hard-core monomers, which takes into account all low-lying energy modes in a highly frustrated parameter space involving the monomer-tetramer, localized many-magnon and fully polarized ground states. It is shown that the developed lattice-gas model satisfactorily describes all pronounced features of the low-temperature magnetization process and the magneto-thermodynamics such as abrupt changes of the isothermal magnetization curves, a double-peak structure of the specific heat or a giant magnetocaloric effect.
NASA Astrophysics Data System (ADS)
Wang, Yannan; Xin, Yunchang; Chapuis, Adrien; Yu, Huihui; Liu, Qing
2016-08-01
Rolled Mg alloys often present a basal texture with the (0002) poles slightly tilting from the normal direction (ND) towards the rolling direction. The current work systematically studies the formation of a double-peaked basal texture tilting from the ND towards the transverse direction (TD) of Mg-5.7Zn-0.5Zr (ZK60) plates hot rolled from the as-cast condition. Our results show that a basal texture forms with the two peaks obviously tilting from the ND towards the TD after rolling to reductions over 19 pct at 673 K (400 °C), but does not appear after rolling at 293 K (20 °C). The TD-tilted double peaks of basal poles disappear after annealing, developing a stronger peak of basal poles around the ND. The microstructural examination indicates that this TD-tilted basal texture mainly results from rolling deformation rather than dynamic recrystallization. Crystal plasticity simulation using the VPSC model was used to understand the effect of slips and twinning on the formation of this TD-tilted basal texture. Simulation demonstrates that, compared to prismatic slip, pyramidal slip is more efficient to generate the basal texture tilting towards the TD. The possible mechanisms affecting the activity of non-basal slips are discussed.
Single- and Double-Strand Breaks of Dry DNA Exposed to Protons at Bragg-Peak Energies.
Souici, Mounir; Khalil, Talat T; Muller, Dominique; Raffy, Quentin; Barillon, Rémi; Belafrites, Abdelfettah; Champion, Christophe; Fromm, Michel
2017-01-26
Ultrathin layers (<20 nm) of pBR322 plasmid DNA were deposited onto 2.5 μm thick polyester films and exposed to proton Bragg-peak energies (90-3000 keV) at various fluences. A quantitative analysis of radio-induced DNA damage is reported here in terms of single- and double-strand breaks (SSB and DSB, respectively). The corresponding yields as well as G-values and the cross sections exhibit fairly good agreement with the rare available data, stemming from close experimental conditions, namely, based on α particle irradiation. SSB/DSB rates appear to be linear when plotted against linear energy transfer (LET) in the whole energy range studied. All the data present a maximum in the 150-200 keV energy range; as for LET, it peaks at 90 keV. We also show that fragmentation starts to be significant for proton fluences greater than 1 × 10 11 cm -2 at the Bragg-peak energies. Finally, we determine the average proton track radial extension, r max , corresponding to an occupation probability of 100% DSB in the Bragg-peak region. The r max values determined are in excellent agreement with the radial extensions of proton tracks determined by simulation approaches in water. When plotted as a function of LET, both SSB and DSB cross sections bend back at high LETs.
The double layers in the plasma sheet boundary layer during magnetic reconnection
NASA Astrophysics Data System (ADS)
Guo, J.; Yu, B.
2014-11-01
We studied the evolutions of double layers which appear after the magnetic reconnection through two-dimensional electromagnetic particle-in-cell simulation. The simulation results show that the double layers are formed in the plasma sheet boundary layer after magnetic reconnection. At first, the double layers which have unipolar structures are formed. And then the double layers turn into bipolar structures, which will couple with another new weak bipolar structure. Thus a new double layer or tripolar structure comes into being. The double layers found in our work are about several ten Debye lengths, which accords with the observation results. It is suggested that the electron beam formed during the magnetic reconnection is responsible for the production of the double layers.
Using a double-doping strategy to improve physical properties of nanostructured CdO films
NASA Astrophysics Data System (ADS)
Aydin, R.; Sahin, B.
2018-06-01
In this present study nanostructured dually doped samples of Cd1‑x‑yMgxMyO (M: Sn, Pb, Bi) are synthesized by SILAR method. The effects of the mono and dual doping on the structural, morphological and optoelectronic characteristics of CdO nanoparticles are examined. The SEM images verify that deposited CdO films are nano-sized. Also the SEM computations demonstrated that the morphological surface structures of the films were influenced from the Mg mono doping and (Mg, Sn), (Mg, Pb) and (Mg, Bi) dual doping. The XRD designs specified that all the CdO samples have polycrystalline structure exhibiting cubic crystal form with dominant peaks of (111) and (220). The results display that Mg and (Mg, Sn), (Mg, Pb) and (Mg, Bi) ions were successfully doped into CdO film matrix. The UV spectroscopy results show that the optical energy band gap of the CdO films, ranging from 2.21 to 2.66 eV, altered with the dopant materials.
Antagonist muscle co-contraction during a double-leg landing maneuver at two heights.
Mokhtarzadeh, Hossein; Yeow, Chen Hua; Goh, James Cho Hong; Oetomo, Denny; Ewing, Katie; Lee, Peter Vee Sin
2017-10-01
Knee injuries are common during landing activities. Greater landing height increases peak ground reaction forces (GRFs) and loading at the knee joint. As major muscles to stabilize the knee joint, Quadriceps and Hamstring muscles provide internal forces to attenuate the excessive GRF. Despite the number of investigations on the importance of muscle function during landing, the role of landing height on these muscles forces using modeling during landing is not fully investigated. Participant-specific musculoskeletal models were developed using experimental motion analysis data consisting of anatomic joint motions and GRF from eight male participants performing double-leg drop landing from 30 and 60 cm. Muscle forces were calculated in OpenSim and their differences were analyzed at the instances of high risk during landing i.e. peak GRF for both heights. The maximum knee flexion angle and moments were found significantly higher from a double-leg landing at 60 cm compared to 30 cm. The results showed elevated GRF, and mean muscle forces during landing. At peak GRF, only quadriceps showed significantly greater forces at 60 cm. Hamstring muscle forces did not significantly change at 60 cm compared to 30 cm. Quadriceps and hamstring muscle forces changed at different heights. Since hamstring forces were similar in both landing heights, this could lead to an imbalance between the antagonist muscles, potentially placing the knee at risk of injury if combined with small flexion angles that was not observed at peak GRF in our study. Thus, enhanced neuromuscular training programs strengthening the hamstrings may be required to address this imbalance. These findings may contribute to enhance neuromuscular training programs to prevent knee injuries during landing.
Fast-scale non-linear distortion analysis of peak-current-controlled buck-boost inverters
NASA Astrophysics Data System (ADS)
Zhang, Hao; Dong, Shuai; Yi, Chuanzhi; Guan, Weimin
2018-02-01
This paper deals with fast-scale non-linear distortion behaviours including asymmetrical period-doubling bifurcation and zero-crossing distortion in peak-current-controlled buck-boost inverters. The underlying mechanisms of the fast-scale non-linear distortion behaviours in inverters are revealed. The folded bifurcation diagram is presented to analyse the asymmetrical phenomenon of fast-scale period-doubling bifurcation. In view of the effect of phase shift and current ripple, the analytical expressions for one pair of critical phase angles are derived by using the design-oriented geometrical current approach. It is shown that the phase shift between inductor current and capacitor voltage should be responsible for the zero-crossing distortion phenomenon. These results obtained here are useful to optimise the circuit design and improve the circuit performance.
Lightning-channel morphology by return-stroke radiation field waveforms
NASA Technical Reports Server (NTRS)
Willett, J. C.; Le Vine, D. M.; Idone, V. P.
1995-01-01
Simultaneous video and wideband electric field recordings of 32 cloud-to-ground lightning flashes in Florida were analyzed to show the formation of new channels to ground can be detected by examination of the return-stroke radiation fields alone. The return-stroke E and dE/dt waveforms were subjectively classified according to their fine structure. Then the video images were examined field by field to identify each waveform with a visible channel to ground. Fifty-five correlated waveforms and channel images were obtained. Of these, all 34 first-stroke waveforms (multiple jagged E peaks, noisy dE/dt), 8 of which were not radiated by the chronologically first stroke in the flash, came from new channels to ground (not previously seen on video). All 18 subsequent-stroke waveforms (smoothly rounded E and quiet dE/dt after initial peak) were radiated by old channels (illuminated by a previous stroke). Two double-ground waveforms (two distinct first-return-stroke pulses separated by tens of microseconds or less) coincided with video fields showing two new channels. One `anomalous-stroke' waveform (beginning like a first stroke and ending like a subsequent) was produced by a new channel segment to ground branching off an old channel. This waveform classification depends on the presence or absence of high-frequency fine structure. Fourier analysis shows that first-stroke waveforms contain about 18 dB more spectral power in the frequency interval from 500 kHz to at least 7 MHz than subsequent-stroke waveforms for at least 13 microseconds after the main peak.
NASA Astrophysics Data System (ADS)
Taguchi, M.; Chainani, A.; Ueda, S.; Matsunami, M.; Ishida, Y.; Eguchi, R.; Tsuda, S.; Takata, Y.; Yabashi, M.; Tamasaku, K.; Nishino, Y.; Ishikawa, T.; Daimon, H.; Todo, S.; Tanaka, H.; Oura, M.; Senba, Y.; Ohashi, H.; Shin, S.
2015-12-01
We study the electronic structure of bulk single crystals and epitaxial films of Fe3 O4 . Fe 2 p core level spectra show clear differences between hard x-ray (HAX) and soft x-ray photoemission spectroscopy (PES). The bulk-sensitive spectra exhibit temperature (T ) dependence across the Verwey transition, which is missing in the surface-sensitive spectra. By using an extended impurity Anderson full-multiplet model—and in contrast to an earlier peak assignment—we show that the two distinct Fe species (A and B site) and the charge modulation at the B site are responsible for the newly found double peaks in the main peak above TV and its T -dependent evolution. The Fe 2 p HAXPES spectra show a clear magnetic circular dichroism (MCD) in the metallic phase of magnetized 100-nm-thick films. The model calculations also reproduce the MCD and identify the contributions from magnetically distinct A and B sites. Valence band HAXPES shows a finite density of states at EF for the polaronic half metal with a remnant order above TV and a clear gap formation below TV. The results indicate that the Verwey transition is driven by changes in the strongly correlated and magnetically active B -site electronic states, consistent with resistivity and optical spectra.
NASA Astrophysics Data System (ADS)
Biffi, Carlo Alberto; Previtali, Barbara; Tuissi, Ausonio
Cellular shape memory alloys (SMAs) are very promising smart materials able to combine functional properties of the material with lightness, stiffness, and damping capacity of the cellular structure. Their processing with low modification of the material properties remains an open question. In this work, the laser weldability of CuZnAl SMA in the form of open cell foams was studied. The cellular structure was proved to be successfully welded in lap joint configuration by using a thin plate of the same alloy. Softening was seen in the welded bead in all the investigated ranges of process speed as well as a double stage heat affected zone was identified due to different microstructures; the martensitic transformation was shifted to higher temperatures and the corresponding peaks were sharper with respect to the base material due to the rapid solidification of the material. Anyways, no compositional variations were detected in the joints.
Yan, Yun-An
2016-01-14
The quantum interference is an intrinsic phenomenon in quantum physics for photon and massive quantum particles. In principle, the quantum interference may also occur with quasi-particles, such as the exciton. In this study, we show how the exciton quantum interference can be significant in aggregates through theoretical simulations with hierarchical equations of motion. The systems under investigation are generalized donor-bridge-acceptor model aggregates with the donor consisting of six homogeneous sites assuming the nearest neighbor coupling. For the models with single-path bridge, the exciton transfer time only shows a weak excitation energy dependence. But models with double-path bridge have a new short transfer time scale and the excitation energy dependence of the exciton transfer time assumes clear peak structure which is detectable with today's nonlinear spectroscopy. This abnormality is attributed to the exciton quantum interference and the condition for a clear observation in experiment is also explored.
The structure of poly(carbonsuboxide) on the atomic scale: a solid-state NMR study.
Schmedt auf der Günne, Jörn; Beck, Johannes; Hoffbauer, Wilfried; Krieger-Beck, Petra
2005-07-18
In this contribution we present a study of the structure of amorphous poly(carbonsuboxide) (C3O2)x by 13C solid-state NMR spectroscopy supported by infrared spectroscopy and chemical analysis. Poly(carbonsuboxide) was obtained by polymerization of carbonsuboxide C3O2, which in turn was synthesized from malonic acid bis(trimethylsilylester). Two different 13C labeling schemes were applied to probe inter- and intramonomeric bonds in the polymer by dipolar solid-state NMR methods and also to allow quantitative 13C MAS NMR spectra. Four types of carbon environments can be distinguished in the NMR spectra. Double-quantum and triple-quantum 2D correlation experiments were used to assign the observed peaks using the through-space and through-bond dipolar coupling. In order to obtain distance constraints for the intermonomeric bonds, double-quantum constant-time experiments were performed. In these experiments an additional filter step was applied to suppress contributions from not directly bonded 13C,13C spin pairs. The 13C NMR intensities, chemical shifts, connectivities and distances gave constraints for both the polymerization mechanism and the short-range order of the polymer. The experimental results were complemented by bond lengths predicted by density functional theory methods for several previously suggested models. Based on the presented evidence we can unambiguously exclude models based on gamma-pyronic units and support models based on alpha-pyronic units. The possibility of planar ladder- and bracelet-like alpha-pyronic structures is discussed.
Karthikeyan, S; Kim, Kwang S
2009-08-13
Protonated water clusters H+(H2O)n favor two-dimensional (2D) structures for n < or = 7 at low temperatures. At 0 K, the 2D and three-dimensional (3D) structures for n = 8 are almost isoenergetic, and the 3D structures for n > 9 tend to be more stable. However, for n = 9, the netlike structures are likely to be more stable above 150 K. In this regard, we investigate the case of n = 10 to find which structure is more stable between the 3D structure and the netlike structure around 150 and 250 K. We use density functional theory, Møller-Plesset second-order perturbation theory, and coupled cluster theory with single, double, and perturbative triple excitations (CCSD(T)). At the complete basis set limit for the CCSD(T) level of theory, three isomers of 3D cage structure are much more stable in zero point energy corrected binding energy and in free binding energies at 150 K than the lowest energy netlike structures, while the netlike structure would be more stable around approximately 250 K. The predicted vibrational spectra are in good agreement with the experiment. One of the three isomers explains the experimental IR observation of an acceptor (A) type peak of a dangling hydrogen atom.
[Caloric value and energy allocation of Chloris virgata in northeast grassland].
Guo, J; Wang, R; Wang, W
2001-06-01
The rules of seasonal changes in caloric values of individual plant, stem, and leaves of Chloris virgata were similar, which had two peak values from early July to early August, and then decreased gradually. Those of inflorescence assumed U shape, and had two peak values in early August and middle September, respectively. The seasonal changes in caloric values of dead standing were irregular, and the maximum value was appeared in early August. The seasonal changes in existent energy value of the aboveground parts in Chloris virgata population presented double peak curve. The two peak values were appeared in early August and early September respectively, and the maximum value was 7381.27 kJ.m-2 in early September. The energy allocation in different seasons was leaf > stem in early July, stem > leaf > dead standing in middle July, stem > leaf > inflorescence > dead standing in August, stem > inflorescence > leaf > dead standing in early September, and stem > inflorescence > dead standing > leaf in middle September. The vertical structure of energy in the aboveground parts was that the energy value gradually increased from the earth's surface to 20 cm high, and then decreased. The maximum value, which accounted for 25.75% of energy in the aboveground parts, was appeared in the layer of 10-20 cm high. In the underground parts, the energy value progressively decreased with the increase of depth, and the maximum value, which accounted for 74.21% of energy in the underground parts, was appeared in the layer of 0-10 cm depth.
Asymmetry of bifurcated features in radio pulsar profiles
NASA Astrophysics Data System (ADS)
Dyks, J.; Rudak, B.
2012-03-01
High-quality integrated radio profiles of some pulsars contain bifurcated, highly symmetric emission components (BECs). They are observed when our line of sight traverses through a split-fan shaped emission beam. It is shown that for oblique cuts through such a beam, the features appear asymmetric at nearly all frequencies, except for a single 'frequency of symmetry'νsym, at which both peaks in the BEC have the same height. Around νsym, the ratio of flux in the two peaks of a BEC evolves in a way resembling the multifrequency behaviour of J1012+5307. Because of the inherent asymmetry resulting from the oblique traverse of the sightline, each minimum in double notches can be modelled independently. Such a composed model reproduces the double notches of B1929+10 if the fitted function is the microscopic beam of curvature radiation in the orthogonal polarization mode. These results confirm our view that some of the double components in radio pulsar profiles directly reveal the microscopic nature of the emitted radiation beam as the microbeam of the curvature radiation polarized orthogonally to the trajectory of electrons.
A Double Dwell High Sensitivity GPS Acquisition Scheme Using Binarized Convolution Neural Network
Wang, Zhen; Zhuang, Yuan; Yang, Jun; Zhang, Hengfeng; Dong, Wei; Wang, Min; Hua, Luchi; Liu, Bo; Shi, Longxing
2018-01-01
Conventional GPS acquisition methods, such as Max selection and threshold crossing (MAX/TC), estimate GPS code/Doppler by its correlation peak. Different from MAX/TC, a multi-layer binarized convolution neural network (BCNN) is proposed to recognize the GPS acquisition correlation envelope in this article. The proposed method is a double dwell acquisition in which a short integration is adopted in the first dwell and a long integration is applied in the second one. To reduce the search space for parameters, BCNN detects the possible envelope which contains the auto-correlation peak in the first dwell to compress the initial search space to 1/1023. Although there is a long integration in the second dwell, the acquisition computation overhead is still low due to the compressed search space. Comprehensively, the total computation overhead of the proposed method is only 1/5 of conventional ones. Experiments show that the proposed double dwell/correlation envelope identification (DD/CEI) neural network achieves 2 dB improvement when compared with the MAX/TC under the same specification. PMID:29747373
Vickers, D.; Thomas, C. K.
2014-09-16
Observations of the scale-dependent turbulent fluxes, variances, and the bulk transfer parameterization for sensible heat above, within, and beneath a tall closed Douglas-fir canopy in very weak winds are examined. The daytime sub-canopy vertical velocity spectra exhibit a double-peak structure with peaks at timescales of 0.8 s and 51.2 s. A double-peak structure is also observed in the daytime sub-canopy heat flux co-spectra. The daytime momentum flux co-spectra in the upper bole space and in the sub-canopy are characterized by a relatively large cross-wind component, likely due to the extremely light and variable winds, such that the definition of amore » mean wind direction, and subsequent partitioning of the momentum flux into along- and cross-wind components, has little physical meaning. Positive values of both momentum flux components in the sub-canopy contribute to upward transfer of momentum, consistent with the observed sub-canopy secondary wind speed maximum. For the smallest resolved scales in the canopy at nighttime, we find increasing vertical velocity variance with decreasing timescale, consistent with very small eddies possibly generated by wake shedding from the canopy elements that transport momentum, but not heat. Unusually large values of the velocity aspect ratio within the canopy were observed, consistent with enhanced suppression of the horizontal wind components compared to the vertical by the very dense canopy. The flux–gradient approach for sensible heat flux is found to be valid for the sub-canopy and above-canopy layers when considered separately in spite of the very small fluxes on the order of a few W m −2 in the sub-canopy. However, single-source approaches that ignore the canopy fail because they make the heat flux appear to be counter-gradient when in fact it is aligned with the local temperature gradient in both the sub-canopy and above-canopy layers. While sub-canopy Stanton numbers agreed well with values typically reported in the literature, our estimates for the above-canopy Stanton number were much larger, which likely leads to underestimated modeled sensible heat fluxes above dark warm closed canopies.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vickers, D.; Thomas, C. K.
Observations of the scale-dependent turbulent fluxes, variances, and the bulk transfer parameterization for sensible heat above, within, and beneath a tall closed Douglas-fir canopy in very weak winds are examined. The daytime sub-canopy vertical velocity spectra exhibit a double-peak structure with peaks at timescales of 0.8 s and 51.2 s. A double-peak structure is also observed in the daytime sub-canopy heat flux co-spectra. The daytime momentum flux co-spectra in the upper bole space and in the sub-canopy are characterized by a relatively large cross-wind component, likely due to the extremely light and variable winds, such that the definition of amore » mean wind direction, and subsequent partitioning of the momentum flux into along- and cross-wind components, has little physical meaning. Positive values of both momentum flux components in the sub-canopy contribute to upward transfer of momentum, consistent with the observed sub-canopy secondary wind speed maximum. For the smallest resolved scales in the canopy at nighttime, we find increasing vertical velocity variance with decreasing timescale, consistent with very small eddies possibly generated by wake shedding from the canopy elements that transport momentum, but not heat. Unusually large values of the velocity aspect ratio within the canopy were observed, consistent with enhanced suppression of the horizontal wind components compared to the vertical by the very dense canopy. The flux–gradient approach for sensible heat flux is found to be valid for the sub-canopy and above-canopy layers when considered separately in spite of the very small fluxes on the order of a few W m −2 in the sub-canopy. However, single-source approaches that ignore the canopy fail because they make the heat flux appear to be counter-gradient when in fact it is aligned with the local temperature gradient in both the sub-canopy and above-canopy layers. While sub-canopy Stanton numbers agreed well with values typically reported in the literature, our estimates for the above-canopy Stanton number were much larger, which likely leads to underestimated modeled sensible heat fluxes above dark warm closed canopies.« less
Probabilistic Model of a Floating Target Behaviour in Rough Seas
2013-07-01
Project OH Ochi- Hubble wave spectrum PD-HE Point-Detonation High-Explosive round PM Pierson–Moskowitz wave spectrum ST Soares–Torsethaugen...double peaked spectra. Commonly used doubly-peaked models are Ochi- Hubble (OH) [9] and Soares- Torsethaugen (ST) spectra [2] [13] [14]. Both...models use similar approaches: they describe a bimodal spectrum as a superposition of two unimodal spectra. The Ochi- Hubble model uses two modified
Thermodynamic Properties of a Double Ring-Shaped Quantum Dot at Low and High Temperatures
NASA Astrophysics Data System (ADS)
Khordad, R.; Sedehi, H. R. Rastegar
2018-02-01
In this work, we study thermodynamic properties of a GaAs double ring-shaped quantum dot under external magnetic and electric fields. To this end, we first solve the Schrödinger equation and obtain the energy levels and wave functions, analytically. Then, we calculate the entropy, heat capacity, average energy and magnetic susceptibility of the quantum dot in the presence of a magnetic field using the canonical ensemble approach. According to the results, it is found that the entropy is an increasing function of temperature. At low temperatures, the entropy increases monotonically with raising the temperature for all values of the magnetic fields and it is independent of the magnetic field. But, the entropy depends on the magnetic field at high temperatures. The entropy also decreases with increasing the magnetic field. The heat capacity and magnetic susceptibility show a peak structure. The heat capacity reduces with increasing the magnetic field at low temperatures. The magnetic susceptibility shows a transition between diamagnetic and paramagnetic below for T<4 K. The transition temperature depends on the magnetic field.
rf traveling-wave electron gun for photoinjectors
NASA Astrophysics Data System (ADS)
Schaer, Mattia; Citterio, Alessandro; Craievich, Paolo; Reiche, Sven; Stingelin, Lukas; Zennaro, Riccardo
2016-07-01
The design of a photoinjector, in particular that of the electron source, is of central importance for free electron laser (FEL) machines where a high beam brightness is required. In comparison to standard designs, an rf traveling-wave photocathode gun can provide a more rigid beam with a higher brightness and a shorter pulse. This is illustrated by applying a specific optimization procedure to the SwissFEL photoinjector, for which a brightness improvement up to a factor 3 could be achieved together with a double gun output energy compared to the reference setup foreseeing a state-of-the-art S-band rf standing-wave gun. The higher brightness is mainly given by a (at least) double peak current at the exit of the gun which brings benefits for both the beam dynamics in the linac and the efficiency of the FEL process. The gun design foresees an innovative coaxial rf coupling at both ends of the structure which allows a solenoid with integrated bucking coil to be placed around the cathode in order to provide the necessary focusing right after emission.
Studying dielectric mechanism and magnetization of double perovskite Gd2NiMnO6 ceramic
NASA Astrophysics Data System (ADS)
Mohapatra, S. R.; Sahu, B.; Kaushik, S. D.; Singh, A. K.
2016-05-01
In the present work, the structure, dielectric and magnetic properties of Gd2NiMnO6 double perovskite have been studied. X-Ray diffraction study reveals the phase pure formation of the material that crystallizes into monoclinic phase (space group 'P21/n'). Surface morphology depicts heterogeneous grain distribution with average grain size of ~1 µm. Temperature dependent (50 - 330 K) dielectric measurements at different frequencies (0.5 - 50 kHz) relate to Maxwell-Wagner interfacial polarization model. Giant dielectric constant at 1 kHz for 300 K (ɛ' ~1900) is noticed as compared to that of 50 K (ɛ' ~10) coupled with a peak shift in tan loss towards higher temperature with frequency. The activation energy (0.24 eV) obtained using Arrhenius relation for thermally activated relaxor behavior of the material signifies an electron hopping mechanism between Ni2+ and Mn4+ cations. Lastly, M-H study shows `S' shape hysteresis loop at 50 K with remnant magnetization (Mr) of 0.72 µB/f.u. along with a linear plot for 300 K which reveals paramagnetic nature of the material.
Four-wave mixing in an asymmetric double quantum dot molecule
NASA Astrophysics Data System (ADS)
Kosionis, Spyridon G.
2018-06-01
The four-wave mixing (FWM) effect of a weak probe field, in an asymmetric semiconductor double quantum dot (QD) structure driven by a strong pump field is theoretically studied. Similarly to the case of examining several other nonlinear optical processes, the nonlinear differential equations of the density matrix elements are used, under the rotating wave approximation. By suitably tuning the intensity and the frequency of the pump field as well as by changing the value of the applied bias voltage, a procedure used to properly adjust the electron tunneling coupling, we control the FWM in the same way as several other nonlinear optical processes of the system. While in the weak electron tunneling regime, the impact of the pump field intensity on the FWM is proven to be of crucial importance, for even higher rates of the electron tunneling it is evident that the intensity of the pump field has only a slight impact on the form of the FWM spectrum. The number of the spectral peaks, depends on the relation between specific parameters of the system.
A model for the response of vertical axis wind turbines to turbulent flow: Parts 1 and 2
NASA Astrophysics Data System (ADS)
Malcolm, D. R.
1988-07-01
This report describes a project intended to incorporate the effects of atmospheric turbulence into the structural response of Darrieus rotor, vertical axis wind turbines. The basis of the technique is the generation of a suitable time series of wind velocities, which are passed through a double multiple streamtube aerodynamic representation of the rotor. The aerodynamic loads are decomposed into components of the real eigenvectors of the rotor and subsequently into full-power and cross-spectral densities. These modal spectra are submitted as input to a modified NASTRAN random load analysis and the power spectra of selected responses are obtained. This procedure appears to be successful. Results at zero turbulence agree with alternative solutions, and when turbulence is included, the predicted stress spectra for the Indal 6400 rotor are in good agreement with field data. The model predicts that the effect of turbulence on harmonic frequency peaks and on all lead-lag bending will not be great. However, it appears that only 11 percent turbulence intensity can almost double the rms of cyclic flatwise blade bending.
NASA Astrophysics Data System (ADS)
Liang, Jingyun; Zhao, Shancang; Yuan, Xuexia; Li, Zengmei
2018-05-01
A series of novel double perovskite tellurate red-emitting phosphors Sr2MgTeO6:xEu3+ (x = 0.05-0.40) were successfully synthesized by a high-temperature solid-state reaction method. The phase structure, photoluminescence properties and thermal stability of the phosphor were investigated in detail. The phosphor shows dominant emission peak at 614 nm belonging to the 5D0 → 7F2 electric dipole transition under 465 nm excitation. The luminescence intensity keeps increasing with increasing the content of Eu3+ to 25 mol%, and the critical transfer distance of Eu3+ was calculated to be 12 Å. The quenching temperature for Sr2MgTeO6:0.25Eu3+ was estimated to be above 500 K. This spectral feature reveals high color purity and excellent chromaticity coordinate characteristics. Therefore, Eu3+-doped Sr2MgTeO6 phosphors are potential red phosphors for blue chip-based white light-emitting diode and display devices.
Chen, Dan; Li, Yuexia; Liao, Shijun; ...
2015-08-03
Core–shell structured catalysts, made by placing either a monolayer or a thin layer of a noble metal on relatively cheap core-metal nanoparticles, are fascinating and promising fuel cell catalysts due to their high utilization of noble metals. Here, we report our development of a core–shell structured catalyst, Ru@Pt/C, generated by a novel and facile pulse electrochemical deposition (PED) approach. We demonstrate that compared with a commercial Pt/C catalyst, this novel catalyst achieves over four times higher mass activity towards the anodic oxidation of methanol, and 3.6 times higher mass activity towards the cathodic reduction of oxygen. Importantly, we find thatmore » the intrinsic activity of Pt in this Ru@Pt/C catalyst is doubled due to the formation of the core–shell structure. The catalyst also shows superior stability: even after 2000 scans, it still retains up to 90% of the peak current. As a result, our findings demonstrate that this novel PED approach is a promising method for preparing high-performance core–shell catalysts for fuel cell applications.« less
Zhao, Danying; Shen, Lin; Fan, Bei; Yu, Mengmeng; Zheng, Yang; Lv, Shengnan; Sheng, Jiping
2009-10-20
C-repeat/dehydration-responsive element binding factor (CBF) is a transcription factor regulating cold response in plants, of which little is known in fruits. We showed a double-peak expression pattern of Lycopersicon esculentum putative transcriptional activator CBF1 (LeCBF1) in mature green fruit. The peaks appeared at 2 and 16 h after subjection to cold storage (2 degrees C). The second peak was coincident with, and thus caused by a peak in endogenous ethylene production. We showed that LeCBF1 expression was regulated by exogenous ethylene and 1-methylcyclopropene, and was not expressed without cold induction. LeCBF1 expression was different in the five maturation stages of fruits, but expression peaked at 2 h at all stages.
NASA Astrophysics Data System (ADS)
Sarkadi, L.
2018-04-01
Fully differential cross sections (FDCSs) have been calculated for the single ionization of helium by 1- and 3-MeV proton and 100-MeV/u C6 + ion impact using the classical trajectory Monte Carlo (CTMC) method in the nonrelativistic, three-body approximation. The calculations were made employing a Wigner-type model in which the quantum-mechanical position distribution of the electron is approximated by a weighted integral of the microcanonical distribution over a range of the binding energy of the electron. In the scattering plane, the model satisfactorily reproduces the observed shape of the binary peak. In the region of the peak the calculated FDCSs agree well with the results of continuum-distorted-wave calculations for all the investigated collisions. For 1-MeV proton impact the experimentally observed shift of the binary peak with respect to the first Born approximation is compared with the shifts obtained by different higher-order quantum-mechanical theories and the present CTMC method. The best result was achieved by CTMC, but still a large part of the shift remained unexplained. Furthermore, it was found that the classical theory failed to reproduce the shape of the recoil peak observed in the experiments, it predicts a much narrower peak. This indicates that the formation of the recoil peak is dominated by quantum-mechanical effects. For 100-MeV/u C6 + ion impact the present CTMC calculations confirmed the existence of the "double-peak" structure of the angular distribution of the electron in the plane perpendicular to the momentum transfer, in accordance with the observation, the prediction of an incoherent semiclassical model, and previous CTMC results. This finding together with wave-packet calculations suggests that the "C6 + puzzle" may be solved by considering the loss of the projectile coherence. Experiments to be conducted using ion beams of anisotropic coherence are proposed for a more differential investigation of the ionization dynamics.
Xu, Xiaohan; Zhang, Weijun; Zhou, Yujie; Zhao, Yingxin; Liu, Yuyang; Shi, Dongmei; Zhou, Zhiming; Ma, Hanying; Wang, Zhijian; Yu, Miao; Ma, Qian; Gao, Fei; Shen, Hua; Zhang, Jianwei
2014-04-01
Trimetazidine has been shown to improve angina pectoris and left ventricular (LV) function in diabetic patients with ischaemic cardiomyopathy. The objective of this study was to evaluate the effects of trimetazidine on recurrent angina pectoris and LV structure after drug-eluting stent (DES) implantation in elderly multivessel coronary heart disease (CHD) patients with diabetes mellitus (DM) and a left ventricular ejection fraction (LVEF) of ≥ 50 %. This was a single-centre, prospective, randomized, double-blind evaluation study. Between January 2010 and September 2010, 700 CHD patients with DM who were aged ≥ 65 years and undergoing coronary angiography at An Zhen Hospital (Beijing, China) were recruited and prospectively randomized to receive trimetazidine (20 mg three times daily) or placebo after DES implantation as an addition to conventional CHD treatment. The primary end points were the incidence of recurrent angina pectoris and measures of various echocardiographic parameters, which included LVEF. At 2-year follow-up, patients in the trimetazidine group (n = 255) showed significant improvements in the incidence (P = 0.024) and severity of angina pectoris, compared with the control group, as well as silent myocardial ischaemia (P = 0.009) and angina pectoris-free survival (P = 0.011). LV function and structure in trimetazidine-treated patients were relatively stable at 2-year follow-up, while they deteriorated in the control group (n = 255) with a significant difference between groups (all P < 0.01). The E peak to A peak (E/A) ratio in trimetazidine-treated patients and in the control group decreased after 2 years; the E/A ratio in trimetazidine-treated patients was slightly better than that in the control group, without a significant difference (P = 0.170). There was no significant difference in event-free survival for the composite end point including death, myocardial infarction, cerebrovascular accident (P = 0.422) and subsequent revascularization (P = 0.073). Adjunctive therapy with trimetazidine after DES implantation can have a beneficial effect on recurrent angina pectoris as well as LV function and structure in elderly multivessel CHD patients with DM.
Reliability Modeling of Double Beam Bridge Crane
NASA Astrophysics Data System (ADS)
Han, Zhu; Tong, Yifei; Luan, Jiahui; Xiangdong, Li
2018-05-01
This paper briefly described the structure of double beam bridge crane and the basic parameters of double beam bridge crane are defined. According to the structure and system division of double beam bridge crane, the reliability architecture of double beam bridge crane system is proposed, and the reliability mathematical model is constructed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Klopf, J. Michael; Kaufmann, Pierre; Raulin, Jean-Pierre
2014-07-01
Recent solar flare observations in the sub-terahertz range have provided evidence of a new spectral component with fluxes increasing for larger frequencies, separated from the well-known microwave emission that maximizes in the gigahertz range. Suggested interpretations explain the terahertz spectral component but do not account for the simultaneous microwave component. We present a mechanism for producing the observed "double spectra." Based on coherent enhancement of synchrotron emission at long wavelengths in laboratory accelerators, we consider how similar processes may occur within a solar flare. The instability known as microbunching arises from perturbations that produce electron beam density modulations, giving risemore » to broadband coherent synchrotron emission at wavelengths comparable to the characteristic size of the microbunch structure. The spectral intensity of this coherent synchrotron radiation (CSR) can far exceed that of the incoherent synchrotron radiation (ISR), which peaks at a higher frequency, thus producing a double-peaked spectrum. Successful CSR simulations are shown to fit actual burst spectral observations, using typical flaring physical parameters and power-law energy distributions for the accelerated electrons. The simulations consider an energy threshold below which microbunching is not possible because of Coulomb repulsion. Only a small fraction of the radiating charges accelerated to energies above the threshold is required to produce the microwave component observed for several events. The ISR/CSR mechanism can occur together with other emission processes producing the microwave component. It may bring an important contribution to microwaves, at least for certain events where physical conditions for the occurrence of the ISR/CSR microbunching mechanism are possible.« less
Thomas, Vinoy; Jayabalan, Muthu
2002-01-01
In vitro oxidative degradation and lipid sorption of aliphatic, low elastic modulus and virtually cross-linked poly(urethane urea)s based on 4,4' methylene bis(cyclohexyl isocyanate), hydroxy terminated poly butadiene and hexamethylene diamine were evaluated. The aged samples revealed no weight loss in the oxidation medium. The IR spectral analyses revealed the stability of unsaturated double bonds at 964 cm(-1) (characteristic for polybutadiene soft segment) with no change in peak intensity. The poly(tetramethylene glycol) (PTMG)-added poly(ether urethane urea) polymer also revealed no disappearance of IR peaks for ether and unsaturated double bonds in samples aged in vitro oxidation medium. All the polymers have shown increase in weight due to lipid up take in lipid-rich medium (palm oil) but it was rather low in Dulbecco's modified eagle medium (DMEM) cholesterol. The slight change in mechanical properties of the present polymers in oxidation and DMEM is due to the rearrangement of molecular structure with virtual cross links of hydrogen bonding (physical cross linking) without degradation and plasticization effect of lipid. The influence of these media on the rearrangement of virtual cross links has been observed. Higher the virtual cross-link density, lesser is the loss of tensile properties of poly(urethane urea)s in the oxidation medium and vice versa. On the other hand, higher the virtual cross-link density of poly(urethane urea), higher is the loss of ultimate tensile strength and stress at 100% strain and vice versa in DMEM medium.
Structure of the bulge of the galaxy NGC 4258
NASA Astrophysics Data System (ADS)
Matveyenko, L. I.; Demichev, V. A.
2017-09-01
The superfine structure of the bulge of the galaxy NGC 4258 has been investigated in H2O maser emission at the epochs on February 4, 2013, and November 29, 2013. The peak intensities of the spectral components reached F ≈ 5 Jy. The emission of the component at v = 476 km s-1 dominated at the beginning of this period; the second component at v = 487 km s-1 was observed at the end of the period. The structure is a chain of compact components up to 200 µas or 7mpc in extent. The velocity of the local standard of rest is v LSR = 482 km s-1. Two bright compact components with a separation between them Δ ρ ≈ 35 µas or 1.3 mpc and a pair of components spaced 13 µas apart, whose brightness reaches 30% of the peak value corresponding to a brightness temperature T b ≈ 1018 K, are located at the center. The sizes of the components are 2-3 µas. A splitting and a shift of the two pairs of components relative to each other by 8 µas or 0.3 mpc in the 45° direction are observed at the end of the period. The velocity gradient of the structure is dV/dρ = 224 km s-1 mas-1, suggesting a solid-body rotation with a period T ≈ 760 years. The compact components correspond to the tangential directions of the arm. Two parallel chains of components corresponding to the tangential directions of the walls of the bipolar outflow carrying away an excess angular momentum are ejected from the central part of the bulge, two sources. The outflow is oriented at an angle X ≈ 15° relative to the disk axis. The brightness of the outflow fragments does not exceed 1.5% of the peak value. The ejection of material from the central part in the northward direction at a level up to 0.2%, T b ≈ 1015 K, is observed at the epoch on February 4, 2013, at v = 478 km s-1. The core structure suggests a double system: parallel disks-vortices spaced 0.25 mpc apart.
In vivo characterization of the liver fat 1H MR spectrum
Hamilton, Gavin; Yokoo, Takeshi; Bydder, Mark; Cruite, Irene; Schroeder, Michael E.; Sirlin, Claude B.; Middleton, Michael S.
2013-01-01
A theoretical triglyceride model was developed for in vivo human liver fat 1H MRS characterization, using the number of double bonds (–CH=CH–), number of methylene-interrupted double bonds (–CH=CH–CH2–CH=CH–) and average fatty acid chain length. Five 3 T, single-voxel, stimulated echo acquisition mode spectra (STEAM) were acquired consecutively at progressively longer TEs in a fat–water emulsion phantom and in 121 human subjects with known or suspected nonalcoholic fatty liver disease. T2-corrected peak areas were calculated. Phantom data were used to validate the model. Human data were used in the model to determine the complete liver fat spectrum. In the fat–water emulsion phantom, the spectrum predicted by the model (based on known fatty acid chain distribution) agreed closely with spectroscopic measurement. In human subjects, areas of CH2 peaks at 2.1 and 1.3 ppm were linearly correlated (slope, 0.172; r = 0.991), as were the 0.9 ppm CH3 and 1.3 ppm CH2 peaks (slope, 0.125; r = 0.989). The 2.75 ppm CH2 peak represented 0.6% of the total fat signal in high-liver-fat subjects. These values predict that 8.6% ofm the total fat signal overlies the water peak. The triglyceride model can characterize human liver fat spectra. This allows more accurate determination of liver fat fraction from MRI and MRS. PMID:21834002
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Jian; Torres, Diego F.; Zhang, Shu
2014-04-10
We present an INTEGRAL spectral analysis in the orbital/superorbital phase space of LS I +61°303. A hard X-ray spectrum with no cutoff is observed at all orbital/superorbital phases. The hard X-ray index is found to be uncorrelated with the radio index (non-simultaneously) measured at the same orbital and superorbital phases. In particular, the absence of an X-ray spectrum softening during periods of negative radio index does not favor a simple interpretation of the radio index variations in terms of a microquasar's changes of state. We uncover hints of superorbital variability in the hard X-ray flux, in phase with the superorbitalmore » modulation in soft X-rays. An orbital phase drift of the radio peak flux and index along the superorbital period is observed in the radio data. We explore its influence on a previously reported double-peak structure of a radio orbital light curve, and present it as a plausible explanation.« less
Superconductivity in doped Dirac semimetals
NASA Astrophysics Data System (ADS)
Hashimoto, Tatsuki; Kobayashi, Shingo; Tanaka, Yukio; Sato, Masatoshi
2016-07-01
We theoretically study intrinsic superconductivity in doped Dirac semimetals. Dirac semimetals host bulk Dirac points, which are formed by doubly degenerate bands, so the Hamiltonian is described by a 4 ×4 matrix and six types of k -independent pair potentials are allowed by the Fermi-Dirac statistics. We show that the unique spin-orbit coupling leads to characteristic superconducting gap structures and d vectors on the Fermi surface and the electron-electron interaction between intra and interorbitals gives a novel phase diagram of superconductivity. It is found that when the interorbital attraction is dominant, an unconventional superconducting state with point nodes appears. To verify the experimental signature of possible superconducting states, we calculate the temperature dependence of bulk physical properties such as electronic specific heat and spin susceptibility and surface state. In the unconventional superconducting phase, either dispersive or flat Andreev bound states appear between point nodes, which leads to double peaks or a single peak in the surface density of states, respectively. As a result, possible superconducting states can be distinguished by combining bulk and surface measurements.
Coulomb Impurity Potential RbCl Quantum Pseudodot Qubit
NASA Astrophysics Data System (ADS)
Ma, Xin-Jun; Qi, Bin; Xiao, Jing-Lin
2015-08-01
By employing a variational method of Pekar type, we study the eigenenergies and the corresponding eigenfunctions of the ground and the first-excited states of an electron strongly coupled to electron-LO in a RbCl quantum pseudodot (QPD) with a hydrogen-like impurity at the center. This QPD system may be used as a two-level quantum qubit. The expressions of electron's probability density versus time and the coordinates, and the oscillating period versus the Coulombic impurity potential and the polaron radius have been derived. The investigated results indicate ① that the probability density of the electron oscillates in the QPD with a certain oscillating period of , ② that due to the presence of the asymmetrical potential in the z direction of the RbCl QPD, the electron probability density shows double-peak configuration, whereas there is only one peak if the confinement is a two-dimensional symmetric structure in the xy plane of the QPD, ③ that the oscillation period is a decreasing function of the Coulombic impurity potential, whereas it is an increasing one of the polaron radius.
An imaging-based computational model for simulating angiogenesis and tumour oxygenation dynamics
NASA Astrophysics Data System (ADS)
Adhikarla, Vikram; Jeraj, Robert
2016-05-01
Tumour growth, angiogenesis and oxygenation vary substantially among tumours and significantly impact their treatment outcome. Imaging provides a unique means of investigating these tumour-specific characteristics. Here we propose a computational model to simulate tumour-specific oxygenation changes based on the molecular imaging data. Tumour oxygenation in the model is reflected by the perfused vessel density. Tumour growth depends on its doubling time (T d) and the imaged proliferation. Perfused vessel density recruitment rate depends on the perfused vessel density around the tumour (sMVDtissue) and the maximum VEGF concentration for complete vessel dysfunctionality (VEGFmax). The model parameters were benchmarked to reproduce the dynamics of tumour oxygenation over its entire lifecycle, which is the most challenging test. Tumour oxygenation dynamics were quantified using the peak pO2 (pO2peak) and the time to peak pO2 (t peak). Sensitivity of tumour oxygenation to model parameters was assessed by changing each parameter by 20%. t peak was found to be more sensitive to tumour cell line related doubling time (~30%) as compared to tissue vasculature density (~10%). On the other hand, pO2peak was found to be similarly influenced by the above tumour- and vasculature-associated parameters (~30-40%). Interestingly, both pO2peak and t peak were only marginally affected by VEGFmax (~5%). The development of a poorly oxygenated (hypoxic) core with tumour growth increased VEGF accumulation, thus disrupting the vessel perfusion as well as further increasing hypoxia with time. The model with its benchmarked parameters, is applied to hypoxia imaging data obtained using a [64Cu]Cu-ATSM PET scan of a mouse tumour and the temporal development of the vasculature and hypoxia maps are shown. The work underscores the importance of using tumour-specific input for analysing tumour evolution. An extended model incorporating therapeutic effects can serve as a powerful tool for analysing tumour response to anti-angiogenic therapies.
Sidelobe suppression in all-fiber acousto-optic tunable filter using torsional acoustic wave.
Lee, Kwang Jo; Hwang, In-Kag; Park, Hyun Chul; Kim, Byoung Yoon
2010-06-07
We propose two techniques to suppress intrinsic sidelobe spectra in all-fiber acousto-optic tunable filter using torsional acoustic wave. The techniques are based on either double-pass filter configuration or axial tailoring of mode coupling strength along an acousto-optic interaction region in a highly birefringent optical fiber. The sidelobe peak in the filter spectrum is experimentally suppressed from -8.3 dB to -16.4 dB by employing double-pass configuration. Axial modulation of acousto-optic coupling strength is proposed using axial variation of the fiber diameter, and the simulation results show that the maximum side peak of -9.3 dB can be reduced to -22.2dB. We also discuss the possibility of further spectral shaping of the filter based on the axial tailoring of acousto-optic coupling strength.
Diagnosing the Fine Structure of Electron Energy Within the ECRIT Ion Source
NASA Astrophysics Data System (ADS)
Jin, Yizhou; Yang, Juan; Tang, Mingjie; Luo, Litao; Feng, Bingbing
2016-07-01
The ion source of the electron cyclotron resonance ion thruster (ECRIT) extracts ions from its ECR plasma to generate thrust, and has the property of low gas consumption (2 sccm, standard-state cubic centimeter per minute) and high durability. Due to the indispensable effects of the primary electron in gas discharge, it is important to experimentally clarify the electron energy structure within the ion source of the ECRIT through analyzing the electron energy distribution function (EEDF) of the plasma inside the thruster. In this article the Langmuir probe diagnosing method was used to diagnose the EEDF, from which the effective electron temperature, plasma density and the electron energy probability function (EEPF) were deduced. The experimental results show that the magnetic field influences the curves of EEDF and EEPF and make the effective plasma parameter nonuniform. The diagnosed electron temperature and density from sample points increased from 4 eV/2×1016 m-3 to 10 eV/4×1016 m-3 with increasing distances from both the axis and the screen grid of the ion source. Electron temperature and density peaking near the wall coincided with the discharge process. However, a double Maxwellian electron distribution was unexpectedly observed at the position near the axis of the ion source and about 30 mm from the screen grid. Besides, the double Maxwellian electron distribution was more likely to emerge at high power and a low gas flow rate. These phenomena were believed to relate to the arrangements of the gas inlets and the magnetic field where the double Maxwellian electron distribution exits. The results of this research may enhance the understanding of the plasma generation process in the ion source of this type and help to improve its performance. supported by National Natural Science Foundation of China (No. 11475137)
NASA Astrophysics Data System (ADS)
Hsu, M. K.; Chiu, S. Y.; Wu, C. H.; Guo, D. F.; Lour, W. S.
2008-12-01
Pseudomorphic Al0.22Ga0.78As/In0.16Ga0.84As/Al0.22Ga0.78As double heterojunction high electron mobility transistors (DH-HEMTs) fabricated with different gate-formation structures of a single-recess gate (SRG), a double-recess gate (DRG) and a field-plate gate (FPG) were comparatively investigated. FPG devices show the best breakdown characteristics among these devices due to great reduction in the peak electric field between the drain and gate electrodes. The measured gate-drain breakdown voltages defined at a 1 mA mm-1 reverse gate-drain current density were -15.3, -19.1 and -26.0 V for SRG, DRG and FPG devices, respectively. No significant differences in their room-temperature common-source current-voltage characteristics were observed. However, FPG devices exhibit threshold voltages being the least sensitive to temperature. Threshold voltages as a function of temperature indicate a threshold-voltage variation as low as -0.97 mV K-1 for FPG devices. According to the 2.4 GHz load-pull power measurement at VDS = 3.0 V and VGS = -0.5 V, the saturated output power (POUT), power gain (GP) and maximum power-added efficiency (PAE) were 10.3 dBm/13.2 dB/36.6%, 11.2 dBm/13.1 dB/39.7% and 13.06 dBm/12.8 dB/47.3%, respectively, for SRG, DRG and FPG devices with a pi-gate in class AB operation. When the FPG device is biased at a VDS of 10 V, the saturated power density is more than 600 mW mm-1.
Gamma Ray Pulsars: Multiwavelength Observations
NASA Technical Reports Server (NTRS)
Thompson, David J.
2004-01-01
High-energy gamma rays are a valuable tool for studying particle acceleration and radiation in the magnetospheres of energetic pulsars. The seven or more pulsars seen by instruments on the Compton Gamma Ray Observatory (CGRO) show that: the light curves usually have double-peak structures (suggesting a broad cone of emission); gamma rays are frequently the dominant component of the radiated power; and all the spectra show evidence of a high-energy turnover. For all the known gamma-ray pulsars, multiwavelength observations and theoretical models based on such observations offer the prospect of gaining a broad understanding of these rotating neutron stars. The Gamma-ray Large Area Space Telescope (GLAST), now in planning for a launch in 2006, will provide a major advance in sensitivity, energy range, and sky coverage.
Initial drop size and velocity distributions for airblast coaxial atomizers
NASA Technical Reports Server (NTRS)
Eroglu, H.; Chigier, N.
1991-01-01
Phase Doppler measurements were used to determine initial drop size and velocity distributions after a complete disintegration of coaxial liquid jets. The Sauter mean diameter (SMD) distribution was found to be strongly affected by the structure and behavior of the preceding liquid intact jet. The axial measurement stations were determined from the photographs of the coaxial liquid jet at very short distances (1-2 mm) downstream of the observed break-up locations. Minimum droplet mean velocities were found at the center, and maximum velocities were near the spray boundary. Size-velocity correlations show that the velocity of larger drops did not change with drop size. Drop rms velocity distributions have double peaks whose radial positions coincide with the maximum mean velocity gradients.
Mineral Tells Tale of Watery Past
NASA Technical Reports Server (NTRS)
2004-01-01
This spectrum, taken by the Mars Exploration Rover Opportunity's Moessbauer spectrometer, shows the presence of an iron-bearing mineral called jarosite in the collection of rocks dubbed 'El Capitan.' 'El Capitan' is located within the rock outcrop that lines the inner edge of the small crater where Opportunity landed. The pair of yellow peaks specifically indicates a jarosite phase, which contains water in the form of hydroxyl as a part of its structure. These data suggest water-driven processes exist on Mars. Three other phases are also identified in this spectrum: a magnetic phase (blue), attributed to an iron-oxide mineral; a silicate phase (green), indicative of minerals containing double-ionized iron (Fe 2+); and a third phase (red) of minerals with triple-ionized iron (Fe 3+).
Mineral Tells Tale of Watery Past-2
NASA Technical Reports Server (NTRS)
2004-01-01
This spectrum, taken by the Mars Exploration Rover Opportunity's Moessbauer spectrometer, shows the presence of an iron-bearing mineral called jarosite in the collection of rocks dubbed 'El Capitan.' 'El Capitan' is located within the outcrop that lines the inner edge of the small crater where Opportunity landed. The pair of yellow peaks specifically indicates a jarosite phase, which contains water in the form of hydroxyl as a part of its structure. These data suggest water-driven processes exist on Mars. Three other phases are also identified in this spectrum: a magnetic phase (blue), attributed to an iron-oxide mineral; a silicate phase (green), indicative of minerals containing double-ionized iron (Fe 2+); and a third phase (red) of minerals with triple-ionized iron (Fe 3+).
Tunable plasmon-induced transparency with graphene-based T-shaped array metasurfaces
NASA Astrophysics Data System (ADS)
Niu, Yuying; Wang, Jicheng; Hu, Zhengda; Zhang, Feng
2018-06-01
The frequency tunable Plasmonic induced transparency (PIT) effect is researched with a periodically patterned T-shaped graphene array in mid-infrared region. We adjust the geometrical parameters to obtain the optimized combination for the realization of the PIT response and use the coupled Lorentz oscillator model to analysis the physical mechanism. Due to the properties of graphene, the PIT effect can be easily and markedly enhanced with the increase of chemical potential and carrier mobility. The frequency of PIT effect is also insensitive with the angle of incident light. In addition, we also propose the π shaped structure to realizing the double-peak PIT effect. The results offer a flexible approach for the development of tunable graphene-based photonic devices.
NASA Astrophysics Data System (ADS)
Prakash, J. Thomas Joseph; Gnanaraj, J. Martin Sam; Dhavud, S. Shek; Ekadevasena, S.
2015-09-01
Undoped and amino acid (L-Arginine and L-Valine) doped KAP crystals were grown by slow evaporation solution growth technique. The changes in the structural, spectral, optical, mechanical and thermal properties were observed. The sharp prominent peaks in the indexed powder XRD pattern confirms the crystalline nature of the sample. Optical studies reveal that the crystal is transparent in the entire visible light region. Thermal stability was checked by TG/DTA analysis. The mechanical stability was evaluated from Vicker's microhardness test. The SHG efficiency for the title materials was tested with different particle sizes by the Kurtz and Perry powder method, which established the existence of phase matching.
NASA Astrophysics Data System (ADS)
Heide, N.; Rebel, H.; Corcalciuc, V.; Gils, H. J.; Jelitto, H.; Kiener, J.; Wentz, J.; Zagromski, S.; Srivastava, D. K.
1989-11-01
The triple-differential cross sections for elastic break-up of 156 MeV 6Li projectiles by the reactions 208Pb( 6Li, αd) 208Pb g.s. and 12C( 6Li, αd) 12C g.s. have been measured with large asymptotic relative momenta of the outgoing fragments. The data exhibit rather unfamiliar shapes of the energy spectra, often replacing the usual bell-shape distributions by double-peaked structures and varying rapidly with the relative emission angles. The origin of these features has been explored and the cross sections have been analysed on the basis of a diffractive disintegration approach.
The Expanding Bipolar Conic Shell of the Symbiotic Star AG Peg
NASA Astrophysics Data System (ADS)
Lee, Seong-Jae; Hyung, Siek
2018-06-01
Symbiotic stars are the most interesting since some systems are believed to host the most massive white dwarf, like SN Ia progenitors. Most recently, Lee and Hyung (2018, LH18) proposed a bipolar conic shell structure for the observed high expansion Hα and Hβ line profiles and other double peak lines observed in 1998 September (phase φ = 10.24): the physical conditions for the white dwarf luminosity and the ionized HII zone, responsible for double Gaussian optical lines including Balmer and Lyman line fluxes, were taken from the P-I model with gas density, nH = 109.85 cm-3 , while the column density for the scattering neutral zone was derived from the broader line components based on the result by Monte Carlo simulations. In this investigation, we examined whether the expanding shells of the bipolar conical geometry as proposed by LH18 would be able to form the other Hα and Hβ line profiles observed in other phases, φ = 11.56 and 11.98 (in 2001 August and 2002 August). We look into the kinematical property of the bipolar conic shell structure responsible for the HII and HI zones and then we discuss the secular variation of the broad line feature and the origin of the bipolar cone, i.e., part of a common envelope formed through the mass inflows from the giant star.
NASA Astrophysics Data System (ADS)
Higashiguchi, Takeshi; Kaku, Masanori; Katto, Masahito; Kubodera, Shoichi
2007-10-01
We have demonstrated suppression of suprathermal ions from a colloidal microjet target plasma containing tin-dioxide (SnO2) nanoparticles irradiated by double laser pulses. We observed a significant decrease of the tin and oxygen ion signals in the charged-state-separated energy spectra when double laser pulses were irradiated. The peak energy of the singly ionized tin ions decreased from 9to3keV when a preplasma was produced. The decrease in the ion energy, considered as debris suppression, is attributed to the interaction between an expanding low-density preplasma and a main laser pulse.
Origin of double-line structure in nonsequential double ionization by few-cycle laser pulses
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, Cheng, E-mail: huangcheng@swu.edu.cn; Zhong, Mingmin; Wu, Zhengmao
2016-07-28
We investigate nonsequential double ionization (NSDI) of molecules by few-cycle laser pulses at the laser intensity of 1.2–1.5 × 10{sup 14} W/cm{sup 2} using the classical ensemble model. The same double-line structure as the lower intensity (1.0 × 10{sup 14} W/cm{sup 2}) is also observed in the correlated electron momentum spectra for 1.2–1.4 × 10{sup 14} W/cm{sup 2}. However, in contrast to the lower intensity where NSDI proceeds only through the recollision-induced double excitation with subsequent ionization (RDESI) mechanism, here, the recollision-induced excitation with subsequent ionization (RESI) mechanism has a more significant contribution to NSDI. This indicates that RDESI ismore » not necessary for the formation of the double-line structure and RESI can give rise to the same type of structure independently. Furthermore, we explore the ultrafast dynamics underlying the formation of the double-line structure in RESI.« less
ION COMPOSITION ELUCIDATION (ICE)
Ion Composition Elucidation (ICE) utilizes selected ion recording with a double focusing mass spectrometer to simultaneously determine exact masses and relative isotopic abundances from mass peak profiles. These can be determined more accurately and at higher sensitivity ...
Double-frequency microwave ionization of Na
NASA Astrophysics Data System (ADS)
Ruff, G. A.; Dietrick, K. M.; Gallagher, T. F.
1990-11-01
We report the ionization of Na atoms by the simultaneous application of microwave fields of two different frequencies. We conclude that the salient features of double-frequency ionization can be readily understood. Both the hydrogenlike ||m||=2 states and the nonhydrogenic ||m||=0 and 1 states ionize when the sum of the field amplitudes, the peak field, reaches the field required for ionization by a single microwave frequency, E=1/9n4 and E=1/3n5, respectively.
Development of a Double-Gauss Lens Based Setup for Optoacoustic Applications
Choi, Hojong; Ryu, Jae-Myung; Yeom, Jung-Yeol
2017-01-01
In optoacoustic (photoacoustic) systems, different echo signal intensities such as amplitudes, center frequencies, and bandwidths need to be compensated by utilizing variable gain or time-gain compensation amplifiers. However, such electronic components can increase system complexities and signal noise levels. In this paper, we introduce a double-Gauss lens to generate a large field of view with uniform light intensity due to the low chromatic aberrations of the lens, thus obtaining uniform echo signal intensities across the field of view of the optoacoustic system. In order to validate the uniformity of the echo signal intensities in the system, an in-house transducer was placed at various positions above a tissue sample and echo signals were measured and compared with each other. The custom designed double-Gauss lens demonstrated negligible light intensity variation (±1.5%) across the illumination field of view (~2 cm diameter). When the transducer was used to measure echo signal from an eye of a bigeye tuna within a range of ±1 cm, the peak-to-peak amplitude, center frequency, and their −6 dB bandwidth variations were less than 2 mV, 1 MHz, and 6%, respectively. The custom designed double-Gauss lens can provide uniform light beam across a wide area while generating insignificant echo signal variations, and thus can lower the burden of the receiving electronics or signal processing in the optoacoustic system. PMID:28273794
NASA Astrophysics Data System (ADS)
Akbari, Kamran; Mišković, Zoran L.; Segui, Silvina; Gervasoni, Juana L.; Arista, Néstor R.
2018-06-01
We analyze the energy loss channels for a fast charged particle traversing a multi-layer graphene (MLG) structure with N layers under normal incidence. Focusing on a terahertz (THz) range of frequencies, and assuming equally doped graphene layers with a large enough separation d between them to neglect interlayer electron hopping, we use the Drude model for two-dimensional conductivity of each layer to describe hybridization of graphene’s Dirac plasmon polaritons (DPPs). Performing a layer decomposition of ohmic energy losses, which include excitation of hybridized DPPs (HDPPs), we have found for N = 3 that the middle HDPP eigenfrequency is not excited in the middle layer due to symmetry constraint, whereas the excitation of the lowest HDPP eigenfrequency produces a Fano resonance in the graphene layer that is first traversed by the charged particle. While the angular distribution of transition radiation emitted in the far field region also shows asymmetry with respect to the traversal order by the incident charged particle at supra-THz frequencies, the integrated radiative energy loss is surprisingly independent of both d and N for N ≤ 5, which is explained by a dominant role of the outer graphene layers in transition radiation. We have further found that the integrated ohmic energy loss in optically thin MLG scales as ∝1/N at sub-THz frequencies, which is explained by exposing the role of dissipative processes in graphene at low frequencies. Finally, prominent peaks are observed at supra-THz frequencies in the integrated ohmic energy loss for MLG structures that are not optically thin. The magnitude of those peaks is found to scale with N for N ≥ 2, while their shape and position replicate the peak in a double-layer graphene (N = 2), which is explained by arguing that plasmon hybridization in such MLG structures is dominated by electromagnetic interaction between the nearest-neighbor graphene layers.
Mechanisms of ripple migration on a natural sand bed under waves
NASA Astrophysics Data System (ADS)
Carlson, E.; Foster, D. L.
2016-02-01
In nearshore environments, the wave bottom boundary layer is of particular importance to bedform migration and evolution as it is the location of energy transfer from the water column to the bed. This effort examines the mechanisms responsible for bedform evolution and migration. In a field scale laboratory study, sand ripple dynamics were measured using particle image velocimetry. Both monotonic (T = 4 s, 8 s), bimodal (wave pair T = 3.7, 4.3 s), and solitary wave cases were examined. Bedform states included orbital and anorbital rippled beds with wavelengths ranging from 5 to 15 cm. During cases of moderately high energy, time series of instantaneous ripple migration rates oscillated with the same frequency as the surface waves. The oscillatory ripple migration signature was asymmetric, with higher amplitudes during onshore directed movement. This asymmetry leads to a net onshore migration, ranging from 0.1 to 0.6 cm/min in the wave conditions mentioned. The cyclic motion of the ripple field was compared to concomitant transfer mechanisms affecting the boundary layer dynamics including: bed shear stress, coherent structure generation, and free stream velocity. Coherent structures were identified using the swirling strength criterion, and were present during each half wave developing in the ripple troughs. Two estimates of bed shear stress were made: 1) Meyer-Peter Muller method using the bed migration to determine the necessary stress and 2) double averaging of the velocity field and partitioning into components of stress, following the methods of Rodriguez-Abudo and Foster (2014). Peak ripple migration rates occurred during strengthening onshore flow, which coincides with peak bed shear stresses and the onset of coherent structure formation. Higher energy bimodal wave groups caused periods of high suspension which were coincident with peak onshore migrations, during the low velocity periods of the bimodal forcing the bed did not migrate.
Akbari, Kamran; Mišković, Zoran L; Segui, Silvina; Gervasoni, Juana L; Arista, Néstor R
2018-06-01
We analyze the energy loss channels for a fast charged particle traversing a multi-layer graphene (MLG) structure with N layers under normal incidence. Focusing on a terahertz (THz) range of frequencies, and assuming equally doped graphene layers with a large enough separation d between them to neglect interlayer electron hopping, we use the Drude model for two-dimensional conductivity of each layer to describe hybridization of graphene's Dirac plasmon polaritons (DPPs). Performing a layer decomposition of ohmic energy losses, which include excitation of hybridized DPPs (HDPPs), we have found for N = 3 that the middle HDPP eigenfrequency is not excited in the middle layer due to symmetry constraint, whereas the excitation of the lowest HDPP eigenfrequency produces a Fano resonance in the graphene layer that is first traversed by the charged particle. While the angular distribution of transition radiation emitted in the far field region also shows asymmetry with respect to the traversal order by the incident charged particle at supra-THz frequencies, the integrated radiative energy loss is surprisingly independent of both d and N for N ≤ 5, which is explained by a dominant role of the outer graphene layers in transition radiation. We have further found that the integrated ohmic energy loss in optically thin MLG scales as ∝1/N at sub-THz frequencies, which is explained by exposing the role of dissipative processes in graphene at low frequencies. Finally, prominent peaks are observed at supra-THz frequencies in the integrated ohmic energy loss for MLG structures that are not optically thin. The magnitude of those peaks is found to scale with N for N ≥ 2, while their shape and position replicate the peak in a double-layer graphene (N = 2), which is explained by arguing that plasmon hybridization in such MLG structures is dominated by electromagnetic interaction between the nearest-neighbor graphene layers.
NEXAFS Study of the Annealing Effect on the Local Structure of FIB-CVD DLC
DOE Office of Scientific and Technical Information (OSTI.GOV)
Saikubo, Akihiko; Kato, Yuri; Igaki, Jun-ya
2007-01-19
Annealing effect on the local structure of diamond like carbon (DLC) formed by focused ion beam-chemical vapor deposition (FIB-CVD) was investigated by the measurement of near edge x-ray absorption fine structure (NEXAFS) and energy dispersive x-ray (EDX) spectra. Carbon K edge absorption NEXAFS spectrum of FIB-CVD DLC was measured in the energy range of 275-320 eV. In order to obtain the information on the location of the gallium in the depth direction, incidence angle dependence of NEXAFS spectrum was measured in the incident angle range from 0 deg. to 60 deg. . The peak intensity corresponding to the resonance transitionmore » of 1s{yields}{sigma}* originating from carbon-gallium increased from the FIB-CVD DLC annealed at 200 deg. C to the FIB-CVD DLC annealed at 400 deg. C and decreased from that at 400 deg. C to that at 600 deg. C. Especially, the intensity of this peak remarkably enhanced in the NEXAFS spectrum of the FIB-CVD DLC annealed at 400 deg. C at the incident angle of 60 deg. . On the contrary, the peak intensity corresponding to the resonance transition of 1s{yields}{pi}* originating from carbon double bonding of emission spectrum decreased from the FIB-CVD DLC annealed at 200 deg. C to that at 400 deg. C and increased from that at 400 deg. C to that at 600 deg. C. Gallium concentration in the FIB-CVD DLC decreased from {approx_equal}2.2% of the as-deposited FIB-CVD DLC to {approx_equal}1.5% of the FIB-CVD DLC annealed at 600 deg. C from the elementary analysis using EDX. Both experimental results indicated that gallium atom departed from FIB-CVD DLC by annealing at the temperature of 600 deg. C.« less
Failed landings after laying hen flight in a commercial aviary over two flock cycles.
Campbell, D L M; Goodwin, S L; Makagon, M M; Swanson, J C; Siegford, J M
2016-01-01
Many egg producers are adopting alternative housing systems such as aviaries that provide hens a tiered cage and a litter-covered open floor area. This larger, more complex environment permits expression of behaviors not seen in space-limited cages, such as flight. Flight is an exercise important for strengthening bones; but domestic hens might display imperfect flight landings due to poor flight control. To assess the potential implications of open space, we evaluated the landing success of Lohmann white laying hens in a commercial aviary. Video recordings of hens were taken from 4 aviary sections at peak lay, mid lay and end lay across two flock cycles. Observations were made in each focal section of all flights throughout the day noting flight origin and landing location (outer perch or litter) and landing success or failure. In Flock 1, 9.1% of all flights failed and 21% failed in Flock 2. The number of flights decreased across the laying cycle for both flocks. Proportionally more failed landings were observed in the double row sections in Flock 2. Collisions with other hens were more common than slipping on the ground or colliding with aviary structures across sections and flocks. More hens slipped on the ground and collided with physical structures at peak lay for Flock 2 than at other time points. More collisions with other hens were seen at mid and end lay than at peak lay for Flock 2. Landings ending on perches failed more often than landings on litter. These results indicate potential for flight-related hen injuries in aviary systems resulting from failed landings, which may have implications for hen welfare and optimal system design and management.
Interior and Ejecta Morphologies of Impact Craters on Ganymede
NASA Astrophysics Data System (ADS)
Barlow, Nadine G.; Klaybor, K.; Katz-Wigmore, J.
2006-09-01
We are utilizing Galileo SSI imagery of Ganymede to classify impact crater interior and ejecta morphologies. Although we are in the early stages of compiling our Catalog of Impact Craters on Ganymede, some interesting trends are beginning to emerge. Few craters display obvious ejecta morphologies, but 68 craters are classified as single layer ejecta and 3 as double layer ejecta. We see no obvious correlation of layered ejecta morphologies with terrain or latitude. All layered ejecta craters have diameters between 10 and 40 km. Sinuosity ("lobateness") and ejecta extent ("ejecta mobility ratio") of Ganymede layered ejecta craters are lower than for martian layered ejecta craters. This suggests less mobility of ejecta materials on Ganymede, perhaps due to the colder temperatures. Interior structures being investigated include central domes, peaks, and pits. 57 dome craters, 212 central peak craters, and 313 central pit craters have been identified. Central domes occur in 50-100 km diameter craters while peaks are found in craters between 20 and 50 km and central pit craters range between 29 and 74 km in diameter. The Galileo Regio region displays higher concentrations of central dome and central pit craters than other regions we have investigated. 67% of central pit craters studied to date are small pits, where the ratio of pit diameter to crater diameter is <0.2. Craters containing the three interior structures preferentially occur on darker terrain units, suggesting that an ice-silicate composition is more conducive to interior feature formation than pure ice alone. Results of this study have important implications not only for the formation of specific interior and ejecta morphologies on Ganymede but also for analogous features associated with Martian impact craters. This research is funded through NASA Outer Planets Research Program Award #NNG05G116G to N. G. Barlow.
NASA Astrophysics Data System (ADS)
Gao, Deheng; Mou, Yingping; Feng, Shiping
2018-02-01
The recent discovery of a direct link between the sharp peak in the electron quasiparticle scattering rate of cuprate superconductors and the well-known peak-dip-hump structure in the electron quasiparticle excitation spectrum is calling for an explanation. Within the framework of the kinetic-energy-driven superconducting mechanism, the complicated line-shape in the electron quasiparticle excitation spectrum of cuprate superconductors is investigated. It is shown that the interaction between electrons by the exchange of spin excitations generates a notable peak structure in the electron quasiparticle scattering rate around the antinodal and nodal regions. However, this peak structure disappears at the hot spots, which leads to that the striking peak-dip-hump structure is developed around the antinodal and nodal regions, and vanishes at the hot spots. The theory also confirms that the sharp peak observed in the electron quasiparticle scattering rate is directly responsible for the remarkable peak-dip-hump structure in the electron quasiparticle excitation spectrum of cuprate superconductors.
Monopole transition strength function of 12C in a three-α model
NASA Astrophysics Data System (ADS)
Ishikawa, Souichi
2016-12-01
The energy-level structure of the 12C nucleus at a few MeV above the three-α (3 α ) threshold is still unsatisfactorily known. For instance, most microscopic calculations predicted that there exist one 0+ state in this energy region besides the well-known Hoyle state, whereas some experimental and theoretical studies show the existence of two 0+ states. In this paper, I will take a 3 α -boson model for bound and continuum states in 12C and study a transition process from the 12C(01+) ground state to 3 α 0+ continuum states by the electric monopole (E 0 ) operator. The strength distribution of the process will be calculated as a function of 3 α energy using the Faddeev three-body theory. The Hamiltonian for the 3 α system consists of two- and three-α potentials, and some three-α potentials with different range parameters will be examined. Results of the strength function show a double-peaked bump at the low-energy region, which can be considered as two 0+ states. The peak at higher energy may originate from a 3 α resonant state. However, it is unlikely that the peak at the lower energy is related to a resonant state, which suggests that it may be due to a so-called "ghost anomaly." Distributions of decaying particles are also calculated.
Surface atoms in Sc-O/W(1 0 0) system as Schottky emitter at high temperature
NASA Astrophysics Data System (ADS)
Tsujita, T.; Iida, S.; Nagatomi, T.; Takai, Y.
2003-12-01
The chemical bonding state of surface atoms in the Sc-O/W(1 0 0) system as a Schottky emitter was investigated at high temperature using a profile of Auger electron peaks to elucidate the mechanism of the marked reduction of the work function of the Sc-O/W(1 0 0) Schottky emitter. For this, Sc-deposited W(1 0 0), oxygen-exposed W(1 0 0) and Sc surfaces were prepared as reference surfaces. A comparison of the profiles of the Auger electron peaks from the Sc-O/W(1 0 0) surface with those from the reference surfaces has revealed that oxygen and Sc atoms on the Sc-O/W(1 0 0) surface form the Sc-O complexes at the operating temperature of the Sc-O/W(1 0 0) emitter of 1400 K. In addition, the ratio of the number of Sc atoms to that of oxygen atoms is estimated as 1:1 by the quantitative analysis of the AES peaks. The present results strongly suggest that the work function of the Sc-O/W(1 0 0) emitter is caused by the formation of Sc-O electric dipoles aligning into the p(2 × 1)-p(1 × 2) double-domain structure [Surf. Sci. 523 (2003) L37] on the Sc-O/W(1 0 0) surface at the operating temperature.
NASA Astrophysics Data System (ADS)
Arai, Kohsaku; Sakai, Hideo; Konishi, Kenji
1997-05-01
An outer shelf deposit in central Japan centered on the Olduvai normal polarity event in the reversed Matuyama chron reveals a close correlation of both the magnetic susceptibility and remanent intensity with the sedimentary cyclicities apparent in lithologies and molluscan assemblages. Two sedimentary cycles are characterized by distinctly similar, but double-peaked magnetic cyclicities. The rock-magnetic variability is primarily attributed to the relative abundance of terrigenous magnetic minerals, and the double peak of the variability is characterized by the concentration of finer-grained magnetic minerals. The concentration is suspected to be controlled by both climatic change and shifting proximity of the shoreline as a function of rise and fall of the sea level due to glacio-eustasy. Rock-magnetic study reveals the record of a 21 ka period of orbital precession cycles within the sedimentary cyclicity attributable to a 41 ka period of orbital obliquity forcing.
Neutral Gas Properties of Extremely Isolated Early-type Galaxies
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ashley, Trisha; Marcum, Pamela M.; Fanelli, Michael N., E-mail: trisha.l.ashley@nasa.gov, E-mail: pamela.m.marcum@nasa.gov, E-mail: michael.n.fanelli@nasa.gov
We present the results of single-dish atomic hydrogen (H i) observations of six highly isolated early-type galaxies. These objects are a representative subset of galaxies previously studied at optical wavelengths and selected to be separated by at least 2.5 Mpc from companions brighter than M{sub V} = −16.5 mag. Each galaxy was observed with a single pointing using the NRAO Green Bank Telescope L -band receiver. Five of these systems were strongly detected in H i. These five galaxies exhibit H i profiles with a range of properties: single Gaussian-like peaks, separate double peaks, and double horn-like profiles. The four bluestmore » galaxies ( B − V < 0.54) all contain significant gas with H i masses ranging from 1.1 × 10{sup 8} to 1.4 × 10{sup 9}.« less
NASA Astrophysics Data System (ADS)
Csete, M.; Sipos, Á.; Kőházi-Kis, A.; Szalai, A.; Szekeres, G.; Mathesz, A.; Csákó, T.; Osvay, K.; Bor, Zs.; Penke, B.; Deli, M. A.; Veszelka, Sz.; Schmatulla, A.; Marti, O.
2007-12-01
Two-dimensional gratings are generated on poly-carbonate films spin-coated onto thin gold-silver bimetallic layers by two-beam interference method. Sub-micrometer periodic polymer dots and stripes are produced illuminating the poly-carbonate surface by p- and s-polarized beams of a frequency quadrupled Nd:YAG laser, and crossed gratings are generated by rotating the substrates between two sequential treatments. It is shown by pulsed force mode atomic force microscopy that the mean value of the adhesion is enhanced on the dot-arrays and on the crossed gratings. The grating-coupling on the two-dimensional structures results in double peaks on the angle dependent resonance curves of the surface plasmons excited by frequency doubled Nd:YAG laser. The comparison of the resonance curves proves that a surface profile ensuring minimal undirected scattering is required to optimize the grating-coupling, in addition to the minimal modulation amplitude, and to the optimal azimuthal orientation. The secondary minima are the narrowest in presence of linear gratings on multi-layers having optimized composition, and on crossed structures consisting of appropriately oriented polymer stripes. The large coupling efficiency and adhesion result in high detection sensitivity on the crossed gratings. Bio-sensing is realized by monitoring the rotated-crossed grating-coupled surface plasmon resonance curves, and detecting the chemical heterogeneity by tapping-mode atomic force microscopy. The interaction of Amyloid-β peptide, a pathogenetic factor in Alzheimer disease, with therapeutical molecules is demonstrated.
NASA Astrophysics Data System (ADS)
Kelkar, A. H.; Misra, D.; Chatterjee, S.; Kasthurirangan, S.; Agnihotri, A.; Tribedi, L. C.
2009-11-01
We report the first direct measurement of GDPR peak in heavy ion (4 MeV/u F9+) induced secondary electron DDCS (double differential cross section) spectrum of C60 fullerene. A peak corresponding to GDPR is seen at all angles and the angular distribution, showing a dip at 90°, is in contrast with ion-atom collisions, indicating plasmon oscillations along beam direction. A comparison has also been done between C60 and other gaseous targets as well as with state-of-the art theoretical models, based on density functional methods.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Denholm, Paul L; Margolis, Robert M
In this report, we examine the potential for replacing conventional peaking capacity in California with energy storage, including analysis of the changing technical potential with increased storage deployment and the effect of PV deployment. We examine nine years of historic load data, a range of storage durations (2-8 hours), and a range of PV penetration levels (0%-30%). We demonstrate how PV increases the ability of storage to reduce peak net demand. In the scenarios analyzed, the expected penetration of PV in California in 2020 could more than double the potential for 4-hour energy storage to provide capacity services.
Automated protein NMR structure determination using wavelet de-noised NOESY spectra.
Dancea, Felician; Günther, Ulrich
2005-11-01
A major time-consuming step of protein NMR structure determination is the generation of reliable NOESY cross peak lists which usually requires a significant amount of manual interaction. Here we present a new algorithm for automated peak picking involving wavelet de-noised NOESY spectra in a process where the identification of peaks is coupled to automated structure determination. The core of this method is the generation of incremental peak lists by applying different wavelet de-noising procedures which yield peak lists of a different noise content. In combination with additional filters which probe the consistency of the peak lists, good convergence of the NOESY-based automated structure determination could be achieved. These algorithms were implemented in the context of the ARIA software for automated NOE assignment and structure determination and were validated for a polysulfide-sulfur transferase protein of known structure. The procedures presented here should be commonly applicable for efficient protein NMR structure determination and automated NMR peak picking.
Preparations of PbSe quantum dots in silicate glasses by a melt-annealing technique
NASA Astrophysics Data System (ADS)
Ma, D. W.; Cheng, C.; Zhang, Y. N.; Xu, Z. S.
2014-11-01
Silicate glass containing PbSe quantum dots (QDs) has important prospective applications in near infra-red optoelectronic devices. In this study, single-stage and double-stage heat-treatment methods were used respectively to prepare PbSe QDs in silicate glasses. Investigation results show that the double-stage heat-treatment is a favorable method to synthesize PbSe QDs with strong photoluminescence (PL) intensity and narrow full weight at half maximum (FWHM) in PL peak. Therefore, the method to prepare PbSe QDs was emphasized on the double-stage heat-treatment. Transmission electron microscopy measurements show that the standard deviations of the average QD sizes from the samples heat-treated at the development temperature of 550 °C fluctuate slightly in the range of 0.6-0.8 nm, while this deviation increases up to 1.2 nm for the sample with the development temperature of 600 °C. In addition, the linear relationship between the QD size and holding time indicates that the crystallization behavior of PbSe QDs in silicate glasses is interface-controlled growth in early stage of crystallization. The growth rates of PbSe QDs are determined to be 0.24 nm/h at 550 °C and 0.72 nm/h at 600 °C. In short, the double-stage heat-treatment at 450 °C for 20 h followed by heat-treatment at 550 °C for 5 h is a preferred process for the crystallization of PbSe QDs in silicate glass. Through this treatment, PbSe QDs with a narrow size dispersion of 5.0 ± 0.6 nm can be obtained, the PL peak from this sample is highest in intensity and narrowest in FWHM among all samples, and the peak is centered on 1575 nm, very close to the most common wavelength of 1550 nm in fiber-optic communication systems.
Longitudinal structure of the equatorial ionosphere: Time evolution of the four-peaked EIA structure
NASA Astrophysics Data System (ADS)
Lin, C. H.; Hsiao, C. C.; Liu, J. Y.; Liu, C. H.
2007-12-01
Longitudinal structure of the equatorial ionosphere during the 24 h local time period is observed by the FORMOSAT-3/COSMIC (F3/C) satellite constellation. By binning the F3/C radio occultation observations during September and October 2006, global ionospheric total electron content (TEC) maps at a constant local time map (local time TEC map, referred as LT map) can be obtained to monitor the development and subsidence of the four-peaked longitudinal structure of the equatorial ionosphere. From LT maps, the four-peaked structure starts to develop at 0800-1000 LT and becomes most prominent at 1200-1600 LT. The longitudinal structure starts to subside after 2200-2400 LT and becomes indiscernible after 0400-0600 LT. In addition to TEC, ionospheric peak altitude also shows a four-peaked longitudinal structure with variation very similar to TEC during daytime. The four-peaked structure of the ionospheric peak altitude is indiscernible at night. With global local time maps of ionospheric TEC and peak altitude, we compare temporal variations of the longitudinal structure with variations of E × B drift from the empirical model. Our results indicate that the observations are consistent with the hypothesis that the four-peaked longitudinal structure is caused by the equatorial plasma fountain modulated by the E3 nonmigrating tide. Additionally, the four maximum regions show a tendency of moving eastward with propagation velocity of several 10 s m/s.
New results on the mid-latitude midnight temperature maximum
NASA Astrophysics Data System (ADS)
Mesquita, Rafael L. A.; Meriwether, John W.; Makela, Jonathan J.; Fisher, Daniel J.; Harding, Brian J.; Sanders, Samuel C.; Tesema, Fasil; Ridley, Aaron J.
2018-04-01
Fabry-Perot interferometer (FPI) measurements of thermospheric temperatures and winds show the detection and successful determination of the latitudinal distribution of the midnight temperature maximum (MTM) in the continental mid-eastern United States. These results were obtained through the operation of the five FPI observatories in the North American Thermosphere Ionosphere Observing Network (NATION) located at the Pisgah Astronomic Research Institute (PAR) (35.2° N, 82.8° W), Virginia Tech (VTI) (37.2° N, 80.4° W), Eastern Kentucky University (EKU) (37.8° N, 84.3° W), Urbana-Champaign (UAO) (40.2° N, 88.2° W), and Ann Arbor (ANN) (42.3° N, 83.8° W). A new approach for analyzing the MTM phenomenon is developed, which features the combination of a method of harmonic thermal background removal followed by a 2-D inversion algorithm to generate sequential 2-D temperature residual maps at 30 min intervals. The simultaneous study of the temperature data from these FPI stations represents a novel analysis of the MTM and its large-scale latitudinal and longitudinal structure. The major finding in examining these maps is the frequent detection of a secondary MTM peak occurring during the early evening hours, nearly 4.5 h prior to the timing of the primary MTM peak that generally appears after midnight. The analysis of these observations shows a strong night-to-night variability for this double-peaked MTM structure. A statistical study of the behavior of the MTM events was carried out to determine the extent of this variability with regard to the seasonal and latitudinal dependence. The results show the presence of the MTM peak(s) in 106 out of the 472 determinable nights (when the MTM presence, or lack thereof, can be determined with certainty in the data set) selected for analysis (22 %) out of the total of 846 nights available. The MTM feature is seen to appear slightly more often during the summer (27 %), followed by fall (22 %), winter (20 %), and spring (18 %). Also seen is a northwestward propagation of the MTM signature with a latitude-dependent amplitude. This behavior suggests either a latitudinal dependence of thermosphere tidal dissipation or a night-to-night variation of the composition of the higher-order tidal modes that contribute to the production of the MTM peak at mid-latitudes. Also presented in this paper is the perturbation on the divergence of the wind fields, which is associated with the passage of each MTM peak analyzed with the 2-D interpolation.
NASA Astrophysics Data System (ADS)
Favreau, Peter; Gapud, Albert A.; Moraes, Sunhee; Delong, Lance; Reyes, Arneil P.; Thompson, James R.; Christen, David K.
2010-03-01
The interaction of two different ordering schemes -- charge density waves (CDWs) and superconductivity -- is studied in high-quality samples of NbSe2, particularly in the motion of magnetic flux quanta. More specifically, the study is on the effect of ``switching off'' the CDW phase -- effected by doping with Ta -- on the magnetic-field H dependence of: (i) the Lorentz-force-driven free flux flow (FFF) resistivity ρf associated with the ordered motion of vortices, and (ii) critical current density Jc. FFF is achieved for the first time in this material. The field dependence of ρf deviates from traditional Bardeen-Stephen flux flow and is more consistent with effects of flux core size as predicted by Kogan and Zelezhina. However, the suppression of CDW's seems to have no significant effect on these properties. On the other hand, Jc(H) shows a surprising double peak for the CDW-suppressed sample --contrary to previous studies in which the Jc peak was shown to disappear. Possible mechanisms are discussed.
Helicon double layer thruster operation in a low magnetic field mode
NASA Astrophysics Data System (ADS)
Harle, T.; Pottinger, S. J.; Lappas, V. J.
2013-02-01
Direct thrust measurements are made of a helicon double layer thruster operating in a low magnetic field mode. The relationship between the imposed axial magnetic field and generated thrust is investigated for a radio frequency input power range 200-500 W for propellant flow rates of 16.5 and 20 sccm (0.46 and 0.55 mg s-1) of argon. The measured thrust shows a strong dependence on the magnetic field strength, increasing by up to a factor of 5 compared with the minimum thrust level recorded. A peak thrust of 0.4-1.1 mN depending on thruster operating conditions is obtained. This increase is observed to take place over a small range of peak magnetic field strengths in the region of 70-110 G. The magnitude of the thrust and the corresponding magnitude of the magnetic field at which the peak thrust occurs is shown to increase with increasing input power for a given propellant flow rate. The ion current determined using a retarding field energy analyser and the electron number density found using a microwave resonator probe both correlate with the observed trend in thrust as a function of applied magnetic field.
Gorsche, Christian; Harikrishna, Reghunathan; Baudis, Stefan; Knaack, Patrick; Husar, Branislav; Laeuger, Joerg; Hoffmann, Helmuth; Liska, Robert
2017-05-02
In photopolymerization reactions, mostly multifunctional monomers are employed, as they ensure fast reaction times and good final mechanical properties of the cured materials. Drawing conclusions about the influence of the components and curing conditions on the mechanical properties of the subsequently formed insoluble networks is challenging. Therefore, an in situ observation of chemical and mechanical characteristics during the photopolymerization reaction is desired. By coupling of an infrared spectrometer with a photorheometer, a broad spectrum of different photopolymerizable formulations can be analyzed during the curing reaction. The rheological information (i.e., time to gelation, final modulus, shrinkage force) can be derived from a parallel plate rheometer equipped with a UV- and IR-translucent window (glass for NIR and CaF 2 window for MIR). Chemical information (i.e., conversion at the gel point and final conversion) is gained by monitoring the decrease of the corresponding IR-peak for the reactive monomer unit (e.g., C═C double bond peak for (meth)acrylates, H-S thiol and C═C double bond peak in thiol-ene systems, C-O epoxy peak for epoxy resins). Depending on the relative concentration of reactive functional groups in the sample volume and the intensity of the IR signal, the conversion can be monitored in the near-infrared region (e.g., acrylate double bonds, epoxy groups) or the MIR region (e.g., thiol signal). Moreover, an integrated Peltier element and external heating hood enable the characterization of photopolymerization reactions at elevated temperatures, which also widens the window of application to resins that are waxy or solid at ambient conditions. By switching from water to heavy water, the chemical conversion during photopolymerization of hydrogel precursor formulations can also be examined. Moreover, this device could also represent an analytical tool for a variety of thermally and redox initiated systems.
High-Power Growth-Robust InGaAs/InAlAs Terahertz Quantum Cascade Lasers
2017-01-01
We report on high-power terahertz quantum cascade lasers based on low effective electron mass InGaAs/InAlAs semiconductor heterostructures with excellent reproducibility. Growth-related asymmetries in the form of interface roughness and dopant migration play a crucial role in this material system. These bias polarity dependent phenomena are studied using a nominally symmetric active region resulting in a preferential electron transport in the growth direction. A structure based on a three-well optical phonon depletion scheme was optimized for this bias direction. Depending on the sheet doping density, the performance of this structure shows a trade-off between high maximum operating temperature and high output power. While the highest operating temperature of 155 K is observed for a moderate sheet doping density of 2 × 1010 cm–2, the highest peak output power of 151 mW is found for 7.3 × 1010 cm–2. Furthermore, by abutting a hyperhemispherical GaAs lens to a device with the highest doping level a record output power of 587 mW is achieved for double-metal waveguide structures. PMID:28470028
High-Power Growth-Robust InGaAs/InAlAs Terahertz Quantum Cascade Lasers.
Deutsch, Christoph; Kainz, Martin Alexander; Krall, Michael; Brandstetter, Martin; Bachmann, Dominic; Schönhuber, Sebastian; Detz, Hermann; Zederbauer, Tobias; MacFarland, Donald; Andrews, Aaron Maxwell; Schrenk, Werner; Beck, Mattias; Ohtani, Keita; Faist, Jérôme; Strasser, Gottfried; Unterrainer, Karl
2017-04-19
We report on high-power terahertz quantum cascade lasers based on low effective electron mass InGaAs/InAlAs semiconductor heterostructures with excellent reproducibility. Growth-related asymmetries in the form of interface roughness and dopant migration play a crucial role in this material system. These bias polarity dependent phenomena are studied using a nominally symmetric active region resulting in a preferential electron transport in the growth direction. A structure based on a three-well optical phonon depletion scheme was optimized for this bias direction. Depending on the sheet doping density, the performance of this structure shows a trade-off between high maximum operating temperature and high output power. While the highest operating temperature of 155 K is observed for a moderate sheet doping density of 2 × 10 10 cm -2 , the highest peak output power of 151 mW is found for 7.3 × 10 10 cm -2 . Furthermore, by abutting a hyperhemispherical GaAs lens to a device with the highest doping level a record output power of 587 mW is achieved for double-metal waveguide structures.
Rounding corners of nano-square patches for multispectral plasmonic metamaterial absorbers.
Ayas, Sencer; Bakan, Gokhan; Dana, Aykutlu
2015-05-04
Multispectral metamaterial absorbers based on metal-insulator-metal nano-square patch resonators are studied here. For a geometry consisting of perfectly nano-square patches and vertical sidewalls, double resonances in the visible regime are observed due to simultaneous excitation of electric and magnetic plasmon modes. Although slightly modifying the sizes of the square patches makes the resonance wavelengths simply shift, rounding corners of the square patches results in emergence of a third resonance due to excitation of the circular cavity modes. Sidewall angle of the patches are also observed to affect the absorption spectra significantly. Peak absorption values for the triple resonance structures are strongly affected as the sidewall angle varies from 90 to 50 degrees. Rounded corners and slanted sidewalls are typical imperfections for lithographically fabricated metamaterial structures. The presented results suggest that imperfections caused during fabrication of the top nano-structures must be taken into account when designing metamaterial absorbers. Furthermore, it is shown that these fabrication imperfections can be exploited for improving resonance properties and bandwidths of metamaterials for various potential applications such as solar energy harvesting, thermal emitters, surface enhanced spectroscopies and photodetection.
Spectroscopic follow-up of the Hercules-Aquila Cloud
NASA Astrophysics Data System (ADS)
Simion, Iulia T.; Belokurov, Vasily; Koposov, Sergey E.; Sheffield, Allyson; Johnston, Kathryn V.
2018-05-01
We designed a follow-up program to find the spectroscopic properties of the Hercules-Aquila Cloud (HAC) and test scenarios for its formation. We measured the radial velocities (RVs) of 45 RR Lyrae in the southern portion of the HAC using the facilities at the MDM observatory, producing the first large sample of velocities in the HAC. We found a double-peaked distribution in RVs, skewed slightly to negative velocities. We compared both the morphology of HAC projected on to the plane of the sky and the distribution of velocities in this structure outlined by RR Lyrae and other tracer populations at different distances to N-body simulations. We found that the behaviour is characteristic of an old, well-mixed accretion event with small apo-galactic radius. We cannot yet rule out other formation mechanisms for the HAC. However, if our interpretation is correct, HAC represents just a small portion of a much larger debris structure spread throughout the inner Galaxy whose distinct kinematic structure should be apparent in RV studies along many lines of sight.
Coulomb double helical structure
NASA Astrophysics Data System (ADS)
Kamimura, Tetsuo; Ishihara, Osamu
2012-01-01
Structures of Coulomb clusters formed by dust particles in a plasma are studied by numerical simulation. Our study reveals the presence of various types of self-organized structures of a cluster confined in a prolate spheroidal electrostatic potential. The stable configurations depend on a prolateness parameter for the confining potential as well as on the number of dust particles in a cluster. One-dimensional string, two-dimensional zigzag structure and three-dimensional double helical structure are found as a result of the transition controlled by the prolateness parameter. The formation of stable double helical structures resulted from the transition associated with the instability of angular perturbations on double strings. Analytical perturbation study supports the findings of numerical simulations.
Molecular characterization of Giardia psittaci by multilocus sequence analysis.
Abe, Niichiro; Makino, Ikuko; Kojima, Atsushi
2012-12-01
Multilocus sequence analyses targeting small subunit ribosomal DNA (SSU rDNA), elongation factor 1 alpha (ef1α), glutamate dehydrogenase (gdh), and beta giardin (β-giardin) were performed on Giardia psittaci isolates from three Budgerigars (Melopsittacus undulates) and four Barred parakeets (Bolborhynchus lineola) kept in individual households or imported from overseas. Nucleotide differences and phylogenetic analyses at four loci indicate the distinction of G. psittaci from the other known Giardia species: Giardia muris, Giardia microti, Giardia ardeae, and Giardia duodenalis assemblages. Furthermore, G. psittaci was related more closely to G. duodenalis than to the other known Giardia species, except for G. microti. Conflicting signals regarded as "double peaks" were found at the same nucleotide positions of the ef1α in all isolates. However, the sequences of the other three loci, including gdh and β-giardin, which are known to be highly variable, from all isolates were also mutually identical at every locus. They showed no double peaks. These results suggest that double peaks found in the ef1α sequences are caused not by mixed infection with genetically different G. psittaci isolates but by allelic sequence heterogeneity (ASH), which is observed in diplomonad lineages including G. duodenalis. No sequence difference was found in any G. psittaci isolates at the gdh and β-giardin, suggesting that G. psittaci is indeed not more diverse genetically than other Giardia species. This report is the first to provide evidence related to the genetic characteristics of G. psittaci obtained using multilocus sequence analysis. Copyright © 2012 Elsevier B.V. All rights reserved.
Increasing the Life of a Xenon-Ion Spacecraft Thruster
NASA Technical Reports Server (NTRS)
Goebel, Dan; Polk, James; Sengupta, Anita; Wirz, Richard
2007-01-01
A short document summarizes the redesign of a xenon-ion spacecraft thruster to increase its operational lifetime beyond a limit heretofore imposed by nonuniform ion-impact erosion of an accelerator electrode grid. A peak in the ion current density on the centerline of the thruster causes increased erosion in the center of the grid. The ion-current density in the NSTAR thruster that was the subject of this investigation was characterized by peak-to-average ratio of 2:1 and a peak-to-edge ratio of greater than 10:1. The redesign was directed toward distributing the same beam current more evenly over the entire grid andinvolved several modifications of the magnetic- field topography in the thruster to obtain more nearly uniform ionization. The net result of the redesign was to reduce the peak ion current density by nearly a factor of two, thereby halving the peak erosion rate and doubling the life of the thruster.
Matsumoto, Shinnosuke; Koba, Yusuke; Kohno, Ryosuke; Lee, Choonsik; Bolch, Wesley E; Kai, Michiaki
2016-04-01
Proton therapy has the physical advantage of a Bragg peak that can provide a better dose distribution than conventional x-ray therapy. However, radiation exposure of normal tissues cannot be ignored because it is likely to increase the risk of secondary cancer. Evaluating secondary neutrons generated by the interaction of the proton beam with the treatment beam-line structure is necessary; thus, performing the optimization of radiation protection in proton therapy is required. In this research, the organ dose and energy spectrum were calculated from secondary neutrons using Monte Carlo simulations. The Monte Carlo code known as the Particle and Heavy Ion Transport code System (PHITS) was used to simulate the transport proton and its interaction with the treatment beam-line structure that modeled the double scattering body of the treatment nozzle at the National Cancer Center Hospital East. The doses of the organs in a hybrid computational phantom simulating a 5-y-old boy were calculated. In general, secondary neutron doses were found to decrease with increasing distance to the treatment field. Secondary neutron energy spectra were characterized by incident neutrons with three energy peaks: 1×10, 1, and 100 MeV. A block collimator and a patient collimator contributed significantly to organ doses. In particular, the secondary neutrons from the patient collimator were 30 times higher than those from the first scatter. These results suggested that proactive protection will be required in the design of the treatment beam-line structures and that organ doses from secondary neutrons may be able to be reduced.
NASA Astrophysics Data System (ADS)
Ho, Jen-Hsuan; Berkhoff, Arthur
2014-03-01
This paper compares various decentralised control strategies, including structural and acoustic actuator-sensor configuration designs, to reduce noise transmission through a double panel structure. The comparison is based on identical control stability indexes. The double panel structure consists of two panels with air in between and offers the advantages of low sound transmission at high frequencies, low heat transmission, and low weight. The double panel structure is widely used, such as in the aerospace and automotive industries. Nevertheless, the resonance of the cavity and the poor sound transmission loss at low frequencies limit the double panel's noise control performance. Applying active structural acoustic control to the panels or active noise control to the cavity has been discussed in many papers. In this paper, the resonances of the panels and the cavity are considered simultaneously to further reduce the transmitted noise through an existing double panel structure. A structural-acoustic coupled model is developed to investigate and compare various structural control and cavity control methods. Numerical analysis and real-time control results show that structural control should be applied to both panels. Three types of cavity control sources are presented and compared. The results indicate that the largest noise reduction is obtained with cavity control by loudspeakers modified to operate as incident pressure sources.
Simulation of plasma double-layer structures
NASA Technical Reports Server (NTRS)
Borovsky, J. E.; Joyce, G.
1982-01-01
Electrostatic plasma double layers are numerically simulated by means of a magnetized 2 1/2 dimensional particle in cell method. The investigation of planar double layers indicates that these one dimensional potential structures are susceptible to periodic disruption by instabilities in the low potential plasmas. Only a slight increase in the double layer thickness with an increase in its obliqueness to the magnetic field is observed. Weak magnetization results in the double layer electric field alignment of accelerated particles and strong magnetization results in their magnetic field alignment. The numerical simulations of spatially periodic two dimensional double layers also exhibit cyclical instability. A morphological invariance in two dimensional double layers with respect to the degree of magnetization implies that the potential structures scale with Debye lengths rather than with gyroradii. Electron beam excited electrostatic electron cyclotron waves and (ion beam driven) solitary waves are present in the plasmas adjacent to the double layers.
Nonlinear Optics Technology. Volume 1. Solid State Laser Technology. Phase 3
1991-01-12
84 Figure 5.6 Modulator diffraction efficiency as a function of peak power for several 86 RF frequencies Figure 5.7 Thermal effects in the modulator. a...far-field profile of a beam making a 87 double pass through the modulator operating with a peak power of 80 W and average power of 1.6 W. b) same...AU three shown incorporate phase conjugation to provide good beam quality. Figure 1.1a is a standard phase conjugated master oscillator power
Novel mid-infrared silicon/germanium detector concepts
NASA Astrophysics Data System (ADS)
Presting, Hartmut; Konle, Johannes; Hepp, Markus; Kibbel, Horst; Thonke, Klaus; Sauer, Rolf; Corbin, Elizabeth A.; Jaros, Milan
2000-10-01
Highly p-doped silicon/silicon-germanium (Si/SiGe) quantum well (QW) structures are grown by molecular beam epitaxy on double-sided polished (100)Si substrates for mid-IR (3 to 5 micrometers and 8 to 12 micrometers ) detection. The samples are characterized by secondary ion mass spectroscopy, x-ray diffraction, and absorption measurements. Single mesa detectors are fabricated as well as large-area focal plane arrays with 256 X 256 pixels using standard Si integrated processing techniques. The detectors, based on heterointernal photo-emission (HIP) of photogenerated holes from a heavily p-doped (p++ approximately 5 X 1020 cm-3) SiGe QW into an undoped silicon layer, operate at 77 K. Various novel designs of the SiGe HIP's such as Ge- and B-grading, double- and multi-wells, are realized; in addition, thin doping setback layers between the highly doped well and the undoped Si layer are introduced. The temperature dependence of dark currents and photocurrents are measured up to 225 K. In general, we observe broad photoresponse curves with peak external quantum efficiencies, up to (eta) ext approximately 0.5% at 77 K and 4(mu) , detectivities up to 8 X 1011 cm(root)Hz/W are obtained. We demonstrate that by varying the thickness, Ge content, and doping level of the single- and the multi-QWs of SiGe HIP detectors, the photoresponse peak and the cutoff of the spectrum can be tuned over a wide wavelength range. The epitaxial versatility of the Si/SiGe system enables a tailoring of the photoresponse spectrum which demonstrates the advantages of the SiGe system in comparison over commercially used silicide detectors.
Kinematic Properties of Double-barred Galaxies: Simulations versus Integral-field Observations
NASA Astrophysics Data System (ADS)
Du, Min; Debattista, Victor P.; Shen, Juntai; Cappellari, Michele
2016-09-01
Using high-resolution N-body simulations, we recently reported that a dynamically cool inner disk embedded in a hotter outer disk can naturally generate a steady double-barred (S2B) structure. Here we study the kinematics of these S2B simulations, and compare them to integral-field observations from ATLAS 3D and SAURON. We show that S2B galaxies exhibit several distinct kinematic features, namely: (1) significantly distorted isovelocity contours at the transition region between the two bars, (2) peaks in σ LOS along the minor axis of inner bars, which we term “σ-humps,” that are often accompanied by ring/spiral-like features of increased σ LOS, (3) {h}3{--}\\bar{v} anti-correlations in the region of the inner bar for certain orientations, and (4) rings of positive h 4 when viewed at low inclinations. The most impressive of these features are the σ-humps these evolve with the inner bar, oscillating in strength just as the inner bar does as it rotates relative to the outer bar. We show that, in cylindrical coordinates, the inner bar has similar streaming motions and velocity dispersion properties as normal large-scale bars, except for σ z , which exhibits peaks on the minor axis, I.e., humps. These σ z humps are responsible for producing the σ-humps. For three well-resolved early-type S2Bs (NGC 2859, NGC 2950, and NGC 3941) and a potential S2B candidate (NGC 3384), the S2B model qualitatively matches the integral-field data well, including the “σ-hollows” previously identified. We also discuss the kinematic effect of a nuclear disk in S2Bs.
Abellán, Gonzalo; Jordá, Jose Luis; Atienzar, Pedro; ...
2014-12-04
In this study, a hybrid magnetic multilayer material of micrometric size, with highly crystalline hexagonal crystals consisting of CoAl–LDH ferromagnetic layers intercalated with thermoresponsive 4-(4 anilinophenylazo)benzenesulfonate (AO5) molecules diluted (ratio 9 : 1) with a flexible sodium dodecylsulphate (SDS) surfactant has been obtained. The resulting material exhibits thermochromism attributable to the isomerization between the azo (prevalent at room temperature) and the hydrazone (favoured at higher temperatures) tautomers, leading to a thermomechanical response. In fact, these crystals exhibited thermally induced motion triggering remarkable changes in the crystal morphology and volume. In situ variable temperature XRD of these thin hybrids shows thatmore » the reversible change into the two tautomers is reflected in a shift of the position of the diffraction peaks at high temperatures towards lower interlayer spacing for the hydrazone form, as well as a broadening of the peaks reflecting lower crystallinity and ordering due to non-uniform spacing between the layers. These structural variations between room temperature (basal spacing (BS) = 25.91 Å) and 100 °C (BS = 25.05 Å) are also reflected in the magnetic properties of the layered double hydroxide (LDH) due to the variation of the magnetic coupling between the layers. Finally and in conclusion, our study constitutes one of the few examples showing fully reversible thermo-responsive breathing in a 2D hybrid material. In addition, the magnetic response of the hybrid can be modulated due to the thermotropism of the organic component that, by influencing the distance and in-plane correlation of the inorganic LDH, modulates the magnetism of the CoAl–LDH sheets in a certain range.« less
A realistic treatment of geomagnetic Cherenkov radiation from cosmic ray air showers
NASA Astrophysics Data System (ADS)
Werner, Klaus; de Vries, Krijn D.; Scholten, Olaf
2012-09-01
We present a macroscopic calculation of coherent electro-magnetic radiation from air showers initiated by ultra-high energy cosmic rays, based on currents obtained from three-dimensional Monte Carlo simulations of air showers in a realistic geo-magnetic field. We discuss the importance of a correct treatment of the index of refraction in air, given by the law of Gladstone and Dale, which affects the pulses enormously for certain configurations, compared to a simplified treatment using a constant index. We predict in particular a geomagnetic Cherenkov radiation, which provides strong signals at high frequencies (GHz), for certain geometries together with "normal radiation" from the shower maximum, leading to a double peak structure in the frequency spectrum. We also provide some information about the numerical procedures referred to as EVA 1.0.
The influence of rotation on optical emission profiles of O stars
NASA Astrophysics Data System (ADS)
Hillier, D. John; Bouret, Jean-Claude; Lanz, Thierry; Busche, Joseph R.
2012-10-01
We study the formation of photospheric emission lines in O stars and show that the rectangular profiles, sometimes double peaked, that are observed for some stars are a direct consequence of rotation, and it is unnecessary to invoke an enhanced density structure in the equatorial regions. Emission lines, such as N IV λ4058 and the N III λλ4634-4640-4642 multiplet, exhibit non-standard 'limb-darkening' laws. The lines can be in absorption for rays striking the centre of the star and in emission for rays near the limb. Weak features in the flux spectrum do not necessarily indicate an intrinsically weak feature - instead the feature can be weak because of cancellation between absorption in 'core' rays and emission from rays near the limb. Rotation also modifies line profiles of wind diagnostics such as He II λ4686 and Hα and should not be neglected when inferring the actual stratification, level and nature of wind structures.
Double perovskite Ca2GdNbO6:Mn4+ deep red phosphor: Potential application for warm W-LEDs
NASA Astrophysics Data System (ADS)
Lu, Zuizhi; Huang, Tianjiao; Deng, Ruopeng; Wang, Huan; Wen, Lingling; Huang, Meixin; Zhou, Liya; Yao, Chunying
2018-05-01
A novel Mn4+-doped Ca2GdNbO6 (CGN) phosphor was prepared by high-temperature solid-state reaction. The crystal structure was investigated by X-ray diffraction patterns and unit cell structure. Mn4+ replaced the location of Nb5+ in the CGN lattice, and the value of energy gap (Egap) decreased from 2.16 eV to 1.13 eV, indicating that Mn4+ ions play a great influence on the absorption of CGN hosts. The broad excitation band from 250 nm to 550 nm matches well with commercial near-UV light emitting diodes, and the emission peak centered at 680 nm is due to 2E→4A2g transition in Mn4+ ions. The CIE chromaticity coordinates (0.698, 0.303) of CGN:Mn4+ phosphor was close to standard red color coordinates (0.666, 0.333). These investigations demonstrate CGN:Mn4+ phosphor as an efficient red phosphor for potential applications.
NASA Astrophysics Data System (ADS)
Wolf, Alexey; Dostovalov, Alexandr; Skvortsov, Mikhail; Raspopin, Kirill; Parygin, Alexandr; Babin, Sergey
2018-05-01
In this work, long high-quality fiber Bragg gratings with phase shifts in the structure are inscribed directly in the optical fiber by point-by-point technique using femtosecond laser pulses. Phase shifts are introduced during the inscription process with a piezoelectric actuator, which rapidly shifts the fiber along the direction of its movement in a chosen point of the grating with a chosen shift value. As examples, single and double π phase shifts are introduced in fiber Bragg gratings with a length up to 34 mm in passive fibers, which provide corresponding transmission peaks with bandwidth less than 1 pm. It is shown that 37 mm π -phase-shifted grating inscribed in an active Er-doped fiber forms high-quality DFB laser cavity generating single-frequency radiation at 1550 nm with bandwidth of 20 kHz and signal-to-noise ratio of >70 dB. The inscription technique has a high degree of performance and flexibility and can be easily implemented in fibers of various types.
An effective method to increase bandwidth of EIK at 0.34 THz
NASA Astrophysics Data System (ADS)
Li, Shuang; Wang, Guangqiang; Wang, Dongyang
2018-02-01
To increase the bandwidth of Extended Interaction Klystron (EIK) at 0.34 THz, the method of staggered tuning on cavities' configurations is proposed. Based on the analysis of phase relationship between gap voltage and the bunched beam, the buncher cavities in EIK are reasonably staggered-tuned to achieve various resonance frequencies, which is helpful to flat the gain response of the whole device. The characteristics of output cavities with different numbers of gaps are then researched and the issue of start current for the self-oscillation mode is also involved, leading to the optimum number of gaps to enhance the interaction and avoid the instability. By comparing the performances of various typical stagger-tuned models, the final configuration is accordingly confirmed. Particle-in-cell simulation is eventually applied to study performance of the optimised structure, whose gain is 34.8 dB in peak and -3 dB bandwidth reaches about 500 MHz, which is double that of the synchronous-tuned structure.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yan, Yun-An, E-mail: yunan@gznc.edu.cn
2016-01-14
The quantum interference is an intrinsic phenomenon in quantum physics for photon and massive quantum particles. In principle, the quantum interference may also occur with quasi-particles, such as the exciton. In this study, we show how the exciton quantum interference can be significant in aggregates through theoretical simulations with hierarchical equations of motion. The systems under investigation are generalized donor-bridge-acceptor model aggregates with the donor consisting of six homogeneous sites assuming the nearest neighbor coupling. For the models with single-path bridge, the exciton transfer time only shows a weak excitation energy dependence. But models with double-path bridge have a newmore » short transfer time scale and the excitation energy dependence of the exciton transfer time assumes clear peak structure which is detectable with today’s nonlinear spectroscopy. This abnormality is attributed to the exciton quantum interference and the condition for a clear observation in experiment is also explored.« less
Vertical resonant tunneling transistors with molecular quantum dots for large-scale integration.
Hayakawa, Ryoma; Chikyow, Toyohiro; Wakayama, Yutaka
2017-08-10
Quantum molecular devices have a potential for the construction of new data processing architectures that cannot be achieved using current complementary metal-oxide-semiconductor (CMOS) technology. The relevant basic quantum transport properties have been examined by specific methods such as scanning probe and break-junction techniques. However, these methodologies are not compatible with current CMOS applications, and the development of practical molecular devices remains a persistent challenge. Here, we demonstrate a new vertical resonant tunneling transistor for large-scale integration. The transistor channel is comprised of a MOS structure with C 60 molecules as quantum dots, and the structure behaves like a double tunnel junction. Notably, the transistors enabled the observation of stepwise drain currents, which originated from resonant tunneling via the discrete molecular orbitals. Applying side-gate voltages produced depletion layers in Si substrates, to achieve effective modulation of the drain currents and obvious peak shifts in the differential conductance curves. Our device configuration thus provides a promising means of integrating molecular functions into future CMOS applications.
Nascimento, Daniel R; DePrince, A Eugene
2017-07-06
An explicitly time-dependent (TD) approach to equation-of-motion (EOM) coupled-cluster theory with single and double excitations (CCSD) is implemented for simulating near-edge X-ray absorption fine structure in molecular systems. The TD-EOM-CCSD absorption line shape function is given by the Fourier transform of the CCSD dipole autocorrelation function. We represent this transform by its Padé approximant, which provides converged spectra in much shorter simulation times than are required by the Fourier form. The result is a powerful framework for the blackbox simulation of broadband absorption spectra. K-edge X-ray absorption spectra for carbon, nitrogen, and oxygen in several small molecules are obtained from the real part of the absorption line shape function and are compared with experiment. The computed and experimentally obtained spectra are in good agreement; the mean unsigned error in the predicted peak positions is only 1.2 eV. We also explore the spectral signatures of protonation in these molecules.
Palmer, Sara J; Frost, Ray L
2011-05-01
Near infrared (NIR), X-ray diffraction (XRD) and infrared (IR) spectroscopy have been applied to halotrichites of the formula MgAl(2)(SO(4))(4)·22H(2)O, MnAl(2)(SO(4))(4)·22H(2)O and ZnAl(2)(SO(4))(4)·22H(2)O. Comparison of the halotrichites in different spectral regions has shown that the incorporation of a divalent transition metal into the halotrichite structure causes a shift in OH stretching band positions to lower wavenumbers. Therefore, an increase of the hydrogen bond strength of the bonded water is observed for divalent cations with a larger molecular mass. XRD has confirmed the formation of halotrichite for all three samples and characteristic peaks of halotrichite have been identified for each halotrichite-type compound. It has been observed that Mg-Al and Mn-Al halotrichite are very similar in structure, while Zn-Al showed several differences particularly in the NIR spectra. This work has shown that compounds with halotrichite structures can be synthesised and characterised by infrared and NIR spectroscopy. Copyright © 2011 Elsevier B.V. All rights reserved.
Electronic structure of the benzene dimer cation
NASA Astrophysics Data System (ADS)
Pieniazek, Piotr A.; Krylov, Anna I.; Bradforth, Stephen E.
2007-07-01
The benzene and benzene dimer cations are studied using the equation-of-motion coupled-cluster model with single and double substitutions for ionized systems. The ten lowest electronic states of the dimer at t-shaped, sandwich, and displaced sandwich configurations are described and cataloged based on the character of the constituent fragment molecular orbitals. The character of the states, bonding patterns, and important features of the electronic spectrum are explained using qualitative dimer molecular orbital linear combination of fragment molecular orbital framework. Relaxed ground state geometries are obtained for all isomers. Calculations reveal that the lowest energy structure of the cation has a displaced sandwich structure and a binding energy of 20kcal/mol, while the t-shaped isomer is 6kcal/mol higher. The calculated electronic spectra agree well with experimental gas phase action spectra and femtosecond transient absorption in liquid benzene. Both sandwich and t-shaped structures feature intense charge resonance bands, whose location is very sensitive to the interfragment distance. Change in the electronic state ordering was observed between σ and πu states, which correlate to the B˜ and C˜ bands of the monomer, suggesting a reassignment of the local excitation peaks in the gas phase experimental spectrum.
Spak, Josef; Votruba, Ivan; Pavingerová, Daniela; Holý, Antonín; Spaková, Vlastimila; Petrzik, Karel
2011-11-01
The antiviral effect of the acyclic nucleoside phosphonate tenofovir (R)-PMPA on double-stranded DNA Cauliflower mosaic virus (CaMV) in Brassica pekinensis plants grown in vitro on liquid medium was evaluated. Double antibody sandwich ELISA and PCR were used for relative quantification of viral protein and detecting nucleic acid in plants. (R)-PMPA at concentrations of 25 and 50 mg/l significantly reduced CaMV titers in plants within 6-9 weeks to levels detectable neither by ELISA nor by PCR. Virus-free plants were obtained after 3-month cultivation of meristem tips on semisolid medium containing 50 mg/l (R)-PMPA and their regeneration to whole plants in the greenhouse. Studying the metabolism of (R)-PMPA in B. pekinensis revealed that mono- and diphosphate, structural analogs of NDP and/or NTP, are the only metabolites formed. The data indicate very low substrate activity of the enzymes toward (R)-PMPA as substrate. The extent of phosphorylation in the plant's leaves represents only 4.5% of applied labeled (R)-PMPA. In roots, we detected no radioactive peaks of phosphorylated metabolites of (R)-PMPAp or (R)-PMPApp. Copyright © 2011 Elsevier B.V. All rights reserved.
[Investigation of tympanogram in newborns with 226 hz and 1000 hz probe tones].
Li, Mengyin; Zheng, Yun; Li, Gang; Wang, Kai
2012-11-01
This study aims at investigating tympanogram in newborns who passed hearing screening using 226 and 1 000 Hz probe tones in order to interpret the test results correctly and find out its clinical value in audiological evaluation and diagnosis in this population. Tympanogram was conducted using 226 and 1000 Hz probe tones in 206 newborns between 2 and 7 days of age (3.92 +/- 1.24) in both ears that passed the DPOAE screening and without any of the high risk register (HRR) factors associated with hearing loss according to the Joint Committee on Infant Hearing in 2007. The tympanogram results tested in 408 ear were as following: the percentage of single-peaked, double-peaked, and none-peaked tympanograms using 226 Hz were 52.20% (213 ears), 47.55% (194 ears) and 0.25% (1 ear) respectively. The percentage of single-peaked and other morphological type tympanograms using 1000 Hz were 94.85%(387 ears) and 5.15% (21 ears) respectively. The parameters of 1000 Hz single-peaked tympanogram in this study were as following: the average tympanometric peak pressure was 33.24 +/- 44.37 dapa, the average peak compensated static acoustic admittance was 0.52 +/- 0.25 mmho, the average tympanometric width for right and left ears were 121.38 +/- 28.79 and 108.63 +/- 26.00 dapa respectively with a statistically significant difference between them (P < 0.01). The average volume of ear canal (Vec, using 226 Hz probe tone) at boys and girls were 0.44 +/- 0.10 and 0.43 +/- 0.08 ml respectively with a statistically significant difference between them (P < 0.05). The morphology of tympanogram using a 226 Hz probe tone in newborns usually includes two main types: single-peaked and double-peaked, while it is primarily the single-peaked tympanogram while using a 1000 Hz probe tone. It is more appropriate to use a 1000 Hz probe tone than 226 Hz when testing newborns' tympanogram. The parameters obtained in this study using 1000 Hz and 226 Hz could be tried and applied to interpret clinical tympanogram test results and evaluate middle ear function. However, more studies with bigger sample size are necessary in this field.
Bifurcation structure of successive torus doubling
NASA Astrophysics Data System (ADS)
Sekikawa, Munehisa; Inaba, Naohiko; Yoshinaga, Tetsuya; Tsubouchi, Takashi
2006-01-01
The authors discuss the “embryology” of successive torus doubling via the bifurcation theory, and assert that the coupled map of a logistic map and a circle map has a structure capable of generating infinite number of torus doublings.
Measurement of the conductance properties of single organic molecules using gold nanoparticles
NASA Astrophysics Data System (ADS)
Gordin, Yoav
In this work we describe the development and application of a new method for the electrical conductance measurement of single molecules. The issue of reliable theoretical modeling of molecular electronic transport is still very much in debate. The experimental methods used in the field are difficult to realize and interpret; most have very low yield, preventing proper statistical analysis and many have problems in the researchers' ability to characterize the system properly. We address this issue by using self assembly of gold nanoparticle-molecule-gold nanoparticle objects called dimers. This method allows fabrication of molecular junctions with greater ease; moreover it allows individual characterization of the various elements of the junction, removing much of the uncertainties that exist in this kind of measurements. We make use of home grown gold nanoparticles with a few tens of nanometer diameter to form the hybrid dimers. The dimers are large enough to connect between electrodes fabricated using electron beam lithography and to measure the electric properties of the molecule. We have invested significant effort in the characterization of the system, ensuring that the dimers are indeed bridged by the molecules, and that the chances that more than a single molecule exists in a dimer are negligibly small. We have made measurements on single gold nanoparticles, to characterize their properties separately from those of the molecule. These measurements have allowed us to observe single electron transistor (SET) behavior, resulting from the requirement that electrons charge the nanoparticle during transport. We have shown that the energy associated with this charging scales with nanoparticle size as expected. We have performed measurements on single organic molecules, showing that there is a very strong influence of molecular conjugation (the way electronic orbitals are spread along the molecular backbone) on its conductance. The molecules with broken conjugation conduct more than an order of magnitude less than those that are fully conjugated. A distinct feature of the conjugated molecule is the appearance of pronounced peaks in its conductance at certain voltage values. We have shown that these peaks can be gated randomly by the electrostatic environment, but the peak spectrum is reproducible among the different samples of the same molecular species that we studied. To properly study and understand the peak structure we developed the ability to add gate dependent measurements to our system. Unfortunately the backdrop of this was a drastic reduction in the yield of good samples for measurement. We focused on four different conjugated molecules to attempt to understand the effect of the molecular structure on the properties of the peak spectra. We have been able to measure three of these molecules, and obtained SET diamond plots reminiscent of those seen for the single particles. The molecular diamonds have a larger energy gap than that found in single particles, as can be expected from their smaller size. We do not yet have enough data on this issue to make any definite statements on the influence of the molecular structure on the peak structure. Another topic investigated in this work is the physics of the two gold nanoparticles, giving rise to double quantum dot (DQD) phenomena. This physics is observed in dimers that do not exhibit "molecular" (high energy) features, or at low voltages before the appearance of the molecular peaks. We have used these phenomena to fully characterize the properties of our system and understand better the role the molecule plays in transport at low bias (below the voltage of the first peak). I begin this thesis with an introduction to the field of molecular electronics; I briefly review the theoretical approaches and the experimental methods used. I then describe in detail the dimer method, whose development took up a major part of this work, relaying in detail the relevant issues and considerations. I relate briefly some early measurements done on single nanoparticles to verify our understanding of transport in the system. Moving to the description of single molecule conductance measurements I start by describing measurements demonstrating the importance of conjugation to molecular conductance. I discuss in detail the peaks appearing in the conductance measurements of the conjugated molecules describing their sample to sample variability, temporal behavior and temperature dependence. I describe the importance of gating for a comprehensive understanding of the peak spectrum and present some preliminary measurements of three different molecular species that we have been able to gate. In the final chapter of this work I describe the double quantum dot phenomena observed in the dimer system; these phenomena are not immediately relevant to the issue of single molecule conductance, but serve as a tool to characterize our system fully while providing assurance that the current goes through both nanoparticles. (Abstract shortened by UMI.)
Juhász, Márk; Nagy, Viktor L.; Székely, Hajnal; Kocsis, Dorottya; Tulassay, Zsolt; László, János F.
2014-01-01
This pilot study was devoted to the effect of static magnetic field (SMF)-exposure on erosive gastritis. The randomized, self- and placebo-controlled, double-blind, pilot study included 16 patients of the 2nd Department of Internal Medicine, Semmelweis University diagnosed with erosive gastritis. The instrumental analysis followed a qualitative (pre-intervention) assessment of the symptoms by the patient: lower heartburn (in the ventricle), upper heartburn (in the oesophagus), epigastric pain, regurgitation, bloating and dry cough. Medical diagnosis included a double-line upper panendoscopy followed by 30 min local inhomogeneous SMF-exposure intervention at the lower sternal region over the stomach with peak-to-peak magnetic induction of 3 mT and 30 mT m−1 gradient at the target site. A qualitative (post-intervention) assessment of the same symptoms closed the examination. Sham- or SMF-exposure was used in a double-blind manner. The authors succeeded in justifying the clinically and statistically significant beneficial effect of the SMF- over sham-exposure on the symptoms of erosive gastritis, the average effect of inhibition was 56% by p = 0.001, n = 42 + 96. This pilot study was aimed to encourage gastroenterologists to test local, inhomogeneous SMF-exposure on erosive gastritis patients, so this intervention may become an evidence-based alternative or complementary method in the clinical use especially in cases when conventional therapy options are contraindicated. PMID:25008086
Juhász, Márk; Nagy, Viktor L; Székely, Hajnal; Kocsis, Dorottya; Tulassay, Zsolt; László, János F
2014-09-06
This pilot study was devoted to the effect of static magnetic field (SMF)-exposure on erosive gastritis. The randomized, self- and placebo-controlled, double-blind, pilot study included 16 patients of the 2nd Department of Internal Medicine, Semmelweis University diagnosed with erosive gastritis. The instrumental analysis followed a qualitative (pre-intervention) assessment of the symptoms by the patient: lower heartburn (in the ventricle), upper heartburn (in the oesophagus), epigastric pain, regurgitation, bloating and dry cough. Medical diagnosis included a double-line upper panendoscopy followed by 30 min local inhomogeneous SMF-exposure intervention at the lower sternal region over the stomach with peak-to-peak magnetic induction of 3 mT and 30 mT m(-1) gradient at the target site. A qualitative (post-intervention) assessment of the same symptoms closed the examination. Sham- or SMF-exposure was used in a double-blind manner. The authors succeeded in justifying the clinically and statistically significant beneficial effect of the SMF- over sham-exposure on the symptoms of erosive gastritis, the average effect of inhibition was 56% by p = 0.001, n = 42 + 96. This pilot study was aimed to encourage gastroenterologists to test local, inhomogeneous SMF-exposure on erosive gastritis patients, so this intervention may become an evidence-based alternative or complementary method in the clinical use especially in cases when conventional therapy options are contraindicated. © 2014 The Author(s) Published by the Royal Society. All rights reserved.
Code of Federal Regulations, 2014 CFR
2014-10-01
... independent tanks 3 Wood hull ship and barge Unmanned deck cargo barge 4 Unmanned double hull freight barge 5....40-3(a)—Salt Water Service Vessels Examination Intervals in Years Single hull ship and barge Double... hull structure. 5 Applicable to unmanned/non-permissively manned double hull freight barges (double...
Code of Federal Regulations, 2012 CFR
2012-10-01
... independent tanks 3 Wood hull ship and barge Unmanned deck cargo barge 4 Unmanned double hull freight barge 5....40-3(a)—Salt Water Service Vessels Examination Intervals in Years Single hull ship and barge Double... hull structure. 5 Applicable to unmanned/non-permissively manned double hull freight barges (double...
Code of Federal Regulations, 2013 CFR
2013-10-01
... independent tanks 3 Wood hull ship and barge Unmanned deck cargo barge 4 Unmanned double hull freight barge 5....40-3(a)—Salt Water Service Vessels Examination Intervals in Years Single hull ship and barge Double... hull structure. 5 Applicable to unmanned/non-permissively manned double hull freight barges (double...
Code of Federal Regulations, 2011 CFR
2011-10-01
... independent tanks 3 Wood hull ship and barge Unmanned deck cargo barge 4 Unmanned double hull freight barge 5....40-3(a)—Salt Water Service Vessels Examination Intervals in Years Single hull ship and barge Double... hull structure. 5 Applicable to unmanned/non-permissively manned double hull freight barges (double...
WE-E-17A-01: Characterization of An Imaging-Based Model of Tumor Angiogenesis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Adhikarla, V; Jeraj, R
2014-06-15
Purpose: Understanding the transient dynamics of tumor oxygenation is important when evaluating tumor-vasculature response to anti-angiogenic therapies. An imaging-based tumor-vasculature model was used to elucidate factors that affect these dynamics. Methods: Tumor growth depends on its doubling time (Td). Hypoxia increases pro-angiogenic factor (VEGF) concentration which is modeled to reduce vessel perfusion, attributing to its effect of increasing vascular permeability. Perfused vessel recruitment depends on the existing perfused vasculature, VEGF concentration and maximum VEGF concentration (VEGFmax) for vessel dysfunction. A convolution-based algorithm couples the tumor to the normal tissue vessel density (VD-nt). The parameters are benchmarked to published pre-clinical datamore » and a sensitivity study evaluating the changes in the peak and time to peak tumor oxygenation characterizes them. The model is used to simulate changes in hypoxia and proliferation PET imaging data obtained using [Cu- 61]Cu-ATSM and [F-18]FLT respectively. Results: Td and VD-nt were found to be the most influential on peak tumor pO2 while VEGFmax was marginally influential. A +20 % change in Td, VD-nt and VEGFmax resulted in +50%, +25% and +5% increase in peak pO2. In contrast, Td was the most influential on the time to peak oxygenation with VD-nt and VEGFmax playing marginal roles. A +20% change in Td, VD-nt and VEGFmax increased the time to peak pO2 by +50%, +5% and +0%. A −20% change in the above parameters resulted in comparable decreases in the peak and time to peak pO2. Model application to the PET data was able to demonstrate the voxel-specific changes in hypoxia of the imaged tumor. Conclusion: Tumor-specific doubling time and vessel density are important parameters to be considered when evaluating hypoxia transients. While the current model simulates the oxygen dynamics of an untreated tumor, incorporation of therapeutic effects can make the model a potent tool for analyzing anti-angiogenic therapies.« less
Saturation analysis of ChIP-seq data for reproducible identification of binding peaks
Hansen, Peter; Hecht, Jochen; Ibrahim, Daniel M.; Krannich, Alexander; Truss, Matthias; Robinson, Peter N.
2015-01-01
Chromatin immunoprecipitation coupled with next-generation sequencing (ChIP-seq) is a powerful technology to identify the genome-wide locations of transcription factors and other DNA binding proteins. Computational ChIP-seq peak calling infers the location of protein–DNA interactions based on various measures of enrichment of sequence reads. In this work, we introduce an algorithm, Q, that uses an assessment of the quadratic enrichment of reads to center candidate peaks followed by statistical analysis of saturation of candidate peaks by 5′ ends of reads. We show that our method not only is substantially faster than several competing methods but also demonstrates statistically significant advantages with respect to reproducibility of results and in its ability to identify peaks with reproducible binding site motifs. We show that Q has superior performance in the delineation of double RNAPII and H3K4me3 peaks surrounding transcription start sites related to a better ability to resolve individual peaks. The method is implemented in C+l+ and is freely available under an open source license. PMID:26163319
Scientific Staff | ast.noao.edu
Emeritus Double stars; stellar rotation; stellar characteristics; publication practices in astronomy Thai formation; infrared astronomy and instrumentation NOAO Associate Director for Kitt Peak National Observatory clumpy media, software development, modeling & SED fitting, big data, HPC in astronomy, visualization
Code of Federal Regulations, 2010 CFR
2010-10-01
... hull barge with internal framing 1 Double hull barge with external framing 2 Single hull barge with..., ends, and bottoms) when the structural framing is on the internal tank surface. 2 Applicable to double hull tank barges (double sides, ends, and bottoms) when the structural framing is on the external tank...
Nelson, Cory O; Sileo, Michael J; Grossman, Mark G; Serra-Hsu, Frederick
2008-08-01
The purpose of this study was to compare the time-zero biomechanical strength and the surface area of repair between a single-row modified Mason-Allen rotator cuff repair and a double-row arthroscopic repair. Six matched pairs of sheep infraspinatus tendons were repaired by both techniques. Pressure-sensitive film was used to measure the surface area of repair for each configuration. Specimens were biomechanically tested with cyclic loading from 20 N to 30 N for 20 cycles and were loaded to failure at a rate of 1 mm/s. Failure was defined at 5 mm of gap formation. Double-row suture anchor fixation restored a mean surface area of 258.23 +/- 69.7 mm(2) versus 148.08 +/- 75.5 mm(2) for single-row fixation, a 74% increase (P = .025). Both repairs had statistically similar time-zero biomechanics. There was no statistical difference in peak-to-peak displacement or elongation during cyclic loading. Single-row fixation showed a higher mean load to failure (110.26 +/- 26.4 N) than double-row fixation (108.93 +/- 21.8 N). This was not statistically significant (P = .932). All specimens failed at the suture-tendon interface. Double-row suture anchor fixation restores a greater percentage of the anatomic footprint when compared with a single-row Mason-Allen technique. The time-zero biomechanical strength was not significantly different between the 2 study groups. This study suggests that the 2 factors are independent of each other. Surface area and biomechanical strength of fixation are 2 independent factors in the outcome of rotator cuff repair. Maximizing both factors may increase the likelihood of complete tendon-bone healing and ultimately improve clinical outcomes. For smaller tears, a single-row modified Mason-Allen suture technique may provide sufficient strength, but for large amenable tears, a double row can provide both strength and increased surface area for healing.
Electromagnetic and optical characteristics of Nb5+-doped double-crossover and salmon DNA thin films
NASA Astrophysics Data System (ADS)
Babu Mitta, Sekhar; Reddy Dugasani, Sreekantha; Jung, Soon-Gil; Vellampatti, Srivithya; Park, Tuson; Park, Sung Ha
2017-10-01
We report the fabrication and physical characteristics of niobium ion (Nb5+)-doped double-crossover DNA (DX-DNA) and salmon DNA (SDNA) thin films. Different concentrations of Nb5+ ([Nb5+]) are coordinated into the DNA molecules, and the thin films are fabricated via substrate-assisted growth (DX-DNA) and drop-casting (SDNA) on oxygen plasma treated substrates. We conducted atomic force microscopy to estimate the optimum concentration of Nb5+ ([Nb5+]O = 0.08 mM) in Nb5+-doped DX-DNA thin films, up to which the DX-DNA lattices maintain their structures without deformation. X-ray photoelectron spectroscopy (XPS) was performed to probe the chemical nature of the intercalated Nb5+ in the SDNA thin films. The change in peak intensities and the shift in binding energy were witnessed in XPS spectra to explicate the binding and charge transfer mechanisms between Nb5+ and SDNA molecules. UV-visible, Raman, and photoluminescence (PL) spectra were measured to determine the optical properties and thus investigate the binding modes, Nb5+ coordination sites in Nb5+-doped SDNA thin films, and energy transfer mechanisms, respectively. As [Nb5+] increases, the absorbance peak intensities monotonically increase until ˜[Nb5+]O and then decrease. However, from the Raman measurements, the peak intensities gradually decrease with an increase in [Nb5+] to reveal the binding mechanism and binding sites of metal ions in the SDNA molecules. From the PL, we observe the emission intensities to reduce them at up to ˜[Nb5+]O and then increase after that, expecting the energy transfer between the Nb5+ and SDNA molecules. The current-voltage measurement shows a significant increase in the current observed as [Nb5+] increases in the SDNA thin films when compared to that of pristine SDNA thin films. Finally, we investigate the temperature dependent magnetization in which the Nb5+-doped SDNA thin films reveal weak ferromagnetism due to the existence of tiny magnetic dipoles in the Nb5+-doped SDNA complex.
NASA Astrophysics Data System (ADS)
Liu, Y.; Gao, B.; Gong, M.
2017-06-01
In this paper, we proposed to use step heterojunctions emitter spacer (SHES) and InGaN sub-quantum well in AlGaN/GaN/AlGaN double barrier resonant tunnelling diodes (RTDs). Theoretical analysis of RTD with SHES and InGaN sub-quantum well was presented, which indicated that the negative differential resistance (NDR) characteristic was improved. And the simulation results, peak current density JP=82.67 mA/μm2, the peak-to-valley current ratio PVCR=3.38, and intrinsic negative differential resistance RN=-0.147Ω at room temperature, verified the improvement of NDR characteristic brought about by SHES and InGaN sub-quantum well. Both the theoretical analysis and simulation results showed that the device performance, especially the average oscillator output power presented great improvement and reached 2.77mW/μm2 magnitude. And the resistive cut-off frequency would benefit a lot from the relatively small RN as well. Our works provide an important alternative to the current approaches in designing new structure GaN based RTD for practical high frequency and high power applications.
Experimental results of sodium-water reaction test No. 3 in LLTR
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miller, A.E.; Neely, H.H.
1977-08-01
Computer-generated plots of the transient data obtained during the third sodium-water reaction test (SWR-3) and observations made after the test are presented. Similar to the first two tests of Series I, a double-ended guillotine rupture was produced in a water tube of the Atomics International Modular Steam Generator (AI-MSG). Prior to tube rupture, the temperature distribution in the vertical AI-MSG was linear from 600/sup 0/F at the bottom to 800/sup 0/F at the top. The rupture was located in the horizontal section 1.75 in. from the upper tubesheet. Peak pressures generated in this test were somewhat lower than the 400more » psi and 500 psi measured in the prior tests; while peak temperatures, about 1600/sup 0/F, were higher than were measured previously. The interest examinations revealed no structural damage, material wastage, stress corrosion cracking, or dimensional changes. Additional reaction products have been accumulated in the bottom of the AI-MSG up to Spacer 3, so that the flow path in the AI-MSG to both the lower relief line and the drain line is restricted. The relief lines are relatively clear.« less
Mid-infrared GaSb-based resonant tunneling diode photodetectors for gas sensing applications
NASA Astrophysics Data System (ADS)
Rothmayr, F.; Pfenning, A.; Kistner, C.; Koeth, J.; Knebl, G.; Schade, A.; Krueger, S.; Worschech, L.; Hartmann, F.; Höfling, S.
2018-04-01
We present resonant tunneling diode-photodetectors (RTD-PDs) with GaAs0.15Sb0.85/AlAs0.1Sb0.9 double barrier structures combined with an additional quaternary Ga0.64In0.36As0.33Sb0.67 absorption layer covering the fingerprint absorption lines of various gases in the mid-infrared wavelength spectral region. The absorption layer cut-off wavelength is determined to be 3.5 μm, and the RTD-PDs show peak-to-valley current ratios up to 4.3 with a peak current density of 12 A/cm-2. The incorporation of the quaternary absorption layer enables the RTD-PDs to be sensitive to illumination with light up to the absorption lines of HCl at 3395 nm. At this wavelength, the detector shows a responsivity of 6.3 mA/W. At the absorption lines of CO2 and CO at 2004 nm and 2330 nm, respectively, the RTD-PDs reach responsivities up to 0.97 A/W. Thus, RTD-PDs pave the way towards high sensitive mid-infrared detectors that can be utilized in tunable laser absorption spectroscopy.
Agent-based spin model for financial markets on complex networks: Emergence of two-phase phenomena
NASA Astrophysics Data System (ADS)
Kim, Yup; Kim, Hong-Joo; Yook, Soon-Hyung
2008-09-01
We study a microscopic model for financial markets on complex networks, motivated by the dynamics of agents and their structure of interaction. The model consists of interacting agents (spins) with local ferromagnetic coupling and global antiferromagnetic coupling. In order to incorporate more realistic situations, we also introduce an external field which changes in time. From numerical simulations, we find that the model shows two-phase phenomena. When the local ferromagnetic interaction is balanced with the global antiferromagnetic interaction, the resulting return distribution satisfies a power law having a single peak at zero values of return, which corresponds to the market equilibrium phase. On the other hand, if local ferromagnetic interaction is dominant, then the return distribution becomes double peaked at nonzero values of return, which characterizes the out-of-equilibrium phase. On random networks, the crossover between two phases comes from the competition between two different interactions. However, on scale-free networks, not only the competition between the different interactions but also the heterogeneity of underlying topology causes the two-phase phenomena. Possible relationships between the critical phenomena of spin system and the two-phase phenomena are discussed.
NASA Technical Reports Server (NTRS)
Kreykenbohm, Ingo; Fuerst, Felix; Barragan, Laura; Wilms, Joern; Rothschild, Richard E.; Suchy, Slawomir; Pottschmidt, Katja
2010-01-01
We present a detailed spectral and timing analysis of the High Mass X-ray Binary (HMXB) 4U 1909+07 with INTEGRAL and RXTE. 4U 1909+07 is a persistent accreting X-ray pulsar with a period of approximately 605 s. The period changes erratically consistent with a random walk expected for a wind accreting system. INTEGRAL detects the source with an average of 2.4 cps (corresponding to 15 mCrab), but sometimes exhibits flaring activity up to 50 cps (i.e. 300 mCrab). The strongly energy dependent pulse profile shows a double peaked structure at low energies and only a single narrow peak at energies above 20 keV. The phase averaged spectrum is well described by a powerlaw modified at higher energies by an exponential cutoff and photoelectric absorption at low energies. In addition at 6.4 keV a strong iron fluorescence line and at lower energies a black body component are present. We performed phase resolved spectroscopy to study the pulse phase dependence of the spectral parameters: while most spectral parameters are constant within uncertainties, the blackbody normalization and the cutoff folding energy vary strongly with phase.
Numerical study of double-pulse laser ablation of Al
NASA Astrophysics Data System (ADS)
Förster, G. D.; Lewis, Laurent J.
2018-06-01
The effect of double laser pulses (DPs) on the ablation process in solids is studied using a hybrid two-temperature model combining a continuum description of the conduction band electrons with a classical molecular dynamics (MD) approach for the ions. The study is concerned with double pulses with delays in the range of 0-50 ps and absorbed laser fluences of 0.5, 1.0, and 1.5 J/m 2 [i.e., 1-3 times the ablation threshold for single-pulse ablation (SP)], taking Al as a generic example of simple metals. A detailed analysis, including the assessment of thermodynamic pathways and cavitation rates, leads to a comprehensive picture of the mechanisms active during the different stages of the ablation process initiated by DPs. This study provides an explanation for several phenomena observed in DP ablation experiments. In particular, with respect to SP ablation, crater depths are reduced, which can be explained by the compensation of the rarefaction wave from the first laser pulse with the compression wave from the second pulse, or, at higher fluences and larger delays, by the fact that the target surface is shielded with matter ablated by the first laser pulse. Also, we discuss how smoother surface structures obtained using DPs may be related to features found in the simulations—viz., reduced mechanical strain and peak lattice temperatures. Finally, vaporization appears to be enhanced in DP ablation, which may improve the resolution of emission spectra.
Multi-wavelength Observations of the Dissociative Merger in the Galaxy Cluster CIZA J0107.7+5408
NASA Astrophysics Data System (ADS)
Randall, S. W.; Clarke, T. E.; van Weeren, R. J.; Intema, H. T.; Dawson, W. A.; Mroczkowski, T.; Blanton, E. L.; Bulbul, E.; Giacintucci, S.
2016-06-01
We present results based on X-ray, optical, and radio observations of the massive galaxy cluster CIZA J0107.7+5408. We find that this system is a post-core-passage, dissociative, binary merger, with the optical galaxy density peaks of each subcluster leading their associated X-ray emission peaks. This separation occurs because the diffuse gas experiences ram pressure forces, while the effectively collisionless galaxies (and presumably their associated dark matter (DM) halos) do not. This system contains double-peaked diffuse radio emission, possibly a double radio relic with the relics lying along the merger axis and also leading the X-ray cores. We find evidence for a temperature peak associated with the SW relic, likely created by the same merger shock that is powering the relic radio emission in this region. Thus, this system is a relatively rare, clean example of a dissociative binary merger, which can in principle be used to place constraints on the self-interaction cross-section of DM. Low-frequency radio observations reveal ultra-steep spectrum diffuse radio emission that is not correlated with the X-ray, optical, or high-frequency radio emission. We suggest that these sources are radio phoenixes, which are preexisting non-thermal particle populations that have been re-energized through adiabatic compression by the same merger shocks that power the radio relics. Finally, we place upper limits on inverse Compton emission from the SW radio relic.
MULTI-WAVELENGTH OBSERVATIONS OF THE DISSOCIATIVE MERGER IN THE GALAXY CLUSTER CIZA J0107.7+5408
DOE Office of Scientific and Technical Information (OSTI.GOV)
Randall, S. W.; Weeren, R. J. van; Clarke, T. E.
We present results based on X-ray, optical, and radio observations of the massive galaxy cluster CIZA J0107.7+5408. We find that this system is a post-core-passage, dissociative, binary merger, with the optical galaxy density peaks of each subcluster leading their associated X-ray emission peaks. This separation occurs because the diffuse gas experiences ram pressure forces, while the effectively collisionless galaxies (and presumably their associated dark matter (DM) halos) do not. This system contains double-peaked diffuse radio emission, possibly a double radio relic with the relics lying along the merger axis and also leading the X-ray cores. We find evidence for amore » temperature peak associated with the SW relic, likely created by the same merger shock that is powering the relic radio emission in this region. Thus, this system is a relatively rare, clean example of a dissociative binary merger, which can in principle be used to place constraints on the self-interaction cross-section of DM. Low-frequency radio observations reveal ultra-steep spectrum diffuse radio emission that is not correlated with the X-ray, optical, or high-frequency radio emission. We suggest that these sources are radio phoenixes, which are preexisting non-thermal particle populations that have been re-energized through adiabatic compression by the same merger shocks that power the radio relics. Finally, we place upper limits on inverse Compton emission from the SW radio relic.« less
Multi-wavelength Observations of the Dissociative Merger in the Galaxy Cluster CIZA J0107.7+5408
DOE Office of Scientific and Technical Information (OSTI.GOV)
Randall, S. W.; Clarke, T. E.; Weeren, R. J. van
We present results based on X-ray, optical, and radio observations of the massive galaxy cluster CIZA J0107.7+5408. We find that this system is a post-core-passage, dissociative, binary merger, with the optical galaxy density peaks of each subcluster leading their associated X-ray emission peaks. This separation occurs because the diffuse gas experiences ram pressure forces, while the effectively collisionless galaxies (and presumably their associated dark matter (DM) halos) do not. This system contains double-peaked diffuse radio emission, possibly a double radio relic with the relics lying along the merger axis and also leading the X-ray cores. We find evidence for amore » temperature peak associated with the SW relic, likely created by the same merger shock that is powering the relic radio emission in this region. Thus, this system is a relatively rare, clean example of a dissociative binary merger, which can in principle be used to place constraints on the self-interaction cross-section of DM. Low-frequency radio observations reveal ultra-steep spectrum diffuse radio emission that is not correlated with the X-ray, optical, or high-frequency radio emission. Here, we suggest that these sources are radio phoenixes, which are preexisting non-thermal particle populations that have been re-energized through adiabatic compression by the same merger shocks that power the radio relics. Finally, we place upper limits on inverse Compton emission from the SW radio relic.« less
Multi-wavelength Observations of the Dissociative Merger in the Galaxy Cluster CIZA J0107.7+5408
Randall, S. W.; Clarke, T. E.; Weeren, R. J. van; ...
2016-05-25
We present results based on X-ray, optical, and radio observations of the massive galaxy cluster CIZA J0107.7+5408. We find that this system is a post-core-passage, dissociative, binary merger, with the optical galaxy density peaks of each subcluster leading their associated X-ray emission peaks. This separation occurs because the diffuse gas experiences ram pressure forces, while the effectively collisionless galaxies (and presumably their associated dark matter (DM) halos) do not. This system contains double-peaked diffuse radio emission, possibly a double radio relic with the relics lying along the merger axis and also leading the X-ray cores. We find evidence for amore » temperature peak associated with the SW relic, likely created by the same merger shock that is powering the relic radio emission in this region. Thus, this system is a relatively rare, clean example of a dissociative binary merger, which can in principle be used to place constraints on the self-interaction cross-section of DM. Low-frequency radio observations reveal ultra-steep spectrum diffuse radio emission that is not correlated with the X-ray, optical, or high-frequency radio emission. Here, we suggest that these sources are radio phoenixes, which are preexisting non-thermal particle populations that have been re-energized through adiabatic compression by the same merger shocks that power the radio relics. Finally, we place upper limits on inverse Compton emission from the SW radio relic.« less
Application of hollow anodes in a Hall thruster with double-peak magnetic fields
NASA Astrophysics Data System (ADS)
Ding, Yongjie; Sun, Hezhi; Li, Peng; Wei, Liqiu; Su, Hongbo; Peng, Wuji; Li, Hong; Yu, Daren
2017-08-01
A low-power Hall thruster was designed with two permanent magnet rings. Unlike conventional Hall thrusters, this one has a symmetrical double-peak magnetic field with a larger gradient. Moreover, the highest magnetic field strength appears in the plume region; hence, the distance from the zero-magnetic region to the channel outlet is shorter than that of other Hall thrusters. This paper presents the law and mechanism of the effect of a U-shaped hollow anode with the front end in the zero-magnetic region and anodes at the first magnetic peak and zero-magnetic point (corresponding to the front and rear end faces of the U-shaped anode, respectively) on the discharge characteristics of the thruster. The study shows that the overall performance of the hollow anode under the same operating conditions is the highest. For the anode at the magnetic peak, although the ionization rate is the highest, most of the ions generated by ionization collide with the walls, causing greater energy loss and minimizing its performance. For the anode at the zero-magnetic point, although its maximum ionization rate is higher than that of the hollow anode, and the power deposition on the walls is slightly smaller, its propellant utilization and voltage utilization are lower than those of the hollow anode; furthermore, its overall performance is poorer than that of the hollow anode because of the short channel and shorter ionization region.
NASA Astrophysics Data System (ADS)
Capan, Ivana; Brodar, Tomislav; Pastuović, Željko; Siegele, Rainer; Ohshima, Takeshi; Sato, Shin-ichiro; Makino, Takahiro; Snoj, Luka; Radulović, Vladimir; Coutinho, José; Torres, Vitor J. B.; Demmouche, Kamel
2018-04-01
We present results from combined Laplace-Deep Level Transient Spectroscopy (Laplace-DLTS) and density functional theory studies of the carbon vacancy (VC) in n-type 4H-SiC. Using Laplace-DLTS, we were able to distinguish two previously unresolved sub-lattice-inequivalent emissions, causing the broad Z1/2 peak at 290 K that is commonly observed by conventional DLTS in n-type 4H-SiC. This peak has two components with activation energies for electron emission of 0.58 eV and 0.65 eV. We compared these results with the acceptor levels of VC obtained by means of hybrid density functional supercell calculations. The calculations support the assignment of the Z1/2 signal to a superposition of emission peaks from double negatively charged VC defects. Taking into account the measured and calculated energy levels, the calculated relative stability of VC in hexagonal (h) and cubic (k) lattice sites, as well as the observed relative amplitude of the Laplace-DLTS peaks, we assign Z1 and Z2 to VC(h) and VC(k), respectively. We also present the preliminary results of DLTS and Laplace-DLTS measurements on deep level defects (ET1 and ET2) introduced by fast neutron irradiation and He ion implantation in 4H-SiC. The origin of ET1 and ET2 is still unclear.
Secular Resonance Sweeping of the Main Asteroid Belt During Planet Migration
NASA Astrophysics Data System (ADS)
Minton, David A.; Malhotra, Renu
2011-05-01
We calculate the eccentricity excitation of asteroids produced by the sweeping ν6 secular resonance during the epoch of planetesimal-driven giant planet migration in the early history of the solar system. We derive analytical expressions for the magnitude of the eccentricity change and its dependence on the sweep rate and on planetary parameters; the ν6 sweeping leads to either an increase or a decrease of eccentricity depending on an asteroid's initial orbit. Based on the slowest rate of ν6 sweeping that allows a remnant asteroid belt to survive, we derive a lower limit on Saturn's migration speed of ~0.15 AU Myr-1 during the era that the ν6 resonance swept through the inner asteroid belt (semimajor axis range 2.1-2.8 AU). This rate limit is for Saturn's current eccentricity and scales with the square of its eccentricity; the limit on Saturn's migration rate could be lower if its eccentricity were lower during its migration. Applied to an ensemble of fictitious asteroids, our calculations show that a prior single-peaked distribution of asteroid eccentricities would be transformed into a double-peaked distribution due to the sweeping of the ν6 resonance. Examination of the orbital data of main belt asteroids reveals that the proper eccentricities of the known bright (H <= 10.8) asteroids may be consistent with a double-peaked distribution. If so, our theoretical analysis then yields two possible solutions for the migration rate of Saturn and for the dynamical states of the pre-migration asteroid belt: a dynamically cold state (single-peaked eccentricity distribution with mean of ~0.05) linked with Saturn's migration speed ~4 AU Myr-1 or a dynamically hot state (single-peaked eccentricity distribution with mean of ~0.3) linked with Saturn's migration speed ~0.8 AU Myr-1.
NASA Astrophysics Data System (ADS)
Khalil, A. A. I.; Morsy, M. A.; El-Deen, H. Z.
2017-11-01
Series of manganese-co-precipitated poly (vinyl alcohol) (PVA) polymer were quantitatively and qualitatively analyzed using laser ablation system (LAS) based on double-pulse laser induced breakdown spectroscopy (DP-LIBS) and electron paramagnetic resonance (EPR) spectroscopy. The collinear nanosecond laser beams of 266 and 1064 nm were optimized to focus on the surface of the PVA polymer target. Both laser beams were employed to estimate the natural properties of the excited Mn-PVA plasma, such as electron number density (Ne), electron temperature (Te), and Mn concentration. Individual transition lines of manganese (Mn), carbon (C), lithium (Li), hydrogen (H) and oxygen (O) atoms are identified based on the NIST spectral database. The results show better responses with DP-LIBS than the single-pulse laser induced breakdown spectroscopy (SP-LIBS). On the other hand, the EPR investigation shows characteristic broad peak of Mn-nano-particles (Mn-NPs) in the range of quantum dots of superparamagnetic materials. The line width (peak-to-peak, ΔHpp) and g-value of the observed Mn-EPR peak are ∼20 mT and 2.0046, respectively. The intensities of Mn-emission line at a wavelength 403.07 nm and the Mn-EPR absorption peak were used to accurate quantify the Mn-content in the polymer matrix. The results produce linear trends within the studied concentration range with regression coefficient (R2) value of ∼0.99, and limit of detection (LOD) of 0.026 mol.% and 0.016 mol.%, respectively. The LOD values are at a fold change of about -0.2 of the studied lowest mol.%. The proposed protocols of trace element detection are of significant advantage and can be applied to the other metal analysis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Lei; Department of Medical Physics, Basic Medical College, Hebei Medical University, Shijiazhuang, Hebei 050017; Li, Yu-Xian
2014-01-14
The transport properties in graphene-based asymmetric double velocity well (Fermi velocity inside the well less than that outside the well) and electrostatic well structures are investigated using the transfer matrix method. The results show that quantum beats occur in the oscillations of the conductance for asymmetric double velocity wells. The beating effect can also be found in asymmetric double electrostatic wells, but only if the widths of the two wells are different. The beat frequency for the asymmetric double well is exactly equal to the frequency difference between the oscillation rates in two isolated single wells with the same structuresmore » as the individual wells in the double well structure. A qualitative interpretation is proposed based on the fact that the resonant levels depend upon the sizes of the quantum wells. The beating behavior can provide a new way to identify the symmetry of double well structures.« less
Li, Jian-Bo; Xiao, Si; Liang, Shan; He, Meng-Dong; Luo, Jian-Hua; Kim, Nam-Chol; Chen, Li-Qun
2017-10-16
We perform a theoretical study of the bistable four-wave mixing (FWM) response in a coupled system comprised of a semiconductor quantum dot (SQD) and a photonic crystal (PC) nanocavity in which the SQD is embedded. It is shown that the shape of the FWM spectrum can switch among single-peaked, double-peaked, triple-peaked, and four-peaked arising from the vacuum Rabi splitting and the exciton-nanocavity coupling. Especially, we map out bistability phase diagrams within a parameter subspace of the system, and find that it is easy to turn on or off the bistable FWM response by only adjusting the excitation frequency or the pumping intensity. Our results offer a feasible means for measuring the SQD-PC nanocavity coupling strength and open a new avenue to design optical switches and memories.
Everse, S J; Spraggon, G; Veerapandian, L; Doolittle, R F
1999-03-09
The structure of fragment double-D from human fibrin has been solved in the presence and absence of the peptide ligands that simulate the two knobs exposed by the removal of fibrinopeptides A and B, respectively. All told, six crystal structures have been determined, three of which are reported here for the first time: namely, fragments D and double-D with the peptide GHRPam alone and double-D in the absence of any peptide ligand. Comparison of the structures has revealed a series of conformational changes that are brought about by the various knob-hole interactions. Of greatest interest is a moveable "flap" of two negatively charged amino acids (Glubeta397 and Aspbeta398) whose side chains are pinned back to the coiled coil with a calcium atom bridge until GHRPam occupies the beta-chain pocket. Additionally, in the absence of the peptide ligand GPRPam, GHRPam binds to the gamma-chain pocket, a new calcium-binding site being formed concomitantly.
Topological defects in electric double layers of ionic liquids at carbon interfaces
Black, Jennifer M.; Okatan, Mahmut Baris; Feng, Guang; ...
2015-06-07
The structure and properties of the electrical double layer in ionic liquids is of interest in a wide range of areas including energy storage, catalysis, lubrication, and many more. Theories describing the electrical double layer for ionic liquids have been proposed, however a full molecular level description of the double layer is lacking. To date, studies have been predominantly focused on ion distributions normal to the surface, however the 3D nature of the electrical double layer in ionic liquids requires a full picture of the double layer structure not only normal to the surface, but also in plane. Here wemore » utilize 3D force mapping to probe the in plane structure of an ionic liquid at a graphite interface and report the direct observation of the structure and properties of topological defects. The observation of ion layering at structural defects such as step-edges, reinforced by molecular dynamics simulations, defines the spatial resolution of the method. Observation of defects allows for the establishment of the universality of ionic liquid behavior vs. separation from the carbon surface and to map internal defect structure. In conclusion, these studies offer a universal pathway for probing the internal structure of topological defects in soft condensed matter on the nanometer level in three dimensions.« less
Structural, thermal, and morphological characteristics of cassava amylodextrins.
Costa, Mariana Souza; Volanti, Diogo Paschoalini; Grossmann, Maria Victória Eiras; Franco, Célia Maria Landi
2018-05-01
Amylodextrins from cassava starch were obtained by acid hydrolysis, and their structural, thermal and morphological characteristics were evaluated and compared to those from potato and corn amylodextrins. Cassava starch was the most susceptible to hydrolysis due to imperfections in its crystalline structure. The crystalline patterns of amylodextrins remained unchanged, and crystallinity and peak temperature increased with hydrolysis time, whereas thermal degradation temperature decreased, independent of treatment time and starch source. Cassava amylodextrins had similar structural and morphological characteristics to those from corn amylodextrins due to their A-type crystalline arrangements. A-amylodextrins were structurally and thermally more stable than potato amylodextrins (B-type). Starch nanocrystals (SNC) were observed by transmission electron microscopy from the third day of hydrolysis in cassava amylodextrins, whereas potato and corn amylodextrins displayed SNC only on the fifth day. A-SNC displayed platelet shapes, whereas B-SNC were rounded. The SNC shape was related to the packing form and geometry of unit cells of allomorphs A and B. Microstructures (agglomerated crystalline particles) and nanostructures (double helix organization) were observed for amylodextrins. Cassava starch was shown to be a promising material for SNC production, since it requires less hydrolysis time to obtaining more stable crystals. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Dissociative and double photoionization of CO from threshold to 90 A
NASA Technical Reports Server (NTRS)
Masuoka, T.; Samson, J. A. R.
1981-01-01
Partial cross sections for molecular photoionization (CO(+)), dissociative photoionization (C(+) and O(+)), and dissociative double photoionization (C(2+)) in CO have been measured from their thresholds to 90 A using techniques of mass spectrometry. The results are compared with data reported previously. Several peaks observed in the cross section curves for dissociated fragments are tentatively assigned by comparing with those in the photoelectron spectra reported for CO. It is concluded that the shoulder in the total absorption cross section curve between 400 and 90 A results solely from the dissociative ionization processes.
Design of a Double Anode Magnetron Injection Gun for Q-band Gyro-TWT Using Boundary Element Method
NASA Astrophysics Data System (ADS)
Li, Zhiliang; Feng, Jinjun; Liu, Bentian
2018-04-01
This paper presents a novel design code for double anode magnetron injection guns (MIGs) in gyro-devices based on boundary element method (BEM). The physical and mathematical models were constructed, and then the code using BEM for MIG's calculation was developed. Using the code, a double anode MIG for a Q-band gyrotron traveling-wave tube (gyro-TWT) amplifier operating in the circular TE01 mode at the fundamental cyclotron harmonic was designed. In order to verify the reliability of this code, velocity spread and guiding center radius of the MIG simulated by the BEM code were compared with these from the commonly used EGUN code, showing a reasonable agreement. Then, a Q-band gyro-TWT was fabricated and tested. The testing results show that the device has achieved an average power of 5kW and peak power ≥ 150 kW at a 3% duty cycle within bandwidth of 2 GHz, and maximum output peak power of 220 kW, with a corresponding saturated gain of 50.9 dB and efficiency of 39.8%. This paper demonstrates that the BEM code can be used as an effective approach for analysis of electron optics system in gyro-devices.
Ion heating and characteristics of ST plasma used by double-pulsing CHI on HIST
NASA Astrophysics Data System (ADS)
Hanao, Takafumi; Hirono, Hidetoshi; Hyobu, Takahiro; Ito, Kengo; Matsumoto, Keisuke; Nakayama, Takashi; Oki, Nobuharu; Kikuchi, Yusuke; Fukumoto, Naoyuki; Nagata, Masayoshi
2013-10-01
Multi-pulsing Coaxial Helicity Injection (M-CHI) is an efficient current drive and sustainment method used in spheromak and spherical torus (ST). We have observed plasma current/flux amplification by double pulsing CHI. Poloidal ion temperature measured by Ion Doppler Spectrometer (IDS) has a peak at plasma core region. In this region, radial electric field has a negative peak. At more inboard side that is called separatrix between closed flux region and inner open flux region, poloidal flow has a large shear and radial electric field changes the polarity. After the second CHI pulse, we observed sharp and rapid ion heating at plasma core region and separatrix. In this region, the poloidal ion temperature is selective heating because electron temperature is almost uniform. At this time, flow shear become larger and radial electric field is amplified at separatorix. These effects produce direct heating of ion through the viscous flow damping. Furthermore, we observed decrease of electron density at separatrix. Decreased density makes Hall dynamo electric field as two-fluid effect. When the ion temperature is increasing, dynamo electric field is observed at separatrix. It may have influence with the ion heating. We will discuss characteristic of double pulsing CHI driven ST plasmas and correlation of direct heating of ion with dynamo electric field and any other parameters.
NASA Astrophysics Data System (ADS)
Bekkouche, Toufik; Bouguezel, Saad
2018-03-01
We propose a real-to-real image encryption method. It is a double random amplitude encryption method based on the parametric discrete Fourier transform coupled with chaotic maps to perform the scrambling. The main idea behind this method is the introduction of a complex-to-real conversion by exploiting the inherent symmetry property of the transform in the case of real-valued sequences. This conversion allows the encrypted image to be real-valued instead of being a complex-valued image as in all existing double random phase encryption methods. The advantage is to store or transmit only one image instead of two images (real and imaginary parts). Computer simulation results and comparisons with the existing double random amplitude encryption methods are provided for peak signal-to-noise ratio, correlation coefficient, histogram analysis, and key sensitivity.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schimoia, Jaderson S.; Storchi-Bergmann, Thaisa; Grupe, Dirk
2015-02-10
Recent studies have suggested that the short-timescale (≲ 7 days) variability of the broad (∼10,000 km s{sup –1}) double-peaked Hα profile of the LINER nucleus of NGC 1097 could be driven by a variable X-ray emission from a central radiatively inefficient accretion flow. To test this scenario, we have monitored the NGC 1097 nucleus in X-ray and UV continuum with Swift and the Hα flux and profile in the optical spectrum using SOAR and Gemini-South from 2012 August to 2013 February. During the monitoring campaign, the Hα flux remained at a very low level—three times lower than the maximum flux observed in previousmore » campaigns and showing only limited (∼20%) variability. The X-ray variations were small, only ∼13% throughout the campaign, while the UV did not show significant variations. We concluded that the timescale of the Hα profile variation is close to the sampling interval of the optical observations, which results in only a marginal correlation between the X-ray and Hα fluxes. We have caught the active galaxy nucleus in NGC 1097 in a very low activity state, in which the ionizing source was very weak and capable of ionizing just the innermost part of the gas in the disk. Nonetheless, the data presented here still support the picture in which the gas that emits the broad double-peaked Balmer lines is illuminated/ionized by a source of high-energy photons which is located interior to the inner radius of the line-emitting part of the disk.« less
Ultra-large core birefringent Yb-doped tapered double clad fiber for high power amplifiers.
Fedotov, Andrey; Noronen, Teppo; Gumenyuk, Regina; Ustimchik, Vasiliy; Chamorovskii, Yuri; Golant, Konstantin; Odnoblyudov, Maxim; Rissanen, Joona; Niemi, Tapio; Filippov, Valery
2018-03-19
We present a birefringent Yb-doped tapered double-clad fiber with a record core diameter of 96 µm. An impressive gain of over 38 dB was demonstrated for linearly polarized CW and pulsed sources at a wavelength of 1040 nm. For the CW regime the output power was70 W. For a mode-locked fiber laser a pulse energy of 28 µJ with 292 kW peak power was reached at an average output power of 28 W for a 1 MHz repetition rate. The tapered double-clad fiber has a high value of polarization extinction ratio at 30 dB and is capable of delivering the linearly polarized diffraction-limited beam (M 2 = 1.09).
Stöggl, Thomas; Müller, Erich; Lindinger, Stefan
2008-09-01
The aims of the study were to: (1) adapt the "double-push" technique from inline skating to cross-country skiing; (2) compare this new skiing technique with the conventional skate skiing cross-country technique; and (3) test the hypothesis that the double-push technique improves skiing speed in a short sprint. 13 elite skiers performed maximum-speed sprints over 100 m using the double-push skate skiing technique and using the conventional "V2" skate skiing technique. Pole and plantar forces, knee angle, cycle characteristics, and electromyography of nine lower body muscles were analysed. We found that the double-push technique could be successfully transferred to cross-country skiing, and that this new technique is faster than the conventional skate skiing technique. The double-push technique was 2.9 +/- 2.2% faster (P < 0.001), which corresponds to a time advantage of 0.41 +/- 0.31 s over 100 m. The double-push technique had a longer cycle length and a lower cycle rate, and it was characterized by higher muscle activity, higher knee extension amplitudes and velocities, and higher peak foot forces, especially in the first phase of the push-off. Also, the foot was more loaded laterally in the double-push technique than in the conventional skate skiing technique.
Saseen, J J; Porter, J A; Barnette, D J; Bauman, J L; Zajac, E J; Carter, B L
1997-06-01
The pharmacokinetic actions, bioequivalence, and cardiovascular effects of two verapamil products were studied in a randomized, double-blind, crossover study in eight elderly hypertensive patients (median age, 69.5 years; range, 60-79 years) given brand-name or generic immediate-release verapamil in 120-mg twice-daily doses for 14 days. Blood pressures, heart rates, P-R intervals; and serum concentrations of R-/S-verapamil and norverapamil were measured multiple times in patients during the last day of each therapy. Median blood pressure decreased more with generic verapamil than with the brand-name drug, with the largest difference occurring at 0.5 hours (137/74 mmHg versus 144.5/80.5 mmHg; P = 0.05 and 0.091, respectively). Pharmacokinetic parameters were not different for the two products (P < 0.01). However, the generic product, compared with the brand-name drug, had mean area under the concentration-time curve (time 0 to 12 hours) ratios (90% CI) of 1.09 (0.78-1.52), 1.16 (0.87-1.55) and 1.11 (0.81-1.52) for R-, S-, and total verapamil. Seventy concentration peaks (31 with the brand-name drug, 39 with the generic drug) appeared between 8 and 24 hours. Median percentages of increase of these peaks, compared with those of previous concentrations, were 48.3% and 36.3% for brand-name and generic drugs, respectively. Fifty of the 70 peaks (71%) were associated with a stereospecific concentration peak of norverapamil and, temporally, with meals. Our findings suggest that whereas the two verapamil products may not be bioequivalent by Food and Drug Administration criteria, the observed differences in effects were not clinically significant in this elderly population. Multiple concentration peaks after absorption were observed in all patients with both verapamil products and were perhaps related to enterohepatic recirculation.
Neunhäuserer, Daniel; Steidle-Kloc, Eva; Weiss, Gertraud; Kaiser, Bernhard; Niederseer, David; Hartl, Sylvia; Tschentscher, Marcus; Egger, Andreas; Schönfelder, Martin; Lamprecht, Bernd; Studnicka, Michael; Niebauer, Josef
2016-11-01
Physical exercise training is an evidence-based treatment in chronic obstructive pulmonary disease, and patients' peak work rate is associated with reduced chronic obstructive pulmonary disease mortality. We assessed whether supplemental oxygen during exercise training in nonhypoxemic patients with chronic obstructive pulmonary disease might lead to superior training outcomes, including improved peak work rate. This was a randomized, double-blind, controlled, crossover trial. Twenty-nine patients with chronic obstructive pulmonary disease (aged 63.5 ± 5.9 years; forced expiratory volume in 1 second percent predicted, 46.4 ± 8.6) completed 2 consecutive 6-week periods of endurance and strength training with progressive intensity, which was performed 3 times per week with supplemental oxygen or compressed medical air (flow via nasal cannula: 10 L/min). Each session of electrocardiography-controlled interval cycling lasted 31 minutes and consisted of a warm-up, 7 cycles of 1-minute intervals at 70% to 80% of peak work rate alternating with 2 minutes of active recovery, and final cooldown. Thereafter, patients completed 8 strength-training exercises of 1 set each with 8 to 15 repetitions to failure. Change in peak work rate was the primary study end point. The increase in peak work rate was more than twice as high when patients exercised with supplemental oxygen compared with medical air (0.16 ± 0.02 W/kg vs 0.07 ± 0.02 W/kg; P < .001), which was consistent with all other secondary study end points related to exercise capacity. The impact of oxygen on peak work rate was 39.1% of the overall training effect, whereas it had no influence on strength gain (P > .1 for all exercises). We report that supplemental oxygen in nonhypoxemic chronic obstructive pulmonary disease doubled the effect of endurance training but had no effect on strength gain. Copyright © 2016 Elsevier Inc. All rights reserved.
Cuaron, John J.; Chang, Chang; Lovelock, Michael; Higginson, Daniel S.; Mah, Dennis; Cahlon, Oren; Powell, Simon
2016-01-01
Purpose To quantify the relative biological effectiveness (RBE) of the distal edge of the proton Bragg peak, using an in vitro assay of DNA double-strand breaks (DSBs). Methods and Materials U2OS cells were irradiated within the plateau of a spread-out Bragg peak and at each millimeter position along the distal edge using a custom slide holder, allowing for simultaneous measurement of physical dose. A reference radiation signal was generated using photons. The DNA DSBs at 3 hours (to assess for early damage) and at 24 hours (to assess for residual damage and repair) after irradiation were measured using the γH2AX assay and quantified via flow cytometry. Results were confirmed with clonogenic survival assays. A detailed map of the RBE as a function of depth along the Bragg peak was generated using γH2AX measurements as a biological endpoint. Results At 3 hours after irradiation, DNA DSBs were higher with protons at every point along the distal edge compared with samples irradiated with photons to similar doses. This effect was even more pronounced after 24 hours, indicating that the impact of DNA repair is less after proton irradiation relative to photons. The RBE demonstrated an exponential increase as a function of depth and was measured to be as high as 4.0 after 3 hours and as high as 6.0 after 24 hours. When the RBE-corrected dose was plotted as a function of depth, the peak effective dose was extended 2-3 mm beyond what would be expected with physical measurement. Conclusions We generated a highly comprehensive map of the RBE of the distal edge of the Bragg peak, using a direct assay of DNA DSBs in vitro. Our data show that the RBE of the distal edge increases with depth and is significantly higher than previously reported estimates. PMID:27084629
Cuaron, John J; Chang, Chang; Lovelock, Michael; Higginson, Daniel S; Mah, Dennis; Cahlon, Oren; Powell, Simon
2016-05-01
To quantify the relative biological effectiveness (RBE) of the distal edge of the proton Bragg peak, using an in vitro assay of DNA double-strand breaks (DSBs). U2OS cells were irradiated within the plateau of a spread-out Bragg peak and at each millimeter position along the distal edge using a custom slide holder, allowing for simultaneous measurement of physical dose. A reference radiation signal was generated using photons. The DNA DSBs at 3 hours (to assess for early damage) and at 24 hours (to assess for residual damage and repair) after irradiation were measured using the γH2AX assay and quantified via flow cytometry. Results were confirmed with clonogenic survival assays. A detailed map of the RBE as a function of depth along the Bragg peak was generated using γH2AX measurements as a biological endpoint. At 3 hours after irradiation, DNA DSBs were higher with protons at every point along the distal edge compared with samples irradiated with photons to similar doses. This effect was even more pronounced after 24 hours, indicating that the impact of DNA repair is less after proton irradiation relative to photons. The RBE demonstrated an exponential increase as a function of depth and was measured to be as high as 4.0 after 3 hours and as high as 6.0 after 24 hours. When the RBE-corrected dose was plotted as a function of depth, the peak effective dose was extended 2-3 mm beyond what would be expected with physical measurement. We generated a highly comprehensive map of the RBE of the distal edge of the Bragg peak, using a direct assay of DNA DSBs in vitro. Our data show that the RBE of the distal edge increases with depth and is significantly higher than previously reported estimates. Copyright © 2016 Elsevier Inc. All rights reserved.
Assessing the therapeutic effect of 625-nm light-emitting diodes
NASA Astrophysics Data System (ADS)
Mao, Zongzhen; Xu, Guodong; Yang, Yi
2014-09-01
To evaluate the effects of red Light-Emitting Diodes on elbow extensor and flexor strength and the recovery of exercise induced fatigue, the torque values from the isokinetic dynamometer as well as biochemistry parameters were used as outcome measures. A randomized double-blind placebo-controlled crossover trial was performed with twenty male young tennis athletes. Active LED therapy (LEDT, with wavelength 625nm, 10 minutes total irradiation time, irradiated area amount to 30cm2, and 900J of total energy irradiated) or an identical placebo was delivered under double-blinded conditions to the left elbow just before exercise. The isokinetic muscle strength was measured immediately after irradiation. The blood lactate levels were sampled pre-exercise and post-exercise. The peak torque values of elbow extensor strength were significantly different between two groups. As in elbow flexor strength, the difference of peak torque was not significant. The blood lactate concentration of LEDT group post-exercise was significantly lower than those of placebo group. The results indicate that 625nm LED therapy is effective in preventing muscle fatigue as it can significantly reduce peak torque value of elbow extensors and blood lactate concentration. It has no effect on the strength of left elbow flexor or backhand performance in tennis.
Matrix decompositions of two-dimensional nuclear magnetic resonance spectra.
Havel, T F; Najfeld, I; Yang, J X
1994-08-16
Two-dimensional NMR spectra are rectangular arrays of real numbers, which are commonly regarded as digitized images to be analyzed visually. If one treats them instead as mathematical matrices, linear algebra techniques can also be used to extract valuable information from them. This matrix approach is greatly facilitated by means of a physically significant decomposition of these spectra into a product of matrices--namely, S = PAPT. Here, P denotes a matrix whose columns contain the digitized contours of each individual peak or multiple in the one-dimensional spectrum, PT is its transpose, and A is an interaction matrix specific to the experiment in question. The practical applications of this decomposition are considered in detail for two important types of two-dimensional NMR spectra, double quantum-filtered correlated spectroscopy and nuclear Overhauser effect spectroscopy, both in the weak-coupling approximation. The elements of A are the signed intensities of the cross-peaks in a double quantum-filtered correlated spectrum, or the integrated cross-peak intensities in the case of a nuclear Overhauser effect spectrum. This decomposition not only permits these spectra to be efficiently simulated but also permits the corresponding inverse problems to be given an elegant mathematical formulation to which standard numerical methods are applicable. Finally, the extension of this decomposition to the case of strong coupling is given.
Matrix decompositions of two-dimensional nuclear magnetic resonance spectra.
Havel, T F; Najfeld, I; Yang, J X
1994-01-01
Two-dimensional NMR spectra are rectangular arrays of real numbers, which are commonly regarded as digitized images to be analyzed visually. If one treats them instead as mathematical matrices, linear algebra techniques can also be used to extract valuable information from them. This matrix approach is greatly facilitated by means of a physically significant decomposition of these spectra into a product of matrices--namely, S = PAPT. Here, P denotes a matrix whose columns contain the digitized contours of each individual peak or multiple in the one-dimensional spectrum, PT is its transpose, and A is an interaction matrix specific to the experiment in question. The practical applications of this decomposition are considered in detail for two important types of two-dimensional NMR spectra, double quantum-filtered correlated spectroscopy and nuclear Overhauser effect spectroscopy, both in the weak-coupling approximation. The elements of A are the signed intensities of the cross-peaks in a double quantum-filtered correlated spectrum, or the integrated cross-peak intensities in the case of a nuclear Overhauser effect spectrum. This decomposition not only permits these spectra to be efficiently simulated but also permits the corresponding inverse problems to be given an elegant mathematical formulation to which standard numerical methods are applicable. Finally, the extension of this decomposition to the case of strong coupling is given. PMID:8058742
Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G
2017-07-19
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.
Balseiro, C A; Usaj, G; Sánchez, M J
2010-10-27
We study non-equilibrium electron transport through a quantum impurity coupled to metallic leads using the equation of motion technique at finite temperature T. Assuming that the interactions are taking place solely in the impurity and focusing on the infinite Hubbard limit, we compute the out of equilibrium density of states and the differential conductance G(2)(T, V) in order to test several scaling laws. We find that G(2)(T, V)/G(2)(T, 0) is a universal function of both eV/T(K) and T/T(K), T(K) being the Kondo temperature. The effect of an in-plane magnetic field on the splitting of the zero bias anomaly in the differential conductance is also analyzed. For a Zeeman splitting Δ, the computed differential conductance peak splitting depends only on Δ/T(K), and for large fields approaches the value of 2Δ. Besides studying the traditional two leads setup, we also consider other configurations that mimic recent experiments, namely, an impurity embedded in a mesoscopic wire and the presence of a third weakly coupled lead. In these cases, a double peak structure of the Kondo resonance is clearly obtained in the differential conductance while the amplitude of the highest peak is shown to decrease as ln(eV/T(K)). Several features of these results are in qualitative agreement with recent experimental observations reported on quantum dots.
Pinjari, Rahul V; Delcey, Mickaël G; Guo, Meiyuan; Odelius, Michael; Lundberg, Marcus
2016-02-15
The restricted active-space (RAS) approach can accurately simulate metal L-edge X-ray absorption spectra of first-row transition metal complexes without the use of any fitting parameters. These characteristics provide a unique capability to identify unknown chemical species and to analyze their electronic structure. To find the best balance between cost and accuracy, the sensitivity of the simulated spectra with respect to the method variables has been tested for two models, [FeCl6 ](3-) and [Fe(CN)6 ](3-) . For these systems, the reference calculations give deviations, when compared with experiment, of ≤1 eV in peak positions, ≤30% for the relative intensity of major peaks, and ≤50% for minor peaks. When compared with these deviations, the simulated spectra are sensitive to the number of final states, the inclusion of dynamical correlation, and the ionization potential electron affinity shift, in addition to the selection of the active space. The spectra are less sensitive to the quality of the basis set and even a double-ζ basis gives reasonable results. The inclusion of dynamical correlation through second-order perturbation theory can be done efficiently using the state-specific formalism without correlating the core orbitals. Although these observations are not directly transferable to other systems, they can, together with a cost analysis, aid in the design of RAS models and help to extend the use of this powerful approach to a wider range of transition metal systems. © 2015 Wiley Periodicals, Inc.
The QBito CubeSat: Applications in Space Engineering Education at Technical University of Madrid
NASA Astrophysics Data System (ADS)
Fernandez Fraile, Jose Javier; Laverón-Simavilla, Ana; Calvo, Daniel; Moreno Benavides, Efren
The QBito CubeSat is one of the 50 CubeSats that is being developed for the QB50 project. The project is funded by the 7 (th) Frame Program to launch 50 CubeSats in a ‘string-of-pearls’ configuration for multi-point, in-situ measurements in the lower thermosphere and re-entry research. The 50 CubeSats, developed by an international network of universities and research institutions, will comprise 40 double CubeSats with atmospheric sensors and 10 double or triple CubeSats for science and technology demonstration. It will be the first large-scale CubeSat constellation in orbit; a concept that has been under discussion for several years but not implemented up to now. This project has a high educational interest for universities; beyond the scientific and technological results, being part of an international group of over 90 universities all over the world working and sharing knowledge to achieve a successful mission represents an exciting opportunity. The QBito project main educational motivation is to educate students in space technologies and in space systems engineering. The Universidad Politécnica de Madrid (UPM) is designing, developing, building and testing one of the double CubeSats carrying as payload a kit of atmospheric sensors from the consortium, and other payloads developed by the team such as an IR non-refrigerated sensor, a Phase Change Material (PCM) for thermal control applications, a Fuzzy Logic Attitude Control System and other technological developments such as an optimized antenna deployment mechanism, a lightweight multi-mission configurable structure, and an efficient Electric Power System (EPS) with a Maximum Peak Power Tracker (MPPT). This project has been integrated in the training of the Aerospatiale Engineering, Master and PhD degree students by involving them in the complete engineering process, from its conceptual design to the post-flight conclusions. Three subsystems have been selected for being developed from the conceptual design stage to the flight device: structure, electrical power system and antenna deployment mechanism. In this work, the main characteristics adopted for structure are presented. The project has already provided very interesting lessons to all the people involved, not only students.
Q-switched slab RF discharge CO laser
NASA Astrophysics Data System (ADS)
Ionin, A. A.; Kochetkov, Yu V.; Kozlov, A. Yu; Mokrousova, D. V.; Seleznev, L. V.; Sinitsyn, D. V.; Sunchugasheva, E. S.; Zemtsov, D. S.
2017-05-01
A compact repetitively pulsed cryogenically cooled slab RF discharge CO laser with double path V-type laser resonator equipped with external Q-switching system based on rotating mirror was developed and studied. The laser produced mid-IR (λ ~ 5-7 µm) radiation pulses of ~1 ÷ 2 µs duration (FWHM), peak power up to ~3 kW, and pulse repetition rate up to 130 Hz. Averaged output laser power reached 0.5 W, the laser spectrum consisted of ~80 laser lines with individual peak power up to 80 W.
Effect of Photogenerated Carriers on Ferroelectric Polarization Reversal
NASA Astrophysics Data System (ADS)
Weis, Martin; Li, Jun; Taguchi, Dai; Manaka, Takaaki; Iwamoto, Mitsumasa
2011-12-01
Three non-symmetric switching peaks were observed in current-voltage (J-V) characteristic of the pentacene/poly(vinylidene fluoride-trifluoroethylene) double-layer device. However, upon illumination only two symmetric switching peaks appeared during the same J-V measurement. The similar difference between dark and illumination were also obtained in capacitance-voltage characteristics. These results showed the strong influence of internal fields by photogenerated carriers, which modifies the polarization reversal process of ferroelectric layer. The gradual shift of the polarization reversal with increase of illumination intensity is assigned to the space-charge field of trapped electrons.
NASA Astrophysics Data System (ADS)
Yang, Xiao-tao; Zhang, Peng; Xie, Wen-qiang; Li, Lin-jun
2018-01-01
A double Q-switch (DQS) Ho:Sc2SiO5 laser modulated by a acousto-optic modulators (AOM) combined with a Cr2+:ZnSe saturable absorber (SA) was reported for the first time. The actively Q-switch (AQS) and passively Q-switch (PQS) were also studied. For the DQS mode, a maximum average output power of 2.49 W under the incident pump power of 12.5 W was obtained, corresponding to a slope efficiency of 24%. The characteristics of the DQS Ho:SSO laser versus different repetition frequencies (RF) of the AOM were researched. The maximum single-pulse energy of the DQS Ho:SSO laser was calculated to 1.98 mJ. The maximum peak power of the DQS Ho:SSO laser was 49.5 kW. The output beam quality factor M2 of DQS Ho:SSO laser was measured to be 1.15 with the highest peak power by knife-edge method at different positions.
An Improved Algorithm to Generate a Wi-Fi Fingerprint Database for Indoor Positioning
Chen, Lina; Li, Binghao; Zhao, Kai; Rizos, Chris; Zheng, Zhengqi
2013-01-01
The major problem of Wi-Fi fingerprint-based positioning technology is the signal strength fingerprint database creation and maintenance. The significant temporal variation of received signal strength (RSS) is the main factor responsible for the positioning error. A probabilistic approach can be used, but the RSS distribution is required. The Gaussian distribution or an empirically-derived distribution (histogram) is typically used. However, these distributions are either not always correct or require a large amount of data for each reference point. Double peaks of the RSS distribution have been observed in experiments at some reference points. In this paper a new algorithm based on an improved double-peak Gaussian distribution is proposed. Kurtosis testing is used to decide if this new distribution, or the normal Gaussian distribution, should be applied. Test results show that the proposed algorithm can significantly improve the positioning accuracy, as well as reduce the workload of the off-line data training phase. PMID:23966197
Choi, Soo Jin; Yoh, Jack J
2011-08-01
A short laser pulse is irradiated on a sample to create a highly energetic plasma that emits light of a specific peak wavelength according to the material. By identifying different peaks for the analyzed samples, their chemical composition can be rapidly determined. The characteristics of the laser-induced breakdown spectroscopy (LIBS) plasma are strongly dependent on the ambient conditions. Research aimed at enhancing LIBS intensity is of great benefit in advancing LIBS for the exploration of harsh environments. By using double-pulse LIBS, the signal intensity of Al and Ca lines was enhanced by five times compared to the single-pulse signal. Also, the angles of the target and detector are adjusted to simulate samples of arbitrary shape. We verified that there exists an optimal angle at which specific elements of a test sample may be detected with stronger signal intensity. We provide several optimum configurations for the LIBS system for maximizing the signal intensity for the analysis of a nonstandard aluminum sample.
An improved algorithm to generate a Wi-Fi fingerprint database for indoor positioning.
Chen, Lina; Li, Binghao; Zhao, Kai; Rizos, Chris; Zheng, Zhengqi
2013-08-21
The major problem of Wi-Fi fingerprint-based positioning technology is the signal strength fingerprint database creation and maintenance. The significant temporal variation of received signal strength (RSS) is the main factor responsible for the positioning error. A probabilistic approach can be used, but the RSS distribution is required. The Gaussian distribution or an empirically-derived distribution (histogram) is typically used. However, these distributions are either not always correct or require a large amount of data for each reference point. Double peaks of the RSS distribution have been observed in experiments at some reference points. In this paper a new algorithm based on an improved double-peak Gaussian distribution is proposed. Kurtosis testing is used to decide if this new distribution, or the normal Gaussian distribution, should be applied. Test results show that the proposed algorithm can significantly improve the positioning accuracy, as well as reduce the workload of the off-line data training phase.
Di Stanislao, C; Di Berardino, L; Bianchi, I; Bologna, G
1997-02-01
Control of seasonal symptoms by means of a preventive and easy to use (only one intradermal injection eight weeks before the pollen peak) immunotherapy, is recommended nowadays. We verified the clinical efficacy of E.P.D. (Enzyme Potentiated Desensibilization) in a double-blind, placebo-controlled study. This particular immunotherapy consists of an intradermal injection mix, made up of allergenic extracts at extremely low doses and an enzyme called beta-glucuronidase. The vaccine is administered once a year, eight weeks before pollen peaks. We studied a group of 40 patients allergic to grass pollen. The results, analysed statistically on the basis of a symptoms score, showed good clinical efficacy and a significant reduction of drug consumption during the high pollen period. Due to the clinical effectiveness, easy administration (only on injection) and excellent tolerance of the immunotherapy, E.P.D. is particularly suited for the prevention of seasonal symptoms in patients allergic to grass pollen.
Diedrichs, Danilo R; Isihara, Paul A; Buursma, Doeke D
2014-02-01
Using a basic, two transmission level seasonal SIR model, we introduce mathematical evidence for the schedule effect which asserts that major recurring peak infections can be significantly reduced by modification of the traditional school calendar. The schedule effect is observed first in simulated time histories of the infectious population. Schedules with higher average transmission rate may exhibit reduced peak infections. Splitting vacations changes the period of the oscillating transmission function and can confine limit cycles in the proportion susceptible/proportion infected phase plane. Numerical analysis of the phase plane shows the relationship between the transmission period and the maximum recurring infection peaks and period of the response. For certain transmission periods, this response may exhibit period-doubling and chaos, leading to increased peaks. Non-monotonic infectious response is also observed in conjunction with changing birth rate. We discuss how to take these effects into consideration to design an optimum school schedule with particular reference to a hypothetical developing world context. Copyright © 2013 Elsevier Inc. All rights reserved.
Iron K Features in the Quasar E 1821+643: Evidence for Gravitationally Redshifted Absorption?
NASA Technical Reports Server (NTRS)
Yaqoob, Tahir; Serlemitsos, Peter
2005-01-01
We report a Chandra high-energy grating detection of a narrow, redshifted absorption line superimposed on the red wing of a broad Fe K line in the z = 0.297 quasar E 1821+643. The absorption line is detected at a confidence level, estimated by two different methods, in the range approx. 2 - 3 sigma. Although the detection significance is not high enough to exclude a non-astrophysical origin, accounting for the absorption feature when modeling the X-ray spectrum implies that the Fe-K emission line is broad, and consistent with an origin in a relativistic accretion disk. Ignoring the apparent absorption feature leads to the conclusion that the Fe-K emission line is narrower, and also affects the inferred peak energy of the line (and hence the inferred ionization state of Fe). If the absorption line (at approx. 6.2 keV in the quasar frame) is real, we argue that it could be due to gravitationally redshifted Fe XXV or Fe XXVI resonance absorption within approx. 10 - 20 gravitational radii of the putative central black hole. The absorption line is not detected in earlier ASCA and Chandra low-energy grating observations, but the absorption line is not unequivocally ruled out by these data. The Chandra high-energy grating Fe-K emission line is consistent with an origin predominantly in Fe I-XVII or so. In an ASCA observation eight years earlier, the Fe-K line peaked at approx. 6.6 keV, closer to the energies of He-like Fe triplet lines. Further, in a Chandra low-energy grating observation the Fe-K line profile was double-peaked, one peak corresponding to Fe I-XVII or so, the other peak to Fe XXVI Ly alpha. Such a wide range in ionization state of Fe is not ruled out by the HEG and ASCA data either, and is suggestive of a complex structure for the line-emitter.
2D Raman band splitting in graphene: Charge screening and lifting of the K-point Kohn anomaly.
Wang, Xuanye; Christopher, Jason W; Swan, Anna K
2017-10-19
Pristine graphene encapsulated in hexagonal boron nitride has transport properties rivalling suspended graphene, while being protected from contamination and mechanical damage. For high quality devices, it is important to avoid and monitor accidental doping and charge fluctuations. The 2D Raman double peak in intrinsic graphene can be used to optically determine charge density, with decreasing peak split corresponding to increasing charge density. We find strong correlations between the 2D 1 and 2D 2 split vs 2D line widths, intensities, and peak positions. Charge density fluctuations can be measured with orders of magnitude higher precision than previously accomplished using the G-band shift with charge. The two 2D intrinsic peaks can be associated with the "inner" and "outer" Raman scattering processes, with the counterintuitive assignment of the phonon closer to the K point in the KM direction (outer process) as the higher energy peak. Even low charge screening lifts the phonon Kohn anomaly near the K point for graphene encapsulated in hBN, and shifts the dominant intensity from the lower to the higher energy peak.
Kuwahara-Otani, Sachi; Maeda, Seishi; Tanaka, Koichi; Hayakawa, Tetsu; Seki, Makoto
2013-01-01
We investigated the effects of lipopolysaccharide (LPS)-induced endotoxemia on the expression of aquaporin-4 (AQP4) in the rat anterior pituitary gland, using the real-time polymerase chain reaction and immunohistochemistry. After intraperitoneal injection of LPS, the level of AQP4 mRNA doubled at 2, 4 and 8 hr. Immunohistochemical analysis showed an increase with time in AQP4 immunostaining in folliculo-stellate cells following LPS injection; the intensity of immunoreactivity peaked at 8 hr. At the same time, some cyst-like structures, formed by AQP4-positive cells, were observed. These findings indicate that LPS induces the expression of AQP4 in the anterior pituitary gland. The present results should provide an important key to elucidate the pathogenesis of the anterior pituitary gland during endotoxemia.
Diurnal variation of tropospheric relative humidity in tropical regions
NASA Astrophysics Data System (ADS)
Moradi, Isaac; Arkin, Philip; Ferraro, Ralph; Eriksson, Patrick; Fetzer, Eric
2016-06-01
Despite the importance of water vapor especially in the tropical region, the diurnal variations of water vapor have not been completely investigated in the past due to the lack of adequate observations. Measurements from Sondeur Atmosphérique du Profil d'Humidité Intertropicale par Radiométrie (SAPHIR) onboard the low inclination Megha-Tropiques satellite with frequent daily revisits provide a valuable dataset for investigating the diurnal and spatial variation of tropospheric relative humidity in the tropical region. In this study, we first transformed SAPHIR observations into layer-averaged relative humidity, then partitioned the data based on local observation time into 24 bins with a grid resolution of one degree. Afterwards, we fitted Fourier series to the binned data. Finally, the mean, amplitude, and diurnal peak time of relative humidity in tropical regions were calculated for each grid point using either the measurements or Fourier series. The results were separately investigated for different SAPHIR channels as well as for relative humidity with respect to both liquid and ice phases. The results showed that the wet and dry regions are, respectively, associated with convective and subsidence regions which is consistent with the previous studies. The mean tropospheric humidity values reported in this study are generally 10 to 15 % higher than those reported using infrared observations which is because of strict cloud screening for infrared measurements. The results showed a large inhomogeneity in diurnal variation of tropospheric relative humidity in tropical region. The diurnal amplitude was larger over land than over ocean and the oceanic amplitude was larger over convective regions than over subsidence regions. The results showed that the diurnal amplitude is less than 10 % in middle and upper troposphere, but it is up to 30 % in lower troposphere over land. Although the peak of RH generally occurs over night or in early morning, there are several regions where the diurnal peak occurs at other times of the day. The early morning peak time is because of a peak in convective activities in early morning. Additionally, a double peak was observed in tropospheric humidity over some regions which is consistent with double peak in precipitation.
NASA Astrophysics Data System (ADS)
Li, Songhai; Wang, Kexiong; Wang, Ding; Akamatsu, Tomonari
2005-12-01
The signals of dolphins and porpoises often exhibit a multi-pulse structure. Here, echolocation signal recordings were made from four geometrically distinct positions of seven Yangtze finless porpoises temporarily housed in a relatively small, enclosed area. Some clicks demonstrated double-pulse, and others multi-pulse, structure. The interpulse intervals between the first and second pulse of the double- and multi-pulse clicks were significantly different among data from the four different positions (p<0.01, one-way ANOVA). These results indicate that the interpulse interval and structure of the double- and multi-pulse echolocation signals depend on the hydrophone geometry of the animal, and that the double- and multi-pulse structure of echolocation signals in Yangtze finless porpoise is not caused by the phonating porpoise itself, but by the multipath propagation of the signal. Time delays in the 180° phase-shifted surface reflection pulse and the nonphase-shifted bottom reflection pulse of the multi-pulse structures, relative to the direct signal, can be used to calculate the distance to a phonating animal.
Effects of historical land-cover changes on flooding and sedimentation, North Fish Creek, Wisconsin
Fitzpatrick, Faith A.; Knox, James C.; Whitman, Heather E.
1999-01-01
Results from hydrologic and sediment-transport modeling indicate that modern flood peaks and sediment loads in North Fish Creek may be double that expected under pre-settlement forest cover. During maximum agricultural activity in the mid-1920's to mid-1930's, flood peaks probably were about 3 times larger and sediment loads were about 5 times larger than expected under pre-settlement forest cover. These results indicate that future changes from pasture or cropland to forest will help reduce flood peaks, thereby reducing erosion and sedimentation. The addition of detention basins (to decrease flood peaks) on tributaries to North Fish Creek, or bank and instream restoration (to decrease erosion) in the upper main stem, also may help reduce the contribution of sediment from the upper main stem to the transitional section and lower main stem of the creek.
Seasonal variation of seismic ambient noise level at King Sejong Station, Antarctica
NASA Astrophysics Data System (ADS)
Lee, W.; Sheen, D.; Seo, K.; Yun, S.
2009-12-01
The generation of the secondary- or double-frequency (DF) microseisms with dominant frequencies between 0.1 and 0.5 Hz has been explained by nonlinear second-order pressure perturbations on the ocean bottom due to the interference of two ocean waves of equal wavelengths traveling in opposite directions. Korea Polar Research Institute (KOPRI) has been operating a broadband seismic station (KSJ1) at King George Island (KGI), Antarctica, since 2001. Examining the ambient seismic noise level for the period from 2006 to 2008 at KSJ1, we found a significant seasonal variation in the frequency range 0.1-0.5 Hz. Correlation of the DF peaks with significant ocean wave height and peak wave period models indicates that the oceanic infragravity waves in the Drake Passage is a possible source to excite the DF microseisms at KGI. Location of King Sejong Station, Antarctica Seasonal variations of DF peak, significant wave height, and peak wave period
Bittencourt, P R; Wade, P; Smith, A T; Richens, A
1981-01-01
1 Six healthy male volunteers received single oral doses of 10 mg diazepam, 20 mg temazepam, 15 mg flurazepam, 5 mg nitrazepam, 10 mg desmethyl-diazepam and placebo in a double-blind randomized fashion. 2 Peak velocity of saccadic eye movements, serum benzodiazepine concentration, and subjective ratings of wakefulness and co-ordination were measured at intervals up to 12 h after drug administration. 3 All active treatments produced a statistically significant decrease in peak saccadic velocity. The effect of temazepam and diazepam was generally more pronounced than that of flurazepam, nitrazepam and desmethyl-diazepam. 4 There were log-linear correlations between peak saccadic velocity and serum benzodiazepine concentration after ingestion of temazepam, diazepam and nitrazepam. 5 These results demonstrate a clear relationship between serum benzodiazepine concentration and its effect on a convenient measure of brainstem reticular formation function. PMID:6794587
The Kinematics of Multiple-peaked Lyα Emission in Star-forming Galaxies at z ~ 2-3
NASA Astrophysics Data System (ADS)
Kulas, Kristin R.; Shapley, Alice E.; Kollmeier, Juna A.; Zheng, Zheng; Steidel, Charles C.; Hainline, Kevin N.
2012-01-01
We present new results on the Lyα emission-line kinematics of 18 z ~ 2-3 star-forming galaxies with multiple-peaked Lyα profiles. With our large spectroscopic database of UV-selected star-forming galaxies at these redshifts, we have determined that ~30% of such objects with detectable Lyα emission display multiple-peaked emission profiles. These profiles provide additional constraints on the escape of Lyα photons due to the rich velocity structure in the emergent line. Despite recent advances in modeling the escape of Lyα from star-forming galaxies at high redshifts, comparisons between models and data are often missing crucial observational information. Using Keck II NIRSPEC spectra of Hα (z ~ 2) and [O III]λ5007 (z ~ 3), we have measured accurate systemic redshifts, rest-frame optical nebular velocity dispersions, and emission-line fluxes for the objects in the sample. In addition, rest-frame UV luminosities and colors provide estimates of star formation rates and the degree of dust extinction. In concert with the profile sub-structure, these measurements provide critical constraints on the geometry and kinematics of interstellar gas in high-redshift galaxies. Accurate systemic redshifts allow us to translate the multiple-peaked Lyα profiles into velocity space, revealing that the majority (11/18) display double-peaked emission straddling the velocity-field zero point with stronger red-side emission. Interstellar absorption-line kinematics suggest the presence of large-scale outflows for the majority of objects in our sample, with an average measured interstellar absorption velocity offset of langΔv absrang = -230 km s-1. A comparison of the interstellar absorption kinematics for objects with multiple- and single-peaked Lyα profiles indicate that the multiple-peaked objects are characterized by significantly narrower absorption line widths. We compare our data with the predictions of simple models for outflowing and infalling gas distributions around high-redshift galaxies. While popular "shell" models provide a qualitative match with many of the observations of Lyα emission, we find that in detail there are important discrepancies between the models and data, as well as problems with applying the framework of an expanding thin shell of gas to explain high-redshift galaxy spectra. Our data highlight these inconsistencies, as well as illuminating critical elements for success in future models of outflow and infall in high-redshift galaxies. Based, in part, on data obtained at the W. M. Keck Observatory, which is operated as a scientific partnership among the California Institute of Technology, the University of California, and NASA, and was made possible by the generous financial support of the W. M. Keck Foundation.
Action detection by double hierarchical multi-structure space-time statistical matching model
NASA Astrophysics Data System (ADS)
Han, Jing; Zhu, Junwei; Cui, Yiyin; Bai, Lianfa; Yue, Jiang
2018-03-01
Aimed at the complex information in videos and low detection efficiency, an actions detection model based on neighboring Gaussian structure and 3D LARK features is put forward. We exploit a double hierarchical multi-structure space-time statistical matching model (DMSM) in temporal action localization. First, a neighboring Gaussian structure is presented to describe the multi-scale structural relationship. Then, a space-time statistical matching method is proposed to achieve two similarity matrices on both large and small scales, which combines double hierarchical structural constraints in model by both the neighboring Gaussian structure and the 3D LARK local structure. Finally, the double hierarchical similarity is fused and analyzed to detect actions. Besides, the multi-scale composite template extends the model application into multi-view. Experimental results of DMSM on the complex visual tracker benchmark data sets and THUMOS 2014 data sets show the promising performance. Compared with other state-of-the-art algorithm, DMSM achieves superior performances.
Action detection by double hierarchical multi-structure space–time statistical matching model
NASA Astrophysics Data System (ADS)
Han, Jing; Zhu, Junwei; Cui, Yiyin; Bai, Lianfa; Yue, Jiang
2018-06-01
Aimed at the complex information in videos and low detection efficiency, an actions detection model based on neighboring Gaussian structure and 3D LARK features is put forward. We exploit a double hierarchical multi-structure space-time statistical matching model (DMSM) in temporal action localization. First, a neighboring Gaussian structure is presented to describe the multi-scale structural relationship. Then, a space-time statistical matching method is proposed to achieve two similarity matrices on both large and small scales, which combines double hierarchical structural constraints in model by both the neighboring Gaussian structure and the 3D LARK local structure. Finally, the double hierarchical similarity is fused and analyzed to detect actions. Besides, the multi-scale composite template extends the model application into multi-view. Experimental results of DMSM on the complex visual tracker benchmark data sets and THUMOS 2014 data sets show the promising performance. Compared with other state-of-the-art algorithm, DMSM achieves superior performances.
Self-assembly of a double-helical complex of sodium.
Bell, T W; Jousselin, H
1994-02-03
Spontaneous self-organization of helical and multiple-helical molecular structures occurs on several levels in living organisms. Key examples are alpha-helical polypeptides, double-helical nucleic acids and helical protein structures, including F-actin, microtubules and the protein sheath of the tobacco mosaic virus. Although the self-assembly of double-helical transition-metal complexes bears some resemblance to the molecular organization of double-stranded DNA, selection between monohelical, double-helical and triple-helical structures is determined largely by the size and geometrical preference of the tightly bound metal. Here we present an example of double-helical assembly induced by the weaker and non-directional interactions of an alkali-metal ion with an organic ligand that is pre-organized into a coil. We have characterized the resulting complex by two-dimensional NMR and fast-atom-bombardment mass spectrometry. These results provide a step toward the creation of molecular tubes or ion channels consisting of intertwined coils.
Plasma l-citrulline concentrations in l-arginine-supplemented healthy dogs.
Flynn, K M; Kellihan, H B; Trepanier, L A
2017-08-01
To determine whether oral l-arginine increases plasma [l-citrulline] in dogs. Eleven healthy staff-owned dogs were used in this study. Dogs (n = 3) were given l-arginine (50mg/kg PO q8h) for 7 days, and plasma [l-arginine] and [l-citrulline] were analyzed by high performance liquid chromatography at baseline (BL), steady state trough, and 0.5, 1, 1.5, 2, 4, 6, and 8 h after final dosing on day 7. Eleven dogs were then treated with 100mg/kg l-arginine PO q8h for 7 days, and [l-arginine] and [l-citrulline] were measured at BL, steady state trough, and at peak 4 hrs after dosing (T4 hrs). - Plasma [l-arginine] and [l-citrulline] peaked at T4 hrs on the 50mg/kg dosage. Target outcome, modeled after human study results, of a doubling of [l-arginine] and a 25-30% increase in [l-citrulline] from BL were not reached. After the 100mg/kg dosage, plasma [l-arginine] increased from a BL median of 160.1 μM (range, 100.2-231.4 μM) to a peak of 417.4 μM (206.5-807.3 μM) at T4 hrs, and plasma [l-citrulline] increased from a BL median of 87.8 μM (59.1-117.1 μM) to peak of 102.2 μM (47.4-192.6 μM) at T4 hrs. Ten of eleven dogs showed a doubling of plasma [l-arginine] and 4/11 dogs achieved 25-30% or greater increases in plasma [l-citrulline]. No adverse effects on heart rate or blood pressure were noted. - Oral l-arginine dosage of 100mg/kg q8h doubles plasma [l-arginine] in healthy dogs, but conversion to l-citrulline is quite variable. Further evaluation of this dosage regimen in dogs with pulmonary hypertension is warranted. Copyright © 2017 Elsevier B.V. All rights reserved.
Broadband Spectral Modeling of the Extreme Gigahertz-peaked Spectrum Radio Source PKS B0008-421
NASA Astrophysics Data System (ADS)
Callingham, J. R.; Gaensler, B. M.; Ekers, R. D.; Tingay, S. J.; Wayth, R. B.; Morgan, J.; Bernardi, G.; Bell, M. E.; Bhat, R.; Bowman, J. D.; Briggs, F.; Cappallo, R. J.; Deshpande, A. A.; Ewall-Wice, A.; Feng, L.; Greenhill, L. J.; Hazelton, B. J.; Hindson, L.; Hurley-Walker, N.; Jacobs, D. C.; Johnston-Hollitt, M.; Kaplan, D. L.; Kudrayvtseva, N.; Lenc, E.; Lonsdale, C. J.; McKinley, B.; McWhirter, S. R.; Mitchell, D. A.; Morales, M. F.; Morgan, E.; Oberoi, D.; Offringa, A. R.; Ord, S. M.; Pindor, B.; Prabu, T.; Procopio, P.; Riding, J.; Srivani, K. S.; Subrahmanyan, R.; Udaya Shankar, N.; Webster, R. L.; Williams, A.; Williams, C. L.
2015-08-01
We present broadband observations and spectral modeling of PKS B0008-421 and identify it as an extreme gigahertz-peaked spectrum (GPS) source. PKS B0008-421 is characterized by the steepest known spectral slope below the turnover, close to the theoretical limit of synchrotron self-absorption, and the smallest known spectral width of any GPS source. Spectral coverage of the source spans from 0.118 to 22 GHz, which includes data from the Murchison Widefield Array and the wide bandpass receivers on the Australia Telescope Compact Array. We have implemented a Bayesian inference model fitting routine to fit the data with internal free-free absorption (FFA), single- and double-component FFA in an external homogeneous medium, FFA in an external inhomogeneous medium, or single- and double-component synchrotron self-absorption models, all with and without a high-frequency exponential break. We find that without the inclusion of a high-frequency break these models cannot accurately fit the data, with significant deviations above and below the peak in the radio spectrum. The addition of a high-frequency break provides acceptable spectral fits for the inhomogeneous FFA and double-component synchrotron self-absorption models, with the inhomogeneous FFA model statistically favored. The requirement of a high-frequency spectral break implies that the source has ceased injecting fresh particles. Additional support for the inhomogeneous FFA model as being responsible for the turnover in the spectrum is given by the consistency between the physical parameters derived from the model fit and the implications of the exponential spectral break, such as the necessity of the source being surrounded by a dense ambient medium to maintain the peak frequency near the gigahertz region. This implies that PKS B0008-421 should display an internal H i column density greater than 1020 cm-2. The discovery of PKS B0008-421 suggests that the next generation of low radio frequency surveys could reveal a large population of GPS sources that have ceased activity, and that a portion of the ultra-steep-spectrum source population could be composed of these GPS sources in a relic phase.
Comparison of completely knotless and hybrid double-row fixation systems: a biomechanical study.
Chu, Thomas; McDonald, Erik; Tufaga, Michael; Kandemir, Utku; Buckley, Jenni; Ma, C Benjamin
2011-04-01
The purpose of this study was to compare the biomechanical performance of a completely knotless double-row repair system (SutureCross Knotless Anatomic Fixation System; KFx Medical, Carlsbad, CA) with 2 commonly used hybrid double-row repair (medial knot-tying, lateral knotless) systems (Bio-Corkscrew/PushLock [Arthrex, Naples, FL] and Spiralok/Versalok [DePuy Mitek, Raynham, MA]). Fourteen pairs of fresh-frozen cadaveric shoulders were harvested, the supraspinatus tendons were isolated, and full-thickness supraspinatus tears were created. One of each pair was repaired with the completely knotless system, and the contralateral side was repaired with either of the hybrid systems. The repairs were then subjected to cyclic loading followed by load to failure. Conditioning elongation, peak-to-peak elongation, ultimate load, and mechanism of failure were recorded and compared by use of paired t tests. Seven additional shoulders were tested to determine the effect of refrigeration storage on the completely knotless system by use of the same mechanical testing protocol. For the completely knotless repair group, 11 of 14 paired specimens failed during the cyclic loading period. Only 1 of 14 hybrid repair systems had failures during cyclic loading, and both hybrid repair systems had statistically lower conditioning elongation than the completely knotless repair group. The mean ultimate load of the SutureCross group was 166 ± 87 N, which was significantly lower than that in the Corkscrew/PushLock (310 ± 82 N) and Spiralok/Versalok (337 ± 44 N) groups. There was an effect of refrigeration storage on the peak-to-peak elongation and stiffness of the SutureCross group; however, there was no difference in ultimate tensile load or conditioning elongation. The completely knotless repair system has lower time-zero biomechanical properties than the other 2 hybrid systems. The SutureCross system has lower time-zero biomechanical properties when compared with other hybrid repair systems. Clinical outcome studies are needed to determine the significance. Copyright © 2011 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.
Optical and electrical properties of P3HT:graphene composite based devices
NASA Astrophysics Data System (ADS)
Yadav, Anjali; Verma, Ajay Singh; Gupta, Saral Kumar; Negi, Chandra Mohan Singh
2018-04-01
The polymer-carbon derivate composites are well known for their uses and performances in the photovoltaic and optoelectronic industries. In this paper, we synthesis P3HT:graphene composites and discuss their optical and electrical properties. The composites have been prepared by using spin-coating technique onto the glass substrates. It has been found that the incorporation of graphene reduces absorption intensity. However, absorption peak remain unchanged with addition of graphene. The surface morphology studies display homogeneous distribution of graphene with P3HT. Raman studies suggest that chemical structure was not affected by graphene doping. Devices having the structure of glass/ITO/P3HT/ Al and glass ITO/P3HT:graphene/Al were then fabricated. I-V behavior of the fabricated devices was found to be similar to the Schottky diode. ITO/P3HT:graphene/Al structure shows tremendous increase in current values as compared to the ITO/P3HT/Al. Furthermore, charge transport mechanism were studied by analyzing the double logarithmic J-V characteristics curve, which indicates that the current at low voltage follows Ohmic behavior, trap-charge limited conduction (TCLC) mechanism at an intermediate voltage and space charge limited conduction (SCLC) mechanism at sufficiently high voltages.
Qin, Fengling; Man, Jianmin; Xu, Bin; Hu, Maozhi; Gu, Minghong; Liu, Qiaoquan; Wei, Cunxu
2011-12-14
High-amylose cereal starch has a great benefit on human health through its resistant starch (RS) content. Enzyme hydrolysis of native starch is very helpful in understanding the structure of starch granules and utilizing them. In this paper, native starch granules were isolated from a transgenic rice line (TRS) enriched with amylose and RS and hydrolyzed by α-amylase. Structural properties of hydrolyzed TRS starches were studied by X-ray powder diffraction, Fourier transform infrared, and differential scanning calorimetry. The A-type polymorph of TRS C-type starch was hydrolyzed faster than the B-type polymorph, but the crystallinity did not significantly change during enzyme hydrolysis. The degree of order in the external region of starch granule increased with increasing enzyme hydrolysis time. The amylose content decreased at first and then went back up during enzyme hydrolysis. The hydrolyzed starches exhibited increased onset and peak gelatinization temperatures and decreased gelatinization enthalpy on hydrolysis. These results suggested that the B-type polymorph and high amylose that formed the double helices and amylose-lipid complex increased the resistance to BAA hydrolysis. Furthermore, the spectrum results of RS from TRS native starch digested by pancreatic α-amylase and amyloglucosidase also supported the above conclusion.
McGill, Stuart M; Chaimberg, Jon D; Frost, David M; Fenwick, Chad M J
2010-02-01
The main issue addressed here is the paradox of muscle contraction to optimize speed and strike force. When muscle contracts, it increases in both force and stiffness. Force creates faster movement, but the corresponding stiffness slows the change of muscle shape and joint velocity. The purpose of this study was to investigate how this speed strength is accomplished. Five elite mixed martial arts athletes were recruited given that they must create high strike force very quickly. Muscle activation using electromyography and 3-dimensional spine motion was measured. A variety of strikes were performed. Many of the strikes intend to create fast motion and finish with a very large striking force, demonstrating a "double peak" of muscle activity. An initial peak was timed with the initiation of motion presumably to enhance stiffness and stability through the body before motion. This appeared to create an inertial mass in the large "core" for limb muscles to "pry" against to initiate limb motion. Then, some muscles underwent a relaxation phase as speed of limb motion increased. A second peak was observed upon contact with the opponent (heavy bag). It was postulated that this would increase stiffness through the body linkage, resulting in a higher effective mass behind the strike and likely a higher strike force. Observation of the contract-relax-contract pulsing cycle during forceful and quick strikes suggests that it may be fruitful to consider pulse training that involves not only the rate of muscle contraction but also the rate of muscle relaxation.
Stochastic P-bifurcation and stochastic resonance in a noisy bistable fractional-order system
NASA Astrophysics Data System (ADS)
Yang, J. H.; Sanjuán, Miguel A. F.; Liu, H. G.; Litak, G.; Li, X.
2016-12-01
We investigate the stochastic response of a noisy bistable fractional-order system when the fractional-order lies in the interval (0, 2]. We focus mainly on the stochastic P-bifurcation and the phenomenon of the stochastic resonance. We compare the generalized Euler algorithm and the predictor-corrector approach which are commonly used for numerical calculations of fractional-order nonlinear equations. Based on the predictor-corrector approach, the stochastic P-bifurcation and the stochastic resonance are investigated. Both the fractional-order value and the noise intensity can induce an stochastic P-bifurcation. The fractional-order may lead the stationary probability density function to turn from a single-peak mode to a double-peak mode. However, the noise intensity may transform the stationary probability density function from a double-peak mode to a single-peak mode. The stochastic resonance is investigated thoroughly, according to the linear and the nonlinear response theory. In the linear response theory, the optimal stochastic resonance may occur when the value of the fractional-order is larger than one. In previous works, the fractional-order is usually limited to the interval (0, 1]. Moreover, the stochastic resonance at the subharmonic frequency and the superharmonic frequency are investigated respectively, by using the nonlinear response theory. When it occurs at the subharmonic frequency, the resonance may be strong and cannot be ignored. When it occurs at the superharmonic frequency, the resonance is weak. We believe that the results in this paper might be useful for the signal processing of nonlinear systems.
A Fuzzy Control System for Reducing Urban Runoff by a Stormwater Storage Tank
NASA Astrophysics Data System (ADS)
Zhang, P.; Cai, Y.; Wang, J.
2017-12-01
Stormwater storage tank (SST) is a popular low impact development technology for reducing stormwater runoff in the construction of sponge city. Most researches on SST were mainly the design, pollutants removal effect, and operation assessment. While there were few researches on the automatic control of SST for reducing peak flow. In this paper, fuzzy control was introduced into the peak control of SST to improve the efficiency of reducing stormawter runoff. Firstly, the design of SST was investigated. A catchment area and return period were assumed, a SST model was manufactured, and then the storage capacity of the SST was verified. Secondly, the control parameters of the SST based on reducing stormwater runoff was analyzed, and a schematic diagram of real-time control (RTC) system based on peak control SST was established. Finally, fuzzy control system of a double input (flow and water level) and double output (inlet and outlet valve) was designed. The results showed that 1) under the different return periods (one year, three years, five years), the SST had the effect of delayed peak control and storage by increasing the detention time, 2) rainfall, pipeline flow, the influent time and the water level in the SST could be used as RTC parameters, and 3) the response curves of flow velocity and water level fluctuated very little and reached equilibrium in a short time. The combination of online monitoring and fuzzy control was feasible to control the SST automatically. This paper provides a theoretical reference for reducing stormwater runoff and improving the operation efficiency of SST.
Göpfert, Caroline; Holmberg, Hans-Christer; Stöggl, Thomas; Müller, Erich; Lindinger, Stefan Josef
2013-06-01
Recent developments in cross-country ski racing should promote the use of kick double poling. This technique, however, has not been the focus in athletes' training and has barely been investigated. The aims of the present study were to develop a function-based phase definition and to analyse speed adaptation mechanisms for kick double poling in elite cross-country skiers. Joint kinematics and pole/plantar forces were recorded in 10 athletes while performing kick double poling at three submaximal roller skiing speeds. A speed increase was associated with increases in cycle length and rate, while absolute poling and leg push-off durations shortened. Despite maintained impulses of force, the peak and average pole/leg forces increased. During double poling and leg push-off, ranges of motion of elbow flexion and extension increased (p < 0.05) and were maintained for hip/knee flexion and extension. Cycle length increase was correlated to increases in average poling force (r = 0.71) and arm swing time (r = 0.88; both p < 0.05). The main speed adaptation was achieved by changes in double poling technique; however, leg push-off showed high variability among elite skiers, thus illustrating important aspects for technique training.
In-phased second harmonic wave array generation with intra-Talbot-cavity frequency-doubling.
Hirosawa, Kenichi; Shohda, Fumio; Yanagisawa, Takayuki; Kannari, Fumihiko
2015-03-23
The Talbot cavity is one promising method to synchronize the phase of a laser array. However, it does not achieve the lowest array mode with the same phase but the highest array mode with the anti-phase between every two adjacent lasers, which is called out-phase locking. Consequently, their far-field images exhibit 2-peak profiles. We propose intra-Talbot-cavity frequency-doubling. By placing a nonlinear crystal in a Talbot cavity, the Talbot cavity generates an out-phased fundamental wave array, which is converted into an in-phase-locked second harmonic wave array at the nonlinear crystal. We demonstrate numerical calculations and experiments on intra-Talbot-cavity frequency-doubling and obtain an in-phase-locked second harmonic wave array for a Nd:YVO₄ array laser.
NASA Astrophysics Data System (ADS)
Carneal, James P.; Fuller, Chris R.
2004-05-01
An analytical and experimental investigation of active control of sound transmission through double panel systems has been performed. The technique used was active structural acoustic control (ASAC) where the control inputs, in the form of piezoelectric actuators, were applied to the structure while the radiating pressure field was minimized. Results verify earlier experimental investigations and indicate the application of control inputs to the radiating panel of the double panel system resulted in greater transmission loss (TL) due to its direct effect on the nature of the structural-acoustic (or radiation) coupling between the radiating panel and the receiving acoustic space. Increased control performance was seen in a double panel system consisting of a stiffer radiating panel due to its lower modal density and also as a result of better impedance matching between the piezoelectric actuator and the radiating plate. In general the results validate the ASAC approach for double panel systems, demonstrating that it is possible to take advantage of double panel system passive behavior to enhance control performance, and provide design guidelines.
Sound transmission through stiffened double-panel structures lined with elastic porous materials
NASA Astrophysics Data System (ADS)
Mathur, Gopal P.; Tran, Boi N.; Bolton, J. S.; Shiau, Nae-Ming
This paper presents transmission loss prediction models for a periodically stiffened panel and stiffened double-panel structures using the periodic structure theory. The inter-panel cavity in the double-panels structures can be modeled as being separated by an airspace or filled with an elastic porous layer in various configurations. The acoustic behavior of elastic porous layer is described by a theory capable of accounting fully for multi-dimensional wave propagation in such materials. The predicted transmission loss of a single stiffened panel is compared with the measured data.
Implosion Dynamics and Mix in Double-Shell ICF Capsule Designs
NASA Astrophysics Data System (ADS)
Gunderson, Mark; Daughton, William; Simakov, Andrei; Wilson, Douglas; Watt, Robert; Delamater, Norman; Montgomery, David
2015-11-01
From an implosion dynamics perspective, double-shell ICF capsule designs have several advantages over the single-shell NIF ICF capsule point design. Double shell designs do not require precise shock sequencing, do not rely on hot spot ignition, have lower peak implosion speed requirements, and have lower convergence ratio requirements. However, there are still hurdles that must be overcome. The timing of the two main shocks in these designs is important in achieving sufficient compression of the DT fuel. Instability of the inner gold shell due to preheat from the hohlraum environment can disrupt the implosion of the inner pill. Mix, in addition to quenching burn in the DT fuel, also decreases the transfer of energy between the beryllium ablator and the inner gold shell during collision thus decreasing the implosion speed of the inner shell along with compression of the DT fuel. Herein, we will discuss practical implications of these effects on double-shell design we carry out in preparation for the NIF double-shell campaign. Work performed under the auspices of DOE by LANL under contract DE-AC52-06NA25396.
NASA Astrophysics Data System (ADS)
Tóth, A.; Veres, M.; Kereszturi, K.; Mohai, M.; Bertóti, I.; Szépvölgyi, J.
2011-10-01
The surfaces of untreated and helium plasma-based ion implantation (He PBII) treated poly(ethylene terephthalate) (PET) samples were characterised by reflectance colorimetry, contact angle studies and measurements of surface electrical resistance. The results were related to the structural and compositional data obtained by the authors earlier on parallel samples by XPS and Raman spectroscopy. Inverse correlations between lightness and ID/ IG ratio and between chroma and ID/ IG ratio were obtained, suggesting that the PBII-treated PET samples darken and their colourfulness decreases with the increase of the portion of aromatic sp 2 carbon rings in the chemical structure of the modified layer. Direct correlation between water contact angle and the ID/ IG ratio and inverse correlations between surface energy and ID/ IG ratio and between dispersive component of surface energy and ID/ IG ratio were found, reflecting that surface wettability, surface energy and its dispersive component decrease with the formation of surface structure, characterised again by enhanced portion of aromatic sp 2 carbon rings. The surface electrical resistance decreased with the increase of the surface C-content determined by XPS and also with the increase of the surface concentration of conjugated double bonds, reflected by the increase of the π → π* shake-up satellite of the C 1s peak.
NASA Astrophysics Data System (ADS)
Sadamasu, Kengo; Inoue, Takafumi; Ogomi, Yuhei; Pandey, Shyam S.; Hayase, Shuzi
2011-02-01
We report a hybrid dye-sensitized solar cell consisting of double titania layers (top and bottom layers) stained with two dyes. A top layer fabricated on a glass was mechanically pressed with a bottom layer fabricated on a glass cloth. The glass cloth acts as a supporter of a porous titania layer as well as a holder of electrolyte. The incident photon to current efficiency (IPCE) curve had two peaks corresponding to those of the two dyes, which demonstrates that electrons are collected from both the top and bottom layers.
Electron Raman scattering in a strained ZnO/MgZnO double quantum well
NASA Astrophysics Data System (ADS)
Mojab-abpardeh, M.; Karimi, M. J.
2018-02-01
In this work, the electron Raman scattering in a strained ZnO / MgZnO double quantum wells is studied. The energy eigenvalues and the wave functions are obtained using the transfer matrix method. The effects of Mg composition, well width and barrier width on the internal electric field in well and barrier layers are investigated. Then, the influences of these parameters on the differential cross-section of electron Raman scattering are studied. Results indicate that the position, magnitude and the number of the peaks depend on the Mg composition, well width and barrier width.
NASA Astrophysics Data System (ADS)
Ci, Lijie; Zhou, Zhenping; Yan, Xiaoqin; Liu, Dongfang; Yuan, Huajun; Song, Li; Gao, Yan; Wang, Jianxiong; Liu, Lifeng; Zhou, Weiya; Wang, Gang; Xie, Sishen; Tan, Pingheng
2003-11-01
Resonant Raman spectra of double wall carbon nanotubes (DWCNTs), with diameters from 0.4 to 3.0 nm, were investigated with several laser excitations. The peak position and line shape of Raman bands were shown to be strongly dependent on the laser energies. With different excitations, the diameter and chirality of the DWCNTs can be discussed in detail. We show that tubes (the inner or outer layers of DWCNTs) with all kinds of chiralities could be synthesized, and a DWCNT can have any combination of chiralities of the inner and outer tubes.
Differences of Ballet Turns ("Pirouette") Performance between Experienced and Novice Ballet Dancers
ERIC Educational Resources Information Center
Lin, Chia-Wei; Chen, Shing-Jye; Su, Fong-Chin; Wu, Hong-Wen; Lin, Cheng-Feng
2014-01-01
Purpose: This study investigated the different postural control strategies exhibited by experienced and novice dancers in ballet turns ("pirouettes"). Method: Thirteen novice and 13 experienced dancers performed ballet turns with dominant-leg support. The peak push force was measured in the double-leg support phase. The inclination…
Mitzi, David B.; Chondroudis, Konstantinos; Kagan, Cherie R.
1999-12-27
A quaterthiophene derivative, 5,5' "-bis(aminoethyl)-2,2':5',2' ':5' ',2' "-quaterthiophene (AEQT), has been selected for incorporation within the layered organic-inorganic perovskite structure. In addition to having an appropriate molecular shape and two tethering aminoethyl groups to bond to the inorganic framework, AEQT is also a dye and can influence the optical properties of lead(II) halide-based perovskites. Crystals of C(20)H(22)S(4)N(2)PbBr(4) were grown from a slowly cooled aqueous solution containing lead(II) bromide and quaterthiophene derivative (AEQT.2HBr) salts. The new layered perovskite adopts a monoclinic (C2/c) subcell with the lattice parameters a = 39.741(2) Å, b = 5.8420(3) Å, c = 11.5734(6) Å, beta = 92.360(1) degrees, and Z = 4. Broad superstructure peaks are observed in the X-ray diffraction data, indicative of a poorly ordered, doubled supercell along both the a and b axes. The quaterthiophene segment of AEQT(2+) is nearly planar, with a syn-anti-syn relationship between adjacent thiophene rings. Each quaterthiophene chromophore is ordered between nearest-neighbor lead(II) bromide sheets in a herringbone arrangement with respect to neighboring quaterthiophenes. Room temperature optical absorption spectra for thermally ablated films of the perovskites (AEQT)PbX(4) (X = Cl, Br, I) exhibit an exciton peak arising from the lead(II) halide sheets, along with absorption from the quaterthiophene moiety. No evidence of the inorganic sheet excitonic transition is observed in the photoluminescence spectra for any of the chromophore-containing perovskites. However, strong quaterthiophene photoluminescence is observed for X = Cl, with an emission peak at approximately lambda(max) = 532 nm. Similar photoluminescence is observed for the X = Br and I materials, but with substantial quenching, as the inorganic layer band gap decreases relative to the chromophore HOMO-LUMO gap.
Feugmo, Conrard Giresse Tetsassi; Champagne, Benoît; Caudano, Yves; Cecchet, Francesca; Chabal, Yves J; Liégeois, Vincent
2012-03-28
In this work, we investigate the adsorption process of two carboxylic acids (stearic and undecylenic) on a H-Si(111) surface via the calculation of structural and energy changes as well as the simulation of their IR and Raman spectra. The two molecules adsorb differently at the surface since the stearic acid simply physisorbs while the undecylenic acid undergoes a chemical reaction with the hydrogen atoms of the surface. This difference is observed in the change of geometry during the adsorption. Indeed, the chemisorption of the undecylenic acid has a bigger impact on the structure than the physisorption of the stearic acid. Consistently, the former is also characterized by a larger value of adsorption energy and a smaller value of the tilting angle with respect to the normal plane. For both the IR and Raman signatures, the spectra of both molecules adsorbed at the surface are in a first approximation the superposition of the spectra of the Si cluster and of the carboxylic acid considered individually. The main deviation from this simple observation is the peak of the stretching Si-H (ν(Si-H)) mode, which is split into two peaks upon adsorption. As expected, the splitting is bigger for the chemisorption than the physisorption. The modes corresponding to atomic displacements close to the adsorption site display a frequency upshift by a dozen wavenumbers. One can also see the disappearance of the peaks associated with the C=C double bond when the undecylenic acid chemisorbs at the surface. The Raman and IR spectra are complementary and one can observe here that the most active Raman modes are generally IR inactive. Two exceptions to this are the two ν(Si-H) modes which are active in both spectroscopies. Finally, we compare our simulated spectra with some experimental measurements and we find an overall good agreement. © 2012 IOP Publishing Ltd
Extragalactic Peaked-spectrum Radio Sources at Low Frequencies
DOE Office of Scientific and Technical Information (OSTI.GOV)
Callingham, J. R.; Gaensler, B. M.; Sadler, E. M.
We present a sample of 1483 sources that display spectral peaks between 72 MHz and 1.4 GHz, selected from the GaLactic and Extragalactic All-sky Murchison Widefield Array (GLEAM) survey. The GLEAM survey is the widest fractional bandwidth all-sky survey to date, ideal for identifying peaked-spectrum sources at low radio frequencies. Our peaked-spectrum sources are the low-frequency analogs of gigahertz-peaked spectrum (GPS) and compact-steep spectrum (CSS) sources, which have been hypothesized to be the precursors to massive radio galaxies. Our sample more than doubles the number of known peaked-spectrum candidates, and 95% of our sample have a newly characterized spectral peak.more » We highlight that some GPS sources peaking above 5 GHz have had multiple epochs of nuclear activity, and we demonstrate the possibility of identifying high-redshift ( z > 2) galaxies via steep optically thin spectral indices and low observed peak frequencies. The distribution of the optically thick spectral indices of our sample is consistent with past GPS/CSS samples but with a large dispersion, suggesting that the spectral peak is a product of an inhomogeneous environment that is individualistic. We find no dependence of observed peak frequency with redshift, consistent with the peaked-spectrum sample comprising both local CSS sources and high-redshift GPS sources. The 5 GHz luminosity distribution lacks the brightest GPS and CSS sources of previous samples, implying that a convolution of source evolution and redshift influences the type of peaked-spectrum sources identified below 1 GHz. Finally, we discuss sources with optically thick spectral indices that exceed the synchrotron self-absorption limit.« less
Studying dielectric mechanism and magnetization of double perovskite Gd{sub 2}NiMnO{sub 6} ceramic
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mohapatra, S. R.; Sahu, B., E-mail: 512PH3009@nitrkl.ac.in; Singh, A. K.
2016-05-23
In the present work, the structure, dielectric and magnetic properties of Gd{sub 2}NiMnO{sub 6} double perovskite have been studied. X-Ray diffraction study reveals the phase pure formation of the material that crystallizes into monoclinic phase (space group ’P2{sub 1}/n’). Surface morphology depicts heterogeneous grain distribution with average grain size of ~1 µm. Temperature dependent (50 – 330 K) dielectric measurements at different frequencies (0.5 - 50 kHz) relate to Maxwell-Wagner interfacial polarization model. Giant dielectric constant at 1 kHz for 300 K (ε’ ~1900) is noticed as compared to that of 50 K (ε’ ~10) coupled with a peak shiftmore » in tan loss towards higher temperature with frequency. The activation energy (0.24 eV) obtained using Arrhenius relation for thermally activated relaxor behavior of the material signifies an electron hopping mechanism between Ni{sup 2+} and Mn{sup 4+} cations. Lastly, M-H study shows ‘S’ shape hysteresis loop at 50 K with remnant magnetization (M{sub r}) of 0.72 µ{sub B}/f.u. along with a linear plot for 300 K which reveals paramagnetic nature of the material.« less
Measurement Of Gas Electron Multiplier (GEM) Detector Characteristics
NASA Astrophysics Data System (ADS)
Park, Seongtae; Baldelomar, Edwin; Park, Kwangjune; Sosebee, Mark; White, Andy; Yu, Jaehoon
2011-06-01
The High Energy Physics group of the University of Texas at Arlington has been developing gas electron multiplier detectors to use them as sensitive gap detectors in digital hadron calorimeters for the International Linear Collider, a future high energy particle accelerator. For this purpose, we constructed numerous GEM detectors that employ double GEM layers. In this study, two kinds of prototype GEM detectors were tested; one with 28×28 cm2 active area double GEM structure with a 3 mm drift gap, a 1 mm transfer gap and a 1 mm induction gap and the other with two 3×3 cm2 GEM foils in the amplifier stage with a 5 mm drift gap, a 2 mm transfer gap and a 1 mm induction gap. The detectors' characteristics from exposure to high-energy charged particles and other radiations were measured using cosmic rays and 55Fe radioactive source. From the 55Fe tests, we observed two well separated characteristic X-ray emission peaks and confirmed the detectors' functionality. We also measured chamber gains to be over 6000 at a high voltage of 395 V across each GEM electrode. The responses to cosmic rays show the spectra that fit well to Landau distributions as expected from minimum ionizing particles.
NASA Astrophysics Data System (ADS)
Bao, Jianfeng; Cui, Xiaohong; Huang, Yuqing; Zhong, Jianhui; Chen, Zhong
2015-08-01
High-resolution 1H magnetic resonance spectroscopy (MRS) is generally inaccessible in red bone marrow (RBM) tissues using conventional MRS techniques. This is because signal from these tissues suffers from severe inhomogeneity in the main static B0 field originated from the intrinsic honeycomb structures in trabecular bone. One way to reduce effects of B0 field inhomogeneity is by using the intermolecular double quantum coherence (iDQC) technique, which has been shown in other systems to obtain signals insensitive to B0 field inhomogeneity. In the present study, we employed an iDQC approach to enhance the spectral resolution of RBM. The feasibility and performance of this method for achieving high resolution MRS was verified by experiments on phantoms and pig vertebral bone samples. Unsaturated fatty acid peaks which overlap in the conventional MRS were well resolved and identified in the iDQC spectrum. Quantitative comparison of fractions of three types of fatty acids was performed between iDQC spectra on the in situ RMB and conventional MRS on the extracted fat from the same RBM. Observations of unsaturated fatty acids with iDQC MRS may provide valuable information and may hold potential in diagnosis of diseases such as obesity, diabetes, and leukemia.
Peng, Xianglu; Zhao, Lei; Guo, Jinxiu; Yang, Shenghong; Ding, Hui; Wang, Xiayan; Pu, Qiaosheng
2015-10-15
Micro-channels that contain a special inner structure are critical for efficient mixing and chemical reactions. In this paper, we described the facile fabrication of an integrated microchip with double-helix type micro-channels to improve mixing efficiency and to facilitate multi-step derivatization reactions prior to electrophoretic separation. With a prepared microchip, reagents, samples and reaction products could be driven through micro-channels by siphon, and no other pumping device was necessary. To test its performance, reductive amination of aldehydes with 8-aminonaphthalene-1,3,6-trisulfonate acid disodium (ANTS) was attempted via microchip electrophoresis with laser induced fluorescence (LIF). The effect of the geometry of the reaction micro-channel on the reaction's efficiency was evaluated. Under the selected conditions, successful derivatization of five aldehydes was realized for highly reproducible analysis. The relative standard deviations of the peak areas for 30 consecutive injections were in the range of 0.28-1.61%. The method was applied for the determination of aldehydes in real samples with standard addition recoveries of 87.8-102.8%. Good tolerance of organic solvents was achieved, and the proposed method can potentially be employed for rapid screening of excessively added aldehyde food flavoring. Copyright © 2015 Elsevier B.V. All rights reserved.
Sound transmission through triple-panel structures lined with poroelastic materials
NASA Astrophysics Data System (ADS)
Liu, Yu
2015-03-01
In this paper, previous theories on the prediction of sound transmission loss for a double-panel structure lined with poroelastic materials are extended to address the problem of a triple-panel structure. Six typical configurations are considered for a triple-panel structure based on the method of coupling the porous layers to the facing panels which determines critically the sound insulation performance of the system. The transfer matrix method is employed to solve the system by applying appropriate types of boundary conditions for these configurations. The transmission loss of the triple-panel structures in a diffuse sound field is calculated as a function of frequency and compared with that of corresponding double-panel structures. Generally, the triple-panel structure with poroelastic linings has superior acoustic performance to the double-panel counterpart, remarkably in the mid-high frequency range and possibly at low frequencies, by selecting appropriate configurations in which those with two air gaps in the structure exhibit the best overall performance over the entire frequency range. The poroelastic lining significantly lowers the cut-on frequency above which the triple-panel structure exhibits noticeably higher transmission loss. Compared with a double-panel structure, the wider range of system parameters for a triple-panel structure due to the additional partition provides more design space for tuning the sound insulation performance. Despite the increased structural complexity, the triple-panel structure lined with poroelastic materials has the obvious advantages in sound transmission loss while without the penalties in weight and volume, and is hence a promising replacement for the widely used double-panel sandwich structure.
Tunneling conductance in superconductor-hybrid double quantum dots Josephson junction
NASA Astrophysics Data System (ADS)
Chamoli, Tanuj; Ajay
2018-05-01
The present work deals with the theoretical model study to analyse the tunneling conductance across a superconductor hybrid double quantum dots tunnel junction (S-DQD-S). Recently, there are many experimental works where the Josephson current across such nanoscopic junction is found to be dependent on nature of the superconducting electrodes, coupling of the hybrid double quantum dot's electronic states with the electronic states of the superconductors and nature of electronic structure of the coupled dots. For this, we have attempted a theoretical model containing contributions of BCS superconducting leads, magnetic coupled quantum dot states and coupling of superconducting leads with QDs. In order to include magnetic coupled QDs the contributions of competitive Kondo and Ruderman-Kittel- Kasuya-Yosida (RKKY) interaction terms are also introduced through many body effects in the model Hamiltonian at low temperatures (where Kondo temperature TK < superconducting transition temperature TC). Employing non-equilibrium Green's function approach within mean field approximation, we have obtained expressions for density of states (DOS) and analysed the same using numerical computation to underline the nature of DOS close to Fermi level in S-DQD-S junctions. On the basis of numerical computation, it is pointed out that indirect exchange interaction between impurities (QD) i.e. RKKY interaction suppresses the screening of magnetic QD due to Cooper pair electrons i.e. Kondo effect in the form of reduction in the magnitude of sharp DOS peak close to Fermi level which is in qualitative agreement with the experimental observations in such tunnel junctions. Tunneling conductance is proportional to DOS, hence we can analyse it's behaviour with the help of DOS.
Deformation effect simulation and optimization for double front axle steering mechanism
NASA Astrophysics Data System (ADS)
Wu, Jungang; Zhang, Siqin; Yang, Qinglong
2013-03-01
This paper research on tire wear problem of heavy vehicles with Double Front Axle Steering Mechanism from the flexible effect of Steering Mechanism, and proposes a structural optimization method which use both traditional static structural theory and dynamic structure theory - Equivalent Static Load (ESL) method to optimize key parts. The good simulated and test results show this method has high engineering practice and reference value for tire wear problem of Double Front Axle Steering Mechanism design.
2005-07-01
evaluate the functional, structural, and economic performance of the patented Beachsaver Reef prefabricated concrete submerged breakwater and the less...expensive prefabricated concrete structure called a Double-T sill. This demonstration project was developed through a cooperative effort of the U.S...patented Beachsaver Reef prefabricated concrete submerged breakwater and a less expensive, prefabricated concrete structure called a Double-T sill. Data
Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju
2017-02-01
Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.
Morphologic classes of impact basins on Venus
NASA Technical Reports Server (NTRS)
Wood, Charles A.; Tam, Wesley
1993-01-01
An independent survey of 60% of Venus has resulted in the detection of 35 impact basins and associated transitional rings. Contrary to previous studies central peak basins have been identified, as well as peak ring basins. But no unambiguous multi-ring basins have been detected. A new class of crateriform - expanded peak structure - has been noticed, which is transitional in diameter, but apparently not in structure, between central peak and peak ring basins.
NASA Astrophysics Data System (ADS)
Ma, Xiyue; Chen, Kean; Ding, Shaohu; Yu, Haoxin
2016-06-01
This paper presents an analytical investigation on physical mechanisms of actively controlling sound transmission through a rib stiffened double-panel structure using point source in the cavity. The combined modal expansion and vibro-acoustic coupling methods are applied to establish the theoretical model of such active structure. Under the condition of minimizing radiated power of the radiating ribbed plate, the physical mechanisms are interpreted in detail from the point of view of modal couplings similar as that used in existed literatures. Results obtained demonstrate that the rule of sound energy transmission and the physical mechanisms for the rib stiffened double-panel structure are all changed, and affected by the coupling effects of the rib when compared with the analytical results obtained for unribbed double-panel case. By taking the coupling effects of the rib into considerations, the cavity modal suppression and rearrangement mechanisms obtained in existed investigations are modified and supplemented for the ribbed plate case, which gives a clear interpretation for the physical nature involved in the active rib stiffened double-panel structure.
NASA Astrophysics Data System (ADS)
Brant Dodson, J.; Taylor, Patrick C.; Branson, Mark
2018-05-01
Recently launched cloud observing satellites provide information about the vertical structure of deep convection and its microphysical characteristics. In this study, CloudSat reflectivity data is stratified by cloud type, and the contoured frequency by altitude diagrams reveal a double-arc structure in deep convective cores (DCCs) above 8 km. This suggests two distinct hydrometeor modes (snow versus hail/graupel) controlling variability in reflectivity profiles. The day-night contrast in the double arcs is about four times larger than the wet-dry season contrast. Using QuickBeam, the vertical reflectivity structure of DCCs is analyzed in two versions of the Superparameterized Community Atmospheric Model (SP-CAM) with single-moment (no graupel) and double-moment (with graupel) microphysics. Double-moment microphysics shows better agreement with observed reflectivity profiles; however, neither model variant captures the double-arc structure. Ultimately, the results show that simulating realistic DCC vertical structure and its variability requires accurate representation of ice microphysics, in particular the hail/graupel modes, though this alone is insufficient.
Sandbakk, Øyvind; Leirdal, Stig; Ettema, Gertjan
2015-03-01
The current study compared differences in cycle characteristics, energy expenditure and peak speed between double poling (DP) and G3 skating. Eight world class male sprint skiers performed a 5-min submaximal test at 16 km h(-1) and an incremental test to exhaustion at a 5% incline during treadmill roller skiing with two different techniques: DP where all propulsion comes from poling, and G3 skating where leg skating is added to each double poling movement. Video analyses determined cycle characteristics; respiratory parameters and blood lactate concentration determined the physiological responses. G3 skating resulted in 16% longer cycle lengths at 16% lower cycle rates, whereas oxygen uptake was independent of technique during submaximal roller skiing. The corresponding advantages for G3 skating during maximal roller skiing were reflected in 14% higher speed, 30% longer cycle length at 16% lower cycle rate and 11% higher peak oxygen uptake (all p < 0.05). Compared to DP approximately 14% higher speed was achieved when leg push-offs were added in G3 skating. This was done by major increases in cycle lengths at slightly lower cycle rates and a higher aerobic energy delivery. However, the oxygen uptake for a given submaximal speed was not affected by technique although higher cycle rate was used in DP.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Asgari, H., E-mail: hamed.asgari@usask.ca; Odeshi, A.G.; Szpunar, J.A.
2015-08-15
The effects of grain size on the dynamic deformation behavior of rolled AZ31B alloy at high strain rates were investigated. Rolled AZ31B alloy samples with grain sizes of 6, 18 and 37 μm, were subjected to shock loading tests using Split Hopkinson Pressure Bar at room temperature and at a strain rate of 1100 s{sup −} {sup 1}. It was found that a double-peak basal texture formed in the shock loaded samples. The strength and ductility of the alloy under the high strain-rate compressive loading increased with decreasing grain size. However, twinning fraction and strain hardening rate were found tomore » decrease with decreasing grain size. In addition, orientation imaging microscopy showed a higher contribution of double and contraction twins in the deformation process of the coarse-grained samples. Using transmission electron microscopy, pyramidal dislocations were detected in the shock loaded sample, proving the activation of pyramidal slip system under dynamic impact loading. - Highlights: • A double-peak basal texture developed in all shock loaded samples. • Both strength and ductility increased with decreasing grain size. • Twinning fraction and strain hardening rate decreased with decreasing grain size. • ‘g.b’ analysis confirmed the presence of dislocations in shock loaded alloy.« less
Transmission loss of orthogonally rib-stiffened double-panel structures with cavity absorption.
Xin, F X; Lu, T J
2011-04-01
The transmission loss of sound through infinite orthogonally rib-stiffened double-panel structures having cavity-filling fibrous sound absorptive materials is theoretically investigated. The propagation of sound across the fibrous material is characterized using an equivalent fluid model, and the motions of the rib-stiffeners are described by including all possible vibrations, i.e., flexural displacements, bending, and torsional rotations. The effects of fluid-structure coupling are account for by enforcing velocity continuity conditions at fluid-panel interfaces. By taking full advantage of the periodic nature of the double-panel, the space-harmonic approach and virtual work principle are applied to solve the sets of resultant governing equations, which are eventually truncated as a finite system of simultaneous algebraic equations and numerically solved insofar as the solution converges. To validate the proposed model, a comparison between the present model predictions and existing numerical and experimental results for a simplified version of the double-panel structure is carried out, with overall agreement achieved. The model is subsequently employed to explore the influence of the fluid-structure coupling between fluid in the cavity and the two panels on sound transmission across the orthogonally rib-stiffened double-panel structure. Obtained results demonstrate that this fluid-structure coupling affects significantly sound transmission loss (STL) at low frequencies and cannot be ignored when the rib-stiffeners are sparsely distributed. As a highlight of this research, an integrated optimal algorithm toward lightweight, high-stiffness and superior sound insulation capability is proposed, based on which a preliminary optimal design of the double-panel structure is performed.
Structural and functional predictors of regional peak pressures under the foot during walking.
Morag, E; Cavanagh, P R
1999-04-01
The objective of this study was to identify structural and functional factors which are predictors of peak pressure underneath the human foot during walking. Peak plantar pressure during walking and eight data sets of structural and functional measures were collected on 55 asymptomatic subjects between 20 and 70 yr. A best subset regression approach was used to establish models which predicted peak regional pressure under the foot. Potential predictor variables were chosen from physical characteristics, anthropometric data, passive range of motion (PROM), measurements from standardized weight bearing foot radiographs, mechanical properties of the plantar soft tissue, stride parameters, foot motion in 3D, and EMG during walking. Peak pressure values under the rearfoot, midfoot, MTH1, and hallux were measured. Heel pressure was a function of linear kinematics, longitudinal arch structure, thickness of plantar soft tissue, and age. Midfoot pressure prediction was dominated by arch structure, while MTH1 pressure was a function of radiographic measurements, talo-crural joint motion, and gastrocnemius activity. Hallux pressure was a function of structural measures and MTP1 joint motion. Foot structure and function predicted only approximately 50% of the variance in peak pressure, although the relative contributions in different anatomical regions varied dramatically. Structure was dominant in predicting peak pressure under the midfoot and MTH1, while both structure and function were important at the heel and hallux. The predictive models developed in this study give insight into potential etiological factors associated with elevated plantar pressure. They also provide direction for future studies designed to reduce elevated pressure in "at-risk" patients.
Zhang, Hai-Lin; Bai, Xiao-Lin; Xue, Jian-Fu; Chen, Zhong-Du; Tang, Hai-Ming; Chen, Fu
2013-01-01
Understanding greenhouse gases (GHG) emissions is becoming increasingly important with the climate change. Most previous studies have focused on the assessment of soil organic carbon (SOC) sequestration potential and GHG emissions from agriculture. However, specific experiments assessing tillage impacts on GHG emission from double-cropped paddy fields in Southern China are relatively scarce. Therefore, the objective of this study was to assess the effects of tillage systems on methane (CH4) and nitrous oxide (N2O) emission in a double rice (Oryza sativa L.) cropping system. The experiment was established in 2005 in Hunan Province, China. Three tillage treatments were laid out in a randomized complete block design: conventional tillage (CT), rotary tillage (RT) and no-till (NT). Fluxes of CH4 from different tillage treatments followed a similar trend during the two years, with a single peak emission for the early rice season and a double peak emission for the late rice season. Compared with other treatments, NT significantly reduced CH4 emission among the rice growing seasons (P<0.05). However, much higher variations in N2O emission were observed across the rice growing seasons due to the vulnerability of N2O to external influences. The amount of CH4 emission in paddy fields was much higher relative to N2O emission. Conversion of CT to NT significantly reduced the cumulative CH4 emission for both rice seasons compared with other treatments (P<0.05). The mean value of global warming potentials (GWPs) of CH4 and N2O emissions over 100 years was in the order of NT
Zhang, Hai-Lin; Bai, Xiao-Lin; Xue, Jian-Fu; Chen, Zhong-Du; Tang, Hai-Ming; Chen, Fu
2013-01-01
Understanding greenhouse gases (GHG) emissions is becoming increasingly important with the climate change. Most previous studies have focused on the assessment of soil organic carbon (SOC) sequestration potential and GHG emissions from agriculture. However, specific experiments assessing tillage impacts on GHG emission from double-cropped paddy fields in Southern China are relatively scarce. Therefore, the objective of this study was to assess the effects of tillage systems on methane (CH4) and nitrous oxide (N2O) emission in a double rice (Oryza sativa L.) cropping system. The experiment was established in 2005 in Hunan Province, China. Three tillage treatments were laid out in a randomized complete block design: conventional tillage (CT), rotary tillage (RT) and no-till (NT). Fluxes of CH4 from different tillage treatments followed a similar trend during the two years, with a single peak emission for the early rice season and a double peak emission for the late rice season. Compared with other treatments, NT significantly reduced CH4 emission among the rice growing seasons (P<0.05). However, much higher variations in N2O emission were observed across the rice growing seasons due to the vulnerability of N2O to external influences. The amount of CH4 emission in paddy fields was much higher relative to N2O emission. Conversion of CT to NT significantly reduced the cumulative CH4 emission for both rice seasons compared with other treatments (P<0.05). The mean value of global warming potentials (GWPs) of CH4 and N2O emissions over 100 years was in the order of NT
Marini, C; Noked, O; Kantor, I; Joseph, B; Mathon, O; Shuker, R; Kennedy, B J; Pascarelli, S; Sterer, E
2016-02-03
Nb K-edge x-ray absorption spectroscopy is utilized to investigate the changes in the local structure of the A-site deficient double perovskite La1/3NbO3 which undergoes a pressure induced irreversible amorphization. EXAFS results show that with increasing pressure up to 7.5 GPa, the average Nb-O bond distance decreases in agreement with the expected compression and tilting of the NbO6 octahedra. On the contrary, above 7.5 GPa, the average Nb-O bond distance show a tendency to increase. Significant changes in the Nb K-edge XANES spectrum with evident low energy shift of the pre-peak and the absorption edge is found to happen in La1/3NbO3 above 6.3 GPa. These changes evidence a gradual reduction of the Nb cations from Nb(5+) towards Nb(4+) above 6.3 GPa. Such a valence change accompanied by the elongation of the average Nb-O bond distances in the octahedra, introduces repulsion forces between non-bonding adjacent oxygen anions in the unoccupied A-sites. Above a critical pressure, the Nb reduction mechanism can no longer be sustained by the changing local structure and amorphization occurs, apparently due to the build-up of local strain. EXAFS and XANES results indicate two distinct pressure regimes having different local and electronic response in the La1/3NbO3 system before the occurence of the pressure induced amorphization at ∼14.5 GPa.
Bromine-doped DWNTs: A Molecular Faraday Cage
NASA Astrophysics Data System (ADS)
Chen, Gugang; Margine, Roxana; Gupta, Rajeev; Crespi, Vincent; Eklund, Peter; Sumanasekera, Gamini; Bandow, Shunji; Iijima, S.
2003-03-01
Raman scattering is used to probe the charge transfer distribution in Bromine-doped double-walled carbon nanotubes (DWNT). Using 1064 nm and 514.5 nm laser excitation we are able to study the charge-transfer sensitive phonons in the inner ( (5,5)) and outer ( (10,10)) tubes of the double-walled pair. The experimental results are compared to our tight binding band structure calculations that include a self-consistent electrostatic term sensitive to the average net charge density on each tube. Upon doping, the nanotube tangential and radial Raman bands from the outer (primary) tubes were observed to shift dramatically to higher frequencies, consistent with a C-C bond contraction driven by the acceptor-doping. The peak intensities of these bands significantly decreased with increasing doping exposure, and they eventually vanished, consistent with a deep depression in the Fermi energy that extinguishes the resonant Raman effect. Interestingly, at the same time, we observed little or no change for the tangential and radial Raman features identified with the inner (secondary) tubes during the bromine doping. Our electronic structure calculations show that the charge distribution between the outer and inner tubes depends on doping level and also, to some extent, on specific tube chirality combinations. In general, in agreement with experiment, the calculations find a very small net charge on the inner tube, consistent with a "Molecular Faraday Effect", e.g., a DWNT of (10, 10)/ (5, 5) configuration that exhibits 0.5 holes/Å total charge transfer, has only 0.04 holes/Å on the inner (secondary) tube.