Sample records for double-stranded dna binding

  1. Surface shapes and surrounding environment analysis of single- and double-stranded DNA-binding proteins in protein-DNA interface.

    PubMed

    Wang, Wei; Liu, Juan; Sun, Lin

    2016-07-01

    Protein-DNA bindings are critical to many biological processes. However, the structural mechanisms underlying these interactions are not fully understood. Here, we analyzed the residues shape (peak, flat, or valley) and the surrounding environment of double-stranded DNA-binding proteins (DSBs) and single-stranded DNA-binding proteins (SSBs) in protein-DNA interfaces. In the results, we found that the interface shapes, hydrogen bonds, and the surrounding environment present significant differences between the two kinds of proteins. Built on the investigation results, we constructed a random forest (RF) classifier to distinguish DSBs and SSBs with satisfying performance. In conclusion, we present a novel methodology to characterize protein interfaces, which will deepen our understanding of the specificity of proteins binding to ssDNA (single-stranded DNA) or dsDNA (double-stranded DNA). Proteins 2016; 84:979-989. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  2. Loop L1 governs the DNA-binding specificity and order for RecA-catalyzed reactions in homologous recombination and DNA repair

    PubMed Central

    Shinohara, Takeshi; Ikawa, Shukuko; Iwasaki, Wakana; Hiraki, Toshiki; Hikima, Takaaki; Mikawa, Tsutomu; Arai, Naoto; Kamiya, Nobuo; Shibata, Takehiko

    2015-01-01

    In all organisms, RecA-family recombinases catalyze homologous joint formation in homologous genetic recombination, which is essential for genome stability and diversification. In homologous joint formation, ATP-bound RecA/Rad51-recombinases first bind single-stranded DNA at its primary site and then interact with double-stranded DNA at another site. The underlying reason and the regulatory mechanism for this conserved binding order remain unknown. A comparison of the loop L1 structures in a DNA-free RecA crystal that we originally determined and in the reported DNA-bound active RecA crystals suggested that the aspartate at position 161 in loop L1 in DNA-free RecA prevented double-stranded, but not single-stranded, DNA-binding to the primary site. This was confirmed by the effects of the Ala-replacement of Asp-161 (D161A), analyzed directly by gel-mobility shift assays and indirectly by DNA-dependent ATPase activity and SOS repressor cleavage. When RecA/Rad51-recombinases interact with double-stranded DNA before single-stranded DNA, homologous joint-formation is suppressed, likely by forming a dead-end product. We found that the D161A-replacement reduced this suppression, probably by allowing double-stranded DNA to bind preferentially and reversibly to the primary site. Thus, Asp-161 in the flexible loop L1 of wild-type RecA determines the preference for single-stranded DNA-binding to the primary site and regulates the DNA-binding order in RecA-catalyzed recombinase reactions. PMID:25561575

  3. Vital Roles of the Second DNA-binding Site of Rad52 Protein in Yeast Homologous Recombination*

    PubMed Central

    Arai, Naoto; Kagawa, Wataru; Saito, Kengo; Shingu, Yoshinori; Mikawa, Tsutomu; Kurumizaka, Hitoshi; Shibata, Takehiko

    2011-01-01

    RecA/Rad51 proteins are essential in homologous DNA recombination and catalyze the ATP-dependent formation of D-loops from a single-stranded DNA and an internal homologous sequence in a double-stranded DNA. RecA and Rad51 require a “recombination mediator” to overcome the interference imposed by the prior binding of single-stranded binding protein/replication protein A to the single-stranded DNA. Rad52 is the prototype of recombination mediators, and the human Rad52 protein has two distinct DNA-binding sites: the first site binds to single-stranded DNA, and the second site binds to either double- or single-stranded DNA. We previously showed that yeast Rad52 extensively stimulates Rad51-catalyzed D-loop formation even in the absence of replication protein A, by forming a 2:1 stoichiometric complex with Rad51. However, the precise roles of Rad52 and Rad51 within the complex are unknown. In the present study, we constructed yeast Rad52 mutants in which the amino acid residues corresponding to the second DNA-binding site of the human Rad52 protein were replaced with either alanine or aspartic acid. We found that the second DNA-binding site is important for the yeast Rad52 function in vivo. Rad51-Rad52 complexes consisting of these Rad52 mutants were defective in promoting the formation of D-loops, and the ability of the complex to associate with double-stranded DNA was specifically impaired. Our studies suggest that Rad52 within the complex associates with double-stranded DNA to assist Rad51-mediated homologous pairing. PMID:21454474

  4. Amino acids 16-275 of minute virus of mice NS1 include a domain that specifically binds (ACCA)2-3-containing DNA.

    PubMed

    Mouw, M; Pintel, D J

    1998-11-10

    GST-NS1 purified from Escherichia coli and insect cells binds double-strand DNA in an (ACCA)2-3-dependent fashion under similar ionic conditions, independent of the presence of anti-NS1 antisera or exogenously supplied ATP and interacts with single-strand DNA and RNA in a sequence-independent manner. An amino-terminal domain (amino acids 1-275) of NS1 [GST-NS1(1-275)], representing 41% of the full-length NS1 molecule, includes a domain that binds double-strand DNA in a sequence-specific manner at levels comparable to full-length GST-NS1, as well as single-strand DNA and RNA in a sequence-independent manner. The deletion of 15 additional amino-terminal amino acids yielded a molecule [GST-NS1(1-275)] that maintained (ACCA)2-3-specific double-strand DNA binding; however, this molecule was more sensitive to increasing ionic conditions than full-length GST-NS1 and GST-NS1(1-275) and could not be demonstrated to bind single-strand nucleic acids. A quantitative filter binding assay showed that E. coli- and baculovirus-expressed GST-NS1 and E. coli GST-NS1(1-275) specifically bound double-strand DNA with similar equilibrium kinetics [as measured by their apparent equilibrium DNA binding constants (KD)], whereas GST-NS1(16-275) bound 4- to 8-fold less well. Copyright 1998 Academic Press.

  5. Cryptic MCAT enhancer regulation in fibroblasts and smooth muscle cells. Suppression of TEF-1 mediated activation by the single-stranded DNA-binding proteins, Pur alpha, Pur beta, and MSY1.

    PubMed

    Carlini, Leslie E; Getz, Michael J; Strauch, Arthur R; Kelm, Robert J

    2002-03-08

    An asymmetric polypurine-polypyrimidine cis-element located in the 5' region of the mouse vascular smooth muscle alpha-actin gene serves as a binding site for multiple proteins with specific affinity for either single- or double-stranded DNA. Here, we test the hypothesis that single-stranded DNA-binding proteins are responsible for preventing a cryptic MCAT enhancer centered within this element from cooperating with a nearby serum response factor-interacting CArG motif to trans-activate the minimal promoter in fibroblasts and smooth muscle cells. DNA binding studies revealed that the core MCAT sequence mediates binding of transcription enhancer factor-1 to the double-stranded polypurine-polypyrimidine element while flanking nucleotides account for interaction of Pur alpha and Pur beta with the purine-rich strand and MSY1 with the complementary pyrimidine-rich strand. Mutations that selectively impaired high affinity single-stranded DNA binding by fibroblast or smooth muscle cell-derived Pur alpha, Pur beta, and MSY1 in vitro, released the cryptic MCAT enhancer from repression in transfected cells. Additional experiments indicated that Pur alpha, Pur beta, and MSY1 also interact specifically, albeit weakly, with double-stranded DNA and with transcription enhancer factor-1. These results are consistent with two plausible models of cryptic MCAT enhancer regulation by Pur alpha, Pur beta, and MSY1 involving either competitive single-stranded DNA binding or masking of MCAT-bound transcription enhancer factor-1.

  6. Comparison between TRF2 and TRF1 of their telomeric DNA-bound structures and DNA-binding activities

    PubMed Central

    Hanaoka, Shingo; Nagadoi, Aritaka; Nishimura, Yoshifumi

    2005-01-01

    Mammalian telomeres consist of long tandem arrays of double-stranded telomeric TTAGGG repeats packaged by the telomeric DNA-binding proteins TRF1 and TRF2. Both contain a similar C-terminal Myb domain that mediates sequence-specific binding to telomeric DNA. In a DNA complex of TRF1, only the single Myb-like domain consisting of three helices can bind specifically to double-stranded telomeric DNA. TRF2 also binds to double-stranded telomeric DNA. Although the DNA binding mode of TRF2 is likely identical to that of TRF1, TRF2 plays an important role in the t-loop formation that protects the ends of telomeres. Here, to clarify the details of the double-stranded telomeric DNA-binding modes of TRF1 and TRF2, we determined the solution structure of the DNA-binding domain of human TRF2 bound to telomeric DNA; it consists of three helices, and like TRF1, the third helix recognizes TAGGG sequence in the major groove of DNA with the N-terminal arm locating in the minor groove. However, small but significant differences are observed; in contrast to the minor groove recognition of TRF1, in which an arginine residue recognizes the TT sequence, a lysine residue of TRF2 interacts with the TT part. We examined the telomeric DNA-binding activities of both DNA-binding domains of TRF1 and TRF2 and found that TRF1 binds more strongly than TRF2. Based on the structural differences of both domains, we created several mutants of the DNA-binding domain of TRF2 with stronger binding activities compared to the wild-type TRF2. PMID:15608118

  7. The Fanconi anemia associated protein FAAP24 uses two substrate specific binding surfaces for DNA recognition

    PubMed Central

    Wienk, Hans; Slootweg, Jack C.; Speerstra, Sietske; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

    2013-01-01

    To maintain the integrity of the genome, multiple DNA repair systems exist to repair damaged DNA. Recognition of altered DNA, including bulky adducts, pyrimidine dimers and interstrand crosslinks (ICL), partially depends on proteins containing helix-hairpin-helix (HhH) domains. To understand how ICL is specifically recognized by the Fanconi anemia proteins FANCM and FAAP24, we determined the structure of the HhH domain of FAAP24. Although it resembles other HhH domains, the FAAP24 domain contains a canonical hairpin motif followed by distorted motif. The HhH domain can bind various DNA substrates; using nuclear magnetic resonance titration experiments, we demonstrate that the canonical HhH motif is required for double-stranded DNA (dsDNA) binding, whereas the unstructured N-terminus can interact with single-stranded DNA. Both DNA binding surfaces are used for binding to ICL-like single/double-strand junction-containing DNA substrates. A structural model for FAAP24 bound to dsDNA has been made based on homology with the translesion polymerase iota. Site-directed mutagenesis, sequence conservation and charge distribution support the dsDNA-binding model. Analogous to other HhH domain-containing proteins, we suggest that multiple FAAP24 regions together contribute to binding to single/double-strand junction, which could contribute to specificity in ICL DNA recognition. PMID:23661679

  8. C60 fullerene binding to DNA

    NASA Astrophysics Data System (ADS)

    Alshehri, Mansoor H.; Cox, Barry J.; Hill, James M.

    2014-09-01

    Fullerenes have attracted considerable attention in various areas of science and technology. Owing to their exceptional physical, chemical, and biological properties, they have many applications, particularly in cosmetic and medical products. Using the Lennard-Jones 6-12 potential function and the continuum approximation, which assumes that intermolecular interactions can be approximated by average atomic surface densities, we determine the binding energies of a C60 fullerene with respect to both single-strand and double-strand DNA molecules. We assume that all configurations are in a vacuum and that the C60 fullerene is initially at rest. Double integrals are performed to determine the interaction energy of the system. We find that the C60 fullerene binds to the double-strand DNA molecule, at either the major or minor grooves, with binding energies of -4.7 eV or -2.3 eV, respectively, and that the C60 molecule binds to the single-strand DNA molecule with a binding energy of -1.6 eV. Our results suggest that the C60 molecule is most likely to be linked to the major groove of the dsDNA molecule.

  9. Solution structure of CEH-37 homeodomain of the nematode Caenorhabditis elegans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moon, Sunjin; Lee, Yong Woo; Kim, Woo Taek

    Highlights: •We have determined solution structures of CEH-37 homedomain. •CEH-37 HD has a compact α-helical structure with HTH DNA binding motif. •Solution structure of CEH-37 HD shares its molecular topology with that of the homeodomain proteins. •Residues in the N-terminal region and HTH motif are important in binding to Caenorhabditis elegans telomeric DNA. •CEH-37 could play an important role in telomere function via DNA binding. -- Abstract: The nematode Caenorhabditis elegans protein CEH-37 belongs to the paired OTD/OTX family of homeobox-containing homeodomain proteins. CEH-37 shares sequence similarity with homeodomain proteins, although it specifically binds to double-stranded C. elegans telomeric DNA,more » which is unusual to homeodomain proteins. Here, we report the solution structure of CEH-37 homeodomain and molecular interaction with double-stranded C. elegans telomeric DNA using nuclear magnetic resonance (NMR) spectroscopy. NMR structure shows that CEH-37 homeodomain is composed of a flexible N-terminal region and three α-helices with a helix-turn-helix (HTH) DNA binding motif. Data from size-exclusion chromatography and fluorescence spectroscopy reveal that CEH-37 homeodomain interacts strongly with double-stranded C. elegans telomeric DNA. NMR titration experiments identified residues responsible for specific binding to nematode double-stranded telomeric DNA. These results suggest that C. elegans homeodomain protein, CEH-37 could play an important role in telomere function via DNA binding.« less

  10. Structure of an XPF endonuclease with and without DNA suggests a model for substrate recognition

    PubMed Central

    Newman, Matthew; Murray-Rust, Judith; Lally, John; Rudolf, Jana; Fadden, Andrew; Knowles, Philip P; White, Malcolm F; McDonald, Neil Q

    2005-01-01

    The XPF/Mus81 structure-specific endonucleases cleave double-stranded DNA (dsDNA) within asymmetric branched DNA substrates and play an essential role in nucleotide excision repair, recombination and genome integrity. We report the structure of an archaeal XPF homodimer alone and bound to dsDNA. Superposition of these structures reveals a large domain movement upon binding DNA, indicating how the (HhH)2 domain and the nuclease domain are coupled to allow the recognition of double-stranded/single-stranded DNA junctions. We identify two nonequivalent DNA-binding sites and propose a model in which XPF distorts the 3′ flap substrate in order to engage both binding sites and promote strand cleavage. The model rationalises published biochemical data and implies a novel role for the ERCC1 subunit of eukaryotic XPF complexes. PMID:15719018

  11. Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert

    Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This alsomore » represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.« less

  12. Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase

    DOE PAGES

    Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert; ...

    2015-06-02

    Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This alsomore » represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.« less

  13. Triple Helix Formation in a Topologically Controlled DNA Nanosystem.

    PubMed

    Yamagata, Yutaro; Emura, Tomoko; Hidaka, Kumi; Sugiyama, Hiroshi; Endo, Masayuki

    2016-04-11

    In the present study, we demonstrate single-molecule imaging of triple helix formation in DNA nanostructures. The binding of the single-molecule third strand to double-stranded DNA in a DNA origami frame was examined using two different types of triplet base pairs. The target DNA strand and the third strand were incorporated into the DNA frame, and the binding of the third strand was controlled by the formation of Watson-Crick base pairing. Triple helix formation was monitored by observing the structural changes in the incorporated DNA strands. It was also examined using a photocaged third strand wherein the binding of the third strand was directly observed using high-speed atomic force microscopy during photoirradiation. We found that the binding of the third strand could be controlled by regulating duplex formation and the uncaging of the photocaged strands in the designed nanospace. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. DNA purification by triplex-affinity capture and affinity capture electrophoresis

    DOEpatents

    Cantor, Charles R.; Ito, Takashi; Smith, Cassandra L.

    1996-01-01

    The invention provides a method for purifying or isolating double stranded DNA intact using triple helix formation. The method includes the steps of complexing an oligonucleotide and double stranded DNA to generate a triple helix and immobilization of the triple helix on a solid phase by means of a molecular recognition system such as avidin/biotin. The purified DNA is then recovered intact by treating the solid phase with a reagent that breaks the bonds between the oligonucleotide and the intact double stranded DNA while not affecting the Watson-Crick base pairs of the double helix. The present invention also provides a method for purifying or isolating double stranded DNA intact by complexing the double stranded DNA with a specific binding partner and recovering the complex during electrophoresis by immobilizing it on a solid phase trap imbedded in an electrophoretic gel.

  15. The adsorption-desorption transition of double-stranded DNA interacting with an oppositely charged dendrimer induced by multivalent anions.

    PubMed

    Jiang, Yangwei; Zhang, Dong; Zhang, Yaoyang; Deng, Zhenyu; Zhang, Linxi

    2014-05-28

    The adsorption-desorption transition of DNA in DNA-dendrimer solutions is observed when high-valence anions, such as hexavalent anions, are added to the DNA-dendrimer solutions. In the DNA-dendrimer solutions with low-valence anions, dendrimers bind tightly with the V-shaped double-stranded DNA. When high-valence anions, such as pentavalent or hexavalent anions, are added to the DNA-dendrimer solutions, the double-stranded DNA chains can be stretched straightly and the dendrimers are released from the double-stranded DNA chains. In fact, adding high-valence anions to the solutions can change the charge spatial distribution in the DNA-dendrimer solutions, and weaken the electrostatic interactions between the positively charged dendrimers and the oppositely charged DNA chains. Adsorption-desorption transition of DNA is induced by the overcharging of dendrimers. This investigation is capable of helping us understand how to control effectively the release of DNA in gene/drug delivery because an effective gene delivery for dendrimers includes non-covalent DNA-dendrimer binding and the effective release of DNA in gene therapy.

  16. DNA purification by triplex-affinity capture and affinity capture electrophoresis

    DOEpatents

    Cantor, C.R.; Ito, Takashi; Smith, C.L.

    1996-01-09

    The invention provides a method for purifying or isolating double stranded DNA intact using triple helix formation. The method includes the steps of complexing an oligonucleotide and double stranded DNA to generate a triple helix and immobilization of the triple helix on a solid phase by means of a molecular recognition system such as avidin/biotin. The purified DNA is then recovered intact by treating the solid phase with a reagent that breaks the bonds between the oligonucleotide and the intact double stranded DNA while not affecting the Watson-Crick base pairs of the double helix. The present invention also provides a method for purifying or isolating double stranded DNA intact by complexing the double stranded DNA with a specific binding partner and recovering the complex during electrophoresis by immobilizing it on a solid phase trap imbedded in an electrophoretic gel. 6 figs.

  17. Lipophilic oligonucleotides spontaneously insert into lipid membranes, bind complementary DNA strands, and sequester into lipid-disordered domains.

    PubMed

    Bunge, Andreas; Kurz, Anke; Windeck, Anne-Kathrin; Korte, Thomas; Flasche, Wolfgang; Liebscher, Jürgen; Herrmann, Andreas; Huster, Daniel

    2007-04-10

    For the development of surface functionalized bilayers, we have synthesized lipophilic oligonucleotides to combine the molecular recognition mechanism of nucleic acids and the self-assembly characteristics of lipids in planar membranes. A lipophilic oligonucleotide consisting of 21 thymidine units and two lipophilic nucleotides with an alpha-tocopherol moiety as a lipophilic anchor was synthesized using solid-phase methods with a phosphoramadite strategy. The interaction of the water soluble lipophilic oligonucleotide with vesicular lipid membranes and its capability to bind complementary DNA strands was studied using complementary methods such as NMR, EPR, DSC, fluorescence spectroscopy, and fluorescence microscopy. This oligonucleotide inserted stably into preformed membranes from the aqueous phase. Thereby, no significant perturbation of the lipid bilayer and its stability was observed. However, the non-lipidated end of the oligonucleotide is exposed to the aqueous environment, is relatively mobile, and is free to interact with complementary DNA strands. Binding of the complementary single-stranded DNA molecules is fast and accomplished by the formation of Watson-Crick base pairs, which was confirmed by 1H NMR chemical shift analysis and fluorescence resonance energy transfer. The molecular structure of the membrane bound DNA double helix is very similar to the free double-stranded DNA. Further, the membrane bound DNA double strands also undergo regular melting. Finally, in raft-like membrane mixtures, the lipophilic oligonucleotide was shown to preferentially sequester into liquid-disordered membrane domains.

  18. Why double-stranded RNA resists condensation

    PubMed Central

    Tolokh, Igor S.; Pabit, Suzette A.; Katz, Andrea M.; Chen, Yujie; Drozdetski, Aleksander; Baker, Nathan; Pollack, Lois; Onufriev, Alexey V.

    2014-01-01

    The addition of small amounts of multivalent cations to solutions containing double-stranded DNA leads to inter-DNA attraction and eventual condensation. Surprisingly, the condensation is suppressed in double-stranded RNA, which carries the same negative charge as DNA, but assumes a different double helical form. Here, we combine experiment and atomistic simulations to propose a mechanism that explains the variations in condensation of short (25 base-pairs) nucleic acid (NA) duplexes, from B-like form of homopolymeric DNA, to mixed sequence DNA, to DNA:RNA hybrid, to A-like RNA. Circular dichroism measurements suggest that duplex helical geometry is not the fundamental property that ultimately determines the observed differences in condensation. Instead, these differences are governed by the spatial variation of cobalt hexammine (CoHex) binding to NA. There are two major NA-CoHex binding modes—internal and external—distinguished by the proximity of bound CoHex to the helical axis. We find a significant difference, up to 5-fold, in the fraction of ions bound to the external surfaces of the different NA constructs studied. NA condensation propensity is determined by the fraction of CoHex ions in the external binding mode. PMID:25123663

  19. RAP80, ubiquitin and SUMO in the DNA damage response.

    PubMed

    Lombardi, Patrick M; Matunis, Michael J; Wolberger, Cynthia

    2017-08-01

    A decade has passed since the first reported connection between RAP80 and BRCA1 in DNA double-strand break repair. Despite the initial identification of RAP80 as a factor localizing BRCA1 to DNA double-strand breaks and potentially promoting homologous recombination, there is increasing evidence that RAP80 instead suppresses homologous recombination to fine-tune the balance of competing DNA repair processes during the S/G 2 phase of the cell cycle. RAP80 opposes homologous recombination by inhibiting DNA end-resection and sequestering BRCA1 into the BRCA1-A complex. Ubiquitin and SUMO modifications of chromatin at DNA double-strand breaks recruit RAP80, which contains distinct sequence motifs that recognize ubiquitin and SUMO. Here, we review RAP80's role in repressing homologous recombination at DNA double-strand breaks and how this role is facilitated by its ability to bind ubiquitin and SUMO modifications.

  20. The occurrence of antibodies against single-stranded DNA in the sera of patients with acute and chronic leukaemia.

    PubMed Central

    Izui, S; Lambert, P H; Carpentier, N; Miescher, P A

    1976-01-01

    One hundred and seventy-five sera from thirty-three patients with acute myeloid leukaemia, forty-two patients with chronic myeloid leukaemia and twelve patients with acute lymphatic leukaemia were examined by a radioimmunological technique for the presence of antibodies against single-stranded and double-stranded DNA. The levels of single-stranded DNA binding activity was significantly higher in all three types of leukaemia compared to those of healthy controls. In contrast, none of these sera exhibited a positive reaction with double-stranded DNA. In some cases the level of serum anti-DNA antibodies increased after the decrease of the leucocyte count. The presence of anti-DNA antibodies in leukaemic patients may have some biological significance. PMID:780020

  1. Effect of Escherichia coli DNA binding protein on the transcription of single-stranded phage M13 DNA by Escherichia coli RNA polymerase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Niyogi, S.K.; Ratrie, H. III; Datta, A.K.

    E. coli DNA binding protein strongly inhibits the transcription of single-stranded rather than double-stranded phage M13 DNA by E. coli RNA polymerase. This inhibition cannot be significantly overcome by increasing the concentration of RNA polymerase. Nor does the order of addition of binding protein affect its inhibitory property: inhibition is evident whether binding protein is added before or after the formation of the RNA polymerase--DNA complex. Inhibition is also observed if binding protein is added at various times after initiation of RNA synthesis. Maximal inhibition occurs at a binding protein-to-DNA ratio (w/w) of about 8:1. This corresponds to one bindingmore » protein molecule covering about 30 nucleotides, in good agreement with values obtained by physical measurements.« less

  2. IDN2 Interacts with RPA and Facilitates DNA Double-Strand Break Repair by Homologous Recombination in Arabidopsis.

    PubMed

    Liu, Mingming; Ba, Zhaoqing; Costa-Nunes, Pedro; Wei, Wei; Li, Lanxia; Kong, Fansi; Li, Yan; Chai, Jijie; Pontes, Olga; Qi, Yijun

    2017-03-01

    Repair of DNA double-strand breaks (DSBs) is critical for the maintenance of genome integrity. We previously showed that DSB-induced small RNAs (diRNAs) facilitate homologous recombination-mediated DSB repair in Arabidopsis thaliana Here, we show that INVOLVED IN DE NOVO2 (IDN2), a double-stranded RNA binding protein involved in small RNA-directed DNA methylation, is required for DSB repair in Arabidopsis. We find that IDN2 interacts with the heterotrimeric replication protein A (RPA) complex. Depletion of IDN2 or the diRNA binding ARGONAUTE2 leads to increased accumulation of RPA at DSB sites and mislocalization of the recombination factor RAD51. These findings support a model in which IDN2 interacts with RPA and facilitates the release of RPA from single-stranded DNA tails and subsequent recruitment of RAD51 at DSB sites to promote DSB repair. © 2017 American Society of Plant Biologists. All rights reserved.

  3. Biochemical analyses indicate that binding and cleavage specificities define the ordered processing of human Okazaki fragments by Dna2 and FEN1.

    PubMed

    Gloor, Jason W; Balakrishnan, Lata; Campbell, Judith L; Bambara, Robert A

    2012-08-01

    In eukaryotic Okazaki fragment processing, the RNA primer is displaced into a single-stranded flap prior to removal. Evidence suggests that some flaps become long before they are cleaved, and that this cleavage involves the sequential action of two nucleases. Strand displacement characteristics of the polymerase show that a short gap precedes the flap during synthesis. Using biochemical techniques, binding and cleavage assays presented here indicate that when the flap is ∼ 30 nt long the nuclease Dna2 can bind with high affinity to the flap and downstream double strand and begin cleavage. When the polymerase idles or dissociates the Dna2 can reorient for additional contacts with the upstream primer region, allowing the nuclease to remain stably bound as the flap is further shortened. The DNA can then equilibrate to a double flap that can bind Dna2 and flap endonuclease (FEN1) simultaneously. When Dna2 shortens the flap even more, FEN1 can displace the Dna2 and cleave at the flap base to make a nick for ligation.

  4. Binding to the minor groove of the double-strand, tau protein prevents DNA from damage by peroxidation.

    PubMed

    Wei, Yan; Qu, Mei-Hua; Wang, Xing-Sheng; Chen, Lan; Wang, Dong-Liang; Liu, Ying; Hua, Qian; He, Rong-Qiao

    2008-07-02

    Tau, an important microtubule associated protein, has been found to bind to DNA, and to be localized in the nuclei of both neurons and some non-neuronal cells. Here, using electrophoretic mobility shifting assay (EMSA) in the presence of DNA with different chain-lengths, we observed that tau protein favored binding to a 13 bp or a longer polynucleotide. The results from atomic force microscopy also showed that tau protein preferred a 13 bp polynucleotide to a 12 bp or shorter polynucleotide. In a competitive assay, a minor groove binder distamycin A was able to replace the bound tau from the DNA double helix, indicating that tau protein binds to the minor groove. Tau protein was able to protect the double-strand from digestion in the presence of DNase I that was bound to the minor groove. On the other hand, a major groove binder methyl green as a negative competitor exhibited little effect on the retardation of tau-DNA complex in EMSA. This further indicates the DNA minor groove as the binding site for tau protein. EMSA with truncated tau proteins showed that both the proline-rich domain (PRD) and the microtubule-binding domain (MTBD) contributed to the interaction with DNA; that is to say, both PRD and MTBD bound to the minor groove of DNA and bent the double-strand, as observed by electron microscopy. To investigate whether tau protein is able to prevent DNA from the impairment by hydroxyl free radical, the chemiluminescence emitted by the phen-Cu/H(2)O(2)/ascorbate was measured. The emission intensity of the luminescence was markedly decreased when tau protein was present, suggesting a significant protection of DNA from the damage in the presence of hydroxyl free radical.

  5. RecA binding to a single double-stranded DNA molecule: A possible role of DNA conformational fluctuations

    PubMed Central

    Leger, J. F.; Robert, J.; Bourdieu, L.; Chatenay, D.; Marko, J. F.

    1998-01-01

    Most genetic regulatory mechanisms involve protein–DNA interactions. In these processes, the classical Watson–Crick DNA structure sometimes is distorted severely, which in turn enables the precise recognition of the specific sites by the protein. Despite its key importance, very little is known about such deformation processes. To address this general question, we have studied a model system, namely, RecA binding to double-stranded DNA. Results from micromanipulation experiments indicate that RecA binds strongly to stretched DNA; based on this observation, we propose that spontaneous thermal stretching fluctuations may play a role in the binding of RecA to DNA. This has fundamental implications for the protein–DNA binding mechanism, which must therefore rely in part on a combination of flexibility and thermal fluctuations of the DNA structure. We also show that this mechanism is sequence sensitive. Theoretical simulations support this interpretation of our experimental results, and it is argued that this is of broad relevance to DNA–protein interactions. PMID:9770480

  6. Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy

    NASA Astrophysics Data System (ADS)

    Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.

    2016-03-01

    We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e

  7. 5-Hydroxymethylcytosine in E-box motifs ACAT|GTG and ACAC|GTG increases DNA-binding of the B-HLH transcription factor TCF4.

    PubMed

    Khund-Sayeed, Syed; He, Ximiao; Holzberg, Timothy; Wang, Jun; Rajagopal, Divya; Upadhyay, Shriyash; Durell, Stewart R; Mukherjee, Sanjit; Weirauch, Matthew T; Rose, Robert; Vinson, Charles

    2016-09-12

    We evaluated DNA binding of the B-HLH family members TCF4 and USF1 using protein binding microarrays (PBMs) containing double-stranded DNA probes with cytosine on both strands or 5-methylcytosine (5mC) or 5-hydroxymethylcytosine (5hmC) on one DNA strand and cytosine on the second strand. TCF4 preferentially bound the E-box motif (CAN|NTG) with strongest binding to the 8-mer CAG|GTGGT. 5mC uniformly decreases DNA binding of both TCF4 and USF1. The bulkier 5hmC also inhibited USF1 binding to DNA. In contrast, 5hmC dramatically enhanced TCF4 binding to E-box motifs ACAT|GTG and ACAC|GTG, being better bound than any 8-mer containing cytosine. Examination of X-ray structures of the closely related TCF3 and USF1 bound to DNA suggests TCF3 can undergo a conformational shift to preferentially bind to 5hmC while the USF1 basic region is bulkier and rigid precluding a conformation shift to bind 5hmC. These results greatly expand the regulatory DNA sequence landscape bound by TCF4.

  8. Deinococcus radiodurans RecA nucleoprotein filaments characterized at the single-molecule level with optical tweezers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pobegalov, Georgii, E-mail: george.pobegalov@nanobio.spbstu.ru; Cherevatenko, Galina; Alekseev, Aleksandr

    2015-10-23

    Deinococcus radiodurans can survive extreme doses of ionizing radiation due to the very efficient DNA repair mechanisms that are able to cope even with hundreds of double-strand breaks. RecA, the critical protein of homologous recombination in bacteria, is one of the key components of the DNA-repair system. Repair of double-strand breaks requires RecA binding to DNA and assembly of the RecA nucleoprotein helical filaments. The Escherichia coli RecA protein (EcRecA) and its interactions with DNA have been extensively studied using various approaches including single-molecule techniques, while the D. radiodurans RecA (DrRecA) remains much less characterized. However, DrRecA shows some remarkable differencesmore » from E. coli homolog. Here we combine microfluidics and single-molecule DNA manipulation with optical tweezers to follow the binding of DrRecA to long double-stranded DNA molecules and probe the mechanical properties of DrRecA nucleoprotein filaments at physiological pH. Our data provide a direct comparison of DrRecA and EcRecA binding to double-stranded DNA under identical conditions. We report a significantly faster filaments assembly as well as lower values of persistence length and contour length for DrRecA nucleoprotein filaments compared to EcRecA. Our results support the existing model of DrRecA forming more frequent and less continuous filaments relative to those of EcRecA. - Highlights: • We investigate Deinococcus radiodurans RecA interactions with long double-stranded DNA at the single-molecule level. • At physiological pH D. radiodurans RecA forms nucleoprotein filaments significantly faster relative to Escherichia coli RecA. • D. radiodurans RecA-dsDNA nucleoprotein filaments are more flexible and slightly shorter compared to those of E. coli RecA.« less

  9. Mismatch repair factor MSH2-MSH3 binds and alters the conformation of branched DNA structures predicted to form during genetic recombination.

    PubMed

    Surtees, Jennifer A; Alani, Eric

    2006-07-14

    Genetic studies in Saccharomyces cerevisiae predict that the mismatch repair (MMR) factor MSH2-MSH3 binds and stabilizes branched recombination intermediates that form during single strand annealing and gene conversion. To test this model, we constructed a series of DNA substrates that are predicted to form during these recombination events. We show in an electrophoretic mobility shift assay that S. cerevisiae MSH2-MSH3 specifically binds branched DNA substrates containing 3' single-stranded DNA and that ATP stimulates its release from these substrates. Chemical footprinting analyses indicate that MSH2-MSH3 specifically binds at the double-strand/single-strand junction of branched substrates, alters its conformation and opens up the junction. Therefore, MSH2-MSH3 binding to its substrates creates a unique nucleoprotein structure that may signal downstream steps in repair that include interactions with MMR and nucleotide excision repair factors.

  10. Characterization of the interaction of yeast enolase with polynucleotides.

    PubMed

    al-Giery, A G; Brewer, J M

    1992-09-23

    Yeast enolase is inhibited under certain conditions by DNA. The enzyme binds to single-stranded DNA-cellulose. Inhibition was used for routine characterization of the interaction. The presence of the substrate 2-phospho-D-glycerate reduces inhibition and binding. Both yeast enolase isozymes behave similarly. Impure yeast enolase was purified by adsorption onto a single-stranded DNA-cellulose column followed by elution with substrate. Interaction with RNA, double-stranded DNA, or degraded DNA results in less inhibition, suggesting that yeast enolase preferentially binds single-stranded DNA. However, yeast enolase is not a DNA-unwinding protein. The enzyme is inhibited by the short synthetic oligodeoxynucleotides G6, G8 and G10 but not T8 or T6, suggesting some base specificity in the interaction. The interaction is stronger at more acid pH values, with an apparent pK of 5.6. The interaction is prevented by 0.3 M KCl, suggesting that electrostatic factors are important. Histidine or lysine reverse the inhibition at lower concentrations, while phosphate is still more effective. Binding of single-stranded DNA to enolase reduces the reaction of protein histidyl residues with diethylpyrocarbonate. The inhibition of yeast enolase by single-stranded DNA is not total, and suggests the active site is not directly involved in the interaction. Binding of substrate may induce a conformational change in the enzyme that interferes with DNA binding and vice versa.

  11. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    PubMed

    Fornander, Louise H; Frykholm, Karolin; Reymer, Anna; Renodon-Cornière, Axelle; Takahashi, Masayuki; Nordén, Bengt

    2012-06-01

    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

  12. Purification and general properties of the DNA-binding protein (P16) from rat liver mitochondria.

    PubMed

    Pavco, P A; Van Tuyle, G C

    1985-01-01

    The mitochondrial DNA-binding protein P16 was isolated from rat liver mitochondrial lysates by affinity chromatography on single strand DNA agarose and separated from DNA in the preparation by alkaline CsCl isopycnic gradients. The top fraction of the gradients contained a single polypeptide species (Mr approximately equal to 15,200) based upon SDS PAGE. Digestion of single strand DNA-bound P16 with proteinase K produced a protease-insensitive, DNA-binding fragment (Mr approximately equal to 6,000) that has been purified by essentially the same procedures used for intact P16. The partial amino acid compositions for P16 and the DNA-binding fragment were obtained by conventional methods. Analysis of subcellular fractions revealed that nearly all of the cellular P16 was located in the mitochondria and that only trace amounts of protein of comparable electrophoretic mobility could be isolated from the nuclear or cytoplasmic fractions. The labeling of P16 with [35S]methionine in primary rat hepatocyte cultures was inhibited by more than 90% by the cytoplasmic translation inhibitor cycloheximide, but unaffected by the mitochondrial-specific agent chloramphenicol. These results indicate that P16 is synthesized on cytoplasmic ribosomes and imported into the mitochondria. The addition of purified P16 to deproteinized mitochondrial DNA resulted in the complete protection of the labeled nascent strands of displacement loops against branch migrational loss during cleavage of parental DNA with SstI, thus providing strong evidence that P16 is the single entity required for this in vitro function. Incubation of P16 with single strand phi X174 DNA, double strand (RF) phi X174 DNA, or Escherichia coli ribosomal RNA and subsequent analysis of the nucleic acid species for bound protein indicated a strong preference of P16 for single strand DNA and no detectable affinity for RNA or double strand DNA. Examination of P16-single strand phi X174 DNA complexes by direct electron microscopy revealed thickened, irregular fibers characteristic of protein-associated single strand DNA.

  13. Molecular cloning of MSSP-2, a c-myc gene single-strand binding protein: characterization of binding specificity and DNA replication activity.

    PubMed Central

    Takai, T; Nishita, Y; Iguchi-Ariga, S M; Ariga, H

    1994-01-01

    We have previously reported the human cDNA encoding MSSP-1, a sequence-specific double- and single-stranded DNA binding protein [Negishi, Nishita, Saëgusa, Kakizaki, Galli, Kihara, Tamai, Miyajima, Iguchi-Ariga and Ariga (1994) Oncogene, 9, 1133-1143]. MSSP-1 binds to a DNA replication origin/transcriptional enhancer of the human c-myc gene and has turned out to be identical with Scr2, a human protein which complements the defect of cdc2 kinase in S.pombe [Kataoka and Nojima (1994) Nucleic Acid Res., 22, 2687-2693]. We have cloned the cDNA for MSSP-2, another member of the MSSP family of proteins. The MSSP-2 cDNA shares highly homologous sequences with MSSP-1 cDNA, except for the insertion of 48 bp coding 16 amino acids near the C-terminus. Like MSSP-1, MSSP-2 has RNP-1 consensus sequences. The results of the experiments using bacterially expressed MSSP-2, and its deletion mutants, as histidine fusion proteins suggested that the binding specificity of MSSP-2 to double- and single-stranded DNA is the same as that of MSSP-1, and that the RNP consensus sequences are required for the DNA binding of the protein. MSSP-2 stimulated the DNA replication of an SV40-derived plasmid containing the binding sequence for MSSP-1 or -2. MSSP-2 is hence suggested to play an important role in regulation of DNA replication. Images PMID:7838710

  14. RPA binds histone H3-H4 and functions in DNA replication-coupled nucleosome assembly.

    PubMed

    Liu, Shaofeng; Xu, Zhiyun; Leng, He; Zheng, Pu; Yang, Jiayi; Chen, Kaifu; Feng, Jianxun; Li, Qing

    2017-01-27

    DNA replication-coupled nucleosome assembly is essential to maintain genome integrity and retain epigenetic information. Multiple involved histone chaperones have been identified, but how nucleosome assembly is coupled to DNA replication remains elusive. Here we show that replication protein A (RPA), an essential replisome component that binds single-stranded DNA, has a role in replication-coupled nucleosome assembly. RPA directly binds free H3-H4. Assays using a synthetic sequence that mimics freshly unwound single-stranded DNA at replication fork showed that RPA promotes DNA-(H3-H4) complex formation immediately adjacent to double-stranded DNA. Further, an RPA mutant defective in H3-H4 binding exhibited attenuated nucleosome assembly on nascent chromatin. Thus, we propose that RPA functions as a platform for targeting histone deposition to replication fork, through which RPA couples nucleosome assembly with ongoing DNA replication. Copyright © 2017, American Association for the Advancement of Science.

  15. The HTLV-1 Tax Oncoprotein Represses Ku80 Gene Expression

    PubMed Central

    Ducu, Razvan I.; Dayaram, Tajhal; Marriott, Susan J.

    2011-01-01

    The HTLV-I oncoprotein Tax interferes with DNA double strand break repair. Since non-homologous end joining (NHEJ) is a major pathway used to repair DNA double strand breaks we examined the effect of Tax on this pathway, with particular interest in the expression and function of Ku80, a critical component of the NHEJ pathway. Tax expression decreased Ku80 mRNA and protein levels, and repressed transcription from the Ku80 promoter. Conversely, Ku80 mRNA increased following siRNA knockdown of Tax in HTLV-I infected cells. Tax expression was associated with an elevated number of micronuclei and nucleoplasmic bridges, hallmarks of improper DNA double strand break repair. Our studies identified Tax as a transcriptional repressor of Ku80 that correlates with decreased DNA repair function. The reduction of Ku80 transcription by Tax may deplete the cell of an essential DNA break binding protein, resulting in reduced repair of DNA double strand breaks and accumulation genomic mutations. PMID:21571351

  16. Wing 1 of protein HOP2 is as important as helix 3 in DNA binding by MD simulation.

    PubMed

    Moktan, Hem; Zhou, Donghua H

    2018-05-01

    The repair of programmed DNA double-strand breaks through recombination is required for proper association and disjunction of the meiotic homologous chromosomes. Meiosis-specific protein HOP2 plays essential roles in recombination by promoting recombinase activities. The N-terminal domain of HOP2 interacts with DNA through helix 3 (H3) and wing 1 (W1). Mutations in wing 1 (Y65A/K67A/Q68A) slightly weakened the binding but mutations in helices 2 and 3 (Q30A/K44A/K49A) nearly abolished the binding. To better understand such differential effects at atomic level, molecular dynamics simulations were employed. Despite losing some hydrogen bonds, the W1-mutant DNA complex was rescued by stronger hydrophobic interactions. For the wild type and W1-mutant, the protein was found to slide along the DNA grooves as the DNA rolls along its double-helix axis. This motion could be functionally important to facilitate the precise positioning of the single-stranded DNA with the homologous double-stranded DNA. The sliding motion was reduced in the W1-mutant. The H-mutant nearly lost all intermolecular interactions. Moreover, an additional mutation in wing 1 (Y65A/K67A/Q68A/K69A) also caused complete complex dissociation. Therefore, both wing 1 and helix 3 make important contribution to the DNA binding, which could be important to the strand invasion function of HOP2 homodimer and HOP2-MND1 heterodimer. Similar to cocking a medieval crossbow with the archer's foot placed in the stirrup, wing 1 may push the minor groove to cause distortion while helix 3 grabs the major groove.

  17. Cyclic perylene diimide: Selective ligand for tetraplex DNA binding over double stranded DNA.

    PubMed

    Vasimalla, Suresh; Sato, Shinobu; Takenaka, Fuminori; Kurose, Yui; Takenaka, Shigeori

    2017-12-15

    Synthesized cyclic perylene diimide, cPDI, showed the binding constant of 6.3 × 10 6  M -1 with binding number of n = 2 with TA-core as a tetraplex DNA in 50 mM Tris-HCl buffer (pH = 7.4) containing 100 mM KCl using Schatchard analysis and showed a higher preference for tetraplex DNA than for double stranded DNA with over 10 3 times. CD spectra showed that TA-core induced its antiparallel conformation upon addition of cPDI in the absence or presence of K + or Na + ions. The cPDI inhibits the telomerase activity with IC 50 of 0.3 µM using TRAP assay which is potential anti-cancer drug with low side effect. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Investigating actinomycin D binding to G-quadruplex, i-motif and double-stranded DNA in 27-nt segment of c-MYC gene promoter.

    PubMed

    Niknezhad, Zhila; Hassani, Leila; Norouzi, Davood

    2016-01-01

    c-MYC DNA is an attractive target for drug design, especially for cancer chemotherapy. Around 90% of c-MYC transcription is controlled by NHE III1, whose 27-nt purine-rich strand has the ability to form G-quadruplex structure. In this investigation, interaction of ActD with 27-nt G-rich strand (G/c-MYC) and its equimolar mixture with the complementary sequence, (GC/c-MYC) as well as related C-rich oligonucleotide (C/c-MYC) was evaluated. Molecular dynamic simulations showed that phenoxazine and lactone rings of ActD come close to the outer G-tetrad nucleotides indicating that ActD binds through end-stacking to the quadruplex DNA. RMSD and RMSF revealed that fluctuation of the quadruplex DNA increases upon interaction with the drug. The results of spectrophotometry and spectrofluorometry indicated that ActD most probably binds to the c-MYC quadruplex and duplex DNA via end-stacking and intercalation, respectively and polarity of ActD environment decreases due to the interaction. It was also found that binding of ActD to the GC-rich DNA is stronger than the two other forms of DNA. Circular dichroism results showed that the type of the three forms of DNA structures doesn't change, but their compactness alters due to their interaction with ActD. Finally, it can be concluded that ActD binds differently to double stranded DNA, quadruplex DNA and i-motif. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Melting of DNA double strand after binding to geroprotective tetrapeptide.

    PubMed

    Khavinson, V Kh; Solovyov, A Yu; Shataeva, L K

    2008-11-01

    Experimental relationship between the hyperchromic effect of DNA [poly(dA-dT):poly(dA-dT)] interacting with Ala-Glu-Asp-Gly peptide is presented by a saturation isotherm. The free DNA double strand is melting (the strands separate) at 69.5 degrees C and at higher energy expenditures (enthalpy increase by 976.4 kJ/mol b.p.) in comparison with melting of the DNA-peptide complex (28 degrees C and 444.6 kJ/mol b.p.). The detected regularities of melting of duplex DNA and the thermodynamic parameters of this process indicate the natural mechanism of interaction between DNA and regulatory peptides underlying functioning of the living matter.

  20. Binding mode and thermodynamic studies on the interaction of the anticancer drug dacarbazine and dacarbazine-Cu(II) complex with single and double stranded DNA.

    PubMed

    Temerk, Yassien; Ibrahim, Hossieny

    2014-07-01

    The binding mode and thermodynamic characteristics of the anticancer drug dacarbazine (Dac) with double and single stranded DNA were investigated in the absence and presence of Cu(II) using cyclic voltammetry, square wave voltammetry and fluorescence spectroscopy. The interaction of Dac and Dac-Cu(II) complex with dsDNA indicated their intercalation into the base stacking domain of dsDNA double helix and the strength of interaction is independent on the ionic strength. The interaction of Dac with dsDNA in the presence of Cu(II) leads to a much stronger intercalation. The interaction mode of Dac molecules with ssDNA is electrostatic attraction via negative phosphate on the exterior of the ssDNA with Dac. The binding constants, stoichiometric coefficients and thermodynamic parameters of Dac and Dac-Cu(II) complex with dsDNA and ssDNA were evaluated. Comparison of the mode interaction of Dac with dsDNA and ssDNA was discussed. The decrease of peak current of Dac was proportional to DNA concentration, which was applied for determination of dsDNA and ssDNA concentration. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. IFI16 Preferentially Binds to DNA with Quadruplex Structure and Enhances DNA Quadruplex Formation.

    PubMed

    Hároníková, Lucia; Coufal, Jan; Kejnovská, Iva; Jagelská, Eva B; Fojta, Miroslav; Dvořáková, Petra; Muller, Petr; Vojtesek, Borivoj; Brázda, Václav

    2016-01-01

    Interferon-inducible protein 16 (IFI16) is a member of the HIN-200 protein family, containing two HIN domains and one PYRIN domain. IFI16 acts as a sensor of viral and bacterial DNA and is important for innate immune responses. IFI16 binds DNA and binding has been described to be DNA length-dependent, but a preference for supercoiled DNA has also been demonstrated. Here we report a specific preference of IFI16 for binding to quadruplex DNA compared to other DNA structures. IFI16 binds to quadruplex DNA with significantly higher affinity than to the same sequence in double stranded DNA. By circular dichroism (CD) spectroscopy we also demonstrated the ability of IFI16 to stabilize quadruplex structures with quadruplex-forming oligonucleotides derived from human telomere (HTEL) sequences and the MYC promotor. A novel H/D exchange mass spectrometry approach was developed to assess protein interactions with quadruplex DNA. Quadruplex DNA changed the IFI16 deuteration profile in parts of the PYRIN domain (aa 0-80) and in structurally identical parts of both HIN domains (aa 271-302 and aa 586-617) compared to single stranded or double stranded DNAs, supporting the preferential affinity of IFI16 for structured DNA. Our results reveal the importance of quadruplex DNA structure in IFI16 binding and improve our understanding of how IFI16 senses DNA. IFI16 selectivity for quadruplex structure provides a mechanistic framework for IFI16 in immunity and cellular processes including DNA damage responses and cell proliferation.

  2. BLM and RMI1 alleviate RPA inhibition of TopoIIIα decatenase activity.

    PubMed

    Yang, Jay; Bachrati, Csanad Z; Hickson, Ian D; Brown, Grant W

    2012-01-01

    RPA is a single-stranded DNA binding protein that physically associates with the BLM complex. RPA stimulates BLM helicase activity as well as the double Holliday junction dissolution activity of the BLM-topoisomerase IIIα complex. We investigated the effect of RPA on the ssDNA decatenase activity of topoisomerase IIIα. We found that RPA and other ssDNA binding proteins inhibit decatenation by topoisomerase IIIα. Complex formation between BLM, TopoIIIα, and RMI1 ablates inhibition of decatenation by ssDNA binding proteins. Together, these data indicate that inhibition by RPA does not involve species-specific interactions between RPA and BLM-TopoIIIα-RMI1, which contrasts with RPA modulation of double Holliday junction dissolution. We propose that topoisomerase IIIα and RPA compete to bind to single-stranded regions of catenanes. Interactions with BLM and RMI1 enhance toposiomerase IIIα activity, promoting decatenation in the presence of RPA.

  3. Inhibition mechanisms of hemoglobin, immunoglobulin G, and whole blood in digital and real-time PCR.

    PubMed

    Sidstedt, Maja; Hedman, Johannes; Romsos, Erica L; Waitara, Leticia; Wadsö, Lars; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter

    2018-04-01

    Blood samples are widely used for PCR-based DNA analysis in fields such as diagnosis of infectious diseases, cancer diagnostics, and forensic genetics. In this study, the mechanisms behind blood-induced PCR inhibition were evaluated by use of whole blood as well as known PCR-inhibitory molecules in both digital PCR and real-time PCR. Also, electrophoretic mobility shift assay was applied to investigate interactions between inhibitory proteins and DNA, and isothermal titration calorimetry was used to directly measure effects on DNA polymerase activity. Whole blood caused a decrease in the number of positive digital PCR reactions, lowered amplification efficiency, and caused severe quenching of the fluorescence of the passive reference dye 6-carboxy-X-rhodamine as well as the double-stranded DNA binding dye EvaGreen. Immunoglobulin G was found to bind to single-stranded genomic DNA, leading to increased quantification cycle values. Hemoglobin affected the DNA polymerase activity and thus lowered the amplification efficiency. Hemoglobin and hematin were shown to be the molecules in blood responsible for the fluorescence quenching. In conclusion, hemoglobin and immunoglobulin G are the two major PCR inhibitors in blood, where the first affects amplification through a direct effect on the DNA polymerase activity and quenches the fluorescence of free dye molecules, and the latter binds to single-stranded genomic DNA, hindering DNA polymerization in the first few PCR cycles. Graphical abstract PCR inhibition mechanisms of hemoglobin and immunoglobulin G (IgG). Cq quantification cycle, dsDNA double-stranded DNA, ssDNA single-stranded DNA.

  4. Modulation of the Pyrococcus abyssi NucS Endonuclease Activity by Replication Clamp at Functional and Structural Levels*

    PubMed Central

    Creze, Christophe; Ligabue, Alessio; Laurent, Sébastien; Lestini, Roxane; Laptenok, Sergey P.; Khun, Joelle; Vos, Marten H.; Czjzek, Mirjam; Myllykallio, Hannu; Flament, Didier

    2012-01-01

    Pyrococcus abyssi NucS is the founding member of a new family of structure-specific DNA endonucleases that interact with the replication clamp proliferating cell nuclear antigen (PCNA). Using a combination of small angle x-ray scattering and surface plasmon resonance analyses, we demonstrate the formation of a stable complex in solution, in which one molecule of the PabNucS homodimer binds to the outside surface of the PabPCNA homotrimer. Using fluorescent labels, PCNA is shown to increase the binding affinity of NucS toward single-strand/double-strand junctions on 5′ and 3′ flaps, as well as to modulate the cleavage specificity on the branched DNA structures. Our results indicate that the presence of a single major contact between the PabNucS and PabPCNA proteins, together with the complex-induced DNA bending, facilitate conformational flexibility required for specific cleavage at the single-strand/double-strand DNA junction. PMID:22431731

  5. Modulation of the Pyrococcus abyssi NucS endonuclease activity by replication clamp at functional and structural levels.

    PubMed

    Creze, Christophe; Ligabue, Alessio; Laurent, Sébastien; Lestini, Roxane; Laptenok, Sergey P; Khun, Joelle; Vos, Marten H; Czjzek, Mirjam; Myllykallio, Hannu; Flament, Didier

    2012-05-04

    Pyrococcus abyssi NucS is the founding member of a new family of structure-specific DNA endonucleases that interact with the replication clamp proliferating cell nuclear antigen (PCNA). Using a combination of small angle x-ray scattering and surface plasmon resonance analyses, we demonstrate the formation of a stable complex in solution, in which one molecule of the PabNucS homodimer binds to the outside surface of the PabPCNA homotrimer. Using fluorescent labels, PCNA is shown to increase the binding affinity of NucS toward single-strand/double-strand junctions on 5' and 3' flaps, as well as to modulate the cleavage specificity on the branched DNA structures. Our results indicate that the presence of a single major contact between the PabNucS and PabPCNA proteins, together with the complex-induced DNA bending, facilitate conformational flexibility required for specific cleavage at the single-strand/double-strand DNA junction.

  6. Why double-stranded RNA resists condensation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tolokh, Igor S.; Pabit, Suzette; Katz, Andrea M.

    2014-09-15

    The addition of small amounts of multivalent cations to solutions containing double-stranded DNA leads to attraction between the negatively charged helices and eventually to condensation. Surprisingly, this effect is suppressed in double-stranded RNA, which carries the same charge as the DNA, but assumes a different double helical form. However, additional characterization of short (25 base-pairs) nucleic acid (NA) duplex structures by circular dichroism shows that measured differences in condensation are not solely determined by duplex helical geometry. Here we combine experiment, theory, and atomistic simulations to propose a mechanism that connects the observed variations in condensation of short NA duplexesmore » with the spatial variation of cobalt hexammine (CoHex) binding at the NA duplex surface. The atomistic picture that emerged showed that CoHex distributions around the NA reveals two major NA-CoHex binding modes -- internal and external -- distinguished by the proximity of bound CoHex to the helical axis. Decreasing trends in experimentally observed condensation propensity of the four studied NA duplexes (from B-like form of homopolymeric DNA, to mixed sequence DNA, to DNA:RNA hybrid, to A-like RNA) are explained by the progressive decrease of a single quantity: the fraction of CoHex ions in the external binding mode. Thus, while NA condensation depends on a complex interplay between various structural and sequence features, our coupled experimental and theoretical results suggest a new model in which a single parameter connects the NA condensation propensity with geometry and sequence dependence of CoHex binding.« less

  7. Single-strand DNA binding protein SSB1 facilitates TERT recruitment to telomeres and maintains telomere G-overhangs

    PubMed Central

    Pandita, Raj K.; Chow, Tracy T.; Udayakumar, Durga; Bain, Amanda L.; Cubeddu, Liza; Hunt, Clayton R.; Shi, Wei; Horikoshi, Nobuo; Zhao, Yong; Wright, Woodring E.; Khanna, Kum Kum; Shay, Jerry W.; Pandita, Tej K.

    2015-01-01

    Proliferating mammalian stem and cancer cells express telomerase (TERT) in an effort to extend chromosomal G-overhangs and maintain telomere ends. Telomerase-expressing cells also have higher levels of the single-stranded DNA binding protein SSB1, which has a critical role in DNA double-strand break repair. Here we report that SSB1 binds specifically to G-strand telomeric DNA in vitro and associates with telomeres in vivo. SSB1 interacted with the TERT catalytic subunit and regulates its interaction with telomeres. Deletion of SSB1 reduced TERT interaction with telomeres and lead to G-overhang loss. While SSB1 was recruited to DSB sites, we found no corresponding change in TERT levels at these sites, implying that SSB1-TERT interaction relied upon a specific chromatin structure or context. Our findings offer an explanation for how telomerase is recruited to telomeres to facilitate G-strand DNA extension, a critical step in maintaining telomere ends and cell viability in all cancer cells. PMID:25589350

  8. ATP binding and hydrolysis by Saccharomyces cerevisiae Msh2-Msh3 are differentially modulated by mismatch and double-strand break repair DNA substrates.

    PubMed

    Kumar, Charanya; Eichmiller, Robin; Wang, Bangchen; Williams, Gregory M; Bianco, Piero R; Surtees, Jennifer A

    2014-06-01

    In Saccharomyces cerevisiae, Msh2-Msh3-mediated mismatch repair (MMR) recognizes and targets insertion/deletion loops for repair. Msh2-Msh3 is also required for 3' non-homologous tail removal (3'NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, we recently demonstrated that the two pathways have distinct requirements with respect to Msh2-Msh3 activities. We identified a set of aromatic residues in the nucleotide binding pocket (FLY motif) of Msh3 that, when mutated, disrupted MMR, but left 3'NHTR largely intact. One of these mutations, msh3Y942A, was predicted to disrupt the nucleotide sandwich and allow altered positioning of ATP within the pocket. To develop a mechanistic understanding of the differential requirements for ATP binding and/or hydrolysis in the two pathways, we characterized Msh2-Msh3 and Msh2-msh3Y942A ATP binding and hydrolysis activities in the presence of MMR and 3'NHTR DNA substrates. We observed distinct, substrate-dependent ATP hydrolysis and nucleotide turnover by Msh2-Msh3, indicating that the MMR and 3'NHTR DNA substrates differentially modify the ATP binding/hydrolysis activities of Msh2-Msh3. Msh2-msh3Y942A retained the ability to bind DNA and ATP but exhibited altered ATP hydrolysis and nucleotide turnover. We propose that both ATP and structure-specific repair substrates cooperate to direct Msh2-Msh3-mediated repair and suggest an explanation for the msh3Y942A separation-of-function phenotype. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. ATP binding and hydrolysis by Saccharomyces cerevisiae Msh2-Msh3 are differentially modulated by Mismatch and Double-strand Break Repair DNA substrates

    PubMed Central

    Kumar, Charanya; Eichmiller, Robin; Wang, Bangchen; Williams, Gregory M.; Bianco, Piero R.; Surtees, Jennifer A.

    2014-01-01

    In Saccharomyces cerevisiae, Msh2-Msh3-mediated mismatch repair (MMR) recognizes and targets insertion/deletion loops for repair. Msh2-Msh3 is also required for 3′ non-homologous tail removal (3′NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, we recently demonstrated that the two pathways have distinct requirements with respect to Msh2-Msh3 activities. We identified a set of aromatic residues in the nucleotide binding pocket (FLY motif) of Msh3 that, when mutated, disrupted MMR, but left 3′ NHTR largely intact. One of these mutations, msh3Y942A, was predicted to disrupt the nucleotide sandwich and allow altered positioning of ATP within the pocket. To develop a mechanistic understanding of the differential requirements for ATP binding and/or hydrolysis in the two pathways, we characterized Msh2-Msh3 and Msh2-msh3Y942A ATP binding and hydrolysis activities in the presence of MMR and 3′ NHTR DNA substrates. We observed distinct, substrate-dependent ATP hydrolysis and nucleotide turnover by Msh2-Msh3, indicating that the MMR and 3′ NHTR DNA substrates differentially modify the ATP binding/hydrolysis activities of Msh2-Msh3. Msh2-msh3Y942A retained the ability to bind DNA and ATP but exhibited altered ATP hydrolysis and nucleotide turnover. We propose that both ATP and structure-specific repair substrates cooperate to direct Msh2-Msh3-mediated repair and suggest an explanation for the msh3Y942A separation-of-function phenotype. PMID:24746922

  10. Tetrameric Ctp1 coordinates DNA binding and DNA bridging in DNA double-strand-break repair

    DOE PAGES

    Andres, Sara N.; Appel, C. Denise; Westmoreland, James W.; ...

    2015-01-12

    Ctp1 (also known as CtIP or Sae2) collaborates with Mre11-Rad50-Nbs1 to initiate repair of DNA double-strand breaks (DSBs), but its functions remain enigmatic. In this paper, we report that tetrameric Schizosaccharomyces pombe Ctp1 contains multivalent DNA-binding and DNA-bridging activities. Through structural and biophysical analyses of the Ctp1 tetramer, we define the salient features of Ctp1 architecture: an N-terminal interlocking tetrameric helical dimer-of-dimers (THDD) domain and a central intrinsically disordered region (IDR) linked to C-terminal 'RHR' DNA-interaction motifs. The THDD, IDR and RHR are required for Ctp1 DNA-bridging activity in vitro, and both the THDD and RHR are required for efficientmore » DSB repair in S. pombe. Finally, our results establish non-nucleolytic roles of Ctp1 in binding and coordination of DSB-repair intermediates and suggest that ablation of human CtIP DNA binding by truncating mutations underlie the CtIP-linked Seckel and Jawad syndromes.« less

  11. DNA conformational change induced by the bacteriophage phi 29 connector.

    PubMed Central

    Valpuesta, J M; Serrano, M; Donate, L E; Herranz, L; Carrascosa, J L

    1992-01-01

    Translocation of viral DNA inwards and outwards of the capsid of double-stranded DNA bacteriophages occurs through the connector, a key viral structure that is known to interact with DNA. It is shown here that phage phi 29 connector binds both linear and circular double-stranded DNA. However, DNA-mediated protection of phi 29 connectors against Staphylococcus aureus endoprotease V8 digestion suggests that binding to linear DNA is more stable than to circular DNA. Endoprotease V8-protection assays also suggest that the length of the linear DNA required to produce a stable phi 29 connector-DNA interaction is, at least, twice longer than the phi 29 connector channel. This result is confirmed by experiments of phi 29 connector-protection of DNA against DNase I digestion. Furthermore, DNA circularization assays indicate that phi 29 connectors restrain negative supercoiling when bound to linear DNA. This DNA conformational change is not observed upon binding to circular DNA and it could reflect the existence of some left-handed DNA coiling or DNA untwisting inside of the phi 29 connector channel. Images PMID:1454519

  12. SAMHD1 Sheds Moonlight on DNA Double-Strand Break Repair.

    PubMed

    Cabello-Lobato, Maria Jose; Wang, Siyue; Schmidt, Christine Katrin

    2017-12-01

    SAMHD1 (sterile α motif and histidine (H) aspartate (D) domain-containing protein 1) is known for its antiviral activity of hydrolysing deoxynucleotides required for virus replication. Daddacha et al. identify a hydrolase-independent, moonlighting function of SAMHD1 that facilitates homologous recombination of DNA double-strand breaks (DSBs) by promoting recruitment of C-terminal binding protein interacting protein (CTIP), a DNA-end resection factor, to damaged DNA. These findings could benefit anticancer treatment. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  13. Binding of radiation-induced phenylalanine radicals to DNA: influence on the biological activity of the DNA and on its sensitivity to the induction of breaks by gamma rays

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vanderschans, G.P.; Vanrijn, C.J.S.; Bleichrodt, J.F.

    1975-11-01

    When an aqueous solution of double-stranded deoxyribonucleic acid (DNA) of bacteriophage PM2 containing phenylalanine and saturated with N2O is irradiated with gamma rays, radiation induced phenylalanine radicals are bound covalently. Under the conditions used about 25 phenylalanine molecules may be bound per lethal hit. Also for single-stranded PM2 DNA most of the phenylalanine radicals bound are nonlethal. Evidence is presented that in double-stranded DNA an appreciable fraction of the single-strand breaks is induced by phenylalanine radicals. Radiation products of phenylalanine and the phenylalanine bound to the DNA decrease the sensitivity of the DNA to the induction of single-strand breaks. Theremore » are indications that the high efficiency of protection by radiation products of phenylalanine is due to their positive charge, which will result in a relatively high concentration of these compounds in the vicinity of the negatively charged DNA molecules. (Author) (GRA)« less

  14. Actinomycin D binding mode reveals the basis for its potent HIV-1 and cancer activity

    NASA Astrophysics Data System (ADS)

    Paramanathan, Thayaparan; Vladescu, Ioana D.; McCauley, Micah J.; Rouzina, Ioulia; Williams, Mark C.

    2011-03-01

    Actinomycin D (ActD) is one of the most studied antibiotics, which has been used as an anti-cancer agent and also shown to inhibit HIV reverse transcription. Initial studies with ActD established that it intercalates double stranded DNA (dsDNA). However, recent studies have shown that ActD binds with even higher affinity to single stranded DNA (ssDNA). In our studies we use optical tweezers to stretch and hold single dsDNA molecule at constant force in the presence of varying ActD concentrations until the binding reaches equilibrium. The change in dsDNA length upon ActD binding measured as a function of time yields the rate of binding in addition to the equilibrium lengthening of DNA. The results suggest extremely slow kinetics, on the order of several minutes and 0.52 +/- 0.06 μ M binding affinity. Holding DNA at constant force while stretching and relaxing suggests that ActD binds to two single strands that are close to each other rather than to pure dsDNA or ssDNA. This suggests that biological activity of ActD that contributes towards the inhibition of cellular replication is due to its ability to bind at DNA bubbles during RNA transcription, thereby stalling the transcription process.

  15. Interactive Roles of DNA Helicases and Translocases with the Single-Stranded DNA Binding Protein RPA in Nucleic Acid Metabolism.

    PubMed

    Awate, Sanket; Brosh, Robert M

    2017-06-08

    Helicases and translocases use the energy of nucleoside triphosphate binding and hydrolysis to unwind/resolve structured nucleic acids or move along a single-stranded or double-stranded polynucleotide chain, respectively. These molecular motors facilitate a variety of transactions including replication, DNA repair, recombination, and transcription. A key partner of eukaryotic DNA helicases/translocases is the single-stranded DNA binding protein Replication Protein A (RPA). Biochemical, genetic, and cell biological assays have demonstrated that RPA interacts with these human molecular motors physically and functionally, and their association is enriched in cells undergoing replication stress. The roles of DNA helicases/translocases are orchestrated with RPA in pathways of nucleic acid metabolism. RPA stimulates helicase-catalyzed DNA unwinding, enlists translocases to sites of action, and modulates their activities in DNA repair, fork remodeling, checkpoint activation, and telomere maintenance. The dynamic interplay between DNA helicases/translocases and RPA is just beginning to be understood at the molecular and cellular levels, and there is still much to be learned, which may inform potential therapeutic strategies.

  16. Interactive Roles of DNA Helicases and Translocases with the Single-Stranded DNA Binding Protein RPA in Nucleic Acid Metabolism

    PubMed Central

    Awate, Sanket; Brosh, Robert M.

    2017-01-01

    Helicases and translocases use the energy of nucleoside triphosphate binding and hydrolysis to unwind/resolve structured nucleic acids or move along a single-stranded or double-stranded polynucleotide chain, respectively. These molecular motors facilitate a variety of transactions including replication, DNA repair, recombination, and transcription. A key partner of eukaryotic DNA helicases/translocases is the single-stranded DNA binding protein Replication Protein A (RPA). Biochemical, genetic, and cell biological assays have demonstrated that RPA interacts with these human molecular motors physically and functionally, and their association is enriched in cells undergoing replication stress. The roles of DNA helicases/translocases are orchestrated with RPA in pathways of nucleic acid metabolism. RPA stimulates helicase-catalyzed DNA unwinding, enlists translocases to sites of action, and modulates their activities in DNA repair, fork remodeling, checkpoint activation, and telomere maintenance. The dynamic interplay between DNA helicases/translocases and RPA is just beginning to be understood at the molecular and cellular levels, and there is still much to be learned, which may inform potential therapeutic strategies. PMID:28594346

  17. TIRR regulates 53BP1 by masking its histone methyl-lysine binding function.

    PubMed

    Drané, Pascal; Brault, Marie-Eve; Cui, Gaofeng; Meghani, Khyati; Chaubey, Shweta; Detappe, Alexandre; Parnandi, Nishita; He, Yizhou; Zheng, Xiao-Feng; Botuyan, Maria Victoria; Kalousi, Alkmini; Yewdell, William T; Münch, Christian; Harper, J Wade; Chaudhuri, Jayanta; Soutoglou, Evi; Mer, Georges; Chowdhury, Dipanjan

    2017-03-09

    P53-binding protein 1 (53BP1) is a multi-functional double-strand break repair protein that is essential for class switch recombination in B lymphocytes and for sensitizing BRCA1-deficient tumours to poly-ADP-ribose polymerase-1 (PARP) inhibitors. Central to all 53BP1 activities is its recruitment to double-strand breaks via the interaction of the tandem Tudor domain with dimethylated lysine 20 of histone H4 (H4K20me2). Here we identify an uncharacterized protein, Tudor interacting repair regulator (TIRR), that directly binds the tandem Tudor domain and masks its H4K20me2 binding motif. Upon DNA damage, the protein kinase ataxia-telangiectasia mutated (ATM) phosphorylates 53BP1 and recruits RAP1-interacting factor 1 (RIF1) to dissociate the 53BP1-TIRR complex. However, overexpression of TIRR impedes 53BP1 function by blocking its localization to double-strand breaks. Depletion of TIRR destabilizes 53BP1 in the nuclear-soluble fraction and alters the double-strand break-induced protein complex centring 53BP1. These findings identify TIRR as a new factor that influences double-strand break repair using a unique mechanism of masking the histone methyl-lysine binding function of 53BP1.

  18. Studies of Xenopus laevis mitochondrial DNA: D-loop mapping and characterization of DNA-binding proteins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cairns, S.S.

    1987-01-01

    In X. laevis oocytes, mitochondrial DNA accumulates to 10/sup 5/ times the somatic cell complement, and is characterized by a high frequency of a triple-stranded displacement hoop structure at the origin of replication. To map the termini of the single strands, it was necessary to correct the nucleotide sequence of the D-loop region. The revised sequence of 2458 nucleotides contains 54 discrepancies in comparison to a previously published sequence. Radiolabeling of the nascent strands of the D-loop structure either at the 5' end or at the 3' end identifies a major species with a length of 1670 nucleotides. Cleavage ofmore » the 5' labeled strands reveals two families of ends located near several matches to an element, designated CSB-1, that is conserved in this location in several vertebrate genomes. Cleavage of 3' labeled strands produced one fragment. The unique 3' end maps to about 15 nucleotides preceding the tRNA/sup Pro/ gene. A search for proteins which may bind to mtDNA in this region to regulate nucleic acid synthesis has identified three activities in lysates of X. laevis mitochondria. The DNA-binding proteins were assayed by monitoring their ability to retard the migration of labeled double- or single-stranded DNA fragments in polyacrylamide gels. The DNA binding preference was determined by competition with an excess of either ds- or ssDNA.« less

  19. Recognition of the pro-mutagenic base uracil by family B DNA polymerases from archaea.

    PubMed

    Shuttleworth, Gillian; Fogg, Mark J; Kurpiewski, Michael R; Jen-Jacobson, Linda; Connolly, Bernard A

    2004-03-26

    Archaeal family B DNA polymerases contain a specialised pocket that binds tightly to template-strand uracil, causing the stalling of DNA replication. The mechanism of this unique "template-strand proof-reading" has been studied using equilibrium binding measurements, DNA footprinting, van't Hoff analysis and calorimetry. Binding assays have shown that the polymerase preferentially binds to uracil in single as opposed to double-stranded DNA. Tightest binding is observed using primer-templates that contain uracil four bases in front of the primer-template junction, corresponding to the observed stalling position. Ethylation interference analysis of primer-templates shows that the two phosphates, immediately flanking the uracil (NpUpN), are important for binding; contacts are also made to phosphates in the primer-strand. Microcalorimetry and van't Hoff analysis have given a fuller understanding of the thermodynamic parameters involved in uracil recognition. All the results are consistent with a "read-ahead" mechanism, in which the replicating polymerase scans the template, ahead of the replication fork, for the presence of uracil and halts polymerisation on detecting this base. Post-stalling events, serving to eliminate uracil, await full elucidation.

  20. Direct DNA binding by Brca1.

    PubMed

    Paull, T T; Cortez, D; Bowers, B; Elledge, S J; Gellert, M

    2001-05-22

    The tumor suppressor Brca1 plays an important role in protecting mammalian cells against genomic instability, but little is known about its modes of action. In this work we demonstrate that recombinant human Brca1 protein binds strongly to DNA, an activity conferred by a domain in the center of the Brca1 polypeptide. As a result of this binding, Brca1 inhibits the nucleolytic activities of the Mre11/Rad50/Nbs1 complex, an enzyme implicated in numerous aspects of double-strand break repair. Brca1 displays a preference for branched DNA structures and forms protein-DNA complexes cooperatively between multiple DNA strands, but without DNA sequence specificity. This fundamental property of Brca1 may be an important part of its role in DNA repair and transcription.

  1. Genetics Home Reference: Warsaw breakage syndrome

    MedlinePlus

    ... helicase. Helicases are enzymes that attach (bind) to DNA and temporarily unwind the two spiral strands (double helix) of the DNA molecule. This unwinding is necessary for copying ( replicating ) ...

  2. Viral interference with DNA repair by targeting of the single-stranded DNA binding protein RPA.

    PubMed

    Banerjee, Pubali; DeJesus, Rowena; Gjoerup, Ole; Schaffhausen, Brian S

    2013-10-01

    Correct repair of damaged DNA is critical for genomic integrity. Deficiencies in DNA repair are linked with human cancer. Here we report a novel mechanism by which a virus manipulates DNA damage responses. Infection with murine polyomavirus sensitizes cells to DNA damage by UV and etoposide. Polyomavirus large T antigen (LT) alone is sufficient to sensitize cells 100 fold to UV and other kinds of DNA damage. This results in activated stress responses and apoptosis. Genetic analysis shows that LT sensitizes via the binding of its origin-binding domain (OBD) to the single-stranded DNA binding protein replication protein A (RPA). Overexpression of RPA protects cells expressing OBD from damage, and knockdown of RPA mimics the LT phenotype. LT prevents recruitment of RPA to nuclear foci after DNA damage. This leads to failure to recruit repair proteins such as Rad51 or Rad9, explaining why LT prevents repair of double strand DNA breaks by homologous recombination. A targeted intervention directed at RPA based on this viral mechanism could be useful in circumventing the resistance of cancer cells to therapy.

  3. End-specific strategies of attachment of long double stranded DNA onto gold-coated nanofiber arrays

    NASA Astrophysics Data System (ADS)

    Peckys, Diana B.; de Jonge, Niels; Simpson, Michael L.; McKnight, Timothy E.

    2008-10-01

    We report the effective and site-specific binding of long double stranded (ds)DNA to high aspect ratio carbon nanofiber arrays. The carbon nanofibers were first coated with a thin gold layer to provide anchorage for two controllable binding methods. One method was based on the direct binding of thiol end-labeled dsDNA. The second and enhanced method used amine end-labeled dsDNA bound with crosslinkers to a carboxyl-terminated self-assembled monolayer. The bound dsDNA was first visualized with a fluorescent, dsDNA-intercalating dye. The specific binding onto the carbon nanofiber was verified by a high resolution detection method using scanning electron microscopy in combination with the binding of neutravidin-coated fluorescent microspheres to the immobilized and biotinylated dsDNA. Functional activity of thiol end-labeled dsDNA on gold-coated nanofiber arrays was verified with a transcriptional assay, whereby Chinese hamster lung cells (V79) were impaled upon the DNA-modified nanofibers and scored for transgene expression of the tethered template. Thiol end-labeled dsDNA demonstrated significantly higher expression levels than nanofibers prepared with control dsDNA that lacked a gold-binding end-label. Employing these site-specific and robust techniques of immobilization of dsDNA onto nanodevices can be of advantage for the study of DNA/protein interactions and for gene delivery applications.

  4. Yeast Pif1 Accelerates Annealing of Complementary DNA Strands

    PubMed Central

    2015-01-01

    Pif1 is a helicase involved in the maintenance of nuclear and mitochondrial genomes in eukaryotes. Here we report a new activity of Saccharomyces cerevisiae Pif1, annealing of complementary DNA strands. We identified preferred substrates for annealing as those that generate a duplex product with a single-stranded overhang relative to a blunt end duplex. Importantly, we show that Pif1 can anneal DNA in the presence of ATP and Mg2+. Pif1-mediated annealing also occurs in the presence of single-stranded DNA binding proteins. Additionally, we show that partial duplex substrates with 3′-single-stranded overhangs such as those generated during double-strand break repair can be annealed by Pif1. PMID:25393406

  5. Yeast Pif1 accelerates annealing of complementary DNA strands.

    PubMed

    Ramanagoudr-Bhojappa, Ramanagouda; Byrd, Alicia K; Dahl, Christopher; Raney, Kevin D

    2014-12-09

    Pif1 is a helicase involved in the maintenance of nuclear and mitochondrial genomes in eukaryotes. Here we report a new activity of Saccharomyces cerevisiae Pif1, annealing of complementary DNA strands. We identified preferred substrates for annealing as those that generate a duplex product with a single-stranded overhang relative to a blunt end duplex. Importantly, we show that Pif1 can anneal DNA in the presence of ATP and Mg(2+). Pif1-mediated annealing also occurs in the presence of single-stranded DNA binding proteins. Additionally, we show that partial duplex substrates with 3'-single-stranded overhangs such as those generated during double-strand break repair can be annealed by Pif1.

  6. Effect of DNA type on response of DNA biosensor for carcinogens

    NASA Astrophysics Data System (ADS)

    Sani, Nor Diyana bt. Md.; Heng, Lee Yook; Surif, Salmijah; Lazim, Azwani Mat

    2013-11-01

    Carcinogens are cancer causing chemicals that can bind to DNA and cause damage to the DNA. These chemicals are available everywhere including in water, air, soil and food. Therefore, a sensor that can detect the presence of these chemicals will be a very useful tool. Since carcinogens bind to DNA, DNA can be used as the biological element in a biosensor. This study has utilized different types of DNA in a biosensor for carcinogen detection. The DNAs include double stranded calf thymus DNA, single stranded calf thymus DNA and guanine rich single stranded DNA. The modified SPE was exposed to a carcinogen followed by interaction with methylene blue which acts as the electroactive indicator. The SPE was then analysed using differential pulse voltammetry (DPV). Optimization studies were conducted for MB concentration and accumulation time, DNA concentration, as well as effect of buffer concentration, buffer pH and ionic strength. The performance of the biosensor was tested on a group 1 carcinogen, formaldehyde. The results indicated that the usage of guanine rich single stranded DNA also gives higher response as carcinogens prefer to bind with guanine compared to other bases.

  7. Switching bonds in a DNA gel: an all-DNA vitrimer.

    PubMed

    Romano, Flavio; Sciortino, Francesco

    2015-02-20

    We design an all-DNA system that behaves like vitrimers, innovative plastics with self-healing and stress-releasing properties. The DNA sequences are engineered to self-assemble first into tetra- and bifunctional units which, upon further cooling, bind to each other forming a fully bonded network gel. An innovative design of the binding regions of the DNA sequences, exploiting a double toehold-mediated strand displacement, generates a network gel which is able to reshuffle its bonds, retaining at all times full bonding. As in vitrimers, the rate of bond switching can be controlled via a thermally activated catalyst, which in the present design is very short DNA strands.

  8. An immunoassay for the study of DNA-binding activities of herpes simplex virus protein ICP8.

    PubMed

    Lee, C K; Knipe, D M

    1985-06-01

    An immunoassay was used to examine the interaction between a herpes simplex virus protein, ICP8, and various types of DNA. The advantage of this assay is that the protein is not subjected to harsh purification procedures. We characterized the binding of ICP8 to both single-stranded (ss) and double-stranded (ds) DNA. ICP8 bound ss DNA fivefold more efficiently than ds DNA, and both binding activities were most efficient in 150 mM NaCl. Two lines of evidence indicate that the binding activities were not identical: (i) ds DNA failed to complete with ss DNA binding even with a large excess of ds DNA; (ii) Scatchard plots of DNA binding with various amounts of DNA were fundamentally different for ss DNA and ds DNA. However, the two activities were related in that ss DNA efficiently competed with the binding of ds DNA. We conclude that the ds DNA-binding activity of ICP8 is probably distinct from the ss DNA-binding activity. No evidence for sequence-specific ds DNA binding was obtained for either the entire herpes simplex virus genome or cloned viral sequences.

  9. DOTAP cationic liposomes prefer relaxed over supercoiled plasmids.

    PubMed

    Even-Chen, S; Barenholz, Y

    2000-12-20

    Cationic liposomes and DNA interact electrostatically to form complexes called lipoplexes. The amounts of unbound (free) DNA in a mixture of cationic liposomes and DNA at different cationic lipid:DNA molar ratios can be used to describe DNA binding isotherms; these provide a measure of the binding efficiency of DNA to different cationic lipid formulations at various medium conditions. In order to quantify the ratio between the various forms of naked DNA and supercoiled, relaxed and single-stranded DNA, and the ratio between cationic lipid bound and unbound DNA of various forms we developed a simple, sensitive quantitative assay using agarose gel electrophoresis, followed by staining with the fluorescent cyanine DNA dyes SYBR Green I or SYBR Gold. This assay was compared with that based on the use of ethidium bromide (the most commonly used nucleic acid stain). Unlike ethidium bromide, SYBR Green I DNA sensitivity and concentration-dependent fluorescence intensity were identical for supercoiled and nicked-relaxed forms. DNA detection by SYBR Green I in solution is approximately 40-fold more sensitive than by ethidium bromide for double-stranded DNA and approximately 10-fold for single-stranded DNA, and in agarose gel it is 16-fold more sensitive for double-stranded DNA compared with ethidium bromide. SYBR Gold performs similarly to SYBR Green I. This study shows that: (a) there is no significant difference in DNA binding isotherms to the monocationic DOTAP (DOTAP/DOPE) liposomes and to the polycationic DOSPA (DOSPA/DOPE) liposomes, even when four DOSPA positive charges are involved in the electrostatic interaction with DNA; (b) the helper lipids affect DNA binding, as DOTAP/DOPE liposomes bind more DNA than DOTAP/cholesterol; (c) in the process of lipoplex formation, when the DNA is a mixture of two forms, supercoiled and nicked-relaxed (open circular), there is a preference for the binding to the cationic liposomes of plasmid DNA in the nicked-relaxed over the supercoiled form. This preference is much more pronounced when the cationic liposome formulation is based on the monocationic lipid DOTAP than on the polycationic lipid DOSPA. The preference of DOTAP formulations to bind to the relaxed DNA plasmid suggests that the binding of supercoiled DNA is weaker and easier to dissociate from the complex.

  10. DNA sensing by a Eu-binding peptide containing a proflavine unit.

    PubMed

    Ancel, Laetitia; Gateau, Christelle; Lebrun, Colette; Delangle, Pascale

    2013-01-18

    Synthesis of a lanthanide-binding peptide (LBP) for the detection of double-stranded DNA is presented. A proflavine moiety was introduced into a high affinity LBP involving two unnatural chelating amino acids in the Ln ion coordination. The Eu(3+)-LBP complex is demonstrated to bind to ct-DNA and to sensitize Eu luminescence. The DNA binding process is effectively detected via the Eu-centered luminescence thanks to the intimate coupling between the LBP scaffold and DNA intercalating unit.

  11. The ATPase domain of the large terminase protein, gp17, from bacteriophage T4 binds DNA: implications to the DNA packaging mechanism.

    PubMed

    Alam, Tanfis I; Rao, Venigalla B

    2008-03-07

    Translocation of double-stranded DNA into a preformed capsid by tailed bacteriophages is driven by powerful motors assembled at the special portal vertex. The motor is thought to drive processive cycles of DNA binding, movement, and release to package the viral genome. In phage T4, there is evidence that the large terminase protein, gene product 17 (gp17), assembles into a multisubunit motor and translocates DNA by an inchworm mechanism. gp17 consists of two domains; an N-terminal ATPase domain (amino acids 1-360) that powers translocation of DNA, and a C-terminal nuclease domain (amino acids 361-610) that cuts concatemeric DNA to generate a headful-size viral genome. While the functional motifs of ATPase and nuclease have been well defined and the ATPase atomic structure has been solved, the DNA binding motif(s) responsible for viral DNA recognition, cutting, and translocation are unknown. Here we report the first evidence for the presence of a double-stranded DNA binding activity in the gp17 ATPase domain. Binding to DNA is sensitive to Mg(2+) and salt, but not the type of DNA used. DNA fragments as short as 20 bp can bind to the ATPase but preferential binding was observed to DNA greater than 1 kb. A high molecular weight ATPase-DNA complex was isolated by gel filtration, suggesting oligomerization of ATPase following DNA interaction. DNA binding was not observed with the full-length gp17, or the C-terminal nuclease domain. The small terminase protein, gp16, inhibited DNA binding, which was further accentuated by ATP. The presence of a DNA binding site in the ATPase domain and its binding properties implicate a role in the DNA packaging mechanism.

  12. Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay

    PubMed Central

    Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.

    2011-01-01

    The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207

  13. Monitoring ssDNA Binding to the DnaB Helicase from Helicobacter pylori by Solid-State NMR Spectroscopy.

    PubMed

    Wiegand, Thomas; Cadalbert, Riccardo; Gardiennet, Carole; Timmins, Joanna; Terradot, Laurent; Böckmann, Anja; Meier, Beat H

    2016-11-02

    DnaB helicases are bacterial, ATP-driven enzymes that unwind double-stranded DNA during DNA replication. Herein, we study the sequential binding of the "non-hydrolysable" ATP analogue AMP-PNP and of single-stranded (ss) DNA to the dodecameric DnaB helicase from Helicobacter pylori using solid-state NMR. Phosphorus cross-polarization experiments monitor the binding of AMP-PNP and DNA to the helicase. 13 C chemical-shift perturbations (CSPs) are used to detect conformational changes in the protein upon binding. The helicase switches upon AMP-PNP addition into a conformation apt for ssDNA binding, and AMP-PNP is hydrolyzed and released upon binding of ssDNA. Our study sheds light on the conformational changes which are triggered by the interaction with AMP-PNP and are needed for ssDNA binding of H. pylori DnaB in vitro. They also demonstrate the level of detail solid-state NMR can provide for the characterization of protein-DNA interactions and the interplay with ATP or its analogues. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Transcription and DNA Damage: Holding Hands or Crossing Swords?

    PubMed

    D'Alessandro, Giuseppina; d'Adda di Fagagna, Fabrizio

    2017-10-27

    Transcription has classically been considered a potential threat to genome integrity. Collision between transcription and DNA replication machinery, and retention of DNA:RNA hybrids, may result in genome instability. On the other hand, it has been proposed that active genes repair faster and preferentially via homologous recombination. Moreover, while canonical transcription is inhibited in the proximity of DNA double-strand breaks, a growing body of evidence supports active non-canonical transcription at DNA damage sites. Small non-coding RNAs accumulate at DNA double-strand break sites in mammals and other organisms, and are involved in DNA damage signaling and repair. Furthermore, RNA binding proteins are recruited to DNA damage sites and participate in the DNA damage response. Here, we discuss the impact of transcription on genome stability, the role of RNA binding proteins at DNA damage sites, and the function of small non-coding RNAs generated upon damage in the signaling and repair of DNA lesions. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Force-induced rupture of double-stranded DNA in the absence and presence of covalently bonded anti-tumor drugs: Insights from molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Upadhyaya, Anurag; Nath, Shesh; Kumar, Sanjay

    2018-06-01

    DNA intra-strand cross-link (ICL) agents are widely used in the treatment of cancer. ICLs are thought to form a link between the same strand (intra-strand) or complimentary strand (inter-strand) and thereby increase the stability of DNA, which forbids the processes like replication and transcription. As a result, cell death occurs. In this work, we have studied the enhanced stability of a double stranded DNA in the presence of ICLs and compared our findings with the results obtained in the absence of these links. Using atomistic simulations with explicit solvent, a force is applied along and perpendicular to the direction of the helix and we measured the rupture force and the unzipping force of DNA-ICL complexes. Our results show that the rupture and the unzipping forces increase significantly in the presence of these links. The ICLs bind to the minor groove of DNA, which enhance the DNA stabilisation. Such information may be used to design alternative drugs that can stall replication and transcription that are critical to a growing number of anticancer drug discovery efforts.

  16. Nucleosomes suppress the formation of double-strand DNA breaks during attempted base excision repair of clustered oxidative damages.

    PubMed

    Cannan, Wendy J; Tsang, Betty P; Wallace, Susan S; Pederson, David S

    2014-07-18

    Exposure to ionizing radiation can produce multiple, clustered oxidative lesions in DNA. The near simultaneous excision of nearby lesions in opposing DNA strands by the base excision repair (BER) enzymes can produce double-strand DNA breaks (DSBs). This attempted BER accounts for many of the potentially lethal or mutagenic DSBs that occur in vivo. To assess the impact of nucleosomes on the frequency and pattern of BER-dependent DSB formation, we incubated nucleosomes containing oxidative damages in opposing DNA strands with selected DNA glycosylases and human apurinic/apyrimidinic endonuclease 1. Overall, nucleosomes substantially suppressed DSB formation. However, the degree of suppression varied as a function of (i) the lesion type and DNA glycosylase tested, (ii) local sequence context and the stagger between opposing strand lesions, (iii) the helical orientation of oxidative lesions relative to the underlying histone octamer, and (iv) the distance between the lesion cluster and the nucleosome edge. In some instances the binding of a BER factor to one nucleosomal lesion appeared to facilitate binding to the opposing strand lesion. DSB formation did not invariably lead to nucleosome dissolution, and in some cases, free DNA ends resulting from DSB formation remained associated with the histone octamer. These observations explain how specific structural and dynamic properties of nucleosomes contribute to the suppression of BER-generated DSBs. These studies also suggest that most BER-generated DSBs will occur in linker DNA and in genomic regions associated with elevated rates of nucleosome turnover or remodeling. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Nucleosomes Suppress the Formation of Double-strand DNA Breaks during Attempted Base Excision Repair of Clustered Oxidative Damages*

    PubMed Central

    Cannan, Wendy J.; Tsang, Betty P.; Wallace, Susan S.; Pederson, David S.

    2014-01-01

    Exposure to ionizing radiation can produce multiple, clustered oxidative lesions in DNA. The near simultaneous excision of nearby lesions in opposing DNA strands by the base excision repair (BER) enzymes can produce double-strand DNA breaks (DSBs). This attempted BER accounts for many of the potentially lethal or mutagenic DSBs that occur in vivo. To assess the impact of nucleosomes on the frequency and pattern of BER-dependent DSB formation, we incubated nucleosomes containing oxidative damages in opposing DNA strands with selected DNA glycosylases and human apurinic/apyrimidinic endonuclease 1. Overall, nucleosomes substantially suppressed DSB formation. However, the degree of suppression varied as a function of (i) the lesion type and DNA glycosylase tested, (ii) local sequence context and the stagger between opposing strand lesions, (iii) the helical orientation of oxidative lesions relative to the underlying histone octamer, and (iv) the distance between the lesion cluster and the nucleosome edge. In some instances the binding of a BER factor to one nucleosomal lesion appeared to facilitate binding to the opposing strand lesion. DSB formation did not invariably lead to nucleosome dissolution, and in some cases, free DNA ends resulting from DSB formation remained associated with the histone octamer. These observations explain how specific structural and dynamic properties of nucleosomes contribute to the suppression of BER-generated DSBs. These studies also suggest that most BER-generated DSBs will occur in linker DNA and in genomic regions associated with elevated rates of nucleosome turnover or remodeling. PMID:24891506

  18. Double-stranded DNA translocase activity of transcription factor TFIIH and the mechanism of RNA polymerase II open complex formation.

    PubMed

    Fishburn, James; Tomko, Eric; Galburt, Eric; Hahn, Steven

    2015-03-31

    Formation of the RNA polymerase II (Pol II) open complex (OC) requires DNA unwinding mediated by the transcription factor TFIIH helicase-related subunit XPB/Ssl2. Because XPB/Ssl2 binds DNA downstream from the location of DNA unwinding, it cannot function using a conventional helicase mechanism. Here we show that yeast TFIIH contains an Ssl2-dependent double-stranded DNA translocase activity. Ssl2 tracks along one DNA strand in the 5' → 3' direction, implying it uses the nontemplate promoter strand to reel downstream DNA into the Pol II cleft, creating torsional strain and leading to DNA unwinding. Analysis of the Ssl2 and DNA-dependent ATPase activity of TFIIH suggests that Ssl2 has a processivity of approximately one DNA turn, consistent with the length of DNA unwound during transcription initiation. Our results can explain why maintaining the OC requires continuous ATP hydrolysis and the function of TFIIH in promoter escape. Our results also suggest that XPB/Ssl2 uses this translocase mechanism during DNA repair rather than physically wedging open damaged DNA.

  19. The UL5 and UL52 subunits of the herpes simplex virus type 1 helicase-primase subcomplex exhibit a complex interdependence for DNA binding.

    PubMed

    Biswas, N; Weller, S K

    2001-05-18

    Herpes simplex virus type 1 encodes a heterotrimeric helicase-primase complex composed of the products of the UL5, UL52, and UL8 genes. The UL5 protein contains seven motifs found in all members of helicase Superfamily 1 (SF1), and the UL52 protein contains several conserved motifs found in primases; however, the contributions of each subunit to the biochemical activities of the subcomplex are not clear. In this work, the DNA binding properties of wild type and mutant subcomplexes were examined using single-stranded, duplex, and forked substrates. A gel mobility shift assay indicated that the UL5-UL52 subcomplex binds more efficiently to the forked substrate than to either single strand or duplex DNA. Although nucleotides are not absolutely required for DNA binding, ADP stimulated the binding of UL5-UL52 to single strand DNA whereas ATP, ADP, and adenosine 5'-O-(thiotriphosphate) stimulated the binding to a forked substrate. We have previously shown that both subunits contact single-stranded DNA in a photocross-linking assay (Biswas, N., and Weller, S. K. (1999) J. Biol. Chem. 274, 8068-8076). In this study, photocross-linking assays with forked substrates indicate that the UL5 and UL52 subunits contact the forked substrates at different positions, UL52 at the single-stranded DNA tail and UL5 near the junction between single-stranded and double-stranded DNA. Neither subunit was able to cross-link a forked substrate when 5-iododeoxyuridine was located within the duplex portion. Photocross-linking experiments with subcomplexes containing mutant versions of UL5 and wild type UL52 indicated that the integrity of the ATP binding region is important for DNA binding of both subunits. These results support our previous proposal that UL5 and UL52 exhibit a complex interdependence for DNA binding (Biswas, N., and Weller, S. K. (1999) J. Biol. Chem. 274, 8068-8076) and indicate that the UL52 subunit may play a more active role in helicase activity than had previously been thought.

  20. Inhibition of adenovirus DNA synthesis in vitro by sera from patients with systemic lupus erythematosus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Horwitz, M.S.; Friefeld, B.R.; Keiser, H.D.

    1982-12-01

    Sera containing antinuclear antibodies from patients with systemic lupus erythematosus (SLE) and related disorders were tested for their effect on the synthesis of adenovirus (Ad) DNA in an in vitro replication system. After being heated at 60/sup 0/C for 1 h, some sera from patients with SLE inhibited Ad DNA synthesis by 60 to 100%. Antibodies to double-stranded DNA were present in 15 of the 16 inhibitory sera, and inhibitory activity copurified with anti-double-stranded DNA in the immunoglobulin G fraction. These SLE sera did not inhibit the DNA polymerases ..cap alpha.., BETA, ..gamma.. and had no antibody to the 72,000-daltonmore » DNA-binding protein necessary for Ad DNA synthesis. The presence of antibodies to single-stranded DNA and a variety of saline-extractable antigens (Sm, Ha, nRNP, and rRNP) did not correlate with SLE serum inhibitory activity. Methods previously developed for studying the individual steps in Ad DNA replication were used to determine the site of inhibition by the SLE sera that contained antibody to double-stranded DNA. Concentrations of the SLE inhibitor that decreased the elongation of Ad DNA by greater than 85% had no effect on either the initiation of Ad DNA synthesis or the polymerization of the first 26 deoxyribonucleotides.« less

  1. cgDNAweb: a web interface to the cgDNA sequence-dependent coarse-grain model of double-stranded DNA.

    PubMed

    De Bruin, Lennart; Maddocks, John H

    2018-06-14

    The sequence-dependent statistical mechanical properties of fragments of double-stranded DNA is believed to be pertinent to its biological function at length scales from a few base pairs (or bp) to a few hundreds of bp, e.g. indirect read-out protein binding sites, nucleosome positioning sequences, phased A-tracts, etc. In turn, the equilibrium statistical mechanics behaviour of DNA depends upon its ground state configuration, or minimum free energy shape, as well as on its fluctuations as governed by its stiffness (in an appropriate sense). We here present cgDNAweb, which provides browser-based interactive visualization of the sequence-dependent ground states of double-stranded DNA molecules, as predicted by the underlying cgDNA coarse-grain rigid-base model of fragments with arbitrary sequence. The cgDNAweb interface is specifically designed to facilitate comparison between ground state shapes of different sequences. The server is freely available at cgDNAweb.epfl.ch with no login requirement.

  2. Identification of the SRC pyrimidine-binding protein (SPy) as hnRNP K: implications in the regulation of SRC1A transcription

    PubMed Central

    Ritchie, Shawn A.; Pasha, Mohammed K.; Batten, Danielle J. P.; Sharma, Rajendra K.; Olson, Douglas J. H.; Ross, Andrew R. S.; Bonham, Keith

    2003-01-01

    The human SRC gene encodes pp60c–src, a non-receptor tyrosine kinase involved in numerous signaling pathways. Activation or overexpression of c-Src has also been linked to a number of important human cancers. Transcription of the SRC gene is complex and regulated by two closely linked but highly dissimilar promoters, each associated with its own distinct non-coding exon. In many tissues SRC expression is regulated by the housekeeping-like SRC1A promoter. In addition to other regulatory elements, three substantial polypurine:polypyrimidine (TC) tracts within this promoter are required for full transcriptional activity. Previously, we described an unusual factor called SRC pyrimidine-binding protein (SPy) that could bind to two of these TC tracts in their double-stranded form, but was also capable of interacting with higher affinity to all three pyrimidine tracts in their single-stranded form. Mutations in the TC tracts, which abolished the ability of SPy to interact with its double-stranded DNA target, significantly reduced SRC1A promoter activity, especially in concert with mutations in critical Sp1 binding sites. Here we expand upon our characterization of this interesting factor and describe the purification of SPy from human SW620 colon cancer cells using a DNA affinity-based approach. Subsequent in-gel tryptic digestion of purified SPy followed by MALDI-TOF mass spectrometric analysis identified SPy as heterogeneous nuclear ribonucleoprotein K (hnRNP K), a known nucleic-acid binding protein implicated in various aspects of gene expression including transcription. These data provide new insights into the double- and single-stranded DNA-binding specificity, as well as functional properties of hnRNP K, and suggest that hnRNP K is a critical component of SRC1A transcriptional processes. PMID:12595559

  3. Assays for the determination of the activity of DNA nucleases based on the fluorometric properties of the YOYO dye.

    PubMed

    Fernández-Sierra, Mónica; Quiñones, Edwin

    2015-03-15

    Here we characterize the fluorescence of the YOYO dye as a tool for studying DNA-protein interactions in real time and present two continuous YOYO-based assays for sensitively monitoring the kinetics of DNA digestion by λ-exonuclease and the endonuclease EcoRV. The described assays rely on the different fluorescence intensities between single- and double-stranded DNA-YOYO complexes, allowing straightforward determination of nuclease activity and quantitative determination of reaction products. The assays were also employed to assess the effect of single-stranded DNA-binding proteins on the λ-exonuclease reaction kinetics, showing that the extreme thermostable single-stranded DNA-binding protein (ET-SSB) significantly reduced the reaction rate, while the recombination protein A (RecA) displayed no effect. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Evaluation of aluminum phthalocyanine chloride and DNA interactions for the design of an advanced drug delivery system in photodynamic therapy.

    PubMed

    Jayme, Cristiano Ceron; Calori, Italo Rodrigo; Cunha, Elise Marques Freire; Tedesco, Antonio Claudio

    2018-08-05

    The aim of this study was to evaluate the interaction of aluminum phthalocyanine chloride (AlClPc) with double-stranded DNA. Absorption and fluorescence spectra, resonance light scattering, and circular dichroism were evaluated in water and water/ethanol mixtures with different concentrations of DNA or AlClPc. AlClPc showed a high ability to bind to DNA in both water and 4/6 water/ethanol mixture (v/v), with a majority of monomeric and aggregated initial forms of AlClPc, respectively. In this interaction, AlClPc bound preferentially to the grooves of DNA. The monomeric/aggregate state of AlClPc in DNA was dependent on the AlClPc/DNA ratio. At low concentrations of AlClPc, the interaction of AlClPc with few DNA sites caused a curvature in the DNA structure that provided a favorable environment for the intercalation of AlClPc aggregates. Increase in AlClPc concentration induced interactions with a high number of binding sites on DNA, which prevented bending and therefore aggregation of AlClPc molecules throughout the double-stranded DNA. These results are relevant to the understanding of the behavior and interaction of AlClPc with double-stranded DNA in the design of novel drug delivery systems for clinical application in photodynamic therapy as a new approach to treat skin or oral cancer, scars, or wound healing. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. DNA Hairpins Containing the Cytidine Analog Pyrrolo-dC: Structural, Thermodynamic, and Spectroscopic Studies

    PubMed Central

    Zhang, Xu; Wadkins, Randy M.

    2009-01-01

    Structures formed by single-strand DNA have become increasingly interesting because of their roles in a number of biological processes, particularly transcription and its regulation. Of particular importance is the fact that antitumor drugs such as Actinomycin D can selectively bind DNA hairpins over fully paired, double-strand DNA. A new fluorescent base analog, pyrrolo-deoxycytidine (PdC), can now be routinely incorporated into single-strand DNA. The fluorescence of PdC is particularly useful for studying the formation of single-strand DNA in regions of double-strand DNA. The fluorescence is quenched when PdC is paired with a complementary guanine residue, and thus is greatly enhanced upon formation of single-strand DNA. Hence, any process that results in melting or opening of DNA strands produces an increase in the fluorescence intensity of this base analog. In this study we measured the structural effects of incorporating PdC into DNA hairpins, and the effect of this incorporation on the binding of the hairpins by a fluorescent analog of the drug Actinomycin D. Two hairpin DNAs were used: one with PdC in the stem (basepaired) and one with PdC in the loop (unpaired). The thermal stability, 7-aminoactinomycin D binding, and three-dimensional structures of PdC incorporated into these DNA hairpins were all quite similar as compared to the hairpins containing an unmodified dC residue. Fluorescence lifetime measurements indicate that two lifetimes are present in PdC, and that the increase in fluorescence of the unpaired PdC residue compared to the basepaired PdC is due to an increase in the contribution of the longer lifetime to the average fluorescence lifetime. Our data indicate that PdC can be used effectively to differentiate paired and unpaired bases in DNA hairpin secondary structures, and should be similarly applicable for related structures such as cruciforms and quadruplexes. Further, our data indicate that PdC can act as a fluorescence resonance energy transfer donor for the fluorescent drug 7-aminoactinomycin D. PMID:19254547

  6. DNA hairpins containing the cytidine analog pyrrolo-dC: structural, thermodynamic, and spectroscopic studies.

    PubMed

    Zhang, Xu; Wadkins, Randy M

    2009-03-04

    Structures formed by single-strand DNA have become increasingly interesting because of their roles in a number of biological processes, particularly transcription and its regulation. Of particular importance is the fact that antitumor drugs such as Actinomycin D can selectively bind DNA hairpins over fully paired, double-strand DNA. A new fluorescent base analog, pyrrolo-deoxycytidine (PdC), can now be routinely incorporated into single-strand DNA. The fluorescence of PdC is particularly useful for studying the formation of single-strand DNA in regions of double-strand DNA. The fluorescence is quenched when PdC is paired with a complementary guanine residue, and thus is greatly enhanced upon formation of single-strand DNA. Hence, any process that results in melting or opening of DNA strands produces an increase in the fluorescence intensity of this base analog. In this study we measured the structural effects of incorporating PdC into DNA hairpins, and the effect of this incorporation on the binding of the hairpins by a fluorescent analog of the drug Actinomycin D. Two hairpin DNAs were used: one with PdC in the stem (basepaired) and one with PdC in the loop (unpaired). The thermal stability, 7-aminoactinomycin D binding, and three-dimensional structures of PdC incorporated into these DNA hairpins were all quite similar as compared to the hairpins containing an unmodified dC residue. Fluorescence lifetime measurements indicate that two lifetimes are present in PdC, and that the increase in fluorescence of the unpaired PdC residue compared to the basepaired PdC is due to an increase in the contribution of the longer lifetime to the average fluorescence lifetime. Our data indicate that PdC can be used effectively to differentiate paired and unpaired bases in DNA hairpin secondary structures, and should be similarly applicable for related structures such as cruciforms and quadruplexes. Further, our data indicate that PdC can act as a fluorescence resonance energy transfer donor for the fluorescent drug 7-aminoactinomycin D.

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schellenberg, Matthew J; Appel, C Denise; Adhikari, Sanjay

    The topoisomerase II (topo II) DNA incision-and-ligation cycle can be poisoned (for example following treatment with cancer chemotherapeutics) to generate cytotoxic DNA double-strand breaks (DSBs) with topo II covalently conjugated to DNA. Tyrosyl-DNA phosphodiesterase 2 (Tdp2) protects genomic integrity by reversing 5'-phosphotyrosyl–linked topo II–DNA adducts. Here, X-ray structures of mouse Tdp2–DNA complexes reveal that Tdp2 β–2-helix–β DNA damage–binding 'grasp', helical 'cap' and DNA lesion–binding elements fuse to form an elongated protein-DNA conjugate substrate-interaction groove. The Tdp2 DNA-binding surface is highly tailored for engagement of 5'-adducted single-stranded DNA ends and restricts nonspecific endonucleolytic or exonucleolytic processing. Structural, mutational and functional analysesmore » support a single–metal ion catalytic mechanism for the exonuclease-endonuclease-phosphatase (EEP) nuclease superfamily and establish a molecular framework for targeted small-molecule blockade of Tdp2-mediated resistance to anticancer topoisomerase drugs.« less

  8. A conserved MCM single-stranded DNA binding element is essential for replication initiation.

    PubMed

    Froelich, Clifford A; Kang, Sukhyun; Epling, Leslie B; Bell, Stephen P; Enemark, Eric J

    2014-04-01

    The ring-shaped MCM helicase is essential to all phases of DNA replication. The complex loads at replication origins as an inactive double-hexamer encircling duplex DNA. Helicase activation converts this species to two active single hexamers that encircle single-stranded DNA (ssDNA). The molecular details of MCM DNA interactions during these events are unknown. We determined the crystal structure of the Pyrococcus furiosus MCM N-terminal domain hexamer bound to ssDNA and define a conserved MCM-ssDNA binding motif (MSSB). Intriguingly, ssDNA binds the MCM ring interior perpendicular to the central channel with defined polarity. In eukaryotes, the MSSB is conserved in several Mcm2-7 subunits, and MSSB mutant combinations in S. cerevisiae Mcm2-7 are not viable. Mutant Mcm2-7 complexes assemble and are recruited to replication origins, but are defective in helicase loading and activation. Our findings identify an important MCM-ssDNA interaction and suggest it functions during helicase activation to select the strand for translocation. DOI: http://dx.doi.org/10.7554/eLife.01993.001.

  9. A conserved MCM single-stranded DNA binding element is essential for replication initiation

    PubMed Central

    Froelich, Clifford A; Kang, Sukhyun; Epling, Leslie B; Bell, Stephen P; Enemark, Eric J

    2014-01-01

    The ring-shaped MCM helicase is essential to all phases of DNA replication. The complex loads at replication origins as an inactive double-hexamer encircling duplex DNA. Helicase activation converts this species to two active single hexamers that encircle single-stranded DNA (ssDNA). The molecular details of MCM DNA interactions during these events are unknown. We determined the crystal structure of the Pyrococcus furiosus MCM N-terminal domain hexamer bound to ssDNA and define a conserved MCM-ssDNA binding motif (MSSB). Intriguingly, ssDNA binds the MCM ring interior perpendicular to the central channel with defined polarity. In eukaryotes, the MSSB is conserved in several Mcm2-7 subunits, and MSSB mutant combinations in S. cerevisiae Mcm2-7 are not viable. Mutant Mcm2-7 complexes assemble and are recruited to replication origins, but are defective in helicase loading and activation. Our findings identify an important MCM-ssDNA interaction and suggest it functions during helicase activation to select the strand for translocation. DOI: http://dx.doi.org/10.7554/eLife.01993.001 PMID:24692448

  10. Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes

    PubMed Central

    Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.

    2015-01-01

    Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076

  11. Spectroscopic Study of the Binding of Netropsin and Hoechst 33258 to Nucleic Acids

    NASA Astrophysics Data System (ADS)

    Vardevanyan, P. O.; Parsadanyan, M. A.; Antonyan, A. P.; Sahakyan, V. G.

    2018-05-01

    The interaction of groove binding compounds — peptide antibiotic (polyamide) netropsin and fluorescent dye (bisbenzimidazole) Hoechst 33258 — with the double-stranded DNA and synthetic double-stranded polynucleotide poly(rA)-poly(rU) has been studied by spectrophotometry. Absorption spectra of these ligand complexes with nucleic acids have been obtained. Spectral changes at the complexation of individual ligands with the mentioned nucleic acids reveal the similarity of binding of each of these ligands with both DNA and RNA. Based on the spectroscopic measurements, the binding parameters of netropsin and Hoechst 33258 binding to DNA and poly(rA)-poly(rU) - K and n, as well as the thermodynamic parameters ΔS, ΔG, and ΔH have been determined. It was found that the binding of Hoechst 33258 to both nucleic acids is accompanied by a positive change in enthalpy, while in the case of netropsin the change in enthalpy is negative. Moreover, the contribution of entropy to the formation of the complexes is more pronounced in the case of Hoechst 33258.

  12. Single helically folded aromatic oligoamides that mimic the charge surface of double-stranded B-DNA

    NASA Astrophysics Data System (ADS)

    Ziach, Krzysztof; Chollet, Céline; Parissi, Vincent; Prabhakaran, Panchami; Marchivie, Mathieu; Corvaglia, Valentina; Bose, Partha Pratim; Laxmi-Reddy, Katta; Godde, Frédéric; Schmitter, Jean-Marie; Chaignepain, Stéphane; Pourquier, Philippe; Huc, Ivan

    2018-05-01

    Numerous essential biomolecular processes require the recognition of DNA surface features by proteins. Molecules mimicking these features could potentially act as decoys and interfere with pharmacologically or therapeutically relevant protein-DNA interactions. Although naturally occurring DNA-mimicking proteins have been described, synthetic tunable molecules that mimic the charge surface of double-stranded DNA are not known. Here, we report the design, synthesis and structural characterization of aromatic oligoamides that fold into single helical conformations and display a double helical array of negatively charged residues in positions that match the phosphate moieties in B-DNA. These molecules were able to inhibit several enzymes possessing non-sequence-selective DNA-binding properties, including topoisomerase 1 and HIV-1 integrase, presumably through specific foldamer-protein interactions, whereas sequence-selective enzymes were not inhibited. Such modular and synthetically accessible DNA mimics provide a versatile platform to design novel inhibitors of protein-DNA interactions.

  13. Single-strand DNA-binding protein SSB1 facilitates TERT recruitment to telomeres and maintains telomere G-overhangs.

    PubMed

    Pandita, Raj K; Chow, Tracy T; Udayakumar, Durga; Bain, Amanda L; Cubeddu, Liza; Hunt, Clayton R; Shi, Wei; Horikoshi, Nobuo; Zhao, Yong; Wright, Woodring E; Khanna, Kum Kum; Shay, Jerry W; Pandita, Tej K

    2015-03-01

    Proliferating mammalian stem and cancer cells express telomerase [telomerase reverse transcriptase (TERT)] in an effort to extend chromosomal G-overhangs and maintain telomere ends. Telomerase-expressing cells also have higher levels of the single-stranded DNA-binding protein SSB1, which has a critical role in DNA double-strand break (DSB) repair. Here, we report that SSB1 binds specifically to G-strand telomeric DNA in vitro and associates with telomeres in vivo. SSB1 interacts with the TERT catalytic subunit and regulates its interaction with telomeres. Deletion of SSB1 reduces TERT interaction with telomeres and leads to G-overhang loss. Although SSB1 is recruited to DSB sites, we found no corresponding change in TERT levels at these sites, implying that SSB1-TERT interaction relies upon a specific chromatin structure or context. Our findings offer an explanation for how telomerase is recruited to telomeres to facilitate G-strand DNA extension, a critical step in maintaining telomere ends and cell viability in all cancer cells. Cancer Res; 75(5); 858-69. ©2015 AACR. ©2015 American Association for Cancer Research.

  14. DNA Double-Strand Breaks Coupled with PARP1 and HNRNPA2B1 Binding Sites Flank Coordinately Expressed Domains in Human Chromosomes

    PubMed Central

    Fedoseeva, Daria M.; Sosin, Dmitri V.; Grachev, Sergei A.; Serebraykova, Marina V.; Romanenko, Svetlana A.; Vorobieva, Nadezhda V.; Kravatsky, Yuri V.

    2013-01-01

    Genome instability plays a key role in multiple biological processes and diseases, including cancer. Genome-wide mapping of DNA double-strand breaks (DSBs) is important for understanding both chromosomal architecture and specific chromosomal regions at DSBs. We developed a method for precise genome-wide mapping of blunt-ended DSBs in human chromosomes, and observed non-random fragmentation and DSB hot spots. These hot spots are scattered along chromosomes and delimit protected 50–250 kb DNA domains. We found that about 30% of the domains (denoted forum domains) possess coordinately expressed genes and that PARP1 and HNRNPA2B1 specifically bind DNA sequences at the forum domain termini. Thus, our data suggest a novel type of gene regulation: a coordinated transcription or silencing of gene clusters delimited by DSB hot spots as well as PARP1 and HNRNPa2B1 binding sites. PMID:23593027

  15. Specific interaction of the nonstructural protein NS1 of minute virus of mice (MVM) with [ACCA](2) motifs in the centre of the right-end MVM DNA palindrome induces hairpin-primed viral DNA replication.

    PubMed

    Willwand, Kurt; Moroianu, Adela; Hörlein, Rita; Stremmel, Wolfgang; Rommelaere, Jean

    2002-07-01

    The linear single-stranded DNA genome of minute virus of mice (MVM) is replicated via a double-stranded replicative form (RF) intermediate DNA. Amplification of viral RF DNA requires the structural transition of the right-end palindrome from a linear duplex into a double-hairpin structure, which serves for the repriming of unidirectional DNA synthesis. This conformational transition was found previously to be induced by the MVM nonstructural protein NS1. Elimination of the cognate NS1-binding sites, [ACCA](2), from the central region of the right-end palindrome next to the axis of symmetry was shown to markedly reduce the efficiency of hairpin-primed DNA replication, as measured in a reconstituted in vitro replication system. Thus, [ACCA](2) sequence motifs are essential as NS1-binding elements in the context of the structural transition of the right-end MVM palindrome.

  16. Development of novel decoy oligonucleotides: advantages of circular dumb-bell decoy.

    PubMed

    Tomita, Naruya; Tomita, Tetsuya; Yuyama, Kazuhiko; Tougan, Takahiro; Tajima, Tsuyoshi; Ogihara, Toshio; Morishita, Ryuichi

    2003-04-01

    The inhibition of specific transcription regulatory proteins is a novel approach to regulate gene expression. The transcriptional activities of DNA binding proteins can be inhibited by the use of double-stranded oligonucleotides (ODNs) that compete for binding to their specific target sequences in promoters and enhancers. Transfection of this cis-element double-stranded ODN, referred to as decoy ODN, has been reported to be a powerful tool that provides a new class of anti-gene strategies to gene therapy and permits examination of specific gene regulation. We have demonstrated the usefulness of this decoy ODN strategy in animal models of restenosis, myocardial infarction, glomerulonephritis and rheumatoid arthritis. However, one of the major limitations of decoy ODN technology is the rapid degradation of phosphodiester ODNs by intracellular nucleases. To date, several different types of double-stranded decoy ODNs have been developed to overcome this issue. Circular dumb-bell (CD) double-stranded decoy ODNs that were developed to resolve this issue have attracted a high level of interest. In this review, the applications of decoy ODN strategy and the advantages of modified CD double-stranded decoy ODNs will be discussed.

  17. Enzyme-adenylate structure of a bacterial ATP-dependent DNA ligase with a minimized DNA-binding surface.

    PubMed

    Williamson, Adele; Rothweiler, Ulli; Leiros, Hanna Kirsti Schrøder

    2014-11-01

    DNA ligases are a structurally diverse class of enzymes which share a common catalytic core and seal breaks in the phosphodiester backbone of double-stranded DNA via an adenylated intermediate. Here, the structure and activity of a recombinantly produced ATP-dependent DNA ligase from the bacterium Psychromonas sp. strain SP041 is described. This minimal-type ligase, like its close homologues, is able to ligate singly nicked double-stranded DNA with high efficiency and to join cohesive-ended and blunt-ended substrates to a more limited extent. The 1.65 Å resolution crystal structure of the enzyme-adenylate complex reveals no unstructured loops or segments, and suggests that this enzyme binds the DNA without requiring full encirclement of the DNA duplex. This is in contrast to previously characterized minimal DNA ligases from viruses, which use flexible loop regions for DNA interaction. The Psychromonas sp. enzyme is the first structure available for the minimal type of bacterial DNA ligases and is the smallest DNA ligase to be crystallized to date.

  18. Biopolymers: Protein and Nucleic Acids

    DTIC Science & Technology

    1987-09-15

    characterized a 45 kDa "ZSB, de!•ignted S’SB1, most extensively. SSB1 was isolated on the basis of preferential binding to sin ie-stranded versus double...stranded DNA and was subsequently shown also to bind to RNA (9). Although SSB1 seems to bind without sequen-e specificity, it is interesting to note...that it copurifies through several a inity steps with the yeast poly (A) binding protein (11, Sach3 and Jong, unpublished observations). SSB1 stimulates

  19. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    PubMed

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Mechanisms of radiation-induced gene responses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Woloschak, G.E.; Paunesku, T.

    1996-10-01

    In the process of identifying genes differentially expressed in cells exposed ultraviolet radiation, we have identified a transcript having a 26-bp region that is highly conserved in a variety of species including Bacillus circulans, yeast, pumpkin, Drosophila, mouse, and man. When the 5` region (flanking region or UTR) of a gene, the sequence is predominantly in +/+ orientation with respect to the coding DNA strand; while in the coding region and the 3` region (UTR), the sequence is most frequently in the +/-orientation with respect to the coding DNA strand. In two genes, the element is split into two parts;more » however, in most cases, it is found only once but with a minimum of 11 consecutive nucleotides precisely depicting the original sequence. The element is found in a large number of different genes with diverse functions (from human ras p21 to B. circulans chitonase). Gel shift assays demonstrated the presence of a protein in HeLa cell extracts that binds to the sense and antisense single-stranded consensus oligomers, as well as to the double- stranded oligonucleotide. When double-stranded oligomer was used, the size shift demonstrated as additional protein-oligomer complex larger than the one bound to either sense or antisense single-stranded consensus oligomers alone. It is speculated either that this element binds to protein(s) important in maintaining DNA is a single-stranded orientation for transcription or, alternatively that this element is important in the transcription-coupled DNA repair process.« less

  1. Evidence for double-strand break mediated mitochondrial DNA replication in Saccharomyces cerevisiae

    PubMed Central

    Prasai, Kanchanjunga; Robinson, Lucy C.; Scott, Rona S.; Tatchell, Kelly

    2017-01-01

    Abstract The mechanism of mitochondrial DNA (mtDNA) replication in Saccharomyces cerevisiae is controversial. Evidence exists for double-strand break (DSB) mediated recombination-dependent replication at mitochondrial replication origin ori5 in hypersuppressive ρ− cells. However, it is not clear if this replication mode operates in ρ+ cells. To understand this, we targeted bacterial Ku (bKu), a DSB binding protein, to the mitochondria of ρ+ cells with the hypothesis that bKu would bind persistently to mtDNA DSBs, thereby preventing mtDNA replication or repair. Here, we show that mitochondrial-targeted bKu binds to ori5 and that inducible expression of bKu triggers petite formation preferentially in daughter cells. bKu expression also induces mtDNA depletion that eventually results in the formation of ρ0 cells. This data supports the idea that yeast mtDNA replication is initiated by a DSB and bKu inhibits mtDNA replication by binding to a DSB at ori5, preventing mtDNA segregation to daughter cells. Interestingly, we find that mitochondrial-targeted bKu does not decrease mtDNA content in human MCF7 cells. This finding is in agreement with the fact that human mtDNA replication, typically, is not initiated by a DSB. Therefore, this study provides evidence that DSB-mediated replication is the predominant form of mtDNA replication in ρ+ yeast cells. PMID:28549155

  2. Dna2 initiates resection at clean DNA double-strand breaks

    PubMed Central

    Paudyal, Sharad C.; Li, Shan; Yan, Hong; Hunter, Tony

    2017-01-01

    Abstract Nucleolytic resection of DNA double-strand breaks (DSBs) is essential for both checkpoint activation and homology-mediated repair; however, the precise mechanism of resection, especially the initiation step, remains incompletely understood. Resection of blocked ends with protein or chemical adducts is believed to be initiated by the MRN complex in conjunction with CtIP through internal cleavage of the 5′ strand DNA. However, it is not clear whether resection of clean DSBs with free ends is also initiated by the same mechanism. Using the Xenopus nuclear extract system, here we show that the Dna2 nuclease directly initiates the resection of clean DSBs by cleaving the 5′ strand DNA ∼10–20 nucleotides away from the ends. In the absence of Dna2, MRN together with CtIP mediate an alternative resection initiation pathway where the nuclease activity of MRN apparently directly cleaves the 5′ strand DNA at more distal sites. MRN also facilitates resection initiation by promoting the recruitment of Dna2 and CtIP to the DNA substrate. The ssDNA-binding protein RPA promotes both Dna2- and CtIP–MRN-dependent resection initiation, but a RPA mutant can distinguish between these pathways. Our results strongly suggest that resection of blocked and clean DSBs is initiated via distinct mechanisms. PMID:28981724

  3. Direct Comparison of Amino Acid and Salt Interactions with Double-Stranded and Single-Stranded DNA from Explicit-Solvent Molecular Dynamics Simulations.

    PubMed

    Andrews, Casey T; Campbell, Brady A; Elcock, Adrian H

    2017-04-11

    Given the ubiquitous nature of protein-DNA interactions, it is important to understand the interaction thermodynamics of individual amino acid side chains for DNA. One way to assess these preferences is to perform molecular dynamics (MD) simulations. Here we report MD simulations of 20 amino acid side chain analogs interacting simultaneously with both a 70-base-pair double-stranded DNA and with a 70-nucleotide single-stranded DNA. The relative preferences of the amino acid side chains for dsDNA and ssDNA match well with values deduced from crystallographic analyses of protein-DNA complexes. The estimated apparent free energies of interaction for ssDNA, on the other hand, correlate well with previous simulation values reported for interactions with isolated nucleobases, and with experimental values reported for interactions with guanosine. Comparisons of the interactions with dsDNA and ssDNA indicate that, with the exception of the positively charged side chains, all types of amino acid side chain interact more favorably with ssDNA, with intercalation of aromatic and aliphatic side chains being especially notable. Analysis of the data on a base-by-base basis indicates that positively charged side chains, as well as sodium ions, preferentially bind to cytosine in ssDNA, and that negatively charged side chains, and chloride ions, preferentially bind to guanine in ssDNA. These latter observations provide a novel explanation for the lower salt dependence of DNA duplex stability in GC-rich sequences relative to AT-rich sequences.

  4. Interactions of Ku70/80 with Double-Strand DNA: Energetic, Dynamics, and Functional Implications

    NASA Technical Reports Server (NTRS)

    Hu, Shaowen; Cucinotta, Francis A.

    2010-01-01

    Space radiation is a proficient inducer of DNA damage leading to mutation, aberrant cell signaling, and cancer formation. Ku is among the first responding proteins in nucleus to recognize and bind the DNA double strand breaks (DSBs) whenever they are introduced. Once loaded Ku works as a scaffold to recruit other repair factors of non-homologous end joining and facilitates the following repair processes. The crystallographic study of the Ku70/80 heterodimer indicate the core structure of this protein shows virtually no conformational change after binding with DNA. To investigate the dynamical features as well as the energetic characteristics of Ku-DNA binding, we conduct multi-nanosecond molecular dynamics simulations of a modeled Ku70/80 structure and several complexes with two 24-bp DNA duplexes. Free energy calculations show significant energy differences between the complexes with Ku bound at DSBs and those with Ku associated at an internal site of a chromosome. The results also reveal detailed interactions between different nucleotides and the amino acids along the DNA-binding cradle of Ku, indicating subtle binding preference of Ku at specific DNA sequences. The covariance matrix analyses along the trajectories demonstrate the protein is stimulated to undergo correlated motions of different domains once bound to DNA ends. Additionally, principle component analyses identify these low frequency collective motions suitable for binding with and translocation along duplex DNA. It is proposed that the modification of dynamical properties of Ku upon binding with DSBs may provide a signal for the further recruitment of other repair factors such as DNA-PKcs, XLF, and XRCC4.

  5. Fanconi Anemia Complementation Group A (FANCA) Protein Has Intrinsic Affinity for Nucleic Acids with Preference for Single-stranded Forms*

    PubMed Central

    Yuan, Fenghua; Qian, Liangyue; Zhao, Xinliang; Liu, Jesse Y.; Song, Limin; D'Urso, Gennaro; Jain, Chaitanya; Zhang, Yanbin

    2012-01-01

    The Fanconi anemia complementation group A (FANCA) gene is one of 15 disease-causing genes and has been found to be mutated in ∼60% of Fanconi anemia patients. Using purified protein, we report that human FANCA has intrinsic affinity for nucleic acids. FANCA binds to both single-stranded (ssDNA) and double-stranded (dsDNA) DNAs; however, its affinity for ssDNA is significantly higher than for dsDNA in an electrophoretic mobility shift assay. FANCA also binds to RNA with an intriguingly higher affinity than its DNA counterpart. FANCA requires a certain length of nucleic acids for optimal binding. Using DNA and RNA ladders, we determined that the minimum number of nucleotides required for FANCA recognition is ∼30 for both DNA and RNA. By testing the affinity between FANCA and a variety of DNA structures, we found that a 5′-flap or 5′-tail on DNA facilitates its interaction with FANCA. A patient-derived FANCA truncation mutant (Q772X) has diminished affinity for both DNA and RNA. In contrast, the complementing C-terminal fragment of Q772X, C772–1455, retains the differentiated nucleic acid-binding activity (RNA > ssDNA > dsDNA), indicating that the nucleic acid-binding domain of FANCA is located primarily at its C terminus, where most disease-causing mutations are found. PMID:22194614

  6. Fanconi anemia complementation group A (FANCA) protein has intrinsic affinity for nucleic acids with preference for single-stranded forms.

    PubMed

    Yuan, Fenghua; Qian, Liangyue; Zhao, Xinliang; Liu, Jesse Y; Song, Limin; D'Urso, Gennaro; Jain, Chaitanya; Zhang, Yanbin

    2012-02-10

    The Fanconi anemia complementation group A (FANCA) gene is one of 15 disease-causing genes and has been found to be mutated in ∼60% of Fanconi anemia patients. Using purified protein, we report that human FANCA has intrinsic affinity for nucleic acids. FANCA binds to both single-stranded (ssDNA) and double-stranded (dsDNA) DNAs; however, its affinity for ssDNA is significantly higher than for dsDNA in an electrophoretic mobility shift assay. FANCA also binds to RNA with an intriguingly higher affinity than its DNA counterpart. FANCA requires a certain length of nucleic acids for optimal binding. Using DNA and RNA ladders, we determined that the minimum number of nucleotides required for FANCA recognition is ∼30 for both DNA and RNA. By testing the affinity between FANCA and a variety of DNA structures, we found that a 5'-flap or 5'-tail on DNA facilitates its interaction with FANCA. A patient-derived FANCA truncation mutant (Q772X) has diminished affinity for both DNA and RNA. In contrast, the complementing C-terminal fragment of Q772X, C772-1455, retains the differentiated nucleic acid-binding activity (RNA > ssDNA > dsDNA), indicating that the nucleic acid-binding domain of FANCA is located primarily at its C terminus, where most disease-causing mutations are found.

  7. The adenovirus L4-22K protein regulates transcription and RNA splicing via a sequence-specific single-stranded RNA binding.

    PubMed

    Lan, Susan; Kamel, Wael; Punga, Tanel; Akusjärvi, Göran

    2017-02-28

    The adenovirus L4-22K protein both activates and suppresses transcription from the adenovirus major late promoter (MLP) by binding to DNA elements located downstream of the MLP transcriptional start site: the so-called DE element (positive) and the R1 region (negative). Here we show that L4-22K preferentially binds to the RNA form of the R1 region, both to the double-stranded RNA and the single-stranded RNA of the same polarity as the nascent MLP transcript. Further, L4-22K binds to a 5΄-CAAA-3΄ motif in the single-stranded RNA, which is identical to the sequence motif characterized for L4-22K DNA binding. L4-22K binding to single-stranded RNA results in an enhancement of U1 snRNA recruitment to the major late first leader 5΄ splice site. This increase in U1 snRNA binding results in a suppression of MLP transcription and a concurrent stimulation of major late first intron splicing. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Mechanism of the formation of the RecA-ssDNA nucleoprotein filament structure: a coarse-grained approach.

    PubMed

    Mukherjee, Goutam; Pal, Arumay; Levy, Yaakov

    2017-11-21

    In prokaryotes, the RecA protein catalyzes the repair and strand exchange of double-stranded DNA. RecA binds to single-stranded DNA (ssDNA) and forms a presynaptic complex in which the protein polymerizes around the ssDNA to form a right-handed helical nucleoprotein filament structure. In the present work, the mechanism for the formation of the RecA-ssDNA filament structure is modeled using coarse-grained molecular dynamics simulations. Information from the X-ray structure was used to model the protein itself but not its interactions; the interactions between the protein and the ssDNA were modeled solely by electrostatic, aromatic, and repulsive energies. For the present study, the monomeric, dimeric, and trimeric units of RecA and 4, 8, and 11 NT-long ssDNA, respectively, were studied. Our results indicate that monomeric RecA is not sufficient for nucleoprotein filament formation; rather, dimeric RecA is the elementary binding unit, with higher multimeric units of RecA facilitating filament formation. Our results reveal that loop region flexibility at the primary binding site of RecA is essential for it to bind the incoming ssDNA, that the aromatic residues present in the loop region play an important role in ssDNA binding, and that ATP may play a role in guiding the ssDNA by changing the electrostatic potential of the RecA protein.

  9. Controllable g5p-Protein-Directed Aggregation of ssDNA-Gold Nanoparticles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, S.; Maye, M; Zhang, Y

    We assembled single-stranded DNA (ssDNA) conjugated nanoparticles using the phage M13 gene 5 protein (g5p) as the molecular glue to bind two antiparallel noncomplementary ssDNA strands. The entire process was controlled tightly by the concentration of the g5p protein and the presence of double-stranded DNA. The g5p-ssDNA aggregate was disintegrated by hybridization with complementary ssDNA (C-ssDNA) that triggers the dissociation of the complex. Polyhistidine-tagged g5p was bound to nickel nitrilotriacetic acid (Ni2+-NTA) conjugated nanoparticles and subsequently used to coassemble the ssDNA-conjugated nanoparticles into multiparticle-type aggregates. Our approach offers great promise for designing biologically functional, controllable protein/nanoparticle composites.

  10. Complex formation by the human Rad51B and Rad51C DNA repair proteins and their activities in vitro

    NASA Technical Reports Server (NTRS)

    Lio, Yi-Ching; Mazin, Alexander V.; Kowalczykowski, Stephen C.; Chen, David J.

    2003-01-01

    The human Rad51 protein is essential for DNA repair by homologous recombination. In addition to Rad51 protein, five paralogs have been identified: Rad51B/Rad51L1, Rad51C/Rad51L2, Rad51D/Rad51L3, XRCC2, and XRCC3. To further characterize a subset of these proteins, recombinant Rad51, Rad51B-(His)(6), and Rad51C proteins were individually expressed employing the baculovirus system, and each was purified from Sf9 insect cells. Evidence from nickel-nitrilotriacetic acid pull-down experiments demonstrates a highly stable Rad51B.Rad51C heterodimer, which interacts weakly with Rad51. Rad51B and Rad51C proteins were found to bind single- and double-stranded DNA and to preferentially bind 3'-end-tailed double-stranded DNA. The ability to bind DNA was elevated with mixed Rad51 and Rad51C, as well as with mixed Rad51B and Rad51C, compared with that of the individual protein. In addition, both Rad51B and Rad51C exhibit DNA-stimulated ATPase activity. Rad51C displays an ATP-independent apparent DNA strand exchange activity, whereas Rad51B shows no such activity; this apparent strand exchange ability results actually from a duplex DNA destabilization capability of Rad51C. By analogy to the yeast Rad55 and Rad57, our results suggest that Rad51B and Rad51C function through interactions with the human Rad51 recombinase and play a crucial role in the homologous recombinational repair pathway.

  11. Flexible DNA Path in the MCM Double Hexamer Loaded on DNA.

    PubMed

    Hizume, Kohji; Kominami, Hiroaki; Kobayashi, Kei; Yamada, Hirofumi; Araki, Hiroyuki

    2017-05-16

    The formation of the pre-replicative complex (pre-RC) during the G1 phase, which is also called the licensing of DNA replication, is the initial and essential step of faithful DNA replication during the subsequent S phase. It is widely accepted that in the pre-RC, double-stranded DNA passes through the holes of two ring-shaped minichromosome maintenance (MCM) 2-7 hexamers; however, the spatial organization of the DNA and proteins involved in pre-RC formation is unclear. Here we reconstituted the pre-RC from purified DNA and proteins and visualized the complex using atomic force microscopy (AFM). AFM revealed that the MCM double hexamers formed elliptical particles on DNA. Analysis of the angle of binding of DNA to the MCM double hexamer suggests that the DNA does not completely pass through both holes of the MCM hexamers, possibly because the DNA exited from the gap between Mcm2 and Mcm5. A DNA loop fastened by the MCM double hexamer was detected in pre-RC samples reconstituted from purified proteins as well as those purified from yeast cells, suggesting a higher-order architecture of the loaded MCM hexamers and DNA strands.

  12. A single-stranded DNA binding protein from mouse tumor cells specifically recognizes the C-rich strand of the (AGG:CCT)n repeats that can alter DNA conformation.

    PubMed Central

    Muraiso, T; Nomoto, S; Yamazaki, H; Mishima, Y; Kominami, R

    1992-01-01

    A protein that binds to a synthetic oligonucleotide of (CCT)12 has been purified from Ehrlich ascites tumor cells by a (CCT)12 affinity chromatography. The protein (p70) has an apparent molecular mass of 70 kDa, as assayed by Southwestern analysis. A competition experiment revealed that p70 binds to (CCT)12, (CCCT)8 and (CCTCCCT)6, but not to (CTT)12, (CT)16 and (CCTGCCT)6, suggesting that p70 has a sequence-specificity. The complementary (AGG)12 and the double stranded DNA did not show the binding. It is also confirmed by S1 nuclease analysis that the (AGG:CCT)12 duplex takes a single-stranded conformation in the absence of the protein. This raises a possibility that the duplex forms two single-stranded loops in chromosomes, the C-rich strand being bound to p70. Structural analysis of the resulting (AGG)12 strand by non-denaturing polyacrylamide gel electrophoresis demonstrated the presence of slower and faster migrated conformers in a neutral pH buffer containing 50 mM NaCl at 5 degrees C. The ratio was dependent on the DNA concentration. Both conformers disappeared in the absence of NaCl. This suggests that (AGG)12 can form intra- and inter-molecular complexes by non-Watson-Crick, guanine:guanine base-pairing. The possible biological function of the (AGG:CCT)n duplex and the p70 is discussed. Images PMID:1480484

  13. Synthesis of DNA

    DOEpatents

    Mariella, Jr., Raymond P.

    2008-11-18

    A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

  14. Formation of template-switching artifacts by linear amplification.

    PubMed

    Chakravarti, Dhrubajyoti; Mailander, Paula C

    2008-07-01

    Linear amplification is a method of synthesizing single-stranded DNA from either a single-stranded DNA or one strand of a double-stranded DNA. In this protocol, molecules of a single primer DNA are extended by multiple rounds of DNA synthesis at high temperature using thermostable DNA polymerases. Although linear amplification generates the intended full-length single-stranded product, it is more efficient over single-stranded templates than double-stranded templates. We analyzed linear amplification over single- or double-stranded mouse H-ras DNA (exon 1-2 region). The single-stranded H-ras template yielded only the intended product. However, when the double-stranded template was used, additional artifact products were observed. Increasing the concentration of the double-stranded template produced relatively higher amounts of these artifact products. One of the artifact DNA bands could be mapped and analyzed by sequencing. It contained three template-switching products. These DNAs were formed by incomplete DNA strand extension over the template strand, followed by switching to the complementary strand at a specific Ade nucleotide within a putative hairpin sequence, from which DNA synthesis continued over the complementary strand.

  15. Site- and strand-specific nicking of DNA by fusion proteins derived from MutH and I-SceI or TALE repeats.

    PubMed

    Gabsalilow, Lilia; Schierling, Benno; Friedhoff, Peter; Pingoud, Alfred; Wende, Wolfgang

    2013-04-01

    Targeted genome engineering requires nucleases that introduce a highly specific double-strand break in the genome that is either processed by homology-directed repair in the presence of a homologous repair template or by non-homologous end-joining (NHEJ) that usually results in insertions or deletions. The error-prone NHEJ can be efficiently suppressed by 'nickases' that produce a single-strand break rather than a double-strand break. Highly specific nickases have been produced by engineering of homing endonucleases and more recently by modifying zinc finger nucleases (ZFNs) composed of a zinc finger array and the catalytic domain of the restriction endonuclease FokI. These ZF-nickases work as heterodimers in which one subunit has a catalytically inactive FokI domain. We present two different approaches to engineer highly specific nickases; both rely on the sequence-specific nicking activity of the DNA mismatch repair endonuclease MutH which we fused to a DNA-binding module, either a catalytically inactive variant of the homing endonuclease I-SceI or the DNA-binding domain of the TALE protein AvrBs4. The fusion proteins nick strand specifically a bipartite recognition sequence consisting of the MutH and the I-SceI or TALE recognition sequences, respectively, with a more than 1000-fold preference over a stand-alone MutH site. TALE-MutH is a programmable nickase.

  16. DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

    PubMed

    Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

    2012-11-01

    The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

  17. Sequence-specific DNA binding Pyrrole-imidazole polyamides and their applications.

    PubMed

    Kawamoto, Yusuke; Bando, Toshikazu; Sugiyama, Hiroshi

    2018-05-01

    Pyrrole-imidazole polyamides (Py-Im polyamides) are cell-permeable compounds that bind to the minor groove of double-stranded DNA in a sequence-specific manner without causing denaturation of the DNA. These compounds can be used to control gene expression and to stain specific sequences in cells. Here, we review the history, structural variations, and functional investigations of Py-Im polyamides. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    PubMed Central

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-01-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

  19. Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

    PubMed

    Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

    2015-05-14

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  20. Excess single-stranded DNA inhibits meiotic double-strand break repair.

    PubMed

    Johnson, Rebecca; Borde, Valérie; Neale, Matthew J; Bishop-Bailey, Anna; North, Matthew; Harris, Sheila; Nicolas, Alain; Goldman, Alastair S H

    2007-11-01

    During meiosis, self-inflicted DNA double-strand breaks (DSBs) are created by the protein Spo11 and repaired by homologous recombination leading to gene conversions and crossovers. Crossover formation is vital for the segregation of homologous chromosomes during the first meiotic division and requires the RecA orthologue, Dmc1. We analyzed repair during meiosis of site-specific DSBs created by another nuclease, VMA1-derived endonuclease (VDE), in cells lacking Dmc1 strand-exchange protein. Turnover and resection of the VDE-DSBs was assessed in two different reporter cassettes that can repair using flanking direct repeat sequences, thereby obviating the need for a Dmc1-dependent DNA strand invasion step. Access of the single-strand binding complex replication protein A, which is normally used in all modes of DSB repair, was checked in chromatin immunoprecipitation experiments, using antibody against Rfa1. Repair of the VDE-DSBs was severely inhibited in dmc1Delta cells, a defect that was associated with a reduction in the long tract resection required to initiate single-strand annealing between the flanking repeat sequences. Mutants that either reduce Spo11-DSB formation or abolish resection at Spo11-DSBs rescued the repair block. We also found that a replication protein A component, Rfa1, does not accumulate to expected levels at unrepaired single-stranded DNA (ssDNA) in dmc1Delta cells. The requirement of Dmc1 for VDE-DSB repair using flanking repeats appears to be caused by the accumulation of large quantities of ssDNA that accumulate at Spo11-DSBs when Dmc1 is absent. We propose that these resected DSBs sequester both resection machinery and ssDNA binding proteins, which in wild-type cells would normally be recycled as Spo11-DSBs repair. The implication is that repair proteins are in limited supply, and this could reflect an underlying mechanism for regulating DSB repair in wild-type cells, providing protection from potentially harmful effects of overabundant repair proteins.

  1. Excess Single-Stranded DNA Inhibits Meiotic Double-Strand Break Repair

    PubMed Central

    Bishop-Bailey, Anna; North, Matthew; Harris, Sheila; Nicolas, Alain; Goldman, Alastair S. H

    2007-01-01

    During meiosis, self-inflicted DNA double-strand breaks (DSBs) are created by the protein Spo11 and repaired by homologous recombination leading to gene conversions and crossovers. Crossover formation is vital for the segregation of homologous chromosomes during the first meiotic division and requires the RecA orthologue, Dmc1.We analyzed repair during meiosis of site-specific DSBs created by another nuclease, VMA1-derived endonuclease (VDE), in cells lacking Dmc1 strand-exchange protein. Turnover and resection of the VDE-DSBs was assessed in two different reporter cassettes that can repair using flanking direct repeat sequences, thereby obviating the need for a Dmc1-dependent DNA strand invasion step. Access of the single-strand binding complex replication protein A, which is normally used in all modes of DSB repair, was checked in chromatin immunoprecipitation experiments, using antibody against Rfa1. Repair of the VDE-DSBs was severely inhibited in dmc1Δ cells, a defect that was associated with a reduction in the long tract resection required to initiate single-strand annealing between the flanking repeat sequences. Mutants that either reduce Spo11-DSB formation or abolish resection at Spo11-DSBs rescued the repair block. We also found that a replication protein A component, Rfa1, does not accumulate to expected levels at unrepaired single-stranded DNA (ssDNA) in dmc1Δ cells. The requirement of Dmc1 for VDE-DSB repair using flanking repeats appears to be caused by the accumulation of large quantities of ssDNA that accumulate at Spo11-DSBs when Dmc1 is absent. We propose that these resected DSBs sequester both resection machinery and ssDNA binding proteins, which in wild-type cells would normally be recycled as Spo11-DSBs repair. The implication is that repair proteins are in limited supply, and this could reflect an underlying mechanism for regulating DSB repair in wild-type cells, providing protection from potentially harmful effects of overabundant repair proteins. PMID:18081428

  2. Expression, purification, and DNA-binding activity of the Herbaspirillum seropedicae RecX protein.

    PubMed

    Galvão, Carolina W; Pedrosa, Fábio O; Souza, Emanuel M; Yates, M Geoffrey; Chubatsu, Leda S; Steffens, Maria Berenice R

    2004-06-01

    The Herbaspirillum seropedicae RecX protein participates in the SOS response: a process in which the RecA protein plays a central role. The RecX protein of the H. seropedicae, fused to a His-tag sequence (RecX His-tagged), was over-expressed in Escherichia coli and purified by metal-affinity chromatography to yield a highly purified and active protein. DNA band-shift assays showed that the RecX His-tagged protein bound to both circular and linear double-stranded DNA and also to circular single-stranded DNA. The apparent affinity of RecX for DNA decreased in the presence of Mg(2+) ions. The ability of RecX to bind DNA may be relevant to its function in the SOS response.

  3. Structural analysis of viral replicative intermediates isolated from adenovirus type 2-infected HeLa cell nuclei.

    PubMed Central

    Kedinger, C; Brison, O; Perrin, F; Wilhelm, J

    1978-01-01

    Deoxyribonucleoprotein complexes released 17 h postinfection from adenovirus type 1 (Ad2)-infected HeLa cell nuclei were shown by electron microscopy to contain filaments much thicker (about 200 A [20 nm]) than double-stranded DNA (about 20 A [2 nm]). The complexes were partially purified through a linear sucrose gradient, concentrated, and further purified in a metrizamide gradient. The major protein present in the complexes was identified as the 72,000-dalton (72K), adenovirus-coded single-stranded DNA-binding protein (72K DBP). Three types of complexes have been visualized by electron microscopy. Some linear complexes were uniformly thick, and their length corresponded roughly to that of the adenovirus genome. Other linear genome-length complexes appeared to consist of a thick filament connected to a thinner filament with the diameter of double-stranded DNA. Forked complexes consisting of one thick filament connected to a genome-length, thinner double-stranded DNA filament were also visualized. Both thick and thin filaments were sensitive to DNase and not to RNase, but only the thick filaments were digested by the single-strand-specific Neurospora crassa nuclease, indicating that they correspond to a complex of 72K DBP and Ad2 single-stranded DNA. Experiments with anti-72K DBP immunoglobulins indicated that these nucleoprotein complexes, containing the 72K DBP, correspond to replicative intermediates. Both strands of the Ad2 genome were found associated to the 72K DBP. Altogether, our results establish the in vivo association of the 72K DBP with adenovirus single-stranded DNA, as previously suggested from in vitro studies, and support a strand displacement mechanism for Ad2 DNA replication, in which both strands can be displaced. In addition, our results indicate that, late in infection, histones are not bound to adenovirus DNA in the form of a nucleosomal chromatine-like structure. Images PMID:207893

  4. Structural analysis of viral replicative intermediates isolated from adenovirus type 2-infected HeLa cell nuclei.

    PubMed

    Kedinger, C; Brison, O; Perrin, F; Wilhelm, J

    1978-05-01

    Deoxyribonucleoprotein complexes released 17 h postinfection from adenovirus type 1 (Ad2)-infected HeLa cell nuclei were shown by electron microscopy to contain filaments much thicker (about 200 A [20 nm]) than double-stranded DNA (about 20 A [2 nm]). The complexes were partially purified through a linear sucrose gradient, concentrated, and further purified in a metrizamide gradient. The major protein present in the complexes was identified as the 72,000-dalton (72K), adenovirus-coded single-stranded DNA-binding protein (72K DBP). Three types of complexes have been visualized by electron microscopy. Some linear complexes were uniformly thick, and their length corresponded roughly to that of the adenovirus genome. Other linear genome-length complexes appeared to consist of a thick filament connected to a thinner filament with the diameter of double-stranded DNA. Forked complexes consisting of one thick filament connected to a genome-length, thinner double-stranded DNA filament were also visualized. Both thick and thin filaments were sensitive to DNase and not to RNase, but only the thick filaments were digested by the single-strand-specific Neurospora crassa nuclease, indicating that they correspond to a complex of 72K DBP and Ad2 single-stranded DNA. Experiments with anti-72K DBP immunoglobulins indicated that these nucleoprotein complexes, containing the 72K DBP, correspond to replicative intermediates. Both strands of the Ad2 genome were found associated to the 72K DBP. Altogether, our results establish the in vivo association of the 72K DBP with adenovirus single-stranded DNA, as previously suggested from in vitro studies, and support a strand displacement mechanism for Ad2 DNA replication, in which both strands can be displaced. In addition, our results indicate that, late in infection, histones are not bound to adenovirus DNA in the form of a nucleosomal chromatine-like structure.

  5. Detection of DNA damage in individual cells by flow cytometric analysis using anti-DNA monoclonal antibody

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Frankfurt, O.S.

    A new method for the measurement of DNA damage in individual cells treated with alkylating agents is described. The method is based on the binding of anti-DNA monoclonal antibody to DNA in situ. Binding of antibody was evaluated by flow cytometry with indirect immunofluorescence. No binding of antibody to DNA in non-treated HeLa S3 cells was detected. Treatment of cells with HN2 or L-phenylalanine mustard induced binding of antibody to DNA in situ. Binding of antibody was observed after treating cells with doses of drugs which reduced the surviving fraction below 20%. Intensity of binding increased in proportion to themore » drug dose. In HN2-treated cells a cell subset with the lowest antibody binding was observed among cells in G1 phase. Binding of antibody to DNA in HN2-treated cells was eliminated by single-strand (ss) specific S1 nuclease. In competition assay, antibody was inhibited by thermally denatured DNA, but not by native double-stranded (ds) DNA, RNA, nucleosides and deoxyribohomopolymers. Immunoreactivity of cells with the monoclonal antibody F7-26 may be a useful probe for the assessment of cell damage induced by alkylating agents, especially in heterogeneous cell populations.« less

  6. Translocation of double strand DNA into a biological nanopore

    NASA Astrophysics Data System (ADS)

    Chatkaew, Sunita; Mlayeh, Lamia; Leonetti, Marc; Homble, Fabrice

    2009-03-01

    Translocation of double strand DNA across a unique mitochondrial biological nanopore (VDAC) is observed by an electrophysiological method. Characteristics of opened and sub-conductance states of VDAC are studied. When the applied electric potential is beyond ± 20 mV, VDAC transits to a sub-conductance state. Plasmids (circular double strand DNA) with a diameter greater than that of the channel shows the current reduction into the channel during the interaction but the state with zero-current is not observed. On the contrary, the interaction of linear double strand DNA with the channel shows the current reduction along with the zero-current state. These show the passages of linear double strand DNA across the channel and the electrostatic effect due to the surface charges of double strand DNA and channel for circular and linear double strand DNA.

  7. Evidence for double-strand break mediated mitochondrial DNA replication in Saccharomyces cerevisiae.

    PubMed

    Prasai, Kanchanjunga; Robinson, Lucy C; Scott, Rona S; Tatchell, Kelly; Harrison, Lynn

    2017-07-27

    The mechanism of mitochondrial DNA (mtDNA) replication in Saccharomyces cerevisiae is controversial. Evidence exists for double-strand break (DSB) mediated recombination-dependent replication at mitochondrial replication origin ori5 in hypersuppressive ρ- cells. However, it is not clear if this replication mode operates in ρ+ cells. To understand this, we targeted bacterial Ku (bKu), a DSB binding protein, to the mitochondria of ρ+ cells with the hypothesis that bKu would bind persistently to mtDNA DSBs, thereby preventing mtDNA replication or repair. Here, we show that mitochondrial-targeted bKu binds to ori5 and that inducible expression of bKu triggers petite formation preferentially in daughter cells. bKu expression also induces mtDNA depletion that eventually results in the formation of ρ0 cells. This data supports the idea that yeast mtDNA replication is initiated by a DSB and bKu inhibits mtDNA replication by binding to a DSB at ori5, preventing mtDNA segregation to daughter cells. Interestingly, we find that mitochondrial-targeted bKu does not decrease mtDNA content in human MCF7 cells. This finding is in agreement with the fact that human mtDNA replication, typically, is not initiated by a DSB. Therefore, this study provides evidence that DSB-mediated replication is the predominant form of mtDNA replication in ρ+ yeast cells. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. A paper-based device for double-stranded DNA detection with Zif268

    NASA Astrophysics Data System (ADS)

    Zhang, Daohong

    2017-05-01

    Here, a small analytical device was fabricated on both nitrocellulose membrane and filter paper, for the detection of biotinylated double-stranded DNA (dsDNA) from 1 nM. Zif268 was utilized for capturing the target DNA, which was a zinc finger protein that recognized only a dsDNA with specific sequence. Therefore, this detection platform could be utilized for PCR result detection, with the well-designed primers (interpolate both biotin and Zif268 binding sequence). The result of the assay could be recorded by a camera-phone, and analyzed with software. The whole assay finished within 1 hour. Due to the easy fabrication, operation and disposal of this device, this method can be employed in point-of-care detection or on-site monitoring.

  9. Characterization of biochemical properties of Bacillus subtilis RecQ helicase.

    PubMed

    Qin, Wei; Liu, Na-Nv; Wang, Lijun; Zhou, Min; Ren, Hua; Bugnard, Elisabeth; Liu, Jie-Lin; Zhang, Lin-Hu; Vendôme, Jeremie; Hu, Jin-Shan; Xi, Xu Guang

    2014-12-01

    RecQ family helicases function as safeguards of the genome. Unlike Escherichia coli, the Gram-positive Bacillus subtilis bacterium possesses two RecQ-like homologues, RecQ[Bs] and RecS, which are required for the repair of DNA double-strand breaks. RecQ[Bs] also binds to the forked DNA to ensure a smooth progression of the cell cycle. Here we present the first biochemical analysis of recombinant RecQ[Bs]. RecQ[Bs] binds weakly to single-stranded DNA (ssDNA) and blunt-ended double-stranded DNA (dsDNA) but strongly to forked dsDNA. The protein exhibits a DNA-stimulated ATPase activity and ATP- and Mg(2+)-dependent DNA helicase activity with a 3' → 5' polarity. Molecular modeling shows that RecQ[Bs] shares high sequence and structure similarity with E. coli RecQ. Surprisingly, RecQ[Bs] resembles the truncated Saccharomyces cerevisiae Sgs1 and human RecQ helicases more than RecQ[Ec] with regard to its enzymatic activities. Specifically, RecQ[Bs] unwinds forked dsDNA and DNA duplexes with a 3'-overhang but is inactive on blunt-ended dsDNA and 5'-overhung duplexes. Interestingly, RecQ[Bs] unwinds blunt-ended DNA with structural features, including nicks, gaps, 5'-flaps, Kappa joints, synthetic replication forks, and Holliday junctions. We discuss these findings in the context of RecQ[Bs]'s possible functions in preserving genomic stability. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  10. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Seongman; Chul Ahn, Byung; O'Callaghan, Dennis J.

    2012-10-25

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealedmore » that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.« less

  11. Identification of Proteins Required for Repair of Double-Strand Chromosome Breaks, a Predisposing Factor in Breast Cancer

    DTIC Science & Technology

    2001-06-01

    enzymatic apparatus needed to initiate DNA replication on recombination intermediates. Escherichia coli PriA protein was found to play a critical function in...the transition from recombination to DNA replication . PriA specifically binds to forked DNA structures created by recombination or replication fork

  12. Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets.

    PubMed

    Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard

    2007-10-30

    We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 x 10(8) bound targets per cm(2) sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format.

  13. Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets

    PubMed Central

    Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard

    2007-01-01

    We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 × 108 bound targets per cm2 sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format. PMID:17951434

  14. Interplay between CedA, rpoB and double stranded DNA: A step towards understanding CedA mediated cell division in E. coli.

    PubMed

    Sharma, Pankaj; Tomar, Anil Kumar; Kundu, Bishwajit

    2018-02-01

    Cell division is compromised in DnaAcos mutant E. coli cells due to chromosome over-replication. In these cells, CedA acts as a regulatory protein and initiates cell division by a hitherto unknown mechanism. CedA, a double stranded DNA binding protein, interacts with various subunits of RNA polymerase complex, including rpoB. To reveal how this concert between CedA, rpoB and DNA brings about cell division in E. coli, we performed biophysical and in silico analysis and obtained mechanistic insights. Interaction between CedA and rpoB was shown by circular dichroism spectrometry and in silico docking experiments. Further, CedA and rpoB were allowed to interact individually to a selected DNA and their binding was monitored by fluorescence spectroscopy. The binding constants of these interactions as determined by BioLayer Interferometry clearly show that rpoB binds to DNA with higher affinity (K D2 =<1.0E-12M) as compared to CedA (K D2 =9.58E-09M). These findings were supported by docking analysis where 12 intermolecular H-bonds were formed in rpoB-DNA complex as compared to 4 in CedA-DNA complex. Based on our data we propose that in E. coli cells chromosome over-replication signals CedA to recruit rpoB to specific DNA site(s), which initiates transcription of cell division regulatory elements. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Nonenzymatic Role for WRN in Preserving Nascent DNA Strands after Replication Stress

    DOE PAGES

    Su, Fengtao; Mukherjee, Shibani; Yang, Yanyong; ...

    2014-11-20

    WRN, the protein defective in Werner syndrome (WS), is a multifunctional nuclease involved in DNA damage repair, replication, and genome stability maintenance. It was assumed that the nuclease activities of WRN were critical for these functions. Here, we report a nonenzymatic role for WRN in preserving nascent DNA strands following replication stress. We found that lack of WRN led to shortening of nascent DNA strands after replication stress. Furthermore, we discovered that the exonuclease activity of MRE11 was responsible for the shortening of newly replicated DNA in the absence of WRN. Mechanistically, the N-terminal FHA domain of NBS1 recruits WRNmore » to replication-associated DNA double-stranded breaks to stabilize Rad51 and to limit the nuclease activity of its C-terminal binding partner MRE11. Thus, this previously unrecognized nonenzymatic function of WRN in the stabilization of nascent DNA strands sheds light on the molecular reason for the origin of genome instability in WS individuals.« less

  16. Strand-Specific Analysis of DNA Synthesis and Proteins Association with DNA Replication Forks in Budding Yeast.

    PubMed

    Yu, Chuanhe; Gan, Haiyun; Zhang, Zhiguo

    2018-01-01

    DNA replication initiates at DNA replication origins after unwinding of double-strand DNA(dsDNA) by replicative helicase to generate single-stranded DNA (ssDNA) templates for the continuous synthesis of leading-strand and the discontinuous synthesis of lagging-strand. Therefore, methods capable of detecting strand-specific information will likely yield insight into the association of proteins at leading and lagging strand of DNA replication forks and the regulation of leading and lagging strand synthesis during DNA replication. The enrichment and Sequencing of Protein-Associated Nascent DNA (eSPAN), which measure the relative amounts of proteins at nascent leading and lagging strands of DNA replication forks, is a step-wise procedure involving the chromatin immunoprecipitation (ChIP) of a protein of interest followed by the enrichment of protein-associated nascent DNA through BrdU immunoprecipitation. The isolated ssDNA is then subjected to strand-specific sequencing. This method can detect whether a protein is enriched at leading or lagging strand of DNA replication forks. In addition to eSPAN, two other strand-specific methods, (ChIP-ssSeq), which detects potential protein-ssDNA binding and BrdU-IP-ssSeq, which can measure synthesis of both leading and lagging strand, were developed along the way. These methods can provide strand-specific and complementary information about the association of the target protein with DNA replication forks as well as synthesis of leading and lagging strands genome wide. Below, we describe the detailed eSPAN, ChIP-ssSeq, and BrdU-IP-ssSeq protocols.

  17. Protection of Arabidopsis Blunt-Ended Telomeres Is Mediated by a Physical Association with the Ku Heterodimer[OPEN

    PubMed Central

    Valuchova, Sona; Prokop, Zbynek; Hofr, Ctirad

    2017-01-01

    Telomeres form specialized chromatin that protects natural chromosome termini from being recognized as DNA double-strand breaks. Plants possess unusual blunt-ended telomeres that are unable to form t-loops or complex with single-strand DNA binding proteins, raising the question of the mechanism behind their protection. We have previously suggested that blunt-ended telomeres in Arabidopsis thaliana are protected by Ku, a DNA repair factor with a high affinity for DNA ends. In nonhomologous end joining, Ku loads onto broken DNA via a channel consisting of positively charged amino acids. Here, we demonstrate that while association of Ku with plant telomeres also depends on this channel, Ku’s requirements for DNA binding differ between DNA repair and telomere protection. We show that a Ku complex proficient in DNA loading but impaired in translocation along DNA is able to protect blunt-ended telomeres but is deficient in DNA repair. This suggests that Ku physically sequesters blunt-ended telomeres within its DNA binding channel, shielding them from other DNA repair machineries. PMID:28584163

  18. Annealing of Complementary DNA Sequences During Double-Strand Break Repair in Drosophila Is Mediated by the Ortholog of SMARCAL1.

    PubMed

    Holsclaw, Julie Korda; Sekelsky, Jeff

    2017-05-01

    DNA double-strand breaks (DSBs) pose a serious threat to genomic integrity. If unrepaired, they can lead to chromosome fragmentation and cell death. If repaired incorrectly, they can cause mutations and chromosome rearrangements. DSBs are repaired using end-joining or homology-directed repair strategies, with the predominant form of homology-directed repair being synthesis-dependent strand annealing (SDSA). SDSA is the first defense against genomic rearrangements and information loss during DSB repair, making it a vital component of cell health and an attractive target for chemotherapeutic development. SDSA has also been proposed to be the primary mechanism for integration of large insertions during genome editing with CRISPR/Cas9. Despite the central role for SDSA in genome stability, little is known about the defining step: annealing. We hypothesized that annealing during SDSA is performed by the annealing helicase SMARCAL1, which can anneal RPA-coated single DNA strands during replication-associated DNA damage repair. We used unique genetic tools in Drosophila melanogaster to test whether the fly ortholog of SMARCAL1, Marcal1, mediates annealing during SDSA. Repair that requires annealing is significantly reduced in Marcal1 null mutants in both synthesis-dependent and synthesis-independent (single-strand annealing) assays. Elimination of the ATP-binding activity of Marcal1 also reduced annealing-dependent repair, suggesting that the annealing activity requires translocation along DNA. Unlike the null mutant, however, the ATP-binding defect mutant showed reduced end joining, shedding light on the interaction between SDSA and end-joining pathways. Copyright © 2017 by the Genetics Society of America.

  19. Characterization of Bleomycin-Mediated Cleavage of a Hairpin DNA Library

    PubMed Central

    Segerman, Zachary J.; Roy, Basab; Hecht, Sidney M.

    2013-01-01

    A study of BLM A5 was conducted using a previously isolated library of hairpin DNAs found to bind strongly to metal free BLM. The ability of Fe(II)•BLM to effect cleavage on both the 3' and 5'-arms of the hairpin DNAs was characterized. The strongly bound DNAs were found to be efficient substrates for Fe•BLM A5-mediated hairpin DNA cleavage. Surprisingly, the most prevalent site of BLM-mediated cleavage was found to be the 5′-AT-3′ dinucleotide sequence. This dinucleotide sequence, and other sequences generally not cleaved well by BLM when examined using arbitrarily chosen DNA substrates, were apparent when examining the library of ten hairpin DNAs. In total, 132 sites of DNA cleavage were produced by exposure of the hairpin DNA library to Fe•BLM A5. The existence of multiple sites of cleavage on both the 3′- and 5′-arms of the hairpin DNAs suggested that some of these might be double-strand cleavage events. Accordingly, an assay was developed with which to test the propensity of the hairpin DNAs to undergo double-strand DNA damage. One hairpin DNA was characterized using this method, and gave results consistent with earlier reports of double-strand DNA cleavage, but with a sequence selectivity different from those reported previously. PMID:23834496

  20. The C terminus of Ku80 activates the DNA-dependent protein kinase catalytic subunit.

    PubMed

    Singleton, B K; Torres-Arzayus, M I; Rottinghaus, S T; Taccioli, G E; Jeggo, P A

    1999-05-01

    Ku is a heterodimeric protein with double-stranded DNA end-binding activity that operates in the process of nonhomologous end joining. Ku is thought to target the DNA-dependent protein kinase (DNA-PK) complex to the DNA and, when DNA bound, can interact and activate the DNA-PK catalytic subunit (DNA-PKcs). We have carried out a 3' deletion analysis of Ku80, the larger subunit of Ku, and shown that the C-terminal 178 amino acid residues are dispensable for DNA end-binding activity but are required for efficient interaction of Ku with DNA-PKcs. Cells expressing Ku80 proteins that lack the terminal 178 residues have low DNA-PK activity, are radiation sensitive, and can recombine the signal junctions but not the coding junctions during V(D)J recombination. These cells have therefore acquired the phenotype of mouse SCID cells despite expressing DNA-PKcs protein, suggesting that an interaction between DNA-PKcs and Ku, involving the C-terminal region of Ku80, is required for DNA double-strand break rejoining and coding but not signal joint formation. To gain further insight into important domains in Ku80, we report a point mutational change in Ku80 in the defective xrs-2 cell line. This residue is conserved among species and lies outside of the previously reported Ku70-Ku80 interaction domain. The mutational change nonetheless abrogates the Ku70-Ku80 interaction and DNA end-binding activity.

  1. From face to interface recognition: a differential geometric approach to distinguish DNA from RNA binding surfaces.

    PubMed

    Shazman, Shula; Elber, Gershon; Mandel-Gutfreund, Yael

    2011-09-01

    Protein nucleic acid interactions play a critical role in all steps of the gene expression pathway. Nucleic acid (NA) binding proteins interact with their partners, DNA or RNA, via distinct regions on their surface that are characterized by an ensemble of chemical, physical and geometrical properties. In this study, we introduce a novel methodology based on differential geometry, commonly used in face recognition, to characterize and predict NA binding surfaces on proteins. Applying the method on experimentally solved three-dimensional structures of proteins we successfully classify double-stranded DNA (dsDNA) from single-stranded RNA (ssRNA) binding proteins, with 83% accuracy. We show that the method is insensitive to conformational changes that occur upon binding and can be applicable for de novo protein-function prediction. Remarkably, when concentrating on the zinc finger motif, we distinguish successfully between RNA and DNA binding interfaces possessing the same binding motif even within the same protein, as demonstrated for the RNA polymerase transcription-factor, TFIIIA. In conclusion, we present a novel methodology to characterize protein surfaces, which can accurately tell apart dsDNA from an ssRNA binding interfaces. The strength of our method in recognizing fine-tuned differences on NA binding interfaces make it applicable for many other molecular recognition problems, with potential implications for drug design.

  2. Synthesis of mouse centromere-targeted polyamides and physico-chemical studies of their interaction with the target double-stranded DNA.

    PubMed

    Nozeret, Karine; Bonan, Marc; Yarmoluk, Serguiy M; Novopashina, Darya S; Boutorine, Alexandre S

    2015-09-01

    Synthetic minor groove-binding pyrrole-imidazole polyamides labeled by fluorophores are promising candidates for fluorescence imaging of double-stranded DNA in isolated chromosomes or fixed and living cells. We synthesized nine hairpin and two head-to-head tandem polyamides targeting repeated sequences from mouse major satellites. Their interaction with synthetic target dsDNA has been studied by physico-chemical methods in vitro before and after coupling to various fluorophores. Great variability in affinities and fluorescence properties reveals a conclusion that these properties do not only rely on recognition rules, but also on other known and unknown structural factors. Individual testing of each probe is needed before cellular applications. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Fe65 is required for Tip60-directed histone H4 acetylation at DNA strand breaks

    PubMed Central

    Stante, Maria; Minopoli, Giuseppina; Passaro, Fabiana; Raia, Maddalena; Vecchio, Luigi Del; Russo, Tommaso

    2009-01-01

    Fe65 is a binding partner of the Alzheimer's β-amyloid precursor protein APP. The possible involvement of this protein in the cellular response to DNA damage was suggested by the observation that Fe65 null mice are more sensitive to genotoxic stress than WT counterpart. Fe65 associated with chromatin under basal conditions and its involvement in DNA damage repair requires this association. A known partner of Fe65 is the histone acetyltransferase Tip60. Considering the crucial role of Tip60 in DNA repair, we explored the hypothesis that the phenotype of Fe65 null cells depended on its interaction with Tip60. We demonstrated that Fe65 knockdown impaired recruitment of Tip60-TRRAP complex to DNA double strand breaks and decreased histone H4 acetylation. Accordingly, the efficiency of DNA repair was decreased upon Fe65 suppression. To explore whether APP has a role in this mechanism, we analyzed a Fe65 mutant unable to bind to APP. This mutant failed to rescue the phenotypes of Fe65 null cells; furthermore, APP/APLP2 suppression results in the impairment of recruitment of Tip60-TRRAP complex to DNA double strand breaks, decreased histone H4 acetylation and repair efficiency. On these bases, we propose that Fe65 and its interaction with APP play an important role in the response to DNA damage by assisting the recruitment of Tip60-TRRAP to DNA damage sites. PMID:19282473

  4. Dyes designed for high sensitivity detection of double-stranded DNA

    DOEpatents

    Glazer, Alexander N.; Benson, Scott C.

    2000-01-01

    Novel fluorescent dyes are provided, characterized by having a fluorophore joined to a cationic chain. The dyes are found to provide for high enhancement upon binding to nucleic acid and have strong binding affinities to the nucleic acid, as compared to the fluorophore without the polycationic chain. The dyes find use in detection of dsDNA in gel electrophoresis and solution at substantially higher sensitivities using substantially less dye.

  5. Dyes designed for high sensitivity detection of double-stranded DNA

    DOEpatents

    Glazer, Alexander N.; Benson, Scott C.

    1998-01-01

    Novel fluorescent dyes are provided, characterized by having a fluorophore joined to a cationic chain. The dyes are found to provide for high enhancement upon binding to nucleic acid and have strong binding affinities to the nucleic acid, as compared to the fluorophore without the polycationic chain. The dyes find use in detection of dsDNA in gel electrophoresis and solution at substantially higher sensitivities using substantially less dye.

  6. Molecular interactions between single-stranded DNA-binding proteins associated with an essential MCAT element in the mouse smooth muscle alpha-actin promoter.

    PubMed

    Kelm, R J; Cogan, J G; Elder, P K; Strauch, A R; Getz, M J

    1999-05-14

    Transcriptional activity of the mouse vascular smooth muscle alpha-actin gene in fibroblasts is regulated, in part, by a 30-base pair asymmetric polypurine-polypyrimidine tract containing an essential MCAT enhancer motif. The double-stranded form of this sequence serves as a binding site for a transcription enhancer factor 1-related protein while the separated single strands interact with two distinct DNA binding activities termed VACssBF1 and 2 (Cogan, J. G., Sun, S., Stoflet, E. S., Schmidt, L. J., Getz, M. J., and Strauch, A. R. (1995) J. Biol. Chem. 270, 11310-11321; Sun, S., Stoflet, E. S., Cogan, J. G., Strauch, A. R., and Getz, M. J. (1995) Mol. Cell. Biol. 15, 2429-2936). VACssBF2 has been recently cloned and shown to consist of two closely related proteins, Puralpha and Purbeta (Kelm, R. J., Elder, P. K., Strauch, A. R., and Getz, M. J. (1997) J. Biol. Chem. 272, 26727-26733). In this study, we demonstrate that Puralpha and Purbeta interact with each other via highly specific protein-protein interactions and bind to the purine-rich strand of the MCAT enhancer in the form of both homo- and heteromeric complexes. Moreover, both Pur proteins interact with MSY1, a VACssBF1-like protein cloned by virtue of its affinity for the pyrimidine-rich strand of the enhancer. Interactions between Puralpha, Purbeta, and MSY1 do not require the participation of DNA. Combinatorial interactions between these three single-stranded DNA-binding proteins may be important in regulating activity of the smooth muscle alpha-actin MCAT enhancer in fibroblasts.

  7. New insight into multifunctional role of peroxiredoxin family protein: Determination of DNA protection properties of bacterioferritin comigratory protein under hyperthermal and oxidative stresses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Sangmin, E-mail: taeinlee2011@kangwon.ac.kr; Chung, Jeong Min; Yun, Hyung Joong

    Bacterioferritin comigratory protein (BCP) is a monomeric conformer acting as a putative thiol-dependent bacterial peroxidase, however molecular basis of DNA-protection via DNA-binding has not been clearly understood. In this study, we characterized the DNA binding properties of BCP using various lengths and differently shaped architectures of DNA. An electrophoretic mobility shift assay and electron microscopy analysis showed that recombinant TkBCP bound to DNA of a circular shape (double-stranded DNA and single-stranded DNA) and a linear shape (16–1000 bp) as well as various architectures of DNA. In addition, DNA protection experiments indicated that TkBCP can protect DNA against hyperthermal and oxidative stressmore » by removing highly reactive oxygen species (ROS) or by protecting DNA from thermal degradation. Based on these results, we suggest that TkBCP is a multi-functional DNA-binding protein which has DNA chaperon and antioxidant functions. - Highlights: • Bacterioferritin comigratory protein (BCP) protects DNA from oxidative stress by reducing ROS. • TkBCP does not only scavenge ROS, but also protect DNA from hyperthermal stress. • BCP potentially adopts the multi-functional role in DNA binding activities and anti-oxidant functions.« less

  8. Photosensitization by iodinated DNA minor groove binding ligands: Evaluation of DNA double-strand break induction and repair.

    PubMed

    Briggs, Benjamin; Ververis, Katherine; Rodd, Annabelle L; Foong, Laura J L; Silva, Fernando M Da; Karagiannis, Tom C

    2011-05-03

    Iodinated DNA minor groove binding bibenzimidazoles represent a unique class of UVA photosensitizer and their extreme photopotency has been previously characterized. Earlier studies have included a comparison of three isomers, referred to as ortho-, meta- and para-iodoHoechst, which differ only in the location of the iodine substituent in the phenyl ring of the bibenzimidazole. DNA breakage and clonogenic survival studies in human erythroleukemic K562 cells have highlighted the higher photo-efficiency of the ortho-isomer (subsequently designated UV(A)Sens) compared to the meta- and para-isomers. In this study, the aim was to compare the induction and repair of DNA double-strand breaks induced by the three isomers in K562 cells. Further, we examined the effects of the prototypical broad-spectrum histone deacetylase inhibitor, Trichostatin A, on ortho-iodoHoechst/UVA-induced double-strand breaks in K562 cells. Using γH2AX as a molecular marker of the DNA lesions, our findings indicate a disparity in the induction and particularly, in the repair kinetics of double-strand breaks for the three isomers. The accumulation of γH2AX foci induced by the meta- and para-isomers returned to background levels within 24 and 48 h, respectively; the number of γH2AX foci induced by ortho-iodoHoechst remained elevated even after incubation for 96 h post-irradiation. These findings provide further evidence that the extreme photopotency of ortho-iodoHoechst is due to not only to the high quantum yield of dehalogenation, but also to the severity of the DNA lesions which are not readily repaired. Finally, our findings which indicate that Trichostatin A has a remarkable potentiating effect on ortho-iodoHoechst/UVA-induced DNA lesions are encouraging, particularly in the context of cutaneous T-cell lymphoma, for which a histone deacetylase inhibitor is already approved for therapy. This finding prompts further evaluation of the potential of combination therapies. Copyright © 2011 Elsevier B.V. All rights reserved.

  9. The Apis mellifera Filamentous Virus Genome

    PubMed Central

    Gauthier, Laurent; Cornman, Scott; Hartmann, Ulrike; Cousserans, François; Evans, Jay D.; de Miranda, Joachim R.; Neumann, Peter

    2015-01-01

    A complete reference genome of the Apis mellifera Filamentous virus (AmFV) was determined using Illumina Hiseq sequencing. The AmFV genome is a double stranded DNA molecule of approximately 498,500 nucleotides with a GC content of 50.8%. It encompasses 247 non-overlapping open reading frames (ORFs), equally distributed on both strands, which cover 65% of the genome. While most of the ORFs lacked threshold sequence alignments to reference protein databases, twenty-eight were found to display significant homologies with proteins present in other large double stranded DNA viruses. Remarkably, 13 ORFs had strong similarity with typical baculovirus domains such as PIFs (per os infectivity factor genes: pif-1, pif-2, pif-3 and p74) and BRO (Baculovirus Repeated Open Reading Frame). The putative AmFV DNA polymerase is of type B, but is only distantly related to those of the baculoviruses. The ORFs encoding proteins involved in nucleotide metabolism had the highest percent identity to viral proteins in GenBank. Other notable features include the presence of several collagen-like, chitin-binding, kinesin and pacifastin domains. Due to the large size of the AmFV genome and the inconsistent affiliation with other large double stranded DNA virus families infecting invertebrates, AmFV may belong to a new virus family. PMID:26184284

  10. The Apis mellifera Filamentous Virus Genome.

    PubMed

    Gauthier, Laurent; Cornman, Scott; Hartmann, Ulrike; Cousserans, François; Evans, Jay D; de Miranda, Joachim R; Neumann, Peter

    2015-07-09

    A complete reference genome of the Apis mellifera Filamentous virus (AmFV) was determined using Illumina Hiseq sequencing. The AmFV genome is a double stranded DNA molecule of approximately 498,500 nucleotides with a GC content of 50.8%. It encompasses 247 non-overlapping open reading frames (ORFs), equally distributed on both strands, which cover 65% of the genome. While most of the ORFs lacked threshold sequence alignments to reference protein databases, twenty-eight were found to display significant homologies with proteins present in other large double stranded DNA viruses. Remarkably, 13 ORFs had strong similarity with typical baculovirus domains such as PIFs (per os infectivity factor genes: pif-1, pif-2, pif-3 and p74) and BRO (Baculovirus Repeated Open Reading Frame). The putative AmFV DNA polymerase is of type B, but is only distantly related to those of the baculoviruses. The ORFs encoding proteins involved in nucleotide metabolism had the highest percent identity to viral proteins in GenBank. Other notable features include the presence of several collagen-like, chitin-binding, kinesin and pacifastin domains. Due to the large size of the AmFV genome and the inconsistent affiliation with other large double stranded DNA virus families infecting invertebrates, AmFV may belong to a new virus family.

  11. Programmable RNA recognition and cleavage by CRISPR/Cas9.

    PubMed

    O'Connell, Mitchell R; Oakes, Benjamin L; Sternberg, Samuel H; East-Seletsky, Alexandra; Kaplan, Matias; Doudna, Jennifer A

    2014-12-11

    The CRISPR-associated protein Cas9 is an RNA-guided DNA endonuclease that uses RNA-DNA complementarity to identify target sites for sequence-specific double-stranded DNA (dsDNA) cleavage. In its native context, Cas9 acts on DNA substrates exclusively because both binding and catalysis require recognition of a short DNA sequence, known as the protospacer adjacent motif (PAM), next to and on the strand opposite the twenty-nucleotide target site in dsDNA. Cas9 has proven to be a versatile tool for genome engineering and gene regulation in a large range of prokaryotic and eukaryotic cell types, and in whole organisms, but it has been thought to be incapable of targeting RNA. Here we show that Cas9 binds with high affinity to single-stranded RNA (ssRNA) targets matching the Cas9-associated guide RNA sequence when the PAM is presented in trans as a separate DNA oligonucleotide. Furthermore, PAM-presenting oligonucleotides (PAMmers) stimulate site-specific endonucleolytic cleavage of ssRNA targets, similar to PAM-mediated stimulation of Cas9-catalysed DNA cleavage. Using specially designed PAMmers, Cas9 can be specifically directed to bind or cut RNA targets while avoiding corresponding DNA sequences, and we demonstrate that this strategy enables the isolation of a specific endogenous messenger RNA from cells. These results reveal a fundamental connection between PAM binding and substrate selection by Cas9, and highlight the utility of Cas9 for programmable transcript recognition without the need for tags.

  12. DNA-binding and oxidative properties of cationic phthalocyanines and their dimeric complexes with anionic phthalocyanines covalently linked to oligonucleotides.

    PubMed

    Kuznetsova, A A; Lukyanets, E A; Solovyeva, L I; Knorre, D G; Fedorova, O S

    2008-12-01

    Design of chemically modified oligonucleotides for regulation of gene expression has attracted considerable attention over the past decades. One actively pursued approach involves antisense or antigene oligonucleotide constructs carrying reactive groups, many of these based on transition metal complexes. The complexes of Fe(II) and Co(II) with phthalocyanines are extremely good catalysts of oxidation of organic compounds with molecular oxygen and hydrogen peroxide. The binding of positively charged Fe(II) and Co(II) phthalocyanines with single- and double-stranded DNA was investigated. It was shown that these phthalocyanines interact with nucleic acids through an outside binding mode. The site-directed modification of single-stranded DNA by O2 and H2O2 in the presence of dimeric complexes of negatively and positively charged Fe(II) and Co(II) phthalocyanines was investigated. These complexes were formed directly on single-stranded DNA through interaction between negatively charged phthalocyanine in conjugate and positively charged phthalocyanine in solution. The resulting oppositely charged phthalocyanine complexes showed significant increase of catalytic activity compared with monomeric forms of phthalocyanines Fe(II) and Co(II). These complexes catalyzed the DNA oxidation with high efficacy and led to direct DNA strand cleavage. It was determined that oxidation of DNA by molecular oxygen catalyzed by complex of Fe(II)-phthalocyanines proceeds with higher rate than in the case of Co(II)-phthalocyanines but the latter led to a greater extent of target DNA modification.

  13. Mechanism of duplex DNA destabilization by RNA-guided Cas9 nuclease during target interrogation

    PubMed Central

    Mekler, Vladimir; Minakhin, Leonid; Severinov, Konstantin

    2017-01-01

    The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9 (Cas9) endonuclease cleaves double-stranded DNA sequences specified by guide RNA molecules and flanked by a protospacer adjacent motif (PAM) and is widely used for genome editing in various organisms. The RNA-programmed Cas9 locates the target site by scanning genomic DNA. We sought to elucidate the mechanism of initial DNA interrogation steps that precede the pairing of target DNA with guide RNA. Using fluorometric and biochemical assays, we studied Cas9/guide RNA complexes with model DNA substrates that mimicked early intermediates on the pathway to the final Cas9/guide RNA–DNA complex. The results show that Cas9/guide RNA binding to PAM favors separation of a few PAM-proximal protospacer base pairs allowing initial target interrogation by guide RNA. The duplex destabilization is mediated, in part, by Cas9/guide RNA affinity for unpaired segments of nontarget strand DNA close to PAM. Furthermore, our data indicate that the entry of double-stranded DNA beyond a short threshold distance from PAM into the Cas9/single-guide RNA (sgRNA) interior is hindered. We suggest that the interactions unfavorable for duplex DNA binding promote DNA bending in the PAM-proximal region during early steps of Cas9/guide RNA–DNA complex formation, thus additionally destabilizing the protospacer duplex. The mechanism that emerges from our analysis explains how the Cas9/sgRNA complex is able to locate the correct target sequence efficiently while interrogating numerous nontarget sequences associated with correct PAMs. PMID:28484024

  14. Mechanism of duplex DNA destabilization by RNA-guided Cas9 nuclease during target interrogation.

    PubMed

    Mekler, Vladimir; Minakhin, Leonid; Severinov, Konstantin

    2017-05-23

    The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9 (Cas9) endonuclease cleaves double-stranded DNA sequences specified by guide RNA molecules and flanked by a protospacer adjacent motif (PAM) and is widely used for genome editing in various organisms. The RNA-programmed Cas9 locates the target site by scanning genomic DNA. We sought to elucidate the mechanism of initial DNA interrogation steps that precede the pairing of target DNA with guide RNA. Using fluorometric and biochemical assays, we studied Cas9/guide RNA complexes with model DNA substrates that mimicked early intermediates on the pathway to the final Cas9/guide RNA-DNA complex. The results show that Cas9/guide RNA binding to PAM favors separation of a few PAM-proximal protospacer base pairs allowing initial target interrogation by guide RNA. The duplex destabilization is mediated, in part, by Cas9/guide RNA affinity for unpaired segments of nontarget strand DNA close to PAM. Furthermore, our data indicate that the entry of double-stranded DNA beyond a short threshold distance from PAM into the Cas9/single-guide RNA (sgRNA) interior is hindered. We suggest that the interactions unfavorable for duplex DNA binding promote DNA bending in the PAM-proximal region during early steps of Cas9/guide RNA-DNA complex formation, thus additionally destabilizing the protospacer duplex. The mechanism that emerges from our analysis explains how the Cas9/sgRNA complex is able to locate the correct target sequence efficiently while interrogating numerous nontarget sequences associated with correct PAMs.

  15. Structure and Mechanism of Action of the BRCA2 Breast Cancer Tumor Suppressor

    PubMed Central

    Malivert, Laurent; McIlwraith, Michael J.; Pape, Tillman; West, Stephen C.; Zhang, Xiaodong

    2014-01-01

    Mutations in BRCA2 increase susceptibility to breast, ovarian and prostate cancers. The product of human BRCA2, BRCA2 protein, plays a key role in the repair of DNA double strand breaks and interstrand crosslinks by RAD51-mediated homologous recombination. Here, we present a biochemical and structural characterization of full length (3,418 amino acid) BRCA2, alone and in complex with RAD51. We show that BRCA2 facilitates nucleation of RAD51 filaments at multiple sites on single-stranded DNA. Three-dimensional electron microscopy reconstructions revealed that BRCA2 exists as a dimer and that two oppositely-oriented sets of RAD51 molecules bind the dimer. Single stranded DNA binds along the long axis of BRCA2, such that only one set of RAD51 monomers can form a productive complex with DNA and establish filament formation. Our data define the molecular mechanism by which this tumor suppressor facilitates RAD51-mediated homologous recombinational repair. PMID:25282148

  16. Trifluorothymidine exhibits potent antitumor activity via the induction of DNA double-strand breaks.

    PubMed

    Suzuki, Norihiko; Nakagawa, Fumio; Nukatsuka, Mamoru; Fukushima, Masakazu

    2011-05-01

    TAS-102 is an oral anticancer drug composed of trifluorothymidine (TFT) and TPI (an inhibitor of thymidine phosphorylase that strongly inhibits the biodegradation of TFT). Similar to 5-fluorouracil (5FU) and 5-fluoro-2'-deoxyuridine (FdUrd), TFT also inhibits thymidylate synthase (TS), a rate-limiting enzyme of DNA biosynthesis, and is incorporated into DNA. TFT exhibits an anticancer effect on colorectal cancer cells that have acquired 5FU and/or FdUrd resistance as a result of the overexpression of TS. Therefore, we examined the mode of action of TFT-induced DNA damage after its incorporation into DNA. When HeLa cells were treated with TFT, the number of ring-open aldehyde forms at apurinic/apyrimidinic sites increased in a dose-dependent manner, although we previously reported that no detectable excisions of TFT paired to adenine were observed using uracil DNA glycosylases, thymine DNA glycosylase or methyl-CpG binding domain 4 and HeLa whole cell extracts. To investigate the functional mechanism of TFT-induced DNA damage, we measured the phosphorylation of ATR, ATM, BRCA2, chk1 and chk2 in nuclear extracts of HeLa cells after 0, 24, 48 or 72 h of exposure to an IC(50) concentration of TFT, FdUrd or 5FU using Western blot analysis or an enzyme-linked immunosorbent assay (ELISA). Unlike FdUrd and 5FU, TFT resulted in an earlier phosphorylation of ATR and chk1 proteins after only 24 h of exposure, while phosphorylated ATM, BRCA2 and chk2 proteins were detected after more than 48 h of exposure to TFT. These results suggest that TFT causes single-strand breaks followed by double-strand breaks in the DNA of TFT-treated cells. TFT (as TAS-102) showed a more potent antitumor activity than oral 5FU on CO-3 colon cancer xenografts in mice, and such antitumor potency was supported by the increased number of double-strand breaks occurring after single-strand breaks in the DNA of the TFT-treated tumors. These results suggest that TFT causes single-strand breaks after its incorporation into DNA followed by double-strand breaks, resulting in DNA damage. This effect of TFT on DNA may explain its potent anticancer activity in cancer therapy.

  17. Trifluorothymidine exhibits potent antitumor activity via the induction of DNA double-strand breaks

    PubMed Central

    SUZUKI, NORIHIKO; NAKAGAWA, FUMIO; NUKATSUKA, MAMORU; FUKUSHIMA, MASAKAZU

    2011-01-01

    TAS-102 is an oral anticancer drug composed of trifluorothymidine (TFT) and TPI (an inhibitor of thymidine phosphorylase that strongly inhibits the biodegradation of TFT). Similar to 5-fluorouracil (5FU) and 5-fluoro-2′-deoxyuridine (FdUrd), TFT also inhibits thymidylate synthase (TS), a rate-limiting enzyme of DNA biosynthesis, and is incorporated into DNA. TFT exhibits an anticancer effect on colorectal cancer cells that have acquired 5FU and/or FdUrd resistance as a result of the overexpression of TS. Therefore, we examined the mode of action of TFT-induced DNA damage after its incorporation into DNA. When HeLa cells were treated with TFT, the number of ring-open aldehyde forms at apurinic/apyrimidinic sites increased in a dose-dependent manner, although we previously reported that no detectable excisions of TFT paired to adenine were observed using uracil DNA glycosylases, thymine DNA glycosylase or methyl-CpG binding domain 4 and HeLa whole cell extracts. To investigate the functional mechanism of TFT-induced DNA damage, we measured the phosphorylation of ATR, ATM, BRCA2, chk1 and chk2 in nuclear extracts of HeLa cells after 0, 24, 48 or 72 h of exposure to an IC50 concentration of TFT, FdUrd or 5FU using Western blot analysis or an enzyme-linked immunosorbent assay (ELISA). Unlike FdUrd and 5FU, TFT resulted in an earlier phosphorylation of ATR and chk1 proteins after only 24 h of exposure, while phosphorylated ATM, BRCA2 and chk2 proteins were detected after more than 48 h of exposure to TFT. These results suggest that TFT causes single-strand breaks followed by double-strand breaks in the DNA of TFT-treated cells. TFT (as TAS-102) showed a more potent antitumor activity than oral 5FU on CO-3 colon cancer xenografts in mice, and such antitumor potency was supported by the increased number of double-strand breaks occurring after single-strand breaks in the DNA of the TFT-treated tumors. These results suggest that TFT causes single-strand breaks after its incorporation into DNA followed by double-strand breaks, resulting in DNA damage. This effect of TFT on DNA may explain its potent anticancer activity in cancer therapy. PMID:22977515

  18. Adenovirus Core Protein VII Protects the Viral Genome from a DNA Damage Response at Early Times after Infection▿

    PubMed Central

    Karen, Kasey A.; Hearing, Patrick

    2011-01-01

    Adenovirus has a linear, double-stranded DNA genome that is perceived by the cellular Mre11-Rad50-Nbs1 (MRN) DNA repair complex as a double-strand break. If unabated, MRN elicits a double-strand break repair response that blocks viral DNA replication and ligates the viral genomes into concatemers. There are two sets of early viral proteins that inhibit the MRN complex. The E1B-55K/E4-ORF6 complex recruits an E3 ubiquitin ligase and targets MRN proteins for proteasome-dependent degradation. The E4-ORF3 protein inhibits MRN through sequestration. The mechanism that prevents MRN recognition of the viral genome prior to the expression of these early proteins was previously unknown. Here we show a temporal correlation between the loss of viral core protein VII from the adenovirus genome and a gain of checkpoint signaling due to the double-strand break repair response. While checkpoint signaling corresponds to the recognition of the viral genome, core protein VII binding to and checkpoint signaling at viral genomes are largely mutually exclusive. Transcription is known to release protein VII from the genome, and the inhibition of transcription shows a decrease in checkpoint signaling. Finally, we show that the nuclease activity of Mre11 is dispensable for the inhibition of viral DNA replication during a DNA damage response. These results support a model involving the protection of the incoming viral genome from checkpoint signaling by core protein VII and suggest that the induction of an MRN-dependent DNA damage response may inhibit adenovirus replication by physically masking the origins of DNA replication rather than altering their integrity. PMID:21345950

  19. A novel electrochemical aptasensor based on single-walled carbon nanotubes, gold electrode and complimentary strand of aptamer for ultrasensitive detection of cocaine.

    PubMed

    Taghdisi, Seyed Mohammad; Danesh, Noor Mohammad; Emrani, Ahmad Sarreshtehdar; Ramezani, Mohammad; Abnous, Khalil

    2015-11-15

    Cocaine is a strong central nervous system stimulant and one of the most commonly abused drugs. In this study, an electrochemical aptasensor was designed for sensitive and selective detection of cocaine, based on single-walled carbon nanotubes (SWNTs), gold electrode and complimentary strand of aptamer (CS). This electrochemical aptasensor inherits properties of SWNTs and gold such as large surface area and high electrochemical conductivity, as well as high affinity and selectivity of aptamer toward its target and the stronger interaction of SWNTs with single-stranded DNA (ssDNA) than double-stranded DNA (dsDNA). In the absence of cocaine, a little amount of SWNTs bind to Aptamer-CS-modified electrode, so that the electrochemical signal is weak. In the presence of cocaine, aptamer binds to cocaine, leaves the surface of electrode. So that, a large amount of SWNTs bind to CS-modified electrode, generating to a strong electrochemical signal. The designed electrochemical aptasensor showed good selectivity toward cocaine with a limit of detection (LOD) as low as 105 pM. Moreover, the fabricated electrochemical aptasensor was successfully applied to detect cocaine in serum with a LOD as low as 136 pM. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. DNA binding polarity, dimerization, and ATPase ring remodeling in the CMG helicase of the eukaryotic replisome

    PubMed Central

    Costa, Alessandro; Renault, Ludovic; Swuec, Paolo; Petojevic, Tatjana; Pesavento, James J; Ilves, Ivar; MacLellan-Gibson, Kirsty; Fleck, Roland A; Botchan, Michael R; Berger, James M

    2014-01-01

    The Cdc45/Mcm2-7/GINS (CMG) helicase separates DNA strands during replication in eukaryotes. How the CMG is assembled and engages DNA substrates remains unclear. Using electron microscopy, we have determined the structure of the CMG in the presence of ATPγS and a DNA duplex bearing a 3′ single-stranded tail. The structure shows that the MCM subunits of the CMG bind preferentially to single-stranded DNA, establishes the polarity by which DNA enters into the Mcm2-7 pore, and explains how Cdc45 helps prevent DNA from dissociating from the helicase. The Mcm2-7 subcomplex forms a cracked-ring, right-handed spiral when DNA and nucleotide are bound, revealing unexpected congruencies between the CMG and both bacterial DnaB helicases and the AAA+ motor of the eukaryotic proteasome. The existence of a subpopulation of dimeric CMGs establishes the subunit register of Mcm2-7 double hexamers and together with the spiral form highlights how Mcm2-7 transitions through different conformational and assembly states as it matures into a functional helicase. DOI: http://dx.doi.org/10.7554/eLife.03273.001 PMID:25117490

  1. Dyes designed for high sensitivity detection of double-stranded DNA

    DOEpatents

    Glazer, A.N.; Benson, S.C.

    1998-07-21

    Novel fluorescent dyes are provided, characterized by having a fluorophore joined to a cationic chain. The dyes are found to provide for high enhancement upon binding to nucleic acid and have strong binding affinities to the nucleic acid, as compared to the fluorophore without the polycationic chain. The dyes find use in detection of dsDNA in gel electrophoresis and solution at substantially higher sensitivities using substantially less dye. 10 figs.

  2. Current-voltage characteristics of double stranded versus single stranded DNA molecules

    NASA Astrophysics Data System (ADS)

    Hartzell, B.; Chen, Hong; Heremans, J. J.; McCord, B.; Soghomonian, V.

    2004-03-01

    Investigation of DNA conductivity has focused on the native, duplex structure, with controversial results. Here, we present the influence of the double-helical structure on charge transport through lambda DNA molecules. The current-voltage (I-V) characteristics of both disulfide-labeled double stranded DNA (dsDNA) and disulfide-labeled single stranded DNA (ssDNA) were measured. The ssDNA was formed from the dsDNA using two different methods for comparison purposes: a thermal/chemical denaturation and enzymatic digestion utilizing lambda exonuclease. Resulting I-V characteristics of both the double stranded and single stranded samples were close-to-linear when measured at room temperature. However, the ssDNA samples consistently gave conductivity values about two orders of magnitude smaller in amplitude. Our results suggest an integral relationship between the native structure of DNA with its stacked base pairs and the molecule's ability to support charge transport.(NSF NIRT 0103034)

  3. Direct Single-Molecule Observation of Mode and Geometry of RecA-Mediated Homology Search.

    PubMed

    Lee, Andrew J; Endo, Masayuki; Hobbs, Jamie K; Wälti, Christoph

    2018-01-23

    Genomic integrity, when compromised by accrued DNA lesions, is maintained through efficient repair via homologous recombination. For this process the ubiquitous recombinase A (RecA), and its homologues such as the human Rad51, are of central importance, able to align and exchange homologous sequences within single-stranded and double-stranded DNA in order to swap out defective regions. Here, we directly observe the widely debated mechanism of RecA homology searching at a single-molecule level using high-speed atomic force microscopy (HS-AFM) in combination with tailored DNA origami frames to present the reaction targets in a way suitable for AFM-imaging. We show that RecA nucleoprotein filaments move along DNA substrates via short-distance facilitated diffusions, or slides, interspersed with longer-distance random moves, or hops. Importantly, from the specific interaction geometry, we find that the double-stranded substrate DNA resides in the secondary DNA binding-site within the RecA nucleoprotein filament helical groove during the homology search. This work demonstrates that tailored DNA origami, in conjunction with HS-AFM, can be employed to reveal directly conformational and geometrical information on dynamic protein-DNA interactions which was previously inaccessible at an individual single-molecule level.

  4. A cryptochrome-like protein is involved in the regulation of photosynthesis genes in Rhodobacter sphaeroides.

    PubMed

    Hendrischk, Anne-Kathrin; Frühwirth, Sebastian Walter; Moldt, Julia; Pokorny, Richard; Metz, Sebastian; Kaiser, Gebhard; Jäger, Andreas; Batschauer, Alfred; Klug, Gabriele

    2009-11-01

    Blue light receptors belonging to the cryptochrome/photolyase family are found in all kingdoms of life. The functions of photolyases in repair of UV-damaged DNA as well as of cryptochromes in the light-dependent regulation of photomorphogenetic processes and in the circadian clock in plants and animals are well analysed. In prokaryotes, the only role of members of this protein family that could be demonstrated is DNA repair. Recently, we identified a gene for a cryptochrome-like protein (CryB) in the alpha-proteobacterium Rhodobacter sphaeroides. The protein lacks the typical C-terminal extension of cryptochromes, and is not related to the Cry DASH family. Here we demonstrate that CryB binds flavin adenine dinucleotide that can be photoreduced by blue light. CryB binds single-stranded DNA with very high affinity (K(d) approximately 10(-8) M) but double-stranded DNA and single-stranded RNA with far lower affinity (K(d) approximately 10(-6) M). Despite of that, no in vitro repair activity for pyrimidine dimers in single-stranded DNA could be detected. However, we show that CryB clearly affects the expression of genes for pigment-binding proteins and consequently the amount of photosynthetic complexes in R. sphaeroides. Thus, for the first time a role of a bacterial cryptochrome in gene regulation together with a biological function is demonstrated.

  5. Homologous Recombination Repair Signaling in Chemical Carcinogenesis: Prolonged Particulate Hexavalent Chromium Exposure Suppresses the Rad51 Response in Human Lung Cells

    PubMed Central

    Qin, Qin; Xie, Hong; Wise, Sandra S.; Browning, Cynthia L.; Thompson, Kelsey N.; Holmes, Amie L.; Wise, John Pierce

    2014-01-01

    The aim of this study was to focus on hexavalent chromium, [Cr(VI)], a chemical carcinogen and major public health concern, and consider its ability to impact DNA double strand break repair. We further focused on particulate Cr(VI), because it is the more potent carcinogenic form of Cr(VI). DNA double strand break repair serves to protect cells against the detrimental effects of DNA double strand breaks. For particulate Cr(VI), data show DNA double strand break repair must be overcome for neoplastic transformation to occur. Acute Cr(VI) exposures reveal a robust DNA double strand break repair response, however, longer exposures have not been considered. Using the comet assay, we found longer exposures to particulate zinc chromate induced concentration-dependent increases in DNA double strand breaks indicating breaks were occurring throughout the exposure time. Acute (24 h) exposure induced DNA double strand break repair signaling by inducing Mre11 foci formation, ATM phosphorylation and phosphorylated ATM foci formation, Rad51 protein levels and Rad51 foci formation. However, longer exposures reduced the Rad51 response. These data indicate a major chemical carcinogen can simultaneously induce DNA double strand breaks and alter their repair and describe a new and important aspect of the carcinogenic mechanism for Cr(VI). PMID:25173789

  6. Presynaptic Filament Dynamics in Homologous Recombination and DNA Repair

    PubMed Central

    Liu, Jie; Ehmsen, Kirk T.; Heyer, Wolf-Dietrich; Morrical, Scott W.

    2014-01-01

    Homologous Recombination (HR) is an essential genome stability mechanism used for high-fidelity repair of DNA double-strand breaks and for the recovery of stalled or collapsed DNA replication forks. The crucial homology search and DNA strand exchange steps of HR are catalyzed by presynaptic filaments—helical filaments of a recombinase enzyme bound to single-stranded DNA. Presynaptic filaments are fundamentally dynamic structures, the assembly, catalytic turnover, and disassembly of which must be closely coordinated with other elements of the DNA recombination, repair, and replication machinery in order for genome maintenance functions to be effective. Here, we review the major dynamic elements controlling the assembly, activity, and disassembly of presynaptic filaments: some intrinsic such as recombinase ATP binding and hydrolytic activities, others extrinsic such as ssDNA-binding proteins, mediator proteins, and DNA motor proteins. We examine dynamic behavior on multiple levels, including atomic- and filament-level structural changes associated with ATP binding and hydrolysis as evidenced in crystal structures, as well as subunit binding and dissociation events driven by intrinsic and extrinsic factors. We examine the biochemical properties of recombination proteins from four model systems (T4 phage, E. coli, S. cerevisiae, and H. sapiens), demonstrating how their properties are tailored for the context-specific requirements in these diverse species. We propose that the presynaptic filament has evolved to rely on multiple external factors for increased multi-level regulation of HR processes in genomes with greater structural and sequence complexity. PMID:21599536

  7. Cryo-EM structure of Mcm2-7 double hexamer on DNA suggests a lagging-strand DNA extrusion model.

    PubMed

    Noguchi, Yasunori; Yuan, Zuanning; Bai, Lin; Schneider, Sarah; Zhao, Gongpu; Stillman, Bruce; Speck, Christian; Li, Huilin

    2017-11-07

    During replication initiation, the core component of the helicase-the Mcm2-7 hexamer-is loaded on origin DNA as a double hexamer (DH). The two ring-shaped hexamers are staggered, leading to a kinked axial channel. How the origin DNA interacts with the axial channel is not understood, but the interaction could provide key insights into Mcm2-7 function and regulation. Here, we report the cryo-EM structure of the Mcm2-7 DH on dsDNA and show that the DNA is zigzagged inside the central channel. Several of the Mcm subunit DNA-binding loops, such as the oligosaccharide-oligonucleotide loops, helix 2 insertion loops, and presensor 1 (PS1) loops, are well defined, and many of them interact extensively with the DNA. The PS1 loops of Mcm 3, 4, 6, and 7, but not 2 and 5, engage the lagging strand with an approximate step size of one base per subunit. Staggered coupling of the two opposing hexamers positions the DNA right in front of the two Mcm2-Mcm5 gates, with each strand being pressed against one gate. The architecture suggests that lagging-strand extrusion initiates in the middle of the DH that is composed of the zinc finger domains of both hexamers. To convert the Mcm2-7 DH structure into the Mcm2-7 hexamer structure found in the active helicase, the N-tier ring of the Mcm2-7 hexamer in the DH-dsDNA needs to tilt and shift laterally. We suggest that these N-tier ring movements cause the DNA strand separation and lagging-strand extrusion. Copyright © 2017 the Author(s). Published by PNAS.

  8. From face to interface recognition: a differential geometric approach to distinguish DNA from RNA binding surfaces

    PubMed Central

    Shazman, Shula; Elber, Gershon; Mandel-Gutfreund, Yael

    2011-01-01

    Protein nucleic acid interactions play a critical role in all steps of the gene expression pathway. Nucleic acid (NA) binding proteins interact with their partners, DNA or RNA, via distinct regions on their surface that are characterized by an ensemble of chemical, physical and geometrical properties. In this study, we introduce a novel methodology based on differential geometry, commonly used in face recognition, to characterize and predict NA binding surfaces on proteins. Applying the method on experimentally solved three-dimensional structures of proteins we successfully classify double-stranded DNA (dsDNA) from single-stranded RNA (ssRNA) binding proteins, with 83% accuracy. We show that the method is insensitive to conformational changes that occur upon binding and can be applicable for de novo protein-function prediction. Remarkably, when concentrating on the zinc finger motif, we distinguish successfully between RNA and DNA binding interfaces possessing the same binding motif even within the same protein, as demonstrated for the RNA polymerase transcription-factor, TFIIIA. In conclusion, we present a novel methodology to characterize protein surfaces, which can accurately tell apart dsDNA from an ssRNA binding interfaces. The strength of our method in recognizing fine-tuned differences on NA binding interfaces make it applicable for many other molecular recognition problems, with potential implications for drug design. PMID:21693557

  9. RPA coordinates DNA end resection and prevents formation of DNA hairpins.

    PubMed

    Chen, Huan; Lisby, Michael; Symington, Lorraine S

    2013-05-23

    Replication protein A (RPA) is an essential eukaryotic single-stranded DNA binding protein with a central role in DNA metabolism. RPA directly participates in DNA double-strand break repair by stimulating 5'-3' end resection by the Sgs1/BLM helicase and Dna2 endonuclease in vitro. Here we investigated the role of RPA in end resection in vivo, using a heat-inducible degron system that allows rapid conditional depletion of RPA in Saccharomyces cerevisiae. We found that RPA depletion eliminated both the Sgs1-Dna2- and Exo1-dependent extensive resection pathways and synergized with mre11Δ to prevent end resection. The short single-stranded DNA tails formed in the absence of RPA were unstable due to 3' strand loss and the formation of fold-back hairpin structures that required resection initiation and Pol32-dependent DNA synthesis. Thus, RPA is required to generate ssDNA, and also to protect ssDNA from degradation and inappropriate annealing that could lead to genome rearrangements. Copyright © 2013 Elsevier Inc. All rights reserved.

  10. Computational Study on Full-length Human Ku70 with Double Stranded DNA: Dynamics, Interactions and Functional Implications

    NASA Technical Reports Server (NTRS)

    Hu, Shaowen; Cucinotta, Francis A.

    2009-01-01

    The Ku70/80 heterodimer is the first repair protein in the initial binding of double-strand break (DSB) ends following DNA damage, and is a component of nonhomologous end joining repair, the primary pathway for DSB repair in mammalian cells. In this study we constructed a full-length human Ku70 structure based on its crystal structure, and performed 20 ns conventional molecular dynamic (CMD) simulations on this protein and several other complexes with short DNA duplexes of different sequences. The trajectories of these simulations indicated that, without the topological support of Ku80, the residues in the bridge and C-terminal arm of Ku70 are more flexible than other experimentally identified domains. We studied the two missing loops in the crystal structure and predicted that they are also very flexible. Simulations revealed that they make an important contribution to the Ku70 interaction with DNA. Dislocation of the previously studied SAP domain was observed in several systems, implying its role in DNA binding. Targeted molecular dynamic (TMD) simulation was also performed for one system with a far-away 14bp DNA duplex. The TMD trajectory and energetic analysis disclosed detailed interactions of the DNA-binding residues during the DNA dislocation, and revealed a possible conformational transition for a DSB end when encountering Ku70 in solution. Compared to experimentally based analysis, this study identified more detailed interactions between DNA and Ku70. Free energy analysis indicated Ku70 alone is able to bind DNA with relatively high affinity, with consistent contributions from various domains of Ku70 in different systems. The functional implications of these domains in the processes of Ku heterodimerization and DNA damage recognition and repair can be characterized in detail based upon this analysis.

  11. Triple helical DNA in a duplex context and base pair opening

    PubMed Central

    Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

    2014-01-01

    It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

  12. The N-terminus of RPA large subunit and its spatial position are important for the 5'->3' resection of DNA double-strand breaks.

    PubMed

    Tammaro, Margaret; Liao, Shuren; McCane, Jill; Yan, Hong

    2015-10-15

    The first step of homology-dependent repair of DNA double-strand breaks (DSBs) is the resection of the 5' strand to generate 3' ss-DNA. Of the two major nucleases responsible for resection, EXO1 has intrinsic 5'->3' directionality, but DNA2 does not. DNA2 acts with RecQ helicases such as the Werner syndrome protein (WRN) and the heterotrimeric eukaryotic ss-DNA binding protein RPA. We have found that the N-terminus of the RPA large subunit (RPA1N) interacts with both WRN and DNA2 and is essential for stimulating WRN's 3'->5' helicase activity and DNA2's 5'->3' ss-DNA exonuclease activity. A mutant RPA complex that lacks RPA1N is unable to support resection in Xenopus egg extracts and human cells. Furthermore, relocating RPA1N to the middle subunit but not to the small subunit causes severe defects in stimulating DNA2 and WRN and in supporting resection. Together, these findings suggest that RPA1N and its spatial position are critical for restricting the directionality of the WRN-DNA2 resection pathway. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. The N-terminus of RPA large subunit and its spatial position are important for the 5′->3′ resection of DNA double-strand breaks

    PubMed Central

    Tammaro, Margaret; Liao, Shuren; McCane, Jill; Yan, Hong

    2015-01-01

    The first step of homology-dependent repair of DNA double-strand breaks (DSBs) is the resection of the 5′ strand to generate 3′ ss-DNA. Of the two major nucleases responsible for resection, EXO1 has intrinsic 5′->3′ directionality, but DNA2 does not. DNA2 acts with RecQ helicases such as the Werner syndrome protein (WRN) and the heterotrimeric eukaryotic ss-DNA binding protein RPA. We have found that the N-terminus of the RPA large subunit (RPA1N) interacts with both WRN and DNA2 and is essential for stimulating WRN's 3′->5′ helicase activity and DNA2's 5′->3′ ss-DNA exonuclease activity. A mutant RPA complex that lacks RPA1N is unable to support resection in Xenopus egg extracts and human cells. Furthermore, relocating RPA1N to the middle subunit but not to the small subunit causes severe defects in stimulating DNA2 and WRN and in supporting resection. Together, these findings suggest that RPA1N and its spatial position are critical for restricting the directionality of the WRN-DNA2 resection pathway. PMID:26227969

  14. Structures of minute virus of mice replication initiator protein N-terminal domain: Insights into DNA nicking and origin binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tewary, Sunil K.; Liang, Lingfei; Lin, Zihan

    Members of the Parvoviridae family all encode a non-structural protein 1 (NS1) that directs replication of single-stranded viral DNA, packages viral DNA into capsid, and serves as a potent transcriptional activator. Here we report the X-ray structure of the minute virus of mice (MVM) NS1 N-terminal domain at 1.45 Å resolution, showing that sites for dsDNA binding, ssDNA binding and cleavage, nuclear localization, and other functions are integrated on a canonical fold of the histidine-hydrophobic-histidine superfamily of nucleases, including elements specific for this Protoparvovirus but distinct from its Bocaparvovirus or Dependoparvovirus orthologs. High resolution structural analysis reveals a nickase activemore » site with an architecture that allows highly versatile metal ligand binding. The structures support a unified mechanism of replication origin recognition for homotelomeric and heterotelomeric parvoviruses, mediated by a basic-residue-rich hairpin and an adjacent helix in the initiator proteins and by tandem tetranucleotide motifs in the replication origins. - Highlights: • The structure of a parvovirus replication initiator protein has been determined; • The structure sheds light on mechanisms of ssDNA binding and cleavage; • The nickase active site is preconfigured for versatile metal ligand binding; • The binding site for the double-stranded replication origin DNA is identified; • A single domain integrates multiple functions in virus replication.« less

  15. Dyes designed for high sensitivity detection of double-stranded DNA

    DOEpatents

    Glazer, Alexander N.; Benson, Scott C.

    1994-01-01

    Novel fluorescent dyes are provided, characterized by having a fluorophore joined to a polycationic chain of at least two positive charges. The dyes are found to provide for high enhancement upon binding to nucleic acid and have strong binding affinities to the nucleic acid, as compared to the fluorophore without the polycationic chain. The dyes find use in detection of dsDNA in gel electrophoresis and solution at substantially higher sensitivities using substantially less dye.

  16. Left-handed Z-DNA: structure and function

    NASA Technical Reports Server (NTRS)

    Herbert, A.; Rich, A.

    1999-01-01

    Z-DNA is a high energy conformer of B-DNA that forms in vivo during transcription as a result of torsional strain generated by a moving polymerase. An understanding of the biological role of Z-DNA has advanced with the discovery that the RNA editing enzyme double-stranded RNA adenosine deaminase type I (ADAR1) has motifs specific for the Z-DNA conformation. Editing by ADAR1 requires a double-stranded RNA substrate. In the cases known, the substrate is formed by folding an intron back onto the exon that is targeted for modification. The use of introns to direct processing of exons requires that editing occurs before splicing. Recognition of Z-DNA by ADAR1 may allow editing of nascent transcripts to be initiated immediately after transcription, ensuring that editing and splicing are performed in the correct sequence. Structural characterization of the Z-DNA binding domain indicates that it belongs to the winged helix-turn-helix class of proteins and is similar to the globular domain of histone-H5.

  17. The cell pole: the site of cross talk between the DNA uptake and genetic recombination machinery.

    PubMed

    Kidane, Dawit; Ayora, Silvia; Sweasy, Joann B; Graumann, Peter L; Alonso, Juan C

    2012-01-01

    Natural transformation is a programmed mechanism characterized by binding of free double-stranded (ds) DNA from the environment to the cell pole in rod-shaped bacteria. In Bacillus subtilis some competence proteins, which process the dsDNA and translocate single-stranded (ss) DNA into the cytosol, recruit a set of recombination proteins mainly to one of the cell poles. A subset of single-stranded binding proteins, working as "guardians", protects ssDNA from degradation and limit the RecA recombinase loading. Then, the "mediators" overcome the inhibitory role of guardians, and recruit RecA onto ssDNA. A RecA·ssDNA filament searches for homology on the chromosome and, in a process that is controlled by "modulators", catalyzes strand invasion with the generation of a displacement loop (D-loop). A D-loop resolvase or "resolver" cleaves this intermediate, limited DNA replication restores missing information and a DNA ligase seals the DNA ends. However, if any step fails, the "rescuers" will repair the broken end to rescue chromosomal transformation. If the ssDNA does not share homology with resident DNA, but it contains information for autonomous replication, guardian and mediator proteins catalyze plasmid establishment after inhibition of RecA. DNA replication and ligation reconstitute the molecule (plasmid transformation). In this review, the interacting network that leads to a cross talk between proteins of the uptake and genetic recombination machinery will be placed into prospective.

  18. The cell pole: The site of cross talk between the DNA uptake and genetic recombination machinery

    PubMed Central

    Kidane, Dawit; Ayora, Silvia; Sweasy, Joann; Graumann, Peter L.; Alonso, Juan C.

    2012-01-01

    Natural transformation is a programmed mechanism characterized by binding of free double-stranded (ds) DNA from the environment to the cell pole in rod-shaped bacteria. In Bacillus subtilis some competence proteins, which process the dsDNA and translocate single-stranded (ss) DNA into the cytosol, recruit a set of recombination proteins mainly to one of the cell poles. A subset of single-stranded binding proteins, working as “guardians”, protect ssDNA from degradation and limit the RecA recombinase loading. Then, the “mediators” overcome the inhibitory role of guardians, and recruit RecA onto ssDNA. A RecA·ssDNA filament searches for homology on the chromosome and, in a process that is controlled by “modulators”, catalyzes strand invasion with the generation of a displacement loop (D-loop). A D-loop resolvase or “resolver” cleaves this intermediate, limited DNA replication restores missing information and a DNA ligase seals the DNA ends. However, if any step fails, the “rescuers” will repair the broken end to rescue chromosomal transformation. If the ssDNA does not share homology with resident DNA, but it contains information for autonomous replication, guardian and mediator proteins catalyze plasmid establishment after inhibition of RecA. DNA replication and ligation reconstitute the molecule (plasmid transformation). In this review, the interacting network that leads to a cross talk between proteins of the uptake and genetic recombination machinery will be placed into prospective. PMID:23046409

  19. Relative stabilities of triple helices composed of combinations of DNA, RNA and 2'-O-methyl-RNA backbones: chimeric circular oligonucleotides as probes.

    PubMed

    Wang, S; Kool, E T

    1995-04-11

    Described is a systematic study of the effects of varied backbone structure on the stabilities of pyr.pur.pyr triple helices. The effects were measured using six circular 34 base oligonucleotides containing DNA (D), RNA (R) and/or 2'-O-methyl-RNA (M) residues designed to bind a complementary single-stranded purine target strand by triple helix formation. Eighteen different backbone combinations were studied at pH 5.5 and 7.0 by optical melting experiments and the results compared with the stabilities of the corresponding Watson-Crick duplexes. When the target purine strand is DNA, all circles form pH-dependent triple helical complexes which are considerably stronger than the duplexes alone. When RNA is the target, five of the nine complexes studied are of the pH-dependent triplex type and the other four complexes are not significantly stronger than the corresponding duplexes. The results are useful in the design of the highest affinity ligands for single- and double-stranded DNAs and RNAs and also point out novel ways to engender DNA- or RNA-selective binding.

  20. Method for promoting specific alignment of short oligonucleotides on nucleic acids

    DOEpatents

    Studier, F. William; Kieleczawa, Jan; Dunn, John J.

    1996-01-01

    Disclosed is a method for promoting specific alignment of short oligonucleotides on a nucleic acid polymer. The nucleic acid polymer is incubated in a solution containing a single-stranded DNA-binding protein and a plurality of oligonucleotides which are perfectly complementary to distinct but adjacent regions of a predetermined contiguous nucleotide sequence in the nucleic acid polymer. The plurality of oligonucleotides anneal to the nucleic acid polymer to form a contiguous region of double stranded nucleic acid. Specific application of the methods disclosed include priming DNA synthesis and template-directed ligation.

  1. Synthesis and crystal structure elucidation of new copper(II)-based chemotherapeutic agent coupled with 1,2-DACH and orthovanillin: Validated by in vitro DNA/HSA binding profile and pBR322 cleavage pathway.

    PubMed

    Zaki, Mehvash; Afzal, Mohd; Ahmad, Musheer; Tabassum, Sartaj

    2016-08-01

    New copper(II)-based complex (1) was synthesized and characterized by analytical, spectroscopic and single crystal X-ray diffraction. The in vitro binding studies of complex 1 with CT DNA and HSA have been investigated by employing biophysical techniques to examine the binding propensity of 1 towards DNA and HSA. The results showed that 1 avidly binds to CT DNA via electrostatic mode along with the hydrogen bonding interaction of NH2 and CN groups of Schiff base ligand with the base pairs of DNA helix, leads to partial unwinding and destabilization of the DNA double helix. Moreover, the CD spectral studies revealed that complex 1 binds through groove binding interaction that stabilizes the right-handed B-form of DNA. Complex 1 showed an impressive photoinduced nuclease activity generating single-strand breaks in comparison with the DNA cleavage activity in presence of visible light. The mechanistic investigation revealed the efficiency of 1 to cleave DNA strands by involving the generation of reactive oxygen species. Furthermore, the time dependent DNA cleavage activity showed that there was gradual increase in the amount of NC DNA on increasing the photoexposure time. However, the interaction of 1 and HSA showed that the change of intrinsic fluorescence intensity of HSA was induced by the microenvironment of Trp residue. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Investigating Deinococcus radiodurans RecA protein filament formation on dsDNA by a real-time single-molecule approach

    PubMed Central

    Hsu, Hsin-Fang; Ngo, Khanh V.; Chitteni-Pattu, Sindhu; Cox, Michael M.; Li, Hung-Wen

    2011-01-01

    With the aid of an efficient, precise, and almost error-free DNA repair system, Deinococcus radiodurans can survive hundreds of double strand breaks inflicted by high doses of irradiation or desiccation. The RecA of Deinococcus radiodurans (DrRecA) plays a central role both in the early phase of repair by an extended synthesis-dependent strand annealing process and in the later more general homologous recombination phase. Both roles likely require DrRecA filament formation on duplex DNA. We have developed single-molecule tethered particle motion (TPM) experiments to study the assembly dynamics of RecA proteins on individual duplex DNA molecules by observing changes in DNA tether length resulting from RecA binding. We demonstrate that DrRecA nucleation on dsDNA is much faster than Escherichia coli (Ec) RecA protein, but the extension is slower. This combination of attributes would tend to increase the number and decrease the length of DrRecA filaments relative to those of EcRecA, a feature that may reflect the requirement to repair hundreds of genomic double strand breaks concurrently in irradiated Deinococcus cells. PMID:21853996

  3. Quantitative, non-invasive imaging of radiation-induced DNA double strand breaks in vivo

    PubMed Central

    Li, Wenrong; Li, Fang; Huang, Qian; Shen, Jingping; Wolf, Frank; He, Yujun; Liu, Xinjian; Hu, Y. Angela; Bedford, Joel. S.; Li, Chuan-Yuan

    2011-01-01

    DNA double strand breaks is a major form of DNA damage and a key mechanism through which radiotherapy and some chemotherapeutic agents kill cancer cells. Despite its importance, measuring DNA double strand breaks is still a tedious task that is normally carried out by gel electrophoresis or immunofluorescence staining. Here we report a novel approach to image and quantify DNA double strand breaks in live mammalian cells through bi-fragment luciferase reconstitution. N- and C- terminal fragments of firefly luciferase gene were fused with H2AX and MDC1 genes, respectively. Our strategy was based on the established fact that at the sites of DNA double strand breaks, H2AX protein is phosphoryated and physically associates with the MDC1 protein, thus bringing together N- and C- luciferase fragments and reconstituting luciferase activity. Our strategy allowed serial, non-invasive quantification of DNA double strand breaks in cells irradiated with x-rays and 56Fe ions. Furthermore, it allowed for the evaluation of DNA double strand breaks (DSBs) non-invasively in vivo in irradiated tumors over two weeks. Surprisingly, we detected a second wave of DSB induction in irradiated tumor cells days after radiation exposure in addition to the initial rapid induction of DSBs. We conclude that our new split-luciferase based method for imaging γ-H2AX-MDC1 interaction is a powerful new tool to study DNA double strand break repair kinetics in vivo with considerable advantage for experiments requiring observations over an extended period of time. PMID:21527553

  4. Spectroscopic and electrochemical studies of the interaction between oleuropein, the major bio-phenol in olives, and salmon sperm DNA

    NASA Astrophysics Data System (ADS)

    Mohamadi, Maryam; Afzali, Daryoush; Esmaeili-Mahani, Saeed; Mostafavi, Ali; Torkzadeh-Mahani, Masoud

    2015-09-01

    Interaction of oleuropein, the major bio-phenol in olive leaf and fruit, with salmon sperm double-stranded DNA was investigated by employing electronic absorption titrations, fluorescence quenching spectroscopy, competitive fluorescence spectroscopy, thermal denaturation and voltammetric studies. Titration of oleuropein with the DNA caused a hypochromism accompanied with a red shift indicating an intercalative mode of interaction. Binding constant of 1.4 × 104 M-1 was obtained for this interaction. From the curves of fluorescence titration of oleuropein with the DNA, binding constant and binding sites were calculated to be 8.61 × 103 M-1 and 1.05, respectively. Competitive studies with ethidium bromide (a well-known DNA intercalator) showed that the bio-phenol could take the place of ethidium bromide in the DNA intercalation sites. The interaction of oleuropein with DNA was also studied electrochemically. In the presence of the DNA, the anodic and cathodic peak currents of oleuropein decreased accompanied with increases in peak-to-peak potential separation and formal potential, indicating the intercalation of oleuropein into the DNA double helix. Moreover, melting temperature of the DNA was found to increase in the presence of oleuropein, indicating the stabilization of the DNA double helix due to an intercalative interaction.

  5. PARP-1 and Ku compete for repair of DNA double strand breaks by distinct NHEJ pathways

    PubMed Central

    Wang, Minli; Wu, Weizhong; Wu, Wenqi; Rosidi, Bustanur; Zhang, Lihua; Wang, Huichen; Iliakis, George

    2006-01-01

    Poly(ADP-ribose)polymerase 1 (PARP-1) recognizes DNA strand interruptions in vivo and triggers its own modification as well as that of other proteins by the sequential addition of ADP-ribose to form polymers. This modification causes a release of PARP-1 from DNA ends and initiates a variety of responses including DNA repair. While PARP-1 has been firmly implicated in base excision and single strand break repair, its role in the repair of DNA double strand breaks (DSBs) remains unclear. Here, we show that PARP-1, probably together with DNA ligase III, operates in an alternative pathway of non-homologous end joining (NHEJ) that functions as backup to the classical pathway of NHEJ that utilizes DNA-PKcs, Ku, DNA ligase IV, XRCC4, XLF/Cernunnos and Artemis. PARP-1 binds to DNA ends in direct competition with Ku. However, in irradiated cells the higher affinity of Ku for DSBs and an excessive number of other forms of competing DNA lesions limit its contribution to DSB repair. When essential components of the classical pathway of NHEJ are absent, PARP-1 is recruited for DSB repair, particularly in the absence of Ku and non-DSB lesions. This form of DSB repair is sensitive to PARP-1 inhibitors. The results define the function of PARP-1 in DSB repair and characterize a candidate pathway responsible for joining errors causing genomic instability and cancer. PMID:17088286

  6. Ionic modulation of QPX stability as a nano-switch regulating gene expression in neurons

    NASA Astrophysics Data System (ADS)

    Baghaee Ravari, Soodeh

    G-quadruplexes (G-QPX) have been the subject of intense research due to their unique structural configuration and potential applications, particularly their functionality in biological process as a novel type of nano--switch. They have been found in critical regions of the human genome such as telomeres, promoter regions, and untranslated regions of RNA. About 50% of human DNA in promoters has G-rich regions with the potential to form G-QPX structures. A G-QPX might act mechanistically as an ON/OFF switch, regulating gene expression, meaning that the formation of G-QPX in a single strand of DNA disrupts double stranded DNA, prevents the binding of transcription factors (TF) to their recognition sites, resulting in gene down-regulation. Although there are numerous studies on biological roles of G-QPXs in oncogenes, their potential formation in neuronal cells, in particular upstream of transcription start sites, is poorly investigated. The main focus of this research is to identify stable G-QPXs in the 97bp active promoter region of the choline acetyltransferase (ChAT) gene, the terminal enzyme involved in synthesis of the neurotransmitter acetylcholine, and to clarify ionic modulation of G-QPX nanostructures through the mechanism of neural action potentials. Different bioinformatics analyses (in silico), including the QGRS, quadparser and G4-Calculator programs, have been used to predict stable G-QPX in the active promoter region of the human ChAT gene, located 1000bp upstream from the TATA box. The results of computational studies (using those three different algorithms) led to the identification of three consecutive intramolecular G-QPX structures in the negative strand (ChAT G17-2, ChAT G17, and ChAT G29) and one intramolecular G-QPX structure in the positive strand (ChAT G30). Also, the results suggest the possibility that nearby G-runs in opposed DNA strands with a short distance of each other may be able to form a stable intermolecular G-QPX involving two DNA complementary strands (ds ChAT G21). Formation of G-QPX structures, by blocking the availability of the transcription factor binding site (TFBS) on double stranded DNA, can interfere with transcriptional activation. This suggests that there is competition between TFBS binding to dsDNA and the conversion to high order non-B form secondary structures (G-QPXs) in the active promoter region. TFBS mapping analysis of the active promoter region of the human ChAT gene revealed that it contains multiple consensus AP-2alpha and Sp1 binding sites and consensus sites for other TF, including multiple sites for GR-alpha, Pax-5, p53 and GC box proteins. (Abstract shortened by ProQuest.).

  7. Mgm101 is a Rad52-related protein required for mitochondrial DNA recombination.

    PubMed

    Mbantenkhu, MacMillan; Wang, Xiaowen; Nardozzi, Jonathan D; Wilkens, Stephan; Hoffman, Elizabeth; Patel, Anamika; Cosgrove, Michael S; Chen, Xin Jie

    2011-12-09

    Homologous recombination is a conserved molecular process that has primarily evolved for the repair of double-stranded DNA breaks and stalled replication forks. However, the recombination machinery in mitochondria is poorly understood. Here, we show that the yeast mitochondrial nucleoid protein, Mgm101, is related to the Rad52-type recombination proteins that are widespread in organisms from bacteriophage to humans. Mgm101 is required for repeat-mediated recombination and suppression of mtDNA fragmentation in vivo. It preferentially binds to single-stranded DNA and catalyzes the annealing of ssDNA precomplexed with the mitochondrial ssDNA-binding protein, Rim1. Transmission electron microscopy showed that Mgm101 forms large oligomeric rings of ∼14-fold symmetry and highly compressed helical filaments. Specific mutations affecting ring formation reduce protein stability in vitro. The data suggest that the ring structure may provide a scaffold for stabilization of Mgm101 by preventing the aggregation of the otherwise unstable monomeric conformation. Upon binding to ssDNA, Mgm101 is remobilized from the rings to form distinct nucleoprotein filaments. These studies reveal a recombination protein of likely bacteriophage origin in mitochondria and support the notion that recombination is indispensable for mtDNA integrity.

  8. Three New Structures of Left-Handed RadA Helical Filaments: Structural Flexibility of N-Terminal Domain Is Critical for Recombinase Activity

    PubMed Central

    Chang, Yu-Wei; Ko, Tzu-Ping; Lee, Chien-Der; Chang, Yuan-Chih; Lin, Kuei-Ann; Chang, Chia-Seng; Wang, Andrew H.-J.; Wang, Ting-Fang

    2009-01-01

    RecA family proteins, including bacterial RecA, archaeal RadA, and eukaryotic Dmc1 and Rad51, mediate homologous recombination, a reaction essential for maintaining genome integrity. In the presence of ATP, these proteins bind a single-strand DNA to form a right-handed nucleoprotein filament, which catalyzes pairing and strand exchange with a homologous double-stranded DNA (dsDNA), by as-yet unknown mechanisms. We recently reported a structure of RadA left-handed helical filament, and here present three new structures of RadA left-handed helical filaments. Comparative structural analysis between different RadA/Rad51 helical filaments reveals that the N-terminal domain (NTD) of RadA/Rad51, implicated in dsDNA binding, is highly flexible. We identify a hinge region between NTD and polymerization motif as responsible for rigid body movement of NTD. Mutant analysis further confirms that structural flexibility of NTD is essential for RadA's recombinase activity. These results support our previous hypothesis that ATP-dependent axial rotation of RadA nucleoprotein helical filament promotes homologous recombination. PMID:19295907

  9. Analysis of DNA binding by human factor xeroderma pigmentosum complementation group A (XPA) provides insight into its interactions with nucleotide excision repair substrates.

    PubMed

    Sugitani, Norie; Voehler, Markus W; Roh, Michelle S; Topolska-Woś, Agnieszka M; Chazin, Walter J

    2017-10-13

    Xeroderma pigmentosum (XP) complementation group A (XPA) is an essential scaffolding protein in the multiprotein nucleotide excision repair (NER) machinery. The interaction of XPA with DNA is a core function of this protein; a number of mutations in the DNA-binding domain (DBD) are associated with XP disease. Although structures of the central globular domain of human XPA and data on binding of DNA substrates have been reported, the structural basis for XPA's DNA-binding activity remains unknown. X-ray crystal structures of the central globular domain of yeast XPA (Rad14) with lesion-containing DNA duplexes have provided valuable insights, but the DNA substrates used for this study do not correspond to the substrates of XPA as it functions within the NER machinery. To better understand the DNA-binding activity of human XPA in NER, we used NMR to investigate the interaction of its DBD with a range of DNA substrates. We found that XPA binds different single-stranded/double-stranded junction DNA substrates with a common surface. Comparisons of our NMR-based mapping of binding residues with the previously reported Rad14-DNA crystal structures revealed similarities and differences in substrate binding between XPA and Rad14. This includes direct evidence for DNA contacts to the residues extending C-terminally from the globular core, which are lacking in the Rad14 construct. Moreover, mutation of the XPA residue corresponding to Phe-262 in Rad14, previously reported as being critical for DNA binding, had only a moderate effect on the DNA-binding activity of XPA. The DNA-binding properties of several disease-associated mutations in the DBD were investigated. These results suggest that for XPA mutants exhibiting altered DNA-binding properties, a correlation exists between the extent of reduction in DNA-binding affinity and the severity of symptoms in XP patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Binding mechanism of PicoGreen to DNA characterized by magnetic tweezers and fluorescence spectroscopy.

    PubMed

    Wang, Ying; Schellenberg, Helene; Walhorn, Volker; Toensing, Katja; Anselmetti, Dario

    2017-09-01

    Fluorescent dyes are broadly used in many biotechnological applications to detect and visualize DNA molecules. However, their binding to DNA alters the structural and nanomechanical properties of DNA and, thus, interferes with associated biological processes. In this work we employed magnetic tweezers and fluorescence spectroscopy to investigate the binding of PicoGreen to DNA at room temperature in a concentration-dependent manner. PicoGreen is an ultrasensitive quinolinium nucleic acid stain exhibiting hardly any background signal from unbound dye molecules. By means of stretching and overwinding single, torsionally constrained, nick-free double-stranded DNA molecules, we acquired force-extension and supercoiling curves which allow quantifying DNA contour length, persistence length and other thermodynamical binding parameters, respectively. The results of our magnetic tweezers single-molecule binding study were well supported through analyzing the fluorescent spectra of stained DNA. On the basis of our work, we could identify a concentration-dependent bimodal binding behavior, where, apparently, PicoGreen associates to DNA as an intercalator and minor-groove binder simultaneously.

  11. Strand-invading linear probe combined with unmodified PNA.

    PubMed

    Asanuma, Hiroyuki; Niwa, Rie; Akahane, Mariko; Murayama, Keiji; Kashida, Hiromu; Kamiya, Yukiko

    2016-09-15

    Efficient strand invasion by a linear probe to fluorescently label double-stranded DNA has been implemented by employing a probe and unmodified PNA. As a fluorophore, we utilized ethynylperylene. Multiple ethynylperylene residues were incorporated into the DNA probe via a d-threoninol scaffold. The ethynylperylene did not significantly disrupt hybridization with complementary DNA. The linear probe self-quenched in the absence of target DNA and did not hybridize with PNA. A gel-shift assay revealed that linear probe and PNA combination invaded the central region of double-stranded DNA upon heat-shock treatment to form a double duplex. To further suppress the background emission and increase the stability of the probe/DNA duplex, a probe containing anthraquinones as well as ethynylperylene was synthesized. This probe and PNA invader pair detected an internal sequence in a double-stranded DNA with high sensitivity when heat shock treatment was used. The probe and PNA pair was able to invade at the terminus of a long double-stranded DNA at 40°C at 100mM NaCl concentration. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Noncovalent Interactions of Tiopronin-Protected Gold Nanoparticles with DNA: Two Methods to Quantify Free Energy of Binding

    PubMed Central

    Prado-Gotor, R.; Grueso, E.

    2014-01-01

    The binding of gold nanoparticles capped with N-(2-mercaptopropionyl)glycine (Au@tiopronin) with double-stranded DNA has been investigated and quantified in terms of free energies by using two different approaches. The first approach follows the DNA conformational changes induced by gold nanoparticles using the CD technique. The second methodology consists in the use of pyrene-1-carboxaldehyde as a fluorescent probe. This second procedure implies the determination of the “true” free energy of binding of the probe with DNA, after corrections through solubility measurements. Working at different salt concentrations, the nonelectrostatic and electrostatic components of the binding free energy have been separated. The results obtained revealed that the binding is of nonelectrostatic character, fundamentally. The procedure used in this work could be extended to quantify the binding affinity of other AuNPs/DNA systems. PMID:24587710

  13. DNA-binding activity of TNF-{alpha} inducing protein from Helicobacter pylori

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kuzuhara, T.; Suganuma, M.; Oka, K.

    2007-11-03

    Tumor necrosis factor-{alpha} (TNF-{alpha}) inducing protein (Tip{alpha}) is a carcinogenic factor secreted from Helicobacter pylori (H. pylori), mediated through both enhanced expression of TNF-{alpha} and chemokine genes and activation of nuclear factor-{kappa}B. Since Tip{alpha} enters gastric cancer cells, the Tip{alpha} binding molecules in the cells should be investigated. The direct DNA-binding activity of Tip{alpha} was observed by pull down assay using single- and double-stranded genomic DNA cellulose. The surface plasmon resonance assay, indicating an association between Tip{alpha} and DNA, revealed that the affinity of Tip{alpha} for (dGdC)10 is 2400 times stronger than that of del-Tip{alpha}, an inactive Tip{alpha}. This suggestsmore » a strong correlation between DNA-binding activity and carcinogenic activity of Tip{alpha}. And the DNA-binding activity of Tip{alpha} was first demonstrated with a molecule secreted from H. pylori.« less

  14. Asymmetric Assembly of Merkel Cell Polyomavirus Large T-Antigen Origin Binding Domains at the Viral Origin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    C Harrison; G Meinke; H Kwun

    2011-12-31

    The double-stranded DNA polyomavirus Merkel cell polyomavirus (MCV) causes Merkel cell carcinoma, an aggressive but rare human skin cancer that most often affects immunosuppressed and elderly persons. As in other polyomaviruses, the large T-antigen of MCV recognizes the viral origin of replication by binding repeating G(A/G)GGC pentamers. The spacing, number, orientation, and necessity of repeats for viral replication differ, however, from other family members such as SV40 and murine polyomavirus. We report here the 2.9 {angstrom} crystal structure of the MCV large T-antigen origin binding domain (OBD) in complex with a DNA fragment from the MCV origin of replication. Consistentmore » with replication data showing that three of the G(A/G)GGC-like binding sites near the center of the origin are required for replication, the crystal structure contains three copies of the OBD. This stoichiometry was verified using isothermal titration calorimetry. The affinity for G(A/G)GGC-containing double-stranded DNA was found to be {approx} 740 nM, approximately 8-fold weaker than the equivalent domain in SV40 for the analogous region of the SV40 origin. The difference in affinity is partially attributable to DNA-binding residue Lys331 (Arg154 in SV40). In contrast to SV40, a small protein-protein interface is observed between MCV OBDs when bound to the central region of the origin. This protein-protein interface is reminiscent of that seen in bovine papilloma virus E1 protein. Mutational analysis indicates, however, that this interface contributes little to DNA binding energy.« less

  15. DNA interrogation by the CRISPR RNA-guided endonuclease Cas9.

    PubMed

    Sternberg, Samuel H; Redding, Sy; Jinek, Martin; Greene, Eric C; Doudna, Jennifer A

    2014-03-06

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

  16. DNA interrogation by the CRISPR RNA-guided endonuclease Cas9

    NASA Astrophysics Data System (ADS)

    Sternberg, Samuel H.; Redding, Sy; Jinek, Martin; Greene, Eric C.; Doudna, Jennifer A.

    2014-03-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

  17. Quenching the chemiluminescence of acridinium ester by graphene oxide for label-free and homogeneous DNA detection.

    PubMed

    He, Yi; Huang, Guangming; Cui, Hua

    2013-11-13

    It was found that graphene oxide (GO) could effectively quench the chemiluminescence (CL) emission from a acridinium ester (AE)-hydrogen peroxide system. By taking advantage of this quenching effect, as a proof of concept, a label-free and homogeneous DNA assay was developed for the detection of Mycobacterium tuberculosis DNA. In the absence of target DNA, both probe DNA and AE were absorbed on the surface of GO, producing a weak CL emission owing to the CL quenching effect of GO. However, in the presence of target DNA, a double-stranded structure of DNA was generated, leading to the release of the oligonucleotide from the GO surface. AE favors binding with double-stranded DNA, which will be released from the GO surface; thus, the quenching effect of GO will be no longer effective and a strong CL signal can be observed. This assay can detect M. tuberculosis DNA with a detection limit of 0.65 nM. This sensitivity is lower than that of previously reported electrochemical detection.

  18. Caffeine inhibits gene conversion by displacing Rad51 from ssDNA

    PubMed Central

    Tsabar, Michael; Mason, Jennifer M.; Chan, Yuen-Ling; Bishop, Douglas K.; Haber, James E.

    2015-01-01

    Efficient repair of chromosomal double-strand breaks (DSBs) by homologous recombination relies on the formation of a Rad51 recombinase filament that forms on single-stranded DNA (ssDNA) created at DSB ends. This filament facilitates the search for a homologous donor sequence and promotes strand invasion. Recently caffeine treatment has been shown to prevent gene targeting in mammalian cells by increasing non-productive Rad51 interactions between the DSB and random regions of the genome. Here we show that caffeine treatment prevents gene conversion in yeast, independently of its inhibition of the Mec1ATR/Tel1ATM-dependent DNA damage response or caffeine's inhibition of 5′ to 3′ resection of DSB ends. Caffeine treatment results in a dosage-dependent eviction of Rad51 from ssDNA. Gene conversion is impaired even at low concentrations of caffeine, where there is no discernible dismantling of the Rad51 filament. Loss of the Rad51 filament integrity is independent of Srs2's Rad51 filament dismantling activity or Rad51's ATPase activity and does not depend on non-specific Rad51 binding to undamaged double-stranded DNA. Caffeine treatment had similar effects on irradiated HeLa cells, promoting loss of previously assembled Rad51 foci. We conclude that caffeine treatment can disrupt gene conversion by disrupting Rad51 filaments. PMID:26019181

  19. The nature of the force-induced conformation transition of dsDNA studied by using single molecule force spectroscopy.

    PubMed

    Liu, Ningning; Bu, Tianjia; Song, Yu; Zhang, Wei; Li, Jinjing; Zhang, Wenke; Shen, Jiacong; Li, Hongbin

    2010-06-15

    Single-stranded DNA binding proteins (SSB) interact with single-stranded DNA (ssDNA) specifically. Taking advantage of this character, we have employed Bacillus subtilis SSB protein to investigate the nature of force-induced conformation transition of double-stranded DNA (dsDNA) by using AFM-based single molecule force spectroscopy (SMFS) technique. Our results show that, when a dsDNA is stretched beyond its contour length, the dsDNA is partially melted, producing some ssDNA segments which can be captured by SSB proteins. We have also systematically investigated the effects of stretching length, waiting time, and salt concentration on the conformation transition of dsDNA and SSB-ssDNA interactions, respectively. Furthermore, the effect of proflavine, a DNA intercalator, on the SSB-DNA interactions has been investigated, and the results indicate that the proflavine-saturated dsDNA can be stabilized to the extent that the dsDNA will no longer melt into ssDNA under the mechanical force even up to 150 pN, and no SSB-DNA interactions are detectable.

  20. Double stranded nucleic acid biochips

    DOEpatents

    Chernov, Boris; Golova, Julia

    2006-05-23

    This invention describes a new method of constructing double-stranded DNA (dsDNA) microarrays based on the use of pre-synthesized or natural DNA duplexes without a stem-loop structure. The complementary oligonucleotide chains are bonded together by a novel connector that includes a linker for immobilization on a matrix. A non-enzymatic method for synthesizing double-stranded nucleic acids with this novel connector enables the construction of inexpensive and robust dsDNA/dsRNA microarrays. DNA-DNA and DNA-protein interactions are investigated using the microarrays.

  1. Kinetics of presynaptic filament assembly in the presence of single-stranded DNA binding protein and recombination mediator protein.

    PubMed

    Liu, Jie; Berger, Christopher L; Morrical, Scott W

    2013-11-12

    Enzymes of the RecA/Rad51 family catalyze DNA strand exchange reactions that are important for homologous recombination and for the accurate repair of DNA double-strand breaks. RecA/Rad51 recombinases are activated by their assembly into presynaptic filaments on single-stranded DNA (ssDNA), a process that is regulated by ssDNA binding protein (SSB) and mediator proteins. Mediator proteins stimulate strand exchange by accelerating the rate-limiting displacement of SSB from ssDNA by the incoming recombinase. The use of mediators is a highly conserved strategy in recombination, but the precise mechanism of mediator activity is unknown. In this study, the well-defined bacteriophage T4 recombination system (UvsX recombinase, Gp32 SSB, and UvsY mediator) is used to examine the kinetics of presynaptic filament assembly on native ssDNA in vitro. Results indicate that the ATP-dependent assembly of UvsX presynaptic filaments on Gp32-covered ssDNA is limited by a salt-sensitive nucleation step in the absence of mediator. Filament nucleation is selectively enhanced and rendered salt-resistant by mediator protein UvsY, which appears to stabilize a prenucleation complex. This mechanism potentially explains how UvsY promotes presynaptic filament assembly at physiologically relevant ionic strengths and Gp32 concentrations. Other data suggest that presynaptic filament assembly involves multiple nucleation events, resulting in many short UvsX-ssDNA filaments or clusters, which may be the relevant form for recombination in vivo. Together, these findings provide the first detailed kinetic model for presynaptic filament assembly involving all three major protein components (recombinase, mediator, and SSB) on native ssDNA.

  2. The bipolar filaments formed by Herpes simplex virus type 1 SSB/recombination protein (ICP8) suggest a mechanism for DNA annealing

    PubMed Central

    Makhov, Alexander M.; Sen, Anindito; Yu, Xiong; Simon, Martha N.; Griffith, Jack D.; Egelman, Edward H.

    2009-01-01

    Herpes simplex virus type 1 encodes a multifunctional protein, ICP8, which serves both as a single strand binding protein and recombinase, catalyzing reactions involved in replication and recombination of the viral genome. In the presence of divalent ions and at low temperature, previous electron microscopic (EM) studies showed that ICP8 will form long left-handed helical filaments. Here EM image reconstruction reveals that the filaments are bipolar, with an asymmetric unit containing two subunits of ICP8 that constitute a symmetrical dimer. This organization of the filament has been confirmed using Scanning Transmission Electron Microscopy. The pitch of the filaments is ~ 250 Å, with ~ 6.2 dimers per turn. Docking of a crystal structure of ICP8 into the reconstructed filament shows that the C-terminal domain of ICP8, attached to the body of the subunit by a flexible linker containing ~ 10 residues, is packed into a pocket in the body of a neighboring subunit in the crystal in a similar manner as in the filament. However, the interactions between the large N-terminal domains are quite different in the filament from that observed in the crystal. A previously proposed model for ICP8 binding single-stranded DNA, based upon the crystal structure, leads to a model for a continuous strand of ssDNA near the filament axis. The bipolar nature of the ICP8 filaments means that a second strand of ssDNA would be running through this filament in the opposite orientation, and this provides a potential mechanism for how ICP8 anneals complementary single stranded DNA into double-stranded DNA, where each strand runs in opposite directions. PMID:19138689

  3. In trans paired nicking triggers seamless genome editing without double-stranded DNA cutting.

    PubMed

    Chen, Xiaoyu; Janssen, Josephine M; Liu, Jin; Maggio, Ignazio; 't Jong, Anke E J; Mikkers, Harald M M; Gonçalves, Manuel A F V

    2017-09-22

    Precise genome editing involves homologous recombination between donor DNA and chromosomal sequences subjected to double-stranded DNA breaks made by programmable nucleases. Ideally, genome editing should be efficient, specific, and accurate. However, besides constituting potential translocation-initiating lesions, double-stranded DNA breaks (targeted or otherwise) are mostly repaired through unpredictable and mutagenic non-homologous recombination processes. Here, we report that the coordinated formation of paired single-stranded DNA breaks, or nicks, at donor plasmids and chromosomal target sites by RNA-guided nucleases based on CRISPR-Cas9 components, triggers seamless homology-directed gene targeting of large genetic payloads in human cells, including pluripotent stem cells. Importantly, in addition to significantly reducing the mutagenicity of the genome modification procedure, this in trans paired nicking strategy achieves multiplexed, single-step, gene targeting, and yields higher frequencies of accurately edited cells when compared to the standard double-stranded DNA break-dependent approach.CRISPR-Cas9-based gene editing involves double-strand breaks at target sequences, which are often repaired by mutagenic non-homologous end-joining. Here the authors use Cas9 nickases to generate coordinated single-strand breaks in donor and target DNA for precise homology-directed gene editing.

  4. Structure of the E2 DNA-binding domain from human papillomavirus serotype 31 at 2.4 A.

    PubMed

    Bussiere, D E; Kong, X; Egan, D A; Walter, K; Holzman, T F; Lindh, F; Robins, T; Giranda, V L

    1998-11-01

    The papillomaviruses are a family of small double-stranded DNA viruses which exclusively infect epithelial cells and stimulate the proliferation of those cells. A key protein within the papillomavirus life-cycle is known as the E2 (Early 2) protein and is responsible for regulating viral transcription from all viral promoters as well as for replication of the papillomavirus genome in tandem with another protein known as E1. The E2 protein itself consists of three functional domains: an N-terminal trans-activation domain, a proline-rich linker, and a C-terminal DNA-binding domain. The first crystal structure of the human papillomavirus, serotype 31 (HPV-31), E2 DNA-binding domain has been determined at 2.4 A resolution. The HPV DNA-binding domain monomer consists of two beta-alpha-beta repeats of approximately equal length and is arranged as to have an anti-parallel beta-sheet flanked by the two alpha-helices. The monomers form the functional in vivo dimer by association of the beta-sheets of each monomer so as to form an eight-stranded anti-parallel beta-barrel at the center of the dimer, with the alpha-helices lining the outside of the barrel. The overall structure of HVP-31 E2 DNA-binding domain is similar to both the bovine papillomavirus E2-binding domain and the Epstein-Barr nuclear antigen-1 DNA-binding domain.

  5. The Human L1 Element Causes DNA Double-Strand Breaks in Breast Cancer

    DTIC Science & Technology

    2006-08-01

    cancer is complex. However, defects in DNA repair genes in the double-strand break repair pathway are cancer predisposing. My lab has characterized...a new potentially important source of double-strand breaks (DSBs) in human cells and are interested in characterizing which DNA repair genes act on...this particular source of DNA damage. Selfish DNA accounts for 45% of the human genome. We have recently demonstrated that one particular selfish

  6. The role of the C-domain of bacteriophage T4 gene 32 protein in ssDNA binding and dsDNA helix-destabilization: Kinetic, single-molecule, and cross-linking studies

    PubMed Central

    Pant, Kiran; Anderson, Brian; Perdana, Hendrik; Malinowski, Matthew A.; Win, Aye T.; Williams, Mark C.

    2018-01-01

    The model single-stranded DNA binding protein of bacteriophage T4, gene 32 protein (gp32) has well-established roles in DNA replication, recombination, and repair. gp32 is a single-chain polypeptide consisting of three domains. Based on thermodynamics and kinetics measurements, we have proposed that gp32 can undergo a conformational change where the acidic C-terminal domain binds internally to or near the single-stranded (ss) DNA binding surface in the core (central) domain, blocking ssDNA interaction. To test this model, we have employed a variety of experimental approaches and gp32 variants to characterize this conformational change. Utilizing stopped-flow methods, the association kinetics of wild type and truncated forms of gp32 with ssDNA were measured. When the C-domain is present, the log-log plot of k vs. [NaCl] shows a positive slope, whereas when it is absent (*I protein), there is little rate change with salt concentration, as expected for this model.A gp32 variant lacking residues 292–296 within the C-domain, ΔPR201, displays kinetic properties intermediate between gp32 and *I. The single molecule force-induced DNA helix-destabilizing activitiesas well as the single- and double-stranded DNA affinities of ΔPR201 and gp32 truncated at residue 295 also fall between full-length protein and *I. Finally, chemical cross-linking of recombinant C-domain and gp32 lacking both N- and C-terminal domains is inhibited by increasing concentrations of a short single-stranded oligonucleotide, and the salt dependence of cross-linking mirrors that expected for the model. Taken together, these results provide the first evidence in support of this model that have been obtained through structural probes. PMID:29634784

  7. Rupture of DNA aptamer: New insights from simulations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mishra, Rakesh Kumar; Nath, Shesh; Kumar, Sanjay

    2015-10-28

    Base-pockets (non-complementary base-pairs) in a double-stranded DNA play a crucial role in biological processes. Because of thermal fluctuations, it can lower the stability of DNA, whereas, in case of DNA aptamer, small molecules, e.g., adenosinemonophosphate and adenosinetriphosphate, form additional hydrogen bonds with base-pockets termed as “binding-pockets,” which enhance the stability. Using the Langevin dynamics simulations of coarse grained model of DNA followed by atomistic simulations, we investigated the influence of base-pocket and binding-pocket on the stability of DNA aptamer. Striking differences have been reported here for the separation induced by temperature and force, which require further investigation by single moleculemore » experiments.« less

  8. Can a double stranded DNA be unzipped by pulling a single strand?: phases of adsorbed DNA.

    PubMed

    Kapri, Rajeev

    2009-04-14

    We study the unzipping of a double stranded DNA (dsDNA) by applying an external force on a single strand while leaving the other strand free. We find that the dsDNA can be unzipped to two single strands if the external force exceeds a critical value. We obtain the phase diagram, which is found to be different from the phase diagram of unzipping by pulling both the strands in opposite directions. In the presence of an attractive surface near DNA, the phase diagram gets modified drastically and shows richer surprises including a critical end point and a triple point.

  9. Plasticity of BRCA2 Function in Homologous Recombination: Genetic Interactions of the PALB2 and DNA Binding Domains

    PubMed Central

    Siaud, Nicolas; Lam, Isabel; Christ, Nicole; Schlacher, Katharina; Xia, Bing; Jasin, Maria

    2011-01-01

    The breast cancer suppressor BRCA2 is essential for the maintenance of genomic integrity in mammalian cells through its role in DNA repair by homologous recombination (HR). Human BRCA2 is 3,418 amino acids and is comprised of multiple domains that interact with the RAD51 recombinase and other proteins as well as with DNA. To gain insight into the cellular function of BRCA2 in HR, we created fusions consisting of various BRCA2 domains and also introduced mutations into these domains to disrupt specific protein and DNA interactions. We find that a BRCA2 fusion peptide deleted for the DNA binding domain and active in HR is completely dependent on interaction with the PALB2 tumor suppressor for activity. Conversely, a BRCA2 fusion peptide deleted for the PALB2 binding domain is dependent on an intact DNA binding domain, providing a role for this conserved domain in vivo; mutagenesis suggests that both single-stranded and double-stranded DNA binding activities in the DNA binding domain are required for its activity. Given that PALB2 itself binds DNA, these results suggest alternative mechanisms to deliver RAD51 to DNA. In addition, the BRCA2 C terminus contains both RAD51-dependent and -independent activities which are essential to HR in some contexts. Finally, binding the small peptide DSS1 is essential for activity when its binding domain is present, but not when it is absent. Our results reveal functional redundancy within the BRCA2 protein and emphasize the plasticity of this large protein built for optimal HR function in mammalian cells. The occurrence of disease-causing mutations throughout BRCA2 suggests sub-optimal HR from a variety of domain modulations. PMID:22194698

  10. DNA forms of the geminivirus African cassava mosaic virus consistent with a rolling circle mechanism of replication.

    PubMed Central

    Saunders, K; Lucy, A; Stanley, J

    1991-01-01

    We have analysed DNA from African cassava mosaic virus (ACMV)-infected Nicotiana benthamiana by two-dimensional agarose gel electrophoresis and detected ACMV-specific DNAs by blot-hybridisation. ACMV DNA forms including the previously characterised single-stranded, open-circular, linear and supercoiled DNAs along with five previously uncharacterised heterogeneous DNAs (H1-H5) were resolved. The heterogeneous DNAs were characterised by their chromatographic properties on BND-cellulose and their ability to hybridise to strand-specific and double-stranded probes. The data suggest a rolling circle mechanism of DNA replication, based on the sizes and strand specificity of the heterogeneous single-stranded DNA forms and their electrophoretic properties in relation to genome length single-stranded DNAs. Second-strand synthesis on a single-stranded virus-sense template is evident from the position of heterogeneous subgenomic complementary-sense DNA (H3) associated with genome-length virus-sense template (VT) DNA. The position of heterogeneous virus-sense DNA (H5), ranging in size from one to two genome lengths, is consistent with its association with genome-length complementary-sense template (CT) DNA, reflecting virus-sense strand displacement during replication from a double-stranded intermediate. The absence of subgenomic complementary-sense DNA associated with the displaced virus-sense strand suggests that replication proceeds via an obligate single-stranded intermediate. The other species of heterogeneous DNAs comprised concatemeric single-stranded virus-sense DNA (H4), and double-stranded or partially single-stranded DNA (H1 and H2). Images PMID:2041773

  11. Strand displacement by DNA polymerase III occurs through a tau-psi-chi link to single-stranded DNA-binding protein coating the lagging strand template.

    PubMed

    Yuan, Quan; McHenry, Charles S

    2009-11-13

    In addition to the well characterized processive replication reaction catalyzed by the DNA polymerase III holoenzyme on single-stranded DNA templates, the enzyme possesses an intrinsic strand displacement activity on flapped templates. The strand displacement activity is distinguished from the single-stranded DNA-templated reaction by a high dependence upon single-stranded DNA binding protein and an inability of gamma-complex to support the reaction in the absence of tau. However, if gamma-complex is present to load beta(2), a truncated tau protein containing only domains III-V will suffice. This truncated protein is sufficient to bind both the alpha subunit of DNA polymerase (Pol) III and chipsi. This is reminiscent of the minimal requirements for Pol III to replicate short single-stranded DNA-binding protein (SSB)-coated templates where tau is only required to serve as a scaffold to hold Pol III and chi in the same complex (Glover, B., and McHenry, C. (1998) J. Biol. Chem. 273, 23476-23484). We propose a model in which strand displacement by DNA polymerase III holoenzyme depends upon a Pol III-tau-psi-chi-SSB binding network, where SSB is bound to the displaced strand, stabilizing the Pol III-template interaction. The same interaction network is probably important for stabilizing the leading strand polymerase interactions with authentic replication forks. The specificity constant (k(cat)/K(m)) for the strand displacement reaction is approximately 300-fold less favorable than reactions on single-stranded templates and proceeds with a slower rate (150 nucleotides/s) and only moderate processivity (approximately 300 nucleotides). PriA, the initiator of replication restart on collapsed or misassembled replication forks, blocks the strand displacement reaction, even if added to an ongoing reaction.

  12. Control of DNA hybridization by photoswitchable molecular glue.

    PubMed

    Dohno, Chikara; Nakatani, Kazuhiko

    2011-12-01

    Hybridization of DNA is one of the most intriguing events in molecular recognition and is essential for living matter to inherit life beyond generations. In addition to the function of DNA as genetic material, DNA hybridization is a key to control the function of DNA-based materials in nanoscience. Since the hybridization of two single stranded DNAs is a thermodynamically favorable process, dissociation of the once formed DNA duplex is normally unattainable under isothermal conditions. As the progress of DNA-based nanoscience, methodology to control the DNA hybridization process has become increasingly important. Besides many reports using the chemically modified DNA for the regulation of hybridization, we focused our attention on the use of a small ligand as the molecular glue for the DNA. In 2001, we reported the first designed molecule that strongly and specifically bound to the mismatched base pairs in double stranded DNA. Further studies on the mismatch binding molecules provided us a key discovery of a novel mode of the binding of a mismatch binding ligand that induced the base flipping. With these findings we proposed the concept of molecular glue for DNA for the unidirectional control of DNA hybridization and, eventually photoswitchable molecular glue for DNA, which enabled the bidirectional control of hybridization under photoirradiation. In this tutorial review, we describe in detail how we integrated the mismatch binding ligand into photoswitchable molecular glue for DNA, and the application and perspective in DNA-based nanoscience.

  13. Role of allosteric switch residue histidine 195 in maintaining active-site asymmetry in presynaptic filaments of bacteriophage T4 UvsX recombinase.

    PubMed

    Farb, Joshua N; Morrical, Scott W

    2009-01-16

    Recombinases of the highly conserved RecA/Rad51 family play central roles in homologous recombination and DNA double-stranded break repair. RecA/Rad51 enzymes form presynaptic filaments on single-stranded DNA (ssDNA) that are allosterically activated to catalyze ATPase and DNA strand-exchange reactions. Information is conveyed between DNA- and ATP-binding sites, in part, by a highly conserved glutamine residue (Gln194 in Escherichia coli RecA) that acts as an allosteric switch. The T4 UvsX protein is a divergent RecA ortholog and contains histidine (His195) in place of glutamine at the allosteric switch position. UvsX and RecA catalyze similar strand-exchange reactions, but differ in other properties. UvsX produces both ADP and AMP as products of its ssDNA-dependent ATPase activity--a property that is unique among characterized recombinases. Details of the kinetics of ssDNA-dependent ATP hydrolysis reactions indicate that UvsX-ssDNA presynaptic filaments are asymmetric and contain two classes of ATPase active sites: one that generates ADP, and another that generates AMP. Active-site asymmetry is reduced by mutations at the His195 position, since UvsX-H195Q and UvsX-H195A mutants both exhibit stronger ssDNA-dependent ATPase activity, with lower cooperativity and markedly higher ADP/AMP product ratios, than wild-type UvsX. Reduced active-site asymmetry correlates strongly with reduced ssDNA-binding affinity and DNA strand-exchange activity in both H195Q and H195A mutants. These and other results support a model in which allosteric switch residue His195 controls the formation of an asymmetric conformation of UvsX-ssDNA filaments that is active in DNA strand exchange. The implications of our findings for UvsX recombination functions, and for RecA functions in general, are discussed.

  14. Double-stranded telomeric DNA binding proteins: Diversity matters.

    PubMed

    Červenák, Filip; Juríková, Katarína; Sepšiová, Regina; Neboháčová, Martina; Nosek, Jozef; Tomáška, L'ubomír

    2017-01-01

    Telomeric sequences constitute only a small fraction of the whole genome yet they are crucial for ensuring genomic stability. This function is in large part mediated by protein complexes recruited to telomeric sequences by specific telomere-binding proteins (TBPs). Although the principal tasks of nuclear telomeres are the same in all eukaryotes, TBPs in various taxa exhibit a surprising diversity indicating their distinct evolutionary origin. This diversity is especially pronounced in ascomycetous yeasts where they must have co-evolved with rapidly diversifying sequences of telomeric repeats. In this article we (i) provide a historical overview of the discoveries leading to the current list of TBPs binding to double-stranded (ds) regions of telomeres, (ii) describe examples of dsTBPs highlighting their diversity in even closely related species, and (iii) speculate about possible evolutionary trajectories leading to a long list of various dsTBPs fulfilling the same general role(s) in their own unique ways.

  15. Exploring the Interactions of the Dietary Plant Flavonoids Fisetin and Naringenin with G-Quadruplex and Duplex DNA, Showing Contrasting Binding Behavior: Spectroscopic and Molecular Modeling Approaches.

    PubMed

    Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta

    2016-09-01

    Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.

  16. The bipolar filaments formed by herpes simplex virus type 1 SSB/recombination protein (ICP8) suggest a mechanism for DNA annealing.

    PubMed

    Makhov, Alexander M; Sen, Anindito; Yu, Xiong; Simon, Martha N; Griffith, Jack D; Egelman, Edward H

    2009-02-20

    Herpes simplex virus type 1 encodes a multifunctional protein, ICP8, which serves both as a single-strand binding protein and as a recombinase, catalyzing reactions involved in replication and recombination of the viral genome. In the presence of divalent ions and at low temperature, previous electron microscopic studies showed that ICP8 will form long left-handed helical filaments. Here, electron microscopic image reconstruction reveals that the filaments are bipolar, with an asymmetric unit containing two subunits of ICP8 that constitute a symmetrical dimer. This organization of the filament has been confirmed using scanning transmission electron microscopy. The pitch of the filaments is approximately 250 A, with approximately 6.2 dimers per turn. Docking of a crystal structure of ICP8 into the reconstructed filament shows that the C-terminal domain of ICP8, attached to the body of the subunit by a flexible linker containing approximately 10 residues, is packed into a pocket in the body of a neighboring subunit in the crystal in a similar manner as in the filament. However, the interactions between the large N-terminal domains are quite different in the filament from that observed in the crystal. A previously proposed model for ICP8 binding single-stranded DNA (ssDNA), based upon the crystal structure, leads to a model for a continuous strand of ssDNA near the filament axis. The bipolar nature of the ICP8 filaments means that a second strand of ssDNA would be running through this filament in the opposite orientation, and this provides a potential mechanism for how ICP8 anneals complementary ssDNA into double-stranded DNA, where each strand runs in opposite directions.

  17. The Bipolar Filaments Formed by Herpes Simplex Virus Type 1 SSB/Recombination Protein (ICP8) Suggest a Mechanism for DNA Annealing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Makhov, A.M.; Simon, M.; Sen, A.

    2009-02-20

    Herpes simplex virus type 1 encodes a multifunctional protein, ICP8, which serves both as a single-strand binding protein and as a recombinase, catalyzing reactions involved in replication and recombination of the viral genome. In the presence of divalent ions and at low temperature, previous electron microscopic studies showed that ICP8 will form long left-handed helical filaments. Here, electron microscopic image reconstruction reveals that the filaments are bipolar, with an asymmetric unit containing two subunits of ICP8 that constitute a symmetrical dimer. This organization of the filament has been confirmed using scanning transmission electron microscopy. The pitch of the filaments ismore » {approx} 250 {angstrom}, with {approx} 6.2 dimers per turn. Docking of a crystal structure of ICP8 into the reconstructed filament shows that the C-terminal domain of ICP8, attached to the body of the subunit by a flexible linker containing {approx} 10 residues, is packed into a pocket in the body of a neighboring subunit in the crystal in a similar manner as in the filament. However, the interactions between the large N-terminal domains are quite different in the filament from that observed in the crystal. A previously proposed model for ICP8 binding single-stranded DNA (ssDNA), based upon the crystal structure, leads to a model for a continuous strand of ssDNA near the filament axis. The bipolar nature of the ICP8 filaments means that a second strand of ssDNA would be running through this filament in the opposite orientation, and this provides a potential mechanism for how ICP8 anneals complementary ssDNA into double-stranded DNA, where each strand runs in opposite directions.« less

  18. Structure of a bacterial RNA polymerase holoenzyme open promoter complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bae, Brian; Feklistov, Andrey; Lass-Napiorkowska, Agnieszka

    2015-09-08

    Initiation of transcription is a primary means for controlling gene expression. In bacteria, the RNA polymerase (RNAP) holoenzyme binds and unwinds promoter DNA, forming the transcription bubble of the open promoter complex (RPo). We have determined crystal structures, refined to 4.14 Å-resolution, of RPo containing Thermus aquaticus RNAP holoenzyme and promoter DNA that includes the full transcription bubble. The structures, combined with biochemical analyses, reveal key features supporting the formation and maintenance of the double-strand/single-strand DNA junction at the upstream edge of the -10 element where bubble formation initiates. The results also reveal RNAP interactions with duplex DNA just upstreammore » of the -10 element and potential protein/DNA interactions that direct the DNA template strand into the RNAP active site. Addition of an RNA primer to yield a 4 base-pair post-translocated RNA:DNA hybrid mimics an initially transcribing complex at the point where steric clash initiates abortive initiation and σA dissociation.« less

  19. Structure of a bacterial RNA polymerase holoenzyme open promoter complex

    DOE PAGES

    Bae, Brian; Feklistov, Andrey; Lass-Napiorkowska, Agnieszka; ...

    2015-09-08

    Initiation of transcription is a primary means for controlling gene expression. In bacteria, the RNA polymerase (RNAP) holoenzyme binds and unwinds promoter DNA, forming the transcription bubble of the open promoter complex (RPo). We have determined crystal structures, refined to 4.14 Å-resolution, of RPo containing Thermus aquaticus RNAP holoenzyme and promoter DNA that includes the full transcription bubble. The structures, combined with biochemical analyses, reveal key features supporting the formation and maintenance of the double-strand/single-strand DNA junction at the upstream edge of the -10 element where bubble formation initiates. The results also reveal RNAP interactions with duplex DNA just upstreammore » of the -10 element and potential protein/DNA interactions that direct the DNA template strand into the RNAP active site. Additionally a RNA primer to yield a 4 base-pair post-translocated RNA:DNA hybrid mimics an initially transcribing complex at the point where steric clash initiates abortive initiation and σ A dissociation.« less

  20. Autonomous parvovirus LuIII encapsidates equal amounts of plus and minus DNA strands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bates, R.C.; Snyder, C.E.; Banerjee, P.T.

    1984-02-01

    Autonomous parvoviruses are thought to uniquely encapsidate single-stranded DNA of minus polarity. In contrast, the defective adeno-associated viruses separately encapsidate equal amounts of plus and minus DNA strands. The uniqueness of minus strand encapsidation is reexamined for the autonomous parvoviruses. Although it was found that Kilham rat virus and H-1 virus encapsidate varying but small amounts of complementary-strand DNA, it was unexpected to find that LuIII virus encapsidated equal amounts of plus and minus DNA. The extracted LuIII DNA possessed properties of double-stranded replicative-form DNA, including insensitivity to S1 endonuclease, cleavage by restriction enzymes, and conversion to unit-length, single-stranded DNAmore » when electrophoresed under denaturing conditions. However, the inability of this DNA to form single-stranded DNA circles when denatured and then renatured in the presence of formamide and the lack of double-stranded DNA circle formation after treatment with exonuclease III and reannealing shows a lack of sequence homology of the 3' and 5' termini of LuIII DNA, in contrast to adeno-associated virus DNA. Digestion of LuIII double-stranded DNA with EcoRI and HincII and separation of plus and minus DNA strands on composite agarose-acrylamide gels identified a heterogeneity present only in the plus DNA strand. These results suggest that strand specificity of viral DNA encapsidation is not a useful property for differentiation between the autonomous and defective parvoviruses. Furthermore, encapsidation by LuIII of equal amounts of complementary DNA strands in contrast to encapsidation of minus strands by H-1 virus, when propagated in the same host cell type, suggests that selection of strands for encapsidation is a virus-coded rather than host-controlled event.« less

  1. Thiophene antibacterials that allosterically stabilize DNA-cleavage complexes with DNA gyrase.

    PubMed

    Chan, Pan F; Germe, Thomas; Bax, Benjamin D; Huang, Jianzhong; Thalji, Reema K; Bacqué, Eric; Checchia, Anna; Chen, Dongzhao; Cui, Haifeng; Ding, Xiao; Ingraham, Karen; McCloskey, Lynn; Raha, Kaushik; Srikannathasan, Velupillai; Maxwell, Anthony; Stavenger, Robert A

    2017-05-30

    A paucity of novel acting antibacterials is in development to treat the rising threat of antimicrobial resistance, particularly in Gram-negative hospital pathogens, which has led to renewed efforts in antibiotic drug discovery. Fluoroquinolones are broad-spectrum antibacterials that target DNA gyrase by stabilizing DNA-cleavage complexes, but their clinical utility has been compromised by resistance. We have identified a class of antibacterial thiophenes that target DNA gyrase with a unique mechanism of action and have activity against a range of bacterial pathogens, including strains resistant to fluoroquinolones. Although fluoroquinolones stabilize double-stranded DNA breaks, the antibacterial thiophenes stabilize gyrase-mediated DNA-cleavage complexes in either one DNA strand or both DNA strands. X-ray crystallography of DNA gyrase-DNA complexes shows the compounds binding to a protein pocket between the winged helix domain and topoisomerase-primase domain, remote from the DNA. Mutations of conserved residues around this pocket affect activity of the thiophene inhibitors, consistent with allosteric inhibition of DNA gyrase. This druggable pocket provides potentially complementary opportunities for targeting bacterial topoisomerases for antibiotic development.

  2. Dynamic and Progressive Control of DNA Origami Conformation by Modulating DNA Helicity with Chemical Adducts.

    PubMed

    Chen, Haorong; Zhang, Hanyu; Pan, Jing; Cha, Tae-Gon; Li, Shiming; Andréasson, Joakim; Choi, Jong Hyun

    2016-05-24

    DNA origami has received enormous attention for its ability to program complex nanostructures with a few nanometer precision. Dynamic origami structures that change conformation in response to environmental cues or external signals hold great promises in sensing and actuation at the nanoscale. The reconfiguration mechanism of existing dynamic origami structures is mostly limited to single-stranded hinges and relies almost exclusively on DNA hybridization or strand displacement. Here, we show an alternative approach by demonstrating on-demand conformation changes with DNA-binding molecules, which intercalate between base pairs and unwind DNA double helices. The unwinding effect modulates the helicity mismatch in DNA origami, which significantly influences the internal stress and the global conformation of the origami structure. We demonstrate the switching of a polymerized origami nanoribbon between different twisting states and a well-constrained torsional deformation in a monomeric origami shaft. The structural transformation is shown to be reversible, and binding isotherms confirm the reconfiguration mechanism. This approach provides a rapid and reversible means to change DNA origami conformation, which can be used for dynamic and progressive control at the nanoscale.

  3. Creating Directed Double-strand Breaks with the Ref Protein: A Novel Rec A-Dependent Nuclease from Bacteriophage P1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gruenig, Marielle C.; Lu, Duo; Won, Sang Joon

    2012-03-16

    The bacteriophage P1-encoded Ref protein enhances RecA-dependent recombination in vivo by an unknown mechanism. We demonstrate that Ref is a new type of enzyme; that is, a RecA-dependent nuclease. Ref binds to ss- and dsDNA but does not cleave any DNA substrate until RecA protein and ATP are added to form RecA nucleoprotein filaments. Ref cleaves only where RecA protein is bound. RecA functions as a co-nuclease in the Ref/RecA system. Ref nuclease activity can be limited to the targeted strands of short RecA-containing D-loops. The result is a uniquely programmable endonuclease activity, producing targeted double-strand breaks at any chosenmore » DNA sequence in an oligonucleotide-directed fashion. We present evidence indicating that cleavage occurs in the RecA filament groove. The structure of the Ref protein has been determined to 1.4 {angstrom} resolution. The core structure, consisting of residues 77-186, consists of a central 2-stranded {beta}-hairpin that is sandwiched between several {alpha}-helical and extended loop elements. The N-terminal 76 amino acid residues are disordered; this flexible region is required for optimal activity. The overall structure of Ref, including several putative active site histidine residues, defines a new subclass of HNH-family nucleases. We propose that enhancement of recombination by Ref reflects the introduction of directed, recombinogenic double-strand breaks.« less

  4. DNA/RNA hybrid substrates modulate the catalytic activity of purified AID.

    PubMed

    Abdouni, Hala S; King, Justin J; Ghorbani, Atefeh; Fifield, Heather; Berghuis, Lesley; Larijani, Mani

    2018-01-01

    Activation-induced cytidine deaminase (AID) converts cytidine to uridine at Immunoglobulin (Ig) loci, initiating somatic hypermutation and class switching of antibodies. In vitro, AID acts on single stranded DNA (ssDNA), but neither double-stranded DNA (dsDNA) oligonucleotides nor RNA, and it is believed that transcription is the in vivo generator of ssDNA targeted by AID. It is also known that the Ig loci, particularly the switch (S) regions targeted by AID are rich in transcription-generated DNA/RNA hybrids. Here, we examined the binding and catalytic behavior of purified AID on DNA/RNA hybrid substrates bearing either random sequences or GC-rich sequences simulating Ig S regions. If substrates were made up of a random sequence, AID preferred substrates composed entirely of DNA over DNA/RNA hybrids. In contrast, if substrates were composed of S region sequences, AID preferred to mutate DNA/RNA hybrids over substrates composed entirely of DNA. Accordingly, AID exhibited a significantly higher affinity for binding DNA/RNA hybrid substrates composed specifically of S region sequences, than any other substrates composed of DNA. Thus, in the absence of any other cellular processes or factors, AID itself favors binding and mutating DNA/RNA hybrids composed of S region sequences. AID:DNA/RNA complex formation and supporting mutational analyses suggest that recognition of DNA/RNA hybrids is an inherent structural property of AID. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. The N-terminal Region of the DNA-dependent Protein Kinase Catalytic Subunit Is Required for Its DNA Double-stranded Break-mediated Activation*

    PubMed Central

    Davis, Anthony J.; Lee, Kyung-Jong; Chen, David J.

    2013-01-01

    DNA-dependent protein kinase (DNA-PK) plays an essential role in the repair of DNA double-stranded breaks (DSBs) mediated by the nonhomologous end-joining pathway. DNA-PK is a holoenzyme consisting of a DNA-binding (Ku70/Ku80) and catalytic (DNA-PKcs) subunit. DNA-PKcs is a serine/threonine protein kinase that is recruited to DSBs via Ku70/80 and is activated once the kinase is bound to the DSB ends. In this study, two large, distinct fragments of DNA-PKcs, consisting of the N terminus (amino acids 1–2713), termed N-PKcs, and the C terminus (amino acids 2714–4128), termed C-PKcs, were produced to determine the role of each terminal region in regulating the activity of DNA-PKcs. N-PKcs but not C-PKcs interacts with the Ku-DNA complex and is required for the ability of DNA-PKcs to localize to DSBs. C-PKcs has increased basal kinase activity compared with DNA-PKcs, suggesting that the N-terminal region of DNA-PKcs keeps basal activity low. The kinase activity of C-PKcs is not stimulated by Ku70/80 and DNA, further supporting that the N-terminal region is required for binding to the Ku-DNA complex and full activation of kinase activity. Collectively, the results show the N-terminal region mediates the interaction between DNA-PKcs and the Ku-DNA complex and is required for its DSB-induced enzymatic activity. PMID:23322783

  6. Flow cytomeric measurement of DNA and incorporated nucleoside analogs

    DOEpatents

    Dolbeare, Frank A.; Gray, Joe W.

    1989-01-01

    A method is provided for simultaneously measuring total cellular DNA and incorporated nucleoside analog. The method entails altering the cellular DNA of cells grown in the presence of a nucleoside analog so that single stranded and double stranded portions are present. Separate stains are used against the two portions. An immunochemical stain is used against the single stranded portion to provide a measure of incorporated nucleoside analog, and a double strand DNA-specific stain is used against the double stranded portion to simultaneously provide a measure of total cellular DNA. The method permits rapid flow cytometric analysis of cell populations, rapid identification of cycling and noncycling subpopulations, and determination of the efficacy of S phase cytotoxic anticancer agents.

  7. Recognition of RNA by amide modified backbone nucleic acids: molecular dynamics simulations of DNA-RNA hybrids in aqueous solution.

    PubMed

    Nina, Mafalda; Fonné-Pfister, Raymonde; Beaudegnies, Renaud; Chekatt, Habiba; Jung, Pierre M J; Murphy-Kessabi, Fiona; De Mesmaeker, Alain; Wendeborn, Sebastian

    2005-04-27

    Thermodynamic and structural properties of a chemically modified DNA-RNA hybrid in which a phosphodiester linkage is replaced by a neutral amide-3 linkage (3'-CH(2)-CONH-5') were investigated using UV melting experiments, molecular dynamics simulations in explicit water, and continuum solvent models. van't Hoff analysis of the experimental UV melting curves suggests that the significant increase of the thermodynamic stability of a 15-mer DNA-RNA with seven alternated amide-3 modifications (+11 degrees C) is mainly due to an increased binding enthalpy. To further evaluate the origin in the observed affinities differences, the electrostatic contribution to the binding free energy was calculated by solving the Poisson-Boltzmann equation numerically. The nonelectrostatic contribution was estimated as the product of a hydrophobic surface tension coefficient and the surface area that is buried upon double strand formation. Structures were taken from 10 ns molecular dynamics simulations computed in a consistent fashion using explicit solvent, counterions, and the particle-mesh Ewald procedure. The present preliminary thermodynamic study suggests that the favorable binding free energy of the amide-3 DNA single strand to the complementary RNA is equally driven by electrostatic and nonpolar contributions to the binding compared to their natural analogues. In addition, molecular dynamics simulations in explicit water were performed on an amide-3 DNA single strand and the corresponding natural DNA. Results from the conformations cluster analysis of the simulated amide-3 DNA single strand ensembles suggest that the 25% of the population sampled within 10 ns has a pre-organized conformation where the sugar C3' endo pucker is favored at the 3'-flanking nucleotides. These structural and thermodynamic features contribute to the understanding of the observed increased affinities of the amide-3 DNA-RNA hybrids at the microscopic level.

  8. Detection of Z DNA binding proteins in tissue culture cells.

    PubMed Central

    Leith, I R; Hay, R T; Russell, W C

    1988-01-01

    A gel electrophoresis DNA binding assay to detect Z DNA binding proteins has been developed utilising [32P] labelled poly [d(G-C)] which was converted to the Z form by incubation in 100 microM Co(NH3)6Cl3. The parameters of the assay were established using a Z DNA antibody as a model system and then applied to extracts of Hela and BHK21 cells. Using an anti-Z DNA antibody conditions were established which allowed resolution of antibody-DNA complexes and free DNA in the presence of 100 microM Co(NH3)6Cl3. The inclusion of unlabelled complementary homopolymers eliminated non-specific binding to the labelled Z-DNA probe. Competition experiments demonstrated that the assay was highly specific for double stranded non-B DNA. Application of the technique to extracts of mammalian cells demonstrated that human and hamster cells contain Z-DNA binding proteins; further characterisation by a blotting technique indicated that a 56,000 molecular weight cell protein preferentially binds Z-DNA. Images PMID:3419919

  9. Surface plasmon resonance imaging reveals multiple binding modes of Agrobacterium transformation mediator VirE2 to ssDNA.

    PubMed

    Kim, Sanghyun; Zbaida, David; Elbaum, Michael; Leh, Hervé; Nogues, Claude; Buckle, Malcolm

    2015-07-27

    VirE2 is the major secreted protein of Agrobacterium tumefaciens in its genetic transformation of plant hosts. It is co-expressed with a small acidic chaperone VirE1, which prevents VirE2 oligomerization. After secretion into the host cell, VirE2 serves functions similar to a viral capsid in protecting the single-stranded transferred DNA en route to the nucleus. Binding of VirE2 to ssDNA is strongly cooperative and depends moreover on protein-protein interactions. In order to isolate the protein-DNA interactions, imaging surface plasmon resonance (SPRi) studies were conducted using surface-immobilized DNA substrates of length comparable to the protein-binding footprint. Binding curves revealed an important influence of substrate rigidity with a notable preference for poly-T sequences and absence of binding to both poly-A and double-stranded DNA fragments. Dissociation at high salt concentration confirmed the electrostatic nature of the interaction. VirE1-VirE2 heterodimers also bound to ssDNA, though by a different mechanism that was insensitive to high salt. Neither VirE2 nor VirE1-VirE2 followed the Langmuir isotherm expected for reversible monomeric binding. The differences reflect the cooperative self-interactions of VirE2 that are suppressed by VirE1. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Distinct requirements within the Msh3 nucleotide binding pocket for mismatch and double-strand break repair.

    PubMed

    Kumar, Charanya; Williams, Gregory M; Havens, Brett; Dinicola, Michelle K; Surtees, Jennifer A

    2013-06-12

    In Saccharomyces cerevisiae, repair of insertion/deletion loops is carried out by Msh2-Msh3-mediated mismatch repair (MMR). Msh2-Msh3 is also required for 3' non-homologous tail removal (3' NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, the kinetics of the two processes appear different; MMR is likely rapid in order to coordinate with the replication fork, whereas 3' NHTR has been shown to be a slower process. To understand the molecular requirements in both repair pathways, we performed an in vivo analysis of well-conserved residues in Msh3 that are hypothesized to be required for MMR and/or 3' NHTR. These residues are predicted to be involved in either communication between the DNA-binding and ATPase domains within the complex or nucleotide binding and/or exchange within Msh2-Msh3. We identified a set of aromatic residues within the FLY motif of the predicted Msh3 nucleotide binding pocket that are essential for Msh2-Msh3-mediated MMR but are largely dispensable for 3' NHTR. In contrast, mutations in other regions gave similar phenotypes in both assays. Based on these results, we suggest that the two pathways have distinct requirements with respect to the position of the bound ATP within Msh3. We propose that the differences are related, at least in part, to the kinetics of each pathway. Proper binding and positioning of ATP is required to induce rapid conformational changes at the replication fork, but is less important when more time is available for repair, as in 3' NHTR. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. Distinct requirements within the Msh3 nucleotide binding pocket for mismatch and double-strand break repair

    PubMed Central

    Kumar, Charanya; Williams, Gregory M.; Havens, Brett; Dinicola, Michelle; Surtees, Jennifer A.

    2013-01-01

    In Saccharomyces cerevisiae, repair of insertion/deletion loops is carried out by Msh2-Msh3-mediated mismatch repair (MMR). Msh2-Msh3 is also required for 3’ non-homologous tail removal (3’NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, the kinetics of the two processes appear different; MMR is likely rapid in order to coordinate with the replication fork, whereas 3’ NHTR has been shown to be a slower process. To understand the molecular requirements in both repair pathways, we performed an in vivo analysis of well conserved residues in Msh3 that are hypothesized to be required for MMR and/or 3’NHTR. These residues are predicted to be involved in either communication between the DNA-binding and ATPase domains within the complex or nucleotide binding and/or exchange within Msh2-Msh3. We identified a set of aromatic residues within the FLY motif of the predicted Msh3 nucleotide binding pocket that are essential for Msh2-Msh3-mediated MMR but are largely dispensable for 3’NHTR. In contrast, mutations in other regions gave similar phenotypes in both assays. Based on these results, we suggest the two pathways have distinct requirements with respect to the position of the bound ATP within Msh3. We propose that the differences are related, at least in part, to the kinetics of each pathway. Proper binding and positioning of ATP is required to induce rapid conformational changes at the replication fork, but is less important when more time is available for repair, as in 3’ NHTR. PMID:23458407

  12. Supramolecular approach to enantioselective DNA recognition using enantiomerically resolved cationic 4-amino-1,8-naphthalimide-based Tröger's bases.

    PubMed

    Banerjee, Swagata; Bright, Sandra A; Smith, Jayden A; Burgeat, Jeremy; Martinez-Calvo, Miguel; Williams, D Clive; Kelly, John M; Gunnlaugsson, Thorfinnur

    2014-10-03

    The synthesis and photophysical studies of two cationic Tröger's base (TB)-derived bis-naphthalimides 1 and 2 and the TB derivative 6, characterized by X-ray crystallography, are presented. The enantiomers of 1 and 2 are separated by cation-exchange chromatography on Sephadex C25 using sodium (-)-dibenzoyl-l-tartarate as the chiral mobile phase. The binding of enantiomers with salmon testes (st)-DNA and synthetic polynucleotides are studied by a variety of spectroscopic methods including UV/vis absorbance, circular dichroism, linear dichroism, and ethidium bromide displacement assays, which demonstrated binding of these compounds to the DNA grooves with very high affinity (K ∼ 10(6) M(-1)) and preferential binding of (-)-enantiomer. In all cases, binding to DNA resulted in a significant stabilization of the double-helical structure of DNA against thermal denaturation. Compound (±)-2 and its enantiomers possessed significantly higher binding affinity for double-stranded DNA compared to 1, possibly due to the presence of the methyl group, which allows favorable hydrophobic and van der Waals interactions with DNA. The TB derivatives exhibited marked preference for AT rich sequences, where the binding affinities follow the order (-)-enantiomer > (±) > (+)-enantiomer. The compounds exhibited significant photocleavage of plasmid DNA upon visible light irradiation and are rapidly internalized into malignant cell lines.

  13. The basic tilted helix bundle domain of the prolyl isomerase FKBP25 is a novel double-stranded RNA binding module

    PubMed Central

    Dilworth, David; Bonnafous, Pierre; Edoo, Amiirah Bibi; Bourbigot, Sarah; Pesek-Jardim, Francy; Gudavicius, Geoff; Serpa, Jason J.; Petrotchenko, Evgeniy V.; Borchers, Christoph H.

    2017-01-01

    Abstract Prolyl isomerases are defined by a catalytic domain that facilitates the cis–trans interconversion of proline residues. In most cases, additional domains in these enzymes add important biological function, including recruitment to a set of protein substrates. Here, we report that the N-terminal basic tilted helix bundle (BTHB) domain of the human prolyl isomerase FKBP25 confers specific binding to double-stranded RNA (dsRNA). This binding is selective over DNA as well as single-stranded oligonucleotides. We find that FKBP25 RNA-association is required for its nucleolar localization and for the vast majority of its protein interactions, including those with 60S pre-ribosome and early ribosome biogenesis factors. An independent mobility of the BTHB and FKBP catalytic domains supports a model by which the N-terminus of FKBP25 is anchored to regions of dsRNA, whereas the FKBP domain is free to interact with neighboring proteins. Apart from the identification of the BTHB as a new dsRNA-binding module, this domain adds to the growing list of auxiliary functions used by prolyl isomerases to define their primary cellular targets. PMID:29036638

  14. [Ru(phen)2DPPZ]2+ is in contact with DNA bases when it forms a luminescent complex with single-stranded oligonucleotides.

    PubMed

    Moon, Seok Joon; Kim, Jong Moon; Choi, Ji Youn; Kim, Seog K; Lee, Je Seung; Jang, Ho G

    2005-05-01

    The luminescence intensity of the Delta- and Lambda-enantiomer of [Ru(phen)2DPPZ]2+ ([Ru(phenanthroline)2 dipyrido[3,2-a:2',3'-c]phenazine]2+) complex enhanced upon binding to double stranded DNA, which has been known as "light switch effect". The enhancement of the luminescence required the intercalation of the large ligand between DNA base pairs. In this study, we report the enhancement in the luminescence intensity when the metal complexes bind to single stranded oligonucleotides, indicating that the "light switch effect" does not require intercalation of the large DPPZ ligand. Oligonucleotides may provide a hydrophobic cavity for the [Ru(phen)2DPPZ]2+ complex to prevent the quenching by the water molecule. In the cavity, the metal complex is in contact with DNA bases as is evidenced by the observation that the excited energy of the DNA bases transfer to the bound metal complex. However, the contact of the metal complex with DNA bases is different from the stacking of DPPZ in the intercalation pocket. In addition to the normal two luminescence lifetimes, a short lifetime in the range of 1-2 ns was found for both the delta- and lambda-enantiomer of [Ru(phen)2DPPZ]2+ when complexed with single stranded oligonucleotides, which may be assigned to the metal complex that is outside of the cavity, interacting with phosphate groups of DNA.

  15. Crystal structure of clustered regularly interspaced short palindromic repeats (CRISPR)-associated Csn2 protein revealed Ca2+-dependent double-stranded DNA binding activity.

    PubMed

    Nam, Ki Hyun; Kurinov, Igor; Ke, Ailong

    2011-09-02

    Clustered regularly interspaced short palindromic repeats (CRISPR) and their associated protein genes (cas genes) are widespread in bacteria and archaea. They form a line of RNA-based immunity to eradicate invading bacteriophages and malicious plasmids. A key molecular event during this process is the acquisition of new spacers into the CRISPR loci to guide the selective degradation of the matching foreign genetic elements. Csn2 is a Nmeni subtype-specific cas gene required for new spacer acquisition. Here we characterize the Enterococcus faecalis Csn2 protein as a double-stranded (ds-) DNA-binding protein and report its 2.7 Å tetrameric ring structure. The inner circle of the Csn2 tetrameric ring is ∼26 Å wide and populated with conserved lysine residues poised for nonspecific interactions with ds-DNA. Each Csn2 protomer contains an α/β domain and an α-helical domain; significant hinge motion was observed between these two domains. Ca(2+) was located at strategic positions in the oligomerization interface. We further showed that removal of Ca(2+) ions altered the oligomerization state of Csn2, which in turn severely decreased its affinity for ds-DNA. In summary, our results provided the first insight into the function of the Csn2 protein in CRISPR adaptation by revealing that it is a ds-DNA-binding protein functioning at the quaternary structure level and regulated by Ca(2+) ions.

  16. Crystal Structure of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated Csn2 Protein Revealed Ca[superscript 2+]-dependent Double-stranded DNA Binding Activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nam, Ki Hyun; Kurinov, Igor; Ke, Ailong

    Clustered regularly interspaced short palindromic repeats (CRISPR) and their associated protein genes (cas genes) are widespread in bacteria and archaea. They form a line of RNA-based immunity to eradicate invading bacteriophages and malicious plasmids. A key molecular event during this process is the acquisition of new spacers into the CRISPR loci to guide the selective degradation of the matching foreign genetic elements. Csn2 is a Nmeni subtype-specific cas gene required for new spacer acquisition. Here we characterize the Enterococcus faecalis Csn2 protein as a double-stranded (ds-) DNA-binding protein and report its 2.7 {angstrom} tetrameric ring structure. The inner circle ofmore » the Csn2 tetrameric ring is {approx}26 {angstrom} wide and populated with conserved lysine residues poised for nonspecific interactions with ds-DNA. Each Csn2 protomer contains an {alpha}/{beta} domain and an {alpha}-helical domain; significant hinge motion was observed between these two domains. Ca{sup 2+} was located at strategic positions in the oligomerization interface. We further showed that removal of Ca{sup 2+} ions altered the oligomerization state of Csn2, which in turn severely decreased its affinity for ds-DNA. In summary, our results provided the first insight into the function of the Csn2 protein in CRISPR adaptation by revealing that it is a ds-DNA-binding protein functioning at the quaternary structure level and regulated by Ca{sup 2+} ions.« less

  17. Detecting the Length of Double-stranded DNA with Solid State Nanopores

    NASA Astrophysics Data System (ADS)

    Li, Jiali; Gershow, Marc; Stein, Derek; Qun, Cai; Brandin, Eric; Wang, Hui; Huang, Albert; Branton, Dan; Golovchenko, Jene

    2003-03-01

    We report on the use of nanometer scale diameter, solid-state nanopores as single molecule detectors of double stranded DNA molecules. These solid-state nanopores are fabricated in thin membranes of silicon nitride, by ion beam sculpting 1. They produce discrete electronic signals: current blockages, when an electrically biased nanopore is exposed to DNA molecules in aqueous salt solutions. We demonstrate examples of such electronic signals for 3k base pairs (bp) and 10k bp double stranded DNA molecules, which suggest that these molecules are individually translocating through the nanopore during the detection process. The translocating time for the 10k bp double stranded DNA is about 3 times longer than the 3k bp, demonstrating that a solid-state nanopore device can be used to detect the lengths of double stranded DNA molecules. Similarities and differences with signals obtained from single stranded DNA in a biological nanopores are discussed 2. 1. Li, J., Stein, D., McMullan, C., Branton, D. Aziz, M. J. and Golovchenko, J. Ion Beam Sculpting at nanometer length scales. Nature 412, 166-169 (2001). 2. Meller, A., L. Nivon, E. Brandin, Golovchenko, J. & Branton, D. Proc. Natl. Acad. Sci. USA 97, 1079-1084 (2000).

  18. Analysis of autoimmune bone marrow by antibody-phage display: somatic mutations and third complementarity-determining region arginines in anti-DNA gamma and kappa V genes.

    PubMed

    Seal, S N; Hoet, R M; Raats, J M; Radic, M Z

    2000-09-01

    To examine anti-double-stranded DNA (anti-dsDNA) IgG autoantibodies from the bone marrow of individuals with systemic lupus erythematosus (SLE). A library of single-chain variable fragments (scFv) was constructed from SLE bone marrow complementary DNA of gamma, kappa, and lambda isotype by cloning into the pHENIX phagemid vector. The library was screened with dsDNA in solution, and 2 anti-DNA phage, DNA1 and DNA4, were isolated and their Ig V genes sequenced. Soluble scFv corresponding to DNA1 and DNA4, and their heavy (H)- and light (L)-chain recombinants, were prepared, purified, and analyzed for binding to DNA by enzyme-linked immunosorbent assay. DNA1 and DNA4 used different Ig H-chain (3-30 and 5-51, respectively) and L-chain (DPK15 and DPK22, respectively) V genes. The ratios of replacement mutations to silent mutations in DNA1 and DNA4 suggest that their V genes were selected for improved antigen binding in vivo. The recombinant between DNA4VH and DNA1VL showed the highest relative affinity for both single-stranded DNA and dsDNA. These 2 Ig subunits contained third complementarity-determining region arginines and had acquired the majority of replacement mutations. Anti-dsDNA IgG autoantibodies from the bone marrow of SLE patients exploit diverse V genes and cationic V-D-J and V-J junctions for DNA binding, and accumulate replacement mutations that enhance binding.

  19. A Graphene-Based Biosensing Platform Based on Regulated Release of an Aptameric DNA Biosensor

    PubMed Central

    Mao, Yu; Chen, Yongli; Li, Song; Lin, Shuo; Jiang, Yuyang

    2015-01-01

    A novel biosensing platform was developed by integrating an aptamer-based DNA biosensor with graphene oxide (GO) for rapid and facile detection of adenosine triphosphate (ATP, as a model target). The DNA biosensor, which is locked by GO, is designed to contain two sensing modules that include recognition site for ATP and self-replication track that yields the nicking domain for Nt.BbvCI. By taking advantage of the different binding affinity of single-stranded DNA, double-stranded DNA and aptamer-target complex toward GO, the DNA biosensor could be efficiently released from GO in the presence of target with the help of a complementary DNA strand (CPDNA) that partially hybridizes to the DNA biosensor. Then, the polymerization/nicking enzyme synergetic isothermal amplification could be triggered, leading to the synthesis of massive DNA amplicons, thus achieving an enhanced sensitivity with a wide linear dynamic response range of four orders of magnitude and good selectivity. This biosensing strategy expands the applications of GO-DNA nanobiointerfaces in biological sensing, showing great potential in fundamental research and biomedical diagnosis. PMID:26569239

  20. A Graphene-Based Biosensing Platform Based on Regulated Release of an Aptameric DNA Biosensor.

    PubMed

    Mao, Yu; Chen, Yongli; Li, Song; Lin, Shuo; Jiang, Yuyang

    2015-11-09

    A novel biosensing platform was developed by integrating an aptamer-based DNA biosensor with graphene oxide (GO) for rapid and facile detection of adenosine triphosphate (ATP, as a model target). The DNA biosensor, which is locked by GO, is designed to contain two sensing modules that include recognition site for ATP and self-replication track that yields the nicking domain for Nt.BbvCI. By taking advantage of the different binding affinity of single-stranded DNA, double-stranded DNA and aptamer-target complex toward GO, the DNA biosensor could be efficiently released from GO in the presence of target with the help of a complementary DNA strand (CPDNA) that partially hybridizes to the DNA biosensor. Then, the polymerization/nicking enzyme synergetic isothermal amplification could be triggered, leading to the synthesis of massive DNA amplicons, thus achieving an enhanced sensitivity with a wide linear dynamic response range of four orders of magnitude and good selectivity. This biosensing strategy expands the applications of GO-DNA nanobiointerfaces in biological sensing, showing great potential in fundamental research and biomedical diagnosis.

  1. The role of solitons on the tunneling magnetoresistance through a double-stranded DNA molecule

    NASA Astrophysics Data System (ADS)

    Ashhadi, M.

    2018-07-01

    We have studied the role of solitons on the spin-dependent transport properties of through a double-stranded DNA (dsDNA) molecule attached to two the semi-infinite ferromagnetic (FM) electrodes. The work is based on a tight-binding Hamiltonian model within the framework of a generalized Green's function technique and relies on the Landauer-Bütikker formalism as the basis for studying the current-voltage characteristic of this system. The conductance properties of the spin system are studied for a ladder model for poly (dG)-poly (dC) DNA molecule. Our calculations indicate that the presence of a homogeneous distribution of the solitons along the molecular, as a sublattice of the correlated solitons, gives rise to significant enhancement in the density of states within the bandgap and large enhancement in conductance and the current-voltage characteristic. It is also shown that tunnel magnetoresistance (TMR) decreases in compared with TMR obtained in the absence of solitons.

  2. Interaction of vasicine with calf thymus DNA: Molecular docking, spectroscopic and differential scanning calorimetric insights

    NASA Astrophysics Data System (ADS)

    R. S., Sai Murali; R. S., Sai Siddhardha; Rajesh Babu, D.; Venketesh, S.; Basavaraju, R.; Nageswara Rao, G.

    2017-06-01

    The present study brings out the interaction between vasicine, an alkaloid and Adhatoda vasica Nees with double stranded DNA. The physico-chemical interaction between small molecules and nucleic acids is a major area of focus in screening drugs against various cancers. Molecular probing in our study using Molecular Operating Environment (MOE) has revealed interaction of vasicine with DNA double helix. Here we report the interaction of vasicine with Calf thymus DNA. We present for the first time the results obtained from UV-visible, fluorescence spectroscopic and differential scanning calorimetric techniques that suggest a moderate to strong electrostatic, hydrophobic and van der Waals interactions mediating the DNA binding properties of vasicine, leading to disruption of DNA secondary structure.

  3. Ataxia telangiectasia mutated (ATM) interacts with p400 ATPase for an efficient DNA damage response.

    PubMed

    Smith, Rebecca J; Savoian, Matthew S; Weber, Lauren E; Park, Jeong Hyeon

    2016-11-04

    Ataxia telangiectasia mutated (ATM) and TRRAP proteins belong to the phosphatidylinositol 3-kinase-related kinase family and are involved in DNA damage repair and chromatin remodeling. ATM is a checkpoint kinase that is recruited to sites of DNA double-strand breaks where it phosphorylates a diverse range of proteins that are part of the chromatin and DNA repair machinery. As an integral subunit of the TRRAP-TIP60 complexes, p400 ATPase is a chromatin remodeler that is also targeted to DNA double-strand break sites. While it is understood that DNA binding transcriptional activators recruit p400 ATPase into a regulatory region of the promoter, how p400 recognises and moves to DNA double-strand break sites is far less clear. Here we investigate a possibility whether ATM serves as a shuttle to deliver p400 to break sites. Our data indicate that p400 co-immunoprecipitates with ATM independently of DNA damage state and that the N-terminal domain of p400 is vital for this interaction. Heterologous expression studies using Sf9 cells revealed that the ATM-p400 complex can be reconstituted without other mammalian bridging proteins. Overexpression of ATM-interacting p400 regions in U2OS cells induced dominant negative effects including the inhibition of both DNA damage repair and cell proliferation. Consistent with the dominant negative effect, the stable expression of an N-terminal p400 fragment showed a decrease in the association of p400 with ATM, but did not alter the association of p400 with TRRAP. Taken together, our findings suggest that a protein-protein interaction between ATM and p400 ATPase occurs independently of DNA damage and contributes to efficient DNA damage response and repair.

  4. RPA Stabilization of Single-Stranded DNA Is Critical for Break-Induced Replication.

    PubMed

    Ruff, Patrick; Donnianni, Roberto A; Glancy, Eleanor; Oh, Julyun; Symington, Lorraine S

    2016-12-20

    DNA double-strand breaks (DSBs) are cytotoxic lesions that must be accurately repaired to maintain genome stability. Replication protein A (RPA) plays an important role in homology-dependent repair of DSBs by protecting the single-stranded DNA (ssDNA) intermediates formed by end resection and by facilitating Rad51 loading. We found that hypomorphic mutants of RFA1 that support intra-chromosomal homologous recombination are profoundly defective for repair processes involving long tracts of DNA synthesis, in particular break-induced replication (BIR). The BIR defects of the rfa1 mutants could be partially suppressed by eliminating the Sgs1-Dna2 resection pathway, suggesting that Dna2 nuclease attacks the ssDNA formed during end resection when not fully protected by RPA. Overexpression of Rad51 was also found to suppress the rfa1 BIR defects. We suggest that Rad51 binding to the ssDNA formed by excessive end resection and during D-loop migration can partially compensate for dysfunctional RPA. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  5. Ssb1 and Ssb2 cooperate to regulate mouse hematopoietic stem and progenitor cells by resolving replicative stress.

    PubMed

    Shi, Wei; Vu, Therese; Boucher, Didier; Biernacka, Anna; Nde, Jules; Pandita, Raj K; Straube, Jasmin; Boyle, Glen M; Al-Ejeh, Fares; Nag, Purba; Jeffery, Jessie; Harris, Janelle L; Bain, Amanda L; Grzelak, Marta; Skrzypczak, Magdalena; Mitra, Abhishek; Dojer, Norbert; Crosetto, Nicola; Cloonan, Nicole; Becherel, Olivier J; Finnie, John; Skaar, Jeffrey R; Walkley, Carl R; Pandita, Tej K; Rowicka, Maga; Ginalski, Krzysztof; Lane, Steven W; Khanna, Kum Kum

    2017-05-04

    Hematopoietic stem and progenitor cells (HSPCs) are vulnerable to endogenous damage and defects in DNA repair can limit their function. The 2 single-stranded DNA (ssDNA) binding proteins SSB1 and SSB2 are crucial regulators of the DNA damage response; however, their overlapping roles during normal physiology are incompletely understood. We generated mice in which both Ssb1 and Ssb2 were constitutively or conditionally deleted. Constitutive Ssb1/Ssb2 double knockout (DKO) caused early embryonic lethality, whereas conditional Ssb1/Ssb2 double knockout (cDKO) in adult mice resulted in acute lethality due to bone marrow failure and intestinal atrophy featuring stem and progenitor cell depletion, a phenotype unexpected from the previously reported single knockout models of Ssb1 or Ssb2 Mechanistically, cDKO HSPCs showed altered replication fork dynamics, massive accumulation of DNA damage, genome-wide double-strand breaks enriched at Ssb-binding regions and CpG islands, together with the accumulation of R -loops and cytosolic ssDNA. Transcriptional profiling of cDKO HSPCs revealed the activation of p53 and interferon (IFN) pathways, which enforced cell cycling in quiescent HSPCs, resulting in their apoptotic death. The rapid cell death phenotype was reproducible in in vitro cultured cDKO-hematopoietic stem cells, which were significantly rescued by nucleotide supplementation or after depletion of p53. Collectively, Ssb1 and Ssb2 control crucial aspects of HSPC function, including proliferation and survival in vivo by resolving replicative stress to maintain genomic stability. © 2017 by The American Society of Hematology.

  6. Ssb1 and Ssb2 cooperate to regulate mouse hematopoietic stem and progenitor cells by resolving replicative stress

    PubMed Central

    Vu, Therese; Boucher, Didier; Biernacka, Anna; Nde, Jules; Pandita, Raj K.; Straube, Jasmin; Boyle, Glen M.; Al-Ejeh, Fares; Jeffery, Jessie; Harris, Janelle L.; Bain, Amanda L.; Grzelak, Marta; Skrzypczak, Magdalena; Mitra, Abhishek; Dojer, Norbert; Crosetto, Nicola; Cloonan, Nicole; Becherel, Olivier J.; Finnie, John; Skaar, Jeffrey R.; Walkley, Carl R.; Pandita, Tej K.; Rowicka, Maga; Ginalski, Krzysztof

    2017-01-01

    Hematopoietic stem and progenitor cells (HSPCs) are vulnerable to endogenous damage and defects in DNA repair can limit their function. The 2 single-stranded DNA (ssDNA) binding proteins SSB1 and SSB2 are crucial regulators of the DNA damage response; however, their overlapping roles during normal physiology are incompletely understood. We generated mice in which both Ssb1 and Ssb2 were constitutively or conditionally deleted. Constitutive Ssb1/Ssb2 double knockout (DKO) caused early embryonic lethality, whereas conditional Ssb1/Ssb2 double knockout (cDKO) in adult mice resulted in acute lethality due to bone marrow failure and intestinal atrophy featuring stem and progenitor cell depletion, a phenotype unexpected from the previously reported single knockout models of Ssb1 or Ssb2. Mechanistically, cDKO HSPCs showed altered replication fork dynamics, massive accumulation of DNA damage, genome-wide double-strand breaks enriched at Ssb-binding regions and CpG islands, together with the accumulation of R-loops and cytosolic ssDNA. Transcriptional profiling of cDKO HSPCs revealed the activation of p53 and interferon (IFN) pathways, which enforced cell cycling in quiescent HSPCs, resulting in their apoptotic death. The rapid cell death phenotype was reproducible in in vitro cultured cDKO-hematopoietic stem cells, which were significantly rescued by nucleotide supplementation or after depletion of p53. Collectively, Ssb1 and Ssb2 control crucial aspects of HSPC function, including proliferation and survival in vivo by resolving replicative stress to maintain genomic stability. PMID:28270450

  7. Ligand induced stabilization of the melting temperature of the HSV-1 single-strand DNA binding protein using the thermal shift assay.

    PubMed

    Rupesh, Kanchi Ravi; Smith, Aaron; Boehmer, Paul E

    2014-11-28

    We have adapted the thermal shift assay to measure the ligand binding properties of the herpes simplex virus-1 single-strand DNA binding protein, ICP8. By measuring SYPRO Orange fluorescence in microtiter plates using a fluorescence-enabled thermal cycler, we have quantified the effects of oligonucleotide ligands on the melting temperature of ICP8. We found that single-stranded oligomers raise the melting temperature of ICP8 in a length- and concentration-dependent manner, ranging from 1°C for (dT)5 to a maximum of 9°C with oligomers ⩾10 nucleotides, with an apparent Kd of <1μM for (dT)20. Specifically, the results indicate that ICP8 is capable of interacting with oligomers as short as 5 nucleotides. Moreover, the observed increases in melting temperature of up to 9°C, indicates that single-strand DNA binding significantly stabilizes the structure of ICP8. This assay may be applied to investigate the ligand binding proteins of other single-strand DNA binding proteins and used as a high-throughput screen to identify compounds with therapeutic potential that inhibit single-strand DNA binding. As proof of concept, the single-strand DNA binding agent ciprofloxacin reduces the ligand induced stabilization of the melting temperature of ICP8 in a dose-dependent manner. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Cisplatin enhances the formation of DNA single- and double-strand breaks by hydrated electrons and hydroxyl radicals.

    PubMed

    Rezaee, Mohammad; Sanche, Léon; Hunting, Darel J

    2013-03-01

    The synergistic interaction of cisplatin with ionizing radiation is the clinical rationale for the treatment of several cancers including head and neck, cervical and lung cancer. The underlying molecular mechanism of the synergy has not yet been identified, although both DNA damage and repair processes are likely involved. Here, we investigate the indirect effect of γ rays on strand break formation in a supercoiled plasmid DNA (pGEM-3Zf-) covalently modified by cisplatin. The yields of single- and double-strand breaks were determined by irradiation of DNA and cisplatin/DNA samples with (60)Co γ rays under four different scavenging conditions to examine the involvement of hydrated electrons and hydroxyl radicals in inducing the DNA damage. At 5 mM tris in an N2 atmosphere, the presence of an average of two cisplatins per plasmid increased the yields of single- and double-strand breaks by factors of 1.9 and 2.2, respectively, relative to the irradiated unmodified DNA samples. Given that each plasmid of 3,200 base pairs contained an average of two cisplatins, this represents an increase in radiosensitivity of 3,200-fold on a per base pair basis. When hydrated electrons were scavenged by saturating the samples with N2O, these enhancement factors decreased to 1.5 and 1.2, respectively, for single- and double-strand breaks. When hydroxyl radicals were scavenged using 200 mM tris, the respective enhancement factors were 1.2 and 1.6 for single- and double-strand breaks, respectively. Furthermore, no enhancement in DNA damage by cisplatin was observed after scavenging both hydroxyl radicals and hydrated electrons. These findings show that hydrated electrons can induce both single- and double-strand breaks in the platinated DNA, but not in unmodified DNA. In addition, cisplatin modification is clearly an extremely efficient means of increasing the formation of both single- and double-strand breaks by the hydrated electrons and hydroxyl radicals created by ionizing radiation.

  9. The N-Terminal Domain of Human DNA Helicase Rtel1 Contains a Redox Active Iron-Sulfur Cluster

    PubMed Central

    Landry, Aaron P.

    2014-01-01

    Human telomere length regulator Rtel1 is a superfamily II DNA helicase and is essential for maintaining proper length of telomeres in chromosomes. Here we report that the N-terminal domain of human Rtel1 (RtelN) expressed in Escherichia coli cells produces a protein that contains a redox active iron-sulfur cluster with the redox midpoint potential of −248 ± 10 mV (pH 8.0). The iron-sulfur cluster in RtelN is sensitive to hydrogen peroxide and nitric oxide, indicating that reactive oxygen/nitrogen species may modulate the DNA helicase activity of Rtel1 via modification of its iron-sulfur cluster. Purified RtelN retains a weak binding affinity for the single-stranded (ss) and double-stranded (ds) DNA in vitro. However, modification of the iron-sulfur cluster by hydrogen peroxide or nitric oxide does not significantly affect the DNA binding activity of RtelN, suggesting that the iron-sulfur cluster is not directly involved in the DNA interaction in the N-terminal domain of Rtel1. PMID:25147792

  10. The N-terminal domain of human DNA helicase Rtel1 contains a redox active iron-sulfur cluster.

    PubMed

    Landry, Aaron P; Ding, Huangen

    2014-01-01

    Human telomere length regulator Rtel1 is a superfamily II DNA helicase and is essential for maintaining proper length of telomeres in chromosomes. Here we report that the N-terminal domain of human Rtel1 (RtelN) expressed in Escherichia coli cells produces a protein that contains a redox active iron-sulfur cluster with the redox midpoint potential of -248 ± 10 mV (pH 8.0). The iron-sulfur cluster in RtelN is sensitive to hydrogen peroxide and nitric oxide, indicating that reactive oxygen/nitrogen species may modulate the DNA helicase activity of Rtel1 via modification of its iron-sulfur cluster. Purified RtelN retains a weak binding affinity for the single-stranded (ss) and double-stranded (ds) DNA in vitro. However, modification of the iron-sulfur cluster by hydrogen peroxide or nitric oxide does not significantly affect the DNA binding activity of RtelN, suggesting that the iron-sulfur cluster is not directly involved in the DNA interaction in the N-terminal domain of Rtel1.

  11. Identification and analysis of recombineering functions from Gram-negative and Gram-positive bacteria and their phages

    PubMed Central

    Datta, Simanti; Costantino, Nina; Zhou, Xiaomei; Court, Donald L.

    2008-01-01

    We report the identification and functional analysis of nine genes from Gram-positive and Gram-negative bacteria and their phages that are similar to lambda (λ) bet or Escherichia coli recT. Beta and RecT are single-strand DNA annealing proteins, referred to here as recombinases. Each of the nine other genes when expressed in E. coli carries out oligonucleotide-mediated recombination. To our knowledge, this is the first study showing single-strand recombinase activity from diverse bacteria. Similar to bet and recT, most of these other recombinases were found to be associated with putative exonuclease genes. Beta and RecT in conjunction with their cognate exonucleases carry out recombination of linear double-strand DNA. Among four of these foreign recombinase/exonuclease pairs tested for recombination with double-strand DNA, three had activity, albeit barely detectable. Thus, although these recombinases can function in E. coli to catalyze oligonucleotide recombination, the double-strand DNA recombination activities with their exonuclease partners were inefficient. This study also demonstrated that Gam, by inhibiting host RecBCD nuclease activity, helps to improve the efficiency of λ Red-mediated recombination with linear double-strand DNA, but Gam is not absolutely essential. Thus, in other bacterial species where Gam analogs have not been identified, double-strand DNA recombination may still work in the absence of a Gam-like function. We anticipate that at least some of the recombineering systems studied here will potentiate oligonucleotide and double-strand DNA-mediated recombineering in their native or related bacteria. PMID:18230724

  12. Dynamics and Regulation of RecA Polymerization and De-Polymerization on Double-Stranded DNA

    PubMed Central

    Muniyappa, Kalappa; Yan, Jie

    2013-01-01

    The RecA filament formed on double-stranded (ds) DNA is proposed to be a functional state analogous to that generated during the process of DNA strand exchange. RecA polymerization and de-polymerization on dsDNA is governed by multiple physiological factors. However, a comprehensive understanding of how these factors regulate the processes of polymerization and de-polymerization of RecA filament on dsDNA is still evolving. Here, we investigate the effects of temperature, pH, tensile force, and DNA ends (in particular ssDNA overhang) on the polymerization and de-polymerization dynamics of the E. coli RecA filament at a single-molecule level. Our results identified the optimal conditions that permitted spontaneous RecA nucleation and polymerization, as well as conditions that could maintain the stability of a preformed RecA filament. Further examination at a nano-meter spatial resolution, by stretching short DNA constructs, revealed a striking dynamic RecA polymerization and de-polymerization induced saw-tooth pattern in DNA extension fluctuation. In addition, we show that RecA does not polymerize on S-DNA, a recently identified novel base-paired elongated DNA structure that was previously proposed to be a possible binding substrate for RecA. Overall, our studies have helped to resolve several previous single-molecule studies that reported contradictory and inconsistent results on RecA nucleation, polymerization and stability. Furthermore, our findings also provide insights into the regulatory mechanisms of RecA filament formation and stability in vivo. PMID:23825559

  13. RNA-dependent RNA targeting by CRISPR-Cas9

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strutt, Steven C.; Torrez, Rachel M.; Kaya, Emine

    Double-stranded DNA (dsDNA) binding and cleavage by Cas9 is a hallmark of type II CRISPR-Cas bacterial adaptive immunity. All known Cas9 enzymes are thought to recognize DNA exclusively as a natural substrate, providing protection against DNA phage and plasmids. Here, we show that Cas9 enzymes from both subtypes II-A and II-C can recognize and cleave single-stranded RNA (ssRNA) by an RNA-guided mechanism that is independent of a protospacer-adjacent motif (PAM) sequence in the target RNA. RNA-guided RNA cleavage is programmable and site-specific, and we find that this activity can be exploited to reduce infection by single-stranded RNA phage in vivo.more » We also demonstrate that Cas9 can direct PAM-independent repression of gene expression in bacteria. In conclusion, these results indicate that a subset of Cas9 enzymes have the ability to act on both DNA and RNA target sequences, and suggest the potential for use in programmable RNA targeting applications.« less

  14. RNA-dependent RNA targeting by CRISPR-Cas9

    DOE PAGES

    Strutt, Steven C.; Torrez, Rachel M.; Kaya, Emine; ...

    2018-01-05

    Double-stranded DNA (dsDNA) binding and cleavage by Cas9 is a hallmark of type II CRISPR-Cas bacterial adaptive immunity. All known Cas9 enzymes are thought to recognize DNA exclusively as a natural substrate, providing protection against DNA phage and plasmids. Here, we show that Cas9 enzymes from both subtypes II-A and II-C can recognize and cleave single-stranded RNA (ssRNA) by an RNA-guided mechanism that is independent of a protospacer-adjacent motif (PAM) sequence in the target RNA. RNA-guided RNA cleavage is programmable and site-specific, and we find that this activity can be exploited to reduce infection by single-stranded RNA phage in vivo.more » We also demonstrate that Cas9 can direct PAM-independent repression of gene expression in bacteria. In conclusion, these results indicate that a subset of Cas9 enzymes have the ability to act on both DNA and RNA target sequences, and suggest the potential for use in programmable RNA targeting applications.« less

  15. RNA-dependent RNA targeting by CRISPR-Cas9

    PubMed Central

    Strutt, Steven C; Torrez, Rachel M; Kaya, Emine; Negrete, Oscar A

    2018-01-01

    Double-stranded DNA (dsDNA) binding and cleavage by Cas9 is a hallmark of type II CRISPR-Cas bacterial adaptive immunity. All known Cas9 enzymes are thought to recognize DNA exclusively as a natural substrate, providing protection against DNA phage and plasmids. Here, we show that Cas9 enzymes from both subtypes II-A and II-C can recognize and cleave single-stranded RNA (ssRNA) by an RNA-guided mechanism that is independent of a protospacer-adjacent motif (PAM) sequence in the target RNA. RNA-guided RNA cleavage is programmable and site-specific, and we find that this activity can be exploited to reduce infection by single-stranded RNA phage in vivo. We also demonstrate that Cas9 can direct PAM-independent repression of gene expression in bacteria. These results indicate that a subset of Cas9 enzymes have the ability to act on both DNA and RNA target sequences, and suggest the potential for use in programmable RNA targeting applications. PMID:29303478

  16. [DNA structure from A to Z--biological implications of structural diversity of DNA].

    PubMed

    Bukowiecka-Matusiak, Małgorzata; Woźniak, Lucyna A

    2006-01-01

    Deoxyribonucleic acid (DNA) is a biopolymer of nucleotides, usually adopting a double-stranded helical form in cells, with complementary base pairing holding the two strands together. The most stable is B-DNA conformation, although numerous other double helical structures can occur under specific conditions (A-DNA, Z-DNA, P-DNA). The existence of multiple-stranded (triplex, tetraplex) forms in vivo and their biological function in cells are subject of intensive studies.

  17. Members of the RAD52 Epistasis Group Contribute to Mitochondrial Homologous Recombination and Double-Strand Break Repair in Saccharomyces cerevisiae.

    PubMed

    Stein, Alexis; Kalifa, Lidza; Sia, Elaine A

    2015-11-01

    Mitochondria contain an independently maintained genome that encodes several proteins required for cellular respiration. Deletions in the mitochondrial genome have been identified that cause several maternally inherited diseases and are associated with certain cancers and neurological disorders. The majority of these deletions in human cells are flanked by short, repetitive sequences, suggesting that these deletions may result from recombination events. Our current understanding of the maintenance and repair of mtDNA is quite limited compared to our understanding of similar events in the nucleus. Many nuclear DNA repair proteins are now known to also localize to mitochondria, but their function and the mechanism of their action remain largely unknown. This study investigated the contribution of the nuclear double-strand break repair (DSBR) proteins Rad51p, Rad52p and Rad59p in mtDNA repair. We have determined that both Rad51p and Rad59p are localized to the matrix of the mitochondria and that Rad51p binds directly to mitochondrial DNA. In addition, a mitochondrially-targeted restriction endonuclease (mtLS-KpnI) was used to produce a unique double-strand break (DSB) in the mitochondrial genome, which allowed direct analysis of DSB repair in vivo in Saccharomyces cerevisiae. We find that loss of these three proteins significantly decreases the rate of spontaneous deletion events and the loss of Rad51p and Rad59p impairs the repair of induced mtDNA DSBs.

  18. Members of the RAD52 Epistasis Group Contribute to Mitochondrial Homologous Recombination and Double-Strand Break Repair in Saccharomyces cerevisiae

    PubMed Central

    Stein, Alexis; Kalifa, Lidza; Sia, Elaine A.

    2015-01-01

    Mitochondria contain an independently maintained genome that encodes several proteins required for cellular respiration. Deletions in the mitochondrial genome have been identified that cause several maternally inherited diseases and are associated with certain cancers and neurological disorders. The majority of these deletions in human cells are flanked by short, repetitive sequences, suggesting that these deletions may result from recombination events. Our current understanding of the maintenance and repair of mtDNA is quite limited compared to our understanding of similar events in the nucleus. Many nuclear DNA repair proteins are now known to also localize to mitochondria, but their function and the mechanism of their action remain largely unknown. This study investigated the contribution of the nuclear double-strand break repair (DSBR) proteins Rad51p, Rad52p and Rad59p in mtDNA repair. We have determined that both Rad51p and Rad59p are localized to the matrix of the mitochondria and that Rad51p binds directly to mitochondrial DNA. In addition, a mitochondrially-targeted restriction endonuclease (mtLS-KpnI) was used to produce a unique double-strand break (DSB) in the mitochondrial genome, which allowed direct analysis of DSB repair in vivo in Saccharomyces cerevisiae. We find that loss of these three proteins significantly decreases the rate of spontaneous deletion events and the loss of Rad51p and Rad59p impairs the repair of induced mtDNA DSBs. PMID:26540255

  19. Understanding the Effect of Carbonate Ion on Cisplatin Binding to DNA

    PubMed Central

    Todd, Ryan C.; Lovejoy, Katherine S.; Lippard, Stephen J.

    2008-01-01

    The role of carbonate in the binding of cis-diamminedichloroplatinum(II) to DNA was investigated in order to understand the potential involvement of carbonato-cisplatin species in the mechanism of action of platinum anticancer agents. Cisplatin was allowed to react with both double- and single-stranded DNA in carbonate, phosphate, and HEPES buffers, and the products were analyzed by agarose gel electrophoresis and enzymatic digestion/mass spectrometry, respectively. The data from these experiments demonstrate (1) that carbonate, like other biological nucleophiles, forms relatively inert complexes with platinum that inactivate cisplatin, and (2) that the major cisplatin-DNA adduct formed is a bifunctional cross-link. These results are in accord with previous studies of cisplatin-DNA binding and reveal that the presence of carbonate has no consequence on the nature of the resulting adducts. PMID:17465550

  20. Structural basis of the 3′-end recognition of a leading strand in stalled replication forks by PriA

    PubMed Central

    Sasaki, Kaori; Ose, Toyoyuki; Okamoto, Naoaki; Maenaka, Katsumi; Tanaka, Taku; Masai, Hisao; Saito, Mihoko; Shirai, Tsuyoshi; Kohda, Daisuke

    2007-01-01

    In eubacteria, PriA helicase detects the stalled DNA replication forks. This critical role of PriA is ascribed to its ability to bind to the 3′ end of a nascent leading DNA strand in the stalled replication forks. The crystal structures in complexes with oligonucleotides and the combination of fluorescence correlation spectroscopy and mutagenesis reveal that the N-terminal domain of PriA possesses a binding pocket for the 3′-terminal nucleotide residue of DNA. The interaction with the deoxyribose 3′-OH is essential for the 3′-terminal recognition. In contrast, the direct interaction with 3′-end nucleobase is unexpected, considering the same affinity for oligonucleotides carrying the four bases at the 3′ end. Thus, the N-terminal domain of PriA recognizes the 3′-end base in a base-non-selective manner, in addition to the deoxyribose and 5′-side phosphodiester group, of the 3′-terminal nucleotide to acquire both sufficient affinity and non-selectivity to find all of the stalled replication forks generated during DNA duplication. This unique feature is prerequisite for the proper positioning of the helicase domain of PriA on the unreplicated double-stranded DNA. PMID:17464287

  1. Phenolic promiscuity in the cell nucleus--epigallocatechingallate (EGCG) and theaflavin-3,3'-digallate from green and black tea bind to model cell nuclear structures including histone proteins, double stranded DNA and telomeric quadruplex DNA.

    PubMed

    Mikutis, Gediminas; Karaköse, Hande; Jaiswal, Rakesh; LeGresley, Adam; Islam, Tuhidul; Fernandez-Lahore, Marcelo; Kuhnert, Nikolai

    2013-02-01

    Flavanols from tea have been reported to accumulate in the cell nucleus in considerable concentrations. The nature of this phenomenon, which could provide novel approaches in understanding the well-known beneficial health effects of tea phenols, is investigated in this contribution. The interaction between epigallocatechin gallate (EGCG) from green tea and a selection of theaflavins from black tea with selected cell nuclear structures such as model histone proteins, double stranded DNA and quadruplex DNA was investigated using mass spectrometry, Circular Dichroism spectroscopy and fluorescent assays. The selected polyphenols were shown to display affinity to all of the selected cell nuclear structures, thereby demonstrating a degree of unexpected molecular promiscuity. Most interestingly theaflavin-digallate was shown to display the highest affinity to quadruplex DNA reported for any naturally occurring molecule reported so far. This finding has immediate implications in rationalising the chemopreventive effect of the tea beverage against cancer and possibly the role of tea phenolics as "life span essentials".

  2. Discovery of DNA repair inhibitors by combinatorial library profiling

    PubMed Central

    Moeller, Benjamin J.; Sidman, Richard L.; Pasqualini, Renata; Arap, Wadih

    2011-01-01

    Small molecule inhibitors of DNA repair are emerging as potent and selective anti-cancer therapies, but the sheer magnitude of the protein networks involved in DNA repair processes poses obstacles to discovery of effective candidate drugs. To address this challenge, we used a subtractive combinatorial selection approach to identify a panel of peptide ligands that bind DNA repair complexes. Supporting the concept that these ligands have therapeutic potential, we show that one selected peptide specifically binds and non-competitively inactivates DNA-PKcs, a protein kinase critical in double-strand DNA break repair. In doing so, this ligand sensitizes BRCA-deficient tumor cells to genotoxic therapy. Our findings establish a platform for large-scale parallel screening for ligand-directed DNA repair inhibitors, with immediate applicability to cancer therapy. PMID:21343400

  3. Interplay between Ku and Replication Protein A in the Restriction of Exo1-mediated DNA Break End Resection*

    PubMed Central

    Krasner, Danielle S.; Daley, James M.; Sung, Patrick; Niu, Hengyao

    2015-01-01

    DNA double-strand breaks can be eliminated via non-homologous end joining or homologous recombination. Non-homologous end joining is initiated by the association of Ku with DNA ends. In contrast, homologous recombination entails nucleolytic resection of the 5′-strands, forming 3′-ssDNA tails that become coated with replication protein A (RPA). Ku restricts end access by the resection nuclease Exo1. It is unclear how partial resection might affect Ku engagement and Exo1 restriction. Here, we addressed these questions in a reconstituted system with yeast proteins. With blunt-ended DNA, Ku protected against Exo1 in a manner that required its DNA end-binding activity. Despite binding poorly to ssDNA, Ku could nonetheless engage a 5′-recessed DNA end with a 40-nucleotide (nt) ssDNA overhang, where it localized to the ssDNA-dsDNA junction and efficiently blocked resection by Exo1. Interestingly, RPA could exclude Ku from a partially resected structure with a 22-nt ssDNA tail and thus restored processing by Exo1. However, at a 40-nt tail, Ku remained stably associated at the ssDNA-dsDNA junction, and RPA simultaneously engaged the ssDNA region. We discuss a model in which the dynamic equilibrium between Ku and RPA binding to a partially resected DNA end influences the timing and efficiency of the resection process. PMID:26067273

  4. Interaction of small molecules with double-stranded RNA: spectroscopic, viscometric, and calorimetric study of hoechst and proflavine binding to PolyCG structures.

    PubMed

    Sinha, Rangana; Hossain, Maidul; Kumar, Gopinatha Suresh

    2009-04-01

    Design and synthesis of new small molecules binding to double-stranded RNA necessitate complete understanding of the molecular aspects of the binding of many existing molecules. Toward this goal, in this work we evaluated the biophysical aspects of the interaction of a DNA intercalator (proflavine) and a minor groove binder (hoechst 33258) with two polymorphic forms of polyCG, namely, the right-handed Watson-Crick base paired A-form and the left-handed Hoogsteen base paired H(L)-form, by absorption, fluorescence, and viscometry experiments. The energetics of the interaction of these molecules with the RNA structures has also been elucidated by isothermal titration calorimetry (ITC). Results suggest that proflavine strongly intercalates in both forms of polyCG, whereas hoechst shows mainly groove-binding modes. The binding of both drugs to both forms of RNA resulted in significant conformational change to the RNA structure with the bound molecules being placed in the chiral RNA helix. ITC profiles for both proflavine and hoechst show two binding sites. Binding of proflavine to both forms of RNA is endothermic and entropy driven in the first site and exothermic and enthalpy driven in the second site, whereas hoechst binding to both forms of RNA is exothermic and enthalpy driven in the first site and endothermic and entropy driven in the second site. This study suggests that the binding affinity characteristics and energetics of interaction of these DNA binding molecules with the RNA conformations are significantly different and may serve as data for future development of effective structure-selective RNA-based drugs.

  5. Folate deficiency facilitates recruitment of upstream binding factor to hot spots of DNA double-strand breaks of rRNA genes and promotes its transcription.

    PubMed

    Xie, Qiu; Li, Caihua; Song, Xiaozhen; Wu, Lihua; Jiang, Qian; Qiu, Zhiyong; Cao, Haiyan; Yu, Kaihui; Wan, Chunlei; Li, Jianting; Yang, Feng; Huang, Zebing; Niu, Bo; Jiang, Zhengwen; Zhang, Ting

    2017-03-17

    The biogenesis of ribosomes in vivo is an essential process for cellular functions. Transcription of ribosomal RNA (rRNA) genes is the rate-limiting step in ribosome biogenesis controlled by environmental conditions. Here, we investigated the role of folate antagonist on changes of DNA double-strand breaks (DSBs) landscape in mouse embryonic stem cells. A significant DSB enhancement was detected in the genome of these cells and a large majority of these DSBs were found in rRNA genes. Furthermore, spontaneous DSBs in cells under folate deficiency conditions were located exclusively within the rRNA gene units, representing a H3K4me1 hallmark. Enrichment H3K4me1 at the hot spots of DSB regions enhanced the recruitment of upstream binding factor (UBF) to rRNA genes, resulting in the increment of rRNA genes transcription. Supplement of folate resulted in a restored UBF binding across DNA breakage sites of rRNA genes, and normal rRNA gene transcription. In samples from neural tube defects (NTDs) with low folate level, up-regulation of rRNA gene transcription was observed, along with aberrant UBF level. Our results present a new view by which alterations in folate levels affects DNA breakage through epigenetic control leading to the regulation of rRNA gene transcription during the early stage of development. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Chromosome demise in the wake of ligase-deficient replication.

    PubMed

    Kouzminova, Elena A; Kuzminov, Andrei

    2012-06-01

    Bacterial DNA ligases, NAD⁺-dependent enzymes, are distinct from eukaryotic ATP-dependent ligases, representing promising targets for broad-spectrum antimicrobials. Yet, the chromosomal consequences of ligase-deficient DNA replication, during which Okazaki fragments accumulate, are still unclear. Using ligA251(Ts), the strongest ligase mutant of Escherichia coli, we studied ligase-deficient DNA replication by genetic and physical approaches. Here we show that replication without ligase kills after a short resistance period. We found that double-strand break repair via RecA, RecBCD, RuvABC and RecG explains the transient resistance, whereas irreparable chromosomal fragmentation explains subsequent cell death. Remarkably, death is mostly prevented by elimination of linear DNA degradation activity of ExoV, suggesting that non-allelic double-strand breaks behind replication forks precipitate DNA degradation that enlarge them into allelic double-strand gaps. Marker frequency profiling of synchronized replication reveals stalling of ligase-deficient forks with subsequent degradation of the DNA synthesized without ligase. The mechanism that converts unsealed nicks behind replication forks first into repairable double-strand breaks and then into irreparable double-strand gaps may be behind lethality of any DNA damaging treatment. © 2012 Blackwell Publishing Ltd.

  7. The natural absence of RPA1N domain did not impair Leishmania amazonensis RPA-1 participation in DNA damage response and telomere protection.

    PubMed

    Da Silveira, Rita De Cássia Viveiros; Da Silva, Marcelo Santos; Nunes, Vinícius Santana; Perez, Arina Marina; Cano, Maria Isabel Nogueira

    2013-04-01

    We have previously shown that the subunit 1 of Leishmania amazonensis RPA (LaRPA-1) alone binds the G-rich telomeric strand and is structurally different from other RPA-1. It is analogous to telomere end-binding proteins described in model eukaryotes whose homologues were not identified in the protozoan´s genome. Here we show that LaRPA-1 is involved with damage response and telomere protection although it lacks the RPA1N domain involved with the binding with multiple checkpoint proteins. We induced DNA double-strand breaks (DSBs) in Leishmania using phleomycin. Damage was confirmed by TUNEL-positive nuclei and triggered a G1/S cell cycle arrest that was accompanied by nuclear accumulation of LaRPA-1 and RAD51 in the S phase of hydroxyurea-synchronized parasites. DSBs also increased the levels of RAD51 in non-synchronized parasites and of LaRPA-1 and RAD51 in the S phase of synchronized cells. More LaRPA-1 appeared immunoprecipitating telomeres in vivo and associated in a complex containing RAD51, although this interaction needs more investigation. RAD51 apparently co-localized with few telomeric clusters but it did not immunoprecipitate telomeric DNA. These findings suggest that LaRPA-1 and RAD51 work together in response to DNA DSBs and at telomeres, upon damage, LaRPA-1 works probably to prevent loss of single-stranded DNA and to assume a capping function.

  8. Construction of a microfluidic chip, using dried-down reagents, for LATE-PCR amplification and detection of single-stranded DNA.

    PubMed

    Jia, Yanwei; Mak, Pui-In; Massey, Conner; Martins, Rui P; Wangh, Lawrence J

    2013-12-07

    LATE-PCR is an advanced form of non-symmetric PCR that efficiently generates single-stranded DNA which can readily be characterized at the end of amplification by hybridization to low-temperature fluorescent probes. We demonstrate here for the first time that monoplex and duplex LATE-PCR amplification and probe target hybridization can be carried out in double layered PDMS microfluidics chips containing dried reagents. Addition of a set of reagents during dry down overcomes the common problem of single-stranded oligonucleotide binding to PDMS. These proof-of-principle results open the way to construction of inexpensive point-of-care devices that take full advantage of the analytical power of assays built using LATE-PCR and low-temperature probes.

  9. Interaction of vasicine with calf thymus DNA: Molecular docking, spectroscopic and differential scanning calorimetric insights.

    PubMed

    R S, Sai Murali; R S, Sai Siddhardha; D, Rajesh Babu; S, Venketesh; R, Basavaraju; G, Nageswara Rao

    2017-06-05

    The present study brings out the interaction between vasicine, an alkaloid and Adhatoda vasica Nees with double stranded DNA. The physico-chemical interaction between small molecules and nucleic acids is a major area of focus in screening drugs against various cancers. Molecular probing in our study using Molecular Operating Environment (MOE) has revealed interaction of vasicine with DNA double helix. Here we report the interaction of vasicine with Calf thymus DNA. We present for the first time the results obtained from UV-visible, fluorescence spectroscopic and differential scanning calorimetric techniques that suggest a moderate to strong electrostatic, hydrophobic and van der Waals interactions mediating the DNA binding properties of vasicine, leading to disruption of DNA secondary structure. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Reversed-phase ion-pair liquid chromatography method for purification of duplex DNA with single base pair resolution

    PubMed Central

    Wysoczynski, Christina L.; Roemer, Sarah C.; Dostal, Vishantie; Barkley, Robert M.; Churchill, Mair E. A.; Malarkey, Christopher S.

    2013-01-01

    Obtaining quantities of highly pure duplex DNA is a bottleneck in the biophysical analysis of protein–DNA complexes. In traditional DNA purification methods, the individual cognate DNA strands are purified separately before annealing to form DNA duplexes. This approach works well for palindromic sequences, in which top and bottom strands are identical and duplex formation is typically complete. However, in cases where the DNA is non-palindromic, excess of single-stranded DNA must be removed through additional purification steps to prevent it from interfering in further experiments. Here we describe and apply a novel reversed-phase ion-pair liquid chromatography purification method for double-stranded DNA ranging in lengths from 17 to 51 bp. Both palindromic and non-palindromic DNA can be readily purified. This method has the unique ability to separate blunt double-stranded DNA from pre-attenuated (n-1, n-2, etc) synthesis products, and from DNA duplexes with single base pair overhangs. Additionally, palindromic DNA sequences with only minor differences in the central spacer sequence of the DNA can be separated, and the purified DNA is suitable for co-crystallization of protein–DNA complexes. Thus, double-stranded ion-pair liquid chromatography is a useful approach for duplex DNA purification for many applications. PMID:24013567

  11. Generation of DNA single-strand displacement by compromised nucleotide excision repair

    PubMed Central

    Godon, Camille; Mourgues, Sophie; Nonnekens, Julie; Mourcet, Amandine; Coin, Fréderic; Vermeulen, Wim; Mari, Pierre-Olivier; Giglia-Mari, Giuseppina

    2012-01-01

    Nucleotide excision repair (NER) is a precisely coordinated process essential to avoid DNA damage-induced cellular malfunction and mutagenesis. Here, we investigate the mechanistic details and effects of the NER machinery when it is compromised by a pathologically significant mutation in a subunit of the repair/transcription factor TFIIH, namely XPD. In contrast to previous studies, we find that no single- or double-strand DNA breaks are produced at early time points after UV irradiation of cells bearing a specific XPD mutation, despite the presence of a clear histone H2AX phosphorylation (γH2AX) signal in the UV-exposed areas. We show that the observed γH2AX signal can be explained by the presence of longer single-strand gaps possibly generated by strand displacement. Our in vivo measurements also indicate a strongly reduced TFIIH-XPG binding that could promote single-strand displacement at the site of UV lesions. This finding not only highlights the crucial role of XPG's interactions with TFIIH for proper NER, but also sheds new light on how a faulty DNA repair process can induce extreme genomic instability in human patients. PMID:22863773

  12. [Single-molecule detection and characterization of DNA replication based on DNA origami].

    PubMed

    Wang, Qi; Fan, Youjie; Li, Bin

    2014-08-01

    To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.

  13. An electrochemical sensing platform based on local repression of electrolyte diffusion for single-step, reagentless, sensitive detection of a sequence-specific DNA-binding protein.

    PubMed

    Zhang, Yun; Liu, Fang; Nie, Jinfang; Jiang, Fuyang; Zhou, Caibin; Yang, Jiani; Fan, Jinlong; Li, Jianping

    2014-05-07

    In this paper, we report for the first time an electrochemical biosensor for single-step, reagentless, and picomolar detection of a sequence-specific DNA-binding protein using a double-stranded, electrode-bound DNA probe terminally modified with a redox active label close to the electrode surface. This new methodology is based upon local repression of electrolyte diffusion associated with protein-DNA binding that leads to reduction of the electrochemical response of the label. In the proof-of-concept study, the resulting electrochemical biosensor was quantitatively sensitive to the concentrations of the TATA binding protein (TBP, a model analyte) ranging from 40 pM to 25.4 nM with an estimated detection limit of ∼10.6 pM (∼80 to 400-fold improvement on the detection limit over previous electrochemical analytical systems).

  14. Importance of the efficiency of double-stranded DNA formation in cDNA synthesis for the imprecision of microarray expression analysis.

    PubMed

    Thormar, Hans G; Gudmundsson, Bjarki; Eiriksdottir, Freyja; Kil, Siyoen; Gunnarsson, Gudmundur H; Magnusson, Magnus Karl; Hsu, Jason C; Jonsson, Jon J

    2013-04-01

    The causes of imprecision in microarray expression analysis are poorly understood, limiting the use of this technology in molecular diagnostics. Two-dimensional strandness-dependent electrophoresis (2D-SDE) separates nucleic acid molecules on the basis of length and strandness, i.e., double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), and RNA·DNA hybrids. We used 2D-SDE to measure the efficiency of cDNA synthesis and its importance for the imprecision of an in vitro transcription-based microarray expression analysis. The relative amount of double-stranded cDNA formed in replicate experiments that used the same RNA sample template was highly variable, ranging between 0% and 72% of the total DNA. Microarray experiments showed an inverse relationship between the difference between sample pairs in probe variance and the relative amount of dsDNA. Approximately 15% of probes showed between-sample variation (P < 0.05) when the dsDNA percentage was between 12% and 35%. In contrast, only 3% of probes showed between-sample variation when the dsDNA percentage was 69% and 72%. Replication experiments of the 35% dsDNA and 72% dsDNA samples were used to separate sample variation from probe replication variation. The estimated SD of the sample-to-sample variation and of the probe replicates was lower in 72% dsDNA samples than in 35% dsDNA samples. Variation in the relative amount of double-stranded cDNA synthesized can be an important component of the imprecision in T7 RNA polymerase-based microarray expression analysis. © 2013 American Association for Clinical Chemistry

  15. The mismatch repair and meiotic recombination endonuclease Mlh1-Mlh3 is activated by polymer formation and can cleave DNA substrates in trans

    PubMed Central

    Manhart, Carol M.; Ni, Xiaodan; White, Martin A.; Ortega, Joaquin; Surtees, Jennifer A.

    2017-01-01

    Crossing over between homologs is initiated in meiotic prophase by the formation of DNA double-strand breaks that occur throughout the genome. In the major interference-responsive crossover pathway in baker’s yeast, these breaks are resected to form 3' single-strand tails that participate in a homology search, ultimately forming double Holliday junctions (dHJs) that primarily include both homologs. These dHJs are resolved by endonuclease activity to form exclusively crossovers, which are critical for proper homolog segregation in Meiosis I. Recent genetic, biochemical, and molecular studies in yeast are consistent with the hypothesis of Mlh1-Mlh3 DNA mismatch repair complex acting as the major endonuclease activity that resolves dHJs into crossovers. However, the mechanism by which the Mlh1-Mlh3 endonuclease is activated is unknown. Here, we provide evidence that Mlh1-Mlh3 does not behave like a structure-specific endonuclease but forms polymers required to generate nicks in DNA. This conclusion is supported by DNA binding studies performed with different-sized substrates that contain or lack polymerization barriers and endonuclease assays performed with varying ratios of endonuclease-deficient and endonuclease-proficient Mlh1-Mlh3. In addition, Mlh1-Mlh3 can generate religatable double-strand breaks and form an active nucleoprotein complex that can nick DNA substrates in trans. Together these observations argue that Mlh1-Mlh3 may not act like a canonical, RuvC-like Holliday junction resolvase and support a novel model in which Mlh1-Mlh3 is loaded onto DNA to form an activated polymer that cleaves DNA. PMID:28453523

  16. The mismatch repair and meiotic recombination endonuclease Mlh1-Mlh3 is activated by polymer formation and can cleave DNA substrates in trans.

    PubMed

    Manhart, Carol M; Ni, Xiaodan; White, Martin A; Ortega, Joaquin; Surtees, Jennifer A; Alani, Eric

    2017-04-01

    Crossing over between homologs is initiated in meiotic prophase by the formation of DNA double-strand breaks that occur throughout the genome. In the major interference-responsive crossover pathway in baker's yeast, these breaks are resected to form 3' single-strand tails that participate in a homology search, ultimately forming double Holliday junctions (dHJs) that primarily include both homologs. These dHJs are resolved by endonuclease activity to form exclusively crossovers, which are critical for proper homolog segregation in Meiosis I. Recent genetic, biochemical, and molecular studies in yeast are consistent with the hypothesis of Mlh1-Mlh3 DNA mismatch repair complex acting as the major endonuclease activity that resolves dHJs into crossovers. However, the mechanism by which the Mlh1-Mlh3 endonuclease is activated is unknown. Here, we provide evidence that Mlh1-Mlh3 does not behave like a structure-specific endonuclease but forms polymers required to generate nicks in DNA. This conclusion is supported by DNA binding studies performed with different-sized substrates that contain or lack polymerization barriers and endonuclease assays performed with varying ratios of endonuclease-deficient and endonuclease-proficient Mlh1-Mlh3. In addition, Mlh1-Mlh3 can generate religatable double-strand breaks and form an active nucleoprotein complex that can nick DNA substrates in trans. Together these observations argue that Mlh1-Mlh3 may not act like a canonical, RuvC-like Holliday junction resolvase and support a novel model in which Mlh1-Mlh3 is loaded onto DNA to form an activated polymer that cleaves DNA.

  17. Alpha-crystallins are involved in specific interactions with the murine gamma D/E/F-crystallin-encoding gene.

    PubMed

    Pietrowski, D; Durante, M J; Liebstein, A; Schmitt-John, T; Werner, T; Graw, J

    1994-07-08

    The promoter of the murine gamma E-crystallin (gamma E-Cry) encoding gene (gamma E-cry) was analyzed for specific interactions with lenticular proteins in a gel-retardation assay. A 21-bp fragment immediately downstream of the transcription initiation site (DOTIS) is demonstrated to be responsible for specific interactions with lens extracts. The DOTIS-binding protein(s) accept only the sense DNA strand as target; anti-sense or double-stranded DNA do not interact with these proteins. The DOTIS sequence element is highly conserved among the murine gamma D-, gamma E- and gamma F-cry and is present at comparable positions in the orthologous rat genes. Only a weak or even no protein-binding activity is observed if a few particular bases are changed, as in the rat gamma A-, gamma C- and gamma E-cry elements. DOTIS-binding proteins were found in commercially available bovine alpha-Cry preparations. The essential participation of alpha-Cry in the DNA-binding protein complex was confirmed using alpha-Cry-specific monoclonal antibody. The results reported here point to a novel function of alpha-Cry besides the structural properties in the lens.

  18. The DNA-dependent protein kinase: a multifunctional protein kinase with roles in DNA double strand break repair and mitosis

    PubMed Central

    Jette, Nicholas; Lees-Miller, Susan P.

    2015-01-01

    The DNA-dependent protein kinase (DNA-PK) is a serine/threonine protein kinase composed of a large catalytic subunit (DNA-PKcs) and the Ku70/80 heterodimer. Over the past two decades, significant progress has been made in elucidating the role of DNA-PK in non-homologous end joining (NHEJ), the major pathway for repair of ionizing radiation-induced DNA double strand breaks in human cells and recently, additional roles for DNA-PK have been reported. In this review, we will describe the biochemistry, structure and function of DNA-PK, its roles in DNA double strand break repair and its newly described roles in mitosis and other cellular processes. PMID:25550082

  19. Artificial and Solar UV Radiation Induces Strand Breaks and Cyclobutane Pyrimidine Dimers in Bacillus subtilis Spore DNA

    PubMed Central

    Slieman, Tony A.; Nicholson, Wayne L.

    2000-01-01

    The loss of stratospheric ozone and the accompanying increase in solar UV flux have led to concerns regarding decreases in global microbial productivity. Central to understanding this process is determining the types and amounts of DNA damage in microbes caused by solar UV irradiation. While UV irradiation of dormant Bacillus subtilis endospores results mainly in formation of the “spore photoproduct” 5-thyminyl-5,6-dihydrothymine, genetic evidence indicates that an additional DNA photoproduct(s) may be formed in spores exposed to solar UV-B and UV-A radiation (Y. Xue and W. L. Nicholson, Appl. Environ. Microbiol. 62:2221–2227, 1996). We examined the occurrence of double-strand breaks, single-strand breaks, cyclobutane pyrimidine dimers, and apurinic-apyrimidinic sites in spore DNA under several UV irradiation conditions by using enzymatic probes and neutral or alkaline agarose gel electrophoresis. DNA from spores irradiated with artificial 254-nm UV-C radiation accumulated single-strand breaks, double-strand breaks, and cyclobutane pyrimidine dimers, while DNA from spores exposed to artificial UV-B radiation (wavelengths, 290 to 310 nm) accumulated only cyclobutane pyrimidine dimers. DNA from spores exposed to full-spectrum sunlight (UV-B and UV-A radiation) accumulated single-strand breaks, double-strand breaks, and cyclobutane pyrimidine dimers, whereas DNA from spores exposed to sunlight from which the UV-B component had been removed with a filter (“UV-A sunlight”) accumulated only single-strand breaks and double-strand breaks. Apurinic-apyrimidinic sites were not detected in spore DNA under any of the irradiation conditions used. Our data indicate that there is a complex spectrum of UV photoproducts in DNA of bacterial spores exposed to solar UV irradiation in the environment. PMID:10618224

  20. Solution structure and DNA-binding properties of the C-terminal domain of UvrC from E.coli

    PubMed Central

    Singh, S.; Folkers, G.E.; Bonvin, A.M.J.J.; Boelens, R.; Wechselberger, R.; Niztayev, A.; Kaptein, R.

    2002-01-01

    The C-terminal domain of the UvrC protein (UvrC CTD) is essential for 5′ incision in the prokaryotic nucleotide excision repair process. We have determined the three-dimensional structure of the UvrC CTD using heteronuclear NMR techniques. The structure shows two helix–hairpin–helix (HhH) motifs connected by a small connector helix. The UvrC CTD is shown to mediate structure-specific DNA binding. The domain binds to a single-stranded–double-stranded junction DNA, with a strong specificity towards looped duplex DNA that contains at least six unpaired bases per loop (‘bubble DNA’). Using chemical shift perturbation experiments, the DNA-binding surface is mapped to the first hairpin region encompassing the conserved glycine–valine–glycine residues followed by lysine–arginine–arginine, a positively charged surface patch and the second hairpin region consisting of glycine–isoleucine–serine. A model for the protein– DNA complex is proposed that accounts for this specificity. PMID:12426397

  1. Eukaryotic Replicative Helicase Subunit Interaction with DNA and Its Role in DNA Replication

    PubMed Central

    Martinez, Matthew P.; Wacker, Amanda L.; Bruck, Irina; Kaplan, Daniel L.

    2017-01-01

    The replicative helicase unwinds parental double-stranded DNA at a replication fork to provide single-stranded DNA templates for the replicative polymerases. In eukaryotes, the replicative helicase is composed of the Cdc45 protein, the heterohexameric ring-shaped Mcm2-7 complex, and the tetrameric GINS complex (CMG). The CMG proteins bind directly to DNA, as demonstrated by experiments with purified proteins. The mechanism and function of these DNA-protein interactions are presently being investigated, and a number of important discoveries relating to how the helicase proteins interact with DNA have been reported recently. While some of the protein-DNA interactions directly relate to the unwinding function of the enzyme complex, other protein-DNA interactions may be important for minichromosome maintenance (MCM) loading, origin melting or replication stress. This review describes our current understanding of how the eukaryotic replicative helicase subunits interact with DNA structures in vitro, and proposed models for the in vivo functions of replicative helicase-DNA interactions are also described. PMID:28383499

  2. Electrochemical detection of synthetic DNA and native 16S rRNA fragments on a microarray using a biotinylated intercalator as coupling site for an enzyme label.

    PubMed

    Zimdars, Andreas; Gebala, Magdalena; Hartwich, Gerhard; Neugebauer, Sebastian; Schuhmann, Wolfgang

    2015-10-01

    The direct electrochemical detection of synthetic DNA and native 16S rRNA fragments isolated from Escherichia coli is described. Oligonucleotides are detected via selective post-labeling of double stranded DNA and DNA-RNA duplexes with a biotinylated intercalator that enables high-specific binding of a streptavidin/alkaline phosphatase conjugate. The alkaline phosphatase catalyzes formation of p-aminophenol that is subsequently oxidized at the underlying gold electrode and hence enables the detection of complementary hybridization of the DNA capture strands due to the enzymatic signal amplification. The hybridization assay was performed on microarrays consisting of 32 individually addressable gold microelectrodes. Synthetic DNA strands with sequences representing six different pathogens which are important for the diagnosis of urinary tract infections could be detected at concentrations of 60 nM. Native 16S rRNA isolated from the different pathogens could be detected at a concentration of 30 fM. Optimization of the sensing surface is described and influences on the assay performance are discussed. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Enzyme-free detection and quantification of double-stranded nucleic acids.

    PubMed

    Feuillie, Cécile; Merheb, Maxime Mohamad; Gillet, Benjamin; Montagnac, Gilles; Hänni, Catherine; Daniel, Isabelle

    2012-08-01

    We have developed a fully enzyme-free SERRS hybridization assay for specific detection of double-stranded DNA sequences. Although all DNA detection methods ranging from PCR to high-throughput sequencing rely on enzymes, this method is unique for being totally non-enzymatic. The efficiency of enzymatic processes is affected by alterations, modifications, and/or quality of DNA. For instance, a limitation of most DNA polymerases is their inability to process DNA damaged by blocking lesions. As a result, enzymatic amplification and sequencing of degraded DNA often fail. In this study we succeeded in detecting and quantifying, within a mixture, relative amounts of closely related double-stranded DNA sequences from Rupicapra rupicapra (chamois) and Capra hircus (goat). The non-enzymatic SERRS assay presented here is the corner stone of a promising approach to overcome the failure of DNA polymerase when DNA is too degraded or when the concentration of polymerase inhibitors is too high. It is the first time double-stranded DNA has been detected with a truly non-enzymatic SERRS-based method. This non-enzymatic, inexpensive, rapid assay is therefore a breakthrough in nucleic acid detection.

  4. Double-stranded DNA-dependent ATPase Irc3p is directly involved in mitochondrial genome maintenance

    PubMed Central

    Sedman, Tiina; Gaidutšik, Ilja; Villemson, Karin; Hou, YingJian; Sedman, Juhan

    2014-01-01

    Nucleic acid-dependent ATPases are involved in nearly all aspects of DNA and RNA metabolism. Previous studies have described a number of mitochondrial helicases. However, double-stranded DNA-dependent ATPases, including translocases or enzymes remodeling DNA-protein complexes, have not been identified in mitochondria of the yeast Saccharomyces cerevisae. Here, we demonstrate that Irc3p is a mitochondrial double-stranded DNA-dependent ATPase of the Superfamily II. In contrast to the other mitochondrial Superfamily II enzymes Mss116p, Suv3p and Mrh4p, which are RNA helicases, Irc3p has a direct role in mitochondrial DNA (mtDNA) maintenance. Specific Irc3p-dependent mtDNA metabolic intermediates can be detected, including high levels of double-stranded DNA breaks that accumulate in irc3Δ mutants. irc3Δ-related topology changes in rho- mtDNA can be reversed by the deletion of mitochondrial RNA polymerase RPO41, suggesting that Irc3p counterbalances adverse effects of transcription on mitochondrial genome stability. PMID:25389272

  5. Helical filaments of human Dmc1 protein on single-stranded DNA: a cautionary tale

    PubMed Central

    Yu, Xiong; Egelman, Edward H.

    2010-01-01

    Proteins in the RecA/Rad51/RadA family form nucleoprotein filaments on DNA that catalyze a strand exchange reaction as part of homologous genetic recombination. Because of the centrality of this system to many aspects of DNA repair, the generation of genetic diversity, and cancer when this system fails or is not properly regulated, these filaments have been the object of many biochemical and biophysical studies. A recent paper has argued that the human Dmc1 protein, a meiotic homolog of bacterial RecA and human Rad51, forms filaments on single stranded DNA with ∼ 9 subunits per turn in contrast to the filaments formed on double stranded DNA with ∼ 6.4 subunits per turn, and that the stoichiometry of DNA binding is different between these two filaments. We show using scanning transmission electron microscopy (STEM) that the Dmc1 filament formed on single stranded DNA has a mass per unit length expected from ∼ 6.5 subunits per turn. More generally, we show how ambiguities in helical symmetry determination can generate incorrect solutions, and why one sometimes must use other techniques, such as biochemistry, metal shadowing, or STEM to resolve these ambiguities. While three-dimensional reconstruction of helical filaments from EM images is a powerful tool, the intrinsic ambiguities that may be present with limited resolution are not sufficiently appreciated. PMID:20600108

  6. Exploiting Tumor-Activated Testes Proteins to Enhance Efficacy of First-Line Chemotherapeutics in NSCLC

    DTIC Science & Technology

    2015-10-01

    TERMS Cancer Testis Antigen (CTA), Fanconia- Anemia (FA), DNA Damage, Genomic Instability, DNA Double Strand Break (DSB) 16. SECURITY CLASSIFICATION OF...Cancer Testis Antigen (CTA) o Fanconia- Anemia (FA) o DNA Damage o Genomic Instability o DNA Double Strand Break (DSB) 3. Accomplishments • What

  7. [Investigation of RNA viral genome amplification by multiple displacement amplification technique].

    PubMed

    Pang, Zheng; Li, Jian-Dong; Li, Chuan; Liang, Mi-Fang; Li, De-Xin

    2013-06-01

    In order to facilitate the detection of newly emerging or rare viral infectious diseases, a negative-strand RNA virus-severe fever with thrombocytopenia syndrome bunyavirus, and a positive-strand RNA virus-dengue virus, were used to investigate RNA viral genome unspecific amplification by multiple displacement amplification technique from clinical samples. Series of 10-fold diluted purified viral RNA were utilized as analog samples with different pathogen loads, after a series of reactions were sequentially processed, single-strand cDNA, double-strand cDNA, double-strand cDNA treated with ligation without or with supplemental RNA were generated, then a Phi29 DNA polymerase depended isothermal amplification was employed, and finally the target gene copies were detected by real time PCR assays to evaluate the amplification efficiencies of various methods. The results showed that multiple displacement amplification effects of single-strand or double-strand cDNA templates were limited, while the fold increases of double-strand cDNA templates treated with ligation could be up to 6 X 10(3), even 2 X 10(5) when supplemental RNA existed, and better results were obtained when viral RNA loads were lower. A RNA viral genome amplification system using multiple displacement amplification technique was established in this study and effective amplification of RNA viral genome with low load was achieved, which could provide a tool to synthesize adequate viral genome for multiplex pathogens detection.

  8. Fluorometric determination of nucleic acids based on the use of polydopamine nanotubes and target-induced strand displacement amplification.

    PubMed

    Ge, Jia; Bai, Dong-Mei; -Geng, Xin; Hu, Ya-Lei; Cai, Qi-Yong; Xing, Ke; Zhang, Lin; Li, Zhao-Hui

    2018-01-10

    The authors describe a fluorometric method for the quantitation of nucleic acids by combining (a) cycled strand displacement amplification, (b) the unique features of the DNA probe SYBR Green, and (c) polydopamine nanotubes. SYBR Green undergoes strong fluorescence enhancement upon intercalation into double-stranded DNA (dsDNA). The polydopamine nanotubes selectively adsorb single-stranded DNA (ssDNA) and molecular beacons. In the absence of target DNA, the molecular beacon, primer and SYBR Green are adsorbed on the surface of polydopamine nanotubes. This results in quenching of the fluorescence of SYBR Green, typically measured at excitation/emission wavelengths of 488/518 nm. Upon addition of analyte (target DNA) and polymerase, the stem of the molecular beacon is opened so that it can bind to the primer. This triggers target strand displacement polymerization, during which dsDNA is synthesized. The hybridized target is then displaced due to the strand displacement activity of the polymerase. The displaced target hybridizes with another molecular beacon. This triggers the next round of polymerization. Consequently, a large amount of dsDNA is formed which is detected by addition of SYBR Green. Thus, sensitive and selective fluorometric detection is realized. The fluorescent sensing strategy shows very good analytical performances towards DNA detection, such as a wide linear range from 0.05 to 25 nM with a low limit of detection of 20 pM. Graphical abstract Schematic of a fluorometric strategy for highly sensitive and selective determination of nucleic acids by combining strand displacement amplification and the unique features of SYBR Green I (SG) and polydopamine nanotubes.

  9. Deletions at short direct repeats and base substitutions are characteristic mutations for bleomycin-induced double- and single-strand breaks, respectively, in a human shuttle vector system

    NASA Technical Reports Server (NTRS)

    Dar, M. E.; Jorgensen, T. J.

    1995-01-01

    Using the radiomimetic drug, bleomycin, we have determined the mutagenic potential of DNA strand breaks in the shuttle vector pZ189 in human fibroblasts. The bleomycin treatment conditions used produce strand breaks with 3'-phosphoglycolate termini as > 95% of the detectable dose-dependent lesions. Breaks with this end group represent 50% of the strand break damage produced by ionizing radiation. We report that such strand breaks are mutagenic lesions. The type of mutation produced is largely determined by the type of strand break on the plasmid (i.e. single versus double). Mutagenesis studies with purified DNA forms showed that nicked plasmids (i.e. those containing single-strand breaks) predominantly produce base substitutions, the majority of which are multiples, which presumably originate from error-prone polymerase activity at strand break sites. In contrast, repair of linear plasmids (i.e. those containing double-strand breaks) mainly results in deletions at short direct repeat sequences, indicating the involvement of illegitimate recombination. The data characterize the nature of mutations produced by single- and double-strand breaks in human cells, and suggests that deletions at direct repeats may be a 'signature' mutation for the processing of DNA double-strand breaks.

  10. Pyrrole-Imidazole Polyamides: Manual Solid-Phase Synthesis.

    PubMed

    Pauff, Steven M; Fallows, Andrew J; Mackay, Simon P; Su, Wu; Cullis, Paul M; Burley, Glenn A

    2015-12-01

    Pyrrole-imidazole polyamides (PAs) are a family of DNA-binding peptides that bind in the minor groove of double-stranded DNA (dsDNA) in a sequence-selective, programmable fashion. This protocol describes a detailed manual procedure for the solid-phase synthesis of this family of compounds. The protocol entails solution-phase synthesis of the Boc-protected pyrrole (Py) and imidazole (Im) carboxylic acid building blocks. This unit also describes the importance of choosing the appropriate condensing agent to form the amide linkages between each building block. Finally, a monomeric coupling protocol and a fragment-based approach are described that delivers PAs in 13% to 30% yield in 8 days. Copyright © 2015 John Wiley & Sons, Inc.

  11. 21 CFR 866.5820 - Systemic lupus erythema-tosus immunological test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... with cellular nuclear double-stranded deoxyribonucleic acid (DNA) or other nuclear constituents that are specifically diagnostic of SLE. Measurement of nuclear double-stranded DNA antibodies aids in the...

  12. 21 CFR 866.5820 - Systemic lupus erythema-tosus immunological test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... with cellular nuclear double-stranded deoxyribonucleic acid (DNA) or other nuclear constituents that are specifically diagnostic of SLE. Measurement of nuclear double-stranded DNA antibodies aids in the...

  13. 21 CFR 866.5820 - Systemic lupus erythema-tosus immunological test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... with cellular nuclear double-stranded deoxyribonucleic acid (DNA) or other nuclear constituents that are specifically diagnostic of SLE. Measurement of nuclear double-stranded DNA antibodies aids in the...

  14. 21 CFR 866.5820 - Systemic lupus erythema-tosus immunological test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... with cellular nuclear double-stranded deoxyribonucleic acid (DNA) or other nuclear constituents that are specifically diagnostic of SLE. Measurement of nuclear double-stranded DNA antibodies aids in the...

  15. Splicing stimulates siRNA formation at Drosophila DNA double-strand breaks

    PubMed Central

    Merk, Karin; Breinig, Marco; Böttcher, Romy; Krebs, Stefan; Blum, Helmut; Boutros, Michael

    2017-01-01

    DNA double-strand breaks trigger the production of locus-derived siRNAs in fruit flies, human cells and plants. At least in flies, their biogenesis depends on active transcription running towards the break. Since siRNAs derive from a double-stranded RNA precursor, a major question is how broken DNA ends can generate matching sense and antisense transcripts. We performed a genome-wide RNAi-screen in cultured Drosophila cells, which revealed that in addition to DNA repair factors, many spliceosome components are required for efficient siRNA generation. We validated this observation through site-specific DNA cleavage with CRISPR-cas9 followed by deep sequencing of small RNAs. DNA breaks in intron-less genes or upstream of a gene’s first intron did not efficiently trigger siRNA production. When DNA double-strand breaks were induced downstream of an intron, however, this led to robust siRNA generation. Furthermore, a downstream break slowed down splicing of the upstream intron and a detailed analysis of siRNA coverage at the targeted locus revealed that unspliced pre-mRNA contributes the sense strand to the siRNA precursor. Since splicing factors are stimulating the response but unspliced transcripts are entering the siRNA biogenesis, the spliceosome is apparently stalled in a pre-catalytic state and serves as a signaling hub. We conclude that convergent transcription at DNA breaks is stimulated by a splicing dependent control process. The resulting double-stranded RNA is converted into siRNAs that instruct the degradation of cognate mRNAs. In addition to a potential role in DNA repair, the break-induced transcription may thus be a means to cull improper RNAs from the transcriptome of Drosophila melanogaster. Since the splicing factors identified in our screen also stimulated siRNA production from high copy transgenes, it is possible that this surveillance mechanism serves in genome defense beyond DNA double-strand breaks. PMID:28628606

  16. Crystal Structure of a CRISPR RNA-guided Surveillance Complex Bound to a ssDNA Target

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mulepati, Sabin; Heroux, Annie; Bailey, Scott

    In prokaryotes, RNA derived from type I and type III CRISPR loci direct large ribonucleoprotein complexes to destroy invading bacteriophage and plasmids. In Escherichia coli, this 405-kilodalton complex is called Cascade. We report the crystal structure of Cascade bound to a single-stranded DNA (ssDNA) target at a resolution of 3.03 angstroms. The structure reveals that the CRISPR RNA and target strands do not form a double helix but instead adopt an underwound ribbon-like structure. This noncanonical structure is facilitated by rotation of every sixth nucleotide out of the RNA-DNA hybrid and is stabilized by the highly interlocked organization of proteinmore » subunits. These studies provide insight into both the assembly and the activity of this complex and suggest a mechanism to enforce fidelity of target binding.« less

  17. Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

    DOEpatents

    Soares, Marcelo Bento; Bonaldo, Maria de Fatima

    1998-01-01

    This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.

  18. Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

    DOEpatents

    Soares, M.B.; Fatima Bonaldo, M. de

    1998-12-08

    This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.

  19. Differential Targeting of Unpaired Bases within Duplex DNA by the Natural Compound Clerocidin: A Valuable Tool to Dissect DNA Secondary Structure

    PubMed Central

    Nadai, Matteo; Palù, Giorgio; Palumbo, Manlio; Richter, Sara N.

    2012-01-01

    Non-canonical DNA structures have been postulated to mediate protein-nucleic acid interactions and to function as intermediates in the generation of frame-shift mutations when errors in DNA replication occur, which result in a variety of diseases and cancers. Compounds capable of binding to non-canonical DNA conformations may thus have significant diagnostic and therapeutic potential. Clerocidin is a natural diterpenoid which has been shown to selectively react with single-stranded bases without targeting the double helix. Here we performed a comprehensive analysis on several non-canonical DNA secondary structures, namely mismatches, nicks, bulges, hairpins, with sequence variations in both the single-stranded region and the double-stranded flanking segment. By analysis of clerocidin reactivity, we were able to identify the exposed reactive residues which provided information on both the secondary structure and the accessibility of the non-paired sites. Mismatches longer than 1 base were necessary to be reached by clerocidin reactive groups, while 1-base nicks were promptly targeted by clerocidin; in hairpins, clerocidin reactivity increased with the length of the hairpin loop, while, interestingly, reactivity towards bulges reached a maximum in 3-base-long bulges and declined in longer bulges. Electrophoretic mobility shift analysis demonstrated that bulges longer than 3 bases (i.e. 5- and 7-bases) folded or stacked on the duplex region therefore being less accessible by the compound. Clerocidin thus represents a new valuable diagnostic tool to dissect DNA secondary structures. PMID:23285245

  20. Differential targeting of unpaired bases within duplex DNA by the natural compound clerocidin: a valuable tool to dissect DNA secondary structure.

    PubMed

    Nadai, Matteo; Palù, Giorgio; Palumbo, Manlio; Richter, Sara N

    2012-01-01

    Non-canonical DNA structures have been postulated to mediate protein-nucleic acid interactions and to function as intermediates in the generation of frame-shift mutations when errors in DNA replication occur, which result in a variety of diseases and cancers. Compounds capable of binding to non-canonical DNA conformations may thus have significant diagnostic and therapeutic potential. Clerocidin is a natural diterpenoid which has been shown to selectively react with single-stranded bases without targeting the double helix. Here we performed a comprehensive analysis on several non-canonical DNA secondary structures, namely mismatches, nicks, bulges, hairpins, with sequence variations in both the single-stranded region and the double-stranded flanking segment. By analysis of clerocidin reactivity, we were able to identify the exposed reactive residues which provided information on both the secondary structure and the accessibility of the non-paired sites. Mismatches longer than 1 base were necessary to be reached by clerocidin reactive groups, while 1-base nicks were promptly targeted by clerocidin; in hairpins, clerocidin reactivity increased with the length of the hairpin loop, while, interestingly, reactivity towards bulges reached a maximum in 3-base-long bulges and declined in longer bulges. Electrophoretic mobility shift analysis demonstrated that bulges longer than 3 bases (i.e. 5- and 7-bases) folded or stacked on the duplex region therefore being less accessible by the compound. Clerocidin thus represents a new valuable diagnostic tool to dissect DNA secondary structures.

  1. A Unique HMG-Box Domain of Mouse Maelstrom Binds Structured RNA but Not Double Stranded DNA

    PubMed Central

    Genzor, Pavol; Bortvin, Alex

    2015-01-01

    Piwi-interacting piRNAs are a major and essential class of small RNAs in the animal germ cells with a prominent role in transposon control. Efficient piRNA biogenesis and function require a cohort of proteins conserved throughout the animal kingdom. Here we studied Maelstrom (MAEL), which is essential for piRNA biogenesis and germ cell differentiation in flies and mice. MAEL contains a high mobility group (HMG)-box domain and a Maelstrom-specific domain with a presumptive RNase H-fold. We employed a combination of sequence analyses, structural and biochemical approaches to evaluate and compare nucleic acid binding of mouse MAEL HMG-box to that of canonical HMG-box domain proteins (SRY and HMGB1a). MAEL HMG-box failed to bind double-stranded (ds)DNA but bound to structured RNA. We also identified important roles of a novel cluster of arginine residues in MAEL HMG-box in these interactions. Cumulatively, our results suggest that the MAEL HMG-box domain may contribute to MAEL function in selective processing of retrotransposon RNA into piRNAs. In this regard, a cellular role of MAEL HMG-box domain is reminiscent of that of HMGB1 as a sentinel of immunogenic nucleic acids in the innate immune response. PMID:25807393

  2. Multiphoton near-infrared femtosecond laser pulse-induced DNA damage with and without the photosensitizer proflavine.

    PubMed

    Shafirovich, V; Dourandin, A; Luneva, N P; Singh, C; Kirigin, F; Geacintov, N E

    1999-03-01

    The excitation of pBr322 supercoiled plasmid DNA with intense near-IR 810 nm fs laser pulses by a simultaneous multiphoton absorption mechanism results in single-strand breaks after treatment of the irradiated samples with Micrococcus luteus UV endonuclease. This enzyme cleaves DNA strands at sites of cyclobutane dimers that are formed by the simultaneous absorption of three (or more) 810 nm IR photons (pulse width approximately 140 fs, 76 MHz pulse repetition, average power output focused through 10x microscope objective is approximately 1.2 MW/cm2). Direct single-strand breaks (without treatment with M. luteus) were not observed under these conditions. However, in the presence of 6 microM of the intercalator proflavine (PF), both direct single- and double-strand breaks are observed under conditions where substantial fractions of undamaged supercoiled DNA molecules are still present. The fraction of direct double-strand breaks is 30 +/- 5% of all measurable strand cleavage events, is independent of dosage (up to 6.4 GJ/cm2) and is proportional to In, where I is the average power/area of the 810 nm fs laser pulses, and n = 3 +/- 1. The nicking of two DNA strands in the immediate vicinity of the excited PF molecules gives rise to this double-strand cleavage. In contrast, excitation of the same samples under low-power, single-photon absorption conditions (approximately 400-500 nm) gives rise predominantly to single-strand breaks, but some double-strand breaks are observed at the higher dosages. Thus, single-photon excitation with 400-500 nm light and multiphoton activation of PF by near-IR fs laser pulses produces different distributions of single- and double-strand breaks. These results suggest that DNA strand cleavage originates from unrelaxed, higher excited states when PF is excited by simultaneous IR multiphoton absorption processes.

  3. Electrochemical label-free and sensitive nanobiosensing of DNA hybridization by graphene oxide modified pencil graphite electrode.

    PubMed

    Ahour, F; Shamsi, A

    2017-09-01

    Based on the strong interaction between single-stranded DNA (ss-DNA) and graphene material, we have constructed a novel label-free electrochemical biosensor for rapid and facile detection of short sequences ss-DNA molecules related to hepatitis C virus 1a using graphene oxide modified pencil graphite electrode. The sensing mechanism is based on the superior adsorption of single-stranded DNA to GO over double stranded DNA (ds-DNA). The intrinsic guanine oxidation signal measured by differential pulse voltammetry (DPV) has been used for duplex DNA formation detection. The probe ss-DNA adsorbs onto the surface of GO via the π- π* stacking interactions leading to a strong background guanine oxidation signal. In the presence of complementary target, formation of helix which has weak binding ability to GO induced ds-DNA to release from the electrode surface and significant variation in differential pulse voltammetric response of guanine bases. The results indicated that the oxidation peak current was proportional to the concentration of complementary strand in the range of 0.1 nM-0.5 μM with a detection limit of 4.3 × 10 -11  M. The simple fabricated electrochemical biosensor has high sensitivity, good selectivity, and could be applied as a new platform for a range of target molecules in future. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Rad51 and RecA juxtapose dsDNA ends ready for DNA ligase-catalyzed end-joining under recombinase-suppressive conditions

    PubMed Central

    Konomura, Naoto; Arai, Naoto; Shinohara, Takeshi; Kobayashi, Jun; Iwasaki, Wakana; Ikawa, Shukuko; Kusano, Kohji; Shibata, Takehiko

    2017-01-01

    RecA-family recombinase-catalyzed ATP-dependent homologous joint formation is critical for homologous recombination, in which RecA or Rad51 binds first to single-stranded (ss)DNA and then interacts with double-stranded (ds)DNA. However, when RecA or Rad51 interacts with dsDNA before binding to ssDNA, the homologous joint-forming activity of RecA or Rad51 is quickly suppressed. We found that under these and adenosine diphosphate (ADP)-generating suppressive conditions for the recombinase activity, RecA or Rad51 at similar optimal concentrations enhances the DNA ligase-catalyzed dsDNA end-joining (DNA ligation) about 30- to 40-fold. The DNA ligation enhancement by RecA or Rad51 transforms most of the substrate DNA into multimers within 2–5 min, and for this enhancement, ADP is the common and best cofactor. Adenosine triphosphate (ATP) is effective for RecA, but not for Rad51. Rad51/RecA-enhanced DNA ligation depends on dsDNA-binding, as shown by a mutant, and is independent of physical interactions with the DNA ligase. These observations demonstrate the common and unique activities of RecA and Rad51 to juxtapose dsDNA-ends in preparation for covalent joining by a DNA ligase. This new in vitro function of Rad51 provides a simple explanation for our genetic observation that Rad51 plays a role in the fidelity of the end-joining of a reporter plasmid DNA, by yeast canonical non-homologous end-joining (NHEJ) in vivo. PMID:27794044

  5. Senataxin Mutation Reveals How R-Loops Promote Transcription by Blocking DNA Methylation at Gene Promoters.

    PubMed

    Grunseich, Christopher; Wang, Isabel X; Watts, Jason A; Burdick, Joshua T; Guber, Robert D; Zhu, Zhengwei; Bruzel, Alan; Lanman, Tyler; Chen, Kelian; Schindler, Alice B; Edwards, Nancy; Ray-Chaudhury, Abhik; Yao, Jianhua; Lehky, Tanya; Piszczek, Grzegorz; Crain, Barbara; Fischbeck, Kenneth H; Cheung, Vivian G

    2018-02-01

    R-loops are three-stranded nucleic acid structures found abundantly and yet often viewed as by-products of transcription. Studying cells from patients with a motor neuron disease (amyotrophic lateral sclerosis 4 [ALS4]) caused by a mutation in senataxin, we uncovered how R-loops promote transcription. In ALS4 patients, the senataxin mutation depletes R-loops with a consequent effect on gene expression. With fewer R-loops in ALS4 cells, the expression of BAMBI, a negative regulator of transforming growth factor β (TGF-β), is reduced; that then leads to the activation of the TGF-β pathway. We uncovered that genome-wide R-loops influence promoter methylation of over 1,200 human genes. DNA methyl-transferase 1 favors binding to double-stranded DNA over R-loops. Thus, in forming R-loops, nascent RNA blocks DNA methylation and promotes further transcription. Hence, our results show that nucleic acid structures, in addition to sequences, influence the binding and activity of regulatory proteins. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Interaction of Ddc1 and RPA with single-stranded/double-stranded DNA junctions in yeast whole cell extracts: Proteolytic degradation of the large subunit of replication protein A in ddc1Δ strains.

    PubMed

    Sukhanova, Maria V; D'Herin, Claudine; Boiteux, Serge; Lavrik, Olga I

    2014-10-01

    To characterize proteins that interact with single-stranded/double-stranded (ss/ds) DNA junctions in whole cell free extracts of Saccharomyces cerevisiae, we used [(32)P]-labeled photoreactive partial DNA duplexes containing a 3'-ss/ds-junction (3'-junction) or a 5'-ss/ds-junction (5'-junction). Identification of labeled proteins was achieved by MALDI-TOF mass spectrometry peptide mass fingerprinting and genetic analysis. In wild-type extract, one of the components of the Ddc1-Rad17-Mec3 complex, Ddc1, was found to be preferentially photocrosslinked at a 3'-junction. On the other hand, RPAp70, the large subunit of the replication protein A (RPA), was the predominant crosslinking product at a 5'-junction. Interestingly, ddc1Δ extracts did not display photocrosslinking of RPAp70 at a 5'-junction. The results show that RPAp70 crosslinked to DNA with a 5'-junction is subject to limited proteolysis in ddc1Δ extracts, whereas it is stable in WT, rad17Δ, mec3Δ and mec1Δ extracts. The degradation of the RPAp70-DNA adduct in ddc1Δ extract is strongly reduced in the presence of the proteasome inhibitor MG 132. We also addressed the question of the stability of free RPA, using anti-RPA antibodies. The results show that RPAp70 is also subject to proteolysis without photocrosslinking to DNA upon incubation in ddc1Δ extract. The data point to a novel property of Ddc1, modulating the turnover of DNA binding proteins such as RPAp70 by the proteasome. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Repair of DNA Strand Breaks in a Minichromosome In Vivo: Kinetics, Modeling, and Effects of Inhibitors

    PubMed Central

    Kumala, Slawomir; Fujarewicz, Krzysztof; Jayaraju, Dheekollu; Rzeszowska-Wolny, Joanna; Hancock, Ronald

    2013-01-01

    To obtain an overall picture of the repair of DNA single and double strand breaks in a defined region of chromatin in vivo, we studied their repair in a ∼170 kb circular minichromosome whose length and topology are analogous to those of the closed loops in genomic chromatin. The rate of repair of single strand breaks in cells irradiated with γ photons was quantitated by determining the sensitivity of the minichromosome DNA to nuclease S1, and that of double strand breaks by assaying the reformation of supercoiled DNA using pulsed field electrophoresis. Reformation of supercoiled DNA, which requires that all single strand breaks have been repaired, was not slowed detectably by the inhibitors of poly(ADP-ribose) polymerase-1 NU1025 or 1,5-IQD. Repair of double strand breaks was slowed by 20–30% when homologous recombination was supressed by KU55933, caffeine, or siRNA-mediated depletion of Rad51 but was completely arrested by the inhibitors of nonhomologous end-joining wortmannin or NU7441, responses interpreted as reflecting competition between these repair pathways similar to that seen in genomic DNA. The reformation of supercoiled DNA was unaffected when topoisomerases I or II, whose participation in repair of strand breaks has been controversial, were inhibited by the catalytic inhibitors ICRF-193 or F11782. Modeling of the kinetics of repair provided rate constants and showed that repair of single strand breaks in minichromosome DNA proceeded independently of repair of double strand breaks. The simplicity of quantitating strand breaks in this minichromosome provides a usefull system for testing the efficiency of new inhibitors of their repair, and since the sequence and structural features of its DNA and its transcription pattern have been studied extensively it offers a good model for examining other aspects of DNA breakage and repair. PMID:23382828

  8. Synthesis, DNA binding, topoisomerase inhibition and cytotoxic properties of 2-chloroethylnitrosourea derivatives of hoechst 33258.

    PubMed

    Bielawski, Krzysztof; Bielawska, Anna; Anchim, Tomasz; Wołczyński, Sławomir

    2005-06-01

    A number of novel 2-chloroethylnitrosourea derivatives of Hoechst 33258 were synthesized and examined for cytotoxicity in breast cancer cell cultures and for inhibition of topoisomerases I and II. Evaluation of the cytotoxicity of these compounds employing a MTT assay and inhibition of [3H]thymidine incorporation into DNA in both MDA-MB-231 and MCF-7 breast cancer cells demonstrated that these compounds were more active than Hoechst 33258. The DNA-binding ability of these compounds was evaluated by an ultrafiltration method using calf thymus DNA, poly(dA-dT)2 and poly(dG-dC)2, indicated that these compounds as well as Hoechst 33258 well interact with AT base pair compared with GC pair. Binding studies indicate that these compounds bind more tightly to double-stranded DNA than the parent compound Hoechst 33258. The degree to which these compounds inhibited cell growth breast cancer cells was generally consistent with their relative DNA binding affinity. Mechanistic studies revealed that these compounds act as topoisomerase I (topo I) or topoisomerase II (topo II) inhibitors in plasmid relaxation assays.

  9. Exploiting Tumor Activated Testes Proteins To Enhance Efficacy of First Line Chemotherapeutics in NSCLC

    DTIC Science & Technology

    2016-10-01

    Antigen (CTA), Fanconia- Anemia (FA), DNA Damage, Genomic Instability, DNA Double Strand Break (DSB) 16. SECURITY CLASSIFICATION OF: 17. LIMITATION...Fanconia- Anemia (FA) o DNA Damage o Genomic Instability o DNA Double Strand Break (DSB) 3. Accomplishments • What were the major goals and objectives of

  10. Immunofluorescence-based methods to monitor DNA end resection

    PubMed Central

    Mukherjee, Bipasha; Tomimatsu, Nozomi; Burma, Sandeep

    2017-01-01

    Summary Double-strand breaks (DSBs) are the most deleterious amongst all types of DNA damage that can occur in the cell. These breaks arise from both endogenous (for example, DNA replication stress) as well as exogenous insults (for example, ionizing radiation). DSBs are principally repaired by one of two major pathways: non-homologous end joining (NHEJ) or homologous recombination (HR). NHEJ is an error-prone process that can occur in all phases of the cell cycle, while HR is limited to the S and G2 phases of the cell cycle when a sister chromatid is available as a template for error-free repair. The first step in HR is “DNA end resection”, a process during which the broken DNA end is converted into a long stretch of 3′-ended single-stranded DNA (ssDNA). In recent years, DNA end resection has been identified as a pivotal step that controls “repair pathway choice” i.e., the appropriate choice between NHEJ and HR for DSB repair. Therefore, methods to quantitatively or semi-quantitatively assess DNA end resection have gained importance in laboratories working on DNA repair. In this chapter, we describe two simple immunofluorescence-based techniques to monitor DNA end resection in mammalian cells. The first technique involves immuno-detection of Replication Protein A (RPA), a ssDNA-binding protein that binds to resected DNA. The second technique involves labeling of genomic DNA with 5-bromo-2′-deoxyuridine (BrdU) that can be detected by anti-BrdU antibody only after the DNA becomes single stranded due to resection. These methods are not complicated, do not involve sophisticated instrumentation or reporter constructs, and can be applied to most mammalian cell lines, and therefore, should be of broad utility as simple ways of monitoring DNA end resection in vivo. PMID:25804748

  11. Interactions of the SAP Domain of Human Ku70 with DNA Substrate: A Molecular Dynamics Study

    NASA Technical Reports Server (NTRS)

    Hu, Shaowen; Carra, Claudio; Huff, Janice; Pluth, Janice M.; Cucinotta, Francis A.

    2007-01-01

    NASA is developing a systems biology approach to improve the assessment of health risks associated with space radiation. The primary toxic and mutagenic lesion following radiation exposure is the DNA double strand break (DSB), thus a model incorporating proteins and pathways important in response and repair of this lesion is critical. One key protein heterodimer for systems models of radiation effects is the Ku70/80 complex. The Ku70/80 complex is important in the initial binding of DSB ends following DNA damage, and is a component of nonhomologous end joining repair, the primary pathway for DSB repair in mammalian cells. The SAP domain of Ku70 (residues 556-609), contains an a helix-extended strand-helix motif and similar motifs have been found in other nucleic acid-binding proteins critical for DNA repair. However, the exact mechanism of damage recognition and substrate specificity for the Ku heterodimer remains unclear in part due to the absence of a high-resolution structure of the SAP/DNA complex. We performed a series of molecular dynamics (MD) simulations on a system with the SAP domain of Ku70 and a 10 base pairs DNA duplex. Large-scale conformational changes were observed and some putative binding modes were suggested based on energetic analysis. These modes are consistent with previous experimental investigations. In addition, the results indicate that cooperation of SAP with other domains of Ku70/80 is necessary to explain the high affinity of binding as observed in experiments.

  12. Nuclear ARP2/3 drives DNA break clustering for homology-directed repair.

    PubMed

    Schrank, Benjamin R; Aparicio, Tomas; Li, Yinyin; Chang, Wakam; Chait, Brian T; Gundersen, Gregg G; Gottesman, Max E; Gautier, Jean

    2018-06-20

    DNA double-strand breaks repaired by non-homologous end joining display limited DNA end-processing and chromosomal mobility. By contrast, double-strand breaks undergoing homology-directed repair exhibit extensive processing and enhanced motion. The molecular basis of this movement is unknown. Here, using Xenopus laevis cell-free extracts and mammalian cells, we establish that nuclear actin, WASP, and the actin-nucleating ARP2/3 complex are recruited to damaged chromatin undergoing homology-directed repair. We demonstrate that nuclear actin polymerization is required for the migration of a subset of double-strand breaks into discrete sub-nuclear clusters. Actin-driven movements specifically affect double-strand breaks repaired by homology-directed repair in G2 cell cycle phase; inhibition of actin nucleation impairs DNA end-processing and homology-directed repair. By contrast, ARP2/3 is not enriched at double-strand breaks repaired by non-homologous end joining and does not regulate non-homologous end joining. Our findings establish that nuclear actin-based mobility shapes chromatin organization by generating repair domains that are essential for homology-directed repair in eukaryotic cells.

  13. Structure of the EndoMS-DNA Complex as Mismatch Restriction Endonuclease.

    PubMed

    Nakae, Setsu; Hijikata, Atsushi; Tsuji, Toshiyuki; Yonezawa, Kouki; Kouyama, Ken-Ichi; Mayanagi, Kouta; Ishino, Sonoko; Ishino, Yoshizumi; Shirai, Tsuyoshi

    2016-11-01

    Archaeal NucS nuclease was thought to degrade the single-stranded region of branched DNA, which contains flapped and splayed DNA. However, recent findings indicated that EndoMS, the orthologous enzyme of NucS, specifically cleaves double-stranded DNA (dsDNA) containing mismatched bases. In this study, we determined the structure of the EndoMS-DNA complex. The complex structure of the EndoMS dimer with dsDNA unexpectedly revealed that the mismatched bases were flipped out into binding sites, and the overall architecture most resembled that of restriction enzymes. The structure of the apo form was similar to the reported structure of Pyrococcus abyssi NucS, indicating that movement of the C-terminal domain from the resting state was required for activity. In addition, a model of the EndoMS-PCNA-DNA complex was preliminarily verified with electron microscopy. The structures strongly support the idea that EndoMS acts in a mismatch repair pathway. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Method for assaying clustered DNA damages

    DOEpatents

    Sutherland, Betsy M.

    2004-09-07

    Disclosed is a method for detecting and quantifying clustered damages in DNA. In this method, a first aliquot of the DNA to be tested for clustered damages with one or more lesion-specific cleaving reagents under conditions appropriate for cleavage of the DNA to produce single-strand nicks in the DNA at sites of damage lesions. The number average molecular length (Ln) of double stranded DNA is then quantitatively determined for the treated DNA. The number average molecular length (Ln) of double stranded DNA is also quantitatively determined for a second, untreated aliquot of the DNA. The frequency of clustered damages (.PHI..sub.c) in the DNA is then calculated.

  15. Binding Mode and Selectivity of a Scorpiand-Like Polyamine Ligand to Single- and Double-Stranded DNA and RNA: Metal- and pH-Driven Modulation.

    PubMed

    Inclán, Mario; Guijarro, Lluis; Pont, Isabel; Frías, Juan C; Rotger, Carmen; Orvay, Francisca; Costa, Antoni; García-España, Enrique; Albelda, M Teresa

    2017-11-13

    The interaction of a polyazacyclophane ligand having an ethylamine pendant arm functionalized with an anthryl group (L), with the single-stranded polynucleotides polyA, polyG, polyU, and polyC as well as with the double-stranded polynucleotides polyA-polyU, poly(dAT) 2 , and poly(dGC) 2 has been followed by UV/Vis titration, steady state fluorescence spectroscopy, and thermal denaturation measurements. In the case of the single-stranded polynucleotides, the UV/Vis and fluorescence titrations permit to distinguish between sequences containing purine and pyrimidine bases. For the double-stranded polynucleotides the UV/Vis measurements show for all of them hypochromicity and bathochromic shifts. However, the fluorescence studies reveal that both polyA-polyU and poly(dAT) 2 induce a twofold increase in the fluorescence, whereas interaction of poly(dGC) 2 with the ligand L induces a quenching of the fluorescence. Cu 2+ modulates the interaction with the double-stranded polynucleotides due to the conformation changes that its coordination induces in compound L. In general, the spectroscopic studies show that intercalation seems to be blocked by the formation of the metal complex. All these features suggest the possibility of using compound L as a sequence-selective fluorescence probe. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Cdc45 (cell division cycle protein 45) guards the gate of the Eukaryote Replisome helicase stabilizing leading strand engagement

    PubMed Central

    Petojevic, Tatjana; Pesavento, James J.; Costa, Alessandro; Liang, Jingdan; Wang, Zhijun; Berger, James M.; Botchan, Michael R.

    2015-01-01

    DNA replication licensing is now understood to be the pathway that leads to the assembly of double hexamers of minichromosome maintenance (Mcm2–7) at origin sites. Cell division control protein 45 (Cdc45) and GINS proteins activate the latent Mcm2–7 helicase by inducing allosteric changes through binding, forming a Cdc45/Mcm2-7/GINS (CMG) complex that is competent to unwind duplex DNA. The CMG has an active gate between subunits Mcm2 and Mcm5 that opens and closes in response to nucleotide binding. The consequences of inappropriate Mcm2/5 gate actuation and the role of a side channel formed between GINS/Cdc45 and the outer edge of the Mcm2–7 ring for unwinding have remained unexplored. Here we uncover a novel function for Cdc45. Cross-linking studies trace the path of the DNA with the CMG complex at a fork junction between duplex and single strands with the bound CMG in an open or closed gate conformation. In the closed state, the lagging strand does not pass through the side channel, but in the open state, the leading strand surprisingly interacts with Cdc45. Mutations in the recombination protein J fold of Cdc45 that ablate this interaction diminish helicase activity. These data indicate that Cdc45 serves as a shield to guard against occasional slippage of the leading strand from the core channel. PMID:25561522

  17. Simultaneous binding to the tracking strand, displaced strand and the duplex of a DNA fork enhances unwinding by Dda helicase

    PubMed Central

    Aarattuthodiyil, Suja; Byrd, Alicia K.; Raney, Kevin D.

    2014-01-01

    Interactions between helicases and the tracking strand of a DNA substrate are well-characterized; however, the role of the displaced strand is a less understood characteristic of DNA unwinding. Dda helicase exhibited greater processivity when unwinding a DNA fork compared to a ss/ds DNA junction substrate. The lag phase in the unwinding progress curve was reduced for the forked DNA compared to the ss/ds junction. Fewer kinetic steps were required to unwind the fork compared to the ss/ds junction, suggesting that binding to the fork leads to disruption of the duplex. DNA footprinting confirmed that interaction of Dda with a fork leads to two base pairs being disrupted whereas no disruption of base pairing was observed with the ss/ds junction. Neutralization of the phosphodiester backbone resulted in a DNA-footprinting pattern similar to that observed with the ss/ds junction, consistent with disruption of the interaction between Dda and the displaced strand. Several basic residues in the 1A domain which were previously proposed to bind to the incoming duplex DNA were replaced with alanines, resulting in apparent loss of interaction with the duplex. Taken together, these results suggest that Dda interaction with the tracking strand, displaced strand and duplex coordinates DNA unwinding. PMID:25249618

  18. Physical interaction between replication protein A (RPA) and MRN: involvement of RPA2 phosphorylation and the N-terminus of RPA1.

    PubMed

    Oakley, Greg G; Tillison, Kristin; Opiyo, Stephen A; Glanzer, Jason G; Horn, Jeffrey M; Patrick, Steve M

    2009-08-11

    Replication protein A (RPA) is a heterotrimeric protein consisting of RPA1, RPA2, and RPA3 subunits that binds to single-stranded DNA (ssDNA) with high affinity. The response to replication stress requires the recruitment of RPA and the MRE11-RAD50-NBS1 (MRN) complex. RPA bound to ssDNA stabilizes stalled replication forks by recruiting checkpoint proteins involved in fork stabilization. MRN can bind DNA structures encountered at stalled or collapsed replication forks, such as ssDNA-double-stranded DNA (dsDNA) junctions or breaks, and promote the restart of DNA replication. Here, we demonstrate that RPA2 phosphorylation regulates the assembly of DNA damage-induced RPA and MRN foci. Using purified proteins, we observe a direct interaction between RPA with both NBS1 and MRE11. By utilizing RPA bound to ssDNA, we demonstrate that substituting RPA with phosphorylated RPA or a phosphomimetic weakens the interaction with the MRN complex. Also, the N-terminus of RPA1 is a critical component of the RPA-MRN protein-protein interaction. Deletion of the N-terminal oligonucleotide-oligosaccharide binding fold (OB-fold) of RPA1 abrogates interactions of RPA with MRN and individual proteins of the MRN complex. Further identification of residues critical for MRN binding in the N-terminus of RPA1 shows that substitution of Arg31 and Arg41 with alanines disrupts the RPA-MRN interaction and alters cell cycle progression in response to DNA damage. Thus, the N-terminus of RPA1 and phosphorylation of RPA2 regulate RPA-MRN interactions and are important in the response to DNA damage.

  19. Lack of dependence on p53 for DNA double strand break repair of episomal vectors in human lymphoblasts

    NASA Technical Reports Server (NTRS)

    Kohli, M.; Jorgensen, T. J.

    1999-01-01

    The p53 tumor suppressor gene has been shown to be involved in a variety of repair processes, and recent findings have suggested that p53 may be involved in DNA double strand break repair in irradiated cells. The role of p53 in DNA double strand break repair, however, has not been fully investigated. In this study, we have constructed a novel Epstein-Barr virus (EBV)-based shuttle vector, designated as pZEBNA, to explore the influence of p53 on DNA strand break repair in human lymphoblasts, since EBV-based vectors do not inactivate the p53 pathway. We have compared plasmid survival of irradiated, restriction enzyme linearized, and calf intestinal alkaline phosphatase (CIP)-treated pZEBNA with a Simian virus 40 (SV40)-based shuttle vector, pZ189, in TK6 (wild-type p53) and WTK1 (mutant p53) lymphoblasts and determined that p53 does not modulate DNA double strand break repair in these cell lines. Copyright 1999 Academic Press.

  20. Biochemical evidence for Ku-independent backup pathways of NHEJ.

    PubMed

    Wang, Huichen; Perrault, Ange Ronel; Takeda, Yoshihiko; Qin, Wei; Wang, Hongyan; Iliakis, George

    2003-09-15

    Cells of higher eukaryotes process within minutes double strand breaks (DSBs) in their genome using a non-homologous end joining (NHEJ) apparatus that engages DNA-PKcs, Ku, DNA ligase IV, XRCC4 and other as of yet unidentified factors. Although chemical inhibition, or mutation, in any of these factors delays processing, cells ultimately remove the majority of DNA DSBs using an alternative pathway operating with an order of magnitude slower kinetics. This alternative pathway is active in mutants deficient in genes of the RAD52 epistasis group and frequently joins incorrect ends. We proposed, therefore, that it reflects an alternative form of NHEJ that operates as a backup (B-NHEJ) to the DNA-PK-dependent (D-NHEJ) pathway, rather than homology directed repair of DSBs. The present study investigates the role of Ku in the coordination of these pathways using as a model end joining of restriction endonuclease linearized plasmid DNA in whole cell extracts. Efficient, error-free, end joining observed in such in vitro reactions is strongly inhibited by anti-Ku antibodies. The inhibition requires DNA-PKcs, despite the fact that Ku efficiently binds DNA ends in the presence of antibodies, or in the absence of DNA-PKcs. Strong inhibition of DNA end joining is also mediated by wortmannin, an inhibitor of DNA-PKcs, in the presence but not in the absence of Ku, and this inhibition can be rescued by pre-incubating the reaction with double stranded oligonucleotides. The results are compatible with a role of Ku in directing end joining to a DNA-PK dependent pathway, mediated by efficient end binding and productive interactions with DNA-PKcs. On the other hand, efficient end joining is observed in extracts of cells lacking DNA-PKcs, as well as in Ku-depleted extracts in line with the operation of alternative pathways. Extracts depleted of Ku and DNA-PKcs rejoin blunt ends, as well as homologous ends with 3' or 5' protruding single strands with similar efficiency, but addition of Ku suppresses joining of blunt ends and homologous ends with 3' overhangs. We propose that the affinity of Ku for DNA ends, particularly when cooperating with DNA-PKcs, suppresses B-NHEJ by quickly and efficiently binding DNA ends and directing them to D-NHEJ for rapid joining. A chromatin-based model of DNA DSB rejoining accommodating biochemical and genetic results is presented and deviations between in vitro and in vivo results discussed.

  1. Biochemical evidence for Ku-independent backup pathways of NHEJ

    PubMed Central

    Wang, Huichen; Perrault, Ange Ronel; Takeda, Yoshihiko; Qin, Wei; Wang, Hongyan; Iliakis, George

    2003-01-01

    Cells of higher eukaryotes process within minutes double strand breaks (DSBs) in their genome using a non-homologous end joining (NHEJ) apparatus that engages DNA-PKcs, Ku, DNA ligase IV, XRCC4 and other as of yet unidentified factors. Although chemical inhibition, or mutation, in any of these factors delays processing, cells ultimately remove the majority of DNA DSBs using an alternative pathway operating with an order of magnitude slower kinetics. This alternative pathway is active in mutants deficient in genes of the RAD52 epistasis group and frequently joins incorrect ends. We proposed, therefore, that it reflects an alternative form of NHEJ that operates as a backup (B-NHEJ) to the DNA-PK-dependent (D-NHEJ) pathway, rather than homology directed repair of DSBs. The present study investigates the role of Ku in the coordination of these pathways using as a model end joining of restriction endonuclease linearized plasmid DNA in whole cell extracts. Efficient, error-free, end joining observed in such in vitro reactions is strongly inhibited by anti-Ku antibodies. The inhibition requires DNA-PKcs, despite the fact that Ku efficiently binds DNA ends in the presence of antibodies, or in the absence of DNA-PKcs. Strong inhibition of DNA end joining is also mediated by wortmannin, an inhibitor of DNA-PKcs, in the presence but not in the absence of Ku, and this inhibition can be rescued by pre-incubating the reaction with double stranded oligonucleotides. The results are compatible with a role of Ku in directing end joining to a DNA-PK dependent pathway, mediated by efficient end binding and productive interactions with DNA-PKcs. On the other hand, efficient end joining is observed in extracts of cells lacking DNA-PKcs, as well as in Ku-depleted extracts in line with the operation of alternative pathways. Extracts depleted of Ku and DNA-PKcs rejoin blunt ends, as well as homologous ends with 3′ or 5′ protruding single strands with similar efficiency, but addition of Ku suppresses joining of blunt ends and homologous ends with 3′ overhangs. We propose that the affinity of Ku for DNA ends, particularly when cooperating with DNA-PKcs, suppresses B-NHEJ by quickly and efficiently binding DNA ends and directing them to D-NHEJ for rapid joining. A chromatin-based model of DNA DSB rejoining accommodating biochemical and genetic results is presented and deviations between in vitro and in vivo results discussed. PMID:12954774

  2. Quantitative determination of testosterone levels with biolayer interferometry.

    PubMed

    Zhang, Hao; Li, Wei; Luo, Hong; Xiong, Guangming; Yu, Yuanhua

    2017-10-01

    Natural and synthetic steroid hormones are widely spread in the environment and are considered as pollutants due to their endocrine activities, even at low concentrations, which are harmful to human health. To detect steroid hormones in the environment, a novel biosensor system was developed based on the principle of biolayer interferometry. Detection is based on changes in the interference pattern of white light reflected from the surface of an optical fiber with bound biomolecules. Monitoring interactions between molecules does not require radioactive, enzymatic, or fluorescent labels. Here, 2 double-stranded DNA fragments of operator 1 (OP1) and OP2 containing 10-bp palindromic sequences in chromosomal Comamonas testosteroni DNA (ATCC11996) were surface-immobilized to streptavidin sensors. Interference changes were detected when repressor protein RepA bound the DNA sequences. DNA-protein interactions were characterized and kinetic parameters were obtained. The dissociation constants between the OP1 and OP2 DNA sequences and RepA were 9.865 × 10 -9  M and 2.750 × 10 -8  M, respectively. The reactions showed high specifically and affinity. Because binding of the 10-bp palindromic sequence and RepA was affected by RepA-testosterone binding, the steroid could be quantitatively determined rapidly using the biosensor system. The mechanism of the binding assay was as follows. RepA could bind both OP1 and testosterone. RepA binding to testosterone changed the protein conformation, which influenced the binding between RepA and OP1. The percentage of the signal detected negative correlation with the testosterone concentration. A standard curve was obtained, and the correlation coefficient value was approximately 0.97. We could quantitatively determine testosterone levels between 2.13 and 136.63 ng/ml. Each sample could be quantitatively detected in 17 min. These results suggested that the specific interaction between double-stranded OP1 DNA and the RepA protein could be used to rapidly and quantitatively determine environmental testosterone levels by the biolayer interferometry technique. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. TRF2/RAP1 and DNA–PK mediate a double protection against joining at telomeric ends

    PubMed Central

    Bombarde, Oriane; Boby, Céline; Gomez, Dennis; Frit, Philippe; Giraud-Panis, Marie-Josèphe; Gilson, Eric; Salles, Bernard; Calsou, Patrick

    2010-01-01

    DNA-dependent protein kinase (DNA-PK) is a double-strand breaks repair complex, the subunits of which (KU and DNA-PKcs) are paradoxically present at mammalian telomeres. Telomere fusion has been reported in cells lacking these proteins, raising two questions: how is DNA–PK prevented from initiating classical ligase IV (LIG4)-dependent non-homologous end-joining (C-NHEJ) at telomeres and how is the backup end-joining (EJ) activity (B-NHEJ) that operates at telomeres under conditions of C-NHEJ deficiency controlled? To address these questions, we have investigated EJ using plasmid substrates bearing double-stranded telomeric tracks and human cell extracts with variable C-NHEJ or B-NHEJ activity. We found that (1) TRF2/RAP1 prevents C-NHEJ-mediated end fusion at the initial DNA–PK end binding and activation step and (2) DNA–PK counteracts a potent LIG4-independent EJ mechanism. Thus, telomeres are protected against EJ by a lock with two bolts. These results account for observations with mammalian models and underline the importance of alternative non-classical EJ pathways for telomere fusions in cells. PMID:20407424

  4. Nbs1 ChIP-Seq Identifies Off-Target DNA Double-Strand Breaks Induced by AID in Activated Splenic B Cells

    PubMed Central

    Linehan, Erin K.; Schrader, Carol E.; Stavnezer, Janet

    2015-01-01

    Activation-induced cytidine deaminase (AID) is required for initiation of Ig class switch recombination (CSR) and somatic hypermutation (SHM) of antibody genes during immune responses. AID has also been shown to induce chromosomal translocations, mutations, and DNA double-strand breaks (DSBs) involving non-Ig genes in activated B cells. To determine what makes a DNA site a target for AID-induced DSBs, we identify off-target DSBs induced by AID by performing chromatin immunoprecipitation (ChIP) for Nbs1, a protein that binds DSBs, followed by deep sequencing (ChIP-Seq). We detect and characterize hundreds of off-target AID-dependent DSBs. Two types of tandem repeats are highly enriched within the Nbs1-binding sites: long CA repeats, which can form Z-DNA, and tandem pentamers containing the AID target hotspot WGCW. These tandem repeats are not nearly as enriched at AID-independent DSBs, which we also identified. Msh2, a component of the mismatch repair pathway and important for genome stability, increases off-target DSBs, similar to its effect on Ig switch region DSBs, which are required intermediates during CSR. Most of the off-target DSBs are two-ended, consistent with generation during G1 phase, similar to DSBs in Ig switch regions. However, a minority are one-ended, presumably due to conversion of single-strand breaks to DSBs during replication. One-ended DSBs are repaired by processes involving homologous recombination, including break-induced replication repair, which can lead to genome instability. Off-target DSBs, especially those present during S phase, can lead to chromosomal translocations, deletions and gene amplifications, resulting in the high frequency of B cell lymphomas derived from cells that express or have expressed AID. PMID:26263206

  5. DNA gyrase with a single catalytic tyrosine can catalyze DNA supercoiling by a nicking-closing mechanism

    PubMed Central

    Gubaev, Airat; Weidlich, Daniela; Klostermeier, Dagmar

    2016-01-01

    The topological state of DNA is important for replication, recombination and transcription, and is regulated in vivo by DNA topoisomerases. Gyrase introduces negative supercoils into DNA at the expense of ATP hydrolysis. It is the accepted view that gyrase achieves supercoiling by a strand passage mechanism, in which double-stranded DNA is cleaved, and a second double-stranded segment is passed through the gap, converting a positive DNA node into a negative node. We show here that gyrase with only one catalytic tyrosine that cleaves a single strand of its DNA substrate can catalyze DNA supercoiling without strand passage. We propose an alternative mechanism for DNA supercoiling via nicking and closing of DNA that involves trapping, segregation and relaxation of two positive supercoils. In contrast to DNA supercoiling, ATP-dependent relaxation and decatenation of DNA by gyrase lacking the C-terminal domains require both tyrosines and strand passage. Our results point towards mechanistic plasticity of gyrase and might pave the way for finding novel and specific mechanism-based gyrase inhibitors. PMID:27557712

  6. Chlorella virus DNA ligase: nick recognition and mutational analysis.

    PubMed

    Sriskanda, V; Shuman, S

    1998-01-15

    Chlorella virus PBCV-1 DNA ligase seals nicked DNA substrates consisting of a 5'-phosphate-terminated strand and a 3'-hydroxyl-terminated strand annealed to a bridging DNA template strand. The enzyme discriminates at the DNA binding step between substrates containing a 5'-phosphate versus a 5'-hydroxyl at the nick. Mutational analysis of the active site motif KxDGxR (residues 27-32) illuminates essential roles for the conserved Lys, Asp and Arg moieties at different steps of the ligase reaction. Mutant K27A is unable to form the covalent ligase-(Lys-straightepsilonN-P)-adenylate intermediate and hence cannot activate a nicked DNA substrate via formation of the DNA-adenylate intermediate. Nonetheless, K27A catalyzes phosphodiester bond formation at a pre-adenylated nick. This shows that the active site lysine is not required for the strand closure reaction. K27A binds to nicked DNA-adenylate, but not to a standard DNA nick. This suggests that occupancy of the AMP binding pocket of DNA ligase is important for nick recognition. Mutant D29A is active in enzyme-adenylate formation and binds readily to nicked DNA, but is inert in DNA-adenylate formation. R32A is unable to catalyze any of the three reactions of the ligation pathway and does not bind to nicked DNA.

  7. Strand displacement activated peroxidase activity of hemin for fluorescent DNA sensing.

    PubMed

    Wang, Quanbo; Xu, Nan; Gui, Zhen; Lei, Jianping; Ju, Huangxian; Yan, Feng

    2015-10-07

    To efficiently regulate the catalytic activity of the peroxidase mimic hemin, this work designs a double-stranded DNA probe containing an intermolecular dimer of hemin, whose peroxidase activity can be activated by a DNA strand displacement reaction. The double-stranded probe is prepared by annealing two strands of hemin labelled DNA oligonucleotides. Using the fluorescent oxidation product of tyramine by H2O2 as a tracing molecule, the low peroxidase activity of the hemin dimer ensures a low fluorescence background. The strand displacement reaction of the target DNA dissociates the hemin dimer and thus significantly increases the catalytic activity of hemin to produce a large amount of dityramine for fluorescence signal readout. Based on the strand displacement regulated peroxidase activity, a simple and sensitive homogeneous fluorescent DNA sensing method is proposed. The detection can conveniently be carried out in a 96-well plate within 20 min with a detection limit of 0.18 nM. This method shows high specificity, which can effectively distinguish single-base mismatched DNA from perfectly matched target DNA. The DNA strand displacement regulated catalytic activity of hemin has promising application in the determination of various DNA analytes.

  8. CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference.

    PubMed

    Hochstrasser, Megan L; Taylor, David W; Bhat, Prashant; Guegler, Chantal K; Sternberg, Samuel H; Nogales, Eva; Doudna, Jennifer A

    2014-05-06

    In bacteria, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) DNA-targeting complex Cascade (CRISPR-associated complex for antiviral defense) uses CRISPR RNA (crRNA) guides to bind complementary DNA targets at sites adjacent to a trinucleotide signature sequence called the protospacer adjacent motif (PAM). The Cascade complex then recruits Cas3, a nuclease-helicase that catalyzes unwinding and cleavage of foreign double-stranded DNA (dsDNA) bearing a sequence matching that of the crRNA. Cascade comprises the CasA-E proteins and one crRNA, forming a structure that binds and unwinds dsDNA to form an R loop in which the target strand of the DNA base pairs with the 32-nt RNA guide sequence. Single-particle electron microscopy reconstructions of dsDNA-bound Cascade with and without Cas3 reveal that Cascade positions the PAM-proximal end of the DNA duplex at the CasA subunit and near the site of Cas3 association. The finding that the DNA target and Cas3 colocalize with CasA implicates this subunit in a key target-validation step during DNA interference. We show biochemically that base pairing of the PAM region is unnecessary for target binding but critical for Cas3-mediated degradation. In addition, the L1 loop of CasA, previously implicated in PAM recognition, is essential for Cas3 activation following target binding by Cascade. Together, these data show that the CasA subunit of Cascade functions as an essential partner of Cas3 by recognizing DNA target sites and positioning Cas3 adjacent to the PAM to ensure cleavage.

  9. Human DNA ligase III bridges two DNA ends to promote specific intermolecular DNA end joining

    PubMed Central

    Kukshal, Vandna; Kim, In-Kwon; Hura, Gregory L.; Tomkinson, Alan E.; Tainer, John A.; Ellenberger, Tom

    2015-01-01

    Mammalian DNA ligase III (LigIII) functions in both nuclear and mitochondrial DNA metabolism. In the nucleus, LigIII has functional redundancy with DNA ligase I whereas LigIII is the only mitochondrial DNA ligase and is essential for the survival of cells dependent upon oxidative respiration. The unique LigIII zinc finger (ZnF) domain is not required for catalytic activity but senses DNA strand breaks and stimulates intermolecular ligation of two DNAs by an unknown mechanism. Consistent with this activity, LigIII acts in an alternative pathway of DNA double strand break repair that buttresses canonical non-homologous end joining (NHEJ) and is manifest in NHEJ-defective cancer cells, but how LigIII acts in joining intermolecular DNA ends versus nick ligation is unclear. To investigate how LigIII efficiently joins two DNAs, we developed a real-time, fluorescence-based assay of DNA bridging suitable for high-throughput screening. On a nicked duplex DNA substrate, the results reveal binding competition between the ZnF and the oligonucleotide/oligosaccharide-binding domain, one of three domains constituting the LigIII catalytic core. In contrast, these domains collaborate and are essential for formation of a DNA-bridging intermediate by adenylated LigIII that positions a pair of blunt-ended duplex DNAs for efficient and specific intermolecular ligation. PMID:26130724

  10. Human DNA ligase III bridges two DNA ends to promote specific intermolecular DNA end joining.

    PubMed

    Kukshal, Vandna; Kim, In-Kwon; Hura, Gregory L; Tomkinson, Alan E; Tainer, John A; Ellenberger, Tom

    2015-08-18

    Mammalian DNA ligase III (LigIII) functions in both nuclear and mitochondrial DNA metabolism. In the nucleus, LigIII has functional redundancy with DNA ligase I whereas LigIII is the only mitochondrial DNA ligase and is essential for the survival of cells dependent upon oxidative respiration. The unique LigIII zinc finger (ZnF) domain is not required for catalytic activity but senses DNA strand breaks and stimulates intermolecular ligation of two DNAs by an unknown mechanism. Consistent with this activity, LigIII acts in an alternative pathway of DNA double strand break repair that buttresses canonical non-homologous end joining (NHEJ) and is manifest in NHEJ-defective cancer cells, but how LigIII acts in joining intermolecular DNA ends versus nick ligation is unclear. To investigate how LigIII efficiently joins two DNAs, we developed a real-time, fluorescence-based assay of DNA bridging suitable for high-throughput screening. On a nicked duplex DNA substrate, the results reveal binding competition between the ZnF and the oligonucleotide/oligosaccharide-binding domain, one of three domains constituting the LigIII catalytic core. In contrast, these domains collaborate and are essential for formation of a DNA-bridging intermediate by adenylated LigIII that positions a pair of blunt-ended duplex DNAs for efficient and specific intermolecular ligation. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Isolation and characterization of naturally occurring hairpin structures in single-stranded DNA of coliphage M13

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Niyogi, S.K.; Mitra, S.

    With precise conditions of digestion with single-strand-specific nucleases, namely, endonuclease S1 of Aspergillus oryzae and exonuclease I of Escherichia coli, nuclease-resistant DNA cores can be obtained reproducibly from single-stranded M13 DNA. The DNA cores are composed almost exclusively of two sizes (60 and 44 nucleotides long). These have high (G + C)-contents relative to that of intact M13 DNA, and arise from restricted regions of the M13 genome. The resistance of these fragments to single-strand-specific nucleases and their nondenaturability strongly suggest the presence of double-stranded segments in these core pieces. That the core pieces are only partially double-stranded is shownmore » by their lack of complete base complementarity and their pattern of elution from hydroxyapatite.« less

  12. Zinc Chromate Induces Chromosome Instability and DNA Double Strand Breaks in Human Lung Cells

    PubMed Central

    Xie, Hong; Holmes, Amie L.; Young, Jamie L.; Qin, Qin; Joyce, Kellie; Pelsue, Stephen C.; Peng, Cheng; Wise, Sandra S.; Jeevarajan, Antony S.; Wallace, William T.; Hammond, Dianne; Wise, John Pierce

    2014-01-01

    Hexavalent chromium Cr(VI) is a respiratory toxicant and carcinogen, with solubility playing an important role in its carcinogenic potential. Zinc chromate, a water insoluble or ‘particulate’ Cr(VI) compound, has been shown to be carcinogenic in epidemiology studies and to induce tumors in experimental animals, but its genotoxicity is poorly understood. Our study shows that zinc chromate induced concentration-dependent increases in cytotoxicity, chromosome damage and DNA double strand breaks in human lung cells. In response to zinc chromate-induced breaks, MRE11 expression was increased and ATM and ATR were phosphorylated, indicating that the DNA double strand break repair system was initiated in the cells. In addition, our data show that zinc chromate-induced double strand breaks were only observed in the G2/M phase population, with no significant amount of double strand breaks observed in G1 and S phase cells. These data will aid in understanding the mechanisms of zinc chromate toxicity and carcinogenesis. PMID:19027772

  13. Structure of a preternary complex involving a prokaryotic NHEJ DNA polymerase.

    PubMed

    Brissett, Nigel C; Martin, Maria J; Pitcher, Robert S; Bianchi, Julie; Juarez, Raquel; Green, Andrew J; Fox, Gavin C; Blanco, Luis; Doherty, Aidan J

    2011-01-21

    In many prokaryotes, a specific DNA primase/polymerase (PolDom) is required for nonhomologous end joining (NHEJ) repair of DNA double-strand breaks (DSBs). Here, we report the crystal structure of a catalytically active conformation of Mycobacterium tuberculosis PolDom, consisting of a polymerase bound to a DNA end with a 3' overhang, two metal ions, and an incoming nucleotide but, significantly, lacking a primer strand. This structure represents a polymerase:DNA complex in a preternary intermediate state. This polymerase complex occurs in solution, stabilizing the enzyme on DNA ends and promoting nucleotide extension of short incoming termini. We also demonstrate that the invariant Arg(220), contained in a conserved loop (loop 2), plays an essential role in catalysis by regulating binding of a second metal ion in the active site. We propose that this NHEJ intermediate facilitates extension reactions involving critically short or noncomplementary DNA ends, thus promoting break repair and minimizing sequence loss during DSB repair. Copyright © 2011 Elsevier Inc. All rights reserved.

  14. Nanoparticles Affect PCR Primarily via Surface Interactions with PCR Components: Using Amino-Modified Silica-Coated Magnetic Nanoparticles as a Main Model.

    PubMed

    Bai, Yalong; Cui, Yan; Paoli, George C; Shi, Chunlei; Wang, Dapeng; Shi, Xianming

    2015-06-24

    Nanomaterials have been widely reported to affect the polymerase chain reaction (PCR). However, many studies in which these effects were observed were not comprehensive, and many of the proposed mechanisms have been primarily speculative. In this work, we used amino-modified silica-coated magnetic nanoparticles (ASMNPs, which can be collected very easily using an external magnetic field) as a model and compared them with gold nanoparticles (AuNPs, which have been studied extensively) to reveal the mechanisms by which nanoparticles affect PCR. We found that nanoparticles affect PCR primarily by binding to PCR components: (1) inhibition, (2) specifity, and (3) efficiency and yield of PCR are impacted. (1) Excess nanomaterials inhibit PCR by adsorbing to DNA polymerase, Mg(2+), oligonucleotide primers, or DNA templates. Nanoparticle surface-active groups are particularly important to this effect. (2, a) Nanomaterials do not inhibit nonspecific amplification products caused by false priming as previously surmised. It was shown that relatively low concentrations of nanoparticles inhibited the amplification of long amplicons, and increasing the amount of nanoparticles inhibited the amplification of short amplicons. This concentration phenomenon appears to be the result of the formation of "joints" upon the adsorption of ASMNPs to DNA templates. (b) Nanomaterials are able to inhibit nonspecific amplification products due to incomplete amplification by preferably adsorbing single-stranded incomplete amplification products. (3) Some types of nanomaterials, such as AuNPs, enhance the efficiency and yield of PCR because these types of nanoparticles can adsorb to single-stranded DNA more strongly than to double-stranded DNA. This behavior assists in the rapid and thorough denaturation of double-stranded DNA templates. Therefore, the interaction between the surface of nanoparticles and PCR components is sufficient to explain most of the effects of nanoparticles on PCR.

  15. Dna2 nuclease-helicase structure, mechanism and regulation by Rpa.

    PubMed

    Zhou, Chun; Pourmal, Sergei; Pavletich, Nikola P

    2015-11-02

    The Dna2 nuclease-helicase maintains genomic integrity by processing DNA double-strand breaks, Okazaki fragments and stalled replication forks. Dna2 requires ssDNA ends, and is dependent on the ssDNA-binding protein Rpa, which controls cleavage polarity. Here we present the 2.3 Å structure of intact mouse Dna2 bound to a 15-nucleotide ssDNA. The nuclease active site is embedded in a long, narrow tunnel through which the DNA has to thread. The helicase domain is required for DNA binding but not threading. We also present the structure of a flexibly-tethered Dna2-Rpa interaction that recruits Dna2 to Rpa-coated DNA. We establish that a second Dna2-Rpa interaction is mutually exclusive with Rpa-DNA interactions and mediates the displacement of Rpa from ssDNA. This interaction occurs at the nuclease tunnel entrance and the 5' end of the Rpa-DNA complex. Hence, it only displaces Rpa from the 5' but not 3' end, explaining how Rpa regulates cleavage polarity.

  16. Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Neto, J.L. Siqueira; Instituto de Biologia, UNICAMP, Campinas, SP; Lira, C.B.B.

    Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 ismore » a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres.« less

  17. Highly sensitive surface plasmon resonance biosensor for the detection of HIV-related DNA based on dynamic and structural DNA nanodevices.

    PubMed

    Diao, Wei; Tang, Min; Ding, Shijia; Li, Xinmin; Cheng, Wenbin; Mo, Fei; Yan, Xiaoyu; Ma, Hongmin; Yan, Yurong

    2018-02-15

    Early detection, diagnosis and treatment of human immune deficiency virus (HIV) infection is the key to reduce acquired immunodeficiency syndrome (AIDS) mortality. In our research, an innovative surface plasmon resonance (SPR) biosensing strategy has been developed for highly sensitive detection of HIV-related DNA based on entropy-driven strand displacement reactions (ESDRs) and double-layer DNA tetrahedrons (DDTs). ESDRs as enzyme-free and label-free signal amplification circuit can be specifically triggered by target DNA, leading to the cyclic utilization of target DNA and the formation of plentiful double-stranded DNA (dsDNA) products. Subsequently, the dsDNA products bind to the immobilized hairpin capture probes and further combine with DDTs nanostructures. Due to the high efficiency of ESDRs and large molecular weight of DDTs, the SPR response signal was enhanced dramatically. The proposed SPR biosensor could detect target DNA sensitively and specifically in a linear range from 1pM to 150nM with a detection limit of 48fM. In addition, the whole detecting process can be accomplished in 60min with high accuracy and duplicability. In particular, the developed SPR biosensor was successfully used to analyze target DNA in complex biological sample, indicating that the developed strategy is promising for rapid and early clinical diagnosis of HIV infection. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Application of Laser Micro-irradiation for Examination of Single and Double Strand Break Repair in Mammalian Cells.

    PubMed

    Holton, Nathaniel W; Andrews, Joel F; Gassman, Natalie R

    2017-09-05

    Highly coordinated DNA repair pathways exist to detect, excise and replace damaged DNA bases, and coordinate repair of DNA strand breaks. While molecular biology techniques have clarified structure, enzymatic functions, and kinetics of repair proteins, there is still a need to understand how repair is coordinated within the nucleus. Laser micro-irradiation offers a powerful tool for inducing DNA damage and monitoring the recruitment of repair proteins. Induction of DNA damage by laser micro-irradiation can occur with a range of wavelengths, and users can reliably induce single strand breaks, base lesions and double strand breaks with a range of doses. Here, laser micro-irradiation is used to examine repair of single and double strand breaks induced by two common confocal laser wavelengths, 355 nm and 405 nm. Further, proper characterization of the applied laser dose for inducing specific damage mixtures is described, so users can reproducibly perform laser micro-irradiation data acquisition and analysis.

  19. Helical filaments of human Dmc1 protein on single-stranded DNA: a cautionary tale.

    PubMed

    Yu, Xiong; Egelman, Edward H

    2010-08-20

    Proteins in the RecA/Rad51/RadA family form nucleoprotein filaments on DNA that catalyze a strand exchange reaction as part of homologous genetic recombination. Because of the centrality of this system to many aspects of DNA repair, the generation of genetic diversity, and cancer when this system fails or is not properly regulated, these filaments have been the object of many biochemical and biophysical studies. A recent paper has argued that the human Dmc1 protein, a meiotic homolog of bacterial RecA and human Rad51, forms filaments on single-stranded DNA with approximately 9 subunits per turn in contrast to the filaments formed on double-stranded DNA with approximately 6.4 subunits per turn and that the stoichiometry of DNA binding is different between these two filaments. We show using scanning transmission electron microscopy that the Dmc1 filament formed on single-stranded DNA has a mass per unit length expected from approximately 6.5 subunits per turn. More generally, we show how ambiguities in helical symmetry determination can generate incorrect solutions and why one sometimes must use other techniques, such as biochemistry, metal shadowing, or scanning transmission electron microscopy, to resolve these ambiguities. While three-dimensional reconstruction of helical filaments from EM images is a powerful tool, the intrinsic ambiguities that may be present with limited resolution are not sufficiently appreciated. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  20. DNA-mediated strand displacement facilitates sensitive electronic detection of antibodies in human serums.

    PubMed

    Dou, Baoting; Yang, Jianmei; Shi, Kai; Yuan, Ruo; Xiang, Yun

    2016-09-15

    We describe here the development of a sensitive and convenient electronic sensor for the detection of antibodies in human serums. The sensor is constructed by self-assembly formation of a mixed monolayer containing the small molecule epitope conjugated double stranded DNA probes on gold electrode. The target antibody binds the epitope on the dsDNA probe and lowers the melting temperature of the duplex, which facilitates the displacement of the antibody-linked strand of the duplex probe by an invading methylene blue-tagged single stranded DNA (MB-ssDNA) through the strand displacement reaction and leads to the capture of many MB-ssDNA on the sensor surface. Subsequent electrochemical oxidation of the methylene blue labels results in amplified current response for sensitive monitoring of the antibodies. The antibody assay conditions are optimized and the sensor exhibits a linear range between 1.0 and 25.0nM with a detection limit of 0.67nM for the target antibody. The sensor is also selective and can be employed to detect the target antibodies in human serum samples. With the advantages of using small molecule epitope as the antibody recognition element over traditional antigen, the versatile manipulability of the DNA probes and the unique properties of the electrochemical transduction technique, the developed sensor thus hold great potential for simple and sensitive detection of different antibodies and other proteins in real samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

    PubMed Central

    Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

    2017-01-01

    In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

  2. A simple procedure for parallel sequence analysis of both strands of 5'-labeled DNA.

    PubMed

    Razvi, F; Gargiulo, G; Worcel, A

    1983-08-01

    Ligation of a 5'-labeled DNA restriction fragment results in a circular DNA molecule carrying the two 32Ps at the reformed restriction site. Double digestions of the circular DNA with the original enzyme and a second restriction enzyme cleavage near the labeled site allows direct chemical sequencing of one 5'-labeled DNA strand. Similar double digestions, using an isoschizomer that cleaves differently at the 32P-labeled site, allows direct sequencing of the now 3'-labeled complementary DNA strand. It is possible to directly sequence both strands of cloned DNA inserts by using the above protocol and a multiple cloning site vector that provides the necessary restriction sites. The simultaneous and parallel visualization of both DNA strands eliminates sequence ambiguities. In addition, the labeled circular molecules are particularly useful for single-hit DNA cleavage studies and DNA footprint analysis. As an example, we show here an analysis of the micrococcal nuclease-induced breaks on the two strands of the somatic 5S RNA gene of Xenopus borealis, which suggests that the enzyme may recognize and cleave small AT-containing palindromes along the DNA helix.

  3. Spectroscopic and microcalorimetric studies on the molecular binding of food colorant acid red 27 with deoxyribonucleic acid.

    PubMed

    Basu, Anirban; Kumar, Gopinatha Suresh

    2016-08-01

    Interaction of the food colorant acid red 27 with double stranded DNA was investigated using spectroscopic and calorimetric methods. Absorbance and fluorescence studies suggested an intimate binding interaction between the dye and DNA. The quantum efficiency value testified an effective energy transfer from the DNA base pairs to the dye molecules. Minor groove displacement assay with Hoechst 33258 revealed that the binding occurs in the minor groove of DNA. Circular dichroism studies revealed that acid red 27 induces moderate conformational perturbations in DNA. Results of calorimetric studies suggested that the complexation process was driven largely by positive entropic contribution with a smaller favorable enthalpy contribution. The equilibrium constant of the binding was calculated to be (3.04 ± 0.09) × 10(4)  M(-1) at 298.15 K. Negative heat capacity value along with the enthalpy-entropy compensation phenomenon established the involvement of dominant hydrophobic forces in the binding process. Differential scanning calorimetry studies presented evidence for an increased thermal stability of DNA on binding of acid red 27. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  4. RPA homologs and ssDNA processing during meiotic recombination.

    PubMed

    Ribeiro, Jonathan; Abby, Emilie; Livera, Gabriel; Martini, Emmanuelle

    2016-06-01

    Meiotic homologous recombination is a specialized process that involves homologous chromosome pairing and strand exchange to guarantee proper chromosome segregation and genetic diversity. The formation and repair of DNA double-strand breaks (DSBs) during meiotic recombination differs from those during mitotic recombination in that the homologous chromosome rather than the sister chromatid is the preferred repair template. The processing of single-stranded DNA (ssDNA) formed on intermediate recombination structures is central to driving the specific outcomes of DSB repair during meiosis. Replication protein A (RPA) is the main ssDNA-binding protein complex involved in DNA metabolism. However, the existence of RPA orthologs in plants and the recent discovery of meiosis specific with OB domains (MEIOB), a widely conserved meiosis-specific RPA1 paralog, strongly suggest that multiple RPA complexes evolved and specialized to subdivide their roles during DNA metabolism. Here we review ssDNA formation and maturation during mitotic and meiotic recombination underlying the meiotic specific features. We describe and discuss the existence and properties of MEIOB and multiple RPA subunits in plants and highlight how they can provide meiosis-specific fates to ssDNA processing during homologous recombination. Understanding the functions of these RPA homologs and how they interact with the canonical RPA subunits is of major interest in the fields of meiosis and DNA repair.

  5. Comparison of specific binding sites for Escherichia coli RNA polymerase with naturally occurring hairpin regions in single-stranded DNA of coliphage M13. [Aspergillus oryzae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Niyogi, S.K.; Mitra, S.

    Escherichia coli RNA polymerase binds specifically to the single-stranded circular DNA of coliphage M13 in the presence of a saturating concentration of the bacterial DNA binding protein presumably as an essential step in the synthesis of the RNA primer required for synthesizing the complementary DNA strand in parental replicative-form DNA. The RNA polymerase-protected DNA regions were isolated after extensive digestion with pancreatic DNase, S1 endonuclease of Aspergillus oryzae, and exonuclease I of E. coli. The physicochemical properties of the RNA polymerase-protected segments (called PI and PII) were compared with those of the naturally occurring hairpin regions.

  6. Light-Triggered Release of DNA from Plasmon-Resonant Nanoparticles

    NASA Astrophysics Data System (ADS)

    Huschka, Ryan

    Plasmon-resonant nanoparticle complexes show promising potential for lighttriggered, controllable delivery of deoxyribonucleic acids (DNA) for research and therapeutic purposes. For example, the approach of RNA interference (RNAi) . using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein . is very useful in dissecting genetic function and holds promise as a molecular therapeutic. Herein, we investigate the mechanism and probe the in vitro therapeutic potential of DNA light-triggered release from plasmonic nanoparticles. First, we investigate the mechanism of light-triggered release by dehybridizing double-stranded (dsDNA) via laser illumination from two types of nanoparticle substrates: gold (Au) nanoshells and Au nanorods. Both light-triggered and thermally induced releases are distinctly observable from nanoshell-based complexes. Surprisingly, no analogous measurable light-triggered release was observable from nanorod-based complexes below the DNA melting temperature. These results suggest that a nonthermal mechanism may play a role in light-triggered DNA release. Second, we demonstrate the in vitro light-triggered release of molecules noncovalently attached within dsDNA bound to the Au nanoshell surface. DAPI (4',6- diamidino-2-phenylindole), a bright blue fluorescent molecule that binds reversibly to double-stranded DNA, was chosen to visualize this intracellular light-induced release process. Illumination through the cell membrane of the nanoshell-dsDNA-DAPI complexes dehybridizes the DNA and releases the DAPI molecules within living cells. The DAPI molecules diffuse to the nucleus and associate with the cell's endogenous DNA. This work could have future applications towards drug delivery of molecules that associate with dsDNA. Finally, we demonstrate an engineered Au nanoshell (AuNS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer coated onto the AuNS surface (AuNS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotide, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and GFP gene silencing mediated by AuNS-PLL delivery vector. The light-triggered release of oligonucleotides could have broad applications in the study of cellular processes and in the development of intracellular targeted therapies.

  7. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA.

    PubMed

    Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V

    2015-03-04

    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

  8. Regulation of yeast DNA polymerase δ-mediated strand displacement synthesis by 5′-flaps

    PubMed Central

    Koc, Katrina N.; Stodola, Joseph L.; Burgers, Peter M.; Galletto, Roberto

    2015-01-01

    The strand displacement activity of DNA polymerase δ is strongly stimulated by its interaction with proliferating cell nuclear antigen (PCNA). However, inactivation of the 3′–5′ exonuclease activity is sufficient to allow the polymerase to carry out strand displacement even in the absence of PCNA. We have examined in vitro the basic biochemical properties that allow Pol δ-exo− to carry out strand displacement synthesis and discovered that it is regulated by the 5′-flaps in the DNA strand to be displaced. Under conditions where Pol δ carries out strand displacement synthesis, the presence of long 5′-flaps or addition in trans of ssDNA suppress this activity. This suggests the presence of a secondary DNA binding site on the enzyme that is responsible for modulation of strand displacement activity. The inhibitory effect of a long 5′-flap can be suppressed by its interaction with single-stranded DNA binding proteins. However, this relief of flap-inhibition does not simply originate from binding of Replication Protein A to the flap and sequestering it. Interaction of Pol δ with PCNA eliminates flap-mediated inhibition of strand displacement synthesis by masking the secondary DNA site on the polymerase. These data suggest that in addition to enhancing the processivity of the polymerase PCNA is an allosteric modulator of other Pol δ activities. PMID:25813050

  9. Molecular docking studies of curcumin natural derivatives with DNA topoisomerase I and II-DNA complexes.

    PubMed

    Kumar, Anil; Bora, Utpal

    2014-12-01

    DNA topoisomerase I (topo I) and II (topo II) are essential enzymes that solve the topological problems of DNA by allowing DNA strands or double helices to pass through each other during cellular processes such as replication, transcription, recombination, and chromatin remodeling. Their critical roles make topoisomerases an attractive drug target against cancer. The present molecular docking study provides insights into the inhibition of topo I and II by curcumin natural derivatives. The binding modes suggested that curcumin natural derivatives docked at the site of DNA cleavage parallel to the axis of DNA base pairing. Cyclocurcumin and curcumin sulphate were predicted to be the most potent inhibitors amongst all the curcumin natural derivatives docked. The binding modes of cyclocurcumin and curcumin sulphate were similar to known inhibitors of topo I and II. Residues like Arg364, Asn722 and base A113 (when docked to topo I-DNA complex) and residues Asp479, Gln778 and base T9 (when docked to topo II-DNA complex) seem to play important role in the binding of curcumin natural derivatives at the site of DNA cleavage.

  10. Isohelical DNA-Binding Oligomers: Antiviral Activity and Application for the Design of Nanostructured Devices

    NASA Astrophysics Data System (ADS)

    Gursky, Georgy; Nikitin, Alexei; Surovaya, Anna; Grokhovsky, Sergey; Andronova, Valeria; Galegov, Georgy

    We performed a systematic search for new structural motifs isohelical to double-stranded DNA and found five motifs that can be used for the design and synthesis of new DNA-binding oligomers. Some of the DNA-binding oligomers can be equipped with fluorescence chromophores and metal-chelating groups and may serve as conductive wires in nano-scaled electric circuits. A series of new DNA-binding ligands were synthesized by a modular assembly of pyrrole carboxamides and novel pseudopeptides of the form (XY)n. Here, Y is a glycine residue; n is the degree of polymerization. X is an unusual amino acid residue containing a five-membered aromatic ring. Antiviral activity of bis-linked netropsin derivatives is studied. Bis-netropsins containing 15 and 31 lysine residues at the N-termini inhibit most effectively reproduction of the herpes virus type 1 in the Vero cell culture, including virus variants resistant to acyclovir and its analogues. Antiviral activity of bis-linked netropsin derivatives is correlated with their ability to interact with long clusters of AT-base pairs in the origin of replication of the viral DNA.

  11. Crystal structure of a CRISPR RNA-guided surveillance complex bound to a ssDNA target

    PubMed Central

    Mulepati, Sabin; Héroux, Annie; Bailey, Scott

    2015-01-01

    In prokaryotes, RNA derived from type I and type III CRISPR loci direct large ribonucleoprotein complexes to destroy invading bacteriophage and plasmids. In Escherichia coli, this 405-kDa complex is called Cascade. Here we report the 3.03Å crystal structure of Cascade bound to a single-stranded DNA target. The structure reveals that the CRISPR RNA and target strands do not form a double helix but instead adopt an underwound ribbon-like structure. This non-canonical structure is facilitated by rotation of every sixth nucleotide out of the RNA-DNA hybrid and is stabilized by the highly interlocked organization of protein subunits. These studies provide insight into both the assembly and the activity of this complex and suggest a mechanism to enforce fidelity of target binding. PMID:25123481

  12. Evaluation of the Comet Assay for Assessing the Dose-Response Relationship of DNA Damage Induced by Ionizing Radiation

    PubMed Central

    Wang, Yan; Xu, Chang; Du, Li Qing; Cao, Jia; Liu, Jian Xiang; Su, Xu; Zhao, Hui; Fan, Fei-Yue; Wang, Bing; Katsube, Takanori; Fan, Sai Jun; Liu, Qiang

    2013-01-01

    Dose- and time-response curves were combined to assess the potential of the comet assay in radiation biodosimetry. The neutral comet assay was used to detect DNA double-strand breaks in lymphocytes caused by γ-ray irradiation. A clear dose-response relationship with DNA double-strand breaks using the comet assay was found at different times after irradiation (p < 0.001). A time-response relationship was also found within 72 h after irradiation (p < 0.001). The curves for DNA double-strand breaks and DNA repair in vitro of human lymphocytes presented a nice model, and a smooth, three-dimensional plane model was obtained when the two curves were combined. PMID:24240807

  13. Influence of the DNA structure on the free radical induction due to proflavine and light treatment.

    PubMed

    Piette, J; Calberg-Bacq, C M; Van de Vorst, A

    1979-04-30

    Induction of peroxide free radicals (detected by Electron Paramagnetic Resonance at 77 K) due to the photodynamic activity of proflavine was measured on bacteriophage phi X174 DNA either single-stranded (ss) as isolated from the virion, or double-stranded supercoiled (RFI) as isolated from the infected bacteria. Comparison was made with calf thymus DNA photosensitization. In order to use equivalent DNA-proflavine complexes, binding of the dye to the three DNA's was first determined under those conditions of high ionic strength favourable to the photodynamic reaction. Free radical induction was maximal for definite amounts of bound proflavine (which varied depending upon the DNA substrate) and at an ionic strength value of 0.5. The level of the maximal reaction increased in the following order: from phi Xss DNA to calf thymus DNA and finally to phi XRFI DNA. The conformation of the proflavine-DNA complex was thus a determinant for the efficiency of the photodynamic process. The ionic strength effect could not be explained by the evolution of the proflavine triplet state in irradiated proflavine-calf thymus DNA complexes.

  14. Triplex-forming oligonucleotides: a third strand for DNA nanotechnology

    PubMed Central

    2018-01-01

    Abstract DNA self-assembly has proved to be a useful bottom-up strategy for the construction of user-defined nanoscale objects, lattices and devices. The design of these structures has largely relied on exploiting simple base pairing rules and the formation of double-helical domains as secondary structural elements. However, other helical forms involving specific non-canonical base-base interactions have introduced a novel paradigm into the process of engineering with DNA. The most notable of these is a three-stranded complex generated by the binding of a third strand within the duplex major groove, generating a triple-helical (‘triplex’) structure. The sequence, structural and assembly requirements that differentiate triplexes from their duplex counterparts has allowed the design of nanostructures for both dynamic and/or structural purposes, as well as a means to target non-nucleic acid components to precise locations within a nanostructure scaffold. Here, we review the properties of triplexes that have proved useful in the engineering of DNA nanostructures, with an emphasis on applications that hitherto have not been possible by duplex formation alone. PMID:29228337

  15. Introduction of structural affinity handles as a tool in selective nucleic acid separations

    NASA Technical Reports Server (NTRS)

    Willson, III, Richard Coale (Inventor); Cano, Luis Antonio (Inventor)

    2011-01-01

    The method is used for separating nucleic acids and other similar constructs. It involves selective introduction, enhancement, or stabilization of affinity handles such as single-strandedness in the undesired (or desired) nucleic acids as compared to the usual structure (e.g., double-strandedness) of the desired (or undesired) nucleic acids. The undesired (or desired) nucleic acids are separated from the desired (or undesired) nucleic acids due to capture by methods including but not limited to immobilized metal affinity chromatography, immobilized single-stranded DNA binding (SSB) protein, and immobilized oligonucleotides. The invention is useful to: remove contaminating genomic DNA from plasmid DNA; remove genomic DNA from plasmids, BACs, and similar constructs; selectively separate oligonucleotides and similar DNA fragments from their partner strands; purification of aptamers, (deoxy)-ribozymes and other highly structured nucleic acids; Separation of restriction fragments without using agarose gels; manufacture recombinant Taq polymerase or similar products that are sensitive to host genomic DNA contamination; and other applications.

  16. Mapping DNA cleavage by the Type ISP restriction-modification enzymes following long-range communication between DNA sites in different orientations

    PubMed Central

    van Aelst, Kara; Saikrishnan, Kayarat; Szczelkun, Mark D.

    2015-01-01

    The prokaryotic Type ISP restriction-modification enzymes are single-chain proteins comprising an Mrr-family nuclease, a superfamily 2 helicase-like ATPase, a coupler domain, a methyltransferase, and a DNA-recognition domain. Upon recognising an unmodified DNA target site, the helicase-like domain hydrolyzes ATP to cause site release (remodeling activity) and to then drive downstream translocation consuming 1–2 ATP per base pair (motor activity). On an invading foreign DNA, double-strand breaks are introduced at random wherever two translocating enzymes form a so-called collision complex following long-range communication between a pair of target sites in inverted (head-to-head) repeat. Paradoxically, structural models for collision suggest that the nuclease domains are too far apart (>30 bp) to dimerise and produce a double-strand DNA break using just two strand-cleavage events. Here, we examined the organisation of different collision complexes and how these lead to nuclease activation. We mapped DNA cleavage when a translocating enzyme collides with a static enzyme bound to its site. By following communication between sites in both head-to-head and head-to-tail orientations, we could show that motor activity leads to activation of the nuclease domains via distant interactions of the helicase or MTase-TRD. Direct nuclease dimerization is not required. To help explain the observed cleavage patterns, we also used exonuclease footprinting to demonstrate that individual Type ISP domains can swing off the DNA. This study lends further support to a model where DNA breaks are generated by multiple random nicks due to mobility of a collision complex with an overall DNA-binding footprint of ∼30 bp. PMID:26507855

  17. Herpes Simplex Virus Processivity Factor UL42 Imparts Increased DNA-Binding Specificity to the Viral DNA Polymerase and Decreased Dissociation from Primer-Template without Reducing the Elongation Rate

    PubMed Central

    Weisshart, Klaus; Chow, Connie S.; Coen, Donald M.

    1999-01-01

    Herpes simplex virus DNA polymerase consists of a catalytic subunit, Pol, and a processivity subunit, UL42, that, unlike other established processivity factors, binds DNA directly. We used gel retardation and filter-binding assays to investigate how UL42 affects the polymerase-DNA interaction. The Pol/UL42 heterodimer bound more tightly to DNA in a primer-template configuration than to single-stranded DNA (ssDNA), while Pol alone bound more tightly to ssDNA than to DNA in a primer-template configuration. The affinity of Pol/UL42 for ssDNA was reduced severalfold relative to that of Pol, while the affinity of Pol/UL42 for primer-template DNA was increased ∼15-fold relative to that of Pol. The affinity of Pol/UL42 for circular double-stranded DNA (dsDNA) was reduced drastically relative to that of UL42, but the affinity of Pol/UL42 for short primer-templates was increased modestly relative to that of UL42. Pol/UL42 associated with primer-template DNA ∼2-fold faster than did Pol and dissociated ∼10-fold more slowly, resulting in a half-life of 2 h and a subnanomolar Kd. Despite such stable binding, rapid-quench analysis revealed that the rates of elongation of Pol/UL42 and Pol were essentially the same, ∼30 nucleotides/s. Taken together, these studies indicate that (i) Pol/UL42 is more likely than its subunits to associate with DNA in a primer-template configuration rather than nonspecifically to either ssDNA or dsDNA, and (ii) UL42 reduces the rate of dissociation from primer-template DNA but not the rate of elongation. Two models of polymerase-DNA interactions during replication that may explain these findings are presented. PMID:9847307

  18. Inactivation of the budding yeast cohesin loader Scc2 alters gene expression both globally and in response to a single DNA double strand break

    PubMed Central

    Lindgren, Emma; Hägg, Sara; Giordano, Fosco; Björkegren, Johan; Ström, Lena

    2014-01-01

    Genome integrity is fundamental for cell survival and cell cycle progression. Important mechanisms for keeping the genome intact are proper sister chromatid segregation, correct gene regulation and efficient repair of damaged DNA. Cohesin and its DNA loader, the Scc2/4 complex have been implicated in all these cellular actions. The gene regulation role has been described in several organisms. In yeast it has been suggested that the proteins in the cohesin network would effect transcription based on its role as insulator. More recently, data are emerging indicating direct roles for gene regulation also in yeast. Here we extend these studies by investigating whether the cohesin loader Scc2 is involved in regulation of gene expression. We performed global gene expression profiling in the absence and presence of DNA damage, in wild type and Scc2 deficient G2/M arrested cells, when it is known that Scc2 is important for DNA double strand break repair and formation of damage induced cohesion. We found that not only the DNA damage specific transcriptional response is distorted after inactivation of Scc2 but also the overall transcription profile. Interestingly, these alterations did not correlate with changes in cohesin binding. PMID:25483075

  19. A double chain reversal loop and two diagonal loops define the architecture of a unimolecular DNA quadruplex containing a pair of stacked G(syn)-G(syn)-G(anti)-G(anti) tetrads flanked by a G-(T-T) Triad and a T-T-T triple.

    PubMed

    Kuryavyi, V; Majumdar, A; Shallop, A; Chernichenko, N; Skripkin, E; Jones, R; Patel, D J

    2001-06-29

    The architecture of G-G-G-G tetrad-aligned DNA quadruplexes in monovalent cation solution is dependent on the directionality of the four strands, which in turn are defined by loop connectivities and the guanine syn/anti distribution along individual strands and within individual G-G-G-G tetrads. The smallest unimolecular G-quadruplex belongs to the d(G2NnG2NnG2NnG2) family, which has the potential to form two stacked G-tetrads linked by Nn loop connectivities. Previous studies have focused on the thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2), where Nn was T2 for the first and third connecting loops and TGT for the middle connecting loop. This DNA aptamer in K(+) cation solution forms a unimolecular G-quadruplex stabilized by two stacked G(syn)-G(anti)-G(syn)-G(anti) tetrads, adjacent strands which are antiparallel to each other and edge-wise connecting T2, TGT and T2 loops. We now report on the NMR-based solution structure of the d(G2T4G2CAG2GT4G2T) sequence, which differs from the thrombin-binding DNA aptamer sequence in having longer first (T4) and third (GT4) loops and a shorter (CA) middle loop. This d(G2T4G2CAG2GT4G2T) sequence in Na(+) cation solution forms a unimolecular G-quadruplex stabilized by two stacked G(syn)-G(syn)-G(anti)-G(anti) tetrads, adjacent strands which have one parallel and one antiparallel neighbors and distinct non-edge-wise loop connectivities. Specifically, the longer first (T4) and third (GT4) loops are of the diagonal type while the shorter middle loop is of the double chain reversal type. In addition, the pair of stacked G-G-G-G tetrads are flanked on one side by a G-(T-T) triad and on the other side by a T-T-T triple. The distinct differences in strand directionalities, loop connectivities and syn/anti distribution within G-G-G-G tetrads between the thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2) quadruplex reported previously, and the d(G2T4G2CAG2GT4G2T) quadruplex reported here, reinforces the polymorphic nature of higher-order DNA architectures. Further, these two small unimolecular G-quadruplexes, which are distinct from each other and from parallel-stranded G-quadruplexes, provide novel targets for ligand recognition. Our results demonstrate that the double chain reversal loop connectivity identified previously by our laboratory within the Tetrahymena telomere d(T2G4)4 quadruplex, is a robust folding topology, since it has now also been observed within the d(G2T4G2CAG2GT4G2T) quadruplex. The identification of a G-(T-T) triad and a T-T-T triple, expands on the available recognition alignments for base triads and triples. Copyright 2001 Academic Press.

  20. Dissimilar Kinetic Behavior of Electrically Manipulated Single- and Double-Stranded DNA Tethered to a Gold Surface

    PubMed Central

    Rant, Ulrich; Arinaga, Kenji; Tornow, Marc; Kim, Yong Woon; Netz, Roland R.; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard

    2006-01-01

    We report on the electrical manipulation of single- and double-stranded oligodeoxynucleotides that are end tethered to gold surfaces in electrolyte solution. The response to alternating repulsive and attractive electric surface fields is studied by time-resolved fluorescence measurements, revealing markedly distinct dynamics for the flexible single-stranded and stiff double-stranded DNA, respectively. Hydrodynamic simulations rationalize this finding and disclose two different kinetic mechanisms: stiff polymers undergo rotation around the anchoring pivot point; flexible polymers, on the other hand, are pulled onto the attracting surface segment by segment. PMID:16473909

  1. Dissimilar kinetic behavior of electrically manipulated single- and double-stranded DNA tethered to a gold surface.

    PubMed

    Rant, Ulrich; Arinaga, Kenji; Tornow, Marc; Kim, Yong Woon; Netz, Roland R; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard

    2006-05-15

    We report on the electrical manipulation of single- and double-stranded oligodeoxynucleotides that are end tethered to gold surfaces in electrolyte solution. The response to alternating repulsive and attractive electric surface fields is studied by time-resolved fluorescence measurements, revealing markedly distinct dynamics for the flexible single-stranded and stiff double-stranded DNA, respectively. Hydrodynamic simulations rationalize this finding and disclose two different kinetic mechanisms: stiff polymers undergo rotation around the anchoring pivot point; flexible polymers, on the other hand, are pulled onto the attracting surface segment by segment.

  2. Optical tweezers reveal how proteins alter replication

    NASA Astrophysics Data System (ADS)

    Chaurasiya, Kathy

    Single molecule force spectroscopy is a powerful method that explores the DNA interaction properties of proteins involved in a wide range of fundamental biological processes such as DNA replication, transcription, and repair. We use optical tweezers to capture and stretch a single DNA molecule in the presence of proteins that bind DNA and alter its mechanical properties. We quantitatively characterize the DNA binding mechanisms of proteins in order to provide a detailed understanding of their function. In this work, we focus on proteins involved in replication of Escherichia coli (E. coli ), endogenous eukaryotic retrotransposons Ty3 and LINE-1, and human immunodeficiency virus (HIV). DNA polymerases replicate the entire genome of the cell, and bind both double-stranded DNA (dsDNA) and single-stranded DNA (ssDNA) during DNA replication. The replicative DNA polymerase in the widely-studied model system E. coli is the DNA polymerase III subunit alpha (DNA pol III alpha). We use optical tweezers to determine that UmuD, a protein that regulates bacterial mutagenesis through its interactions with DNA polymerases, specifically disrupts alpha binding to ssDNA. This suggests that UmuD removes alpha from its ssDNA template to allow DNA repair proteins access to the damaged DNA, and to facilitate exchange of the replicative polymerase for an error-prone translesion synthesis (TLS) polymerase that inserts nucleotides opposite the lesions, so that bacterial DNA replication may proceed. This work demonstrates a biophysical mechanism by which E. coli cells tolerate DNA damage. Retroviruses and retrotransposons reproduce by copying their RNA genome into the nuclear DNA of their eukaryotic hosts. Retroelements encode proteins called nucleic acid chaperones, which rearrange nucleic acid secondary structure and are therefore required for successful replication. The chaperone activity of these proteins requires strong binding affinity for both single- and double-stranded nucleic acids. We use single molecule DNA stretching to show that the nucleocapsid protein (NC) of the yeast retrotransposon Ty3, which is likely to be an ancestor of HIV NC, has optimal nucleic acid chaperone activity with only a single zinc finger. We also show that the chaperone activity of the ORF1 protein is responsible for successful replication of the mouse LINE-1 retrotransposon. LINE-1 is also 17% of the human genome, where it generates insertion mutations and alters gene expression. Retrotransposons such as LINE-1 and Ty3 are likely to be ancestors of retroviruses such as HIV. Human APOBEC3G (A3G) inhibits HIV-1 replication via cytidine deamination of the viral ssDNA genome, as well as via a distinct deamination-independent mechanism. Efficient deamination requires rapid on-off binding kinetics, but a slow dissociation rate is required for the proposed deaminase-independent mechanism. We resolve this apparent contradiction with a new quantitative single molecule method, which shows that A3G initially binds ssDNA with fast on-off rates and subsequently converts to a slow binding mode. This suggests that oligomerization transforms A3G from a fast enzyme to a slow binding protein, which is the biophysical mechanism that allows A3G to inhibit HIV replication. A complete understanding of the mechanism of A3G-mediated antiviral activity is required to design drugs that disrupt the viral response to A3G, enhance A3G packaging inside the viral core, and other potential strategies for long-term treatment of HIV infection. We use single molecule biophysics to explore the function of proteins involved in bacterial DNA replication, endogenous retrotransposition of retroelements in eukaryotic hosts such yeast and mice, and HIV replication in human cells. Our quantitative results provide insight into protein function in a range of complex biological systems and have wide-ranging implications for human health.

  3. A critical role for topoisomerase IIb and DNA double strand breaks in transcription

    PubMed Central

    Calderwood, Stuart K.

    2016-01-01

    ABSTRACT Recent studies have indicated a novel role for topoisomerase IIb in transcription. Transcription of heat shock genes, serum-induced immediate early genes and nuclear receptor-activated genes, each required DNA double strands generated by topoisomerase IIb. Such strand breaks seemed both necessary and sufficient for transcriptional activation. In addition, such transcription was associated with initiation of the DNA damage response pathways, including the activation of the enzymes: ataxia-telangiectasia mutated (ATM), DNA-dependent protein kinase and poly (ADP ribose) polymerase 1. DNA damage response signaling was involved both in transcription and in repair of DNA breaks generated by topoisomerase IIb. PMID:27100743

  4. A critical role for topoisomerase IIb and DNA double strand breaks in transcription.

    PubMed

    Calderwood, Stuart K

    2016-05-26

    Recent studies have indicated a novel role for topoisomerase IIb in transcription. Transcription of heat shock genes, serum-induced immediate early genes and nuclear receptor-activated genes, each required DNA double strands generated by topoisomerase IIb. Such strand breaks seemed both necessary and sufficient for transcriptional activation. In addition, such transcription was associated with initiation of the DNA damage response pathways, including the activation of the enzymes: ataxia-telangiectasia mutated (ATM), DNA-dependent protein kinase and poly (ADP ribose) polymerase 1. DNA damage response signaling was involved both in transcription and in repair of DNA breaks generated by topoisomerase IIb.

  5. Controlling Valence of DNA-Coated Emulsion Droplets with Multiple Flavors of DNA

    NASA Astrophysics Data System (ADS)

    McMullen, Angus; Bargteil, Dylan; Pine, David; Brujic, Jasna

    We explore the control of valence of DNA-coated emulsion droplets as a first step in developing DNA-directed self-assembly of emulsions. Emulsion droplets differ from solid colloids in that they are deformable and the DNA strands attached to them are free to move along the emulsion surface. The balance of binding energy and droplet deformation provides control over a droplet's valence via its ligand density. After binding, some DNA often remains unbound due to the entropic cost of DNA recruitment. In practice, therefore, the assembly kinetics yield a distribution in valence. Our goal is to control valence by altering the binding kinetics with multiple flavors of DNA. We coat one set of droplets with two DNA types, A and B, and two other sets with one complementary strand, A' or B'. When an AB droplet binds to an A' droplet, the adhesion patch depletes A strands, leaving the rest of the droplet coated with more B than A strands. This increases the chance that the next droplet to bind will be a B' rather than an A'. Controlling valence will allow us to build a wide array of soft structures, such as emulsion polymers or networks with a determined coordination number. This work was supported by the NSF MRSEC Program (DMR-0820341).

  6. GC-Rich Extracellular DNA Induces Oxidative Stress, Double-Strand DNA Breaks, and DNA Damage Response in Human Adipose-Derived Mesenchymal Stem Cells.

    PubMed

    Kostyuk, Svetlana; Smirnova, Tatiana; Kameneva, Larisa; Porokhovnik, Lev; Speranskij, Anatolij; Ershova, Elizaveta; Stukalov, Sergey; Izevskaya, Vera; Veiko, Natalia

    2015-01-01

    Cell free DNA (cfDNA) circulates throughout the bloodstream of both healthy people and patients with various diseases. CfDNA is substantially enriched in its GC-content as compared with human genomic DNA. Exposure of haMSCs to GC-DNA induces short-term oxidative stress (determined with H2DCFH-DA) and results in both single- and double-strand DNA breaks (comet assay and γH2AX, foci). As a result in the cells significantly increases the expression of repair genes (BRCA1 (RT-PCR), PCNA (FACS)) and antiapoptotic genes (BCL2 (RT-PCR and FACS), BCL2A1, BCL2L1, BIRC3, and BIRC2 (RT-PCR)). Under the action of GC-DNA the potential of mitochondria was increased. Here we show that GC-rich extracellular DNA stimulates adipocyte differentiation of human adipose-derived mesenchymal stem cells (haMSCs). Exposure to GC-DNA leads to an increase in the level of RNAPPARG2 and LPL (RT-PCR), in the level of fatty acid binding protein FABP4 (FACS analysis) and in the level of fat (Oil Red O). GC-rich fragments in the pool of cfDNA can potentially induce oxidative stress and DNA damage response and affect the direction of mesenchymal stem cells differentiation in human adipose-derived mesenchymal stem cells. Such a response may be one of the causes of obesity or osteoporosis.

  7. GC-Rich Extracellular DNA Induces Oxidative Stress, Double-Strand DNA Breaks, and DNA Damage Response in Human Adipose-Derived Mesenchymal Stem Cells

    PubMed Central

    Smirnova, Tatiana; Kameneva, Larisa; Porokhovnik, Lev; Speranskij, Anatolij; Ershova, Elizaveta; Stukalov, Sergey; Izevskaya, Vera; Veiko, Natalia

    2015-01-01

    Background. Cell free DNA (cfDNA) circulates throughout the bloodstream of both healthy people and patients with various diseases. CfDNA is substantially enriched in its GC-content as compared with human genomic DNA. Principal Findings. Exposure of haMSCs to GC-DNA induces short-term oxidative stress (determined with H2DCFH-DA) and results in both single- and double-strand DNA breaks (comet assay and γH2AX, foci). As a result in the cells significantly increases the expression of repair genes (BRCA1 (RT-PCR), PCNA (FACS)) and antiapoptotic genes (BCL2 (RT-PCR and FACS), BCL2A1, BCL2L1, BIRC3, and BIRC2 (RT-PCR)). Under the action of GC-DNA the potential of mitochondria was increased. Here we show that GC-rich extracellular DNA stimulates adipocyte differentiation of human adipose-derived mesenchymal stem cells (haMSCs). Exposure to GC-DNA leads to an increase in the level of RNAPPARG2 and LPL (RT-PCR), in the level of fatty acid binding protein FABP4 (FACS analysis) and in the level of fat (Oil Red O). Conclusions. GC-rich fragments in the pool of cfDNA can potentially induce oxidative stress and DNA damage response and affect the direction of mesenchymal stem cells differentiation in human adipose—derived mesenchymal stem cells. Such a response may be one of the causes of obesity or osteoporosis. PMID:26273425

  8. DNA Binding of Centromere Protein C (CENPC) Is Stabilized by Single-Stranded RNA

    PubMed Central

    Du, Yaqing; Topp, Christopher N.; Dawe, R. Kelly

    2010-01-01

    Centromeres are the attachment points between the genome and the cytoskeleton: centromeres bind to kinetochores, which in turn bind to spindles and move chromosomes. Paradoxically, the DNA sequence of centromeres has little or no role in perpetuating kinetochores. As such they are striking examples of genetic information being transmitted in a manner that is independent of DNA sequence (epigenetically). It has been found that RNA transcribed from centromeres remains bound within the kinetochore region, and this local population of RNA is thought to be part of the epigenetic marking system. Here we carried out a genetic and biochemical study of maize CENPC, a key inner kinetochore protein. We show that DNA binding is conferred by a localized region 122 amino acids long, and that the DNA-binding reaction is exquisitely sensitive to single-stranded RNA. Long, single-stranded nucleic acids strongly promote the binding of CENPC to DNA, and the types of RNAs that stabilize DNA binding match in size and character the RNAs present on kinetochores in vivo. Removal or replacement of the binding module with HIV integrase binding domain causes a partial delocalization of CENPC in vivo. The data suggest that centromeric RNA helps to recruit CENPC to the inner kinetochore by altering its DNA binding characteristics. PMID:20140237

  9. Single-stranded DNA condensed with poly-L-lysine results in nanometric particles that are significantly smaller, more stable in physiological ionic strength fluids and afford higher efficiency of gene delivery than their double-stranded counterparts.

    PubMed

    Molas, M; Bartrons, R; Perales, J C

    2002-08-15

    Nonviral gene transfer vectors have been actively studied in the past years in order to obtain structural entities with minimum size and defined shape. The final size of a gene transfer vector, which is compacted into unimolecular complexes, is directly proportional to the mass of the nucleic acid to be compacted. Thus, the purpose of this study was to assess the possibility of producing ssDNA vectors and their biophysical and biological characterization. We have obtained ssDNA/poly-L-lysine complexes that are significantly smaller than their double-stranded counterparts. We have also identified a lesser aggregative behavior of compacted single-stranded vs. double-stranded DNA vectors in the presence of physiological NaCl concentrations. Expression of compacted ssDNA is observed in hepatoma cell lines. Moreover, we have successfully delivered galactosylated ssDNA complexes into cells that express the asialoglycoprotein receptor via receptor-mediated endocytosis. The reduced size and biophysical behavior of ssDNA vectors may provide an advantage for transfection of eukaryotic cells.

  10. Aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe.

    PubMed

    Lu, Ying; Li, Xianchan; Zhang, Limin; Yu, Ping; Su, Lei; Mao, Lanqun

    2008-03-15

    This study describes a facile and general strategy for the development of aptamer-based electrochemical sensors with a high specificity toward the targets and a ready regeneration feature. Very different from the existing strategies for the development of electrochemical aptasensors with the aptamers as the probes, the strategy proposed here is essentially based on the utilization of the aptamer-complementary DNA (cDNA) oligonucleotides as the probes for electrochemical sensing. In this context, the sequences at both ends of the cDNA are tailor-made to be complementary and both the redox moiety (i.e., ferrocene in this study) and thiol group are labeled onto the cDNA. The labeled cDNA are hybridized with their respective aptamers (i.e., ATP- and thrombin-binding aptamers in this study) to form double-stranded DNA (ds-DNA) and the electrochemical aptasensors are prepared by self-assembling the labeled ds-DNA onto Au electrodes. Upon target binding, the aptamers confined onto electrode surface dissociate from their respective cDNA oligonucleotides into the solution and the single-stranded cDNA could thus tend to form a hairpin structure through the hybridization of the complementary sequences at both its ends. Such a conformational change of the cDNA resulting from the target binding-induced dissociation of the aptamers essentially leads to the change in the voltammetric signal of the redox moiety labeled onto the cDNA and thus constitutes the mechanism for the electrochemical aptasensors for specific target sensing. The aptasensors demonstrated here with the cDNA as the probe are readily regenerated and show good responses toward the targets. This study may offer a new and relatively general approach to electrochemical aptasensors with good analytical properties and potential applications.

  11. Modelling of DNA-protein recognition

    NASA Technical Reports Server (NTRS)

    Rein, R.; Garduno, R.; Colombano, S.; Nir, S.; Haydock, K.; Macelroy, R. D.

    1980-01-01

    Computer model-building procedures using stereochemical principles together with theoretical energy calculations appear to be, at this stage, the most promising route toward the elucidation of DNA-protein binding schemes and recognition principles. A review of models and bonding principles is conducted and approaches to modeling are considered, taking into account possible di-hydrogen-bonding schemes between a peptide and a base (or a base pair) of a double-stranded nucleic acid in the major groove, aspects of computer graphic modeling, and a search for isogeometric helices. The energetics of recognition complexes is discussed and several models for peptide DNA recognition are presented.

  12. Single-stranded DNA Binding by the Helix-Hairpin-Helix Domain of XPF Protein Contributes to the Substrate Specificity of the ERCC1-XPF Protein Complex*

    PubMed Central

    Das, Devashish; Faridounnia, Maryam; Kovacic, Lidija; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

    2017-01-01

    The nucleotide excision repair protein complex ERCC1-XPF is required for incision of DNA upstream of DNA damage. Functional studies have provided insights into the binding of ERCC1-XPF to various DNA substrates. However, because no structure for the ERCC1-XPF-DNA complex has been determined, the mechanism of substrate recognition remains elusive. Here we biochemically characterize the substrate preferences of the helix-hairpin-helix (HhH) domains of XPF and ERCC-XPF and show that the binding to single-stranded DNA (ssDNA)/dsDNA junctions is dependent on joint binding to the DNA binding domain of ERCC1 and XPF. We reveal that the homodimeric XPF is able to bind various ssDNA sequences but with a clear preference for guanine-containing substrates. NMR titration experiments and in vitro DNA binding assays also show that, within the heterodimeric ERCC1-XPF complex, XPF specifically recognizes ssDNA. On the other hand, the HhH domain of ERCC1 preferentially binds dsDNA through the hairpin region. The two separate non-overlapping DNA binding domains in the ERCC1-XPF heterodimer jointly bind to an ssDNA/dsDNA substrate and, thereby, at least partially dictate the incision position during damage removal. Based on structural models, NMR titrations, DNA-binding studies, site-directed mutagenesis, charge distribution, and sequence conservation, we propose that the HhH domain of ERCC1 binds to dsDNA upstream of the damage, and XPF binds to the non-damaged strand within a repair bubble. PMID:28028171

  13. Cdc6-Induced Conformational Changes in ORC Bound to Origin DNA Revealed by Cryo-Electron Microscopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sun J.; Li H.; Kawakami, H.

    2012-03-07

    The eukaryotic origin recognition complex (ORC) interacts with and remodels origins of DNA replication prior to initiation in S phase. Here, we report a single-particle cryo-EM-derived structure of the supramolecular assembly comprising Saccharomyces cerevisiae ORC, the replication initiation factor Cdc6, and double-stranded ARS1 origin DNA in the presence of ATP{gamma}S. The six subunits of ORC are arranged as Orc1:Orc4:Orc5:Orc2:Orc3, with Orc6 binding to Orc2. Cdc6 binding changes the conformation of ORC, in particular reorienting the Orc1 N-terminal BAH domain. Segmentation of the 3D map of ORC-Cdc6 on DNA and docking with the crystal structure of the homologous archaeal Orc1/Cdc6 proteinmore » suggest an origin DNA binding model in which the DNA tracks along the interior surface of the crescent-like ORC. Thus, ORC bends and wraps the DNA. This model is consistent with the observation that binding of a single Cdc6 extends the ORC footprint on origin DNA from both ends.« less

  14. DNA hybridization kinetics: zippering, internal displacement and sequence dependence.

    PubMed

    Ouldridge, Thomas E; Sulc, Petr; Romano, Flavio; Doye, Jonathan P K; Louis, Ard A

    2013-10-01

    Although the thermodynamics of DNA hybridization is generally well established, the kinetics of this classic transition is less well understood. Providing such understanding has new urgency because DNA nanotechnology often depends critically on binding rates. Here, we explore DNA oligomer hybridization kinetics using a coarse-grained model. Strand association proceeds through a complex set of intermediate states, with successful binding events initiated by a few metastable base-pairing interactions, followed by zippering of the remaining bonds. But despite reasonably strong interstrand interactions, initial contacts frequently dissociate because typical configurations in which they form differ from typical states of similar enthalpy in the double-stranded equilibrium ensemble. Initial contacts must be stabilized by two or three base pairs before full zippering is likely, resulting in negative effective activation enthalpies. Non-Arrhenius behavior arises because the number of base pairs required for nucleation increases with temperature. In addition, we observe two alternative pathways-pseudoknot and inchworm internal displacement-through which misaligned duplexes can rearrange to form duplexes. These pathways accelerate hybridization. Our results explain why experimentally observed association rates of GC-rich oligomers are higher than rates of AT- rich equivalents, and more generally demonstrate how association rates can be modulated by sequence choice.

  15. Structural Reorganization and the Cooperative Binding of Single-stranded Telomere DNA in Sterkiella nova*

    PubMed Central

    Buczek, Pawel; Horvath, Martin P.

    2009-01-01

    In Sterkiella nova, α and β telomere proteins bind cooperatively with single-stranded DNA to form a ternary α·β·DNA complex. Association of telomere protein subunits is DNA-dependent, and α-β association enhances DNA affinity. To further understand the molecular basis for binding cooperativity, we characterized several possible stepwise assembly pathways using isothermal titration calorimetry. In one path, α and DNA first form a stable α·DNA complex followed by addition of β in a second step. Binding energy accumulates with nearly equal free energy of association for each of these steps. Heat capacity is nonetheless dramatically different with ΔCp = −305 ± 3 cal mol−1 K−1 for α binding with DNA and ΔCp = −2010 ± 20 cal mol−1 K−1 for addition of β to complete the α·β·DNA complex. By examining alternate routes including titration of single-stranded DNA with a preformed α·β complex, a significant portion of binding energy and heat capacity could be assigned to structural reorganization involving protein-protein interactions and repositioning of the DNA. Structural reorganization probably affords a mechanism to regulate high affinity binding of telomere single-stranded DNA with important implications for telomere biology. Regulation of telomere complex dissociation is thought to involve post-translational modifications in the lysine-rich C-terminal portion of β. We observed no difference in binding energetics or crystal structure when comparing complexes prepared with full-length β or a C-terminally truncated form, supporting interesting parallels between the intrinsically disordered regions of histones and this portion of β. PMID:17082188

  16. Gadd45a Is an RNA Binding Protein and Is Localized in Nuclear Speckles

    PubMed Central

    Sytnikova, Yuliya A.; Kubarenko, Andriy V.; Schäfer, Andrea; Weber, Alexander N. R.; Niehrs, Christof

    2011-01-01

    Background The Gadd45 proteins play important roles in growth control, maintenance of genomic stability, DNA repair, and apoptosis. Recently, Gadd45 proteins have also been implicated in epigenetic gene regulation by promoting active DNA demethylation. Gadd45 proteins have sequence homology with the L7Ae/L30e/S12e RNA binding superfamily of ribosomal proteins, which raises the question if they may interact directly with nucleic acids. Principal Findings Here we show that Gadd45a binds RNA but not single- or double stranded DNA or methylated DNA in vitro. Sucrose density gradient centrifugation experiments demonstrate that Gadd45a is present in high molecular weight particles, which are RNase sensitive. Gadd45a displays RNase-sensitive colocalization in nuclear speckles with the RNA helicase p68 and the RNA binding protein SC35. A K45A point mutation defective in RNA binding was still active in DNA demethylation. This suggests that RNA binding is not absolutely essential for demethylation of an artificial substrate. A point mutation at G39 impared RNA binding, nuclear speckle localization and DNA demethylation, emphasizing its relevance for Gadd45a function. Significance The results implicate RNA in Gadd45a function and suggest that Gadd45a is associated with a ribonucleoprotein particle. PMID:21249130

  17. Non-uniform binding of single-stranded DNA binding proteins to hybrids of single-stranded DNA and single-walled carbon nanotubes observed by atomic force microscopy in air and in liquid

    NASA Astrophysics Data System (ADS)

    Umemura, Kazuo; Ishizaka, Kei; Nii, Daisuke; Izumi, Katsuki

    2016-12-01

    Using atomic force spectroscopy (AFM), we observed hybrids of single-stranded DNA (ssDNA) and single-walled carbon nanotubes (SWNTs) with or without protein molecules in air and in an aqueous solution. This is the first report of ssDNA-SWNT hybrids with proteins in solution analyzed by AFM. In the absence of protein, the height of the ssDNA-SWNT hybrids was 1.1 ± 0.3 nm and 2.4 ± 0.6 nm in air and liquid, respectively, suggesting that the ssDNA molecules adopted a flexible structure on the SWNT surface. In the presence of single-stranded DNA binding (SSB) proteins, the heights of the hybrids in air and liquid increased to 6.4 ± 3.1 nm and 10.0 ± 4.5 nm, respectively. The AFM images clearly showed binding of the SSB proteins to the ssDNA-SWNT hybrids. The morphology of the SSB-ssDNA-SWNT hybrids was non-uniform, particularly in aqueous solution. The variance of hybrid height was quantitatively estimated by cross-section analysis along the long-axis of each hybrid. The SSB-ssDNA-SWNT hybrids showed much larger variance than the ssDNA-SWNT hybrids.

  18. Herpes simplex virus DNA packaging sequences adopt novel structures that are specifically recognized by a component of the cleavage and packaging machinery.

    PubMed

    Adelman, K; Salmon, B; Baines, J D

    2001-03-13

    The product of the herpes simplex virus type 1 U(L)28 gene is essential for cleavage of concatemeric viral DNA into genome-length units and packaging of this DNA into viral procapsids. To address the role of U(L)28 in this process, purified U(L)28 protein was assayed for the ability to recognize conserved herpesvirus DNA packaging sequences. We report that DNA fragments containing the pac1 DNA packaging motif can be induced by heat treatment to adopt novel DNA conformations that migrate faster than the corresponding duplex in nondenaturing gels. Surprisingly, these novel DNA structures are high-affinity substrates for U(L)28 protein binding, whereas double-stranded DNA of identical sequence composition is not recognized by U(L)28 protein. We demonstrate that only one strand of the pac1 motif is responsible for the formation of novel DNA structures that are bound tightly and specifically by U(L)28 protein. To determine the relevance of the observed U(L)28 protein-pac1 interaction to the cleavage and packaging process, we have analyzed the binding affinity of U(L)28 protein for pac1 mutants previously shown to be deficient in cleavage and packaging in vivo. Each of the pac1 mutants exhibited a decrease in DNA binding by U(L)28 protein that correlated directly with the reported reduction in cleavage and packaging efficiency, thereby supporting a role for the U(L)28 protein-pac1 interaction in vivo. These data therefore suggest that the formation of novel DNA structures by the pac1 motif confers added specificity on recognition of DNA packaging sequences by the U(L)28-encoded component of the herpesvirus cleavage and packaging machinery.

  19. Blending DNA binding dyes to improve detection in real-time PCR.

    PubMed

    Jansson, Linda; Koliana, Marianne; Sidstedt, Maja; Hedman, Johannes

    2017-03-01

    The success of real-time PCR (qPCR) analysis is partly limited by the presence of inhibitory compounds in the nucleic acid samples. For example, humic acid (HA) from soil and aqueous sediment interferes with amplification and also quenches the fluorescence of double-stranded (ds) DNA binding dyes, thus hindering amplicon detection. We aimed to counteract the HA fluorescence quenching effect by blending complementary dsDNA binding dyes, thereby elevating the dye saturation levels and increasing the fluorescence signals. A blend of the four dyes EvaGreen, ResoLight, SYBR Green and SYTO9 gave significantly higher fluorescence intensities in the presence and absence of HA, compared with the dyes applied separately and two-dye blends. We propose blending of dyes as a generally applicable means for elevating qPCR fluorescence signals and thus enabling detection in the presence of quenching substances.

  20. ATM-dependent pathways of chromatin remodelling and oxidative DNA damage responses.

    PubMed

    Berger, N Daniel; Stanley, Fintan K T; Moore, Shaun; Goodarzi, Aaron A

    2017-10-05

    Ataxia-telangiectasia mutated (ATM) is a serine/threonine protein kinase with a master regulatory function in the DNA damage response. In this role, ATM commands a complex biochemical network that signals the presence of oxidative DNA damage, including the dangerous DNA double-strand break, and facilitates subsequent repair. Here, we review the current state of knowledge regarding ATM-dependent chromatin remodelling and epigenomic alterations that are required to maintain genomic integrity in the presence of DNA double-strand breaks and/or oxidative stress. We will focus particularly on the roles of ATM in adjusting nucleosome spacing at sites of unresolved DNA double-strand breaks within complex chromatin environments, and the impact of ATM on preserving the health of cells within the mammalian central nervous system.This article is part of the themed issue 'Chromatin modifiers and remodellers in DNA repair and signalling'. © 2017 The Author(s).

  1. Co-opting the Fanconi Anemia Genomic Stability Pathway Enables Herpesvirus DNA Synthesis and Productive Growth

    PubMed Central

    Karttunen, Heidi; Savas, Jeffrey N.; McKinney, Caleb; Chen, Yu-Hung; Yates, John R.; Hukkanen, Veijo; Huang, Tony T.; Mohr, Ian

    2015-01-01

    SUMMARY DNA damage associated with viral DNA synthesis can result in double strand breaks that threaten genome integrity and must be repaired. Here, we establish that the cellular Fanconi Anemia (FA) genomic stability pathway is exploited by HSV1 to promote viral DNA synthesis and enable its productive growth. Potent FA pathway activation in HSV1-infected cells resulted in monoubiquitination of FA effector proteins, FANCI and FANCD2 (FANCI-D2) and required the viral DNA polymerase. FANCD2 relocalized to viral replication compartments and FANCI-D2 interacted with a multi-subunit complex containing the virus-encoded single-stranded DNA-binding protein ICP8. Significantly, while HSV1 productive growth was impaired in monoubiquitination-defective FA patient cells, this restriction was partially surmounted by antagonizing the DNA-dependent protein kinase (DNA-PK), a critical enzyme required for non-homologous end-joining (NHEJ). This identifies the FA-pathway as a new cellular factor required for herpesvirus productive growth and suggests that FA-mediated suppression of NHEJ is a fundamental step in the viral lifecycle. PMID:24954902

  2. hSSB1 phosphorylation is dynamically regulated by DNA-PK and PPP-family protein phosphatases.

    PubMed

    Ashton, Nicholas W; Paquet, Nicolas; Shirran, Sally L; Bolderson, Emma; Kariawasam, Ruvini; Touma, Christine; Fallahbaghery, Azadeh; Gamsjaeger, Roland; Cubeddu, Liza; Botting, Catherine; Pollock, Pamela M; O'Byrne, Kenneth J; Richard, Derek J

    2017-06-01

    The maintenance of genomic stability is essential for cellular viability and the prevention of diseases such as cancer. Human single-stranded DNA-binding protein 1 (hSSB1) is a protein with roles in the stabilisation and restart of stalled DNA replication forks, as well as in the repair of oxidative DNA lesions and double-strand DNA breaks. In the latter process, phosphorylation of threonine 117 by the ATM kinase is required for hSSB1 stability and efficient DNA repair. The regulation of hSSB1 in other DNA repair pathways has however remained unclear. Here we report that hSSB1 is also directly phosphorylated by DNA-PK at serine residue 134. While this modification is largely suppressed in undamaged cells by PPP-family protein phosphatases, S134 phosphorylation is enhanced following the disruption of replication forks and promotes cellular survival. Together, these data thereby represent a novel mechanism for hSSB1 regulation following the inhibition of replication. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  3. Replication-mediated disassociation of replication protein A-XPA complex upon DNA damage: implications for RPA handing off.

    PubMed

    Jiang, Gaofeng; Zou, Yue; Wu, Xiaoming

    2012-08-01

    RPA (replication protein A), the eukaryotic ssDNA (single-stranded DNA)-binding protein, participates in most cellular processes in response to genotoxic insults, such as NER (nucleotide excision repair), DNA, DSB (double-strand break) repair and activation of cell cycle checkpoint signalling. RPA interacts with XPA (xeroderma pigmentosum A) and functions in early stage of NER. We have shown that in cells the RPA-XPA complex disassociated upon exposure of cells to high dose of UV irradiation. The dissociation required replication stress and was partially attributed to tRPA hyperphosphorylation. Treatment of cells with CPT (camptothecin) and HU (hydroxyurea), which cause DSB DNA damage and replication fork collapse respectively and also leads to the disruption of RPA-XPA complex. Purified RPA and XPA were unable to form complex in vitro in the presence of ssDNA. We propose that the competition-based RPA switch among different DNA metabolic pathways regulates the dissociation of RPA with XPA in cells after DNA damage. The biological significances of RPA-XPA complex disruption in relation with checkpoint activation, DSB repair and RPA hyperphosphorylation are discussed.

  4. Cryo-EM Structures Reveal Mechanism and Inhibition of DNA Targeting by a CRISPR-Cas Surveillance Complex.

    PubMed

    Guo, Tai Wei; Bartesaghi, Alberto; Yang, Hui; Falconieri, Veronica; Rao, Prashant; Merk, Alan; Eng, Edward T; Raczkowski, Ashleigh M; Fox, Tara; Earl, Lesley A; Patel, Dinshaw J; Subramaniam, Sriram

    2017-10-05

    Prokaryotic cells possess CRISPR-mediated adaptive immune systems that protect them from foreign genetic elements, such as invading viruses. A central element of this immune system is an RNA-guided surveillance complex capable of targeting non-self DNA or RNA for degradation in a sequence- and site-specific manner analogous to RNA interference. Although the complexes display considerable diversity in their composition and architecture, many basic mechanisms underlying target recognition and cleavage are highly conserved. Using cryoelectron microscopy (cryo-EM), we show that the binding of target double-stranded DNA (dsDNA) to a type I-F CRISPR system yersinia (Csy) surveillance complex leads to large quaternary and tertiary structural changes in the complex that are likely necessary in the pathway leading to target dsDNA degradation by a trans-acting helicase-nuclease. Comparison of the structure of the surveillance complex before and after dsDNA binding, or in complex with three virally encoded anti-CRISPR suppressors that inhibit dsDNA binding, reveals mechanistic details underlying target recognition and inhibition. Published by Elsevier Inc.

  5. Effects of Complementary DNA and Salt on the Thermoresponsiveness of Poly(N-isopropylacrylamide)-b-DNA.

    PubMed

    Fujita, Masahiro; Hiramine, Hayato; Pan, Pengju; Hikima, Takaaki; Maeda, Mizuo

    2016-02-02

    The thermoresponsive structural transition of poly(N-isopropylacrylamide) (PNIPAAm)-b-DNA copolymers was explored. Molecular assembly of the block copolymers was facilitated by adding salt, and this assembly was not nucleated by the association between DNA strands but by the coil-globule transition of PNIPAAm blocks. Below the lower critical solution temperature (LCST) of PNIPAAm, the copolymer solution remained transparent even at high salt concentrations, regardless of whether DNA was hybridized with its complementary partner to form a double-strand (or single-strand) structure. At the LCST, the hybridized copolymer assembled in spherical nanoparticles, surrounded by double-stranded DNA; subsequently, the non-cross-linking aggregation occurred, while the nanoparticles were dispersed if the salt concentration was low or DNA blocks were unhybridized. When the DNA duplex was denatured to a single-stranded state by heating, the aggregated nanoparticles redispersed owing to the recovery of the steric repulsion of the DNA strands. The changes in the steric and electrostatic effects by hybridization and the addition of salt did not result in any specific attraction between DNA strands but merely decreased the repulsive interactions. The van der Waals attraction between the nanoparticles overcame such repulsive interactions so that the non-cross-linking aggregation of the micellar particles was mediated.

  6. Binding Linkage in a Telomere DNA–Protein Complex at the Ends of Oxytricha nova Chromosomes

    PubMed Central

    Buczek, Pawel; Orr, Rochelle S.; Pyper, Sean R.; Shum, Mili; Ota, Emily Kimmel Irene; Gerum, Shawn E.; Horvath, Martin P.

    2005-01-01

    Alpha and beta protein subunits of the telomere end binding protein from Oxytricha nova (OnTEBP) combine with telomere single strand DNA to form a protective cap at the ends of chromosomes. We tested how protein–protein interactions seen in the co-crystal structure relate to DNA binding through use of fusion proteins engineered as different combinations of domains and subunits derived from OnTEBP. Joining alpha and beta resulted in a protein that bound single strand telomere DNA with high affinity (KD-DNA=1.4 nM). Another fusion protein, constructed without the C-terminal protein–protein interaction domain of alpha, bound DNA with 200-fold diminished affinity (KD-DNA=290 nM) even though the DNA-binding domains of alpha and beta were joined through a peptide linker. Adding back the alpha C-terminal domain as a separate protein restored high-affinity DNA binding. The binding behaviors of these fusion proteins and the native protein subunits are consistent with cooperative linkage between protein-association and DNA-binding equilibria. Linking DNA–protein stability to protein–protein contacts at a remote site may provide a trigger point for DNA–protein disassembly during telomere replication when the single strand telomere DNA must exchange between a very stable OnTEBP complex and telomerase. PMID:15967465

  7. Cigarette smoke-induced DNA damage and repair detected by the comet assay in HPV-transformed cervical cells.

    PubMed

    Moktar, Afsoon; Ravoori, Srivani; Vadhanam, Manicka V; Gairola, C Gary; Gupta, Ramesh C

    2009-12-01

    Human papillomavirus (HPV) is the causative factor in the development and progression of cervical cancers in >97% of the cases, although insufficient. Epidemiological studies suggest an elevated risk of cervical cancer for cigarette smokers; therefore, we examined cigarette smoke-induced DNA damage and repair in HPV16-transformed human ectocervical cells (ECT1/E6 E7). Cells were treated with cigarette smoke condensate (CSC) for 72 h to assess the formation of single- and double-strand DNA breaks, measured by alkaline and neutral single cell gel electrophoresis assays, respectively. The mean tail length of cells with single-strand breaks was increased by 1.8-, 2.7- and 3.7-fold (p<0.001) after treatment with 4, 8 and 12 microg/ml CSC, respectively. The tail length with double-strand breaks was also increased dose-dependently. These results were further supported by measurement of the mean tail moment: the increase in both single- and double-strand breaks were much more pronounced with increasing concentration of CSC, by up to 23.5-fold (p<0.0001 for both assays). To examine the DNA repair, cells were treated with CSC for 72 h, followed by CSC withdrawal and re-incubation of the cells with fresh medium for 24, 48, or 72 h. Both single- and double-strand DNA breaks were removed during the initial 24 h but no further removal of the damage was observed. Up to 80% of residual single- and double-strand DNA breaks (p<0.05) were found to persist at all CSC concentrations examined. Ellagic acid, a known antioxidant and free-radical scavenger, was found to significantly inhibit DNA breaks induced by CSC. Thus, free radicals may be a plausible source of CSC-induced DNA damage. These data show that CSC-mediated DNA strand breaks are highly persistent, and suggest that persistence of cigarette smoke-associated DNA damage in the presence of HPV infection may lead to increased mutations in cervical cells and ultimately higher cancer risk.

  8. Super-resolution imaging identifies PARP1 and the Ku complex acting as DNA double-strand break sensors

    PubMed Central

    Yang, Guang; Liu, Chao; Chen, Shih-Hsun; Kassab, Muzaffer A; Hoff, J Damon; Yu, Xiaochun

    2018-01-01

    Abstract DNA double-strand breaks (DSBs) are fatal DNA lesions and activate a rapid DNA damage response. However, the earliest stage of DSB sensing remains elusive. Here, we report that PARP1 and the Ku70/80 complex localize to DNA lesions considerably earlier than other DSB sensors. Using super-resolved fluorescent particle tracking, we further examine the relocation kinetics of PARP1 and the Ku70/80 complex to a single DSB, and find that PARP1 and the Ku70/80 complex are recruited to the DSB almost at the same time. Notably, only the Ku70/80 complex occupies the DSB exclusively in the G1 phase; whereas PARP1 competes with the Ku70/80 complex at the DSB in the S/G2 phase. Moreover, in the S/G2 phase, PARP1 removes the Ku70/80 complex through its enzymatic activity, which is further confirmed by in vitro DSB-binding assays. Taken together, our results reveal PARP1 and the Ku70/80 complex as critical DSB sensors, and suggest that PARP1 may function as an important regulator of the Ku70/80 complex at the DSBs in the S/G2 phase. PMID:29447383

  9. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  10. Interactions of the C-terminal Domain of Human Ku70 with DNA Substrate: A Molecular Dynamics Study

    NASA Technical Reports Server (NTRS)

    Hu, Shaowen; Huff, Janice; Pluth, Janice M.; Cucinotta, Francis A.

    2007-01-01

    NASA is developing a systems biology approach to improve the assessment of health risks associated with space radiation. The primary toxic and mutagenic lesion following radiation exposure is the DNA double strand break (DSB), thus a model incorporating proteins and pathways important in response and repair of this lesion is critical. One key protein heterodimer for systems models of radiation effects is the Ku(sub 70/80) complex. The Ku70/80 complex is important in the initial binding of DSB ends following DNA damage, and is a component of nonhomologous end joining repair, the primary pathway for DSB repair in mammalian cells. The C-terminal domain of Ku70 (Ku70c, residues 559-609), contains an helix-extended strand-helix motif and similar motifs have been found in other nucleic acid-binding proteins critical for DNA repair. However, the exact mechanism of damage recognition and substrate specificity for the Ku heterodimer remains unclear in part due to the absence of a high-resolution structure of the Ku70c/DNA complex. We performed a series of molecular dynamics (MD) simulations on a system with the subunit Ku70c and a 14 base pairs DNA duplex, whose starting structures are designed to be variable so as to mimic their different binding modes. By analyzing conformational changes and energetic properties of the complex during MD simulations, we found that interactions are preferred at DNA ends, and within the major groove, which is consistent with previous experimental investigations. In addition, the results indicate that cooperation of Ku70c with other subunits of Ku(sub 70/80) is necessary to explain the high affinity of binding as observed in experiments.

  11. Moving beyond Watson-Crick models of coarse grained DNA dynamics.

    PubMed

    Linak, Margaret C; Tourdot, Richard; Dorfman, Kevin D

    2011-11-28

    DNA produces a wide range of structures in addition to the canonical B-form of double-stranded DNA. Some of these structures are stabilized by Hoogsteen bonds. We developed an experimentally parameterized, coarse-grained model that incorporates such bonds. The model reproduces many of the microscopic features of double-stranded DNA and captures the experimental melting curves for a number of short DNA hairpins, even when the open state forms complicated secondary structures. We demonstrate the utility of the model by simulating the folding of a thrombin aptamer, which contains G-quartets, and strand invasion during triplex formation. Our results highlight the importance of including Hoogsteen bonding in coarse-grained models of DNA.

  12. Improved bioactivity of G-rich triplex-forming oligonucleotides containing modified guanine bases

    PubMed Central

    Rogers, Faye A; Lloyd, Janice A; Tiwari, Meetu Kaushik

    2014-01-01

    Triplex structures generated by sequence-specific triplex-forming oligonucleotides (TFOs) have proven to be promising tools for gene targeting strategies. In addition, triplex technology has been highly utilized to study the molecular mechanisms of DNA repair, recombination and mutagenesis. However, triplex formation utilizing guanine-rich oligonucleotides as third strands can be inhibited by potassium-induced self-association resulting in G-quadruplex formation. We report here that guanine-rich TFOs partially substituted with 8-aza-7-deaza-guanine (PPG) have improved target site binding in potassium compared with TFOs containing the natural guanine base. We designed PPG-substituted TFOs to bind to a polypurine sequence in the supFG1 reporter gene. The binding efficiency of PPG-substituted TFOs to the target sequence was analyzed using electrophoresis mobility gel shift assays. We have determined that in the presence of potassium, the non-substituted TFO, AG30 did not bind to its target sequence, however binding was observed with the PPG-substituted AG30 under conditions with up to 140 mM KCl. The PPG-TFOs were able to maintain their ability to induce genomic modifications as measured by an assay for gene-targeted mutagenesis. In addition, these compounds were capable of triplex-induced DNA double strand breaks, which resulted in activation of apoptosis. PMID:25483840

  13. The occurrence of double strand DNA breaks is not the sole condition for meiotic crossing over in Drosophila melanogaster.

    PubMed

    Portin, P; Rantanen, M

    2000-01-01

    Analysis of the interchromosomal effects of In(2L + 2R)Cy, In(3L + 3R)LVM and their joint effect on the frequencies of single and double crossovers in the cv-v-f region of the X chromosome as well as interference showed that both inversions, occurring separately, increased the frequency of single as well as double crossovers and the coefficient of coincidence. However, when the inversions occurred together the frequencies of single crossovers no longer increased, but the frequency of double crossovers, as well as the coefficient of coincidence did increase. These results indicate firstly that the interchromosomal effects influence some precondition of exchange, but that this precondition is not an occurrence of double strand DNA breaks. Thus, the occurrence of double strand DNA breaks is not the sole condition for crossing over in Drosophila melanogaster.

  14. On the Role of low-energy electrons in the radiosensitization of DNA by gold nanoparticles

    PubMed Central

    Xiao, Fangxing; Zheng, Yi; Cloutier, Pierre; He, Yunhui; Hunting, Darel; Sanche, Léon

    2013-01-01

    Four different gold nanoparticle (GNP) preparations, including nude GNP and GNP coated either with thiolated undecane (S-C11H23), or with dithiolated diethylenetriaminepentaacetic (DTDTPA) or gadolinium (Gd) DTDTPA chelating agents were synthesized. The average diameters, for each type of nanoparticle are 5 nm, 10 and 13 nm, respectively. Dry films of plasmid DNA pGEM-3Zf(-), DNA with bound GNP and DNA with coated GNP were bombarded with 60 keV electrons. The yields of single and double strand breaks were measured as a function of exposure by electrophoresis. The binding of only one GNP without coating to DNA containing 3197 base pairs increases single and double strand breaks by a factor of 2.3 while for GNP coated with S-C11H23 this factor is reduced to 1.6. GNP coated with the DTDTPA and DTDTPA:Gd in same ratio with DNA, produce essentially no increment in damage. These results could be explained by the attenuation by the coatings of the intensity of low energy photoelectrons emitted from GNP. Thus, coatings of GNP may considerably attenuate short-range low energy electrons emitted from gold, leading to a considerable decrease of radiosensitization. According to our results, the highest radiosensitization should be obtained with GNP having the shortest possible ligand, directed to the DNA of cancer cells. PMID:22024607

  15. Drug-DNA interactions at single molecule level: A view with optical tweezers

    NASA Astrophysics Data System (ADS)

    Paramanathan, Thayaparan

    Studies of small molecule--DNA interactions are essential for developing new drugs for challenging diseases like cancer and HIV. The main idea behind developing these molecules is to target and inhibit the reproduction of the tumor cells and infected cells. We mechanically manipulate single DNA molecule using optical tweezers to investigate two molecules that have complex and multiple binding modes. Mononuclear ruthenium complexes have been extensively studied as a test for rational drug design. Potential drug candidates should have high affinity to DNA and slow dissociation kinetics. To achieve this, motifs of the ruthenium complexes are altered. Our collaborators designed a dumb-bell shaped binuclear ruthenium complex that can only intercalate DNA by threading through its bases. Studying the binding properties of this complex in bulk studies took hours. By mechanically manipulating a single DNA molecule held with optical tweezers, we lower the barrier to thread and make it fast compared to the bulk experiments. Stretching single DNA molecules with different concentration of drug molecules and holding it at a constant force allows the binding to reach equilibrium. By this we can obtain the equilibrium fractional ligand binding and length of DNA at saturated binding. Fitting these results yields quantitative measurements of the binding thermodynamics and kinetics of this complex process. The second complex discussed in this study is Actinomycin D (ActD), a well studied anti-cancer agent that is used as a prototype for developing new generations of drugs. However, the biophysical basis of its activity is still unclear. Because ActD is known to intercalate double stranded DNA (dsDNA), it was assumed to block replication by stabilizing dsDNA in front of the replication fork. However, recent studies have shown that ActD binds with even higher affinity to imperfect duplexes and some sequences of single stranded DNA (ssDNA). We directly measure the on and off rates by stretching the DNA molecule to a certain force and holding it at constant force while adding the drug and then while washing off the drug. Our finding resolves the long lasting controversy of ActD binding modes, clearly showing that both the dsDNA binding and ssDNA binding converge to the same single mode. The result supports the hypothesis that the primary characteristic of ActD that contributes to its biological activity is its ability to inhibit cellular replication by binding to transcription bubbles and causing cell death.

  16. A soluble RecN homologue provides means for biochemical and genetic analysis of DNA double-strand break repair in Escherichia coli.

    PubMed

    Grove, Jane I; Wood, Stuart R; Briggs, Geoffrey S; Oldham, Neil J; Lloyd, Robert G

    2009-12-03

    RecN is a highly conserved, SMC-like protein in bacteria. It plays an important role in the repair of DNA double-strand breaks and is therefore a key factor in maintaining genome integrity. The insolubility of Escherichia coli RecN has limited efforts to unravel its function. We overcame this limitation by replacing the resident coding sequence with that of Haemophilus influenzae RecN. The heterologous construct expresses Haemophilus RecN from the SOS-inducible E. coli promoter. The hybrid gene is fully functional, promoting survival after I-SceI induced DNA breakage, gamma irradiation or exposure to mitomycin C as effectively as the native gene, indicating that the repair activity is conserved between these two species. H. influenzae RecN is quite soluble, even when expressed at high levels, and is readily purified. Its analysis by ionisation-mass spectrometry, gel filtration and glutaraldehyde crosslinking indicates that it is probably a dimer under physiological conditions, although a higher multimer cannot be excluded. The purified protein displays a weak ATPase activity that is essential for its DNA repair function in vivo. However, no DNA-binding activity was detected, which contrasts with RecN from Bacillus subtilis. RecN proteins from Aquifex aeolicus and Bacteriodes fragilis also proved soluble. Neither binds DNA, but the Aquifex RecN has weak ATPase activity. Our findings support studies indicating that RecN, and the SOS response in general, behave differently in E. coli and B. subtilis. The hybrid recN reported provides new opportunities to study the genetics and biochemistry of how RecN operates in E. coli.

  17. Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions

    NASA Astrophysics Data System (ADS)

    Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory

    1989-04-01

    The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.

  18. A Polyamide Inhibits Replication of Vesicular Stomatitis Virus by Targeting RNA in the Nucleocapsid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gumpper, Ryan H.; Li, Weike; Castañeda, Carlos H.

    Polyamides have been shown to bind double-stranded DNA by complementing the curvature of the minor groove and forming various hydrogen bonds with DNA. Several polyamide molecules have been found to have potent antiviral activities against papillomavirus, a double-stranded DNA virus. By analogy, we reason that polyamides may also interact with the structured RNA bound in the nucleocapsid of a negative-strand RNA virus. Vesicular stomatitis virus (VSV) was selected as a prototype virus to test this possibility since its genomic RNA encapsidated in the nucleocapsid forms a structure resembling one strand of an A-form RNA duplex. One polyamide molecule, UMSL1011, wasmore » found to inhibit infection of VSV. To confirm that the polyamide targeted the nucleocapsid, a nucleocapsid-like particle (NLP) was incubated with UMSL1011. The encapsidated RNA in the polyamide-treated NLP was protected from thermo-release and digestion by RNase A. UMSL1011 also inhibits viral RNA synthesis in the intracellular activity assay for the viral RNA-dependent RNA polymerase. The crystal structure revealed that UMSL1011 binds the structured RNA in the nucleocapsid. The conclusion of our studies is that the RNA in the nucleocapsid is a viable antiviral target of polyamides. Since the RNA structure in the nucleocapsid is similar in all negative-strand RNA viruses, polyamides may be optimized to target the specific RNA genome of a negative-strand RNA virus, such as respiratory syncytial virus and Ebola virus. IMPORTANCENegative-strand RNA viruses (NSVs) include several life-threatening pathogens, such as rabies virus, respiratory syncytial virus, and Ebola virus. There are no effective antiviral drugs against these viruses. Polyamides offer an exceptional opportunity because they may be optimized to target each NSV. Our studies on vesicular stomatitis virus, an NSV, demonstrated that a polyamide molecule could specifically target the viral RNA in the nucleocapsid and inhibit viral growth. The target specificity of the polyamide molecule was proved by its inhibition of thermo-release and RNA nuclease digestion of the RNA bound in a model nucleocapsid, and a crystal structure of the polyamide inside the nucleocapsid. This encouraging observation provided the proof-of-concept rationale for designing polyamides as antiviral drugs against NSVs.« less

  19. A Polyamide Inhibits Replication of Vesicular Stomatitis Virus by Targeting RNA in the Nucleocapsid.

    PubMed

    Gumpper, Ryan H; Li, Weike; Castañeda, Carlos H; Scuderi, M José; Bashkin, James K; Luo, Ming

    2018-04-15

    Polyamides have been shown to bind double-stranded DNA by complementing the curvature of the minor groove and forming various hydrogen bonds with DNA. Several polyamide molecules have been found to have potent antiviral activities against papillomavirus, a double-stranded DNA virus. By analogy, we reason that polyamides may also interact with the structured RNA bound in the nucleocapsid of a negative-strand RNA virus. Vesicular stomatitis virus (VSV) was selected as a prototype virus to test this possibility since its genomic RNA encapsidated in the nucleocapsid forms a structure resembling one strand of an A-form RNA duplex. One polyamide molecule, UMSL1011, was found to inhibit infection of VSV. To confirm that the polyamide targeted the nucleocapsid, a nucleocapsid-like particle (NLP) was incubated with UMSL1011. The encapsidated RNA in the polyamide-treated NLP was protected from thermo-release and digestion by RNase A. UMSL1011 also inhibits viral RNA synthesis in the intracellular activity assay for the viral RNA-dependent RNA polymerase. The crystal structure revealed that UMSL1011 binds the structured RNA in the nucleocapsid. The conclusion of our studies is that the RNA in the nucleocapsid is a viable antiviral target of polyamides. Since the RNA structure in the nucleocapsid is similar in all negative-strand RNA viruses, polyamides may be optimized to target the specific RNA genome of a negative-strand RNA virus, such as respiratory syncytial virus and Ebola virus. IMPORTANCE Negative-strand RNA viruses (NSVs) include several life-threatening pathogens, such as rabies virus, respiratory syncytial virus, and Ebola virus. There are no effective antiviral drugs against these viruses. Polyamides offer an exceptional opportunity because they may be optimized to target each NSV. Our studies on vesicular stomatitis virus, an NSV, demonstrated that a polyamide molecule could specifically target the viral RNA in the nucleocapsid and inhibit viral growth. The target specificity of the polyamide molecule was proved by its inhibition of thermo-release and RNA nuclease digestion of the RNA bound in a model nucleocapsid, and a crystal structure of the polyamide inside the nucleocapsid. This encouraging observation provided the proof-of-concept rationale for designing polyamides as antiviral drugs against NSVs. Copyright © 2018 American Society for Microbiology.

  20. Dna2 nuclease-helicase structure, mechanism and regulation by Rpa

    PubMed Central

    Zhou, Chun; Pourmal, Sergei; Pavletich, Nikola P

    2015-01-01

    The Dna2 nuclease-helicase maintains genomic integrity by processing DNA double-strand breaks, Okazaki fragments and stalled replication forks. Dna2 requires ssDNA ends, and is dependent on the ssDNA-binding protein Rpa, which controls cleavage polarity. Here we present the 2.3 Å structure of intact mouse Dna2 bound to a 15-nucleotide ssDNA. The nuclease active site is embedded in a long, narrow tunnel through which the DNA has to thread. The helicase domain is required for DNA binding but not threading. We also present the structure of a flexibly-tethered Dna2-Rpa interaction that recruits Dna2 to Rpa-coated DNA. We establish that a second Dna2-Rpa interaction is mutually exclusive with Rpa-DNA interactions and mediates the displacement of Rpa from ssDNA. This interaction occurs at the nuclease tunnel entrance and the 5’ end of the Rpa-DNA complex. Hence, it only displaces Rpa from the 5’ but not 3’ end, explaining how Rpa regulates cleavage polarity. DOI: http://dx.doi.org/10.7554/eLife.09832.001 PMID:26491943

  1. A complex of RAG-1 and RAG-2 proteins persists on DNA after single-strand cleavage at V(D)J recombination signal sequences.

    PubMed Central

    Grawunder, U; Lieber, M R

    1997-01-01

    The recombination activating gene (RAG) 1 and 2 proteins are required for initiation of V(D)J recombination in vivo and have been shown to be sufficient to introduce DNA double-strand breaks at recombination signal sequences (RSSs) in a cell-free assay in vitro. RSSs consist of a highly conserved palindromic heptamer that is separated from a slightly less conserved A/T-rich nonamer by either a 12 or 23 bp spacer of random sequence. Despite the high sequence specificity of RAG-mediated cleavage at RSSs, direct binding of the RAG proteins to these sequences has been difficult to demonstrate by standard methods. Even when this can be demonstrated, questions about the order of events for an individual RAG-RSS complex will require methods that monitor aspects of the complex during transitions from one step of the reaction to the next. Here we have used template-independent DNA polymerase terminal deoxynucleotidyl transferase (TdT) in order to assess occupancy of the reaction intermediates by the RAG complex during the reaction. In addition, this approach allows analysis of the accessibility of end products of a RAG-catalyzed cleavage reaction for N nucleotide addition. The results indicate that RAG proteins form a long-lived complex with the RSS once the initial nick is generated, because the 3'-OH group at the nick remains obstructed for TdT-catalyzed N nucleotide addition. In contrast, the 3'-OH group generated at the signal end after completion of the cleavage reaction can be efficiently tailed by TdT, suggesting that the RAG proteins disassemble from the signal end after DNA double-strand cleavage has been completed. Therefore, a single RAG complex maintains occupancy from the first step (nick formation) to the second step (cleavage). In addition, the results suggest that N region diversity at V(D)J junctions within rearranged immunoglobulin and T cell receptor gene loci can only be introduced after the generation of RAG-catalyzed DNA double-strand breaks, i.e. during the DNA end joining phase of the V(D)J recombination reaction. PMID:9060432

  2. What controls the hybridization thermodynamics of spherical nucleic acids?

    PubMed

    Randeria, Pratik S; Jones, Matthew R; Kohlstedt, Kevin L; Banga, Resham J; Olvera de la Cruz, Monica; Schatz, George C; Mirkin, Chad A

    2015-03-18

    The hybridization of free oligonucleotides to densely packed, oriented arrays of DNA modifying the surfaces of spherical nucleic acid (SNA)-gold nanoparticle conjugates occurs with negative cooperativity; i.e., each binding event destabilizes subsequent binding events. DNA hybridization is thus an ever-changing function of the number of strands already hybridized to the particle. Thermodynamic quantification of this behavior reveals a 3 orders of magnitude decrease in the binding constant for the capture of a free oligonucleotide by an SNA conjugate as the fraction of pre-hybridized strands increases from 0 to ∼30%. Increasing the number of pre-hybridized strands imparts an increasing enthalpic penalty to hybridization that makes binding more difficult, while simultaneously decreasing the entropic penalty to hybridization, which makes binding more favorable. Hybridization of free DNA to an SNA is thus governed by both an electrostatic barrier as the SNA accumulates charge with additional binding events and an effect consistent with allostery, where hybridization at certain sites on an SNA modify the binding affinity at a distal site through conformational changes to the remaining single strands. Leveraging these insights allows for the design of conjugates that hybridize free strands with significantly higher efficiencies, some of which approach 100%.

  3. Cas9-catalyzed DNA Cleavage Generates Staggered Ends: Evidence from Molecular Dynamics Simulations

    NASA Astrophysics Data System (ADS)

    Zuo, Zhicheng; Liu, Jin

    2016-11-01

    The CRISPR-associated endonuclease Cas9 from Streptococcus pyogenes (spCas9) along with a single guide RNA (sgRNA) has emerged as a versatile toolbox for genome editing. Despite recent advances in the mechanism studies on spCas9-sgRNA-mediated double-stranded DNA (dsDNA) recognition and cleavage, it is still unclear how the catalytic Mg2+ ions induce the conformation changes toward the catalytic active state. It also remains controversial whether Cas9 generates blunt-ended or staggered-ended breaks with overhangs in the DNA. To investigate these issues, here we performed the first all-atom molecular dynamics simulations of the spCas9-sgRNA-dsDNA system with and without Mg2+ bound. The simulation results showed that binding of two Mg2+ ions at the RuvC domain active site could lead to structurally and energetically favorable coordination ready for the non-target DNA strand cleavage. Importantly, we demonstrated with our simulations that Cas9-catalyzed DNA cleavage produces 1-bp staggered ends rather than generally assumed blunt ends.

  4. The G-quadruplex DNA stabilizing drug pyridostatin promotes DNA damage and downregulates transcription of Brca1 in neurons.

    PubMed

    Moruno-Manchon, Jose F; Koellhoffer, Edward C; Gopakumar, Jayakrishnan; Hambarde, Shashank; Kim, Nayun; McCullough, Louise D; Tsvetkov, Andrey S

    2017-09-12

    The G-quadruplex is a non-canonical DNA secondary structure formed by four DNA strands containing multiple runs of guanines. G-quadruplexes play important roles in DNA recombination, replication, telomere maintenance, and regulation of transcription. Small molecules that stabilize the G-quadruplexes alter gene expression in cancer cells. Here, we hypothesized that the G-quadruplexes regulate transcription in neurons. We discovered that pyridostatin, a small molecule that specifically stabilizes G-quadruplex DNA complexes, induced neurotoxicity and promoted the formation of DNA double-strand breaks (DSBs) in cultured neurons. We also found that pyridostatin downregulated transcription of the Brca1 gene, a gene that is critical for DSB repair. Importantly, in an in vitro gel shift assay, we discovered that an antibody specific to the G-quadruplex structure binds to a synthetic oligonucleotide, which corresponds to the first putative G-quadruplex in the Brca1 gene promoter. Our results suggest that the G-quadruplex complexes regulate transcription in neurons. Studying the G-quadruplexes could represent a new avenue for neurodegeneration and brain aging research.

  5. Chemical probes of the conformation of DNA modified by cis-diamminedichloroplatinum(II)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marrot, L.; Leng, M.

    The purpose of this work was to analyze at the nucleotide level the distortions induced by the binding of cis-diamminedichloroplatinum(II) (cis-DDP) to DNA by means of chemical probes. In order to test the chemical probes, experiments were first carried out on two platinated oligonucleotides. It has been verified by circular dichroism and gel electrophoresis that the binding of cis-DDP to an AG or to a GTG site within a double-stranded oligonucleotide distorts the double helix. The reactivity of the oligonucleotide platinated at the GTG site with chloroacetaldehyde, diethyl pyrocarbonate, and osmium tetraoxide, respectively, suggests a local denaturation of the doublemore » helix. The 5'G residue and the T residue within the adduct are no longer paired, while the 3'G residue is paired. The double helix is more distorted (but not denatured) at the 5' side of the adduct than at the 3' side. The reactivities of the chemical probes with six platinated DNA restriction fragments show that even at a relatively high level of platination only a few base pairs are unpaired but the double helix is largely distorted. No local denaturation has been detected at the GG sites separated from the nearest GG or AG sites by at least three base pairs. The AG sites separated from the nearest AG or GG sites by at least three base pairs do not denature the double helix locally when they are in the sequences puAG/pyTC. It is suggested that the distortion within these sequences is induced by adducts located further away along the DNA fragments, these sequences not being the major sites for the binding of cis-DDP.« less

  6. Crystal structure of RecBCD enzyme reveals a machine for processing DNA breaks

    NASA Astrophysics Data System (ADS)

    Singleton, Martin R.; Dillingham, Mark S.; Gaudier, Martin; Kowalczykowski, Stephen C.; Wigley, Dale B.

    2004-11-01

    RecBCD is a multi-functional enzyme complex that processes DNA ends resulting from a double-strand break. RecBCD is a bipolar helicase that splits the duplex into its component strands and digests them until encountering a recombinational hotspot (Chi site). The nuclease activity is then attenuated and RecBCD loads RecA onto the 3' tail of the DNA. Here we present the crystal structure of RecBCD bound to a DNA substrate. In this initiation complex, the DNA duplex has been split across the RecC subunit to create a fork with the separated strands each heading towards different helicase motor subunits. The strands pass along tunnels within the complex, both emerging adjacent to the nuclease domain of RecB. Passage of the 3' tail through one of these tunnels provides a mechanism for the recognition of a Chi sequence by RecC within the context of double-stranded DNA. Gating of this tunnel suggests how nuclease activity might be regulated.

  7. RPA facilitates telomerase activity at chromosome ends in budding and fission yeasts

    PubMed Central

    Luciano, Pierre; Coulon, Stéphane; Faure, Virginie; Corda, Yves; Bos, Julia; Brill, Steven J; Gilson, Eric; Simon, Marie-Noelle; Géli, Vincent

    2012-01-01

    In Saccharomyces cerevisiae, the telomerase complex binds to chromosome ends and is activated in late S-phase through a process coupled to the progression of the replication fork. Here, we show that the single-stranded DNA-binding protein RPA (replication protein A) binds to the two daughter telomeres during telomere replication but only its binding to the leading-strand telomere depends on the Mre11/Rad50/Xrs2 (MRX) complex. We further demonstrate that RPA specifically co-precipitates with yKu, Cdc13 and telomerase. The interaction of RPA with telomerase appears to be mediated by both yKu and the telomerase subunit Est1. Moreover, a mutation in Rfa1 that affects both the interaction with yKu and telomerase reduces the dramatic increase in telomere length of a rif1Δ, rif2Δ double mutant. Finally, we show that the RPA/telomerase association and function are conserved in Schizosaccharomyces pombe. Our results indicate that in both yeasts, RPA directly facilitates telomerase activity at chromosome ends. PMID:22354040

  8. RPA facilitates telomerase activity at chromosome ends in budding and fission yeasts.

    PubMed

    Luciano, Pierre; Coulon, Stéphane; Faure, Virginie; Corda, Yves; Bos, Julia; Brill, Steven J; Gilson, Eric; Simon, Marie-Noelle; Géli, Vincent

    2012-04-18

    In Saccharomyces cerevisiae, the telomerase complex binds to chromosome ends and is activated in late S-phase through a process coupled to the progression of the replication fork. Here, we show that the single-stranded DNA-binding protein RPA (replication protein A) binds to the two daughter telomeres during telomere replication but only its binding to the leading-strand telomere depends on the Mre11/Rad50/Xrs2 (MRX) complex. We further demonstrate that RPA specifically co-precipitates with yKu, Cdc13 and telomerase. The interaction of RPA with telomerase appears to be mediated by both yKu and the telomerase subunit Est1. Moreover, a mutation in Rfa1 that affects both the interaction with yKu and telomerase reduces the dramatic increase in telomere length of a rif1Δ, rif2Δ double mutant. Finally, we show that the RPA/telomerase association and function are conserved in Schizosaccharomyces pombe. Our results indicate that in both yeasts, RPA directly facilitates telomerase activity at chromosome ends.

  9. MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

    DOE PAGES

    Paugh, Steven W.; Coss, David R.; Bao, Ju; ...

    2016-02-04

    MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

  10. MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Paugh, Steven W.; Coss, David R.; Bao, Ju

    MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

  11. Deciphering the groove binding modes of tau-fluvalinate and flumethrin with calf thymus DNA

    NASA Astrophysics Data System (ADS)

    Tao, Mo; Zhang, Guowen; Pan, Junhui; Xiong, Chunhong

    2016-02-01

    Tau-fluvalinate (TFL) and flumethrin (FL), widely used in agriculture and a class of synthetic pyrethroid pesticides with a similar structure, may cause a potential security risk. Herein, the modes of binding in vitro of TFL and FL with calf thymus DNA (ctDNA) were characterized by fluorescence, UV-vis absorption, circular dichroism (CD) and Fourier transform infrared (FT-IR) spectroscopy with the aid of viscosity measurements, melting analyses and molecular docking studies. The fluorescence titration indicated that both TFL and FL bound to ctDNA forming complexes through hydrogen bonding and van der Waals forces. The binding constants of TFL and FL with ctDNA were in the range of 104 L mol- 1, and FL exhibited a higher binding propensity than TFL. The iodide quenching effect, single/double-stranded DNA effects, and ctDNA melting and viscosity measurements demonstrated that the binding of both TFL and FL to ctDNA was groove mode. The FT-IR analyses suggested the A-T region of the minor groove of ctDNA as the preferential binding for TFL and FL, which was confirmed by the displacement assays with Hoechst 33258 probe, and the molecular docking visualized the specific binding. The changes in CD spectra indicated that both FL and TFL induced the perturbation on the base stacking and helicity of B-DNA, but the disturbance caused by FL was more obvious. Gel electrophoresis analyses indicated that both TFL and FL did not cause significant DNA cleavage. This study provides novel insights into the binding properties of TFL/FL with ctDNA and its toxic mechanisms.

  12. Mre11 and Exo1 contribute to the initiation and processivity of resection at meiotic double-strand breaks made independently of Spo11.

    PubMed

    Hodgson, Adam; Terentyev, Yaroslav; Johnson, Rebecca A; Bishop-Bailey, Anna; Angevin, Thibaut; Croucher, Adam; Goldman, Alastair S H

    2011-02-07

    During meiosis DNA double-strand breaks (DSBs) are induced and repaired by homologous recombination to create gene conversion and crossover products. Mostly these DSBs are made by Spo11, which covalently binds to the DSB ends. More rarely in Saccharomyces cerevisiae, other meiotic DSBs are formed by self-homing endonucleases such as VDE, which is site specific and does not covalently bind to the DSB ends. We have used experimentally located VDE-DSB sites to analyse an intermediate step in homologous recombination, resection of the single-strand ending 5' at the DSB site. Analysis of strains with different mutant alleles of MRE11 (mre11-58S and mre11-H125N) and deleted for EXO1 indicated that these two nucleases make significant contributions to repair of VDE-DSBs. Physical analysis of single-stranded repair intermediates indicates that efficient initiation and processivity of resection at VDE-DSBs require both Mre11 and Exo1, with loss of function for either protein causing severe delay in resection. We propose that these experiments model what happens at Spo11-DSBs after removal of the covalently bound protein, and that Mre11 and Exo1 are the major nucleases involved in creating resection tracts of widely varying lengths typical of meiotic recombination. Copyright © 2010 Elsevier B.V. All rights reserved.

  13. Mlh1-Mlh3, a Meiotic Crossover and DNA Mismatch Repair Factor, Is a Msh2-Msh3-stimulated Endonuclease*

    PubMed Central

    Rogacheva, Maria V.; Manhart, Carol M.; Chen, Cheng; Guarne, Alba; Surtees, Jennifer; Alani, Eric

    2014-01-01

    Crossing over between homologous chromosomes is initiated in meiotic prophase in most sexually reproducing organisms by the appearance of programmed double strand breaks throughout the genome. In Saccharomyces cerevisiae the double-strand breaks are resected to form three prime single-strand tails that primarily invade complementary sequences in unbroken homologs. These invasion intermediates are converted into double Holliday junctions and then resolved into crossovers that facilitate homolog segregation during Meiosis I. Work in yeast suggests that Msh4-Msh5 stabilizes invasion intermediates and double Holliday junctions, which are resolved into crossovers in steps requiring Sgs1 helicase, Exo1, and a putative endonuclease activity encoded by the DNA mismatch repair factor Mlh1-Mlh3. We purified Mlh1-Mlh3 and showed that it is a metal-dependent and Msh2-Msh3-stimulated endonuclease that makes single-strand breaks in supercoiled DNA. These observations support a direct role for an Mlh1-Mlh3 endonuclease activity in resolving recombination intermediates and in DNA mismatch repair. PMID:24403070

  14. Mlh1-Mlh3, a meiotic crossover and DNA mismatch repair factor, is a Msh2-Msh3-stimulated endonuclease.

    PubMed

    Rogacheva, Maria V; Manhart, Carol M; Chen, Cheng; Guarne, Alba; Surtees, Jennifer; Alani, Eric

    2014-02-28

    Crossing over between homologous chromosomes is initiated in meiotic prophase in most sexually reproducing organisms by the appearance of programmed double strand breaks throughout the genome. In Saccharomyces cerevisiae the double-strand breaks are resected to form three prime single-strand tails that primarily invade complementary sequences in unbroken homologs. These invasion intermediates are converted into double Holliday junctions and then resolved into crossovers that facilitate homolog segregation during Meiosis I. Work in yeast suggests that Msh4-Msh5 stabilizes invasion intermediates and double Holliday junctions, which are resolved into crossovers in steps requiring Sgs1 helicase, Exo1, and a putative endonuclease activity encoded by the DNA mismatch repair factor Mlh1-Mlh3. We purified Mlh1-Mlh3 and showed that it is a metal-dependent and Msh2-Msh3-stimulated endonuclease that makes single-strand breaks in supercoiled DNA. These observations support a direct role for an Mlh1-Mlh3 endonuclease activity in resolving recombination intermediates and in DNA mismatch repair.

  15. Restriction Endonucleases from Invasive Neisseria gonorrhoeae Cause Double-Strand Breaks and Distort Mitosis in Epithelial Cells during Infection

    PubMed Central

    Weyler, Linda; Engelbrecht, Mattias; Mata Forsberg, Manuel; Brehwens, Karl; Vare, Daniel; Vielfort, Katarina; Wojcik, Andrzej; Aro, Helena

    2014-01-01

    The host epithelium is both a barrier against, and the target for microbial infections. Maintaining regulated cell growth ensures an intact protective layer towards microbial-induced cellular damage. Neisseria gonorrhoeae infections disrupt host cell cycle regulation machinery and the infection causes DNA double strand breaks that delay progression through the G2/M phase. We show that intracellular gonococci upregulate and release restriction endonucleases that enter the nucleus and damage human chromosomal DNA. Bacterial lysates containing restriction endonucleases were able to fragment genomic DNA as detected by PFGE. Lysates were also microinjected into the cytoplasm of cells in interphase and after 20 h, DNA double strand breaks were identified by 53BP1 staining. In addition, by using live-cell microscopy and NHS-ester stained live gonococci we visualized the subcellular location of the bacteria upon mitosis. Infected cells show dysregulation of the spindle assembly checkpoint proteins MAD1 and MAD2, impaired and prolonged M-phase, nuclear swelling, micronuclei formation and chromosomal instability. These data highlight basic molecular functions of how gonococcal infections affect host cell cycle regulation, cause DNA double strand breaks and predispose cellular malignancies. PMID:25460012

  16. Restriction endonucleases from invasive Neisseria gonorrhoeae cause double-strand breaks and distort mitosis in epithelial cells during infection.

    PubMed

    Weyler, Linda; Engelbrecht, Mattias; Mata Forsberg, Manuel; Brehwens, Karl; Vare, Daniel; Vielfort, Katarina; Wojcik, Andrzej; Aro, Helena

    2014-01-01

    The host epithelium is both a barrier against, and the target for microbial infections. Maintaining regulated cell growth ensures an intact protective layer towards microbial-induced cellular damage. Neisseria gonorrhoeae infections disrupt host cell cycle regulation machinery and the infection causes DNA double strand breaks that delay progression through the G2/M phase. We show that intracellular gonococci upregulate and release restriction endonucleases that enter the nucleus and damage human chromosomal DNA. Bacterial lysates containing restriction endonucleases were able to fragment genomic DNA as detected by PFGE. Lysates were also microinjected into the cytoplasm of cells in interphase and after 20 h, DNA double strand breaks were identified by 53BP1 staining. In addition, by using live-cell microscopy and NHS-ester stained live gonococci we visualized the subcellular location of the bacteria upon mitosis. Infected cells show dysregulation of the spindle assembly checkpoint proteins MAD1 and MAD2, impaired and prolonged M-phase, nuclear swelling, micronuclei formation and chromosomal instability. These data highlight basic molecular functions of how gonococcal infections affect host cell cycle regulation, cause DNA double strand breaks and predispose cellular malignancies.

  17. TALE-PvuII fusion proteins--novel tools for gene targeting.

    PubMed

    Yanik, Mert; Alzubi, Jamal; Lahaye, Thomas; Cathomen, Toni; Pingoud, Alfred; Wende, Wolfgang

    2013-01-01

    Zinc finger nucleases (ZFNs) consist of zinc fingers as DNA-binding module and the non-specific DNA-cleavage domain of the restriction endonuclease FokI as DNA-cleavage module. This architecture is also used by TALE nucleases (TALENs), in which the DNA-binding modules of the ZFNs have been replaced by DNA-binding domains based on transcription activator like effector (TALE) proteins. Both TALENs and ZFNs are programmable nucleases which rely on the dimerization of FokI to induce double-strand DNA cleavage at the target site after recognition of the target DNA by the respective DNA-binding module. TALENs seem to have an advantage over ZFNs, as the assembly of TALE proteins is easier than that of ZFNs. Here, we present evidence that variant TALENs can be produced by replacing the catalytic domain of FokI with the restriction endonuclease PvuII. These fusion proteins recognize only the composite recognition site consisting of the target site of the TALE protein and the PvuII recognition sequence (addressed site), but not isolated TALE or PvuII recognition sites (unaddressed sites), even at high excess of protein over DNA and long incubation times. In vitro, their preference for an addressed over an unaddressed site is > 34,000-fold. Moreover, TALE-PvuII fusion proteins are active in cellula with minimal cytotoxicity.

  18. Structure of the human DNA-repair protein RAD52 containing surface mutations.

    PubMed

    Saotome, Mika; Saito, Kengo; Onodera, Keiichi; Kurumizaka, Hitoshi; Kagawa, Wataru

    2016-08-01

    The Rad52 protein is a eukaryotic single-strand DNA-annealing protein that is involved in the homologous recombinational repair of DNA double-strand breaks. The isolated N-terminal half of the human RAD52 protein (RAD52(1-212)) forms an undecameric ring structure with a surface that is mostly positively charged. In the present study, it was found that RAD52(1-212) containing alanine mutations of the charged surface residues (Lys102, Lys133 and Glu202) is highly amenable to crystallization. The structure of the mutant RAD52(1-212) was solved at 2.4 Å resolution. The structure revealed an association between the symmetry-related RAD52(1-212) rings, in which a partially unfolded, C-terminal region of RAD52 extended into the DNA-binding groove of the neighbouring ring in the crystal. The alanine mutations probably reduced the surface entropy of the RAD52(1-212) ring and stabilized the ring-ring association observed in the crystal.

  19. Production of DNA minicircles less than 250 base pairs through a novel concentrated DNA circularization assay enabling minicircle design with NF-κB inhibition activity

    PubMed Central

    Thibault, Thomas; Degrouard, Jeril; Baril, Patrick; Pichon, Chantal; Midoux, Patrick

    2017-01-01

    Abstract Double-stranded DNA minicircles of less than 1000 bp in length have great interest in both fundamental research and therapeutic applications. Although minicircles have shown promising activity in gene therapy thanks to their good biostability and better intracellular trafficking, minicircles down to 250 bp in size have not yet been investigated from the test tube to the cell for lack of an efficient production method. Herein, we report a novel versatile plasmid-free method for the production of DNA minicircles comprising fewer than 250 bp. We designed a linear nicked DNA double-stranded oligonucleotide blunt-ended substrate for efficient minicircle production in a ligase-mediated and bending protein-assisted circularization reaction at high DNA concentration of 2 μM. This one pot multi-step reaction based-method yields hundreds of micrograms of minicircle with sequences of any base composition and position and containing or not a variety of site-specifically chemical modifications or physiological supercoiling. Biochemical and cellular studies were then conducted to design a 95 bp minicircle capable of binding in vitro two NF-κB transcription factors per minicircle and to efficiently inhibiting NF-κB-dependent transcriptional activity in human cells. Therefore, our production method could pave the way for the design of minicircles as new decoy nucleic acids. PMID:27899652

  20. Reliable method for generating double-stranded DNA vectors containing site-specific base modifications.

    PubMed

    Brégeon, Damien; Doetsch, Paul W

    2004-11-01

    Cells of all living organisms are continuously exposed to physical and chemical agents that damage DNA and alter the integrity of their genomes. Despite the relatively high efficiency of the different repair pathways, some lesions remain in DNA when it is replicated or transcribed. Lesion bypass by DNA and RNA polymerases has been the subject of numerous investigations. However, knowledge of the in vivo mechanism of transcription lesion bypass is very limited because no robust methodology is available. Here we describe a protocol based on the synthesis of a complementary strand of a circular, single-stranded DNA molecule, which allows for the production of large amounts of double-stranded DNA containing a lesion at a specific position in a transcribed sequence. Such constructs can subsequently be used for lesion bypass studies in vivo by RNA polymerase and to ascertain how these events can be affected by the genetic background of the cells.

  1. An alternative mechanism for radioprotection by dimethyl sulfoxide; possible facilitation of DNA double-strand break repair.

    PubMed

    Kashino, Genro; Liu, Yong; Suzuki, Minoru; Masunaga, Shin-ichiro; Kinashi, Yuko; Ono, Koji; Tano, Keizo; Watanabe, Masami

    2010-01-01

    The radioprotective effects of dimethyl sulfoxide (DMSO) have been known for many years, and the suppression of hydroxyl (OH) radicals induced by ionizing radiation has been thought to be the main cause of this effect. However, the DMSO concentration used was very high, and might be toxic, in earlier studies. In the present study, we administered a lower, non-toxic concentration (0.5%, i.e., 64 mM) of DMSO before irradiation and examined its radioprotective effects. Colony formation assay and micronucleus assay showed significant radioprotective effects in CHO, but not in xrs5, which is defective in the repair function of DNA double-strand breaks. The levels of phosphorylated H2AX and the formation of 53BP1 foci 15 minutes after irradiation, which might reflect initial DNA double-strand breaks, in DMSO-treated CHO cells were similar to those in non-treated cells, suggesting that the radioprotective effects were not attributable to the suppression of general indirect action in the lower concentration of DMSO. On the other hand, 2 hours after irradiation, the average number of 53BP1 foci, which might reflect residual DNA double-strand breaks, was significantly decreased in DMSO-treated CHO cells compared to non-treated cells. The results indicated that low concentration of DMSO exerts radioprotective effects through the facilitation of DNA double-strand break repair rather than through the suppression of indirect action.

  2. One ring to bring them all--the role of Ku in mammalian non-homologous end joining.

    PubMed

    Grundy, Gabrielle J; Moulding, Hayley A; Caldecott, Keith W; Rulten, Stuart L

    2014-05-01

    The repair of DNA double strand breaks is essential for cell survival and several conserved pathways have evolved to ensure their rapid and efficient repair. The non-homologous end joining pathway is initiated when Ku binds to the DNA break site. Ku is an abundant nuclear heterodimer of Ku70 and Ku80 with a toroidal structure that allows the protein to slide over the broken DNA end and bind with high affinity. Once locked into placed, Ku acts as a tool-belt to recruit multiple interacting proteins, forming one or more non-homologous end joining complexes that act in a regulated manner to ensure efficient repair of DNA ends. Here we review the structure and functions of Ku and the proteins with which it interacts during non-homologous end joining. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Binding polarity of RPA to telomeric sequences and influence of G-quadruplex stability.

    PubMed

    Safa, Layal; Delagoutte, Emmanuelle; Petruseva, Irina; Alberti, Patrizia; Lavrik, Olga; Riou, Jean-François; Saintomé, Carole

    2014-08-01

    Replication protein A (RPA) is a single-stranded DNA binding protein that plays an essential role in telomere maintenance. RPA binds to and unfolds G-quadruplex (G4) structures formed in telomeric DNA, thus facilitating lagging strand DNA replication and telomerase activity. To investigate the effect of G4 stability on the interactions with human RPA (hRPA), we used a combination of biochemical and biophysical approaches. Our data revealed an inverse relationship between G4 stability and ability of hRPA to bind to telomeric DNA; notably small G4 ligands that enhance G4 stability strongly impaired G4 unfolding by hRPA. To gain more insight into the mechanism of binding and unfolding of telomeric G4 structures by RPA, we carried out photo-crosslinking experiments to elucidate the spatial arrangement of the RPA subunits along the DNA strands. Our results showed that RPA1 and RPA2 are arranged from 5' to 3' along the unfolded telomeric G4, as already described for unstructured single-stranded DNA, while no contact is possible with RPA3 on this short oligonucleotide. In addition, these data are compatible with a 5' to 3' directionality in G4 unfolding by hRPA. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  4. A ruthenium dimer complex with a flexible linker slowly threads between DNA bases in two distinct steps.

    PubMed

    Bahira, Meriem; McCauley, Micah J; Almaqwashi, Ali A; Lincoln, Per; Westerlund, Fredrik; Rouzina, Ioulia; Williams, Mark C

    2015-10-15

    Several multi-component DNA intercalating small molecules have been designed around ruthenium-based intercalating monomers to optimize DNA binding properties for therapeutic use. Here we probe the DNA binding ligand [μ-C4(cpdppz)2(phen)4Ru2](4+), which consists of two Ru(phen)2dppz(2+) moieties joined by a flexible linker. To quantify ligand binding, double-stranded DNA is stretched with optical tweezers and exposed to ligand under constant applied force. In contrast to other bis-intercalators, we find that ligand association is described by a two-step process, which consists of fast bimolecular intercalation of the first dppz moiety followed by ∼10-fold slower intercalation of the second dppz moiety. The second step is rate-limited by the requirement for a DNA-ligand conformational change that allows the flexible linker to pass through the DNA duplex. Based on our measured force-dependent binding rates and ligand-induced DNA elongation measurements, we are able to map out the energy landscape and structural dynamics for both ligand binding steps. In addition, we find that at zero force the overall binding process involves fast association (∼10 s), slow dissociation (∼300 s), and very high affinity (Kd ∼10 nM). The methodology developed in this work will be useful for studying the mechanism of DNA binding by other multi-step intercalating ligands and proteins. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Association of Many Regions of the Bacillus subtilis Chromosome with the Cell Membrane

    PubMed Central

    Ivarie, Robert D.; Pène, Jacques J.

    1973-01-01

    Unsheared lysates of Bacillus subtilis 168T− containing uniformly labeled deoxyribonucleic acid (DNA) were exposed to varying doses of gamma rays to introduce double-strand scissions in the chromosome. From an estimate of the number-average molecular weight and the amount of DNA bound to membrane after irradiation, about 70 to 90 regions of the bacterial chromosome were detected in membrane fractions. Since this number was independent of the molecular weight of the DNA (i.e., the extent of fragmentation of the chromosome), it is thought to represent an upper limit in the number of membrane-binding sites per chromosome. PMID:4196245

  6. Two-Tailed Comet Assay (2T-Comet): Simultaneous Detection of DNA Single and Double Strand Breaks.

    PubMed

    Cortés-Gutiérrez, Elva I; Fernández, José Luis; Dávila-Rodríguez, Martha I; López-Fernández, Carmen; Gosálvez, Jaime

    2017-01-01

    A modification of the original comet assay was developed for the simultaneous evaluation of DNA single strand breaks (SSBs) and double strand breaks (DSBs) in human spermatozoa. The two-dimensional perpendicular tail comet assay (2T-comet) combines non-denaturing and denaturant conditions to the same sperm nucleoid. In this case, the species-specific deproteinized sperm is first subjected to an electrophoretic field under non-denaturing conditions to mobilize isolated free discrete DNA fragments produced from DSBs; this is then followed by a second electrophoresis running perpendicular to the first one but under alkaline conditions to produce DNA denaturation, exposing SSBs on the same linear DNA chain or DNA fragments flanked by DSBs. This procedure results in a two dimensional comet tail emerging from the core where two types of original DNA affected molecule can be simultaneously discriminated. The 2T-comet is a fast, sensitive, and reliable procedure to distinguish between single and double strand DNA damage within the same cell. It is an innovative method for assessing sperm DNA integrity, which has important implications for human fertility and andrological pathology. This technique may be adapted to assess different DNA break types in other species and other cell types.

  7. SINGLE STRAND-CONTAINING REPLICATING MOLECULES OF CIRCULAR MITOCHONDRIAL DNA

    PubMed Central

    Wolstenholme, David R.; Koike, Katsuro; Cochran-Fouts, Patricia

    1973-01-01

    Mitochondrial DNAs (mtDNAs) from Chang rat solid hepatomas and Novikoff rat ascites hepatomas were examined in the electron microscope after preparation by the aqueous and by the formamide protein monolayer techniques. MtDNAs from both tumors were found to include double-forked circular molecules with a form and size suggesting they were replicative intermediates. These molecules were of two classes. In molecules of one class, all three segments were apparently totally double stranded. Molecules of the second class were distinguished by the fact that one of the segments spanning the region between the forks in which replication had occurred (the daughter segments) was either totally single stranded, or contained a single-stranded region associated with one of the forks. Daughter segments of both totally double-stranded and single strand-containing replicating molecules varied in length from about 3 to about 80% of the circular contour length of the molecule. Similar classes of replicating molecules were found in mtDNA from regenerating rat liver and chick embryos, indicating them to be normal intermediates in the replication of mtDNA All of the mtDNAs examined included partially single-stranded simple (nonforked) circular molecules. A possible scheme for the replication of mtDNA is presented, based on the different molecular forms observed PMID:4345165

  8. T7 RNA polymerase non-specifically transcribes and induces disassembly of DNA nanostructures

    PubMed Central

    Schaffter, Samuel W; Green, Leopold N; Schneider, Joanna; Subramanian, Hari K K; Schulman, Rebecca

    2018-01-01

    Abstract The use of proteins that bind and catalyze reactions with DNA alongside DNA nanostructures has broadened the functionality of DNA devices. DNA binding proteins have been used to specifically pattern and tune structural properties of DNA nanostructures and polymerases have been employed to directly and indirectly drive structural changes in DNA structures and devices. Despite these advances, undesired and poorly understood interactions between DNA nanostructures and proteins that bind DNA continue to negatively affect the performance and stability of DNA devices used in conjunction with enzymes. A better understanding of these undesired interactions will enable the construction of robust DNA nanostructure-enzyme hybrid systems. Here, we investigate the undesired disassembly of DNA nanotubes in the presence of viral RNA polymerases (RNAPs) under conditions used for in vitro transcription. We show that nanotubes and individual nanotube monomers (tiles) are non-specifically transcribed by T7 RNAP, and that RNA transcripts produced during non-specific transcription disassemble the nanotubes. Disassembly requires a single-stranded overhang on the nanotube tiles where transcripts can bind and initiate disassembly through strand displacement, suggesting that single-stranded domains on other DNA nanostructures could cause unexpected interactions in the presence of viral RNA polymerases. PMID:29718412

  9. T7 RNA polymerase non-specifically transcribes and induces disassembly of DNA nanostructures.

    PubMed

    Schaffter, Samuel W; Green, Leopold N; Schneider, Joanna; Subramanian, Hari K K; Schulman, Rebecca; Franco, Elisa

    2018-06-01

    The use of proteins that bind and catalyze reactions with DNA alongside DNA nanostructures has broadened the functionality of DNA devices. DNA binding proteins have been used to specifically pattern and tune structural properties of DNA nanostructures and polymerases have been employed to directly and indirectly drive structural changes in DNA structures and devices. Despite these advances, undesired and poorly understood interactions between DNA nanostructures and proteins that bind DNA continue to negatively affect the performance and stability of DNA devices used in conjunction with enzymes. A better understanding of these undesired interactions will enable the construction of robust DNA nanostructure-enzyme hybrid systems. Here, we investigate the undesired disassembly of DNA nanotubes in the presence of viral RNA polymerases (RNAPs) under conditions used for in vitro transcription. We show that nanotubes and individual nanotube monomers (tiles) are non-specifically transcribed by T7 RNAP, and that RNA transcripts produced during non-specific transcription disassemble the nanotubes. Disassembly requires a single-stranded overhang on the nanotube tiles where transcripts can bind and initiate disassembly through strand displacement, suggesting that single-stranded domains on other DNA nanostructures could cause unexpected interactions in the presence of viral RNA polymerases.

  10. The Walker A motif mutation recA4159 abolishes the SOS response and recombination in a recA730 mutant of Escherichia coli.

    PubMed

    Šimatović, Ana; Mitrikeski, Petar T; Vlašić, Ignacija; Sopta, Mary; Brčić-Kostić, Krunoslav

    2016-01-01

    In bacteria, the RecA protein forms recombinogenic filaments required for the SOS response and DNA recombination. In order to form a recombinogenic filament, wild type RecA needs to bind ATP and to interact with mediator proteins. The RecA730 protein is a mutant version of RecA with superior catalytic abilities, allowing filament formation without the help of mediator proteins. The mechanism of RecA730 filament formation is not well understood, and the question remains as to whether the RecA730 protein requires ATP binding in order to become competent for filament formation. We examined two mutants, recA730,4159 (presumed to be defective for ATP binding) and recA730,2201 (defective for ATP hydrolysis), and show that they have different properties with respect to SOS induction, conjugational recombination and double-strand break repair. We show that ATP binding is essential for all RecA730 functions, while ATP hydrolysis is required only for double-strand break repair. Our results emphasize the similarity of the SOS response and conjugational recombination, neither of which requires ATP hydrolysis by RecA730. Copyright © 2016 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  11. Recent Advances in Chemical Modification of Peptide Nucleic Acids

    PubMed Central

    Rozners, Eriks

    2012-01-01

    Peptide nucleic acid (PNA) has become an extremely powerful tool in chemistry and biology. Although PNA recognizes single-stranded nucleic acids with exceptionally high affinity and sequence selectivity, there is considerable ongoing effort to further improve properties of PNA for both fundamental science and practical applications. The present paper discusses selected recent studies that improve on cellular uptake and binding of PNA to double-stranded DNA and RNA. The focus is on chemical modifications of PNA's backbone and heterocyclic nucleobases. The paper selects representative recent studies and does not attempt to provide comprehensive coverage of the broad and vibrant field of PNA modification. PMID:22991652

  12. Time-lapse crystallography snapshots of a double-strand break repair polymerase in action.

    PubMed

    Jamsen, Joonas A; Beard, William A; Pedersen, Lars C; Shock, David D; Moon, Andrea F; Krahn, Juno M; Bebenek, Katarzyna; Kunkel, Thomas A; Wilson, Samuel H

    2017-08-15

    DNA polymerase (pol) μ is a DNA-dependent polymerase that incorporates nucleotides during gap-filling synthesis in the non-homologous end-joining pathway of double-strand break repair. Here we report time-lapse X-ray crystallography snapshots of catalytic events during gap-filling DNA synthesis by pol μ. Unique catalytic intermediates and active site conformational changes that underlie catalysis are uncovered, and a transient third (product) metal ion is observed in the product state. The product manganese coordinates phosphate oxygens of the inserted nucleotide and PP i . The product metal is not observed during DNA synthesis in the presence of magnesium. Kinetic analyses indicate that manganese increases the rate constant for deoxynucleoside 5'-triphosphate insertion compared to magnesium. The likely product stabilization role of the manganese product metal in pol μ is discussed. These observations provide insight on structural attributes of this X-family double-strand break repair polymerase that impact its biological function in genome maintenance.DNA polymerase (pol) μ functions in DNA double-strand break repair. Here the authors use time-lapse X-ray crystallography to capture the states of pol µ during the conversion from pre-catalytic to product complex and observe a third transiently bound metal ion in the product state.

  13. DNA Stimulates ATP-Dependent Proteolysis and Protein-Dependent ATPase Activity of Protease La from Escherichia coli

    NASA Astrophysics Data System (ADS)

    Chung, Chin Ha; Goldberg, Alfred L.

    1982-02-01

    The product of the lon gene in Escherichia coli is an ATP-dependent protease, protease La, that also binds strongly to DNA. Addition of double-stranded or single-stranded DNA to the protease in the presence of ATP was found to stimulate the hydrolysis of casein or globin 2- to 7-fold, depending on the DNA concentration. Native DNA from several sources (plasmid pBR322, phage T7, or calf thymus) had similar effects, but after denaturation the DNA was 20-100% more effective than the native form. Although poly(rA), globin mRNA, and various tRNAs did not stimulate proteolysis, poly(rC) and poly(rU) were effective. Poly(dT) was stimulatory but (dT)10 was not. In the presence of DNA as in its absence, proteolysis required concomitant ATP hydrolysis, and the addition of DNA also enhanced ATP hydrolysis by protease La 2-fold, but only in the presence of casein. At much higher concentrations, DNA inhibited proteolysis as well as ATP cleavage. Thus, association of this enzyme with DNA may regulate the degradation of cell proteins in vivo.

  14. Extended Minus-Strand DNA as Template for R-U5-Mediated Second-Strand Transfer in Recombinational Rescue of Primer Binding Site-Modified Retroviral Vectors

    PubMed Central

    Mikkelsen, Jacob Giehm; Lund, Anders H.; Dybkær, Karen; Duch, Mogens; Pedersen, Finn Skou

    1998-01-01

    We have previously demonstrated recombinational rescue of primer binding site (PBS)-impaired Akv murine leukemia virus-based vectors involving initial priming on endogenous viral sequences and template switching during cDNA synthesis to obtain PBS complementarity in second-strand transfer of reverse transcription (Mikkelsen et al., J. Virol. 70:1439–1447, 1996). By use of the same forced recombination system, we have now found recombinant proviruses of different structures, suggesting that PBS knockout vectors may be rescued through initial priming on endogenous virus RNA, read-through of the mutated PBS during minus-strand synthesis, and subsequent second-strand transfer mediated by the R-U5 complementarity of the plus strand and the extended minus-strand DNA acceptor template. Mechanisms for R-U5-mediated second-strand transfer and its possible role in retrovirus replication and evolution are discussed. PMID:9499117

  15. Molecular and functional characterization of single-box high-mobility group B (HMGB) chromosomal protein from Aedes aegypti.

    PubMed

    de Abreu da Silva, Isabel Caetano; Vicentino, Amanda Roberta Revoredo; Dos Santos, Renata Coutinho; da Fonseca, Rodrigo Nunes; de Mendonça Amarante, Anderson; Carneiro, Vitor Coutinho; de Amorim Pinto, Marcia; Aguilera, Estefania Anahi; Mohana-Borges, Ronaldo; Bisch, Paulo Mascarello; da Silva-Neto, Mario Alberto Cardoso; Fantappié, Marcelo Rosado

    2018-05-30

    High-mobility group B (HMGB) proteins have highly conserved, unique DNA-binding domains, HMG boxes, that can bind non-B-type DNA structures, such as bent, kinked and unwound structures, with high affinity. HMGB proteins also promote DNA bending, looping and unwinding. In this study, we determined the role of the Aedes aegypti single HMG-box domain protein AaHMGB; characterized its structure, spatiotemporal expression levels, subcellular localization, and nucleic acid binding activities; and compared these properties with those of its double-HMG-box counterpart protein, AaHMGB1. Via qRT-PCR, we showed that AaHMGB is expressed at much higher levels than AaHMGB1 throughout mosquito development. In situ hybridization results suggested a role for AaHMGB and AaHMGB1 during embryogenesis. Immunolocalization in the midgut revealed that AaHMGB is exclusively nuclear. Circular dichroism and fluorescence spectroscopy analyses showed that AaHMGB exhibits common features of α-helical structures and is more stably folded than AaHMGB1, likely due to the presence of one or two HMG boxes. Using several DNA substrates or single-stranded RNAs as probes, we observed significant differences between AaHMGB and AaHMGB1 in terms of their binding patterns, activity and/or specificity. Importantly, we showed that the phosphorylation of AaHMGB plays a critical role in its DNA-binding activity. Our study provides additional insight into the roles of single- versus double-HMG-box-containing proteins in nucleic acid interactions for better understanding of mosquito development, physiology and homeostasis. Copyright © 2017. Published by Elsevier B.V.

  16. Probing the Potential Role of Non-B DNA Structures at Yeast Meiosis-Specific DNA Double-Strand Breaks.

    PubMed

    Kshirsagar, Rucha; Khan, Krishnendu; Joshi, Mamata V; Hosur, Ramakrishna V; Muniyappa, K

    2017-05-23

    A plethora of evidence suggests that different types of DNA quadruplexes are widely present in the genome of all organisms. The existence of a growing number of proteins that selectively bind and/or process these structures underscores their biological relevance. Moreover, G-quadruplex DNA has been implicated in the alignment of four sister chromatids by forming parallel guanine quadruplexes during meiosis; however, the underlying mechanism is not well defined. Here we show that a G/C-rich motif associated with a meiosis-specific DNA double-strand break (DSB) in Saccharomyces cerevisiae folds into G-quadruplex, and the C-rich sequence complementary to the G-rich sequence forms an i-motif. The presence of G-quadruplex or i-motif structures upstream of the green fluorescent protein-coding sequence markedly reduces the levels of gfp mRNA expression in S. cerevisiae cells, with a concomitant decrease in green fluorescent protein abundance, and blocks primer extension by DNA polymerase, thereby demonstrating the functional significance of these structures. Surprisingly, although S. cerevisiae Hop1, a component of synaptonemal complex axial/lateral elements, exhibits strong affinity to G-quadruplex DNA, it displays a much weaker affinity for the i-motif structure. However, the Hop1 C-terminal but not the N-terminal domain possesses strong i-motif binding activity, implying that the C-terminal domain has a distinct substrate specificity. Additionally, we found that Hop1 promotes intermolecular pairing between G/C-rich DNA segments associated with a meiosis-specific DSB site. Our results support the idea that the G/C-rich motifs associated with meiosis-specific DSBs fold into intramolecular G-quadruplex and i-motif structures, both in vitro and in vivo, thus revealing an important link between non-B form DNA structures and Hop1 in meiotic chromosome synapsis and recombination. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  17. Cooperation of breast cancer proteins PALB2 and piccolo BRCA2 in stimulating homologous recombination.

    PubMed

    Buisson, Rémi; Dion-Côté, Anne-Marie; Coulombe, Yan; Launay, Hélène; Cai, Hong; Stasiak, Alicja Z; Stasiak, Andrzej; Xia, Bing; Masson, Jean-Yves

    2010-10-01

    Inherited mutations in human PALB2 are associated with a predisposition to breast and pancreatic cancers. PALB2's tumor-suppressing effect is thought to be based on its ability to facilitate BRCA2's function in homologous recombination. However, the biochemical properties of PALB2 are unknown. Here we show that human PALB2 binds DNA, preferentially D-loop structures, and directly interacts with the RAD51 recombinase to stimulate strand invasion, a vital step of homologous recombination. This stimulation occurs through reinforcing biochemical mechanisms, as PALB2 alleviates inhibition by RPA and stabilizes the RAD51 filament. Moreover, PALB2 can function synergistically with a BRCA2 chimera (termed piccolo, or piBRCA2) to further promote strand invasion. Finally, we show that PALB2-deficient cells are sensitive to PARP inhibitors. Our studies provide the first biochemical insights into PALB2's function with piBRCA2 as a mediator of homologous recombination in DNA double-strand break repair.

  18. Cell-type specific role of the RNA-binding protein, NONO, in the DNA double-strand break response in the mouse testes.

    PubMed

    Li, Shuyi; Shu, Feng-Jue; Li, Zhentian; Jaafar, Lahcen; Zhao, Shourong; Dynan, William S

    2017-03-01

    The tandem RNA recognition motif protein, NONO, was previously identified as a candidate DNA double-strand break (DSB) repair factor in a biochemical screen for proteins with end-joining stimulatory activity. Subsequent work showed that NONO and its binding partner, SFPQ, have many of the properties expected for bona fide repair factors in cell-based assays. Their contribution to the DNA damage response in intact tissue in vivo has not, however, been demonstrated. Here we compare DNA damage sensitivity in the testes of wild-type mice versus mice bearing a null allele of the NONO homologue (Nono gt ). In wild-type mice, NONO protein was present in Sertoli, peritubular myoid, and interstitial cells, with an increase in expression following induction of DNA damage. As expected for the product of an X-linked gene, NONO was not detected in germ cells. The Nono gt/0 mice had at most a mild testis developmental phenotype in the absence of genotoxic stress. However, following irradiation at sublethal, 2-4 Gy doses, Nono gt/0 mice displayed a number of indicators of radiosensitivity as compared to their wild-type counterparts. These included higher levels of persistent DSB repair foci, increased numbers of apoptotic cells in the seminiferous tubules, and partial degeneration of the blood-testis barrier. There was also an almost complete loss of germ cells at later times following irradiation, evidently arising as an indirect effect reflecting loss of stromal support. Results demonstrate a role for NONO protein in protection against direct and indirect biological effects of ionizing radiation in the whole animal. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Depletion of tyrosyl DNA phosphodiesterase 2 activity enhances etoposide-mediated double-strand break formation and cell killing.

    PubMed

    Kont, Yasemin Saygideger; Dutta, Arijit; Mallisetty, Apurva; Mathew, Jeena; Minas, Tsion; Kraus, Christina; Dhopeshwarkar, Priyanka; Kallakury, Bhaskar; Mitra, Sankar; Üren, Aykut; Adhikari, Sanjay

    2016-07-01

    DNA topoisomerase 2 (Top2) poisons, including common anticancer drugs etoposide and doxorubicin kill cancer cells by stabilizing covalent Top2-tyrosyl-DNA 5'-phosphodiester adducts and DNA double-strand breaks (DSBs). Proteolytic degradation of the covalently attached Top2 leaves a 5'-tyrosylated blocked termini which is removed by tyrosyl DNA phosphodiesterase 2 (TDP2), prior to DSB repair through non-homologous end joining (NHEJ). Thus, TDP2 confers resistance of tumor cells to Top2-poisons by repairing such covalent DNA-protein adducts, and its pharmacological inhibition could enhance the efficacy of Top2-poisons. We discovered NSC111041, a selective inhibitor of TDP2, by optimizing a high throughput screening (HTS) assay for TDP2's 5'-tyrosyl phosphodiesterase activity and subsequent validation studies. We found that NSC111041 inhibits TDP2's binding to DNA without getting intercalated into DNA and enhanced etoposide's cytotoxicity synergistically in TDP2-expressing cells but not in TDP2 depleted cells. Furthermore, NSC111041 enhanced formation of etoposide-induced γ-H2AX foci presumably by affecting DSB repair. Immuno-histochemical analysis showed higher TDP2 expression in a sub-set of different type of tumor tissues. These findings underscore the feasibility of clinical use of suitable TDP2 inhibitors in adjuvant therapy with Top2-poisons for a sub-set of cancer patients with high TDP2 expression. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Computational characterization of DNA/peptide/nanotube self assembly for bioenergy applications

    NASA Astrophysics Data System (ADS)

    Ortiz, Vanessa; Araki, Ruriko; Collier, Galen

    2012-02-01

    Multi-enzyme pathways have become a subject of increasing interest for their role in the engineering of biomimetic systems for applications including biosensors, bioelectronics, and bioenergy. The efficiencies found in natural metabolic pathways partially arise from biomolecular self-assembly of the component enzymes in an effort to avoid transport limitations. The ultimate goal of this effort is to design and build biofuel cells with efficiencies similar to those of native systems by introducing biomimetic structures that immobilize multiple enzymes in specific orientations on a bioelectrode. To achieve site-specific immobilization, the specificity of DNA-binding domains is exploited with an approach that allows any redox enzyme to be modified to site-specifically bind to double stranded (ds) DNA while retaining activity. Because of its many desirable properties, the bioelectrode of choice is single-wall carbon nanotubes (SWNTs), but little is known about dsDNA/SWNT assembly and how this might affect the activity of the DNA-binding domains. Here we evaluate the feasibility of the proposed assembly by performing atomistic molecular dynamics simulations to look at the stability and conformations adopted by dsDNA when bound to a SWNT. We also evaluate the effects of the presence of a SWNT on the stability of the complex formed by a DNA-binding domain and DNA.

  1. Dewar Lesion Formation in Single- and Double-Stranded DNA is Quenched by Neighboring Bases.

    PubMed

    Bucher, Dominik B; Pilles, Bert M; Carell, Thomas; Zinth, Wolfgang

    2015-07-16

    UV-induced Dewar lesion formation is investigated in single- and double-stranded oligonucleotides with ultrafast vibrational spectroscopy. The quantum yield for the conversion of the (6-4) lesion to the Dewar isomer in DNA strands is reduced by a factor of 4 in comparison to model dinucleotides. Time resolved spectroscopy reveals a fast process in the excited state with spectral characteristics of bases which are adjacent to the excited (6-4) lesion. These kinetic components have large amplitudes and indicate that an additional quenching channel acts in the stranded DNA systems and reduces the Dewar formation yield. Presumably relaxation evolves via a charge transfer to the neighboring guanine and the paired cytosine participates in a double-stranded oligomer. Changes in the decay of the relaxed excited electronic state of the (6-4) chromophore point to modifications in the excited state energy landscape which may lead to an additional reduction of the Dewar formation yield.

  2. p53 isoform Δ113p53/Δ133p53 promotes DNA double-strand break repair to protect cell from death and senescence in response to DNA damage.

    PubMed

    Gong, Lu; Gong, Hongjian; Pan, Xiao; Chang, Changqing; Ou, Zhao; Ye, Shengfan; Yin, Le; Yang, Lina; Tao, Ting; Zhang, Zhenhai; Liu, Cong; Lane, David P; Peng, Jinrong; Chen, Jun

    2015-03-01

    The inhibitory role of p53 in DNA double-strand break (DSB) repair seems contradictory to its tumor-suppressing property. The p53 isoform Δ113p53/Δ133p53 is a p53 target gene that antagonizes p53 apoptotic activity. However, information on its functions in DNA damage repair is lacking. Here we report that Δ113p53 expression is strongly induced by γ-irradiation, but not by UV-irradiation or heat shock treatment. Strikingly, Δ113p53 promotes DNA DSB repair pathways, including homologous recombination, non-homologous end joining and single-strand annealing. To study the biological significance of Δ113p53 in promoting DNA DSB repair, we generated a zebrafish Δ113p53(M/M) mutant via the transcription activator-like effector nuclease technique and found that the mutant is more sensitive to γ-irradiation. The human ortholog, Δ133p53, is also only induced by γ-irradiation and functions to promote DNA DSB repair. Δ133p53-knockdown cells were arrested at the G2 phase at the later stage in response to γ-irradiation due to a high level of unrepaired DNA DSBs, which finally led to cell senescence. Furthermore, Δ113p53/Δ133p53 promotes DNA DSB repair via upregulating the transcription of repair genes rad51, lig4 and rad52 by binding to a novel type of p53-responsive element in their promoters. Our results demonstrate that Δ113p53/Δ133p53 is an evolutionally conserved pro-survival factor for DNA damage stress by preventing apoptosis and promoting DNA DSB repair to inhibit cell senescence. Our data also suggest that the induction of Δ133p53 expression in normal cells or tissues provides an important tolerance marker for cancer patients to radiotherapy.

  3. The biology of DHX9 and its potential as a therapeutic target

    PubMed Central

    Lee, Teresa; Pelletier, Jerry

    2016-01-01

    DHX9 is member of the DExD/H-box family of helicases with a “DEIH” sequence at its eponymous DExH-box motif. Initially purified from human and bovine cells and identified as a homologue of the Drosophila Maleless (MLE) protein, it is an NTP-dependent helicase consisting of a conserved helicase core domain, two double-stranded RNA-binding domains at the N-terminus, and a nuclear transport domain and a single-stranded DNA-binding RGG-box at the C-terminus. With an ability to unwind DNA and RNA duplexes, as well as more complex nucleic acid structures, DHX9 appears to play a central role in many cellular processes. Its functions include regulation of DNA replication, transcription, translation, microRNA biogenesis, RNA processing and transport, and maintenance of genomic stability. Because of its central role in gene regulation and RNA metabolism, there are growing implications for DHX9 in human diseases and their treatment. This review will provide an overview of the structure, biochemistry, and biology of DHX9, its role in cancer and other human diseases, and the possibility of targeting DHX9 in chemotherapy. PMID:27034008

  4. The effects of buffers and pH on the thermal stability, unfolding and substrate binding of RecA.

    PubMed

    Metrick, Michael A; Temple, Joshua E; MacDonald, Gina

    2013-12-31

    The Escherichia coli protein RecA is responsible for catalysis of the strand transfer reaction used in DNA repair and recombination. Previous studies in our lab have shown that high concentrations of salts stabilize RecA in a reverse-anionic Hofmeister series. Here we investigate how changes in pH and buffer alter the thermal unfolding and cofactor binding. RecA in 20mM HEPES, MES, Tris and phosphate buffers was studied in the pH range from 6.5 to 8.5 using circular dichroism (CD), infrared (IR) and fluorescence spectroscopies. The results show all of the buffers studied stabilize RecA up to 50°C above the Tris melting temperature and influence RecA's ability to nucleate on double-stranded DNA. Infrared and CD spectra of RecA in the different buffers do not show that secondary structural changes are associated with increased stability or decreased ability to nucleate on dsDNA. These results suggest the differences in stability arise from decreasing positive charge and/or buffer interactions. © 2013. Published by Elsevier B.V. All rights reserved.

  5. B-DNA Structure and Stability as Function of Nucleic Acid Composition: Dispersion-Corrected DFT Study of Dinucleoside Monophosphate Single and Double Strands

    PubMed Central

    Barone, Giampaolo; Fonseca Guerra, Célia; Bickelhaupt, F Matthias

    2013-01-01

    We have computationally investigated the structure and stability of all 16 combinations of two out of the four natural DNA bases A, T, G and C in a di-2′-deoxyribonucleoside-monophosphate model DNA strand as well as in 10 double-strand model complexes thereof, using dispersion-corrected density functional theory (DFT-D). Optimized geometries with B-DNA conformation were obtained through the inclusion of implicit water solvent and, in the DNA models, of sodium counterions, to neutralize the negative charge of the phosphate groups. The results obtained allowed us to compare the relative stability of isomeric single and double strands. Moreover, the energy of the Watson–Crick pairing of complementary single strands to form double-helical structures was calculated. The latter furnished the following increasing stability trend of the double-helix formation energy: d(TpA)2

  6. Endogenous Hot Spots of De Novo Telomere Addition in the Yeast Genome Contain Proximal Enhancers That Bind Cdc13

    PubMed Central

    Obodo, Udochukwu C.; Epum, Esther A.; Platts, Margaret H.; Seloff, Jacob; Dahlson, Nicole A.; Velkovsky, Stoycho M.; Paul, Shira R.

    2016-01-01

    DNA double-strand breaks (DSBs) pose a threat to genome stability and are repaired through multiple mechanisms. Rarely, telomerase, the enzyme that maintains telomeres, acts upon a DSB in a mutagenic process termed telomere healing. The probability of telomere addition is increased at specific genomic sequences termed sites of repair-associated telomere addition (SiRTAs). By monitoring repair of an induced DSB, we show that SiRTAs on chromosomes V and IX share a bipartite structure in which a core sequence (Core) is directly targeted by telomerase, while a proximal sequence (Stim) enhances the probability of de novo telomere formation. The Stim and Core sequences are sufficient to confer a high frequency of telomere addition to an ectopic site. Cdc13, a single-stranded DNA binding protein that recruits telomerase to endogenous telomeres, is known to stimulate de novo telomere addition when artificially recruited to an induced DSB. Here we show that the ability of the Stim sequence to enhance de novo telomere addition correlates with its ability to bind Cdc13, indicating that natural sites at which telomere addition occurs at high frequency require binding by Cdc13 to a sequence 20 to 100 bp internal from the site at which telomerase acts to initiate de novo telomere addition. PMID:27044869

  7. Triplex technology in studies of DNA damage, DNA repair, and mutagenesis.

    PubMed

    Mukherjee, Anirban; Vasquez, Karen M

    2011-08-01

    Triplex-forming oligonucleotides (TFOs) can bind to the major groove of homopurine-homopyrimidine stretches of double-stranded DNA in a sequence-specific manner through Hoogsteen hydrogen bonding to form DNA triplexes. TFOs by themselves or conjugated to reactive molecules can be used to direct sequence-specific DNA damage, which in turn results in the induction of several DNA metabolic activities. Triplex technology is highly utilized as a tool to study gene regulation, molecular mechanisms of DNA repair, recombination, and mutagenesis. In addition, TFO targeting of specific genes has been exploited in the development of therapeutic strategies to modulate DNA structure and function. In this review, we discuss advances made in studies of DNA damage, DNA repair, recombination, and mutagenesis by using triplex technology to target specific DNA sequences. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  8. MicroCantilever (MC) based nanomechanical sensor for detection of molecular interactions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kang, Kyung

    Specific aims of this study are to investigate the mechanism governing surface stress generation associated with chemical or molecular binding on functionalized microcantilevers. Formation of affinity complexes on cantilever surfaces leads to charge redistribution, configurational change and steric hindrance between neighboring molecules resulting in surface stress change and measureable cantilever deformation. A novel interferometry technique employing two adjacent micromachined cantilevers (a sensing/reference pair) was utilized to measure the cantilever deformation. The sensing principle is that binding/reaction of specific chemical or biological species on the sensing cantilever transduces to mechanical deformation. The differential bending of the sensing cantilever respect to themore » reference cantilever ensures that measured response is insensitive to environmental disturbances. As a proof of principle for the measurement technique, surface stress changes associated with: self-assembly of alkanethiol, hybridization of ssDNA, and the formation of cocaine-aptamer complexes were measured. Dissociation constant (K d) for each molecular reaction was utilized to estimate the surface coverage of affinity complexes. In the cases of DNA hybridization and cocaine-aptamer binding, measured surface stress was found to be dependent on the surface coverage of the affinity complexes. In order to achieve a better sensitivity for DNA hybridization, immobilization of receptor molecules was modified to enhance the deformation of underlying surface. Single-stranded DNA (ssDNA) strands with thiol-modification on both 3-foot and 5-foot ends were immobilized on the gold surface such that both ends are attached to the gold surface. Immobilization condition was controlled to obtain similar receptor density as single-thiolated DNA strands. Hybridization of double-thiolated DNA strands leads to an almost two orders of magnitude increase in cantilever deformation. In both DNA hybridization and the conventional mode for cocaine detection, the lowest detectable concentration was determined by binding activity between the ligand and receptor molecules. In order to overcome this limitation for cocaine detection, a novel competition sensing mode that relies on rate of aptamers unbinding from the cantilever due to either diffusion or reaction with cocaine as target ligands in solution was investigated. The rate of unbinding is found to be dependent on the concentration of cocaine molecules. A model based on diffusion-reaction equation was developed to explain the experimental observation. Experimental results indicate that the competition mode reduces the lowest detectable threshold to 200 nM which is comparable to that achieved analytical techniques such as mass spectrometry.« less

  9. Microwave-Induced Inactivation of DNA-Based Hybrid Catalyst in Asymmetric Catalysis

    PubMed Central

    Zhao, Hua; Shen, Kai

    2015-01-01

    DNA-based hybrid catalysts have gained strong interests in asymmetric reactions. However, to maintain the high enantioselectivity, these reactions are usually conducted at relatively low temperatures (e.g. < 5 °C) for 2–3 days. Aiming to improve the reaction’s turnover rate, we evaluated microwave irradiation with simultaneous cooling as potential energy source since this method has been widely used to accelerate various chemical and enzymatic reactions. However, our data indicated that microwave irradiation induced an inactivation of DNA-based hybrid catalyst even at low temperatures (such as 5 °C). Circular dichroism (CD) spectra and gel electrophoresis of DNA suggest that microwave exposure degrades DNA molecules and disrupts DNA double-stranded structures, causing changes of DNA–metal ligand binding properties and thus poor DNA catalytic performance. PMID:26712696

  10. Histone H3 and the histone acetyltransferase Hat1p contribute to DNA double-strand break repair.

    PubMed

    Qin, Song; Parthun, Mark R

    2002-12-01

    The modification of newly synthesized histones H3 and H4 by type B histone acetyltransferases has been proposed to play a role in the process of chromatin assembly. The type B histone acetyltransferase Hat1p and specific lysine residues in the histone H3 NH(2)-terminal tail (primarily lysine 14) are redundantly required for telomeric silencing. As many gene products, including other factors involved in chromatin assembly, have been found to participate in both telomeric silencing and DNA damage repair, we tested whether mutations in HAT1 and the histone H3 tail were also sensitive to DNA-damaging agents. Indeed, mutations both in specific lysine residues in the histone H3 tail and in HAT1 resulted in sensitivity to methyl methanesulfonate. The DNA damage sensitivity of the histone H3 and HAT1 mutants was specific for DNA double-strand breaks, as these mutants were sensitive to the induction of an exogenous restriction endonuclease, EcoRI, but not to UV irradiation. While histone H3 mutations had minor effects on nonhomologous end joining, the primary defect in the histone H3 and HAT1 mutants was in the recombinational repair of DNA double-strand breaks. Epistasis analysis indicates that the histone H3 and HAT1 mutants may influence DNA double-strand break repair through Asf1p-dependent chromatin assembly.

  11. A new trinuclear complex of platinum and iron efficiently promotes cleavage of plasmid DNA.

    PubMed Central

    Lempers, E L; Bashkin, J S; Kostić, N M

    1993-01-01

    The compound [[Pt(trpy)]2Arg-EDTA]+ is synthesized in five steps, purified, and characterized by 1H, 13C, and 195Pt NMR spectroscopy, mass spectrometry, UV-vis spectrophotometry, and elemental analysis. The binuclear [[(Pt(trpy)]2Arg]3+ moiety binds to double-stranded DNA, and the chelating EDTA moiety holds metal cations. In the presence of ferrous ions and the reductant dithiothreitol, the new compound cleaves DNA. It cleaves a single strand in the pBR322 plasmid nearly as efficiently as methidiumrpropyl-EDTA (MPE), and it cleaves a restriction fragment of the XP10 plasmid nonselectively and more efficiently than [Fe(EDTA)]2-. The mechanism of cleavage was studied in control experiments involving different transition-metal ions, superoxide dismutase, catalase, glucose oxidase with glucose, metal-sequestering agents, and deaeration. These experiments indicate that adventitious iron and copper ions, superoxide anion, and hydrogen peroxide are not involved and that dioxygen is required. The cleavage apparently is done by hydroxyl radicals generated in the vicinity of the DNA molecule. The reagent [[Pt(trypy)]2Arg-EDTA]+ differs from methidiumpropyl-EDTA in not containing an intercalator. This difference in binding modes between the binuclear platinum(II) complex and the planar heterocycle may cause useful differences between the two reagents in cleavage of nucleic acids. Images PMID:8493109

  12. Structure of homeodomain-leucine zipper/DNA complexes studied using hydroxyl radical cleavage of DNA and methylation interference.

    PubMed

    Tron, Adriana E; Comelli, Raúl N; Gonzalez, Daniel H

    2005-12-27

    Homeodomain-leucine zipper (HD-Zip) proteins, unlike most homeodomain proteins, bind a pseudopalindromic DNA sequence as dimers. We have investigated the structure of the DNA complexes formed by two HD-Zip proteins with different nucleotide preferences at the central position of the binding site using footprinting and interference methods. The results indicate that the respective complexes are not symmetric, with the strand bearing a central purine (top strand) showing higher protection around the central region and the bottom strand protected toward the 3' end. Binding to a sequence with a nonpreferred central base pair produces a decrease in protection in either the top or the bottom strand, depending upon the protein. Modeling studies derived from the complex formed by the monomeric Antennapedia homeodomain with DNA indicate that in the HD-Zip/DNA complex the recognition helix of one of the monomers is displaced within the major groove respective to the other one. This monomer seems to lose contacts with a part of the recognition sequence upon binding to the nonpreferred site. The results show that the structure of the complex formed by HD-Zip proteins with DNA is dependent upon both protein intrinsic characteristics and the nucleotides present at the central position of the recognition sequence.

  13. A Comparison of Two Single-Stranded DNA Binding Models by Mutational Analysis of APOBEC3G

    PubMed Central

    Shindo, Keisuke; Li, Ming; Gross, Phillip J.; Brown, William L.; Harjes, Elena; Lu, Yongjian; Matsuo, Hiroshi; Harris, Reuben S.

    2012-01-01

    APOBEC3G is the best known of several DNA cytosine deaminases that function to inhibit the replication of parasitic genetic elements including the lentivirus HIV. Several high-resolution structures of the APOBEC3G catalytic domain have been generated, but none reveal how this enzyme binds to substrate single-stranded DNA. Here, we constructed a panel of APOBEC3G amino acid substitution mutants and performed a series of biochemical, genetic, and structural assays to distinguish between “Brim” and “Kink” models for single-strand DNA binding. Each model predicts distinct sets of interactions between surface arginines and negatively charged phosphates in the DNA backbone. Concordant with both models, changing the conserved arginine at position 313 to glutamate abolished both catalytic and restriction activities. In support of the Brim model, arginine to glutamate substitutions at positions 213, 215, and 320 also compromised these APOBEC3G activities. Arginine to glutamate substitutions at Kink model residues 374 and 376 had smaller effects. These observations were supported by A3G catalytic domain-ssDNA chemical shift perturbation experiments. The overall data set is most consistent with the Brim model for single-stranded DNA binding by APOBEC3G. PMID:24832226

  14. Plasmid-derived DNA Strand Displacement Gates for Implementing Chemical Reaction Networks.

    PubMed

    Chen, Yuan-Jyue; Rao, Sundipta D; Seelig, Georg

    2015-11-25

    DNA nanotechnology requires large amounts of highly pure DNA as an engineering material. Plasmid DNA could meet this need since it is replicated with high fidelity, is readily amplified through bacterial culture and can be stored indefinitely in the form of bacterial glycerol stocks. However, the double-stranded nature of plasmid DNA has so far hindered its efficient use for construction of DNA nanostructures or devices that typically contain single-stranded or branched domains. In recent work, it was found that nicked double stranded DNA (ndsDNA) strand displacement gates could be sourced from plasmid DNA. The following is a protocol that details how these ndsDNA gates can be efficiently encoded in plasmids and can be derived from the plasmids through a small number of enzymatic processing steps. Also given is a protocol for testing ndsDNA gates using fluorescence kinetics measurements. NdsDNA gates can be used to implement arbitrary chemical reaction networks (CRNs) and thus provide a pathway towards the use of the CRN formalism as a prescriptive molecular programming language. To demonstrate this technology, a multi-step reaction cascade with catalytic kinetics is constructed. Further it is shown that plasmid-derived components perform better than identical components assembled from synthetic DNA.

  15. PHF1 Tudor and N-terminal domains synergistically target partially unwrapped nucleosomes to increase DNA accessibility

    PubMed Central

    Gibson, Matthew D.; Gatchalian, Jovylyn; Slater, Andrew; Kutateladze, Tatiana G.

    2017-01-01

    Abstract The Tudor domain of human PHF1 recognizes trimethylated lysine 36 on histone H3 (H3K36me3). PHF1 relies on this interaction to regulate PRC2 methyltransferase activity, localize to DNA double strand breaks and mediate nucleosome accessibility. Here, we investigate the impact of the PHF1 N-terminal domain (NTD) on the Tudor domain interaction with the nucleosome. We show that the NTD is partially ordered when it is natively attached to the Tudor domain. Through a combination of FRET and single molecule studies, we find that the increase of DNA accessibility within the H3K36me3-containing nucleosome, instigated by the Tudor binding to H3K36me3, is dramatically enhanced by the NTD. We demonstrate that this nearly order of magnitude increase is due to preferential binding of PHF1 to partially unwrapped nucleosomes, and that PHF1 alters DNA–protein binding within the nucleosome by decreasing dissociation rates. These results highlight the potency of a PTM-binding protein to regulate DNA accessibility and underscores the role of the novel mechanism by which nucleosomes control DNA–protein binding through increasing protein dissociation rates. PMID:28082396

  16. Structural basis of nucleic-acid recognition and double-strand unwinding by the essential neuronal protein Pur-alpha

    PubMed Central

    Weber, Janine; Bao, Han; Hartlmüller, Christoph; Wang, Zhiqin; Windhager, Almut; Janowski, Robert; Madl, Tobias; Jin, Peng; Niessing, Dierk

    2016-01-01

    The neuronal DNA-/RNA-binding protein Pur-alpha is a transcription regulator and core factor for mRNA localization. Pur-alpha-deficient mice die after birth with pleiotropic neuronal defects. Here, we report the crystal structure of the DNA-/RNA-binding domain of Pur-alpha in complex with ssDNA. It reveals base-specific recognition and offers a molecular explanation for the effect of point mutations in the 5q31.3 microdeletion syndrome. Consistent with the crystal structure, biochemical and NMR data indicate that Pur-alpha binds DNA and RNA in the same way, suggesting binding modes for tri- and hexanucleotide-repeat RNAs in two neurodegenerative RNAopathies. Additionally, structure-based in vitro experiments resolved the molecular mechanism of Pur-alpha's unwindase activity. Complementing in vivo analyses in Drosophila demonstrated the importance of a highly conserved phenylalanine for Pur-alpha's unwinding and neuroprotective function. By uncovering the molecular mechanisms of nucleic-acid binding, this study contributes to understanding the cellular role of Pur-alpha and its implications in neurodegenerative diseases. DOI: http://dx.doi.org/10.7554/eLife.11297.001 PMID:26744780

  17. How Cations Can Assist DNase I in DNA Binding and Hydrolysis

    PubMed Central

    Guéroult, Marc; Picot, Daniel; Abi-Ghanem, Joséphine; Hartmann, Brigitte; Baaden, Marc

    2010-01-01

    DNase I requires Ca2+ and Mg2+ for hydrolyzing double-stranded DNA. However, the number and the location of DNase I ion-binding sites remain unclear, as well as the role of these counter-ions. Using molecular dynamics simulations, we show that bovine pancreatic (bp) DNase I contains four ion-binding pockets. Two of them strongly bind Ca2+ while the other two sites coordinate Mg2+. These theoretical results are strongly supported by revisiting crystallographic structures that contain bpDNase I. One Ca2+ stabilizes the functional DNase I structure. The presence of Mg2+ in close vicinity to the catalytic pocket of bpDNase I reinforces the idea of a cation-assisted hydrolytic mechanism. Importantly, Poisson-Boltzmann-type electrostatic potential calculations demonstrate that the divalent cations collectively control the electrostatic fit between bpDNase I and DNA. These results improve our understanding of the essential role of cations in the biological function of bpDNase I. The high degree of conservation of the amino acids involved in the identified cation-binding sites across DNase I and DNase I-like proteins from various species suggests that our findings generally apply to all DNase I-DNA interactions. PMID:21124947

  18. Human cytomegalovirus inhibits a DNA damage response by mislocalizing checkpoint proteins

    NASA Astrophysics Data System (ADS)

    Gaspar, Miguel; Shenk, Thomas

    2006-02-01

    The DNA damage checkpoint pathway responds to DNA damage and induces a cell cycle arrest to allow time for DNA repair. Several viruses are known to activate or modulate this cellular response. Here we show that the ataxia-telangiectasia mutated checkpoint pathway, which responds to double-strand breaks in DNA, is activated in response to human cytomegalovirus DNA replication. However, this activation does not propagate through the pathway; it is blocked at the level of the effector kinase, checkpoint kinase 2 (Chk2). Late after infection, several checkpoint proteins, including ataxia-telangiectasia mutated and Chk2, are mislocalized to a cytoplasmic virus assembly zone, where they are colocalized with virion structural proteins. This colocalization was confirmed by immunoprecipitation of virion proteins with an antibody that recognizes Chk2. Virus replication was resistant to ionizing radiation, which causes double-strand breaks in DNA. We propose that human CMV DNA replication activates the checkpoint response to DNA double-strand breaks, and the virus responds by altering the localization of checkpoint proteins to the cytoplasm and thereby inhibiting the signaling pathway. ionizing radiation | ataxia-telangiectasia mutated pathway

  19. Rapid and Sensitive Isothermal Detection of Nucleic-acid Sequence by Multiple Cross Displacement Amplification.

    PubMed

    Wang, Yi; Wang, Yan; Ma, Ai-Jing; Li, Dong-Xun; Luo, Li-Juan; Liu, Dong-Xin; Jin, Dong; Liu, Kai; Ye, Chang-Yun

    2015-07-08

    We have devised a novel amplification strategy based on isothermal strand-displacement polymerization reaction, which was termed multiple cross displacement amplification (MCDA). The approach employed a set of ten specially designed primers spanning ten distinct regions of target sequence and was preceded at a constant temperature (61-65 °C). At the assay temperature, the double-stranded DNAs were at dynamic reaction environment of primer-template hybrid, thus the high concentration of primers annealed to the template strands without a denaturing step to initiate the synthesis. For the subsequent isothermal amplification step, a series of primer binding and extension events yielded several single-stranded DNAs and single-stranded single stem-loop DNA structures. Then, these DNA products enabled the strand-displacement reaction to enter into the exponential amplification. Three mainstream methods, including colorimetric indicators, agarose gel electrophoresis and real-time turbidity, were selected for monitoring the MCDA reaction. Moreover, the practical application of the MCDA assay was successfully evaluated by detecting the target pathogen nucleic acid in pork samples, which offered advantages on quick results, modest equipment requirements, easiness in operation, and high specificity and sensitivity. Here we expounded the basic MCDA mechanism and also provided details on an alternative (Single-MCDA assay, S-MCDA) to MCDA technique.

  20. Objective Molecular Dynamics with Self-consistent Charge Density Functional Tight-Binding (SCC-DFTB) Method

    NASA Astrophysics Data System (ADS)

    Dumitrica, Traian; Hourahine, Ben; Aradi, Balint; Frauenheim, Thomas

    We discus the coupling of the objective boundary conditions into the SCC density functional-based tight binding code DFTB+. The implementation is enabled by a generalization to the helical case of the classical Ewald method, specifically by Ewald-like formulas that do not rely on a unit cell with translational symmetry. The robustness of the method in addressing complex hetero-nuclear nano- and bio-fibrous systems is demonstrated with illustrative simulations on a helical boron nitride nanotube, a screw dislocated zinc oxide nanowire, and an ideal double-strand DNA. Work supported by NSF CMMI 1332228.

  1. Label-Free Detection of Sequence-Specific DNA Based on Fluorescent Silver Nanoclusters-Assisted Surface Plasmon-Enhanced Energy Transfer.

    PubMed

    Ma, Jin-Liang; Yin, Bin-Cheng; Le, Huynh-Nhu; Ye, Bang-Ce

    2015-06-17

    We have developed a label-free method for sequence-specific DNA detection based on surface plasmon enhanced energy transfer (SPEET) process between fluorescent DNA/AgNC string and gold nanoparticles (AuNPs). DNA/AgNC string, prepared by a single-stranded DNA template encoded two emitter-nucleation sequences at its termini and an oligo spacer in the middle, was rationally designed to produce bright fluorescence emission. The proposed method takes advantage of two strategies. The first one is the difference in binding properties of single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) toward AuNPs. The second one is SPEET process between fluorescent DNA/AgNC string and AuNPs, in which fluorescent DNA/AgNC string can be spontaneously adsorbed onto the surface of AuNPs and correspondingly AuNPs serve as "nanoquencher" to quench the fluorescence of DNA/AgNC string. In the presence of target DNA, the sensing probe hybridized with target DNA to form duplex DNA, leading to a salt-induced AuNP aggregation and subsequently weakened SPEET process between fluorescent DNA/AgNC string and AuNPs. A red-to-blue color change of AuNPs and a concomitant fluorescence increase were clearly observed in the sensing system, which had a concentration dependent manner with specific DNA. The proposed method achieved a detection limit of ∼2.5 nM, offering the following merits of simple design, convenient operation, and low experimental cost because of no chemical modification, organic dye, enzymatic reaction, or separation procedure involved.

  2. Mechanisms for RNA capture by ssDNA viruses: grand theft RNA.

    PubMed

    Stedman, Kenneth

    2013-06-01

    Viruses contain three common types of packaged genomes; double-stranded DNA (dsDNA), RNA (mostly single and occasionally double stranded) and single-stranded DNA (ssDNA). There are relatively straightforward explanations for the prevalence of viruses with dsDNA and RNA genomes, but the evolutionary basis for the apparent success of ssDNA viruses is less clear. The recent discovery of four ssDNA virus genomes that appear to have been formed by recombination between co-infecting RNA and ssDNA viruses, together with the high mutation rate of ssDNA viruses provide possible explanations. RNA-DNA recombination allows ssDNA viruses to access much broader sequence space than through nucleotide substitution and DNA-DNA recombination alone. Multiple non-exclusive mechanisms, all due to the unique replication of ssDNA viruses, are proposed for this unusual RNA capture. RNA capture provides an explanation for the evolutionary success of the ssDNA viruses and may help elucidate the mystery of integrated RNA viruses in viral and cellular DNA genomes.

  3. DNA double-strand breaks induced by high-energy neon and iron ions in human fibroblasts. II. Probing individual notI fragments by hybridization.

    PubMed

    Löbrich, M; Rydberg, B; Cooper, P K

    1994-08-01

    The initial yields of DNA double-strand breaks induced by energetic heavy ions (425 MeV/u neon and 250, 400 and 600 MeV/u iron) in comparison to X rays were measured in normal human diploid fibroblast cells within three small areas of the genome, defined by NotI fragments of 3.2, 2.0 and 1.2 Mbp. The methodology involves NotI restriction endonuclease digestion of DNA from irradiated cells, followed by pulsed-field gel electrophoresis, Southern blotting and hybridization with probes recognizing single-copy sequences within the three NotI fragments. The gradual disappearance of the full-size NotI fragment with dose and the appearance of a smear of broken DNA molecules are quantified. Assuming Poisson statistics for the number of double-strand breaks induced per NotI fragment of known size, absolute yields of DNA double-strand breaks were calculated and determined to be linear with dose in all cases, with the neon ion (LET 32 keV/microns) producing 4.4 x 10(-3) breaks/Mbp/Gy and all three iron-ion beams (LETs from 190 to 350 keV/microns) producing 2.8 x 10(-3) breaks/Mbp/Gy, giving RBE values for production of double-strand breaks of 0.76 for neon and 0.48 for iron in comparison to our previously determined X-ray induction rate of 5.8 x 10(-3) breaks/Mbp/Gy. These RBE values are in good agreement with results of measurements over the whole genome as reported in the accompanying paper (B. Rydberg, M. Löbrich and P. Cooper, Radiat. Res. 139, 133-141, 1994). The distribution of broken DNA molecules was similar for the various radiations, supporting a random distribution of double-strand breaks induced by the heavy ions over Mbp distances; however, correlated breaks (clusters) over much smaller distances are not ruled out. Reconstitution of the 3.2 Mbp NotI fragment was studied during postirradiation incubation of the cells as a measure of rejoining of correct DNA ends. The proportion of breaks repaired decreased with increasing LET.

  4. Detection of DNA double-strand breaks and chromosome translocations using ligation-mediated PCR and inverse PCR.

    PubMed

    Villalobos, Michael J; Betti, Christopher J; Vaughan, Andrew T M

    2006-01-01

    Current techniques for examining the global creation and repair of DNA double-strand breaks are restricted in their sensitivity, and such techniques mask any site-dependent variations in breakage and repair rate or fidelity. We present here a system for analyzing the fate of documented DNA breaks, using the MLL gene as an example, through application of ligation-mediated PCR. Here, a simple asymmetric double-stranded DNA adapter molecule is ligated to experimentally induced DNA breaks and subjected to seminested PCR using adapter and gene-specific primers. The rate of appearance and loss of specific PCR products allows detection of both the break and its repair. Using the additional technique of inverse PCR, the presence of misrepaired products (translocations) can be detected at the same site, providing information on the fidelity of the ligation reaction in intact cells. Such techniques may be adapted for the analysis of DNA breaks introduced into any identifiable genomic location.

  5. Clusters of DNA damage induced by ionizing radiation: formation of short DNA fragments. II. Experimental detection

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Chatterjee, A. (Principal Investigator)

    1996-01-01

    The basic 30-nm chromatin fiber in the mammalian cell consists of an unknown (possibly helical) arrangement of nucleosomes, with about 1.2 kb of DNA per 10-nm length of fiber. Track-structure considerations suggest that interactions of single delta rays or high-LET particles with the chromatin fiber might result in the formation of multiple lesions spread over a few kilobases of DNA (see the accompanying paper: W.R. Holley and A. Chatterjee, Radiat. Res. 145, 188-199, 1996). In particular, multiple DNA double-strand breaks and single-strand breaks may form. To test this experimentally, primary human fibroblasts were labeled with [3H]thymidine and exposed at 0 degrees C to X rays or accelerated nitrogen or iron ions in the LET range of 97-440 keV/microns. DNA was isolated inside agarose plugs and subjected to agarose gel electrophoresis under conditions that allowed good separation of 0.1-2 kb size DNA. The bulk of DNA remained in the well or migrated only a small distance into the gel. It was found that DNA fragments in the expected size range were formed linearly with dose with an efficiency that increased with LET. A comparison of the yield of such fragments with the yield of total DNA double-strand breaks suggests that for the high-LET ions a substantial proportion (20-90%) of DNA double-strand breaks are accompanied within 0.1-2 kb by at least one additional DNA double-strand break. It is shown that these results are in good agreement with theoretical calculations based on treating the 30-nm chromatin fiber as the target for ionizing particles. Theoretical considerations also predict that the clusters will contain numerous single-strand breaks and base damages. It is proposed that such clusters be designated "regionally multiply damaged sites." Postirradiation incubation at 37 degrees C resulted in a decline in the number of short DNA fragments, suggesting a repair activity. The biological significance of regionally multiply damaged sites is presently unknown.

  6. DNA Repair by DNA: The UV1C DNAzyme Catalyzes Photoreactivation of Cyclobutane Thymine Dimers in DNA More Effectively than Their de Novo Formation.

    PubMed

    Barlev, Adam; Sekhon, Gurpreet S; Bennet, Andrew J; Sen, Dipankar

    2016-11-01

    UV1C, a 42-nt DNA oligonucleotide, is a deoxyribozyme (DNAzyme) that optimally uses 305 nm wavelength light to catalyze photoreactivation of a cyclobutane thymine dimer placed within a gapped, unnatural DNA substrate, TDP. Herein we show that UV1C is also capable of photoreactivating thymine dimers within an authentic single-stranded DNA substrate, LDP. This bona fide UV1C substrate enables, for the first time, investigation of whether UV1C catalyzes only photoreactivation or also the de novo formation of thymine dimers. Single-turnover experiments carried out with LDP and UV1C, relative to control experiments with LDP alone in single-stranded and double-stranded contexts, show that while UV1C does modestly promote thymine dimer formation, its major activity is indeed photoreactivation. Distinct photostationary states are reached for LDP in its three contexts: as a single strand, as a constituent of a double-helix, and as a 1:1 complex with UV1C. The above results on the cofactor-independent photoreactivation capabilities of a catalytic DNA reinforce a series of recent, unexpected reports that purely nucleotide-based photoreactivation is also operational within conventional double-helical DNA.

  7. An electrochemical biosensor for double-stranded Wnt7B gene detection based on enzymatic isothermal amplification.

    PubMed

    Li, Junlong; Chen, Zhongping; Xiang, Yu; Zhou, Lili; Wang, Ting; Zhang, Zhang; Sun, Kexin; Yin, Dan; Li, Yi; Xie, Guoming

    2016-12-15

    Wnt7B gene plays an important role in the development and progression of breast cancer, gastric cancer, esophageal cancer and pancreatic cancer. While, the natural state of DNA is double stranded, which makes it difficult to be directly detected. Here, we develop an electrochemical biosensor method for Wnt7B gene detection without the need to denature the target. This method firstly used nicking enzyme for exploiting in the double-stranded DNA (dsDNA). Then, long single-stranded DNA (ssDNA) was generated from the cutting site through polymerase extension reaction. Whereafter, the long ssDNA triggered a hairpin self-assembly recycling reaction, which gave rise to another isothermal amplification reaction. Last, short ssDNA was formed after the this amplification process, which could hybridize with the capture probe immobilized on Au electrode and result in signal variation. This method showed excellent analytical performance for dsDNA, of which the linear range was 2fM to 500pM and the detection limit was 1.6fM (S/N=3). It also showed an good results when applied to the real sample of Wnt7B gene detection. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Prereplicative repair of oxidized bases in the human genome is mediated by NEIL1 DNA glycosylase together with replication proteins

    PubMed Central

    Hegde, Muralidhar L.; Hegde, Pavana M.; Bellot, Larry J.; Mandal, Santi M.; Hazra, Tapas K.; Li, Guo-Min; Boldogh, Istvan; Tomkinson, Alan E.; Mitra, Sankar

    2013-01-01

    Base oxidation by endogenous and environmentally induced reactive oxygen species preferentially occurs in replicating single-stranded templates in mammalian genomes, warranting prereplicative repair of the mutagenic base lesions. It is not clear how such lesions (which, unlike bulky adducts, do not block replication) are recognized for repair. Furthermore, strand breaks caused by base excision from ssDNA by DNA glycosylases, including Nei-like (NEIL) 1, would generate double-strand breaks during replication, which are not experimentally observed. NEIL1, whose deficiency causes a mutator phenotype and is activated during the S phase, is present in the DNA replication complex isolated from human cells, with enhanced association with DNA in S-phase cells and colocalization with replication foci containing DNA replication proteins. Furthermore, NEIL1 binds to 5-hydroxyuracil, the oxidative deamination product of C, in replication protein A-coated ssDNA template and inhibits DNA synthesis by DNA polymerase δ. We postulate that, upon encountering an oxidized base during replication, NEIL1 initiates prereplicative repair by acting as a “cowcatcher” and preventing nascent chain growth. Regression of the stalled replication fork, possibly mediated by annealing helicases, then allows lesion repair in the reannealed duplex. This model is supported by our observations that NEIL1, whose deficiency slows nascent chain growth in oxidatively stressed cells, is stimulated by replication proteins in vitro. Furthermore, deficiency of the closely related NEIL2 alone does not affect chain elongation, but combined NEIL1/2 deficiency further inhibits DNA replication. These results support a mechanism of NEIL1-mediated prereplicative repair of oxidized bases in the replicating strand, with NEIL2 providing a backup function. PMID:23898192

  9. A non-canonical DNA structure enables homologous recombination in various genetic systems.

    PubMed

    Masuda, Tokiha; Ito, Yutaka; Terada, Tohru; Shibata, Takehiko; Mikawa, Tsutomu

    2009-10-30

    Homologous recombination, which is critical to genetic diversity, depends on homologous pairing (HP). HP is the switch from parental to recombinant base pairs, which requires expansion of inter-base pair spaces. This expansion unavoidably causes untwisting of the parental double-stranded DNA. RecA/Rad51-catalyzed ATP-dependent HP is extensively stimulated in vitro by negative supercoils, which compensates for untwisting. However, in vivo, double-stranded DNA is relaxed by bound proteins and thus is an unfavorable substrate for RecA/Rad51. In contrast, Mhr1, an ATP-independent HP protein required for yeast mitochondrial homologous recombination, catalyzes HP without the net untwisting of double-stranded DNA. Therefore, we questioned whether Mhr1 uses a novel strategy to promote HP. Here, we found that, like RecA, Mhr1 induced the extension of bound single-stranded DNA. In addition, this structure was induced by all evolutionarily and structurally distinct HP proteins so far tested, including bacterial RecO, viral RecT, and human Rad51. Thus, HP includes the common non-canonical DNA structure and uses a common core mechanism, independent of the species of HP proteins. We discuss the significance of multiple types of HP proteins.

  10. Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates

    PubMed Central

    Gwon, Gwang Hyeon; Jo, Aera; Baek, Kyuwon; Jin, Kyeong Sik; Fu, Yaoyao; Lee, Jong-Bong; Kim, YoungChang; Cho, Yunje

    2014-01-01

    The Mus81-Eme1 complex is a structure-selective endonuclease with a critical role in the resolution of recombination intermediates during DNA repair after interstrand cross-links, replication fork collapse, or double-strand breaks. To explain the molecular basis of 3′ flap substrate recognition and cleavage mechanism by Mus81-Eme1, we determined crystal structures of human Mus81-Eme1 bound to various flap DNA substrates. Mus81-Eme1 undergoes gross substrate-induced conformational changes that reveal two key features: (i) a hydrophobic wedge of Mus81 that separates pre- and post-nick duplex DNA and (ii) a “5′ end binding pocket” that hosts the 5′ nicked end of post-nick DNA. These features are crucial for comprehensive protein-DNA interaction, sharp bending of the 3′ flap DNA substrate, and incision strand placement at the active site. While Mus81-Eme1 unexpectedly shares several common features with members of the 5′ flap nuclease family, the combined structural, biochemical, and biophysical analyses explain why Mus81-Eme1 preferentially cleaves 3′ flap DNA substrates with 5′ nicked ends. PMID:24733841

  11. Replication-mediated disassociation of replication protein A–XPA complex upon DNA damage: implications for RPA handing off

    PubMed Central

    Jiang, Gaofeng; Zou, Yue; Wu, Xiaoming

    2013-01-01

    RPA (replication protein A), the eukaryotic ssDNA (single-stranded DNA)-binding protein, participates in most cellular processes in response to genotoxic insults, such as NER (nucleotide excision repair), DNA, DSB (double-strand break) repair and activation of cell cycle checkpoint signalling. RPA interacts with XPA (xeroderma pigmentosum A) and functions in early stage of NER. We have shown that in cells the RPA–XPA complex disassociated upon exposure of cells to high dose of UV irradiation. The dissociation required replication stress and was partially attributed to tRPA hyperphosphorylation. Treatment of cells with CPT (camptothecin) and HU (hydroxyurea), which cause DSB DNA damage and replication fork collapse respectively and also leads to the disruption of RPA–XPA complex. Purified RPA and XPA were unable to form complex in vitro in the presence of ssDNA. We propose that the competition-based RPA switch among different DNA metabolic pathways regulates the dissociation of RPA with XPA in cells after DNA damage. The biological significances of RPA–XPA complex disruption in relation with checkpoint activation, DSB repair and RPA hyperphosphorylation are discussed. PMID:22578086

  12. Fractional Brownian motion and the critical dynamics of zipping polymers.

    PubMed

    Walter, J-C; Ferrantini, A; Carlon, E; Vanderzande, C

    2012-03-01

    We consider two complementary polymer strands of length L attached by a common-end monomer. The two strands bind through complementary monomers and at low temperatures form a double-stranded conformation (zipping), while at high temperature they dissociate (unzipping). This is a simple model of DNA (or RNA) hairpin formation. Here we investigate the dynamics of the strands at the equilibrium critical temperature T=T(c) using Monte Carlo Rouse dynamics. We find that the dynamics is anomalous, with a characteristic time scaling as τ∼L(2.26(2)), exceeding the Rouse time ∼L(2.18). We investigate the probability distribution function, velocity autocorrelation function, survival probability, and boundary behavior of the underlying stochastic process. These quantities scale as expected from a fractional Brownian motion with a Hurst exponent H=0.44(1). We discuss similarities to and differences from unbiased polymer translocation.

  13. Structural Basis for Guide RNA Processing and Seed-Dependent DNA Targeting by CRISPR-Cas12a.

    PubMed

    Swarts, Daan C; van der Oost, John; Jinek, Martin

    2017-04-20

    The CRISPR-associated protein Cas12a (Cpf1), which has been repurposed for genome editing, possesses two distinct nuclease activities: endoribonuclease activity for processing its own guide RNAs and RNA-guided DNase activity for target DNA cleavage. To elucidate the molecular basis of both activities, we determined crystal structures of Francisella novicida Cas12a bound to guide RNA and in complex with an R-loop formed by a non-cleavable guide RNA precursor and a full-length target DNA. Corroborated by biochemical experiments, these structures reveal the mechanisms of guide RNA processing and pre-ordering of the seed sequence in the guide RNA that primes Cas12a for target DNA binding. Furthermore, the R-loop complex structure reveals the strand displacement mechanism that facilitates guide-target hybridization and suggests a mechanism for double-stranded DNA cleavage involving a single active site. Together, these insights advance our mechanistic understanding of Cas12a enzymes and may contribute to further development of genome editing technologies. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Promotion of Homologous Recombination and Genomic Stability byRAD51AP1 via RAD51 Recombinase Enhancement

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wiese, Claudia; Dray, Eloise; Groesser, Torsten

    2007-04-11

    Homologous recombination (HR) repairs chromosome damage and is indispensable for tumor suppression in humans. RAD51 mediates the DNA strand pairing step in HR. RAD51AP1 (RAD51 Associated Protein 1) is a RAD51-interacting protein whose function has remained elusive. Knockdown of RAD51AP1 in human cells by RNA interference engenders sensitivity to different types of genotoxic stress. Moreover, RAD51AP1-depleted cells are impaired for the recombinational repair of a DNA double-strand break and exhibit chromatid breaks both spontaneously and upon DNA damaging treatment. Purified RAD51AP1 binds dsDNA and RAD51, and it greatly stimulates the RAD51-mediated D-loop reaction. Biochemical and cytological results show that RAD51AP1more » functions at a step subsequent to the assembly of the RAD51-ssDNA nucleoprotein filament. Our findings provide the first evidence that RAD51AP1 helps maintain genomic integrity via RAD51 recombinase enhancement.« less

  15. Investigations on the Interactions of 5-Fluorouracil with Herring Sperm DNA: Steady State/Time Resolved and Molecular Modeling Studies

    NASA Astrophysics Data System (ADS)

    Chinnathambi, Shanmugavel; Karthikeyan, Subramani; Velmurugan, Devadasan; Hanagata, Nobutaka; Aruna, Prakasarao; Ganesan, Singaravelu

    2015-04-01

    In the present study, the interaction of 5-Fluorouracil with herring sperm DNA is reported using spectroscopic and molecular modeling techniques. This binding study of 5-FU with hs-DNA is of paramount importance in understanding chemico-biological interactions for drug design, pharmacy and biochemistry without altering the original structure. The challenge of the study was to find the exact binding mode of the drug 5-Fluorouracil with hs-DNA. From the absorption studies, a hyperchromic effect was observed for the herring sperm DNA in the presence of 5-Fluorouracil and a binding constant of 6.153 × 103 M-1 for 5-Fluorouracil reveals the existence of weak interaction between the 5-Fluorouracil and herring sperm DNA. Ethidium bromide loaded herring sperm DNA showed a quenching in the fluorescence intensity after the addition of 5-Fluorouracil. The binding constants for 5-Fluorouracil stranded DNA and competitive bindings of 5-FU interacting with DNA-EB systems were examined by fluorescence spectra. The Stern-Volmer plots and fluorescence lifetime results confirm the static quenching nature of the drug-DNA complex. The binding constant Kb was 2.5 × 104 L mol-1 and the number of binding sites are 1.17. The 5-FU on DNA system was calculated using double logarithmic plot. From the Forster nonradiative energy transfer study it has been found that the distance of 5-FU from DNA was 4.24 nm. In addition to the spectroscopic results, the molecular modeling studies also revealed the major groove binding as well as the partial intercalation mode of binding between the 5-Fluorouracil and herring sperm DNA. The binding energy and major groove binding as -6.04 kcal mol-1 and -6.31 kcal mol-1 were calculated from the modeling studies. All the testimonies manifested that binding modes between 5-Fluorouracil and DNA were evidenced to be groove binding and in partial intercalative mode.

  16. Quantification of transcription factor-DNA binding affinity in a living cell

    PubMed Central

    Belikov, Sergey; Berg, Otto G.; Wrange, Örjan

    2016-01-01

    The apparent dissociation constant (Kd) for specific binding of glucocorticoid receptor (GR) and androgen receptor (AR) to DNA was determined in vivo in Xenopus oocytes. The total nuclear receptor concentration was quantified as specifically retained [3H]-hormone in manually isolated oocyte nuclei. DNA was introduced by nuclear microinjection of single stranded phagemid DNA, chromatin is then formed during second strand synthesis. The fraction of DNA sites occupied by the expressed receptor was determined by dimethylsulphate in vivo footprinting and used for calculation of the receptor-DNA binding affinity. The forkhead transcription factor FoxA1 enhanced the DNA binding by GR with an apparent Kd of ∼1 μM and dramatically stimulated DNA binding by AR with an apparent Kd of ∼0.13 μM at a composite androgen responsive DNA element containing one FoxA1 binding site and one palindromic hormone receptor binding site known to bind one receptor homodimer. FoxA1 exerted a weak constitutive- and strongly cooperative DNA binding together with AR but had a less prominent effect with GR, the difference reflecting the licensing function of FoxA1 at this androgen responsive DNA element. PMID:26657626

  17. An Aromatic Sensor with Aversion to Damaged Strands Confers Versatility to DNA Repair

    PubMed Central

    Maillard, Olivier; Solyom, Szilvia; Naegeli, Hanspeter

    2007-01-01

    It was not known how xeroderma pigmentosum group C (XPC) protein, the primary initiator of global nucleotide excision repair, achieves its outstanding substrate versatility. Here, we analyzed the molecular pathology of a unique Trp690Ser substitution, which is the only reported missense mutation in xeroderma patients mapping to the evolutionary conserved region of XPC protein. The function of this critical residue and neighboring conserved aromatics was tested by site-directed mutagenesis followed by screening for excision activity and DNA binding. This comparison demonstrated that Trp690 and Phe733 drive the preferential recruitment of XPC protein to repair substrates by mediating an exquisite affinity for single-stranded sites. Such a dual deployment of aromatic side chains is the distinctive feature of functional oligonucleotide/oligosaccharide-binding folds and, indeed, sequence homologies with replication protein A and breast cancer susceptibility 2 protein indicate that XPC displays a monomeric variant of this recurrent interaction motif. An aversion to associate with damaged oligonucleotides implies that XPC protein avoids direct contacts with base adducts. These results reveal for the first time, to our knowledge, an entirely inverted mechanism of substrate recognition that relies on the detection of single-stranded configurations in the undamaged complementary sequence of the double helix. PMID:17355181

  18. Dynamic binding of replication protein a is required for DNA repair

    PubMed Central

    Chen, Ran; Subramanyam, Shyamal; Elcock, Adrian H.; Spies, Maria; Wold, Marc S.

    2016-01-01

    Replication protein A (RPA), the major eukaryotic single-stranded DNA (ssDNA) binding protein, is essential for replication, repair and recombination. High-affinity ssDNA-binding by RPA depends on two DNA binding domains in the large subunit of RPA. Mutation of the evolutionarily conserved aromatic residues in these two domains results in a separation-of-function phenotype: aromatic residue mutants support DNA replication but are defective in DNA repair. We used biochemical and single-molecule analyses, and Brownian Dynamics simulations to determine the molecular basis of this phenotype. Our studies demonstrated that RPA binds to ssDNA in at least two modes characterized by different dissociation kinetics. We also showed that the aromatic residues contribute to the formation of the longer-lived state, are required for stable binding to short ssDNA regions and are needed for RPA melting of partially duplex DNA structures. We conclude that stable binding and/or the melting of secondary DNA structures by RPA is required for DNA repair, including RAD51 mediated DNA strand exchange, but is dispensable for DNA replication. It is likely that the binding modes are in equilibrium and reflect dynamics in the RPA–DNA complex. This suggests that dynamic binding of RPA to DNA is necessary for different cellular functions. PMID:27131385

  19. In vitro DNA binding studies of lenalidomide using spectroscopic in combination with molecular docking techniques

    NASA Astrophysics Data System (ADS)

    Xu, Liang; Hu, Yan-Xi; Li, Yan-Cheng; Zhang, Li; Ai, Hai-Xin; Liu, Yu-Feng; Liu, Hong-Sheng

    2018-02-01

    In the present work, the binding interaction between lenalidomide (LEN) and calf thymus DNA (ct-DNA) was systematically studied by using fluorescence, ultraviolet-visible (UV-vis) absorption, circular dichroism (CD) spectroscopies under imitated physiological conditions (pH = 7.4) coupled with molecular docking. It was found that LEN was bound to ct-DNA with high binding affinity (Ka = 2.308 × 105 M-1 at 283 K) through groove binding as evidenced by a slight decrease in the absorption intensity in combination with CD spectra. Thermodynamic parameters (ΔG < 0, ΔH > 0 and ΔS < 0) of the LEN-DNA system obtained at three different temperatures suggested that the binding process was spontaneous and was primarily driven by hydrogen bonds and hydrophobic interaction. Furthermore, competitive binding experiments with ethidium bromide and 4‧, 6-dia-midino-2-phenylindoleas probes showed that LEN could preferentially bind in the minor groove of double-stranded DNA. The average lifetime of LEN was calculated to be 7.645 ns. The φ of LEN was measured as 0.09 and non-radiation energy transfer between LEN and DNA had occurred. The results of the molecular docking were consistent with the experimental results. This study explored the potential applicability of the spectroscopic properties of LEN and also investigated its interactions with relevant biological targets. In addition, it will provide some theoretical references for the deep research of simultaneous administration of LEN with other drugs.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sobottka, Marcelo, E-mail: sobottka@mtm.ufsc.br; Hart, Andrew G., E-mail: ahart@dim.uchile.cl

    Highlights: {yields} We propose a simple stochastic model to construct primitive DNA sequences. {yields} The model provide an explanation for Chargaff's second parity rule in primitive DNA sequences. {yields} The model is also used to predict a novel type of strand symmetry in primitive DNA sequences. {yields} We extend the results for bacterial DNA sequences and compare distributional properties intrinsic to the model to statistical estimates from 1049 bacterial genomes. {yields} We find out statistical evidences that the novel type of strand symmetry holds for bacterial DNA sequences. -- Abstract: Chargaff's second parity rule for short oligonucleotides states that themore » frequency of any short nucleotide sequence on a strand is approximately equal to the frequency of its reverse complement on the same strand. Recent studies have shown that, with the exception of organellar DNA, this parity rule generally holds for double-stranded DNA genomes and fails to hold for single-stranded genomes. While Chargaff's first parity rule is fully explained by the Watson-Crick pairing in the DNA double helix, a definitive explanation for the second parity rule has not yet been determined. In this work, we propose a model based on a hidden Markov process for approximating the distributional structure of primitive DNA sequences. Then, we use the model to provide another possible theoretical explanation for Chargaff's second parity rule, and to predict novel distributional aspects of bacterial DNA sequences.« less

  1. Single-stranded DNA binding protein Gp5 of Bacillus subtilis phage Φ29 is required for viral DNA replication in growth-temperature dependent fashion.

    PubMed

    Tone, Takahiro; Takeuchi, Ari; Makino, Osamu

    2012-01-01

    In the absence of viral single-stranded DNA binding protein gp5, Bacillus subtilis phage φ29 failed to grow and to replicate its genome at 45 °C, while it grew and replicated normally at 30 °C and 42 °C. This indicates that gp5 is dispensable for φ29 DNA replication at 42 °C and lower temperatures.

  2. Mechanisms controlling nucleic acid-sensing Toll-like receptors.

    PubMed

    Miyake, Kensuke; Shibata, Takuma; Ohto, Umeharu; Shimizu, Toshiyuki; Saitoh, Shin-Ichiroh; Fukui, Ryutaro; Murakami, Yusuke

    2018-03-08

    Nucleic acid (NA)-sensing Toll-like receptors (TLRs) respond to DNA/RNA derived from pathogens and dead cells. Structural studies have revealed a variety of molecular mechanisms by which TLRs sense NAs. Double-stranded RNA and single-stranded DNA directly bind to TLR3 and TLR9, respectively, whereas TLR7 and TLR8 bind to nucleosides and oligoribonucleotides derived from RNAs. Activation of ligand-bound TLRs is influenced by the functional status of TLRs. Proteolytic cleavage of NA-sensing TLRs enables ligand-dependent TLR dimerization. Trafficking of ligand-activated TLRs in endosomal and lysosomal compartments is requisite for production of type I interferons. Activation of NA-sensing TLRs is required for the control of viruses such as herpes simplex virus and endogenous retroviruses. On the other hand, excessive activation of NA-sensing TLRs drives disease progression in a variety of inflammatory diseases including systemic lupus erythematosus, heart failure, arthritis and non-alcoholic steatohepatitis. NA-sensing TLRs are targets for therapeutic intervention in these diseases. We here focus on our recent progresses in our understanding of NA-sensing TLRs.

  3. Quantum dot nanocrystals having guanosine imprinted nanoshell for DNA recognition.

    PubMed

    Diltemiz, Sibel Emir; Say, Ridvan; Büyüktiryaki, Sibel; Hür, Deniz; Denizli, Adil; Ersöz, Arzu

    2008-05-30

    Molecular imprinted polymers (MIPs) as a recognition element for sensors are increasingly of interest and MIP nanoparticles have started to appear in the literature. In this study, we have proposed a novel thiol ligand-capping method with polymerizable methacryloylamido-cysteine (MAC) attached to CdS quantum dots (QDs), reminiscent of a self-assembled monolayer and have reconstructed surface shell by synthetic host polymers based on molecular imprinting method for DNA recognition. In this method, methacryloylamidohistidine-platinium (MAH-Pt(II)) is used as a new metal-chelating monomer via metal coordination-chelation interactions and guanosine templates of DNA. Nanoshell sensors with guanosine templates give a cavity that is selective for guanosine and its analogues. The guanosine can simultaneously chelate to Pt(II) metal ion and fit into the shape-selective cavity. Thus, the interaction between Pt(II) ion and free coordination spheres has an effect on the binding ability of the CdS QD nanosensor. The binding affinity of the guanosine imprinted nanocrystals has investigated by using the Langmuir and Scatchard methods, and experiments have shown the shape-selective cavity formation with O6 and N7 of a guanosine nucleotide (K(a) = 4.841x10(6) mol L(-1)) and a free guanine base (K(a) = 0.894x10(6) mol L(-1)). Additionally, the guanosine template of the nanocrystals is more favored for single stranded DNA compared to double stranded DNA.

  4. DNA Interactions Probed by Hydrogen-Deuterium Exchange (HDX) Fourier Transform Ion Cyclotron Resonance Mass Spectrometry Confirm External Binding Sites on the Minichromosomal Maintenance (MCM) Helicase*

    PubMed Central

    Graham, Brian W.; Tao, Yeqing; Dodge, Katie L.; Thaxton, Carly T.; Olaso, Danae; Young, Nicolas L.; Marshall, Alan G.

    2016-01-01

    The archaeal minichromosomal maintenance (MCM) helicase from Sulfolobus solfataricus (SsoMCM) is a model for understanding structural and mechanistic aspects of DNA unwinding. Although interactions of the encircled DNA strand within the central channel provide an accepted mode for translocation, interactions with the excluded strand on the exterior surface have mostly been ignored with regard to DNA unwinding. We have previously proposed an extension of the traditional steric exclusion model of unwinding to also include significant contributions with the excluded strand during unwinding, termed steric exclusion and wrapping (SEW). The SEW model hypothesizes that the displaced single strand tracks along paths on the exterior surface of hexameric helicases to protect single-stranded DNA (ssDNA) and stabilize the complex in a forward unwinding mode. Using hydrogen/deuterium exchange monitored by Fourier transform ion cyclotron resonance MS, we have probed the binding sites for ssDNA, using multiple substrates targeting both the encircled and excluded strand interactions. In each experiment, we have obtained >98.7% sequence coverage of SsoMCM from >650 peptides (5–30 residues in length) and are able to identify interacting residues on both the interior and exterior of SsoMCM. Based on identified contacts, positively charged residues within the external waist region were mutated and shown to generally lower DNA unwinding without negatively affecting the ATP hydrolysis. The combined data globally identify binding sites for ssDNA during SsoMCM unwinding as well as validating the importance of the SEW model for hexameric helicase unwinding. PMID:27044751

  5. Real-space and real-time dynamics of CRISPR-Cas9 visualized by high-speed atomic force microscopy.

    PubMed

    Shibata, Mikihiro; Nishimasu, Hiroshi; Kodera, Noriyuki; Hirano, Seiichi; Ando, Toshio; Uchihashi, Takayuki; Nureki, Osamu

    2017-11-10

    The CRISPR-associated endonuclease Cas9 binds to a guide RNA and cleaves double-stranded DNA with a sequence complementary to the RNA guide. The Cas9-RNA system has been harnessed for numerous applications, such as genome editing. Here we use high-speed atomic force microscopy (HS-AFM) to visualize the real-space and real-time dynamics of CRISPR-Cas9 in action. HS-AFM movies indicate that, whereas apo-Cas9 adopts unexpected flexible conformations, Cas9-RNA forms a stable bilobed structure and interrogates target sites on the DNA by three-dimensional diffusion. These movies also provide real-time visualization of the Cas9-mediated DNA cleavage process. Notably, the Cas9 HNH nuclease domain fluctuates upon DNA binding, and subsequently adopts an active conformation, where the HNH active site is docked at the cleavage site in the target DNA. Collectively, our HS-AFM data extend our understanding of the action mechanism of CRISPR-Cas9.

  6. Structural and Functional Analysis of DDX41: a bispecific immune receptor for DNA and cyclic dinucleotide

    PubMed Central

    Omura, Hiroki; Oikawa, Daisuke; Nakane, Takanori; Kato, Megumi; Ishii, Ryohei; Ishitani, Ryuichiro; Tokunaga, Fuminori; Nureki, Osamu

    2016-01-01

    In the innate immune system, pattern recognition receptors (PRRs) specifically recognize ligands derived from bacteria or viruses, to trigger the responsible downstream pathways. DEAD box protein 41 (DDX41) is an intracellular PRR that triggers the downstream pathway involving the adapter STING, the kinase TBK1, and the transcription factor IRF3, to activate the type I interferon response. DDX41 is unique in that it recognizes two different ligands; i.e., double-stranded DNA (dsDNA) and cyclic dinucleotides (CDN), via its DEAD domain. However, the structural basis for the ligand recognition by the DDX41 DEAD domain has remained elusive. Here, we report two crystal structures of the DDX41 DEAD domain in apo forms, at 1.5 and 2.2 Å resolutions. A comparison of the two crystal structures revealed the flexibility in the ATP binding site, suggesting its formation upon ATP binding. Structure-guided functional analyses in vitro and in vivo demonstrated the overlapped binding surface for dsDNA and CDN, which is distinct from the ATP-binding site. We propose that the structural rearrangement of the ATP binding site is crucial for the release of ADP, enabling the fast turnover of DDX41 for the dsDNA/CDN-induced STING activation pathway. PMID:27721487

  7. Experimental design, modeling and optimization of polyplex formation between DNA oligonucleotides and branched polyethylenimine.

    PubMed

    Clima, Lilia; Ursu, Elena L; Cojocaru, Corneliu; Rotaru, Alexandru; Barboiu, Mihail; Pinteala, Mariana

    2015-09-28

    The complexes formed by DNA and polycations have received great attention owing to their potential application in gene therapy. In this study, the binding efficiency between double-stranded oligonucleotides (dsDNA) and branched polyethylenimine (B-PEI) has been quantified by processing of the images captured from the gel electrophoresis assays. The central composite experimental design has been employed to investigate the effects of controllable factors on the binding efficiency. On the basis of experimental data and the response surface methodology, a multivariate regression model has been constructed and statistically validated. The model has enabled us to predict the binding efficiency depending on experimental factors, such as concentrations of dsDNA and B-PEI as well as the initial pH of solution. The optimization of the binding process has been performed using simplex and gradient methods. The optimal conditions determined for polyplex formation have yielded a maximal binding efficiency close to 100%. In order to reveal the mechanism of complex formation at the atomic-scale, a molecular dynamic simulation has been carried out. According to the computation results, B-PEI amine hydrogen atoms have interacted with oxygen atoms from dsDNA phosphate groups. These interactions have led to the formation of hydrogen bonds between macromolecules, stabilizing the polyplex structure.

  8. A calmodulin-like protein (LCALA) is a new Leishmania amazonensis candidate for telomere end-binding protein.

    PubMed

    Morea, Edna G O; Viviescas, Maria Alejandra; Fernandes, Carlos A H; Matioli, Fabio F; Lira, Cristina B B; Fernandez, Maribel F; Moraes, Barbara S; da Silva, Marcelo S; Storti, Camila B; Fontes, Marcos R M; Cano, Maria Isabel N

    2017-11-01

    Leishmania spp. telomeres are composed of 5'-TTAGGG-3' repeats associated with proteins. We have previously identified LaRbp38 and LaRPA-1 as proteins that bind the G-rich telomeric strand. At that time, we had also partially characterized a protein: DNA complex, named LaGT1, but we could not identify its protein component. Using protein-DNA interaction and competition assays, we confirmed that LaGT1 is highly specific to the G-rich telomeric single-stranded DNA. Three protein bands, with LaGT1 activity, were isolated from affinity-purified protein extracts in-gel digested, and sequenced de novo using mass spectrometry analysis. In silico analysis of the digested peptide identified them as a putative calmodulin with sequences identical to the T. cruzi calmodulin. In the Leishmania genome, the calmodulin ortholog is present in three identical copies. We cloned and sequenced one of the gene copies, named it LCalA, and obtained the recombinant protein. Multiple sequence alignment and molecular modeling showed that LCalA shares homology to most eukaryotes calmodulin. In addition, we demonstrated that LCalA is nuclear, partially co-localizes with telomeres and binds in vivo the G-rich telomeric strand. Recombinant LCalA can bind specifically and with relative affinity to the G-rich telomeric single-strand and to a 3'G-overhang, and DNA binding is calcium dependent. We have described a novel candidate component of Leishmania telomeres, LCalA, a nuclear calmodulin that binds the G-rich telomeric strand with high specificity and relative affinity, in a calcium-dependent manner. LCalA is the first reported calmodulin that binds in vivo telomeric DNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. DNA-hosted copper nanoclusters/graphene oxide based fluorescent biosensor for protein kinase activity detection.

    PubMed

    Wang, Mengke; Lin, Zihan; Liu, Qing; Jiang, Shan; Liu, Hua; Su, Xingguang

    2018-07-05

    A novel fluorescent biosensor for protein kinase activity (PKA) detection was designed by applying double-strands DNA-hosted copper nanoclusters (dsDNA-CuNCs) and graphene oxide (GO). One DNA strand of the dsDNA consisted of two domains, one domain can hybridize with another complementary DNA strand to stabilize the fluorescent CuNCs and another domain was adenosine 5'-triphosphate (ATP) aptamer. ATP aptamer of the dsDNA-CuNCs would be spontaneously absorbed onto the GO surface through π-π stacking interactions. Thus GO can efficiently quench the fluorescence (FL) of dsDNA-CuNCs through fluorescence resonance energy transfer (FRET). In the present of ATP, ATP specifically combined with ATP aptamer to form ATP-ATP aptamer binding complexes, which had much less affinity to GO, resulting in the fluorescence recovery of the system. Nevertheless, in the presence of PKA, ATP could be translated into ADP and ADP could not combine with ATP aptamer resulting in the fluorescence quenching of dsDNA-CuNCs again. According to the change of the fluorescence signal, PKA activity could be successfully monitored in the range of 0.1-5.0 U mL -1 with a detection limit (LOD) of 0.039 U mL -1 . Besides, the inhibitory effect of H-89 on PKA activity was studied. The sensor was performed for PKA activity detection in cell lysates with satisfactory results. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Concentration-Dependent Exchange of Replication Protein A on Single-Stranded DNA Revealed by Single-Molecule Imaging

    PubMed Central

    Gibb, Bryan; Ye, Ling F.; Gergoudis, Stephanie C.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.

    2014-01-01

    Replication protein A (RPA) is a ubiquitous eukaryotic single-stranded DNA (ssDNA) binding protein necessary for all aspects of DNA metabolism involving an ssDNA intermediate, including DNA replication, repair, recombination, DNA damage response and checkpoint activation, and telomere maintenance [1], [2], [3]. The role of RPA in most of these reactions is to protect the ssDNA until it can be delivered to downstream enzymes. Therefore a crucial feature of RPA is that it must bind very tightly to ssDNA, but must also be easily displaced from ssDNA to allow other proteins to gain access to the substrate. Here we use total internal reflection fluorescence microscopy and nanofabricated DNA curtains to visualize the behavior of Saccharomyces cerevisiae RPA on individual strands of ssDNA in real-time. Our results show that RPA remains bound to ssDNA for long periods of time when free protein is absent from solution. In contrast, RPA rapidly dissociates from ssDNA when free RPA is present in solution allowing rapid exchange between the free and bound states. In addition, the S. cerevisiae DNA recombinase Rad51 and E. coli single-stranded binding protein (SSB) also promote removal of RPA from ssDNA. These results reveal an unanticipated exchange between bound and free RPA suggesting a binding mechanism that can confer exceptionally slow off rates, yet also enables rapid displacement through a direct exchange mechanism that is reliant upon the presence of free ssDNA-binding proteins in solution. Our results indicate that RPA undergoes constant microscopic dissociation under all conditions, but this is only manifested as macroscopic dissociation (i.e. exchange) when free proteins are present in solution, and this effect is due to mass action. We propose that the dissociation of RPA from ssDNA involves a partially dissociated intermediate, which exposes a small section of ssDNA allowing other proteins to access to the DNA. PMID:24498402

  11. [Lethal effect after transmutation of 33P incorporated into bacteriophage S 13 and mechanisms of DNA double helix rupture].

    PubMed

    Apelgot, S

    1980-04-01

    The experiments show the lethal effect of the beta decay of 33P incorporated in DNA of bacteriophage S 13. The lethal efficiency is high, 0.72 at 0 degrees C and 0.55 at--197 degrees C. The presence of a radical scavenger like AET has no influence. It was found previously that for such phages with single-stranded DNA, the lethal efficiency of 32P decay is unity, and that the lethal event is a DNA single-strand break, owing to the high energy of the nucleogenic 32S atom. As the recoil energy of the 33S atom is too low to account for such a break, it is suggested that the reorganization of the phosphate molecule into sulphate is able to bring about a DNA single-strand break with an efficiency as high as 0.7, at 0 degrees C. A model for the DNA double-strand-break produced by a transmutation processes is suggested.

  12. Expression, purification and biochemical characterization of a single-stranded DNA binding protein from Herbaspirillum seropedicae.

    PubMed

    Vernal, Javier; Serpa, Viviane I; Tavares, Carolina; Souza, Emanuel M; Pedrosa, Fábio O; Terenzi, Hernán

    2007-05-01

    An open reading frame encoding a protein similar in size and sequence to the Escherichia coli single-stranded DNA binding protein (SSB protein) was identified in the Herbaspirillum seropedicae genome. This open reading frame was cloned into the expression plasmid pET14b. The SSB protein from H. seropedicae, named Hs_SSB, was overexpressed in E. coli strain BL21(DE3) and purified to homogeneity. Mass spectrometry data confirmed the identity of this protein. The apparent molecular mass of the native Hs_SSB was estimated by gel filtration, suggesting that the native protein is a tetramer made up of four similar subunits. The purified protein binds to single-stranded DNA (ssDNA) in a similar manner to other SSB proteins. The production of this recombinant protein in good yield opens up the possibility of obtaining its 3D-structure and will help further investigations into DNA metabolism.

  13. DNA Strand Breaks in Mitotic Germ Cells of Caenorhabditis elegans Evaluated by Comet Assay

    PubMed Central

    Park, Sojin; Choi, Seoyun; Ahn, Byungchan

    2016-01-01

    DNA damage responses are important for the maintenance of genome stability and the survival of organisms. Such responses are activated in the presence of DNA damage and lead to cell cycle arrest, apoptosis, and DNA repair. In Caenorhabditis elegans, double-strand breaks induced by DNA damaging agents have been detected indirectly by antibodies against DSB recognizing proteins. In this study we used a comet assay to detect DNA strand breaks and to measure the elimination of DNA strand breaks in mitotic germline nuclei of C. elegans. We found that C. elegans brc-1 mutants were more sensitive to ionizing radiation and camptothecin than the N2 wild-type strain and repaired DNA strand breaks less efficiently than N2. This study is the first demonstration of direct measurement of DNA strand breaks in mitotic germline nuclei of C. elegans. This newly developed assay can be applied to detect DNA strand breaks in different C. elegans mutants that are sensitive to DNA damaging agents. PMID:26903030

  14. Cdc45-induced loading of human RPA onto single-stranded DNA

    PubMed Central

    Tessmer, Ingrid; Prus, Piotr; Schlott, Bernhard; Pospiech, Helmut

    2017-01-01

    Abstract Cell division cycle protein 45 (Cdc45) is an essential component of the eukaryotic replicative DNA helicase. We found that human Cdc45 forms a complex with the single-stranded DNA (ssDNA) binding protein RPA. Moreover, it actively loads RPA onto nascent ssDNA. Pull-down assays and surface plasmon resonance studies revealed that Cdc45-bound RPA complexed with ssDNA in the 8–10 nucleotide binding mode, but dissociated when RPA covered a 30-mer. Real-time analysis of RPA-ssDNA binding demonstrated that Cdc45 catalytically loaded RPA onto ssDNA. This placement reaction required physical contacts of Cdc45 with the RPA70A subdomain. Our results imply that Cdc45 controlled stabilization of the 8-nt RPA binding mode, the subsequent RPA transition into 30-mer mode and facilitated an ordered binding to ssDNA. We propose that a Cdc45-mediated loading guarantees a seamless deposition of RPA on newly emerging ssDNA at the nascent replication fork. PMID:28100698

  15. Architecture and DNA Recognition Elements of the Fanconi Anemia FANCM-FAAP24 Complex

    PubMed Central

    Coulthard, Rachel; Deans, Andrew J.; Swuec, Paolo; Bowles, Maureen; Costa, Alessandro; West, Stephen C.; McDonald, Neil Q.

    2013-01-01

    Summary Fanconi anemia (FA) is a disorder associated with a failure in DNA repair. FANCM (defective in FA complementation group M) and its partner FAAP24 target other FA proteins to sites of DNA damage. FANCM-FAAP24 is related to XPF/MUS81 endonucleases but lacks endonucleolytic activity. We report a structure of an FANCM C-terminal fragment (FANCMCTD) bound to FAAP24 and DNA. This S-shaped structure reveals the FANCM (HhH)2 domain is buried, whereas the FAAP24 (HhH)2 domain engages DNA. We identify a second DNA contact and a metal center within the FANCM pseudo-nuclease domain and demonstrate that mutations in either region impair double-stranded DNA binding in vitro and FANCM-FAAP24 function in vivo. We show the FANCM translocase domain lies in proximity to FANCMCTD by electron microscopy and that binding fork DNA structures stimulate its ATPase activity. This suggests a tracking model for FANCM-FAAP24 until an encounter with a stalled replication fork triggers ATPase-mediated fork remodeling. PMID:23932590

  16. Recognition and repair of chemically heterogeneous structures at DNA ends

    PubMed Central

    Andres, Sara N.; Schellenberg, Matthew J.; Wallace, Bret D.; Tumbale, Percy; Williams, R. Scott

    2014-01-01

    Exposure to environmental toxicants and stressors, radiation, pharmaceutical drugs, inflammation, cellular respiration, and routine DNA metabolism all lead to the production of cytotoxic DNA strand breaks. Akin to splintered wood, DNA breaks are not “clean”. Rather, DNA breaks typically lack DNA 5'-phosphate and 3'-hydroxyl moieties required for DNA synthesis and DNA ligation. Failure to resolve damage at DNA ends can lead to abnormal DNA replication and repair, and is associated with genomic instability, mutagenesis, neurological disease, ageing and carcinogenesis. An array of chemically heterogeneous DNA termini arises from spontaneously generated DNA single-strand and double-strand breaks (SSBs and DSBs), and also from normal and/or inappropriate DNA metabolism by DNA polymerases, DNA ligases and topoisomerases. As a front line of defense to these genotoxic insults, eukaryotic cells have accrued an arsenal of enzymatic first responders that bind and protect damaged DNA termini, and enzymatically tailor DNA ends for DNA repair synthesis and ligation. These nucleic acid transactions employ direct damage reversal enzymes including Aprataxin (APTX), Polynucleotide kinase phosphatase (PNK), the tyrosyl DNA phosphodiesterases (TDP1 and TDP2), the Ku70/80 complex and DNA polymerase β (POLβ). Nucleolytic processing enzymes such as the MRE11/RAD50/NBS1/CtIP complex, Flap endonuclease (FEN1) and the apurinic endonucleases (APE1 and APE2) also act in the chemical "cleansing" of DNA breaks to prevent genomic instability and disease, and promote progression of DNA- and RNA-DNA damage response (DDR and RDDR) pathways. Here, we provide an overview of cellular first responders dedicated to the detection and repair of abnormal DNA termini. PMID:25111769

  17. ⁹⁹mTc pyrene derivative complex causes double-strand breaks in dsDNA mainly through cluster-mediated indirect effect in aqueous solution.

    PubMed

    Chung, Wei-Ju; Cui, Yujia; Huang, Feng-Yun J; Tu, Tzu-Hui; Yang, Tzu-Sen; Lo, Jem-Mau; Chiang, Chi-Shiun; Hsu, Ian C

    2014-01-01

    Radiation therapy for cancer patients works by ionizing damage to nuclear DNA, primarily by creating double-strand breaks (DSB). A major shortcoming of traditional radiation therapy is the set of side effect associated with its long-range interaction with nearby tissues. Low-energy Auger electrons have the advantage of an extremely short effective range, minimizing damage to healthy tissue. Consequently, the isotope ⁹⁹mTc, an Auger electron source, is currently being studied for its beneficial potential in cancer treatment. We examined the dose effect of a pyrene derivative ⁹⁹mTc complex on plasmid DNA by using gel electrophoresis in both aqueous and methanol solutions. In aqueous solutions, the average yield per decay for double-strand breaks is 0.011±0.005 at low dose range, decreasing to 0.0005±0.0003 in the presence of 1 M dimethyl sulfoxide (DMSO). The apparent yield per decay for single-strand breaks (SSB) is 0.04±0.02, decreasing to approximately a fifth with 1 M DMSO. In methanol, the average yield per decay of DSB is 0.54±0.06 and drops to undetectable levels in 2 M DMSO. The SSB yield per decay is 7.2±0.2, changing to 0.4±0.2 in the presence of 2 M DMSO. The 95% decrease in the yield of DSB in DMSO indicates that the main mechanism for DSB formation is through indirect effect, possibly by cooperative binding or clustering of intercalators. In the presence of non-radioactive ligands at a near saturation concentration, where radioactive Tc compounds do not form large clusters, the yield of SSB stays the same while the yield of DSB decreases to the value in DMSO. DSBs generated by ⁹⁹mTc conjugated to intercalators are primarily caused by indirect effects through clustering.

  18. Temperature-dependent conformations of exciton-coupled Cy3 dimers in double-stranded DNA

    NASA Astrophysics Data System (ADS)

    Kringle, Loni; Sawaya, Nicolas P. D.; Widom, Julia; Adams, Carson; Raymer, Michael G.; Aspuru-Guzik, Alán; Marcus, Andrew H.

    2018-02-01

    Understanding the properties of electronically interacting molecular chromophores, which involve internally coupled electronic-vibrational motions, is important to the spectroscopy of many biologically relevant systems. Here we apply linear absorption, circular dichroism, and two-dimensional fluorescence spectroscopy to study the polarized collective excitations of excitonically coupled cyanine dimers (Cy3)2 that are rigidly positioned within the opposing sugar-phosphate backbones of the double-stranded region of a double-stranded (ds)-single-stranded (ss) DNA fork construct. We show that the exciton-coupling strength of the (Cy3)2-DNA construct can be systematically varied with temperature below the ds-ss DNA denaturation transition. We interpret spectroscopic measurements in terms of the Holstein vibronic dimer model, from which we obtain information about the local conformation of the (Cy3)2 dimer, as well as the degree of static disorder experienced by the Cy3 monomer and the (Cy3)2 dimer probe locally within their respective DNA duplex environments. The properties of the (Cy3)2-DNA construct we determine suggest that it may be employed as a useful model system to test fundamental concepts of protein-DNA interactions and the role of electronic-vibrational coherence in electronic energy migration within exciton-coupled bio-molecular arrays.

  19. Analysis of nucleotides and oligonucleotides immobilized as self-assembled monolayers by static secondary ion mass spectrometry.

    PubMed

    Patrick, J S; Cooks, R G; Pachuta, S J

    1994-11-01

    Nucleic acid constituents can be bound to a metal surface in the form of self-assembled monolayers. Binding is achieved either through ionic interactions with a self-assembled 2-aminoethanethiol monolayer or by direct covalent binding of a dithiophosphate oligonucleotide to a metal surface through a sulfur-metal bond. Nucleotides, polynucleotides (both normal and a dithiophosphate analog) and double-stranded DNA have all been bound to surfaces. When the surfaces are interrogated using static secondary ion mass spectrometry (SIMS), the surface-bound nucleic acid constituents are observed in the form of the characteristic protonated nucleic acid base ions (BH2+). While a silver foil substrate was found to provide the highest absolute signal, vapor-deposited gold yields the best signal-to-noise ratio for ionically bound deoxyguanosine monophosphate. Under comparable conditions, a Cs+ projectile produces a 10-fold increase in the secondary ion signal relative to a Ga+ projectile. The experiment has been extended to a triple-quadrupole instrument where tandem mass spectrometric experiments on ionically immobilized dGMP showed the characteristic loss of ammonia from the released BH2+ ion. When a 'biomimetic' surface formed by ionically immobilizing double-stranded DNA is exposed to a solution containing ethidium bromide, ions corresponding to the non-covalent adduct are readily detectable using SIMS. This adduct and the nucleic acid constituents can be monitored at levels below 10 fmol.

  20. Rapid and simple method for purification of nucleic acids.

    PubMed

    Boom, R; Sol, C J; Salimans, M M; Jansen, C L; Wertheim-van Dillen, P M; van der Noordaa, J

    1990-03-01

    We have developed a simple, rapid, and reliable protocol for the small-scale purification of DNA and RNA from, e.g., human serum and urine. The method is based on the lysing and nuclease-inactivating properties of the chaotropic agent guanidinium thiocyanate together with the nucleic acid-binding properties of silica particles or diatoms in the presence of this agent. By using size-fractionated silica particles, nucleic acids (covalently closed circular, relaxed circular, and linear double-stranded DNA; single-stranded DNA; and rRNA) could be purified from 12 different specimens in less than 1 h and were recovered in the initial reaction vessel. Purified DNA (although significantly sheared) was a good substrate for restriction endonucleases and DNA ligase and was recovered with high yields (usually over 50%) from the picogram to the microgram level. Copurified rRNA was recovered almost undegraded. Substituting size-fractionated silica particles for diatoms (the fossilized cell walls of unicellular algae) allowed for the purification of microgram amounts of genomic DNA, plasmid DNA, and rRNA from cell-rich sources, as exemplified for pathogenic gram-negative bacteria. In this paper, we show representative experiments illustrating some characteristics of the procedure which may have wide application in clinical microbiology.

Top